Science.gov

Sample records for beta chain gene

  1. Hemoglobin Cranston, an unstable variant having an elongated beta chain due to nonhomologous crossover between two normal beta chain genes.

    PubMed Central

    Bunn, H F; Schmidt, G J; Haney, D N; Dluhy, R G

    1975-01-01

    An asymptomatic woman was found to have a compensated hemolytic state due to an unstable hemoglobin variant, comprising 35% of the total. Peptide maps of tryptic digests of the abnormal beta chain were identical to those of beta A except that tryptic peptide 15 (Tyr-His-COOH) was absent and a new peptide was detected, containing equivalent amounts of Ser, Ile, Thr, and Lys. Its sequence was determined by manual Edman degradation. An additional hydrophobic peptide isolated by counter-current distribution contained: Asx, Ser, Ala, Tyr, 2 Phe, and 3 Leu. Its sequence was determined on an automatic solid phase sequencer. Digestion with carboxypeptidase A confirmed the C-terminal sequence. Hemoglobin Cranston has an elongated beta chain with the following structure: (see article). This variant is the first "adult" human hemoglobin known to contain isoleucine. It is likely that hemoglobin Cranston arose because of a nonhomologous crossover of two normal beta chain genes, probably during meiosis, with the insertion of two nucleotides (AG) at position 144, resulting in a frame shift. Hemoglobin Cranston provides new information on the structure of the beta chain gene as well as an explanation of both the structure and genetic basis of hemoglobin Tak, the only other elongated beta chain variant that has been described. Images PMID:1059149

  2. Sequence and evolution of HLA-DR7- and -DRw53-associated beta-chain genes.

    PubMed

    Young, J A; Wilkinson, D; Bodmer, W F; Trowsdale, J

    1987-07-01

    cDNA clones representing products of the DR7 and DRw53 beta-chain genes were isolated from the human B-lymphoblastoid cell line MANN (DR7,DRw53,DQw2, DPw2). The DRw53 beta sequence was identical to a DRw53 beta sequence derived from cells with a DR4 haplotype. In contrast, the DR7 beta sequence was as unrelated to DR4 beta sequence as it was to other DR beta-related genes, except at the 3'-untranslated region. These results suggest that the DR7 and DR4 haplotypes may have been derived relatively recently from a common ancestral haplotype and that the DR4 and DR7 beta-chain genes have undergone more rapid diversification in their beta 1 domains, most probably as a result of natural selection, than have the DRw53 beta-chain genes. Short tracts of sequence within the DR7 and DRw53 beta 1 domains were shared with other DR beta sequences, indicating that exchanges of genetic information between beta 1 domains of DR beta-related genes have played a part in their evolution. Serological analysis of mouse L-cell transfectants expressing surface HLA-DR7 molecules, confirmed by antibody binding and allelic sequence comparisons, identified amino acid residues that may be critical to the binding of a monomorphic DR- and DP-specific monoclonal antibody.

  3. Missense mutation of the {beta}-cardiac myosin heavy-chain gene in hypertrophic cardiomyopathy

    SciTech Connect

    Arai, Shoichi; Matsuoka, Rumiko; Hirayama, Kenji; Sakurai, Hisanao

    1995-09-11

    Hypertrophic cardiomyopathy occurs as an autosomal dominant familial disorder or as a sporadic disease without familial involvement. We describe a missense mutation of the {beta}-cardiac myosin heavy chain (MHC) gene, a G to T transversion (741 Gly{r_arrow}Trp) identified by direct sequencing of exon 20 in four individuals affected with familial hypertrophic cardiomyopathy. Three individuals with sporadic hypertrophic cardiomyopathy, whose parents are clinically and genetically unaffected, had sequence variations of exon 34 of the {alpha}-cardiac MHC gene (a C to T transversion, 1658 Asp{r_arrow}Asp, resulting in FokI site polymorphism), of intron 33 of the {alpha}-cardiac MHC gene (a G to A and an A to T transversion), and also of intron 14 of the {beta}-cardiac MHC gene (a C to T transversion in a patient with Noonan syndrome). Including our case, 30 missense mutations of the {beta}-cardiac MHC gene in 49 families have been reported thus far worldwide. Almost all are located in the region of the gene coding for the globular head of the molecule, and only one mutation was found in both Caucasian and Japanese families. Missense mutations of the {Beta}-cardiac MHC gene in hypertrophic cardiomyopathy may therefore differ according to race. 29 refs., 6 figs., 3 tabs.

  4. Identification of genes for the constant region of rabbit T-cell receptor beta chains.

    PubMed Central

    Angiolillo, A L; Lamoyi, E; Bernstein, K E; Mage, R G

    1985-01-01

    We describe cDNA clones from thymus mRNA of a young rabbit that have sequences highly homologous to the human and murine T-cell receptor beta-chain constant region (C beta). In rabbit, man, and mouse there is a conserved extra cysteine in the constant region that could lead to a free thiol group or alternative disulfide bond formation depending on the locations and total numbers of cysteines in assembled receptor molecules. A cDNA clone (CL ANA 11) with 571 bases 5' of the C beta coding sequence has an open reading frame starting at a methionine codon that encodes 141 amino acids in frame with the C beta sequence. The encoded sequence has no resemblance to known immunoglobulin or beta-chain variable regions or other known proteins. An oligonucleotide probe from the 5' end of the encoded protein hybridizes to an approximately equal to 2-kilobase genomic DNA fragment that contains C beta gene sequences and to an approximately equal to 8-kilobase mRNA species in the thymus mRNA preparation from which the clone was derived. Within the 5' coding sequence there is a stretch of 211 bases containing strings of alternating purines and pyrimidines that may form Z-DNA. The sequence of the last 55 base pairs adjacent to C beta resembles the corresponding segment of mouse cDNA clone 86T3 that contains sequence 5' of the mouse C beta 1 gene. Although the function of a potential protein encoded by the 5' end of CL ANA 11 is unknown, it could play a role in regulation of thymocyte growth and differentiation. Images PMID:2989826

  5. Characterization of horse (Equus caballus) T-cell receptor beta chain genes

    SciTech Connect

    Schrenzel, M.D.; Watson, J.L.; Ferrick, D.A.

    1994-12-31

    Genes encoding the horse (Equus caballus) T-cell receptor beta chain (TCRB) were cloned and characterized. Of 33 cDNA clones isolated from the mesenteric lymph node, 30 had functionally rearranged gene segments, and three contained germline sequences. Sixteen unique variable segments (TCRBV), 14 joining genes (TCRBJ), and two constant region genes (TCRBC) were identified. Horse TCRBV were grouped into nine families based on similarity to human sequences. TCRBV2 and TCRBV12 were the most commonly represented horse families. Analysis of predicted protein structure revealed the presence of conserved regions similar to those seen in TCRB of other species. A decanucleotide promoter sequence homologous to those found in humans and mice was located in the 5{prime} untranslated region of one horse gene. Germline sequences included the 5{prime} region of the TCRBD2 gene with flanking heptamer/nonamer recombination signals and portions of the TCRBJ2-C2 intro. Southern blot hybridizations demonstrated restriction fragment length polymorphisms at the TCRBC locus among different horse breeds.

  6. Normal transcription of the beta-hexosaminidase alpha-chain gene in the Ashkenazi Tay-Sachs mutation.

    PubMed

    Paw, B H; Neufeld, E F

    1988-02-25

    Tay-Sachs disease is a biochemically heterogeneous lysosomal storage disorder caused by lack of the A isoenzyme of beta-hexosaminidase; the underlying defect is a mutation in the gene encoding the alpha-chain. It has been shown that fibroblasts isolated from Tay-Sachs patients of Ashkenazi Jewish origin contain no alpha-chain mRNA detectable on Northern blots. We now have compared run-on transcription in nuclei isolated from three strains of Ashkenazi Tay-Sachs fibroblasts and from a strain of normal (IMR90) cells. Using alpha-chain and beta-chain cDNAs as probes, we found no difference in the relative amount of [32P]ribonucleotide added to nascent transcripts; the average ratio of alpha/beta hybridizable radioactivity was 1.3 and 1.4 for mutant and normal cells, respectively. The identity of the Tay-Sachs alpha-chain transcript was confirmed by competition hybridization with excess alpha-chain mRNA. The results indicate that the Ashkenazi Tay-Sachs mutation permits a normal level of transcription of the alpha-chain gene and points to a posttranscriptional defect, such as RNA processing, transport, or stability.

  7. Haplotyping the human T-cell receptor. beta. -chain gene complex by use of restriction fragment length polymorphisms

    SciTech Connect

    Charmley, P.; Chao, A.; Gatti, R.A. ); Concannon, P. ); Hood, L. )

    1990-06-01

    The authors have studied the genetic segregation of human T-cell receptor {beta}-chain (TCR{beta}) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCR{beta} gene complex. Analysis of allele distributions between TCR{beta} genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCR{beta} gene complex. The results should provide new insight into recent reports of disease associations with the TCR{beta} gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome.

  8. The dynein genes of Paramecium tetraurelia: the structure and expression of the ciliary beta and cytoplasmic heavy chains.

    PubMed Central

    Kandl, K A; Forney, J D; Asai, D J

    1995-01-01

    The genes encoding two Paramecium dynein heavy chains, DHC-6 and DHC-8, have been cloned and sequenced. Sequence-specific antibodies demonstrate that DHC-6 encodes ciliary outer arm beta-chain and DHC-8 encodes a cytoplasmic dynein heavy chain. Therefore, this study is the first opportunity to compare the primary structures and expression of two heavy chains representing the two functional classes of dynein expressed in the same cell. Deciliation of paramecia results in the accumulation of mRNA from DHC-6, but not DHC-8. Nuclear run-on transcription experiments demonstrate that this increase in the steady state concentration of DHC-6 mRNA is a consequence of a rapid induction of transcription in response to deciliation. This is the first demonstration that dynein, like other axonemal components, is transcriptionally regulated during reciliation. Analyses of the sequences of the two Paramecium dyneins and the dynein heavy chains from other organisms indicate that the heavy chain can be divided into three regions: 1) the sequence of the central catalytic domain is conserved among all dyneins; 2) the tail domain sequence, consisting of the N-terminal 1200 residues, differentiates between axonemal and cytoplasmic dyneins; and 3) the N-terminal 200 residues are the most divergent and appear to classify the isoforms. The organization of the heavy chain predicts that the variable tail domain may be sufficient to target the dynein to the appropriate place in the cell. Images PMID:8589455

  9. Association study of schizophrenia and IL-2 receptor {beta} chain gene

    SciTech Connect

    Nimgaonkar, V.L.; Yang, Z.W.; Zhang, X.R.; Brar, J.S.

    1995-10-09

    A case-control association study was conducted in Caucasian patients with schizophrenia (DSM-III-R, n = 42) and unaffected controls (n = 47) matched for ethnicity and area of residence. Serum interleukin-2 receptor (IL-2R) concentrations, as well as a dinucleotide repeat polymorphism in the IL-2RP chain gene, were examined in both groups. No significant differences in IL-2R concentrations or in the distribution of the polymorphism were noted. This study does not support an association between schizophrenia and the IL-2RP gene locus, contrary to the suggestive evidence from linkage analysis in multicase families. 17 refs., 2 tabs.

  10. Provocative pattern of rearrangements of the genes for the gamma and beta chains of the T-cell receptor in human leukemias.

    PubMed Central

    Goorha, R; Bunin, N; Mirro, J; Murphy, S B; Cross, A H; Behm, F G; Quertermous, T; Seidman, J; Kitchingman, G R

    1987-01-01

    To examine the distribution of rearrangements of the gamma- and beta-chain T-cell receptor (TCR) genes in T- and non-T acute lymphoblastic leukemias (ALLs), and potentially to determine which genes rearrange first in ontogeny, we analyzed high molecular weight DNA from 102 patients with acute leukemia. Rearranged gamma- and beta-chain genes were found in all T-cell ALLs (22/22) examined. Overall, 27% (18/66) of B-lineage ALLs had beta-chain gene rearrangements, and 41% (24/58) had gamma-chain gene rearrangements, but the distribution of rearranged genes varied according to the stage of B-cell differentiation. The gamma-chain genes were rearranged in 11% (1/9) of the B-lineage patients negative for the common acute lymphoblastic leukemia antigen (cALLA) and 50% (23/46) of cALLA+ ALL patients, while the beta-chain genes were not rearranged in any of the 7 cALLA- ALL patients examined but were rearranged in 32% (18/56) of the cALLA+ patients. Neither TCR gene was found to be rearranged in acute nonlymphoid leukemia patients (0/12) or in patients with B-cell (surface immunoglobulin-positive) leukemia (0/3). Of the 44 cALLA+ patients in which a direct comparison of gamma- and beta-chain gene rearrangements could be made, 34% had both genes rearranged, 16% had only gamma-chain gene rearrangements, and the remaining 50% had both genes in the germ-line configuration. beta-Chain rearrangements have not been found in the absence of gamma-chain rearrangements, thus supporting a proposed hierarchy of TCR gene rearrangements. A provocative finding was that only a small percentage (11%) of the patients with cALLA- B precursor cell ALLs had rearranged TCR genes, while 50% of the cALLA+ leukemia patients had at least gamma-chain rearrangement, raising a question as to whether indeed cALLA- cells are precursors to cALLA+ cells. Interestingly, 18% (2/11) of the cytoplasmic immunoglobulin (cIg)-positive cALLA+ (pre-B) ALLs involved TCR gene rearrangements, compared to 60% (21/35) of

  11. A homozygous nonsense mutation in the {beta}3 chain gene of laminin 5 (LAMB3) in herlitz junctional epidermolysis bullosa

    SciTech Connect

    Pulkkinen, L.; Christiano, A.M.; Uitto, J.

    1994-11-15

    Herlitz junctional epidermolysis bullosa (H-JEB) is a severe autosomal recessive disorder characterized by blister formation within the dermal-epidermal basement membrane. Based on immunofluorescence analysis recognizing laminin 5 epitopes (previously known as nicein/kalinin), the genes for this lamina lucida protein have been proposed as candidate genes in H-JEB. Amplification of mRNA by RT-PCR, followed by direct nucleotide sequencing, revealed a homozygous C-to T transition resulting in a premature termination codon (CGA{r_arrow}TGA) on both alleles. This mutation was verified at the genomic DNA level, and both parents were shown to be heterozygous carriers of the same mutation. This is the first description of a mutation in the laminin {beta}3 chain gene (LAMB3) of laminin 5 in an H-JEB patient. 15 refs., 2 figs.

  12. Cloning of the beta 3 chain gene (LAMB3) of human laminin 5, a candidate gene in junctional epidermolysis bullosa.

    PubMed

    Pulkkinen, L; Gerecke, D R; Christiano, A M; Wagman, D W; Burgeson, R E; Uitto, J

    1995-01-01

    Laminin 5 consists of three polypeptides, alpha 3, beta 3, and gamma 2, encoded by the genes LAMA3, LAMB3, and LAMC2, respectively. In this study, we have elucidated the exon-intron organization of the human LAMB3 gene. Characterization of five overlapping lambda phage DNA clones revealed that the gene was approximately 29 kb in size. Subsequent sequence data revealed that the gene consisted of 23 exons that varied from 64 to 379 bp in size, accounting for the full-length cDNA with an open reading frame of 3516 bp encoding 1172 amino acids. Comparison of the LAMB3 gene structure with the previously characterized LAMB1 gene revealed that LAMB3 was considerably more compact. Knowledge of the exon-intron organization of the LAMB3 gene will facilitate elucidation of mutations in patients with the junctional forms of epidermolysis bullosa, some of which have been associated with mutations in the laminin 5 genes. PMID:7774918

  13. Cloning of the {beta}3 chain gene (LAMB3) of human laminin 5, a candidate gene in junctional epidermolysis bullosa

    SciTech Connect

    Pulkkinen, L.; Christiano, A.M.; Uitto, J.

    1995-01-01

    Laminin 5 consists of three polypeptides, {alpha}3, {beta}3, and {gamma}2, encoded by the genes LAMA3, LAMB3, and LAMC2, respectively. In this study, we have elucidated the exon-intron organization of the human LAMB3 gene. Characterization of five overlapping {lambda} phage DNA clones revealed that the gene was approximately 29 kb in size. Subsequent sequence data revealed that the gene consisted of 23 exons that varied from 64 to 379 bp in size, accounting for the full-length cDNA with an open reading frame of 3516 hp encoding 1172 amino acids. Comparison of the LAMB3 gene structure with the previously characterized LAMB1 gene revealed that LAMB3 was considerably more compact. Knowledge of the exon-intron organization of the LAMB3 gene will facilitate elucidation of mutations in patients with the junctional forms of epidermolysis bullosa, some of which have been associated with mutations in the laminin 5 genes. 33 refs., 3 figs., 2 tabs.

  14. Detection of sequence variants in the gene encoding the beta 3 chain of laminin 5 (LAMB3).

    PubMed

    Pulkkinen, L; McGrath, J A; Christiano, A M; Uitto, J

    1995-01-01

    Laminin 5, a candidate gene/protein system for mutations in the junctional forms of epidermolysis bullosa (JEB), consists of three polypeptides encoded by the LAMA3, LAMB3, and LAMC2 genes. In this study, primer pairs for the amplification of the complete cDNA as well as 22 exons of the LAMB3 gene encoding the entire beta 3 chain of laminin 5, were established. The primers for amplification of individual exons from genomic DNA were placed at least 50 bp away from the exon-intron borders in the flanking intronic sequences. For amplification of cDNA generated by RT-PCR, eight primer pairs covering overlapping segments of mRNA were used. The amplified sequences were used to study sequence variations of the LAMB3 gene in patients with JEB and unrelated individuals using heteroduplex analysis. Nine out of 13 JEB patients examined showed heteroduplexes in at least one of the PCR products, indicating the existence of two variable alleles in their DNA. Sequence analyses revealed putative pathogenetic mutations in seven of the JEB patients, while four of the heteroduplexes resulted from polymorphisms, reflecting a single basepair substitution. The results demonstrate that this method is useful in the detection of JEB mutations, as well as polymorphisms in the LAMB3 gene. PMID:7550237

  15. Familial hypertrophic cardiomyopathy. Microsatellite haplotyping and identification of a hot spot for mutations in the beta-myosin heavy chain gene.

    PubMed Central

    Dausse, E; Komajda, M; Fetler, L; Dubourg, O; Dufour, C; Carrier, L; Wisnewsky, C; Bercovici, J; Hengstenberg, C; al-Mahdawi, S

    1993-01-01

    Familial hypertrophic cardiomyopathy (FHC) is a clinically and genetically heterogeneous disease. The first identified disease gene, located on chromosome 14q11-q12, encodes the beta-myosin heavy chain. We have performed linkage analysis of two French FHC pedigrees, 720 and 730, with two microsatellite markers located in the beta-myosin heavy chain gene (MYO I and MYO II) and with four highly informative markers, recently mapped to chromosome 14q11-q12. Significant linkage was found with MYO I and MYO II in pedigree 720, but results were not conclusive for pedigree 730. Haplotype analysis of the six markers allowed identification of affected individuals and of some unaffected subjects carrying the disease gene. Two novel missense mutations were identified in exon 13 by direct sequencing, 403Arg-->Leu and 403Arg-->Trp in families 720 and 730, respectively. The 403Arg-->Leu mutation was associated with incomplete penetrance, a high incidence of sudden deaths and severe cardiac events, whereas the consequences of the 403Arg-->Trp mutation appeared less severe. Haplotyping of polymorphic markers in close linkage to the beta-myosin heavy chain gene can, thus, provide rapid analysis of non informative pedigrees and rapid detection of carrier status. Our results also indicate that codon 403 of the beta-myosin heavy chain gene is a hot spot for mutations causing FHC. Images PMID:8254035

  16. In vivo regulation of the beta-myosin heavy chain gene in soleus muscle of suspended and weight-bearing rats

    NASA Technical Reports Server (NTRS)

    Giger, J. M.; Haddad, F.; Qin, A. X.; Baldwin, K. M.

    2000-01-01

    In the weight-bearing hindlimb soleus muscle of the rat, approximately 90% of muscle fibers express the beta-myosin heavy chain (beta-MHC) isoform protein. Hindlimb suspension (HS) causes the MHC isoform population to shift from beta toward the fast MHC isoforms. Our aim was to establish a model to test the hypothesis that this shift in expression is transcriptionally regulated through specific cis elements of the beta-MHC promoter. With the use of a direct gene transfer approach, we determined the activity of different length beta-MHC promoter fragments, linked to a firefly luciferase reporter gene, in soleus muscle of control and HS rats. In weight-bearing rats, the relative luciferase activity of the longest beta-promoter fragment (-3500 bp) was threefold higher than the shorter promoter constructs, which suggests that an enhancer sequence is present in the upstream promoter region. After 1 wk of HS, the reporter activities of the -3500-, -914-, and -408-bp promoter constructs were significantly reduced ( approximately 40%), compared with the control muscles. However, using the -215-bp construct, no differences in promoter activity were observed between HS and control muscles, which indicates that the response to HS in the rodent appears to be regulated within the -408 and -215 bp of the promoter.

  17. The Y chromosomal fertility factor Threads in Drosophila hydei harbors a functional gene encoding an axonemal dynein beta heavy chain protein.

    PubMed Central

    Kurek, R; Reugels, A M; Glätzer, K H; Bünemann, H

    1998-01-01

    To understand the contradiction between megabase-sized lampbrush loops and putative protein encoding genes both associated with the loci of Y chromosomal fertility genes of Drosophila on the molecular level, we used PCR-mediated cloning to identify and isolate the cDNA sequence of the Y chromosomal Drosophila hydei gene DhDhc7(Y). Alignment of the sequences of the putative protein DhDhc7(Y) and the outer arm dynein beta heavy chain protein DYH2 of Tripneustes gratilla shows homology over the entire length of the protein chains. Therefore the proteins can be assumed to fulfill orthologous functions within the sperm tail axonemes of both species. Functional dynein beta heavy chain molecules, however, are necessary for the assembly and attachment of outer dynein arms within the sperm tail axoneme. Localization of DhDhc7(Y) to the fertility factor Threads, comprising at least 5.1 Mb of transcriptionally active repetitive DNA, results from an infertile Threads- mutant where large clusters of Threads specifically transcribed satellites and parts of DhDhc7(Y) encoding sequences are missing simultaneously. Consequently, the complete lack of the outer dynein arms in Threads- males most probably causes sperm immotility and hence infertility of the fly. Moreover, preliminary sequence analysis and several other features support the hypothesis that DhDhc7(Y) on the lampbrush loops Threads in D. hydei and Dhc-Yh3 on the lampbrush loops kl-5 in Drosophila melanogaster on the heterochromatic Y chromosome of both species might indeed code for orthologous dynein beta heavy chain proteins. PMID:9649526

  18. Human {beta}2 chain of laminin (formerly S chain): cDNA cloning, chromosomal localization, and expression in carcinomas

    SciTech Connect

    Wewer, U.M.; Durkin, M.E.; Albrechtsen, R.

    1994-11-15

    Overlapping cDNA clones that encode the full-length human laminin {beta}2 chain, formerly called the S chain, were isolated. The cDNA of 5680 nt contains a 5391-nt open reading frame encoding 1797 amino acids. At the amino terminus is a 32-amino-acid signal peptide that is followed by the mature {beta}2 chain polypeptide of 1765 amino acids with a calculated molecular mass of 192,389 Da. The human {beta}2 chain is predicted to have all of the seven structural domains typical of the {beta} chains of laminin, including the short cysteine-rich {alpha} region. The amino acid sequence of human {beta}2 chain showed 86.1% sequence identity to the rat {beta}2 chain, 50.0% to human {beta}1 chain, and 36.3% to the human {beta}3 chain. The greatest sequence identity was in domains VI, V, and III. The sequence of a 24-amino-acid peptide fragment isolated from the {beta}2 chain of laminin purified from human amniotic basement membrane matched the sequence predicted from the cDNA, confirming that the cDNA encodes human {beta}2 laminin. The cDNA was used to assign the gene (LAMB2) to human chromosome 3p21 by in situ hybridization. It is not linked to genes for human laminin chains {alpha}1, {beta}1, and {gamma}1 or other known laminin genes. Immunostaining showed that the {beta}2 chain is localized to the smooth muscle basement membranes of the arteries, while the homologous {beta}1 chain is confined to the subendothelial basement membranes. The {beta}2 chain was found in the basement membranes of ovarian carcinomas but not colon carcinomas. These results indicate that the expression of the {beta}2 chain gene is tightly regulated in normal human tissues and in disease. 43 refs., 6 figs., 1 tab.

  19. Identification of clonally rearranged T-cell receptor beta chain genes in HTLV-I carriers as a potential instrument for early detection of neoplasia.

    PubMed

    Sales, M M; Bezerra, C N A; Hiraki, Y; Melo, N B; Rebouças, N A

    2005-05-01

    We analyzed the genetic recombination pattern of the T-cell receptor beta-chain gene (TCR-beta) in order to identify clonal expansion of T-lymphocytes in 17 human T-lymphotropic virus type I (HTLV-I)-positive healthy carriers, 7 of them with abnormal features in the peripheral blood lymphocytes. Monoclonal or oligoclonal expansion of T-cells was detected in 5 of 7 HTLV-I-positive patients with abnormal lymphocytes and unconfirmed diagnosis by using PCR amplification of segments of TCR-beta gene, in a set of reactions that target 102 different variable (V) segments, covering all members of the 24 V families available in the gene bank, including the more recently identified segments of the Vbeta-5 and Vbeta-8 family and the two diversity beta segments. Southern blots, the gold standard method to detect T-lymphocyte clonality, were negative for all of these 7 patients, what highlights the low sensitivity of this method that requires a large amount of very high quality DNA. To evaluate the performance of PCR in the detection of clonality we also analyzed 18 leukemia patients, all of whom tested positive. Clonal expansion was not detected in any of the negative controls or healthy carriers without abnormal lymphocytes. In conclusion, PCR amplification of segments of rearranged TCR-beta is reliable and highly suitable for the detection of small populations of clonal T-cells in asymptomatic HTLV-I carriers who present abnormal peripheral blood lymphocytes providing an additional instrument for following up these patients with potentially higher risk of leukemia. PMID:15917950

  20. Reliability of detection by polymerase chain reaction of the sickle cell-containing region of the beta-globin gene in single human blastomeres.

    PubMed

    Pickering, S J; McConnell, J M; Johnson, M H; Braude, P R

    1992-05-01

    Human preimplantation embryos at various stages of development have been analysed using the polymerase chain reaction to amplify a 680 base pair fragment of the beta-globin gene. Successful amplification was achieved more frequently with DNA from intact embryos containing between one and 11 cells, single cumulus cells, oocytes which had failed to fertilize and polar bodies than from single blastomeres disaggregated from intact embryos and treated in an identical manner. The distribution of nuclei demonstrated using the nuclear chromophore diamino-phenyl-indole showed considerable inter-blastomere variation; however, no clear correlation between staining pattern and successful amplification was observed. The reason for the unreliable amplification of DNA from single blastomeres is unclear but this finding has important implications for preimplantation diagnosis of genetic disease.

  1. Amplification of human beta-actin gene by the reverse transcriptase-polymerase chain reaction: implications for assessment of RNA from formalin-fixed, paraffin-embedded material.

    PubMed

    Dakhama, A; Macek, V; Hogg, J C; Hegele, R G

    1996-10-01

    The polymerase chain reaction (PCR) is a powerful method that allows enzymatic amplification of rate target nucleic acid sequences. It has been applied to the amplification of viral genomes from paraffin-embedded pathology specimens. However, interpretation of negative results requires amplification of a housekeeping gene such as beta-actin. In the present study we used specific oligonucleotide primers previously designed to amplify both the genomic DNA and the mRNA transcript from paraffin-embedded tissue. These products have predicted sizes of 250 BP and 154 BP, respectively, but our results showed that PCR amplification only (without reverse transcription) unexpectedly generated the 154-BP product. Further investigation of the nature of this product demonstrated that it originated from the amplification of DNA, not RNA. We conclude that the 154-BP product generated by these primers cannot be exclusively considered as beta-actin RNA product and should not be used to assess successful extraction of RNA, to ascertain its integrity, or to normalize for the total amount of RNA assayed by RT-PCR from paraffin-embedded tissue.

  2. Conserved structure of amphibian T-cell antigen receptor beta chain.

    PubMed

    Fellah, J S; Kerfourn, F; Guillet, F; Charlemagne, J

    1993-07-15

    All jawed vertebrates possess well-differentiated thymuses and elicit T-cell-like cell-mediated responses; however, no surface T-cell receptor (TCR) molecules or TCR genes have been identified in ectothermic vertebrate species. Here we describe cDNA clones from an amphibian species, Ambystoma mexicanum (the Mexican axolotl), that have sequences highly homologous to the avian and mammalian TCR beta chains. The cloned amphibian beta chain variable region (V beta) shares most of the structural characteristics with the more evolved vertebrate V beta and presents approximately 56% amino acid identities with the murine V beta 14 and human V beta 18 families. The two different cloned axolotl beta chain joining regions (J beta) were found to have conserved all the invariant mammalian J beta residues, and in addition, the presence of a conserved glycine at the V beta-J beta junction suggests the existence of diversity elements. The extracellular domains of the two axolotl beta chain constant region isotypes C beta 1 and C beta 2 show an impressively high degree of identity, thus suggesting that a very efficient mechanism of gene correction has been in operation to preserve this structure at least from the early tetrapod evolution. The transmembrane axolotl C beta domains have been less well conserved when compared to the mammalian C beta but they do maintain the lysine residue that is thought to be involved in the charged interaction between the TCR alpha beta heterodimer and the CD3 complex. PMID:8341702

  3. Frequency and polymorphism of simple sequence repeats in a contiguous 685-kb DNA sequence containing the human T-cell receptor {beta}-chain gene complex

    SciTech Connect

    Charmley, P.; Concannon, P.; Hood, L.; Rowen, L.

    1995-10-10

    The human T-cell receptor {beta}-chain (TCRB) gene complex spans 575 kb in chromosome region 7q35 and has been the subject of a large-scale DNA sequencing effort. A contiguous 685-kb DNA sequence from this region was searched by computer analysis for the occurrence of simple sequence repeats (microsatellites) with core sequence lengths of 2-5 nucleotides. Twenty-nine such microsatellites of repeat number n {ge} 9 were found, with the majority being dinucleotide repeats. By PCR analysis, 19 were found to be polymorphic in repeat number, thus averaging one per 36 kb. These polymorphic di-, tri-, and tetranucleotide repeats had between 3 and 15 differently sized alleles each. The potential usefulness of these TCRB microsatellites for detecting disease susceptibility alleles was examined by measuring the linkage disequilibrium between these markers and flanking biallelic mutations. All but 4 microsatellites (79%) demonstrated significant linkage disequilibrium (P < 0.0001). This present study highlights the utility and potential outcomes of large-scale DNA sequencing for the identification of polymorphic simple sequence repeats. 20 refs., 2 figs., 1 tab.

  4. The structure, rearrangement, and ontogenic expression of DB and JB gene segments of the Mexican axolotl T-cell antigen receptor beta chain (TCRB).

    PubMed

    Kerfourn, F; Charlemagne, J; Fellah, J S

    1996-01-01

    We sequenced a total of 189 independent rearrangements in which the VB7.1 element is associated with CB1 (99 clones) or CB2 (90 clones) isotypes of the T-cell receptor (TCR) beta chain in the Mexican axolotl. Three stages of development were analyzed: 2.5 months, 10 months, and 25 months. Three JB1 segments were associated with the VB-CB1 rearrangements and six JB2 segments with VB-CB2. As in other vertebrates, some amino acid positions were conserved in all Jbetas (e. g., Phe-108, Gly-109, Gly-111, Thr-112, and Val-116). Two 11 nucleotides DB-like sequences, differed by one (A or T) central residue and could be productively read in the three putative reading frames. Most of the DB1 and JB1 segments were in the VB-CB1 clones, and most of the DB2 and JB2 segments were in the VB-CB2 clones, suggesting that the TCRB locus is organized into independent DB-JB-CB clusters that used the same collection of VB segments. About 40% of the beta-chain VDJ junctions in 2.5-month-old larvae had N nucleotides, compared with about 73% in 10 - 25-month old animals. The beta-chain VDJ junctions had about 30% of defective rearrangements at all stages of development, which could be due to the slow rate of cell division in the axolotl lymphoid organs, and the large genome in this urodele. Many of the axolotl CDRbeta3 sequences deduced for in frame VDJ rearrangements are the same in animals of different origins. Such redundancy could be a statistical effect due to the small number of thymocytes in the developing axolotl, rather than to some bias due to junctional preferences.

  5. The structure, rearrangement, and ontogenic expression of DB and JB gene segments of the Mexican axolotl T-cell antigen receptor beta chain (TCRB).

    PubMed

    Kerfourn, F; Charlemagne, J; Fellah, J S

    1996-01-01

    We sequenced a total of 189 independent rearrangements in which the VB7.1 element is associated with CB1 (99 clones) or CB2 (90 clones) isotypes of the T-cell receptor (TCR) beta chain in the Mexican axolotl. Three stages of development were analyzed: 2.5 months, 10 months, and 25 months. Three JB1 segments were associated with the VB-CB1 rearrangements and six JB2 segments with VB-CB2. As in other vertebrates, some amino acid positions were conserved in all Jbetas (e. g., Phe-108, Gly-109, Gly-111, Thr-112, and Val-116). Two 11 nucleotides DB-like sequences, differed by one (A or T) central residue and could be productively read in the three putative reading frames. Most of the DB1 and JB1 segments were in the VB-CB1 clones, and most of the DB2 and JB2 segments were in the VB-CB2 clones, suggesting that the TCRB locus is organized into independent DB-JB-CB clusters that used the same collection of VB segments. About 40% of the beta-chain VDJ junctions in 2.5-month-old larvae had N nucleotides, compared with about 73% in 10 - 25-month old animals. The beta-chain VDJ junctions had about 30% of defective rearrangements at all stages of development, which could be due to the slow rate of cell division in the axolotl lymphoid organs, and the large genome in this urodele. Many of the axolotl CDRbeta3 sequences deduced for in frame VDJ rearrangements are the same in animals of different origins. Such redundancy could be a statistical effect due to the small number of thymocytes in the developing axolotl, rather than to some bias due to junctional preferences. PMID:8753858

  6. Tissue-specific and cell surface expression of human major histocompatibility complex class I heavy (HLA-B7) and light (beta 2-microglobulin) chain genes in transgenic mice.

    PubMed Central

    Chamberlain, J W; Nolan, J A; Conrad, P J; Vasavada, H A; Vasavada, H H; Ploegh, H L; Ganguly, S; Janeway, C A; Weissman, S M

    1988-01-01

    We introduced the human genes HLA-B7 and B2M encoding the heavy (HLA-B7) and light [beta 2-microglobulin (beta 2m)] chains of a human major histocompatibility complex class I antigen into separate lines of transgenic mice. The tissue-specific pattern of HLA-B7 RNA expression was similar to that of endogenous class I H-2 genes, although the HLA-B7 gene was about 10-fold underexpressed in liver. Identical patterns of RNA expression were detected whether the HLA-B7 gene contained 12 or 0.66 kilobase(s) (kb) of 5' flanking sequence. The level of expression was copy number dependent and as efficient as that of H-2 genes; gamma interferon enhanced HLA-B7 RNA expression in parallel to that of H-2. In addition to the mechanism(s) responsible for gamma interferon-enhanced expression, there must be at least one other tissue-specific mechanism controlling the constitutive levels of class I RNA. Tissue-specific human beta 2m RNA expression was similar to that of mouse beta 2m, including high-level expression in liver. Cell surface HLA-B7 increased 10- to 17-fold on T cells and on a subset of thymocytes from HLA-B7/B2M doubly transgenic mice compared to HLA-B7 singly transgenic mice. The pattern of expression of HLA-B7 on thymocytes resembled that of H-2K as opposed to H-2D. These results confirm that coexpression of both human chains is required for efficient surface expression and that HLA-B7 may share a regulatory mechanism with H-2K, which distinguishes it from H-2D. Images PMID:2459712

  7. Interspecies hybrid HbS: complete neutralization of Val6(beta)-dependent polymerization of human beta-chain by pig alpha-chains.

    PubMed

    Rao, M J; Malavalli, A; Manjula, B N; Kumar, R; Prabhakaran, M; Sun, D P; Ho, N T; Ho, C; Nagel, R L; Acharya, A S

    2000-07-28

    alpha(2)(P)beta(2)(S) relative to that in HbS, particularly the ones involving CD region, E-helix and EF-corner of pig alpha-chain are responsible for the polymerization neutralization activity. The pig and human-pig chimeric alpha-chains can serve as blueprints for the design of a new generation of variants of alpha-chain(s) suitable for the gene therapy of sickle cell disease. PMID:10903876

  8. Same. beta. -globin gene mutation is present on nine different. beta. -thalassemia chromosomes in a Sardinian population

    SciTech Connect

    Pirastu, M.; Galanello, R.; Doherty, M.A.; Tuveri, T.; Cao, A.; Kan, Y.W.

    1987-05-01

    The predominant ..beta..-thalassemia in Sardinia is the ..beta../sup 0/ type in which no ..beta..-globin chains are synthesized in the homozygous state. The authors determined the ..beta..-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same ..beta../sup 39(CAG..-->..TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the ..beta..-globin gene region.

  9. Structure and diversity of the T cell antigen receptor beta-chain in a teleost fish.

    PubMed

    Partula, S; de Guerra, A; Fellah, J S; Charlemagne, J

    1995-07-15

    Cell-mediated immunity (e.g., allograft rejection) is found in all vertebrates, and these reactions are known to depend on thymus-derived cells in amphibian, avian, and mammalian species. The participation of peripheral T cell-like lymphocytes subpopulations to fish immunity is now well documented, but the developmental origin, migration, and peripheral tissue distribution of these cells remain practically unknown. This is mainly due to the difficulty of efficiently thymectomizing fish at an early stage of development and to the lack of Ab strictly specific for thymocytes and T cell surface Ag. One strategy for analyzing T cell biology in fish would be to characterize the genes encoding polypeptides homologous to the TCR molecules. This report describes cDNA clones from the rainbow trout (Oncorhynchus mykiss) that have sequences very similar to amphibian, avian, and mammalian TCR beta-chains. Three complete trout V beta segments belonging to different families were analyzed; one of them had limited amino acid sequence similarity to the human V beta 20 family. The 10 trout beta-chain-joining segments all retain the invariant mammalian J beta residues, and comparison of 66 V beta-J beta junctions led to the identification of a D beta-like sequence (GGACAGGG) that is shorter than but very similar to the chicken D beta and mammalian D beta 1 sequences. There is considerable diversity at the V beta-D beta and D beta-J beta junctions, suggesting the presence of N-nucleotides. The trout C beta extracellular domain is shorter than mammalian C beta, and the hinge region has no cysteine residue. The transmembrane C beta domain contains a lysine residue that in mammals is thought to be involved in charged interactions with members of the CD3 complex. PMID:7608547

  10. Energetic, Structural, and Antimicrobial Analyses of [beta]-Lactam Side Chain Recognition by [beta]-Lactamases

    SciTech Connect

    Caselli, E.; Powers, R.A.; Blaszczak, L.C.; Wu, C.Y.E.; Prati, F.; Shoichet, B.K.

    2010-03-05

    Penicillins and cephalosporins are among the most widely used and successful antibiotics. The emergence of resistance to these {beta}-lactams, most often through bacterial expression of {beta}-lactamases, threatens public health. To understand how {beta}-lactamases recognize their substrates, it would be helpful to know their binding energies. Unfortunately, these have been difficult to measure because {beta}-lactams form covalent adducts with {beta}-lactamases. This has complicated functional analyses and inhibitor design. To investigate the contribution to interaction energy of the key amide (R1) side chain of {beta}-lactam antibiotics, eight acylglycineboronic acids that bear the side chains of characteristic penicillins and cephalosporins, as well as four other analogs, were synthesized. These transition-state analogs form reversible adducts with serine {beta}-lactamases. Therefore, binding energies can be calculated directly from K{sub i} values. The K{sub i} values measured span four orders of magnitude against the Group I {beta}-lactamase AmpC and three orders of magnitude against the Group II {beta}-lactamase TEM-1. The acylglycineboronic acids have K{sub i} values as low as 20 nM against AmpC and as low as 390 nM against TEM-1. The inhibitors showed little activity against serine proteases, such as chymotrypsin. R1 side chains characteristic of {beta}-lactam inhibitors did not have better affinity for AmpC than did side chains characteristic of {beta}-lactam substrates. Two of the inhibitors reversed the resistance of pathogenic bacteria to {beta}-lactams in cell culture. Structures of two inhibitors in their complexes with AmpC were determined by X-ray crystallography to 1.90 {angstrom} and 1.75 {angstrom} resolution; these structures suggest interactions that are important to the affinity of the inhibitors. Acylglycineboronic acids allow us to begin to dissect interaction energies between {beta}-lactam side chains and {beta}-lactamases. Surprisingly

  11. Two new beta-chain variants: Hb Tripoli [beta26(B8)Glu-->Ala] and Hb Tizi-Ouzou [beta29(B11)Gly-->Ser].

    PubMed

    Lacan, Philippe; Becchi, Michel; Zanella-Cleon, Isabelle; Aubry, Martine; Ffrench, Martine; Couprie, Nicole; Francina, Alain

    2004-08-01

    Two new beta-globin chain variants: Hb Tripoli: codon 26, GAG-->GCG [beta26(B8)Glu-->Ala] and Hb Tizi-Ouzou: codon 29, GGC-->AGC [beta29(B11)Gly-->Ser] are described on the first exon of the beta-globin gene. The two variants are characterized by DNA sequencing and mass spectrometry (MS). Hematological abnormalities were found in the two carriers. The presence of microcytosis and hypochromia is explained by an additional homozygous 3.7 kb alpha(+) thalassemic deletion for the carrier of Hb Tizi-Ouzou. Hb Tizi-Ouzou showed a slight instability in vitro. The same hematological abnormalities associated with anemia are difficult to explain for Hb Tripoli's carrier in the absence of an alpha-globin genes abnormality and could suggest a possible abnormal splicing.

  12. Beta+-thalassemia in cis of a sickle cell gene: occurrence of a promoter mutation on a beta s chromosome.

    PubMed

    Baklouti, F; Ouazana, R; Gonnet, C; Lapillonne, A; Delaunay, J; Godet, J

    1989-10-01

    An atypical sickle cell trait with a very low level of hemoglobin S and features of heterozygous beta-thalassemia was recently described. In vitro globin chain synthesis strongly suggested the presence of the two abnormalities on the same chromosome. We report the corresponding beta S-thal gene. DNA sequence revealed a C----T base substitution in the distal promoter element CACCC, at position-88 from the cap site, in addition to the expected GAG----GTG mutation responsible for the structural variant (beta 6 Glu----Val). Reticulocyte mRNA titration and transient assay of the mutant gene in COS cells showed a defect in beta-mRNA production. Restriction haplotype and DNA sequence analyses revealed that the doubly mutated gene is associated with haplotype 19 (or Benin/Algeria haplotype). In particular, we found the (AT)9(T)4 repeated sequences specifically encountered 5' to the beta S gene of Benin Algeria type. These results support the view that the beta S-thal gene resulted from an independent thalassemic mutation having occurred on a beta S chromosome rather than (a) from a beta S mutation having altered a beta-thalassemic gene or (b) from a recombination event between two chromosomes, each carrying one of the mutations.

  13. Induction of assembly of MHC class I heavy chains with beta 2microglobulin by interferon-gamma.

    PubMed Central

    Klar, D; Hämmerling, G J

    1989-01-01

    Assembly of histocompatibility class I heavy chains with beta 2microglobulin (beta 2m) is known to be necessary for cell surface expression. Studies on the H-2 class I deficient but interferon-gamma (IFN-gamma) inducible fibrosarcoma BC2 and the lung carcinoma CMT 64.5 showed that after transfection with allogeneic H-2 class I genes the class I proteins are expressed, but only intracellularly and not on the cell surface. In spite of the presence of beta 2m in the cells no association of the transfected class I chain with beta 2m was observed. However, stimulation with IFN-gamma induced assembly and subsequent surface expression. These findings show that the assembly of class I heavy chains with beta 2m is not a spontaneous event but appears to be regulated by cellular mechanisms the nature of which is still unknown. Images PMID:2498080

  14. Evolution of T cell receptor genes. Extensive diversity of V beta families in the Mexican axolotl.

    PubMed

    Fellah, J S; Kerfourn, F; Charlemagne, J

    1994-11-15

    We have cloned 36 different rearranged variable regions (V beta) genes encoding the beta-chain of the T cell receptor in an amphibian species, Ambystoma mexicanum (the Mexican axolotl). Eleven different V beta segments were identified, which can be classified into 9 families on the basis of a minimum of 75% nucleotide identity. All the cloned V beta segments have the canonical features of known mammalian and avian V beta, including conserved residues Cys23, Trp34, Arg69, Tyr90, and Cys92. There seems to be a greater genetic distance between the axolotl V beta families than between the different V beta families of any mammalian species examined to date: most of the axolotl V beta s have fewer than 35% identical nucleotides and the less related families (V beta 4 and V beta 8) have no more than 23.2% identity (13.5% at the amino acid level). Despite their great mutual divergence, several axolotl V beta are sequence-related to some mammalian V beta genes, like the human V beta 13 and V beta 20 segments and their murine V beta 8 and V beta 14 homologues. However, the axolotl V beta 8 and V beta 9 families are not significantly related to any other V beta sequence at the nucleotide level and show limited amino acid similarity to mammalian V alpha, V kappa III, or VH sequences. The detection of nine V beta families among 35 randomly cloned V beta segments suggests that the V beta gene repertoire in the axolotl is probably larger than presently estimated. PMID:7963525

  15. Limited T-cell receptor beta-chain heterogeneity among interleukin 2 receptor-positive synovial T cells suggests a role for superantigen in rheumatoid arthritis.

    PubMed Central

    Howell, M D; Diveley, J P; Lundeen, K A; Esty, A; Winters, S T; Carlo, D J; Brostoff, S W

    1991-01-01

    Rheumatoid arthritis (RA) is a disease affecting the synovial membranes of articulating joints that is thought to result from T-cell-mediated autoimmune phenomena. T cells responsible for the pathogenesis of RA are likely present in that fraction of synovial T cells that expresses the interleukin 2 receptor (IL-2R), one marker of T-cell activation. We report herein an analysis of T-cell receptor (TCR) beta-chain gene expression by IL-2R-positive synovial T cells. These T cells were isolated from uncultured synovial tissue specimens by using IL-2R-specific monoclonal antibodies and magnetic beads, and TCR beta-chain transcription was analyzed by PCR-catalyzed amplification using a panel of primers specific for the human TCR beta-chain variable region (V beta). Multiple V beta gene families were found to be transcribed in these patients samples; however, three gene families, V beta 3, V beta 14, and V beta 17, were found in a majority of the five synovial samples analyzed, suggesting that T cells bearing these V beta s had been selectively retained in the synovial microenvironment. In many instances, the V beta 3, V beta 14, or V beta 17 repertoires amplified from an individual patient were dominated by a single rearrangement, indicative of clonal expansion in the synovium and supportive of a role for these T cells in RA. Of note is a high sequence similarity between V beta 3, V beta 14, and V beta 17 polypeptides, particularly in the fourth complementarity-determining region (CDR). Given that binding sites for superantigens have been mapped to the CDR4s of TCR beta chains, the synovial localization of T cells bearing V beta s with significant CDR4 homology indicates that V beta-specific T-cell activation by superantigen may play a role in RA. PMID:1660155

  16. Arrested rearrangement of TCR V[beta] genes in thymocytes from children with x-linked severe combined immunodeficiency disease

    SciTech Connect

    Sleasman, J.W.; Harville, T.O.; White, G.B.; Barrett, D.J. ); George, J.F. ); Goodenow, M.M. Univ. of Alabama, Birmingham, AL )

    1994-07-01

    Human X-linked severe combined immunodeficiency disease (SCID) is an immunodeficiency disorder in which T cell development is arrested in the thymic cortex. B lymphocytes in children with X-linked SCID seem to differentiate normally. X-linked SCID is associated with a mutation in the gene that encodes the IL-2R [gamma]-chain. Because TCR-[beta] gene recombination is a pivotal initial event in T lymphocyte onteogeny within the thymus, the authors hypothesized that a failure to express normal IL-2R[gamma] could lead to impaired TCR-[beta] gene recombination in early thymic development. PCR was used to determine the status of TCR-[beta] gene-segment rearrangements in thymic DNA that had been obtained from children with X-linked SCID. The initial step in TCR-[beta] gene rearrangement, that of D[beta] to J[beta] recombination, was readily detected in all thymus samples from children with X-linked SCID; in contrast, V[beta] to DJ[beta] gene rearrangements were undetectable in the same samples. Both D[beta] to J[beta] and V[beta] to DJ[beta] TCR genes were rearranged in the thymic tissues obtained from immunologically normal children. The authors conclude that TCR[beta]-chain gene rearrangement is arrested in children with X-linked SCID. The results suggest a causative relationship between the failure of TCR [beta]-chain gene arrangements to proceed beyond DJ[beta] rearrangements and the production of a nonfunctional IL-2R [gamma]-chain. 45 refs., 3 figs.

  17. Effects of increased anionic charge in the beta-globin chain on assembly of hemoglobin in vitro.

    PubMed

    Adachi, K; Yamaguchi, T; Pang, J; Surrey, S

    1998-02-15

    Studies on assembly in vitro of alpha-globin chains with recombinant beta16 Gly-->Asp, beta95 Lys-->Glu, beta120 Lys-->Glu and beta16 Gly-->Asp, 120 Lys-->Glu human beta-globin chain variants in addition to human betaA- and betaS-globin chains were performed to evaluate effects of increased anionic charge in the beta chain on hemoglobin assembly using soluble recombinant beta-globin chains expressed in bacteria. A beta112 Cys-->Asp change was also engineered to monitor effects on assembly of increased negative charge at alpha1beta1 interaction sites. Order of tetramer formation in vitro under limiting alpha-globin chain conditions showed Hb betaG16D, K120E = Hb betaK120E = Hb betaK95E > Hb betaG16D > Hb A > Hb S > Hb betaC112D. In addition, beta112 Cys-->Asp chains exist as monomers rather than beta4 tetramers in the absence of alpha chains, and the beta chain in Hb betaC112D tetramers was readily exchanged by addition of betas. These results suggest that affinity between alpha and beta chains is promoted by negatively-charged beta chains up to a maximum of two additional net negative charges and is independent of location on the surface except at the alpha1beta1 interaction site. In addition, our findings show that beta112 Cys on the G helix is critical for facilitating formation of stable alphabeta dimers, which then form functional hemoglobin tetramers, and that beta112 Cys-->Asp inhibits formation of stable alpha1beta1 and beta1beta2 interactions in alpha2beta2 and beta4 tetramers, respectively. PMID:9454775

  18. Involvement of protein N-glycosyl chain glucosylation and processing in the biosynthesis of cell wall beta-1,6-glucan of Saccharomyces cerevisiae.

    PubMed Central

    Shahinian, S; Dijkgraaf, G J; Sdicu, A M; Thomas, D Y; Jakob, C A; Aebi, M; Bussey, H

    1998-01-01

    beta-1,6-Glucan plays a key structural role in the yeast cell wall. Of the genes involved in its biosynthesis, the activity of Cwh41p is known, i.e., the glucosidase I enzyme of protein N-chain glucose processing. We therefore examined the effects of N-chain glucosylation and processing mutants on beta-1,6-glucan biosynthesis and show that incomplete N-chain glucose processing results in a loss of beta-1,6-glucan, demonstrating a relationship between N-chain glucosylation/processing and beta-1,6-glucan biosynthesis. To explore the involvement of other N-chain-dependent events with beta-1,6-glucan synthesis, we investigated the Saccharomyces cerevisiae KRE5 and CNE1 genes, which encode homologs of the "quality control" components UDP-Glc:glycoprotein glucosyltransferase and calnexin, respectively. We show that the essential activity of Kre5p is separate from its possible role as a UDP-Glc:glycoprotein glucosyltransferase. We also observe a approximately 30% decrease in beta-1,6-glucan upon disruption of the CNE1 gene, a phenotype that is additive with other beta-1,6-glucan synthetic mutants. Analysis of the cell wall anchorage of the mannoprotein alpha-agglutinin suggests the existence of two beta-1,6-glucan biosynthetic pathways, one N-chain dependent, the other involving protein glycosylphosphatidylinositol modification. PMID:9611196

  19. Hemoglobin Indianapolis (beta 112[G14] arginine). An unstable beta-chain variant producing the phenotype of severe beta-thalassemia.

    PubMed Central

    Adams, J G; Boxer, L A; Baehner, R L; Forget, B G; Tsistrakis, G A; Steinberg, M H

    1979-01-01

    Hemoglobin (Hb) Indianapolis is an extremely labile beta-chain variant, present in such small amounts that it was undetectable by usual techniques. Clinically, it produces the phenotype of severe beta-thalassemia. Biosynthetic studies showed a beta:alpha ratio of 0.5 in reticulocytes and about 1.0 in marrow after a 1-h incubation. These results, similar to those seen in typical heterozygous beta-thalassemia, suggested that betaIndianapolis was destroyed so rapidly that its net synthesis was essentially zero. To examine the kinetics of globin synthesis, reticulocyte incubations of 1.25--20 min were performed with [3H]leucine. The betaIndianapolis:beta A ratio at 1.25 min was 0.80 suggesting that beta Indianapolis was synthesized at a near normal rate. At 20 min, this ratio was 0.46 reflecting rapid turnover of beta Indianapolis. The erythrocyte ghosts from these incubations contained only betaIndianapolis and alpha-chains, and the proportion of betaIndianapolis decreased with time, indicating loss of betaIndianapolis. Pulse-chase studies showed little change in beta A:alpha ratio and decreasing betaIndianapolis:alpha and betaIndianapolis:beta A with time. The half-life of betaIndianapolis in the soluble hemoglobin was approximately equal to 7 min. There was also rapid loss of beta Indianapolis from the erythrocyte membrane. From these results, it may be inferred that betaIndianapolis is rapidly precipitated from the soluble cell phase to the membrane, where it is catabolized. Heterozygotes for beta 0-thalassemia usually have minimal hematologic abnormalities, whereas heterozygotes with betaIndianapolis, having a similar net content of beta-chain, have severe disease. The extremely rapid precipitation and catabolism of betaIndianapolis and the resulting excess of alpha-chains, both causing membrane damage, may be responsible for the severe clinical manifestations associated with this variant. It seems likely that other, similar disturbances in the primary sequence of

  20. Analysis of betaS and betaA genes in a Mexican population with African roots.

    PubMed

    Magaña, María Teresa; Ongay, Zoyla; Tagle, Juan; Bentura, Gilberto; Cobián, José G; Perea, F Javier; Casas-Castañeda, Maricela; Sánchez-López, Yoaly J; Ibarra, Bertha

    2002-01-01

    To investigate the origin of the beta(A) and beta(S) genes in a Mexican population with African roots and a high frequency of hemoglobin S, we analyzed 467 individuals (288 unrelated) from different towns in the states of Guerrero and Oaxaca in the Costa Chica region. The frequency of the sickle-cell trait was 12.8%, which may represent a public health problem. The frequencies of the beta-haplotypes were determined from 350 nonrelated chromosomes (313 beta(A) and 37 beta(S)). We observed 15 different beta(A) haplotypes, the most common of which were haplotypes 1 (48.9%), 2 (13.4%), and 3 (13.4%). The calculation of pairwise distributions and Nei's genetic distance analysis using 32 worldwide populations showed that the beta(A) genes are more closely related to those of Mexican Mestizos and North Africans. Bantu and Benin haplotypes and haplotype 9 were related to the beta(S) genes, with frequencies of 78.8, 18.2, and 3.0%, respectively. Comparison of these haplotypes with 17 other populations revealed a high similitude with the population of the Central African Republic. These data suggest distinct origins for the beta(A) and beta(S) genes in Mexican individuals from the Costa Chica region.

  1. Structure and expression of the mouse beta 2-microglobulin gene isolated from somatic and non-expressing teratocarcinoma cells.

    PubMed Central

    Daniel, F; Morello, D; Le Bail, O; Chambon, P; Cayre, Y; Kourilsky, P

    1983-01-01

    Mouse teratocarcinoma cells express neither H-2 heavy chains nor beta 2-microglobulin (beta 2-m). We have constructed two genomic libraries, one from PCC4-aza-RI embryonal carcinoma cells and the other from their adult syngenic counterpart 129/Sv liver cells (H-2bc). The libraries were screened with a full length mouse beta 2-m cDNA probe which we isolated and sequenced. Two cosmid clones carrying the entire beta 2-m gene were isolated, one from each library. There was no detectable difference in structure between the two genes. Furthermore, both were shown to be active and to restore beta 2-m synthesis upon transfer into mutant cells deficient in beta 2-m. Irreversible DNA alterations in or around the beta 2-m gene are thus unlikely to account for the lack of beta 2-m gene expression in embryonal teratocarcinoma cells. Images Fig. 3. Fig. 4. Fig. 6. PMID:6354707

  2. Total beta-globin gene deletion has high frequency in Filipinos

    SciTech Connect

    Patrick, N.; Miyakawa, F.; Hunt, J.A.

    1994-09-01

    The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5 of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].

  3. beta2 adrenoceptor gene polymorphisms in cystic fibrosis lung disease.

    PubMed

    Büscher, Rainer; Eilmes, Katrin Jennifer; Grasemann, Hartmut; Torres, Brian; Knauer, Nicola; Sroka, Karin; Insel, Paul A; Ratjen, Felix

    2002-07-01

    The cystic fibrosis membrane conductance regulator can be activated through beta2-adrenoceptor (beta2AR) stimulation. We tested the hypothesis that coding sequence polymorphisms in the beta2AR gene contribute to the disease state in patients with cystic fibrosis. The Arg16Gly, Gln27Glu, and Thr164Ile beta2AR polymorphisms were studied by specific polymerase chain reaction and restriction fragment length polymorphism analysis in 126 cystic fibrosis patients. Forced expiratory volume in 1 s was significantly (P < 0.05) reduced in cystic fibrosis patients carrying the Gly16 allele in either homozygous or heterozygous form (Gly16Gly + Arg16Gly) compared to patients homozygous for the Arg16 allele (60.3 +/- 3.5% versus 75.7 +/- 4.9% predicted). Similarly, forced vital capacity and flows at lower lung volumes were significantly (P < 0.05 and P < 0.01) lower in cystic fibrosis patients carrying the Gly16 allele. In addition, the Gly16 allele was associated with a greater 5 year decline in pulmonary function (P < 0.01). Bronchodilator responses to albuterol were not significantly different between the groups. The Thr164Ile variant was found in four patients; these patients had markedly reduced pulmonary function. Isoproterenol-stimulated cyclic AMP formation was significantly blunted in cystic fibrosis patients carrying either the Gly16 allele or Thr164Ile genotype compared to cystic fibrosis patients homozygous for the respective Arg16 alleles. These data provide the first evidence suggesting that polymorphisms of the beta2AR gene contribute to clinical severity and disease progression in cystic fibrosis.

  4. Interstrand side chain--side chain interactions in a designed beta-hairpin: significance of both lateral and diagonal pairings.

    PubMed

    Syud, F A; Stanger, H E; Gellman, S H

    2001-09-12

    The contributions of interstrand side chain-side chain contacts to beta-sheet stability have been examined with an autonomously folding beta-hairpin model system. RYVEV(D)PGOKILQ-NH2 ((D)P = D-proline, O = ornithine) has previously been shown to adopt a beta-hairpin conformation in aqueous solution, with a two-residue loop at D-Pro-Gly. In the present study, side chains that display interstrand NOEs (Tyr-2, Lys-9, and Leu-11) are mutated to alanine or serine, and the conformational impact of the mutations is assessed. In the beta-hairpin conformation Tyr-2 and Leu-11 are directly across from one another (non-hydrogen bonded pair). This "lateral" juxtaposition of two hydrophobic side chains appears to contribute to beta-hairpin conformational stability, which is consistent with results from other beta-sheet model studies and with statistical analyses of interstrand residue contacts in protein crystal structures. Interaction between the side chains of Tyr-2 and Lys-9 also stabilizes the beta-hairpin conformation. Tyr-2/Lys-9 is a "diagonal" interstrand juxtaposition because these residues are not directly across from one another in terms of the hydrogen bonding registry between the strands. This diagonal interaction arises from the right-handed twist that is commonly observed among beta-sheets. Evidence of diagonal side chain-side chain contacts has been observed in other autonomously folding beta-sheet model systems, but we are not aware of other efforts to determine whether a diagonal interaction contributes to beta-sheet stability.

  5. Retroviral transfer of a human beta-globin/delta-globin hybrid gene linked to beta locus control region hypersensitive site 2 aimed at the gene therapy of sickle cell disease.

    PubMed

    Takekoshi, K J; Oh, Y H; Westerman, K W; London, I M; Leboulch, P

    1995-03-28

    Human gamma-globin and delta-globin chains have been previously identified as strong inhibitors of the polymerization of hemoglobin S, in contrast to the beta-globin chain, which exerts only a moderate antisickling effect. However, gamma-globin and delta-globin are normally expressed at very low levels in adult erythroid cells, in contrast to beta-globin. We report the design of a beta-globin/delta-globin hybrid gene, beta/delta-sickle cell inhibitor 1 (beta/delta-SCI1) and its transduction by retrovirus-mediated gene transfer. The beta/delta-SCI1-encoding gene retains the overall structure of the human beta-globin gene, while incorporating specific amino acid residues from the delta chain previously found responsible for its enhanced antisickling properties. To achieve high expression levels of beta/delta-SCI1 in adult erythrocytes, the hybrid gene was placed under the transcriptional control of the human beta-globin promoter and the DNase I hypersensitive site 2 of the human beta locus control region. High-titer retroviruses were generated, and stable proviral transmission was achieved in infected cells. The mRNA expression levels of the beta/delta-SCI1 gene in infected, dimethyl sulfoxide-induced murine erythroleukemia cells approached 85% of the endogenous murine beta maj-globin mRNA, on a per gene basis, evidence that high gene expression levels were achieved in adult erythroid cells. Further evaluation of this strategy in transgenic animal models of sickle cell disease should assess its efficacy for the gene therapy of human patients.

  6. Domains of the TCR beta-chain required for early thymocyte development

    PubMed Central

    1996-01-01

    The T cell receptor beta (TCR beta) chain controls the developmental transition from CD4-CD8- to CD4+8+thymocytes. We show that the extracellular constant region and the transmembrane region, but not the variable domain or cytoplasmic tail of the TCR beta chain are required for this differentiation step. TCR beta mutant chains lacking the cytoplasmic tail can be found at the cell surface both in functional TCR/CD3 complexes and in a GPI-anchored monomeric form indicating that the cytoplasmic tail of the TCR beta chain functions as an ER retention signal. The concordance between cell surface expression of the mutant chains as TCR/CD3 complexes and their capacity to mediate thymocyte differentiation supports the CD3 mediated feedback model in which preTCR/CD3 complexes control the developmental transition from CD4-CD8- to CD4+CD8+thymocytes. PMID:8920871

  7. Human globin gene analysis for a patient with beta-o/delta beta-thalassemia.

    PubMed Central

    Ottolenghi, S; Lanyon, W G; Williamson, R; Weatherall, D J; Clegg, J B; Pitcher, C S

    1975-01-01

    Complementary DNA (cDNA) was prepared with RNA-dependent DNA polymerase from human globin messenger RNA (mRNA). Annealing and translation experimenta with total mRNA from circulating cells from a patient with heterozygous beta/heterozygous beta-delta-o thalassemia (beta-o/delta beta-o-thalassemia) demonstrated no detectable mRNA for beta-globin. cDNA enriched in sequences homologous to beta-globin mRNA was prepared by hydroxylapatite fractionation of hybrids formed between beta-o/delta beta-o-thalassemic mRNA and cDNA made from mRNA from a patient with alpha-thalassemia (hemoglobin H disease). The rate of annealing of this beta-enriched cDNA to normal human nuclear DNA was that of a sequence present as only a single copy per haploid genome. The beta-enriched cDNA annealed to the beta-o-delta beta-o-thalassemia total DNA with approximately the same kinetics as to normal DNA, indicating that no total gene deletion of beta-globin genes from the diploid genome has occurred, although the accuracy of the technique could not exclude with certainty a partial deletion or a deletion of a beta-globin gene from only one of the haploid genomes. This demonstrates that at least one of the beta-o- or the delta beta-o-thalassemia haploid genomes in this case contains a substantially intact beta-globin gene. PMID:49057

  8. Aspartic acid at position 57 of the HLA-DQ beta chain protects against type I diabetes: a family study.

    PubMed Central

    Morel, P A; Dorman, J S; Todd, J A; McDevitt, H O; Trucco, M

    1988-01-01

    One hundred seventy-two members from 27 randomly selected multiple case Caucasian families of patients with insulin-dependent diabetes mellitus (IDDM) were studied at the DNA level to ascertain the reliability of codon 57 of the HLA-DQ beta-chain gene as a disease protection/susceptibility marker. The analysis was carried out by polymerase chain reaction amplification of DNA encoding the first domain of the DQ beta chain and by dot blot analysis of the amplified material with allele-specific oligonucleotide probes. One hundred twenty-three randomly selected healthy Caucasian donors were also tested. The results demonstrated that haplotypes carrying an aspartic acid in position 57 (Asp-57) of their DQ beta chain were significantly increased in frequency among nondiabetic haplotypes (23/38), while non-Asp-57 haplotypes were significantly increased in frequency among diabetic haplotypes (65/69). Ninety-six percent of the diabetic probands in our study were homozygous non-Asp/non-Asp as compared to 19.5% of healthy unrelated controls. This conferred a relative risk of 107 (chi 2 = 54.97; P = 0.00003) for non-Asp-57 homozygous individuals. Even though the inheritance and genetic features of IDDM are complex and are not necessarily fully explained by DQ beta chain polymorphism, this approach is much more sensitive than HLA serolog in assessing risk for IDDM. PMID:3186714

  9. Hemoglobin Agenogi--A rare abnormal beta globin chain variant.

    PubMed

    Sharma, Sunita; Sharma, Geetika; Chandra, Jagdish; Colah, Roshan

    2016-01-01

    Haemoglobin (Hb) Agenogi is clinically asymptomatic, rare β-globin chain variant characterized by a substitution of glutamic acid by lysine at position 90 of β-chain. It elutes in the C-window on high-performance liquid chromatography (HPLC). We report a 10-year-old male with easy fatigability, lethargy, pallor, and mild splenomegaly. Hematological parameters revealed microcytic hypochromic anemia and mildly raised red blood cells count, suggestive of thalassemia trait. On HPLC, a predominant peak was observed in the C-window (82.6%) along with raised HbA 2 level (9.3%). Based on these findings, a possibility of HbC disease/β-thalassemia trait doubly heterozygous was considered. Family studies were advised. HPLC findings in father were suggestive of β-thalassemia trait, while both his mother and brother had an abnormal peak in the C-window of 42.7% and 40.8%, respectively, with elevated HbA 2 values of 5% and 4.9%, respectively. Direct DNA sequencing revealed intervening sequences 1-5 (G ; C) in father, confirming β-thalassemia trait. His mother and brother had heterozygous gene mutation at codon 90 of β-globin chain (G ; A) suggestive of Hb Agenogi. The child carried mutations for both β-thalassemia trait as well as Hb Agenogi. PMID:26960650

  10. Crystal Structures of T Cell Receptor (Beta) Chains Related to Rheumatoid Arthritis

    SciTech Connect

    Li,H.; van Vranken, S.; Zhao, Y.; Li, Z.; Guo, Y.; Eisele, L.; Li, Y.

    2005-01-01

    The crystal structures of the V{beta}17+ {beta} chains of two human T cell receptors (TCRs), originally derived from the synovial fluid (SF4) and tissue (C5-1) of a patient with rheumatoid arthritis (RA), have been determined in native (SF4) and mutant (C5-1{sub F104{yields}Y/C187{yields}S}) forms, respectively. These TCR {beta} chains form homo-dimers in solution and in crystals. Structural comparison reveals that the main-chain conformations in the CDR regions of the C5-1 and SF4 V{beta}17 closely resemble those of a V{beta}17 JM22 in a bound form; however, the CDR3 region shows different conformations among these three V{beta}17 structures. At the side-chain level, conformational differences were observed at the CDR2 regions between our two ligand-free forms and the bound JM22 form. Other significant differences were observed at the V{beta} regions 8-12, 40-44, and 82-88 between C5-1/SF4 and JM22 V{beta}17, implying that there is considerable variability in the structures of very similar {beta} chains. Structural alignments also reveal a considerable variation in the V{beta}-C{beta} associations, and this may affect ligand recognition. The crystal structures also provide insights into the structure basis of T cell recognition of Mycoplasma arthritidis mitogen (MAM), a superantigen that may be implicated in the development of human RA. Structural comparisons of the V{beta} domains of known TCR structures indicate that there are significant similarities among V{beta} regions that are MAM-reactive, whereas there appear to be significant structural differences among those V{beta} regions that lack MAM-reactivity. It further reveals that CDR2 and framework region (FR) 3 are likely to account for the binding of TCR to MAM.

  11. Characterization of a cDNA clone coding for the beta chain of bovine fibrinogen.

    PubMed Central

    Chung, D W; Rixon, M W; MacGillivray, R T; Davie, E W

    1981-01-01

    Recombinant plasmids containing bovine cDNA have been screened with a radiolabeled cDNA enriched for bovine fibrinogen. A number of plasmids containing cDNAs for fibrinogen were identified by this assay. One plasmid, designated pBI beta 1, was found to contain a cDNA insert of 1372 base pairs. The sequence of the cDNA insert for this plasmid was then determined. It was shown to code for 424 amino acids of the beta chain of fibrinogen, starting with residue 44. This and other data made it possible to construct the complete amino acid sequence of the beta chain of the protein. Comparison of the amino acid sequence of the beta chain of bovine fibrinogen with the corresponding chain of the human molecule indicated that the two chains are greater than 80% homologous. PMID:6262803

  12. Spectrin Rouen (beta 220-218), a novel shortened beta-chain variant in a kindred with hereditary elliptocytosis. Characterization of the molecular defect as exon skipping due to a splice site mutation.

    PubMed Central

    Garbarz, M; Tse, W T; Gallagher, P G; Picat, C; Lecomte, M C; Galibert, F; Dhermy, D; Forget, B G

    1991-01-01

    The molecular defect responsible for the shortened beta-spectrin chain variant, spectrin Rouen, was identified by analysis of cDNA and genomic DNA of affected individuals after amplification by the polymerase chain reaction. Peripheral blood reticulocyte RNA was transcribed into cDNA and amplified using primers corresponding to the 3' end of beta-spectrin cDNA. Agarose gel electrophoresis of cDNA amplification products from affected individuals revealed the expected band of 391 bp as well as a shortened band of 341 bp. Nucleotide sequencing of the shortened cDNA amplification product revealed that the sequences corresponding to the penultimate exon of the beta-spectrin gene (exon Y) were absent. This result was confirmed by hybridization of a Southern blot of amplification products with a labeled probe specific for exon Y. Nucleotide sequencing of the proband's amplified genomic DNA corresponding to this region of the beta-spectrin gene revealed a mutation in the 5' donor consensus splice site of the intron downstream of the Y exon, TGG/GTGAGT to TGG/GTTAGT, in one allele. We postulate that this mutation leads to the splicing out or skipping of exon Y, thus producing a shortened beta-spectrin chain. To our knowledge, this is the first documented example of exon skipping as the cause of a shortened beta-spectrin chain in a case of hereditary elliptocytosis. The exon skip results in the loss of the 17 amino acids of exon Y and creates a frameshift with the synthesis of 33 novel amino acids prior to premature chain termination 14 residues upstream of the normal carboxy terminus of the beta-spectrin chain, giving a mutant beta-spectrin chain that is 31 amino acids shorter than the normal chain. Images PMID:2056132

  13. [Characterization of cDNA of T-cell receptor beta chain in rainbow trout].

    PubMed

    Partula, S; Fellah, J S; de Guerra, A; Charlemagne, J

    1994-08-01

    Using a two-step PCR strategy, we have cloned several cDNA segments encoding the T-cell receptor beta chain in a Teleost fish, the rainbow trout (Oncorhynchus mykiss). The nine clones analyzed encode identical N-terminal-truncated V beta regions which present limited sequence similarities with several mammalian TcR V beta chains, from residue Tyr-35 to residue Ser-95. These V beta regions are followed by V beta-D beta-J beta-like regions which are different in all the sequenced clones, and by identical C beta regions. The trout C beta domain (156 amino acids) is most related to the chicken and to amphibian (axolotl) C beta domains but no cysteine residue appears in the hinge region. Like in other vertebrate C beta s, the TM region carries a positively charged lysine residue (Lys-271). The intracytoplasmic domain is virtually absent. The possibility to analyze the structure, expression and diversity of a T-cell receptor chain in a Teleost fish model will be important for our future understanding of the evolution of specific immune recognition in vertebrates. PMID:7882160

  14. Cardiac and skeletal myopathy in beta myosin heavy-chain simian virus 40 tsA58 transgenic mice.

    PubMed Central

    De Leon, J R; Federoff, H J; Dickson, D W; Vikstrom, K L; Fishman, G I

    1994-01-01

    The mechanisms regulating cardiac muscle differentiation and development are incompletely understood. To examine the relationships between cardiocyte proliferation and differentiation, we tested the ability of a fragment from the rat beta myosin heavy-chain (MHC beta) gene to correctly target expression of a thermolabile simian virus 40 large tumor antigen allele (tsA58) in the developing mouse. Transgene expression in the heart was observed as early as 10 days postconception and was developmentally regulated in parallel with the endogenous MHC beta gene. Expression was also detected in developing skeletal muscle, although at low levels. Despite the temperature sensitivity of the mutant large tumor antigen protein, a subset of transgenic mice in several lineages developed marked cardiac and skeletal myopathies. Images Fig. 2 Fig. 3 Fig. 4 PMID:8290557

  15. Isolation and characterization of BetaM protein encoded by ATP1B4 - a unique member of the Na,K-ATPase {beta}-subunit gene family

    SciTech Connect

    Pestov, Nikolay B.; Zhao, Hao; Basrur, Venkatesha; Modyanov, Nikolai N.

    2011-09-09

    Highlights: {yields} Structural properties of BetaM and Na,K-ATPase {beta}-subunits are sharply different. {yields} BetaM protein is concentrated in nuclear membrane of skeletal myocytes. {yields} BetaM does not associate with a Na,K-ATPase {alpha}-subunit in skeletal muscle. {yields} Polypeptide chain of the native BetaM is highly sensitive to endogenous proteases. {yields} BetaM in neonatal muscle is a product of alternative splice mRNA variant B. -- Abstract: ATP1B4 genes represent a rare instance of the orthologous gene co-option that radically changed functions of encoded BetaM proteins during vertebrate evolution. In lower vertebrates, this protein is a {beta}-subunit of Na,K-ATPase located in the cell membrane. In placental mammals, BetaM completely lost its ancestral role and through acquisition of two extended Glu-rich clusters into the N-terminal domain gained entirely new properties as a muscle-specific protein of the inner nuclear membrane possessing the ability to regulate gene expression. Strict temporal regulation of BetaM expression, which is the highest in late fetal and early postnatal myocytes, indicates that it plays an essential role in perinatal development. Here we report the first structural characterization of the native eutherian BetaM protein. It should be noted that, in contrast to structurally related Na,K-ATPase {beta}-subunits, the polypeptide chain of BetaM is highly sensitive to endogenous proteases that greatly complicated its isolation. Nevertheless, using a complex of protease inhibitors, a sample of authentic BetaM was isolated from pig neonatal skeletal muscle by a combination of ion-exchange and lectin-affinity chromatography followed by SDS-PAGE. Results of the analysis of the BetaM tryptic digest using MALDI-TOF and ESI-MS/MS mass spectrometry have demonstrated that native BetaM in neonatal skeletal muscle is a product of alternative splice mRNA variant B and comprised of 351 amino acid residues. Isolated BetaM protein was

  16. Maple syrup urine disease: The E1{beta} gene of human branched-chain {alpha}-ketoacid dehydrogenase complex has 11 rather than 10 exons, and the 3{prime} UTR in one of the two E1{beta} mRNAs arises from intronic sequences

    SciTech Connect

    Chuang, J.L.; Chuang, D.T.; Cox, R.P.

    1996-06-01

    Maple syrup urine disease (MSUD) or branched-chain ketoaciduria is caused by a deficiency in the mitochondrial branched-chain {alpha}-ketoacid dehydrogenase (BCKAD) complex. The clinical manifestations are characterized by accumulation of branched chain amino and {alpha}-ketoacids, which leads to severe cerebral edema with seizures, ketoacidosis, and mental retardation. The BCKAD complex comprises three catalytic components, i.e., a decarboxylase (E1) consisting of two E1{alpha} (M{sub r} = 46,000) and two E1{Beta} (M{sub r} = 37,500) subunits, a transacylase (E2) that contains 24 lipoic acid-bearing subunits, and a dehydrogenase (E3), which is a homodimeric flavoprotein. MSUD is genetically heterogeneous, since mutations in the E1{alpha} subunit (type IA MSUD), the E1{Beta} subunit (type IB), the E2 subunit (type II) and the E3 subunit (type III) have been described. The functional consequences of certain mutations in the BCKAD complex have been studied. 23 refs., 3 figs.

  17. Positive selection determines T cell receptor V beta 14 gene usage by CD8+ T cells

    PubMed Central

    1989-01-01

    We report here a mAb, 14-2, reactive with TCRs that include V beta 14. The frequency of V beta 14+ T cells varies with CD4 and CD8 subset and is controlled by the H-2 genes. Thus CD8+ T cells from H-2b mice include approximately 2.3% V beta 14+ T cells while CD8+ T cells from mice expressing K kappa include greater than 8% V beta 14+ T cells. In all strains examined, 7-8% of CD4+ T cells express V beta 14. The frequent usage of V beta 14 in CD8+ T cells of K kappa-expressing mice is a result of preferential positive selection of V beta 14+ CD8+ T cells as demonstrated by analysis of radiation chimeras. These studies demonstrate that H-2-dependent positive selection occurs in unmanipulated mice. Furthermore, the results imply that positive selection, and possibly H-2 restriction, can be strongly influenced by a V beta domain, with some independence from the beta-junctional sequence and alpha chain. PMID:2501444

  18. Interleukin-1 beta gene polymorphism and traditional constitution in obese women.

    PubMed

    Lee, Jeong-Hoon; Kwon, Young-Dal; Hong, Seung-Heon; Jeong, Hyun-Ja; Kim, Hyung-Min; Um, Jae-Young

    2008-06-01

    In adipose tissue metabolism, cytokines were major regulators. mRNA expression studies show that adipocytes can synthesize both tumor necrosis factor-alpha and several interleukins (ILs), notably IL-1 beta (IL-1beta) and IL-6. In particular, IL-1beta expression is under strong genetic control. We examined the relationship among obesity, polymorphism of the IL-1beta at position +3953 in exon 5, and Sasang constitution. In a group of 181 healthy females with a marked variation in body mass index (BMI), we determined the genotype of IL-1beta by polymerase chain reaction-restriction fragment length polymorphism assays. A significant decrease was found for the IL-1beta T allele in the overweight group (BMI 25 approximately 29 kg/m(2)) compared with the lean group with a BMI < 25 kg/m(2) (P = .049, odds ratio [OR] = 0.296). Carriers of T allele in the heterozygous or homozygous form did not show a significant difference in physical and clinical characteristics. In addition, in Taeumin female subjects, the frequency of IL-1beta T allele was apparently decreased in the overweight group (BMI 25 approximately 29 kg/m(2)) compared with the lean group with a BMI < 25 kg/m(2) (P = .007, OR = 0.152). In overweight women, we found an association between the +3953 C/T polymorphism in the IL-1beta gene and BMI. In addition, we found an association among IL-1beta polymorphism, obesity, and Sasang constitution.

  19. T-cell receptor (TCR) usage in Lewis rat experimental autoimmune encephalomyelitis: TCR beta-chain-variable-region V beta 8.2-positive T cells are not essential for induction and course of disease.

    PubMed Central

    Gold, R; Giegerich, G; Hartung, H P; Toyka, K V

    1995-01-01

    Predominant usage of V beta 8.2 gene segments, encoding a T-cell receptor (TCR) beta chain variable region, has been reported for pathogenic Lewis rat T cells reactive to myelin basic protein (MBP). However, up to 75% of the alpha/beta T cells in a panel of MBP-specific T-cell lines did not display TCR V beta 8.2, V beta 8.5, V beta 10, or V beta 16 elements. To further investigate TCR usage, we sorted the T-cell lines for V beta 8.2- and V beta 10-positive T cells or depleted the lines of cells with these TCRs. V beta 8.2-positive T cells and one of the depleted T-cell lines strongly reacted against the MBP peptide MBP-(68-88). The depleted T-cell line caused marked experimental autoimmune encephalomyelitis (EAE) even in Lewis rats in which endogenous V beta 8.2-positive T cells had been eliminated by neonatal treatment with anti-V beta 8.2 monoclonal antibodies. T-cell hybridomas generated from this line predominantly used V beta 3 TCR genes coexpressed with TCR V alpha 2 transcripts, which were also used by V beta 8.2-positive T cells. Furthermore, V beta 10-positive T cells reactive to MBP-(44-67) were encephalitogenic when injected immediately after positive selection. After induction of EAE by sorted V beta 8.2- or V beta 10-positive T-cell lines, immunocytochemical analysis of the spinal cord tissue showed a predominance of the injected TCR or of nontypable alpha/beta T cells after injection of the depleted line. Our results demonstrate heterogeneity of TCR beta-chain usage even for a single autoantigen in an inbred strain. Moreover, V beta 8.2-positive T cells are not essential for the induction and progression of adoptive-transfer EAE. Images Fig. 4 Fig. 5 PMID:7597040

  20. Effect of casein genes - beta-LGB, DGAT1, GH, and LHR - on milk production and milk composition traits in crossbred Holsteins.

    PubMed

    Molee, A; Poompramun, C; Mernkrathoke, P

    2015-03-30

    The objectives of this study were to determine the effects of a single gene and composite genotype of the casein gene family, including the beta-lactoglobulin gene (beta-LGB), acyl-CoA: diacylglycerol acyltransferase 1 gene (DGAT1), growth hormone gene (GH), and luteinizing hormone receptor gene (LHR) on milk yield, milk composition, the percentage of fat, protein, solids-not-fat, and total solid in crossbred Holsteins. A total of 231 crossbred Holstein cows were examined for the study. The genotype of the beta-casein gene was analyzed by allele-specific polymerase chain reaction, while the alpha-S1, alpha-S2, kappa-casein, DGAT1, beta-LGB, and GH genes were analyzed using a polymerase chain reaction-restriction fragment length polymorphism assay. The association between genes and milk yield and milk composition was analyzed. Three pairs of genes, for which significant associations were detected, were beta + kappa-casein, DGAT1 + beta-casein, and GH + beta-LGB. In the single-gene model, most loci are significantly associated with traits. A significant association between the composite genotype and the traits was detected in all composite genotypes. GH + beta-LGB appears to be the most suitable variants for improving milk production and percentage of milk protein. Overall, the effects of the composite genotype and single gene were different. A physical or functional relationship between genes is necessary for investigating gene markers.

  1. No evidence of the human chorionic gonadotropin-beta gene 5 betaV79M polymorphism in Mexican women.

    PubMed

    Dominguez-Lopez, Pablo; Diaz-Cueto, Laura; Ulloa-Aguirre, Alfredo; Lopez-Valle, Miguel Angel; Arechavaleta-Velasco, Fabian

    2008-01-01

    Human chorionic gonadotropin (hCG) is a placental hormone essential for the maintenance of pregnancy. Previous studies have shown a G to A transition in exon 3 of the hCGbeta gene 5, which changes the naturally occurring valine to methionine in codon 79. The frequency of this transition varies among different ethnic groups, being high in USA women, and less common, or absent, in various European populations. The purpose of the present study was to determine the frequency of the betaV79M allelic variant of the beta-subunit of hCG in a Mexican population, and to compare this frequency with those found in other ethnic groups. Placental DNA from 161 pregnant Mexican women was genotyped for the betaV79M by polymerase chain reaction (PCR)-restriction fragments length polymorphism analysis. No polymorphic betaV79M alleles were identified in the population studied. The allele and genotypic frequencies of betaV79M polymorphism in Mexican Mestizo women were significantly different from those reported for the US population, but not from five different European populations. In contrast to what has been found in women from the USA, it seems that the hCGbeta V79M polymorphism is absent or extremely rare in Mexican Mestizo women.

  2. Pancreatic beta cells express a diverse set of homeobox genes.

    PubMed Central

    Rudnick, A; Ling, T Y; Odagiri, H; Rutter, W J; German, M S

    1994-01-01

    Homeobox genes, which are found in all eukaryotic organisms, encode transcriptional regulators involved in cell-type differentiation and development. Several homeobox genes encoding homeodomain proteins that bind and activate the insulin gene promoter have been described. In an attempt to identify additional beta-cell homeodomain proteins, we designed primers based on the sequences of beta-cell homeobox genes cdx3 and lmx1 and the Drosophila homeodomain protein Antennapedia and used these primers to amplify inserts by PCR from an insulinoma cDNA library. The resulting amplification products include sequences encoding 10 distinct homeodomain proteins; 3 of these proteins have not been described previously. In addition, an insert was obtained encoding a splice variant of engrailed-2, a homeodomain protein previously identified in the central nervous system. Northern analysis revealed a distinct pattern of expression for each homeobox gene. Interestingly, the PCR-derived clones do not represent a complete sampling of the beta-cell library because no inserts encoding cdx3 or lmx1 protein were obtained. Beta cells probably express additional homeobox genes. The abundance and diversity of homeodomain proteins found in beta cells illustrate the remarkable complexity and redundancy of the machinery controlling beta-cell development and differentiation. Images PMID:7991607

  3. Isolated beta-heavy chain subunit of dynein translocates microtubules in vitro

    PubMed Central

    1988-01-01

    Our goal was to assess the microtubule translocating ability of individual ATPase subunits of outer arm dynein. Solubilized outer arm dynein from sea urchin sperm (Stronglocentrotus purpuratus) was dissociated into subunits by low ionic strength buffer and fractionated by zonal centrifugation. Fractions were assessed by an in vitro functional assay wherein microtubules move across a glass surface to which isolated dynein fractions had been absorbed. Microtubule gliding activity was coincident with the 12-S beta-heavy chain-intermediate chain 1 ATPase fractions (beta/IC1). Neither the alpha-heavy chain nor the intermediate chains 2 and 3 fractions coincided with microtubule gliding activity. The beta/IC1 ATPase induced very rapid gliding velocities (9.7 +/- 0.88 micron/s, range 7-11.5 micron/s) in 1 mM ATP- containing motility buffers. In direct comparison, isolated intact 21-S outer arm dynein, from which the beta/IC1 fraction was derived, induced slower microtubule gliding rates (21-S dynein, 5.6 +/- 0.7 micron/s; beta/IC1, 8.7 +/- 1.2 micron/s). These results demonstrate that a single subdomain in dynein, the beta/IC1 ATPase, is sufficient for microtubule sliding activity. PMID:2972730

  4. [Knock out of bovine beta casein gene by homologous recombination].

    PubMed

    Xue, Ke; Li, Feng; Luo, Guang-Bin; Huang, Wei-Wei; Chen, Xue-Jin

    2007-05-01

    It has been reported that homologous recombination with Red system has been successfully used for knock-out. We try to work on the construction of the expression vector of Mammary Gland with Red system. This study takes CSN2 as a vector for gene target, which contains the complete bovine beta casein gene. Different homologous arms were designed and the CDS region of the beta casein gene was successfully knocked out. The efficiency was also explored for knocking out different DNA fragment. Based on the study, it is very convenient for making a deep research of the foreign gene expression under the regulation of CSN2 flanking region.

  5. The beta-tubulin gene family of Arabidopsis thaliana: preferential accumulation of the beta 1 transcript in roots.

    PubMed

    Oppenheimer, D G; Haas, N; Silflow, C D; Snustad, D P

    1988-01-01

    The genome of Arabidopsis thaliana (L.) Heynh. was shown to contain a beta-tubulin gene family consisting of at least seven distinct genes and/or pseudogenes. Genomic clones of five different beta-tubulin genes and/or pseudogenes have been isolated and partially characterized. The complete nucleotide sequence of one A. thaliana beta-tubulin gene, designated beta 1, has been determined. A comparison of the predicted amino acid sequence of the A. thaliana beta 1-tubulin with the predicted sequences of beta-tubulins of animals and protists indicated that this plant beta-tubulin shows a high degree of homology with other beta-tubulins. However, the beta 1-tubulin contains a novel single amino acid insertion at position 41. The A. thaliana beta 1-tubulin gene is transcribed, as shown by RNA blot hybridization and S1 nuclease analyses. A 3'-noncoding gene-specific probe was used to examine the expression of the beta 1-tubulin gene in leaves, roots, and flowers by blot hybridization analyses of total RNA isolated from these tissues. The results showed that the transcript of the beta 1 gene accumulates predominantly in roots, with low levels of transcript in flowers, and barely detectable levels of transcript in leaves. A second genomic clone was shown to contain two essentially identical beta-tubulin coding sequences in direct tandem orientation and separated by 1 kb.

  6. Identification of beta,beta-turns and unordered conformations in polypeptide chains by vacuum ultraviolet circular dichroism.

    PubMed

    Brahms, S; Brahms, J; Spach, G; Brack, A

    1977-08-01

    Different conformations of polypeptides were characterized by measurements of the circular dichroism (CD) extended into the vacuum ultraviolet region. (i) The linear beta-pleated sheet structure was characterized in a broad ultraviolet region down to 165 nm by examination of copolypeptides composed of alternating hydrophobic and hydrophilic amino-acid residues, e.g., poly(Lys-Leu-Lys-Leu). A short-wavelength intense band was found at about 169 nm, which is characteristic of beta-pleated sheet conformation. (ii) The beta-turns were experimentally measured using poly(Ala(2)-Gly(2)) in a broad spectral region down to 165 nm with accuracy. The observed CD spectrum is in excellent qualitative agreement with the theoretical curve calculated by Woody for the beta-turns of type II and/or I of Venkatachalam. The similarity in shape between the theoretical curve and the observed CD spectra suggests a dominance of beta-turn segments in the poly(Ala(2)-Gly(2)) structure. The presence of beta-turns in poly(Ala(2)-Gly(2)) is also in agreement with the characterization of this polypeptide by solid state methods (electron microscopy and x-ray diffraction). The CD spectrum of beta-turns is characterized by a very intense band at 207.5 nm and strong negative bands at 191 and 169 nm. Copolypeptides such as poly(Ala(2)-Gly(3)) and poly(Ala(3)-Gly(3)) yielded a similar type of CD spectrum, analysis of which indicates that a large fraction of their residues is contained in beta-turn regions. (iii) The CD spectrum of the unordered chain of these alternating copolypeptides in salt-free solution is observed in the vacuum ultraviolet region.

  7. Presence and diversity of the beta-lactamase gene in cat and dog staphylococci.

    PubMed

    Malik, Seidu; Christensen, Henrik; Peng, Haihong; Barton, Mary D

    2007-07-20

    Staphylococci are part of the normal microflora of humans and animals and some are potential pathogens that have become resistant to almost all known antibiotics. Despite the widespread reports of penicillin resistance in cat and dog staphylococci, the mechanism underlying penicillin resistance has not been examined. This study was aimed at investigating the molecular basis of resistance to penicillin in cat and dog staphylococcal isolates that showed phenotypic resistance to beta-lactam antibiotics. An 861 bp fragment of the structural blaZ gene which codes for beta-lactamase production in staphylococci was amplified by polymerase chain reaction (PCR) and the products were sequenced. Sequenced fragments were analysed by protein signature typing and sequences were compared to published blaZ sequences of human and bovine staphylococcal strains held in a public database. Four known protein signature types (1, 3, 5 and 6) and one new type (12) were identified in this study. When sequences were compared with published blaZ sequences, gene phylogenetic analysis revealed three major groups. The four variants of beta-lactamases types (A, B, C and D) belonged to each major group except for types A and D which were both in group II. These findings confirm that the blaZ gene is responsible for beta-lactamase production leading to subsequent resistance to beta-lactam antibiotics in feline and canine staphylococci and that the gene shows similar diversity and relatedness as found with blaZ sequences obtained from human and bovine staphylococci.

  8. Chain length scaling of protein folding time: Beta sheet structures

    NASA Astrophysics Data System (ADS)

    Dimitrievski, K.; Kasemo, B.; Zhdanov, V. P.

    2000-07-01

    We present comprehensive 3D lattice Monte Carlo simulations of the folding kinetics of two-turn antiparallel β sheets. The model employed takes into account isotropic nonspecific interactions as in previous flexible heteropolymer models and also orientation-dependent monomer-monomer interactions, mimicking the formation of hydrogen bonds and chain rigidity. The chain length is varied from N=15 to 33. For each chain length, we calculate the fastest folding temperature, Tfast, folding temperature, Tfold, and glass-transition temperature, Tg. The time-averaged occupation probability of the native state is found to be nearly independent of N at all temperatures. The dependence of Tfast and Tfold on N is accordingly relatively weak. The temperature interval where the folding is fast rapidly decreases with increasing N. For the chain lengths chosen, Tfold slightly exceeds Tg. The dependence of the folding time τf on N is well fitted by using the power law, τf∝Nλ. The exponent λ is found to depend on temperature and on the distribution of nonspecific interactions in the chain. In particular, λ=2.7-4.0 at T=Tfast and 5.2 at T slightly below Tfold. Evaluating τf in real units at T near Tfold yields physically reasonable results.

  9. Anti-beta s-ribozyme reduces beta s mRNA levels in transgenic mice: potential application to the gene therapy of sickle cell anemia.

    PubMed

    Alami, R; Gilman, J G; Feng, Y Q; Marmorato, A; Rochlin, I; Suzuka, S M; Fabry, M E; Nagel, R L; Bouhassira, E E

    1999-04-01

    Our current strategy for gene therapy of sickle cell anemia involves retroviral vectors capable of transducing "designer" globin genes that code for novel anti-sickling globins (while resisting digestion by a ribozyme), coupled with the expression of a hammerhead ribozyme that can selectively cleave the human beta s mRNA. In this report, we have tested in vivo an anti-beta s hammerhead ribozyme embedded within a cDNA coding for the luciferase reporter gene driven by the human beta-globin promoter and hyper-sensitive sites 3 and 4 of the locus control region. We have created mice transgenic for this luciferase-ribozyme construct and bred the ribozyme transgene into mice that were already transgenic for the human beta s gene. We then measured expression of the beta s transgene at the protein and RNA levels by HPLC and primer extension. The presence of the ribozyme was associated with a statistically significant reduction in the level of beta s mRNA in spleen stress reticulocytes (from 60.5 +/- 4.1% to 52.9 +/- 4.2%) and in the percentage of beta s globin chains in very young mice (from 44.5 +/- 0.6% to 40.8 +/- 0.7%). These results demonstrate that it is possible to decrease the concentration of beta s chains and mRNA with the help of a hammerhead ribozyme. While the enormous amount of globin mRNA in reticulocytes is a challenge for ribozyme technology, the exquisite dependence of the delay time for formation of Hb S nuclei on the concentration of Hb S in red blood cells suggests that even a modest reduction in Hb S concentration would have therapeutic value.

  10. Ca2+-dependent dephosphorylation of kinesin heavy chain on beta-granules in pancreatic beta-cells. Implications for regulated beta-granule transport and insulin exocytosis

    NASA Technical Reports Server (NTRS)

    Donelan, Matthew J.; Morfini, Gerardo; Julyan, Richard; Sommers, Scott; Hays, Lori; Kajio, Hiroshi; Briaud, Isabelle; Easom, Richard A.; Molkentin, Jeffery D.; Brady, Scott T.; Rhodes, Christopher J.

    2002-01-01

    The specific biochemical steps required for glucose-regulated insulin exocytosis from beta-cells are not well defined. Elevation of glucose leads to increases in cytosolic [Ca2+]i and biphasic release of insulin from both a readily releasable and a storage pool of beta-granules. The effect of elevated [Ca2+]i on phosphorylation of isolated beta-granule membrane proteins was evaluated, and the phosphorylation of four proteins was found to be altered by [Ca2+]i. One (a 18/20-kDa doublet) was a Ca2+-dependent increase in phosphorylation, and, surprisingly, three others (138, 42, and 36 kDa) were Ca2+-dependent dephosphorylations. The 138-kDa beta-granule phosphoprotein was found to be kinesin heavy chain (KHC). At low levels of [Ca2+]i KHC was phosphorylated by casein kinase 2, but KHC was rapidly dephosphorylated by protein phosphatase 2B beta (PP2Bbeta) as [Ca2+]i increased. Inhibitors of PP2B specifically reduced the second, microtubule-dependent, phase of insulin secretion, suggesting that dephosphorylation of KHC was required for transport of beta-granules from the storage pool to replenish the readily releasable pool of beta-granules. This is distinct from synaptic vesicle exocytosis, because neurotransmitter release from synaptosomes did not require a Ca2+-dependent KHC dephosphorylation. These results suggest a novel mechanism for regulating KHC function and beta-granule transport in beta-cells that is mediated by casein kinase 2 and PP2B. They also implicate a novel regulatory role for PP2B/calcineurin in the control of insulin secretion downstream of a rise in [Ca2+]i.

  11. Synthesis and activity of 2-oxoamides containing long chain beta-amino acids.

    PubMed

    Constantinou-Kokotou, Violetta; Peristeraki, Anna; Kokotos, Christoforos G; Six, David A; Dennis, Edward A

    2005-07-01

    2-Oxoamides based on long chain beta-amino acids were synthesized. 1-Benzyl substituted long chain amines, needed for such synthesis, were synthesized starting from Boc-phenylalaninol. The oxidative conversion of a phenyl group to a carboxyl group was used as the key transformation synthetic step. The compounds synthesized were studied for their activity against GIVA PLA(2), and were proven to be weak inhibitors. PMID:15635664

  12. Nucleotide sequence of SHV-2 beta-lactamase gene

    SciTech Connect

    Garbarg-Chenon, A.; Godard, V.; Labia, R.; Nicolas, J.C. )

    1990-07-01

    The nucleotide sequence of plasmid-mediated beta-lactamase SHV-2 from Salmonella typhimurium (SHV-2pHT1) was determined. The gene was very similar to chromosomally encoded beta-lactamase LEN-1 of Klebsiella pneumoniae. Compared with the sequence of the Escherichia coli SHV-2 enzyme (SHV-2E.coli) obtained by protein sequencing, the deduced amino acid sequence of SHV-2pHT1 differed by three amino acid substitutions.

  13. cDNA clone for the alpha-chain of human beta-hexosaminidase: deficiency of alpha-chain mRNA in Ashkenazi Tay-Sachs fibroblasts.

    PubMed Central

    Myerowitz, R; Proia, R L

    1984-01-01

    We have isolated a cDNA clone containing sequences complementary to mRNA encoding the alpha-chain of the lysosomal enzyme beta-hexosaminidase. RNA from a human lung fibroblast strain, IMR90, was enriched for beta-hexosaminidase messenger by polysome immunoselection with antiserum against beta-hexosaminidase A. This preparation was used to construct cDNA recombinant plasmids by the Okayama-Berg vector primer procedure. After transformation of Escherichia coli, 385 ampicillin-resistant colonies were obtained, 44 of which contained inserts in the plasmid DNA. Differential hybridization, with cDNA probes prepared from polysomal RNA enriched or depleted for beta-hexosaminidase messenger, was used to screen the recombinant plasmids for sequences encoding beta-hexosaminidase. One clone, p beta H alpha-1, containing a cDNA insert of approximately equal to 240 base pairs, was identified in this manner. The plasmid hybrid-selected a messenger from placental RNA that programed a translation system to synthesize the alpha-chain of beta-hexosaminidase. p beta H alpha-1 hybridized to an mRNA of approximately equal to 1.9 kilobases in preparations enriched separately in messenger for the alpha-chain or for both alpha- and beta-chains (by polysome immunoselection with antiserum against isolated alpha-chain or against beta-hexosaminidase A, respectively). It did not hybridize to an RNA preparation enriched for messenger of beta-chain by immunoselection with antiserum against beta-hexosaminidase B. The 1.9-kilobase mRNA was observed in poly(A)+ RNA preparations from control fibroblasts and from fibroblasts of a Tay-Sachs patient that synthesize an altered alpha-chain; however, it was not seen in similar preparations from fibroblasts of four Ashkenazi Tay-Sachs patients. Images PMID:6236461

  14. Amino acid sequences of the alpha and beta chains of adult hemoglobin of the slender loris, Loris tardigradus.

    PubMed

    Maita, T; Goodman, M; Matsuda, G

    1978-08-01

    alpha and beta chains from adult hemoglobin of the slender loris (Loris tardigradus) were isolated by Amberlite CG-50 column chromatography. After S-aminoethylation, both chains were digested with trypsin and the amino acid sequences of the tryptic peptides obtained were analyzed. Further, the order of these tryptic peptides in each chain was deduced from their homology with the primary structures of alpha and beta chains of human adult hemoglobin. Comparing the primary structures of the alpha and beta chains of adult hemoglobin of the slender loris thus obtained with those of adult hemoglobin of the slow loris, 4 amino acid substitutions in the alpha chains and 2 in the beta chains were recognized.

  15. Cloning and sequencing of the gene for human. beta. -casein

    SciTech Connect

    Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O. )

    1990-02-26

    Human {beta}-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on {beta}casein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic {sup 32}p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human {beta}-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human {beta}-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human {beta}-casein gene and will facilitate studies on factors affecting its expression.

  16. Origin and spread of beta-globin gene mutations in India, Africa, and Mediterranea: analysis of the 5' flanking and intragenic sequences of beta S and beta C genes.

    PubMed

    Trabuchet, G; Elion, J; Baudot, G; Pagnier, J; Bouhass, R; Nigon, V M; Labie, D; Krishnamoorthy, R

    1991-06-01

    Nucleotide polymorphisms of both the 5' flanking and intragenic regions of the human beta-globin gene were investigated by directly sequencing genomic DNA after amplification by the polymerase chain reaction in 47 subjects homozygous for the beta S or the beta C mutation. The sickle-cell mutation was found in the context of five different haplotypes defined by eight nucleotide substitutions and various structures of a region of the simple repeated sequence (AT) chi Ty. All subjects from the same geographic origin bear an identical chromosomal structure, defining the Senegal-, Bantu-, Benin-, Cameroon-, and Indian-type chromosomes. These results strengthen our previous conclusions about the multiple occurrence of the sickle-cell mutation. The Benin-type chromosome was also found among Algerian and Sicilian sickle-cell patients, whereas the Indian-type chromosome was observed in two geographically distant tribes, illustrating the spread of these sickle-cell genes. We also found that the intragenic sequence polymorphisms (frameworks) are not always in linkage disequilibrium with the BamH I polymorphism downstream from the beta-globin gene, as had been previously observed. Finally, we present a tentative phylogenetic tree of the different alleles at this locus. Some polymorphisms of this sequence might be contemporary with our last common ancestor, the great apes, that is, about 4-6 millions years old.

  17. Cloning of T-cell antigen receptor beta chain cDNAs from Atlantic salmon (Salmo salar).

    PubMed

    Hordvik, I; Jacob, A L; Charlemagne, J; Endresen, C

    1996-01-01

    Atlantic salmon (Salmo salar) cDNAs encoding the T-cell antigen receptor beta chain (TCRB) were isolated from leukocyte RNA by reverse transcription - polymerase chain reaction (RT-PCR). Twenty-five distinct cDNA fragments covering the variable (V) - diversity (D) - joining (J) junction and part of the constant (C) region were characterized; the sequences of which indicate interchangeable V/D/J usage and expression in the context of one TCRBC gene. Full-length TCRBC sequence information was derived from a leukocyte cDNA library. Key residues of the salmon TCRBC region are in good agreement with those of other species. One distinct exception is the absence of the hinge region cysteine residue which is involved in covalent bonding between the alpha and beta chain in mammalian TCRs. As in amphibian and avian species, the salmon TCRBC membrane proximal region is considerably shorter than the mammalian. An octamer sequence (GGACAGGG) very similar to amphibian, avian, and mammalian D sequences could be recognized in the VDJ junctions from salmon. The pattern of VDJ variability also indicates that mechanisms like trimming and addition occur in fish as in higher vertebrates. Compared with mammals, a relatively high frequency (32%) of the VDJ junctions in salmon were out of frame. PMID:8881032

  18. Fusion of the Saccharomyces cerevisiae leu2 gene to an Escherichia coli beta-galactosidase gene.

    PubMed Central

    Martinez-Arias, A E; Casadaban, M J

    1983-01-01

    The promoter and translation initiation region of the Saccharomyces cerevisiae leu2 gene was fused to the Escherichia coli beta-galactosidase gene. This fusion located the control region of the leu gene and orientated its direction of expression. When the fusion was placed into yeast cells, beta-galactosidase was expressed under the same regulatory pattern as the original leu2 gene product: its synthesis was repressed in the presence of leucine and threonine. Sensitive chromogenic substrates for beta-galactosidase were used to detect expression in isolated colonies growing on agar medium. Mutant yeast cells with increased beta-galactosidase activity were identified by the color of the colonies they formed. One class of mutants obtained appeared to affect ars1 plasmid maintenance, and another class appeared to affect beta-galactoside uptake. PMID:6406836

  19. Assignment of an intron-containing human heat-shock protein gene (hsp90[beta], HSPCB) to chromosome 6 near TCTE1 (6p21) and two intronless pseudogenes to chromosomes 4 and 15 by polymerase chain reaction amplification from a panel of hybrid cell lines

    SciTech Connect

    Durkin, A.S.; Nierman, W.C.; Maglott, D.R. ); Vamvakopoulos, N.C. ); Zoghbi, H.Y. )

    1993-11-01

    We report here the successful application of designing primers from intronic sequences to map a structural hsp90[beta] gene to a unique human chromosome distinct from potential pseudogenes or rodent background. Also, by designing primers that bracket an intron and detecting products from intronless genes, we localized two hsp90[beta] pseudogenes to human chromosomes 4 and 15. PCR primers were designed from the published human hsp90[beta] DNA sequence from exon 11 (nucleotides 7066-7085, 7181-7198), intron A (1659-1678, 1722-1741), intron B (8109, 8170-8187), and exons 3 and 4 to amplify across intron C (3391-3412, 3731-3752).

  20. Characterization of beta-R1, a gene that is selectively induced by interferon beta (IFN-beta) compared with IFN-alpha.

    PubMed

    Rani, M R; Foster, G R; Leung, S; Leaman, D; Stark, G R; Ransohoff, R M

    1996-09-13

    We report preliminary characterization of a gene designated beta-R1, which is selectively expressed in response to interferon beta (IFN-beta) compared with IFN-alpha. In human astrocytoma cells, beta-R1 was induced to an equivalent extent by 10 IU/mL IFN-beta or 2500 IU/mL IFN-alpha2. To address the mechanism of this differential response, we analyzed induction of the beta-R1 gene in fibrosarcoma cells and derivative mutant cells lacking components required for signaling by type I IFNs. beta-R1 was readily induced by IFN-beta in the parental 2fTGH cell line, but not by recombinant IFN-alpha2, IFN-alpha Con1, or a mixture of IFN-alpha subtypes. IFN-alpha8 induced beta-R1 weakly. beta-R1 was not induced by IFN-beta in mutant cell lines U2A, U3A, U4A, and U6A, which lack, respectively, p48, STAT1, JAK1, and STAT2. U5A cells, which lack the Ifnar 2.2 component of the IFN-alpha and -beta receptor, also failed to express beta-R1. U1A cells are partially responsive to IFN-beta and IFN-alpha8 but lacked beta-R1 expression, indicating that TYK2 protein is essential for induction of this gene. Taken together, these results suggest that the expression of beta-R1 in response to type I IFN requires IFN-stimulated gene factor 3 plus an additional component, which is more efficiently formed on induction by IFN-beta compared with IFN-alpha.

  1. Molecular basis of an adult form of Sandhoff disease: substitution of glutamine for arginine at position 505 of the beta-chain of beta-hexosaminidase results in a labile enzyme.

    PubMed

    Bolhuis, P A; Ponne, N J; Bikker, H; Baas, F; Vianney de Jong, J M

    1993-09-01

    Sandhoff disease is a lysosomal storage disorder characterized by accumulation of GM2 ganglioside due to mutations in the beta-chain of beta-hexosaminidase. Hexosaminidase activity is negligible in infantile Sandhoff disease whereas residual activity is present in juvenile and adult forms. Here we report the molecular basis of the first described adult form of Sandhoff disease. Southern analysis of chromosomal DNA indicated the absence of chromosomal deletions in the gene encoding the beta-chain. Northern analysis of RNA from cultured fibroblasts demonstrated that at least one of the beta-chain alleles was transcribed into normal-length mRNA. Sequence analysis of the entire cDNA prepared from poly-adenylated RNA showed that only one point mutation was present, consisting of a G-->A transition at nucleotide position 1514. This mutation changes the electric charge at amino acid position 505 by substitution of glutamine for arginine in a highly conserved part of the beta-chain, present even in the slime mold Dictyostelium discoideum. The nucleotide transition generated a new restriction site for DdeI, which was present in only one of the alleles of the patient. Reverse transcription of mRNA followed by restriction with DdeI resulted in complete digestion at the mutation site, demonstrating that the second allele was of an mRNA-negative type. Transfection of COS cells with a cDNA construct containing the mutation but otherwise the normal sequence resulted in the expression of a labile form of beta-hexosaminidase. These results show that the patient's is a genetic compound, and that the lability of beta-hexosaminidase found in this form of Sandhoff disease is based on a single nucleotide transition. PMID:8357844

  2. Correction of human. beta. sup S -globin gene by gene targeting

    SciTech Connect

    Shesely, E.G.; Hyungsuk Kim; Shehee, W.R.; Smithies, O. ); Papayannopoulou, T. ); Popovich, B.W. )

    1991-05-15

    As a step toward using gene targeting for gene therapy, the authors have corrected a human {beta}{sup S}-globin gene to the normal {beta}{sup A} allele by homologous recombination in the mouse-human hybrid cell line BSM. BSM is derived from a mouse erythroleukemia cell line and carries a single human chromosome 11 with the {beta}{sup S}-globin allele. A {beta}{sup A}-globin targeting construct containing a unique oligomer and a neomycin-resistance gene was electroporated into the BSM cells, which were then placed under G418 selection. Then 126 resulting pools containing a total {approx}29,000 G418-resistant clones were screened by PCR for the presence of a targeted recombinant: 3 positive pools were identified. A targeted clone was isolated by replating one of the positive pools into smaller pools and rescreening by PCR, followed by dilution cloning. Southern blot analysis demonstrated that the isolated clone had been targeted as planned. The correction of the {beta}{sup S} allele to {beta}{sup A} was confirmed both by allele-specific PCR and by allele-specific antibodies. Expression studies comparing the uninduced and induced RNA levels in unmodified BSM cells and in the targeted clone showed no significant alteration in the ability of the targeted clone to undergo induction, despite the potentially disrupting presence of a transcriptionally active neomycin gene 5{prime} to the human {beta}{sup A}-globin gene. Thus gene targeting can correct a {beta}{sup S} allele to {beta}{sup A}, and the use of a selectable helper gene need not significantly interfere with the induction of the corrected gene.

  3. A synthetic peptide from the third hypervariable region of major histocompatibility complex class II beta chain as a vaccine for treatment of experimental autoimmune encephalomyelitis.

    PubMed Central

    Topham, D J; Nag, B; Arimilli, S; Sriram, S

    1994-01-01

    Experimental autoimmune encephalomyelitis (EAE) is a class II major histocompatibility complex (MHC)-restricted, T-cell-mediated, demyelinating autoimmune disease of the central nervous system and represents a model for human multiple sclerosis. The present study demonstrates that vaccination of SJL/J mice with an 18-amino acid synthetic peptide from the third hypervariable region of the murine class II MHC IAs beta chain (IAs beta 58-75; 18-mer peptide) is capable of eliciting auto-anti-IAs antibodies specific for the IAs beta chain and preventing and treating EAE. A similar approach may be useful in the treatment of human autoimmune diseases in which susceptibility is linked to class II MHC genes. Images PMID:8058747

  4. Detection of genes mediating beta-lactamase production in isolates of enterobacteria recovered from wild pets in Saudi Arabia

    PubMed Central

    Hassan, Sabry A.; Shobrak, Mohammed Y.

    2015-01-01

    Aim: To determine the genetic basis and types of beta-lactamase encountered among enterobacterial isolates of wild pets from the animal exhibit. Materials and Methods: A total of 17 beta-lactamase-producing enterobacteria recovered from fecal samples of wild pet animals were analyzed for a selected beta-lactamase gene by polymerase chain reaction. Results: Molecular analysis identified one or more β-lactamase-encoding genes in 14 enterobacterial isolates as a single or gene combination. The most frequent extended-spectrum β-lactamases types were TEM and CTX-M, and the most common AmpC enzymes were CMY-2 and DHA types. Conclusions: The study is the first in Saudi Arabia, have established the presence of β-lactamase-encoding genes in the fecal isolates of wild pets. PMID:27047051

  5. Rejection of cardiac allografts by T cells expressing a restricted repertoire of T-cell receptor V beta genes.

    PubMed Central

    Shirwan, H; Barwari, L; Cramer, D V

    1997-01-01

    We have recently shown that T cells infiltrating cardiac allografts early in graft rejection use a limited T-cell receptor (TCR) V beta repertoire. In this study we tested whether this limited repertoire of V beta genes is important for graft rejection. A cell line, AL2-L3, was established from LEW lymphocytes infiltrating ACI heart allografts 2 days after transplantation. This cell line is composed of CD4+ T cells that primarily recognize the class II RTI.B major histocompatibility complex (MHC) molecule expressed by the donor graft. This cell line precipitated acute rejection of donor hearts with a median survival time (MST) of 10.5 days following adoptive transfer to sublethally irradiated LEW recipients. This rate of graft rejection was significantly (P < 0.0007) accelerated when compared with a MST of 60 days for allografts in irradiated control recipients. The AL2-L3-mediated acceleration of graft rejection was donor specific as WF third-party heart allografts were rejected with a delayed tempo (MST = 28.5 days). The V beta repertoire of this cell line was primarily restricted to the expression of V beta 4, 15 and 19 genes. The nucleotide sequence analysis of the beta-chain cDNAs from this cell line demonstrated that the restricted use of the V gene repertoire was not shared with the N, D and J regions. A wide variety of CDR3 loops and J beta genes were used in association with selected V beta genes. These data provide evidence for the role a restricted repertoire of V beta genes plays in cardiac allograft rejection in this model. The restricted usage of the V beta repertoire in an early T-cell response to allografts may provide the opportunity to therapeutically disrupt the rejection reaction by targeting selected T-cell populations for elimination at the time of organ transplantation. Images Figure 2 PMID:9176111

  6. (The isolation and characterization of beta-glucosidase gene and beta-glucosidase of Trichoderma viride): Progress report

    SciTech Connect

    Stafford, D.W.

    1983-01-01

    Our project was to isolate and characterize the enzyme ..beta..-glucosidase and to clone and characterize the ..beta..-glucosidase gene; our goal is to clone and characterize each of the cellulase genes from Trichoderma. The induction of the Trichoderma reesei cellulase complex by cellulose and by the soluble inducer, sophorose, has been demonstrated. Although the induction of the cellulase complex has previously been well documented, the induction of ..beta..-glucosidase had been questioned. 49 refs., 6 figs., 2 tabs.

  7. Effect of polymorphic variants of GH, Pit-1, and beta-LG genes on milk production of Holstein cows.

    PubMed

    Heidari, M; Azari, M A; Hasani, S; Khanahmadi, A; Zerehdaran, S

    2012-04-01

    Effect of polymorphic variants of growth hormone (GH), beta-lactoglobulin (beta-LG), and Pit-1 genes on milk yield was analyzed in a Holstein herd. Genotypes of the cows for these genes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Allele frequencies were 0.884 and 0.116 for L and V variants of GH, 0.170 and 0.830 for A and B variants of Pit-1, and 0.529 and 0.471 for A and B variants of beta-LG, respectively. GLM procedure of SAS software was used to test the effects of these genes on milk yield. Results indicated significant effects of these genes on milk yield (P < 0.05). Cows with LL genotype of GH produced more milk than cows with LVgenotype (P < 0.05). Also, for Pit-1 gene, animals with AB genotype produced more milk than BB genotype (P < 0.05). In the case of beta-LG gene, milk yield of animals with AA genotype was more than BB genotype (P < 0.01). Therefore, it might be concluded that homozygote genotypes of GH (LL) and beta-LG (AA) were superior compared to heterozygote genotypes, whereas, the heterozygote genotype of Pit-1 gene (AB) was desirable.

  8. Random length assortment of human and mouse T cell receptor for antigen alpha and beta chain CDR3.

    PubMed

    Johnson, G; Wu, T T

    1999-10-01

    In view of the recently determined three-dimensional structures of complexes formed by the T cell receptor for antigen (TCR), the processed peptide and the MHC class I molecule, it is expected that the combined configuration formed by the third complementarity determining regions (CDR3) of TCR alpha and beta chains will be very restricted in size and shape due to the limited length variations of the processed peptides. Thus, the combined TCR alpha and beta chain CDR3 lengths should have a fairly narrow distribution. This feature can be due to the selective association of long alpha chain CDR3 with short beta chain CDR3 and vice versa or due to random assortment of alpha and beta chain CDR3 of even narrower length distribution. Based on existing translated amino acid sequence data, it has been found that the latter mechanism is responsible.

  9. beta-adrenergic receptor gene polymorphisms and beta-blocker treatment outcomes in hypertension.

    PubMed

    Pacanowski, M A; Gong, Y; Cooper-Dehoff, R M; Schork, N J; Shriver, M D; Langaee, T Y; Pepine, C J; Johnson, J A

    2008-12-01

    Numerous studies have demonstrated that beta(1)- and beta(2)-adrenergic receptor gene (ADRB1 and ADRB2) variants influence cardiovascular risk and beta-blocker responses in hypertension and heart failure. We evaluated the relationship between ADRB1 and ADRB2 haplotypes, cardiovascular risk (death, nonfatal myocardial infarction (MI), and nonfatal stroke), and atenolol-based vs. verapamil sustained-release (SR)-based antihypertensive therapy in 5,895 coronary artery disease (CAD) patients. After an average of 2.8 years, death rates were higher in patients carrying the ADRB1 Ser49-Arg389 haplotype (hazard ratio (HR) 3.66, 95% confidence interval (95% CI) 1.68-7.99). This mortality risk was significant in patients randomly assigned to verapamil SR (HR 8.58, 95% CI 2.06-35.8) but not atenolol (HR 2.31, 95% CI 0.82-6.55), suggesting a protective role for the beta-blocker. ADRB2 haplotype associations were divergent within the treatment groups but did not remain significant after adjustment for multiple comparisons. ADRB1 haplotype variation is associated with mortality risk, and beta-blockers may be preferred in subgroups of patients defined by ADRB1 or ADRB2 polymorphisms.

  10. BetaSCPWeb: side-chain prediction for protein structures using Voronoi diagrams and geometry prioritization

    PubMed Central

    Ryu, Joonghyun; Lee, Mokwon; Cha, Jehyun; Laskowski, Roman A.; Ryu, Seong Eon; Kim, Deok-Soo

    2016-01-01

    Many applications, such as protein design, homology modeling, flexible docking, etc. require the prediction of a protein's optimal side-chain conformations from just its amino acid sequence and backbone structure. Side-chain prediction (SCP) is an NP-hard energy minimization problem. Here, we present BetaSCPWeb which efficiently computes a conformation close to optimal using a geometry-prioritization method based on the Voronoi diagram of spherical atoms. Its outputs are visual, textual and PDB file format. The web server is free and open to all users at http://voronoi.hanyang.ac.kr/betascpweb with no login requirement. PMID:27151195

  11. INS-gene mutations: From genetics and beta cell biology to clinical disease

    PubMed Central

    Liu, Ming; Sun, Jinhong; Cui, Jinqiu; Chen, Wei; Guo, Huan; Barbetti, Fabrizio; Arvan, Peter

    2015-01-01

    A growing list of insulin gene mutations causing a new form of monogenic diabetes has drawn increasing attention over the past seven years. The mutations have been identified in the untranslated regions of the insulin gene as well as the coding sequence of preproinsulin including within the signal peptide, insulin B-chain, C-peptide, insulin A-chain, and the proteolytic cleavage sites both for signal peptidase and the prohormone convertases. These mutations affect a variety of different steps of insulin biosynthesis in pancreatic beta cells. Importantly, although many of these mutations cause proinsulin misfolding with early onset autosomal dominant diabetes, some of the mutant alleles appear to engage different cellular and molecular mechanisms that underlie beta cell failure and diabetes. In this article, we review the most recent advances in the field and discuss challenges as well as potential strategies to prevent/delay the development and progression of autosomal dominant diabetes caused by INS-gene mutations. It is worth noting that although diabetes caused by INS gene mutations is rare, increasing evidence suggests that defects in the pathway of insulin biosynthesis may also be involved in the progression of more common types of diabetes. Collectively, the (pre)proinsulin mutants provide insightful molecular models to better understand the pathogenesis of all forms of diabetes in which preproinsulin processing defects, proinsulin misfolding, and ER stress are involved. PMID:25542748

  12. Peroxisomal beta-oxidation of branched chain fatty acids in rat liver. Evidence that carnitine palmitoyltransferase I prevents transport of branched chain fatty acids into mitochondria.

    PubMed

    Singh, H; Beckman, K; Poulos, A

    1994-04-01

    Fatty acid beta-oxidation was investigated in highly purified mitochondrial and peroxisomal preparations from rat liver. Under isotonic conditions, pristanic and homophytanic acid beta-oxidation in purified peroxisomes was severalfold greater compared to the oxidation in purified mitochondria. Branched chain fatty acid beta-oxidation in purified mitochondria was very low, and the oxidation was not stimulated by exogenous L-carnitine or L-malate. In contrast, stearic acid beta-oxidation by purified mitochondria depended upon exogenous L-carnitine, and the oxidation was stimulated by L-malate. Both mitochondrial and peroxisomal beta-oxidation of branched chain fatty acids was strongly inhibited by fatty acid-free bovine serum albumin, whereas stearic acid oxidation was either unaffected or slightly inhibited by bovine serum albumin. The results presented clearly indicate that branched chain fatty acids are mainly degraded in peroxisomes in rat liver. Branched chain fatty acids were efficiently converted to coenzyme A thioesters by purified mitochondria, peroxisomes, and microsomes. Although pristanic and phytanic acids were rapidly converted to pristanoyl-CoA and phytanoyl-CoA, respectively, they were not converted to carnitine esters by mitochondrial outer membranes. The results indicate that acyl-CoA synthetase and carnitine acyltransferase located at the mitochondrial outer membranes regulate entry of branched chain fatty acids into mitochondria. Mitochondrial carnitine acyltransferase I appears to be highly specific for straight chain fatty acids and restricts entry of branched chain fatty acids into mitochondria. Thus, branched chain fatty acids which cannot be transported across the mitochondrial membranes via the carnitine acyltransferase system are directed to peroxisomes for beta-oxidation. The results reported indicate that phytanic acid, the fatty acid which can be initially degraded by alpha-oxidation due to the presence of a beta-methyl group in the

  13. The organization of the gamma-delta-beta gene complex in normal and thalassemia cells.

    PubMed

    Bank, A; Mears, J G; Ramirez, F; Burns, A L; Spence, S; Feldenzer, J; Baird, M

    1980-01-01

    Restriction enzyme digestion analysis and direct human globin gene cloning have permitted analysis of the physical arrangement of nucleotide sequences within and surrounding the human globin genes. With these methods it has been shown that the linear arrangement 5' to 3' of the globin genes is G gamma-A gamma-delta-beta. The G gamma and A gamma genes are separated by about 3.5 kilobases (kb), while the A gamma and delta genes are 15 kb apart, and the delta and beta 6.5 kb apart. Each of these genes contains a large intervening sequence (IVS) of approximately 1 kb in precisely the same position between condons 104 and 105. In addition, each of these genes has a small IVS between codons 30 and 31. In homozygous delta beta thalassemia DNA, there is deletion of all of the normal delta and beta gene fragments. However, a new fragment 4.2 kb in size containing the 5' end of the delta globin gene is retained. Retention of this fragment in delta beta thalassemia, but not in HPFH is consistent with a role for sequences in this region for limiting gamma globin gene expression. Studies to date suggest that the beta + and beta 0 thalassemias will be due to a heterogeneous group of DNA defects affecting either beta globin gene transcription or beta mRNA processing. In most cases of beta + and beta 0 thalassemia DNA analyzed, there is no detectable deletion of beta or delta genes. In three India beta 0 patients, deletion of the 3' end of the beta gene has been found. Analysis of cloned beta globin genes from a patient with beta + thalasseia shows differences from normal in the fragments generated by restriction enzymes which cut frequently. Whether these differences are responsible for the defect in thalassemia or are polymorphisms unrelated to thalassemia remains to be determined.

  14. Transforming growth factor-beta/Smad3 signaling regulates insulin gene transcription and pancreatic islet beta-cell function.

    PubMed

    Lin, Huei-Min; Lee, Ji-Hyeon; Yadav, Hariom; Kamaraju, Anil K; Liu, Eric; Zhigang, Duan; Vieira, Anthony; Kim, Seong-Jin; Collins, Heather; Matschinsky, Franz; Harlan, David M; Roberts, Anita B; Rane, Sushil G

    2009-05-01

    Pancreatic islet beta-cell dysfunction is a signature feature of Type 2 diabetes pathogenesis. Consequently, knowledge of signals that regulate beta-cell function is of immense clinical relevance. Transforming growth factor (TGF)-beta signaling plays a critical role in pancreatic development although the role of this pathway in the adult pancreas is obscure. Here, we define an important role of the TGF-beta pathway in regulation of insulin gene transcription and beta-cell function. We identify insulin as a TGF-beta target gene and show that the TGF-beta signaling effector Smad3 occupies the insulin gene promoter and represses insulin gene transcription. In contrast, Smad3 small interfering RNAs relieve insulin transcriptional repression and enhance insulin levels. Transduction of adenoviral Smad3 into primary human and non-human primate islets suppresses insulin content, whereas, dominant-negative Smad3 enhances insulin levels. Consistent with this, Smad3-deficient mice exhibit moderate hyperinsulinemia and mild hypoglycemia. Moreover, Smad3 deficiency results in improved glucose tolerance and enhanced glucose-stimulated insulin secretion in vivo. In ex vivo perifusion assays, Smad3-deficient islets exhibit improved glucose-stimulated insulin release. Interestingly, Smad3-deficient islets harbor an activated insulin-receptor signaling pathway and TGF-beta signaling regulates expression of genes involved in beta-cell function. Together, these studies emphasize TGF-beta/Smad3 signaling as an important regulator of insulin gene transcription and beta-cell function and suggest that components of the TGF-beta signaling pathway may be dysregulated in diabetes.

  15. The role of EKLF in human beta-globin gene competition.

    PubMed

    Wijgerde, M; Gribnau, J; Trimborn, T; Nuez, B; Philipsen, S; Grosveld, F; Fraser, P

    1996-11-15

    We have investigated the role of erythroid Kruppel-like factor (EKLF) in expression of the human beta-globin genes in compound EKLF knockout/human beta-locus transgenic mice. EKLF affects only the adult mouse beta-globin genes in homozygous knockout mice; heterozygous mice are unaffected. Here we show that EKLF knockout mice express the human epsilon and gamma-globin genes normally in embryonic red cells. However, fetal liver erythropoiesis, which is marked by a period of gamma- and beta-gene competition in which the genes are alternately transcribed, exhibits an altered ratio of gamma- to beta-gene transcription. EKLF heterozygous fetal livers display a decrease in the number of transcriptionally active beta genes with a reciprocal increase in the number of transcriptionally active gamma genes. beta-Gene transcription is absent in homozygous knockout fetuses with coincident changes in chromatin structure at the beta promoter. There is a further increase in the number of transcriptionally active gamma genes and accompanying gamma gene promoter chromatin alterations. These results indicate that EKLF plays a major role in gamma- and beta-gene competition and suggest that EKLF is important in stabilizing the interaction between the Locus Control Region and the beta-globin gene. In addition, these findings provide further evidence that developmental modulation of globin gene expression within individual cells is accomplished by altering the frequency and/or duration of transcriptional periods of a gene rather than changing the rate of transcription.

  16. Anti-cardiolipin/beta-2 glycoprotein activities co-exist on human anti-DNA antibody light chains.

    PubMed

    Kumar, Sanjeev; Nagl, Sylvia; Kalsi, J K; Ravirajan, C T; Athwal, Dee; Latchman, David S; Pearl, Laurence H; Isenberg, David A

    2003-12-01

    We have recently shown that the human anti-DNA antibodies B3 and 33H11 also bind cardiolipin and that the anti-autoantigen activity resides predominantly on their lambda light chains. We now show that the two auto-antibodies possess strong reactivity to the plasma-protein 2-Glycoprotein I (beta2-GPI) also. Utilizing chain shuffling experiments involving an unrelated anti-p185 antibody 4D5 with insignificant reactivity to cardiolipin or to beta2-GPI, we now demonstrate that hybrid Fabs with constituent light chain, but not the heavy chain, of B3 or 33H11, exhibit anti-cardiolipin activity. Furthermore, the constructs possessing the auto-antibody-derived light chain also exhibited significant reactivity to beta2-GPI. The results suggest that anti-DNA, anti-cardiolipin and anti-beta2-GPI activities co-exist on the light chains of the antibodies studied and, importantly, these activities could be transferred to antibody constructs by their light chains alone. Computer-generated models of the three-dimensional structures of the auto-antibodies and their hybrids, suggest predominant interaction of their light chains with domain IV of beta2-GPI.

  17. Flow cytometric analysis of expression of interleukin-2 receptor beta chain (p70-75) on various leukemic cells

    SciTech Connect

    Hoshino, S.; Oshimi, K.; Tsudo, M.; Miyasaka, M.; Teramura, M.; Masuda, M.; Motoji, T.; Mizoguchi, H. )

    1990-08-15

    We analyzed the expression of the interleukin-2 receptor (IL-2R) beta chain (p70-75) on various leukemic cells from 44 patients by flow cytometric analysis using the IL-2R beta chain-specific monoclonal antibody, designated Mik-beta 1. Flow cytometric analysis demonstrated the expression of the IL-2R beta chain on granular lymphocytes (GLs) from all eight patients with granular lymphocyte proliferative disorders (GLPDs), on adult T-cell leukemia (ATL) cells from all three patients with ATL, and on T-cell acute lymphoblastic leukemia (T-ALL) cells from one of three patients with T-ALL. Although GLs from all the GLPD patients expressed the IL-2R beta chain alone and not the IL-2R alpha chain (Tac-antigen: p55), ATL and T-ALL cells expressing the beta chain coexpressed the alpha chain. In two of seven patients with common ALL (cALL) and in both patients with B-cell chronic lymphocytic leukemia, the leukemic cells expressed the alpha chain alone. Neither the alpha chain nor the beta chain was expressed on leukemic cells from the remaining 28 patients, including all 18 patients with acute nonlymphocytic leukemia, five of seven patients with cALL, all three patients with multiple myeloma, and two of three patients with T-ALL. These results indicate that three different forms of IL-2R chain expression exist on leukemic cells: the alpha chain alone; the beta chain alone; and both the alpha and beta chains. To examine whether the results obtained by flow cytometric analysis actually reflect functional aspects of the expressed IL-2Rs, we studied the specific binding of 125I-labeled IL-2 (125I-IL-2) to leukemic cells in 18 of the 44 patients. In addition, we performed 125I-IL-2 crosslinking studies in seven patients. The results of IL-2R expression of both 125I-IL-2 binding assay and crosslinking studies were in agreement with those obtained by flow cytometric analysis.

  18. Prominent expression of transforming growth factor beta2 gene in the chicken embryonic gonad as revealed by suppressive subtraction cloning.

    PubMed

    Hattori Ma, Masa-aki; Furuta, Hiroki; Hiyama, Yoshio; Kato, Yukio; Fujihara, Noboru

    2002-02-01

    cDNA cloning from chicken embryonic gonad subtracted from tissues of the brain, heart, liver, gizzard, mesonephros, and muscle was performed to identify growth factor genes with expression unique to embryonic ovary and testis. We obtained several cDNA clones encoding known and many unknown genes. We found for the first time that the transforming growth factor beta2 (TGF-beta2) is preferentially expressed in the chicken embryonic ovary and testis. cDNA subtraction cloning with respect to the selective expression of TGF-beta2 in the ovary and testis was further analyzed by reverse transcription-polymerase chain reaction analyses of other embryonic tissues. The ontogeny of TGF-beta2 was evaluated in chicken embryonic ovary and testis. In both testis and ovary, the levels of TGF-beta2 transcripts were high during the early period of embryonic development (E7), gradually decreased until the late embryonic days (E14--E17), and then slightly increased at the last embryonic day (E21). There was no difference in the TGF-beta2 transcripts per RNA between the left and the right ovaries. TGF-beta2 may have a critical role in the regulation of the development of chicken ovarian and testicular germ cells during the embryonic period.

  19. Identification of HLA-DR1 beta chain residues critical for binding staphylococcal enterotoxins A and E

    PubMed Central

    1992-01-01

    Superantigens are thought to make external contacts with major histocompatibility complex (MHC) class II molecules and with the V beta portion of a T cell antigen receptor (TCR), thereby stimulating entire families of T cells. The precise mapping of superantigen binding sites on class II molecules may provide valuable information on how TCR and MHC molecules interact. Two bacterial superantigens, staphylococcal enterotoxins A and E (SEA/SEE) bind well to most HLA-DR alleles, but poorly to HLA-DRw53. The sequences responsible for this binding were localized to the putative alpha helix of the DR beta chain by measuring toxin binding to a panel of chimeric class II molecules expressed on transfected cells. Binding of SEA/SEE to the DRw14 (Dw9) molecule suggested that the conserved histidine 81 in the beta chain of most DR molecules was important, whereas the tyrosine 81 in the DRw53 beta chain was detrimental for high-affinity binding. To prove this, reciprocal point mutations were introduced in the DR1 and DRw53 beta chains. Mutation of histidine 81 in the DR1 beta chain to tyrosine reduced SEA/SEE binding, but did not prevent recognition of two DR1- restricted peptides by six of eight antigen-specific T cell lines. Conversely, introduction to histidine at position 81 in the DRw53 beta chain restored normal levels of SEA/SEE binding. These data suggest that a binding site of SEA and SEE lies on the outer face of the beta chain alpha helix, pointing away from the antigen-binding groove. PMID:1370684

  20. Medium-chain fatty acids undergo elongation before {beta}-oxidation in fibroblasts

    SciTech Connect

    Jones, Patricia M. . E-mail: Patti.Jones@childrens.com; Butt, Yasmeen; Messmer, Bette; Boriak, Richard; Bennett, Michael J.

    2006-07-21

    Although mitochondrial fatty acid {beta}-oxidation (FAO) is considered to be well understood, further elucidation of the pathway continues through evaluation of patients with FAO defects. The FAO pathway can be examined by measuring the 3-hydroxy-fatty acid (3-OHFA) intermediates. We present a unique finding in the study of this pathway: the addition of medium-chain fatty acids to the culture media of fibroblasts results in generation of 3-OHFAs which are two carbons longer than the precursor substrate. Cultured skin fibroblasts from normal and LCHAD-deficient individuals were grown in media supplemented with various chain-length fatty acids. The cell-free medium was analyzed for 3-OHFAs by stable-isotope dilution gas-chromatography/mass-spectrometry. Our finding suggests that a novel carbon chain-length elongation process precedes the oxidation of medium-chain fatty acids. This previously undescribed metabolic step may have important implications for the metabolism of medium-chain triglycerides, components in the dietary treatment of a number of disorders.

  1. A study of membrane protein defects and alpha hemoglobin chains of red blood cells in human beta thalassemia

    SciTech Connect

    Rouyer-Fessard, P.; Garel, M.C.; Domenget, C.; Guetarni, D.; Bachir, D.; Colonna, P.; Beuzard, Y. )

    1989-11-15

    The soluble pool of alpha hemoglobin chains present in blood or bone marrow cells was measured with a new affinity method using a specific probe, beta A hemoglobin chain labeled with ({sup 3}H)N-ethylmaleimide. This pool of soluble alpha chains was 0.067 {plus minus} 0.017% of hemoglobin in blood of normal adult, 0.11 {plus minus} 0.03% in heterozygous beta thalassemia and ranged from 0.26 to 1.30% in homozygous beta thalassemia intermedia. This elevated pool of soluble alpha chains observed in human beta thalassemia intermedia decreased 33-fold from a value of 10% of total hemoglobin in bone marrow cells to 0.3% in the most dense red blood cells. The amount of insoluble alpha chains was measured by using the polyacrylamide gel electrophoresis in urea and Triton X-100. In beta thalassemia intermedia the amount of insoluble alpha chains was correlated with the decreased spectrin content of red cell membrane and was associated with a decrease in ankyrin and with other abnormalities of the electrophoretic pattern of membrane proteins. The loss and topology of the reactive thiol groups of membrane proteins was determined by using ({sup 3}H)N-ethylmaleimide added to membrane ghosts prior to urea and Triton X-100 electrophoresis. Spectrin and ankyrin were the major proteins with the most important decrease of thiol groups.

  2. Hemoglobin Birmingham and hemoglobin Galicia: two unstable beta chain variants characterized by small deletions and insertions.

    PubMed

    Wilson, J B; Webber, B B; Hu, H; Kutlar, A; Kutlar, F; Codrington, J F; Prchal, J T; Hall, K M; de Pablos, J M; Rodriguez, I

    1990-05-01

    Two unstable hemoglobins (Hbs) causing rather severe hemolytic anemia have been characterized. The beta chain of Hb Birmingham, found in an adult black man, is characterized by the loss of -Leu-Ala-His-Lys- at positions 141, 142, 143, and 144 and their replacement by one Gln residue. These changes are the result of a deletion of nine nucleotides, namely two base pairs (bp) of codon 141, all of codons 142 and 143, and one bp of codon 144; the remaining CAG triplet (C from codon 141 and AG from codon 144) codes for the inserted glutamine. In the beta chain of Hb Galicia from a Spanish patient, His and Val at positions 97 and 98 are replaced by one Leu residue. This is due to an ACG deletion in codons 97 and 98, which causes the removal of one His and one Val residue, while the remaining CTG triplet (C from codon 97 and TG from codon 98) codes for the inserted leucine residue. Two mechanisms, namely slipped mispairing in the presence of short repeats, and misreading by DNA polymerase due to a local distortion of the DNA helix, are considered in explaining the origin of the small deletions.

  3. Purification of beta-glucuronidase and structural assessment of the carbohydrate chains by lectin affinity immunoelectrophoresis.

    PubMed

    Wójczyk, B; Hoja, D; Lityńska, A

    1991-08-01

    The purification of rat liver beta-glucuronidase from a lysosomal fraction by methods including affinity chromatography, chromatofocusing and preparative PAGE steps is described. Molecular weights of 300,000 and 150,000 were estimated by two dimensional gradient PAGE/immunoelectrophoresis of the lysosomal extract. Isoelectrofocusing in agarose gel followed by immunoelectrophoresis in the second dimension revealed the presence of at least five maxima in the range pH 4.3-7.4. The structural assessment of the carbohydrate chains of lysosomal and microsomal beta-glucuronidase was performed by lectin affinity immunoelectrophoresis. Reaction with Concanavalin A indicated the presence of bi-antennary complex, oligomannosidic and hybrid type structures, whereas the absence of tri- and tetra-antennary complex type structures was deduced from the lack of interaction with phytohemagglutinin-L. The reaction with Lens culinaris agglutinin, Pisum sativum agglutinin and Lotus tetragonolobus lectin revealed that part of the glycans contained a fucose alpha(1-6)-linked to the N-acetylglucosamine attached to asparagine. The presence of terminal beta(1-4)-galactose residues was detected with Ricinus communis agglutinin I. PMID:1841676

  4. A phase I/II clinical trial of beta-globin gene therapy for beta-thalassemia.

    PubMed

    Bank, Arthur; Dorazio, Ronald; Leboulch, Philippe

    2005-01-01

    Recent success in the long-term correction of mouse models of human beta-thalassemia and sickle cell anemia by lentiviral vectors and evidence of high gene transfer and expression in transduced human hematopoietic cells have led to a first clinical trial of gene therapy for the disease. A LentiGlobin vector containing a beta-globin gene (beta(A-T87Q)) that produces a hemoglobin (Hbbeta(A-T87Q)) that can be distinguished from normal hemoglobin will be used. The LentiGlobin vector is self-inactivating and contains large elements of the beta-globin locus control region as well as chromatin insulators and other features that should prevent untoward events. The study will be done in Paris with Eliane Gluckman as the principal investigator and Philippe Leboulch as scientific director. PMID:16339679

  5. Structural organization of the human cardiac [alpha]-myosin heavy chain gene (MYH6)

    SciTech Connect

    Epp, T.A.; Dixon, I.M.C.; Wang, H.Y.; Sole, M.J.; Liew, C.C. )

    1993-12-01

    The human myocardium expresses two cardiac myosin heavy chain (MyHC) isoforms, [alpha] and [beta], that exist in tandem array on chromosome 14q12. The authors have previously sequenced the entire human cardiac [beta]-MyHC gene and now report the complete nucleotide sequence of the human cardiac [alpha]-MyHC, encompassing 26,159 bp as well as the entire 4484-bp 5'-flanking intergenic region. The gene (MYH6) consists of 39 exons, 37 of which contain coding information. The 5'-untranslated region is split into 3 exons, with the third exon containing the AUG translocation initiation codon. With the exception of the 13th intron of the human cardiac [beta]-MyHC, which is not present within the [alpha]-isogene, all exon/intron boundaries are conserved. Conspicuous sequence motifs contained within the [alpha]-MyHC gene include four Alu repeats, a single (GT)[sub n] element, and a homopurine-homopyrimidine tract containing 23 GAA repeating units followed by 10 GAG repeating units. Comparison of the encoded amino acid sequence with a previously reported human [alpha]-MyHC cDNA sequence reveals several potential polymorphisms. 29 refs., 1 fig., 1 tab.

  6. Evidence for beta1-adrenergic receptor involvement in amygdalar corticotropin-releasing factor gene expression: implications for cocaine withdrawal.

    PubMed

    Rudoy, Carla A; Reyes, Arith-Ruth S; Van Bockstaele, Elisabeth J

    2009-04-01

    We previously showed that betaxolol, a selective beta(1)-adrenergic receptor antagonist, administered during early phases of cocaine abstinence, ameliorated withdrawal-induced anxiety and blocked increases in amygdalar beta(1)-adrenergic receptor expression in rats. Here, we report the efficacy of betaxolol in reducing increases in gene expression of amygdalar corticotropin-releasing factor (CRF), a peptide known to be involved in mediating 'anxiety-like' behaviors during initial phases of cocaine abstinence. We also demonstrate attenuation of an amygdalar beta(1)-adrenergic receptor-mediated cell-signaling pathway following this treatment. Male rats were administered betaxolol at 24 and 44 h following chronic cocaine administration. Animals were euthanized at the 48-h time point and the amygdala was microdissected and processed for quantitative reverse transcriptase-polymerase chain reaction and/or western blot analysis. Results showed that betaxolol treatment during early cocaine withdrawal attenuated increases in amygdalar CRF gene expression and cyclic adenosine monophosphate-dependent protein kinase regulatory and catalytic subunit (nuclear fraction) protein expression. Our data also reveal that beta(1)-adrenergic receptors are on amygdalar neurons, which are immunoreactive for CRF. The present findings suggest that the efficacy of betaxolol treatment on cocaine withdrawal-induced anxiety may be related, in part, to its effect on amygdalar beta(1)-adrenergic receptor, modulation of its downstream cell-signaling elements and CRF gene expression.

  7. Targeted inactivation of murine laminin gamma2-chain gene recapitulates human junctional epidermolysis bullosa.

    PubMed

    Meng, Xianmin; Klement, John F; Leperi, Dominic A; Birk, David E; Sasaki, Takako; Timpl, Rupert; Uitto, Jouni; Pulkkinen, Leena

    2003-10-01

    Junctional forms of epidermolysis bullosa (JEB) are associated with mutations in six distinct genes expressed in the cutaneous basement membrane zone; these include LAMA3, LAMB3, and LAMC2, which encode laminin 5 subunit polypeptides, the alpha3-, beta3-, and gamma2-chains, respectively. Here we generated a mouse model for JEB by inactivating the laminin gamma2-chain gene by targeted frameshift deletion of exon 8 in Lamc2. Heterozygous mice were phenotypically normal, whereas the majority of Lamc2-/- mice showed blistering phenotype on days 1 to 2 and died within 5 days of birth. The Lamc2-/- mice demonstrated absent expression of laminin gamma2-chain on the basement membrane zone as well as attenuated expression of alpha3- and beta3-chains of laminin. Transmission electron microscopy revealed rudimentary, poorly developed hemidesmosomes. The epidermis of the Lamc2-/- mice revealed induced apoptosis in the basal cells of the blistered skin, suggesting that cell-matrix adhesion provided by laminin 5 plays a role in cell survival in vivo. Cultured Lamc2-/- keratinocytes demonstrated slightly positive staining with gamma2-chain-specific antibodies, which could be explained by the presence of a transcript with partial restoration of the reading frame owing to alternative splicing in vitro. These cells proliferated in different matrices and attached to type IV collagen and Matrigel as efficiently as the wild-type keratinocytes, whereas their attachment on plastic and laminin was significantly weaker. In summary, Lamc2-/- mouse recapitulates human JEB and provides novel insight into the role of laminin 5 in keratinocyte biology. PMID:14632187

  8. Lactogenic hormonal induction of long distance interactions between beta-casein gene regulatory elements

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lactogenic hormone regulation of beta-casein gene expression in mammary epithelial cells provides, an excellent model in which to study the mechanisms by which steroid and peptide hormone signaling control gene expression. Prolactin- and glucocorticoid-mediated induction of beta-casein gene express...

  9. A chain reaction approach to modelling gene pathways

    PubMed Central

    Cheng, Gary C.; Chen, Dung-Tsa; Chen, James J.; Soong, Seng-jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-01-01

    Background Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. Results In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By

  10. Hepatocyte nuclear factor 3beta is involved in pancreatic beta-cell-specific transcription of the pdx-1 gene.

    PubMed Central

    Wu, K L; Gannon, M; Peshavaria, M; Offield, M F; Henderson, E; Ray, M; Marks, A; Gamer, L W; Wright, C V; Stein, R

    1997-01-01

    The mammalian homeobox gene pdx-1 is expressed in pluripotent precursor cells in the dorsal and ventral pancreatic bud and duodenal endoderm, which will produce the pancreas and the rostral duodenum. In the adult, pdr-1 is expressed principally within insulin-secreting pancreatic islet beta cells and cells of the duodenal epithelium. Our objective in this study was to localize sequences within the mouse pdx-1 gene mediating selective expression within the islet. Studies of transgenic mice in which a genomic fragment of the mouse pdx-1 gene from kb -4.5 to +8.2 was used to drive a beta-galactosidase reporter showed that the control sequences sufficient for appropriate developmental and adult specific expression were contained within this region. Three nuclease-hypersensitive sites, located between bp -2560 and -1880 (site 1), bp -1330 and -800 (site 2), and bp -260 and +180 (site 3), were identified within the 5'-flanking region of the endogenous pdx-1 gene. Pancreatic beta-cell-specific expression was shown to be controlled by sequences within site 1 from an analysis of the expression pattern of various pdr-1-herpes simplex virus thymidine kinase promoter expression constructs in transfected beta-cell and non-beta-cell lines. Furthermore, we also established that this region was important in vivo by demonstrating that expression from a site 1-driven beta-galactosidase reporter construct was directed to islet beta-cells in transgenic mice. The activity of the site 1-driven constructs was reduced substantially in beta-cell lines by mutating a hepatocyte nuclear factor 3 (HNF3)-like site located between nucleotides -2007 and -1996. Gel shift analysis indicated that HNF3beta present in islet beta cells binds to this element. Immunohistochemical studies revealed that HNF3beta was present within the nuclei of almost all islet beta cells and subsets of pancreatic acinar cells. Together, these results suggest that HNF3beta, a key regulator of endodermal cell lineage

  11. Rearrangement and expression of beta-T-cell receptor and immunoglobulin genes in established Ph1 chronic myelogenous leukemia cell lines.

    PubMed

    Berenson, J; Koeffler, H P

    1989-01-01

    We have determined the arrangement and expression of immunoglobulin (Ig) and beta-T-cell receptor (TCR) genes in six established Philadelphia chromosome-positive (Ph1) chronic myelogenous leukemia (CML) cell lines, and correlated these results with their phenotypic characteristics. Three cell lines with nonlymphoid characteristics, EM2, EM3, and K562, did not demonstrate rearrangement or expression of Ig or beta-TCR genes. A new cell line, MB, with a mature B-cell phenotype recently established in our laboratory, contained light and heavy chain immunoglobulin gene rearrangements and expressed mature Ig RNA. In a cell line with an early lymphoid phenotype, BV173, this analysis showed rearrangement of Ig heavy chain and beta-TCR genes, unrearranged Ig light chain DNA, and expression of only an immature beta-TCR transcript. This line provides evidence for T-cell lineage involvement in Ph1 CML. One cell line without markers of any cell type, KCL-22, demonstrated rearranged, unexpressed Ig heavy chain genes, suggesting these cells are at the very earliest stages of lymphoid differentiation. These lines should provide valuable tools to dissect the molecular biology of differentiation in CML and in early lymphocytes.

  12. Gene Prioritization by Compressive Data Fusion and Chaining

    PubMed Central

    Žitnik, Marinka; Nam, Edward A.; Dinh, Christopher; Kuspa, Adam; Shaulsky, Gad; Zupan, Blaž

    2015-01-01

    Data integration procedures combine heterogeneous data sets into predictive models, but they are limited to data explicitly related to the target object type, such as genes. Collage is a new data fusion approach to gene prioritization. It considers data sets of various association levels with the prediction task, utilizes collective matrix factorization to compress the data, and chaining to relate different object types contained in a data compendium. Collage prioritizes genes based on their similarity to several seed genes. We tested Collage by prioritizing bacterial response genes in Dictyostelium as a novel model system for prokaryote-eukaryote interactions. Using 4 seed genes and 14 data sets, only one of which was directly related to the bacterial response, Collage proposed 8 candidate genes that were readily validated as necessary for the response of Dictyostelium to Gram-negative bacteria. These findings establish Collage as a method for inferring biological knowledge from the integration of heterogeneous and coarsely related data sets. PMID:26465776

  13. Characterization of a large deletion in the {beta}-globin gene cluster in a newborn with hemoglobin FE

    SciTech Connect

    Louie, E.; Dietz, L.; Shafer, F.

    1994-09-01

    A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.

  14. Physical mapping of the human t-cell receptor beta gene complex, using yeast artificial chromosomes

    SciTech Connect

    Hashim, Y.; So, A.K.; Kearney, L.

    1995-04-01

    Yeast artificial chromosomes (YACs) were used to construct a physical map of the germline human T-cell {beta} chain gene complex (TCRB). Variable region genes (BV) for the 25 known subfamilies were used as probes to screen the ICRF AM4x YAC library. Of the five positive YACs identified, one YAC designated B3, 820 kilobase pairs (kbp) in size, scored positive for all 25 TCRBV subfamilies plus the constant region genes (BC) when analyzed by pulse field gel electrophoresis. Restriction enzyme mapping of B3 located TCRBV and TCRBC gene regions to 4 Sfi I fragments of 280, 110, 90, and 125 kbp and was in accordance with published data. In addition, comparison of hybridization results of Sfi I-restricted B3 and genomic DNA from the parental cell line GM1416B revealed identical banding patterns. The data thus showed YAC B3 encoded a complete and unrearranged TCRB gene locus of some 600-620 kbp. The map was further resolved by locating restriction sites for Sal I and Bss HII on B3, giving more precise localization of the individual TCRBV gene families. Fluorescent in situ hybridization of B3 to spreads of human metaphase chromosomes localized B3 to 7q35. However, two additional signals were obtained; one attributable to the TCRBV orphon cluster on 9p21, the second to the long arm of chromosome 2. Polymerase chain reaction amplification of a chromosome 2 somatic cell hybrid, using primers for all 25 TCRBV gene families, revealed that the signal was not attributable to a second orphon cluster. It is suggested that B3 is a chimeric YAC with an intact TCRB locus flanked by chromosome 2 sequences. 32 refs., 5 figs., 1 tab.

  15. Concordance of a point mutation 5' to the A gamma-globin gene with A gamma beta + hereditary persistence of fetal hemoglobin in Greeks.

    PubMed

    Waber, P G; Bender, M A; Gelinas, R E; Kattamis, C; Karaklis, A; Sofroniadou, K; Stamatoyannopoulos, G; Collins, F S; Forget, B G; Kazazian, H H

    1986-02-01

    In the Greek A gamma beta + type of hereditary persistence of fetal hemoglobin (HPFH), adult heterozygotes produce about 20% fetal hemoglobin (HbF), which is predominantly of the A gamma chain variety. The affected beta-globin gene cluster produces near normal amounts of beta-like globin, but in a A gamma to beta ratio of 20:80 instead of 0.5:99.5. Gelinas et al and Collins et al have shown a G to A change 117 nucleotides 5' to the A gamma gene in two Greeks with A gamma beta + HPFH. To demonstrate that this change is not a neutral polymorphism, we carried out hybridization with oligonucleotide probes (19mers) specific for the normal and the mutant sequences. While normal probe identified the A gamma fragment in genomic DNA of all subjects studied, mutant probe was positive only in Greeks with A gamma beta + HPFH. In sum, 108 beta-globin gene clusters of individuals without HPFH were negative when tested with mutant probe, but all 11 affected individuals of six families with Greek A gamma beta + HPFH (two previously sequenced and four new families) were positive with mutant probe. These data support the conclusion that the -117 mutation is causative of A gamma beta + HPFH in Greeks.

  16. Genomic evidence for independent origins of beta-like globin genes in monotremes and therian mammals.

    PubMed

    Opazo, Juan C; Hoffmann, Federico G; Storz, Jay F

    2008-02-01

    Phylogenetic reconstructions of the beta-globin gene family in vertebrates have revealed that developmentally regulated systems of hemoglobin synthesis have been reinvented multiple times in independent lineages. For example, the functional differentiation of embryonic and adult beta-like globin genes occurred independently in birds and mammals. In both taxa, the embryonic beta-globin gene is exclusively expressed in primitive erythroid cells derived from the yolk sac. However, the "epsilon-globin" gene in birds is not orthologous to the epsilon-globin gene in mammals, because they are independently derived from lineage-specific duplications of a proto beta-globin gene. Here, we report evidence that the early and late expressed beta-like globin genes in monotremes and therian mammals (marsupials and placental mammals) are the products of independent duplications of a proto beta-globin gene in each of these two lineages. Results of our analysis of genomic sequence data from a large number of vertebrate taxa, including sequence from the recently completed platypus genome, reveal that the epsilon- and beta-globin genes of therian mammals arose via duplication of a proto beta-globin gene after the therian/monotreme split. Our analysis of genomic sequence from the platypus also revealed the presence of a duplicate pair of beta-like globin genes that originated via duplication of a proto beta-globin gene in the monotreme lineage. This discovery provides evidence that, in different lineages of mammals, descendent copies of the same proto beta-globin gene may have been independently neofunctionalized to perform physiological tasks associated with oxygen uptake and storage during embryonic development.

  17. Expression of a mouse metallothionein-Escherichia coli. beta. -galactosidase fusion gene (MT-. beta. gal) in early mouse embryos

    SciTech Connect

    Stevens, M.E.; Meneses, J.J.; Pedersen, R.A. )

    1989-08-01

    The authors have microinjected DNA containing the inducible mouse metallothionein-I (MT-I) promoter, coupled to the structural gene for Escherichia coli {beta}-galactosidase (lacZ), into the pronuclei of one-cell mouse embryos. A qualitative histochemical assay, with 5-bromo-4-chloro-3-indolyl {beta}-D-galactopyranoside (X-Gal) as a substrate, was used to detect expression of lacZ at several preimplantation stages. They observed staining indicative of exogenous {beta}-galactosidase activity in 5-17% of DNA-injected embryos assayed at preimplantation stages after 16-24 h treatment with ZnSO{sub 4}. Thus, lacZ can be used as an indicator gene for promoter function during early mouse embryogenesis, and the incorporation of the MT-I promoter into fusion genes can be a useful means of controlling the expression of exogenous genes in preimplantation mouse embryos.

  18. Biased Immunoglobulin Light Chain Gene Usage in the Shark.

    PubMed

    Iacoangeli, Anna; Lui, Anita; Naik, Ushma; Ohta, Yuko; Flajnik, Martin; Hsu, Ellen

    2015-10-15

    This study of a large family of κ L chain clusters in nurse shark completes the characterization of its classical Ig gene content (two H chain isotypes, μ and ω, and four L chain isotypes, κ, λ, σ, and σ-2). The shark κ clusters are minigenes consisting of a simple VL-JL-CL array, where V to J recombination occurs over an ~500-bp interval, and functional clusters are widely separated by at least 100 kb. Six out of ~39 κ clusters are prerearranged in the germline (germline joined). Unlike the complex gene organization and multistep assembly process of Ig in mammals, each shark Ig rearrangement, somatic or in the germline, appears to be an independent event localized to the minigene. This study examined the expression of functional, nonproductive, and sterile transcripts of the κ clusters compared with the other three L chain isotypes. κ cluster usage was investigated in young sharks, and a skewed pattern of split gene expression was observed, one similar in functional and nonproductive rearrangements. These results show that the individual activation of the spatially distant κ clusters is nonrandom. Although both split and germline-joined κ genes are expressed, the latter are prominent in young animals and wane with age. We speculate that, in the shark, the differential activation of the multiple isotypes can be advantageously used in receptor editing.

  19. Crystal Structure of Staphylococcal Enterotoxin G (SEG) in Complex with a Mouse T-cell Receptor Beta Chain

    SciTech Connect

    Fernandez, M.M.; Robinson, H.; Cho, S.; De Marzi, M. C.; Kerzic, M. C.; Mariuzza, R. A.; Malchiodi, E. L.

    2011-01-14

    Superantigens (SAgs) are bacterial or viral toxins that bind MHC class II (MHC-II) molecules and T-cell receptor (TCR) in a nonconventional manner, inducing T-cell activation that leads to inflammatory cytokine production, which may result in acute toxic shock. In addition, the emerging threat of purpura fulminans and community-associated meticillin-resistant Staphylococcus aureus emphasizes the importance of a better characterization of SAg binding to their natural ligands that may allow the development of reagents to neutralize their action. The three-dimensional structure of the complex between a mouse TCR {beta} chain (mV{beta}8.2) and staphylococcal enterotoxin G (SEG) at 2.0 {angstrom} resolution revealed a binding site that does not conserve the 'hot spots' present in mV{beta}8.2-SEC2, mV{beta}8.2-SEC3, mV{beta}8.2-SEB, and mV{beta}8.2-SPEA complexes. Analysis of the mV{beta}8.2-SEG interface allowed us to explain the higher affinity of this complex compared with the others, which may account for the early activation of T-cells bearing mV{beta}8.2 by SEG. This mode of interaction between SEG and mV{beta}8.2 could be an adaptive advantage to bestow on the pathogen a faster rate of colonization of the host.

  20. Inhibition of bacterial cell wall-induced leukocyte recruitment and hepatic granuloma formation by TGF-beta gene transfer.

    PubMed

    Song, X; Zeng, L; Pilo, C M; Zagorski, J; Wahl, S M

    1999-10-01

    Intraperitoneal injection of streptococcal cell walls (SCW) into Lewis rats results in dissemination of SCW to the liver, spleen, bone marrow, and peripheral joints. The uptake of SCW by Kupffer cells in the liver initiates a chain of events largely mediated by T lymphocytes and macrophages. Local synthesis and secretion of cytokines and growth factors in response to the persistent SCW lead to the evolution and maintenance of a chronic T cell-dependent granulomatous response and result in granuloma formation and irreversible hepatic fibrosis. In an attempt to impede the development of the chronic granulomatous lesions in the liver, we injected a plasmid DNA encoding TGF-beta 1 i.m. to the SCW animals to determine the effect of TGF-beta 1 gene transfer on the course of liver inflammation and fibrosis. A single injection of plasmid DNA encoding TGF-beta 1 resulted in virtual abolition of the development of the SCW-induced hepatic granuloma formation and matrix expansion. TGF-beta 1 DNA not only reduced key proinflammatory cytokines including TNF-alpha, IL-1 beta, IFN-gamma, and IL-18, but also inhibited both CXC and CC chemokine production, thereby blocking inflammatory cell recruitment and accumulation in the liver. Moreover, TGF-beta 1 gene delivery inhibited its own expression in the liver tissue, which is otherwise up-regulated in SCW-injected animals. Our study suggests that TGF-beta 1 gene transfer suppresses hepatic granuloma formation by blocking the recruitment of inflammatory cells to the liver, and thus may provide a new approach to the control of hepatic granulomatous and fibrotic diseases. PMID:10491005

  1. The first intron of the murine beta-casein gene contains a functional promoter.

    PubMed

    Kolb, Andreas

    2003-07-11

    Caseins are the major milk proteins in most mammals. Together with calcium and phosphate they form the casein micelle. The corresponding casein genes are clustered in mammalian genomes and their expression is coordinately regulated with regard to developmental and tissue specificity. Casein gene promoters are responsive to lactogenic hormones, cell-matrix, and cell-cell interactions. Transcriptional enhancer elements are found in the 5(') upstream regions of casein genes but have also been detected in the first intron of the bovine beta-casein gene. We show here that the first intron of the murine beta-casein gene has three discernible functions. First, transcriptional enhancer elements present in the intron increase the basal activity of the beta-casein promoter. In addition, these intronic enhancer elements augment the induction of the beta-casein promoter by lactogenic hormones. Finally, we demonstrate that the first intron of the murine beta-casein gene contains a functional promoter.

  2. Intestinal lactase as an autologous beta-galactosidase reporter gene for in vivo gene expression studies.

    PubMed

    Salehi, Siamak; Eckley, Lorna; Sawyer, Greta J; Zhang, Xiaohong; Dong, Xuebin; Freund, Jean-Noel; Fabre, John W

    2009-01-01

    Intestinal lactase has potential as an autologous beta-galactosidase reporter gene for long-term gene expression studies in vivo, using chromogenic, luminescent, and fluorogenic substrates developed for Escherichia coli beta-galactosidase. In normal rat tissues, reactivity with a chromogenic fucopyranoside (X-Fuc, the preferred substrate of lactase) was present only at the lumenal surface of small intestine epithelial cells. Full-length lactase (domains I-IV), mature lactase (domains III and IV), and a cytosolic form of mature lactase (domains III and IV, without the signal sequence or transmembrane region) were evaluated. Transfection of HuH-7 cells in vitro, and hydrodynamic gene delivery to the liver in vivo, resulted in excellent gene expression. The full-length and mature (homodimeric, membrane-bound) forms reacted strongly with X-Fuc but not with the corresponding galactopyranoside (X-Gal). However, the presumptively monomeric cytosolic lactase unexpectedly reacted equally well with both substrates. The fluorogenic substrate fluorescein-di-beta-D-galactopyranoside was cleaved by cytosolic lactase, but not by full-length or mature lactase. Full-length lactase, when expressed ectopically in hepatocytes in vivo, localized exclusively to the bile canalicular membrane. Intestinal lactase is highly homologous in mice, rats, and humans and has considerable potential for evaluating long-term gene expression in experimental animals and the clinic.

  3. Immunohistochemical analysis of the skin in junctional epidermolysis bullosa using laminin 5 chain specific antibodies is of limited value in predicting the underlying gene mutation.

    PubMed

    McMillan, J R; McGrath, J A; Pulkkinen, L; Kon, A; Burgeson, R E; Ortonne, J P; Meneguzzi, G; Uitto, J; Eady, R A

    1997-06-01

    The anchoring filament protein laminin 5 is composed of three polypeptide chains (alpha 3, beta 3 and gamma 2) each encoded by separate genes (LAMA3, LAMB3 and LAMC2, respectively). Mutations in any of these three genes may give rise to the autosomal recessive blistering skin disease, junctional epidermolysis bullosa. At present, there is no easy way of predicting which of these three genes might harbour the pathogenetic laminin 5 mutations in a case of junctional epidermolysis bullosa. In this study, we assessed whether immunohistochemistry might be helpful in this regard. We performed immunohistochemical labelling of the dermal-epidermal junction using alpha 3, beta 3 and gamma 2 chain-specific antibodies in 11 patients with junctional epidermolysis bullosa, in whom the laminin 5 mutations had been previously delineated. Although, labelling for the laminin 5 chain bearing the mutations was attenuated or undetectable in all cases, a complete absence of labelling or a reduction in the staining intensity for the other two chains was also seen in all cases. The results showed that immunohistochemical labelling of the dermal-epidermal junction using alpha 3, beta 3 and gamma 2 chain-specific antibodies is not a specific indicator for which of the laminin 5 chain genes contains the pathogenetic mutations, and is therefore unreliable in screening for individual laminin 5 gene mutations in cases of junctional epidermolysis bullosa. PMID:9217810

  4. Human T-cell receptor v{beta} gene polymorphism and multiple sclerosis

    SciTech Connect

    Wei, S.; Charmley, P.; Birchfield, R.I.; Concannon, P.

    1995-04-01

    Population-based genetic associations have been reported between RFLPs detected with probes corresponding to the genes encoding the {beta} chain of the T-cell receptor for antigen (RCRB) and a variety of autoimmune disorders. In the case of multiple sclerosis (MS), these studies have localized a putative disease-associated gene to a region of {approximately}110 kb in length, located within the TCRB locus. In the current study, all 14 known TCRBV (variable region) genes within the region of localization were mapped and identified. The nucleotide sequences of these genes were determined in a panel of six MS patients and six healthy controls, who were human-leukocyte antigen and TCRB-RFLP haplotype matched. Nine of the 14 TCRBV genes studied showed evidence of polymorphism. PCR-based assays for each of these polymorphic genes were developed, and allele and genotype frequencies were determined in a panel of DNA samples from 48 MS patients and 60 control individuals. No significant differences in allele, genotype, or phenotype frequencies were observed between the MS patients and controls for any of the 14 TCRBV-gene polymorphisms studied. In light of the extensive linkage disequilibrium across the region studied, the saturating numbers of polymorphisms examined, and the direct sequence analysis of all BV genes in the region, these results suggest that it is unlikely that germ-line polymorphism in the TCRBV locus makes a major contribution to MS susceptibility. The TCRBV coding region-specific markers generated in these studies, as well as the approach of testing for associations with specific functionally relevant polymorphic sites within individual BV genes, should be useful in the evaluation of the many reported disease associations involving the human TCRB region. 22 refs., 1 fig., 3 tabs.

  5. Molecular cloning and characterization of human pyruvate dehydrogenase. beta. subunit gene

    SciTech Connect

    Koike, Kichiko; Urata, Yoshishige; Koike, Masahiko )

    1990-08-01

    A genomic clone encompassing the entire gene for the human pyruvate dehydrogenase {beta} subunit (PDH{beta}) has been isolated by screening a leukocyte genomic library with a nick-translated human foreskin fibroblast PDH{beta} cDNA probe. The 18-kilobase clone was characterized by restriction enzyme analysis, extensive DNA sequencing, and primer-extension analysis. The PDH{beta} structural gene is composed of 10 exons and 9 introns. All intron-exon splice junctions follow the GT/AG rule. The Alu family was found in introns 2 and 8. The 5{prime} flanking region of the PDH{beta} gene contains a CAAT consensus promoter sequence but no TATA sequence. Primer-extension analysis indicated the PDH{beta} gene transcription start site is an adenine residue located 132 bases upstream from the initiation codon in exon 1.

  6. Assignment of the {beta}-arrestin 1 gene (ARRB1) to human chromosome 11q13

    SciTech Connect

    Calabrese, G.; Morizio, E.; Palka, G.

    1994-11-01

    Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor, and its functional cofactor, {beta}-arrestin. {beta}ARK is a member of a multigene family, consisting of six known subtypes, which have also been named G-protein-coupled receptor kinases (GRK 1 to 6) due to the apparently unique functional association of such kinases with this receptor family. The gene for {beta}ARK1 has been localized to human chromosome 11q13. The four members of the arrestin/{beta}-arrestin gene family identified so far are arrestin, X-arrestin, {beta}-arrestin 1, and {beta}-arrestin 2. Here the authors report the chromosome mapping of the human gene for {beta}-arrestin 1 (ARRB1) to chromosome 11q13 by fluorescence in situ hybridization (FISH). Two-color FISH confirmed that the two genes coding for the functionally related proteins {beta}ARK1 and {beta}arrestin 1 both map to 11q13. 16 refs., 1 fig., 1 tab.

  7. Myosin light chain genes in the turkey (Meleagris gallopavo).

    PubMed

    Chaves, L D; Ostroski, B J; Reed, K M

    2003-01-01

    Myosin light chains associate with the motor protein myosin and are believed to play a role in the regulation of its actin-based ATPase activity. Myosin light chain cDNA clones from the turkey (Meleagris gallopavo) were isolated and sequenced. One sequence corresponded to an alternative transcript, the skeletal muscle essential light chain (MYL1 isoform 1) and a second to the smooth muscle isoform of myosin light chain (MYL6). The DNA and predicted amino acid sequences of both light chain genes were compared to that of the chicken. Based on the cDNA sequence, oligonucleotide primers were designed to amplify genomic DNA from six of the seven introns of the MYL1 gene. Approximately 5 kb of DNA was sequenced (introns and 3' UTR) and evaluated for the presence of single nucleotide polymorphisms (SNPs). SNPs were verified by sequencing common intron regions from multiple individuals and three polymorphisms were used to genotype pedigreed families. MYL1 is assigned to a turkey linkage group that corresponds to a region of chicken chromosome 7 (GGA7). The results of this study provide genomic reagents for comparative studies of avian muscle components and muscle biology.

  8. [Perissodactyla: the primary structure of hemoglobins from the lowland tapir (Tapirus terrestris): glutamic acid in position 2 of the beta chains].

    PubMed

    Mazur, G; Braunitzer, G

    1984-09-01

    The hemoglobins from a lowland tapir (Tapirus terrestris) were analysed and the complete primary structure is described. The globin chains were separated on CM cellulose column in 8M urea and the amino-acid sequences were determined in the liquid phase sequenator. The results show that globin consists of two alpha chains (alpha I and alpha II) and beta major and beta minor components. The alpha chains differ only at one position: alpha I contains aspartic acid and alpha II glycine. The beta chains are heterogeneous: aspartic and glutamic acid were found at position beta 21 and beta 73 of the beta major components and asparagine and serine at position beta 139. In the beta minor components four positions were found with more than one amino acid, namely beta 2, beta 4, beta 6 and beta 56. The sequences are compared with those of man, horse and rhinoceros. Four residues of horse methemoglobin, which are involved in the alpha 1 beta 1 contacts are substituted in tapir hemoglobins. In the alpha chains: alpha 107(G14)Ser----Val, alpha 111-(G18) Val----Leu, alpha 115(GH3) Asn----Asp or Gly; in the beta chains: beta 116(G18) Arg----Gln. The amino acid at beta 2 of the major components is glutamic acid while glutamine and histidine are found in the minor components. Although glutamic acid, a binding site for ATP, does not interact with 2,3-bisphosphoglycerate, glutamine and histidine in the minor components are responsible for the slight effect of 2,3-bisphosphoglycerate on tapir hemoglobin.

  9. Sequences of CAZ-3 and CTX-2 extended-spectrum beta-lactamase genes.

    PubMed Central

    Chanal, C; Sirot, D; Malaure, H; Poupart, M C; Sirot, J

    1994-01-01

    The nucleotide sequences of blaTEM genes coding for the extended-spectrum beta-lactamases CAZ-3 and CTX-2 were determined. The gene for CAZ-3 is identical to blaTEM-12b. The gene for CTX-2 differs from characterized blaTEM genes for extended-spectrum beta-lactamases by a new combination of already known mutations. We propose for CTX-2 the designation TEM-25. PMID:7840586

  10. Chromosome mapping of the human arrestin (SAG), {beta}-arrestin 2 (ARRB2), and {beta}-adrenergic receptor kinase 2 (ADRBK2) genes

    SciTech Connect

    Calabrese, G.; Sallese, M.; Stornaiuolo, A.

    1994-09-01

    Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor and its functional cofactor, {beta}-arrestin. Both {beta}ARK and {beta}-arrestin are members of multigene families. The family of G-protein-coupled receptor kinases includes rhodopsin kinase, {beta}ARK1, {beta}ARK2, IT11-A (GRK4), GRK5, and GRK6. The arrestin/{beta}-arrestin gene family includes arrestin (also known as S-antigen), {beta}-arrestin 1, and {beta}-arrestin 2. Here we report the chromosome mapping of the human genes for arrestin (SAG), {beta}arrestin 2 (ARRB2), and {beta}ARK2 (ADRBK2) by fluorescence in situ hybridization (FISH). FISH results confirmed the assignment of the gene coding for arrestin (SAG) to chromosome 2 and allowed us to refine its localization to band q37. The gene coding for {beta}-arrestin 2 (ARRB2) was mapped to chromosome 17p13 and that coding for {beta}ARK2 (ADRBK2) to chromosome 22q11. 17 refs., 1 fig.

  11. Intervening sequence of DNA identified in the structural portion of a mouse beta-globin gene.

    PubMed Central

    Tilghman, S M; Tiemeier, D C; Seidman, J G; Peterlin, B M; Sullivan, M; Maizel, J V; Leder, P

    1978-01-01

    The unusual electron microscopic appearance of a hybrid formed between 9S mouse beta-globin mRNA and its corresponding cloned gene segment is caused by at least one, and possibly two, intervening sequences of DNA that interrupt the mouse beta-globin gene. Such an interpretation is consistent with a paradoxical restriction site pattern previously noted in this gene and with the nucleotide sequence of that portion of the gene that spans both structural and intervening sequences. The large intervening sequence, approximately 550 base pairs in length, occurs in the structural globin sequence and immediately follows the beta-globin codon corresponding to amino acid 104. A smaller, putative intervening sequence is located close to the 5' end of the beta-globin-coding sequence but may reside beyond its initiation codon. The beta-globin gene thus appears to be encoded in two, and possibly three, discontinuous segments. Images PMID:273235

  12. Beta-2-glycoprotein specificity of human anti-phospholipid antibody resides on the light chain: a novel mechanism for acquisition of cross-reactivity by an autoantibody.

    PubMed

    Kumar, Sanjeev; Nagl, Sylvia; Kalsi, Jatinderpal K; Ravirajan, Chelliah T; Athwal, Dee; Latchman, David S; Pearl, Laurence H; Isenberg, David A

    2005-01-01

    We have recently shown that the anti-cardiolipin activity of human anti-phospholipid antibody UK4 (lambda) resides on its heavy chain. We now show that UK4 possesses strong reactivity to the plasma-protein beta2-Glycoprotein I (beta2-GPI) also. Utilizing chain shuffling experiments involving an unrelated anti-p185 antibody 4D5 (kappa) with no reactivity to beta2-GPI, we now demonstrate that both the constructs possessing the auto-antibody-derived light chain exhibited significant binding to beta2-GPI. However, the construct possessing UK4 heavy chain in association with 4D5 light chain, exhibited no anti-beta2-GPI activity. Furthermore, there was a low increase (approximately 10%) in the binding of UK4 to cardiolipin in the presence of beta2-GPI. The results demonstrate that anti-beta2-GPI activity resides on UK4 light chain and, importantly, this activity could be transferred to a novel antibody construct via the light chain alone. Computer-generated models of the three-dimensional structures of UK4 and its hybrids, suggest predominant interaction of UK4 light chain with domain IV of beta2-GPI. Molecular docking experiments highlight a number of potential sites on beta2-GPI for interaction of UK4 and indicate as to how beta2-GPI recognition may occur primarily via the autoantibody light chain. The study provides first demonstration of the occurrence of anti-phospholipid and anti-beta2-GPI activities separately on heavy and light chains of an autoantibody. The possible mechanisms that such antibodies may employ to recognise their antigens, are discussed.

  13. A chain reaction approach to modelling gene pathways.

    PubMed

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By

  14. Structural organization and transcription of the mouse gastric H+, K(+)-ATPase beta subunit gene.

    PubMed Central

    Canfield, V A; Levenson, R

    1991-01-01

    We have cloned and characterized the mouse gene encoding the beta subunit of H+, K(+)-ATPase (EC 3.6.1.36). The entire 10.5-kilobase transcription unit of the H+,K(+)-ATPase beta subunit gene was cloned in three overlapping cosmids encompassing approximately 46 kilobases of genomic DNA. A tight cluster of transcription initiation sites has been localized 24-25 nucleotides upstream of the translation start site and 28-29 nucleotides downstream of a TATA-like sequence. The H+, K(+)-ATPase beta subunit gene is split into seven exons encoding predicted structural domains of the beta subunit protein. The intracellular amino-terminal and putative transmembrane domains are encoded by individual exons, and the extracellular carboxyl-terminal domain is encoded by five exons. The exon/intron organization of the mouse H+,K(+)-ATPase beta subunit gene is identical to that of the mouse Na+,K(+)-ATPase beta 2 subunit gene. The conservation of genomic organization, together with the high sequence homology, indicates that the mouse H+,K(+)-ATPase beta and Na+,K(+)-ATPase beta 2 subunit genes originated from a common ancestral gene. Images PMID:1654563

  15. Functional polymorphism of each of the two HLA-DR beta chain loci demonstrated with antigen-specific DR3- and DRw52-restricted T cell clones

    PubMed Central

    1988-01-01

    HLA-DR3- and HLA-DRw52-associated functional polymorphism was investigated with selected tetanus toxoid (TT)-specific T cell clones. We have shown earlier that HLA-DR antigens are encoded by two distinct loci, DR beta I and DR beta III. The alloantigenic determinant(s) defined by the serological HLA-DR3 specificity map to the former, while the supratypic HLA-DRw52 determinants map to DR beta III. Furthermore, we have recently recognized by DNA sequencing three alleles of HLA- DRw52 at locus DR beta III, referred to as 52 a, b, and c. Our objective was to correlate the pattern of T cell restriction with the gene products of individual DR beta chain loci and with the three newly described alleles of locus DR beta III. Among the selected T cell clones, 5 reacted exclusively when TT was presented by HLA-DR3+ APCs (TT-DR3-APC). In contrast, two T cell clones were stimulated by TT- DRw52-APC. More specifically, these two T cell clones (Clones 10 and 16) were stimulated by different subsets of TT-DRw52-APC. Clone 16 responded to some DR3 and TT-DRw6-APC, while clone 10 was stimulated by other TT-DR3 and TT-DRw6, and all TT-DR5-APC. This same pattern of DRw52 restriction was found in panel, as well as in family studies. Because this suggested a correlation with the pattern of DRw52 polymorphism observed earlier by DNA sequencing and oligonucleotide hybridization, the APC used in these experiments were typed for the 52 a, b, and c alleles of locus DR beta III by allele-specific oligonucleotide probes. This distribution overlapped exactly with the stimulation pattern defined by the T cell clones. Clone 16 responded to TT-52a-APC, clone 10 to TT-52b-APC, and both clones to a TT-52c-APC. The response of the T cell clones was inhibited differentially by mAbs to DR. Raising TT concentration, or increasing HLA-class II expression with INF-gamma both affected the magnitude of response of the TT- specific clones but did not modify their specificities. These results demonstrate that

  16. [Hemoglobin of the golden eagle (Aquila chrysaetos, Accipitriformes): amino acid sequence of the alpha A- and beta chains of the principal component].

    PubMed

    Oberthür, W; Braunitzer, G; Grimm, F; Kösters, J

    1983-07-01

    The primary structures of the alpha A- and beta-chains from the major hemoglobin component of Golden Eagle (Aquila chrysaetos) are given. By homologous comparison, Greylag Goose (Anser anser) hemoglobin and Golden Eagle alpha A-chains differ by 17 amino acids or 19 nucleotides (2 two-point mutations), beta-chains by 9 exchanges. Five substitutions have modified alpha 1 beta 1-contacts, one substitution, one alpha 1 beta 2-contact and one alpha 1 alpha 1-contact. Differences by homologous comparison to other hemoglobins of birds are discussed. PMID:6618445

  17. Ultrasound-mediated interferon {beta} gene transfection inhibits growth of malignant melanoma

    SciTech Connect

    Yamaguchi, Kazuki; Feril, Loreto B.; Tachibana, Katsuro; Takahashi, Akira; Matsuo, Miki; Endo, Hitomi; Harada, Yoshimi; Nakayama, Juichiro

    2011-07-22

    Highlights: {yields} Successful ultrasound-mediated transfection of melanoma (C32) cells with IFN-{beta} genes both in vitro and in vivo. {yields} Ultrasound-mediated IFN-{beta} transfection inhibited proliferation of melanoma cells in vitro. {yields} Ultrasound-mediated IFN-{beta} transfection inhibited melanoma tumor growth in vivo. -- Abstract: We investigated the effects of ultrasound-mediated transfection (sonotransfection) of interferon {beta} (IFN-{beta}) gene on melanoma (C32) both in vitro and in vivo. C32 cells were sonotransfected with IFN-{beta} in vitro. Subcutaneous C32 tumors in mice were sonicated weekly immediately after intra-tumor injection with IFN-{beta} genes mixed with microbubbles. Successful sonotransfection with IFN-{beta} gene in vitro was confirmed by ELISA, which resulted in C32 growth inhibition. In vivo, the growth ratio of tumors transfected with IFN-{beta} gene was significantly lower than the other experimental groups. These results may lead to a new method of treatment against melanoma and other hard-to-treat cancers.

  18. Characterization of a new beta-lactamase gene from isolates of Vibrio spp. in Korea.

    PubMed

    Jun, Lyu Jin; Kim, Jae Hoon; Jin, Ji Woong; Jeong, Hyun Do

    2012-04-01

    PCR was performed to analyze the beta-lactamase genes carried by ampicillin-resistant Vibrio spp. strains isolated from marine environments in Korea between 2006 and 2009. All 36 strains tested showed negative results in PCR with the primers designed from the nucleotide sequences of various known beta-lactamase genes. This prompted us to screen new beta-lactamase genes. A novel beta-lactamase gene was cloned from Vibrio alginolyticus KV3 isolated from the aquaculture water of Geoje Island of Korea. The determined nucleotide sequence (VAK-3 beta-lactamase) revealed an open reading frame (ORF) of 852 bp, encoding a protein of 283 amino acids (aa), which displayed low homology to any other beta-lactamase genes reported in public databases. The deduced 283 aa sequence of VAK-3, consisting of a 19 aa signal peptide and a 264 aa mature protein, contained highly conserved peptide segments specific to class A beta-lactamases including the specific amino acid residues STFK (62-65), SDN (122-124), E (158), and RTG (226-228). Results from PCR performed with primers specific to the VAK-3 beta-lactamase gene identified 3 of the 36 isolated strains as V. alginolyticus, Vibrio cholerae, and Photobacterium damselae subsp. damselae, indicating the utilization of various beta-lactamase genes including unidentified ones in ampicillin-resistant Vibrio spp. strains from the marine environment. In a mating experiment, none of the isolates transfered the VAK-3 beta-lactamase gene to the Escherichia coli recipient. This lack of mobility, and the presence of a chromosomal acyl-CoA flanking sequence upstream of the VAK-3 beta- lactamase gene, led to the assumption that the location of this new beta-lactamase gene was in the chromosome, rather than the mobile plasmid. Antibiotic susceptibility of VAK-3 beta-lactamase was indicated by elevated levels of resistance to penicillins, but not to cephalosporins in the wild type and E. coli harboring recombinant plasmid pKV-3, compared with those of

  19. Genomic organization of the human {beta}-catenin gene (CTNNB1)

    SciTech Connect

    Nollet, F.; Berx, G.; Molemans, F.; Roy, F. van

    1996-03-05

    The cytoplasmic {beta}-catenin protein is implicated in signal transduction and associates with both the cell-cell adhesion protein E-cadherin and the tumor suppressor gene product APC. We determined the primary structure of the human {beta}-catenin gene (CTNNB1) by analysis cDNA and genomic clones. The size of the complete gene was determined to be 23.2 kb. Restriction mapping and partial sequence analysis revealed 16 exons. All splice donor and acceptor sites were conformable to the GT/AG rule. The exon size ranged from 61 to 790 bp. Half of the introns were smaller than 550 bp, with the smallest being 84 pb and the longest being 6700 bp. The intron-exon boundaries did not coincide either with conserved sites in the 12 armadillo repeat sequences of {beta}-catenin or with intron-exon boundaries in the armadillo gene of Drosophila. A major site for transcription initiation was identified as an A residue 214 nucleotides upstream of the ATG initiation codon. The resulting transcript is 3362 nucleotides long. Compared to the previously published mRNA sequence, additional residues were identified, 16 at the 5{prime} end and 766 at the 3{prime} end of the mRNA. An alternative splice acceptor site within exon 16 reduced the 3{prime} UTR sequence by 159 bp. Polymerase chain reaction on cDNA from 14 human cell lines demonstrated the general occurrence of both splice variants. The 5{prime}-flanking region is highly GC-rich and lacks a CCAAT box, but contains a TATA box and potential binding sites for several transcription factors, such as NFkB, SP1, AP2, and EGR1. Both a 437-bp fragment and a 6-kb fragment, containing about 4.7 kb of the 5{prime}-flanking region in addition to the noncoding exon 1 and 1 kb of intron 1, showed clear promoter activity when these fragments were linked to a secreted alkaline phosphatase reporter gene and transfected into a mouse epithelial cell line. 53 refs., 5 figs., 2 tabs.

  20. Analysis of polymorphism in the bovine casein genes by use of the polymerase chain reaction.

    PubMed

    Pinder, S J; Perry, B N; Skidmore, C J; Savva, D

    1991-01-01

    Methods have been devised for detecting polymorphisms in the bovine beta- and kappa-casein genes using the polymerase chain reaction (PCR) followed either by restriction enzyme digestion (to reveal a restriction fragment length polymorphism (RFLP] or by hybridization of an allele-specific oligonucleotide. These methods, as well as being faster and more sensitive than traditional RFLP methods, are of more general applicability since they can detect any change in DNA sequence. They require only a small sample of blood or semen and are applicable to animals of any age or sex. These methods make possible large-scale screening and thus selection for alleles at these loci. Typing of blood DNA can give erroneous results when the animal concerned is a twin; however, this can be overcome by retesting using milk or semen. Analysis of the kappa-casein genotype of Holstein-Friesian bulls gives frequencies for the A and B alleles of 0.80 and 0.20 respectively. Selection in favour of the B allele, which is superior for cheese production, could thus have a large effect. The A3 and B alleles at the beta-casein locus have been shown to be rare in the Holstein-Friesian population. Linkage disequilibrium exists between beta-casein B and kappa-casein B.

  1. Selective inhibition of growth-related gene expression in murine keratinocytes by transforming growth factor beta.

    PubMed Central

    Coffey, R J; Bascom, C C; Sipes, N J; Graves-Deal, R; Weissman, B E; Moses, H L

    1988-01-01

    Transforming growth factor beta (TGF beta) is a potent inhibitor of epithelial cell proliferation. A nontumorigenic epidermal growth factor (EGF)-dependent epithelial cell line, BALB/MK, is reversibly growth arrested by TGF beta. TGF beta will also abrogate EGF-stimulated mitogenesis of quiescent BALB/MK cells. Increased levels of calcium (greater than 1.0 mM) will induce differentiation in BALB/MK cells; in contrast, TGF beta-mediated growth inhibition does not result in induction of terminal differentiation. In the present study, the effects of TGF beta and calcium on growth factor-inducible gene expression were examined. TGF beta markedly decreased c-myc and KC gene expression in rapidly growing BALB/MK cells and reduced the EGF induction of c-myc and KC in a quiescent population of cells. TGF beta exerted its control over c-myc expression at a posttranscriptional level, and this inhibitory effect was dependent on protein synthesis. TGF beta had no effect on c-fos gene expression, whereas 1.5 mM calcium attenuated EGF-induced c-fos expression in quiescent cells. Expression of beta-actin, however, was slightly increased in both rapidly growing and EGF-restimulated quiescent BALB/MK cells treated with TGF beta. Thus, in this system, TGF beta selectively reduced expression of certain genes associated with cell proliferation (c-myc and KC), and at least part of the TGF beta effect was at a posttranscriptional level. Images PMID:2463471

  2. Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB)

    PubMed Central

    Jung, Lenice Roteia Cardoso; Bomfim, Maria Rosa Quaresma; Kroon, Erna Geessien; Nunes, Álvaro Cantini

    2015-01-01

    Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR). The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP) analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars. PMID:26273261

  3. Structure of the three beta-tubulin-encoding genes of the unicellular alga, Polytomella agilis.

    PubMed

    Conner, T W; Thompson, M D; Silflow, C D

    1989-12-14

    The quadriflagellate, unicellular, colorless alga, Polytomella agilis, contains several distinct microtubule arrays. To study the genetic basis of microtubule heterogeneity in P. agilis, we characterized its tubulin(Tub)-encoding genes (tub). The three beta tub genes detected in blots of P. agilis DNA were isolated from a genomic library. The structure and organization of the genes were examined by restriction mapping and nucleotide (nt) sequencing. S1 nuclease protection studies showed that all three genes are expressed. The predicted amino acid (aa) sequences are more than 98% conserved with the Chlamydomonas reinhardtii and Volvox carteri beta-Tubs, underscoring the close phylogenetic relationship of these species. Evolutionary divergence among the P. agilis genes is demonstrated by differences in intron number, nt sequences in noncoding regions, and silent nt substitutions in the coding regions. However, the proteins encoded by the beta 1 and beta 3 tub genes are identical; the beta 2 gene product differs by one conservative aa substitution. These results are in striking contrast to the C-terminal aa diversity reported within beta tub gene families in animal, higher plant and fungal systems. The data support the hypothesis that those tub genes whose products assemble into axonemal microtubules are subject PMID:2533130

  4. Molecular analysis of T cell receptor (Ti) variable region (V) gene expression. Evidence that a single Ti beta V gene family can be used in formation of V domains on phenotypically and functionally diverse T cell populations.

    PubMed

    Acuto, O; Campen, T J; Royer, H D; Hussey, R E; Poole, C B; Reinherz, E L

    1985-06-01

    We examine the rules governing Ti beta variable (V) gene segment usage in the formation of T cell antigen-MHC receptors in diverse regulatory and effector T lymphoid subpopulations. To this end, a single Ti beta V gene family and its products were analyzed. A monoclonal antibody, termed anti-Ti3A, which was shown to be reactive with an epitope encoded by members of the REX cell line Ti beta V gene family, and which was expressed on 2% of human T lymphocytes was used in selection of clones from unprimed peripheral T lymphocytes. Both T4+, as well as T8+ T cell clones with inducer, suppressor, and/or cytotoxic function were defined. Southern analysis, isoelectric focusing and two-dimensional peptide mapping indicated that individual members of the REX V gene family were linked to different Ti beta diversity and/or joining and constant region segments. Moreover, the Ti alpha chains of such clones were distinct. These results imply that Ti beta V gene usage is not restricted to any functionally or phenotypically defined T cell subsets, and there is presumably little, if any, restriction on the mechanisms that generate combinational, junctional or chain association-mediated diversity.

  5. Identical TCR beta-chain rearrangements in streptococcal angina and skin lesions of patients with psoriasis vulgaris.

    PubMed

    Diluvio, Laura; Vollmer, Sigrid; Besgen, Petra; Ellwart, Joachim W; Chimenti, Sergio; Prinz, Joerg C

    2006-06-01

    Tonsillar infection with Streptococcus pyogenes may induce several nonsuppurative autoimmune sequelae. The precise pathogenetic mechanisms behind this clinically well-established association are still unresolved. Using TCR analysis, we sought to identify a link between streptococcal tonsillitis and the T cell-mediated autoimmune response in psoriasis. Three patients with streptococcal-induced psoriasis underwent tonsillectomy. Using size spectratyping and sequencing of TCR beta-chain variable region gene (TCRBV) rearrangements, we compared the TCR usage of psoriatic skin lesions, blood, tonsils, and tonsillar T cells fractionated according to the expression of the skin address in "cutaneous lymphocyte-associated Ag" (CLA). TCRBV-size spectratype analysis of the blood lymphocytes, tonsils, and the CLA-negative tonsillar T cells revealed largely unselected T cell populations. Instead, TCRBV gene families of the psoriatic lesions and skin-homing CLA-positive tonsillar T cells displayed highly restricted spectratypes. Sequencing of TCRBV cDNA identified various clonal TCRBV rearrangements within the psoriatic lesions that indicated Ag-driven T cell expansion. Several of these clonotypes were also detected within the tonsils and, in one of the patients, within the small subset of CLA-positive tonsillar T cells, suggesting that T cells from the same T cell clones were simultaneously present within skin and tonsillar tissue. Because after tonsillectomy psoriasis cleared in all three patients our observations indicate that T cells may connect psoriatic inflammation to streptococcal angina. They suggest that the chronic streptococcal immune stimulus within the tonsils could act as a source for pathogenic T cells in poststreptococcal disorders, and they may help to explain why eliminating this source with tonsillectomy may improve streptococcal-induced sequelae.

  6. Inhibition of spermidine synthase gene expression by transforming growth factor-beta 1 in hepatoma cells.

    PubMed Central

    Nishikawa, Y; Kar, S; Wiest, L; Pegg, A E; Carr, B I

    1997-01-01

    We screened genes responsive to transforming growth factor-beta (TGF-beta 1) protein in a human hepatoma cell line (Hep3B) using a PCR-mediated differential display technique, in order to investigate the mechanisms involved in TGF-beta-induced growth suppression. We found a gene that was down-regulated by TGF-beta 1 to be completely identical in an approx. 620 bp segment to the gene for the enzyme spermidine synthase, which mediates the conversion of putrescine into spermidine. Both spermidine synthase mRNA expression and its enzyme activity were decreased after TGF-beta 1 treatment of Hep3B cells. The inhibition of spermidine synthase gene expression by TGF-beta 1 protein was also observed in other hepatoma cell lines. The expression of genes for other biosynthetic enzymes in polyamine metabolism (ornithine decarboxylase and S-adenosylmethionine decarboxylase) was also inhibited to the same extent as for spermidine synthase, while the gene expression of spermidine/spermine N1-acetyltransferase, a catabolic enzyme, was relatively resistant to TGF-beta 1. Spermine levels in Hep3B cells were decreased by TGF-beta 1 treatment, although the levels of spermidine and putrescine were unchanged, probably due to compensation by remaining spermidine/spermine N1-acetyltransferase activity. Exogenously added spermidine or spermine, but not putrescine, partially antagonized the growth-inhibitor effects of TGF-beta 1 on Hep3B cells. Our data suggest that down-regulation of gene expression of the enzymes involved in polyamine metabolism, including spermidine synthase, may be associated with the mechanism of TGF-beta-induced growth suppression. PMID:9020892

  7. Unusual association of beta 2-microglobulin with certain class I heavy chains of the murine major histocompatibility complex.

    PubMed Central

    Bushkin, Y; Tung, J S; Pinter, A; Michaelson, J; Boyse, E A

    1986-01-01

    Class I products of the major histocompatibility complex (MHC) comprise a heavy chain of about 45 kDa noncovalently linked to a 12-kDa beta 2-microglobulin (beta 2m) light chain encoded on a different chromosome. We find that class I products of some mouse strains include an additional 62-kDa molecule which on the following evidence consists of a heavy chain linked covalently with beta 2m. Production of the 62-kDa protein invariably accorded with the occurrence of cysteine at position 121 of the heavy chain (Kb,Kbm1,Kbm3,Dd, and Ld). Substitution of arginine at position 121 invariably accorded with absence of the 62-kDa protein (Kbm6,Kbm7,Kbm9,Kd, and Db). On the basis of observed production versus nonproduction of the 62-kDa molecule, predictions are made regarding residue 121 in class I products for which this is not yet known; namely, Kk, Ks, and Dk, which produce the 62-kDa molecule, as compared with Kj, Qa-2, and TL, which do not. Reported differences in immunologic reactivity between Kb mutant strains with Arg-121 in place of Cys-121 imply that the occurrence of 62-kDa class I products in mice of Cys-121 genotype has functional consequences. Images PMID:3510435

  8. Tumor-produced, active Interleukin-1 {beta} regulates gene expression in carcinoma-associated fibroblasts

    SciTech Connect

    Dudas, Jozsef; Fullar, Alexandra; Bitsche, Mario; Schartinger, Volker; Kovalszky, Ilona; Sprinzl, Georg Mathias; Riechelmann, Herbert

    2011-09-10

    Recently we described a co-culture model of periodontal ligament (PDL) fibroblasts and SCC-25 lingual squamous carcinoma cells, which resulted in conversion of normal fibroblasts into carcinoma-associated fibroblasts (CAFs), and in epithelial-mesenchymal transition (EMT) of SCC-25 cells. We have found a constitutive high interleukin-1{beta} (IL1-{beta}) expression in SCC-25 cells in normal and in co-cultured conditions. In our hypothesis a constitutive IL1-{beta} expression in SCC-25 regulates gene expression in fibroblasts during co-culture. Co-cultures were performed between PDL fibroblasts and SCC-25 cells with and without dexamethasone (DEX) treatment; IL1-{beta} processing was investigated in SCC-25 cells, tumor cells and PDL fibroblasts were treated with IL1-{beta}. IL1-{beta} signaling was investigated by western blot and immunocytochemistry. IL1-{beta}-regulated genes were analyzed by real-time qPCR. SCC-25 cells produced 16 kD active IL1-{beta}, its receptor was upregulated in PDL fibroblasts during co-culture, which induced phosphorylation of interleukin-1 receptor-associated kinase-1 (IRAK-1), and nuclear translocalization of NF{kappa}B{alpha}. Several genes, including interferon regulatory factor 1 (IRF1) interleukin-6 (IL-6) and prostaglandin-endoperoxide synthase 2 (COX-2) were induced in CAFs during co-culture. The most enhanced induction was found for IL-6 and COX-2. Treatment of PDL fibroblasts with IL1-{beta} reproduced a time- and dose-dependent upregulation of IL1-receptor, IL-6 and COX-2. A further proof was achieved by DEX inhibition for IL1-{beta}-stimulated IL-6 and COX-2 gene expression. Constitutive expression of IL1-{beta} in the tumor cells leads to IL1-{beta}-stimulated gene expression changes in tumor-associated fibroblasts, which are involved in tumor progression. -- Graphical abstract: SCC-25 cells produce active, processed IL1-{beta}. PDL fibroblasts possess receptor for IL1-{beta}, and its expression is increased 4.56-times in the

  9. A beta-galactosidase gene is expressed during mature fruit abscission of 'Valencia' orange (Citrus sinensis).

    PubMed

    Wu, Zhencai; Burns, Jacqueline K

    2004-07-01

    beta-galactosidases have been detected in a wide range of plants and are characterized by their ability to hydrolyse terminal non-reducing beta-D-galactosyl residues from beta-D-galactosides. These enzymes have been detected in a wide range of plant organs and tissues. In a search for differentially expressed genes during the abscission process in citrus, sequences encoding beta-galactosidase were identified. Three cDNA fragments of a beta-galactosidase gene were isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after the application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-1H-pyrazole (CMN-pyrazole). Based on sequence information derived from these fragments, a full-length cDNA of 2847 nucleotides (GenBank accession number AY029198) encoding beta-galactosidase was isolated from mature fruit abscission zones by 5'- and 3'-RACE approaches. The beta-galactosidase cDNA encoded a protein of 737 amino acid residues with a calculated molecular weight of 82 kDa. The deduced protein was highly homologous to plant beta-galactosidases expressed in fruit ripening. Southern blot analysis demonstrated that at least two closely related beta-galactosidase genes were present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones indicated beta-galactosidase mRNA was detected 48 h after treatment of CMN-pyrazole and ethephon in mature fruit abscission zones. beta-galactosidase transcripts were detected in leaf abscission zones only after ethephon application. The citrus beta-galactosidase was expressed in stamens and petals of fully opened flowers and young fruitlets. The results suggest that this beta-galactosidase may play a role during abscission as well as early growth and development processes in flowers and fruitlets.

  10. Role of the von Hippel-Lindau tumor suppressor gene in the formation of beta1-integrin fibrillar adhesions.

    PubMed

    Esteban-Barragán, Miguel A; Avila, Pilar; Alvarez-Tejado, Miguel; Gutiérrez, M Dolores; García-Pardo, Angeles; Sánchez-Madrid, Francisco; Landázuri, Manuel O

    2002-05-15

    The von Hippel-Lindau tumor suppressor gene (VHL) is absent or inactivated in the VHLcancer syndrome and in most sporadic renal cancers. VHL is requiredfor the assembly of a proper extracellular fibronectin matrix, although the exact mechanism remains unknown. In this report, we demonstrate that 786-O renal cancer cells are unable to organize an adequate matrix even in the presence of an excess of exogenous fibronectin. Because the formation of integrin fibrillar adhesions plays a pivotal role in the organization of extracellular fibronectin, we next examined the expression and subcellular distribution of integrins in VHL- cells and their wild-type VHL stably transfected counterparts. The levels of beta1 and alphav integrins were increased in VHL- cells when compared with VHL+ transfectants. Early after plating, both VHL+ and VHL- cells were capable of assembling classic "patch-like" alphav focal contacts. As the culture advanced and cells became confluent, alphav integrins partly relocated to the intercellular junctions in VHL+ transfectants, which then developed large beta1 fibrillar-type adhesions and anchored firmly to the substrate. In contrast, confluent VHL- cells were unable to assemble beta1 fibrillar adhesions, and alphav focal contacts remained unchanged at all stages of the culture. Exogenous activation of beta1 integrins with either divalent cations or activating antibodies partly restored the capability of VHL- cells to assemble beta1 fibrillar adhesions and fibronectin fibers. Finally, pulse-chase studies of metabolically labeled 786-O cells revealed that the maturation of the common beta1-integrin chain was delayed in VHL- cells when compared with VHL+ cells. Our results show that VHL is an important regulator of integrins and is essential for the formation of beta1 fibrillar adhesions. These findings help to explain the abnormal extracellular matrix organization and increased motility of VHL- renal cancer cells. PMID:12019174

  11. Beta-lactamase genes of the penicillin-susceptible Bacillus anthracis Sterne strain.

    PubMed

    Chen, Yahua; Succi, Janice; Tenover, Fred C; Koehler, Theresa M

    2003-02-01

    Susceptibility to penicillin and other beta-lactam-containing compounds is a common trait of Bacillus anthracis. Beta-lactam agents, particularly penicillin, have been used worldwide to treat anthrax in humans. Nonetheless, surveys of clinical and soil-derived strains reveal penicillin G resistance in 2 to 16% of isolates tested. Bacterial resistance to beta-lactam agents is often mediated by production of one or more types of beta-lactamases that hydrolyze the beta-lactam ring, inactivating the antimicrobial agent. Here, we report the presence of two beta-lactamase (bla) genes in the penicillin-susceptible Sterne strain of B. anthracis. We identified bla1 by functional cloning with Escherichia coli. bla1 is a 927-nucleotide (nt) gene predicted to encode a protein with 93.8% identity to the type I beta-lactamase gene of Bacillus cereus. A second gene, bla2, was identified by searching the unfinished B. anthracis chromosome sequence database of The Institute for Genome Research for open reading frames (ORFs) predicted to encode beta-lactamases. We found a partial ORF predicted to encode a protein with significant similarity to the carboxy-terminal end of the type II beta-lactamase of B. cereus. DNA adjacent to the 5' end of the partial ORF was cloned using inverse PCR. bla2 is a 768-nt gene predicted to encode a protein with 92% identity to the B. cereus type II enzyme. The bla1 and bla2 genes confer ampicillin resistance to E. coli and Bacillus subtilis when cloned individually in these species. The MICs of various antimicrobial agents for the E. coli clones indicate that the two beta-lactamase genes confer different susceptibility profiles to E. coli; bla1 is a penicillinase, while bla2 appears to be a cephalosporinase. The beta-galactosidase activities of B. cereus group species harboring bla promoter-lacZ transcriptional fusions indicate that bla1 is poorly transcribed in B. anthracis, B. cereus, and B. thuringiensis. The bla2 gene is strongly expressed in B

  12. The isolation and characterization of beta-glucosidase gene and beta-glucosidase of Trichoderma viride: Progress report

    SciTech Connect

    Stafford, D.W.; Lunblad, R.L.

    1981-05-01

    We have demonstrated the induction by sophorose of ..beta..-glucosidase and other cellulases in Trichoderma cultures, isolated large quantities of intact RNA from induced and noninduced cultures, isolated large quantities of high molecular weight DNA free from contaminating polysaccarides and obtained about 3000 recombinant clones containing inserts, presumably of restriction enzyme cleaved Trichoderma DNA. Additionally we have examined the effect of sophorose on the ..beta..-glucosidase of Sporotrichum pulverentum, established an in vitro translation system, and prepared enzymes from the bacterium Oerskovia which will aid in attempts to insert ethanol producing genes into Trichoderma. 28 refs., 2 figs.

  13. Knocking out the MFE-2 gene of Candida bombicola leads to improved medium-chain sophorolipid production.

    PubMed

    Van Bogaert, Inge N A; Sabirova, Julia; Develter, Dirk; Soetaert, Wim; Vandamme, Erick J

    2009-06-01

    The nonpathogenic yeast Candida bombicola synthesizes sophorolipids. These biosurfactants are composed of the disaccharide sophorose linked to a long-chain hydroxy fatty acid and have potential applications in the food, pharmaceutical, cosmetic and cleaning industries. In order to expand the range of application, a shift of the fatty acid moiety towards medium-chain lengths would be recommendable. However, the synthesis of medium-chain sophorolipids by C. bombicola is a challenging objective. First of all, these sophorolipids can only be obtained by fermentations on unconventional carbon sources, which often have a toxic effect on the cells. Furthermore, medium-chain substrates are partially metabolized in the beta-oxidation pathway. In order to redirect unconventional substrates towards sophorolipid synthesis, the beta-oxidation pathway was blocked on the genome level by knocking out the multifunctional enzyme type 2 (MFE-2) gene. The total gene sequence of the C. bombicola MFE-2 (6033 bp) was cloned (GenBank accession number EU371724), and the obtained nucleotide sequence was used to construct a knock-out cassette. Several knock-out mutants with the correct geno- and phenotype were evaluated in a fermentation on 1-dodecanol. All mutants showed a 1.7-2.9 times higher production of sophorolipids, indicating that in those strains the substrate is redirected towards the sophorolipid synthesis.

  14. Analysis of the transforming growth factor-beta 1 gene promoter polymorphisms in early osseointegrated implant failure.

    PubMed

    Dos Santos, Maria Cristina Leme Godoy; Campos, Maria Isabela Guimarães; Souza, Ana Paula; Scarel-Caminaga, Raquel Mantuaneli; Mazzonetto, Renato; Line, Sergio Roberto Peres

    2004-09-01

    Transforming growth factor-beta 1 is a multifunctional cytokine involved in extracellular matrix deposition, reduction of inflammation, and promotion of wound healing. Single nucleotide polymorphisms in the promoter region of human transforming growth factor-beta 1 gene, C-509T and G-800A, have been shown to increase the transcriptional activity of this cytokine and have been associated with a variety of diseases. The objective of this study was to investigate the possible association between these single nucleotide polymorphisms and the early implant failure. A sample of 68 nonsmoking patients was divided into two groups: a test group comprising 28 patients with one or more early failed implants and a control group consisting of 40 individuals with one or more healthy implants. Genomic DNA from oral mucosa was amplified by polymerase chain reaction and analyzed by restriction fragment length polymorphism. The significance of the differences in observed frequencies of single nucleotide polymorphisms was assessed using the chi square test and Fisher's exact test. The cited single nucleotide polymorphisms in transforming growth factor-beta 1 were analyzed in combination as haplotype using the computer program ARLEQUIN. The authors did not observe significant differences in the allele and genotypes to both single nucleotide polymorphisms of transforming growth factor-beta 1 gene (C-509T and G-800A) between control and early implant failure groups. The distribution of the haplotypes arranged as allele and genotypes were similar between control and test groups. These results indicate that C-509T and G-800A polymorphisms in the transforming growth factor-beta 1 gene are not associated separately or in haplotype combinations with early implant failure, suggesting that the presence of those single nucleotide polymorphisms alone do not constitute a genetic risk factor for early implant failure in the Brazilian population. PMID:15359164

  15. Phenotypic detection and molecular characterization of beta-lactamase genes among Citrobacter species in a tertiary care hospital

    PubMed Central

    Praharaj, Ashok Kumar; Khajuria, Atul; Kumar, Mahadevan; Grover, Naveen

    2016-01-01

    Objective: To examine the distribution, emergence, and spread of genes encoding beta-lactamase resistance in Citrobacter species isolated from hospitalized patients in a tertiary care hospital. Methods: A prospective study was conducted in a 1000-bed tertiary care center in Pune, India from October 2010 to October 2013. A total of 221 Citrobacter spp. isolates were recovered from clinical specimens from different patients (one isolate per patient) admitted to the surgical ward, medical ward and medical and surgical Intensive Care Units. Polymerase chain reaction (PCR) assays and sequencing were used to determine the presence of beta-lactamase encoding genes. Conjugation experiments were performed to determine their transferability. Isolate relatedness were determined by repetitive element based-PCR, enterobacterial repetitive intergenic consensus-PCR and randomly amplified polymorphic DNA. Results: Among 221 tested isolates of Citrobacter spp. recovered from various clinical specimens, 179 (80.9%) isolates showed minimum inhibitory concentration (MIC) >4 μg/ml against meropenem and imipenem. One hundred and forty-five isolates with increased MICs value against carbapenems were further processed for molecular characterization of beta-lactamase genes. Susceptibility profiling of the isolates indicated that 100% retained susceptibility to colistin. Conjugation experiments indicated that blaNDM-1 was transferable via a plasmid. Conclusion: The ease of NDM-1 plasmid transmissibility may help their dissemination among the Citrobacter species as well as to others in Enterobacteriaceae. Early detection, antimicrobial stewardship and adequate infection control measures will help in limiting the spread of these organisms. PMID:26952135

  16. Expression of a preproinsulin-beta-galactosidase gene fusion in mammalian cells.

    PubMed Central

    Nielsen, D A; Chou, J; MacKrell, A J; Casadaban, M J; Steiner, D F

    1983-01-01

    As an approach to the study of mammalian gene expression, the promoters and translation initiation regions of the rat preproinsulin II and the simian virus 40 early genes were fused to the structural gene of Escherichia coli beta-galactosidase, a sensitive probe for gene expression. These fusions were introduced into COS-7 cells, a simian virus 40 large tumor-antigen-producing monkey kidney cell line, where they directed the synthesis of enzymatically active hybrid beta-galactosidase proteins. Conditions for transfection were varied to optimize the expression of beta-galactosidase activity in the transfected cells. The pH optimum of this activity was found to be 7.0, the same as that of native E. coli beta-galactosidase and distinct from the major lysosomal "acid" beta-galactosidase. The fused preproinsulin-beta-galactosidase was further characterized by gel electrophoresis of nondenatured cell extracts stained by a fluorogenic substrate and by immunoprecipitation and gel electrophoresis of 3H-labeled cell proteins. These results all indicate that fully active tetrameric beta-galactosidase hybrids can be produced in mammalian cells. The expression of preproinsulin-beta-galactosidase activity was measured in the presence of high glucose, insulin, dexamethasone, or epidermal growth factor but no regulatory changes were observed. Images PMID:6310564

  17. Influence of the route of infection on development of T-cell receptor beta-chain repertoires of reovirus-specific cytotoxic T lymphocytes.

    PubMed

    Fulton, Jonathan R; Smith, Jeremy; Cunningham, Cynthia; Cuff, Christopher F

    2004-02-01

    It is well established that the route of infection affects the nature of the adaptive immune response. However, little is known about the effects of the route of exposure on development of cytotoxic T-lymphocyte (CTL) responses. Alternative antigen-presenting cell populations, tissue-restricted expression of class I major histocompatibility complex-encoded molecules, and unique T-cell receptor (TCR)-bearing cells in mucosal tissues could influence the selection and expansion of responder T cells. This study addresses the question of whether the route of virus infection affects the selection and expansion of subpopulations of virus-specific CTLs. Mice were infected orally or in the hind footpads with reovirus, and the repertoires of TCR beta-chains expressed on virus-specific CD8(+) T cells in Peyer's patches or lymph nodes and spleens were examined. CD8(+) cells expressing the variable gene segment of the TCR beta-chain 6 (Vbeta6) expanded in the spleens of mice infected by either route and in CTL lines established from the spleens and draining lymphoid tissues. Adoptively transferred Vbeta6(+) CD8(+) T cells from orally or parenterally infected donors expanded in reovirus-infected severe combined immunodeficient recipient mice and mediated cytotoxicity ex vivo. Furthermore, recovered Vbeta6(+) cells were enriched for clones utilizing uniform complementarity-determining region 3 (CDR3) lengths. However, sequencing of CDR3beta regions from Vbeta6(+) CD8(+) cells indicated that Jbeta gene segment usage is significantly more restricted in CTLs from orally infected mice, suggesting that the route of infection affects selection and/or subsequent expansion of virus-specific CTLs. PMID:14722312

  18. Functional study of the equine beta-casein and kappa-casein gene promoters.

    PubMed

    Lenasi, Tina; Kokalj-Vokac, Nadja; Narat, Mojca; Baldi, Antonella; Dovc, Peter

    2005-01-01

    Casein genes are expressed in a tissue-specific and highly coordinated manner. The main goals of casein gene promoter studies are to unravel cis- and trans-acting factors involved in the complex signalling pathway controlling milk production, and to explore the possibility of using these promoters for tissue-specific production of heterologous proteins in the mammary gland. Here we present a comparative study of the equine beta-casein and kappa-casein gene proximal promoters. In order to confirm the assumption that in the horse, as in other mammalian species, casein genes are organized in a cluster located on a single chromosome, we performed in situ hybridization of pro-metaphase chromosomes with two BAC clones containing different equine casein genes. Sequence analysis of the beta-casein and kappa-casein gene proximal promoters revealed binding sites for activators (STAT5, GRE, NF1, MAF) and repressors (YY1, PMF), characteristic for casein genes. The alignments of casein gene promoters revealed the highest sequence identity in the proximal promoter region between the equine and human beta-casein gene promoters. We directly compared the activity of equine beta-casein and kappa-casein gene promoters in vitro using bovine mammary gland cell line BME-UV1. In this system, the kappa-casein gene proximal promoter activated the reporter gene expression more efficiently than the beta-casein gene promoter of approximately the same length. The 810 bp of beta-casein promoter activated the reporter gene expression more efficiently than the long fragment (1920 bp) and the 1206 bp fragment of the same promoter, which included also 396 bp of 5' UTR.

  19. Molecular cloning and characterization of mutant and wild-type human. beta. -actin genes

    SciTech Connect

    Leavitt, J.; Gunning, P.; Porreca, P.; Ng, S.Y.; Lin, C.H.; Kedes, L.

    1984-10-01

    There are more than 20 ..beta..-actin-specific sequences in the human genome, many of which are pseudogenes. To facilitate the isolation of potentially functional ..beta..-actin genes, they used the new method of B. Seed for selecting genomic clones by homologous recombination. A derivative of the ..pi..VX miniplasmid, ..pi..AN7..beta..1, was constructed by insertion of the 600-base-pair 3' untranslated region of the ..beta..-actin mRNA expressed in human fibroblasts. Five clones containing ..beta..-actin sequences were selected from an amplified human fetal gene library by homologous recombination between library phage and the miniplasmid. One of these clones contained a complete ..beta..-actin gene with a coding sequence identical to that determined for the mRNA of human fibroblasts. A DNA fragment consisting of mostly intervening sequences from this gene was then use to identify 13 independent recombinant copies of the analogous gene from two specially constructed gene libraries, each containing one of the two types of mutant ..beta..-actin genes found in a line of neoplastic human fibroblasts. The amino acid and nucleotide sequences encoded by the unmutated gene predict that a guanine-to-adenine transition is responsible for the glycine-to-aspartic acid mutation at codon 244 and would also result in the loss of a HaeIII site. Detection of this HaeIII polymorphism among the fibroblast-derived closed verified the identity of the ..beta..-actin gene expressed in human fibroblasts.

  20. Identification of a recent recombination event within the human beta-globin gene cluster.

    PubMed Central

    Gerhard, D S; Kidd, K K; Kidd, J R; Egeland, J A; Housman, D E

    1984-01-01

    In a detailed study of inheritance of DNA sequence polymorphism in a large reference pedigree, an individual was identified with an apparent genetic recombination event within the human beta-globin gene cluster. Analysis of the haplotypes of relevant individuals within this pedigree suggested that the meiotic crossing-over event is likely to have occurred within a 19.8-kilobase-pair region of the beta-globin gene cluster. Analysis of other DNA markers closely linked to the beta-globin gene cluster--segment 12 of chromosome 11 (D11S12) and loci for insulin, the cellular oncogene c-Ha-ras, and preproparathyroid hormone--confirmed that a crossover event must have occurred within the region of chromosome 11 between D11S12 and the beta-globin gene cluster. It is suggested that the event observed has occurred within a DNA region compatible with recombinational "hot spots" suggested by population studies. PMID:6096866

  1. HLA-DR, DQ and T cell antigen receptor constant beta genes in Japanese patients with ulcerative colitis.

    PubMed Central

    Kobayashi, K; Atoh, M; Konoeda, Y; Yagita, A; Inoko, H; Sekiguchi, S

    1990-01-01

    We studied the T cell antigen receptor (TcR) constant beta chain genes on HLA typed Japanese patients with ulcerative colitis (UC). A TcR constant beta EcoRI 6.0-kb fragment was present in all Japanese UC patients (n = 17) but completely absent in the controls (n = 35) (chi2 = 47.6, P less than 0.001). The frequency of HLA-DR2 antigen was significantly higher in UC patients (85% versus 28% in controls, P less than 0.001). Furthermore, HLA-DQw1 antigen was also increased in UC patients (96% versus 60% in controls, P less than 0.001). However, HLA-DR4 antigen was significantly decreased in UC patients (12% versus 37%, P = 0.02). HLA-DR1 antigen was not found in UC patients and was present in only 15% of the controls. These results suggest that TcR beta chain and HLA-DQw1 antigen may be important in the pathogenesis of Japanese UC. Images Fig. 1 PMID:1973647

  2. Induction of cytochrome P450IA1 gene expression in rat epidermis and human keratinocytes by. beta. -napthoflavone and benzanthracene

    SciTech Connect

    Khan, I.U.; Mukhtar, H.; Bickers, D.R.; Haqqi, T.M. )

    1991-03-15

    Cytochrome P450IA1 (P450IA1) plays a major role in the bioactivation of procarcinogens in various tissues including skin. However, factors controlling the expression of P450IA1 gene message in mammalian skin are unknown. In this study, the polymerase chain reaction (PCR) using specific primers was employed to study the expression of P450IA1 mRNA transcripts in rat epidermis and human keratinocytes (HK) treated with {beta}-napthoflavone ({beta}NF) and benzanthracene (BA). Total RNA was extracted from the epidermis of control and inducer-treated 4-day-old and adult Sprague Dawley rats, and from control and inducer-treated HL. cDNAs were synthesized using random primers and reverse transcriptase. PCR products were analyzed on agarose gel and quantitated by densitometry. Inducer treatment of rats and HK resulted in several-fold increases in aryl hydrocarbon hydroxylase (AHH) activity. The level of P450IA1 gene message increased 2-5-fold in treated animals as compared to controls; higher basal level and inducibility in adult than in 4-day-old rats. This induction occurred as early as 4 h after {beta}NF application, reached a maximum at 16 h and returned to basal levels by 36 h. Exposure to {beta}NF and BA resulted in 2-3-fold increase in gene message in HK. Northern blot analysis complemented PCR data. These results indicate that in mammalian skin P450IA1 gene expression is increased by the inducers of epidermal AHH activity.

  3. Association of beta 2 adrenoceptor gene polymorphisms in Malaysian hypertensive subjects.

    PubMed

    Komara, M; Vasudevan, R; Ismail, P; Bakar, S A; Pishva, S R; Heidari, F

    2014-04-16

    The sympathetic nervous system plays a major role in blood pressure regulation. Beta 2 (β2) adrenoceptor gene polymorphisms have been associated with hypertension in different populations with conflicting results. We examined the association of three common polymorphisms, Arg16Gly, Gln27Glu, and Thr164Ile, of the β2 adrenoceptor gene in Malaysian hypertensive subjects. A total of 160 hypertensive and control subjects were recruited. Systolic blood pressure (SBP), diastolic blood pressure (DBP), and anthropometric measurements were obtained from each subject. Biochemical analyses of lipid profiles were conducted with an autoanalyzer. DNA samples were extracted from blood and buccal cells. Genotyping was accomplished with polymerase chain reaction-restriction fragment length polymorphism. SBP, DBP, body mass index, and biochemical factors all differed significantly between case and control subjects (P < 0.05). The genotype frequencies of Arg16Arg, Arg16Gly, and Gly16Gly were 22.5, 70, and 7.5% among cases and 33.1, 63.1, and 3.8% among controls, respectively. The genotype frequencies of Gln27Gln, Gln27Glu, and Glu27Glu among cases were 41.1, 50, and 1.9% compared to 77.5, 20.6, and 1.9% among controls, respectively. In this study, the Gln27Glu polymorphism was significantly associated with Malaysian hypertensive subjects (P < 0.05). Therefore, the Gln27Glu polymorphism of the β2 adrenoceptor could be a risk factor associated with hypertension among Malaysians.

  4. Sugar-inducible expression of a gene for beta-amylase in Arabidopsis thaliana.

    PubMed Central

    Mita, S; Suzuki-Fujii, K; Nakamura, K

    1995-01-01

    The levels of beta-amylase activity and of the mRNA for beta-amylase in rosette leaves of Arabidopsis thaliana (L.) Heynh. increased significantly, with the concomitant accumulation of starch, when whole plants or excised mature leaves were supplied with sucrose. A supply of glucose or fructose, but not of mannitol or sorbitol, to plants also induced the expression of the gene for beta-amylase, and the induction occurred not only in rosette leaves but also in roots, stems, and bracts. These results suggest that the gene for beta-amylase of Arabidopsis is subject to regulation by a carbohydrate metabolic signal, and expression of the gene in various tissues may be regulated by the carbon partitioning and sink-source interactions in the whole plant. The sugar-inducible expression of the gene in Arabidopsis was severely repressed in the absence of light. The sugar-inducible expression in the light was not inhibited by 3(3,4-dichlorophenyl)-1,1-dimethylurea or by chloramphenicol, but it was inhibited by cycloheximide. These results suggest that a light-induced signal and de novo synthesis of proteins in the cytoplasm are involved in the regulation. A fusion gene composed of the 5' upstream region of the gene for beta-amylase from Arabidopsis and the coding sequence of beta-glucuronidase showed the sugar-inducible expression in a light-dependent manner in rosette leaves of transgenic Arabidopsis. PMID:7716246

  5. Localization of two potassium channel {beta} subunit genes, KCNA1B and KCNA2B

    SciTech Connect

    Schultz, D.; Smith, L.; Thayer, M.

    1996-02-01

    The gating properties and current amplitudes of mammalian voltage-activated Shaker potassium channels are modulated by at least two associated {beta} subunits (Kv{beta}1.1 and Kv{beta}1.2). The human Kv{beta}1.1 gene (KCNA1B) resides on chromosome 3, as indicated by somatic cell hybrid mapping. More precise localization of KCNA1B to 3q26.1 was obtained with fluorescence in situ hybridization (FISH) and was corroborated by PCR screening of the CEPH YAC library. The human Kv{beta}1.2 gene (KCNA2B) resides on chromosome 1, as indicated by somatic cell hybrid mapping, and has been localized by FISH to 1p36.3. 20 refs., 2 figs.

  6. Tyrosine dephosphorylation of nuclear proteins mimics transforming growth factor {beta}1 stimulation of {alpha}2(I) collagen gene expression

    SciTech Connect

    Greenwel, P.; Hu, Wei; Ramirez, F.; Kohanski, R.A.

    1995-12-01

    This report describes how the transforming growth factor {beta}1 (TGF-{beta}1) stimulates the transcription of the gene coding for collagen I (COL1A2). The report goes on to correlate tyrosine dephosphorylation, increased binding of a transcriptional complex and TGF-{beta}1 stimulation of gene expression. 33 refs., 8 figs., 1 tab.

  7. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene.

    PubMed

    Pruthviraj, D R; Usha, A P; Venkatachalapathy, R T

    2016-03-01

    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5'-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity. PMID:26950860

  8. The expression of pregnancy-specific {beta}1-glycoprotein genes in Meckel-Gruber syndrome fibroblasts

    SciTech Connect

    Wu, Shao-Ming; Cham, Wai-Yee

    1994-09-01

    Meckel-Gruber syndrome (MS) is an autosomal recessive disorder with multiple congenital malformations. The only available prenatal diagnostic marker for this disorder is the amniotic fluid level of pregnancy-specific {beta}1-glycoprotein (PSG). PSG is a family of proteins which are expressed at high levels during pregnancy. Increasing maternal serum PSG levels correlate with the progression of pregnancy and can be used as indicators for pregnancy outcome and fetal well-being. The amniotic fluid PSG level is about one-tenth of that of the maternal serum level in normal pregnancy, but are elevated in all cases of MS examined so far. On the other hand, the maternal serum PSG level and third trimester placental PSG content are normal in most cases of MS. This study aims at comparing the expression of PSG in fibroblasts derived from a fetus afflicted with MS. Total cellular RNA was extracted from two MS cultured fibroblast lines (M3206 and GM7817) and four age- and sex-matched control fibroblast lines obtained from the Human Genetic Mutant Cell Repository, Camden, NJ. The expression of eight PSG genes namely, PSG1, PSG2, PSG3, PSG4, PSG5, PSG6, PSG9 and PSG11, were examined with reverse transcription-polymerase chain reaction (RT-PCR). All PSG transcripts present in the cell were first amplified using universal primers in a 28-cycle PCR. Specific PSG gene products were then amplified with PSG gene-specific primers. Results showed that there is no significant difference in PSG expression between control and disease fibroblasts. In both cases, the most abundant transcript was the type II transcript of PSG5 followed by the type I transcripts of PSG1 and PG4. PSG9, PSG11 and PSG 3 were expressed at very low levels or not expressed at all in MS as well as in normal control fibroblasts. These results showed that PSG gene expression was not altered in MS fibroblasts.

  9. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene.

    PubMed

    Pruthviraj, D R; Usha, A P; Venkatachalapathy, R T

    2016-03-01

    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5'-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity.

  10. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene

    PubMed Central

    Pruthviraj, D. R.; Usha, A. P.; Venkatachalapathy, R. T.

    2016-01-01

    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5′-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity. PMID:26950860

  11. Differential expression of alpha- and beta-expansin genes in the elongating leaf of Festuca pratensis.

    PubMed

    Reidy, B; McQueen-Mason, S; Nösberger, J; Fleming, A

    2001-07-01

    Grasses contain a number of genes encoding both alpha- and beta-expansins. These cell wall proteins are predicted to play a role in cell wall modifications, particularly during tissue elongation. We report here on the characterisation of five alpha- and three vegetative beta-expansins expressed in the leaf elongation zone (LEZ) of the forage grass, Festuca pratensis Huds. The expression of the predominant alpha-expansin (FpExp2) was localised to the vascular tissue, as was the beta-expansin FpExpB3. Expression of another beta-expansin (FpExpB2) was not localised to vascular tissue but was highly expressed in roots and initiating tillers. This is the first description of vegetative beta-expansin gene expression at the organ and tissue level and also the first evidence of differential expression between members of this gene family. In addition, an analysis of both alpha- and beta-expansin expression along the LEZ revealed no correlation with growth rate distribution, whereas we were able to identify a novel xyloglucan endotransglycosylase (FpXET1) whose expression profile closely mimicked leaf growth rate. These data suggest that alpha- and beta-expansin activities in the grass leaf are associated with tissue differentiation, that expansins involved in leaf growth may represent more minor components of the spectrum of expansin genes expressed in this tissue, and that XETs may be useful markers for the analysis of grass leaf growth.

  12. A Drosophila gene encoding a protein resembling the human. beta. -amyloid protein precursor

    SciTech Connect

    Rosen, D.R.; Martin-Morris, L.; Luo, L.; White, K. )

    1989-04-01

    The authors have isolated genomic and cDNA clones for a Drosophila gene resembling the human {beta}-amyloid precursor protein (APP). This gene produces a nervous system-enriched 6.5-kilobase transcript. Sequencing of cDNAs derived from the 6.5-kilobase transcript predicts an 886-amino acid polypeptide. This polypeptide contains a putative transmembrane domain and exhibits strong sequence similarity to cytoplasmic and extracellular regions of the human {beta}-amyloid precursor protein. There is a high probability that this Drosophila gene corresponds to the essential Drosophila locus vnd, a gene required for embryonic nervous system development.

  13. The exon-intron organization of the human erythroid [beta]-spectrin gene

    SciTech Connect

    Amin, K.M.; Forget, B.G. ); Scarpa, A.L.; Curtis, P.J. ); Winkelmann, J.C. )

    1993-10-01

    The human erythrocyte [beta]-spectrin gene DNA has been cloned from overlapping human genomic phage and cosmid recombinants. The entire erythroid [beta]-spectrin mRNA is encoded by 32 exons that range in size from 49 to 871 bases. The exon/intron junctions have been identified and the exons mapped. There is no correlation between intron positions and the repeat units of 106 amino acids within domain II of the [beta]-spectrin gene. The scatter of the introns over the 17 repeats argues against the 106-amino-acid unit representing a minigene that underwent repeated duplication resulting in the present [beta]-spectrin gene. In fact, the two largest exons, exon 14 (871 bp) and 16 (757 bp), extend over 4 and 3 repeat units of 106 amino acids, respectively, while repeat [beta]10 is encoded by 4 exons. No single position of an intron in the [beta]-spectrin gene is conserved between any of the 17 [beta]-spectrin and 22 [alpha]-spectrin repeat units. The nucleotide sequences of the exon/intron boundaries conform to the consensus splice site sequences except for exon 20, whose 5[prime] donor splice-site sequence begins with GC. The [beta]-spectrin isoform present in the human brain, the skeletal muscle, and the cardiac muscle is an alternatively spliced product of the erythroid [beta]-spectrin gene. This splice site is located within the coding sequences of exon 32 and its utilization in nonerythroid tissues leads to the use of 4 additional downstream exons with a size range of 44 to 530 bp. 55 refs., 3 figs., 3 tabs.

  14. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls

    NASA Astrophysics Data System (ADS)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T. V.; Alyethodi, Rafeeque R.; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B.

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly ( P < 0.05) higher during the thermal stress. Pearson correlation coefficient analysis revealed that the expression of ATPase Β1, ATPase B2, and ATPase B3 is highly correlated ( P < 0.01) with HSP70, representing that the change in the expression pattern of these genes is positive and synergistic. These may provide a foundation for understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in cattle.

  15. Discovery of five conserved beta -defensin gene clusters using a computational search strategy.

    PubMed

    Schutte, Brian C; Mitros, Joseph P; Bartlett, Jennifer A; Walters, Jesse D; Jia, Hong Peng; Welsh, Michael J; Casavant, Thomas L; McCray, Paul B

    2002-02-19

    The innate immune system includes antimicrobial peptides that protect multicellular organisms from a diverse spectrum of microorganisms. beta-Defensins comprise one important family of mammalian antimicrobial peptides. The annotation of the human genome fails to reveal the expected diversity, and a recent query of the draft sequence with the blast search engine found only one new beta-defensin gene (DEFB3). To define better the beta-defensin gene family, we adopted a genomics approach that uses hmmer, a computational search tool based on hidden Markov models, in combination with blast. This strategy identified 28 new human and 43 new mouse beta-defensin genes in five syntenic chromosomal regions. Within each syntenic cluster, the gene sequences and organization were similar, suggesting each cluster pair arose from a common ancestor and was retained because of conserved functions. Preliminary analysis indicates that at least 26 of the predicted genes are transcribed. These results demonstrate the value of a genomewide search strategy to identify genes with conserved structural motifs. Discovery of these genes represents a new starting point for exploring the role of beta-defensins in innate immunity.

  16. Restricted TCR-alpha CDR3 diversity disadvantages natural regulatory T cell development in the B6.2.16 beta-chain transgenic mouse.

    PubMed

    Singh, Yogesh; Ferreira, Cristina; Chan, Andrew C Y; Dyson, Julian; Garden, Oliver A

    2010-09-15

    To date, analysis of mice expressing TCR-beta transgenes derived from CD4(+) T cell clones has demonstrated equivalent or higher TCR diversity in naturally occurring regulatory CD4(+) T cells (Tregs) versus conventional CD4(+) T cells (Tcons). However, TCR-alpha-chain diversity in these mice may be influenced by the inherent bias toward the CD4(+) lineage in the selected repertoires. We wished to determine whether the choice of TCR-beta-chain influences the relative diversity of the Treg and Tcon repertoires, examining as a model the B6.2.16beta-transgenic mouse, in which the fixed beta-chain is derived from a CD8(+) T cell clone. B6.2.16beta Treg thymocytes showed significantly lower TRAV17 (AV9) CDR3 sequence diversity than both syngeneic Tcon thymocytes, and Treg and Tcon thymocytes from wild-type C57BL/6 (B6) mice. The ratio of single-positive CD4(+)/single-positive CD8(+) thymocytes in B6.2.16beta mice was similar to that in B6, yet both the proportional frequency and absolute number of CD4(+)Foxp3(+) cells was significantly lower in the thymi and peripheral lymph nodes of B6.2.16beta mice. Furthermore, B6 + B6.2.16beta-->B6 mixed bone marrow chimeras revealed that the transgenic beta-chain disadvantaged Treg development in a competitive environment. These data underline the importance of the beta-chain in assessments of Treg alpha-chain diversity and provide further support for the notion that interclonal competition for entry into the Treg lineage is a significant factor in determining the composition of this lineage.

  17. Nonsense mutations in the human. beta. -globin gene affect mRNA metabolism

    SciTech Connect

    Baserga, S.J.; Benz, E.J. Jr. )

    1988-04-01

    A number of premature translation termination mutations (nonsense mutations) have been described in the human {alpha}- and {beta}-globin genes. Studies on mRNA isolated from patients with {beta}{sup 0}-thalassemia have shown that for both the {beta}-17 and the {beta}-39 mutations less than normal levels of {beta}-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human {beta}-globin mRNA). In vitro studies using the cloned {beta}-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human {beta}-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation.

  18. Interactions among the alpha2-, beta2-, and beta3-adrenergic receptor genes and obesity-related phenotypes in the Quebec Family Study.

    PubMed

    Ukkola, O; Rankinen, T; Weisnagel, S J; Sun, G; Pérusse, L; Chagnon, Y C; Després, J P; Bouchard, C

    2000-08-01

    The gene-gene interactions between markers in the alpha2-, beta2-, and beta3-adrenergic receptor (ADR) genes and obesity-related phenotypes were studied in the Quebec Family Study (QFS) cohort. The prevalence of the Arg allele of the Arg16Gly polymorphism in the beta2-ADR gene was higher (49%) in males with a body mass index (BMI) of 35 kg/m2 or higher versus those with a BMI less than 35 kg/m2 (33%; P = .010). The beta2-ADR gene Arg16Gly and Gln27Glu polymorphisms were associated with plasma total and low-density lipoprotein (LDL) cholesterol concentrations. In addition, the homozygotes for the 6.3-kb allele of DraI polymorphism in the alpha2-ADR gene had the lowest mean abdominal subcutaneous fat area (P = .012) and total fat area (P = .003), as well as insulin area, under the curve during an oral glucose tolerance test ([OGTT] P = .004). Several ADR gene-gene interaction effects on abdominal fat distribution and plasma lipids were detected. First, significant interactions between alpha2- and beta3-ADR genes were observed on total (P = .015) and subcutaneous (P = .004) abdominal fat. Second, interaction effects between alpha2- and beta2-ADR gene variants influenced total, high-density lipoprotein (HDL), and LDL cholesterol concentrations. Finally, there were interactions between markers within the beta2-ADR gene affecting plasma triglyceride concentrations and subcutaneous abdominal fat. From these results, we conclude that polymorphisms in the ADR genes contribute to body fat and plasma lipid variability in men. Gene-gene interactions among the ADR genes contribute to the phenotypic variability in abdominal obesity and plasma lipid and lipoprotein, but not in visceral fat levels.

  19. Unusual association of. beta. /sub 2/-microglobulin with certain class I heavy chains of the murine major histocompatibility complex

    SciTech Connect

    Bushkin, Y.; Tung, J.S.; Pinter, A.; Michaelson, J.; Boyse, E.A.

    1986-01-01

    Class I products of the major histocompatibility complex (MHC) comprise a heavy chain of about 45 kDa noncovalently linked to a 12-kDa ..beta../sub 2/-microglobulin (..beta../sub 2/m) light chain encoded on a different chromosome. The authors find that class I products of some mouse strains include an additional 62-kDa molecule which on the following evidence consists of a heavy chain linked covalently with ..beta../sub 2/m. Production of the 62-kDa protein invariably accorded with the occurrence of cysteine at position 121 of the heavy chain (K/sup b/, K/sup bm3/, D/sup d/, and L/sup d/). Substitution of arginine at position 121 invariably accorded with absence of the 62-kDa protein (K/sup bm6/, K/sup bm7/, K/sup bm9/, K/sup d/, and D/sup b/). On the basis of observed production versus nonproduction of the 62-kDa molecule, predictions are made regarding residue 121 in class I products for which this is not yet known; namely, K/sup k/, K/sup s/, and D/sup k/, which produce the 62-kDa molecule, as compared with K/sup j/, Qa-2, and TL, which do not. Reported differences in immunologic reactivity between K/sup b/ mutant strains with Arg-121 in place of Cys-121 imply that the occurrence of 62-kDa class I products in mice of Cys-121 genotype has functional consequences. Lymph node cells were labelled with (/sup 35/S)cysteine and Na/sup 125/I.

  20. Beta-cell gene expression and functional characterisation of the human insulinoma cell line CM.

    PubMed

    Baroni, M G; Cavallo, M G; Mark, M; Monetini, L; Stoehrer, B; Pozzilli, P

    1999-04-01

    Animal insulinoma cell lines are widely used to study physiological and pathophysiological mechanisms involved in glucose metabolism and to establish in vitro models for studies on beta-cells. In contrast, human insulinoma cell lines are rarely used because of difficulties in obtaining and culturing them for long periods. The aim of our study was to investigate, under different experimental conditions, the capacity of the human insulinoma cell line CM to retain beta-cell function, particularly the expression of constitutive beta-cell genes (insulin, the glucose transporters GLUT1 and GLUT2, glucokinase), intracellular and secreted insulin, beta-cell granules, and cAMP content. Results showed that CM cells from an early-passage express specific beta-cell genes in response to glucose stimulation, in particular the insulin and GLUT genes. Such capacity is lost at later passages when cells are cultured at standard glucose concentrations. However, if cultured at lower glucose concentration (0.8 mM) for a longer time, CM cells re-acquire the capacity to respond to glucose stimulation, as shown by the increased expression of beta-cell genes (insulin, GLUT2, glucokinase). Nonetheless, insulin secretion could not be restored under such experimental conditions despite the presence of intracellular insulin, although cAMP response to a potent activator of adenylate cyclase, forskolin, was present indicating a viable system. In conclusion, these data show that the human insulinoma cell line CM, at both early-passage and late-passage, posseses a functional glucose-signalling pathway and insulin mRNA expression similar to normal beta-cells, representing, therefore, a good model for studies concerning the signalling and expression of beta-cells. Furthermore, we have previously shown that it is also a good model for immunological studies. In this respect it is important to note that the CM cell line is one of the very few existing human beta-cell lines in long-term culture.

  1. The lysine residue in the membrane-spanning domain of the beta chain is necessary for cell surface expression of the T cell antigen receptor

    PubMed Central

    1988-01-01

    The TCR is a complex receptor composed of seven polypeptide chains consisting of a ligand-binding subunit, Ti, and a putative signal- transducing subunit, CD3. Phylogenetically conserved charged amino acid residues within the membrane-spanning domains present in all seven chains of the TCR have been proposed to be important in the association between Ti and CD3. Using a Ti beta chain-deficient mutant of the cell line Jurkat, site-directed mutagenesis and transfection of Ti beta chain cDNA was performed to assess the importance of the lysine residue at position 290 within the membrane-spanning domain of the Ti beta chain to expression of the TCR complex. These studies demonstrated that the lysine residue, and not simply conservation of either basic charge or secondary structure, is important at this position. PMID:2974063

  2. Divergence of human [alpha]-chain constant region gene sequences: A novel recombinant [alpha]2 gene

    SciTech Connect

    Chintalacharuvu, K. R.; Morrison, S.L. ); Raines, M. )

    1994-06-01

    IgA is the major Ig synthesized in humans and provides the first line of defense at the mucosal surfaces. The constant region of IgA heavy chain is encoded by the [alpha] gene on chromosome 14. Previous studies have indicated the presence of two [alpha] genes, [alpha]1 and [alpha]2 existing in two allotypic forms, [alpha]2 m(1) and [alpha]2 m(2). Here the authors report the cloning and complete nucleotide sequence determination of a novel human [alpha] gene. Nucleotide sequence comparison with the published [alpha] sequences suggests that the gene arose as a consequence of recombination or gene conversion between the two [alpha]2 alleles. The authors have expressed the gene as a chimeric protein in myeloma cells indicating that it encodes a functional protein. The novel IgA resembles IgA2 m(2) in that disulfide bonds link H and L chains. This novel recombinant gene provides insights into the mechanisms of generation of different constant regions and suggests that within human populations, multiple alleles of [alpha] may be present providing IgAs of different structures.

  3. Volvox carteri alpha 2- and beta 2-tubulin-encoding genes: regulatory signals and transcription.

    PubMed

    Mages, W; Cresnar, B; Harper, J F; Brüderlein, M; Schmitt, R

    1995-07-01

    Microtubules (MT) carry out several specialized morphogenetic functions in the multicellular green alga Volvox carteri (Vc), in addition to functions also executed in its closest unicellular relative, Chlamydomonas reinhardtii (Cr). To find out if these differences in morphogenetic complexity are reflected in tubulin (Tub) differences, we have compared the Vc alpha tub and beta tub genes with their Cr counterparts. The Vc genome contains two alpha tub and two beta tub genes. We report here the sequences of the alpha 2tub and beta 2tub genes, and thus complete the set of four tub sequences. The two alpha tub and two beta tub genes code for identical 451 (alpha) and 443 (beta) amino acid (aa) polypeptides; they differ from the Cr homologs in two (alpha) and one (beta) residues, respectively. Silent nucleotide (nt) exchanges between sibling genes are much more frequent in Vc than in Cr (12 vs. 2%), probably owing to a more stringent codon bias in the latter alga. Transcription of alpha 2tub and beta 2tub starts with an A, 26 bp (alpha 2) or 25 bp (beta 2) downstream from the TATA box. A 16-bp promoter element upstream and a G + C-rich sequence downstream from the TATA box are conserved in all tub of both species. Moreover, a 28-bp element of conserved sequence, and hence of possible functional significance, was found at similar locations in the 5' untranslated region (UTR) of all four alpha tub. A conserved TGTAA downstream from the translation stop codon represents the algal poly(A)-addition signal (in both Vc and Cr).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7628715

  4. Characterization of a psychrotrophic Arthrobacter gene and its cold-active beta-galactosidase.

    PubMed Central

    Trimbur, D E; Gutshall, K R; Prema, P; Brenchley, J E

    1994-01-01

    Enzymes with high specific activities at low temperatures have potential uses for chemical conversions when low temperatures are required, as in the food industry. Psychrotrophic microorganisms which grow at low temperatures may be a valuable source of cold-active enzymes that have higher activities at low temperatures than enzymes found for mesophilic microorganisms. To find cold-active beta-galactosidases, we isolated and characterized several psychrotrophic microorganisms. One isolate, B7, is an Arthrobacter strain which produces beta-galactosidase when grown in lactose minimal media. Extracts have a specific activity at 30 degrees C of 2 U/mg with o-nitrophenyl-beta-D-galactopyranoside as a substrate. Two isozymes were detected when extracts were subjected to electrophoresis in a nondenaturing polyacrylamide gel and stained for activity with 5-bromo-4-chloro-indolyl-beta-D-galactopyranoside (X-Gal). When chromosomal DNA was prepared and transformed into Escherichia coli, three different genes encoding beta-galactosidase activity were obtained. We have subcloned and sequenced one of these beta-galactosidase genes from the Arthrobacter isolate B7. On the basis of amino acid sequence alignment, the gene was found to have probable catalytic sites homologous to those from the E. coli lacZ gene. The gene encoded a protein of 1,016 amino acids with a predicted molecular mass of 111 kDa. The enzyme was purified and characterized. The beta-galactosidase from isolate B7 has kinetic properties similar to those of the E. coli lacZ beta-galactosidase but has a temperature optimum 20 degrees C lower than that of the E. coli enzyme. Images PMID:7811090

  5. Regulation of. beta. -cell glucose transporter gene expression

    SciTech Connect

    Chen, Ling; Alam, Tausif; Johnson, J.H.; Unger, R.H. Department of Veterans Affairs Medical Center, Dallas, TX ); Hughes, S.; Newgard, C.B. )

    1990-06-01

    It has been postulated that a glucose transporter of {beta} cells (GLUT-2) may be important in glucose-stimulated insulin secretion. To determine whether this transporter is constitutively expressed or regulated, the authors subjected conscious unrestrained Wistar rats to perturbations in glucose homeostasis and quantitated {beta}-cell GLUT-2 mRNA by in situ hybridization. After 3 hr of hypoglycemia, GLUT-2 and proinsulin mRNA signal densities were reduced by 25% of the level in control rats. After 4 days, GLUT-2 and proinsulin mRNA densities were reduced by 85% and 65%, respectively. After 12 days of hypoglycemia, the K{sub m} for 3-O-methyl-D-glucose transport in isolated rat islets, normally 18-20 mM, was 2.5 mM. This provides functional evidence of a profound reduction of high K{sub m} glucose transporter in {beta} cells. In contrast, GLUT-2 was only slightly reduced by hypoglycemia in liver. To determine the effect of prolonged hyperglycemia, they also infused animals with 50% (wt/vol) glucose for 5 days. Hyperglycemic clamping increased GLUT-2 mRNA by 46% whereas proinsulin mRNA doubled. They conclude that GLUT-2 expression in {beta} cells, but not liver, is subject to regulation by certain perturbations in blood glucose homeostasis.

  6. The C-terminus of the {gamma}2 chain but not of the {beta}3 chain of laminin-332 is indirectly but indispensably necessary for integrin-mediated cell reactions

    SciTech Connect

    Navdaev, Alexei; Heitmann, Vanessa; Santana Evangelista, Karla de; Moergelin, Matthias; Wegener, Joachim; Eble, Johannes A.

    2008-02-01

    Using a recombinant mini-laminin-332, we showed that truncation of the three C-terminal amino acids of the {gamma}2 chain, but not of the C-terminal amino acid of the {beta}3 chain, completely abolished {alpha}3{beta}1 integrin binding and its cellular functions, such as attachment and spreading. However, a synthetic peptide mimicking the {gamma}2 chain C-terminus did not interfere with {alpha}3{beta}1 integrin binding or cell adhesion and spreading on laminin-332 as measured by protein interaction assays and electric cell-substrate impedance sensing. Nor was the soluble peptide able to restore the loss of integrin-mediated cell adhesiveness to mini-laminin-332 after deletion of the {gamma}2 chain C-terminus. These findings spoke against the hypothesis that the {gamma}2 chain C-terminus of laminin-332 is a part of the {alpha}3{beta}1 integrin interaction site. In addition, structural studies with electron microscopy showed that truncation of the {gamma}2 chain C-terminus opened up the compact supradomain structure of LG1-3 domains. Thus, by inducing or stabilizing an integrin binding-competent conformation or array of the LG1-3 domains, the {gamma}2 chain C-terminus plays an indirect but essential role in laminin-332 recognition by {alpha}3{beta}1 integrin and, hence, its cellular functions.

  7. Identification of monoclonal antibodies with specificity to alpha- or beta-chains of beta 2-integrins using peripheral blood leucocytes of normal and bovine leucocyte adhesion deficient (BLAD) cattle.

    PubMed

    Rutten, V P; Hoek, A; Müller, K E

    1996-08-01

    The reactivity of monoclonal antibodies entered in the panels of the Third Workshop on Ruminant Leucocyte Antigens with lymphocytes and monocytes of normal and beta 2-integrin deficient (Bovine Leucocyte Adhesion Deficiency: BLAD) animals was determined by flow cytometry to investigate potential specificities to alpha- or beta-chains of beta 2-integrins. From the 13 monoclonal antibodies that were entered as having specificity for CD11/CD18 antigens, ten were confirmed correct, but three had reactivity with cells from BLAD animals. We conclude that our approach provides an easy way to reliably identify the majority of beta 2-integrin specific monoclonal antibodies. PMID:8896223

  8. Alternative splicing of HLA-DQB transcripts and secretion of HLA-DQ beta-chain proteins: allelic polymorphism in splicing and polyadenylylation sites.

    PubMed Central

    Briata, P; Radka, S F; Sartoris, S; Lee, J S

    1989-01-01

    HLA class II antigens are highly polymorphic cell-surface proteins involved in initiation and regulation of the immune response. Allelic sequence variation primarily affects the structure of the first external domains of alpha and beta component chains. Here we provide evidence for other types of allelic polymorphism for the genes encoding these chains. Sequences of two cDNA clones corresponding to HLA-DQB mRNAs from an HLA-homozygous cell line exhibit both alternative splicing and read-through of polyadenylylation. Furthermore, alternative splicing that deletes the transmembrane exon is associated with only a subset of HLA-DQB alleles, while the polyadenylylation-site read-through is found in a larger subset. This suggest that polymorphic cis-acting elements within the HLA-DQB gene control both processing steps. Proteins, presumably encoded by alternatively spliced mRNAs lacking transmembrane exons, are immunoprecipitated with a monomorphic monoclonal antibody directed against HLA-DQ. These proteins are found in supernatants of cultured cell lines for which secretion is predicted, but not in those of cell lines that do not contain alternatively spliced mRNAs. Images PMID:2464826

  9. Yeast KRE genes provide evidence for a pathway of cell wall beta-glucan assembly

    PubMed Central

    1990-01-01

    The Saccharomyces cerevisiae KRE1 gene encodes a Ser/Thr-rich protein, that is directed into the yeast secretory pathway, where it is highly modified, probably through addition of O-linked mannose residues. Gene disruption of the KRE1 locus leads to a 40% reduced level of cell wall (1----6)-beta-glucan. Structural analysis of the (1----6)-beta-glucan fraction, isolated from a strain with a krel disruption mutation, showed that it had an altered structure with a smaller average polymer size. Mutations in two other loci, KRE5 and KRE6 also lead to a defect in cell wall (1----6)-beta-glucan production and appear to be epistatic to KRE1. These findings outline a possible pathway of assembly of yeast cell wall (1----6)-beta-glucan. PMID:2186051

  10. Polymorphism in the beta chain of IAq versus IAp influences presentation of protein but not peptide antigens.

    PubMed

    Lambert, L E; Berling, J S; Thompson, S D; Harton, J A; Bishop, G A; Choi, E

    1995-10-15

    T cells play a critical role in the development of collagen-induced arthritis (CIA). Immunization with heterologous (chick) type II collagen (cII) results in chronic inflammation with progressive damage to the joints. The expression of specific MHC Class II alpha beta dimers, including IAq, is critical to induction of disease. The alpha chains of IAq and IAp are identical in sequence. The IAq and IAp beta chains differ by only four amino acid residues: 85, 86, 88, and 89. However, mice of the H-2p haplotype are not susceptible to CIA. To examine the impact of these structural differences in IA molecules on T cell Ag recognition, we studied presentation of cII peptides and denatured cII by APCs obtained from H-2q and H-2p mice. We also assessed presentation of ovalbumin, myelin basic protein (MBP), and MBP peptides by these APC populations. H-2q APCs presented both peptides and proteins to our T cell hybrids. In contrast, APCs obtained from H-2p mice presented peptides, but were defective in the processing and/or presentation of protein Ags. We then altered pairs of the residues in IAq to those found in IAp using site-directed mutagenesis and transfected these constructs into M 12.C3 B cells. All transfectants were able to present peptides, but those expressing IAp were unable to present protein Ags. The use of transfectants expressing hybrid molecules (residues 85 and 86 from IAp, 88 and 89 from IAq, or vice versa) allowed us to localize the region responsible for this defect to residues 85 and 86 of the beta chain. The presence of IAp residues (glu and thr versus gly and val in IAq) at these sites severely compromised the capacity for protein presentation. Resistance to CIA in H-2p haplotype mice may be a reflection of the limited repertoire of epitopes to which these mice can respond relative to susceptible H-2q mice.

  11. Targeting exogenous GDNF gene to the bovine somatic cell beta-casein locus for the production of transgenic bovine animals.

    PubMed

    Zhang, X M; Luo, F H; Ding, H M; Li, B; Zhang, J J; Wu, Y J

    2015-11-25

    Considerable attention is currently being directed toward methods for producing recombinant human proteins in the mammary glands of genetically modified transgenic livestock. However, the expression of inserted genes in transgenic animals is variable and often very low because of the randomness of the site of transgene integration. One possible strategy to avoid the expression problem associated with random integration is to use site-specific integration by targeting integration to a high expression locus and, thereby, to improve expression of the transferred gene. In the present study, we focused on glial cell line-derived neurotrophic factor (GDNF), a novel type of neurotrophic factor first cloned in 1993. Research has shown that GDNF may have potential applications in the treatment of Parkinson's disease and other diseases of the central nervous system since it acts as a protective factor for central dopaminergic neurons. Here, we constructed a gene targeting vector to knock-in the human GDNF gene at the bovine beta-casein gene locus as a first step to producing transgenic animals with a high level of expression of human GDNF protein in their mammary glands. Bovine fetal fibroblast cells were transfected with linearized pNRTCNbG by electroporation. Three cell clones were identified with successful targeting to the beta-casein locus; and were confirmed using both polymerase chain reaction analysis and sequencing. Gene-targeted cells were used as nuclear donors; a total of 161 embryos were reconstructed, 23 of which developed to the blastocyst stage. These blastocysts were transferred to 8 recipient cows, but no offspring were obtained.

  12. Targeting exogenous GDNF gene to the bovine somatic cell beta-casein locus for the production of transgenic bovine animals.

    PubMed

    Zhang, X M; Luo, F H; Ding, H M; Li, B; Zhang, J J; Wu, Y J

    2015-01-01

    Considerable attention is currently being directed toward methods for producing recombinant human proteins in the mammary glands of genetically modified transgenic livestock. However, the expression of inserted genes in transgenic animals is variable and often very low because of the randomness of the site of transgene integration. One possible strategy to avoid the expression problem associated with random integration is to use site-specific integration by targeting integration to a high expression locus and, thereby, to improve expression of the transferred gene. In the present study, we focused on glial cell line-derived neurotrophic factor (GDNF), a novel type of neurotrophic factor first cloned in 1993. Research has shown that GDNF may have potential applications in the treatment of Parkinson's disease and other diseases of the central nervous system since it acts as a protective factor for central dopaminergic neurons. Here, we constructed a gene targeting vector to knock-in the human GDNF gene at the bovine beta-casein gene locus as a first step to producing transgenic animals with a high level of expression of human GDNF protein in their mammary glands. Bovine fetal fibroblast cells were transfected with linearized pNRTCNbG by electroporation. Three cell clones were identified with successful targeting to the beta-casein locus; and were confirmed using both polymerase chain reaction analysis and sequencing. Gene-targeted cells were used as nuclear donors; a total of 161 embryos were reconstructed, 23 of which developed to the blastocyst stage. These blastocysts were transferred to 8 recipient cows, but no offspring were obtained. PMID:26634460

  13. Identification and molecular characterization of four new large deletions in the beta-globin gene cluster.

    PubMed

    Joly, Philippe; Lacan, Philippe; Garcia, Caroline; Couprie, Nicole; Francina, Alain

    2009-01-01

    Despite the fact that mutations in the human beta-globin gene cluster are essentially point mutations, a significant number of large deletions have also been described. We present here four new large deletions in the beta-globin gene cluster that have been identified on patients displaying an atypical hemoglobin phenotype (high HbF) at routine analysis. The first deletion, which spreads over 2.0 kb, removes the entire beta-globin gene, including its promoter, and is associated with a typical beta-thal minor phenotype. The three other deletions are larger (19.7 to 23.9 kb) and remove both the delta and beta-globin genes. Phenotypically, they look like an HPFH-deletion as they are associated with normal hematological parameters. The precise localization of their 5' and 3' breakpoints gives new insights about the differences between HPFH and (deltabeta)(0)-thalassemia at the molecular level. The importance of detection of these deletions in prenatal diagnosis and newborn screening of hemoglobinopathies is also discussed.

  14. A mutation of the beta-globin gene initiation codon, ATG-->AAG, found in a French Caucasian man.

    PubMed

    Lacan, Philippe; Aubry, Martine; Couprie, Nicole; Francina, Alain

    2005-01-01

    A new mutation of the beta-globin gene initiation codon, ATG-->AAG (Met-->Tyr), is reported in a man originating from the southeast of France. Typical hematological findings of beta-thalassemia (thal) trait were found. We emphasize the importance of characterizing uncommon beta-thal mutations for genetic counseling.

  15. Neofunctionalization of Chromoplast Specific Lycopene Beta Cyclase Gene (CYC-B) in Tomato Clade

    PubMed Central

    Mohan, Vijee; Pandey, Arun; Sreelakshmi, Yellamaraju; Sharma, Rameshwar

    2016-01-01

    The ancestor of tomato underwent whole genome triplication ca. 71 Myr ago followed by widespread gene loss. However, few of the triplicated genes are retained in modern day tomato including lycopene beta cyclase that mediates conversion of lycopene to β-carotene. The fruit specific β-carotene formation is mediated by a chromoplast-specific paralog of lycopene beta cyclase (CYC-B) gene. Presently limited information is available about how the variations in CYC-B gene contributed to its neofunctionalization. CYC-B gene in tomato clade contained several SNPs and In-Dels in the coding sequence (33 haplotypes) and promoter region (44 haplotypes). The CYC-B gene coding sequence in tomato appeared to undergo purifying selection. The transit peptide sequence of CYC-B protein was predicted to have a stronger plastid targeting signal than its chloroplast specific paralog indicating a possible neofunctionalization. In promoter of two Bog (Beta old gold) mutants, a NUPT (nuclear plastid) DNA fragment of 256 bp, likely derived from a S. chilense accession, was present. In transient expression assay, this promoter was more efficient than the “Beta type” promoter. CARGATCONSENSUS box sequences are required for the binding of the MADS-box regulatory protein RIPENING INHIBITOR (RIN). The loss of CARGATCONSENSUS box sequence from CYC-B promoter in tomato may be related to attenuation of its efficiency to promote higher accumulation of β-carotene than lycopene during fruit ripening. PMID:27070417

  16. Neofunctionalization of Chromoplast Specific Lycopene Beta Cyclase Gene (CYC-B) in Tomato Clade.

    PubMed

    Mohan, Vijee; Pandey, Arun; Sreelakshmi, Yellamaraju; Sharma, Rameshwar

    2016-01-01

    The ancestor of tomato underwent whole genome triplication ca. 71 Myr ago followed by widespread gene loss. However, few of the triplicated genes are retained in modern day tomato including lycopene beta cyclase that mediates conversion of lycopene to β-carotene. The fruit specific β-carotene formation is mediated by a chromoplast-specific paralog of lycopene beta cyclase (CYC-B) gene. Presently limited information is available about how the variations in CYC-B gene contributed to its neofunctionalization. CYC-B gene in tomato clade contained several SNPs and In-Dels in the coding sequence (33 haplotypes) and promoter region (44 haplotypes). The CYC-B gene coding sequence in tomato appeared to undergo purifying selection. The transit peptide sequence of CYC-B protein was predicted to have a stronger plastid targeting signal than its chloroplast specific paralog indicating a possible neofunctionalization. In promoter of two Bog (Beta old gold) mutants, a NUPT (nuclear plastid) DNA fragment of 256 bp, likely derived from a S. chilense accession, was present. In transient expression assay, this promoter was more efficient than the "Beta type" promoter. CARGATCONSENSUS box sequences are required for the binding of the MADS-box regulatory protein RIPENING INHIBITOR (RIN). The loss of CARGATCONSENSUS box sequence from CYC-B promoter in tomato may be related to attenuation of its efficiency to promote higher accumulation of β-carotene than lycopene during fruit ripening.

  17. Neofunctionalization of Chromoplast Specific Lycopene Beta Cyclase Gene (CYC-B) in Tomato Clade.

    PubMed

    Mohan, Vijee; Pandey, Arun; Sreelakshmi, Yellamaraju; Sharma, Rameshwar

    2016-01-01

    The ancestor of tomato underwent whole genome triplication ca. 71 Myr ago followed by widespread gene loss. However, few of the triplicated genes are retained in modern day tomato including lycopene beta cyclase that mediates conversion of lycopene to β-carotene. The fruit specific β-carotene formation is mediated by a chromoplast-specific paralog of lycopene beta cyclase (CYC-B) gene. Presently limited information is available about how the variations in CYC-B gene contributed to its neofunctionalization. CYC-B gene in tomato clade contained several SNPs and In-Dels in the coding sequence (33 haplotypes) and promoter region (44 haplotypes). The CYC-B gene coding sequence in tomato appeared to undergo purifying selection. The transit peptide sequence of CYC-B protein was predicted to have a stronger plastid targeting signal than its chloroplast specific paralog indicating a possible neofunctionalization. In promoter of two Bog (Beta old gold) mutants, a NUPT (nuclear plastid) DNA fragment of 256 bp, likely derived from a S. chilense accession, was present. In transient expression assay, this promoter was more efficient than the "Beta type" promoter. CARGATCONSENSUS box sequences are required for the binding of the MADS-box regulatory protein RIPENING INHIBITOR (RIN). The loss of CARGATCONSENSUS box sequence from CYC-B promoter in tomato may be related to attenuation of its efficiency to promote higher accumulation of β-carotene than lycopene during fruit ripening. PMID:27070417

  18. Sequence heterogeneity, multiplicity, and genomic organization of. cap alpha. - and. beta. -tubulin genes in Sea Urchins

    SciTech Connect

    Alexandraki, D.; Ruderman, J.V.

    1981-12-01

    The authors analyzed the multiplicity, heterogeneity, and organization of the genes encoding the ..cap alpha.. and ..beta.. tubulins in the sea urchin Lytechinus pictus by using cloned complementary deoxyribonucleic acid (cDNA) and genomic tubulin sequences. cDNA clones were constructed by using immature spermatogenic testis polyadenylic acid-containing ribonucleic acid as a template. ..cap alpha.. and ..beta..-tubulin clones were identified by hybrid selection and in vitro translation of the corresponding messenger ribonucleic acids, followed by immunoprecipitation and two-dimensional gel electrophoresis of the translation products. The ..cap alpha.. cDNA clone contains a sequence that encodes the 48 C-terminal amino acids of ..cap alpha.. tubulin and 104 base pairs of the 3' nontranslated portion of the messenger ribonucleic acid. The ..beta.. cDNA insertion contains the coding sequence for the 100 C-terminal amino acids of ..beta.. tubulin and 83 base pairs of the 3' noncoding sequence. Hybrid selections performed at different criteria demonstrated the presence of several heterogeneous, closely related tubulin messenger ribonucleic acids, suggesting the existence of heterogeneous ..cap alpha..- and ..beta..-tubulin genes. Hybridization analyses indicated that there are at least 9 to 13 sequences for each of the two tubulin gene families per haploid genome. Hybridization of the cDNA probes to both total genomic DNA and cloned germline DNA fragments gave no evidence for close physical linkage of ..cap alpha..-tubulin genes with ..beta..-tubulin genes at the DNA level. In contrast, these experiments indicated that some genes within the same family are clustered.

  19. Intestinal alpha beta T cells differentiate and rearrange antigen receptor genes in situ in the human infant.

    PubMed

    Williams, Amanda M; Bland, Paul W; Phillips, Anne C; Turner, Susan; Brooklyn, Trevor; Shaya, Gabriel; Spicer, Richard D; Probert, Christopher S J

    2004-12-15

    Intestinal Ag exposure during neonatal life influences appropriate adult immune responses. To define the mechanisms shaping the T cell repertoire during this period, we examined T cell differentiation and receptor diversity in the intestine of human infants. Developmental phenotypes of intraepithelial and lamina propria intestinal T cells from infants aged 1 day to 2 years were assessed ex vivo by flow cytometry and in situ by triple-fluorescent immunohistochemistry. Gene recombination-specific enzymes were assessed by PCR. TCR beta-chain V region gene diversity was determined by sequencing. Several different early lineage T cell populations were present neonatally: CD3(+)4(-)8(-) T cells were present at birth and numbers decreased during the neonatal period; CD3(+)4(+)8(+) T cells were present in low numbers throughout infancy; and CD3(+)4(+)8(-) or CD3(+)4(-)8(+) T cells increased with age. Very early lineage T cells, CD3(-)2(-)7(+) and CD3(-)2(+)7(+), were present neonatally, but were essentially absent at 1 year. Most lamina propria T cells differentiated rapidly after birth, but maturation of intraepithelial T cells took place over 1 year. Intestinal samples from infants less than 6 mo old contained transcripts of T early alpha and TdT, and 15 of 19 infant samples contained mRNA for RAG-1, some coexpressing RAG-2. TCR beta-chain repertoires were polyclonal in infants. Immature T cells, pre-T cells, and genes involved in T cell recombination were found in the intestine during infancy. T cell differentiation occurs within the neonatal human intestine, and the TCR repertoire of these developing immature T cells is likely to be influenced by luminal Ags. Thus, mucosal T cell responsiveness to environmental Ag is shaped in situ during early life.

  20. Evolution and molecular characterization of a beta-globin gene from the Australian Echidna Tachyglossus aculeatus (Monotremata).

    PubMed

    Lee, M H; Shroff, R; Cooper, S J; Hope, R

    1999-07-01

    Coinciding with a period in evolution when monotremes, marsupials, and eutherians diverged from a common ancestor, a proto-beta-globin gene duplicated, producing the progenitors of mammalian embryonic and adult beta-like globin genes. To determine whether monotremes contain orthologues of these genes and to further investigate the evolutionary relationships of monotremes, marsupials, and eutherians, we have determined the complete DNA sequence of an echidna (Tachyglossus aculeatus) beta-like globin gene. Conceptual translation of the gene and sequence comparisons with eutherian and marsupial beta-like globin genes and echidna adult beta-globin indicate that the gene is adult expressed. Phylogenetic analyses do not clearly resolve the branching pattern of mammalian beta-like globin gene lineages and it is therefore uncertain whether monotremes have orthologues of the embryonic beta-like globin genes of marsupials and eutherians. Four models are proposed that provide a framework for interpreting further studies on the evolution of beta-like globin genes in the context of the evolution of monotremes, marsupials, and eutherians.

  1. Use of polymerase chain reaction in the quantitation of mdr-1 gene expression

    SciTech Connect

    Murphy, L.D.; Herzog, C.E.; Rudick, J.B.; Fojo, A.T.; Bates, S.E. )

    1990-11-01

    The ability of the polymerase chain reaction (PCR) to quantitate expression of mRNA was examined in the present study. The model chosen was expression of the multidrug resistance gene mdr-1/Pgp in two colon carcinoma cell lines which express mdr-1/Pgp at levels comparable to those found in many clinical samples. PCR was utilized to evaluate differences in mdr-1/Pgp expression in the two cell lines after modulation by sodium butyrate. Thus, comparisons were made across a range of mdr-1/Pgp expression as well as comparisons of small differences. The PCR was found to be both sensitive and quantitative. Accurate quantitation requires demonstration of an exponential range which varies among samples. The exponential range can be determined by carrying out the PCR for a fixed number of cycles on serial dilutions of the RNA reverse transcription product, or by performing the reaction with a varying number of cycles on a fixed quantity of cDNA. By quantitation of the difference in PCR product derived from a given amount of RNA from the sodium butyrate treated and untreated cells, the difference in mRNA expression between samples can be determined. Normalization of the results can be achieved by independent amplification of a control gene, such as {beta}{sub 2}-microglobulin, when the latter is also evaluated in the exponential range. Simultaneous amplification of the control and target genes results in lower levels of PCR products due to competition, which varies from sample to sample. The PCR is thus a labor-intensive but sensitive method of quantitating gene expression in small samples of RNA.

  2. Transposition of the carbenicillin-hydrolyzing beta-lactamase gene.

    PubMed Central

    Katsu, K; Inoue, M; Mitsuhashi, S

    1982-01-01

    We isolated a new transposon Tn2101, from plasmid Rms433 in Enterobacter cloacae. Tn2101 encoded the formation of type IV (carbenicillin-hydrolyzing) beta-lactamase and multiple resistance to streptomycin, sulfanilamide, spectinomycin, and mercury in addition to ampicillin. Tn2101 was transposable between conjugative (or nonconjugative) plasmids and the host chromosome. Transposition occurred independently of the general recombination ability of the host cell. Tn2101 had a molecular size of 9.5 x 10(6) and contained short inverted repeat terminal sequences. Images PMID:6279559

  3. Alpha beta T-cell development is not affected by inversion of TCR beta gene enhancer sequences: polar enhancement of gene expression regardless of enhancer orientation.

    PubMed

    Huang, Fang; Cabaud, Olivier; Verthuy, Christophe; Hueber, Anne-Odile; Ferrier, Pierre

    2003-08-01

    V(D)J recombination and expression of the T-cell receptor beta (TCRbeta) gene are required for the development of the alphabeta T lymphocyte lineage. These processes depend on a transcriptional enhancer (Ebeta) which acts preferentially on adjacent upstream sequences, and has little impact on the 5' distal and 3' proximal regions of the TCRbeta locus. Using knock-in mice, we show that alphabeta T-cell differentiation and TCRbeta gene recombination and expression are not sensitive to the orientation of Ebeta sequences. We discuss the implication of these results regarding the mode of enhancer function at this locus during T lymphocyte development.

  4. Analysis of T cell receptor beta chain CDR3 size using RNA extracted from formalin fixed paraffin wax embedded tissue.

    PubMed Central

    O'Shea, U; Wyatt, J I; Howdle, P D

    1997-01-01

    AIMS: To isolate RNA and DNA simultaneously from formalin fixed paraffin wax embedded tissue to assess the clonality of enteropathy associated T cell lymphomas and to analyse it in detail by a non-radioactive method of T cell receptor complementarity determining region 3 (CDR3) spectratyping. METHODS: DNA and RNA were isolated simultaneously from formalin fixed paraffin wax embedded tissue blocks and subjected to the polymerase chain reaction (PCR) and semi-nested reverse transcription PCR (RT-PCR), respectively. The RT-PCR T cell receptor V beta products were analysed by CDR3 spectratyping using a denaturing polyacrylamide gel and silver staining. RESULTS: Usable DNA and RNA were isolated simultaneously from formalin fixed paraffin wax embedded tissue. The specific clonality of the tissue was successfully analysed by a non-radioactive method of T cell receptor CDR3 spectratyping of the RT-PCR products. CDR3 spectratying of the RT-PCR products demonstrated the precise clonal nature of the tumour and non-tumour tissue showing that the non-tumour tissue comprised an oligoclonal population of a number of different T cell receptor V beta families. The tumour tissue comprised two T cell subtypes of the one family, T cell receptor V beta 9. CONCLUSIONS: RNA and DNA were isolated from formalin fixed paraffin wax embedded enteropathy associated T cell lymphoma tissue. Detailed analysis of clonality can be carried out by a non-radioactive method of CDR3 spectratyping. Images PMID:9462260

  5. Interleukin 2 receptor beta chain expressed in an oligodendroglioma line binds interleukin 2 and delivers growth signal.

    PubMed Central

    Okamoto, Y; Minamoto, S; Shimizu, K; Mogami, H; Taniguchi, T

    1990-01-01

    Interleukin 2 (IL-2) is a potent growth factor for T lymphocytes, playing a crucial role in the immune response. In view of the considerable evidence that the immunoregulatory cytokines (or lymphokines) also play a role in the growth and differentiation of cells in the central nervous system (CNS), we examined the operation of the IL-2 system in a cell line of CNS origin by expressing a cDNA encoding the beta chain of the human IL-2 receptor (IL-2R beta, a 75-kDa protein). When the cDNA was expressed in a human oligodendroglioma cell line, ONS-21, the IL-2R beta bound IL-2 with an affinity similar to that in lymphoid cells (Kd, approximately 2 nM). Furthermore, cell proliferation ([3H]thymidine incorporation) was stimulated by IL-2. These results demonstrate that the same cytokine receptor is functional in cells of the immune system and CNS and point to a molecular mechanism that is similar for growth-signal transduction between lymphoid and neural cells but that may be different in other cells, such as fibroblasts. Images PMID:2395860

  6. Targeting myocardial beta-adrenergic receptor signaling and calcium cycling for heart failure gene therapy.

    PubMed

    Pleger, Sven T; Boucher, Matthieu; Most, Patrick; Koch, Walter J

    2007-06-01

    Heart failure (HF) is a leading cause of morbidity and mortality in Western countries and projections reveal that HF incidence in the coming years will rise significantly because of an aging population. Pharmacologic therapy has considerably improved HF treatment during the last 2 decades, but fails to rescue failing myocardium and to increase global cardiac function. Therefore, novel therapeutic approaches to target the underlying molecular defects of ventricular dysfunction and to increase the outcome of patients in HF are needed. Failing myocardium generally exhibits distinct changes in beta-adrenergic receptor (betaAR) signaling and intracellular Ca2+-handling providing opportunities for research. Recent advances in transgenic and gene therapy techniques have presented novel therapeutic strategies to alter myocardial function and to target both betaAR signaling and Ca2+-cycling. In this review, we will discuss functional alterations of the betaAR system and Ca2+-handling in HF as well as corresponding therapeutic strategies. We will then focus on recent in vivo gene therapy strategies using the targeted inhibition of the betaAR kinase (betaARK1 or GRK2) and the restoration of S100A1 protein expression to support the injured heart and to reverse or prevent HF.

  7. RIII S/J (H-2r). An inbred mouse strain with a massive deletion of T cell receptor V beta genes

    PubMed Central

    1989-01-01

    We have identified an inbred strain of mouse, RIII S/J (H-2r), that has the largest known deletion of the TCR V beta genes by screening with mAb and TCR V beta specific probes. Upon screening of PBL with mAb F23.1, which is specific for V beta 8 TCR, RIII S/J was found to be negative. On further screening with mAb KJ 23a, which is specific for V beta 17a TCR, RIII S/J was completely negative. We next tested RIII S/J with mAb 44-22-1, which is specific for V beta 6 TCR, and found it also to be negative. The (B10 X RIII)F1 mice showed a 50% expression of V beta 6 gene, indicating a genomic rather than a clonal deletion. mAb KJ25, detecting V beta 3, was positive in RIII S/J, denoting the downstream boundary for the deletion. Southern blot analysis of liver DNA using TCR V beta-specific probes confirmed the deletion of V beta 8 gene subfamily and V beta 5 gene subfamily, along with V beta 9, V beta 11, V beta 12, and V beta 13 genes similar to the known TCR V beta deletion mutants (SWR, SJL, C57L, and C57Br). In addition, RIII S/J is missing V beta 6, V beta 15, and V beta 17 genes. Our mapping of the deletion indicates that RIII S/J has lost approximately 130 kb of V beta chromosome and with it 13 V beta genes out of the known 21 V beta genes of the TCR. The deletion is marked by the presence of V beta 10 gene upstream and V beta 3 gene downstream. PMID:2525171

  8. Nitric oxide stimulates insulin gene transcription in pancreatic {beta}-cells

    SciTech Connect

    Campbell, S.C. . E-mail: s.c.campbell@ncl.ac.uk; Richardson, H.; Ferris, W.F.; Butler, C.S.; Macfarlane, W.M.

    2007-02-23

    Recent studies have identified a positive role for nitric oxide (NO) in the regulation of pancreatic {beta}-cell function. The aim of this study was to determine the effects of short-term exposure to NO on {beta}-cell gene expression and the activity of the transcription factor PDX-1. NO stimulated the activity of the insulin gene promoter in Min6 {beta}-cells and endogenous insulin mRNA levels in both Min6 and isolated islets of Langerhans. Addition of wortmannin prior to NO stimulation blocked the observed increases in insulin gene promoter activity. Although NO addition stimulated the phosphorylation of p38, inhibition by SB203580 did not block the effect of NO on the insulin gene promoter. NO addition also stimulated both the nuclear accumulation and the DNA binding activity of PDX-1. This study has shown that over 24 h, NO stimulates insulin gene expression, PI-3-kinase activity and the activity of the critical {beta}-cell transcription factor PDX-1.

  9. Beta-2 adrenergic receptor gene polymorphisms Gln27Glu, Arg16Gly in patients with heart failure

    PubMed Central

    Mansur, Alfredo José; Fontes, Rosana Seleri; Canzi, Regina Airoldi; Nishimura, Raphael; Alencar, Airlane Pereira; de Lima, Antonio Carlos Pedroso; Krieger, José Eduardo; Pereira, Alexandre Costa

    2009-01-01

    Background - Beta-2 adrenergic receptor gene polymorphisms Gln27Glu, Arg16Gly and Thr164Ile were suggested to have an effect in heart failure. We evaluated these polymorphisms relative to clinical characteristics and prognosis of alarge cohort of patients with heart failure of different etiologies. Methods - We studied 501 patients with heart failure of different etiologies. Mean age was 58 years (standard deviation 14.4 years), 298 (60%) were men. Polymorphisms were identified by polymerase chain reaction-restriction fragment length polymorphism. Results - During the mean follow-up of 12.6 months (standard deviation 10.3 months), 188 (38%) patients died. Distribution of genotypes of polymorphism Arg16Gly was different relative to body mass index (χ2 = 9.797;p = 0.04). Overall the probability of survival was not significantly predicted by genotypes of Gln27Glu, Arg16Gly, or Thr164Ile. Allele and haplotype analysis also did not disclose any significant difference regarding mortality. Exploratory analysis through classification trees pointed towards a potential association between the Gln27Glu polymorphism and mortality in older individuals. Conclusion - In this study sample, we were not able to demonstrate an overall influence of polymorphisms Gln27Glu and Arg16Gly of beta-2 receptor gene on prognosis. Nevertheless, Gln27Glu polymorphism may have a potential predictive value in older individuals. PMID:19886995

  10. Development of real-time PCR method for the detection and the quantification of a new endogenous reference gene in sugar beet "Beta vulgaris L.": GMO application.

    PubMed

    Chaouachi, Maher; Alaya, Akram; Ali, Imen Ben Haj; Hafsa, Ahmed Ben; Nabi, Nesrine; Bérard, Aurélie; Romaniuk, Marcel; Skhiri, Fethia; Saïd, Khaled

    2013-01-01

    KEY MESSAGE : Here, we describe a new developed quantitative real-time PCR method for the detection and quantification of a new specific endogenous reference gene used in GMO analysis. The key requirement of this study was the identification of a new reference gene used for the differentiation of the four genomic sections of the sugar beet (Beta vulgaris L.) (Beta, Corrollinae, Nanae and Procumbentes) suitable for quantification of genetically modified sugar beet. A specific qualitative polymerase chain reaction (PCR) assay was designed to detect the sugar beet amplifying a region of the adenylate transporter (ant) gene only from the species of the genomic section I of the genus Beta (cultivated and wild relatives) and showing negative PCR results for 7 species of the 3 other sections, 8 related species and 20 non-sugar beet plants. The sensitivity of the assay was 15 haploid genome copies (HGC). A quantitative real-time polymerase chain reaction (QRT-PCR) assay was also performed, having high linearity (R (2) > 0.994) over sugar beet standard concentrations ranging from 20,000 to 10 HGC of the sugar beet DNA per PCR. The QRT-PCR assay described in this study was specific and more sensitive for sugar beet quantification compared to the validated test previously reported in the European Reference Laboratory. This assay is suitable for GMO quantification in routine analysis from a wide variety of matrices.

  11. Development of real-time PCR method for the detection and the quantification of a new endogenous reference gene in sugar beet "Beta vulgaris L.": GMO application.

    PubMed

    Chaouachi, Maher; Alaya, Akram; Ali, Imen Ben Haj; Hafsa, Ahmed Ben; Nabi, Nesrine; Bérard, Aurélie; Romaniuk, Marcel; Skhiri, Fethia; Saïd, Khaled

    2013-01-01

    KEY MESSAGE : Here, we describe a new developed quantitative real-time PCR method for the detection and quantification of a new specific endogenous reference gene used in GMO analysis. The key requirement of this study was the identification of a new reference gene used for the differentiation of the four genomic sections of the sugar beet (Beta vulgaris L.) (Beta, Corrollinae, Nanae and Procumbentes) suitable for quantification of genetically modified sugar beet. A specific qualitative polymerase chain reaction (PCR) assay was designed to detect the sugar beet amplifying a region of the adenylate transporter (ant) gene only from the species of the genomic section I of the genus Beta (cultivated and wild relatives) and showing negative PCR results for 7 species of the 3 other sections, 8 related species and 20 non-sugar beet plants. The sensitivity of the assay was 15 haploid genome copies (HGC). A quantitative real-time polymerase chain reaction (QRT-PCR) assay was also performed, having high linearity (R (2) > 0.994) over sugar beet standard concentrations ranging from 20,000 to 10 HGC of the sugar beet DNA per PCR. The QRT-PCR assay described in this study was specific and more sensitive for sugar beet quantification compared to the validated test previously reported in the European Reference Laboratory. This assay is suitable for GMO quantification in routine analysis from a wide variety of matrices. PMID:23052591

  12. Light controls phospholipase A2alpha and beta gene expression in Citrus sinensis.

    PubMed

    Liao, Hui-Ling; Burns, Jacqueline K

    2010-05-01

    The low-molecular weight secretory phospholipase A2alpha (CssPLA2alpha) and beta (CsPLA2beta) cloned in this study exhibited diurnal rhythmicity in leaf tissue of Citrus sinensis. Only CssPLA2alpha displayed distinct diurnal patterns in fruit tissues. CssPLA2alpha and CsPLA2beta diurnal expression exhibited periods of approximately 24 h; CssPLA2alpha amplitude averaged 990-fold in the leaf blades from field-grown trees, whereas CsPLA2beta amplitude averaged 6.4-fold. Diurnal oscillation of CssPLA2alpha and CsPLA2beta gene expression in the growth chamber experiments was markedly dampened 24 h after transfer to continuous light or dark conditions. CssPLA2alpha and CsPLA2beta expressions were redundantly mediated by blue, green, red and red/far-red light, but blue light was a major factor affecting CssPLA2alpha and CsPLA2beta expression. Total and low molecular weight CsPLA2 enzyme activity closely followed diurnal changes in CssPLA2alpha transcript expression in leaf blades of seedlings treated with low intensity blue light (24 micromol m(-2) s(-1)). Compared with CssPLA2alpha basal expression, CsPLA2beta expression was at least 10-fold higher. Diurnal fluctuation and light regulation of PLA2 gene expression and enzyme activity in citrus leaf and fruit tissues suggests that accompanying diurnal changes in lipophilic second messengers participate in the regulation of physiological processes associated with phospholipase A2 action.

  13. Peptide-conformed beta2m-free class I heavy chains are intermediates in generation of soluble HLA by the membrane-bound metalloproteinase.

    PubMed

    Demaria, S; DeVito-Haynes, L D; Salter, R D; Burlingham, W J; Bushkin, Y

    1999-12-01

    Molecular mechanisms of soluble HLA-release by a membrane-bound metalloproteinase (MPase) are not defined. We have investigated the possibility that certain beta2-microglobulin (beta2m)-free heavy chains (HC) retain peptide-induced conformations before and after the cleavage by using mutant HLA-A2.242K HC with reduced affinity for beta2m. We show that dissociation of HC/beta2m complexes on the surface of C1R lymphoblastoid cells generates both conformed and non-conformed beta2m-free HC recognized by conformation-dependent antibodies. Conformed HC, having bound the HLA-A2-specific peptide HTLV-1 tax 11-19, can retain their proper conformations after dissociation of beta2m. Further, conformed and non-conformed surface beta2m-free HC are cleaved by the MPase, and some released HC preserve their conformations. Exogenous beta2m binds only to conformed HC, and protects them from cleavage as effectively as the MPase inhibitor BB-2116. We propose that soluble HLA-release requires generation of peptide-conformed beta2m-free HC intermediates on the cell surface, which are then cleaved by the MPase and in solution may reassociate with beta2m. Given the role of soluble HLA in the indirect allorecognition, the activity of this MPase may be important in transplant rejection. PMID:10626735

  14. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  15. Genomic organization of the TcR beta-chain diversity (Dbeta) and joining (Jbeta) segments in the rainbow trout: presence of many repeated sequences.

    PubMed

    De Guerra, A; Charlemagne, J

    1997-06-01

    This work describes a 5.5 kb genomic sequence of the rainbow trout T-cell receptor beta-chain locus. It includes, from 5' to 3', a Dbeta gene, 10 Jbeta genes and the 5'-end of the first Cbeta exon. The trout Dbeta-Jbeta-Cbeta locus is about the same size as the mouse, rat and human homologous loci, but it is less compact and contains 10 Jbeta segments instead of the 6-7 found in mammals. The trout Dbeta coding sequence is identical to those of the mouse, rat and human Dbeta, and the Dbeta recombination signal sequences (RSS) are also very well conserved. Each trout Jbeta segment is flanked in 5' by a 7-mer RSS, which matches with the canonical conserved 7-mer sequences of all RSS. However, 6 of the 10 Jbeta segments have no characteristic 9-mer RSS, although at least some of them are well expressed (Jbeta1 and Jbeta2). The Jbeta region of the trout TcRbeta locus contains numerous micro/minisatellite repeated DNA sequences; some of these repeats contain heptamer RSS-like sequences that could interfere with Jbeta expression. Knowledge of the germline boundaries of the trout Dbeta and Jbeta ends makes it possible to evaluate precisely the exonuclease activity and N-nucleotide addition at the Dbeta-Jbeta junctions of the rearranged TcRbeta chain genes. Many (40%) of the Dbeta-Jbeta junctions in the adult trout have no N-nucleotides, compared to 26.4% in adult mice, and 37% of the adult trout TcRbeta transcripts are out of frame. Thus, there may be major differences in the T-cell developmental kinetics and selection in fish and mammals. PMID:9393968

  16. Cell and Gene Therapy for the Beta-Thalassemias: Advances and Prospects.

    PubMed

    Mansilla-Soto, Jorge; Riviere, Isabelle; Boulad, Farid; Sadelain, Michel

    2016-04-01

    The beta-thalassemias are inherited anemias caused by mutations that severely reduce or abolish expression of the beta-globin gene. Like sickle cell disease, a related beta-globin gene disorder, they are ideal candidates for performing a genetic correction in patient hematopoietic stem cells (HSCs). The most advanced approach utilizes complex lentiviral vectors encoding the human β-globin gene, as first reported by May et al. in 2000. Considerable progress toward the clinical implementation of this approach has been made in the past five years, based on effective CD34+ cell mobilization and improved lentiviral vector manufacturing. Four trials have been initiated in the United States and Europe. Of 16 evaluable subjects, 6 have achieved transfusion independence. One of them developed a durable clonal expansion, which regressed after several years without transformation. Although globin lentiviral vectors have so far proven to be safe, this occurrence suggests that powerful insulators with robust enhancer-blocking activity will further enhance this approach. The combined discovery of Bcl11a-mediated γ-globin gene silencing and advances in gene editing are the foundations for another gene therapy approach, which aims to reactivate fetal hemoglobin (HbF) production. Its clinical translation will hinge on the safety and efficiency of gene targeting in true HSCs and the induction of sufficient levels of HbF to achieve transfusion independence. Altogether, the progress achieved over the past 15 years bodes well for finding a genetic cure for severe globin disorders in the next decade.

  17. Organization, structure, and evolution of the nonadult rat beta-globin gene cluster.

    PubMed

    Satoh, H; Inokuchi, N; Nagae, Y; Okazaki, T

    1999-07-01

    The beta-globin gene cluster of Wistar rat was extensively cloned and the embryonic genes were mapped and sequenced. Four overlapping lambda Dash recombinant clones cover about 31 kb and contain four nonadult beta-globin genes, 5'-epsilon1-gamma1-gamma2-psigamma3-3'. The epsilon1 and gamma2 are active genes, since their protein products were detected in the fetal stage of the rat (Iwahara et al., J Biochem 119:360-366, 1996). The gamma1 locus might be a pseudogene, since the ATA box in the promoter region is mutated to GTA; however, no other defect is observed. The psigamma3 locus is a truncated pseudogene because a 19-base deletion, which causes a shift of the reading frame, is observed between the second nucleotide of the putative codon 68 and codon 76. A sequence comparison suggests that the psigamma3 might be produced by a gene conversion event of the proto-gamma-globin gene set. Possible histories of the evolution of rat nonadult beta-globin genes are discussed.

  18. A new compound heterozygous frameshift mutation in the type II 3{beta}-hydroxysteroid dehydrogenase 3{beta}-HSD gene causes salt-wasting 3{beta}-HSD deficiency congenital adrenal hyperplasia

    SciTech Connect

    Zhang, L.; Sakkal-Alkaddour, S.; Chang, Ying T.; Yang, Xiaojiang; Songya Pang

    1996-01-01

    We report a new compound heterozygous frameshift mutation in the type II 3{Beta}-hydroxysteroid dehydrogenase (3{beta}-HSD) gene in a Pakistanian female child with the salt-wasting form of 3{Beta}-HSD deficiency congenital adrenal hyperplasia. The etiology for her congenital adrenal hyperplasia was not defined. Although the family history suggested possible 3{beta}-HSd deficiency disorder, suppressed adrenal function caused by excess glucocorticoid therapy in this child at 7 yr of age did not allow hormonal diagnosis. To confirm 3{beta}-HSD deficiency, we sequenced the type II 3{beta}-HSD gene in the patient, her family, and the parents of her deceased paternal cousins. The type II 3{beta}-HSD gene region of a putative promotor, exons I, II, III, and IV, and exon-intron boundaries were amplified by PCR and sequenced in all subjects. The DNA sequence of the child revealed a single nucleotide deletion at codon 318 [ACA(Thr){r_arrow}AA] in exon IV in one allele, and two nucleotide deletions at codon 273 [AAA(Lys){r_arrow}A] in exon IV in the other allele. The remaining gene sequences were normal. The codon 318 mutation was found in one allele from the father, brother, and parents of the deceased paternal cousins. The codon 273 mutation was found in one allele of the mother and a sister. These findings confirmed inherited 3{beta}-HSD deficiency in the child caused by the compound heterozygous type II 3{beta}-HSD gene mutation. Both codons at codons 279 and 367, respectively, are predicted to result in an altered and truncated type II 3{beta}-HSD protein, thereby causing salt-wasting 3{beta}-HSD deficiency in the patient. 21 refs., 2 figs., 1 tab.

  19. The T cell receptor beta genes of Xenopus.

    PubMed

    Chretien, I; Marcuz, A; Fellah, J; Charlemagne, J; Du Pasquier, L

    1997-03-01

    cDNA of the T cell receptor beta (TCRB) have been isolated from the anuran amphibian Xenopus and they show strong structural homology to TCRB sequences of other vertebrates. Ten BV families, two D segments, ten J segments, and a single C region have been defined so far. Each V family consists of one to two members per haploid genome. A unique feature of the Xenopus TCRB constant region is the lack of N-linked carbohydrate glycosylation sites. The recombination signal sequences suggest that the mechanism of rearrangements are identical to those of mammals. The locus is inherited in a diploid manner despite the pseudotetraploidy of the Xenopus laevis and X. gilli used in this study. PMID:9079820

  20. Genetic polymorphism of beta-lactoglobulin gene in native Turkish sheep breeds.

    PubMed

    Elmaci, Cengiz; Oner, Yasemin; Balcioglu, M Soner

    2006-10-01

    The genetic polymorphism of the beta-lactoglobulin gene was investigated in three native Turkish sheep breeds. The study was carried out on 108 sheep (29 Kivircik, 38 Gökçeada, and 41 Sakiz) by means of PCR-RFLP methods. Two genetic variants (A and B) and three genotypes (AA, AB, and BB) of beta-lactoglobulin have been identified. The gene frequencies of beta-LG A and B were 0.7759 and 0.2241 in Kivircik, 0.7632 and 0.2368 in Gökçeada, and 0.9756 and 0.0244 in Sakiz breeds, respectively. The populations were in Hardy-Weinberg equilibrium in all samples from the three breeds.

  1. Myosin Heavy Chain Gene Expression in Developing Neonatal Skeletal Muscle: Involvement of the Nerve, Gravity, and Thyroid State

    NASA Technical Reports Server (NTRS)

    Baldwin, K. M.; Adams, G.; Haddad, F.; Zeng, M.; Qin, A.; Qin, L.; McCue, S.; Bodell, P.

    1999-01-01

    The myosin heavy chain (MHC) gene family encodes at least six MHC proteins (herein designated as neonatal, embryonic, slow type I (beta), and fast IIa, IIx, and IIb) that are expressed in skeletal muscle in a muscle-specific and developmentally-regulated fashion. At birth, both antigravity (e.g. soleus) and locomotor (e.g., plantaris) skeletal muscles are undifferentiated relative to the adult MHC phenotype such that the neonatal and embryonic MHC isoforms account for 80 - 90% of the MHC pool in a fast locomotor muscle; whereas, the embryonic and slow, type I isoforms account for approx. 90% of the pool in a typical antigravity muscle. The goal of this study was to investigate the role of an intact nerve, gravity and thyroid hormone (T3), as well as certain interactions of these interventions, on MHC gene expression in developing neonatal skeletal muscles of rodents.

  2. Transposition of the gene encoding a TEM-12 extended-spectrum beta-lactamase.

    PubMed Central

    Heritage, J; Hawkey, P M; Todd, N; Lewis, I J

    1992-01-01

    An isolate of Klebsiella oxytoca from the blood culture of a child with leukemia was found to produce two beta-lactamases, at least one of which conferred resistance to ceftazidime. Genes encoding both enzymes were located on a single self-transmissible 100-kb plasmid, pOZ201. This plasmid was introduced into Escherichia coli UB5201 (pACYC184), and the gene encoding one beta-lactamase was transposed onto plasmid pACYC184 by exploiting a gene dosage effect. The transposable gene was found to encode a TEM-12 enzyme as determined by nucleotide sequencing. This gene was subsequently transposed onto plasmid pUB307. The transposable element encoding the TEM-12 enzyme has been designated Tn841. Both plasmids pACYC184::Tn841 and pUB307::Tn841 were shown to encode a beta-lactamase with the same isoelectric point and substrate profile as the TEM-12 beta-lactamase. Transposon Tn841, at approximately 7 kb, is larger than TnA (4.8 kb) and transposes at a lower frequency. Although it produced a resolvase which can complement the resolvase of Tn3, its transposase function was not able to complement the transposition of a TnA element which lacked transposase. The occurrence of a gene encoding an extended-spectrum beta-lactamase on a transposable element in a clinically significant bacterium is potentially a cause for concern for the spread of resistance to the extended-spectrum cephalosporins. PMID:1329636

  3. Polymorphism of DNA sequence adjacent to human beta-globin structural gene: relationship to sickle mutation.

    PubMed

    Kan, Y W; Dozy, A M

    1978-11-01

    Restriction endonuclease mapping of the human globin genes revealed a genetic variation in a Hpa I recognition site about 5000 nucleotides from the 3' end of the beta-globin structural gene. Instead of a normal 7.6-kilobase (kb) fragment which contains the beta-globin structural gene, 7.0-kb and 13.0-kb variants were detected. Both variants were found in people of African origin and were not detected in Asians or Caucasians. The 13.0-kb variant is frequently associated with the sickle hemoglobin mutation and may be useful for the prediction of the sickle cell gene in prenatal diagnosis. Polymorphism in a restriction enzyme site could be considered as a new class of genetic marker and may offer a new approach to linkage analysis and anthropological studies.

  4. Imputing Variants in HLA-DR Beta Genes Reveals That HLA-DRB1 Is Solely Associated with Rheumatoid Arthritis and Systemic Lupus Erythematosus

    PubMed Central

    Kim, Kwangwoo; Bang, So-Young; Yoo, Dae Hyun; Cho, Soo-Kyung; Choi, Chan-Bum; Sung, Yoon-Kyoung; Kim, Tae-Hwan; Jun, Jae-Bum; Kang, Young Mo; Suh, Chang-Hee; Shim, Seung-Cheol; Lee, Shin-Seok; Lee, Jisoo; Chung, Won Tae; Kim, Seong-Kyu; Choe, Jung-Yoon; Nath, Swapan K.; Lee, Hye-Soon; Bae, Sang-Cheol

    2016-01-01

    The genetic association of HLA-DRB1 with rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE) is well documented, but association with other HLA-DR beta genes (HLA-DRB3, HLA-DRB4 and HLA-DRB5) has not been thoroughly studied, despite their similar functions and chromosomal positions. We examined variants in all functional HLA-DR beta genes in RA and SLE patients and controls, down to the amino-acid level, to better understand disease association with the HLA-DR locus. To this end, we improved an existing HLA reference panel to impute variants in all protein-coding HLA-DR beta genes. Using the reference panel, HLA variants were inferred from high-density SNP data of 9,271 RA-control subjects and 5,342 SLE-control subjects. Disease association tests were performed by logistic regression and log-likelihood ratio tests. After imputation using the newly constructed HLA reference panel and statistical analysis, we observed that HLA-DRB1 variants better accounted for the association between MHC and susceptibility to RA and SLE than did the other three HLA-DRB variants. Moreover, there were no secondary effects in HLA-DRB3, HLA-DRB4, or HLA-DRB5 in RA or SLE. Of all the HLA-DR beta chain paralogs, those encoded by HLA-DRB1 solely or dominantly influence susceptibility to RA and SLE. PMID:26919467

  5. Genetic regulation of carotene biosynthesis in selected tomato strains: aspects of beta-carotene biosynthesis and B gene specificity.

    PubMed

    Premachandra, B R

    1986-01-01

    A comparative qualitative and quantitative study of the carotene compositions of a high beta-carotene type mutant Priya Darshini-1 (PD-1), high lycopene type, Pusa Ruby (PR) and the F1 hybrid of these two strains was carried out. Increased amounts of beta-zeacarotene and gamma-carotene were realized in the PD-1 parent and in the F1 hybrid. This correlates the increased beta-zeacarotene and gamma-carotene synthesis with increased beta-carotene synthesis. Introduction of gene B (the gene that regulates beta-carotene biosynthesis) to a system lacking it induces considerable amount of beta-carotene synthesis at the expense of lycopene in the hybrid. Based on these observations a 'three point control' for the beta-carotene biosynthesis in tomato fruits is suggested with the gene B capable of promoting two different pathways in the high beta-carotene types. The probable sites of action of the modifier mOB (the gene that regulates expression of B gene) are indicated. Beta-carotene and xanthophyll contents of different parts of tomato plants of a PD-1 type and the PR type F2 segregates of the F1 hybrid (PR X PD-1)F1 have been studied. Results indicate that the action of gene B is highly specific and exclusively oriented towards the fruit and not expressed in any other parts of the tomato plant.

  6. Characterization and expression of the beta-N-acetylglucosaminidase gene family of Tribolium castaneum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Enzymes belonging to the Beta-N-acetylglucosaminidase (NAG) family cleave chitin oligosaccharides produced by the action of chitinases on chitin into the constituent N-acetylglucosamine monomer. Four genes encoding putative NAGs in the red flour beetle, Tribolium castaneum, namely TcNAG1, TcFDL, Tc...

  7. Using the NCBI Genome Databases to Compare the Genes for Human & Chimpanzee Beta Hemoglobin

    ERIC Educational Resources Information Center

    Offner, Susan

    2010-01-01

    The beta hemoglobin protein is identical in humans and chimpanzees. In this tutorial, students see that even though the proteins are identical, the genes that code for them are not. There are many more differences in the introns than in the exons, which indicates that coding regions of DNA are more highly conserved than non-coding regions.

  8. Nonblack patients with sickle cell disease have African. beta. sup s gene cluster haplotypes

    SciTech Connect

    Rogers, Z.R.; Powars, D.R.; Williams, W.D. ); Kinney, T.R. ); Schroeder, W.A. )

    1989-05-26

    Of 18 nonblack patients with sickle cell disease, 14 had sickle cell anemia, 2 had hemoglobin SC disease, and 2 had hemoglobin S-{beta}{sup o}-thalassemia. The {beta}{sup s} gene cluster haplotypes that were determined in 7 patients were of African origin and were identified as Central African Republic, Central African Republic minor II, Benin, and Senegal. The haplotype Central African Republic minor II was present on the {beta}{sup o}-thalassemia chromosome in 2 patients. None of 10 patients whose {alpha}-gene status was determined had {alpha}-thalassemia-2. These data strongly support the concept that the {beta}{sup s} gene on chromosome 11 of these individuals is of African origin and that the {alpha}-gene locus on chromosome 16 is of white or native American origin. The clinical severity of the disease in these nonblack patients is appropriate to their haplotype without {alpha}-thalassemia-2 and is comparable with that of black patients. All persons with congenital hemolytic anemia should be examined for the presence of sickle cell disease regardless of physical appearance or ethnic background.

  9. Direct cellobiose production from cellulose using sextuple beta-glucosidase gene deletion Neurospora crassa mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Direct cellobiose production from cellulose by a genetically modified fungus—Neurospora crassa, was explored in this study. A library of N. crassa sextuple beta-glucosidase (bgl) gene deletion strains was constructed. Various concentrations of cellobiose were detected in the culture broth of the N. ...

  10. Chromosome 3p loss of heterozygosity and mutation analysis of the FHIT and beta-cat genes in squamous cell carcinoma of the head and neck.

    PubMed Central

    González, M V; Pello, M F; Ablanedo, P; Suárez, C; Alvarez, V; Coto, E

    1998-01-01

    AIMS: To study the loss of heterozygosity at the short arm of chromosome 3 in primary tumours from patients with squamous cell carcinoma of the head and neck; to determine whether the FHIT gene, mapped to 3p14.2 and the CTNNB1 (beta-cat) gene, mapped to 3p21, are deleted or mutated in these tumours. METHODS: DNA was extracted from fresh tumours. Loss of heterozygosity was assessed by microsatellite analysis of the following markers: D3S1283 and D3S1286 (3p24), D3S966 (3p21), and D3S1300 (3P14.2). Homozygous deletion was determined by radioactive multiplex polymerase chain reaction of exons 5 and 6 of the FHIT gene. The presence of mutations in FHIT exon 5 and beta-cat exon 3 was studied by single strand conformation polymorphism. RESULTS: 50% of informative cases (25/50) showed loss of heterozygosity for at least one of the 3p markers. 3p21 was the region with the highest rate of allelic deletion (63%). No point mutation was found in FHIT exon 5 or beta-cat exon 3. No case showed homozygous deletion for the FHIT (exons 5 and 6) or the beta-cat exon 3. CONCLUSIONS: The short arm of chromosome 3 is often deleted in the head and neck squamous cell carcinomas. In the remaining alleles of the FHIT or beta-cat genes, no evidence was found for point mutations or deletions, documented in other common carcinomas. Inactivation could occur by different mechanisms such as methylation, or other genes (not studied here) could be target of allelic losses in squamous cell carcinoma of the head and neck. Images PMID:9797729

  11. Multidrug resistance mediated by co-carriage of extended-spectrum beta-lactamases, AmpC and New Delhi metallo-beta-lactamase-1 genes among carbapenem-resistant Enterobacteriaceae at five Indian medical centres.

    PubMed

    Manoharan, A; Barla, G S; Peter, R; Sugumar, M; Mathai, D

    2016-01-01

    In this study, we evaluated the coexistence of extended-spectrum beta-lactamases (ESBL), AmpC and New Delhi metallo-beta-lactamase-1 (NDM-1) genes among carbapenem-resistant Enterobacteriaceae (CRE) recovered prospectively from patients at multiple sites. The study included 285 CRE strains from 2782 Gram-negative Bacilli collected from multiple centres during 2007-2010, of which 87 were characterised. Standard and reference laboratory methods were used for resistance determination. Detection of blaNDM-1 , blaAmpC , blaTEM , blaSHV and blaCTX-M was done by polymerase chain reaction. High levels of antimicrobial resistance observed among study isolates. Co-carriage of ESBLs, AmpC and NDM-1 was 26.3%. Nosocomial origin among the co-carriage isolates was 64.3%, with 9.2% associated mortality. PMID:27514962

  12. Association of interleukin 1beta gene (+3953) polymorphism and severity of endometriosis in Turkish women.

    PubMed

    Attar, Rukset; Agachan, Bedia; Kucukhuseyin, Ozlem; Toptas, Bahar; Attar, Erkut; Isbir, Turgay

    2010-01-01

    Endometriosis is regarded as a complex trait, in which genetic and environmental factors contribute to the disease phenotype. We investigated whether the interleukin (IL) 1beta (+3953) polymorphism is associated with the severity of endometriosis. Diagnosis of endometriosis was made on the basis of laparoscopic findings. Stage of endometriosis was determined according to the Revised American Fertility Society classification. 118 women were enrolled in the study. 78 women did not have endometriosis, 6 women had stage I, 3 had stage II, 13 had stage III and 18 had stage IV endometriosis. Polymerase Chain Reaction (PCR), Restriction Fragment Length Polymorphism (RFLP), and agarose gel electrophoresis techniques were used to determine the IL 1beta (+3953) genotype. Frequencies of the IL-1beta (+3953) genotypes in the control group were: CC, 0.397; TT, 0.115; CT, 0.487. Frequencies of the IL-1beta (+3953) genotypes in cases were: CC, 0.375; TT, 0.225; CT, 0.400. We found a 2.22 fold increase in TT genotype in the endometriosis group. However, the difference was not statistically significant (P > 0.05). We also observed an increase in the frequency of IL-1beta (+3953) T allele in the endometriosis group. However, the difference was not statistically significant. We also investigated the association between IL-1beta (+3953) polymorphism and the severity of endometriosis. The frequencies of CC+CT genotypes in stage I, III and IV endometriosis patients were 83.3, 84/6 and 72.2%, respectively; and TT genotypes were 16.7, 15.4 and 27.8%, respectively. We observed a statistically insignificant increase in TT genotype in stage IV endometriosis (P > 0.05). We suggest that IL-1beta (+3953) polymorphism is not associated with endometriosis in Turkish women.

  13. Isolation and functional characterization of a lycopene beta-cyclase gene that controls fruit colour of papaya (Carica papaya L.).

    PubMed

    Devitt, Luke C; Fanning, Kent; Dietzgen, Ralf G; Holton, Timothy A

    2010-01-01

    The colour of papaya fruit flesh is determined largely by the presence of carotenoid pigments. Red-fleshed papaya fruit contain lycopene, whilst this pigment is absent from yellow-fleshed fruit. The conversion of lycopene (red) to beta-carotene (yellow) is catalysed by lycopene beta-cyclase. This present study describes the cloning and functional characterization of two different genes encoding lycopene beta-cyclases (lcy-beta1 and lcy-beta2) from red (Tainung) and yellow (Hybrid 1B) papaya cultivars. A mutation in the lcy-beta2 gene, which inactivates enzyme activity, controls lycopene production in fruit and is responsible for the difference in carotenoid production between red and yellow-fleshed papaya fruit. The expression level of both lcy-beta1 and lcy-beta2 genes is similar and low in leaves, but lcy-beta2 expression increases markedly in ripe fruit. Isolation of the lcy-beta2 gene from papaya, that is preferentially expressed in fruit and is correlated with fruit colour, will facilitate marker-assisted breeding for fruit colour in papaya and should create possibilities for metabolic engineering of carotenoid production in papaya fruit to alter both colour and nutritional properties.

  14. Transcriptional modulation of transin gene expression by epidermal growth factor and transforming growth factor beta

    SciTech Connect

    Machida, C.M.; Muldoon, L.L.; Rodland, K.D.; Magun, B.E.

    1988-06-01

    Transin is a transformation-associated gene which is expressed constitutively in rat fibroblasts transformed by a variety of oncogenes and in malignant mouse skin carcinomas but not benign papillomas or normal skin. It has been demonstrated that, in nontransformed Rat-1 cells, transin RNA expression is modulated positively by epidermal growth factor (EGF) and negatively by transforming growth factor beta (TGF-BETA); other peptide growth factors were found to have no effect on transin expression. Results presented here indicate that both protein synthesis and continuous occupancy of the EGF receptor by EGF were required for sustained induction of transin RNA. Treatment with TGF-BETA inhibited the ability of EGF to induce transin, whether assayed at the transcriptional level by nuclear run-on analysis or at the level of transin RNA accumulation by Northern (RNA) blot analysis of cellular RNA. TGF-BETA both blocked initial production of transin transcription by EGF and halted established production of transin transcripts during prolonged treatment. These results suggest that TGF-BETA acts at the transcriptional level to antagonize EGF-mediated induction of transin gene expression.

  15. Generation of a high-titer retroviral vector capable of expressing high levels of the human beta-globin gene.

    PubMed

    Sadelain, M; Wang, C H; Antoniou, M; Grosveld, F; Mulligan, R C

    1995-07-18

    Retrovirus-mediated gene transfer into hematopoietic cells may provide a means of treating both inherited and acquired diseases involving hematopoietic cells. Implementation of this approach for disorders resulting from mutations affecting the beta-globin gene (e.g., beta-thalassemia and sickle cell anemia), however, has been hampered by the inability to generate recombinant viruses able to efficiently and faithfully transmit the necessary sequences for appropriate gene expression. We have addressed this problem by carefully examining the interactions between retroviral and beta-globin gene sequences which affect vector transmission, stability, and expression. First, we examined the transmission properties of a large number of different recombinant proviral genomes which vary both in the precise nature of vector, beta-globin structural gene, and locus control region (LCR) core sequences incorporated and in the placement and orientation of those sequences. Through this analysis, we identified one specific vector, termed M beta 6L, which carries both the human beta-globin gene and core elements HS2, HS3, and HS4 from the LCR and faithfully transmits recombinant proviral sequences to cells with titers greater than 10(6) per ml. Populations of murine erythroleukemia (MEL) cells transduced by this virus expressed levels of human beta-globin transcript which, on a per gene copy basis, were 78% of the levels detected in an MEL-derived cell line, Hu11, which carries human chromosome 11, the site of the beta-globin locus. Analysis of individual transduced MEL cell clones, however, indicated that, while expression was detected in every clone tested (n = 17), the levels of human beta-globin treatment varied between 4% and 146% of the levels in Hu11. This clonal variation in expression levels suggests that small beta-globin LCR sequences may not provide for as strict chromosomal position-independent expression of beta-globin as previously suspected, at least in the context of

  16. Modified human beta 2-microglobulin (desLys(58)) displays decreased affinity for the heavy chain of MHC class I and induces nitric oxide production and apoptosis.

    PubMed

    Wang, M; Harhaji, L; Lamberth, K; Harndahl, M; Buus, S; Heegaard, N H H; Claesson, M H; Nissen, M H

    2009-03-01

    Beta2-microglobulin (beta2m) is the light chain of major histocompatibility complex class I (MHC-I) molecules, and is a prerequisite for the binding of peptides to the heavy chain and their presentation to CD8+ T cells. beta2m can be modified in vivo and in vitro by proteolytic cleavage by complement C1 and subsequent carboxypeptidase B-like activity--processes that lead to the generation of desLys(58) beta2m (dbeta2m). This work aims to study the effect of dbeta2m on peptide binding to MHC-I, the influence of dbeta2m on the binding of beta2m to the MHC-I heavy chain and the biological activity of dbeta2m. Both beta2m and dbeta2m are able to support the generation of MHC-I/peptide complexes at 18 degrees C, but complexes formed in the presence of dbeta2m destabilize at 37 degrees C. Moreover, a 250 times higher concentration of dbeta2m than of beta2m is needed to displace MHC-I associated beta2m from the cell surface. In addition, only beta2m is able to restore MHC-I/peptide complex formation on acid-treated cells whereas dbeta2m appears to bind preferentially to denatured MHC-I heavy chains. In cell cultures, exogenously added dbeta2m, but not beta2m, induces apoptotic cell death in monocytic leukaemic cell lines but spares other kinds of leukaemic cells. Additionally, the presence of dbeta2m, and to a lesser extent beta2m, enhances IFN-gamma-induced NO production by monocytic leukaemic cells. In conclusion, these data show that dbeta2m is not able to support the formation of a stable tri-molecular MHC-I complex at physiological temperature and that dbeta2m exerts other biological functions compared to beta2m when bound to cells.

  17. Variability in the interaction of beta-thalassemia with the alpha-chain variants Hb G-Philadelphia and Hb Rampa.

    PubMed

    Huisman, T H; Gravely, M E; Henson, J; Felice, A; Wilson, J B; Abraham, E C; Vella, F; Little, M W

    1978-08-01

    Two unrelated families are reported in which beta-thalassemia trait occurred with a heterozygosity of Hb G-Philadelphia (alpha2 68(E17)Asn leads to Lys beta2) in one family and with Hb Rampa (alpha2 95(G2)Pro leads to Ser beta2) in the other. The percentage of Hb G-Philadelphia was not influenced by the simultaneous presence of a beta-thalassemai determinant, but that of Hb Rampa was descreased from 20% in the simple heterozygote to about 6% in persons with the Hb Rampa-beta-thalassemia combination. Data from in vitro recombination experiments with isolated alpha X, alpha A, and beta A chains, with heme attached, indicated a preferential formation of Hb A over Hb Rampa but not over Hb G-Philadelphia in conditions of relative beta-chain deficiency. This suggests that the rate of assembly of monomers to form dimers or tetramers can be an important mechanism of controlling the quantity of certain hemoglobin variants with critical substitutions in heterozygotes. PMID:681817

  18. Determination of gene dosage by a quantitative adaptation of the polymerase chain reaction (gd-PCR): Rapid detection of deletions and duplications of gene sequences

    SciTech Connect

    Celi, F.S.; Roth, J.; Schuldiner, A.R. Johns Hopkins Univ. School of Medicine, Baltimore, MD ); Cohen, M.M. ); Antonarakis, S.E. ); Wertheimer, E. )

    1994-05-15

    Screening methods based on the polymerase chain reaction (PCR), such as denaturing gradient gel electrophoresis, single-stranded conformational polymorphism, and heteroduplex analysis, are powerful tools for the detection of point mutations as well as small deletions and insertions, but are unable to detect heterozygous deletions or duplications of exons, genes, or chromosomes. The authors now report a PCR-based approach, designated gene dosage-PCR (gd-PCR), that allows rapid screening for heterozygous deletions and duplications of genes or exons. Gene dosage-PCR is a quantitative method in which two in vitro-synthesized DNA internal standards are coamplified with the genomic DNA sample, one corresponding to the gene of interest (test sequence) and the other to a reference (disomic) gene (reference sequence). Both internal standards are designed to be amplified with the same primer pairs and with efficiencies similar to those of their genomic DNA counterparts, yielding PCR products slightly smaller than those derived from genomic DNA. Amplification of approximately equimolar amounts of the two internal standards and genomic DNA, in the presence of [[sup 32]P]dCTP, results in four radiolabeled PCR products; after electrophoresis and quantification of the products, gene dosage is easily calculated. For validation, genomic DNA from 56 subjects, 28 with cytogenetically documented Down syndrome (trisomy 21) and 28 controls that were disomic for chromosome 21, was assayed. Using the [beta]-amyloid precursor protein gene (APP: Chromosome 21q21) as the test sequence, control subjects had an adjusted mean gene dose of 2.00 [+-] 0.29, while subjects with Down syndrome had a mean gene dose of 3.05 [+-] 0.27. There was a clear separation of all of the samples between the two groups. The authors also successfully used gd-PCR to detect allelic deletions by screening pertinent regions of the insulin receptor gene. 48 refs., 5 figs., 2 tabs.

  19. A novel mutation of the beta-glucocerebrosidase gene associated with neurologic manifestations in three sibs.

    PubMed

    Parenti, G; Filocamo, M; Titomanlio, L; Rizzolo, G; Silvestro, E; Perretti, A; Gatti, R; Andria, G

    1998-04-01

    We report on a sibship in which three members were affected by Gaucher disease. Molecular analysis of the patients showed homozygosity for a novel mutation (C5390G) of the beta-glucocerebrosidase gene, resulting in the substitution of the arginine 353 with a glycine. Western blot analysis showed a reduced amount of beta-glucocerebrosidase-related polypeptides in fibroblasts. The phenotype resulting from this mutation is characterized by visceral and skeletal manifestations. In addition, the presence of seizures and electrophysiological abnormalities only in the 3 patients and in none of the other unaffected sibs suggests that the mutation is responsible for neurologic involvement. PMID:9650766

  20. Characterization of the genes encoding beta-ketoadipate: succinyl-coenzyme A transferase in Pseudomonas putida.

    PubMed Central

    Parales, R E; Harwood, C S

    1992-01-01

    beta-Ketoadipate:succinyl-coenzyme A transferase (beta-ketoadipate:succinyl-CoA transferase) (EC 2.8.3.6) carries out the penultimate step in the conversion of benzoate and 4-hydroxybenzoate to tricarboxylic acid cycle intermediates in bacteria utilizing the beta-ketoadipate pathway. This report describes the characterization of a DNA fragment from Pseudomonas putida that encodes this enzyme. The fragment complemented mutants defective in the synthesis of the CoA transferase, and two proteins of sizes appropriate to encode the two nonidentical subunits of the enzyme were produced in Escherichia coli when the fragment was placed under the control of a phage T7 promoter. DNA sequence analysis revealed two open reading frames, designated pcaI and pcaJ, that were separated by 8 bp, suggesting that they may comprise an operon. A comparison of the deduced amino acid sequence of the P. putida CoA transferase genes with the sequences of two other bacterial CoA transferases and that of succinyl-CoA:3-ketoacid CoA transferase from pig heart suggests that the homodimeric structure of the mammalian enzyme may have resulted from a gene fusion of the bacterial alpha and beta subunit genes during evolution. Conserved functional groups important to the catalytic activity of CoA transferases were also identified. Images PMID:1624453

  1. Regulated expression of a complete human beta-globin gene encoded by a transmissible retrovirus vector.

    PubMed Central

    Cone, R D; Weber-Benarous, A; Baorto, D; Mulligan, R C

    1987-01-01

    We introduced a human beta-globin gene into murine erythroleukemia (MEL) cells by infection with recombinant retroviruses containing the complete genomic globin sequence. The beta-globin gene was correctly regulated during differentiation, steady-state mRNA levels being induced 5- to 30-fold after treatment of the cells with the chemical inducer dimethyl sulfoxide. Studies using vectors which yield integrated proviruses lacking transcriptional enhancer sequences indicated that neither retroviral transcription nor the retroviral enhancer sequences themselves had any obvious effect on expression of the globin gene. Viral RNA expression also appeared inducible, being considerably depressed in uninduced MEL cells but approaching normal wild-type levels after dimethyl sulfoxide treatment. We provide data which suggest that the control point for both repression and subsequent activation of virus expression in MEL cells lies in the viral enhancer element. Images PMID:3029570

  2. Structural assessment of beta-glucuronidase carbohydrate chains by lectin affinity chromatography.

    PubMed

    Wójczyk, B; Hoja, D; Lityńska, A

    1993-04-01

    Rat liver beta-glucuronidase was studied by sequential lectin affinity chromatography. beta-Glucuronidase glycopeptides were obtained by extensive Pronase digestion followed by N-[14C]acetylation and desialylation by neuraminidase treatment. According to the distribution of the radioactivity in the various fractions obtained by chromatography on different lectins, and on the assumption that all glycopeptides were acetylated to the same specific radioactivity, a relative distribution of glycan structure types is proposed. The presence of complex biantennary and oligomannose type glycans (56.8% and 42.7%, respectively) was indicated by Concanavalin A-Sepharose chromatography. Ulex europaeus agglutinin-agarose chromatography revealed the presence of alpha(1-3)linked fucose in some of the complex biantennary type glycans (16.6% of the total glycopeptides). Wheat germ agglutinin chromatography indicated that the minority (0.5%) were hybrid or poly (N-acetyllactosamine) type glycans. Furthermore, the absence of O-glycans, tri-, tetra- and bisected biantennary type glycans was demonstrated by analysis of Concanavalin A-Sepharose unbound fraction by chromatography on immobilized soybean agglutinin, Ricinus communis agglutinin and Phaseolus vulgaris erythroagglutinin. PMID:8400827

  3. Heterodimerization of the alpha and beta chains of the interleukin-3 (IL-3) receptor is necessary and sufficient for IL-3-induced mitogenesis.

    PubMed

    Orban, P C; Levings, M K; Schrader, J W

    1999-09-01

    The high-affinity receptor for interleukin-3 (IL-3) is a complex of the IL-3-binding subunit (alpha(IL-3)) and a larger beta chain-beta(c), or, in the mouse, beta(c) or its close relative beta(IL-3). There is evidence that the critical event that initiates signaling is not the approximation of the cytoplasmic domains of alpha(IL-3) and beta(IL-3), but is, rather, the formation of a beta-beta homodimer. Many of these studies involved the analyses of receptor chimeras where the cytoplasmic domains were derived from alpha(IL-3), beta(c) or beta(IL-3), and the extracellular domains were derived from other cytokine receptors, such as the erythropoietin receptor (EpoR). However, evidence that the EpoR may also associate with other receptors clouds the interpretation of these experiments. Therefore, we reevaluated the structure of the functional IL-3R using chimeric receptors with extracellular domains derived not from members of the cytokine-receptor family, but from CD8 or CD16. We show, by expression of these chimeras in Ba/F3 or CTLL-2 cells, that mitogenic signals were only generated by heterodimerization of the cytoplasmic domains of alpha(IL-3) and beta(IL-3). Homodimers of either alpha(IL-3) or beta(IL-3), alone or in combination, were nonfunctional. Furthermore, the ability of heterodimers to stimulate mitogenesis correlated with their ability to induce tyrosine phosphorylation of JAK-2. These data suggest that the physiological activation of the IL-3R involves the generation of simple heterodimers of alpha(IL-3) and beta(IL-3).

  4. Beta-globin gene cluster haplotypes and HbF levels are not the only modulators of sickle cell disease in Lebanon.

    PubMed

    Inati, A; Taher, A; Bou Alawi, W; Koussa, S; Kaspar, H; Shbaklo, H; Zalloua, P A

    2003-02-01

    Sickle cell disease (SCD) is an inherited autosomal recessive disorder of the beta-globin chain. Despite the fact that all subjects with SCD have the same single base pair mutation, the severity of the clinical and hematological manifestations is extremely variable. This study examined for the first time in Lebanon the correlation between the clinical manifestation of SCD and the beta-globin gene haplotypes. The haplotypes of 50 patients diagnosed with SCD were determined using polymerase chain reaction amplification of fragments containing nine polymorphic restriction sites around and within the epsilon-Ggamma-Agamma-psibeta-delta-beta-globin gene complex. Most reported haplotypes were found in our population with the Benin haplotype as the most prevalent one. When the patients were divided according to their HbF levels into three groups (Group A: HbF < 5%, Group B: HbF between 5 and 15%, and Group C: HbF > 15%), surprisingly, the highest levels of HbF were associated with the most severe clinical cases. Our findings suggest that fetal hemoglobin levels are important but not the only parameters that affect the severity of the disease. In addition, the high levels of HbF in patients with CAR haplotypes did not seem to ameliorate the severity of symptoms, suggesting that genetic factors other than haplotypes are the major determinants of increased HbF levels in Lebanon.

  5. Assignment of the {beta}B1 crystallin gene (CRYBB1) to human chromosome 22 and mouse chromosome 5

    SciTech Connect

    Hulsebos, T.J.M.; Westerveld, A.; Gilbert, D.J.; Jenkins, N.A.; Copeland, N.G.

    1995-10-10

    By using primers complementary to the rat {beta}B1 crystallin gene sequence, we amplified exons 5 and 6 of the orthologous human gene (CRYBB1). The amplified human segments displayed greater than 88% sequence homology to the corresponding rat and bovine sequences. CRYBB1 was assigned to the group 5 region in 22q11.2-q12.1 by hybridizing the exon 6 PCR product to somatic cell hybrids containing defined portions of human chromosome 22. The exon 5 and exon 6 PCR products of CRYBB1 were used to localize, by interspecific backcross mapping, the mouse gene (Crybb1) to the central portion of chromosome 5. Three other {beta} crystallin genes ({beta}B2(-l), {beta}B3, and {beta}A4) have previously been mapped to the same regions in human and mouse. We demonstrate that the {beta}B1 and {beta}A4 crystallin genes are very closely linked in the two species. These assignments complete the mapping and identification of the human and mouse homologues of the major {beta} crystallins genes that are expressed in the bovine lens. 39 refs., 5 figs., 1 tab.

  6. Inhibition of serine palmitoyltransferase in vitro and long-chain base biosynthesis in intact Chinese hamster ovary cells by. beta. -chloroalanine

    SciTech Connect

    Medlock, K.A.; Merrill, A.H. Jr.

    1988-09-06

    The effects of ..beta..-chloroalanine (..beta..-Cl-alanine) on the serine palmitoyltransferase activity and the de novo biosynthesis of sphinganine and sphingenine were investigated in vitro with rat liver microsomes and in vivo with intact Chinese hamster ovary (CHO) cells. The inhibition in vitro was rapid, irreversible, and concentration and time dependent and apparently involved the active site because inactivation only occurred with ..beta..-Cl-L-alanine and was blocked by L-serine. These are characteristics of mechanism-based (suicide) inhibition. Serine palmitoyltransferase (SPT) was also inhibited when intact CHO cells were incubated with ..beta..-Cl-alanine and this treatment inhibited (/sup 14/C)serine incorporation into long-chain bases by intact cells. The concentration dependence of the loss of SPT activity and of long-chain base synthesis was identical. The effects of ..beta..-Cl-alanine appeared to occur with little perturbation of other cell functions: the cells exhibited no loss in cell viability, (/sup 14/C)serine uptake was not blocked, total lipid biosynthesis from (/sup 14/C)acetic acid was not decreased (nor was the appearance of radiolabel in cholesterol and phosphatidylcholine), and (/sup 3/H)thymidine incorporation into DNA was not affected. There appeared to be little effect on protein synthesis based on the incorporation of (/sup 3/H)leucine, which was only decreased by 14%. Although ..beta..-Cl-L-alanine is known to inhibit other pyridoxal 5'-phosphate dependent enzymes, alanine and aspartate transaminases were not inhibited under these conditions. These results establish the close association between the activity of serine palmitoyltransferase and the cellular rate of long-chain base formation and indicate that ..beta..-Cl-alanine and other mechanism-based inhibitors might be useful to study alterations in cellular long-chain base synthesis.

  7. Increased stability and DNA site discrimination of "single chain" variants of the dimeric beta-barrel DNA binding domain of the human papillomavirus E2 transcriptional regulator.

    PubMed

    Dellarole, Mariano; Sánchez, Ignacio E; Freire, Eleonora; de Prat-Gay, Gonzalo

    2007-10-30

    Human papillomavirus infects millions of people worldwide and is a causal agent of cervical cancer in women. The HPV E2 protein controls the expression of all viral genes through binding of its dimeric C-terminal domain (E2C) to its target DNA site. We engineered monomeric versions of the HPV16 E2C, in order to probe the link of the dimeric beta-barrel fold to stability, dimerization, and DNA binding. Two single-chain variants, with 6 and 12 residue linkers (scE2C-6 and scE2C-12), were purified and characterized. Spectroscopy and crystallography show that the native structure is unperturbed in scE2C-12. The single chain variants are stabilized with respect to E2C, with effective concentrations of 0.6 to 6 mM. The early folding events of the E2C dimer and scE2C-12 are very similar and include formation of a compact species in the submillisecond time scale and a non-native monomeric intermediate with a half-life of 25 ms. However, monomerization changes the unfolding mechanism of the linked species from two-state to three-state, with a high-energy intermediate. Binding to the specific target site is up to 5-fold tighter in the single chain variants. Nonspecific DNA binding is up to 7-fold weaker in the single chain variants, leading to an overall 10-fold increased site discrimination capacity, the largest described so far for linked DNA binding domains. Titration calorimetric binding analysis, however, shows almost identical behavior for dimer and single-chain species, suggesting very subtle changes behind the increased specificity. Global analysis of the mechanisms probed suggests that the dynamics of the E2C domain, rather than the structure, are responsible for the differential properties. Thus, the plastic and dimeric nature of the domain did not evolve for a maximum affinity, specificity, and stability of the quaternary structure, likely because of regulatory reasons and for roles other than DNA binding played by partly folded dimeric or monomeric conformers.

  8. Increased Stability and DNA Site Discrimination of Single Chain Variants of the Dimeric beta-Barrel DNA Binding Domain of the Human Papillomavirus E2 Transcriptional Regulator

    SciTech Connect

    Dellarole,M.; Sanchez, I.; Freire, E.; de Prat-Gay, G.

    2007-01-01

    Human papillomavirus infects millions of people worldwide and is a causal agent of cervical cancer in women. The HPV E2 protein controls the expression of all viral genes through binding of its dimeric C-terminal domain (E2C) to its target DNA site. We engineered monomeric versions of the HPV16 E2C, in order to probe the link of the dimeric {beta}-barrel fold to stability, dimerization, and DNA binding. Two single-chain variants, with 6 and 12 residue linkers (scE2C-6 and scE2C-12), were purified and characterized. Spectroscopy and crystallography show that the native structure is unperturbed in scE2C-12. The single chain variants are stabilized with respect to E2C, with effective concentrations of 0.6 to 6 mM. The early folding events of the E2C dimer and scE2C-12 are very similar and include formation of a compact species in the submillisecond time scale and a non-native monomeric intermediate with a half-life of 25 ms. However, monomerization changes the unfolding mechanism of the linked species from two-state to three-state, with a high-energy intermediate. Binding to the specific target site is up to 5-fold tighter in the single chain variants. Nonspecific DNA binding is up to 7-fold weaker in the single chain variants, leading to an overall 10-fold increased site discrimination capacity, the largest described so far for linked DNA binding domains. Titration calorimetric binding analysis, however, shows almost identical behavior for dimer and single-chain species, suggesting very subtle changes behind the increased specificity. Global analysis of the mechanisms probed suggests that the dynamics of the E2C domain, rather than the structure, are responsible for the differential properties. Thus, the plastic and dimeric nature of the domain did not evolve for a maximum affinity, specificity, and stability of the quaternary structure, likely because of regulatory reasons and for roles other than DNA binding played by partly folded dimeric or monomeric conformers.

  9. The beta-globin gene cluster haplotypes in sickle cell anemia patients from Northeast Brazil: a clinical and molecular view.

    PubMed

    Adorno, Elisângela Vitória; Zanette, Angela; Lyra, Isa; Souza, Cyntia Cajado; Santos, Leandro Ferraz; Menezes, Joelma Figueiredo; Dupuit, Marie France; Almeida, Mari Ney Tavares; Reis, Mitermayer Galvão; Gonçalves, Marilda Souza

    2004-08-01

    The beta(S)-globin haplotypes were studied in 78 sickle cell Brazilian patients from Bahia, Northeast Brazil, that has a large population of African origin. Hemoglobin (Hb) profiles were developed by high-performance liquid chromatography (HPLC), and beta(S)-globin gene haplotypes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) techniques. We identified 44 (55.0%) patients with the CAR/Ben (Central African Republic/Benin) genotype, 16 (20.0%) Ben/Ben, 13 (16.2%) CAR/CAR and seven (8.8%) with other genotypes. Analyses of the phenotypes showed clinical differences related only to Hb F levels and blood transfusion therapy; the presence of -alpha(-3.7)-thalassemia (thal) demonstrated statistical significance when associated with hematocrit (p=0.044), MCV (p=0.0007), MCH (p=0.012) and spleen sequestration events. The haplotype diversity found in the present study can be justified by information about the origin of the slave traffic period in Bahia during the 19th century. The specific characteristics described among the Bahian sickle cell patients could be confirmed by increasing the number of patients with specific genotypes and further studies of genetic markers.

  10. Cloning and expression in Saccharomyces cerevisiae of a Trichoderma reesei beta-mannanase gene containing a cellulose binding domain.

    PubMed Central

    Stålbrand, H; Saloheimo, A; Vehmaanperä, J; Henrissat, B; Penttilä, M

    1995-01-01

    beta-Mannanase (endo-1,4-beta-mannanase; mannan endo-1,4-beta-mannosidase; EC 3.2.1.78) catalyzes endo-wise hydrolysis of the backbone of mannan and heteromannans, including hemicellulose polysaccharides, which are among the major components of plant cell walls. The gene man1, which encodes beta-mannanase, of the filamentous fungus Trichoderma reesei was isolated from an expression library by using antiserum raised towards the earlier-purified beta-mannanase protein. The deduced beta-mannanase consists of 410 amino acids. On the basis of hydrophobic cluster analysis, the beta-mannanase was assigned to family 5 of glycosyl hydrolases (cellulase family A). The C terminus of the beta-mannanase has strong amino acid sequence similarity to the cellulose binding domains of fungal cellulases and is preceded by a serine-, threonine-, and proline-rich region. Consequently, the beta-mannanase is probably organized similarly to the T. reesei cellulases, having a catalytic core domain separated from the substrate-binding domain by an O-glycosylated linker. Active beta-mannanase was expressed and secreted by using the yeast Saccharomyces cerevisiae as the host. The results indicate that the man1 gene encodes the two beta-mannanases with different isoelectric points (pIs 4.6 and 5.4) purified earlier from T. reesei. PMID:7793911

  11. Recurrent fatal hydrops fetalis associated with a nucleotide substitution in the erythrocyte beta-spectrin gene.

    PubMed Central

    Gallagher, P G; Weed, S A; Tse, W T; Benoit, L; Morrow, J S; Marchesi, S L; Mohandas, N; Forget, B G

    1995-01-01

    We studied a kindred in which four third-trimester fetal losses occurred, associated with severe Coombs-negative hemolytic anemia and hydrops fetalis. Postmortem examination of two infants revealed extensive extramedullary erythropoiesis. Studies of erythrocytes and erythrocyte membranes from the parents revealed abnormal erythrocyte membrane mechanical stability as well as structural and functional abnormalities in spectrin, the principal structural protein of the erythrocyte membrane. Genetic studies identified a point mutation of the beta-spectrin gene, S2019P, in a region of beta spectrin that is critical for normal spectrin function. Both parents and two living children were heterozygous for this mutation; three infants dying of hydrops fetalis were homozygous for this mutation. In an in vitro assay using recombinant peptides, the mutant beta-spectrin peptide demonstrated a significant abnormality in its ability to interact with alpha spectrin. This is the first description of a molecular defect of the erythrocyte membrane associated with hydrops fetalis. Images PMID:7883966

  12. Comparison of the canine and human acid {beta}-galactosidase gene

    SciTech Connect

    Ahern-Rindell, A.J.; Kretz, K.A.; O`Brien, J.S.

    1996-05-17

    Several canine cDNA libraries were screened with human {beta}-galactosidase cDNA as probe. Seven positive clones were isolated and sequenced yielding a partial (2060 bp) canine {beta}-galactosidase cDNA with 86% identity to the human {beta}-galactosidase cDNA. Preliminary analysis of a canine genomic library indicated conservation of exon number and size. Analysis by Northern blotting disclosed a single mRNA of 2.4 kb in fibroblasts and liver from normal dogs and dogs affected with GM1 gangliosidosis. Although incomplete, these results indicate canine GM1 gangliosidosis is a suitable animal model of the human disease and should further efforts to devise a gene therapy strategy for its treatment. 20 refs., 2 figs., 1 tab.

  13. MHC evolution in three salmonid species: a comparison between class II alpha and beta genes.

    PubMed

    Gómez, Daniela; Conejeros, Pablo; Marshall, Sergio H; Consuegra, Sofia

    2010-08-01

    The genes of the major histocompatibility complex (MHC) are amongst the most variable in vertebrates and represent some of the best candidates to study processes of adaptive evolution. However, despite the number of studies available, most of the information on the structure and function of these genes come from studies in mammals and birds in which the MHC class I and II genes are tightly linked and class II alpha exhibits low variability in many cases. Teleost fishes are among the most primitive vertebrates with MHC and represent good organisms for the study of MHC evolution because their class I and class II loci are not physically linked, allowing for independent evolution of both classes of genes. We have compared the diversity and molecular mechanisms of evolution of classical MH class II alpha and class II beta loci in farm populations of three salmonid species: Oncorhynchus kisutch, Oncorhynchus mykiss and Salmo salar. We found single classical class II loci and high polymorphism at both class II alpha and beta genes in the three species. Mechanisms of evolution were common for both class II genes, with recombination and point mutation involved in generating diversity and positive selection acting on the peptide-binding residues. These results suggest that the maintenance of variability at the class IIalpha gene could be a mechanism to increase diversity in the MHC class II in salmonids in order to compensate for the expression of one single classical locus and to respond to a wider array of parasites. PMID:20521040

  14. MHC evolution in three salmonid species: a comparison between class II alpha and beta genes.

    PubMed

    Gómez, Daniela; Conejeros, Pablo; Marshall, Sergio H; Consuegra, Sofia

    2010-08-01

    The genes of the major histocompatibility complex (MHC) are amongst the most variable in vertebrates and represent some of the best candidates to study processes of adaptive evolution. However, despite the number of studies available, most of the information on the structure and function of these genes come from studies in mammals and birds in which the MHC class I and II genes are tightly linked and class II alpha exhibits low variability in many cases. Teleost fishes are among the most primitive vertebrates with MHC and represent good organisms for the study of MHC evolution because their class I and class II loci are not physically linked, allowing for independent evolution of both classes of genes. We have compared the diversity and molecular mechanisms of evolution of classical MH class II alpha and class II beta loci in farm populations of three salmonid species: Oncorhynchus kisutch, Oncorhynchus mykiss and Salmo salar. We found single classical class II loci and high polymorphism at both class II alpha and beta genes in the three species. Mechanisms of evolution were common for both class II genes, with recombination and point mutation involved in generating diversity and positive selection acting on the peptide-binding residues. These results suggest that the maintenance of variability at the class IIalpha gene could be a mechanism to increase diversity in the MHC class II in salmonids in order to compensate for the expression of one single classical locus and to respond to a wider array of parasites.

  15. In Vitro and in Vivo nucleosome positioning on the ovine beta-lactoglobulin gene are related.

    PubMed

    Gencheva, Marieta; Boa, Simon; Fraser, Ross; Simmen, Martin W; A Whitelaw, C Bruce; Allan, James

    2006-08-11

    Although positioned nucleosomes are known to play a direct, localised role in regulating access to DNA sequence, they also have the potential, through their long-range distribution, to affect the detailed structure of the higher-order chromatin fibre. To investigate this possibility, we firstly mapped, in vitro, the sequence-dependent positions that the core histone octamer adopts when reconstituted onto DNA containing the ovine beta-lactoglobulin gene. These positioning sites are discussed in terms of their relative affinity for the histone octamer, their locations with respect to the gene sequence and their periodic distribution throughout the gene region. Secondly, we mapped, in vivo, the sites that nucleosomes occupy on the same sequence in liver nuclei, where the gene is transcriptionally inactive. Although the sequence is largely packaged into regularly spaced nucleosomes, reflecting a fibre of uniform higher-order structure, this organisation is disrupted by a number of unusual chromatin structures in a region stretching from the second to the third introns of the gene. A comparison of the in vitro and in vivo nucleosome positioning data shows that they are qualitatively and quantitatively related, suggesting that the structure of the higher-order chromatin fibre containing the beta-lactoglobulin gene is determined, in part, by the long-range organisation of the non-coding sequences within which the gene is embedded.

  16. New Codanin-1 Gene Mutations in a Italian Patient with Congenital Dyserythropoietic Anemia Type I and Heterozygous Beta-Thalassemia.

    PubMed

    D'Alcamo, Elena; Agrigento, V; Pitrolo, L; Sclafani, S; Barone, R; Calvaruso, G; Buffa, V; Maggio, A

    2016-06-01

    Congenital dyserythropoietic anemia type I is an autosomal recessive disorder associated with macrocytic anemia, ineffective erythropoiesis, iron overloading and characterized by abnormal chromatin ultrastructure in erythroblasts such as internuclear chromatin bridges, spongy heterochromatin and invagination of the nuclear membrane. A 58-year-old Causasian man with chronic hemolytic anemia, heterozygous for β (+) -globin IVS1, nt110 G>A mutation (causing abnormal alpha:beta globin chain ratio) showed clinical, laboratory and hematological features suggesting diagnosis of CDA1. Sequence analysis of CDA-related genes revealed compound heterozygosity for two novel mutations in the CDAN1 gene: a frameshift mutation 3367 del 4 (TTAG) in exon 25 and a missense mutation c.1811 G>T in exon 11 causing an aminoacid change from glycine to valine at codon 565 (G565V). One of the propositus' brothers showed the same gene mutations. As the CDA1 can mimic thalassemia, a frequent misdiagnosis is possible especially in countries where the prevalence of thalassemia is high. A strong clinical suspicion in patients who do not reveal a clear genetic basis for presumed thalassemia may help clinch the correct diagnosis. PMID:27408412

  17. Molecular characterization and systemic induction of single-chain ribosome-inactivating proteins (RIPs) in sugar beet (Beta vulgaris) leaves.

    PubMed

    Iglesias, Rosario; Pérez, Yolanda; de Torre, Carlos; Ferreras, J Miguel; Antolín, Pilar; Jiménez, Pilar; Rojo, M Angeles; Méndez, Enrique; Girbés, Tomás

    2005-06-01

    Sugar beet (Beta vulgaris L.) leaves contain virus-inducible type 1 (single chain) ribosome-inactivating proteins that have been named beetins. The structural and functional characterization, the cellular location, and the potential role of beetins as antiviral agents are reported here. Beetins are formed of a single polypeptide chain with a varying degree of glycosylation and strongly inhibited in vitro protein synthesis in rabbit reticulocyte lysates (IC50=1.15 ng ml(-1)) and a Vicia sativa L. cell-free system (IC50=68 ng ml(-1)) through the single depurination of the large rRNA. Beetins trigger the multidepurination of tobacco mosaic virus (TMV) genomic RNA which underwent extensive degradation upon treatment with acid aniline. Beetins are extracellular proteins that were recovered from the apoplastic fluid. Induction of sugar beet RIPs with either H2O2 or artichoke mottled crinkle virus (AMCV) was observed in leaves distant from the site of application of such elicitors. The external application of purified beetin to sugar leaves prevented infection by AMCV which supports the preliminary hypothesis that beetins could be involved in plant systemic acquired resistance subjected to induction by phytopathogens.

  18. Amyloid-beta leads to impaired cellular respiration, energy production and mitochondrial electron chain complex activities in human neuroblastoma cells.

    PubMed

    Rhein, V; Baysang, G; Rao, S; Meier, F; Bonert, A; Müller-Spahn, F; Eckert, A

    2009-09-01

    Evidence suggests that amyloid-beta (Abeta) protein is a key factor in the pathogenesis of Alzheimer's disease (AD) and it has been recently proposed that mitochondria are involved in the biochemical pathway by which Abeta can lead to neuronal dysfunction. Here we investigated the specific effects of Abeta on mitochondrial function under physiological conditions. Mitochondrial respiratory functions and energy metabolism were analyzed in control and in human wild-type amyloid precursor protein (APP) stably transfected human neuroblastoma cells (SH-SY5Y). Mitochondrial respiratory capacity of mitochondrial electron transport chain (ETC) in vital cells was measured with a high-resolution respirometry system (Oxygraph-2k). In addition, we determined the individual activities of mitochondrial complexes I-IV that compose ETC and ATP cellular levels. While the activities of complexes I and II did not change between cell types, complex IV activity was significantly reduced in APP cells. In contrast, activity of complex III was significantly enhanced in APP cells, as compensatory response in order to balance the defect of complex IV. However, this compensatory mechanism could not prevent the strong impairment of total respiration in vital APP cells. As a result, the respiratory control ratio (state3/state4) together with ATP production decreased in the APP cells in comparison with the control cells. Chronic exposure to soluble Abeta protein may result in an impairment of energy homeostasis due to a decreased respiratory capacity of mitochondrial electron transport chain which, in turn, may accelerate neurons demise.

  19. Analysis and expression of the alpha-expansin and beta-expansin gene families in maize

    NASA Technical Reports Server (NTRS)

    Wu, Y.; Meeley, R. B.; Cosgrove, D. J.

    2001-01-01

    Expansins comprise a multigene family of proteins in maize (Zea mays). We isolated and characterized 13 different maize expansin cDNAs, five of which are alpha-expansins and eight of which are beta-expansins. This paper presents an analysis of these 13 expansins, as well as an expression analysis by northern blotting with materials from young and mature maize plants. Some expansins were expressed in restricted regions, such as the beta-expansins ExpB1 (specifically expressed in maize pollen) and ExpB4 (expressed principally in young husks). Other expansins such as alpha-expansin Exp1 and beta-expansin ExpB2 were expressed in several organs. The expression of yet a third group was not detected in the selected organs and tissues. An analysis of expansin sequences from the maize expressed sequence tag collection is also presented. Our results indicate that expansin genes may have general, overlapping expression in some instances, whereas in other cases the expression may be highly specific and limited to a single organ or cell type. In contrast to the situation in Arabidopsis, beta-expansins in maize seem to be more numerous and more highly expressed than are alpha-expansins. The results support the concept that beta-expansins multiplied and evolved special functions in the grasses.

  20. The genes and mRNA coding for the heavy chains of chick embryonic skeletal myosin.

    PubMed

    Patrinou-Georgoulas, M; John, H A

    1977-10-01

    A size class of polysomes was isolated from chick embryonic leg skeletal muscle which synthesized almost exclusively a polypeptide chain with a molecular weight identical to the myosin heavy chain. The mRNA purified from these polysomes was shown to synthesize the 200,000 dalton polypeptide in the wheat germ cell-free translation system. At least 90% of the polypeptide had properties similar to the myosin heavy chain. Isoelectric focusing indicated that the myosin heavy chain synthesized in vitro contained two chains in equal amounts, as did purified embryonic leg skeletal muscle myosin. The kinetics of hybridization of the complementary DNA with an excess of the myosin heavy chain mRNA (MHC mRNA) indicated the presence of two different mRNA sequences. Reassociation of the cDNA to an excess of the DNA of the genome suggest that there is little, if any, reiteration of the myosin heavy chain genes.

  1. Construction of bioactive chimeric MHC class I tetramer by expression and purification of human-murine chimeric MHC heavy chain and beta(2)m as a fusion protein in Escherichia coli.

    PubMed

    Ren, Ding; Wang, Fang; He, Xiaowen; Jiang, Lei; Li, Dean; Ying, He; Sun, Shuhan

    2006-12-01

    Major histocompatibility (MHC) class I tetramers are used in the quantitative analysis of epitope peptide-specific CD8+ T-cells. An MHC class I tetramer was composed of 4 MHC class I complexes and a fluorescently labeled streptavidin (SA) molecule. Each MHC class I complex consists of an MHC heavy chain, a beta(2)-microglobulin (beta(2)m) molecule and a synthetic epitope peptide. In most previous studies, an MHC class I complex was formed in the refolding buffer with an expressed MHC heavy chain molecule and beta(2)m, respectively. This procedure inevitably resulted in the disadvantages of forming unwanted multimers and self-refolding products, and the purification of each kind of monomer was time-consuming. In the present study, the genes of a human/murine chimeric MHC heavy chain (HLA-A2 alpha1, HLA-A2 alpha2 and MHC-H2D alpha3) and beta(2)m were tandem-cloned into plasmid pET17b and expressed as a fusion protein. The recombinant fusion protein was refolded with each of the three HLA-A2 restricted peptides (HBc18-27 FLPSDFFPSI, HBx52-60 HLSLRGLPV, and HBx92-100 VLHKRTLGL) and thus three chimeric MHC class I complexes were obtained. Biotinylation was performed, and its level of efficiency was observed via a band-shift assay in non-reducing polyacrylamide gel electrophoresis (PAGE). Such chimeric MHC class I tetramers showed a sensitive binding activity in monitoring HLA/A2 restrictive cytotoxic T lymphocytes (CTLs) in immunized HLA/A*0201 transgenic mice. PMID:17046278

  2. Cell and Gene Therapy for the Beta-Thalassemias: Advances and Prospects.

    PubMed

    Mansilla-Soto, Jorge; Riviere, Isabelle; Boulad, Farid; Sadelain, Michel

    2016-04-01

    The beta-thalassemias are inherited anemias caused by mutations that severely reduce or abolish expression of the beta-globin gene. Like sickle cell disease, a related beta-globin gene disorder, they are ideal candidates for performing a genetic correction in patient hematopoietic stem cells (HSCs). The most advanced approach utilizes complex lentiviral vectors encoding the human β-globin gene, as first reported by May et al. in 2000. Considerable progress toward the clinical implementation of this approach has been made in the past five years, based on effective CD34+ cell mobilization and improved lentiviral vector manufacturing. Four trials have been initiated in the United States and Europe. Of 16 evaluable subjects, 6 have achieved transfusion independence. One of them developed a durable clonal expansion, which regressed after several years without transformation. Although globin lentiviral vectors have so far proven to be safe, this occurrence suggests that powerful insulators with robust enhancer-blocking activity will further enhance this approach. The combined discovery of Bcl11a-mediated γ-globin gene silencing and advances in gene editing are the foundations for another gene therapy approach, which aims to reactivate fetal hemoglobin (HbF) production. Its clinical translation will hinge on the safety and efficiency of gene targeting in true HSCs and the induction of sufficient levels of HbF to achieve transfusion independence. Altogether, the progress achieved over the past 15 years bodes well for finding a genetic cure for severe globin disorders in the next decade. PMID:27021486

  3. T cell receptor (TCR) structure of autologous melanoma-reactive cytotoxic T lymphocyte (CTL) clones: tumor-infiltrating lymphocytes overexpress in vivo the TCR beta chain sequence used by an HLA-A2- restricted and melanocyte-lineage-specific CTL clone

    PubMed Central

    1993-01-01

    HLA-A2+ melanomas express common melanoma-associated antigens (Ags) recognized in vitro by autologous cytotoxic T lymphocytes (CTL). However, it is not known whether tumor Ags can drive in vivo a selective accumulation/expansion of Ag-specific, tumor-infiltrating T lymphocytes (TIL). Therefore, to evaluate this possibility, 39 CTL clones isolated from several independent mixed lymphocyte tumor cultures (MLTC) of TIL and peripheral blood lymphocytes (PBL) of an HLA- A2+ melanoma patient and selected for T cell receptor (TCR)-dependent, HLA-restricted tumor lysis, were used for analysis of TCR alpha and beta chain structure by the cDNA polymerase chain reaction (PCR) technique with variable gene-specific primers followed by sequencing. Despite absence of oligoclonality in fresh TIL and PBL, as well as in T cells of day 28 MLTC (day of cloning), sequence analysis of TCR alpha and beta chains of TIL clones revealed a dominance of a major category of melanoma-specific, HLA-A2-restricted T cells expressing a V alpha 8.2/J alpha AP511/C alpha and V beta 2.1/D beta 1/J beta 1.1/C beta 1 TCR. The same TCR was also found in 2 out of 14 PBL clones. The other PBL clones employed a V alpha 2.1 gene segment associated with either V beta 13.2, 14, or w22. Clones A81 (V alpha 2.1/J alpha IGRJ alpha 04/C alpha and V beta 14/D beta 1/J beta 1.2/C beta 1) and A21 (V alpha 8.2/J alpha AP511/C alpha and V beta 2.1/D beta 1/J beta 1.1/C beta 1), representative of the two most frequent TCR of PBL and TIL, respectively, expressed different lytic patterns, but both were HLA-A2 restricted and lysed only HLA-A2+ melanomas and normal melanocytes, thus indicating recognition of two distinct HLA-A2-associated and tissue-related Ags. Finally, by the inverse PCR technique, the specific TCR beta chain (V beta 2.1/D beta 1/J beta 1.1/C beta 1) expressed by the dominant TIL clone was found to represent 19 and 18.4% of all V beta 2 sequences expressed in the fresh tumor sample and in the purified TIL

  4. Enantioselective Degradation Mechanism of Beta-Cypermethrin in Soil From the Perspective of Functional Genes.

    PubMed

    Yang, Zhong-Hua; Ji, Guo-Dong

    2015-12-01

    The behavior and mechanisms of the enantioselective degradation of beta-cypermethrin were studied in soil. The four isomers were degraded at different rates, and the enantiomer fractions of alpha-cypermethrin and theta-cypermethrin exceeded 0.5. Moreover, 3-phenoxybenzoic acid, phenol, and protocatechuic acid were detected; based on the presence of these metabolites, we predicted the degradation pathway and identified the functional genes that are related to this degradation process. We established quantitative relationships between the data on degradation kinetics and functional genes; we found that the quantitative relationships between different enantiomers differed even under the same conditions, and the genes pobA and pytH played key roles in limiting the degradation rate. Data obtained using path analysis revealed that the same gene had different direct and indirect effects on the degradation of different isomers. A mechanism was successfully proposed to explain the selective degradation of chiral compounds based on the perspective of functional genes.

  5. Polymorphisms of IL-1beta, IL-1Ra, and TNF-alpha genes: a nested case-control study of their association with risk for stroke.

    PubMed

    Cvetkovic, Jasmina Trifunovic; Wiklund, Per Gunnar; Ahmed, Ejaz; Weinehall, Lars; Hallmans, Göran; Lefvert, Ann Kari

    2005-01-01

    Certain alleles of cytokine genes interleukin-1 beta (IL-1beta), interleukin-1 receptor antagonist (IL-1Ra), and tumor necrosis factor alpha (TNF-alpha) are correlated with increased production of the proteins. The aim of this study was to investigate polymorphisms of these genes and their possible correlation with the development of stroke. This matched case-control study was nested within the population-based Västerbotten Intervention Program (VIP) cohort and the Northern Sweden World Health Organization MONICA (Multinational Monitoring of Trends and Determinants in Cardiovascular Diseases) cohort, based on individuals who were free from cardiovascular events when the cohorts were established. After an average period of 34.1 months, 113 individuals developed stroke and to each case 2 individuals not suffering from cardiovascular events were matched to serve as controls. Polymerase chain reaction amplification was used to analyze genetic polymorphisms. There was no association between polymorphic sites of the IL-1beta and IL-1Ra genes and stroke. Carriage of haplotype A2+IL-1beta/A2+IL-1Ra was significantly increased in normotensive cases (23.1%) compared with normotensive controls (8.9%) (odds ratio [OR] = 3.07; P = .045). In hypertensive male cases, there was an association between the A1A1 genotype of TNF-alpha and risk of stroke (OR = 2.46; P = .034). Our findings indicate an association between allele A1 of the TNF-alpha NcoI polymorphism and stroke in hypertensive male cases, as well as an association between haplotype A2+IL-1beta/A2+IL-1Ra and stroke in normotensive cases.

  6. Transcriptional regulation of the human iNOS gene by IL-1beta in endothelial cells.

    PubMed Central

    Kolyada, A. Y.; Madias, N. E.

    2001-01-01

    BACKGROUND: Vascular endothelium participates in the control of vascular tone and function via the release of nitric oxide (NO) by the endothelial-type NO synthase (eNOS). Inducible NO synthase (iNOS) expression in endothelial cells occurs in many clinical conditions following induction by lipopolysaccharide or cytokines and generates large quantities of NO that result in endothelial cell activation and dysfunction. No information exists on the transcriptional regulation of the human iNOS gene (or that of other species) in endothelial cells. MATERIALS AND METHODS: We examined the transcriptional regulation of the human iNOS gene by interleukin-1beta (IL-1beta) in rat pulmonary microvascular endothelial cells (PVEC) by transient cotransfections of different iNOS-promoter constructs and cDNA of different transcription factors and regulatory proteins. RESULTS: The -1034/+88 bp iNOS promoter was strongly induced by IL-1beta, the regulatory elements for such induction being localized downstream of -205 bp. Cotransfection experiments with NF-kappaB isoforms, IkappaB isoforms, and IKK mutants suggested that the NF-kappaB site at -115/-106 bp is important, but not sufficient, for induction of iNOS promoter and that the role of NF-kappaB is partially independent of its binding site. C/EBP sites within the -205/+88 bp region were shown to be responsible, along with NF-kappaB site, for induction of iNOS promoter by IL-1beta. Overexpression of C/EBPalpha, C/EBPdelta, and liver-enriched activator protein (LAP) activated the promoter, whereas overexpression of liver-enriched inhibitory protein (LIP) strongly suppressed it. C/EBPbeta (LAP and LIP isoforms) was constitutively present in PVEC and was induced (approximately 2-fold) by IL-1beta, whereas C/EBPdelta was not constitutively expressed but was strongly induced by IL-1beta. Both C/EBPbeta and C/EBPdelta participated in DNA-protein complex formation. CONCLUSION: Both NF-kappaB and C/EBP pathways are important for the

  7. A self-excising beta-recombinase/six cassette for repetitive gene deletion and homokaryon purification in Neurospora crassa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a previous study we developed a cassette employing a bacterial beta-recombinase acting on six recognition sequences (beta-rec/six), which allowed repetitive site-specific gene deletion and marker recycling in Neurospora crassa. However, only one positive selection marker was used in the cassette...

  8. The functional importance of a cap site-proximal region of the human prointerleukin 1[beta] gene is defined

    SciTech Connect

    Hunninghake, G.W.; Geist, L.J.; Monick, M.M.; Stinski, M.F. ); Monks, B.G.; Monroy, M.A.; Fenton, M.J. ); Webb, A.C. ); Dayer, J.M. ); Auron, P.E. )

    1992-08-01

    Prointerleukin 1[beta] (IL-1[beta]) is a cytokine that mediates a broad range of biological activities. Genomic sequences that regulate IL-1[beta] transcription include both inducible regulatory elements located more than 2,700 bp upstream of the transcriptional start site (cap site) and proximal elements located near the TATA box of this gene. In this study, we focused on the identification and characterization of trans-acting nuclear regulatory proteins that bind to the cap site-proximal region of the human IL-1[beta] gene. We identified a protein, termed NFIL-1[beta]A (NF[beta]A), that binds to a highly conserved 12-bp DNA sequence (-49 to -38) located upstream of the TATA box motif in both the human and murine IL-1[beta] genes. The IL-1[alpha] gene, which lacks a TATA motif, does not possess an NF[beta]A-binding sequence within the promoter region, suggesting that NF[beta]A may selectively regulate IL-1[beta] expression. Using electrophoretic mobility shift assays, we identified several distinct DNA-protein complexes that are expressed in a cell-type-specific manner. In monocytic cell lines, the relative abundance of these complexes varied rapidly following stimulation of the cells with phorbol esters or lipopolysaccharide. UV cross-linking analysis identified two distinct DNA-binding polypeptides that comprise distinct complexes. The functional role of NF[beta]A was assessed in transient transfection assays. These data indicate the NF[beta]A is required for both basal and inducible promoter activity in monocytic cells. Furthermore, the human cytomegalovirus immediate-early 1 gene product requires the presence of NF[beta]A in order to trans-activate the proximal IL-1[beta] promoter in a monocytic cell line. We propose that NF[beta]A is a factor that mediates either direct or indirect activation by the immediate-early 1 gene product. The proximity of this essential factor to the TATA motif suggests a possible role in transcriptional initiation.

  9. Targets for dioxin: Genes for plasminogen activator inhibitor-2 and interleukin-1. beta

    SciTech Connect

    Sutter, T.R.; Guzman, K.; Dold, K.M. ); Greenlee, W.F. )

    1991-10-18

    Dioxin (2,3,7,8-tetrachlorodibenzo-p-dioxin, TCDD), a widespread environmental contaminant, may elicit its effects by altering gene expression in susceptible cells. Five TCDD-responsive complementary DNA clones were isolated from a human keratinocyte cell line. One of these clones encodes plasminogen activator inhibitor-2, a factor that influences growth and differentiation by regulating proteolysis of the extracellular matrix. Another encodes the cytokine interleukin-1{beta}. Thus, TCDD alters the expression of growth regulator genes and has effects similar to those of other tumor-promoting agents that affect both inflammation and differentiation.

  10. beta. amyloid gene duplication in Alzheimer's disease and karyotypically normal Down syndrome

    SciTech Connect

    Delabar, J.; Goldgaber, D.; Lamour, Y.; Nicole, A.; Huret, J.; De Groucy, J.; Brown, P.; Gajdusek, D.C.; Sinet, P.

    1987-03-13

    With the recently cloned complementary DNA probe, lambdaAm4 for the chromosome 21 gene encoding brain amyloid polypeptide (..beta.. amyloid protein) of Alzheimer's disease, leukocyte DNA from three patients with sporadic Alzheimer's disease and two patients with karyotypically normal Down syndrome was found to contain three copies of this bene. Because a small region of chromosome 21 containing the ets-2 gene is duplicated in patients with Alzheimer's disease, as well as in karyotypically normal Down syndrome, duplication of a subsection of the critical segment of chromosome 21 that is duplicated in Down syndrome may be the genetic defect in Alzeimer's disease.

  11. Beta-Arrestin2 regulates RANKL and ephrins gene expression in response to bone remodeling in mice.

    PubMed

    Pierroz, Dominique D; Rufo, Anna; Bianchi, Estelle N; Glatt, Vaida; Capulli, Mattia; Rucci, Nadia; Cavat, Fanny; Rizzoli, René; Teti, Anna; Bouxsein, Mary L; Ferrari, Serge L

    2009-05-01

    PTH-stimulated intracellular signaling is regulated by the cytoplasmic adaptor molecule beta-arrestin. We reported that the response of cancellous bone to intermittent PTH is reduced in beta-arrestin2(-/-) mice and suggested that beta-arrestins could influence the bone mineral balance by controlling RANKL and osteoprotegerin (OPG) gene expression. Here, we study the role of beta-arrestin2 on the in vitro development and activity of bone marrow (BM) osteoclasts (OCs) and Ephrins ligand (Efn), and receptor (Eph) mRNA levels in bone in response to PTH and the changes of bone microarchitecture in wildtype (WT) and beta-arrestin2(-/-) mice in models of bone remodeling: a low calcium diet (LoCa) and ovariectomy (OVX). The number of PTH-stimulated OCs was higher in BM cultures from beta-arrestin2(-/-) compared with WT, because of a higher RANKL/OPG mRNA and protein ratio, without directly influencing osteoclast activity. In vivo, high PTH levels induced by LoCa led to greater changes in TRACP5b levels in beta-arrestin2(-/-) compared with WT. LoCa caused a loss of BMD and bone microarchitecture, which was most prominent in beta-arrestin2(-/-). PTH downregulated Efn and Eph genes in beta-arrestin2(-/-), but not WT. After OVX, vertebral trabecular bone volume fraction and trabecular number were lower in beta-arrestin2(-/-) compared with WT. Histomorphometry showed that OC number was higher in OVX-beta-arrestin2(-/-) compared with WT. These results indicate that beta-arrestin2 inhibits osteoclastogenesis in vitro, which resulted in decreased bone resorption in vivo by regulating RANKL/OPG production and ephrins mRNAs. As such, beta-arrestins should be considered an important mechanism for the control of bone remodeling in response to PTH and estrogen deprivation. PMID:19113915

  12. Impact of beta2-adrenoreceptor gene variants on cardiac cavity size and systolic function in idiopathic dilated cardiomyopathy.

    PubMed

    Badenhorst, D; Norton, G R; Sliwa, K; Brooksbank, R; Essop, R; Sareli, P; Woodiwiss, A J

    2007-10-01

    In heart failure, the Arg16Gly and Gln27Glu polymorphisms of the beta2-adrenoreceptor (beta2-AR) gene are associated with exercise-capacity, clinical outcomes and response to beta-AR blocker therapy. Whether beta2-AR gene variants mediate these effects in-part through an impact on cardiac structural remodeling and pump function independent of the effects of beta-blockers is uncertain. We evaluated whether the Arg16Gly and Gln27Glu variants of the beta2-AR gene predict left ventricular ejection fraction (LVEF) and LV end diastolic diameter (LVEDD) in patients with idiopathic dilated cardiomyopathy (IDC) before and 6 months after receiving standard medical therapy other than beta-AR blockers. In all, 394 patients with IDC and 393 age and gender-matched controls were genotyped for the beta2-AR gene variants using restriction-fragment length polymorphism-based techniques. LVEF and dimensions were determined in 132 patients (of whom 71 were newly diagnosed) both at baseline and after 6 months. Genotype of neither variant was associated with the presence of IDC. Moreover, beta2-AR genotype did not determine LVEF or LV dimensions prior to initiating therapy. After 6 months of therapy, LVEF increased by 7.1+/-1.0 absolute units (P<0.0001) and LVEDD decreased by 0.27+/-0.06 cm (P<0.02). Adjusting for baseline values as well as gender, age, and type of angiotensin-converting enzyme inhibitor therapy received, genotype was associated with neither final LVEF and LVEDD, nor change in LVEF and LVEDD. In conclusion, these data suggest that in heart failure, the functional Arg16Gly and Gln27Glu variants of the beta2-AR gene have no independent effect on adverse structural remodeling and pump function.

  13. Comparative characterization of the cephamycinase blaCMY-1 gene and its relationship with other beta-lactamase genes.

    PubMed Central

    Bauernfeind, A; Stemplinger, I; Jungwirth, R; Wilhelm, R; Chong, Y

    1996-01-01

    A plasmidic beta-lactamase which hydrolyzed cephamycins was first detected and reported in 1989. At that time its description was restricted to phenotypic characteristics. We analyzed nucleotide sequence of its gene and explored it genetic relationship with other bla genes. The deduced amino acid sequence of the blaCMY-1 product was compared with those of other known plasmidic cephamycinases and of chromosomal AmpC beta-lactamases. The results indicate that the relationship of CMY-1 is closest to MOX-1 among the plasmidic cephamycinases and to AmpC of Pseudomonas aeruginosa among the chromosomal cephalosporinases. We conclude that the plasmidic cephamycinases described up to now may be classified into three families, as follows: CMY-1, MOX-1, and FOX-1 with AmpC of P. aeruginosa; CMY-2, BIL-1 and LAT-1 with AmpC of Citrobacter freundii; and MIR-1 with AmpC of Enterobacter cloacae. Plasmidic cephamycinases are now recognized as clinically relevant class C beta-lactamases. PMID:8843306

  14. Lactogenic hormonal induction of long distance interactions between beta-casein gene regulatory elements.

    PubMed

    Kabotyanski, Elena B; Rijnkels, Monique; Freeman-Zadrowski, Courtneay; Buser, Adam C; Edwards, Dean P; Rosen, Jeffrey M

    2009-08-21

    Lactogenic hormone regulation of beta-casein gene expression in mammary epithelial cells provides an excellent model in which to study the mechanisms by which steroid and peptide hormone signaling control gene expression. Prolactin- and glucocorticoid-mediated induction of beta-casein gene expression involves two principal regulatory regions, a proximal promoter and a distal enhancer located in the mouse approximately -6 kb upstream of the transcription start site. Using a chromosome conformation capture assay and quantitative real time PCR, we demonstrate that a chromatin loop is created in conjunction with the recruitment of specific transcription factors and p300 in HC11 mammary epithelial cells. Stimulation with both prolactin and hydrocortisone is required for the induction of these long range interactions between the promoter and enhancer, and no DNA looping was observed in nontreated cells or cells treated with each of the hormones separately. The lactogenic hormone-induced interaction between the proximal promoter and distal enhancer was confirmed in hormone-treated primary three-dimensional mammary acini cultures. In addition, the developmental regulation of DNA looping between the beta-casein regulatory regions was observed in lactating but not in virgin mouse mammary glands. Furthermore, beta-casein mRNA induction and long range interactions between these regulatory regions were inhibited in a progestin-dependent manner following stimulation with prolactin and hydrocortisone in HC11 cells expressing human PR-B. Collectively, these data suggest that the communication between these regulatory regions with intervening DNA looping is a crucial step required to both create and maintain active chromatin domains and regulate transcription.

  15. Beta S-gene-cluster haplotypes in sickle cell anemia: clinical implications.

    PubMed

    Powars, D R; Chan, L; Schroeder, W A

    1990-01-01

    Restriction endonuclease analysis was used to detect alpha-gene deletions and to determine the haplotypes in the DNA of the beta S-gene-cluster [Benin, Central African Republic (CAR), and Senegal] in 221 patients with sickle cell anemia (SS). The clinical expression of SS was modified by the beta S-gene-cluster polymorphisms and the alpha-gene status (alpha-thalassemia-2). The overall risk of soft tissue organ failure caused by the obliterative sickle vasculopathy (including stroke, renal failure, chronic lung disease with cor pulmonale, leg ulcers, and young adult death) was increased threefold in those with a CAR haplotype and was decreased in those with a Senegalese chromosome (p = 0.003). In the presence of a Senegalese haplotype, the patient's health is better, and with the CAR haplotype it is always worse. With the Benin, it is intermediate. Acute recurrent clinical events including hospitalized sickle cell crisis, bone infarction, and infection are decreased in frequency in those with a Senegalese haplotype. The risk of most acute events including acute chest syndrome is equivalent in those with Benin or CAR haplotypes. In the United States, alpha-thalassemia-2 is co-inherited randomly among the beta S-gene-cluster haplotypes. Acute events occurring during childhood are minimally effected by this co-inheritance. The risk of soft tissue organ failure is decreased. After the age of 20 years, painful episodes of the lumbar dorsal area are increased in patients who had alpha-thalassemia-2 in association with degenerative bone disease.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. Calcium channel beta 4 (CACNB4): human ortholog of the mouse epilepsy gene lethargic.

    PubMed

    Escayg, A; Jones, J M; Kearney, J A; Hitchcock, P F; Meisler, M H

    1998-05-15

    The mouse neurological mutant lethargic (lh) is characterized by ataxia, focal myoclonus, and absence epilepsy due to a loss-of-function mutation in the beta4 subunit of the voltage-gated calcium channel. To evaluate the role of this channel subunit in human neurological disease, we determined the chromosomal location and intron/exon structure of the human CACNB4 gene. The 1560-bp open reading frame of the CACNB4 cDNA predicts a 58-kDa protein with an amino acid sequence that is 99% identical to the rat protein. The 13 coding exons of CACNB4 span >55 kb of genomic DNA. Human cerebellar RNA contains one major CACNB4 transcript that is 9 kb in length. Expression of CACNB4 was detected in cerebellum, kidney, testis, retina, lymphoblasts, and circulating lymphocytes. Retinal transcripts were localized by in situ hybridization to ganglion cells and the inner nuclear layer. Analysis of the GeneBridge 4 radiation hybrid mapping panel localized CACNB4 to position 791 cR on human chromosome 2, in a conserved linkage group on human 2q22-q31 and mouse chromosome 2. We localized CACNB4 to the 1.3-Mb YAC clone 952F10 in Whitehead contig WC861, along with the polymorphic markers D2S2236 and D2S2299. The chromosomal linkage of three of the four beta subunit genes to homeobox gene clusters associates the evolutionary origin of the beta gene family with the events that generated the four HOX clusters early in vertebrate evolution.

  17. Relative locations of the. beta. and delta chains of the acetylcholine receptor determined by electron microscopy of isolated receptor trimer. [Fishes, electric tissue

    SciTech Connect

    Wise, D.S.; Wall, J.; Karlin, A.

    1981-12-25

    The monomeric unit of the acetylcholine receptor of electric tissue of Torpedo californica has previously been shown to have a subunit composition of ..cap alpha../sub 2/..beta gamma..delta. Receptor in membrane isolated from Torpedo electric tissue occurs as both monomer and dimer. In the dimer, which is the predominant form, the monomeric units are cross-linked via a disulfide bond between delta chains. The addition of diamide to receptor-rich membrane causes the formation of trimer and higher oligomers in which the monomeric units are linked by disulfide bonds alternately between pairs of delta chains and between pairs ..beta.. chains. We have isolated receptor trimer and determined the relative locations of the monomeric units by scanning transmission electron microscopy of negatively stained preparations. In face view, the trimer appears as three approximately 90 angstrom disks, each with a central, densely staining pit. From the angles of the triangle formed by the lines connecting the centers of the monomers in the trimer, we infer that the ..beta..-..beta.. disulfide bond is separated from the delta-delta disulfide bond by an angle in the range of 50-80/sup 0/.

  18. Shared idiotypes and restricted immunoglobulin variable region heavy chain genes characterize murine autoantibodies of various specificities.

    PubMed Central

    Monestier, M; Manheimer-Lory, A; Bellon, B; Painter, C; Dang, H; Talal, N; Zanetti, M; Schwartz, R; Pisetsky, D; Kuppers, R

    1986-01-01

    The study of the Ig variable region heavy chain (VH) genes used to encode antibodies specific for self-epitopes from murine hybridomas showed that three VH families are primarily utilized: VH J558, the largest family, and VH QPC52 and VH 7183, the families most proximal to the Ig joining region heavy chain genes. These monoclonal autoantibodies express cross-reactive idiotopes shared by rheumatoid factors and antibodies specific for Sm. The expression of these idiotypes is independent of major histocompatibility complex and Ig constant region heavy chain haplotypes, self-antigen specificity, and even the VH gene family utilized. Though the experiments described here are limited to murine autoantibodies, similarities exist between murine and human autoimmune diseases. Studies that aim to investigate the relationship between VH gene expression and the presence of cross-reactive idiotypes among human autoantibodies should enable us to better understand the mechanisms of autoimmunity and self-tolerance. Images PMID:2427543

  19. A novel fibrinogen B beta chain frameshift mutation causes congenital afibrinogenaemia.

    PubMed

    Zhang, Jian; Zhao, Xiaojuan; Wang, Zhaoyue; Yu, Ziqiang; Cao, Lijuan; Zhang, Wei; Bai, Xia; Ruan, Changgeng

    2013-07-01

    Congenital afibrinogenaemia is a rare autosomal recessive disorder caused by various mutations within the fibrinogen genes FGA, FGB and FGG. Ins/del mutations in FGB are extremely rare. We report a patient with afibrinogenaemia who suffered from umbilical cord bleeding and repeated bleeding episodes. His plasma fibrinogen levels could not be detected using the Clauss method and immunological methods. Molecular analyses revealed homozygosity in a novel four bases insertion in codon 40 of FGB exon 2 (g. 2833_2834 ins GTTT), which resulted in a truncated 50-residue polypeptide that contained 11 exceptional abnormal residues. In the transient expression experiments, mutant fibrinogen could be detected at higher level than wild-type fibrinogen in COS-7 cell lysates but not in culture media. These results suggest that the homozygous mutation in FGB could be responsible for congenital afibrinogenaemia in this patient. This frameshift mutation could impair fibrinogen assembly and secretion without influencing the protein synthesis.

  20. A homozygous nonsense mutation in the alpha 3 chain gene of laminin 5 (LAMA3) in Herlitz junctional epidermolysis bullosa: prenatal exclusion in a fetus at risk.

    PubMed

    McGrath, J A; Kivirikko, S; Ciatti, S; Moss, C; Dunnill, G S; Eady, R A; Rodeck, C H; Christiano, A M; Uitto, J

    1995-09-01

    Mutations in the three genes (LAMA3, LAMB3, and LAMC2) that encode the three chains (alpha 3, beta 3, and gamma 2, respectively) of laminin 5, a protein involved in epidermal-dermal adhesion, have been established as the genetic basis for the inherited blistering skin disorder, Herlitz junctional epidermolysis bullosa (H-JEB). In this study, we performed mutational analysis on genomic DNA from a child with H-JEB and identified a nonsense mutation in the alpha 3 chain gene (LAMA3) consisting of a homozygous C-to-T transition resulting in a premature termination codon (CGA-->TGA) on both alleles. The parents were shown to be heterozygous carriers of the same mutation. Direct mutation analysis was used to perform DNA-based prenatal diagnosis from a chorionic villus biopsy at 10 weeks' gestation in a subsequent pregnancy. The fetus was predicted to be genotypically normal with respect to the LAMA3 mutation. PMID:8530087

  1. Restricted Immunoglobulin Variable Region (Ig V) Gene Expression Accompanies Secondary Rearrangements of Light Chain Ig V Genes in Mouse Plasmacytomas

    PubMed Central

    Diaw, Lena; Siwarski, David; Coleman, Allen; Kim, Jennifer; Jones, Gary M.; Dighiero, Guillaume; Huppi, Konrad

    1999-01-01

    The many binding studies of monoclonal immunoglobulin (Ig) produced by plasmacytomas have found no universally common binding properties, but instead, groups of plasmacytomas with specific antigen-binding activities to haptens such as phosphorylcholine, dextrans, fructofuranans, or dinitrophenyl. Subsequently, it was found that plasmacytomas with similar binding chain specificities not only expressed the same idiotype, but rearranged the same light (VL) and heavy (VH) variable region genes to express a characteristic monoclonal antibody. In this study, we have examined by enzyme-linked immunosorbent assay five antibodies secreted by silicone-induced mouse plasmacytomas using a broader panel of antigens including actin, myosin, tubulin, single-stranded DNA, and double-stranded DNA. We have determined the Ig heavy and light chain V gene usage in these same plasmacytomas at the DNA and RNA level. Our studies reveal: (a) antibodies secreted by plasmacytomas bind to different antigens in a manner similar to that observed for natural autoantibodies; (b) the expressed Ig heavy genes are restricted in V gene usage to the VH-J558 family; and (c) secondary rearrangements occur at the light chain level with at least three plasmacytomas expressing both κ and λ light chain genes. These results suggest that plasmacytomas use a restricted population of B cells that may still be undergoing rearrangement, thereby bypassing the allelic exclusion normally associated with expression of antibody genes. PMID:10562316

  2. Partial deletion of beta9 loop in pancreatic lipase-related protein 2 reduces enzyme activity with a larger effect on long acyl chain substrates.

    PubMed

    Dridi, Kaouthar; Amara, Sawsan; Bezzine, Sofiane; Rodriguez, Jorge A; Carrière, Frédéric; Gaussier, Hélène

    2013-07-01

    Structural studies on pancreatic lipase have revealed a complex architecture of surface loops surrounding the enzyme active site and potentially involved in interactions with lipids. Two of them, the lid and beta loop, expose a large hydrophobic surface and are considered as acyl chain binding sites based on their interaction with an alkyl phosphonate inhibitor. While the role of the lid in substrate recognition and selectivity has been extensively studied, the implication of beta9 loop in acyl chain stabilization remained hypothetical. The characterization of an enzyme with a natural deletion of the lid, guinea pig pancreatic lipase-related protein 2 (GPLRP2), suggests however an essential contribution of the beta9 loop in the stabilization of the acyl enzyme intermediate formed during the lipolysis reaction. A GPLRP2 mutant with a seven-residue deletion of beta9 loop (GPLRP2-deltabeta9) was produced and its enzyme activity was measured using various substrates (triglycerides, monoglycerides, galactolipids, phospholipids, vinyl esters) with short, medium and long acyl chains. Whatever the substrate tested, GPLRP2-deltabeta9 activity is drastically reduced compared to that of wild-type GPLRP2 and this effect is more pronounced as the length of substrate acyl chain increases. Changes in relative substrate selectivity and stereoselectivity remained however weak. The deletion within beta9 loop has also a negative effect on the rate of enzyme inhibition by alkyl phosphonates. All these findings indicate that the reduced enzyme turnover observed with GPLRP2-deltabeta9 results from a weaker stabilization of the acyl enzyme intermediate due to a loss of hydrophobic interactions. PMID:24046870

  3. Activity of proximal promoter of the human beta(1)-integrin gene was increased in Sézary syndrome.

    PubMed

    Paulin, Y; Boukhelifa, M; Derappe, C; Giner, M; Font, J; Aubery, M

    2001-06-01

    Changes in beta1-integrin expression have been involved in abnormal cellular interactions between malignant lymphocytes from Sézary (Sz) patients and keratinocytes. In this paper, we compare the activity of both distal and proximal promoters of the beta1-integrin gene in malignant lymphocytes from Sz patients with human normal lymphocytes. Activity of both beta1-integrin promoters was also analysed in human normal keratinocytes. Northern blot analysis shows that beta1-integrin mRNA expression is higher in malignant Sz lymphocytes than in normal lymphocytes. CAT assays show that the activity of proximal beta1-integrin promoter is markedly increased (up to 6-fold) in malignant lymphocytes from Sz patients, in comparison to normal lymphocytes. These results suggest that changes in activity of the proximal promoter of beta1-integrin subunit could be, in part, responsible for the abnormal cellular interactions between malignant lymphocytes and keratinocytes observed in Sz syndrome.

  4. High divergence in primate-specific duplicated regions: Human and chimpanzee Chorionic Gonadotropin Beta genes

    PubMed Central

    2008-01-01

    Background Low nucleotide divergence between human and chimpanzee does not sufficiently explain the species-specific morphological, physiological and behavioral traits. As gene duplication is a major prerequisite for the emergence of new genes and novel biological processes, comparative studies of human and chimpanzee duplicated genes may assist in understanding the mechanisms behind primate evolution. We addressed the divergence between human and chimpanzee duplicated genomic regions by using Luteinizing Hormone Beta (LHB)/Chorionic Gonadotropin Beta (CGB) gene cluster as a model. The placental CGB genes that are essential for implantation have evolved from an ancestral pituitary LHB gene by duplications in the primate lineage. Results We shotgun sequenced and compared the human (45,165 bp) and chimpanzee (39,876 bp) LHB/CGB regions and hereby present evidence for structural variation resulting in discordant number of CGB genes (6 in human, 5 in chimpanzee). The scenario of species-specific parallel duplications was supported (i) as the most parsimonious solution requiring the least rearrangement events to explain the interspecies structural differences; (ii) by the phylogenetic trees constructed with fragments of intergenic regions; (iii) by the sequence similarity calculations. Across the orthologous regions of LHB/CGB cluster, substitutions and indels contributed approximately equally to the interspecies divergence and the distribution of nucleotide identity was correlated with the regional repeat content. Intraspecies gene conversion may have shaped the LHB/CGB gene cluster. The substitution divergence (1.8–2.59%) exceeded two-three fold the estimates for single-copy loci and the fraction of transversional mutations was increased compared to the unique sequences (43% versus ~30%). Despite the high sequence identity among LHB/CGB genes, there are signs of functional differentiation among the gene copies. Estimates for dn/ds rate ratio suggested a purifying

  5. Nuclear orphan receptor TLX affects gene expression, proliferation and cell apoptosis in beta cells.

    PubMed

    Shi, Xiaoli; Xiong, Xiaokan; Dai, Zhe; Deng, Haohua; Sun, Li; Hu, Xuemei; Zhou, Feng; Xu, Yancheng

    Nuclear orphan receptor TLX is an essential regulator of the growth of neural stem cells. However, its exact function in pancreatic islet cells is still unknown. In the present study, gene expression profiling analysis revealed that overexpression of TLX in beta cell line MIN6 causes suppression of 176 genes and upregulation of 49 genes, including a cadre of cell cycle, cell proliferation and cell death control genes, such as Btg2, Ddit3 and Gadd45a. We next examined the effects of TLX overexpression on proliferation, apoptosis and insulin secretion in MIN6 cells. Proliferation analysis using EdU assay showed that overexpression of TLX increased percentage of EdU-positive cells. Cell cycle and apoptosis analysis revealed that overexpression of TLX in MIN6 cells resulted in higher percentage of cells exiting G1 into S-phase, and a 58.8% decrease of cell apoptosis induced by 0.5 mM palmitate. Moreover, TLX overexpression did not cause impairment of insulin secretion. Together, we conclude that TLX is among factors capable of controlling beta cell proliferation and survival, which may serve as a target for the development of novel therapies for diabetes.

  6. A Putatively Functional Haplotype in the Gene Encoding Transforming Growth Factor Beta-1 as a Potential Biomarker for Radiosensitivity

    SciTech Connect

    Schirmer, Markus A.; Brockmoeller, Juergen; Rave-Fraenk, Margret; Virsik, Patricia; Wilken, Barbara; Kuehnle, Elna; Campean, Radu; Hoffmann, Arne O.; Mueller, Katarina; Goetze, Robert G.; Neumann, Michael; Janke, Joerg H.; Nasser, Fatima; Wolff, Hendrik A.; Ghadimi, B. Michael; Schmidberger, Heinz; Hess, Clemens F.; Christiansen, Hans; Hille, Andrea

    2011-03-01

    Purpose: To determine whether genetic variability in TGFB1 is related to circulating transforming growth factor-{beta}1 (TGF-{beta}1) plasma concentrations after radiotherapy and to radiosensitivity of lymphoid cells. Patients and Methods: Transforming growth factor-{beta}1 plasma concentrations (n = 79) were measured in patients 1 year after radiotherapy and chromosomal aberrations (n = 71) ex vivo before therapy start. Furthermore, TGF-{beta}1 secretion and apoptosis were measured in isolated peripheral blood mononuclear cells of 55 healthy volunteers. These phenotypes were analyzed in relation to five germline polymorphisms in the 5' region of the TGFB1 gene. Because of high linkage disequilibrium, these five polymorphisms reflect frequent genetic variation in this region. A presumed impact of TGF-{beta}1 on DNA damage or repair was measured as micronucleus formation in 30 lymphoblastoid cell lines. Results: We identified a hypofunctional genetic haplotype termed H3 tagging the 5' region of the TGFB1 gene encoding TGF-{beta}1. H3 was associated with lower TGF-{beta}1 plasma concentrations in patients (p = 0.01) and reduced TGF-{beta}1 secretion in irradiated peripheral blood mononuclear cells (p = 0.003). Furthermore, cells with H3 were less prone to induction of chromosomal aberrations (p = 0.001) and apoptosis (p = 0.003) by irradiation. The hypothesis that high TGF-{beta}1 could sensitize cells to DNA damage was further supported by increased micronuclei formation in 30 lymphoblastoid cell lines when preincubated with TGF-{beta}1 before irradiation (p = 0.04). Conclusions: On the basis of TGF-{beta}1 plasma levels and radiation sensitivity of lymphoid cells, this study revealed a putatively hypofunctional TGFB1 haplotype. The significance of this haplotype and the suggested link between TGF-{beta}1 function and DNA integrity should be further explored in other cell types, as well as other experimental and clinical conditions.

  7. Characterization of the CaENG1 gene encoding an endo-1,3-beta-glucanase involved in cell separation in Candida albicans.

    PubMed

    Esteban, Pedro Felipe; Ríos, Inmaculada; García, Raúl; Dueñas, Encarnación; Plá, Jesús; Sánchez, Miguel; de Aldana, Carlos R Vázquez; Del Rey, Francisco

    2005-12-01

    The Candida albicans CaENG1 gene encoding an endo-1,3-beta-glucanase was cloned by screening a genomic library with a DNA probe obtained by polymerase chain reaction using synthetic oligonucleotides designed according to conserved regions found between two Saccharomyces cerevisiae endo-1,3-beta-glucanases (Eng1p and Eng2p). The gene contains a 3435-bp open reading frame (ORF), capable of encoding a protein of 1145 amino acids (124,157 Da), that contains no introns. Comparison of the ScEng1p sequence with partial C. albicans genomic sequences revealed the presence of a second protein with sequence similarity (the product of the Ca20C1.22c ORF, which was named CaENG2). Disruption of the CaENG1 gene in C. albicans had no dramatic effects on the growth rate of the strains, but it resulted in the formation of chains of cells, suggesting that the protein is involved in cell separation. Expression of CaENG1 in S. cerevisiae cells afforded a 12-fold increase in the 1,3-beta-glucanase activity detected in culture supernatants, showing that the protein has similar enzymatic activity to that of the S. cerevisiae Eng1p. In addition, when the C. albicans protein was expressed under its native promoter in S. cerevisiae eng1 mutant cells, it was able to complement the separation defect of this mutant, indicating that these two proteins are true functional homologues.

  8. Hb O-Tibesti [beta121(GH4)Glu-->Lys; beta11(A8)Val-->Ile], a hemoglobin variant carrying in the same beta chain the substitutions of Hb O-Arab and Hb Hamilton, found in combination with Hb S [beta6(A3)Glu-->Val].

    PubMed

    Préhu, Claude; Riou, Jean; Sartelet, Isabelle; Promé, Danielle; Claparols, Catherine; Denier, Mathias; Motte, Jacques; Galactéros, Frederic; Wajcman, Henri

    2002-02-01

    Hb O-Tibesti, carries in the same chain the substitution of Hb O-Arab [beta121(GH4)Glu-->Lys] and that of Hb Hamilton [beta11(A8)Val-->Ile]. Hb O-Tibesti may be distinguished from Hb O-Arab by polyacrylamide gel electrophoresis in the presence of urea and Triton-X100, and by reversed phase high performance liquid chromatography. It was found in a compound heterozygous condition with Hb S [beta6(A3)Glu-->Val] in a child of Chad-Sudanese descent, suffering from a sickle cell syndrome. Compared to the classical description of the Hb S/Hb O-Arab association, the additional Hb Hamilton mutation does not seem to modify the clinical presentation. PMID:11939508

  9. T cell receptor V beta gene usage in a human alloreactive response. Shared structural features among HLA-B27-specific T cell clones

    PubMed Central

    1990-01-01

    A strategy, based on using V beta family-specific oligonucleotides, was developed for specific amplification and direct sequencing of human TCR V beta genes. With this strategy, it was possible to undertake a structural analysis of TCRs from human T cell clones in specific responses. 12 HLA-B27-specific cytotoxic clones were examined. The results reveal a nonrandom use of V beta gene diversity in this alloreactive response in that: (a) the clones express a restricted number of V beta segments, including a subset of V beta families that are significantly more related to one another than to most other V beta families; (b) five of seven clones having a particular reaction pattern with HLA-B27 subtypes possess Alanine at the D-J junction; and (c) identical J beta segments are found associated in several instances with identical or highly homologous V beta gene segments. In addition, two new V beta 13 members are reported. PMID:1691261

  10. An extracytoplasmic function sigma factor controls beta-lactamase gene expression in Bacillus anthracis and other Bacillus cereus group species.

    PubMed

    Ross, Cana L; Thomason, Kerrie S; Koehler, Theresa M

    2009-11-01

    The susceptibility of most Bacillus anthracis strains to beta-lactam antibiotics is intriguing considering that the closely related species Bacillus cereus and Bacillus thuringiensis typically produce beta-lactamases and the B. anthracis genome harbors two beta-lactamase genes, bla1 and bla2. We show that beta-lactamase activity associated with B. anthracis is affected by two genes, sigP (BA2502) and rsiP (BA2503), predicted to encode an extracytoplasmic function sigma factor and an anti-sigma factor, respectively. Deletion of the sigP-rsiP locus abolished beta-lactamase activity in a naturally occurring penicillin-resistant strain and had no effect on beta-lactamase activity in a prototypical penicillin-susceptible strain. Complementation with sigP and rsiP from the penicillin-resistant strain, but not with sigP and rsiP from the penicillin-susceptible strain, conferred constitutive beta-lactamase activity in both mutants. These results are attributed to a nucleotide deletion near the 5' end of rsiP in the penicillin-resistant strain that is predicted to result in a nonfunctional protein. B. cereus and B. thuringiensis sigP and rsiP homologues are required for inducible penicillin resistance in these species. Expression of the B. cereus or B. thuringiensis sigP and rsiP genes in a B. anthracis sigP-rsiP-null mutant confers inducible production of beta-lactamase activity, suggesting that while B. anthracis contains the genes necessary for sensing beta-lactam antibiotics, the B. anthracis sigP and rsiP gene products are not sufficient for bla induction. PMID:19717606

  11. A pseudodeficiency allele (D152N) of the human {beta}-glucuronidase gene

    SciTech Connect

    Vervoort, R.; Liebaers, I.; Lissens, W.

    1995-10-01

    We present evidence that a 480G{r_arrow}A transition in the coding region of the {Beta}glucuronidase gene, which results in an aspartic-acid-to-asparagine substitution at amino acid position 152 (D152N), produces a pseudodeficiency allele (GUSBp) that leads to greatly reduced levels of {Beta}-glucuronidase activity without apparent deleterious consequences. The 48OG{r_arrow}A mutation was found initially in the pseudodeficient mother of a child with mucopolysaccharidosis VII (MPSVII), but it was not on her disease-causing allele, which carried the L176F mutation. The 480G{r_arrow}A change was also present in an unrelated individual with another MPSVII allele who had unusually low {Beta}-glucuronidase activity, but whose clinical symptoms were probably unrelated to {Beta}-glucuronidase deficiency. This individual also had an R357X mutation, probably on his second allele. We screened 100 unrelated normal individuals for the 480G{r_arrow}A mutation with a PCR method and detected one carrier. Reduced {Beta}-glucuronidase activity following transfection of COS cells with the D152N cDNA supported the causal relationship between the D152N allele and pseudodeficiency. The mutation reduced the fraction of expressed enzyme that was secreted. Pulse-chase experiments indicated that the reduced activity in COS cells was due to accelerated intracellular turnover of the D152N enzyme. They also suggested that a potential glycosylation site created by the mutation is utilized in {approximately}50% of the enzyme expressed. 25 refs., 3 figs., 3 tabs.

  12. Assignment of human {alpha}-synuclein (SNCA) and {beta}-synuclein (SNCB) genes to chromosomes 4q21 and 5q35

    SciTech Connect

    Spillantini, M.G.; Goedert, M.; Divane, A.

    1995-05-20

    The authors previously identified two human brain proteins of 140 and 134 amino acids by virtue of their reactivity with a monoclonal antibody raised against a tangle preparation from Alzheimer disease brain. The 140-amino-acid protein is homologous to synuclein from Torpedo electroplaques and rat brain and identical to the precursor of the non-A{beta} component of Alzheimer disease amyloid plaques. The 134-amino-acid protein is homologous to bovine phosphoneuroprotein 14. In view fo the fact that both proteins are 61% identical in sequence, they have called them {alpha}-synuclein and {beta}-synuclein, respectively. Both proteins are present in nerve terminals, where they may be involved in the events mediating exocytosis of synaptic vesicles following nerve stimulation. They have now determined the chromosomal localizations of the {alpha}-synuclein and {beta}-synuclein genes. To map the two genes analyzed a panel of monochromosomal human-rodent somatic cell hybride by polymerase chain reaction and performed fluorescence in situ hybridization on metaphase spreads f human chromosomes.

  13. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  14. Stimulation of mouse lymphocytes by a mitogen derived from Mycoplasma arthritidis. VII. Responsiveness is associated with expression of a product(s) of the V beta 8 gene family present on the T cell receptor alpha/beta for antigen.

    PubMed

    Cole, B C; Kartchner, D R; Wells, D J

    1989-06-15

    Mycoplasma arthritidis produces a potent soluble T lymphocyte mitogen (MAM) which is dependent upon accessory cells bearing the alpha-chain of the I-E molecule (E alpha). Lymphocytes from the RIIIS mouse strain which possess E alpha yet whose T cells fail to recognize the MAM-E alpha complex were shown not to express V beta 8.1, 8.2 or 8.3 gene products present on the TCR-alpha/beta by virtue of their lack of reactivity with the F23.1 mAb. Because lymphocytes from the congenic B10.RIII mouse strain reacted positively with F23.1, we examined the progeny from (RIIIS x B10.RIII)F1 x RIIIS backcross mice for cosegregation of lymphocytes expressing F23.1-reactive sites and ability to proliferate in response to MAM. Whereas lymphocytes of all mice responded to Con A, only lymphocytes from progeny expressing F23.1-reactive cells responded to MAM. Similar studies were conducted on progeny from the F23.1- SWR mouse which was backcrossed to (SWR x B10.RIII)F1 mice. Of the E alpha-bearing progeny, there was a direct correlation between lymphocyte expression of F23.1 determinants and ability to respond to MAM. These results established that MAM reactivity was dependent upon a product(s) of the V beta locus of the TCR-alpha/beta. Nodal and thymic lymphocytes cultured for 3 days in vitro with MAM exhibited clonal expansion of F23.1 and F23.2-reactive cells as compared with cultures treated with Con A. We also demonstrated that F23.1 and F23.2 mAb inhibited the ability of lymphocytes to proliferate in response to MAM but had little effect on responses to Con A. The combined data suggest that the MAM-E alpha complex can utilize a V beta 8 gene product(s) on the TCR-alpha/beta.

  15. A second gene for cerulean cataracts maps to the {beta} crystallin region on chromosome 22

    SciTech Connect

    Kramer, P.; Yount, J.; Lovrien, E.

    1996-08-01

    Cogenital cataracts are one of the most common major eye abnormalities and often lead to blindness in infants. At least a third of all cases are familial. Within this group, highly penetrant, autosomal dominant forms of congenital cataracts (ADCC) are most common. ADCC is a genetically heterogeneous group of disorders, in which at least eight different loci have been identified for nine clinically distinct forms. Among these, Armitage et al. mapped a gene for cerulean blue cataracts to chromosome 17q24. Bodker et al. described a large family with cerulean blue cataracts, in which the affected daughter of affected first cousins was presumed to be homozygous for the purported gene. We report linkage in this family to the region on chromosome 22q that includes two {beta} crystallin genes (CRYBB2, CRYBB3) and one pseudogene (CRYBB2P1). The affected female in question is homozygous at all markers. 25 refs., 1 fig., 1 tab.

  16. Gene expression responses of European flounder (Platichthys flesus) to 17-beta estradiol.

    PubMed

    Williams, Tim D; Diab, Amer M; George, Stephen G; Sabine, Victoria; Chipman, James K

    2007-02-01

    Male European flounder (Platichthys flesus) were intraperitoneally injected with 10mg/kg 17-beta estradiol and tissues taken from individuals over a timecourse of 16 days. The GENIPOL P. flesus cDNA microarray was employed to detect hepatic gene expression differences between fish treated with estradiol and saline controls. Known biomarkers of estrogen exposure, choriogenin L and vitellogenins, showed sustained induction over the time-course. Among 175 identified clones showing sustained statistically significant induction or repression, those associated with the Gene Ontology terms mitochondria, amino acid synthesis, ubiquitination and apoptosis were included amongst those induced while those associated with immune function, electron transport, cell signalling and protein phosphorylation were repressed. Thus, we show the gene expression response of an environmentally relevant fish species to a high dose of an estrogenic endocrine disruptor and also report the sequencing of a further 2121 flounder ESTs.

  17. Effects of different activity and inactivity paradigms on myosin heavy chain gene expression in striated muscle

    NASA Technical Reports Server (NTRS)

    Baldwin, K. M.; Haddad, F.

    2001-01-01

    The goal of this mini-review is to summarize findings concerning the role that different models of muscular activity and inactivity play in altering gene expression of the myosin heavy chain (MHC) family of motor proteins in mammalian cardiac and skeletal muscle. This was done in the context of examining parallel findings concerning the role that thyroid hormone (T(3), 3,5,3'-triiodothyronine) plays in MHC expression. Findings show that both cardiac and skeletal muscles of experimental animals are initially undifferentiated at birth and then undergo a marked level of growth and differentiation in attaining the adult MHC phenotype in a T(3)/activity level-dependent fashion. Cardiac MHC expression in small mammals is highly sensitive to thyroid deficiency, diabetes, energy deprivation, and hypertension; each of these interventions induces upregulation of the beta-MHC isoform, which functions to economize circulatory function in the face of altered energy demand. In skeletal muscle, hyperthyroidism, as well as interventions that unload or reduce the weight-bearing activity of the muscle, causes slow to fast MHC conversions. Fast to slow conversions, however, are seen under hypothyroidism or when the muscles either become chronically overloaded or subjected to intermittent loading as occurs during resistance training and endurance exercise. The regulation of MHC gene expression by T(3) or mechanical stimuli appears to be strongly regulated by transcriptional events, based on recent findings on transgenic models and animals transfected with promoter-reporter constructs. However, the mechanisms by which T(3) and mechanical stimuli exert their control on transcriptional processes appear to be different. Additional findings show that individual skeletal muscle fibers have the genetic machinery to express simultaneously all of the adult MHCs, e.g., slow type I and fast IIa, IIx, and IIb, in unique combinations under certain experimental conditions. This degree of

  18. Generation of a high-titer retroviral vector capable of expressing high levels of the human beta-globin gene.

    PubMed Central

    Sadelain, M; Wang, C H; Antoniou, M; Grosveld, F; Mulligan, R C

    1995-01-01

    Retrovirus-mediated gene transfer into hematopoietic cells may provide a means of treating both inherited and acquired diseases involving hematopoietic cells. Implementation of this approach for disorders resulting from mutations affecting the beta-globin gene (e.g., beta-thalassemia and sickle cell anemia), however, has been hampered by the inability to generate recombinant viruses able to efficiently and faithfully transmit the necessary sequences for appropriate gene expression. We have addressed this problem by carefully examining the interactions between retroviral and beta-globin gene sequences which affect vector transmission, stability, and expression. First, we examined the transmission properties of a large number of different recombinant proviral genomes which vary both in the precise nature of vector, beta-globin structural gene, and locus control region (LCR) core sequences incorporated and in the placement and orientation of those sequences. Through this analysis, we identified one specific vector, termed M beta 6L, which carries both the human beta-globin gene and core elements HS2, HS3, and HS4 from the LCR and faithfully transmits recombinant proviral sequences to cells with titers greater than 10(6) per ml. Populations of murine erythroleukemia (MEL) cells transduced by this virus expressed levels of human beta-globin transcript which, on a per gene copy basis, were 78% of the levels detected in an MEL-derived cell line, Hu11, which carries human chromosome 11, the site of the beta-globin locus. Analysis of individual transduced MEL cell clones, however, indicated that, while expression was detected in every clone tested (n = 17), the levels of human beta-globin treatment varied between 4% and 146% of the levels in Hu11. This clonal variation in expression levels suggests that small beta-globin LCR sequences may not provide for as strict chromosomal position-independent expression of beta-globin as previously suspected, at least in the context of

  19. Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A beta-lactamase isolated from Escherichia coli.

    PubMed Central

    Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H

    1995-01-01

    Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes

  20. Alternative splicing of the beta A4 amyloid gene of Alzheimer's disease in cortex of control and Alzheimer's disease patients.

    PubMed

    König, G; Salbaum, J M; Wiestler, O; Lang, W; Schmitt, H P; Masters, C L; Beyreuther, K

    1991-02-01

    An S1 nuclease protection assay was designed to study the splicing pattern of the alternatively spliced beta A4 amyloid gene (APP gene) of Alzheimer's disease (AD). We determined the splicing pattern of the APP gene in fetal, adult, aged adult and AD human cortex. The results suggest that alternative splicing of the APP gene in AD is not significantly different from age-matched controls, but distinct from the developing fetal brain.

  1. Cationic amphiphiles with fatty acyl chain asymmetry of coconut oil deliver genes selectively to mouse lung.

    PubMed

    Chandrashekhar, Voshavar; Srujan, Marepally; Prabhakar, Rairala; Reddy, Rakesh C; Sreedhar, Bojja; Rentam, Kiran K R; Kanjilal, Sanjit; Chaudhuri, Arabinda

    2011-03-16

    Recent structure-activity studies have revealed a dramatic influence of hydrophobic chain asymmetry in enhancing gene delivery efficacies of synthetic cationic amphiphiles (Nantz, M. H. et al. Mol. Pharmaceutics2010, 7, 786-794; Koynova, R. et al. Mol. Pharmaceutics2009, 6, 951-958). The present findings demonstrate for the first time that such a transfection enhancing influence of asymmetric hydrocarbon chains observed in pure synthetic cationic amphiphiles also works for cationic amphiphiles designed with natural, asymmetric fatty acyl chains of a food-grade oil. Herein, we demonstrate that cationic amphiphiles designed with the natural fatty acyl chain asymmetry of food-grade coconut oil are less cytotoxic and deliver genes selectively to mouse lung. Despite lauroyl chains being the major fatty acyl chains of coconut oil, both the in vitro and In vivo gene transfer efficiencies of such cationic amphiphiles were found to be remarkably superior (>4-fold) to those of their pure dilauroyl analogue. Mechanistic studies involving the technique of fluorescence resonance energy transfer (FRET) revealed higher biomembrane fusibility of the cationic liposomes of the coconut amphiphiles than that of the symmetric dilauroyl analogue. AFM study revealed pronounced fusogenic nonlamellar structures of the liposomes of coconut amphiphiles. Findings in the FRET and cellular uptake study, taken together, support the notion that the higher cellular uptake resulting from the more fusogenic nature of the liposomes of coconut amphiphiles 1 are likely to play a dominant role in making the coconut amphiphiles transfection competent.

  2. Identification and characteristic analysis of the ampC gene encoding beta-lactamase from Vibrio fischeri.

    PubMed

    Weng, Shu-Fen; Chao, Yuh-Fen; Lin, Juey-Wen

    2004-02-13

    Vibrio fischeri ATCC 7744 is an ampicillin resistant (Amp(r)) marine luminous bacterium. The MIC test indicates that V. fischeri is highly resistant to penicillins, and susceptible to cephalosporins. V. fischeri ampC gene was cloned and identified. Nucleotide sequence of an unidentified ufo gene and the ampC, ppiB genes (GenBank Accession No. AY438037) has been determined; whereas the ampC gene encodes the beta-lactamase (AmpC) and the ppiB gene encodes the peptidyl-prolyl cis-trans isomerase B. Alignment and comparison show that V. fischeri beta-lactamase is homologous to the related species'. The specific amino acid residues STFK (62nd to 65th), SDN (122nd to 124th), and D (155th) located 34 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. V. fischeri ampC gene encoding beta-lactamase has a calculated M(r) 31,181 and comprises 283 amino acid residues (pI 5.35). There is a signal peptide of 18 amino acid residues MKIKPFLFGLIVLANNAI in the pro-beta-lactamase, which functioned for secretion; thus, the matured protein only has M(r) 29,197 and comprises 265 amino acid residues (pI 4.95). SDS-PAGE and the beta-lactamase functional assays elicit that the M(r) of the beta-lactamases are close to 29kDa. IEF and the beta-lactamase functional assays show that the beta-lactamases' pI are close to 4.8 as predicted. The results elucidate that V. fischeri ampC gene and the cloned ampC gene in Escherichia coli are the same one. The gene order of the ampC and the related genes is -ufo-(P*-intern)-ampC-ppiB--> (P*-intern: intern promoter for sub-regulation), whereas the P*-intern promoter displays the function to lead the ampC gene's expression for stress response. PMID:14741712

  3. Structure of epiglucan, a highly side-chain/branched (1 --> 3;1 --> 6)-beta-glucan from the micro fungus Epicoccum nigrum Ehrenb. ex Schlecht.

    PubMed

    Schmid, F; Stone, B A; McDougall, B M; Bacic, A; Martin, K L; Brownlee, R T; Chai, E; Seviour, R J

    2001-03-22

    The extracellular fungal polysaccharide, epiglucan, synthesised by Epicoccum nigrum is a side-chain/branched (1 --> 3;1 --> 6)-D-beta-glucan. Methylation analysis, 13C DEPT NMR and specific enzymic digestion data show slight variation in branching frequency among the epiglucans from the three strains examined. The (1 --> 3)-beta-linked backbone has (1 --> 6)-beta-linked branches at frequencies greater than the homologous glucans, scleroglucan and schizophyllan, from Sclerotium spp. and Schizophyllum commune, respectively. The structural analyses do not allow a distinction to be made between structures I and II. [structures: see text] Epiglucan displays non-Newtonian shear thinning rheological properties, typical of these glucans. PMID:11322730

  4. Sickle cell anemia: beta s-gene-cluster haplotypes as prognostic indicators of vital organ failure.

    PubMed

    Powars, D R

    1991-07-01

    Identification of the beta s-gene-cluster haplotype and alpha-gene status provide a useful tool to improve the possibility for early detection in high-risk SS patients. The DNA polymorphisms of the beta s-gene-cluster modify the clinical course in sickle cell anemia especially as it involves the risk of end-stage organ failure of the kidney, lung, and brain. In both Africa and America, the CAR beta s haplotype increases the risk of developing irreversible complications at an early age. The degree of anemia, the Hb F concentration, and the preservation (or lack thereof) of G gamma Hb F is haplotype dependent and correlates with the overall clinical course of the patient. Further modulation of the clinical course by the coinheritance of alpha-thalassemia-2 tends to decrease the risk of soft tissue organ failure but increases the risk of osteonecrosis. A single individual can be expected to fit into the overall pattern. Some sickle related illness will eventually occur in all patients. In the presence of a Senegal haplotype, the patient's health is better, with the CAR haplotype it is always worse; severity is intermediate in the Benin. These genetic markers can be used to identify the endangered patient before the onset of irreversible major organ failure. The high risk SS patient with a CAR chromosome or one who is homozygous Ben without alpha-thalassemia-2 should be monitored closely for evidence of vasculopathy-induced microinfarction of the brain, kidneys, or lungs. Such a patient needs preventive therapy before suffering a major hemisphere stroke, losing kidney function, or developing cor pulmonale secondary to restrictive lung disease.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. Double gene deletion reveals the lack of cooperation between PPAR{alpha} and PPAR{beta} in skeletal muscle

    SciTech Connect

    Bedu, E.; Desplanches, D.; Pequignot, J.; Bordier, B.; Desvergne, B. . E-mail: beatrice.desvergne@unil.ch

    2007-06-15

    The peroxisome proliferator-activated receptors (PPARs) are involved in the regulation of most of the pathways linked to lipid metabolism. PPAR{alpha} and PPAR{beta} isotypes are known to regulate muscle fatty acid oxidation and a reciprocal compensation of their function has been proposed. Herein, we investigated muscle contractile and metabolic phenotypes in PPAR{alpha}-/-, PPAR{beta}-/-, and double PPAR{alpha}-/- {beta}-/- mice. Heart and soleus muscle analyses show that the deletion of PPAR{alpha} induces a decrease of the HAD activity ({beta}-oxidation) while soleus contractile phenotype remains unchanged. A PPAR{beta} deletion alone has no effect. However, these mild phenotypes are not due to a reciprocal compensation of PPAR{beta} and PPAR{alpha} functions since double gene deletion PPAR{alpha}-PPAR{beta} mostly reproduces the null PPAR{alpha}-mediated reduced {beta}-oxidation, in addition to a shift from fast to slow fibers. In conclusion, PPAR{beta} is not required for maintaining skeletal muscle metabolic activity and does not compensate the lack of PPAR{alpha} in PPAR{alpha} null mice.

  6. Developmental regulation of {beta}-hexosaminidase {alpha}- and {beta}-subunit gene expression in the rat reproductive system

    SciTech Connect

    Trasler, J.M.; Wakamatsu, N.; Gravel, R.A.; Benoit, G.

    1994-09-01

    {beta}-Hexosaminidase is an essential lysosomal enzyme whose absence in man results in a group of disorders, the G{sub M2} gangliosidoses. Enzyme activity for {beta}-hexosaminidase is many fold higher in the epididymis than in other tissues, is present in sperm and is postulated to be required for mammalian fertilization. To better understand how {beta}-hexosaminidase is regulated in the reproductive system, we quantitated the mRNA expression of the {alpha}- and {beta}-subunits (Hex {alpha} and Hex {beta}) of the enzyme in the developing rat testis and epididymis. Hex {alpha} mRNA was differentially expressed and abundant in adult rat testis and epididymis, 13- and 2-fold brain levels, respectively. In contrast, Hex {beta} mRNA levels in the testis and epididymis were .3- and 5-fold brain levels. Within the epididymis both Hex {alpha} and Hex {beta} mRNA concentrations were highest in the corpus, 1.5-fold and 9-fold initial segment values, respectively. During testis development from 7-91 days of age, testis levels of Hex {alpha} mRNA increased 10-fold and coincided with the appearance of spermatocytes and spermatids in the epithelium. In isolated male germ cells, Hex {alpha} expression was most abundant in haploid round spermatids. Hex {alpha} mRNA was undetectable after hypophysectomy and returned to normal after testosterone administration and the return of advanced germ cells to the testis. Hex {beta} mRNA was expressed at constant low levels throughout testis development. In the caput-corpus and cauda regions of the epididymis Hex {alpha} mRNA levels increased 2-fold between 14 and 91 days; during the same developmental period epididymal Hex {beta} mRNA levels increased dramatically, by 10-20 fold. In summary, Hex {alpha} and Hex {beta} mRNAs are differentially and developmentally expressed at high levels in the rat testis and epididymis and augur for an important role for {beta}-hexosaminidase in normal male reproductive function.

  7. Carbachol ameliorates lipopolysaccharide-induced intestinal epithelial tight junction damage by down-regulating NF-{kappa}{beta} and myosin light-chain kinase pathways

    SciTech Connect

    Zhang, Ying; Li, Jianguo

    2012-11-16

    Highlights: Black-Right-Pointing-Pointer Carbachol reduced the lipopolysaccharide-induced intestinal barrier breakdown. Black-Right-Pointing-Pointer Carbachol ameliorated the lipopolysaccharide-induced ileal tight junction damage. Black-Right-Pointing-Pointer Carbachol prevented the LPS-induced NF-{kappa}{beta} and myosin light-chain kinase activation. Black-Right-Pointing-Pointer Carbachol exerted its beneficial effects in an {alpha}7 nicotinic receptor-dependent manner. -- Abstract: Carbachol is a cholinergic agonist that protects the intestines after trauma or burn injury. The present study determines the beneficial effects of carbachol and the mechanisms by which it ameliorates the lipopolysaccharide (LPS)-induced intestinal barrier breakdown. Rats were injected intraperitoneally with 10 mg/kg LPS. Results showed that the gut barrier permeability was reduced, the ultrastructural disruption of tight junctions (TJs) was prevented, the redistribution of zonula occludens-1 and claudin-2 proteins was partially reversed, and the nuclear factor-kappa beta (NF-{kappa}{beta}) and myosin light-chain kinase (MLCK) activation in the intestinal epithelium were suppressed after carbachol administration in LPS-exposed rats. Pretreatment with the {alpha}7 nicotinic acetylcholine receptor ({alpha}7nAchR) antagonist {alpha}-bungarotoxin blocked the protective action of carbachol. These results suggested that carbachol treatment can protect LPS-induced intestinal barrier dysfunction. Carbachol exerts its beneficial effect on the amelioration of the TJ damage by inhibiting the NF-{kappa}{beta} and MLCK pathways in an {alpha}7nAchR-dependent manner.

  8. Positive and negative selection in the beta-esterase gene cluster of the Drosophila melanogaster subgroup.

    PubMed

    Balakirev, Evgeniy S; Anisimova, Maria; Ayala, Francisco J

    2006-04-01

    We examine the pattern of molecular evolution of the beta-esterase gene cluster, including the Est-6 and psiEst-6 genes, in eight species of the Drosophila melanogaster subgroup. Using maximum likelihood estimates of nonsynonymous/synonymous rate ratios, we show that the majority of Est-6 sites evolves under strong (48% of sites) or moderate (50% of sites) negative selection and a minority of sites (1.5%) is under significant positive selection. Est-6 sites likely to be under positive selection are associated with increased intraspecific variability. One positively selected site is responsible for the EST-6 F/S allozyme polymorphism; the same site is responsible for the EST-6 functional divergence between species of the melanogaster subgroup. For psiEst-6 83.7% sites evolve under negative selection, 16% sites evolve neutrally, and 0.3% sites are under positive selection. The positively selected sites of psiEst-6 are located at the beginning and at the end of the gene, where there is reduced divergence between D. melanogaster and D. simulans; these regions of psiEst-6 could be involved in regulation or some other function. Branch-site-specific analysis shows that the evolution of the melanogaster subgroup underwent episodic positive selection. Collating the present data with previous results for the beta-esterase genes, we propose that positive and negative selection are involved in a complex relationship that may be typical of the divergence of duplicate genes as one or both duplicates evolve a new function.

  9. Interaction of CCAAT/enhancer-binding protein alpha and beta with the rat caeruloplasmin gene promoter.

    PubMed Central

    Bingle, C D; Fleming, R E; Gitlin, J D

    1993-01-01

    To determine the mechanisms of expression of the rat caeruloplasmin gene, the promoter region was analysed by DNAase I footprinting. Using nuclear extract from rat liver, a prominent site of protein-DNA interaction was detected from -93 to -48 upstream of the caeruloplasmin gene transcription start and sequence analysis of this region revealed three potential CCAAT/enhancer-binding protein (C/EBP) consensus elements. Mobility-shift analysis using an oligonucleotide encoding this region identified specific binding of proteins from rat liver nuclear extract, and some of these complexes were supershifted using antisera to the C/EBP alpha and beta family members. Mobility-shift studies using a polypeptide encoding the DNA-binding domain of C/EBP alpha also revealed a specific interaction with this region of the caeruloplasmin promoter, and DNAase I footprinting using this polypeptide protected the identical region from -93 to -48. Co-transfection of expression plasmids encoding C/EBP alpha or a related leucine-zipper factor D-binding protein (DBP) revealed a C/EBP-specific increase in reporter gene activity in HepG2 cells transfected with caeruloplasmin-chloramphenicol acetyltransferase containing the -93 to -48 region. A similar result was obtained when these constructs were co-transfected into mouse L cells which were shown not to express the endogenous caeruloplasmin gene. Taken together, these data indicate a role for C/EBP alpha and beta in mediating transcription from the caeruloplasmin gene promoter and suggest that this region of the promoter is not responsible for tissue-specific expression. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:8373362

  10. Fine organization of Bombyx mori fibroin heavy chain gene

    PubMed Central

    Zhou, Cong-Zhao; Confalonieri, Fabrice; Medina, Nadine; Zivanovic, Yvan; Esnault, Catherine; Yang, Tie; Jacquet, Michel; Janin, Joel; Duguet, Michel; Perasso, Roland; Li, Zhen-Gang

    2000-01-01

    The complete sequence of the Bombyx mori fibroin gene has been determined by means of combining a shotgun sequencing strategy with physical map-based sequencing procedures. It consists of two exons (67 and 15 750 bp, respectively) and one intron (971 bp). The fibroin coding sequence presents a spectacular organization, with a highly repetitive and G-rich (~45%) core flanked by non-repetitive 5′ and 3′ ends. This repetitive core is composed of alternate arrays of 12 repetitive and 11 amorphous domains. The sequences of the amorphous domains are evolutionarily conserved and the repetitive domains differ from each other in length by a variety of tandem repeats of subdomains of ~208 bp which are reminiscent of the repetitive nucleosome organization. A typical composition of a subdomain is a cluster of repetitive units, Ua, followed by a cluster of units, Ub, (with a Ua:Ub ratio of 2:1) flanked by conserved boundary elements at the 3′ end. Moreover some repeats are also perfectly conserved at the peptide level indicating that the evolutionary pressure is not identical along the sequence. A tentative model for the constitution and evolution of this unusual gene is discussed. PMID:10871375

  11. Quantitative study of effects of free cationic chains on gene transfection in different intracellular stages.

    PubMed

    Cai, Jinge; Yue, Yanan; Wang, Yanjing; Jin, Zhenyu; Jin, Fan; Wu, Chi

    2016-09-28

    Previously, we revealed that in the application of using cationic polymer chains, polyethylenimine (PEI), to condense anionic plasmid DNA chains (pDNA) to form the DNA/polymer polyplexes, after all the pDNAs are complexed with PEI, further added PEIs exist individual chains and free in the solution mixture. It is those uncomplexed polycation chains that dramatically promote the gene transfection. In the current study, we studied how those free cationic chains with different lengths and topologies affect the intracellular trafficking of the polyplexes, the translocation of pDNA through the nuclear membrane, the transcription of pDNA to mRNA and the translocation of mRNA from nucleus to cytosol in HepG2 cells by using a combination of the three-dimensional confocal microscope and TaqMan real-time PCR. We found that free branched PEI chains with a molar mass of 25,000g/mol and a total concentration of 1.8×10(-6)g/mL promote the overall gene transfection efficiency by a factor of ~500 times. Our results quantitatively reveal that free chains help little in the cellular uptake, but clearly reduce the lysosomal entrapment of those internalized polyplexes (2-3 folds); assist the translocation of pDNA through nuclear membrane after it is released from the polyplexes in the cytosol (~5 folds); enhance the pDNA-to-mRNA transcription efficiency (~4 folds); and facilitate the nucleus-to-cytosol translocation of mRNA (7-8 folds). The total enhancement of those steps agrees well with the overall efficiency, demonstrating, for the first time, how free cationic polymer chains quantitatively promote the gene transfection in each step in the intracellular space. PMID:27448443

  12. Group G Beta-Hemolytic Streptococcal Bacteremia Characterized by 16S Ribosomal RNA Gene Sequencing

    PubMed Central

    Woo, Patrick C. Y.; Fung, Ami M. Y.; Lau, Susanna K. P.; Wong, Samson S. Y.; Yuen, Kwok-Yung

    2001-01-01

    Little is known about the relative importance of the four species of Lancefield group G beta-hemolytic streptococci in causing bacteremia and the factors that determine the outcome for patients with group G beta-hemolytic streptococcal bacteremia. From 1997 to 2000, 75 group G beta-hemolytic streptococcal strains were isolated from the blood cultures of 66 patients. Sequencing of the 16S rRNA genes of the group G beta-hemolytic streptococci showed that all 75 isolates were Streptococcus dysgalactiae subspecies equisimilis. The API system (20 STREP) and Vitek system (GPI) successfully identified 65 (98.5%) and 62 (93.9%) isolates, respectively, as S. dysgalactiae subspecies equisimilis with >95% confidence, whereas the ATB Expression system (ID32 STREP) only successfully identified 49 isolates (74.2%) as S. dysgalactiae subspecies equisimilis with >95% confidence. The median age of the patients was 76 years (range, 33 to 99 years). Fifty-six patients (85%) were over 60 years old. All patients had underlying diseases. No source of the bacteremia was identified (primary bacteremia) in 34 patients (52%), whereas 17 (26%) had cellulitis and 8 (12%) had bed sore or wound infections. Fifty-eight patients (88%) had community-acquired group G streptococcal bacteremia. Sixty-two patients (94%) had group G Streptococcus recovered in one blood culture, whereas 4 patients (6%) had it recovered in multiple blood cultures. Fifty-nine patients (89%) had group G Streptococcus as the only bacterium recovered in their blood cultures, whereas in 7 patients other bacteria were recovered concomitantly with the group G Streptococcus in the blood cultures (Staphylococcus aureus in 3, Clostridium perfringens in 2, Citrobacter freundii in 1, and Bacteroides fragilis in 1). Overall, 10 patients (15%) died. Male sex, diagnosis other than cellulitis, hospital-acquired bacteremia, and multiple positive blood cultures were associated with mortality {P < 0.005 (relative risk [RR] = 7.6), P < 0

  13. Extraction and characterization of the rhesus macaque T cell receptor β-chain genes

    PubMed Central

    Greenaway, Hui Yee; Kurniawan, Monica; Price, David A; Douek, Daniel C; Davenport, Miles P; Venturi, Vanessa

    2009-01-01

    Rhesus macaque models have been instrumental for the development and testing of vaccines prior to human studies and have provided fundamental insights into the determinants of immune efficacy in a variety of infectious diseases. However, the characterization of antigen-specific T cell receptor (TCR) repertoires during adaptive immune responses in these models has previously relied on human TCR gene assignments. Here, we extracted and characterized TCR β-chain (TRB) genes from the recently sequenced rhesus macaque genome that are homologous to the human TRB genes. Comparison of the rhesus macaque TRB genes with the human TRB genes revealed an average best-match similarity of 92.9%. Furthermore, we confirmed the usage of most rhesus macaque TRB genes by expressed TCRβ sequences within epitope-specific TCR repertoires. This primary description of the rhesus macaque TRB genes will provide a standardized nomenclature and enable better characterization of TCR usage in studies that utilize this species. PMID:19506572

  14. Cloning of genes related to exo-beta-glucanase production in Saccharomyces cerevisiae: characterization of an exo-beta-glucanase structural gene.

    PubMed

    Nebreda, A R; Villa, T G; Villanueva, J R; del Rey, F

    1986-01-01

    The EXG1 gene of Saccharomyces cerevisiae was cloned and identified by complementation of a mutant strain (exg1-2) with highly reduced extracellular exo-beta-1,3-glucanase (EXG) activity. Two recombinant plasmids containing an overlapping region of 5.2 kb were isolated from a genomic DNA library and characterized by restriction mapping. The coding region was located by subcloning the original DNA inserts in a 2.7-kb HindIII-XhoI fragment. Exg+ strains and Exg- mutants transformed with yeast multicopy plasmids containing this DNA fragment showed an EXG activity 5- to 20-fold higher than for the untransformed Exg+ wild-type (wt) strains. The overproduced EXG had the same enzymic activity on different substrates, and showed the same electrophoretic behaviour on polyacrylamide gels and identical properties upon filtration through Sephacryl S-200 as those of the main EXG from Exg+ wt strains. The EXG1 gene transformed Schizosaccharomyces pombe, yielding extracellular EXG activity which showed cross-reactivity with anti-S. cervisiae EXG antibodies. A fragment including only a part of the EXG1 region was subcloned into the integrating vector YIp5, and the resulting plasmid was used to transform an Exg+ strain. Genetic and Southern analysis of several stable Exg- transformants showed that the fragment integrated by homology with the EXG1 locus. The chromosomal DNA fragment into which the plasmid integrated has a restriction pattern identical to that of the fragment on which we had previously identified the putative EXG1 gene. Only one copy of the EXG1 gene per genome was found in several strains tested by Southern analysis. Furthermore, two additional recombinant plasmids sharing a yeast DNA fragment of about 4.1 kb, which partially complements the exg1-2 mutation but which shows no homology with the 2.7-kb fragment containing the EXG1 gene, were also identified in this study. This 4.1-kb DNA fragment does not appear to contain an extragenic suppressor and could be related

  15. Identification of positive and negative regulatory regions controlling expression of the Xenopus laevis betaTrCP gene.

    PubMed

    Ballarino, Monica; Fruscalzo, Alberto; Marchioni, Marcella; Carnevali, Francesca

    2004-07-21

    betaTrCP mediates the ubiquitination and subsequent degradation of several key molecules thereby playing a relevant role in different cellular processes during development and in the adult. In Xenopus embryo, betaTrCP acts as a negative regulator of Wnt signaling by interacting with beta-catenin. In this paper, we report results of the study on expression and regulation of the Xenopus betaTrCP gene. We found that xbetaTrCP is expressed in Xenopus oocytes as three transcripts, which very likely correspond to the previously identified localized mRNAs, and four isoforms. The xbetaTrCP promoter functional and structural analysis showed the presence of elements target of positive transcriptional control. Among them, we have identified a beta-catenin/Tcf signaling responsive region and a 45-bp element containing a sequence motif conforming to the SRF binding site, closer to the transcription initiation sites. There are also elements of transcriptional negative control.

  16. Selective decreases in T cell receptor V beta expression. Decreased expression of specific V beta families is associated with expression of multiple MHC and non-MHC gene products

    PubMed Central

    1989-01-01

    Previous reports of TCR V beta usage, studying either expression of a single V beta in a wide panel of strains (6, 7, 10, 12, 13), or expression of multiple V beta s in a very limited strain distribution (14, 15), have identified instances of clonal deletion of potentially autoreactive T cells specific for either self E alpha E beta or minor lymphocyte stimulatory (Mls) antigens. The present study has investigated the range of self antigens that can influence V beta usage by evaluating expression of 16 V beta families in 30 strains of mice. It was found that significant decreases in expression occur in at least 8 of the 16 V beta families and that dominant influences on the T cell V beta repertoire are exerted by expression of Mlsa, Mlsc, and MHC gene products. Decreased expressions of V beta 5, -11, -12, and -16 were influenced by MHC gene products. The patterns of decreased expression seen in intra-MHC recombinant strains and strains of different non-MHC background were distinct for V beta 11, -12, and -16, suggesting that different ligands are involved in the deletion of T cells expressing each of these V beta genes. Mice expressing Mlsa show decreased expression of V beta 9 as well as V beta 6. Mlsc mice lacked V beta 3 expression in those strains where the expressed MHC type was compatible with a strongly stimulatory Mlsc phenotype. V beta 7 was strongly influenced by both MHC and non-MHC products that are not yet identified. These results demonstrate that strain-specific decreases of mRNA expression occur in a major portion of the TCR repertoire. Self antigens including Mlsa, Mlsc, and E alpha E beta, as well as additional MHC and non-MHC products, appear to induce these decreases in expression in the process of eliminating self-reactive T cells from the mature T cell pool. PMID:2529341

  17. Influence of beta(2)-adrenoceptor gene polymorphisms on diet-induced thermogenesis.

    PubMed

    Oomen, J M; Waijers, P M C M; van Rossum, C; Hoebee, B; Saris, W H M; van Baak, M A

    2005-11-01

    The sympathetic nervous system is involved in the control of energy metabolism and expenditure. Diet-induced thermogenesis is mediated partly by the ss-adrenergic component of this system. The aim of the present study was to investigate the role of genetic variation in the beta(2)-adrenoceptor in diet-induced thermogenesis. Data from twenty-four subjects (fourteen men and ten women; BMI 26.7(sem 0.8) kg/m(2); age 45.2(sem1.4) years) with different polymorphisms of the beta(2)-adrenoceptor at codon 16 (Gly16Gly, Gly16Arg or Arg16Arg) were recruited for this study. Subjects were given a high-carbohydrate liquid meal, and the energy expenditure, respiratory exchange ratio, and plasma concentrations of NEFA, glycerol, glucose, insulin and catecholamines were measured before and over 4 h after the meal. The AUC of energy expenditure (diet-induced thermogenesis) was not significantly different between polymorphism groups, nor was the response of any of the other measured variables to the meal. In a multiple regression model, the only variable that explained a significant proportion (32 %) of the variation in diet-induced thermogenesis was the increase in plasma adrenaline in response to the meal (P<0.05). The beta(2)-adrenoceptor codon16 polymorphisms did not contribute significantly. In conclusion, an independent contribution of the codon 16 polymorphism of the beta(2)-adrenoceptor gene to the variation in thermogenic response to a high-carbohydrate meal could not be demonstrated. The interindividual variation in thermogenic response to the meal was correlated with variations in the plasma adrenaline response to the meal.

  18. Regulation of UCP gene expression in brown adipocytes differentiated in primary culture. Effects of a new beta-adrenoceptor agonist.

    PubMed

    Champigny, O; Holloway, B R; Ricquier, D

    1992-07-01

    Primary cultures of precursor cells from mouse and rat brown adipose tissue (BAT) were used to study the effect of a new beta-agonist (ICI D7114) on the uncoupling protein (UCP) gene expression. ICI 215001 (the active metabolite of D7114) increased the expression of UCP and its mRNA in brown adipocytes differentiating in vitro in a dose-dependent manner. This stimulating effect was not inhibited by propranolol, a non-specific beta-antagonist, but was partially reduced by bupranolol, a beta 3-antagonist. No expression of UCP mRNA was ever induced by ICI 215001 in white adipocytes differentiated in vitro. It was concluded that the drug could affect the brown adipose cells through a beta 3-pathway. It could clearly modulate the expression of UCP in brown adipocytes differentiated in vitro, but was not able by itself to turn on the gene. PMID:1355051

  19. Role of the 7 alpha-methoxy and side-chain carboxyl of moxalactam in beta-lactamase stability and antibacterial activity.

    PubMed Central

    Murakami, K; Yoshida, T

    1981-01-01

    The effects of the alpha-carboxyl of the phenylmalonyl side chain and the 7 alpha-methoxy group in moxalactam (6059-S) (7 beta-[2-carboxy-2-(4-hydroxyphenyl) acetamido]-7 alpha-methoxy-3[[(1-methyl-1H-tetrazol-5-y])thio] methyl]-1-oxa-1-dethia-3-cephem-4-carboxylic acid) and in the 1-sulfur congener on the stability to beta-lactamase were investigated by spectrophotometric and microbiological assays. The 7 alpha-methoxy substituent stabilized the compounds against penicillinase hydrolysis, and the alpha-carboxyl group stabilized them against cephalosporinase. An exception is the beta-lactamase produced by Proteus vulgaris, an inducible cephalosporinase, which hydrolyzed compounds having the alpha-carboxyl group but not those having the 7 alpha-methoxy group. Both substituents exerted their stabilizing effects independently, and compounds with both substituents, e.g., moxalactam (6059-S) and its 1-sulfur congener, were resistant to both penicillinases and cephalosporinases. The stabilization of the compounds to beta-lactamase hydrolysis improved their antibacterial activity against beta-lactamase-producing strains. PMID:6454378

  20. Cloning and characterization of a glycosyltransferase gene involved in the biosynthesis of anthracycline antibiotic beta-rhodomycin from Streptomyces violaceus.

    PubMed

    Miyamoto, Yuji; Johdo, Osamu; Nagamatsu, Yasunori; Yoshimoto, Akihiro

    2002-01-10

    A glycosyltransferase gene, rhoG, involved in the biosynthesis of the anthracycline antibiotic beta-rhodomycin was isolated as a 4.1-kb DNA fragment containing rhoG and its flanking region from Streptomyces violaceus by degenerate and inverse PCR. Sequencing analysis showed that rhoG was located in a gene cluster involved in the biosynthesis of the constitutive deoxysugar of beta-rhodomycin. The function of rhoG was verified by gene disruption, which was generated by replacing the internal 0.9-kb region of S. violaceus chromosome with a fragment including the SacI-blunted region. The rhoG disruption resulted in complete loss of beta-rhodomycin productivity, along with the accumulation of a non-glycosyl intermediate epsilon-rhodomycinone. In addition, the complementation test demonstrated that rhoG restored beta-rhodomycin production in this gene disruptant. These results indicated that rhoG is the glycosyltransferase gene responsible for the glycosylation of epsilon-rhodomycinone in beta-rhodomycin biosynthesis. PMID:11814657

  1. Expression of herpes simplex virus beta and gamma genes integrated in mammalian cells and their induction by an alpha gene product.

    PubMed Central

    Sandri-Goldin, R M; Goldin, A L; Holland, L E; Glorioso, J C; Levine, M

    1983-01-01

    The proteins of herpes simplex virus type 1 (HSV-1) form three kinetic groups termed alpha, beta, and gamma, whose synthesis is regulated in a cascade fashion. alpha products are synthesized first during infection, and they are required for synthesis of beta and gamma proteins. To examine the expression of several HSV-1 beta and gamma genes in the absence of alpha functions, we transferred into mammalian cells a plasmid containing a region of the HSV-1 genome that codes for only beta and gamma genes (0.315 to 0.421 map units). We found stable integration of at least one copy of the intact plasmid in each cell line. Four HSV-1 transcripts of the beta and gamma classes were transcribed constitutively in the cells, including the genes for glycoprotein B and DNA-binding protein. No constitutive synthesis of these two proteins could be demonstrated, however. The integrated HSV-1 genes responded to viral regulatory signals in that they could be induced by infection with HSV-1 mutants resulting in a high level of synthesis of both glycoprotein B and DNA-binding protein. The HSV-1 alpha gene product ICP4 was necessary for this induction, and it was found to be most efficient at a low multiplicity of infection. Functional expression of four genes was demonstrated in that the cell lines complemented infecting HSV-1 temperature-sensitive mutants. The same genes were not available for homologous recombination with infecting virus, however, since no recombinant wild-type virus could be detected. These data demonstrate that HSV-1 beta and gamma genes can be transcribed in the absence of alpha functions in mammalian cells, but that they still respond to HSV-1 regulatory signals such as the alpha gene product ICP4. Images PMID:6318078

  2. A beta-glucuronidase reporter gene construct for monitoring aflatoxin biosynthesis in Aspergillus flavus.

    PubMed Central

    Flaherty, J E; Weaver, M A; Payne, G A; Woloshuk, C P

    1995-01-01

    Aflatoxins are toxic and carcinogenic secondary metabolites produced by the fungi Aspergillus flavus and A. parasiticus. Current research is directed at the elimination of these compounds in important food sources. The objective of this research was to develop a method to study the induction and regulation of aflatoxin biosynthesis by examining the expression of one aflatoxin pathway gene, ver1. The promoter region of ver1 was fused to the beta-glucuronidase (GUS) gene (uidA) from Escherichia coli to form the reporter construct, GAP13. A. flavus 656-2 was transformed with this construct. Aflatoxin production, GUS activity, and transcript accumulation were determined in transformants after shifting the cultures from a nonconducive medium to a medium conducive to aflatoxin biosynthesis. Transformants harboring GAP13 displayed GUS expression only when aflatoxin was detected in culture. Further, the transcription of the uidA gene driven by the ver1 promoter followed the same profile as for the ver1 genes. The results show that the GAP13 construct may be useful as a genetic tool to study the induction of aflatoxin in situ and to identify substances that affect the expression of genes involved in aflatoxin biosynthesis. The utility of this construct to detect inducers of aflatoxin biosynthesis in maize kernels was tested in a bioassay. A heat-stable inducer of aflatoxin with a molecular size of less than 10 kDa was detected in extracts from maize kernels colonized by A. flavus. PMID:7618859

  3. Obesity-related phenotypes and the beta3-adrenoceptor gene variant in postmenopausal women.

    PubMed

    Tchernof, A; Starling, R D; Walston, J D; Shuldiner, A R; Dvorak, R V; Silver, K; Matthews, D E; Poehlman, E T

    1999-07-01

    We examined the hypothesis that postmenopausal women with the beta3-adrenoceptor gene variant (Trp64Arg) have reduced total daily energy expenditure (TEE), altered free fatty acid kinetics, and increased intra-abdominal fat. A secondary objective was to examine whether the obese state masks the effect of the variant on resting metabolic rate (RMR). There were 23 obese heterozygous women with the genetic variant (age 58 +/- 6 years; BMI 36 +/- 7 kg/m2) who were compared with 19 homozygous obese women with the normal allele (age 56 +/- 4 years; BMI 36 +/- 3 kg/m2). Daily energy expenditure was determined from doubly labeled water and indirect calorimetry, lipolysis from infusion of [1-13C]palmitate, and body fat distribution from computed tomography. No significant differences were found in TEE, RMR, energy expenditure of physical activity, the thermic effect of a meal, fat oxidation as estimated by fasting and postprandial respiratory quotients (RQs), or rate of lipolysis. Similarly, no difference was found in visceral adipose tissue and abdominal subcutaneous fat areas. When RMR was compared between obese (n = 23) and never-obese women with the Trp64Arg variant (n = 16), we found a 317 kcal/day lower RMR in never-obese women after controlling for fat mass, fat-free mass, and age (P < 0.0017). These results do not support the hypothesis that already obese women with the Trp64Arg polymorphism of the beta3-adrenergic receptor gene have lower daily energy expenditure, altered lipolysis, and increased abdominal obesity. On the other hand, the lower RMR in never-obese women suggests that the obese state may mask a moderate effect of the Trp64Arg variant on energy expenditure. Although these results need to be confirmed in other populations, the obese state may have been a confounding factor in previous studies of the beta3-adrenoceptor Trp64Arg variant and energy expenditure. PMID:10389848

  4. Estrogen Receptor beta binds Sp1 and recruits a Corepressor Complex to the Estrogen Receptor alpha Gene Promoter

    PubMed Central

    Bartella, V; Rizza, P; Barone, I; Zito, D; Giordano, F; Giordano, C; Catalano, S; Mauro, L; Sisci, D; Panno, ML; Fuqua, SA; Andò, Sebastiano

    2015-01-01

    Human estrogen receptors (ERs) alpha and beta are crucially involved in the regulation of mammary growth and development. Normal breast tissues display a prevalently expression of ER beta than ER alpha, which drastically increases during breast tumorogenesis. So, it is reasonable to assume how a dysregulation of the two estrogen receptor subtypes may induce breast cancer development. However, the molecular mechanism underlying the opposite role played by the two estrogen receptors on tumor cell growth remains to be elucidated. In the present study, we have demonstrated that ER beta overexpression in breast cancer cells decreases cell proliferation and down-regulates ER alpha mRNA and protein content along with a concomitant repression of estrogen-regulated genes. Transient transfection experiments, using a vector containing the human ER alpha promoter region, showed that elevated levels of the ER beta down-regulated basal ER alpha promoter activity. Furthermore, side-directed mutagenesis and deletion analysis have revealed that the proximal GC-rich motifs at −223 and −214 is crucial for the ER beta-induced ER alpha down-regulation in breast cancer cells. This occurred through ER beta-Sp1 protein-protein interaction within the ER alpha promoter region and the recruitment of a corepressor complex containing NCoR/SMRT (nuclear receptor corepressor/silencing mediator of retinoic acid and thyroid hormone receptor), accompanied by hypoacetylation of histone H4 and displacement of RNA polymerase II. Silencing of NCoR gene expression by RNA interference reversed the down-regulatory effect of ER beta on ER alpha gene expression and cell proliferation. Our results provide evidence for a novel mechanism by which overexpression of ER beta through NCoR is able to down regulate ER alpha gene expression, thus inhibiting ER alpha’s driving role on breast cancer cell growth. PMID:22622808

  5. Inactivation of the ampD gene causes semiconstitutive overproduction of the inducible Citrobacter freundii beta-lactamase.

    PubMed Central

    Lindberg, F; Lindquist, S; Normark, S

    1987-01-01

    In Citrobacter freundii and Enterobacter cloacae, synthesis of AmpC beta-lactamase is inducible by the addition of beta-lactams to the growth medium. Spontaneous mutants that constitutively overproduce the enzyme occur at a high frequency. When the C. freundii ampC beta-lactamase gene is cloned into Escherichia coli together with the regulatory gene ampR, beta-lactamase expression from the clone is inducible. Spontaneous cefotaxime-resistant mutants were selected from an E. coli strain carrying the cloned C. freundii ampC and ampR genes on a plasmid. Virtually all isolates had chromosomal mutations leading to semiconstitutive overproduction of beta-lactamase. The mutation ampD2 in one such mutant was caused by an IS1 insertion into the hitherto unknown ampD gene, located between nadC and aroP at minute 2.4 on the E. coli chromosome. The wild-type ampD allele cloned on a plasmid could fully trans-complement beta-lactamase-overproducing mutants of both E. coli and C. freundii, restoring the wild-type phenotype of highly inducible enzyme synthesis. This indicates that these E. coli and C. freundii mutants have their lesions in ampD. We hypothesize that induction of beta-lactamase synthesis is caused by blocking of the AmpD function by the beta-lactam inducer and that this leads directly or indirectly to an AmpR-mediated stimulation of ampC expression. PMID:3032901

  6. A member of the TGF-beta receptor gene family in the parasitic nematode Brugia pahangi.

    PubMed

    Gomez-Escobar, N; van den Biggelaar, A; Maizels, R

    1997-10-15

    The full length cDNA sequence of a Type I transforming growth factor-beta (TGF-beta) receptor has been isolated from the filarial parasitic nematode Brugia pahangi. This new gene, designated Bp-trk-1, encodes a predicted 645 amino acid sequence with an N-terminal hydrophobic stretch which may act as a signal peptide. The extracellular portion (residues 15-187) is cysteine-rich and has three potential N-glycosylation sites. At positions 250-255 the protein contains the glycine-serine rich motif characteristic of Type I receptors. The closest homologue is a Caenorhabditis elegans gene (Q09488) in cosmid C32D5.2 which shares 67% amino acid identity with Bp-trk-1 in the most conserved kinase domain (aa 259-482). Other type I receptors such as C. elegans daf-1 and Drosophila tkv show 38-53% identity in the same region. Some residues conserved in Drosophila and vertebrates are not present in the B. pahangi sequence. RT-PCR amplification has been used to show that the transcript is expressed in the three main stages of the B. pahangi life cycle: microfilariae, infective larvae and adults. The ligand remains unknown at this time but is likely to be most similar to that for C. elegans Q09488. PMID:9358045

  7. Aspects on evolution of fungal beta-lactam biosynthesis gene clusters and recruitment of trans-acting factors.

    PubMed

    Brakhage, Axel A; Thön, Marcel; Spröte, Petra; Scharf, Daniel H; Al-Abdallah, Qusai; Wolke, Sandra M; Hortschansky, Peter

    2009-01-01

    Penicillins and cephalosporins are beta-lactam antibiotics. The formation of hydrophobic penicillins has been reported in fungi only, notably Penicillium chrysogenum and Aspergillus (Emericella) nidulans, whereas the hydrophilic cephalosporins are produced by both fungi, e.g., Acremonium chrysogenum (cephalosporin C), and bacteria. The producing bacteria include Gram-negatives and Gram-positives, e.g., Streptomyces clavuligerus (cephamycin C) and Lysobacter lactamgenus (cephabacins), respectively. The evolutionary origin of beta-lactam biosynthesis genes has been the subject of discussion for many years, and two main hypotheses have been proposed: (i) horizontal gene transfer (HGT) from bacteria to fungi or (ii) vertical decent. There are strong arguments in favour of HGT, e.g., unlike most other fungal genes, beta-lactam biosynthesis genes are clustered and some of these genes lack introns. In contrast to S. clavuligerus, all regulators of fungal beta-lactam biosynthesis genes represent wide-domain regulators that are not part of the gene cluster. If bacterial regulators were co-transferred with the gene cluster from bacteria to fungi, most likely they would have been non-functional in eukaryotes and lost during evolution. Recently, the penicillin biosynthesis gene aatB was discovered, which is not part of the penicillin biosynthesis gene cluster and is even located on a different chromosome. The aatB gene is regulated by the same regulators AnCF and AnBH1 as the penicillin biosynthesis gene aatA (penDE). Data suggest that aatA and aatB are paralogues derived by duplication of a common ancestor gene. This data supports a model in which part of the beta-lactam biosynthesis gene cluster was transferred to some fungi, i.e., the acvA and ipnA gene without a regulatory gene. We propose that during the assembly of aatA and acvA-ipnA into a single gene cluster, recruitment of transcriptional regulators occurred along with acquisition of the duplicated aatA ancestor gene

  8. A homozygous nonsense mutation in the alpha 3 chain gene of laminin 5 (LAMA3) in lethal (Herlitz) junctional epidermolysis bullosa.

    PubMed

    Kivirikko, S; McGrath, J A; Baudoin, C; Aberdam, D; Ciatti, S; Dunnill, M G; McMillan, J R; Eady, R A; Ortonne, J P; Meneguzzi, G

    1995-05-01

    The inherited mechanobullous disorder, junctional epidermolysis bullosa (JEB), is characterized by extensive blistering and erosions of the skin and mucous membranes. The diagnostic hallmarks of JEB include ultrastructural abnormalities in the hemidesmosomes of the cutaneous basement membrane zone, as well as an absence of staining with antibodies against the anchoring filament protein, laminin 5. Therefore, the three genes encoding alpha 3, beta 3 and gamma 2 chains of laminin 5, known as LAMA3, LAMB3 and LAMC2, are candidate genes for JEB. We have previously demonstrated mutations in the LAMB3 and LAMC2 genes in several families with JEB. We initiated mutation analysis from an affected child by PCR amplification of individual LAMA3 exons, followed by heteroduplex analysis. Nucleotide sequencing of heteroduplexes identified a homozygous nonsense mutation within domain I/II of the alpha 3 chain. These findings provide the first evidence that nonsense mutations within the LAMA3 gene are also involved in the pathogenesis of JEB, and indicate that mutations of all three genes of laminin 5 can result in the JEB phenotype. PMID:7633458

  9. Conservation and divergence of autonomous pathway genes in the flowering regulatory network of Beta vulgaris.

    PubMed

    Abou-Elwafa, Salah F; Büttner, Bianca; Chia, Tansy; Schulze-Buxloh, Gretel; Hohmann, Uwe; Mutasa-Göttgens, Effie; Jung, Christian; Müller, Andreas E

    2011-06-01

    The transition from vegetative growth to reproductive development is a complex process that requires an integrated response to multiple environmental cues and endogenous signals. In Arabidopsis thaliana, which has a facultative requirement for vernalization and long days, the genes of the autonomous pathway function as floral promoters by repressing the central repressor and vernalization-regulatory gene FLC. Environmental regulation by seasonal changes in daylength is under control of the photoperiod pathway and its key gene CO. The root and leaf crop species Beta vulgaris in the caryophyllid clade of core eudicots, which is only very distantly related to Arabidopsis, is an obligate long-day plant and includes forms with or without vernalization requirement. FLC and CO homologues with related functions in beet have been identified, but the presence of autonomous pathway genes which function in parallel to the vernalization and photoperiod pathways has not yet been reported. Here, this begins to be addressed by the identification and genetic mapping of full-length homologues of the RNA-regulatory gene FLK and the chromatin-regulatory genes FVE, LD, and LDL1. When overexpressed in A. thaliana, BvFLK accelerates bolting in the Col-0 background and fully complements the late-bolting phenotype of an flk mutant through repression of FLC. In contrast, complementation analysis of BvFVE1 and the presence of a putative paralogue in beet suggest evolutionary divergence of FVE homologues. It is further shown that BvFVE1, unlike FVE in Arabidopsis, is under circadian clock control. Together, the data provide first evidence for evolutionary conservation of components of the autonomous pathway in B. vulgaris, while also suggesting divergence or subfunctionalization of one gene. The results are likely to be of broader relevance because B. vulgaris expands the spectrum of evolutionarily diverse species which are subject to differential developmental and/or environmental regulation

  10. [Molecular cloning of the DNA sequence of activin beta A subunit gene mature peptides from panda and related species and its application in the research of phylogeny and taxonomy].

    PubMed

    Wang, Xiao-Jing; Wang, Xiao-Xing; Wang, Ya-Jun; Wang, Xi-Zhong; He, Guang-Xin; Chen, Hong-Wei; Fei, Li-Song

    2002-09-01

    Activin, which is included in the transforming growth factor-beta (TGF beta) superfamily of proteins and receptors, is known to have broad-ranging effects in the creatures. The mature peptide of beta A subunit of this gene, one of the most highly conserved sequence, can elevate the basal secretion of follicle-stimulating hormone (FSH) in the pituitary and FSH is pivotal to organism's reproduction. Reproduction block is one of the main reasons which cause giant panda to extinct. The sequence of Activin beta A subunit gene mature peptides has been successfully amplified from giant panda, red panda and malayan sun bear's genomic DNA by using polymerase chain reaction (PCR) with a pair of degenerate primers. The PCR products were cloned into the vector pBlueScript+ of Esherichia coli. Sequence analysis of Activin beta A subunit gene mature peptides shows that the length of this gene segment is the same (359 bp) and there is no intron in all three species. The sequence encodes a peptide of 119 amino acid residues. The homology comparison demonstrates 93.9% DNA homology and 99% homology in amino acid among these three species. Both GenBank blast search result and restriction enzyme map reveal that the sequences of Activin beta A subunit gene mature peptides of different species are highly conserved during the evolution process. Phylogeny analysis is performed with PHYLIP software package. A consistent phylogeny tree has been drawn with three different methods. The software analysis outcome accords with the academic view that giant panda has a closer relationship to the malayan sun bear than the red panda. Giant panda should be grouped into the bear family (Uersidae) with the malayan sun bear. As to the red panda, it would be better that this animal be grouped into the unique family (red panda family) because of great difference between the red panda and the bears (Uersidae).

  11. Specific detection of the toxic shock syndrome toxin-1 gene using the polymerase chain reaction.

    PubMed

    Jaulhac, B; Prevost, G; Piemont, Y

    1991-08-01

    A rapid and specific assay for toxic shock syndrome toxin-1 gene (tst gene) detection in Staphylococcus aureus was developed using the polymerase chain reaction. A two-primer set and an oligonucleotide detection probe were synthesized. After 40 cycles of amplification, detection of a 160-bp amplified DNA fragment was carried out by agarose gel electrophoresis and Southern blot hybridization. This assay was sensitive since it was able to detect 1-10 bacteria. It was also specific since no amplification was documented with DNAs from enterotoxigenic S. aureus or Gram-negative bacteria devoid of the tst gene.

  12. Cloning and sequencing of human lambda immunoglobulin genes by the polymerase chain reaction.

    PubMed

    Songsivilai, S; Bye, J M; Marks, J D; Hughes-Jones, N C

    1990-12-01

    Universal oligonucleotide primers, designed for amplifying and sequencing genes encoding the rearranged human lambda immunoglobulin variable region, were validated by amplification of the lambda light chain genes from four human heterohybridoma cell lines and in the generation of a cDNA library of human V lambda sequences from Epstein-Barr virus-transformed human peripheral blood lymphocytes. This technique allows rapid cloning and sequencing of human immunoglobulin genes, and has potential applications in the rescue of unstable human antibody-producing cell lines and in the production of human monoclonal antibodies.

  13. Polymerase chain reaction-mediated gene synthesis: synthesis of a gene coding for isozyme c of horseradish peroxidase.

    PubMed Central

    Jayaraman, K; Fingar, S A; Shah, J; Fyles, J

    1991-01-01

    The synthesis of a gene coding for horseradish peroxidase (HRP, isozyme c; EC 1.11.1.7) is described using a polymerase chain reaction (PCR)-mediated gene synthesis approach developed in our laboratory. In this approach, all the oligonucleotides making up the gene are ligated in a single step by using the two outer oligonucleotides as PCR primers and the crude ligation mixture as the target. The PCR facilitates synthesis and purification of the gene simultaneously. The gene for HRP was synthesized by ligating all 40 oligonucleotides in a single step followed by PCR amplification. The gene was also synthesized from its fragments by using an overlap extension method similar to the procedure as described [Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K. & Pease, L. R. (1989) Gene 77, 61-68]. A method for combining different DNA fragments, in-frame, by using the PCR was also developed and used to synthesize the HRP gene from its gene fragments. This method is applicable to the synthesis of even larger genes and to combine any DNA fragments in-frame. After the synthesis, preliminary characterization of the HRP gene was also carried out by the PCR to confirm the arrangement of oligonucleotides in the gene. This was done by carrying out the PCR with several sets of primers along the gene and comparing the product sizes with the expected sizes. The gene and the fragments generated by PCR were cloned in Escherichia coli and the sequence was confirmed by manual and automated DNA sequencing. Images PMID:1851991

  14. Prodigiosin induces the proapoptotic gene NAG-1 via glycogen synthase kinase-3beta activity in human breast cancer cells.

    PubMed

    Soto-Cerrato, Vanessa; Viñals, Francesc; Lambert, James R; Kelly, Julie A; Pérez-Tomás, Ricardo

    2007-01-01

    Prodigiosin (2-methyl-3-pentyl-6-methoxyprodigiosene) is a bacterial metabolite that has anticancer and antimetastatic properties. However, the molecular mechanisms responsible for these abilities are not fully understood. Gene expression profiling of the human breast cancer cell line MCF-7 treated with prodigiosin was analyzed by cDNA array technology. The majority of the significantly modified genes were related to apoptosis, cell cycle, cellular adhesion, or transcription regulation. The dramatic increase of the nonsteroidal anti-inflammatory drug-activated gene 1 (NAG-1) made this gene an interesting candidate regarding the possible mechanism by which prodigiosin induces cytotoxicity in MCF-7 cells. Our results show that prodigiosin triggers accumulation of the DNA-damage response tumor-suppressor protein p53 but that NAG-1 induction was independent of p53 accumulation. Moreover, prodigiosin caused AKT dephosphorylation and glycogen synthase kinase-3beta (GSK-3beta) activation, which correlated with NAG-1 expression. Prodigiosin-induced apoptosis was recovered by inhibiting GSK-3beta, which might be due, at least in part, to the blockade of the GSK-3beta-dependent up-regulation of death receptors 4 and 5 expression. These findings suggest that prodigiosin-mediated GSK-3beta activation is a key event in regulating the molecular pathways that trigger the apoptosis induced by this anticancer agent.

  15. Cloning and characterization of 5'-untranslated region of porcine beta casein gene (CSN2).

    PubMed

    Lee, Poongyeon; Chung, Hee Kyoung; Lee, Hyun-Gi; Lee, Hwi-Cheul; Woo, Jae-Seok; Lee, Seunghoon; Jo, Su-Jin; Chang, Won-Kyong; Lee, Hoon-Taek; Kwon, Moosik; Park, Jin-Ki

    2008-10-01

    beta-Casein (CSN2) is a major milk protein in most mammals. The CSN2 gene is generally induced by lactogenic hormones bound to its promoter. The expression of this gene can be enhanced by signal transducers and activators of transcription (STAT) and glucocorticoid receptor (GR). Here, we analyzed the promoter and intron 1 regions of the porcine CSN2 gene. The porcine CSN2 promoter and intron 1 regions (-3098bp to +2446bp) were cloned into the pGL3-Basic vector containing the luciferase reporter gene (pCSN2-PEI). Lactogenic signals induced the transcription of porcine CSN2. By using AG490, a Janus kinase (JAK) inhibitor, we demonstrated that STAT5 positively regulates the transcription of porcine CSN2. Further, seven STAT mutants were generated by site-directed mutagenesis. By performing electrophoretic mobility shift assays (EMSAs), we located a critical element for pCSN2-PEI transcription bound to STAT5 in the -102bp to -84bp region. The construct containing only the promoter region (pCSN2-P), however, did not exert any promotive effects on transcription in two cell types-a mouse mammary epithelial cell line (HC11) and porcine mammary gland epithelial cells (PMECs). Thus, the construct containing intron 1 of porcine CSN2 exerts an elevating effect on transcription. We suggest that the transcription of porcine CSN2 is regulated by lactogenic signals via the STAT5 site (-102bp to -84bp) and intron 1.

  16. A molecular map of the chicken major histocompatibility complex: the class II beta genes are closely linked to the class I genes and the nucleolar organizer.

    PubMed Central

    Guillemot, F; Billault, A; Pourquié, O; Béhar, G; Chaussé, A M; Zoorob, R; Kreibich, G; Auffray, C

    1988-01-01

    We have cloned in a cosmid vector four DNA clusters covering 320 kb of the chicken MHC (B complex), including five class II (B-L) beta genes defining two related isotypic families. Additional B complex genes have been revealed using tissue-specific cDNA probes. A cosmid fragment has been used to isolate a cDNA for a class I (B-F) transcript. This transcript, that is by far the most divergent known member of the class I gene family, hybridized to six B-F genes present in the cosmids. One of the clusters was shown to contain two rRNA transcriptional units from the nucleolar organizer region (NOR), marking the telomeric boundary of the B complex. None of the other B complex genes hybridizes to, or has the transcriptional characteristics of mammalian MHC class II alpha or class III genes. The map we have obtained shows that the B complex does not contain well defined class I and class II regions since B-F and B-L beta genes are closely associated with unrelated genes. Moreover, class II beta genes are very closely linked to class I genes in two clusters, and to the NOR in a third one. Images PMID:3141149

  17. Candidate Gene Study of TRAIL and TRAIL Receptors: Association with Response to Interferon Beta Therapy in Multiple Sclerosis Patients

    PubMed Central

    Órpez-Zafra, Teresa; Pinto-Medel, María Jesús; Oliver-Martos, Begoña; Ortega-Pinazo, Jesús; Arnáiz, Carlos; Guijarro-Castro, Cristina; Varadé, Jezabel; Álvarez-Lafuente, Roberto; Urcelay, Elena; Sánchez-Jiménez, Francisca

    2013-01-01

    TRAIL and TRAIL Receptor genes have been implicated in Multiple Sclerosis pathology as well as in the response to IFN beta therapy. The objective of our study was to evaluate the association of these genes in relation to the age at disease onset (AAO) and to the clinical response upon IFN beta treatment in Spanish MS patients. We carried out a candidate gene study of TRAIL, TRAILR-1, TRAILR-2, TRAILR-3 and TRAILR-4 genes. A total of 54 SNPs were analysed in 509 MS patients under IFN beta treatment, and an additional cohort of 226 MS patients was used to validate the results. Associations of rs1047275 in TRAILR-2 and rs7011559 in TRAILR-4 genes with AAO under an additive model did not withstand Bonferroni correction. In contrast, patients with the TRAILR-1 rs20576-CC genotype showed a better clinical response to IFN beta therapy compared with patients carrying the A-allele (recessive model: p = 8.88×10−4, pc = 0.048, OR = 0.30). This SNP resulted in a non synonymous substitution of Glutamic acid to Alanine in position 228 (E228A), a change previously associated with susceptibility to different cancer types and risk of metastases, suggesting a lack of functionality of TRAILR-1. In order to unravel how this amino acid change in TRAILR-1 would affect to death signal, we performed a molecular modelling with both alleles. Neither TRAIL binding sites in the receptor nor the expression levels of TRAILR-1 in peripheral blood mononuclear cell subsets (monocytes, CD4+ and CD8+ T cells) were modified, suggesting that this SNP may be altering the death signal by some other mechanism. These findings show a role for TRAILR-1 gene variations in the clinical outcome of IFN beta therapy that might have relevance as a biomarker to predict the response to IFN beta in MS. PMID:23658636

  18. Functional role of residue 193 (chymotrypsin numbering) in serine proteases: influence of side chain length and beta-branching on the catalytic activity of blood coagulation factor XIa.

    PubMed

    Schmidt, Amy E; Sun, Mao-fu; Ogawa, Taketoshi; Bajaj, S Paul; Gailani, David

    2008-02-01

    In serine proteases, Gly193 (chymotrypsin numbering) is conserved with rare exception. Mutants of blood coagulation proteases have been reported with Glu, Ala, Arg or Val substitutions for Gly193. To further understand the role of Gly193 in protease activity, we replaced it with Ala or Val in coagulation factor XIa (FXIa). For comparison to the reported FXIa Glu193 mutant, we prepared FXIa with Asp (short side chain) or Lys (opposite charge) substitutions. Binding of p-aminobenzamidine (pAB) and diisopropylfluorphosphate (DFP) were impaired 1.6-36-fold and 35-478-fold, respectively, indicating distortion of, or altered accessibility to, the S1 and oxyanion-binding sites. Val or Asp substitutions caused the most impairment. Salt bridge formation between the amino terminus of the mature protease moiety at Ile16 and Asp194, essential for catalysis, was impaired 1.4-4-fold. Mutations reduced catalytic efficiency of tripeptide substrate hydrolysis 6-280-fold, with Val or Asp causing the most impairment. Further studies were directed toward macromolecular interactions with the FXIa mutants. kcat for factor IX activation was reduced 8-fold for Ala and 400-1100-fold for other mutants, while binding of the inhibitors antithrombin and amyloid beta-precursor protein Kunitz domain (APPI) was impaired 13-2300-fold and 22-27000-fold, respectively. The data indicate that beta-branching of the side chain of residue 193 is deleterious for interactions with pAB, DFP and amidolytic substrates, situations where no S2'-P2' interactions are involved. When an S2'-P2' interaction is involved (factor IX, antithrombin, APPI), beta-branching and increased side chain length are detrimental. Molecular models indicate that the mutants have impaired S2' binding sites and that beta-branching causes steric conflicts with the FXIa 140-loop, which could perturb the local tertiary structure of the protease domain. In conclusion, enzyme activity is impaired in FXIa when Gly193 is replaced by a non

  19. Cloning and sequencing hybrid striped bass (Morone saxatilis x M. chrysops) transforming growth factor-beta (TGF-beta), and development of a reverse transcription quantitative competitive polymerase chain reaction (RT-qcPCR) assay to measure TGF-beta mRNA of teleost fish.

    PubMed

    Harms, C A; Kennedy-Stoskopf, S; Horne, W A; Fuller, F J; Tompkins, W A

    2000-01-01

    A transforming growth factor (TGF)-beta was isolated and cloned from hybrid striped bass (Morone saxatilis x M. chrysops) anterior kidney mononuclear cells. This isolate (Genbank accession number AF140363) contains an open reading frame of 1146 bases coding for a 382 amino acid protein most similar to rainbow trout TGF-beta (57.3 and 78.6% identity with precursor and active protein, respectively) and rat TGF-beta 1 (41.1 and 68.8% identity with precursor and active protein, respectively). Consensus primers were demonstrated to amplify specifically by polymerase chain reaction (PCR), a TGF-beta segment from 14 species of teleost fish comprising 10 taxonomic families in 7 orders. A reverse transcription quantitative competitive polymerase chain reaction (RT-qcPCR) assay was devised to measure TGF-beta mRNA expression in teleost fish. Higher levels of TGF-beta mRNA expression were detected in mononuclear cells of peripheral blood than from spleen or anterior kidney.

  20. Genomic organization of the murine G protein beta subunit genes and related processed pseudogenes.

    PubMed

    Kitanaka, J; Wang, X B; Kitanaka, N; Hembree, C M; Uhl, G R

    2001-12-01

    The functional significance of heterotrimeric guanine nucleotide binding protein (G protein) for the many physiological processes including the molecular mechanisms of drug addiction have been described. In investigating the changes of mRNA expression after acute psychostimulant administration, we previously identified a cDNA encoding a G protein beta1 subunit (Gbeta1) that was increased up to four-fold in certain brain regions after administration of psychostimulants. The mouse Gbeta1 gene (the mouse genetic symbol, GNB1) was mapped to chromosome 4, but little was known of its genetic features. To characterize the GNB1 gene further, we have cloned and analyzed the genomic structures of the mouse GNBI gene and its homologous sequences. The GNBI gene spans at least 50 kb, and consists of 12 exons and 11 introns. The exon/intron boundaries were determined and found to follow the GT/AG rule. Exons 3-11 encode the Gbeta1 protein, and the exon 2 is an alternative, resulting in putative two splicing variants. Although intron 11 is additional for GNBI compared with GNB2 and GNB3, the intron positions within the protein coding region of GNB1, GNB2 and GNB3 are identical, suggesting that GNB1 should have diverged from the ancestral gene family earlier than the genes for GNB2 and GNB3. We also found the 5'-truncated processed pseudogenes with 71-89% similarities to GNBI mRNA sequence, suggesting that the truncated cDNA copies, which have been reverse-transcribed from a processed mRNA for GNB1, might have been integrated into several new locations in the mouse genome. PMID:11913780

  1. Differential cytokine modulation of the genes LAMA3, LAMB3, and LAMC2, encoding the constitutive polypeptides, alpha 3, beta 3, and gamma 2, of human laminin 5 in epidermal keratinocytes.

    PubMed

    Korang, K; Christiano, A M; Uitto, J; Mauviel, A

    1995-07-24

    Laminin 5, an anchoring filament protein previously known as nicein/kalinin/epiligrin, consists of three polypeptide chains, alpha 3, beta 3, and gamma 2, encoded by the genes LAMA3, LAMB3, and LAMC2, respectively. The expression of laminin 5 was detected by Northern hybridization with specific cDNA probes in various epidermal keratinocyte cultures, whereas no expression of any of the three genes could be detected in foreskin fibroblast cultures. Transforming growth factor-beta (TGF-beta) enhanced LAMA3, LAMB3, and LAMC2 gene expression in human epidermal keratinocytes, as well as in HaCaT and Balb/K cells in culture, although the extent of enhancement was greater for LAMA3 and LAMC2 genes than for LAMB3. Interestingly, tumor necrosis factor-alpha, (TNF-alpha) alone did not alter the expression of LAMB3 and LAMC2 genes in human epidermal keratinocytes, whereas it inhibited the expression of LAMA3. These results suggest that the expression of the three genes encoding the laminin 5 subunits is not coordinately regulated by the cytokines tested. PMID:7635220

  2. A review on the origin and spread of deleterious mutants of the beta-globin gene in Indian populations.

    PubMed

    Das, S K; Talukder, G

    2001-01-01

    Deleterious mutations of the human beta-globin gene are responsible for beta-thalassaemia and other haemoglobinopathies, which are the most common genetic diseases in Indian populations. A highly heterogeneous distribution of those mutations is observed in India and certain mutations are restricted to some extent to particular groups only. The reasons behind the geographical clustering and origin of the mutations in India is a highly debated issue and the evidence is conflicting. Our present article aims at tracing the origin of the deleterious beta-globin mutation and evaluates the role of different evolutionary forces responsible for the spread and present distribution of those mutations in Indian populations, using data from molecular biology and statistical methods. Mutations are generated essentially randomly, but "hot-spot" sites for mutation are reported for the beta-globin gene cluster, indicating sequence dependency of mutation. A single origin of a deleterious beta-globin mutation, followed by recombination (in a hot spot region) and/or interallelic gene conversion (within beta-globin gene) through time is the most plausible hypothesis to explain the association of those mutations with multiple haplotype backgrounds and frameworks. It is suggested that India is the place of origin of HbE and HbD mutations and that they dispersed to other parts of the would by migration. HbS mutants present in Indian populations are not of Middle East origin but rather a fresh mutation is the probable explanation for the prevalence among tribal groups. beta-thalassaemia represents a heterogeneous group of mutant alleles in India. Five common and twelve rare mutations have been reported in variable frequencies among different Indian populations. Gene flow of those mutant alleles from different populations of the world by political, military and commercial interactions possibly accounts for the heterogenous nature of beta-thalassaemia among Indians. A multiple allelic

  3. GeneSpeed Beta Cell: An Online Genomics Data Repository and Analysis Resource Tailored for the Islet Cell Biologist

    PubMed Central

    Quayum, Nayeem; Kutchma, Alecksandr; Sarkar, Suparna A.; Juhl, Kirstine; Gradwohl, Gerard; Mellitzer, Georg; Hutton, John C.; Jensen, Jan

    2008-01-01

    Objective. We here describe the development of a freely available online database resource, GeneSpeed Beta Cell, which has been created for the pancreatic islet and pancreatic developmental biology investigator community. Research Design and Methods. We have developed GeneSpeed Beta Cell as a separate component of the GeneSpeed database, providing a genomics-type data repository of pancreas and islet-relevant datasets interlinked with the domain-oriented GeneSpeed database. Results. GeneSpeed Beta Cell allows the query of multiple published and unpublished select genomics datasets in a simultaneous fashion (multiexperiment viewing) and is capable of defining intersection results from precomputed analysis of such datasets (multidimensional querying). Combined with the protein-domain categorization/assembly toolbox provided by the GeneSpeed database, the user is able to define spatial expression constraints of select gene lists in a relatively rigid fashion within the pancreatic expression space. We provide several demonstration case studies of relevance to islet cell biology and development of the pancreas that provide novel insight into islet biology. Conclusions. The combination of an exhaustive domain-based compilation of the transcriptome with gene array data of interest to the islet biologist affords novel methods for multidimensional querying between individual datasets in a rapid fashion, presently not available elsewhere. PMID:18795106

  4. A gene encoding the major beta tubulin of the mitotic spindle in Physarum polycephalum plasmodia

    SciTech Connect

    Burland, T.G.; Paul, E.C.A.; Oetliker, M.; Dove, W.F.

    1988-03-01

    The multinucleate plasmodium of Physarum polycephalum is unusual among eucaryotic cells in that it uses tubulins only in mitotic-spindle microtubules; cytoskeletal, flagellar, and centriolar microtubules are absent in this cell type. The authors identified a ..beta..-tubulin cDNA clone, ..beta..105, which is shown to correspond to the transcript of the betC ..beta..-tubulin locus and to encode ..beta..2 tubulin, the ..beta.. tubulin expressed specifically in the plasmodium and used exclusively in the mitotic spindle. Physarum amoebae utilize tubulins in the cytoskeleton, centrioles, and flagella, in addition to the mitotic spindle. Sequence analysis shows that ..beta..2 tubulin is only 83% identical to the two ..beta.. tubulins expressed in amoebae. This compares with 70 to 83% identity between Physarum ..beta..2 tubulin and the ..beta.. tubulins of yeasts, fungi, alga, trypanosome, fruit fly, chicken, and mouse. On the other hand, Physarum ..beta..2 tubulin is no more similar to, for example, Aspergillus ..beta.. tubulins than it is to those of Drosophila melanogaster or mammals. Several eucaryotes express at least one widely diverged ..beta.. tubulin as well as one or more ..beta.. tubulins that conform more closely to a consensus ..beta..-tubulin sequence. The authors suggest that ..beta..-tubulins diverge more when their expression pattern is restricted, especially when this restriction results in their use in fewer functions. This divergence among ..beta.. tubulins could have resulted through neutral drift. For example, exclusive use of Physarum ..beta..2 tubulin in the spindle may have allowed more amino acid substitutions than would be functionally tolerable in the ..beta.. tubulins that are utilized in multiple microtubular organelles. Alternatively, restricted use of ..beta.. tubulins may allow positive selection to operate more freely to refine ..beta..-tubulin function.

  5. Synthesis of 24-nor-5 beta-cholan-23-oic acid derivatives: a convenient and efficient one-carbon degradation of the side chain of natural bile acids.

    PubMed

    Schteingart, C D; Hofmann, A F

    1988-10-01

    An efficient procedure for obtaining nor-bile acids from natural (C24) bile acids is described. Treatment of formylated bile acids with sodium nitrite in a mixture of trifluoroacetic anhydride with trifluoroacetic acid gives, through a "second order" Beckmann rearrangement, 24-nor-23-nitriles. These compounds, on alkaline hydrolysis, afford the corresponding nor-bile acids in high yields. The sequence was successfully applied to the synthesis of 3 alpha-hydroxy-24-nor-5 beta-cholan-23-oic (norlithocholic) acid, 3 alpha,6 alpha- (norhyodeoxycholic), 3 alpha,7 alpha- (norchenodeoxycholic), 3 alpha,7 beta- (norursodeoxycholic), and 3 alpha,12 alpha-dihydroxy-24-nor-5 beta-cholan-23-oic (nordeoxycholic) acids, as well as 3 alpha,7 alpha,12 alpha-trihydroxy-24-nor-5 beta-cholan-23-oic (norcholic) acid. 13C-NMR spectra of their methyl esters are reported. The procedure provides a more rapid alternative to the Barbier-Wieland degradation for shortening by one methylene group the side chain of natural (C24) bile acids.

  6. Interactive Effects of Dietary Lipid and Phenotypic Feed Efficiency on the Expression of Nuclear and Mitochondrial Genes Involved in the Mitochondrial Electron Transport Chain in Rainbow Trout

    PubMed Central

    Eya, Jonathan C.; Ukwuaba, Vitalis O.; Yossa, Rodrigue; Gannam, Ann L.

    2015-01-01

    A 2 × 3 factorial study was conducted to evaluate the effects of dietary lipid level on the expression of mitochondrial and nuclear genes involved in electron transport chain in all-female rainbow trout Oncorhynchus mykiss. Three practical diets with a fixed crude protein content of 40%, formulated to contain 10% (40/10), 20% (40/20) and 30% (40/30) dietary lipid, were fed to apparent satiety to triplicate groups of either low-feed efficient (F120; 217.66 ± 2.24 g initial average mass) or high-feed efficient (F136; 205.47 ± 1.27 g) full-sib families of fish, twice per day, for 90 days. At the end of the experiment, the results showed that there is an interactive effect of the dietary lipid levels and the phenotypic feed efficiency (growth rate and feed efficiency) on the expression of the mitochondrial genes nd1 (NADH dehydrogenase subunit 1), cytb (Cytochrome b), cox1 (Cytochrome c oxidase subunits 1), cox2 (Cytochrome c oxidase subunits 2) and atp6 (ATP synthase subunit 6) and nuclear genes ucp2α (uncoupling proteins 2 alpha), ucp2β (uncoupling proteins 2 beta), pparα (peroxisome proliferator-activated receptor alpha), pparβ (peroxisome proliferatoractivated receptor beta) and ppargc1α (proliferator-activated receptor gamma coactivator 1 alpha) in fish liver, intestine and muscle, except on ppargc1α in the muscle which was affected by the diet and the family separately. Also, the results revealed that the expression of mitochondrial genes is associated with that of nuclear genes involved in electron transport chain in fish liver, intestine and muscle. Furthermore, this work showed that the expression of mitochondrial genes parallels with the expression of genes encoding uncoupling proteins (UCP) in the liver and the intestine of rainbow trout. This study for the first time presents the molecular basis of the effects of dietary lipid level on mitochondrial and nuclear genes involved in mitochondrial electron transport chain in fish. PMID:25853266

  7. A common system controls the induction of very different genes. The class-A beta-lactamase of Proteus vulgaris and the enterobacterial class-C beta-lactamase.

    PubMed

    Datz, M; Joris, B; Azab, E A; Galleni, M; Van Beeumen, J; Frère, J M; Martin, H H

    1994-11-15

    Among the Enterobacteriaceae, Proteus vulgaris is exceptional in the inducible production of a 29-kDa beta-lactamase (cefuroximase) with an unusually high activity towards the beta-lactamase-stable oximino-cephalosporins (e.g. cefuroxime and cefotaxime). Sequencing of the corresponding gene, cumA, showed that the derived CumA beta-lactamase belonged to the molecular class A. The structural gene was under the direct control of gene cumR, which was transcribed backwards and whose initiation codon was 165 bp away from that of the beta-lactamase gene. This resembled the arrangement of structural and regulator genes ampC and ampR of the 39-kDa molecular-class-C beta-lactamase AmpC present in many enterobacteria. Moreover, cloned genes ampD and ampG for negative modulation and signal transduction of AmpC beta-lactamase induction, respectively, were also able to restore constitutively CumA overproducing and non-inducible P. vulgaris mutants to the inducible, wild-type phenotype. The results indicate that controls of the induction phenomena are equivalent for the CumA and AmpC beta-lactamase. Very different structural genes can thus be under the control of identical systems.

  8. Oct-1 functions as a transactivator in the hormonal induction of beta-casein gene expression.

    PubMed

    Dong, Bing; Huang, Chengfei; Li, Defa; Zhao, Feng-Qi

    2009-08-01

    The ubiquitous transcription factor Oct-1 is involved in the hormonal regulation of the transcription of the major milk protein beta-casein through an interaction with the prolactin receptor, the STAT-5, and the glucocorticoid receptor (GR). In this study, this interaction was further demonstrated using Oct-1-deficient cells. In addition, Oct-1 mRNA expression is shown to increase during pregnancy and reach the highest levels during early lactation in mouse mammary gland. In reconstituted COS-7 cells, the endogenous Oct-1 binding activity rapidly increased within 5 min upon the lactogenic hormone treatment, indicating potential post-transcriptional/translational modification of Oct-1 by prolactin and glucocorticoids. Furthermore, STAT-5B was as effective as STAT-5A in the interaction with Oct-1 during hormonal induction, and a GR mutant, which carries mutations at multiple potential phosphorylation sites, functioned similarly to the wild-type GR, indicating that these phosphorylation sites may not be involved in the interaction of GR with Oct-1 on the beta-casein gene promoter.

  9. A missense mutation in the beta-2 integrin gene (ITGB2) causes canine leukocyte adhesion deficiency.

    PubMed

    Kijas, J M; Bauer, T R; Gäfvert, S; Marklund, S; Trowald-Wigh, G; Johannisson, A; Hedhammar, A; Binns, M; Juneja, R K; Hickstein, D D; Andersson, L

    1999-10-01

    Canine leukocyte adhesion deficiency (CLAD) is a fatal immunodeficiency disease found in Irish setters. The clinical manifestations of CLAD are very similar to LAD in humans and BLAD in cattle, which are both caused by mutations in ITGB2 encoding the leukocyte integrin beta-2 subunit (CD18). Sequence analysis of the ITGB2 coding sequence from a CLAD dog and a healthy control revealed a single missense mutation, Cys36Ser. This cysteine residue is conserved among all beta integrins, and the mutation most likely disrupts a disulfide bond. The mutation showed a complete association with CLAD in Irish setters and was not found in a sample of dogs from other breeds. The causative nature of this mutation was confirmed by transduction experiments using retroviral vectors and human LAD EBV B-cells. The normal canine CD18 formed heterodimers with the human CD11 subunit, whereas gene transfer of the mutant CD18 resulted in very low levels of CD11/CD18 expression. The identification of the causative mutation for CLAD now makes it possible to identify carrier animals with a simple diagnostic DNA test, and it forms the basis for using CLAD as a large animal model for the development and evaluation of clinical treatments for human LAD. PMID:10512685

  10. Molecular analysis of T-cell receptor beta genes in cutaneous T-cell lymphoma reveals Jbeta1 bias.

    PubMed

    Morgan, Suzanne M; Hodges, Elizabeth; Mitchell, Tracey J; Harris, Susan; Whittaker, Sean J; Smith, John L

    2006-08-01

    Molecular characterization of T-cell receptor junctional region sequences in cutaneous T-cell lymphoma had not been previously reported. We have examined in detail the features of the T-cell receptor beta (TCRB) gene rearrangements in 20 individuals with well-defined stages of cutaneous T-cell lymphoma (CTCL) comprising 10 cases with early-stage mycosis fungoides (MF) and 10 cases with late-stage MF or Sezary syndrome. Using BIOMED-2 PCR primers, we detected a high frequency of clonally rearranged TCR gamma and TCRB genes (17/20 and 15/20 cases, respectively). We carried out sequencing analysis of each complete clonal variable (V)beta-diversity (D)beta-joining(J)beta fingerprint generated by PCR amplification, and determined the primary structure of the Vbeta-Dbeta-Jbeta junctional regions. We observed considerable diversity in the T-cell receptor Vbeta gene usage and complementarity-determining region 3 loops. Although we found that TCRB gene usage in CTCL and normal individuals share common features, our analysis also revealed preferential usage of Jbeta1 genes in all cases with advanced stages of disease.

  11. Deletion and replacement of the mouse adult beta-globin genes by a "plug and socket" repeated targeting strategy.

    PubMed

    Detloff, P J; Lewis, J; John, S W; Shehee, W R; Langenbach, R; Maeda, N; Smithies, O

    1994-10-01

    We describe a two-step strategy to alter any mouse locus repeatedly and efficiently by direct positive selection. Using conventional targeting for the first step, a functional neo gene and a nonfunctional HPRT minigene (the "socket") are introduced into the genome of HPRT- embryonic stem (ES) cells close to the chosen locus, in this case the beta-globin locus. For the second step, a targeting construct (the "plug") that recombines homologously with the integrated socket and supplies the remaining portion of the HPRT minigene is used; this homologous recombination generates a functional HPRT gene and makes the ES cells hypoxanthine-aminopterin-thymidine resistant. At the same time, the plug provides DNA sequences that recombine homologously with sequences in the target locus and modifies them in the desired manner; the plug is designed so that correctly targeted cells also lose the neo gene and become G418 sensitive. We have used two different plugs to make alterations in the mouse beta-globin locus starting with the same socket-containing ES cell line. One plug deleted 20 kb of DNA containing the two adult beta-globin genes. The other replaced the same region with the human beta-globin gene containing the mutation responsible for sickle cell anemia.

  12. Cloning, expression, and catabolite repression of a gene encoding beta-galactosidase of Bacillus megaterium ATCC 14581.

    PubMed

    Shaw, G C; Kao, H S; Chiou, C Y

    1998-09-01

    A gene encoding beta-galactosidase, designated mbgA, was isolated from Bacillus megaterium ATCC 14581. Chromosomal beta-galactosidase production could be dramatically induced by lactose but not by isopropyl-beta-D-thiogalactopyranoside (IPTG) and was subject to catabolite repression by glucose. Disruption of mbgA in the B. megaterium chromosome resulted in loss of lactose-inducible beta-galactosidase production. A 27-bp inverted repeat was found to overlap the mbgA promoter sequence. Two partially overlapping catabolite-responsive elements (CREs) were identified within the inverted repeat. Base substitutions within CRE-I and/or CRE-II caused partial relief from catabolite repression. The results suggest that the 27-bp inverted repeat may serve as a target for a catabolite repressor(s). PMID:9721318

  13. Gene structure and chromosomal localization of the human HSD11K gene encoding the kidney (type 2) isozyme of 11{beta}-hydroxysteroid dehydrogenase

    SciTech Connect

    Agarwal, A.K.; Rogerson, F.M.; Mune, T.; White, P.C.

    1995-09-01

    11{beta}-hydroxysteroid dehydrogenase (11{beta}HSD) converts glucocorticoids to inactive products and is thus thought to confer specificity for aldosterone on the type I mineralocorticoid receptor in the kidney. Recent studies indicate the presence of at least two isozymes of 11{beta}HSD. In vitro, the NAD{sup +}-dependent kidney (type 2) isozyme catalyzes 11{beta}-dehydrogenase but not reductase reactions, whereas the NADP{sup +}-dependent liver (type 1) isozyme catalyzes both reactions. We have now characterized the human gene encoding kidney 11{beta}HSD (HSD11K). A bacteriophage P1 clone was isolated after screening a human genomic library by hybridization with sheep HSD11K cDNA. The gene consists of 5 exons spread over 6 kb. The nucleotide binding domain lies in the first exon are GC-rich (80%), suggesting that the gene may be transcriptionally regulated by factors that recognize GC-rich sequences. Fluorescence in situ hybridization of metaphase chromosomes with a positive P1 clone localized the gene to chromosome 16q22. In contrast, the HSD11L (liver isozyme) gene is located on chromosome 1 and contains 6 exons; the coding sequences of these genes are only 21% identical. HSD11K is expressed at high levels in the placenta and kidney of midgestation human fetuses and at lower levels in lung and testes. Different transcriptional start sites are utilized in kidney and placenta. These data should be applicable to genetic analysis of the syndrome of apparent mineralocorticoid excess, which may represent a deficiency of 11{beta}HSD. 25 refs., 5 figs.

  14. Single-cell TCRseq: paired recovery of entire T-cell alpha and beta chain transcripts in T-cell receptors from single-cell RNAseq.

    PubMed

    Redmond, David; Poran, Asaf; Elemento, Olivier

    2016-01-01

    Accurate characterization of the repertoire of the T-cell receptor (TCR) alpha and beta chains is critical to understanding adaptive immunity. Such characterization has many applications across such fields as vaccine development and response, clone-tracking in cancer, and immunotherapy. Here we present a new methodology called single-cell TCRseq (scTCRseq) for the identification and assembly of full-length rearranged V(D)J T-cell receptor sequences from paired-end single-cell RNA sequencing reads. The method allows accurate identification of the V(D)J rearrangements for each individual T-cell and has the novel ability to recover paired alpha and beta segments. Source code is available at https://github.com/ElementoLab/scTCRseq . PMID:27460926

  15. Evaluation of quantitative polymerase chain reaction-based approaches for determining gene copy and gene transcript numbers in environmental samples.

    PubMed

    Smith, Cindy J; Nedwell, David B; Dong, Liang F; Osborn, A Mark

    2006-05-01

    Quantitative polymerase chain reaction (Q-PCR) amplification is widely applied for determining gene and transcript numbers within environmental samples. This research evaluated Q-PCR reproducibility via TaqMan assays quantifying 16S rRNA gene and transcript numbers in sediments, within and between replicate Q-PCR assays. Intra-assay variation in 16S rRNA gene numbers in replicate DNA samples was low (coefficients of variation; CV from 3.2 to 5.2%). However, variability increased using replicated standard curves within separate Q-PCR assays (CV from 11.2% to 26%), indicating absolute comparison of gene numbers between Q-PCR assays was less reliable. 16S rRNA transcript quantification was evaluated using standard curves of diluted RNA or cDNA (before, or following, reverse transcription). These standard curves were statistically different with cDNA-derived curves giving higher r(2) values and Q-PCR efficiencies. Template concentrations used in Q-PCR also affected 16S rRNA gene and transcript numbers. For DNA, 10(-3) dilutions yielded higher gene numbers than 10(-1) and 10(-2) dilutions. Conversely, RNA template dilution reduced numbers of transcripts detected. Finally, different nucleic acid isolation methods also resulted in gene and transcript number variability. This research demonstrates Q-PCR determination of absolute numbers of genes and transcripts using environmental nucleic acids should be treated cautiously.

  16. Cloning of immunoglobulin kappa light chain genes from mouse liver and myeloma MOPC 173.

    PubMed

    Steinmetz, M; Zachau, H G; Mach, B

    1979-07-25

    The organization of the kappa chain constant region gene was compared in DNA from an immunoglobulin-producing mouse myeloma (MOPC 173) and from liver. In situ hybridization using the Southern blotting technique revealed constant region gene-containing EcoRI-DNA fragments of 14 and 20 kb in the myeloma tissue whereas one EcoRI-DNA fragment with a length of 15 kb was found in liver DNA. After enrichment by RPC-5 chromatography and preparative electrophoresis the 14 kb fragment from MOPC 173 DNA and the 15 kb fragment from liver DNA were cloned in the bacteriophage lambda vector Charon 4A using in vitro packaging. Extensive characterization of the two fragments by restriction endonuclease mapping, in situ hybridization, and electron microscopy (R-loop and heteroduplex) showed that both fragments contain the constant region but no MOPC 173 variable region gene. Both fragments are homologous over a length of 12.5 kb including the constant region but differ from one another starting about 2.7 kb from the 5' end of the constant region gene. This indicates that the 14 kb EcoRI-DNA fragment from the myeloma tissue clearly resulted from somatic DNA rearrangement although it does not seem to carry the MOPC 173 variable region gene. These observations suggest that somatic DNA rearrangement of immunoglobulin light chain genes can involve both homologous chromosomes.Images

  17. Transcriptional induction of the agp/ebp (c/ebp beta) gene by hepatocyte growth factor.

    PubMed

    Shen, B J; Chang, C J; Lee, H S; Tsai, W H; Miau, L H; Lee, S C

    1997-06-01

    Hepatocyte growth factor (HGF) is a pleiotropic factor with mitogenic, morphogenic, motogenic, cytotoxic, or growth inhibitory activity. Although the signaling of HGF is mediated through the cell membrane receptor c-Met, the molecular mechanism of downstream signal transduction remains obscure. In this report, we present evidence that shows HGF can stimulate the expression of AGP/EBP (C/EBP beta) and NF-kappaB, which are both key transcription factors responsible for the regulation of many genes under stress conditions or during the acute-phase response. Biochemical and functional analysis indicates that the HGF-responsive element is located in the region -376 to -352 (URE1) of the 5'-upstream regulatory sequence of agp/ebp. Activation of NF-kappaB by HGF was observed to precede the induction of agp/ebp. Further studies indicate that NF-kappaB can cooperate with AGP/EBP or other members of the C/EBP family to activate the agp/ebp gene in both URE1 and URE2-dependent manner. These results suggest that the induction of the agp/ebp gene by HGF is mediated at least in part by its activation of NF-kappaB. The activated NF-kappaB then interacts with AGP/EBP, resulting in the induction of agp/ebp.

  18. Detection of three nonsense mutations and one missense mutation in the interleukin-2 receptor [gamma] chain gene in SCIDX1 that differently affect the mRNA processing

    SciTech Connect

    Markiewicz, S.; Fischer, A.; Saint Basile, G. de ); Subtil, A.; Dautry-Varsat, A. )

    1994-05-01

    The interleukin-2 receptor [gamma] (IL-2R[gamma]) chain gene encodes a 64-kDa protein that not only composes the high-affinity form of the IL-2 binding receptor in association with the 2R [alpha] and [beta] chains, but also participates in at least the IL-4 and IL-7 receptor complexes. Mutations in this gene have recently been shown to cause X-linked severe combined immunodeficiency (SCIDX1). This disease of the immune system results from an early block of T lymphocyte and natural killer (NK) cell differentiation, which leads to a severe cellular and humoral immune defect that is lethal unless treated by bone marrow transplantation. Analysis of the IL-2R[gamma] gene in SCIDX1 patients has revealed the presence of heterogeneous mutations principally located in the extracellular domain of the molecule. We report here three intraexonic mutations and one deletion in the IL-2R[gamma] gene in four SCIDX1 patients. These mutations appear to differentially affect RNA processing, either by decreasing IL-2R[gamma] mRNA level or by the skipping of a constitutive exon. 16 refs., 1 fig.

  19. Suppressors of trp1 fluorescence identify a new arabidopsis gene, TRP4, encoding the anthranilate synthase beta subunit.

    PubMed Central

    Niyogi, K K; Last, R L; Fink, G R; Keith, B

    1993-01-01

    Suppressors of the blue fluorescence phenotype of the Arabidopsis trp1-100 mutant can be used to identify mutations in genes involved in plant tryptophan biosynthesis. Two recessive suppressor mutations define a new gene, TRP4. The trp4 mutant and the trp1-100 mutant are morphologically normal and grow without tryptophan, whereas the trp4; trp1-100 double mutant requires tryptophan for growth. The trp4; trp1-100 double mutant does not segregate at expected frequencies in genetic crosses because of a female-specific defect in transmission of the double mutant genotype, suggesting a role for the tryptophan pathway in female gametophyte development. Genetic and biochemical evidence shows that trp4 mutants are defective in a gene encoding the beta subunit of anthranilate synthase (AS). Arabidopsis AS beta subunit genes were isolated by complementation of an Escherichia coli anthranilate synthase mutation. The trp4 mutation cosegregates with one of the genes, ASB1, located on chromosome 1. Sequence analysis of the ASB1 gene from trp4-1 and trp4-2 plants revealed different single base pair substitutions relative to the wild type. Anthranilate synthase alpha and beta subunit genes are regulated coordinately in response to bacterial pathogen infiltration. PMID:8400875

  20. Analyzing the CDR3 Repertoire with respect to TCR—Beta Chain V-D-J and V-J Rearrangements in Peripheral T Cells using HTS

    PubMed Central

    Ma, Long; Yang, Liwen; Bin Shi; He, Xiaoyan; Peng, Aihua; Li, Yuehong; Zhang, Teng; Sun, Suhong; Ma, Rui; Yao, Xinsheng

    2016-01-01

    V-D-J rearrangement of the TCR—beta chain follows the 12/23 rule and the beyond 12/23 restriction. Currently, the proportion and characteristics of TCR—beta chain V—J rearrangement is unclear. We used high-throughput sequencing to compare and analyze TCR—beta chain V-J rearrangement and V-D-J rearrangement in the CDR3 repertoires of T cells from the PBMCs of six volunteers and six BALB/c mice. The results showed that the percentage of V-J rearrangement of the volunteers was approximately 0.7%, whereas that of the mice was 2.2%. The clonality of mice V-J rearrangement was significantly reduced compared with the V-D-J rearrangement, whereas the clonality of human V-J rearrangement was slightly reduced compared with the V-D-J rearrangement. V-J rearrangement in CDR3 involved the significant usage of N, S, F and L, whereas V-D-J rearrangement in CDR3 involved the significant usage of R and G. The levels of V deletion and J deletion in V-J rearrangement were significantly reduced compared with V-D-J rearrangement. TRBD and TRBJ usage in V-J rearrangement differed from that of V-D-J rearrangement, including dominant usage of TRBV and TRBJ and their pairing. Taken together, these results provide new ideas and technology for studies of V-D-J rearrangement and V-J rearrangement in the CDR3 repertoire. PMID:27404392

  1. Analyzing the CDR3 Repertoire with respect to TCR-Beta Chain V-D-J and V-J Rearrangements in Peripheral T Cells using HTS.

    PubMed

    Ma, Long; Yang, Liwen; Bin Shi; He, Xiaoyan; Peng, Aihua; Li, Yuehong; Zhang, Teng; Sun, Suhong; Ma, Rui; Yao, Xinsheng

    2016-07-12

    V-D-J rearrangement of the TCR-beta chain follows the 12/23 rule and the beyond 12/23 restriction. Currently, the proportion and characteristics of TCR-beta chain V-J rearrangement is unclear. We used high-throughput sequencing to compare and analyze TCR-beta chain V-J rearrangement and V-D-J rearrangement in the CDR3 repertoires of T cells from the PBMCs of six volunteers and six BALB/c mice. The results showed that the percentage of V-J rearrangement of the volunteers was approximately 0.7%, whereas that of the mice was 2.2%. The clonality of mice V-J rearrangement was significantly reduced compared with the V-D-J rearrangement, whereas the clonality of human V-J rearrangement was slightly reduced compared with the V-D-J rearrangement. V-J rearrangement in CDR3 involved the significant usage of N, S, F and L, whereas V-D-J rearrangement in CDR3 involved the significant usage of R and G. The levels of V deletion and J deletion in V-J rearrangement were significantly reduced compared with V-D-J rearrangement. TRBD and TRBJ usage in V-J rearrangement differed from that of V-D-J rearrangement, including dominant usage of TRBV and TRBJ and their pairing. Taken together, these results provide new ideas and technology for studies of V-D-J rearrangement and V-J rearrangement in the CDR3 repertoire.

  2. Live Borrelia burgdorferi preferentially activate interleukin-1 beta gene expression and protein synthesis over the interleukin-1 receptor antagonist.

    PubMed Central

    Miller, L C; Isa, S; Vannier, E; Georgilis, K; Steere, A C; Dinarello, C A

    1992-01-01

    Lyme arthritis is one of the few forms of chronic arthritis in which the cause is known with certainty. Because cytokines are thought to contribute to the pathogenesis of chronic arthritis, we investigated the effect of the Lyme disease spirochete, Borrelia burgdorferi, on the gene expression and synthesis of IL-1 beta and the IL-1 receptor antagonist (IL-1ra) in human peripheral blood mononuclear cells. Live B. burgdorferi induced fivefold more IL-1 beta than IL-1 alpha and sevenfold more IL-1 beta than IL-1ra; LPS or sonicated B. burgdorferi induced similar amounts of all three cytokines. This preferential induction of IL-1 beta was most dramatic in response to a low passage, virulent preparation of B. burgdorferi vs. three high passage avirulent strains. No difference in induction of IL-1ra was seen between these strains. The marked induction of IL-1 beta was partially diminished by heat-treatment and abrogated by sonication; IL-1ra was not affected. This suggested that a membrane component(s) accounted for the preferential induction of IL-1 beta. However, recombinant outer surface protein beta induced little IL-1 beta. By 4 h after stimulation, B. burgdorferi induced sixfold more IL-1 beta protein than LPS. In contrast to LPS-induced IL-1 beta mRNA which reached maximal accumulation after 3 h, B. burgdorferi-induced IL-1 beta mRNA showed biphasic elevations at 3 and 18 h. B. burgdorferi-induced IL-1ra mRNA peaked at 12 h, whereas LPS-induced IL-1ra mRNA peaked at 9 h. IL-1 beta synthesis increased in response to increasing numbers of spirochetes, whereas IL-1ra synthesis did not. The preferential induction by B. burgdorferi of IL-1 beta over IL-1ra is an example of excess agonist over antagonist synthesis induced by a microbial pathogen, and may contribute to the destructive lesion of Lyme arthritis. Images PMID:1387885

  3. Human beta-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old.

    PubMed Central

    Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M

    1995-01-01

    Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible. Images Figure 2 Figure 3 PMID:8533755

  4. Early peroxisome proliferator-activated receptor gamma regulated genes involved in expansion of pancreatic beta cell mass

    PubMed Central

    2011-01-01

    Background The progression towards type 2 diabetes depends on the allostatic response of pancreatic beta cells to synthesise and secrete enough insulin to compensate for insulin resistance. The endocrine pancreas is a plastic tissue able to expand or regress in response to the requirements imposed by physiological and pathophysiological states associated to insulin resistance such as pregnancy, obesity or ageing, but the mechanisms mediating beta cell mass expansion in these scenarios are not well defined. We have recently shown that ob/ob mice with genetic ablation of PPARγ2, a mouse model known as the POKO mouse failed to expand its beta cell mass. This phenotype contrasted with the appropriate expansion of the beta cell mass observed in their obese littermate ob/ob mice. Thus, comparison of these models islets particularly at early ages could provide some new insights on early PPARγ dependent transcriptional responses involved in the process of beta cell mass expansion Results Here we have investigated PPARγ dependent transcriptional responses occurring during the early stages of beta cell adaptation to insulin resistance in wild type, ob/ob, PPARγ2 KO and POKO mice. We have identified genes known to regulate both the rate of proliferation and the survival signals of beta cells. Moreover we have also identified new pathways induced in ob/ob islets that remained unchanged in POKO islets, suggesting an important role for PPARγ in maintenance/activation of mechanisms essential for the continued function of the beta cell. Conclusions Our data suggest that the expansion of beta cell mass observed in ob/ob islets is associated with the activation of an immune response that fails to occur in POKO islets. We have also indentified other PPARγ dependent differentially regulated pathways including cholesterol biosynthesis, apoptosis through TGF-β signaling and decreased oxidative phosphorylation. PMID:22208362

  5. [The ht-PAm cDNA knock-in the goat beta-casein gene locus].

    PubMed

    Shen, Wei; Yang, Zheng-Tian; Tian, Li-Yuan; Wu, Xiao-Jie; Chen, Hong; Huang, Pei-Tang; Deng, Ji-Xian

    2004-05-01

    The production of recombinant protein is one of the major successes of biotechnology, animal cells are required to synthesize proteins with the appropriate post-translational modifications. Transgenic animal mammary gland bioreactor are being used for this purpose. Gene targeting is a more powerful method to produce mammary gland bioreactor, and nuclear transfer from cultured somatic cells provides an wonderful means of cell-mediated transgensis. Here we describe efficient and reproducible gene targeting in goat fetal fibroblasts to place the human tissue plasminogen activator mutant (ht-PAm) cDNA at the beta-casein locus, and would produce the transgenic goat by nuclear transfer. To construct the gene targeting vector pGBC4tPA, the milk goat beta-casein genomic DNA sequence for homologous arms had been cloned firstly. The left arm was 6.3 kb fragment including goat beta-casein gene 5' flanking sequence, and the right arm was 2.4 kb fragement including beta-casein gene from exon 8 to exon 9. The ht-PAm cDNA was subcloned in the goat beta-casein gene exon 2, and the endogenous start condon was replaced by that of ht-PAm. The bacterial neomycin (neo) gene as positive selection marker gene, was placed in the beta-casein gene intron 7, the thymidine kinase (tk) as the negative selection marker gene, was just outside the right arm. The validity of the positive-negative selection vector (PNS), was tested, and targeting homologous recombination (HR) were elevated to 5-fold with the negative selection marker using the drug GANC. The DNA fragment in which two LoxP sequence was delected effectively using Cre recombinase in vitro. Goat fetal fibroblasts were thawed and cultured to subconfluence before transfection, about 10(7) fibroblasts were electoporated at 240V, 600 microF in 0.8 mL PBS buffer containing linear pGBC4tPA. transfected cells were cultured in collagen-coated 96-wellplate for 24h without selection, then added the drug G418 (600 microg/mL) and GANC (2 micromol

  6. Expression of two CYP1A genes in {beta}NF and TCDD-treated rainbow trout primary hepatocyte culture

    SciTech Connect

    Rabergh, C.M.; Lipsky, M.M.; Vroliijk, N.H.; Chen, T.T.

    1995-12-31

    In mammalian systems, it is well known that two CYP1A genes are expressed in response to environmental toxicants such as polycyclic aromatic hydrocarbons (PAHs) and TCDD (2,3,7,3-tetrachlorodibenzo-p-dioxin). The presence of two CYP1A genes in fish has been previously reported, though expression of these two genes has not been characterized. In this study, the authors examined the expression of these two genes in primary culture of rainbow trout hepatocytes treated with {beta}NF and TCDD. Hepatocytes were isolated by a modified two-step collagenase perfusion of the liver and cultured on polylysine coated dishes. The optimum time and concentration of induction was determined for both chemicals. The expression of the genes was also studied in long-term cultures up to 20 days. RNA was isolated by the method of Chomzynski and Sacchi and the RNase protection assay was used to detect the expression of the CYP1A genes by using antisense riboprobes specific for the MRNA of each gene. A differential concentration- and time-dependent expression of the two genes was observed in cells treated with {beta}NF and TCDD. Whether these two genes are paralogous, i.e., produced by gene duplication within the species, or whether one of them may in fact be an orthologue to a mammalian counterpart within the CYP1A family, remains to be determined.

  7. Metabolism of Very Long-Chain Fatty Acids: Genes and Pathophysiology

    PubMed Central

    Sassa, Takayuki; Kihara, Akio

    2014-01-01

    Fatty acids (FAs) are highly diverse in terms of carbon (C) chain-length and number of double bonds. FAs with C>20 are called very long-chain fatty acids (VLCFAs). VLCFAs are found not only as constituents of cellular lipids such as sphingolipids and glycerophospholipids but also as precursors of lipid mediators. Our understanding on the function of VLCFAs is growing in parallel with the identification of enzymes involved in VLCFA synthesis or degradation. A variety of inherited diseases, such as ichthyosis, macular degeneration, myopathy, mental retardation, and demyelination, are caused by mutations in the genes encoding VLCFA metabolizing enzymes. In this review, we describe mammalian VLCFAs by highlighting their tissue distribution and metabolic pathways, and we discuss responsible genes and enzymes with reference to their roles in pathophysiology. PMID:24753812

  8. Characterization of the 5'-flanking region of the gene for the alpha chain of human fibrinogen.

    PubMed

    Hu, C H; Harris, J E; Davie, E W; Chung, D W

    1995-11-24

    The 5'-flanking region of the gene coding for the alpha chain of human fibrinogen was isolated, sequenced, and characterized. The principal site of transcription initiation was determined by primer extension analysis and the RNase protection assay and shown to be at an adenine residue located 55 nucleotides upstream from the initiator methionine codon, or 13,399 nucleotides down-stream from the polyadenylation site of the gene coding for the gamma chain. Transient expression of constructs containing sequentially deleted 5'-flanking sequences of the alpha chain gene fused to the chloramphenicol acetyltransferase reporter gene showed that the promoter was liver-specific and inducible by interleukin 6 (IL-6). The shortest DNA fragment with significant promoter activity and full response to IL-6 stimulation encompassed the region from -217 to +1 base pairs (bp). Although six potential IL-6 responsive sequences homologous to the type II IL-6 responsive element were present, a single sequence of CTGGGA localized from -122 to -127 bp was shown to be a functional element in IL-6 induction. A hepatocyte nuclear factor 1 (HNF-1) binding site, present from -47 to -59 bp, in combination with other upstream elements, was essential for liver-specific expression of the gene. A functional CCAAT/enhancer binding protein site (C/EBP, -134 to -142 bp) was also identified within 217 bp from the transcription initiation site. An additional positive element (-1393 to -1133 bp) and a negative element (-1133 to -749 bp) were also found in the upstream region of the alpha-fibrinogen gene. PMID:7499335

  9. Chicken beta B1-crystallin gene expression: presence of conserved functional polyomavirus enhancer-like and octamer binding-like promoter elements found in non-lens genes.

    PubMed Central

    Roth, H J; Das, G C; Piatigorsky, J

    1991-01-01

    Expression of the chicken beta B1-crystallin gene was examined. Northern (RNA) blot and primer extension analyses showed that while abundant in the lens, the beta B1 mRNA is absent from the liver, brain, heart, skeletal muscle, and fibroblasts of the chicken embryo, suggesting lens specificity. Promoter fragments ranging from 434 to 126 bp of 5'-flanking sequence (plus 30 bp of exon 1) of the beta B1 gene fused to the bacterial chloramphenicol acetyltransferase gene functioned much more efficiently in transfected embryonic chicken lens epithelial cells than in transfected primary muscle fibroblasts or HeLa cells. Transient expression of recombinant plasmids in cultured lens cells, DNase I footprinting, in vitro transcription in a HeLa cell extract, and gel mobility shift assays were used to identify putative functional promoter elements of the beta B1-crystallin gene. Sequence analysis revealed a number of potential regulatory elements between positions -126 and -53 of the beta B1 promoter, including two Sp1 sites, two octamer binding sequence-like sites (OL-1 and OL-2), and two polyomavirus enhancer-like sites (PL-1 and PL-2). Deletion and site-specific mutation experiments established the functional importance of PL-1 (-116 to -102), PL-2 (-90 to -76), and OL-2 (-75 to -68). DNase I footprinting using a lens or a HeLa cell nuclear extract and gel mobility shifts using a lens nuclear extract indicated the presence of putative lens transcription factors binding to these DNA sequences. Competition experiments provided evidence that PL-1 and PL-2 recognize the same or very similar factors, while OL-2 recognizes a different factor. Our data suggest that the same or closely related transcription factors found in many tissues are used for expression of the chicken beta B1-crystallin gene in the lens. Images PMID:1996106

  10. Biotin supplementation increases expression of genes encoding interferon-gamma, interleukin-1beta, and 3-methylcrotonyl-CoA carboxylase, and decreases expression of the gene encoding interleukin-4 in human peripheral blood mononuclear cells.

    PubMed

    Wiedmann, Silke; Eudy, James D; Zempleni, Janos

    2003-03-01

    Stimulation of immune cells by antigens triggers changes in the transcription of genes encoding cytokines and other proteins; these changes in gene expression are part of the normal immune response. Previous studies have provided evidence that biotin status may affect secretion of cytokines by immune cells. Here we determined whether biotin supplementation affects gene expression in human immune cells. Peripheral blood mononuclear cells were isolated from healthy adults before and after supplementation with 8.8 micro mol biotin/d for 21 d. Cells were cultured ex vivo with concanavalin A for 21 h to simulate stimulation with antigens. Expression of genes that play roles in cytokine metabolism, cell proliferation, signal transduction, stress response, apoptosis and biotin homeostasis was quantified by using DNA microarrays and reverse transcriptase-polymerase chain reaction. The abundance of mRNA encoding interferon-gamma, interleukin-1beta, and 3-methylcrotonyl-CoA carboxylase was 4.3, 5.6 and 8.9 times greater, respectively, after supplementation with biotin compared with before supplementation. In contrast, the abundance of mRNA encoding interleukin-4 was 6.8 times greater before supplementation than after supplementation. These data suggest that biotin supplementation affects gene expression in human immune cells. Effects of biotin on gene expression are likely to modulate the response of immune cells to antigens.

  11. Regulatory elements and structural features of Beta vulgaris polygalacturonase-inhibiting protein gene for fungal and pest control

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polygalacturonase-inhibiting proteins (PGIPs) are involved in plant defense. PGIPs are cell wall leucine-rich repeat (LRR) proteins that are known to inhibit pathogen and pest polygalacturonases (PGs) during the infection process. Several sugar beet (Beta vulgaris L.) PGIP genes (BvPGIP) were clon...

  12. Evolution of the Iga Heavy Chain Gene in the Genus Mus

    PubMed Central

    Osborne, B. A.; Golde, T. E.; Schwartz, R. L.; Rudikoff, S.

    1988-01-01

    To examine questions of immunoglobulin gene evolution, the IgA α heavy chain gene from Mus pahari, an evolutionarily distant relative to Mus musculus domesticus, was cloned and sequenced. The sequence, when compared to the IgA gene of BALB/c or human, demonstrated that the IgA gene is evolving in a mosaic fashion with the hinge region accumulating mutations most rapidly and the third domain at a considerably lower frequency. In spite of this pronounced accumulation of mutations, the hinge region appears to maintain the conformation of a random coil. A marked propensity to accumulate replacement over silent site changes in the coding regions was noted, as was a definite codon bias. The possibility that these two phenomena are interrelated is discussed. PMID:2842228

  13. Nested polymerase chain reaction for amplification of the Cryptosporidium oocyst wall protein gene.

    PubMed Central

    Pedraza-Díaz, S.; Amar, C.; Nichols, G. L.; McLauchlin, J.

    2001-01-01

    We developed a sensitive nested polymerase chain reaction procedure for the Cryptosporidium oocyst wall protein (COWP) gene. Amplification and genotyping were successful in 95.2% of 1,680 fecal samples, 77.6% by the unnested and 17.6% by the nested COWP procedure. The COWP gene was amplified from 2,128 fecal samples: 71 from livestock animals and 2,057 from humans. This series included 706 cases from seven drinking water-associated outbreaks and 51 cases from five swimming pool-associated outbreaks, as well as 1,300 sporadic cases. PMID:11266294

  14. Phosphate-haemoglobin interaction. The primary structure of the haemoglobin of the African elephant (Loxodonta africana, Proboscidea): asparagine in position 2 of the beta-chain.

    PubMed

    Braunitzer, G; Stangl, A; Schrank, B; Krombach, C; Wiesner, H

    1984-07-01

    The primary structure of the haemoglobin of the African Elephant (Loxodonta africana) is reported. The sequence was determined by means of a sequenator. The haemoglobin differs in 26 amino acids in the alpha-chains and in 27 in the beta-chains from that of adult human haemoglobin. The haemoglobin of the African Elephant, like that of the Indian Elephant and Ilama, has only 5 binding sites for polyphosphate. This finding explains the low p(O2)50 value in whole blood as a result of the lower 2,3-bisphosphoglycerate-haemoglobin interaction. This is discussed in relation to aspects of respiratory physiology; some points are also of interest with regard to the Second Punic War and Hannibal's crossing of the Alps.

  15. Asthma: Gln27Glu and Arg16Gly polymorphisms of the beta2-adrenergic receptor gene as risk factors

    PubMed Central

    2014-01-01

    Background Asthma is caused by both environmental and genetic factors. The ADRB2 gene, which encodes the beta 2-adrenergic receptor, is one of the most extensively studied genes with respect to asthma prevalence and severity. The Arg16Gly (+46A > G) and Gln27Glu (+79C > G) polymorphisms in the ADRB2 gene cause changes in the amino acids flanking the receptor ligand site, altering the response to bronchodilators and the risk of asthma through complex pathways. The ADRB2 polymorphisms affect beta-adrenergic bronchodilator action and are a tool to identify at-risk populations. Objective To determine the frequency of these two polymorphisms in allergic asthma patients and healthy subjects and to correlate these data with the occurrence and severity of asthma. Methods Eighty-eight allergic asthma patients and 141 healthy subjects were included in this study. The ADRB2 polymorphisms were analyzed using the amplification-refractory mutation system – polymerase chain reaction (ARMS-PCR) technique. The statistical analysis was performed with the SPSS 21.0 software using the Fisher’s Exact and χ2 tests. Results The ADRB2 polymorphisms were associated with asthma occurrence. The Arg16Arg, Gln27Gln and Gln27Glu genotypes were risk factors; the odds ratios were 6.782 (CI = 3.07 to 16.03), 2.120 (CI = 1.22 to 3.71) and 8.096 (CI = 3.90 to 17.77), respectively. For the Gly16Gly and Glu27Glu genotypes, the odds ratios were 0.312 (CI = 0.17 to 0.56) and 0.084 (CI = 0.04 to 0.17), respectively. The haplotype analysis showed that there were associations between the following groups: Arg16Arg-Gln27Gln (OR = 5.108, CI = 1.82 to 16.37), Gly16Gly-Glu27Glu (OR = 2.816, CI = 1.25 to 6.54), Arg16Gly-Gln27Glu (OR = 0.048, CI = 0.01 to 0.14) and Gly16Gly-Gln27Glu (OR = 0.1036, CI = 0.02 to 0.39). The polymorphism Gln27Glu was associated with asthma severity, as the Gln27Gln genotype was a risk factor for severe asthma (OR

  16. A study of deleterious gene structure in plants using Markov chain Monte Carlo.

    PubMed

    Lee, J K; Lascoux, M; Newton, M A; Nordheim, E V

    1999-06-01

    The characteristics of deleterious genes have been of great interest in both theory and practice in genetics. Because of the complex genetic mechanism of these deleterious genes, most current studies try to estimate the overall magnitude of mortality effects on a population, which is characterized classically by the number of lethal equivalents. This number is a combination of several parameters, each of which has a distinct biological effect on genetic mortality. In conservation and breeding programs, it is important to be able to distinguish among different combinations of these parameters that lead to the same number of lethal equivalents, such as a large number of mildly deleterious genes or a few lethal genes, The ability to distinguish such parameter combinations requires more than one generation of mating. We propose a model for survival data from a two-generation mating experiment on the plant species Brassica rapa, and we enable inference with Markov chain Monte Carlo. This computational strategy is effective because a vast amount of missing genotype information must be accounted for. In addition to the lethal equivalents, the two-generation data provide separate information on the average intensity of mortality and the average number of deleterious genes carried by an individual. In our Markov chain Monte Carlo algorithm, we use a vector proposal distribution to overcome inefficiency of a single-site Gibbs sampler. Information about environmental effects is obtained from an outcrossing experiment conducted in parallel with the two-generation mating experiments.

  17. Gene structure and molecular phylogeny of the linker chains from the giant annelid hexagonal bilayer hemoglobins.

    PubMed

    Chabasse, Christine; Bailly, Xavier; Sanchez, Sophie; Rousselot, Morgane; Zal, Franck

    2006-09-01

    Giant extracellular hexagonal bilayer hemoglobin (HBL-Hb), found only in annelids, is an approximately 3500-kDa heteropolymeric structure involved in oxygen transport. The HBL-Hbs are comprised of globin and linker chains, the latter being required for the assembly of the quaternary structure. The linker chains, varying in size from 225 to 283 amino acids, have a conserved cysteine-rich domain within their N-terminal moiety that is homologous to the cysteine-rich modules constituting the ligand binding domain of the low-density lipoprotein receptor (LDLR) protein family found in many metazoans. We have investigated the gene structure of linkers from Arenicola marina, Alvinella pompejana, Nereis diversicolor, Lumbricus terrestris, and Riftia pachyptila. We found, contrary to the results obtained earlier with linker genes from N. diversicolor and L. terrestris, that in all of the foregoing cases, the linker LDL-A module is flanked by two phase 1 introns, as in the human LDLR gene, with two more introns in the 3' side whose positions varied with the species. In addition, we obtained 13 linker cDNAs that have been determined experimentally or found in the EST database LumbriBASE. A molecular phylogenetic analysis of the linker primary sequences demonstrated that they cluster into two distinct families of linker proteins. We propose that the common gene ancestor to annelid linker genes exhibited a four-intron and five-exon structure and gave rise to the two families subsequent to a duplication event. PMID:16838215

  18. An ancient repeat sequence in the ATP synthase beta-subunit gene of forcipulate sea stars.

    PubMed

    Foltz, David W

    2007-11-01

    A novel repeat sequence with a conserved secondary structure is described from two nonadjacent introns of the ATP synthase beta-subunit gene in sea stars of the order Forcipulatida (Echinodermata: Asteroidea). The repeat is present in both introns of all forcipulate sea stars examined, which suggests that it is an ancient feature of this gene (with an approximate age of 200 Mya). Both stem and loop regions show high levels of sequence constraint when compared to flanking nonrepetitive intronic regions. The repeat was also detected in (1) the family Pterasteridae, order Velatida and (2) the family Korethrasteridae, order Velatida. The repeat was not detected in (1) the family Echinasteridae, order Spinulosida, (2) the family Astropectinidae, order Paxillosida, (3) the family Solasteridae, order Velatida, or (4) the family Goniasteridae, order Valvatida. The repeat lacks similarity to published sequences in unrestricted GenBank searches, and there are no significant open reading frames in the repeat or in the flanking intron sequences. Comparison via parametric bootstrapping to a published phylogeny based on 4.2 kb of nuclear and mitochondrial sequence for a subset of these species allowed the null hypothesis of a congruent phylogeny to be rejected for each repeat, when compared separately to the published phylogeny. In contrast, the flanking nonrepetitive sequences in each intron yielded separate phylogenies that were each congruent with the published phylogeny. In four species, the repeat in one or both introns has apparently experienced gene conversion. The two introns also show a correlated pattern of nucleotide substitutions, even after excluding the putative cases of gene conversion.

  19. Transcriptional control of expression of fungal beta-lactam biosynthesis genes.

    PubMed

    Litzka, O; Then Bergh, K; Van den Brulle, J; Steidl, S; Brakhage, A A

    1999-01-01

    The most commonly used beta-lactam antibiotics for the therapy of infectious diseases are penicillin and cephalosporin. Penicillin is produced as end product by some fungi most notably by Aspergillus (Emericella) nidulans and Penicillium chrysogenum. Cephalosporins are synthesised by several bacteria and fungi, e.g. by the fungus Acremonium chrysogenum (syn. Cephalosporium acremonium). The biosynthetic pathways leading to both secondary metabolites start from the same three amino acid precursors and have the first two enzymatic reactions in common. The penicillin biosynthesis is catalysed by three enzymes encoded by acvA (pcbAB), ipnA (pcbC) and aatA (penDE). The genes are organised into a cluster. In A. chrysogenum, in addition to acvA and ipnA, which are also clustered, a second cluster contains the genes for enzymes catalysing the reactions of the later steps of the cephalosporin pathway (cefEF, cefG). Transcription of biosynthesis genes is subject to sophisticated control by nutritional factors (e.g. glucose, nitrogen), amino acids such as lysine and methionine, and ambient pH. Some regulators have been identified such as the A. nidulans pH regulatory protein PACC and the transcriptional complex PENR1. PENR1 is a HAP-like transcriptional complex similar or identical to AnCF. Additional positive regulatory factors seem to be represented by recessive trans-acting mutations of A. nidulans (prgA1, prgB1, npeE1) and P. chrysogenum (carried by mutants Npe2 and Npe3). The GATA-binding factor NRE appears to be involved in the regulation of the penicillin biosynthesis genes by the nitrogen source in P. chrysogenum. Formal genetic evidence suggests the existence of transcriptional repressors as well.

  20. DNA sequence of immunoglobulin heavy chain variable region gene in thyroid lymphoma.

    PubMed

    Miwa, H; Takakuwa, T; Nakatsuka, S; Tomita, Y; Matsuzuka, F; Aozasa, K

    2001-10-01

    Patho-epidemiological studies have shown that thyroid lymphoma (TL) develops in thyroid affected by chronic lymphocytic thyroiditis (CLTH). CLTH is categorized as an organ-specific autoimmune disease, in which activated B-lymphocytes secrete a number of autoantibodies. Because antigenic stimulation might be involved in the pathogenesis of TL, the variable region in heavy chain (V(H)) genes was characterized in 13 cases with TL and 3 with CLTH. Clonal rearrangement of the V(H) gene was found in 11 cases of TL, and cloning study with sequencing of complimentary determining region (CDR) 3 revealed the presence of a major clone in 4. Three of the 4 cases used V(H) 3 gene, with the homologous germline gene of V3-30 in two cases and VH26 in one case. A biased usage of V(H) 3 and V(H) 4 genes with the homologous germline gene of VH26 in V(H) 3 gene was reported previously in cases with CLTH. A high level of somatic mutation (1-21%, average 12%) with non-random distribution of replacement and silent mutations was accumulated in all cases. The frequency of the occurrence of minor clones ranged from 29-44% per case, indicating the presence of on-going mutation. DNA sequencing of immunoglobulin V(H) gene suggests that TL develops among activated lymphoid cells in CLTH at the germinal center stage under antigen selection. PMID:11676854

  1. Ets proteins: new factors that regulate immunoglobulin heavy-chain gene expression.

    PubMed

    Rivera, R R; Stuiver, M H; Steenbergen, R; Murre, C

    1993-11-01

    We used a DNA-protein interaction screening method to isolate a cDNA, Erg-3, whose product binds to a site, designated pi, present in the immunoglobulin (Ig) heavy-chain gene enhancer. Erg-3 is an alternatively spliced product of the erg gene and contains an Ets DNA-binding domain. Fli-1 and PU.1, related Ets proteins, also bind to the same site. In addition, PU.1 binds to a second site, designated microB, in the Ig heavy-chain enhancer. We demonstrate that the pi binding site is crucial for Ig heavy-chain gene enhancer function. In addition, we show that Erg-3 and Fli.1, but not PU.1, can activate a reporter construct containing a multimer of protein-binding sites, synergistically with helix-loop-helix protein E12. We discuss how combinatorial interactions between members of the helix-loop-helix and Ets families may account for the tissue specificity of these proteins.

  2. Human liver long-chain 3-hydroxyacyl-coenzyme A dehydrogenase is a multifunctional membrane-bound beta-oxidation enzyme of mitochondria.

    PubMed

    Carpenter, K; Pollitt, R J; Middleton, B

    1992-03-16

    We have purified to homogeneity the long-chain specific 3-hydroxyacyl-CoA dehydrogenase from mitochondrial membranes of human infant liver. The enzyme is composed of non-identical subunits of 71 kDa and 47 kDa within a native structure of 230 kDa. The pure enzyme is active with 3-ketohexanoyl-CoA and gives maximum activity with 3-ketoacyl-CoA substrates of C10 to C16 acyl-chain length but is inactive with acetoacetyl-CoA. In addition to 3-hydroxyacyl-CoA dehydrogenase activity, the enzyme possesses 2-enoyl-CoA hydratase and 3-ketoacyl-CoA thiolase activities which cannot be separated from the dehydrogenase. None of these enzymes show activity with C4 substrates but all are active with C6 and longer acyl-chain length substrates. They are thus distinct from any described previously. This human liver mitochondrial membrane-bound enzyme catalyses the conversion of medium- and long-chain 2-enoyl-CoA compounds to: 1) 3-ketoacyl-CoA in the presence of NAD alone and 2) to acetyl-CoA (plus the corresponding acyl-CoA derivatives) in the presence of NAD and CoASH. It is therefore a multifunctional enzyme, resembling the beta-oxidation enzyme of E. coli, but unique in its membrane location and substrate specificity. We propose that its existence explains the repeated failure to detect any intermediates of mitochondrial beta-oxidation.

  3. DNA markers closely linked to nematode resistance genes in sugar beet (Beta vulgaris L.) mapped using chromosome additions and translocations originating from wild beets of the Procumbentes section.

    PubMed

    Jung, C; Koch, R; Fischer, F; Brandes, A; Wricke, G; Herrmann, R G

    1992-03-01

    Genes conferring resistance to the beet cyst nematode (Heterodera schachtii Schm.) have been transferred to sugar beet (Beta vulgaris L.) from three wild species of the Procumbentes section using monosomic addition and translocation lines, because no meiotic recombination occurs between chromosomes of cultured and wild species. In the course of a project to isolate the nematode resistance genes by strategies of reverse genetics, probes were cloned from DNA of a fragmented B. procumbens chromosome carrying a resistance gene, which had been isolated by pulsed-field gel electrophoresis. One probe (pRK643) hybridized with a short dispersed repetitive DNA element, which was found only in wild beets, and thus may be used as a molecular marker for nematode resistance to progeneis of monosomic addition lines segregating resistant and susceptible individuals. Additional probes for the resistance gene region were obtained with a polymerase chain reaction (PCR)-based strategy using repetitive primers to amplify DNA located between repetitive elements. One of these probes established the existence of at least six different chromosomes from wild beet species, each conferring resistance independently of the others. A strict correlation between the length of the wild beet chromatin introduced in fragment addition and translocation lines and the repeat copy number has been used physically to map the region conferring resistance to a chromosome segment of 0.5-3 Mb.

  4. Defects in the HSD11 gene encoding 11[beta]-hydroxysteriod dehydrogenase are not found in patients with apparent mineralocorticoid excess or 11-oxoreductase deficiency

    SciTech Connect

    Nikkila, H.; White, P.C. ); Tannin, G.M. ); New, M.I.; Taylor, N.F. ); Kalaitzoglou, G.; Monder, C. )

    1993-09-01

    The syndrome of apparent mineralocorticoid excess (AME) is a form of low renin hypertension that is thought to be caused by congenital deficiency of 11[beta]-hydroxysteroid dehydrogenase (11HSD) activity. This enzyme converts cortisol to cortisone and apparently prevents cortisol from acting as a ligand for the mineralocorticoid (type I) receptor. It also catalyzes the reverse oxoreductase (cortisone to cortisol) reaction. Four patients with AME and the parents of the first patient described (now deceased) were analyzed for mutations in the cloned HSD11 gene encoding an 11HSD enzyme. A patient with suspected cortisone reductase deficiency was also studied. No gross deletions or rearrangements in the HSD11 gene were apparent on hybridizations of blot of genomic DNA. Direct sequencing of polymerase chain reaction-amplified fragments corresponding to the coding sequences, intronexon junctions, and proximal untranslated regions of this gene revealed no mutations. AME may involve mutations in a gene for another enzyme with 11HSD activity or perhaps another cortisol metabolizing enzyme. 48 refs., 2 figs., 2 tabs.

  5. Expression and developmental control of platelet-derived growth factor A-chain and B-chain/Sis genes in rat aortic smooth muscle cells

    SciTech Connect

    Majesky, M.W.; Benditt, E.P.; Schwartz, S.M.

    1988-03-01

    Cultured arterial smooth muscle cells (SMC) can produce platelet-derived growth factor (PDGF)-like molecules. This property raises the possibility that SMC-derived PDGFs function as autocrine/paracrine regulators in the formation and maintenance of the artery wall. In this study the authors have asked if levels of mRNAs directing synthesis of PDFG are modulated in aortic SMC during postnatal development. The authors report here that genes encoding PDGF A- and B-chain precursors are expressed at similar low levels in intact aortas from newborn and adult rats. Marked differences in regulation of transcript abundance of these genes were revealed when aortic SMC were grown in cell culture. PDGF B-chain transcripts accumulated in passaged newborn rat SMC but not adult rat SMC, whereas PDGF A-chain RNA was found in comparable amounts in SMC from both age groups. Similarly, SMC from newborn rats secreted at least 60-fold more PDGF-like activity into conditioned medium than did adult rat SMC. These results show that PDGF A- and B-chain genes are transcribed in the normal rat aorta and provide evidence for age-related change in the control of PDGF B-chain gene expression in aortic SMC. Independent regulation of transcript levels in cultured SMC leaves open the possibility that PDGFs of different composition (AA, AB, BB) play different roles in normal function of the artery wall.

  6. Targeting the exogenous htPAm gene on goat somatic cell beta-casein locus for transgenic goat production.

    PubMed

    Shen, Wei; Lan, Guocheng; Yang, Xueyi; Li, Lan; Min, Lingjiang; Yang, Zhengtian; Tian, Liyuan; Wu, Xiaojie; Sun, Yujiang; Chen, Hong; Tan, Jinghe; Deng, Jixian; Pan, Qingjie

    2007-04-01

    Combining gene targeting of animal somatic cells with nuclear transfer technique has provided a powerful method to produce transgenic animal mammary gland bioreactor. The objective of this study is to make an efficient and reproducible gene targeting in goat fetal fibroblasts by inserting the exogenous htPAm cDNA into the beta-casein locus with liposomes or electroporation so that htPAm protein might be produced in gene-targeted goat mammary gland. By gene-targeting technique, the exogenous htPAm gene was inserted to milk goat beta-casein gene sequences. Fetal fibroblasts were isolated from Day 35 fetuses of Guanzhong milk goats, and transfected with linear gene-targeting vector pGBC4htPAm using Lipefectamin-2000 and electoporation, respectively. Forty-eight gene-targeted cell colonies with homologous recombination were obtained, and three cell colonies were verified by DNA sequence analysis within the homologous recombination region. Using gene-targeted cell lines as donor cells for nuclear transfer, a total of 600 reconstructed embryos had been obtained, and 146 developed cloned embryos were transferred to 16 recipient goats, and finally three goats showed pregnancy at Day 90.

  7. Gene Expression Profiles of Beta-Cell Enriched Tissue Obtained by Laser Capture Microdissection from Subjects with Type 2 Diabetes

    PubMed Central

    Marselli, Lorella; Thorne, Jeffrey; Dahiya, Sonika; Sgroi, Dennis C.; Sharma, Arun; Bonner-Weir, Susan; Marchetti, Piero; Weir, Gordon C.

    2010-01-01

    Background Changes in gene expression in pancreatic beta-cells from type 2 diabetes (T2D) should provide insights into their abnormal insulin secretion and turnover. Methodology/Principal Findings Frozen sections were obtained from cadaver pancreases of 10 control and 10 T2D human subjects. Beta-cell enriched samples were obtained by laser capture microdissection (LCM). RNA was extracted, amplified and subjected to microarray analysis. Further analysis was performed with DNA-Chip Analyzer (dChip) and Gene Set Enrichment Analysis (GSEA) software. There were changes in expression of genes linked to glucotoxicity. Evidence of oxidative stress was provided by upregulation of several metallothionein genes. There were few changes in the major genes associated with cell cycle, apoptosis or endoplasmic reticulum stress. There was differential expression of genes associated with pancreatic regeneration, most notably upregulation of members of the regenerating islet gene (REG) family and metalloproteinase 7 (MMP7). Some of the genes found in GWAS studies to be related to T2D were also found to be differentially expressed. IGF2BP2, TSPAN8, and HNF1B (TCF2) were upregulated while JAZF1 and SLC30A8 were downregulated. Conclusions/Significance This study made possible by LCM has identified many novel changes in gene expression that enhance understanding of the pathogenesis of T2D. PMID:20644627

  8. Beta2-Adrenergic Receptor Gene Polymorphisms as Systemic Determinants of Healthy Aging in an Evolutionary Context

    PubMed Central

    Kulminski, Alexander M.; Culminskaya, Irina V.; Ukraintseva, Svetlana V.; Arbeev, Konstantin G.; Land, Kenneth C.; Yashin, Anatoli I.

    2010-01-01

    The Gln27Glu polymorphism but not the Arg16Gly polymorphism of the beta2-adrenergic receptor (ADRB2) gene appears to be associated with a broad range of aging-associated phenotypes, including cancers at different sites, myocardial infarction (MI), intermittent claudication (IC), and overall/healthy longevity in the Framingham Heart Study Offspring cohort. The Gln27Gln genotype increases risks of cancer, MI and IC, whereas the Glu27 allele or, equivalently, the Gly16Glu27 haplotype tends to be protective against these diseases. Genetic associations with longevity are of opposite nature at young-old and oldest-old ages highlighting the phenomenon of antagonistic pleiotropy. The mechanism of antagonistic pleiotropy is associated with an evolutionary-driven advantage of carriers of a derived Gln27 allele at younger ages and their survival disadvantage at older ages as a result of increased risks of cancer, MI and IC. The ADRB2 gene can play an important systemic role in healthy aging in evolutionary context that warrants exploration in other populations. PMID:20399803

  9. Glomerular expression of interleukin-1 receptor antagonist and interleukin-1 beta genes in antibody-mediated glomerulonephritis.

    PubMed Central

    Tam, F. W.; Smith, J.; Cashman, S. J.; Wang, Y.; Thompson, E. M.; Rees, A. J.

    1994-01-01

    Interleukin-1 (IL-1) is a powerful proinflammatory cytokine whose function is modulated by a natural IL-1 receptor antagonist (IL-1ra). There are few data about kinetics of in vivo synthesis of IL-1ra at tissue level, except in response to bacterial endotoxin. The purpose of this study was to examine the kinetics of local expression of IL-1ra gene in relation to IL-1 beta gene in a model of anti-glomerular basement membrane antibody-mediated glomerulonephritis. Rats were killed in groups of 5 or 6 at 0, 4, 6, 24, 48, and 96 hours after induction of glomerulonephritis. Messenger RNA for IL-1ra and IL-1 beta was undetectable by Northern blot in normal glomeruli but increased markedly 4 to 6 hours after induction of nephritis. The increase in IL-1ra mRNA was more sustained than that of IL-1 beta mRNA. In situ hybridization showed that IL-1 beta mRNA increased diffusely within glomeruli, while IL-1ra mRNA was expressed more discretely. Expression of these mRNA in noninflamed tissues, spleens and lungs, was different, particularly increase in IL-1ra mRNA was more substantial than that of IL-1 beta. These observations suggest that differential expression of IL-1ra and IL-1 beta might focus inflammation in glomeruli while protecting more distant sites. They also raise the possibility of reducing glomerular injury by therapeutic measures that upregulate glomerular synthesis of IL-1ra while reducing that of IL-1 beta. Images Figure 1 Figure 2 Figure 4 Figure 5 PMID:8030744

  10. Clathrin light chain B: gene structure and neuron-specific splicing.

    PubMed Central

    Stamm, S; Casper, D; Dinsmore, J; Kaufmann, C A; Brosius, J; Helfman, D M

    1992-01-01

    The clathrin light chains are components of clathrin coated vesicles, structural constituents involved in endocytosis and membrane recycling. The clathrin light chain B (LCB) gene encodes two isoforms, termed LCB2 and LCB3, via an alternative RNA splicing mechanism. We have determined the structure of the rat clathrin light chain B gene. The gene consists of six exons that extend over 11.9 kb. The first four exons and the last exon are common to the LCB2 and LCB3 isoforms. The fifth exon, termed EN, is included in the mRNA in brain, giving rise to the brain specific form LCB2 but is excluded in other tissues, generating the LCB3 isoform. Primary rat neuronal cell cultures express predominantly the brain specific LCB2 isoform, whereas primary rat cultures of glia express only the LCB3 isoform, suggesting that expression of the brain-specific LCB2 form is limited to neurons. Further evidence for neuronal localization of the LCB2 form is provided using a teratocarcinoma cell line, P19, which can be induced by retinoic acid to express a neuronal phenotype, concomitant with the induction of the LCB2 form. In order to determine the sequences involved in alternative splice site selection, we constructed a minigene containing the alternative spliced exon EN and its flanking intron and exon sequences. This minigene reflects the splicing pattern of the endogenous gene upon transfection in HeLa cell and primary neuronal cell cultures, indicating that this region of the LCB gene contains all the necessary information for neuron-specific splicing. Images PMID:1408826

  11. Involvement of the ubiquitous Oct-1 transcription factor in hormonal induction of beta-casein gene expression.

    PubMed

    Dong, Bing; Zhao, Feng-Qi

    2007-01-01

    Transcription of the milk protein beta-casein gene is induced by the lactogenic hormones Prl (prolactin) and glucocorticoids. Multiple transcription factors involved in this induction have been identified, including the STAT5 (signal transducer and activator of transcription 5) and the GR (glucocorticoid receptor). Our previous studies have identified a binding site for the ubiquitous Oct-1 (octamer-binding transcription factor 1) protein in the lactogenic hormonal regulatory region of the mouse beta-casein promoter. In the present study, we report that Oct-1 is indeed expressed and binds to the beta-casein promoter in mammary epithelial cells. Oct-1 activates hormonally induced beta-casein promoter activity in a dose-dependent manner. Hormonal induction of promoter activity was decreased not only by mutating the Oct-1-binding site from ATTAGCAT to GCTAGCAT, which abolishes Oct-1 binding (50% decrease, P<0.01), but also by changing the site to the consensus Oct-1-binding motif ATTTGCAT (40% decrease, P<0.01). Reversing the Oct-1-binding site reduced hormonal induction by 70% (P<0.01), showing that orientation of Oct-1 binding is also critical in hormonal action. In transient transfection experiments, Oct-1 collaboratively transactivated the beta-casein gene promoter with STAT5 and/or GR in the presence of Prl receptor in cells treated with the lactogenic hormones. The C-terminus of Oct-1 was not essential to its function. The results of the present study provide biochemical evidence that the ubiquitous Oct-1 transcription factor may be involved in hormonally regulated, tissue-specific beta-casein gene expression.

  12. Identification of HLA-A24-binding peptides of Mycobacterium tuberculosis derived proteins with beta 2m linked HLA-A24 single chain expressing cells.

    PubMed

    Ding, Jie; Wang, Yan; Cheng, Tingting; Chen, Xiaowei; Gao, Bin

    2010-01-01

    Tuberculosis is caused by an intracellular pathogen Mycobacterium tuberculosis (Mtb) and poses a persistent threat to global health. MHC class I-restricted CD8 cytotoxic T lymphocytes (CTL) are essential for protective immunity to Tuberculosis. Information for CTL epitopes derived from Mtb is desirable for vaccine design and assessment of T cell responses. However, the knowledge about CTL epitopes of Mtb, particularly those non-A2 HLA alleles restricted is rare. In this study, beta-2-microglobulin (beta 2m, beta(2)m) linked HLA-A24 single chain was expressed on RMA-S cell line defective in the endogenous antigen processing and applied for screening of peptides which could stabilize the HLA-A24 complex on the cell surface. From a group of peptides predicted as binders by a computer algorithm, five peptides were shown to bind to HLA-A24 protein on the cell surface. As comparison we have also identified a dozen Mtb proteins derived peptides that bind to HLA-A2 specifically. The cell line and HLA binders present here would be useful for further identification of CD8 restricted Mtb epitopes.

  13. The PPFLMLLKGSTR motif in globular domain 3 of the human laminin-5 {alpha}3 chain is crucial for integrin {alpha}3{beta}1 binding and cell adhesion

    SciTech Connect

    Kim, Jin-Man; Park, Won Ho; Min, Byung-Moo . E-mail: bmmin@snu.ac.kr

    2005-03-10

    Laminin-5 regulates various cellular functions, including cell adhesion, spreading, and motility. Here, we expressed the five human laminin {alpha}3 chain globular (LG) domains as monomeric, soluble fusion proteins, and examined their biological functions and signaling. Recombinant LG3 (rLG3) protein, unlike rLG1, rLG2, rLG4, and rLG5, played roles in cell adhesion, spreading, and integrin {alpha}3{beta}1 binding. More significantly, we identified a novel motif (PPFLMLLKGSTR) in the LG3 domain that is crucial for these responses. Studies with the synthetic peptides delineated the PPFLMLLKGSTR peptide within LG3 domain as a major site for both integrin {alpha}3{beta}1 binding and cell adhesion. Substitution mutation experiments suggest that the Arg residue is important for these activities. rLG3 protein- and PPFLMLLKGSTR peptide-induced keratinocyte adhesion triggered cell signaling through FAK phosphorylation at tyrosine-397 and -577. To our knowledge, this is the first report demonstrating that the PPFLMLLKGSTR peptide within the LG3 domain is a novel motif that is capable of supporting integrin {alpha}3{beta}1-dependent cell adhesion and spreading.

  14. cDNA sequence and mapping of the mouse Copb gene encoding the beta subunit of the COPI coatomer complex.

    PubMed

    LI, W; Elliott, R W; Novak, E K; Swank, R T

    1999-05-01

    COPI-coated vesicles are involved in retrograde-directed selective transport of proteins from the Golgi complex to the endoplasmic reticulum (ER) as well as mediate anterograde transport of cargo proteins within the Golgi or in endosomal trafficking. The COPI protein complex contains an ADP-ribosylation factor (ARF1) and seven coatamer subunits (alpha, beta, beta', gamma, delta, epsilon, zeta-COP). The localization and function of human beta subunit of coatamer (COPB) suggests it is likely a candidate gene of ruby-eye-2 (ru2), which is a mouse model of human Hermansky-Pudlak syndrome characterized by the dysfunction of several subcellular organelles. In this study, we determined the entire coding sequence of mouse (Copb) cDNA by combining an overlapping mouse EST contig with EST walking. beta-COP was found highly conserved in mouse, rat, and human, and it is ubiquitously expressed in mouse. The Copb gene was mapped to mouse Chr 7 at a position of 53.3 cM by radiation hybrid mapping. Our RH mapping data, sequencing of RT-PCR products, and Western blotting exclude the Copb gene as a candidate for ru2.

  15. Site-specific PEGylation of hemoglobin at Cys-93(beta): correlation between the colligative properties of the PEGylated protein and the length of the conjugated PEG chain.

    PubMed

    Manjula, B N; Tsai, A; Upadhya, R; Perumalsamy, K; Smith, P K; Malavalli, A; Vandegriff, K; Winslow, R M; Intaglietta, M; Prabhakaran, M; Friedman, J M; Acharya, A S

    2003-01-01

    Increasing the molecular size of acellular hemoglobin (Hb) has been proposed as an approach to reduce its undesirable vasoactive properties. The finding that bovine Hb surface decorated with about 10 copies of PEG5K per tetramer is vasoactive provides support for this concept. The PEGylated bovine Hb has a strikingly larger molecular radius than HbA (1). The colligative properties of the PEGylated bovine Hb are distinct from those of HbA and even polymerized Hb, suggesting a role for the colligative properties of PEGylated Hb in neutralizing the vasoactivity of acellular Hb. To correlate the colligative properties of surface-decorated Hb with the mass of the PEG attached and also its vasoactivity, we have developed a new maleimide-based protocol for the site-specific conjugation of PEG to Hb, taking advantage of the unusually high reactivity of Cys-93(beta) of oxy HbA and the high reactivity of the maleimide to protein thiols. PEG chains of 5, 10, and 20 kDa have been functionalized at one of their hydroxyl groups with a maleidophenyl moiety through a carbamate linkage and used to conjugate the PEG chains at the beta-93 Cys of HbA to generate PEGylated Hbs carrying two copies of PEG (of varying chain length) per tetramer. Homogeneous preparations of (SP-PEG5K)(2)-HbA, (SP-PEG10K)(2)-HbA, and (SP-PEG20K)(2)-HbA have been isolated by ion exchange chromatography. The oxygen affinity of Hb is increased slightly on PEGylation, but the length of the PEG-chain had very little additional influence on the O(2) affinity. Both the hydrodynamic volume and the molecular radius of the Hb increased on surface decoration with PEG and exhibited a linear correlation with the mass of the PEG chain attached. On the other hand, both the viscosity and the colloidal osmotic pressure (COP) of the PEGylated Hbs exhibited an exponential increase with the increase in PEG chain length. In contrast to the molecular volume, viscosity, and COP, the vasoactivity of the PEGylated Hbs was not a

  16. Quantitative response relationships between degradation rates and functional genes during the degradation of beta-cypermethrin in soil.

    PubMed

    Yang, Zhong-Hua; Ji, Guo-Dong

    2015-12-15

    In the present study, the degradation mechanisms of beta-cypermethrin and its metabolites in soil were explored through the quantitative response relationships between the degradation rates and related functional genes. We found that the degradation rate of beta-cypermethrin was rapid in unsterilized soil but not in sterilized soil, which indicated that the degradation process is microbially based. Moreover, three metabolites (3-phenoxybenzoic acid, phenol and protocatechuic acid) were detected during the degradation process and used to identify the degradation pathway and functional genes related to the degradation process. The key rate-limiting functional genes were pytH and pobA, and the relative contributions of these genes to the degradation process were examined with a path analysis. The path analysis revealed that the genes pobA and pytH had the greatest direct effects on the degradation of beta-cypermethrin (pobA), alpha-cypermethrin (pobA), theta-cypermethrin (pytH) and 3-phenoxybenzoic acid (pytH).

  17. Pest protection conferred by a Beta vulgaris serine proteinase inhibitor gene.

    PubMed

    Smigocki, Ann C; Ivic-Haymes, Snezana; Li, Haiyan; Savić, Jelena

    2013-01-01

    Proteinase inhibitors provide a means of engineering plant resistance to insect pests. A Beta vulgaris serine proteinase inhibitor gene (BvSTI) was fused to the constitutive CaMV35S promoter for over-expression in Nicotiana benthamiana plants to study its effect on lepidopteran insect pests. Independently derived BvSTI transgenic tobacco T2 homozygous progeny were shown to have relatively high BvSTI gene transcript levels. BvSTI-specific polyclonal antibodies cross-reacted with the expected 30 kDA recombinant BvSTI protein on Western blots. In gel trypsin inhibitor activity assays revealed a major clear zone that corresponded to the BvSTI proteinase inhibitor that was not detected in the untransformed control plants. BvSTI-transgenic plants were bioassayed for resistance to five lepidopteran insect pests. Spodoptera frugiperda, S. exigua and Manduca sexta larvae fed BvSTI leaves had significant reductions in larval weights as compared to larvae fed on untransformed leaves. In contrast, larval weights increased relative to the controls when Heliothis virescens and Agrotis ipsilon larvae were fed on BvSTI leaves. As the larvae entered the pupal stage, pupal sizes reflected the overall larval weights. Some developmental abnormalities of the pupae and emerging moths were noted. These findings suggest that the sugar beet BvSTI gene may prove useful for effective control of several different lepidopteran insect pests in genetically modified tobacco and other plants. The sugar beet serine proteinase inhibitor may be more effective for insect control because sugar beet is cropped in restricted geographical areas thus limiting the exposure of the insects to sugar beet proteinase inhibitors and build up of non-sensitive midgut proteases.

  18. Baseline Gene Expression Signatures in Monocytes from Multiple Sclerosis Patients Treated with Interferon-beta

    PubMed Central

    Bustamante, Marta F.; Nurtdinov, Ramil N.; Río, Jordi; Montalban, Xavier; Comabella, Manuel

    2013-01-01

    Background A relatively large proportion of relapsing-remitting multiple sclerosis (RRMS) patients do not respond to interferon-beta (IFNb) treatment. In previous studies with peripheral blood mononuclear cells (PBMC), we identified a subgroup of IFNb non-responders that was characterized by a baseline over-expression of type I IFN inducible genes. Additional mechanistic experiments carried out in IFNb non-responders suggested a selective alteration of the type I IFN signaling pathway in the population of blood monocytes. Here, we aimed (i) to investigate whether the type I IFN signaling pathway is up-regulated in isolated monocytes from IFNb non-responders at baseline; and (ii) to search for additional biological pathways in this cell population that may be implicated in the response to IFNb treatment. Methods Twenty RRMS patients classified according to their clinical response to IFNb treatment and 10 healthy controls were included in the study. Monocytes were purified from PBMC obtained before treatment by cell sorting and the gene expression profiling was determined with oligonucleotide microarrays. Results and discussion Purified monocytes from IFNb non-responders were characterized by an over-expression of type I IFN responsive genes, which confirms the type I IFN signature in monocytes suggested from previous studies. Other relevant signaling pathways that were up-regulated in IFNb non-responders were related with the mitochondrial function and processes such as protein synthesis and antigen presentation, and together with the type I IFN signaling pathway, may also be playing roles in the response to IFNb. PMID:23637780

  19. A second glutamine synthetase gene with expression in the gills of the gulf toadfish (opsanus beta)

    SciTech Connect

    Walsh, Patrick J.; Mayer, Gregory D.; Medina, Monica; Bernstein, Matthew L.; Barimo, John F.; Mommsen, Thomas P.

    2003-05-08

    Enzyme and molecular biology approaches were used to more completely characterize the expression of the nitrogen metabolism enzyme glutamine synthetase [GSase; L-glutamate: ammonia ligase (ADP-forming), E.C. 6.3.1.2] in a variety of tissues of the gulf toadfish (Opsanus beta) subjected to unconfined (ammonotelic) and confined (ureotelic) conditions. Enzymological results demonstrate that while weight-specific GSase activities rank in the order of brain > liver > stomach {approx} kidney > intestine > gill> heart/spleen > muscle, when tissue mass is used to calculate a glutamine synthetic potential, the liver has the greatest, followed by muscle > stomach and intestine with minor contributions from the remaining tissues. Additionally, during confinement stress, GSase activity only increases significantly in liver (5-fold) and muscle (2-fold), tissues which previously showed significant expression of the other enzymes of urea synthesis. RT PCR and RACE PCR revealed the presence of a second GSas e cDNA from gill tissue that appears to share relatively low nucleotide and amino acid sequence similarity ({approx}73 percent) with the original GSase cloned from liver, and furthermore lacks a mitochondrial leader targeting sequence. RT PCR and restriction digestion experiments demonstrated that mRNA from the original ''liver'' GSase is expressed in all tissues examined (liver, gill, stomach, intestine, kidney, brain and muscle), whereas the new ''gill'' form shows expression primarily in the gill. Enzyme activities of gill GSase also exhibit a different subcellular compartmentation with apparent exclusive expression in the soluble compartment, whereas other tissues expressing the ''liver'' form show both cytoplasmic and mitochondrial activities. Finally, phylogenetic analysis of a number of GSases demonstrates that the toadfish gill GSase has a greater affinity for a clade that includes the Xenopus GSase genes and one of two Fugu GSase genes, than it has for a clade

  20. Influence of beta(2)-integrin adhesion molecule expression and pulmonary infection with Pasteurella haemolytica on cytokine gene expression in cattle.

    PubMed

    Lee, H Y; Kehrli, M E; Brogden, K A; Gallup, J M; Ackermann, M R

    2000-07-01

    beta(2)-Integrins are leukocyte adhesion molecules composed of alpha (CD11a, -b, -c, or -d) and beta (CD18) subunit heterodimers. Genetic CD18 deficiency results in impaired neutrophil egress into tissues that varies between conducting airways and alveoli of the lung. In this study, we investigated whether CD18 deficiency in cattle affects proinflammatory cytokine (PIC) expression in pulmonary tissue after respiratory infection with Pasteurella haemolytica. Cattle were infected with P. haemolytica via fiberoptic deposition of organisms into the posterior part of the right cranial lung lobe. Animals were euthanized at 2 or 4 h postinoculation (p.i.), and tissues were collected to assess PIC gene expression using antisense RNA probes specific for bovine interleukin-1alpha (IL-1alpha), IL-1beta, IL-6, gamma interferon (IFN-gamma), and tumor necrosis factor alpha (TNF-alpha) along with the beta-actin (beta-Act) housekeeping gene. Expression of PIC was induced at 2 h p.i. in P. haemolytica-infected cattle and continued to 4 h p.i. At 2 h p.i., induction of gene expression and increase of cells that expressed PIC were observed both in CD18(+) and CD18(-) cattle after inoculation of P. haemolytica. The induction of gene expression with P. haemolytica inoculation was more prominent in CD18(-) cattle than in CD18(+) cattle by comparison to pyrogen-free saline (PFS)-inoculated control animals. At 4 h p.i., however, the induction of PIC, especially IL-1alpha, IL-6, and IFN-gamma, in the lungs of CD18(+) cattle inoculated with P. haemolytica was greater than that in lungs of the CD18(-) cattle. IFN-gamma and TNF-alpha genes were not increased in P. haemolytica-inoculated CD18(-) cattle lungs compared to the PFS-inoculated control lungs at 4 h p.i. In PFS-inoculated lungs, we generally observed a higher percentage of cells and higher level of gene expression in the lungs of CD18(-) cattle than in the lungs of CD18(+) cattle, especially at 4 h p.i. The rate of neutrophil

  1. [Mechanism of genuineness of liquorice Glycyrrhiza uralensis based on CNVs of HMGR, SQS1 and beta-AS gene].

    PubMed

    Liu, Ying; Liu, Dong-Ji; Liu, Chun-Sheng; Liao, Cai-Li; Cheng, Xiao-Li

    2012-02-01

    This study is to reveal the correlation between CNVs of HMGR, SQS1, beta-AS gene and genuineness of liquorice. Real-time PCR was used to detect the copy number of HMGR, SQS1, beta-AS gene of liquorice. According to the results, the range of the copy number variation of HMGR gene was between 1 and 3, the copy number of SQS1 gene was 1 or 2, and the copy number of beta-AS gene was only 1. On the basis of the copy number of HMGR, SQS1 and beta-AS gene, there were five groups, type A (2 + 1 + 1), type B (1 + 1 + 1), type C (3 + 2 + 1), type D (2 + 2 + 1) and type E (3 + 1 + 1). There were two types, type A and type B, in Hangjinqi of Inner Mongolia, and the ratio of A to B was 1:1.3. There were also two types, type A and type B, in Chifeng of Inner Mongolia, and the ratio of A to B was 3:1. There were four types, type A, type B, type C and type D, in Yanchi of Ningxia province, and the ratio of A to B was 1:5.1. There were three types, type A, type B and type E, in Minqin of Gansu province, and the ratio of A to B was 2:1. So CNVs mainly existed in the liquorice from Ningxia and Gansu provinces. While the genetic background of liquorice from Hangjinqi of Inner Mongolia was stabilized. The results of the experiment proved that the correlation between CNVs and origins was one of the reasons of genuineness of liquorice.

  2. Localized DNA Demethylation at Recombination Intermediates during Immunoglobulin Heavy Chain Gene Assembly

    PubMed Central

    Selimyan, Roza; Gerstein, Rachel M.; Ivanova, Irina; Precht, Patricia; Subrahmanyam, Ramesh; Perlot, Thomas; Alt, Frederick W.; Sen, Ranjan

    2013-01-01

    Multiple epigenetic marks have been proposed to contribute to the regulation of antigen receptor gene assembly via V(D)J recombination. Here we provide a comprehensive view of DNA methylation at the immunoglobulin heavy chain (IgH) gene locus prior to and during V(D)J recombination. DNA methylation did not correlate with the histone modification state on unrearranged alleles, indicating that these epigenetic marks were regulated independently. Instead, pockets of tissue-specific demethylation were restricted to DNase I hypersensitive sites within this locus. Though unrearranged diversity (DH) and joining (JH) gene segments were methylated, DJH junctions created after the first recombination step were largely demethylated in pro-, pre-, and mature B cells. Junctional demethylation was highly localized, B-lineage-specific, and required an intact tissue-specific enhancer, Eμ. We propose that demethylation occurs after the first recombination step and may mark the junction for secondary recombination. PMID:23382652

  3. Localized DNA demethylation at recombination intermediates during immunoglobulin heavy chain gene assembly.

    PubMed

    Selimyan, Roza; Gerstein, Rachel M; Ivanova, Irina; Precht, Patricia; Subrahmanyam, Ramesh; Perlot, Thomas; Alt, Frederick W; Sen, Ranjan

    2013-01-01

    Multiple epigenetic marks have been proposed to contribute to the regulation of antigen receptor gene assembly via V(D)J recombination. Here we provide a comprehensive view of DNA methylation at the immunoglobulin heavy chain (IgH) gene locus prior to and during V(D)J recombination. DNA methylation did not correlate with the histone modification state on unrearranged alleles, indicating that these epigenetic marks were regulated independently. Instead, pockets of tissue-specific demethylation were restricted to DNase I hypersensitive sites within this locus. Though unrearranged diversity (D(H)) and joining (J(H)) gene segments were methylated, DJ(H) junctions created after the first recombination step were largely demethylated in pro-, pre-, and mature B cells. Junctional demethylation was highly localized, B-lineage-specific, and required an intact tissue-specific enhancer, Eμ. We propose that demethylation occurs after the first recombination step and may mark the junction for secondary recombination.

  4. Amyloid beta-protein gene duplication is not common in Alzheimer's disease: analysis by polymorphic restriction fragments.

    PubMed

    Furuya, H; Sasaki, H; Goto, I; Wong, C W; Glenner, G G; Sakaki, Y

    1988-01-15

    The amyloid beta-protein(BP) is an important component of amyloid fibrils of both Alzheimer's disease(AD) and adult Down syndrome(DS). It has been hypothesized that sporadic AD may involve the duplication of a subregion of chromosome 21 containing the BP locus. However, an improved method for detection of the BP gene duplication using polymorphic Hind III fragments led us to a conclusion that BP gene duplication is rare, if any, in (Japanese) sporadic AD patients, indicating that the duplication of the BP gene itself is not the common underlying genetic defect in AD.

  5. Expression of platelet derived growth factor B chain and beta receptor in human coronary arteries after percutaneous transluminal coronary angioplasty: an immunohistochemical study.

    PubMed Central

    Tanizawa, S.; Ueda, M.; van der Loos, C. M.; van der Wal, A. C.; Becker, A. E.

    1996-01-01

    OBJECTIVE: To evaluate whether expression of platelet derived growth factor B (PDGF-B) protein is associated with expression of its receptor protein in human coronary arteries after angioplasty and to identify cells involved. BACKGROUND: PDGF is considered an important growth factor in the repair process of the vessel wall after angioplasty. In situ hybridisation has revealed expression of PDGF-A and -B chain messenger ribonucleic acid (mRNA) in human coronary arteries at sites of postangioplasty injury. METHODS: Target and non-target sites of eight coronary arteries were studied immunohistochemically for PDGF-B and PDGF-beta receptor proteins in relation to macrophages, T lymphocytes, smooth muscle cells, and HLA-DR positive cells. RESULTS: The PDGF-B and PDGF-beta receptor proteins were expressed in areas with distinct repair, containing alpha actin negative spindle cells, macrophages and, at later stages, alpha actin positive smooth muscle cells as well. When the neointima was composed mainly of alpha actin smooth muscle cells, PDGF-B expression was rare and PDGF-beta receptor expression was negative. CONCLUSIONS: There is expression of PDGF-B and PDGF-beta receptor proteins at sites of postangioplasty repair in human coronary arteries. The associated cells are mainly macrophages and alpha actin negative spindle cells; the latter may be dedifferentiated smooth muscle cells. A link between PDGF expression and the postangioplasty time interval suggests a relation with cell differentiation as part of the maturation of the repair tissue. Mutual expression of both the growth factor and its receptor protein strongly suggests that in humans a PDGF mediated repair process occurs, with involvement of smooth muscle cells and macrophages. Images PMID:8697155

  6. Evolutionary diversification of the BetaM interactome acquired through co-option of the ATP1B4 gene in placental mammals

    PubMed Central

    Korneenko, Tatyana V.; Pestov, Nikolay B.; Ahmad, Nisar; Okkelman, Irina A.; Dmitriev, Ruslan I.; Shakhparonov, Mikhail I.; Modyanov, Nikolai N.

    2016-01-01

    ATP1B4 genes represent a rare instance of orthologous vertebrate gene co-option that radically changed properties of the encoded BetaM proteins, which function as Na,K-ATPase subunits in lower vertebrates and birds. Eutherian BetaM has lost its ancestral function and became a muscle-specific resident of the inner nuclear membrane. Our earlier work implicated BetaM in regulation of gene expression through direct interaction with the transcriptional co-regulator SKIP. To gain insight into evolution of BetaM interactome we performed expanded screening of eutherian and avian cDNA libraries using yeast-two-hybrid and split-ubiquitin systems. The inventory of identified BetaM interactors includes lamina-associated protein LAP-1, myocyte nuclear envelope protein Syne1, BetaM itself, heme oxidases HMOX1 and HMOX2; transcription factor LZIP/CREB3, ERGIC3, PHF3, reticulocalbin-3, and β-sarcoglycan. No new interactions were found for chicken BetaM and human Na,K-ATPase β1, β2 and β3 isoforms, indicating the uniqueness of eutherian BetaM interactome. Analysis of truncated forms of BetaM indicates that residues 72-98 adjacent to the membrane in nucleoplasmic domain are important for the interaction with SKIP. These findings demonstrate that evolutionary alterations in structural and functional properties of eutherian BetaM proteins are associated with the increase in its interactome complexity. PMID:26939788

  7. Time-dependent transcriptional profiles of genes of the hypothalamic-pituitary-gonadal axis in medaka (Oryzias latipes) exposed to fadrozole and 17beta-trenbolone.

    PubMed

    Zhang, Xiaowei; Hecker, Markus; Park, June-Woo; Tompsett, Amber R; Jones, Paul D; Newsted, John; Au, Doris W T; Kong, Richard; Wu, Rudolf S S; Giesy, John P

    2008-12-01

    Both the anabolic androgen 17beta-trenbolone (TRB) and the aromatase inhibitor fadrozole (FAD) can cause decreased plasma concentrations of estrogen (E2) and reduce fecundity of fish. However, the underlying mechanisms and the molecular pathways involved are largely unknown. The present study was designed to assess time-dependent effects of FAD and TRB on the transcriptional responses of the hypothalamic-pituitary-gonadal (HPG) axis of Japanese medaka (Oryzias latipes). Fourteen-week-old Japanese medaka were exposed to 50 microg FAD/L or 2 microg TRB/L in a 7-d static renewal test, and the expression profiles of 36 HPG axis genes were measured by means of a medaka HPG real-time reverse-transcription polymerase chain reaction array after 8 h, 32 h, or 7 d of exposure. Exposure to TRB or FAD caused lesser fecundity of Japanese medaka and down-regulated transcription of vitellogenin and choriogenin (CHG) gene expression in the liver of females. Exposure to FAD for 8 h resulted in an 8-fold and 71-fold down-regulation of expression of estrogen receptor alpha and choriogenin L (CHG L), respectively, in female liver. 17beta-Trenbolone caused similar down-regulation of these genes, but the effects were not observed until 32 h of exposure. These results support the hypothesis that FAD reduces plasma E2 more quickly by inhibiting aromatase enzyme activity than does TRB, which inhibits the production of the E2 precursor testosterone. Exposure to FAD and TRB resulted in rapid (after 8 h) down-regulation of luteinizing hormone receptor and low-density-lipoprotein receptor in the testis to compensate for excessive androgen levels. Overall, the molecular responses observed in the present study differentiate the mechanisms of the reduced fecundity by TRB and FAD.

  8. Diacyltransferase Activity and Chain Length Specificity of Mycobacterium tuberculosis PapA5 in the Synthesis of Alkyl Beta-Diol Lipids

    PubMed Central

    Touchette, Megan H.; Bommineni, Gopal R.; Delle Bovi, Richard J.; Gadbery, John E.; Nicora, Carrie D.; Shukla, Anil K.; Kyle, Jennifer E.; Metz, Thomas O.; Martin, Dwight W.; Sampson, Nicole S.; Miller, W. Todd; Tonge, Peter J.; Seeliger, Jessica C.

    2015-01-01

    Although classified as Gram-positive bacteria, Corynebacterineae possess an asymmetric outer membrane that imparts structural and thereby physiological similarity to more distantly related Gram-negative bacteria. Like lipopolysaccharide in Gram-negative bacteria, lipids in the outer membrane of Corynebacterineae have been associated with the virulence of pathogenic species such as Mycobacterium tuberculosis (Mtb). For example, Mtb strains that lack long, branched-chain alkyl esters known as dimycocerosates (DIMs) are significantly attenuated in model infections. The resultant interest in the biosynthetic pathway of these unusual virulence factors has led to the elucidation of many of the steps leading to the final esterification of the alkyl beta-diol, phthiocerol, with branched-chain fatty acids known as mycocerosates. PapA5 is an acyltransferase implicated in these final reactions. We here show that PapA5 is indeed the terminal enzyme in DIM biosynthesis by demonstrating its dual esterification activity and chain-length preference using synthetic alkyl beta-diol substrate analogues. Applying these analogues to a series of PapA5 mutants, we also revise a model for the substrate binding within PapA5. Finally, we demonstrate that the Mtb Ser/Thr kinases PknB and PknE modify PapA5 on three overlapping Thr residues and a fourth Thr is unique to PknE phosphorylation. These results clarify the DIM biosynthetic pathway and indicate post-translational modifications that warrant further elucidation for their roles in regulation DIM biosynthesis. PMID:26271001

  9. Possible deletion of a developmentally regulated heavy-chain variable region gene in autoimmune diseases

    SciTech Connect

    Yang, Pei-Ming; Olee, Tsaiwei; Kozin, F.; Carson, D.A.; Chen, P.P. ); Olsen, N.J. ); Siminovitch, K.A. )

    1990-10-01

    Several autoantibody-associated variable region (V) genes are preferentially expressed during early ontogenic development, suggesting strongly that they are of developmental and physiological importance. As such, it is possible that polymorphisms in one or more of these genes may alter susceptibility to autoimmune disease. The authors have searched extensively for a probe related to a developmentally regulated V gene that has the power to differentiate among highly homologous V genes in human populations. Using such a probe (i.e., Humhv3005/P1) related to both anti-DNA and anti-IgG autoantibodies, they studied restriction fragment length polymorphisms in patients with rheumatoid arthritis and systemic lupus erythematosus and found an apparent heavy-chain V (V{sub H}) gene deletion that was nearly restricted to the autoimmune patients. These data suggest that deletions of physiologically important V{sub H} genes may increase the risk of autoimmunity through indirect effects on the development and homeostasis of the B-cell repertoire.

  10. Analysis of structure and expression of the Xenopus thyroid hormone receptor-beta gene to explain its autoinduction.

    PubMed

    Machuca, I; Esslemont, G; Fairclough, L; Tata, J R

    1995-01-01

    Transcription of both Xenopus thyroid hormone receptor (TR) genes, xTR alpha and -beta, is strongly up-regulated by their own ligand T3 during natural or T3-induced metamorphosis of tadpoles and in some Xenopus cell lines. To explain this autoinduction, we analyzed the sequence of 1.6 kilobases of xTR beta promoter for putative T3-responsive elements. Two direct repeat +4 AGGTCA hexamer motifs (DR+4), an imperfect distal (-793/-778) and a perfect proximal (-5/11) site, a DR+1 site, and some possible half-sites were located in the 1.6-kilobase promoter. Transfection of Xenopus XTC-2 cells (which express xTR alpha and -beta) and XL-2 cells (which predominantly express TR alpha) with chloramphenicol acetyltransferase reporter constructs of deletion mutants and promoter fragments showed that the distal and proximal DR+4 sites responded to T3, although other flanking sequences may also play a role. The thyroid hormone-responsive element half-site present as DR+1 in the up-stream sequence at -1260/-950, when cloned in front of a heterologous promoter, functions independently. T3 enhanced transcription from the two DR+4-containing fragments when present together by only 2- to 3-fold due to a high basal activity. Overexpression of unliganded xTR alpha and xTR beta in XTC-2 cells repressed basal activity, which was then enhanced 7- to 4-fold by T3, respectively; with XL-2 cells cotransfected with xTR beta, T3 inducibility increased to 16-fold. Electrophoretic mobility shift assays with recombinant Xenopus TR alpha, TR beta, retinoid-X receptor-alpha (RXR alpha) and RXR gamma proteins showed that TR-RXR heterodimers, but not TR or RXR monomers or homodimers, strongly bound the natural and synthetic distal and proximal DR+4 elements in a ligand-independent manner. TR/RXR heterodimers exhibited the highest binding affinity for a 28-mer oligonucleotide probe for the -5/11 proximal DR+4 site, with only slight binding to DR+1 (retinoid-X-responsive element-like) site. The x

  11. Influence of polymorphism in the genes for the interleukin (IL)-1 receptor antagonist and IL-1beta on tuberculosis.

    PubMed

    Wilkinson, R J; Patel, P; Llewelyn, M; Hirsch, C S; Pasvol, G; Snounou, G; Davidson, R N; Toossi, Z

    1999-06-21

    Several lines of evidence suggest that host genetic factors controlling the immune response influence infection by Mycobacterium tuberculosis. The proinflammatory cytokine interleukin (IL)-1beta and its antagonist, IL-1Ra (IL-1 receptor agonist), are strongly induced by M. tuberculosis and are encoded by polymorphic genes. The induction of both IL-1Ra mRNA and secreted protein by M. tuberculosis in IL-1Ra allele A2-positive (IL-1Ra A2(+)) healthy subjects was 1.9-fold higher than in IL-1Ra A2(-) subjects. The M. tuberculosis-induced expression of mRNA for IL-1beta was higher in subjects of the IL-1beta (+3953) A1(+) haplotype (P = 0.04). The molar ratio of IL-1Ra/IL-1beta induced by M. tuberculosis was markedly higher in IL-1Ra A2(+) individuals (P < 0.05), with minor overlap between the groups, reflecting linkage between the IL-1Ra A2 and IL-1beta (+3953) A2 alleles. In M. tuberculosis-stimulated peripheral blood mononuclear cells, the addition of IL-4 increased IL-1Ra secretion, whereas interferon gamma increased and IL-10 decreased IL-1beta production, indicative of a differential influence on the IL-1Ra/IL-1beta ratio by cytokines. In a study of 114 healthy purified protein derivative-reactive subjects and 89 patients with tuberculosis, the frequency of allelic variants at two positions (-511 and +3953) in the IL-1beta and IL-1Ra genes did not differ between the groups. However, the proinflammatory IL-1Ra A2(-)/IL-1beta (+3953) A1(+) haplotype was unevenly distributed, being more common in patients with tuberculous pleurisy (92%) in comparison with healthy M. tuberculosis-sensitized control subjects or patients with other disease forms (57%, P = 0.028 and 56%, P = 0. 024, respectively). Furthermore, the IL-1Ra A2(+) haplotype was associated with a reduced Mantoux response to purified protein derivative of M. tuberculosis: 60% of tuberculin-nonreactive patients were of this type. Thus, the polymorphism at the IL-1 locus influences the cytokine response and may

  12. Analysis of structure and expression of the Xenopus thyroid hormone receptor-beta gene to explain its autoinduction.

    PubMed

    Machuca, I; Esslemont, G; Fairclough, L; Tata, J R

    1995-01-01

    Transcription of both Xenopus thyroid hormone receptor (TR) genes, xTR alpha and -beta, is strongly up-regulated by their own ligand T3 during natural or T3-induced metamorphosis of tadpoles and in some Xenopus cell lines. To explain this autoinduction, we analyzed the sequence of 1.6 kilobases of xTR beta promoter for putative T3-responsive elements. Two direct repeat +4 AGGTCA hexamer motifs (DR+4), an imperfect distal (-793/-778) and a perfect proximal (-5/11) site, a DR+1 site, and some possible half-sites were located in the 1.6-kilobase promoter. Transfection of Xenopus XTC-2 cells (which express xTR alpha and -beta) and XL-2 cells (which predominantly express TR alpha) with chloramphenicol acetyltransferase reporter constructs of deletion mutants and promoter fragments showed that the distal and proximal DR+4 sites responded to T3, although other flanking sequences may also play a role. The thyroid hormone-responsive element half-site present as DR+1 in the up-stream sequence at -1260/-950, when cloned in front of a heterologous promoter, functions independently. T3 enhanced transcription from the two DR+4-containing fragments when present together by only 2- to 3-fold due to a high basal activity. Overexpression of unliganded xTR alpha and xTR beta in XTC-2 cells repressed basal activity, which was then enhanced 7- to 4-fold by T3, respectively; with XL-2 cells cotransfected with xTR beta, T3 inducibility increased to 16-fold. Electrophoretic mobility shift assays with recombinant Xenopus TR alpha, TR beta, retinoid-X receptor-alpha (RXR alpha) and RXR gamma proteins showed that TR-RXR heterodimers, but not TR or RXR monomers or homodimers, strongly bound the natural and synthetic distal and proximal DR+4 elements in a ligand-independent manner. TR/RXR heterodimers exhibited the highest binding affinity for a 28-mer oligonucleotide probe for the -5/11 proximal DR+4 site, with only slight binding to DR+1 (retinoid-X-responsive element-like) site. The x

  13. Glial fibrillary acidic protein gene promoter is differently modulated by transforming growth factor-beta 1 in astrocytes from distinct brain regions.

    PubMed

    Sousa, Vivian de Oliveira; Romão, Luciana; Neto, Vivaldo Moura; Gomes, Flávia Carvalho Alcantara

    2004-04-01

    The expression of glial fibrillary acidic protein (GFAP), the major intermediate filament protein of mature astrocytes, is regulated under developmental and pathological conditions. Recently, we have investigated GFAP gene modulation by using a transgenic mouse bearing part of the GFAP gene promoter linked to the beta-galactosidase reporter gene. We demonstrated that cerebral cortex neurons activate the GFAP gene promoter, inducing transforming growth factor-beta 1 (TGF-beta 1) secretion by astrocytes. Here, we report that cortical neurons or conditioned medium derived from them do not activate the GFAP gene promoter of transgenic astrocytes derived from midbrain and cerebellum suggesting a neuroanatomical regional specificity of this phenomenon. Surprisingly, they do induce synthesis of TGF-beta 1 by these cells. Western blot and immunocytochemistry assays revealed wild distribution of TGF receptor in all subpopulations of astrocytes and expression of TGF-beta 1 in neurons derived from all regions, thus indicating that the unresponsiveness of the cerebellar and midbrain GFAP gene to TGF-beta 1 is not due to a defect in TGF-beta 1 signalling. Together, our data highlight the great complexity of neuron-glia interactions and might suggest a distinct mechanism underlying modulation of the GFAP gene in the heterogeneous population of astrocytes throughout the central nervous system.

  14. Interleukin-1 beta, interferon-gamma, and tumor necrosis factor-alpha gene expression in peripheral blood mononuclear cells of patients with coronary artery disease

    PubMed Central

    Enayati, Samaneh; Seifirad, Soroush; Amiri, Parvin; Abolhalaj, Milad; Mohammad -Amoli, Mahsa

    2015-01-01

    BACKGROUND Several inflammatory mediators have been proposed to contribute to the pathogenesis of atherosclerosis. The aim of this study was to evaluate the quantitative expression of pro-inflammatory cytokines in un-stimulated peripheral blood mononuclear cell of patients with coronary artery disease (CAD). METHODS Interleukin-1 beta (IL-1β), tumor necrosis factor-alpha, and interferon-gamma (IFN-γ) gene expression were evaluated in angiography confirmed patients with and without CAD in a case-control study using quantitative real-time polymerase chain reaction. RESULTS A significant increase (P = 0.030) in IL-1β gene expression was found in patients with CAD [median interquartile range (IQR) = 4.890 (6.084)] compared to patients without CAD [median (IQR) = 1.792 (3.172)]. Despite the increase in IFN-γ gene expression in patients with CAD [median (IQR) = 1.298 (3.896)] versus patients without CAD [median (IQR) = 0.841 (2.79)], there was not statistically significant difference (P = 0.990). CONCLUSION Our results provide evidence for possible association between IL-1β and development of atherosclerosis as a crucial cytokine that induce a network of signaling pathways. This finding if proved in future would suggest IL-1β as a potent therapeutic target in CAD. PMID:26715931

  15. Shared Gene Structures and Clusters of Mutually Exclusive Spliced Exons within the Metazoan Muscle Myosin Heavy Chain Genes

    PubMed Central

    Kollmar, Martin; Hatje, Klas

    2014-01-01

    Multicellular animals possess two to three different types of muscle tissues. Striated muscles have considerable ultrastructural similarity and contain a core set of proteins including the muscle myosin heavy chain (Mhc) protein. The ATPase activity of this myosin motor protein largely dictates muscle performance at the molecular level. Two different solutions to adjusting myosin properties to different muscle subtypes have been identified so far: Vertebrates and nematodes contain many independent differentially expressed Mhc genes while arthropods have single Mhc genes with clusters of mutually exclusive spliced exons (MXEs). The availability of hundreds of metazoan genomes now allowed us to study whether the ancient bilateria already contained MXEs, how MXE complexity subsequently evolved, and whether additional scenarios to control contractile properties in different muscles could be proposed, By reconstructing the Mhc genes from 116 metazoans we showed that all intron positions within the motor domain coding regions are conserved in all bilateria analysed. The last common ancestor of the bilateria already contained a cluster of MXEs coding for part of the loop-2 actin-binding sequence. Subsequently the protostomes and later the arthropods gained many further clusters while MXEs got completely lost independently in several branches (vertebrates and nematodes) and species (for example the annelid Helobdella robusta and the salmon louse Lepeophtheirus salmonis). Several bilateria have been found to encode multiple Mhc genes that might all or in part contain clusters of MXEs. Notable examples are a cluster of six tandemly arrayed Mhc genes, of which two contain MXEs, in the owl limpet Lottia gigantea and four Mhc genes with three encoding MXEs in the predatory mite Metaseiulus occidentalis. Our analysis showed that similar solutions to provide different myosin isoforms (multiple genes or clusters of MXEs or both) have independently been developed several times

  16. Variation in the FFAR1 Gene Modifies BMI, Body Composition and Beta-Cell Function in Overweight Subjects: An Exploratory Analysis

    PubMed Central

    Walker, Celia G.; Goff, Louise; Bluck, Les J.; Griffin, Bruce A.; Jebb, Susan A.; Lovegrove, Julie A.; Sanders, Thomas A. B.; Frost, Gary S.

    2011-01-01

    Background FFAR1 receptor is a long chain fatty acid G-protein coupled receptor which is expressed widely, but found in high density in the pancreas and central nervous system. It has been suggested that FFAR1 may play a role in insulin sensitivity, lipotoxicity and is associated with type 2 diabetes. Here we investigate the effect of three common SNPs of FFAR1 (rs2301151; rs16970264; rs1573611) on pancreatic function, BMI, body composition and plasma lipids. Methodology/Principal Findings For this enquiry we used the baseline RISCK data, which provides a cohort of overweight subjects at increased cardiometabolic risk with detailed phenotyping. The key findings were SNPs of the FFAR1 gene region were associated with differences in body composition and lipids, and the effects of the 3 SNPs combined were cumulative on BMI, body composition and total cholesterol. The effects on BMI and body fat were predominantly mediated by rs1573611 (1.06 kg/m2 higher (P = 0.009) BMI and 1.53% higher (P = 0.002) body fat per C allele). Differences in plasma lipids were also associated with the BMI-increasing allele of rs2301151 including higher total cholesterol (0.2 mmol/L per G allele, P = 0.01) and with the variant A allele of rs16970264 associated with lower total (0.3 mmol/L, P = 0.02) and LDL (0.2 mmol/L, P<0.05) cholesterol, but also with lower HDL-cholesterol (0.09 mmol/L, P<0.05) although the difference was not apparent when controlling for multiple testing. There were no statistically significant effects of the three SNPs on insulin sensitivity or beta cell function. However accumulated risk allele showed a lower beta cell function on increasing plasma fatty acids with a carbon chain greater than six. Conclusions/Significance Differences in body composition and lipids associated with common SNPs in the FFAR1 gene were apparently not mediated by changes in insulin sensitivity or beta-cell function. PMID:21552566

  17. Structure of the human laminin {gamma}2 chain gene (LAMC2): Alternative splicing with different tissue distribution of two transcripts

    SciTech Connect

    Airenne, T.; Haakana, H.; Kallunki, T.

    1996-02-15

    This article discusses the exon-intron structure and tissue distribution of the laminin {gamma}2 chain (LAMC2) gene, which is mutated in some cases of junctional epidermolysis bullosa. The article also discusses the transcription and splicing of this gene, which result in alternative uses of the last two exons of the gene. The different tissue distributions of the transcripts indicate different functions for the gene in vivo. 36 refs., 8 figs., 3 tabs.

  18. Genes involved in long-chain alkene biosynthesis in Micrococcus luteus

    SciTech Connect

    Beller, Harry R.; Goh, Ee-Been; Keasling, Jay D.

    2010-01-07

    Aliphatic hydrocarbons are highly appealing targets for advanced cellulosic biofuels, as they are already predominant components of petroleum-based gasoline and diesel fuels. We have studied alkene biosynthesis in Micrococcus luteus ATCC 4698, a close relative of Sarcina lutea (now Kocuria rhizophila), which four decades ago was reported to biosynthesize iso- and anteiso branched, long-chain alkenes. The underlying biochemistry and genetics of alkene biosynthesis were not elucidated in those studies. We show here that heterologous expression of a three-gene cluster from M. luteus (Mlut_13230-13250) in a fatty-acid overproducing E. coli strain resulted in production of long-chain alkenes, predominantly 27:3 and 29:3 (no. carbon atoms: no. C=C bonds). Heterologous expression of Mlut_13230 (oleA) alone produced no long-chain alkenes but unsaturated aliphatic monoketones, predominantly 27:2, and in vitro studies with the purified Mlut_13230 protein and tetradecanoyl-CoA produced the same C27 monoketone. Gas chromatography-time of flight mass spectrometry confirmed the elemental composition of all detected long-chain alkenes and monoketones (putative intermediates of alkene biosynthesis). Negative controls demonstrated that the M. luteus genes were responsible for production of these metabolites. Studies with wild-type M. luteus showed that the transcript copy number of Mlut_13230-13250 and the concentrations of 29:1 alkene isomers (the dominant alkenes produced by this strain) generally corresponded with bacterial population over time. We propose a metabolic pathway for alkene biosynthesis starting with acyl-CoA (or -ACP) thioesters and involving decarboxylative Claisen condensation as a key step, which we believe is catalyzed by OleA. Such activity is consistent with our data and with the homology (including the conserved Cys-His-Asn catalytic triad) of Mlut_13230 (OleA) to FabH (?-ketoacyl-ACP synthase III), which catalyzes decarboxylative Claisen condensation during

  19. Complete physical map of the human immunoglobulin heavy chain constant region gene complex

    SciTech Connect

    Hofker, M.H.; Walter, M.A.; Cox, D.W. )

    1989-07-01

    The authors have found by pulsed-field gel electrophoresis that the human immunoglobulin heavy chain constant region gene complex maps entirely to a 350-kilobase (kb) Mlu I fragment. The enzyme Eag I was used with pulsed-field gel electrophoresis alone and in double digests with Spe I to map the region. C{sub {gamma}}3 maps 60 kb to the 3{prime} side of C{sub {delta}}; C{gamma}2 maps 80 kb to the 3{prime} side of C{sub {alpha}}1. C{sub {psi}{gamma}} maps 35 kb to the 3{prime} side of C{sub {alpha}}1 and is in the same transcriptional orientation as the other genes. Although in the cloned DNA many CpG-containing restriction sites were identified, most of these were methylated in peripheral blood leukocytes. The sites that were not methylated were predominantly found in three clusters, or Hpa I tiny fragment islands. A region showing strong linkage disequilibrium between all C{sub {gamma}} genes spans at least 160 kb. The 70-kb C{sub {mu}}-C{sub {gamma}}3 region, however, shows no linkage disequilibrium, possibly indicating a recombination hot spot. The immunoglobulin heavy chain constant region has been almost entirely cloned and mapped, and thus most rearrangements occurring in this region should be detectable.

  20. Human heavy chain disease protein WIS: implications for the organization of immunoglobulin genes.

    PubMed Central

    Franklin, E C; Prelli, F; Frangione, B

    1979-01-01

    Protein WIS is a human gamma3 heavy (H) chain disease immunoglobulin variant whose amino acid sequence is most readily interpreted by postulating that three residues of the amino terminus are followed by a deletion of most of the variable (VH) domain, which ends at the variable-constant (VC) joining region. Then there is a stretch of eight residues, three of which are unusual, while the other five have striking homology to the VC junction sequence. This is followed by a second deletion, which ends at the beginning of the quadruplicated hinge region. These findings are consistent with mutations resulting in deletions of most of the gene coding for the V region and CH1 domain followed by splicing at the VC joining region and at the hinge. These structural features fit well the notion of genetic discontinuity between V and C genes and also suggest similar mechanisms of excision and splicing in the interdomain regions of the C gene of the heavy chain. PMID:106391

  1. Transforming growth factor beta differentially modulates the inducible nitric oxide synthase gene in distinct cell types.

    PubMed

    Gilbert, R S; Herschman, H R

    1993-08-31

    Nitric oxide is a mediator of paracrine cell signalling. An inducible form of nitric oxide synthase (iNOS) is expressed in macrophages and in Swiss 3T3 cells. Transforming growth factor beta (TGF-beta) is a cytokine that modulates many cellular functions. We find that TGF-beta cannot induce iNOS mRNA expression, either in macrophage cell lines or in Swiss 3T3 cells. However, TGF-beta attenuates lipopolysaccharide induction of iNOS mRNA in macrophages. In contrast, TGF-beta enhances iNOS induction by phorbol ester, serum or lipopolysaccharide in 3T3 cells. Thus TGF-beta can inhibit or augment iNOS mRNA induction in response to primary inducers, depending on the cell type in question.

  2. Transforming growth factor. beta. sub 1 is present at sites of extracellular matrix gene expression in human pulmonary fibrosis

    SciTech Connect

    Broekelmann, T.J.; Limper, A.H.; McDonald, J.A. ); Colby, T.V. )

    1991-08-01

    Idiopathic pulmonary fibrosis is an inexorably fatal disorder characterized by connective tissue deposition within the terminal air spaces resulting in loss of lung function and eventual respiratory failure. Previously, the authors demonstrated that foci of activated fibroblasts expressing high levels of fibronectin, procollagen, and smooth muscle actin and thus resembling those found in healing wounds are responsible for the connective tissue deposition and scarring in idiopathic pulmonary fibrosis. Using in situ hybridization and immunohistochemistry, they now demonstrate the presence of transforming growth factor {beta}{sub 1} (TGF-{beta}{sub 1}), a potent profibrotic cytokine, in the foci containing these activated fibroblasts. These results suggest that matrix-associated TGF-{beta}{sub 1} may serve as a stimulus for the persistent expression of connective tissue genes. One potential source of the TGF-{beta}{sub 1} is the alveolar macrophage, and they demonstrate the expression of abundant TGF-{beta}{sub 1} mRNA in alveolar macrophages in lung tissue from patients with idiopathic pulmonary fibrosis.

  3. Inactivation of the IL-6 gene prevents development of multicentric Castleman's disease in C/EBP beta-deficient mice

    PubMed Central

    1996-01-01

    Castleman's disease is a lymphoproliferative disorder thought to be related to deregulated production of IL-6. We have previously shown that mice lacking the trans-acting factor C/EBP beta, a transcriptional regulator of IL-6 and a mediator of IL-6 intracellular signaling, develop a pathology nearly identical to multicentric Castleman's disease, together with increasingly high levels of circulating IL-6. We describe here how the simultaneous inactivation of both IL-6 and C/EBP beta genes prevents the development of pathological traits of Castleman's disease observed in C/EBP beta-deficient mice. Histological and phenotypic analysis of lymph nodes and spleen of double mutant mice did not show either the lymphoadenopathy and splenomegaly or the abnormal expansion of myeloid, B and plasma cell compartments observed in C/EBP beta-/- mice, while B cell development, although delayed, was normal. Our data demonstrate that IL-6 is essential for the development of multicentric Castleman's disease in C/EBP beta-/- mice. PMID:8879230

  4. Differential activation of transcription versus recombination of transgenic T cell receptor beta variable region gene segments in B and T lineage cells

    PubMed Central

    1994-01-01

    We have tested the ability of the T cell receptor beta (TCR-beta) transcriptional enhancer (E beta) to confer transcriptional activation and tissue-specific V(D)J recombination of TCR-beta V, D, and J segments in a transgenic minilocus recombination substrate. We find that the minimal E beta element, as previously shown for a DNA segment that contained the E mu element, promotes a high level of substrate D to J beta rearrangement in both B and T cells, but only promotes V beta to DJ beta rearrangement in T cells. Thus, both the E mu and E beta elements similarly direct V(D)J recombination of this substrate in vivo, supporting a general role for transcriptional enhancers in the normal regulation of this rearrangement process. Surprisingly, however, we found that both the V beta and DJ beta portion of the constructs were transcribed in an enhancer-dependent fashion (conferred by either E mu or E beta) in both B and T lineage cells, including normal precursor B cells propagated in culture. These findings indicate that, at least in some contexts, transcriptional activation, per se, is not sufficient to confer V(D)J recombinational accessibility to a substrate V gene segment. PMID:8006587

  5. Mutations in the dopamine beta-hydroxylase gene are associated with human norepinephrine deficiency

    NASA Technical Reports Server (NTRS)

    Kim, Chun-Hyung; Zabetian, Cyrus P.; Cubells, Joseph F.; Cho, Sonhae; Biaggioni, Italo; Cohen, Bruce M.; Robertson, David; Kim, Kwang-Soo

    2002-01-01

    Norepinephrine (NE), a key neurotransmitter of the central and peripheral nervous systems, is synthesized by dopamine beta-hydroxylase (DBH) that catalyzes oxidation of dopamine (DA) to NE. NE deficiency is a congenital disorder of unknown etiology, in which affected patients suffer profound autonomic failure. Biochemical features of the syndrome include undetectable tissue and circulating levels of NE and epinephrine, elevated levels of DA, and undetectable levels of DBH. Here, we report identification of seven novel variants including four potentially pathogenic mutations in the human DBH gene (OMIM 223360) from analysis of two unrelated patients and their families. Both patients are compound heterozygotes for variants affecting expression of DBH protein. Each carries one copy of a T-->C transversion in the splice donor site of DBH intron 1, creating a premature stop codon. In patient 1, there is a missense mutation in DBH exon 2. Patient 2 carries missense mutations in exons 1 and 6 residing in cis. We propose that NE deficiency is an autosomal recessive disorder resulting from heterogeneous molecular lesions at DBH. Copyright 2002 Wiley-Liss, Inc.

  6. Nucleotide sequence of the structural gene for diphtheria toxin carried by corynebacteriophage beta.

    PubMed Central

    Greenfield, L; Bjorn, M J; Horn, G; Fong, D; Buck, G A; Collier, R J; Kaplan, D A

    1983-01-01

    A 1,942-base-pair DNA segment encoding the structural gene for diphtheria toxin was sequenced, and the primary structure of the toxin was deduced. Restriction enzyme fragments corresponding to nontoxic or hypotoxic peptides of the toxin were isolated from corynebacteriophage beta and cloned into Escherichia coli on plasmid pBR322, and the sequence was determined. The mature toxin molecule deduced from the sequence has 535 amino acid residues and a molecular weight of 58,342. The deduced sequence for the fragment A moiety was the same as that determined at the protein level, except for a single serine residue, which had been mispositioned in the earlier study. Several differences were noted with respect to the partial sequence data available on the fragment B moiety, some or all of which may reflect genetic variations among populations of corynephages carrying the toxin gene. The DNA sequence predicts a 25-residue leader peptide preceding the mature protein, which is presumably involved in secretion of the toxin from lysogenized Corynebacterium diphtheriae. We infer that initiation of translation probably occurs at a GTG codon (codon -25). Cloned restriction fragments containing sequences for the amino-terminal region of toxin, together with 5' flanking regions, were expressed in E. coli. Toxin-related peptides were synthesized and secreted into the periplasmic space. These results provide a basis for applying recombinant DNA methods to the study of diphtheria toxin and for producing novel, genetically altered forms of the toxin suited to the construction of new classes of immunotoxins. PMID:6316330

  7. Screening of nineteen unrelated families with generalized resistance to thyroid hormone for known point mutations in the thyroid hormone receptor beta gene and the detection of a new mutation.

    PubMed Central

    Takeda, K; Balzano, S; Sakurai, A; DeGroot, L J; Refetoff, S

    1991-01-01

    Generalized resistance to thyroid hormone (GRTH) is a syndrome characterized by impaired tissue responsiveness to thyroid hormone. Two distinct point mutations in the hormone binding domain of the thyroid hormone receptor (TR) beta have recently been identified in two unrelated families with GRTH. One, Mf, involves a replacement of the normal glycine-345 for arginine in exon 7 and another, Mh, replaces the normal proline-453 for histidine in exon 8. To probe for the presence of the Mf and Mh defect in 19 unrelated families with GRTH, we applied separate polymerase chain reactions using allele-specific oligonucleotide primers containing the normal and each of the two mutant nucleotides at the 3'-position. A total of 24 affected subjects and 13 normal family members were studied. The mode of inheritance was dominant in 13 families, was unknown in 5 families, and was clearly recessive in 1 family in which only the consanguineous subjects were affected. Primers containing the substitutions specific for Mf and Mh amplified exons 7 and 8, respectively, only in affected members of each of the two index families. Primers containing the normal sequences amplified exons 7 and 8 of the TR beta gene in all subjects except affected members of one family. In this family with recessively inherited GRTH, neither exon could be amplified using any combinations of primers and DNA blot revealed absence of all coding exons. These results indicate a major deletion of the TR beta gene, including both DNA and hormone binding domains. Since heterozygous members of this family are not affected, the presence of a single normal allele is sufficient for normal function of the TR beta. These data also support the hypothesis that in the dominant mode of GRTH inheritance the presence of an abnormal TR beta interferes with the function of the normal TR beta. Distinct mutations are probably responsible for GRTH in unrelated families. Images PMID:1991834

  8. Occurrence of bacteria producing broad-spectrum beta-lactamases and qnr genes in hospital and urban wastewater samples.

    PubMed

    Röderová, Magdaléna; Sedláková, Miroslava Htoutou; Pudová, Vendula; Hricová, Kristýna; Silová, Romana; Imwensi, Peter Eghonghon Odion; Bardoň, Jan; Kolář, Milan

    2016-04-01

    The aims were to investigate the level of antibiotic-resistant bacteria in hospital and urban wastewater and to determine the similarity of isolates obtained from wastewater and hospitalized patients. Wastewater samples were collected in September 2013 and 2014. After identification using MALDI-TOF MS, beta-lactamase production was determined by relevant phenotypic tests. Genes responsible for the production of single beta-lactamase groups and Qnr proteins were established. The epidemiological relationship of the isolates from wastewater and hospitalized patients was determined by PFGE. A total of 51 isolates of enterobacteria were obtained. Overall, 45.1% of them produced broad-spectrum beta-lactamases. Genes encoding TEM, SHV, CTX-M, CIT, DHA and EBC types of enzymes and Qnr proteins were detected. No broad-spectrum beta-lactamase production was confirmed in the urban wastewater treatment plant. The most important finding was the detection of two identical isolates of K. pneumoniae in 2013, one from a patient's urinary catheter and the other from a wastewater sample. PMID:27196551

  9. Functional analysis of a proline to serine mutation in codon 453 of the thyroid hormone receptor {beta}1 gene

    SciTech Connect

    Ozata, M.; Suzuki, Satoru; Takeda, Teiji

    1995-10-01

    Mutations in the gene encoding human thyroid hormone receptor {beta}(hTR{beta}) have been associated with generalized resistance to thyroid hormone (GRTH). This disorder is associated with significant behavoral abnormalities. We examined the hTR{beta} gene in a family with members who manifest inappropriately normal TSH, elevated free T{sub 4}, and free and total T{sub 3}. Sequence analysis showed a cytosine to thymine transition at nucleotide 1642 in one allele of the index patient`s genomic DNA. This altered proline to serine at codon 453. The resulting mutant receptor when expressed in vitro bound DNA with high affinity, but the T{sub 3} affinity of the receptor was impaired. The mutant TR demonstrated a dominant negative effect when cotransfected with two isoforms of wild-type receptor and also in the presence of TR variant {alpha}2 in COS-1 cells. Mutations of codon 453 occur more frequently than at other sites, and four different amino acid substitutions have been reported. Significant differences in phenotype occur among affected individuals, varying from normality to moderately severe GRTH. There is no clear correlation between K{sub a} or in vitro function of the mutant receptor, and phenotype. This study extends the association between GRTH and illness, and indicates that early diagnosis and counseling are needed in families with TR{beta}1 abnormalities. 34 refs., 5 figs., 2 tabs.

  10. Occurrence of bacteria producing broad-spectrum beta-lactamases and qnr genes in hospital and urban wastewater samples.

    PubMed

    Röderová, Magdaléna; Sedláková, Miroslava Htoutou; Pudová, Vendula; Hricová, Kristýna; Silová, Romana; Imwensi, Peter Eghonghon Odion; Bardoň, Jan; Kolář, Milan

    2016-04-01

    The aims were to investigate the level of antibiotic-resistant bacteria in hospital and urban wastewater and to determine the similarity of isolates obtained from wastewater and hospitalized patients. Wastewater samples were collected in September 2013 and 2014. After identification using MALDI-TOF MS, beta-lactamase production was determined by relevant phenotypic tests. Genes responsible for the production of single beta-lactamase groups and Qnr proteins were established. The epidemiological relationship of the isolates from wastewater and hospitalized patients was determined by PFGE. A total of 51 isolates of enterobacteria were obtained. Overall, 45.1% of them produced broad-spectrum beta-lactamases. Genes encoding TEM, SHV, CTX-M, CIT, DHA and EBC types of enzymes and Qnr proteins were detected. No broad-spectrum beta-lactamase production was confirmed in the urban wastewater treatment plant. The most important finding was the detection of two identical isolates of K. pneumoniae in 2013, one from a patient's urinary catheter and the other from a wastewater sample.

  11. Human-Specific SNP in Obesity Genes, Adrenergic Receptor Beta2 (ADRB2), Beta3 (ADRB3), and PPAR γ2 (PPARG), during Primate Evolution

    PubMed Central

    Takenaka, Akiko; Nakamura, Shin; Mitsunaga, Fusako; Inoue-Murayama, Miho; Udono, Toshifumi; Suryobroto, Bambang

    2012-01-01

    Adrenergic-receptor beta2 (ADRB2) and beta3 (ADRB3) are obesity genes that play a key role in the regulation of energy balance by increasing lipolysis and thermogenesis. The Glu27 allele in ADRB2 and the Arg64 allele in ADRB3 are associated with abdominal obesity and early onset of non-insulin-dependent diabetes mellitus (NIDDM) in many ethnic groups. Peroxisome proliferator-activated receptor γ (PPARG) is required for adipocyte differentiation. Pro12Ala mutation decreases PPARG activity and resistance to NIDDM. In humans, energy-expense alleles, Gln27 in ADRB2 and Trp64 in ADRB3, are at higher frequencies than Glu27 and Arg64, respectively, but Ala12 in PPARG is at lower frequency than Pro12. Adaptation of humans for lipolysis, thermogenesis, and reduction of fat accumulation could be considered by examining which alleles in these genes are dominant in non-human primates (NHP). All NHP (P. troglodytes, G. gorilla, P. pygmaeus, H. agilis and macaques) had energy-thrifty alleles, Gly16 and Glu27 in ADRB2, and Arg64 in ADRB3, but did not have energy-expense alleles, Arg16, Gln27 and Trp64 alleles. In PPARG gene, all NHP had large adipocyte accumulating type, the Pro12 allele. Conclusions These results indicate that a tendency to produce much more heat through the energy-expense alleles developed only in humans, who left tropical rainforests for savanna and developed new features in their heat-regulation systems, such as reduction of body hair and increased evaporation of water, and might have helped the protection of entrails from cold at night, especially in glacial periods. PMID:22937051

  12. Mapping of the gene encoding the. beta. -amyloid precursor protein and its relationship to the Down syndrome region of chromosome 21

    SciTech Connect

    Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. )

    1988-11-01

    The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.

  13. Mapping of Heavy Chain Genes for Mouse Immunoglobulins M and D

    NASA Astrophysics Data System (ADS)

    Liu, Chih-Ping; Tucker, Philip W.; Mushinski, J. Frederic; Blattner, Frederick R.

    1980-09-01

    A single DNA fragment containing both μ and δ immunoglobulin heavy chain genes has been cloned from normal BALB/c mouse liver DNA with a new λ phage vector Charon 28. The physical distance between the membrane terminal exon of μ and the first domain of δ is 2466 base pairs, with δ on the 3' side of μ . A single transcript could contain a variable region and both μ and δ constant regions. The dual expression of immunoglobulins M and D on spleen B cells may be due to alternate splicing of this transcript.

  14. Gene Profiling Studies in Skeletal Muscle by Quantitative Real-Time Polymerase Chain Reaction Assay

    PubMed Central

    Bhatnagar, Shephali; Panguluri, Siva K.; Kumar, Ashok

    2012-01-01

    Summary Gene profiling is an excellent tool to identify the genetic mechanisms, networks, and molecular pathways involved in skeletal muscle development and muscular disorders. Oligonucleotide or cDNA microarray can be the first step to identify the global gene expression in the study of interest. As microarray techniques provide a large set of differentially expressed genes in a given comparison, the expression profile can be narrowed down by taking various parameters into consideration such as fold values, p-values, and their relevance to the study. Every technique has its own limitations. Therefore, further validation of the results with a different technique is always necessary. Quantitative real-time reverse-transcriptase polymerase chain reaction (qRT-PCR) is the most common technique to validate microarray data and to study the relative expression of specific genes in any experimental set-up. Here, we describe, the qRT-PCR technique, in detail, for -successful gene expression studies in skeletal muscle cells and tissues. PMID:22130845

  15. Preferential utilization of conserved immunoglobulin heavy chain variable gene segments during human fetal life.

    PubMed Central

    Schroeder, H W; Wang, J Y

    1990-01-01

    The ability to respond to specific antigens develops in a programmed fashion. Although the antibody repertoire in adults is presumably generated by stochastic combinatorial joining of rearranged heavy variable, diversity, and joining (VH-DH-JH) and light (VL-JL) chains, experimental evidence in the mouse has shown nonrandom utilization of variable gene segments during ontogeny and in response to specific antigens. In this study, we have performed sequence analysis of 104-day human fetal liver-derived, randomly isolated constant region C+ mu transcripts and demonstrate a consistent preference during fetal life for a small subset of three highly conserved VH3 family gene segments. In addition, the data show that this preferential gene segment utilization extends to the DHQ52 and the JH3 and JH4 loci. Sequence analysis of two "sterile" DH-JH transcripts suggests that transcriptional activation of the JH-proximal DHQ52 element may precede initiation of DH-JH rearrangement and influence fetal DH utilization. Sequence comparisons reveal striking nucleotide polymorphism in allelic gene segments which is poorly reflected in the peptide sequence, implying considerable evolutionary selection pressure. Although vertebrate species utilize a variety of strategies to generate their antibody repertoire, preferential utilization of VH3 elements is consistently found during early development. These data support the hypothesis that VH3 gene segments play an essential role in the development of the immune response. Images PMID:2117273

  16. No Effect of the Transforming Growth Factor {beta}1 Promoter Polymorphism C-509T on TGFB1 Gene Expression, Protein Secretion, or Cellular Radiosensitivity

    SciTech Connect

    Reuther, Sebastian; Metzke, Elisabeth; Bonin, Michael; Petersen, Cordula; Dikomey, Ekkehard; Raabe, Annette

    2013-02-01

    Purpose: To study whether the promoter polymorphism (C-509T) affects transforming growth factor {beta}1 gene (TGFB1) expression, protein secretion, and/or cellular radiosensitivity for both human lymphocytes and fibroblasts. Methods and Materials: Experiments were performed with lymphocytes taken either from 124 breast cancer patients or 59 pairs of normal monozygotic twins. We used 15 normal human primary fibroblast strains as controls. The C-509T genotype was determined by polymerase chain reaction-restriction fragment length polymorphism or TaqMan single nucleotide polymorphism (SNP) genotyping assay. The cellular radiosensitivity of lymphocytes was measured by G0/1 assay and that of fibroblasts by colony assay. The amount of extracellular TGFB1 protein was determined by enzyme-linked immunosorbent assay, and TGFB1 expression was assessed via microarray analysis or reverse transcription-polymerase chain reaction. Results: The C-509T genotype was found not to be associated with cellular radiosensitivity, neither for lymphocytes (breast cancer patients, P=.811; healthy donors, P=.181) nor for fibroblasts (P=.589). Both TGFB1 expression and TGFB1 protein secretion showed considerable variation, which, however, did not depend on the C-509T genotype (protein secretion: P=.879; gene expression: lymphocytes, P=.134, fibroblasts, P=.605). There was also no general correlation between TGFB1 expression and cellular radiosensitivity (lymphocytes, P=.632; fibroblasts, P=.573). Conclusion: Our data indicate that any association between the SNP C-509T of TGFB1 and risk of normal tissue toxicity cannot be ascribed to a functional consequence of this SNP, either on the level of gene expression, protein secretion, or cellular radiosensitivity.

  17. Sequential changes in chromatin structure during transcriptional activation in the beta globin LCR and its target gene.

    PubMed

    Kim, Kihoon; Kim, AeRi

    2010-09-01

    Chromatin structure is modulated during transcriptional activation. The changes include the association of transcriptional activators, formation of hypersensitive sites and covalent modifications of histones. To understand the order of the various changes accompanying transcriptional activation, we analyzed the mouse beta globin gene, which is transcriptionally inducible in erythroid MEL cells over a time course of HMBA treatment. Transcription of the globin genes requires the locus control region (LCR) consisting of several hypersensitive sites (HSs). Erythroid specific transcriptional activators such as NF-E2, GATA-1, TAL1 and EKLF were associated with the LCR in the uninduced state before transcriptional activation. The HSs of the LCR were formed in this state as revealed by high sensitivity to DNase I and MNase attack. However the binding of transcriptional activators and the depletion of histones were observed in the promoter of the beta globin gene only after transcriptional activation. In addition, various covalent histone modifications were sequentially detected in lysine residues of histone H3 during the activation. Acetylation of K9, K36 and K27 was notable in both LCR HSs and gene after induction but before transcriptional initiation. Inactive histone marks such as K9me2, K36me2 and K27me2 were removed coincident with transcriptional initiation in the gene region. Taken together, these results indicate that LCR has a substantially active structure in the uninduced state while transcriptional activation serially adds active marks, including histone modifications, and removes inactive marks in the target gene of the LCR.

  18. A summary of 7q interstitial deletions and exclusion mapping of the gene for beta-glucuronidase.

    PubMed Central

    Fagan, K; Gill, A; Henry, R; Wilkinson, I; Carey, B

    1989-01-01

    Three patients are described with different phenotypes and differing de novo interstitial deletions of the long arm of a chromosome 7. The first patient has a deletion with loss of the proximal 7q11.23 band. Only three other cases have been reported with this particular deletion. Our second case shows mild dysmorphism similar to the other four patients reported with deletion of bands 7q21.12----21.3. Our third patient has a deletion of the 7q22.1----32.2 segment and has many of the phenotypic features of the other reported cases of del 7q22----32. GUSB, the gene for beta-glucuronidase, has been localised to the 7cen----q22 region. Analysis of beta-glucuronidase levels in blood leucocytes of our patients has helped more precisely to assign this gene locus to 7q21.11 or 7q22.1. Images PMID:2486209

  19. A red beet (Beta vulgaris) UDP-glucosyltransferase gene induced by wounding, bacterial infiltration and oxidative stress.

    PubMed

    Sepúlveda-Jiménez, Gabriela; Rueda-Benítez, Patricia; Porta, Helena; Rocha-Sosa, Mario

    2005-02-01

    Mechanical wounding, infiltration with P. syringae or A. tumefaciens, and exposure to an H(2)O(2)-generating system (Glc/Glc oxidase) induce betacyanin synthesis in red beet (Beta vulgaris) leaves. These conditions also induced the expression of BvGT, a gene encoding a glucosyltransferase (GT) from Beta vulgaris. BvGT has a high similarity to Dorotheanthus bellidiformis betanidin-5 GT involved in betacyanin synthesis. Furthermore, the transient expression of a BvGT antisense construct resulted in the reduction of BvGT transcript accumulation and betanin synthesis, suggesting a role for this gene product in betacyanin glucosylation. In addition, the NADPH oxidase inhibitor, diphenylene iodonium (DPI), inhibited the accumulation of the BvGT transcript in response to infiltration with Agrobacterium tumefaciens. Hence, this result suggests that ROS produced by a plasma membrane NADPH oxidase may act as a signal to induce BvGT expression, necessary for betanin synthesis after wounding and bacterial infiltration. PMID:15582929

  20. A homozygous nonsense mutation in the {alpha}3 chain gene of laminin 5 (LAMA3) in Herlitz junctional epidermolysis bullosa: Prenatal exclusion in a fetus at risk

    SciTech Connect

    McGrath, J.A. |; Ciatti, S.; Christiano, A.M.

    1995-09-01

    Mutations in the three genes (LAMA3, LAMB3, and LAMC2) that encode the three chains ({alpha}3, {Beta}3, and {gamma}2, respectively) of laminin 5, a protein involved in epidermal-dermal adhesion, have been established as the genetic basis for the inherited blistering skin disorder, Herlitz junctional epidermolysis bullosa (H-JEB). In this study, we performed mutational analysis on genomic DNA from a child with H-JEB and identified a nonsense mutation in the {alpha}3 chain gene (LAMA3) consisting of a homozygous C-to-T transition resulting in a premature termination codon (CGA {r_arrow} TGA) on both alleles. The parents were shown to be heterozygous carriers of the same mutation. Direct mutation analysis was used to perform DNA-based prenatal diagnosis from a chorionic villus biopsy at 10 weeks` gestation in a subsequent pregnancy. The fetus was predicted to be genotypically normal with respect to the LAMA3 mutation. 15 refs., 1 fig.

  1. On the mechanism of side chain oxidation of N-beta-alanyldopamine by cuticular enzymes from Sarcophaga bullata.

    PubMed

    Sugumaran, M; Saul, S J; Dali, H

    1990-01-01

    The metabolism of N-beta-alanyldopamine (NBAD) by Sarcophaga bullata was investigated. Incubation of NBAD with larval cuticular preparations resulted in the covalent bindings of NBAD to the cuticle and generation of N-beta-alanyl-norepinephrine (NBANE) as the soluble product. When the reaction was carried out in presence of a powerful quinone trap viz., N-acetylcysteine, NBANE formation was totally abolished; but a new compound characterized as NBAD-quinone-N-acetylcysteine adduct was generated. These results indicate that NBAD quinone is an obligatory intermediate for the biosynthesis of NBANE in sarcophagid cuticle. Accordingly, phenylthiourea--a well-known phenoloxidase inhibitor--completely inhibited the NBANE production even at 5 microM level. A soluble enzyme isolated from cuticle converted exogenously supplied NBAD quinone to NBANE. Chemical considerations indicated that the enzyme is an isomerase and is converting NBAD quinone to its quinone methide which was rapidly and nonenzymatically hydrated to form NBANE. Consistent with this hypothesis is the finding that NBAD quinone methide can be trapped as beta-methoxy NBAD by performing the enzymatic reaction in 10% methanol. Moreover, when the reaction was carried out in presence of kynurenine, two diastereoisomeric structures of papiliochrome II-(Nar-[alpha-3-aminopropionyl amino methyl-3,4-dihydroxybenzyl]-L-kynurenine) could be isolated as by-products, indicating that the further reactions of NBAD quinone methide with exogenously added nucleophiles are nonenzymatic and nonstereoselective. Based on these results, it is concluded that NBAD is metabolized via NBAD quinone and NBAD quinone methide by the action of phenoloxidase and quinone isomerase respectively. The resultant NBAD quinone methide, being highly reactive, undergoes nonenzymatic and nonstereoselective Michael-1,6-addition reaction with either water (to form NBANE) or other nucleophiles in cuticle to account for the proposed quinone methide

  2. Cloning of the RHO1 gene from Candida albicans and its regulation of beta-1,3-glucan synthesis.

    PubMed Central

    Kondoh, O; Tachibana, Y; Ohya, Y; Arisawa, M; Watanabe, T

    1997-01-01

    The Saccharomyces cerevisiae RHO1 gene encodes a low-molecular-weight GTPase. One of its recently identified functions is the regulation of beta-1,3-glucan synthase, which synthesizes the main component of the fungal cell wall (J. Drgonova et al., Science 272:277-279, 1996; T. Mazur and W. Baginsky, J. Biol. Chem. 271:14604-14609, 1996; and H. Qadota et al., Science 272:279-281, 1996). From the opportunistic pathogenic fungus Candida albicans, we cloned the RHO1 gene by the PCR and cross-hybridization methods. Sequence analysis revealed that the Candida RHO1 gene has a 597-nucleotide region which encodes a putative 22.0-kDa peptide. The deduced amino acid sequence predicts that Candida albicans Rho1p is 82.9% identical to Saccharomyces Rho1p and contains all the domains conserved among Rho-type GTPases from other organisms. The Candida albicans RHO1 gene could rescue a S. cerevisiae strain containing a rho1 deletion. Furthermore, recombinant Candida albicans Rho1p could reactivate the beta-1,3-glucan synthesis activities of both C. albicans and S. cerevisiae membranes in which endogenous Rho1p had been depleted by Tergitol NP-40-NaCl treatment. Candida albicans Rho1p was copurified with the beta-1,3-glucan synthase putative catalytic subunit, Candida albicans Gsc1p, by product entrapment. Candida albicans Rho1p was shown to interact directly with Candida albicans Gsc1p in a ligand overlay assay and a cross-linking study. These results indicate that Candida albicans Rho1p acts in the same manner as Saccharomyces cerevisiae Rho1p to regulate beta-1,3-glucan synthesis. PMID:9401032

  3. Short Chain Fatty Acids (SCFA) Reprogram Gene Expression in Human Malignant Epithelial and Lymphoid Cells

    PubMed Central

    Astakhova, Lidiia; Ngara, Mtakai; Babich, Olga; Prosekov, Aleksandr; Asyakina, Lyudmila; Dyshlyuk, Lyubov; Midtvedt, Tore; Zhou, Xiaoying; Ernberg, Ingemar; Matskova, Liudmila

    2016-01-01

    The effect of short chain fatty acids (SCFAs) on gene expression in human, malignant cell lines was investigated, with a focus on signaling pathways. The commensal microbial flora produce high levels of SCFAs with established physiologic effects in humans. The most abundant SCFA metabolite in the human microflora is n-butyric acid. It is well known to activate endogenous latent Epstein-Barr virus (EBV), that was used as a reference read out system and extended to EBV+ epithelial cancer cell lines. N-butyric acid and its salt induced inflammatory and apoptotic responses in tumor cells of epithelial and lymphoid origin. Epithelial cell migration was inhibited. The n-butyric gene activation was reduced by knock-down of the cell membrane transporters MCT-1 and -4 by siRNA. N-butyric acid show biologically significant effects on several important cellular functions, also with relevance for tumor cell phenotype. PMID:27441625

  4. Real-time reverse-transcription polymerase chain reaction: technical considerations for gene expression analysis.

    PubMed

    Doak, Shareen H; Zaïr, Zoulikha M

    2012-01-01

    The reverse transcription - polymerase chain reaction (RT-PCR) is a sensitive technique for the quantification of steady-state mRNA levels, particularly in samples with limited quantities of extracted RNA, or for analysis of low level transcripts. The procedure amplifies defined mRNA transcripts by taking advantage of retroviral enzymes with reverse transcriptase (RT) activity, coupled to PCR. The resultant PCR product concentration is directly proportional to the initial starting quantity of mRNA, therefore allowing quantification of gene expression by incorporation of a fluorescence detector for the appropriate amplicons. In this chapter, we describe a number of the most popular techniques for performing RT-PCR and detail the subsequent analysis methodologies required to interpret the resultant data in either a relative manner or through absolute quantification of gene expression levels.

  5. Short Chain Fatty Acids (SCFA) Reprogram Gene Expression in Human Malignant Epithelial and Lymphoid Cells.

    PubMed

    Astakhova, Lidiia; Ngara, Mtakai; Babich, Olga; Prosekov, Aleksandr; Asyakina, Lyudmila; Dyshlyuk, Lyubov; Midtvedt, Tore; Zhou, Xiaoying; Ernberg, Ingemar; Matskova, Liudmila

    2016-01-01

    The effect of short chain fatty acids (SCFAs) on gene expression in human, malignant cell lines was investigated, with a focus on signaling pathways. The commensal microbial flora produce high levels of SCFAs with established physiologic effects in humans. The most abundant SCFA metabolite in the human microflora is n-butyric acid. It is well known to activate endogenous latent Epstein-Barr virus (EBV), that was used as a reference read out system and extended to EBV+ epithelial cancer cell lines. N-butyric acid and its salt induced inflammatory and apoptotic responses in tumor cells of epithelial and lymphoid origin. Epithelial cell migration was inhibited. The n-butyric gene activation was reduced by knock-down of the cell membrane transporters MCT-1 and -4 by siRNA. N-butyric acid show biologically significant effects on several important cellular functions, also with relevance for tumor cell phenotype. PMID:27441625

  6. Characterization of cultivar differences in beta-1,3 glucanase gene expression, glucanase activity and fruit pulp softening rates during fruit ripening in three naturally occurring banana cultivars.

    PubMed

    Roy Choudhury, Swarup; Roy, Sujit; Sengupta, Dibyendu N

    2009-11-01

    beta-1,3 glucanase (E.C.3.2.1.39) is the key enzyme involved in the hydrolytic cleavage of 1,3 beta-D glucosidic linkages in beta-1,3 glucans. This work describes a comparative analysis of expression patterns of beta-1,3 glucanase gene in relation to changes in fruit pulp softening rates in three banana cultivars, Rasthali (AAB), Kanthali (AB), and Monthan (ABB). Analysis of transcript and protein levels of beta-1,3 glucanase gene during ripening revealed differential timing in expression of the gene which correlated well with the variation in enzymatic activity of glucanase and fruit pulp softening rates in the three cultivars. Exogenously applied ethylene strongly induced beta-1,3 glucanase expression during the early ripening days in Rasthali, while the expression of the gene was marginally stimulated following ethylene treatment in preclimacteric Kanthali fruit. Conversely, in Monthan, beta-1,3 glucanase expression was very low throughout the ripening stages, and ethylene treatment did not induce the expression of the gene in this cultivar. Analysis of glucanase activity using protein extracts from unripe and ripe fruit of Monthan with crude cell wall polysaccharide fractions (used as substrate) indicated that the natural substrate for glucanase remained almost unutilized in this cultivar due to low in vivo glucanase activity. Furthermore, the recombinant beta-1,3 glucanase protein, overexpressed in E. coli, showed requirement for substrates with contiguous beta-1,3 linkages for optimal activity. Overall, our results provide new information on the expression profile of beta-1,3 glucanase gene in connection with the pattern of changes in fruit firmness at the physiological and molecular levels during ripening in three banana cultivars. PMID:19697038

  7. Muscle fiber type specific induction of slow myosin heavy chain 2 gene expression by electrical stimulation

    SciTech Connect

    Crew, Jennifer R.; Falzari, Kanakeshwari; DiMario, Joseph X.

    2010-04-01

    Vertebrate skeletal muscle fiber types are defined by a broad array of differentially expressed contractile and metabolic protein genes. The mechanisms that establish and maintain these different fiber types vary throughout development and with changing functional demand. Chicken skeletal muscle fibers can be generally categorized as fast and fast/slow based on expression of the slow myosin heavy chain 2 (MyHC2) gene in fast/slow muscle fibers. To investigate the cellular and molecular mechanisms that control fiber type formation in secondary or fetal muscle fibers, myoblasts from the fast pectoralis major (PM) and fast/slow medial adductor (MA) muscles were isolated, allowed to differentiate in vitro, and electrically stimulated. MA muscle fibers were induced to express the slow MyHC2 gene by electrical stimulation, whereas PM muscle fibers did not express the slow MyHC2 gene under identical stimulation conditions. However, PM muscle fibers did express the slow MyHC2 gene when electrical stimulation was combined with inhibition of inositol triphosphate receptor (IP3R) activity. Electrical stimulation was sufficient to increase nuclear localization of expressed nuclear-factor-of-activated-T-cells (NFAT), NFAT-mediated transcription, and slow MyHC2 promoter activity in MA muscle fibers. In contrast, both electrical stimulation and inhibitors of IP3R activity were required for these effects in PM muscle fibers. Electrical stimulation also increased levels of peroxisome-proliferator-activated receptor-{gamma} co-activator-1 (PGC-1{alpha}) protein in PM and MA muscle fibers. These results indicate that MA muscle fibers can be induced by electrical stimulation to express the slow MyHC2 gene and that fast PM muscle fibers are refractory to stimulation-induced slow MyHC2 gene expression due to fast PM muscle fiber specific cellular mechanisms involving IP3R activity.

  8. Cloning and characterization of the endogenous cephalosporinase gene, cepA, from Bacteroides fragilis reveals a new subgroup of Ambler class A beta-lactamases.

    PubMed Central

    Rogers, M B; Parker, A C; Smith, C J

    1993-01-01

    Bacteroides fragilis CS30 is a clinical isolate resistant to high concentrations of benzylpenicillin and cephaloridine but not to cephamycin or penem antibiotics. beta-