Evidence That the [beta] Subunit of Chlamydia trachomatis Ribonucleotide Reductase Is Active with the Manganese Ion of Its Manganese(IV)/Iron(III) Cofactor in Site 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dassama, Laura M.K.; Boal, Amie K.; Krebs, Carsten

2014-10-02

The reaction of a class I ribonucleotide reductase (RNR) begins when a cofactor in the {beta} subunit oxidizes a cysteine residue {approx}35 {angstrom} away in the {alpha} subunit, generating a thiyl radical. In the class Ic enzyme from Chlamydia trachomatis (Ct), the cysteine oxidant is the Mn{sup IV} ion of a Mn{sup IV}/Fe{sup III} cluster, which assembles in a reaction between O{sub 2} and the Mn{sup II}/Fe{sup II} complex of {beta}. The heterodinuclear nature of the cofactor raises the question of which site, 1 or 2, contains the Mn{sup IV} ion. Because site 1 is closer to the conserved locationmore » of the cysteine-oxidizing tyrosyl radical of class Ia and Ib RNRs, we suggested that the Mn{sup IV} ion most likely resides in this site (i.e., {sup 1}Mn{sup IV}/{sup 2}Fe{sup III}), but a subsequent computational study favored its occupation of site 2 ({sup 1}Fe{sup III}/{sup 2}Mn{sup IV}). In this work, we have sought to resolve the location of the Mn{sup IV} ion in Ct RNR-{beta} by correlating X-ray crystallographic anomalous scattering intensities with catalytic activity for samples of the protein reconstituted in vitro by two different procedures. In samples containing primarily Mn{sup IV}/Fe{sup III} clusters, Mn preferentially occupies site 1, but some anomalous scattering from site 2 is observed, implying that both {sup 1}Mn{sup II}/{sup 2}Fe{sup II} and {sup 1}Fe{sup II}/{sup 2}Mn{sup II} complexes are competent to react with O{sub 2} to produce the corresponding oxidized states. However, with diminished Mn{sup II} loading in the reconstitution, there is no evidence for Mn occupancy of site 2, and the greater activity of these 'low-Mn' samples on a per-Mn basis implies that the {sup 1}Mn{sup IV}/{sup 2}Fe{sup III}-{beta} is at least the more active of the two oxidized forms and may be the only active form.« less

Purification and properties of a beta-galactosidase from carambola fruit with significant activity towards cell wall polysaccharides.

PubMed

Balasubramaniam, Sumathi; Lee, Heng Chin; Lazan, Hamid; Othman, Roohaida; Ali, Zainon Mohd

2005-01-01

beta-Galactosidase (EC. 3.2.1.23) from ripe carambola (Averrhoa carambola L. cv. B10) fruit was fractionated through a combination of ion exchange and gel filtration chromatography into four isoforms, viz. beta-galactosidase I, II, III and IV. This beta-galactosidases had apparent native molecular masses of 84, 77, 58 and 130 kDa, respectively. beta-Galactosidase I, the predominant isoform, was purified to electrophoretic homogeneity; analysis of the protein by SDS-PAGE revealed two subunits with molecular masses of 48 and 36 kDa. N-terminal amino acid sequence of the respective polypeptides shared high similarities albeit at different domains, with the deduced amino acid sequence of certain plant beta-galactosidases, thus, explaining the observed low similarity between the two subunits. beta-Galactosidase I was probably a heterodimer that have glycoprotein properties and a pI value of 7.2, with one of the potential glycosylation sites appeared to reside within the 48-kDa-polypeptide. The purified beta-galactosidase I was substantially active in hydrolyzing (1-->4)beta-linked spruce and a mixture of (1-->3)beta- and (1-->6)beta-linked gum arabic galactans. This isoform also had the capability to solubilize and depolymerize structurally intact pectins as well as to modify alkaline-soluble hemicelluloses, reflecting in part changes that occur during ripening.

Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study

PubMed Central

Boonyawat, Boonchai; Monsereenusorn, Chalinee; Traivaree, Chanchai

2014-01-01

Background Beta-thalassemia is one of the most common genetic disorders in Thailand. Clinical phenotype ranges from silent carrier to clinically manifested conditions including severe beta-thalassemia major and mild beta-thalassemia intermedia. Objective This study aimed to characterize the spectrum of beta-globin gene mutations in pediatric patients who were followed-up in Phramongkutklao Hospital. Patients and methods Eighty unrelated beta-thalassemia patients were enrolled in this study including 57 with beta-thalassemia/hemoglobin E, eight with homozygous beta-thalassemia, and 15 with heterozygous beta-thalassemia. Mutation analysis was performed by multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene, and gap polymerase chain reaction for 3.4 kb deletion detection, respectively. Results A total of 13 different beta-thalassemia mutations were identified among 88 alleles. The most common mutation was codon 41/42 (-TCTT) (37.5%), followed by codon 17 (A>T) (26.1%), IVS-I-5 (G>C) (8%), IVS-II-654 (C>T) (6.8%), IVS-I-1 (G>T) (4.5%), and codon 71/72 (+A) (2.3%), and all these six common mutations (85.2%) were detected by M-ARMS. Six uncommon mutations (10.2%) were identified by DNA sequencing including 4.5% for codon 35 (C>A) and 1.1% initiation codon mutation (ATG>AGG), codon 15 (G>A), codon 19 (A>G), codon 27/28 (+C), and codon 123/124/125 (-ACCCCACC), respectively. The 3.4 kb deletion was detected at 4.5%. The most common genotype of beta-thalassemia major patients was codon 41/42 (-TCTT)/codon 26 (G>A) or betaE accounting for 40%. Conclusion All of the beta-thalassemia alleles have been characterized by a combination of techniques including M-ARMS, DNA sequencing, and gap polymerase chain reaction for 3.4 kb deletion detection. Thirteen mutations account for 100% of the beta-thalassemia genes among the pediatric patients in our study. PMID:25525381

[Study on chemical constituents from the roots and rhizomes of Sinopodophyllum emodi].

PubMed

Sun, Yan-Jun; Li, Zhan-Lin; Chen, Hong; Zhou, Wei; Hua, Hui-Ming

2012-10-01

To investigate the chemical constituents in the roots and rhizomes of Sinopodophyllum emodi. The compounds were isolated by many different chromatographic methods such as silica gel, Sephadex LH-20, and ODS column. Their structures were identified by their physicochemical properties and spectrascopic data. Nine compounds were isolated and identified as isopicrodeoxypodophyllotoxin(I), 3beta-hydroxy-7alpha-methoxy-24beta-ethyl-cholest-5-ene(II), 5alpha, 8alpha-epidioxy-(22E,24R)-erg-osta-6,22-dien-3beta-ol(III), 7beta-hydroxysitosterol (IV), beta-sitosterol (V), daucosterol (VI), alpha-glyceryl palmitate (VII), alpha-D-glucose (VIII), 5-hydromethyl furaldehyde (IX). Compounds I - IV, VII - IX are obtained from this genus for the first time.

Subcellular distributions of rat CaM kinase phosphatase N and other members of the CaM kinase regulatory system.

PubMed

Kitani, Takako; Okuno, Sachiko; Takeuchi, Masayuki; Fujisawa, Hitoshi

2003-07-01

Ca2+/Calmodulin-dependent protein kinase (CaM kinase) regulatory system is composed of multifunctional CaM kinases such as CaM kinases IV and I, upstream CaM kinases such as CaM kinase kinases alpha and beta, which activate multifunctional CaM kinases, and CaM kinase phosphatases such as CaM kinase phosphatase and CaM kinase phosphatase N, which deactivate the activated multifunctional CaM kinases. To understand the combinations of CaM kinases I and IV, CaM kinase kinases alpha and beta, and CaM kinase phosphatases, the locations of the enzymes in the cell were examined by immunocytochemical studies of cultured cells. The results indicate that CaM kinase I, CaM kinase kinase beta, and CaM kinase phosphatase occur in the cytoplasm and that CaM kinase IV, CaM kinase kinase alpha (and CaM kinase kinase beta in some cell types and tissues), and CaM kinase phosphatase N occur inside the cellular nucleus, suggesting that there are at least two different sets of CaM kinase regulatory systems, one consisting of CaM kinase I, CaM kinase kinase beta, and CaM kinase phosphatase in the cytoplasm and the other consisting of CaM kinase IV, CaM kinase kinase alpha (and CaM kinase kinase beta in some cell types and tissues), and CaM kinase phosphatase N in the nucleus.

The region of formation of the ultraviolet high temperature resonance lines in the eclipsing binary Beta Persei (Algol)

NASA Technical Reports Server (NTRS)

Brandi, E.; Garcia, L. G.; Kondo, Y.; Sahade, J.

1989-01-01

A new series of IUE observations of Beta Persei has shown that the high temperature resonance lines of Si IV and C IV arise in a region that surrounds the brighter, early-type component of the system. The continuum spectrum corresponds to that of a B8V object, and the value of E(B-V) that yielded the best match between the two IUE regions was 0.06, the value quoted for Beta Per in Jamar et al.'s (1976) Catalog.

[Molecular characterization of heterozygous beta-thalassemia in Lanzarote, Spain].

PubMed

Calvo-Villas, José Manuel; de la Iglesia Iñigo, Silvia; Ropero Gradilla, Paloma; Zapata Ramos, María Francisca; Cuesta Tovar, Jorge; Sicilia Guillén, Francisco

2008-04-05

The aim of this study was to determine the molecular defects of heterozygous beta thalassaemia and to ascertain their distribution in Lanzarote. Molecular characterization was achieved by real time polymerase chain reaction (RT-PCR LightCycler, Roche), PCR-ARMS (PCR-amplification reaction mutations system) and DNA sequencing on an automated DNA sequencer. Two hundred forty-three heterozygous beta thalassaemia carriers were included between July 1991 and February 2007. RT-PCR detected the molecular defect in 81% of the beta thalassaemia chromosomes analyzed [113 codon CD 39 (C --> T); 41 IVS-1-nt-110 (G --> A), 25 IVS 1-nt-1 (G --> A) and 19 IVS 1-nt-6 (T --> C)]. The remaining 12 molecular defects included the deletion 619 bp (7.8%) and the mutations -28 (A --> G), IVS1-nt-2 (T --> G), CD 41/42 (-TTCT), CD 8/9 (+G), CD 51 (-C), CD 22 (G --> T) and CD 24 (T --> A), CD 67 (-TG) and the novel mutation CD 20/21-TGGA. The distribution of the mutations is similar to that found in the Mediterranean area. The increasing migratory flow received in the Canary Islands may explain the emergence of new mutations not reported before in our area.

A new compound heterozygous frameshift mutation in the type II 3{beta}-hydroxysteroid dehydrogenase 3{beta}-HSD gene causes salt-wasting 3{beta}-HSD deficiency congenital adrenal hyperplasia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, L.; Sakkal-Alkaddour, S.; Chang, Ying T.

1996-01-01

We report a new compound heterozygous frameshift mutation in the type II 3{Beta}-hydroxysteroid dehydrogenase (3{beta}-HSD) gene in a Pakistanian female child with the salt-wasting form of 3{Beta}-HSD deficiency congenital adrenal hyperplasia. The etiology for her congenital adrenal hyperplasia was not defined. Although the family history suggested possible 3{beta}-HSd deficiency disorder, suppressed adrenal function caused by excess glucocorticoid therapy in this child at 7 yr of age did not allow hormonal diagnosis. To confirm 3{beta}-HSD deficiency, we sequenced the type II 3{beta}-HSD gene in the patient, her family, and the parents of her deceased paternal cousins. The type II 3{beta}-HSD genemore » region of a putative promotor, exons I, II, III, and IV, and exon-intron boundaries were amplified by PCR and sequenced in all subjects. The DNA sequence of the child revealed a single nucleotide deletion at codon 318 [ACA(Thr){r_arrow}AA] in exon IV in one allele, and two nucleotide deletions at codon 273 [AAA(Lys){r_arrow}A] in exon IV in the other allele. The remaining gene sequences were normal. The codon 318 mutation was found in one allele from the father, brother, and parents of the deceased paternal cousins. The codon 273 mutation was found in one allele of the mother and a sister. These findings confirmed inherited 3{beta}-HSD deficiency in the child caused by the compound heterozygous type II 3{beta}-HSD gene mutation. Both codons at codons 279 and 367, respectively, are predicted to result in an altered and truncated type II 3{beta}-HSD protein, thereby causing salt-wasting 3{beta}-HSD deficiency in the patient. 21 refs., 2 figs., 1 tab.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ngo, K.Y.; Liu, D.; Lee, J.

During the past two years we have tested 2,300 Southeast Asians for alpha- and beta-thaleassemia mutations. We found the incidence of hemoglobin E ({beta}{sup 26}) to be 47% among Laotians and 38% among Cambodians. The incidence of beta thalassemia trait is 9% for Laotians and 6% for Cambodians. Thus, the risk for hemoglobin E/{beta}{sup 26} thalassemia, a transfusion-dependent disorder, is increased in these two population groups. Denaturing gradient gel electrophoresis (DGGE) has proven to be useful in testing for beta-thalassemia carriers and identifying new mutations in the beta globin gene. DNA was extracted from venous blood obtained from patients withmore » elevated Hgb A2 (>4%). Five DNA fragments, encompassing the beta globin gene cluster, were amplified by PCR and analyzed, along with known beta gene mutations as controls, by DGGE using different denaturing gradient concentrations. Different mutations at the same nucleotide position can be distinguished by migration pattern on the DGGE (e.g., in IVS-I-1, G{r_arrow}A and T). Compound heterozygotes for {beta}-thalassemia can be detected on the same gel (e.g., HbE/mutation codon 17). New mutations are identified by their migration pattern compared with controls and determined by subsequent sequencing. We have identified three new mutations: codon 82 CAA{r_arrow}AAA in one Cambodian patient; IVS-II-667, T{r_arrow}C and IVS-II-672, A{r_arrow}C in two Laotian patients. When the parent`s genotypes are known, prenatal diagnosis can be obtained within 24 hours. Thus, PCR/DGGE combination is a rapid and reliable diagnostic approach to clinically significant {beta}-thalassemia. The most important steps are carefully designed primers and predetermined gradient concentrations for DGGE.« less

15 beta-hydroxysteroids (Part IV). Steroids of the human perinatal period: the synthesis of 3 alpha,15 beta,17 alpha-trihydroxy-5 alpha-pregnan-20-one and its A/B-ring configurational isomers.

PubMed

Reeder, A Y; Joannou, G E

1995-12-01

In recent years several 15 beta-hydroxysteroids have emerged pathognomonic of adrenal disorders in human neonates of which 3 alpha,15 beta,17 alpha-trihydroxy-5 beta-pregnan-20-one (2) was the first to be identified in the urine of newborn infants affected with congenital adrenal hyperplasia. In this investigation we report the synthesis of the three remaining 3 xi,5 xi-isomers, namely 3 alpha,15 beta,17 alpha-trihydroxy-5 alpha-pregnan-20-one (3), 3 beta,15 beta,17 alpha-trihydroxy-5 alpha-pregnan-20-one (7) and 3 beta,15 beta,17 alpha-trihydroxy-5 beta-pregnan-20-one (8) for their definitive identification in pathological conditions in human neonates. 3 beta,15 beta-Diacetoxy-17 alpha-hydroxy-5-pregnen-20-one (11), a product of chemical synthesis was converted to the isomeric 3 and 7, while conversion of 15 beta,17 alpha-dihydroxy-4-pregnen-3,20-dione (4), a product of microbiological transformation, resulted in the preparation of 8. In brief, selective acetate hydrolysis of 11 gave 15 beta-acetoxy-3 beta,17 alpha-dihydroxy-5-pregnen-20-one (12) which on catalytic hydrogenation gave 15 beta-acetoxy-3 beta,17 alpha-dihydroxy-5 alpha-pregnan-20-one (13) a common intermediate for the synthesis of the 3 beta(and alpha),5 alpha-isomers. Hydrolysis of the 15 beta-acetate gave 7, whereas oxidation with pyridinium chlorochromate gave 15 beta-acetoxy-17 alpha-hydroxy-5 alpha-pregnan-3,20-dione (14) which on reduction with L-Selectride and hydrolysis of the 15 beta-acetate gave 3. Finally, hydrogenation of 4 gave 15 beta, 17 alpha-dihydroxy-5 beta-pregnan-3,20-dione (10) which on reduction with L-Selectride gave 8.

First direct comparison of high and low ionization line kinematics in active galactic nuclei

NASA Technical Reports Server (NTRS)

Sulentic, J. W.; Marziani, P.; Dultzin-Hacyan, D.; Calvani, M.; Moles, M.

1995-01-01

We present first results of a comparison of emission line shift properties for the high (HILs) and low (LILs) ionization lines in 43 low-reshift quasars. We identify a core sample of C IV lambda 1549 and hydrogen beta profiles with a wide distribution of red- and blueshifts (less than or equal to +/- 1000 km/sec). We also identify two tails in this distribution: one with large hydrogen beta redshifts (greater than or equal to 2000 km/sec) and another with large C IV blueshifts (greater than or equal to 1500 km/sec). The tails are mutually exclusive. All objects with extreme hydrogen beta redshift are radio loud, and all objects with extreme C IV blueshift are radio quiet. The core samples of smaller shifts can be most simply divided into: (1) hydrogen beta - a redshifted radio-loud population (related to the tail) and a radio-quiet population with mean shift near zero, and (2) C IV - a blueshifted radio-quiet population (related to the tail) and a radio-loud population with mean shift near zero. The results suggest fundamentally different kinematics for the HILs and LILs. They also suggest very different kinematics for radio-loud and radio-quiet active galactic nuclei. They also favor a predominance of radial motion in a large fraction of the sample.

The Arg389Gly beta1-adrenoceptor polymorphism does not affect cardiac effects of exercise after parasympathetic inhibition by atropine.

PubMed

Leineweber, Kirsten; Bruck, Heike; Temme, Thomas; Heusch, Gerd; Philipp, Thomas; Brodde, Otto-Erich

2006-01-01

In vitro, Arg389Gly beta1-adrenoceptor (AR) polymorphism exhibits decreased beta-AR signalling. In vivo, beta1-AR-mediated cardiac effects of exercise showed no genotype-dependent differences in Arg389 vs. Gly389 beta1-AR subjects. We studied in 16 male subjects homozygous Arg389 or Gly389 beta1-AR, whether blockade of parasympathetic activity might unmask genotype-dependence of exercise effects. Subjects were infused with atropine (10 microg/kg i.v. loading dose followed by continuous i.v. infusion of 0.15 microg/kg/min throughout exercise-time); 20 min after start of atropine bicycle-exercise in supine position (25, 50, 75 and 100 W for 5 min each) was performed and heart rate, contractility, blood pressure, plasma noradrenaline and plasma-renin activity were assessed. Exercise-evoked increases in all but one parameters were not different between Arg389 and Gly389 beta1-AR subjects; only plasma noradrenaline increased slightly more in Gly389 vs. Arg389 beta1-AR subjects. It appears to be unlikely that lack of Arg389Gly beta1-AR genotype-dependence of exercise-effects can be explained by influences of parasympathetic activity.

[Effects of Valeriana officinalis var. latifolia on expression of transforming growth factor beta 1 in hypercholesterolemic rats].

PubMed

Si, Xiao-yun; Jia, Ru-han; Huang, Cong-xin; Ding, Guo-hua; Liu, Hong-yan

2003-09-01

To evaluate the effect of Valeriana officinalis var latifolia(VOL) on expression of transforming growth factor beta 1 (TGF-beta 1) in hypercholesterolemic rats and study its possible mechanisms. Dietary-induced hypercholesterolemia was induced in male Wistar rats by given 4% cholesterol and 1% cholic acid diet for 16 weeks. Changes of serum lipid, urinary albumin, renal function and Mesangial matrix index were assessed. Moreover, immunohistochemical stain for TGF-beta 1 and type IV collagen were performed. VOL could reduce the serum levels of total cholesterol, low density lipoprotein, urinary albumin and serum creatinine. Light microscopy and immunohistochemical stain revealed that in the same time of lowing serum lipid, Mesangial matrix index was significantly reduced, accompanied by decreased expression of TGF-beta 1 and type IV collagen. VOL has the protective effect on lipid-induced nephropathy, and the inhibition of TGF-beta 1 expression might be the mechanism of VOL on renal protection.

Successful application of preimplantation genetic diagnosis for beta-thalassaemia and sickle cell anaemia in Italy.

PubMed

Chamayou, S; Alecci, C; Ragolia, C; Giambona, A; Siciliano, S; Maggio, A; Fichera, M; Guglielmino, A

2002-05-01

In Italy, the autosomal recessive diseases beta-thalassaemia and sickle cell anaemia are so widespread that in some regions they can be defined as 'social diseases'. In this study, nine clinical applications of preimplantation genetic diagnosis (PGD) were performed for beta-thalassaemia and sickle cell anaemia on seven Sicilian couples and carriers of beta-globin gene mutations. The studied mutations were: Cd39, HbS, IVS1 nt1, IVS1 nt6 and IVS1 nt110. ICSI was performed with partner's sperm on 131 out of 147 retrieved oocytes, and this resulted in 72 zygotes; 32 embryos were successfully biopsied on day 3. The biopsied blastomeres were lysed and the beta-globin alleles amplified by nested PCR. The mutation diagnosis was performed by restriction enzyme digestion and reverse dot-blot. The amplification efficacy was 97.2%. The genotype study of non-transferred and surplus embryos showed that the allele drop-out rate was 8.6%. Seventeen embryos were transferred in utero on day 4. All couples received an embryo transfer; of the four pregnancies obtained, three resulted in live births and one miscarried at 11 weeks. Prenatal diagnosis at the 11th week and miscarriage material analysis confirmed the PGD results. These studies represent the first successful application of PGD for beta-thalassaemia and sickle cell anaemia in Italy.

Beta- and gamma-dose measurements of the Godiva IV critical assembly.

PubMed

Hankins, D E

1984-03-01

To aid in the re-evaluation of an exposure that occurred in 1963, information was required on the response of film badges to the beta- and gamma-ray doses from a critical assembly. Of particular interest was the beta spectra from the assembly. The techniques used and the results obtained in this study are of interest to health physicists at facilities where exposures to betas occur. The dose rates from the Los Alamos National Laboratory Godiva IV Critical Assembly were measured at numerous distances from the assembly four and 12 days following a burst. Information was obtained on the beta-particle spectra using absorption curve studies. The beta/gamma dose-rate ratio as a function of distance from the assembly was determined. Shielding provided by various metals, gloves and clothing was measured. The beta- and gamma-ray doses measured were compared with a film packet used in the past at the Nevada Test Site with two types of current TLD personnel badges. Measurements made with a commercial thin-window ion chamber instrument are compared with the dose rates obtained using other dosimeters.

[Study on the chemical constituents of the leaves of Ipomoea batatas].

PubMed

Lv, Ling-Yuz; Shi, Gao-Feng; Li, Chun-Lei; Han, Xue-Zhe; Lv, Qiu-Nan

2009-06-01

To study the chemical constituents of the leaves of Ipomoea batatas. The constituents were isolated and purified by silica gel and TLC, and their structures were elucidated by spectroscopy. Six compounds were isolated from 90% ethanol extract and identified as tetracosane (I ), myristic acid (II), beta-sitosterol (II), beta-carotene (IV), daucosterol (V) and quercetin (VI). Compounds I, II, IV, V are isolated from this plant for the first time.

[Studies on chemical constituents of cultivated Cistanche salsa].

PubMed

Yang, Jian-Hu; Hu, Jun-Ping; Rena, Kasimu; Du, Nian-Sheng

2008-11-01

To study the chemical constituents of cultivated Cistanche salsa. Compounds were isolated and purified on several chromatography, and then were identified by physico-chemical properties and structurally elucidated by spectral analysis. Seven compounds were isolated and identified as beta-sitosterol (I), daucosterol (II), beta-sitosteryl glucoside 3'-O-heptadecoicate (III), 8-hydroxygeraniol 1-beta-D-glucopyranoside (IV), 2-methanol-5-hydroxy-pyridine (V), betaine (VI), galactitol (VII). The chemical constituents of artificial cultivated Cistanche salsa are studied for the first time. Among them, compound III and IV are isolated from the plant for the first time, compound V is isolated from this genus for the first time.

Discovery of DPP IV inhibitors by pharmacophore modeling and QSAR analysis followed by in silico screening.

PubMed

Al-Masri, Ihab M; Mohammad, Mohammad K; Taha, Mutasem O

2008-11-01

Dipeptidyl peptidase IV (DPP IV) deactivates the natural hypoglycemic incretin hormones. Inhibition of this enzyme should restore glucose homeostasis in diabetic patients making it an attractive target for the development of new antidiabetic drugs. With this in mind, the pharmacophoric space of DPP IV was explored using a set of 358 known inhibitors. Thereafter, genetic algorithm and multiple linear regression analysis were employed to select an optimal combination of pharmacophoric models and physicochemical descriptors that yield selfconsistent and predictive quantitative structure-activity relationships (QSAR) (r(2) (287)=0.74, F-statistic=44.5, r(2) (BS)=0.74, r(2) (LOO)=0.69, r(2) (PRESS) against 71 external testing inhibitors=0.51). Two orthogonal pharmacophores (of cross-correlation r(2)=0.23) emerged in the QSAR equation suggesting the existence of at least two distinct binding modes accessible to ligands within the DPP IV binding pocket. Docking experiments supported the binding modes suggested by QSAR/pharmacophore analyses. The validity of the QSAR equation and the associated pharmacophore models were established by the identification of new low-micromolar anti-DPP IV leads retrieved by in silico screening. One of our interesting potent anti-DPP IV hits is the fluoroquinolone gemifloxacin (IC(50)=1.12 muM). The fact that gemifloxacin was recently reported to potently inhibit the prodiabetic target glycogen synthase kinase 3beta (GSK-3beta) suggests that gemifloxacin is an excellent lead for the development of novel dual antidiabetic inhibitors against DPP IV and GSK-3beta.

The second Lilly Prize Lecture, University of Newcastle, July 1977. beta-Adrenergic receptor blockade in hypertension, past, present and future.

PubMed Central

Prichard, B N

1978-01-01

All beta-adrenoceptor blocking drugs that have been described share the common property of being competitive inhibitors. They differ in their associated properties, the presence or absence of cardioselectivity, membrane stabilizing activity, and partial agonist activity. Recently some beta-adrenoceptor blocking drugs have been reported which also possess alpha-adrenoceptor blocking activity. The associated properties have been used as a basis for classifying beta-adrenoceptor blocking drugs (Fitzgerald, 1969, 1972). The presence or absence of cardioselectivity is most useful for dividing beta-adrenoceptor blocking drugs. The non-selective drugs (Division I) can be further divided according to the presence or absence of intrinsic sympathomimetic activity (ISA) and membrane stabilizing activity (Fitzgerald's groups I-IV). Group I possess both membrane activity and ISA, e.g. alprenolol, oxprenolol, group II just membrane action, e.g. propanolol, group III ISA but no membrane action, e.g. pindolol. Fitzgerald placed pindolol in group I but should be placed in group III as it possesses a high degree of beta-adrenoceptor blocking potency in relation to its membrane activity (Prichard, 1974). Finally drugs in group IV have neither ISA nor membrane action, e.g. sotalol, timolol. The cardioselective drugs (Division II) can be similarly sub-divided into groups I-IV according to the presence or absence of ISA or membrane action (Fitzgerald grouped all these together as group V). Lastly there are new beta-adrenergic receptor blocking drugs which in addition have alpha- adrenergic receptor blocking properties (Division III). PMID:26370

Highly diastereoselective reductive coupling of 2-bromo-2,3,3,3-tetrafluoropropanamide with aldehydes promoted by triphenylphosphine-titanium(IV) isopropoxide. An efficient route to the synthesis of erythro-alpha-fluoro-alpha-(trifluoromethyl)-beta-hydroxy amides.

PubMed

Sato, Kei; Sekiguchi, Takashi; Ishihara, Takashi; Konno, Tsutomu; Yamanaka, Hiroki

2004-07-23

The reductive coupling reaction of N-methoxy-N-methyl-2-bromo-2,3,3,3-tetrafluoropropanamide (Weinreb amide) with various aldehydes under the influence of the combined reagent, 1.2 equiv each of triphenylphosphine and titanium(IV) isopropoxide, took place smoothly at ambient temperature to give the corresponding alpha-fluoro-alpha-(trifluoromethyl)-beta-hydroxy amides in a highly erythro-selective manner. The high erythro selectivity was also obtained even by employing a combination of triphenylphosphine (1.2 equiv) and a catalytic amount of titanium(IV) isopropoxide.

Hydroxyurea responses in clinically varied beta, HbE-beta thalassaemia and sickle cell anaemia patients of Eastern India.

PubMed

Chatterjee, Tridip; Chakravarty, Amit; Chakravarty, Sudipa

2018-05-01

The haematological and clinical response to hydroxyurea was estimated in HbE-beta, beta thalassaemia and sickle cell anaemia patients of Eastern India, with variable clinical severity and transfusion requirement to determine whether hydroxyurea can help these patients to maintain their steady haemoglobin level without blood transfusions. Three hundred patients (189 HbE-beta thalassaemia, 95 beta thalassaemia and 16 other haemoglobinopathies including sickle cell anaemia) were selected for hydroxyurea therapy and were followed up for 48-60 months. Results suggest significant response to hydroxyurea therapy in 19 beta and 99 HbE-beta patients in the transfusion-dependent group (GR-I). All of them became transfusion-independent while on hydroxyurea therapy. The majority of responding patients were IVS1-5(G-C) in one of their alleles in HbE-beta cases (83 out of 119). Though IVS1-5(G-C) was found to be the commonest mutation in our selected patients, the mutational background of the patients does not found to have any significant correlation with the response category towards hydroxyurea as per the results observed in our study. But, the drug works pretty well in most of the transfusion-dependent patients, as these patients were withdrawn from regular blood transfusion. At the same time, partial or no response to the drug hydroxyurea was also recorded in our study.

Beta-ketoacyl-acyl carrier protein synthase IV: a key enzyme for regulation of medium-chain fatty acid synthesis in Cuphea lanceolata seeds.

PubMed

Schütt, Burkhardt Siegfried; Abbadi, Amine; Loddenkötter, Brigitte; Brummel, Monika; Spener, Friedrich

2002-09-01

With the aim of elucidating the mechanisms involved in the biosynthesis of medium-chain fatty acids in Cuphea lanceolata Ait., a crop accumulating up to 90% decanoic acid in seed triacylglycerols, cDNA clones of a beta-ketoacyl-acyl carrier protein (ACP) synthase IV (clKAS IV, EC 2.3.1.41) were isolated from C. lanceolata seed embryos. The amino acid sequence deduced from clKAS IV cDNA showed 80% identity to other plant KAS II-type enzymes, 55% identity towards plant KAS I and over 90% towards other Cuphea KAS IV-type sequences. Recombinant clKAS IV was functionally overexpressed in Escherichia coli, and substrate specificity of purified enzyme showed strong preference for elongation of short-chain and medium-chain acyl-ACPs (C4- to C10-ACP) with nearly equal activity. Further elongation steps were catalysed with distinctly less activity. Moreover, short- and medium-chain acyl-ACPs exerted a chain-length-specific and concentration-dependent substrate inhibition of clKAS IV. Based on these findings a regulatory mechanism for medium-chain fatty acid synthesis in C. lanceolata is presented.

Mechanisms of blood pressure alterations in response to the Valsalva maneuver in postural tachycardia syndrome

NASA Technical Reports Server (NTRS)

Sandroni, P.; Novak, V.; Opfer-Gehrking, T. L.; Huck, C. A.; Low, P. A.

2000-01-01

The postural tachycardia syndrome (POTS) is characterized clinically by orthostatic lightheadedness and tachycardia. When these patients perform a Valsalva maneuver, there is an excessive blood pressure increment after cessation of the maneuver (phase IV) that is sometimes associated with headaches. It is not known whether excessive phase IV is due to excessive peripheral vascular tone (an alpha-adrenergic mechanism) or is a manifestation of increased beta-adrenergic tone (hyperadrenergic state). The authors undertook a pharmacologic study evaluating the effect of intravenous phentolamine (alpha-adrenergic antagonist) and propranolol (beta-adrenergic antagonist) on the different phases of the Valsalva maneuver in a group of patients with POTS and age-matched normal control subjects. Patients with POTS had mean phases, when compared with controls, that were characterized by more negative II_E (p = 0.07), smaller II_L (p = 0.04), and significantly larger phase IV (p = 0.001). The effect of phentolamine was qualitatively and quantitatively different in POTS when compared with controls. Ten mg phentolamine in controls resulted in a significant accentuation of phase II_E (p = 0.001), attenuation of phase II_L (p = 0.002), and increase of phase IV (57.6 vs 30.7 mm Hg; p = 0.025). These changes resembled those of patients with POTS at baseline. In patients with POTS, the phase II abnormalities, already present, were further accentuated (p <0.001), and phase IV became smaller (50.6 vs 73.8 mm Hg; p = 0.09). Propranolol had no significant effect on phases II_E and II_L, but significantly reduced phase IV in both controls (p <0.05) and in patients with POTS (p <0.001) and improved the headache symptoms, when present, during and after phase IV. The authors conclude that phase IV is mainly under beta-adrenergic regulation and that the exaggerated phase IV in POTS is a result of a hyperadrenergic state.

Effects of selenium on the structure and function of recombinant human S-adenosyl-L-methionine dependent arsenic (+3 oxidation state) methyltransferase in E. coli.

PubMed

Geng, Zhirong; Song, Xiaoli; Xing, Zhi; Geng, Jinlong; Zhang, Sichun; Zhang, Xinrong; Wang, Zhilin

2009-05-01

The effects of Se(IV) on the structure and function of recombinant human arsenic (+3 oxidation state) methyltransferase (AS3MT) purified from the cytoplasm of Escherichia coli were studied. The coding region of human AS3MT complementary DNA was amplified from total RNA extracted from HepG2 cell by reverse transcription PCR. Soluble and active human AS3MT was expressed in the E. coli with a Trx fusion tag under a lower induction temperature of 25 degrees C. Spectra (UV-vis, circular dichroism, and fluorescence) were first used to probe the interaction of Se(IV) and recombinant human AS3MT and the structure-function relationship of the enzyme. The recombinant human AS3MT had a secondary structure of 29.0% alpha-helix, 23.9% beta-pleated sheet, 17.9% beta-turn, and 29.2% random coil. When Se(IV) was added, the content of the alpha-helix did not change, but that of the beta-pleated sheet increased remarkably in the conformation of recombinant human AS3MT. Se(IV) inhibited the enzymatic methylation of inorganic As(III) in a concentration-dependent manner. The IC(50) value for Se(IV) was 2.38 muM. Double-reciprocal (1/V vs. 1/[inorganic As(III)]) plots showed Se(IV) to be a noncompetitive inhibitor of the methylation of inorganic As(III) by recombinant human AS3MT with a K (i) value of 2.61 muM. We hypothesized that Se(IV) interacts with the sulfhydryl group of cysteine(s) in the structural residues rather than the cysteines of the active site (Cys156 and Cys206). When Se(IV) was combined with cysteine(s) in the structural residues, the conformation of recombinant human AS3MT changed and the enzymatic activity decreased. Considering the quenching of tryptophan fluorescence, Cys72 and/or Cys226 are deduced to be primary targets for Se(IV).

Ineffectiveness of intravenous beta 2-agonists on improving exercise tolerance in patients with reversible chronic airway obstruction.

PubMed

Malerba, M; Boni, E; Tantucci, C; Filippi, B; Romagnoni, G; Grassi, V

1996-01-01

The effects on exercise tolerance after acute administration of beta 2-agonists were investigated in 11 patients with partly reversible chronic airway obstruction after 400 micrograms of salbutamol (S) given intravenously (i.v.) and after 400 micrograms i.v. of a new selective beta 2-agonist, broxaterol (B), by a cardiopulmonary incremental exercise test. At rest, while VE increased in respect to basal conditions (C) after S (from 13.3 +/- 2.2 to 14.4 +/- 2.8 l/min; p < 0.05) and after B (from 13.6 +/- 3.1 to 15.5 +/- 3.6 l/min; p < 0.05), VO2, VCO2 and VO2/HR showed no substantial variations. A small, not significant reduction of PaO2 was observed both after S (from 82.7 +/- 11.7 to 79.1 +/- 16.7 mm Hg) and B (from 81.6 +/- 10.5 to 78.0 +/- 11.0 mm Hg). The maximum workload increased neither after S (from 67.5 +/- 39.1 to 66.6 +/- 37.0 W) nor after B (from 65.7 +/- 39.3 to 60.0 +/- 35.8 W). At peak of exercise, VO2, VCO2 and VO2/HR did not change after S and B as compared with C, whereas VE remained higher after both beta 2-agonists throughout the effort. VO2 at ventilatory anaerobic threshold (AT) was significantly greater either after S (from 744 +/- 378 to 815 +/- 302 ml/min; p < 0.05) and after B (from 756 +/- 290 to 842 +/- 292 ml/min; p < 0.05). The PaO2 increase shown by these patients during effort was greater after beta 2-agonists administration, delta PaO2 from rest to peak of exercise amounting to 14.9 +/- 14.3 vs. 7.8 +/- 8.2 mm Hg after S and to 17.8 +/- 15.1 vs. 8.8 +/- 10.9 mm Hg after B, in respect to relative baseline (p < 0.05). We conclude that beta 2-agonists, when given acutely, do not improve exercise tolerance in patients with reversible chronic airflow obstruction, although these drugs can induce a small increment of ventilatory AT. In addition, arterial blood gases do not deteriorate at rest and are better preserved during exercise after beta 2-agonists.

Altered expression of extracellular matrix molecules and their receptors in chronic pancreatitis and pancreatic adenocarcinoma in comparison with normal pancreas.

PubMed

Shimoyama, S; Gansauge, F; Gansauge, S; Oohara, T; Beger, H G

1995-12-01

The aim of this study was to elucidate the expression and distribution patterns of both integrins and extracellular matrix (ECM) molecules in chronic pancreatitis (CP) and pancreatic adenocarcinoma (PC) compared with normal pancreas (NP). Expression of nine alpha-subunits (alpha 2-alpha 6, alpha V, alpha L, alpha M, and alpha X), four beta-subunits (beta 1, beta 3-beta 5), and four ECM molecules (type IV collagen, laminin, fibronectin, and vitronectin) was investigated immunohistochemically. In CP, all integrins except alpha V showed nearly the same staining patterns compared with NP. Some acinar cells in CP expressed alpha V. Whereas alpha 2, alpha 3, and alpha 6 expression was stronger and diffuse, no alpha 5 expression was seen in PC. Basement membrane (BM) showed continuous staining in CP, whereas it showed discontinuous/absent staining in PC with antitype IV collagen, laminin, and vitronectin antibodies. Some carcinoma cells showed reverse correlation between alpha 2, alpha 3, and alpha 6 expression and type IV collagen and laminin expression. Fibronectin showed diffuse stromal expression in CP and PC. Some acinar cells or duct cells in CP carcinoma cells in PC showed intracellular VN expression. These results suggest that these integrins and ECM molecules are involved in inflammatory and malignant processes in pancreas.

Hydriding process

DOEpatents

Raymond, J.W.; Taketani, H.

1973-12-01

BS>A method is described for hydriding a body of a Group IV-B metal, preferably zirconium, to produce a crack-free metal-hydride bedy of high hydrogen content by cooling the body at the beta to beta + delta boundary, without further addition of hydrogen, to precipitate a fine-grained delta-phase metal hydride in the beta + delta phase region and then resuming the hydriding, preferably preceded by a reheating step. (Official Gazette)

[Chemical constituents from leaves of Paulownia fortunei].

PubMed

Li, Xiao-Qiang; Wu, Jing-Lian; Cao, Fei-Hua; Li, Chong

2008-06-01

To study the chemical constituents of leaves of Paulownia fortunei (Seem.) Hemsl. The constituents were isolated by column chromatography and their structures were elucidated through spectroscopic analysis. The compounds were identified as mimulone (I), apigenin (II), luteolin (III), 2alpha, 3beta, 19beta-trihydroxyurs-28-O-beta-D-galactonopyranos ylester (anserinoside, IV), 3alpha-hydroxyl-ursolicacid (V), ursolicacid (VI), daucosterol (VII), beta-sitosterol (VIII). The compounds I - V are obtained from leaves of Paulownia fortunei (Seem.) Hemsl for the first time.

The interleukins-1 alpha, -1 beta, and -2 do not acutely disrupt the murine blood-brain barrier.

PubMed

Banks, W A; Kastin, A J

1992-05-01

Previous studies have suggested that some of the central nervous system (CNS) effects of interleukin-2 (IL-2) and perhaps other cytokines might be mediated through disruption of the blood-brain barrier (BBB). We investigated the ability of human IL-2 and, in selected studies, human IL-1 alpha and human IL-1 beta to disrupt the BBB to radioiodinated bovine serum albumin (RISA) after intravenous (i.v.) and intracerebroventricular (i.c.v.) injection. No disruption of the BBB occurred for up to 2 h after the i.v. injection of 2 micrograms/mouse of IL-2 (10(5) U/kg of body weight), 2 micrograms of IL-1 alpha (10(7) U/kg), or 2 micrograms of IL-1 beta (10(7) U/kg). This dose of i.v. IL-2 also did not affect BBB permeability to RISA in the brain to blood direction. Damage to the BBB induced by hypertension elicited by i.v. epinephrine was not enhanced or prolonged by IL-2. When given directly into the CNS by the i.c.v. route, 100 ng of IL-2 (2.2 x 10(5) U/kg of brain), 100 ng of IL-1 alpha (2.2 x 10(7) U/kg of brain), or 100 ng of IL-1 beta (2.2 x 10(7) U/kg of brain) had no effect on BBB integrity in either the blood to brain or the brain to blood direction. We conclude that the effects of IL-1 alpha, IL-1 beta, and IL-2 on the CNS, as studied under these conditions, are not due to disruption of the BBB but are mediated by other mechanisms including the ability of some interleukins to cross the BBB by a saturable transport system described previously.

Metabolism of boldenone in man: gas chromatographic/mass spectrometric identification of urinary excreted metabolites and determination of excretion rates.

PubMed

Schänzer, W; Donike, M

1992-01-01

Urinary metabolites of boldenone (androsta-1,4-dien-17 beta-ol-3-one) following oral administration of boldenone (doses from 11 to 80 mg) to man were isolated from urine via XAD-2 adsorption and enzymatic hydrolysis with beta-glucuronidase from Escherichia coli. The isolated metabolites were derivatized with N-methyl-N-trimethylsilyltri- fluoroacetamide/trimethyliodosilane and analysed by gas chromatography/mass spectrometry with electron impact (EI) ionization at 70 eV. Boldenone (I) and four metabolites were identified after hydrolysis of the urine with beta-glucuronidase: 5 beta-androst-1-en-17 beta-ol-3-one (II), 5 beta-androst-1-ene-3 alpha, 17 beta-diol (III), 5 beta-androst-1-en-3 alpha-ol-17-one (IV) and 5 beta-androst-1-en-6 beta-ol-3,17-dione (V). Five further metabolites in low concentration were identified without enzymatic hydrolysis after treatment of the urine with potassium carbonate: 5 beta-androst-1-ene-3,17-dione (VI), 5 alpha-androst-1-ene-3,17-dione (VII), androsta-1,4-diene-3,17-dione (VIII), androsta-1,4-diene-6 beta,17 beta-diol-3-one (IX) and androsta-1,4-dien-6 beta-ol-3,17-dione (X). The identification of the metabolites is based on the gas chromatography retention index, high-performance liquid chromatography retention, EI mass spectrum, chemical reactions of the isolated metabolites, and synthesis of metabolites II, III, IV, VI and VII. The EI mass spectra of the bis-trimethylsilyl derivatives of boldenone and its metabolites display all intense molecular ions, M-15 ions and fragment ions originating from cleavage of the B-ring. The excreted metabolites can be separated in basic extractable labile conjugates and in stable conjugates. More than 95% of metabolites are excreted as stable conjugates.

Medicinal flowers. XXVII. New flavanone and chalcone glycosides, arenariumosides I, II, III, and IV, and tumor necrosis factor-alpha inhibitors from everlasting, flowers of Helichrysum arenarium.

PubMed

Morikawa, Toshio; Wang, Li-Bo; Nakamura, Seikou; Ninomiya, Kiyofumi; Yokoyama, Eri; Matsuda, Hisashi; Muraoka, Osamu; Wu, Li-Jun; Yoshikawa, Masayuki

2009-04-01

The methanolic extract from the flowers of Helichrysum arenarium L. MOENCH was found to show inhibitory effect on tumor necrosis factor-alpha (TNF-alpha, 1 ng/ml)-induced cytotoxicity in L929 cells. From the methanolic extract, 50 constituents including four new flavanone and chalcone glycosides named arenariumosides I (1), II (2), III (3), and IV (4) were isolated. The stereostructures of 1-4 were elucidated on the basis of chemical and physicochemical evidence. Among the constituents, naringenin 7-O-beta-D-glucopyranoside (7), apigenin 7-O-beta-D-glucopyranoside (14), apigenin 7-O-gentiobioside (16), and apigenin 7,4'-di-O-beta-D-glucopyranoside (17) significantly inhibited TNF-alpha-induced cytotoxicity in L929 cells at 30 microM.

Anomalous H-beta Variability in the 2014 NGC 5548 AGN-STORM Monitoring Campaign

NASA Astrophysics Data System (ADS)

Pei, Liuyi; AGN STORM Collaboration

2016-06-01

Reverberation mapping programs generally find that the continuum and H-beta flux variations in AGNs are well correlated. In the 2014 AGN STORM monitoring program for NGC 5548, we observed a distinct decorrelation of the emission-line light curves from the AGN continuum light curve during the second half of the six-month campaign. This effect was first detected for the C IV, Ly a, HeII 1640 and SiIV/OIV] 1400 lines in Hubble Space Telescope data, then observed for the H-beta line in ground-based data taken during the same monitoring period. We present measurements of the H-beta lags, equivalent width variations, and line responsivity changes during our campaign. We show that the AGN demonstrated unusual behavior in that the broad H-beta responsivity to flux variations decreased significantly during the second half of the campaign. The discovery of this decorrelation phenomenon was made possible by the high cadence and long duration of our monitoring campaign. More multi-wavelength observing campaigns with high sampling cadence, high signal-to-noise ratio, and long temporal baseline are needed for other AGNs in order to determine the prevalence of this phenomenon and to understand its physical origin.

CMS-G from Beta vulgaris ssp. maritima is maintained in natural populations despite containing an atypical cytochrome c oxidase.

PubMed

Meyer, Etienne H; Lehmann, Caroline; Boivin, Stéphane; Brings, Lea; De Cauwer, Isabelle; Bock, Ralph; Kühn, Kristina; Touzet, Pascal

2018-02-23

While mitochondrial mutants of the respiratory machinery are rare and often lethal, cytoplasmic male sterility (CMS), a mitochondrially inherited trait that results in pollen abortion, is frequently encountered in wild populations. It generates a breeding system called gynodioecy. In Beta vulgaris ssp. maritima , a gynodioecious species, we found CMS-G to be widespread across the distribution range of the species. Despite the sequencing of the mitochondrial genome of CMS-G, the mitochondrial sterilizing factor causing CMS-G is still unknown. By characterizing biochemically CMS-G, we found that the expression of several mitochondrial proteins is altered in CMS-G plants. In particular, Cox1, a core subunit of the cytochrome c oxidase (complex IV), is larger but can still assemble into complex IV. However, the CMS-G-specific complex IV was only detected as a stabilized dimer. We did not observe any alteration of the affinity of complex IV for cytochrome c ; however, in CMS-G, complex IV capacity is reduced. Our results show that CMS-G is maintained in many natural populations despite being associated with an atypical complex IV. We suggest that the modified complex IV could incur the associated cost predicted by theoretical models to maintain gynodioecy in wild populations. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Are [O-methyl-11C]derivatives of ICI 89,406 beta1-adrenoceptor selective radioligands suitable for PET?

PubMed

Law, Marilyn P; Wagner, Stefan; Kopka, Klaus; Pike, Victor W; Schober, Otmar; Schäfers, Michael

2008-01-01

Radioligand binding studies show that beta(1)-adrenoceptor (beta(1)-AR) density may be reduced in heart disease without down regulation of beta(2)-ARs. Radioligands are available for measuring total beta-AR density non-invasively with clinical positron emission tomography (PET) but none are selective for beta(1)- or beta(2)-ARs. The aim was to evaluate ICI 89,406, a beta(1)-AR-selective antagonist amenable to labelling with positron emitters, for PET. The S-enantiomer of an [O-methyl-(11)C] derivative of ICI 89,406 ((S)-[(11)C]ICI-OMe) was synthesised. Tissue radioactivity after i.v. injection of (S)-[(11)C]ICI-OMe (< 2 nmol x kg(-1)) into adult Wistar rats was assessed by small animal PET and post mortem dissection. Metabolism was assessed by HPLC of extracts prepared from plasma and tissues and by measuring [(11)C]CO(2) in exhaled air. The heart was visualised by PET after injection of (S)-[(11)C]ICI-OMe but neither unlabelled (S)-ICI-OMe nor propranolol (non-selective beta-AR antagonist) injected 15 min after (S)-[(11)C]ICI-OMe affected myocardial radioactivity. Ex vivo dissection showed that injecting unlabelled (S)-ICI-OMe, propranolol or CGP 20712A (beta(1)-selective AR antagonist) at high dose (> 2 mumol x kg(-1)) before (S)-[(11)C]ICI-OMe had a small effect on myocardial radioactivity. HPLC demonstrated that radioactivity in myocardium was due to unmetabolised (S)-[(11)C]ICI-OMe although (11)C-labelled metabolites rapidly appeared in plasma and liver and [(11)C]CO(2) was detected in exhaled air. Myocardial uptake of (S)-[(11)C]ICI-OMe after i.v. injection was low, possibly due to rapid metabolism in other tissues. Injection of unlabelled ligand or beta-AR antagonists had little effect indicating that binding was mainly to non-specific myocardial sites, thus precluding the use of (S)-[(11)C]ICI-OMe to assess beta(1)-ARs with PET.

Successful implementation of perioperative beta-blockade utilizing a multidisciplinary approach.

PubMed

Armanious, Samuel; Wong, David T; Etchells, Edward; Higgins, Patrick; Chung, Frances

2003-02-01

To describe how we implemented a protocol for perioperative beta-blockade in patients with or at risk of coronary artery disease (CAD) undergoing major non-cardiac surgery and to present our results. After institutional approval, from May 1999 to April 2001, patients with surgical and medical indications (CAD as indicated by previous myocardial infarction, typical angina or atypical angina with a positive stress test or at least two risk factors for CAD: age 65 yr, hypertension, smoking, high cholesterol, diabetes mellitus) for perioperative beta-blockade were identified preoperatively by anesthesiology and referred to the General Internal Medicine Service (MED). MED initiated patients on outpatient beta-blockers. The intraoperative anesthetic management was left to the discretion of the anesthesiologist. In the postanesthesia care unit (PACU), patients received iv metoprolol according to hemodynamic criteria. Postoperatively, patients were followed by MED for adverse cardiac events. Sixty-nine patients received perioperative beta-blockade. Preoperatively, 60% were started on metoprolol, 39% on atenolol and 1% on propranolol. In PACU, 42%, 9% and 38% of patients were given iv metoprolol 0, 5 and 10 mg respectively. One patient was given glycopyrrolate in the PACU for bradycardia and none received vasoactive or inotropic agents. Three patients (4.3%) had postoperative cardiac events. With close collaboration between anesthesiologists, internists, PACU nurses and family physicians, a strategy for perioperative beta-blockade was implemented successfully in patients with cardiac risks. Beta-blockade was associated with few side effects and morbidities.

Peri-OVLT E-series prostaglandins and core temperature do not increase after intravenous IL-1beta in pregnant rats.

PubMed

Fewell, James E; Eliason, Heather L; Auer, Roland N

2002-08-01

Rats have an attenuated febrile response to endogenous pyrogen near the term of pregnancy. Given the fundamental role of E-series prostaglandins (PGEs) in mediating the febrile response to blood-borne endogenous pyrogen, the present experiments were carried out to determine whether PGEs increase in the area surrounding the organum vasculosum laminae terminalis (peri-OVLT) of near-term pregnant (P) rats as in nonpregnant (NP) rats after intravenous (iv) administration of recombinant rat interleukin-1beta (rrIL-1beta). Core temperature was measured by telemetry and peri-OVLT interstitial fluid was sampled in 12 NP and 12 P chronically instrumented, Sprague-Dawley rats by microdialysis for determination of total PGEs by radioimmunoassay. Basal core temperatures were higher in NP compared with P rats (NP 37.9 degrees C +/- 0.5, P 36.9 degrees C +/- 0.4; P < 0.05), but basal peri-OVLT PGEs were similar in both groups (NP 260 +/- 153 pg/ml, P 278 +/- 177 pg/ml; P =not significant). Intravenous administration of rrIL-1beta to NP rats produced a significant increase in core temperature with a latency, magnitude, and duration of 10 min, 0.87 degrees C, and at least 170 min, respectively; peri-OVLT PGEs were increased significantly by 30 min and averaged 270% above basal levels throughout the experiment. In P rats, however, neither core temperature nor peri-OVLT PGEs increased significantly after iv administration of rrIL-1beta. Intravenous administration of vehicle did not significantly alter core temperature or peri-OVLT PGEs in either group of rats. Thus peri-OVLT PGEs do not increase in P rats as they do in NP rats after iv administration of rrIL-1beta. The mechanism of this interesting component of the maternal adaptation to pregnancy, which likely plays a major role in mediating the attenuated febrile response to endogenous pyrogen near the term of pregnancy, warrants further investigation.

Blockade of beta-adrenoceptors enhances cAMP signal transduction in vivo

NASA Technical Reports Server (NTRS)

Whalen, E. J.; Johnson, A. K.; Lewis, S. J.

1998-01-01

The aim of this study was to determine whether the blockade of beta-adrenoceptors would enhance cAMP-mediated signal transduction processes in vivo. The administration of the membrane permeable cAMP analogue, 8-(4-chlorophenylthiol)-cAMP (8-CPT-cAMP, 10 micromol/kg, i.v.) produced an increase in heart rate (+27 +/- 2%, P < 0.05), a fall in mean arterial blood pressure (-21 +/- 3%, P < 0.05) and falls in hindquarter (-12 +/- 3%, P < 0.05) and mesenteric (-32 +/- 3%, P < 0.05) vascular resistances in pentobarbital-anesthetized rats. The beta-adrenoceptor antagonist, propranolol (1 mg/kg, i.v.) lowered heart rate (-12 +/- 3%, P < 0.05) but did not affect mean arterial blood pressure or vascular resistances. The tachycardia, hypotension and vasodilation produced by 8-CPT-cAMP were exaggerated after administration of propranolol (P < 0.05 for all comparisons). The nitric oxide-donor, sodium nitroprusside (2 microg/kg, i.v.), produced falls in mean arterial blood pressure and vascular resistances of similar magnitude to those produced by 8-CPT-cAMP. These sodium nitroprusside-induced responses were unaffected by propranolol (P < 0.05 for all comparisons). Sodium nitroprusside also produced a minor increase in heart rate (+5 +/- 1%, P < 0.05) which was abolished by propranolol. These findings suggest that 8-CPT-cAMP directly increases heart rate and that blockade of beta-adrenoceptors enhances the potency of cAMP within the heart and vasculature.

Pharmacokinetics of diclofenac and its interaction with enrofloxacin in sheep.

PubMed

Rahal, Anu; Kumar, Amit; Ahmad, A H; Malik, J K

2008-06-01

The pharmacokinetics of diclofenac was investigated in sheep given diclofenac alone (1mgkg(-1), i.v. or i.m.) and in combination with enrofloxacin (5mgkg(-1), i.v.). The plasma concentration-time data following i.v. administration of diclofenac was best described by a two compartment open pharmacokinetic model. The elimination half-life (t(1/2beta)), area under concentration-time-curve (AUC), volume of distribution (Vd(area)), mean residence time (MRT) and total body clearance (Cl(B)) were 1.03+/-0.18h, 12.17+/-1.98microg h ml(-1), 0.14+/-0.02Lkg(-1), 1.36+/-0.16h and 0.10+/-0.02Lkg(-1)h(-1), respectively. Following i.m. administration of diclofenac alone and in conjunction with enrofloxacin, the plasma concentration-time data best fitted to a one compartment open model. The t(1/2beta), AUC, Vd(area), MRT and Cl(B) were 1.33+/-0.10h, 7.32+/-1.01microg h mL(-1), 0.13+/-0.01Lkg(-1) and 0.07+/-0.01Lkg(-1)h(-1), respectively. Co-administration of enrofloxacin did not affect Vd(area) and MRT but absorption rate constant (K(a)), beta, t1/2Ka, t1/2beta, AUC, AUMC, Cl(B) and bioavailability (F) were significantly increased. This may be due to direct inhibition of cytochrome P(450) isozymes by enrofloxacin. A dose of 1.4mgkg(-1) of diclofenac administered every 6h may be appropriate for use in sheep.

Effects of nitric oxide synthase inhibition on sympathetically-mediated tachycardia

NASA Technical Reports Server (NTRS)

Whalen, E. J.; Johnson, A. K.; Lewis, S. J.

1999-01-01

The aim of the present study was to determine whether inhibition of nitric oxide (NO) synthesis directly alters the tachycardia produced by sympathetically-derived norepinephrine. The NO synthase inhibitor, N(G)-nitro-L-arginine methyl ester (L-NAME; 50 micromol/kg, i.v.), produced a marked rise in mean arterial blood pressure. This pressor response was associated with a fall in heart rate which involved the withdrawal of cardiac sympathetic nerve activity. The NO-donor, sodium nitroprusside (5 microg/kg, i.v.), produced a pronounced fall in mean arterial blood pressure but only a minor increase in heart rate. The beta-adrenoceptor agonist, isoproterenol (0.5 micromol/kg, i.v.), and the membrane-permeable cAMP analogue, 8-(4-chlorophenylthiol)-cAMP (10 micromol/kg, i.v.), produced falls in mean arterial blood pressure and pronounced increases in heart rate. The indirectly acting sympathomimetic agent, tyramine (0.5 mg/kg, i.v.), produced a pressor response and a tachycardia. The effects of sodium nitroprusside, tyramine, isoproterenol and 8-(4-chlorophenylthiol)-cAMP on mean arterial blood pressure were not markedly affected by L-NAME. However, the tachycardia produced by these agents was considerably exaggerated in the presence of this NO synthesis inhibitor. These findings suggest that L-NAME potentiates the tachycardia produced by sympathetically-derived norepinephrine. The increased responsiveness to norepinephrine may involve (i) a rapid up-regulation of cardiac beta1-adrenoceptors and cAMP signaling in cardiac pacemaker cells due to the loss of the inhibitory influence of cardiac NO, and (ii) the up-regulation of beta1-adrenoceptor-mediated signal transduction processes in response to the L-NAME-induced withdrawal of cardiac sympathetic nerve activity.

[Fat soluble constituents of the leaves of Vaccinium bracteatum Thunb].

PubMed

Tu, P; Liu, J; Li, J

1997-07-01

Four compounds were isolated from the fat soluble fraction of the leaves of Vaccinium bracteatum and identified as friedelin (I), epifriedelinol (II), beta-sitosterol(III) and ursolic acid(IV) by IR, NMR and MS. Compound III and IV are isolated from the leaves of this plant for the first time.

Structure Expression and Function of kynurenine Aminotransferases in Human and Rodent Brains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Q Han; T Cai; D Tagle

Kynurenine aminotransferases (KATs) catalyze the synthesis of kynurenic acid (KYNA), an endogenous antagonist of N-methyl-D: -aspartate and alpha 7-nicotinic acetylcholine receptors. Abnormal KYNA levels in human brains are implicated in the pathophysiology of schizophrenia, Alzheimer's disease, and other neurological disorders. Four KATs have been reported in mammalian brains, KAT I/glutamine transaminase K/cysteine conjugate beta-lyase 1, KAT II/aminoadipate aminotransferase, KAT III/cysteine conjugate beta-lyase 2, and KAT IV/glutamic-oxaloacetic transaminase 2/mitochondrial aspartate aminotransferase. KAT II has a striking tertiary structure in N-terminal part and forms a new subgroup in fold type I aminotransferases, which has been classified as subgroup Iepsilon. Knowledge regarding KATsmore » is vast and complex; therefore, this review is focused on recent important progress of their gene characterization, physiological and biochemical function, and structural properties. The biochemical differences of four KATs, specific enzyme activity assays, and the structural insights into the mechanism of catalysis and inhibition of these enzymes are discussed.« less

Discovery of an imidazopyridine-containing 1,4-benzodiazepine nonpeptide vitronectin receptor (alpha v beta 3) antagonist with efficacy in a restenosis model.

PubMed

Keenan, R M; Lago, M A; Miller, W H; Ali, F E; Cousins, R D; Hall, L B; Hwang, S M; Jakas, D R; Kwon, C; Louden, C; Nguyen, T T; Ohlstein, E H; Rieman, D J; Ross, S T; Samanen, J M; Smith, B R; Stadel, J; Takata, D T; Vickery, L; Yuan, C C; Yue, T L

1998-11-17

In the 3-oxo-1,4-benzodiazepine-2-acetic acid series of vitronectin receptor (alpha v beta 3) antagonists, a compound containing an imidazopyridine arginine mimetic was discovered which had sufficient potency and i.v. pharmacokinetics for demonstration of efficacy in a rat restenosis model.

Antibronchospastic activity of MEN10,627, a novel tachykinin NK2 receptor antagonist, in guinea-pig airways.

PubMed

Perretti, F; Ballati, L; Manzini, S; Maggi, C A; Evangelista, S

1995-01-24

The antibronchospastic activity against acetylcholine, antigen, histamine plus platelet-activating factor (PAF) or the selective tachykinin neurokinin (NK)1 and NK2 receptor agonists of the novel tachykinin NK2 receptor antagonist, MEN10,627 (cyclo(Met-Asp-Trp-Phe-Dap-Leu)cyclo(2 beta-5 beta)), was studied in anesthetized guinea-pigs. MEN10,627 (30-100 nmol/kg i.v.) reduced in a dose-dependent manner the bronchospasm induced by the tachykinin NK2 receptor agonist [beta Ala8]neurokinin A-(4-10) and the effect of the highest dose lasted up to 5 h from its administration. Conversely, airway constriction induced by the NK1 receptor agonist [Sar9]substance P sulfone or acetylcholine was unaffected by MEN10,627 up to a dose of 3 mumol/kg i.v. In animals sensitized with ovalbumin and pretreated with the endopeptidase inhibitor phosphoramidon, the aerosolized antigen produced a bronchospasm which was inhibited by MEN10,627 (30-100 nmol/kg i.v.) but not by the tachykinin NK1 receptor antagonist, (+/-)-CP96,345 ([2R,3R-cis- and [2S,3S)-cis-2-(diphenylmethyl)-N-[(2-methoxyphenyl)-methyl]-1- azabicyclo[2.2.2]octan-3-amine]) (3 mumol/kg i.v.). Both MEN10,627 (30-100 nmol/kg i.v.) and (+/-)-CP96,345 (30-300 nmol/kg i.v.) reduced the PAF-induced hyperresponsiveness to histamine, without affecting the hypotension induced by PAF or the bronchospasm induced by histamine in guinea-pigs not exposed to PAF, showing the involvement of both tachykinin NK1 and NK2 receptors in this model. In summary, MEN10,627 behaves as a potent, selective and long-lasting tachykinin NK2 receptor antagonist in vivo. Further, tachykinin NK2 receptors could be activated during allergic responses and in the development of airway hyperresponsiveness.

Two new triterpene saponins from the anti-inflammatory saponin fraction of Ilex pubescens root.

PubMed

Wang, Jing-Rong; Zhou, Hua; Jiang, Zhi-Hong; Liu, Liang

2008-07-01

The saponin fraction from the ethanolic extracts of the root of Ilex pubescens Hook. et Arn. (Ilexaceae) was found to exhibit potent anti-inflammatory effects on carrageenan-induced paw edema in rats. Two novel triterpene saponins, pubescenosides C and D (1 and 2, resp.), together with five known saponins were isolated from this saponin fraction. The structures of 1 and 2 were elucidated as (20beta)-3-O-[beta-D-glucopyranosyl-(1-->2)-beta-D-xylopyranosyl]ursa-12,18-dien-28-oic acid 28-O-beta-D-glucopyranosyl ester, and (20beta)-3-O-[alpha-L-rhamnopyranosyl-(1-->2)-beta-D-glucopyranosyl-(1-->2)-beta-D-xylopyranosyl]ursa- 12,18-dien-28-oic acid 28-O-beta-D-glucopyranosyl ester, respectively, on the basis of chemical and spectroscopic data. Five known saponins isolated from the saponin fraction were identified as ilexsaponin B(1), B(2), B(3), A(1), and chikusetsusaponin IV(a).

[Studies on chemical constituents of the seeds of Allium cepa].

PubMed

Yuan, Ling; Ji, Teng-Fei; Wang, Ai-Guo; Yang, Jian-Bo; Su, Ya-Lun

2008-02-01

To study the chemical constituents from the seeds of Allium cepa L., the constituents of the seeds of Allium cepa L. To isolate and purify by silica gel, macroporous resin HP-20, Sephadex LH-20, RP-18 column. Seven compounds were isolated from the EtOH extract of the seeds of Allium cepa., their structures were elucidated by physico-chemical properties and spectroscopic analysis as tianshic acid (I), N-trans-feruloyl tyramine (II), beta-sitosterol-3 beta-glucopyranoside-6'-palmitate (III), sitosterol (IV), daucosterol (V), tryptophane (VI), adenine riboside (VI). Compounds V-VIII are obtained from this plant for the first time, compounds I-IV are isolated from the genus Allium for the first time.

Ameliorating effect of anti-Alzheimer's drugs on the bidirectional association between type 2 diabetes mellitus and Alzheimer's disease.

PubMed

Ahmed, Amira S; Elgharabawy, Rehab M; Al-Najjar, Amal H

2017-07-01

Mild to severe forms of nervous system damage were exhibited by approximately 60-70% of diabetics. It is important to understand the association between type 2 diabetes mellitus and Alzheimer's disease. The aim of the present work is to understand the bidirectional association between type 2 diabetes and Alzheimer's disease pathogenesis, that was monitored by glycaemic status, lipid profile, amyloid beta 40 and 42 (Aβ40 and Aβ42), C-reactive protein, total creatine kinase, total lactate dehydrogenase, D-dimer and magnesium measurements, to assess the association between theses biochemical markers and each other, to estimate the possibility of utilizing the amyloid beta as biochemical marker of T2D in Alzheimer's patients, and to evaluate the effect of piracetam and memantine drugs on diabetes mellitus. This study involved 120 subjects divided into 20 healthy control (group I), 20 diabetic patients (group II), 20 Alzheimer's patients (group III), 20 diabetic Alzheimer's patients with symptomatic treatment (group IV), 20 diabetic Alzheimer's patients treated with memantine (group V), and 20 diabetic Alzheimer's patients treated with piracetam (group VI). The demographic characteristics, diabetic index, and lipid profile were monitored. Plasma amyloid beta 40 and amyloid beta 42, C-reactive protein, total creatine kinase, total lactate dehydrogenase, D-dimer, and magnesium were assayed. The levels of amyloid beta 40 and amyloid beta 42 were significantly elevated in diabetic Alzheimer's patients with symptomatic treatment (group IV) compared to group II (by 50.5 and 7.5 fold, respectively) and group III (by 25.4 and 2.8 fold, respectively). In groups II, III, IV, V and VI, significant and positive associations were monitored between insulin and amyloid beta 40, amyloid beta 42, C-reactive protein, total creatine kinase, and D-dimer. Diabetic markers were significantly decreased in diabetic Alzheimer's patients treated with anti-Alzheimer's drugs (especially piracetam) compared to group IV. This study reveals the role of amyloid beta 40, amyloid beta 42, insulin, HbA1c, lipid profile disturbance, C-reactive protein, D-dimer, and magnesium in the bidirectional correlation between T2D and pathogenesis of Alzheimer's disease, that is powered by their correlations, and therefore the possibility of utilizing Aβ as a biochemical marker of T2D in Alzheimer's patients is recommended. Impact statement Several aspects associated with T2D that contribute to AD and vice versa were investigated in this study. Additionally, this work reveals the role of Aβ40, Aβ42, insulin, HbA1c, lipid profile disturbance, CRP, D-dimer, and magnesium in the bidirectional association between T2D and the pathogenesis of AD, that is powered by their correlations, and therefore the possibility of utilizing Aβ as a biochemical marker of T2D in Alzheimer's patients is recommended. Furthermore, the ameloriating effect of anti-Alzheimer's drugs on diabetes mellitus confirms this association. Hereafter, a new approach for treating insulin resistance and diabetes may be developed by new therapeutic potentials such as neutralization of Aβ by anti-Aβ antibodies.

Specific amino acid residues in the beta sliding clamp establish a DNA polymerase usage hierarchy in Escherichia coli.

PubMed

Sutton, Mark D; Duzen, Jill M

2006-03-07

Escherichia coli dnaN159 strains encode a mutant form of the beta sliding clamp (beta159), causing them to display altered DNA polymerase (pol) usage. In order to better understand mechanisms of pol selection/switching in E. coli, we have further characterized pol usage in the dnaN159 strain. The dnaN159 allele contains two amino acid substitutions: G66E (glycine-66 to glutamic acid) and G174A (glycine-174 to alanine). Our results indicated that the G174A substitution impaired interaction of the beta clamp with the alpha catalytic subunit of pol III. In light of this finding, we designed two additional dnaN alleles. One of these dnaN alleles contained a G174A substitution (beta-G174A), while the other contained D173A, G174A and H175A substitutions (beta-173-175). Examination of strains bearing these different dnaN alleles indicated that each conferred a distinct UV sensitive phenotype that was dependent upon a unique combination of Delta polB (pol II), Delta dinB (pol IV) and/or Delta umuDC (pol V) alleles. Taken together, these findings indicate that mutations in the beta clamp differentially affect the functions of these three pols, and suggest that pol II, pol IV and pol V are capable of influencing each others' abilities to gain access to the replication fork. These findings are discussed in terms of a model whereby amino acid residues in the vicinity of those mutated in beta159 (G66 and G174) help to define a DNA polymerase usage hierarchy in E. coli following UV irradiation.

Role of 17 beta-estradiol on type IV collagen fibers volumetric density in the basement membrane of bladder wall.

PubMed

de Fraga, Rogerio; Dambros, Miriam; Miyaoka, Ricardo; Riccetto, Cássio Luís Zanettini; Palma, Paulo César Rodrigues

2007-10-01

The authors quantified the type IV collagen fibers volumetric density in the basement membrane of bladder wall of ovariectomized rats with and without estradiol replacement. This study was conducted on 40 Wistar rats (3 months old) randomly divided in 4 groups: group 1, remained intact (control); group 2, submitted to bilateral oophorectomy and daily replacement 4 weeks later of 17 beta-estradiol for 12 weeks; group 3, sham operated and daily replacement 4 weeks later of sesame oil for 12 weeks; and group 4, submitted to bilateral oophorectomy and killed after 12 weeks. It was used in immunohistochemistry evaluation using type IV collagen polyclonal antibody to stain the fibers on paraffin rat bladder sections. The M-42 stereological grid system was used to analyze the fibers. Ovariectomy had an increase effect on the volumetric density of the type IV collagen fibers in the basement membrane of rat bladder wall. Estradiol replacement in castrated animals demonstrated a significative difference in the stereological parameters when compared to the castrated group without hormonal replacement. Surgical castration performed on rats induced an increasing volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall and the estradiol treatment had a significant effect in keeping a low volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall.

Differences in beta-cell function and insulin secretion in Black vs. White obese adolescents: Do incretin hormones play a role?

USDA-ARS?s Scientific Manuscript database

Black youth are at higher risk for type 2 diabetes (T2D) than their White peers. Previously we demonstrated that for the same degree of insulin sensitivity, Black youth have an upregulated beta-cell function and insulin hypersecretion, in response to intravenous (IV) glucose, compared with Whites. T...

Treating Self-Injection Phobia in Patients Prescribed Injectable Medications: A Case Example Illustrating a Six-Session Treatment Model

ERIC Educational Resources Information Center

Cox, Darcy; Mohr, David C.; Epstein, Lucy

2004-01-01

This article provides a case description of a patient with multiple sclerosis prescribed interferon beta-1a (IFN[beta]-1a), a weekly intramuscular injection, who met "DSM-IV" criteria for specific phobia, blood/injection type. This patient successfully completed a 6-week manualized cognitive-behavioral treatment for self-injection anxiety. Issues…

Electrochemical and optical study of carotenoids in TX 100 micelles: Electron transfer and a large blue shift

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Z.; Kispert, L.D.

1999-10-21

The first oxidation waves of 8{prime}-apo-{beta}-caroten-8{prime}-al (I) and 8{prime}-apo-{beta}-caroten-8{prime}nitrile (II) in TX100 micelles are clearly observed in their cyclic voltammograms (CVs). The CV of {beta}-carotene (III) in TX100 micelles shows that III is not oxidized. It is proposed that the hydrophobic barrier of the micelle is an important reason for the failure to oxidize III, which is totally located in the hydrophobic center of the micelle. The oxidation of I and II demonstrates that electrons can be transferred through the terminal groups over a distance of ca. 22 {angstrom}. An unusually large blue band shift (100 nm, relative to thatmore » in CH{sub 2}Cl{sub 2}) is observed in the optical absorption spectrum of 7{prime}-apo-7{prime},7{prime}-dicyano-{beta}-carotene (IV) in TX100 micelles. This phenomenon is not observed in the absorption spectra of other studied carotenoids. A change in the ground-state electronic structure of IV, due to the influence of water near the terminal dicyanomethylidene group, is proposed to be the major reason for this large band shift.« less

Psychomotor stimulant effects of beta-phenylethylamine in monkeys treated with MAO-B inhibitors.

PubMed

Bergman, J; Yasar, S; Winger, G

2001-12-01

Sufficiently high doses of beta-phenylethylamine (beta-PEA), a trace amine that is rapidly metabolized by monoamine oxidase-type B (MAO-B), can produce effects comparable to those of cocaine or methamphetamine (MA). The present experiments were conducted to study how the discriminative-stimulus (S(D)) and reinforcing-stimulus (S(R)) effects of beta-PEA in monkeys are modified by treatment with inhibitors of MAO-B [R-(-)-deprenyl and MDL 72974]. In studies of its S(D) effects, doses of beta-PEA up to 30 mg/kg engendered only sporadic responding on the drug-associated lever in squirrel monkeys that discriminated intramuscular injections of 0.3 mg/kg MA from vehicle whereas lower doses of 0.3-1.0 mg/kg beta-PEA produced full substitution when administered after either R-(-)-deprenyl or MDL 72974 (0.3 mg/kg). The MA-like S(D) effects of beta-PEA were attenuated by either dopamine D(1) or D(2) receptor blockers. In studies of its S(R) effects, high doses of beta-PEA maintained responding in two of three monkeys under a second-order fixed-interval schedule (3.0 or 10 mg/kg per injection) and two of three monkeys under a simple fixed ratio (FR) schedule (0.3-1.0 mg/kg per injection) of intravenous (i.v.) self-administration. MAO-B inhibition by R-(-)-deprenyl or MDL 72974 enhanced the S(R) effects of beta-PEA in all monkeys and, under the FR schedule, induced a 30-fold or greater leftward shift in the dose-response function for its i.v. self-administration. Based on time-course determinations, the enhanced S(R) effects of beta-PEA under the FR schedule were long-lasting and dissipated gradually over 3-7 days. These results show that inhibition of MAO-B enhances S(D) and S(R) effects of beta-PEA in monkeys, presumably by delaying its inactivation. MAO-B inhibition leading to increased levels of beta-PEA may be useful, alone or in combination with other therapeutic agents, in the pharmacological management of selected aspects of drug dependence.

Non-redundant roles of phosphoinositide 3-kinase isoforms alpha and beta in glycoprotein VI-induced platelet signaling and thrombus formation.

PubMed

Gilio, Karen; Munnix, Imke C A; Mangin, Pierre; Cosemans, Judith M E M; Feijge, Marion A H; van der Meijden, Paola E J; Olieslagers, Servé; Chrzanowska-Wodnicka, Magdalena B; Lillian, Rivka; Schoenwaelder, Simone; Koyasu, Shigeo; Sage, Stewart O; Jackson, Shaun P; Heemskerk, Johan W M

2009-12-04

Platelets are activated by adhesion to vascular collagen via the immunoglobulin receptor, glycoprotein VI (GPVI). This causes potent signaling toward activation of phospholipase Cgamma2, which bears similarity to the signaling pathway evoked by T- and B-cell receptors. Phosphoinositide 3-kinase (PI3K) plays an important role in collagen-induced platelet activation, because this activity modulates the autocrine effects of secreted ADP. Here, we identified the PI3K isoforms directly downstream of GPVI in human and mouse platelets and determined their role in GPVI-dependent thrombus formation. The targeting of platelet PI3Kalpha or -beta strongly and selectively suppressed GPVI-induced Ca(2+) mobilization and inositol 1,4,5-triphosphate production, thus demonstrating enhancement of phospholipase Cgamma2 by PI3Kalpha/beta. That PI3Kalpha and -beta have a non-redundant function in GPVI-induced platelet activation and thrombus formation was concluded from measurements of: (i) serine phosphorylation of Akt, (ii) dense granule secretion, (iii) intracellular Ca(2+) increases and surface expression of phosphatidylserine under flow, and (iv) thrombus formation, under conditions where PI3Kalpha/beta was blocked or p85alpha was deficient. In contrast, GPVI-induced platelet activation was insensitive to inhibition or deficiency of PI3Kdelta or -gamma. Furthermore, PI3Kalpha/beta, but not PI3Kgamma, contributed to GPVI-induced Rap1b activation and, surprisingly, also to Rap1b-independent platelet activation via GPVI. Together, these findings demonstrate that both PI3Kalpha and -beta isoforms are required for full GPVI-dependent platelet Ca(2+) signaling and thrombus formation, partly independently of Rap1b. This provides a new mechanistic explanation for the anti-thrombotic effect of PI3K inhibition and makes PI3Kalpha an interesting new target for anti-platelet therapy.

Losartan improves resistance artery lesions and prevents CTGF and TGF-beta production in mild hypertensive patients.

PubMed

Gómez-Garre, D; Martín-Ventura, J L; Granados, R; Sancho, T; Torres, R; Ruano, M; García-Puig, J; Egido, J

2006-04-01

Although structural and functional changes of resistance arteries have been proposed to participate in arterial hypertension (HTA) outcome, not all therapies may correct these alterations, even if they normalize the blood pressure (BP). The aim of this study was to investigate the mechanisms of the protection afforded by the angiotensin receptor antagonist losartan in resistance arteries from patients with essential HTA. In all, 22 untreated hypertensive patients were randomized to receive losartan or amlodipine for 1 year and the morphological characteristics of resistance vessels from subcutaneous biopsies were evaluated. Protein expression of connective tissue growth factor (CTGF), transforming growth factor beta (TGF-beta), and collagens III and IV was detected by immunohistochemistry. In comparison with normotensive subjects, resistance arteries from hypertensive patients showed a significant media:lumen (M/L) ratio increment and a higher protein expression of CTGF, TGF-beta, and collagens. After 1 year of treatment, both losartan and amlodipine similarly controlled BP. However, M/L only decreased in patients under losartan treatment, whereas in the amlodipine-treated group this ratio continued to increase significantly. The administration of losartan prevented significant increments in CTGF, TGF-beta, and collagens in resistance arteries. By contrast, amlodipine-treated patients showed a higher vascular CTGF, TGF-beta, and collagen IV staining than before treatment. Our results show that the administration of losartan, but not amlodipine, to hypertensive patients improves structural abnormalities and prevents the production of CTGF and TGF-beta in small arteries, despite similar BP lowering. These data may explain the molecular mechanisms of the better vascular protection afforded by drugs interfering with the renin-angiotensin system.

Genotyping of beta thalassemia trait by high-resolution DNA melting analysis.

PubMed

Saetung, Rattika; Ongchai, Siriwan; Charoenkwan, Pimlak; Sanguansermsri, Torpong

2013-11-01

Beta thalassemia is a common hereditary hemalogogical disease in Thailand, with a prevalence of 5-8%. In this study, we evaluated the high resolution DNA melting (HRM) assay to identify beta thalassemia mutation in samples from 143 carriers of the beta thalassemia traits in at risk couples. The DNA was isolated from venous blood samples and tested for mutation under a series of 5 PCR-HRM (A, B, C, D and E primers) protocols. The A primers were for detection of beta thalassemia mutations in the HBB promoter region, the B primers for mutations in exon I, the C primers for exon II, the D primers for exon III and the E primers for the 3.4 kb deletion mutation. The mutations were diagnosed by comparing the complete melting curve profiles of a wild type control with those for each mutant sample. With the PCR-HRM technique, fourteen types of beta thalassemia mutations were detected. Each mutation had a unique and specific melting profile. The mutations included 36.4% (52 cases) codon 41/42-CTTT, 26.6% (38 cases) codon 17 A-T, 11.2% (16 cases) IVS1-1 G-T, 8.4% (12 cases) codon 71/72 +A, 8.4% (12 cases) of the 3.4 kb deletion and 3.5% (5 cases) -28 A-G. The remainder included one instance each of -87 C-A, -31 A-C, codon 27/28 +C, codon 30 G-A, IVS1-5 G-C, codon 35 C-A, codon 41-C and IVSII -654 C-T. Of the total cases, 85.8% of the mutations could be detected by primers B and C. The PCR-HRM method provides a rapid, simple and highly feasible strategy for mutation screening of beta thalassemia traits.

[Studies on the chemical constituents of Ficus microcarpa].

PubMed

Li, Yan-Wen; Sun, Zhi-Rong; Li, Zhi-Yong; Jin, Jia-Xing; Wang, Wen-Quan; Yan, Yu-Ning

2010-06-01

To study the chemical constituents of the Ficus microcarpa. Isolation and identification were carried out by using various chromatography techniques and spectral methods. Eight compounds were isolated. Their structures were identified as beta-amyrone (I), lupeol (II), lupeol acetate (III), maslinic acid (IV), epifriedelinol (V), stearic acid (VI), beta-sitosterol (VI), daucosterol (VI). Compounds I, II, VI are isolated from this plant for the first time.

Local sequence information in cellular retinoic acid-binding protein I: specific residue roles in beta-turns.

PubMed

Rotondi, Kenneth S; Gierasch, Lila M

2003-01-01

We have recently shown that two of the beta-turns (III and IV) in the ten-stranded, beta-clam protein, cellular retinoic acid-binding protein I (CRABP I), are favored in short peptide fragments, arguing that they are encoded by local interactions (K. S. Rotondi and L. M. Gierasch, Biochemistry, 2003, Vol. 42, pp. 7976-7985). In this paper we examine these turns in greater detail to dissect the specific local interactions responsible for their observed native conformational biases. Conformations of peptides corresponding to the turn III and IV fragments were examined under conditions designed to selectively disrupt stabilizing interactions, using pH variation, chaotrope addition, or mutagenesis to probe specific side-chain influences. We find that steric constraints imposed by excluded volume effects between near neighbor residues (i,i+2), favorable polar (i,i+2) interactions, and steric permissiveness of glycines are the principal factors accounting for the observed native bias in these turns. Longer-range stabilizing interactions across the beta-turns do not appear to play a significant role in turn stability in these short peptides, in contrast to their importance in hairpins. Additionally, our data add to a growing number of examples of the 3:5 type I turn with a beta-bulge as a class of turns with high propensity to form locally defined structure. Current work is directed at the interplay between the local sequence information in the turns and more long-range influences in the mechanism of folding of this predominantly beta-sheet protein. Copyright 2004 Wiley Periodicals, Inc.

Care for Haemoglobinopathy Patients in Slovakia.

PubMed

Fábryová, Viera; Božek, Peter; Drakulová, Monika; Kollárová, Andrea; Striežencová, Zuzana Laluhová; Macichová, Michaela; Sakalová, Adriena

2017-03-01

The paper presents the results od 22-year study of screening and follow-up of haemoglobinopathies in Slovakia, an overview of genetic mutations, the coincidence with hereditary haemochromatosis mutations, and the procedure in genetic councelling. Between 1993-2015, in three centres in Bratislava and in one centre in Kosice, carriers of beta-thalassaemic genes or other haemoglobinopathies were searched for. Diagnosis was performed by haematologists, whereby the family history was evaluated, together with the overall clinical condition, blood count and blood smear, iron and haemolysis parameters, mutations of hereditary haemochromatosis, and haemoglobin electrophoresis testing. In the last years the haemoglobin division also examined by high performance liquid chromatography (HPLC). A clinical suspicion of the heterozygous form of beta-thalassaemia or other haemoglobinopathies was documented in 554 patients. Of them 32 (5.8%) were foreigners. 213 (38.45%) patients were genetically examined. In 190 (33.93%) of them heterozygote beta-thalassaemia was confirmed. The most frequent mutations were IVS 1.110 (33.15%), IVS 2.1 (33.15%), and IVS 1.6 (14.7%). Evidence of haemoglobin S (heterozygote sickle cell anaemia) was also notable in two non-relative children, whose fathers were of African origin, and one patient from Ghana. One female patient was followed up for haemoglobin Santa Ana (non-stabile haemoglobin previously diagnosed as mutation de novo). In our group, we took care of pregnant patients with haemoglobinopathies. The study showed that there is a higher number of heterozygotes for beta-thalassaemia and rarely haemoglobinopathies in Slovakia. Over the past years, we have recorded an increase number of foreigners coming to our country. It is necessary to continue in search of pathological gene carriers to avoid serious forms of haemoglobinopathies. Copyright© by the National Institute of Public Health, Prague 2017

[Studies on the chemical constituents of ethyl acetate extract from the roots of Actinidia chrysantha].

PubMed

Meng, Li-Li; Huang, Chu-Sheng; Liu, Hong-Xing; Chen, Xi-Hui

2009-10-01

To study the chemical constituents of ethyl acetate extract from the roots of Actinidia chrysantha. Chromatographic methods were used to isolate the compounds from ethyl acetate extract from the roots of Actinidia chrysantha and chemical and spectral methods were used to elucidate the structures of the isolated compounds. Five compounds were identified as stigmast-3, 6-dione (I), beta-sitosterol (II), ursolicacid (III), beta-daucosterol (IV), 2alpha, 3beta, 23-triol-12-en-28-ursolic acid (V). Those compounds are obtained from the plant for the first time.

Titanium(IV) isopropoxide mediated synthesis of pyrimidin-4-ones.

PubMed

Ramanjulu, Joshi M; Demartino, Michael P; Lan, Yunfeng; Marquis, Robert

2010-05-21

A novel, one-step method for the synthesis of tri- and tetrasubstituted pyrimidin-4-ones is reported. This method involves a titanium(IV)-mediated cyclization involving two sequential condensations of primary and beta-ketoamides. The reaction is operationally facile, readily scalable, and offers rapid entry into differentially substituted pyrimidin-4-one scaffolds. The high functional group compatibility allows for substantial diversification in the products generated from this transformation.

Enzyme potentiated hyposensitization: IV. effect of protamine on the immunological behavior of beta glucuronidase in mice and patients with hay fever.

PubMed

McEwen, L M; Nicholson, M; Kitchen, I; O'Gorman, J; White, S

1975-05-01

The ability of beta glucuronidase and a small dose of antigen to modify the anaphylactic reaction of previously sensitized mice has been further investigated. Protamine has an important effect on the immunological behavior of the enzyme. A trial on hay fever patients shows that the results in mice are relevant and that the method can produce significant clinical hyposensitization.

Chronic administration of DSP-7238, a novel, potent, specific and substrate-selective DPP IV inhibitor, improves glycaemic control and beta-cell damage in diabetic mice.

PubMed

Furuta, Y; Horiguchi, M; Sugaru, E; Ono-Kishino, M; Otani, M; Sakai, M; Masui, Y; Tsuchida, A; Sato, Y; Takubo, K; Hochigai, H; Kimura, H; Nakahira, H; Nakagawa, T; Taiji, M

2010-05-01

The purpose of this study is to assess the in vitro enzyme inhibition profile of DSP-7238, a novel non-cyanopyrrolidine dipeptidyl peptidase (DPP) IV inhibitor and to evaluate the acute and chronic effects of this compound on glucose metabolism in two different mouse models of type 2 diabetes. The in vitro enzyme inhibition profile of DSP-7238 was assessed using plasma and recombinant enzymes including DPP IV, DPP II, DPP8, DPP9 and fibroblast activation protein alpha (FAPalpha) with fluorogenic substrates. The inhibition type was evaluated based on the Lineweaver-Burk plot. Substrate selectivity of DSP-7238 and comparator DPP IV inhibitors (vildagliptin, sitagliptin, saxagliptin and linagliptin) was evaluated by mass spectrometry based on the changes in molecular weight of peptide substrates caused by release of N-terminal dipeptides. In the in vivo experiments, high-fat diet-induced obese (DIO) mice were subjected to oral glucose tolerance test (OGTT) following a single oral administration of DSP-7238. To assess the chronic effects of DSP-7238 on glycaemic control and pancreatic beta-cell damage, DSP-7238 was administered for 11 weeks to mice made diabetic by a combination of high-fat diet (HFD) and a low-dose of streptozotocin (STZ). After the dosing period, HbA1c was measured and pancreatic damage was evaluated by biological and histological analyses. DSP-7238 and sitagliptin both competitively inhibited recombinant human DPP IV (rhDPP IV) with K(i) values of 0.60 and 2.1 nM respectively. Neither vildagliptin nor saxagliptin exhibited competitive inhibition of rhDPP IV. DSP-7238 did not inhibit DPP IV-related enzymes including DPP8, DPP9, DPP II and FAPalpha, whereas vildagliptin and saxagliptin showed inhibition of DPP8 and DPP9. Inhibition of glucagon-like peptide-1 (GLP-1) degradation by DSP-7238 was apparently more potent than its inhibition of chemokine (C-X-C motif) ligand 10 (IP-10) or chemokine (C-X-C motif) ligand 12 (SDF-1alpha) degradation. In contrast, vildagliptin and saxagliptin showed similar degree of inhibition of degradation for all the substrates tested. Compared to treatment with the vehicle, single oral administration of DSP-7238 dose-dependently decreased plasma DPP IV activity and improved glucose tolerance in DIO mice. In addition, DSP-7238 significantly decreased HbA1c and ameliorated pancreatic damage following 11 weeks of chronic treatment in HFD/STZ mice. We have shown in this study that DSP-7238 is a potent DPP IV inhibitor that has high specificity for DPP IV and substrate selectivity against GLP-1. We have also found that chronic treatment with DSP-7238 improves glycaemic control and ameliorates beta-cell damage in a mouse model with impaired insulin sensitivity and secretion. These findings indicate that DSP-7238 may be a new therapeutic agent for the treatment of type 2 diabetes.

A hospital perspective on the cost-effectiveness of beta-blockade for prophylaxis of atrial fibrillation after cardiothoracic surgery.

PubMed

Gillespie, Effie L; White, C Michael; Kluger, Jeffrey; Sahni, Jasmine; Gallagher, Robert; Coleman, Craig I

2005-12-01

Prophylactic beta-blockade is the recommended strategy for suppressing atrial fibrillation after cardiothoracic surgery (CTS). However, beta-blockade's impact on the hospital length of stay (LOS) and other economic end points has not been adequately assessed. The present evaluation sought to determine whether beta-blocker use after CTS is a cost-effective strategy for the prevention of postoperative atrial fibrillation (POAF). This was a piggyback cost-effectiveness analysis of a prospective cohort evaluation comprising 1660 patients undergoing CTS at an urban academic hospital from October 1999 to October 2003. Patients receiving beta-blocker prophylaxis were matched 1:1 with control patients not receiving prophylaxis based on age >70 years, valvular surgery, history of atrial fibrillation, male sex, and use of preoperative digoxin or beta-blockers. The incidence of POAF, total hospital costs, and LOS were compared in each group. Nonparametric bootstrapping analysis was performed to examine the study results as part of a quadrant analysis and to calculate CIs for the incremental cost-effectiveness ratio. LOS and total costs were also compared in patients with and without POAF, regardless of beta-blocker use. Use of prophylactic beta-blockade was associated with a 17.3 % reduction in the incidence of POAF (P = 0.02) and a 2.2-day reduction in LOS (P = 0.001) compared with nonuse. It also was associated with a 25.7% reduction in total hospital costs compared with nonuse (mean [SD], $30,978 [$33,108] vs $41,700 [$67,369], respectively; P < 0.001), possibly due to a 27.6% reduction in room and board costs ($11,144 [$15,398] vs $14,920 [$22,132]; P < 0.001). In the bootstrapping analysis, 99.0% of the time prophylactic beta-blockade fell into quadrant IV, which indicated superior effectiveness and lower total costs. Regardless of beta-blocker use, patients who developed POAF had a significantly longer LOS compared with those who did not develop POAF (14.7 [19.1] days vs 10.1 [11.1] days, respectively; P < 0.001) and higher total costs ($47,240 [$85,941] vs $32,516 [$34,644]; P < 0.001). At the institution studied, beta-blocker prophylaxis against POAF after CTS was associated with significantly reduced total costs compared with nonuse of beta-blocker prophylaxis. Patients who developed POAF had significantly increased LOS and total costs compared with those who did not develop POAE An adequately powered prospective, randomized, placebo-controlled trial is necessary to confirm the results of this evaluation.

IUE observations of long period eclipsing binaries - A study of accretion onto non-degenerate stars

NASA Technical Reports Server (NTRS)

Plavec, M. J.

1980-01-01

IUE observations made in 1978-1979 recorded a whole class of interacting long-period binaries similar to beta Lyrae, which includes RX Cas, SX Cas, V 367 Cyg, W Cru, beta Lyr, and W Ser, called the W Serpentis stars. These mass-transferring binaries with relatively high mass transfer rate show two prominent features in the far ultraviolet: a continuum with a color temperature higher than the one observed in the optical region (about 12,000 K), and a strong emission line spectrum with the N V doublet at 1240 A, C IV doublet at 1550 A and lines of Si II, Si III, Si IV, C II, Fe III, AI III, etc. These phenomena are discussed on the assumption that they are due to accretion onto non-degenerate stars.

40 CFR Appendix IV to Part 266 - Reference Air Concentrations*

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 28 2013-07-01 2013-07-01 false Reference Air Concentrations* IV Appendix IV to Part 266 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES... MANAGEMENT FACILITIES Pt. 266, App. IV Appendix IV to Part 266—Reference Air Concentrations* Constituent CAS...

40 CFR Appendix IV to Part 266 - Reference Air Concentrations*

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 27 2014-07-01 2014-07-01 false Reference Air Concentrations* IV Appendix IV to Part 266 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES... MANAGEMENT FACILITIES Pt. 266, App. IV Appendix IV to Part 266—Reference Air Concentrations* Constituent CAS...

40 CFR Appendix IV to Part 266 - Reference Air Concentrations*

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 27 2011-07-01 2011-07-01 false Reference Air Concentrations* IV Appendix IV to Part 266 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES... MANAGEMENT FACILITIES Pt. 266, App. IV Appendix IV to Part 266—Reference Air Concentrations* Constituent CAS...

40 CFR Appendix IV to Part 266 - Reference Air Concentrations*

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Reference Air Concentrations* IV Appendix IV to Part 266 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES... MANAGEMENT FACILITIES Pt. 266, App. IV Appendix IV to Part 266—Reference Air Concentrations* Constituent CAS...

19 CFR Annex IV to Part 351 - Deadlines for Parties in Antidumping Administrative Reviews

Code of Federal Regulations, 2010 CFR

2010-04-01

... 19 Customs Duties 3 2010-04-01 2010-04-01 false Deadlines for Parties in Antidumping Administrative Reviews IV Annex IV to Part 351 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE ANTIDUMPING AND COUNTERVAILING DUTIES Pt. 351, Annex IV Annex IV to Part 351—Deadlines for Parties...

19 CFR Annex IV to Part 351 - Deadlines for Parties in Antidumping Administrative Reviews

Code of Federal Regulations, 2013 CFR

2013-04-01

... 19 Customs Duties 3 2013-04-01 2013-04-01 false Deadlines for Parties in Antidumping Administrative Reviews IV Annex IV to Part 351 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE ANTIDUMPING AND COUNTERVAILING DUTIES Pt. 351, Annex IV Annex IV to Part 351—Deadlines for Parties...

19 CFR Annex IV to Part 351 - Deadlines for Parties in Antidumping Administrative Reviews

Code of Federal Regulations, 2014 CFR

2014-04-01

... 19 Customs Duties 3 2014-04-01 2014-04-01 false Deadlines for Parties in Antidumping Administrative Reviews IV Annex IV to Part 351 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE ANTIDUMPING AND COUNTERVAILING DUTIES Pt. 351, Annex IV Annex IV to Part 351—Deadlines for Parties...

19 CFR Annex IV to Part 351 - Deadlines for Parties in Antidumping Administrative Reviews

Code of Federal Regulations, 2012 CFR

2012-04-01

... 19 Customs Duties 3 2012-04-01 2012-04-01 false Deadlines for Parties in Antidumping Administrative Reviews IV Annex IV to Part 351 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE ANTIDUMPING AND COUNTERVAILING DUTIES Pt. 351, Annex IV Annex IV to Part 351—Deadlines for Parties...

19 CFR Annex IV to Part 351 - Deadlines for Parties in Antidumping Administrative Reviews

Code of Federal Regulations, 2011 CFR

2011-04-01

... 19 Customs Duties 3 2011-04-01 2011-04-01 false Deadlines for Parties in Antidumping Administrative Reviews IV Annex IV to Part 351 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE ANTIDUMPING AND COUNTERVAILING DUTIES Pt. 351, Annex IV Annex IV to Part 351—Deadlines for Parties...

Deep-level dominated electrical characteristics of Au contacts on beta-SiC

NASA Technical Reports Server (NTRS)

Das, K.; Kong, H. S.; Petit, J. B.; Bumgarner, J. W.; Davis, R. F.; Matus, L. G.

1990-01-01

Electrical characteristics of Au contacts on beta-SiC films, grown epitaxially on both nominal and off-axis (100) silicon substrates, are reported. An analysis of the logarithmic I-V plots of the Au/beta-SiC diodes revealed information pertaining to the deep states present in the materials. It was found that while the beta-SiC films grown on nominally (100) oriented substrates show the presence of two deep levels located between 0.26 and 0.38 eV below the conduction bandedge, the beta-SiC films deposited on off-axis substrates have only one deep level, located about 0.49 eV below the conduction bandedge for the 2-deg off (100) substrates and 0.57 eV for the 4-deg off (100) substrates. The presence of the shallower deep states in the beta-SiC films grown on nominal (100) substrates is attributed to the electrical activity of antiphase domain boundaries.

A single-dose pharmacokinetic study of emamectin benzoate in cod, Gadus morhua L., held in sea water at 9 degrees C.

PubMed

Samuelsen, O B

2010-02-01

The pharmacokinetic profile of the antiparasitic agent emamectin benzoate was studied in plasma after intravenous (i.v.) injection and in plasma, muscle and skin following oral (p.o.) administration to cod, Gadus morhua, held in sea water at 9 degrees C and weighing 100-200 g. Following i.v. injection, the plasma drug concentration-time profile showed two distinct phases. The plasma distribution half-life (t(1/2)alpha) was estimated as 2.5 h, the elimination half-life (t(1/2)beta) as 216 h, the total body clearance (Cl(T)) as 0.0059 L kg(-1) h(-1) and mean residence time (MRT) as 385 h. The volume of distribution at steady state, V(d(ss)), was calculated to be 1.839 L kg(-1). Following p.o. administration the peak plasma concentration (C(max)) was 15 ng mL(-1), the time to peak plasma concentration (T(max)) was 89 h and t(1/2)beta was 180 h. The highest concentration in muscle (21 ng g(-1)) was measured after 7 days and t(1/2)beta was calculated to be 247 h. For skin, a peak concentration of 28 ng g(-1) at 3 days was observed and a t(1/2)beta of 235 h was determined. The bioavailability following p.o. administration was calculated to be 38%.

GABAA receptor subunit gene expression in human prefrontal cortex: comparison of schizophrenics and controls

NASA Technical Reports Server (NTRS)

Akbarian, S.; Huntsman, M. M.; Kim, J. J.; Tafazzoli, A.; Potkin, S. G.; Bunney, W. E. Jr; Jones, E. G.; Bloom, F. E. (Principal Investigator)

1995-01-01

The prefrontal cortex of schizophrenics is hypoactive and displays changes related to inhibitory, GABAergic neurons, and GABAergic synapses. These changes include decreased levels of glutamic acid decarboxylase (GAD), the enzyme for GABA synthesis, upregulation of muscimol binding, and downregulation of benzodiazepine binding to GABAA receptors. Studies in the visual cortex of nonhuman primates have demonstrated that gene expression for GAD and for several GABAA receptor subunit polypeptides is under control of neuronal activity, raising the possibility that similar mechanisms in the hypoactive prefrontal cortex of schizophrenics may explain the abnormalities in GAD and in GABAA receptor regulation. In the present study, which is the first of its type on human cerebral cortex, levels of mRNAs for six GABAA receptor subunits (alpha 1, alpha 2, alpha 5, beta 1, beta 2, gamma 2) and their laminar expression patterns were analyzed in the prefrontal cortex of schizophrenics and matched controls, using in situ hybridization histochemistry and densitometry. Three types of laminar expression pattern were observed: mRNAs for the alpha 1, beta 2, and gamma 2 subunits, which are the predominant receptor subunits expressed in the mature cortex, were expressed at comparatively high levels by cells of all six cortical layers, but most intensely by cells in lower layer III and layer IV. mRNAs for the alpha 2, alpha 5, and beta 1 subunits were expressed at lower levels; alpha 2 and beta 1 were expressed predominantly by cells in layers II, III, and IV; alpha 5 was expressed predominantly in layers IV, V, and VI. There were no significant changes in overall mRNA levels for any of the receptor subunits in the prefrontal cortex of schizophrenics, and the laminar expression pattern of all six receptor subunit mRNAs did not differ between schizophrenics and controls. Because gene expression for GABAA receptor subunits is not consistently altered in the prefrontal cortex of schizophrenics, the previously reported upregulation of muscimol binding sites and downregulation of benzodiazepine binding sites in the prefrontal and adjacent cingulate cortex of schizophrenics are possibly due to posttranscriptional modifications of mRNAs and their translated polypeptides.

Triplication of a four-gene set during evolution of the goat beta-globin locus produced three genes now expressed differentially during development.

PubMed Central

Townes, T M; Fitzgerald, M C; Lingrel, J B

1984-01-01

Distinct hemoglobins are synthesized in goats at different stages of development, similar to humans. Embryonic hemoglobins (zeta 2 epsilon 2 and alpha 2 epsilon 2) are synthesized initially and are followed sequentially by fetal (alpha 2 beta F2), preadult (alpha 2 beta C2), and adult (alpha 2 beta A2) hemoglobins. To help understand the basis of these switches, the genes of the beta-globin locus have been cloned and their linkage arrangement has been determined by the isolation of lambda phage carrying overlapping inserts of genomic goat DNA. The locus extends over 120 kilobase pairs and consists of 12 genes arranged in the following order: epsilon I-epsilon II-psi beta X-beta C-epsilon III-epsilon IV-psi beta Z-beta A-epsilon V-epsilon VI-psi beta Y-beta F. Comparison of the nucleotide sequence of the 12 genes shows that the locus is organized into three homologous four-gene sets that presumably evolved by the triplication of an ancestral set of four genes (epsilon-epsilon-psi beta-beta). Interestingly, the three genes (beta C, beta A, and beta F) located at the ends of the four-gene sets are expressed at different stages of development. Therefore, the goat beta F-, beta C-, and beta A-globin genes appear to have evolved by a mechanism that includes the triplication of 40-50 kilobase pairs of DNA and the recruitment of newly formed genes for expression in fetal, preadult, and adult life. PMID:6593719

[Studies on the chemical constituents from the flowers of Ophiopogon japonicus].

PubMed

Zhu, Yu-Hong; Zhao, Min; Ren, Lu; Tian, Di; Dou, Fang; Wang, Jun-Xian

2011-05-01

To study the chemical constituents from the flowers of Ophiopogon japonicus. Column chromatography and spectral analysis were used to isolate and identify the constituents. Eleven compounds were obtained and identified as beta-sitosterol (I), diosgenin (II), daucosterol (III), ophiopogonin C' (IV), dioscin (V), 7-dihy-droxy-6-methyl-3-(4'-hydroxybenzyl) chroman-4-one(VI), luteolin (VII), kaempferol-3-O-beta-D-glucopyranosides (VIII), kaempferol-3-O-(6"-tigloyl) -beta-D-glucopyranosides (IX), kaempferol-3-O-(6"-acetyl) -beta-D-glucopyranosides (X), glucose (XI). Eleven compounds are obtained from the flowers of O. japonicus for the first time. Compond VI is isolated as a simple substance compound of O. japonicus for the first time. Componds VII, VIII, IX and X are isolated from this genus for the first time.

Ionisation density effects following optical excitation in LiF:Mg, Ti (TLD-100).

PubMed

Weiss, D; Horowitz, Y; Oster, L

2007-01-01

The TL signal following 5 eV photon excitation of previously irradiated and readout material has been studied as a function of ionisation density and various experimental parameters: (i) maximum temperature of the first readout; (ii) photon fluence; (iii) photon energy and (iv) beta ray dose. Following alpha particle irradiation, the ratio of the second-readout to first-readout TL signal, epsilon(alpha,) has been found to be 10-20 times higher than that following beta irradiation, indicative of the possibility of using the double ratio epsilon(alpha)/epsilon(beta) as a mixed-field discriminator. The beginning of an attempt to explain this unusual effect is offered in the framework of the track structure theory and kinetic modelling of the beta ray dose-response of the first and second readouts.

Beta-globin locus activation regions: conservation of organization, structure, and function.

PubMed Central

Li, Q L; Zhou, B; Powers, P; Enver, T; Stamatoyannopoulos, G

1990-01-01

The human beta-globin locus activation region (LAR) comprises four erythroid-specific DNase I hypersensitive sites (I-IV) thought to be largely responsible for activating the beta-globin domain and facilitating high-level erythroid-specific globin gene expression. We identified the goat beta-globin LAR, determined 10.2 kilobases of its sequence, and demonstrated its function in transgenic mice. The human and goat LARs share 6.5 kilobases of homologous sequences that are as highly conserved as the epsilon-globin gene promoters. Furthermore, the overall spatial organization of the two LARs has been conserved. These results suggest that the functionally relevant regions of the LAR are large and that in addition to their primary structure, the spatial relationship of the conserved elements is important for LAR function. Images PMID:2236034

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patrick, N.; Miyakawa, F.; Hunt, J.A.

The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5more » of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].« less

Differential expression of extracellular matrix molecules and the alpha 6-integrins in the normal and neoplastic prostate.

PubMed Central

Knox, J. D.; Cress, A. E.; Clark, V.; Manriquez, L.; Affinito, K. S.; Dalkin, B. L.; Nagle, R. B.

1994-01-01

The epithelial basal lamina composition and integrin expression profile of normal and neoplastic human prostate was characterized using immunohistochemical analysis of frozen samples. The major components of the basal lamina surrounding normal acini were laminin, type IV collagen, entactin, and type VII collagen with variable amounts of tenascin. The basal lamina of neoplastic acini had a similar composition, except for the loss of type VII collagen, which was observed in all grades of carcinoma. The basal cells of the normal prostate express the alpha 6-, beta 1-, and beta 4-integrin subunits, suggesting that both the alpha 6 beta 1- and alpha 6 beta 4-integrin complexes are formed. In prostate carcinoma there is a complete loss of beta 4 expression and the alpha 6- and beta 1-integrin subunits, which are restricted to the basal and basal lateral surfaces of basal cells, are distributed diffusely throughout the cytoplasmic membrane. The differential expression of type VII collagen and beta 4 are discussed in relationship to their possible role in tumor progression. Images Figure 1 Figure 2 Figure 3 PMID:8030747

46 CFR Appendix IV to Part 150 - Data Sheet

Code of Federal Regulations, 2014 CFR

2014-10-01

... 46 Shipping 5 2014-10-01 2014-10-01 false Data Sheet IV Appendix IV to Part 150 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES Pt. 150, App. IV Appendix IV to Part 150—Data Sheet EC02FE91.080 EC02FE91.081 ...

46 CFR Appendix IV to Part 150 - Data Sheet

Code of Federal Regulations, 2013 CFR

2013-10-01

... 46 Shipping 5 2013-10-01 2013-10-01 false Data Sheet IV Appendix IV to Part 150 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES Pt. 150, App. IV Appendix IV to Part 150—Data Sheet EC02FE91.080 EC02FE91.081 ...

46 CFR Appendix IV to Part 150 - Data Sheet

Code of Federal Regulations, 2012 CFR

2012-10-01

... 46 Shipping 5 2012-10-01 2012-10-01 false Data Sheet IV Appendix IV to Part 150 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES Pt. 150, App. IV Appendix IV to Part 150—Data Sheet EC02FE91.080 EC02FE91.081 ...

46 CFR Appendix IV to Part 150 - Data Sheet

Code of Federal Regulations, 2011 CFR

2011-10-01

... 46 Shipping 5 2011-10-01 2011-10-01 false Data Sheet IV Appendix IV to Part 150 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES Pt. 150, App. IV Appendix IV to Part 150—Data Sheet EC02FE91.080 EC02FE91.081 ...

46 CFR Appendix IV to Part 150 - Data Sheet

Code of Federal Regulations, 2010 CFR

2010-10-01

... 46 Shipping 5 2010-10-01 2010-10-01 false Data Sheet IV Appendix IV to Part 150 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES COMPATIBILITY OF CARGOES Pt. 150, App. IV Appendix IV to Part 150—Data Sheet EC02FE91.080 EC02FE91.081 ...

40 CFR Appendix IV to Part 600 - Reserved

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 30 2014-07-01 2014-07-01 false Reserved IV Appendix IV to Part 600 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND GREENHOUSE GAS EXHAUST EMISSIONS OF MOTOR VEHICLES Appendix IV to Part 600 [Reserved] ...

[Anesthetic management using esmolol for arthroscopic synovectomy in a patient with thyroid storm].

PubMed

Torigoe, Kei; Suzuki, Hiroto; Nakajima, Waka; Takahashi, Minori; Aoyagi, Mitsuo

2010-02-01

We report a case of a 47-year-old woman with past medical history of Graves disease who presented with thyroid storm, a state of physiologic decompensation due to severe thyrotoxicosis, and arthritis purulenta. Antithyroid therapy ameliorated thyrotoxicosis in 4 days, and arthroscopic synovectomy of the right knee was performed. Anesthesia was induced with intravenous propofol. Esmolol, an ultra-short-acting beta blocker listed in national drug tariff of Japan for intraoperative continuous iv infusion in March 2008, was also administered to control heart rate. Then, laryngeal mask airway was inserted and echo-guided femoral nerve block was done with ropivacaine. Anesthesia was maintained with i.v. infusion of propofol and fentanyl. Short episode of supraventricular tachycardia occurred twice, but each tachycardia disappered in about a half minute. The postoperative course was uneventful. Esmolol probably acted to prevent intraoperative tachycardia due to increased beta-adrenergic tone.

Development of a PCR/LDR/capillary electrophoresis assay with potential for the detection of a beta-thalassemia fetal mutation in maternal plasma.

PubMed

Yi, Ping; Chen, Zhuqin; Yu, Lili; Zheng, Yingru; Liu, Guodong; Xie, Haichang; Zhou, Yuanguo; Zheng, Xiuhui; Han, Jian; Li, Li

2010-08-01

Analysis of fetal DNA in maternal plasma has recently been introduced for non-invasive prenatal diagnosis. We have now investigated the feasibility of polymerase chain reaction (PCR)/ligase detection reaction (LDR)/capillary electrophoresis for the detection of fetal point mutations, such as the beta-thalassemia mutation, IVS2 654(C --> T), in maternal plasma DNA. The sensitivity of LDR/capillary electrophoresis was examined by quantifying the mutant PCR products in the presence of a vast excess of non-mutant competitor template, a situation that mimics the detection of rare fetal mutations in the presence of excess maternal DNA. PCR/LDR/capillary electrophoresis was applied to detect the mutation, IVS2 654(C --> T), in an experimental model at different sensitivity levels and from 10 maternal plasma samples. Our results demonstrated that this approach to detect a low abundance IVS2 654(C --> T) mutation achieved a sensitivity of approximately 1:10,000. The approach was applied to maternal plasma DNA to detect the paternally inherited fetal IVS2 654(C --> T) mutation, and the results were equivalent to those obtained by PCR/reverse dot blot of amniotic fluid cell DNA. PCR/LDR/capillary electrophoresis has a very high sensitivity that can distinguish low abundance single nucleotide differences and can detect paternally inherited fetal point mutations in maternal plasma.

[Studies on chemical constituents of Taxillus sutchuenenisis].

PubMed

Chen, Jiang-tao; Feng, Feng

2007-11-01

To study the chemical constituents of Taxillus sutchuenenisis (Lecomte) Danser. Chromatography and spectrum analysis were employed to isolated and elucidate the chemical constituents in the plant. 9 compounds were isolated and identified as quercetin (I), quervetin 3-O-beta-D-galactoside (II), isoquercitrin (III), quercitrin (IV), rutin (V), gallic acid (VI), ferulic acid (VII), beta-sitosterol (VIII), daucosterol (IX), respectively. Compounds III-IX are isolated from this plant for the first time. The work provide evidence for the exploitation and utilization of this plant resouce.

The Crystal and Molecular Structure of Acetatochlorobis(4-methylpyridine)oxovanadium (IV)

NASA Technical Reports Server (NTRS)

Schupp, John D.; Hepp, Aloysius F.; Duraj, Stan A.; Richman, Robert M.; Fanwick, Phillip E.; Hakimzadeh, Roshanak (Technical Monitor)

2001-01-01

The crystal and molecular structure of the title compound, VOCl(O2CCH3)(4-CH3C5H4N)2, has been determined by single-crystal x-ray diffraction. The material crystallizes in the space group P 1(bar) (#2) with a = 7.822(2), b = 8.023(l), c = 14.841(2) Angstroms, alpha = 99.73(l), beta = 91.41(l), and gamma = 117.13(l). The coordination geometry around the vanadium is a highly distorted octahedron. The molecule is remarkable for being a monomeric oxovanadium (IV) carboxylate. A generalized synthetic strategy is proposed for the preparation of oxovanadium (IV) monomers.

Transforming Growth Factor-Beta Inhibition Reduces Progression of Early Choroidal Neovascularization Lesions in Rats: P17 and P144 Peptides

PubMed Central

Zarranz-Ventura, Javier; Fernández-Robredo, Patricia; Recalde, Sergio; Salinas-Alamán, Angel; Borrás-Cuesta, Francisco; Dotor, Javier; García-Layana, Alfredo

2013-01-01

The purpose of this study was to assess the effects of transforming growth factor beta (TGF-β) inhibitor peptides (P17 & P144) on early laser-induced choroidal neovascularization (LI-CNV) lesions in rats, two weeks after laser CNV induction. Seventy-one Long Evans rats underwent diode laser application in an established LI-CNV model. Baseline fluorescein angiography (FA) was performed 14 days following laser procedure, and treatments were administered 16 days post-laser application via different administration routes. Intravenous groups included control (IV-Control), P17 (IV-17), and P144 (IV-144) groups, whereas intravitreal groups included P17 (IVT-17), P144 (IVT-144), and a mixture of both peptides (IVT-17+144) (with fellow eyes receiving vehicle alone). CNV evolution was assessed using FA performed weekly for four weeks after treatment. Following sacrifice, VEGF, TGF-β, COX-2, IGF-1, PAI-1, IL-6, MMP-2, MMP-9, and TNF-α gene expression was assessed using RT-PCR. VEGF and p-SMAD2 protein levels were also assessed by western-blot, while MMP-2 activity was assessed with gelatin zymography. Regarding the FA analysis, the mean CNV area was lower from the 3rd week in IVT-17 and IVT-144 groups, and also from the 2nd week in IVT-17+144. Biochemical analysis revealed that gene expression was lower for VEGF and COX-2 genes in IV-17 and IV-144 groups, VEGF gene in IVT-17+144 group and MMP-2 gene in IVT-17 and IVT-144 groups. VEGF protein expression was also decreased in IV-17, IV-144, IVT-17 and IVT-144, whereas pSMAD-2 levels were lower in IV-17, IV-144 and IVT-17+144 groups. Zymogram analysis revealed decreased MMP-2 activity in IV-17, IV-144, IVT-17 and IVT-144 groups. These data suggest that the use of TGF-β inhibitor peptides (P17 & P144) decrease the development of early CNV lesions by targeting different mediators than those typically affected using current anti-angiogenic therapies. Its potential role in the treatment of early CNV appears promising as a single therapy or adjuvant to anti-VEGF drugs. PMID:23741494

SNL-SAND-IV v. 0.9 (beta)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Griffin, Patrick J.

2016-10-05

The code is used to provide an unfolded/adjusted energy-dependent fission reactor neutron spectrum based upon an input trial spectrum and a set of measured activities. This is part of a neutron environment characterization that supports doing testing in a given reactor environment. An iterative perturbation method is used to obtain a "best fit" neutron flux spectrum for a given input set of infinitely dilute foil activities. The calculational procedure consists of the selection of a trial flux spectrum to serve as the initial approximation to the solution, and subsequent iteration to a form acceptable as an appropriate solution. The solutionmore » is specified either as time-integrated flux (fluence) for a pulsed environment or as a flux for a steady-state neutron environment.« less

40 CFR Appendix IV to Part 600 - Sample Fuel Economy Labels for 2008 and Later Model Year Vehicles

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Sample Fuel Economy Labels for 2008 and Later Model Year Vehicles IV Appendix IV to Part 600 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND CARBON-RELATED EXHAUST EMISSIONS OF MOTOR VEHICLES Pt. 600, App. IV Appendix IV to Part 600...

12 CFR Appendix IV to Part 27 - Home Loan Data Submission

Code of Federal Regulations, 2014 CFR

2014-01-01

... 12 Banks and Banking 1 2014-01-01 2014-01-01 false Home Loan Data Submission IV Appendix IV to Part 27 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY FAIR HOUSING HOME LOAN DATA SYSTEM Pt. 27, App. IV Appendix IV to Part 27—Home Loan Data Submission ER21JN94.003 ER21JN94...

12 CFR Appendix IV to Part 27 - Home Loan Data Submission

Code of Federal Regulations, 2013 CFR

2013-01-01

... 12 Banks and Banking 1 2013-01-01 2013-01-01 false Home Loan Data Submission IV Appendix IV to Part 27 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY FAIR HOUSING HOME LOAN DATA SYSTEM Pt. 27, App. IV Appendix IV to Part 27—Home Loan Data Submission ER21JN94.003 ER21JN94...

12 CFR Appendix IV to Part 27 - Home Loan Data Submission

Code of Federal Regulations, 2011 CFR

2011-01-01

... 12 Banks and Banking 1 2011-01-01 2011-01-01 false Home Loan Data Submission IV Appendix IV to Part 27 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY FAIR HOUSING HOME LOAN DATA SYSTEM Pt. 27, App. IV Appendix IV to Part 27—Home Loan Data Submission ER21JN94.003 ER21JN94...

12 CFR Appendix IV to Part 27 - Home Loan Data Submission

Code of Federal Regulations, 2012 CFR

2012-01-01

... 12 Banks and Banking 1 2012-01-01 2012-01-01 false Home Loan Data Submission IV Appendix IV to Part 27 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY FAIR HOUSING HOME LOAN DATA SYSTEM Pt. 27, App. IV Appendix IV to Part 27—Home Loan Data Submission ER21JN94.003 ER21JN94...

12 CFR Appendix IV to Part 27 - Home Loan Data Submission

Code of Federal Regulations, 2010 CFR

2010-01-01

... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Home Loan Data Submission IV Appendix IV to Part 27 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY FAIR HOUSING HOME LOAN DATA SYSTEM Pt. 27, App. IV Appendix IV to Part 27—Home Loan Data Submission ER21JN94.003 ER21JN94...

MT2-MMP-dependent release of collagen IV NC1 domains regulates submandibular gland branching morphogenesis.

PubMed

Rebustini, Ivan T; Myers, Christopher; Lassiter, Keyonica S; Surmak, Andrew; Szabova, Ludmila; Holmbeck, Kenn; Pedchenko, Vadim; Hudson, Billy G; Hoffman, Matthew P

2009-10-01

Proteolysis is essential during branching morphogenesis, but the roles of MT-MMPs and their proteolytic products are not clearly understood. Here, we discover that decreasing MT-MMP activity during submandibular gland branching morphogenesis decreases proliferation and increases collagen IV and MT-MMP expression. Specifically, reducing epithelial MT2-MMP profoundly decreases proliferation and morphogenesis, increases Col4a2 and intracellular accumulation of collagen IV, and decreases the proteolytic release of collagen IV NC1 domains. Importantly, we demonstrate the presence of collagen IV NC1 domains in developing tissue. Furthermore, recombinant collagen IV NC1 domains rescue branching morphogenesis after MT2-siRNA treatment, increasing MT-MMP and proproliferative gene expression via beta1 integrin and PI3K-AKT signaling. Additionally, HBEGF also rescues MT2-siRNA treatment, increasing NC1 domain release, proliferation, and MT2-MMP and Hbegf expression. Our studies provide mechanistic insight into how MT2-MMP-dependent release of bioactive NC1 domains from collagen IV is critical for integrating collagen IV synthesis and proteolysis with epithelial proliferation during branching morphogenesis.

The Magnetically-Tuned Transition-Edge Sensor

NASA Technical Reports Server (NTRS)

Sadleir, John E.; Lee, Sang-Jun; Smith, Stephen J.; Busch, Sarah E.; Bandler, Simon R.; Adams, Joseph S.; Eckart, Megan E.; Chevenak, James A.; Kelley, Richard L.; Kilbourne, Caroline A.;

Evolution of Substrate Specificity within a Diverse Family of [beta/alpha]-Barrel-fold Basic Amino Acid Decarboxylases X-ray Structure Determination of Enzymes with Specificity for L-Arginine and Carboxynorspermidine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deng, Xiaoyi; Lee, Jeongmi; Michael, Anthony J.

2010-08-26

Pyridoxal 5{prime}-phosphate (PLP)-dependent basic amino acid decarboxylases from the {beta}/{alpha}-barrel-fold class (group IV) exist in most organisms and catalyze the decarboxylation of diverse substrates, essential for polyamine and lysine biosynthesis. Herein we describe the first x-ray structure determination of bacterial biosynthetic arginine decarboxylase (ADC) and carboxynorspermidine decarboxylase (CANSDC) to 2.3- and 2.0-{angstrom} resolution, solved as product complexes with agmatine and norspermidine. Despite low overall sequence identity, the monomeric and dimeric structures are similar to other enzymes in the family, with the active sites formed between the {beta}/{alpha}-barrel domain of one subunit and the {beta}-barrel of the other. ADC contains bothmore » a unique interdomain insertion (4-helical bundle) and a C-terminal extension (3-helical bundle) and it packs as a tetramer in the asymmetric unit with the insertions forming part of the dimer and tetramer interfaces. Analytical ultracentrifugation studies confirmed that the ADC solution structure is a tetramer. Specificity for different basic amino acids appears to arise primarily from changes in the position of, and amino acid replacements in, a helix in the {beta}-barrel domain we refer to as the 'specificity helix.' Additionally, in CANSDC a key acidic residue that interacts with the distal amino group of other substrates is replaced by Leu{sup 314}, which interacts with the aliphatic portion of norspermidine. Neither product, agmatine in ADC nor norspermidine in CANSDC, form a Schiff base to pyridoxal 5{prime}-phosphate, suggesting that the product complexes may promote product release by slowing the back reaction. These studies provide insight into the structural basis for the evolution of novel function within a common structural-fold.« less

[Studies on chemical constituents of Heterosmilax yunnanensis].

PubMed

Qin, Wen-jie; Wang, Gang-li; Lin, Rui-chao

2007-08-01

To study the chemical constituents of Heterosmilax yunianensis. The compounds were isolated and repeatedly purified with chromatograph and the structures were elucidated by physico-chemical properties and spectral analysis. Eight compounds were obtained and elucidated as beta-sitosterol (I), glycerol monopalmitate (II), daucosterol (IIl), hexacosanoic acid (IV), 5-hydroxymethyl furaldehyde (V), hergapen (VI), ursolic acid (VII), liquiritigenin (VIII). They have been isolated from this plant for the first time, and IV - VIII are obtained from the plants of Heterosmilax for the first time.

ENDF/B-IV fission-product files: summary of major nuclide data

DOE Office of Scientific and Technical Information (OSTI.GOV)

England, T.R.; Schenter, R.E.

1975-09-01

The major fission-product parameters [sigma/sub th/, RI, tau/sub 1/2/, E- bar/sub $beta$/, E-bar/sub $gamma$/, E-bar/sub $alpha$/, decay and (n,$gamma$) branching, Q, and AWR] abstracted from ENDF/B-IV files for 824 nuclides are summarized. These data are most often requested by users concerned with reactor design, reactor safety, dose, and other sundry studies. The few known file errors are corrected to date. Tabular data are listed by increasing mass number. (auth)

Reduced immunohistochemical expression of adhesion molecules in vitiligo skin biopsies.

PubMed

Reichert Faria, Adriane; Jung, Juliana Elizabeth; Silva de Castro, Caio César; de Noronha, Lucia

2017-03-01

Because defects in adhesion impairment seem to be involved in the etiopathogenesis of vitiligo, this study aimed to compare the immunohistochemical expression of several adhesion molecules in the epidermis of vitiligo and non lesional vitiligo skin. Sixty-six specimens of lesional and non lesional skin from 33 volunteers with vitiligo were evaluated by immunohistochemistry using anti-beta-catenin, anti-E-cadherin, anti-laminin, anti-beta1 integrin, anti-collagen IV, anti-ICAM-1 and anti-VCAM-1 antibodies. Biopsies of vitiligo skin demonstrated a significant reduction in the expression of laminin and integrin. The average value of the immunohistochemically positive reaction area of the vitiligo specimens was 3053.2μm 2 , compared with the observed value of 3431.8μm 2 in non vitiligo skin (p=0.003) for laminin. The immuno-positive area was 7174.6μm 2 (vitiligo) and 8966.7μm 2 (non lesional skin) for integrin (p=0.042). A reduction in ICAM-1 and VCAM-1 expression in the basal layer of the epidermis in vitiligo samples was also observed (p=0.001 and p<0.001, respectively). However, no significant differences were observed with respect to the expression of beta-catenin, E-cadherin, and collagen IV between vitiligo and non lesional skin. Our results suggest that an impairment in adhesion exists in vitiligo skin, which is supported by the diminished immunohistochemical expression of laminin, beta1 integrin, ICAM-1 and VCAM-1. Copyright © 2017 Elsevier GmbH. All rights reserved.

Influence of blood flow on adsorption of beta2-microglobulin onto AN69 dialyzer membrane.

PubMed

Kandus, A; Malovrh, M; Bren, A F

1997-08-01

Adsorption onto the dialyzer membrane is a contributing factor to the elimination of beta2-microglobulin (beta2M) from the sera of uremic patients. The purpose of this prospective study was to ascertain the influence of the blood flow rate on adsorption of beta2M onto the polyacrylonitrile (AN69) hollow-fiber dialyzer membrane in 8 patients during regular hemodialysis (HD). Blood first passed through a low-flux polysulfone dialyzer and then through an AN69 dialyzer, which was not in contact with the dialysis fluid. During the investigation period (first hour of the HD session), the blood flow rate was 100 ml/ min (first part of the study), 200 ml/min (second part of the study), and 300 ml/min (third part of the study). Ultrafiltration was not performed during the investigation period. At the start of the HD sessions, the serum concentration of beta2M in the afferent blood line did not differ significantly among the 3 parts of the study. Serum beta2M was measured in samples taken from the afferent and efferent blood lines of the AN69 dialyzer at 5, 10, 15, 30, 45, and 60 min. The serum beta2M concentration decreased significantly in blood that had passed through the AN69 dialyzer. This decrease, indicating membrane adsorption, was maximal during the first part and minimal during the third part of study. The decrease in the contact time between the blood and the AN69 could be the underlying cause. The calculated quantities of beta2M adsorbed onto the AN69 membrane (44.2 +/- 10.2, 43.2 +/- 12.1, and 42.6 +/- 17.3 mg) did not differ significantly among the 3 parts of the study. These results suggest that an increase in blood flow rate from 100 to 300 ml/min did not significantly affect the quantity of beta2M adsorbed onto the AN69 membrane.

Predicting beta-turns and their types using predicted backbone dihedral angles and secondary structures.

PubMed

Kountouris, Petros; Hirst, Jonathan D

2010-07-31

Beta-turns are secondary structure elements usually classified as coil. Their prediction is important, because of their role in protein folding and their frequent occurrence in protein chains. We have developed a novel method that predicts beta-turns and their types using information from multiple sequence alignments, predicted secondary structures and, for the first time, predicted dihedral angles. Our method uses support vector machines, a supervised classification technique, and is trained and tested on three established datasets of 426, 547 and 823 protein chains. We achieve a Matthews correlation coefficient of up to 0.49, when predicting the location of beta-turns, the highest reported value to date. Moreover, the additional dihedral information improves the prediction of beta-turn types I, II, IV, VIII and "non-specific", achieving correlation coefficients up to 0.39, 0.33, 0.27, 0.14 and 0.38, respectively. Our results are more accurate than other methods. We have created an accurate predictor of beta-turns and their types. Our method, called DEBT, is available online at http://comp.chem.nottingham.ac.uk/debt/.

Neural cell adhesion molecule-deficient beta-cell tumorigenesis results in diminished extracellular matrix molecule expression and tumour cell-matrix adhesion.

PubMed

Håkansson, Joakim; Xian, Xiaojie; He, Liqun; Ståhlberg, Anders; Nelander, Sven; Samuelsson, Tore; Kubista, Mikael; Semb, Henrik

2005-01-01

To understand by which mechanism neural cell adhesion molecule (N-CAM) limits beta tumour cell disaggregation and dissemination, we searched for potential downstream genes of N-CAM during beta tumour cell progression by gene expression profiling. Here, we show that N-CAM-deficient beta-cell tumorigenesis is associated with changes in the expression of genes involved in cell-matrix adhesion and cytoskeletal dynamics, biological processes known to affect the invasive and metastatic behaviour of tumour cells. The extracellular matrix (ECM) molecules emerged as the primary target, i.e. N-CAM deficiency resulted in down-regulated mRNA expression of a broad range of ECM molecules. Consistent with this result, deficient deposition of major ECM stromal components, such as fibronectin, laminin 1 and collagen IV, was observed. Moreover, N-CAM-deficient tumour cells displayed defective matrix adhesion. These results offer a potential mechanism for tumour cell disaggregation during N-CAM-deficient beta tumour cell progression. Prospective consequences of these findings for the role of N-CAM in beta tumour cell dissemination are discussed.

Topological side-chain classification of beta-turns: ideal motifs for peptidomimetic development.

PubMed

Tran, Tran Trung; McKie, Jim; Meutermans, Wim D F; Bourne, Gregory T; Andrews, Peter R; Smythe, Mark L

2005-08-01

Beta-turns are important topological motifs for biological recognition of proteins and peptides. Organic molecules that sample the side chain positions of beta-turns have shown broad binding capacity to multiple different receptors, for example benzodiazepines. Beta-turns have traditionally been classified into various types based on the backbone dihedral angles (phi2, psi2, phi3 and psi3). Indeed, 57-68% of beta-turns are currently classified into 8 different backbone families (Type I, Type II, Type I', Type II', Type VIII, Type VIa1, Type VIa2 and Type VIb and Type IV which represents unclassified beta-turns). Although this classification of beta-turns has been useful, the resulting beta-turn types are not ideal for the design of beta-turn mimetics as they do not reflect topological features of the recognition elements, the side chains. To overcome this, we have extracted beta-turns from a data set of non-homologous and high-resolution protein crystal structures. The side chain positions, as defined by C(alpha)-C(beta) vectors, of these turns have been clustered using the kth nearest neighbor clustering and filtered nearest centroid sorting algorithms. Nine clusters were obtained that cluster 90% of the data, and the average intra-cluster RMSD of the four C(alpha)-C(beta) vectors is 0.36. The nine clusters therefore represent the topology of the side chain scaffold architecture of the vast majority of beta-turns. The mean structures of the nine clusters are useful for the development of beta-turn mimetics and as biological descriptors for focusing combinatorial chemistry towards biologically relevant topological space.

Relationship Between Beta Cell Dysfunction and Severity of Disease Among Critically Ill Children: A STROBE-Compliant Prospective Observational Study.

PubMed

Liu, Ping-Ping; Lu, Xiu-Lan; Xiao, Zheng-Hui; Qiu, Jun; Zhu, Yi-Min

2016-05-01

Although beta cell dysfunction has been proved to predict prognosis among humans and animals, its prediction on severity of disease remains unclear among children. The present study was aimed to examine the relationship between beta cell dysfunction and severity of disease among critically ill children.This prospective study included 1146 critically ill children, who were admitted to Pediatric Intensive Care Unit (PICU) of Hunan Children's Hospital from November 2011 to August 2013. Information on characteristics, laboratory tests, and prognostic outcomes was collected. Homeostasis model assessment (HOMA)-β, evaluating beta cell function, was used to divide all participants into 4 groups: HOMA-β = 100% (group I, n = 339), 80% ≤ HOMA-β < 100% (group II, n = 71), 40% ≤ HOMA-β < 80% (group III, n = 293), and HOMA-β < 40% (group IV, n = 443). Severity of disease was assessed using the worst Sequential Organ Failure Assessment (SOFA) score, Pediatric Risk of Mortality (PRISM) III score, incidence of organ damage, septic shock, multiple organ dysfunction syndrome (MODS), mechanical ventilation (MV) and mortality. Logistic regression analysis was used to evaluate the risk of developing poor outcomes among patients in different HOMA-β groups, with group I as the reference group.Among 1146 children, incidence of HOMA-β < 100% was 70.41%. C-peptide and insulin declined with the decrement of HOMA-β (P < 0.01). C-reactive protein and procalcitonin levels, rather than white blood cell, were significantly different among 4 groups (P < 0.01). In addition, the worst SOFA score and the worst PRISMIII score increased with declined HOMA-β. For example, the worst SOFA score in group I, II, III, and IV was 1.55 ± 1.85, 1.71 ± 1.93, 1.92 ± 1.63, and 2.18 ± 1.77, respectively. Furthermore, patients with declined HOMA-β had higher risk of developing septic shock, MODS, MV, and mortality, even after adjusting age, gender, myocardial injury, and lung injury. For instance, compared with group I, the multivariate-adjusted odds ratio (95% confidence interval) for developing septic shock was 2.17 (0.59, 8.02), 2.94 (2.18, 6.46), and 2.76 (1.18, 6.46) among patients in group II, III, and IV, respectively.Beta cell dysfunction reflected the severity of disease among critically ill children. Therefore, assessment of beta cell function is critically important to reduce incidence of adverse events in PICU.

Tau aggregation influences cognition and hippocampal atrophy in the absence of beta-amyloid: a clinico-imaging-pathological study of primary age-related tauopathy (PART).

PubMed

Josephs, Keith A; Murray, Melissa E; Tosakulwong, Nirubol; Whitwell, Jennifer L; Knopman, David S; Machulda, Mary M; Weigand, Stephen D; Boeve, Bradley F; Kantarci, Kejal; Petrucelli, Leonard; Lowe, Val J; Jack, Clifford R; Petersen, Ronald C; Parisi, Joseph E; Dickson, Dennis W

2017-05-01

We investigate whether there is any association between the Braak neurofibrillary tangle (NFT) stage and clinical and MRI features in definite primary age-related tauopathy (PART). We analysed 52 cases with a Braak NFT tangle stage >0 and ≤IV, and a Thal phase of 0 (no beta-amyloid present). Twenty-nine (56%) were female. Median age at death was 88 years (IQR 82-92 years). Fifteen (29%) were TDP-positive (75% TDP stage I), 16 (31%) had argyrophilic grain disease and three (6%) had alpha-synuclein-positive Lewy bodies. TDP-43 inclusion when present were rare and predominantly perivascular. Of the 15 with TDP-43, three showed a moderate number of inclusions and also had hippocampal sclerosis, neuronal intranuclear inclusions and fine neurites of the CA1 region of the hippocampus. Four cases (8%) had an apolipoprotein epsilon 4 (APOE4) allele. There was a significant correlation between age at death and Braak NFT stage (r = 0.32, p = 0.02). After accounting for age at clinical examination, there were significant associations between Braak NFT stage, and WAIS-R Block Design and Trail Making Tests A and B, with higher Braak stage associated with poorer performances. Thirty of the 52 cases had completed an antemortem volumetric head MRI. Two separate MRI analyses revealed an association between higher Braak NFT stage and grey matter atrophy in the head of the left hippocampus. There were no significant clinical or radiologic associations with TDP-43. Findings from this study demonstrate that aggregated tau distribution is associated with poorer cognitive performance, as well as atrophy, in the absence of beta-amyloid. These findings support the parcellation of definite PART as a useful construct. The relatively low frequencies of APOE4, TDP-43, Lewy bodies, and hippocampal sclerosis, and the rarity and morphology of TDP-43 lesions are noted contrasts to what is typically observed in Alzheimer's disease of the old.

Prostaglandin E1 inhibits collagen expression in anti-thymocyte antibody-induced glomerulonephritis: possible role of TGF beta.

PubMed

Schneider, A; Thaiss, F; Rau, H P; Wolf, G; Zahner, G; Jocks, T; Helmchen, U; Stahl, R A

1996-07-01

To test whether or not prostaglandins mediate extracellular matrix formation in immune-mediated glomerular disease, rats with anti-thymocyte antibody-induced glomerulonephritis were treated with prostaglandin E1 (PGE1) (250 micrograms/twice daily/s.c.). Glomerular expression of collagen types III and IV was assessed by Northern blotting, immunohistology and Western blotting. Proliferation of glomerular cells was evaluated by staining for the proliferating cell nuclear antigen (PCNA) and consecutive cell counting. At day five after induction of the disease, glomerular mRNA levels of collagen types III and IV were three- to fivefold higher compared with non-nephritic controls. Similarly glomerular deposition of these collagens was markedly increased when assessed by immunohistology. The treatment of nephritic rats with PGE1 reduced the increased glomerular mRNA levels as well as the protein concentration and the deposition of extracellular collagens. The number of PCNA positive cells which was significantly higher in nephritic rats when compared with control animals (24 hr, nephritis 2.53 +/- 0.33 and Control 0.26 +/- 0.06, P = 0.011; 5 days, nephritis 5.10 +/- 1.13 and Control 0.75 +/- 0.08, cells per glomerular cross section, P = 0.03) was reduced by PGE1 (24 hr, nephritis+PGE1 0.44 +/- 0.30, P = 0.0001; 5 days, nephritis +/- PGE1 1.91 +/- 1.84 cells per glomerular cross section, P = 0.001). Prostaglandin E1 also ameliorated the glomerular infiltration of monocytes at 24 hours (nephritis 4.36 +/- 2.82, nephritis + PGE1 2.20 +/- 1.82, cells per glomerular cross section) and five days (nephritis 1.51 +/- 0.58, nephritis+PGE1 1.12 +/- 0.61, cells per glomerular cross section). To further characterize possible mechanisms by which PGE1 reduces extracellular matrix deposition, the glomerular expression of transforming growth factor (TGF-beta), and interleukin 1 beta (IL-1 beta) was assessed by Northern blotting. Nephritic glomeruli showed increased mRNA levels of TGF-beta at day 5 and IL-1 beta at 24 hours when compared with control kidneys. Treatment of the animals with PGE1 inhibited the mRNA expression of TGF-beta and IL-1 beta. These data demonstrate that PGE1 reduces the glomerular expression of extracellular matrix proteins in anti-thymocyte antibody-induced glomerulonephritis, suggesting a beneficial role of prostaglandins in this proliferative glomerular immune injury. The effects of PGE1 might be mediated by inhibition of TGF-beta and IL-1 beta production.

Anticandidal activity and interleukin-1 beta and interleukin-6 production by polymorphonuclear leukocytes are preserved in subjects with AIDS.

PubMed Central

Cassone, A; Palma, C; Djeu, J Y; Aiuti, F; Quinti, I

1993-01-01

Polymorphonuclear granulocytes (PMN; or neutrophils) from uninfected or human immunodeficiency virus-infected subjects were tested for their ability to inhibit growth of Candida albicans and produce interleukin-1 beta (IL-1 beta) and IL-6 in vitro. It was seen that PMN from AIDS (Centers for Disease Control stage IV) patients expressed equal if not greater anticandidal activity compared with the activity expressed by neutrophils from all other subjects examined. On exposure to granulocyte macrophage-colony-stimulating factor or to a mannoprotein constituent (MP-F2) from C. albicans itself, PMN from AIDS patients showed enhanced antifungal activity and production of remarkable quantities of IL-1 beta and IL-6. These findings suggest that the functional abilities of PMN to inhibit Candida growth and secrete relevant proinflammatory and immunomodulatory cytokines are intrinsically preserved in AIDS patients. PMID:8501241

[Studies on the chemical constituents from the bark of Choerospondias axillaries].

PubMed

Li, Sheng-Hua; Wu, Xian-Jin; Zheng, Yao; Jiang, Chong-Liang

2009-10-01

To study the chemical constituents of Choerospondias axillaries. All compounds were isolated and purified by normal column chromatograph, paper thin layer chromatograph and sephadex chromatograph, the chemical strucures were mainly elucidated by ESI-MS and NMR spectra. seven compouds were isolated from the Choerospondias axillaries and as following: beta-sitostero (I), hexadecanoic acid (II), correctitude fourty-two alkyl acid (III), daucosterol (IV), quercetin (V), rutinum (VI), lueolin-3'-O-beta-D-glucopyranoside (VII). Compounds II, III, V, VII are isolated from this plant for the first time.

[Studies on chemical constituents of Pinus armandii].

PubMed

Yang, Xin; Ding, Yi; Sun, Zhi-hao; Zhang, Dong-ming

2005-05-01

To study chemical constituents from pine cone of Pinus armandii Franch. The constituents were isolated by chromatographic method and the structures were identified on the basis of spectral analysis. Four compounds were identified as 7-oxo-12alpha, 13beta-dihydroxyabiet-8(14)-en18-oic acid (I), 7-oxo-13beta-hydroxyabiet-8 (14)-en-18-oic acid (II), 8 (14)-podocarpen-13-on-18-oic acid (III) and lambertianic acid (IV). Compound I is a new diterpenoid and compounds II, III were isolated from this plant for the first time.

Multiple oral dosing of ketoconazole influences pharmacokinetics of quinidine after intravenous and oral administration in beagle dogs.

PubMed

Kuroha, M; Shirai, Y; Shimoda, M

2004-10-01

In this study, we investigated the effect of multiple oral dosing of ketoconazole (KTZ) on pharmacokinetics of quinidine (QN), a CYP3A substrate with low hepatic clearance, after i.v. and oral administration in beagle dogs. Four dogs were given p.o. KTZ for 20 days (200 mg, b.i.d.). QN was administered either i.v. (1 mg/kg) or p.o. (100 mg) 10 and 20 days before the KTZ treatment and 10 and 20 days after start of KTZ treatment. Multiple oral dosing of KTZ decreased significantly alpha and beta, whereas increased t(1/2beta), V(1), and k(a). The KTZ treatment also decreased significantly both total body clearance (Cl(tot)) and oral clearance (Cl(oral)). No significant change in bioavailability was observed in the presence of KTZ. Co-administration of KTZ increased C(max) of QN to about 1.5-fold. Mean resident time after i.v. administration (MRT(i.v.)), and after oral administration (MRT(p.o.)) of QN were prolonged to about twofold, whereas mean absorption time (MAT) was decreased to 50%. Volume of distribution at steady state (V(d(ss))) of QN was unchanged in the presence of KTZ. These alterations may be because of a decrease in metabolism of QN by inhibition of KTZ on hepatic CYP3A activity. In conclusion, multiple oral dosing of KTZ affected largely pharmacokinetics of QN after i.v. and oral administration in beagle dogs. Therefore, KTZ at a clinical dosing regimen may markedly change the pharmacokinetics of drugs primarily metabolized by CYP3A with low hepatic clearance in dogs. In clinical use, much attention should be paid to concomitant administration of KTZ with the drug when given either p.o. or i.v.

Prolonged survival of dendritic cell-vaccinated melanoma patients correlates with tumor-specific delayed type IV hypersensitivity response and reduction of tumor growth factor beta-expressing T cells.

PubMed

López, Mercedes N; Pereda, Cristian; Segal, Gabriela; Muñoz, Leonel; Aguilera, Raquel; González, Fermín E; Escobar, Alejandro; Ginesta, Alexandra; Reyes, Diego; González, Rodrigo; Mendoza-Naranjo, Ariadna; Larrondo, Milton; Compán, Alvaro; Ferrada, Carlos; Salazar-Onfray, Flavio

2009-02-20

The aim of this work was to assess immunologic response, disease progression, and post-treatment survival of melanoma patients vaccinated with autologous dendritic cells (DCs) pulsed with a novel allogeneic cell lysate (TRIMEL) derived from three melanoma cell lines. Forty-three stage IV and seven stage III patients were vaccinated four times with TRIMEL/DC vaccine. Specific delayed type IV hypersensitivity (DTH) reaction, ex vivo cytokine production, and regulatory T-cell populations were determined. Overall survival and disease progression rates were analyzed using Kaplan-Meier curves and compared with historical records. The overall survival for stage IV patients was 15 months. More than 60% of patients showed DTH-positive reaction against the TRIMEL. Stage IV/DTH-positive patients displayed a median survival of 33 months compared with 11 months observed for DTH-negative patients (P = .0014). All stage III treated patients were DTH positive and remained alive and tumor free for a median follow-up period of 48 months (range, 33 to 64 months). DTH-positive patients showed a marked reduction in the proportion of CD4+ transforming growth factor (TGF) beta+ regulatory T cells compared to DTH-negative patients (1.54% v 5.78%; P < .0001). Our findings strongly suggest that TRIMEL-pulsed DCs provide a standardized and widely applicable source of melanoma antigens, very effective in evoking antimelanoma immune response. To our knowledge, this is the first report describing a correlation between vaccine-induced reduction of CD4+TGFbeta+ regulatory T cells and in vivo antimelanoma immune response associated to improved patient survival and disease stability.

Baldwin Effect and Additional BLR Component in AGN with Superluminal Jets

NASA Astrophysics Data System (ADS)

Patiño Álvarez, Víctor; Torrealba, Janet; Chavushyan, Vahram; Cruz González, Irene; Arshakian, Tigran; León Tavares, Jonathan; Popovic, Luka

2016-06-01

We study the Baldwin Effect (BE) in 96 core-jet blazars with optical and ultraviolet spectroscopic data from a radio-loud AGN sample obtained from the MOJAVE 2cm survey. A statistical analysis is presented of the equivalent widths W_lambda of emission lines H beta 4861, Mg II 2798, C IV 1549, and continuum luminosities at 5100, 3000, and 1350 angstroms. The BE is found statistically significant (with confidence level c.l. > 95%) in H beta and C IV emission lines, while for Mg II the trend is slightly less significant (c.l. = 94.5%). The slopes of the BE in the studied samples for H beta and Mg II are found steeper and with statistically significant difference than those of a comparison radio-quiet sample. We present simulations of the expected BE slopes produced by the contribution to the total continuum of the non-thermal boosted emission from the relativistic jet, and by variability of the continuum components. We find that the slopes of the BE between radio-quiet and radio-loud AGN should not be different, under the assumption that the broad line is only being emitted by the canonical broad line region around the black hole. We discuss that the BE slope steepening in radio AGN is due to a jet associated broad-line region.

Epibatidine, an alkaloid from the poison frog Epipedobates tricolor, is a powerful ganglionic depolarizing agent.

PubMed

Fisher, M; Huangfu, D; Shen, T Y; Guyenet, P G

1994-08-01

Epibatidine, a newly discovered alkaloid from the skin of Dendrobatidae frogs, has structural similarities to nicotine. We examined the effects of epibatidine on cardiorespiratory function and ganglionic synaptic transmission. Superior cervical or splanchnic sympathetic nerve discharge (sSND) and phrenic nerve discharge (PND) were recorded along with arterial pressure (AP) in urethane-anesthetized, paralyzed and artificially ventilated rats. Epibatidine administered i.v. at low doses (0.5-2 micrograms/kg) produced a transient increase in AP and sSND, followed by a decrease and return to baseline; this low dose of epibatidine also produced a dose-dependent increase in PND. At high doses (cumulative dose of 8-16 micrograms/kg), epibatidine produced bradycardia, a profound depression in sSND and a transient elimination of PND. After i.v. administration of the ganglionic blocker chlorisondamine (5 mg/kg), AP was still increased by 1 microgram/kg epibatidine (+39 +/- 11 mm Hg). This pressor effect was not altered by pretreatment with the alpha-1 adrenergic antagonist phentolamine (+40 +/- 10 mm Hg); however, it was blocked by additional pretreatment with the vasopressin antagonist [beta-mercapto-beta,beta-cyclopentamethylenepropiony1, O-ET-Tyr2,Val4,Arg8]vasopressin (50 micrograms/kg i.v.; +2 +/- 0.4 mm Hg). Low doses of epibatidine (0.5-2 micrograms/kg) produced firing of postganglionic neurons in a decentralized ganglion preparation and potentiated synaptic transmission; at high doses (cumulative dose of 8-16 micrograms/kg), the alkaloid blocked ganglionic synaptic transmission. These results suggest that epibatidine is a potent agonist of ganglionic nicotinic receptors and that the alkaloid elicits cardiorespiratory effects similar to those of nicotine.

The quantified EEG characteristics of responders and non-responders to long-term treatment with atomoxetine in children with attention deficit hyperactivity disorders.

PubMed

Chiarenza, Giuseppe Augusto; Chabot, Robert; Isenhart, Robert; Montaldi, Luciano; Chiarenza, Marco Paolo; Torto, Maria Grazia Lo; Prichep, Leslie S

2016-06-01

The aim of our study is to examine quantitative Electroencephalogram (QEEG) differences between ADHD patients that are responders and non-responders to long-term treatment with Atomoxetine at baseline and after 6 and 12months of treatment. Patients with attention deficit hyperactivity disorder (ADHD) received atomoxetine titrated, over 7days, from 0.5 to 1.2mg/kg/day. QEEG and Swanson, Nolan, and Pelham-IV Questionnaire (SNAP-IV) scores were recorded before treatment and after therapy. Twenty minutes of eyes closed resting EEG was recorded from 19 electrodes referenced to linked earlobes. Full frequency and narrow band spectra of two minutes of artifact-free EEG were computed as well as source localization using Variable Resolution Electrical Tomography (VARETA). Abnormalities were identified using Z-spectra relative to normative values. Patients were classified as responders, non-responders and partial responders based upon the SNAP-IV findings. At baseline, the responders showed increased absolute power in alpha and delta in frontal and temporal regions, whereas, non-responders showed increased absolute power in all frequency bands that was widely distributed. With treatment responders' absolute power values moved toward normal values, whereas, non-responders remained at baseline values. Patients with increased power in the alpha band with no evidence of alterations in the beta or theta range, might be responders to treatment with atomoxetine. Increased power in the beta band coupled with increased alpha seems to be related to non-responders and one should consider atomoxetine withdrawal, especially if there is persistence of increased alpha and beta accompanied by an increase of theta. Copyright © 2016 Elsevier B.V. All rights reserved.

Beta-hairpin formation in aqueous solution and in the presence of trifluoroethanol: a (1)H and (13)C nuclear magnetic resonance conformational study of designed peptides.

PubMed

Santiveri, Clara M; Pantoja-Uceda, David; Rico, Manuel; Jiménez, M Angeles

2005-10-15

In order to check our current knowledge on the principles involved in beta-hairpin formation, we have modified the sequence of a 3:5 beta-hairpin forming peptide with two different purposes, first to increase the stability of the formed 3:5 beta-hairpin, and second to convert the 3:5 beta-hairpin into a 2:2 beta-hairpin. The conformational behavior of the designed peptides was investigated in aqueous solution and in 30% trifluoroethanol (TFE) by analysis of the following nuclear magnetic resonance (NMR) parameters: nuclear Overhauser effect (NOE) data, and C(alpha)H, (13)C(alpha), and (13)C(beta) conformational shifts. From the differences in the ability to adopt beta-hairpin structures in these peptides, we have arrived to the following conclusions: (i) beta-Hairpin population increases with the statistical propensity of residues to occupy each turn position. (ii) The loop length, and in turn, the beta-hairpin type, can be modified as a function of the type of turn favored by the loop sequence. These two conclusions reinforce previous results about the importance of beta-turn sequence in beta-hairpin folding. (iii) Side-chain packing on each face of the beta-sheet may play a major role in beta-hairpin stability; hence simplified analysis in terms of isolated pair interactions and intrinsic beta-sheet propensities is insufficient. (iv) Contributions to beta-hairpin stability of turn and strand sequences are not completely independent. (v) The burial of hydrophobic surface upon beta-hairpin formation that, in turn, depends on side-chain packing also contributes to beta-hairpin stability. (vi) As previously observed, TFE stabilizes beta-hairpin structures, but the extent of the contribution of different factors to beta-hairpin formation is sometimes different in aqueous solution and in 30% TFE. (c) 2005 Wiley Periodicals, Inc. Biopolymers 79: 150-162, 2005.

Dual response of BDNF to sublethal concentrations of beta-amyloid peptides in cultured cortical neurons.

PubMed

Aliaga, E; Silhol, M; Bonneau, N; Maurice, T; Arancibia, S; Tapia-Arancibia, L

2010-01-01

Beta-amyloid (Abeta) deposition is one important pathological hallmark in Alzheimer's disease (AD). However, low levels of Abeta may modify critical endogenous protection systems before neurodegeneration occurs. We examined the time-course effect of sublethal concentrations of Abeta on total BDNF (panBDNF), BDNF transcripts (I, II, IV and VI), trkB.FL, trkB.T1 and p75(NGFR) mRNA expression in cultured cortical neurons. We have shown that Abeta exhibited a dual response on BDNF mRNA, i.e. an increase at short times (3-5 h) and a dramatic decrease at longer times (24 or 48 h). The early increase in BDNF expression seems to be driven by increased expression of transcripts I and IV. The BDNF drop was specific since did not occur for other mRNAs examined. The BDNF protein content showed a similar profile but did not follow the dramatic reduction as its encoding mRNA. These observations may help to explain cognitive deficits observed at initial stages of AD.

[Studies on the chemical constituents of the ethyl acetate portion of Nervilia fordii].

PubMed

Zhen, Han-shen; Zhou, Yan-yuan; Yuan, Ye-fei; Mo, Huan-heng; Zhong, Zhen-guo; Liang, Chen-yan

2007-08-01

To study the chemical constituents of the ethyl acetate portion in the herb of Nervilia fordii from guangxi. The constituents were separated and purified by using column chromatography with silica gel. These compounds were identified by their physical and spectral data. Five compounds were isolated and identified as norleucine (crystal I), 24 (S/beta)-dihydrocycloeucalenol-(E)-p-hydroxy cinnamate (crystal II) , rhamnocitrin (crystal III), rhamnazin (crystal IV), daucosterol (crystal V). Compounds I , II, III, IV, V were isolated from this plant for the first time.

Synthesis of guanosine and its derivatives from 5-amino-1-beta-D-ribofuranosyl-e-imidazolecarboxamide. IV. A new route to guanosine via cyanamide derivative.

PubMed Central

Yamazaki, A; Okutsu, M; Yamada, Y

1976-01-01

4-Cyanamido-5-imidazolecarboxamide (IV) was prepared by brief treatment of 5-(S-methylisothiocarbamoyl) amino-4-imidazolecarboxamide (V) with alkali. Compound VI was converted in an alkaline solution to either guanine (VII) or isoguanine (VIII), depending on the concentration of alkali. This procedure was applied to the synthesis of 2',3'-0-isopropylideneguanosine (XVI) from the riboside of 5-(N'-benzoyl-S-methylthiocarbamoyl) amino-4-imidazolecarboxamide (IX), PROviding a new route to XVI. PMID:1250702

A cytotoxic and apoptosis-inducing sesquiterpenoid isolated from the aerial parts of Artemisia princeps PAMPANINI (Sajabalssuk).

PubMed

Bang, Myun-Ho; Han, Min-Woo; Song, Myoung-Chong; Cho, Jin-Gyeong; Chung, Hae-Gon; Jeong, Tae-Sook; Lee, Kyung-Tae; Choi, Myung-Sook; Kim, Se-Young; Baek, Nam-In

2008-08-01

Repeated silica gel and octadecyl silica gel (ODS) column chromatography of the aerial parts of Artemisia princeps PAMPANINI (Sajabalssuk) led to the isolation of a new sesquiterpenoid, 3-((S)-2-methylbutyryloxy)-costu-1(10),4(5)-dien-12,6 alpha-olide (2), along with two previously reported sesquiterpenoids: 8 alpha-angeloyloxy-3beta,4 beta-epoxy-6 beta H,7 alpha H,8 beta H-guaia-1(10),11(13)-dien-12,6 alpha-olide (1, carlaolide B) and 3beta,4 beta-epoxy-8 alpha-isobutyryloxy-6 beta H,7 alpha H,8 beta H-guaia-1(10),11(13)-dien-12,6 alpha-olide (3, carlaolide A). The structure of compound 2 was elucidated by spectroscopic data analysis, including one dimensional (1D) and two dimensional (2D) nuclear magnetic resonance (NMR) experiments. Of the isolates, compound 2 exhibited potent cytotoxicity against human cervix adenocarcinoma cells and induced apoptosis.

A combination of cytokines EGF and CNTF protects the functional beta cell mass in mice with short-term hyperglycaemia.

PubMed

Lemper, Marie; De Groef, Sofie; Stangé, Geert; Baeyens, Luc; Heimberg, Harry

2016-09-01

When the beta cell mass or function declines beyond a critical point, hyperglycaemia arises. Little is known about the potential pathways involved in beta cell rescue. As two cytokines, epidermal growth factor (EGF) and ciliary neurotrophic factor (CNTF), restored a functional beta cell mass in mice with long-term hyperglycaemia by reprogramming acinar cells that transiently expressed neurogenin 3 (NGN3), the current study assesses the effect of these cytokines on the functional beta cell mass after an acute chemical toxic insult. Glycaemia and insulin levels, pro-endocrine gene expression and beta cell origin, as well as the role of signal transducer and activator of transcription 3 (STAT3) signalling, were assessed in EGF+CNTF-treated mice following acute hyperglycaemia. The mice were hyperglycaemic 1 day following i.v. injection of the beta cell toxin alloxan, when the two cytokines were applied. One week later, 68.6 ± 4.6% of the mice had responded to the cytokine treatment and increased their insulin(+) cell number to 30% that of normoglycaemic control mice, resulting in restoration of euglycaemia. Although insulin(-) NGN3(+) cells appeared following acute EGF+CNTF treatment, genetic lineage tracing showed that the majority of the insulin(+) cells originated from pre-existing beta cells. Beta cell rescue by EGF+CNTF depends on glycaemia rather than on STAT3-induced NGN3 expression in acinar cells. In adult mice, EGF+CNTF allows the rescue of beta cells in distress when treatment is given shortly after the diabetogenic insult. The rescued beta cells restore a functional beta cell mass able to control normal blood glucose levels. These findings may provide new insights into compensatory pathways activated early after beta cell loss.

Early Intravenous Beta-Blockers in Patients With ST-Segment Elevation Myocardial Infarction Before Primary Percutaneous Coronary Intervention.

PubMed

Roolvink, Vincent; Ibáñez, Borja; Ottervanger, Jan Paul; Pizarro, Gonzalo; van Royen, Niels; Mateos, Alonso; Dambrink, Jan-Henk E; Escalera, Noemi; Lipsic, Erik; Albarran, Agustín; Fernández-Ortiz, Antonio; Fernández-Avilés, Francisco; Goicolea, Javier; Botas, Javier; Remkes, Wouter; Hernandez-Jaras, Victoria; Kedhi, Elvin; Zamorano, José L; Navarro, Felipe; Alfonso, Fernando; García-Lledó, Alberto; Alonso, Joaquin; van Leeuwen, Maarten; Nijveldt, Robin; Postma, Sonja; Kolkman, Evelien; Gosselink, Marcel; de Smet, Bart; Rasoul, Saman; Piek, Jan J; Fuster, Valentin; van 't Hof, Arnoud W J

2016-06-14

The impact of intravenous (IV) beta-blockers before primary percutaneous coronary intervention (PPCI) on infarct size and clinical outcomes is not well established. This study sought to conduct the first double-blind, placebo-controlled international multicenter study testing the effect of early IV beta-blockers before PPCI in a general ST-segment elevation myocardial infarction (STEMI) population. STEMI patients presenting <12 h from symptom onset in Killip class I to II without atrioventricular block were randomized 1:1 to IV metoprolol (2 × 5-mg bolus) or matched placebo before PPCI. Primary endpoint was myocardial infarct size as assessed by cardiac magnetic resonance imaging (CMR) at 30 days. Secondary endpoints were enzymatic infarct size and incidence of ventricular arrhythmias. Safety endpoints included symptomatic bradycardia, symptomatic hypotension, and cardiogenic shock. A total of 683 patients (mean age 62 ± 12 years; 75% male) were randomized to metoprolol (n = 336) or placebo (n = 346). CMR was performed in 342 patients (54.8%). Infarct size (percent of left ventricle [LV]) by CMR did not differ between the metoprolol (15.3 ± 11.0%) and placebo groups (14.9 ± 11.5%; p = 0.616). Peak and area under the creatine kinase curve did not differ between both groups. LV ejection fraction by CMR was 51.0 ± 10.9% in the metoprolol group and 51.6 ± 10.8% in the placebo group (p = 0.68). The incidence of malignant arrhythmias was 3.6% in the metoprolol group versus 6.9% in placebo (p = 0.050). The incidence of adverse events was not different between groups. In a nonrestricted STEMI population, early intravenous metoprolol before PPCI was not associated with a reduction in infarct size. Metoprolol reduced the incidence of malignant arrhythmias in the acute phase and was not associated with an increase in adverse events. (Early-Beta blocker Administration before reperfusion primary PCI in patients with ST-elevation Myocardial Infarction [EARLY-BAMI]; EudraCT no: 2010-023394-19). Copyright © 2016 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Design and Characterization of p-i-n Devices for Betavoltaic Microbatteries on Gallium Nitride

NASA Astrophysics Data System (ADS)

Khan, Muhammad Raziuddin A.

Betavoltaic microbatteries convert nuclear energy released as beta particles directly into electrical energy. These batteries are well suited for electrical applications such as micro-electro-mechanical systems (MEMS), implantable medical devices and sensors. Such devices are often located in hard to access places where long life, micro-size and lightweight are required. The working principle of a betavoltaic device is similar to a photovoltaic device; they differ only in that the electron hole pairs (EHPs) are generated in the device by electrons instead of photons. In this study, the performance of a betavoltaic device fabricated from gallium nitride (GaN) is investigated for beta particle energies equivalent to Tritium (3H) and Nickel-63 (N63) beta sources. GaN is an attractive choice for fabricating betavoltaic devices due to its wide band gap and radiation resistance. Another advantage GaN has is that it can be alloyed with aluminum (Al) to further increase the bandgap, resulting in a higher output power and increased efficiency. Betavoltaic devices were fabricated on p-i-n GaN structures grown by metalorganic chemical vapor deposition (MOCVD). The devices were characterized using current - voltage (IV) measurements without illumination (light or beta), using a laser driven light source, and under an electron beam. Dark IV measurements showed a turn on-voltage of ~ 3.4 V, specific-on-resistance of 15.1 m O-cm2, and a leakage current of 0.5 mA at -- 10 V. A clear photo-response was observed when IV curves were measured for these devices under a light source at a wavelength of 310 nm (4.0 eV). These devices were tested under an electron beam in order to evaluate their behavior as betavoltaic microbatteries without using radioactive materials. Output power of 70 nW and 640 nW with overall efficiencies of 1.2% and 4.0% were determined at the average energy emission of 3H (5.6 keV) and 63N (17 keV) respectively.

The large-scale placebo-controlled beta-blocker studies in systolic heart failure revisited: results from CIBIS-II, COPERNICUS and SENIORS-SHF compared with stratified subsets from MERIT-HF.

PubMed

Wikstrand, J; Wedel, H; Castagno, D; McMurray, J J V

2014-02-01

The four pivotal beta-blocker trials in heart failure (HF) had different inclusion criteria, making comparison difficult without patient stratifying. The aim of this study was to compare, in similar patients, the effects of bisoprolol, metoprolol controlled release/extended release (CR/XL), carvedilol and nebivolol on (i) total mortality, (ii) all-cause mortality or hospitalization due to cardiovascular causes (time to first event), (iii) all-cause mortality or hospitalization because of HF and (iv) tolerability, defined as discontinuation of randomized treatment. We compared stratified (s ) subsets in MERIT-HF with patients in CIBIS-II [New York Heart Association (NYHA) class III/IV and ejection fraction (EF) ≤ 35%] and COPERNICUS (NYHA III/IV and EF <25%) and in patients with systolic HF in SENIORS-SHF (age ≥ 70 years and EF ≤ 35%). The annual mortality rates in the placebo and beta-blocker arms were: (i) CIBIS-II (n = 2647), 13.2% vs. 8.8% (relative risk reduction 34%, 95% CI: 19-46, P < 0.0001) and MERIT-HFs (n = 2002), 14.8% vs. 8.6% (relative risk reduction 42%, 95% CI: 24-56, P < 0.0001); (ii) COPERNICUS (n = 2289), 19.7% vs. 12.8% (relative risk reduction 35%, 95% CI: 19-48, P = 0.0014) and MERIT-HFs (n = 795), 19.1% vs. 11.7% (relative risk reduction 39%; 95% CI: 11-58, P = 0.0086); (iii) SENIORS-SHF (n = 1359), 11.3% vs. 9.7% (relative risk reduction 16%, NS) and MERIT-HFs (n = 985), 14.8% vs. 10.1% (relative risk reduction 32%, 95% CI: 2-53, P = 0.038). The effects on the other outcomes assessed were similar. Analyses indicated fewer discontinuations from randomized treatment on beta-blockers compared with placebo in COPERNICUS and the MERIT-HFs subsets. The efficacy and tolerability of bisoprolol, carvedilol and metoprolol CR/XL are similar in patients with systolic HF, irrespective of NYHA class or ejection fraction. Nebivolol is less effective and not better tolerated. © 2013 The Association for the Publication of the Journal of Internal Medicine.

76 FR 36095 - Defense Transportation Regulation, Part IV

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-21

... with the Defense Personal Property Program (DP3) Phase III Domestic Small Shipments (dS2) and... Regulation, Part IV Web site at http://www.transcom.mil/dtr/part-iv/phaseiii.cfm . All identified changes... based on completion of Defense Personal Property System (DPS) Phase III programming projected for FY15...

[Organprotection in cardiac risk patients--rational of perioperative beta-adrenoceptor-antagonists and statins].

PubMed

Hanss, Robert; Bein, Berthold

2010-04-01

The number of patients with limited organ function is steadily increasing due to the aging of the population. Consequently, a growing number of patients needing surgery is accompanied by serious comorbidities. These patients are at high risk of perioperative organ dysfunction. In this context cardiac events (e.g. cardiac arrhythmias, angina or myocardial infarction) play a major role with significant impact on postoperative care, long term outcome and economic sequelae. Thus, anaesthesiologists must prevent such events in the perioperative period. Besides general measures such as adequate analgesia, protection from stressful events and sufficient volume replacement, medical intervention with beta-blockers or HMG-CoA-reductase-inhibitors (statins) are necessary to reduce the incidence of perioperative cardiac events. Both beta-blockers and HMG-CoA-reductase-inhibitors are known to exhibit pleiotropic effects (defined as additional cardioprotective effects) besides the primary blockade of the beta-adrenergic receptor or the inhibition of the synthesis of serum cholesterol, respectively. Both groups of drugs improve cardiac function, decrease inflammatory response, decrease activation of blood coagulation and stabilize endothelial plaques. Based on the current literature the following recommendations are published concerning the perioperative administration of beta-blockers: (i) Patients who are on beta-blockers on a regular basis following guidelines concerning chronic treatment of cardiovascular diseases should continue this medication throughout the perioperative period; (ii) a sufficient indicator of an adequate therapy is the baseline heart rate. It should not exceed 60-70bpm at rest; (iii) the Revised Cardiac Risk Index (RCRI) is a widely accepted score to estimate the patient's perioperative cardiac risk; (iv) patients with a RCRI > or =3 should not be scheduled for routine surgery without sufficient beta-adrenergic-receptor blockade; (v) in patients at high cardiac risk based on the RCRI who are scheduled for emergency surgery beta-blocker-therapy should not be initiated de novo perioperatively. However, for perioperative treatment of tachycardia or hypertension beta-blockers are the drug of first choice. Concerning perioperative statin-therapy the following recommendations are suggested: (i) chronic statin-therapy should be continued throughout surgery and the perioperative period; (ii) in patients without chronic statin-therapy scheduled for vascular surgery this treatment should be started perioperativly; (iii) no data is available concerning other patient populations; (iv) if statin-therapy is indicated it should be started independently from baseline serum LDL-C-concentration; (v) side effects of statin-therapy are rare and usually not live threatening, thus treatment is considered to be without serious risks to the patient. Georg Thieme Verlag Stuttgart. New York.

Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes.

PubMed

El Ghalbzouri, Abdoelwaheb; Jonkman, Marcel F; Dijkman, Remco; Ponec, Maria

2005-01-01

This study was undertaken to examine the role fibroblasts play in the formation of the basement membrane (BM) in human skin equivalents. For this purpose, keratinocytes were seeded on top of fibroblast-free or fibroblast-populated collagen matrix or de-epidermized dermis and cultured in the absence of serum and exogenous growth factors. The expression of various BM components was analyzed on the protein and mRNA level. Irrespective of the presence or absence of fibroblasts, keratin 14, hemidesmosomal proteins plectin, BP230 and BP180, and integrins alpha1beta1, alpha2beta1, alpha3beta1, and alpha6beta4 were expressed but laminin 1 was absent. Only in the presence of fibroblasts or of various growth factors, laminin 5 and laminin 10/11, nidogen, uncein, type IV and type VII collagen were decorating the dermal/epidermal junction. These findings indicate that the attachment of basal keratinocytes to the dermal matrix is most likely mediated by integrins alpha1beta1 and alpha2beta1, and not by laminins that bind to integrin alpha6beta4 and that the epithelial-mesenchymal cross-talk plays an important role in synthesis and deposition of various BM components.

Studies on the mechanism of salicylate-induced increase of insulin secretion in man.

PubMed

Giugliano, D; Cozzolino, D; Ceriello, A; Cerciello, T; Varano, R; Saccomanno, F; Torella, R

1988-01-01

Salicylate compounds are known to increase basal and stimulated insulin secretion in man. In our studies, infusion of lysine acetylsalicylate (72 mg/min) increased basal insulin levels and amplified insulin responses to glucose (5 g i.v.), arginine (5 g i.v.) and tolbutamide (1 g i.v.). Verapamil, an organic calcium antagonist, did not modify LAS-induced increase of basal insulin levels, but reduced the effect of LAS on glucose-induced insulin secretion. Calcitonin and somatostatin, two agents that inhibit basal and glucose-stimulated insulin secretion, inhibited the insulin response to glucose in presence of LAS infusion. The ability of salicylate compounds to augment insulin secretion might be due to multiple sites of action in the Beta-cells.

Cocaine action on peripheral, non-monoamine neural substrates as a trigger of electroencephalographic desynchronization and electromyographic activation following i.v. administration in freely moving rats.

PubMed

Smirnov, M S; Kiyatkin, E A

2010-01-20

Many important physiological, behavioral and subjective effects of i.v. cocaine (COC) are exceptionally rapid and transient, suggesting a possible involvement of peripheral neural substrates in their triggering. In the present study, we used high-speed electroencephalographic (EEG) and electromyographic (EMG) recordings (4-s resolution) in freely moving rats to characterize the central electrophysiological effects of i.v. COC at low doses within a self-administration range (0.25-1.0 mg/kg). We found that COC induces rapid, strong, and prolonged desynchronization of cortical EEG (decrease in alpha and increase in beta and gamma activity) and activation of the neck EMG that begin within 2-6 s following the start of a 10-s injection; immediate components of both effects were dose-independent. The rapid effects of COC were mimicked by i.v. COC methiodide (COC-MET), a derivative that cannot cross the blood-brain barrier. At equimolar doses (0.33-1.33 mg/kg), COC-MET had equally fast and strong effects on EEG and EMG total powers, decreasing alpha and increasing beta and gamma activities. Rapid EEG desynchronization and EMG activation was also induced by i.v. procaine, a structurally similar, short-acting local anesthetic with virtually no effects on monoamine uptake; at equipotential doses (1.25-5.0 mg/kg), these effects were weaker and shorter in duration than those of COC. Surprisingly, i.v. saline injection delivered during slow-wave sleep (but not during quiet wakefulness) also induced a transient EEG desynchronization but without changes in EMG and motor activity; these effects were significantly weaker and much shorter than those induced by all tested drugs. These data suggest that in awake animals, i.v. COC induces rapid cortical activation and a subsequent motor response via its action on peripheral non-monoamine neural elements, involving neural transmission via visceral sensory pathways. By providing a rapid neural signal and triggering neural activation, such an action might play a crucial role in the sensory effects of COC, thus contributing to the learning and development of drug-taking behavior.

[Triterpenes and triterpene glycosides from aerial part of Paraboea glutinosa].

PubMed

Wang, Xiaoqin; Peng, Yong; Xu, Lijia; Xiao, Wei; Xiao, Peigen; Liu, Yong

2009-05-01

To investigate the chemical constituents from aerial part of Paraboea glutinosa. The compounds were isolated with silica gel, Sephadex LH-20 column chromatography and their structures were elucidated by means of spectral data analysis. Five compounds were isolated and identified as 2alpha, 3beta, 19alpha, 24-tetrahydroxyurs-12-en-28-oate(24-hydroxytormentic acid,1), glucosyl-2alpha, 3beta, 19alpha, 24-tetrahydroxyurs-12-en-28-oate (24-hydroxytormentic acid ester glucoside,2), 28-O-beta-D-glucopyranosyl (1-->6)-beta-D-glucopyranosyl-24-hydroxytormentic acid (3), beta-sitosterol (4), daucosterol (5). All these compounds were isolated from the genus Paraboea for the first time.

The Beta Pictoris circumstellar disk. XV - Highly ionized species near Beta Pictoris

NASA Technical Reports Server (NTRS)

Deleuil, M.; Gry, C.; Lagrange-Henri, A.-M.; Vidal-Madjar, A.; Beust, H.; Ferlet, R.; Moos, H. W.; Livengood, T. A.; Ziskin, D.; Feldman, P. D.

1993-01-01

Temporal variations of the Fe II, Mg II, and Al III circumstellar lines towards Beta Pictoris have been detected and monitored since 1985. However, the unusual presence of Al III ions is still puzzling, since the UV stellar flux from an A5V star such as Beta Pic is insufficient to produce such an ion. In order to better define the origin of such a phenomenon, new observations have been carried out to detect faint signatures of other highly ionized species in the short UV wavelength range, where the stellar continuum flux is low. These observations reveal variations not only near the C IV doublet lines, but also in C I and Al II lines, two weakly ionized species, not clearly detectable until now. In the framework of an infalling body scenario, highly ionized species would be created in the tail, far from the comet head, by collisions with ambient gas surrounding the star, or a weak stellar wind. Spectral changes have also been detected near a CO molecular band location, which, if confirmed, would provide the first molecular signature around Beta Pictoris.

(2R)-4-Oxo-4[3-(Trifluoromethyl)-5,6-diihydro:1,2,4}triazolo[4,3-a}pyrazin-7(8H)-y1]-1-(2,4,5-trifluorophenyl)butan-2-amine: A Potent, Orally Active Dipeptidyl Peptidase IV Inhibitor for the Treatment of Type 2 Diabetes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, D.; Wang, L.; Beconi, M.

2010-11-10

A novel series of {beta}-amino amides incorporating fused heterocycles, i.e., triazolopiperazines, were synthesized and evaluated as inhibitors of dipeptidyl peptidase IV (DPP-IV) for the treatment of type 2 diabetes. (2R)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-amine (1) is a potent, orally active DPP-IV inhibitor (IC{sub 50} = 18 nM) with excellent selectivity over other proline-selective peptidases, oral bioavailability in preclinical species, and in vivo efficacy in animal models. MK-0431, the phosphate salt of compound 1, was selected for development as a potential new treatment for type 2 diabetes.

Physico-chemical properties and performance of high oleic and palm-based shortenings.

PubMed

Ramli, Muhamad Roddy; Lin, Siew Wai; Yoo, Cheah Kien; Idris, Nor Aini; Sahri, Miskandar Mat

2008-01-01

Solid fat from fractionation of palm-based products was converted into cake shortening at different processing conditions. High oleic palm stearin with an oleic content of 48.2 % was obtained from fractionation of high oleic palm oil which was produced locally. Palm product was blended with different soft oils at pre-determined ratio and further fractionated to obtain the solid fractions. These fractions were then converted into cake shortenings named as high oleic, N1 and N2 blends. The physico-chemical properties of the experimental shortenings were compared with those of control shortenings in terms of fatty acid composition (FAC), iodine value (IV), slip melting point (SMP), solid fat content (SFC) and polymorphic forms. Unlike the imported commercial shortenings as reported by other studies and the control, experimental shortenings were trans-free. The SMP and SFC of experimental samples, except for the N2 sample, fell within the ranges of commercial and control shortenings. The IV was higher than those of domestic shortenings but lower when compared to imported and control shortenings. They were also observed to be beta tending even though a mixture of beta and beta' was observed in the samples after 3 months of storage. The shortenings were also used in the making of pound cake and sensory evaluation showed the good performance of high oleic sample as compared to the other shortenings.

Ovarian carcinoma ascites spheroids adhere to extracellular matrix components and mesothelial cell monolayers.

PubMed

Burleson, Kathryn M; Casey, Rachael C; Skubitz, Keith M; Pambuccian, Stephan E; Oegema, Theodore R; Skubitz, Amy P N

2004-04-01

Ovarian carcinoma cells form multicellular aggregates, or spheroids, in the peritoneal cavity of patients with advanced disease. The current paradigm that ascites spheroids are non-adhesive leaves their contribution to ovarian carcinoma dissemination undefined. Here, spheroids obtained from ovarian carcinoma patients' ascites were characterized for their ability to adhere to molecules encountered in the peritoneal cavity, with the goal of establishing their potential to contribute to ovarian cancer spread. Spheroids were recovered from the ascites fluid of 11 patients with stage III or stage IV ovarian carcinoma. Adhesion assays to extracellular matrix (ECM) proteins and human mesothelial cell monolayers were performed for each of the ascites spheroid samples. Subsequently, inhibition assays were performed to identify the cell receptors involved. Most ascites samples adhered moderately to fibronectin and type I collagen, with reduced adhesion to type IV collagen and laminin. Monoclonal antibodies against the beta1 integrin subunit partially inhibited this adhesion. Ascites spheroids also adhered to hyaluronan. Additionally, spheroids adhered to live, but not fixed, human mesothelial cell monolayers, and this adhesion was partially mediated by beta1 integrins. The cellular content of the ascites fluid has often been considered non-adhesive, but our findings are the first to suggest that patient-derived ascites spheroids can adhere to mesothelial extracellular matrix via beta1 integrins, indicating that spheroids should not be ignored in the dissemination of ovarian cancer.

Metabolic Stress and Compromised Identity of Pancreatic Beta Cells

PubMed Central

Swisa, Avital; Glaser, Benjamin; Dor, Yuval

2017-01-01

Beta cell failure is a central feature of type 2 diabetes (T2D), but the molecular underpinnings of the process remain only partly understood. It has been suggested that beta cell failure in T2D involves massive cell death. Other studies ascribe beta cell failure to cell exhaustion, due to chronic oxidative or endoplasmic reticulum stress leading to cellular dysfunction. More recently it was proposed that beta cells in T2D may lose their differentiated identity, possibly even gaining features of other islet cell types. The loss of beta cell identity appears to be driven by glucotoxicity inhibiting the activity of key beta cell transcription factors including Pdx1, Nkx6.1, MafA and Pax6, thereby silencing beta cell genes and derepressing alternative islet cell genes. The loss of beta cell identity is at least partly reversible upon normalization of glycemia, with implications for the reversibility of T2D, although it is not known if beta cell failure reaches eventually a point of no return. In this review we discuss current evidence for metabolism-driven compromised beta cell identity, key knowledge gaps and opportunities for utility in the treatment of T2D. PMID:28270834

Metabolic Stress and Compromised Identity of Pancreatic Beta Cells.

PubMed

Swisa, Avital; Glaser, Benjamin; Dor, Yuval

2017-01-01

Beta cell failure is a central feature of type 2 diabetes (T2D), but the molecular underpinnings of the process remain only partly understood. It has been suggested that beta cell failure in T2D involves massive cell death. Other studies ascribe beta cell failure to cell exhaustion, due to chronic oxidative or endoplasmic reticulum stress leading to cellular dysfunction. More recently it was proposed that beta cells in T2D may lose their differentiated identity, possibly even gaining features of other islet cell types. The loss of beta cell identity appears to be driven by glucotoxicity inhibiting the activity of key beta cell transcription factors including Pdx1, Nkx6.1, MafA and Pax6, thereby silencing beta cell genes and derepressing alternative islet cell genes. The loss of beta cell identity is at least partly reversible upon normalization of glycemia, with implications for the reversibility of T2D, although it is not known if beta cell failure reaches eventually a point of no return. In this review we discuss current evidence for metabolism-driven compromised beta cell identity, key knowledge gaps and opportunities for utility in the treatment of T2D.

[The mechanism of vasculogenesis: the critical role of transforming growth factor-beta 1 in the formation of vessel-like structures during the differentiation in vitro of murine embryonic stem cells].

PubMed

Tsung, H C; Yao, Z

1996-09-01

When ES-5 cells were transfected with an exogenous porcine TGF-beta 1 gene, one can obtain clones of genetically modified ES cells with over-expression of the transfected gene. We called the genetically modified ES-5 cells as ES-T cells. When ES-T cells were used to study their differentiation in vitro by all trans-retinoic acid (RA), it was soon noticed that embryoid bodies of ES-T cells can exclusively differentiate into endothelial cells and vessel-like structures, but not in their parent ES-5 cells. The above result is the first indication that the differentiation of tubular structures in embryoid bodies of ES-T cells may somehow be related to TGF-beta 1. To demonstrate further the role of TGF-beta 1 in the formation of vessel-like structures, the cultured ES-5 cells in the presence of added rhTGF-beta 1 were closely followed in the course of their differentiation. We have, thus, demonstrated the promoting effects of exogenous rhTGF-beta 1 in the formation of vessel-like structures, morphologically similar to those structures derived from ES-T6 cells, during the differentiation of ES-5 cells, both in monolayer culture, in three dimensional collagen gel and in embryoid bodies cultured on gelatin-coated tissue culture wells. Addition of suitable amount of anti-TGF-beta 1 monoclonal antibody IgG (TB21) to the culture medium of embryoid bodies of ES-T6 cells could effectively abolish the formation of vessel-like structures induced by retinoic acid. The percentage of the inhibition was very high, giving a figure comparable to that of atypical vessel-like structures formed in the control embryoid bodies from their parent ES-5 cells. The flat epithelial-like cells and round cells differentiated from embryoid bodies of ES-T6 cells were stained rather strongly for laminin and type IV collagen by immunofluorescent procedure. The above results indicate clearly that TGF-beta 1 is a crucial factor in organizing the differentiated derivatives (endothelial-like cells and their immediate progenitor cells) from ES-T6 cells to form vessel-like structures, and that the role of TGF-beta 1 in vasculogenesis might be performed, in part, through the modulation of the composition and organization of the extracellular matrix. In addition, the enhanced expression of bFGF mRNA in derivatives differentiated from both ES-5 cells treated with rhTGF-beta 1 and ES-T6 cells were detected by Northern blot analysis. Thus, aside from its effects on extracellular matrix, TGF-beta 1 might also modulate the bioactivity of bFGF in relation to the growth of vascular endothelial cells in the present system.

[Chemical constituents in aerial part of Reineckea carnea].

PubMed

Xu, Xin; Fu, Hong-Zheng

2008-10-01

To study the chemical constituents in the aerial part of Reineckea carnea. The compounds were isolated by extraction, silica gel, gel, and reversed-phase silica gel coloum chromatography, and high-performance liquid chromatography. The structures were identified by various spectroscopic methods including 1D and 2D NMR spectrum, MS, IR, etc. Six compounds were isolated and identified as 1alpha, 3beta-dihydroxy-5beta-pregn-16-en-20-one-3-O-beta-D-glucopyranoside (1), syringaresinol-beta-D-glucoside (2), sophoraflavone B (3), stigmast-5, 22-dien-3-O-beta-D-glucopyranoside (4), daucosterol (5), a-D-glucose (6). Compound 1 was a new compound, coumpounds 2-6 were obtained from the plant for the first time.

Trypanocidal constituents in plants 6. 1) Minor withanolides from the aerial parts of Physalis angulata.

PubMed

Abe, Fumiko; Nagafuji, Shinya; Okawa, Masafumi; Kinjo, Junei

2006-08-01

Further study of the methanol extract of the aerial parts of Physalis angulata (Solanaceae) resulted in the isolation of new withanolides, designated physagulins L, M and N, together with known withanolide, physagulin D and flavonol glycoside, quercetin 3-O-rhamnosyl-(1-->6)-galactoside. The chemical structures of these new withanolides were elucidated by detailed spectroscopic analyses to be (20R,22R)-15alpha-acetoxy-5alpha,6beta,14beta,17beta,27-pentahydroxy-1-oxo-witha-2, 24-dienolide, (20S,22S)-15alpha-acetoxy-5alpha,6beta,14alpha,23beta-tetrahydroxy-1-oxo-witha-2,16,24-trienolide and (20S,22R)-15alpha-acetoxy-5beta,6beta-epoxy-14alpha-hydoxy-3beta-methoxy-1-oxo-witha-16,24-dienolide, respectively. All these compounds showed weak trypanocidal activity against trypomastigotes, an infectious form of Trypanosoma cruzi, the etiologic agent for Chagas' disease. Withanolides obtained in the previous paper showed considerable trypanocidal activity, suggesting the structure-activity relationships.

Electroencephalographic response following midazolam-induced general anesthesia: relationship to plasma and effect-site midazolam concentrations.

PubMed

Miyake, Wakako; Oda, Yutaka; Ikeda, Yuko; Hagihira, Satoshi; Iwaki, Hiroyoshi; Asada, Akira

2010-06-01

To examine the relationships between effect-site concentrations and electroencephalographic parameters after the induction of general anesthesia with midazolam. Twenty-four patients with American Society of Anesthesiologists status I or II were randomly allocated to receive either an intravenous (i.v.) bolus of midazolam 0.2 mg kg(-1) (small-dose group, n = 12) or 0.3 mg kg(-1) (large-dose group, n = 12) for induction of general anesthesia in a double-blind experimental design. The bispectral index (BIS), 95% spectral edge frequency (SEF95), spectral power density, and plasma concentrations of midazolam were measured for 60 min following the induction of general anesthesia. Plasma and simulated effect-site concentrations of midazolam were significantly higher in the large-dose group than in the small-dose group (P = 0.005 and <0.001, respectively). There was a correlation between the relative beta ratio and BIS (r (2) = 0.30, P < 0.001; n = 168); however, effect-site concentrations of midazolam showed no association with BIS, relative beta ratio, or SEF95 (r (2) = 0.07, 0.11 and 0.01, respectively; n = 168). The electroencephalographic spectral power density in the beta-band (>/=13 and <30 Hz) was significantly increased after induction and was significantly larger in the large-dose group than in the small-dose group (P = 0.009). Following the induction of general anesthesia with i.v. midazolam 0.2 or 0.3 mg kg(-1), the BIS was positively correlated with the relative beta ratio. Despite a rapid decrease in the plasma and effect-site concentrations of midazolam, the average BIS remained >60 for 60 min after induction, reflecting an increased power of the electroencephalographic high-frequency band.

Biodegradation of pharmaceuticals and endocrine disruptors with oxygen, nitrate, manganese (IV), iron (III) and sulfate as electron acceptors

NASA Astrophysics Data System (ADS)

Schmidt, Natalie; Page, Declan; Tiehm, Andreas

2017-08-01

Biodegradation of pharmaceuticals and endocrine disrupting compounds was examined in long term batch experiments for a period of two and a half years to obtain more insight into the effects of redox conditions. A mix including lipid lowering agents (e.g. clofibric acid, gemfibrozil), analgesics (e.g. diclofenac, naproxen), beta blockers (e.g. atenolol, propranolol), X-ray contrast media (e.g. diatrizoic acid, iomeprol) as well as the antiepileptic carbamazepine and endocrine disruptors (e.g. bisphenol A, 17α-ethinylestradiol) was analyzed in batch tests in the presence of oxygen, nitrate, manganese (IV), iron (III), and sulfate. Out of the 23 selected substances, 14 showed a degradation of > 50% of their initial concentrations under aerobic conditions. The beta blockers propranolol and atenolol and the analgesics pentoxifylline and naproxen showed a removal of > 50% under anaerobic conditions. In particular naproxen proved to be degradable with oxygen and under most anaerobic conditions, i.e. with manganese (IV), iron (III), or sulfate. The natural estrogens estriol, estrone and 17β-estradiol showed complete biodegradation under aerobic and nitrate-reducing conditions, with a temporary increase of estrone during transformation of estriol and 17β-estradiol. Transformation of 17β-estradiol under Fe(III)-reducing conditions resulted in an increase of estriol as well. Concentrations of clofibric acid, carbamazepine, iopamidol and diatrizoic acid, known for their recalcitrance in the environment, remained unchanged.

Hyperoxia reduces insulin release and induces mitochondrial dysfunction with possible implications for hyperoxic treatment of neonates.

PubMed

Hals, Ingrid; Ohki, Tsuyoshi; Singh, Rinku; Ma, Zuheng; Björklund, Anneli; Balasuriya, Chandima; Scholz, Hanne; Grill, Valdemar

2017-10-01

We previously showed that hyperoxia in vitro negatively affects beta cells of the rat. Here, we tested for possible clinical significance as well as mitochondrial interactions by hyperoxia, using human islets (function and viability), INS-1 832/13 cells (mitochondrial metabolism), and mouse neonates (effects in vivo). Lastly, we assessed relevant parameters in a cohort of individuals born preterm and then exposed to hyperoxia. Human islets and INS-1 832/13 cells were exposed to 24 h of hyperoxia (90-92% oxygen). Mouse neonates were subjected to 5 days of continuous hyperoxia. Individuals born preterm were evaluated in terms of glucose homeostasis and beta cell function by HbA1c and the HOMA2 formula. In human islets, hyperoxia significantly reduced glucose-stimulated insulin secretion by 42.2 ± 5.3% and viability assessed by MTT by 22.5 ± 5.4%. Hyperoxia down-regulated mitochondrial complex II by 21 ± 5% and upregulated complex III by 26 ± 10.1% and complex IV by 37 ± 10.6%. Partly similar effects on mitochondrial complexes were found in hyperoxia-exposed INS-1 832/13 cells. Exposure to hyperoxia swiftly reduced oxygen consumption in these cells and increased mitochondrial uncoupling. Hyperoxia transiently but significantly reduced insulin release in mouse neonates. Individuals born preterm displayed higher HbA1c versus controls, as well as insulin resistance. Thus, hyperoxia exerts negative effects in vitro on human beta cells and results indicate inhibitory effects on insulin secretion in vivo in mouse neonates. Negative effects may be lessened by the demonstrated swift and profound mitochondrial adaptability. Our findings open the possibility that hyperoxia could negatively affect beta cells of preterm human neonates. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

Intravenous infusion of hexamethonium and atropine but not propranolol diminishes apolipoprotein A-IV gene expression in rat ileum.

PubMed

Sonoyama, K; Tajima, K; Fujiwara, R; Kasai, T

2000-03-01

To clarify the role of neural factors in the regulation of apolipoprotein (apo) A-IV expression in the small intestine, we investigated the effect of neural blockers on mRNA levels of apo A-IV in rat small intestine. Either ganglionic blocker (hexamethonium), cholinergic blocker (atropine) or beta-adrenergic blocker (propranolol) was infused intravenously to unrestrained conscious rats for 8 h, and then total RNA was isolated from the small intestine and analyzed using Northern hybridization. Apo A-IV mRNA levels in the ileum were significantly lower in hexamethonium- or atropine-infused rats than in saline- (control) or propranolol-infused rats. Immunoblot analysis showed no difference in plasma apo A-IV concentrations between hexamethonium- and saline-infused groups. The lower mRNA levels of apo A-IV in the ileum of hexamethonium-infused rats were observed even in bile-drained rats, indicating that the lower expression was not due to any changes in bile availability. The ileal apo A-IV mRNA levels were significantly higher in rats infused with lipid emulsion into the ileum than in rats infused with glucose-saline, and the concomitant infusion of intravenous hexamethonium did not affect the higher levels of apo A-IV mRNA. These results suggest that the basal expression of the ileal A-IV gene is at least partially regulated in a site-specific manner by cholinergic neurons.

[123I]beta-CIT SPECT visualizes dopamine transporter loss in de novo parkinsonian patients.

PubMed

Müller, T; Farahati, J; Kuhn, W; Eising, E G; Przuntek, H; Reiners, C; Coenen, H H

1998-01-01

Parkinson's disease (PD) is characterized by degeneration of dopaminergic neurons in the basal ganglia, which may be visualized by single photon emission computed tomography (SPECT) in combination with the cocaine analog methyl-3-beta-(4-beta[123I]iodophenyl)tropane-2beta-carboxylate ([123I]beta-CIT). The aim of our study was to correlate findings of SPECT with clinical data of 34 previously untreated, idiopathic parkinsonian patients [age: 59.58+/-10.03 (mean+/-SD) years; Hoehn and Yahr Scale (HYS) mean range: 1.97+/-0.83, ranges I-III; Unified PD Rating Scale 3.0 (UPDRS, 30.64+/-18.68) and 15 healthy controls (age 47.93+/-10.47 years). SPECT scans were performed with a single-head gamma-camera 24 h after intravenous injection of [123I]beta-CIT. Comparison of the striatum/cerebellum (S/C) ratio of [123I]beta-CIT uptake of controls and parkinsonian subjects, subdivided according to their HYS range, was significant. No influence of age or sex was observed. Significant correlations were found between scores of the HYS, UPDRS parts I-III, part II, part III, and the S/C ratio of [123I]-CIT uptake. Moreover, SPECT with the radiotracer [123I]beta-CIT revealed side-to-side differences in parkinsonian patients and significant associations to contralateral clinical extrapyramidal symptomatology. Our data show that SPECT with [123I]beta-CIT is a valuable tool for estimating disease severity in PD.

40 CFR Appendix II to Part 257 - Appendix II to Part 257

Code of Federal Regulations, 2014 CFR

2014-07-01

... are only add-on in nature. Beta ray irradiation: Sludge is irradiated with beta rays from an accelerator at dosages of at least 1.0 megarad at room temperature (ca. 20 °C). Gamma ray irradiation: Sludge...

40 CFR Appendix II to Part 257 - Appendix II to Part 257

Code of Federal Regulations, 2010 CFR

2010-07-01

... are only add-on in nature. Beta ray irradiation: Sludge is irradiated with beta rays from an accelerator at dosages of at least 1.0 megarad at room temperature (ca. 20 °C). Gamma ray irradiation: Sludge...

40 CFR Appendix II to Part 257 - Appendix II to Part 257

Code of Federal Regulations, 2011 CFR

2011-07-01

... are only add-on in nature. Beta ray irradiation: Sludge is irradiated with beta rays from an accelerator at dosages of at least 1.0 megarad at room temperature (ca. 20 °C). Gamma ray irradiation: Sludge...

40 CFR Appendix II to Part 257 - Appendix II to Part 257

Code of Federal Regulations, 2012 CFR

2012-07-01

... are only add-on in nature. Beta ray irradiation: Sludge is irradiated with beta rays from an accelerator at dosages of at least 1.0 megarad at room temperature (ca. 20 °C). Gamma ray irradiation: Sludge...

40 CFR Appendix II to Part 257 - Appendix II to Part 257

Code of Federal Regulations, 2013 CFR

2013-07-01

... are only add-on in nature. Beta ray irradiation: Sludge is irradiated with beta rays from an accelerator at dosages of at least 1.0 megarad at room temperature (ca. 20 °C). Gamma ray irradiation: Sludge...

Dipeptidyl peptidase IV inhibitors for the treatment of impaired glucose tolerance and type 2 diabetes.

PubMed

Wiedeman, Paul E; Trevillyan, James M

2003-04-01

Glucagon-like peptide-1 (GLP-1 (7-36) amide) is a gut hormone released from L-cells in the small intestine in response to the ingestion of nutrients and enhances the glucose-dependent secretion of insulin from pancreatic beta-cells. In type 2 diabetic patients, the continuous infusion of GLP-1 (7-36) amide decreases plasma glucose and hemoglobin A1c concentrations and improves beta-cell function. Hormone action is rapidly terminated by the N-terminal cleavage of GLP-1 at Ala2 by the aminopeptidase, dipeptidyl peptidase IV (DPPIV). The short in vivo half-life of GLP-1 (< 3 min) poses challenges to the development of exogenous GLP-1-based therapy. The inhibition of endogenous GLP-1 degradation by reducing DPPIV activity is an alternative strategy for improving the incretin action of GLP-1 in vivo. This review summarizes recent advances in the design of potent and selective small molecule inhibitors of DPPIV and the potential challenges to the development of DPPIV inhibitors for the treatment of impaired glucose tolerance and type 2 diabetes.

Design and characterization of GaN p-i-n diodes for betavoltaic devices

NASA Astrophysics Data System (ADS)

Khan, Muhammad R.; Smith, Joshua R.; Tompkins, Randy P.; Kelley, Stephen; Litz, Marc; Russo, John; Leathersich, Jeff; Shahedipour-Sandvik, Fatemeh (Shadi); Jones, Kenneth A.; Iliadis, Agis

2017-10-01

The performance of gallium nitride (GaN) p-i-n diodes were investigated for use as a betavoltaic device. Dark IV measurements showed a turn on-voltage of approximately 3.2 V, specific-on-resistance of 15.1 mΩ cm2 and a reverse leakage current of -0.14 mA/cm2 at -10 V. A clear photo-response was observed when IV curves were measured under a light source at a wavelength of 310 nm (4.0 eV). In addition, GaN p-i-n diodes were tested under an electron-beam in order to simulate common beta radiation sources ranging from that of 3H (5.6 keV average) to 63Ni (17 keV average). From this data, we estimated output powers of 53 nW and 750 nW with overall efficiencies of 0.96% and 4.4% for our device at incident electron energies of 5.6 keV and 17 keV corresponding to 3H and 63Ni beta sources respectively.

Discovery of Potent and Selective Dipeptidyl Peptidase IV Inhibitors Derived from [beta]-Aminoamides Bearing Subsituted Triazolopiperazines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Dooseop; Kowalchick, Jennifer E.; Brockunier, Linda L.

2008-06-30

A series of {beta}-aminoamides bearing triazolopiperazines have been discovered as potent, selective, and orally active dipeptidyl peptidase IV (DPP-4) inhibitors by extensive structure-activity relationship (SAR) studies around the triazolopiperazine moiety. Among these, compound 34b with excellent in vitro potency (IC{sub 50} = 4.3 nM) against DPP-4, high selectivity over other enzymes, and good pharmacokinetic profiles exhibited pronounced in vivo efficacy in an oral glucose tolerance test (OGTT) in lean mice. On the basis of these properties, compound 34b has been profiled in detail. Further refinement of the triazolopiperazines resulted in the discovery of a series of extremely potent compounds withmore » subnanomolar activity against DPP-4 (42b-49b), that is, 4-fluorobenzyl-substituted compound 46b, which is notable for its superior potency (IC{sub 50} = 0.18 nM). X-ray crystal structure determination of compounds 34b and 46b in complex with DPP-4 enzyme revealed that (R)-stereochemistry at the 8-position of triazolopiperazines is strongly preferred over (S) with respect to DPP-4 inhibition.« less

29 CFR Appendix IV to Part 1918 - Special Cargo Gear and Container Spreader Test Requirements (Mandatory) [see § 1918.61 (f), (g...

Code of Federal Regulations, 2012 CFR

2012-07-01

... 29 Labor 7 2012-07-01 2012-07-01 false Special Cargo Gear and Container Spreader Test Requirements... REGULATIONS FOR LONGSHORING Pt. 1918, App. IV Appendix IV to Part 1918—Special Cargo Gear and Container... structural damage repair 3. Intermodal container spreaders not part of vessel's cargo handling gear Prior to...

29 CFR Appendix IV to Part 1918 - Special Cargo Gear and Container Spreader Test Requirements (Mandatory) [see § 1918.61 (f), (g...

Code of Federal Regulations, 2014 CFR

2014-07-01

... 29 Labor 7 2014-07-01 2014-07-01 false Special Cargo Gear and Container Spreader Test Requirements... REGULATIONS FOR LONGSHORING Pt. 1918, App. IV Appendix IV to Part 1918—Special Cargo Gear and Container... structural damage repair 3. Intermodal container spreaders not part of vessel's cargo handling gear Prior to...

29 CFR Appendix IV to Part 1918 - Special Cargo Gear and Container Spreader Test Requirements (Mandatory) [see § 1918.61 (f), (g...

Code of Federal Regulations, 2013 CFR

2013-07-01

... 29 Labor 7 2013-07-01 2013-07-01 false Special Cargo Gear and Container Spreader Test Requirements... REGULATIONS FOR LONGSHORING Pt. 1918, App. IV Appendix IV to Part 1918—Special Cargo Gear and Container... structural damage repair 3. Intermodal container spreaders not part of vessel's cargo handling gear Prior to...

[Studies on chemical constituents from roots of Mirabilis jalapa].

PubMed

Lai, Guo-Fang; Luo, Shi-De; Cao, Jian-Xin; Wang, Yi-Fen

2008-01-01

To investigate the anti-HIV constituents from the root of Mirabilis jalapa. The compounds were isolated by column chromatography on silica gel, Sephadex LH - 20, MCI-gel CHP-20P and RP-18. The structure were identified by means of NMR and MS analyses (1H-NMR, 13C-NMR, MS). Eleven compounds were isolated and identified as astragaloside II (1), astragaloside II (2), astragaloside IV (3), astragaloside VI (4), flazin (5), 4'-hydroxy-2, 3-dihydroflavone 7-beta-D-glucopyranoside (6), gingerglycolipid A (7), 3, 4-dihydroxybenzaldehyd (8), p-hydroxybenzaldehyde (9), beta-sitosterol (10) and daucosterol (11). Compounds 1-9 were obtained from this genus for the first time.

Cocaine action on peripheral, non-monoamine neural substrates as a trigger of EEG desynchronization and EMG activation following intravenous administration in freely moving rats

PubMed Central

Smirnov, Michael S.; Kiyatkin, Eugene A.

2009-01-01

Many important physiological, behavioral and subjective effects of intravenous (iv) cocaine (COC) are exceptionally rapid and transient, suggesting a possible involvement of peripheral neural substrates in their triggering. In the present study, we used high-speed EEG and EMG recordings (4-s resolution) in freely moving rats to characterize the central electrophysiological effects of iv COC at low doses within a self-administration range (0.25-1.0 mg/kg). We found that COC induces rapid, strong, and prolonged desynchronization of cortical EEG (decrease in alpha and increase in beta and gamma activity) and activation of the neck EMG that begin within 2-6 s following the start of a 10-s injection; immediate components of both effects were dose-independent. The rapid effects of COC were mimicked by iv COC methiodide, a derivative that cannot cross the blood-brain barrier. At equimolar doses (0.33-1.33 mg/kg), COC methiodide had equally fast and strong effects on EEG and EMG total powers, decreasing alpha and increasing beta and gamma activities. Rapid EEG desynchronization and EMG activation was also induced by iv procaine, a structurally similar, short-acting local anesthetic with virtually no effects on monoamine uptake; at equipotential doses (1.25-5.0 mg/kg), these effects were weaker and shorter in duration than those of COC. Surprisingly, iv saline injection delivered during slow-wave sleep (but not during quiet wakefulness) also induced a transient EEG desynchronization but without changes in EMG and motor activity; these effects were significantly weaker and much shorter than those induced by all tested drugs. These data suggest that in awake animals, iv COC induces rapid cortical activation and a subsequent motor response via its action on peripheral non-monoamine neural elements, involving neural transmission via visceral sensory pathways. By providing a rapid neural signal and triggering neural activation, such an action might play a crucial role in the sensory effects of COC, thus contributing to the learning and development of drug-taking behavior. PMID:19861149

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

PubMed

de-la-Cruz-Salcedo, E I; Ibarra, B; Rizo-de-la-Torre, L C; Sánchez-López, J Y; González-Mercado, A; Harteveld, C L; Perea-Díaz, F J

2016-10-01

Alpha-thalassemia (α-thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α-thal and beta-thalassemia (β-thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α- and β-thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2 . Common deletional alleles (-α(3.7) , -α(4.2) , - -(SEA) , - -(MED) , - -(FIL) , - -(THAI) , -α(20.5) ) and α-triplication were studied by gap-PCR and nondeletional alleles (α(IVSI) ((-5nt)) , α2 (NcoI) , α1 (NcoI) ) by ARMS. β-thal alleles Cd39 (C>T), IVS1:1 (G>A), IVS1:110 (G>A), and Spanish δβ-thal were also investigated. DNA sequencing was performed on HBA2, HBA1, and HBB genes. Negative samples were subjected to MLPA. In 35 subjects, we identified the mutations, -α(3.7) , - -(SEA) , - -(FIL) , α(IVSI) ((-5nt)) , and ααα(anti3.7) and two novel deletion alleles - -(Mex1) (6.8-8.9 kb) and - -(Mex2) (77.6-135.7 kb). Four individuals also had a β-thal allele (Cd39/IVS1:110). No α-thal alleles were observed in 16 subjects, but three had a β-thal mutation Cd39, IVS1:110, and Spanish δβ-thal. α-thal is relatively common in Mexican patients, the combination with β-thal is sometimes unexpected, and this underlines the importance of performing molecular analysis for both α- and β-genes defects in patients showing microcytic hypochromic anemia. © 2016 John Wiley & Sons Ltd.

Supplementation of a high-carbohydrate breakfast with barley beta-glucan improves postprandial glycaemic response for meals but not beverages.

PubMed

Poppitt, Sally D; van Drunen, Jenneke D E; McGill, Anne-Thea; Mulvey, Tom B; Leahy, Fiona E

2007-01-01

There is growing support for the protective role of soluble fibre in type II diabetes. Soluble fibre beta-glucan found in cereal products including oats and barley may be the active component. There is evidence of postprandial blunting of blood glucose and insulin responses to dietary carbohydrates when oat soluble fibre is supplemented into the diet but few trials have been carried out using natural barley or enriched barley beta-glucan products. The aim of this trial was to investigate the postprandial effect of a highly enriched barley beta -glucan product on blood glucose, insulin and lipids when given with a high-CHO food and a high-CHO drink. 18 lean, healthy men completed a 4 treatment intervention trial comprising (i) high-CHO(food control), (ii) high-CHO(food+fibre), (iii) high-CHO(drink control), (iv) high-CHO(drink+fibre) where a 10g dose of barley beta-glucan fibre supplement (Cerogen) containing 6.31g beta-glucan was added to food and drink controls. There was an increase of glucose and insulin following all 4 treatments. Addition of the beta -glucan supplement significantly blunted the glycaemic and insulinaemic responses on the food (p<0.05) but not drink (p>0.05) treatments when compared to controls. The high-CHO breakfasts decreased total, LDL- and HDL-cholesterol from baseline to 60 mins postprandially but there were no differential effects of beta-glucan treatment on circulating lipids. We conclude that a high dose barley beta-glucan supplement can improve glucose control when added to a high-CHO starchy food, probably due to increased gastro-intestinal viscosity, but not when added to a high-CHO beverage where rapid absorption combined with decreased beta-glucan concentration and viscosity may obviate this mechanism.

Pharmacokinetics and bioavailability of spectinomycin after i.v., i.m., s.c. and oral administration in broiler chickens.

PubMed

Abu-Basha, E A; Gehring, R; Albwa'neh, S J

2007-04-01

A pharmacokinetic and bioavailability study of spectinomycin was conducted in healthy broiler chickens following administration of a single (50 mg/kg bw) intravenous (i.v.), intramuscular (i.m.) and subcutaneous (s.c.) dose and oral doses of 50 and 100 mg/kg bw. Following i.v. administration, the elimination half-life (t1/2beta), mean residence time (MRT), volume of distribution at steady-state (Vd(ss)), volume of distribution based on the terminal phase (Vd(z)) and total body clearance (ClB) were 1.46+/-1.10 h, 1.61+/-1.05 h, 0.26+/-0.009 L/kg, 0.34 (0.30-0.38) L/kg and 2.68+/-0.017 mL/min/kg respectively. After i.m. and s.c. dosing, the Cmax was 152.76+/-1.08 and 99.77+/-1.04 microg/mL, achieved at 0.25 (0.25-0.50) and 0.25 (0.25-1.00) h, the t1/2beta was 1.65+/-1.07 and 2.03+/-1.06 h and the absolute bioavailability (F) was 136.1% and 128.8% respectively. A significant difference in Cmax (5.13+/-0.10, 14.26+/-1.12 microg/mL), t1/2beta (3.74+/-1.07, 8.93+/-1.13 h) and ClB/F (22.69+/-0.018, 10.14+/-0.018 mL/min/kg) were found between the two oral doses (50 and 100 mg/kg bw respectively), but there were no differences in the tmax [2.00 (2.00-4.00), 2.00 (2.00-2.00) h] and Vd(z)/F [6.95 (6.34-9.06), 7.98 (4.75-10.62) L/kg). The absolute bioavailability (F) of spectinomycin was 11.8% and 26.4% after oral administration of 50 and 100 mg/kg bw respectively.

The evidence for clumpy accretion in the Herbig Ae star HR 5999

NASA Technical Reports Server (NTRS)

Perez, M. R.; Grady, C. A.; The, P. S.

1993-01-01

Analysis of IUE high- and low-dispersion spectra of the young Herbig Ae star HR 5999 (HD 144668) covering 1978-1992 revealed dramatic changes in the Mg II h and k (2795.5, 2802.7 A) emission profiles, changes in the column density and distribution in radial velocity of accreting gas, and flux in the Ly(alpha), O I, and C IV emission lines, which are correlated with the UV excess luminosity. Variability in the spectral type inferred from the UV spectral energy distribution, ranging from A5 IV-III in high state to A7 III in the low state, was also observed. The trend of earlier inferred spectral type with decreasing wavelength and with increasing UV continuum flux has previously been noted as a signature of accretion disks in lower mass pre-main sequence stars (PMS) and in systems undergoing FU Orionis-type outbursts. Our data represent the first detection of similar phenomena in an intermediate mass (M greater than or equal to 2 solar mass) PMS star. Recent IUE spectra show gas accreting toward the star with velocities as high as plus 300 km/s, much as is seen toward beta Pic, and suggest that we also view this system through the debris disk. The absence of UV lines with the rotational broadening expected given the optical data (A7 IV, V sini=180 plus or minus 20 km/s for this system) also suggests that most of the UV light originates in the disk, even in the low continuum state. The dramatic variability in the column density of accreting gas, is consistent with clumpy accretion, such as has been observed toward beta Pic, is a hallmark of accretion onto young stars, and is not restricted to the clearing phase, since detectable amounts of accretion are present for stars with 0.5 Myr less than t(sub age) less than 2.8 Myr. The implications for models of beta Pic and similar systems are briefly discussed.

Antisense and sense poly(A)-RNAs from the Xenopus laevis pyruvate dehydrogenase gene loci are regulated with message production during embryogenesis.

PubMed

Islam, N; Poitras, L; Gagnon, F; Moss, T

1996-10-17

The structure and temporal expression of two Xenopus cDNAs encoding the beta subunit of pyruvate dehydrogenase (XPdhE1 beta) have been determined. XPdhE1 beta was 88% homologous to mature human PdhE1 beta, but the putative N-terminal mitochondrial signal peptide was poorly conserved. Zygotic expression of XPdhE1 beta mRNA was detected at neural tube closure and increased until stage 40. RT-PCR cloning identified a short homology to a protein kinase open reading frame within the 3' non-coding sequence of the XPdhE1 beta cDNAs. This homology, which occurred on the antisense cDNA strand, was shown by strand specific RT-PCR to be transcribed in vivo as part of an antisense RNA. Northern analysis showed that this RNA formed part of an abundant and heterogeneous population of antisense and sense poly(A)-RNAs transcribed from the XPdhE1 beta loci and coordinately regulated with message production.

Re-examination of cellular cyclic beta-1,2-glucans of Rhizobiaceae: distribution of ring sizes and degrees of glycerol-1-phosphate substitution.

PubMed

Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H

1990-04-01

Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.

Diffusion of beta-lactam antibiotics through the porin channels of Escherichia coli K-12.

PubMed Central

Yoshimura, F; Nikaido, H

1985-01-01

Diffusion rates of various beta-lactam antibiotics through the OmpF and OmpC porin channels of Escherichia coli K-12 were measured by the use of reconstituted proteoliposomes. The results can be interpreted on the basis of the gross physicochemical properties of the antibiotics along the following lines. (i) As noted previously (Nikaido et al., J. Bacteriol., 153:232-240, 1983), there was a monotonous dependence of the penetration rate on the hydrophobicity of the molecule among the classical monoanionic beta-lactams, and a 10-fold increase in the octanol-water partition coefficient of the uncharged molecule decreased the penetration rate by a factor of 5 to 6. (ii) Compounds with exceptionally bulky side chains, such as mezlocillin, piperacillin, and cefoperazone, showed much slower penetration rates than expected from their hydrophobicity. (iii) The substituted oxime side chain on the alpha-carbon of the substituent group at position 7 of the cephem nucleus decreased the penetration rate almost by an order of magnitude; this appears to be largely due to the steric effect. (iv) The presence of a methoxy group at position 7 of the cephalosporins also reduced the penetration rate by 20%, probably also due to the steric hindrance. (v) Zwitterionic compounds penetrated very rapidly, and the correlation between the rate and hydrophobicity appeared to be much weaker than with the monoanionic compounds. Imipenem showed the highest permeability among the compounds tested, presumably due, at least in part, to its compact molecular structure. (vi) Compounds with two negative charges penetrated more slowly than did analogs with only one negatively charged group. Among them, only moxalactam, ceftriaxone, and azthreonam showed penetration rates corresponding to, or higher than, 10% of that of imipenem. PMID:2580479

Nuclear magnetic resonance study of the conformation and dynamics of beta-casein at the oil/water interface in emulsions.

PubMed Central

ter Beek, L C; Ketelaars, M; McCain, D C; Smulders, P E; Walstra, P; Hemminga, M A

1996-01-01

A (13)C and (31)P nuclear magnetic resonance (NMR) study has been carried out on beta-casein adsorbed at the interface of a tetradecane/water emulsion. (13)C NMR spectra show signals from the carbonyl, carboxyl, aromatic, and C alpha carbons in beta-casein, well resolved from solvent resonances. Only a small fraction of all carbon atoms in beta-casein contribute to detectable signals; intensity measurements show that the observable spectrum is derived from about 30 to 40 amino acid residues.(31)P NMR spectra show signals from the five phosphoserines on the hydrophilic N-terminal part of the protein. Analysis of T(1) relaxation times of these nuclei, using the model free approach for the spectral density function and the line shape of the alpha-carbon region, indicates that a large part of the protein is in a random coil conformation with restricted motion and a relatively long internal correlation time. The NMR results show that the conformation and dynamics of the N-terminal part of beta-casein are not strongly altered at the oil/water interface, as compared to beta-casein in micelle-like aggregates in aqueous solution. PMID:9172765

46 CFR Appendix IV to Part 390 - Sample Addendum to Maritime Administration Capital Construction Fund Agreement

Code of Federal Regulations, 2010 CFR

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Sample Addendum to Maritime Administration Capital Construction Fund Agreement IV Appendix IV to Part 390 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF... 390—Sample Addendum to Maritime Administration Capital Construction Fund Agreement This Agreement...

A phase I study of human natural interferon-beta in cancer patients.

PubMed

Liberati, A M; Biscottini, B; Fizzotti, M; Schippa, M; De Angelis, V; Senatore, M; Vittori, O; Teggia, L; Natali, R; Palmisano, L

1989-06-01

In this phase I study 15 patients with metastatic tumors were given interferon (IFN)-beta by i.v. bolus injections. Twelve individual doses of 1, 2, 3.3, 5, 7, 9, 12, 16, 21, 27, 35, and 46 x 10(6) IU were administered every other day. The single maximal tolerated dose ranged from 9 to 46 x 10(6) IU. Eight patients tolerated the dose of 46 x 10(6) IU without side effects. Disturbances of cardiac rhythm were observed, but were closely related temporally to severe chills and appeared to be the consequence of adrenergic stimulation associated with this side-effect. In addition, no significant variations in the left ventricular function as assessed by nuclear stethoscope were observed. Neurotoxicity was not a major side-effect. The toxicity of IFN-beta given as scheduled in this study was significant, but acceptable.

Liposomal gene transfer of keratinocyte growth factor improves wound healing by altering growth factor and collagen expression.

PubMed

Pereira, Clifford T; Herndon, David N; Rocker, Roland; Jeschke, Marc G

2007-05-15

Growth factors affect the complex cascade of wound healing; however, interaction between different growth factors during dermal and epidermal regeneration are still not entirely defined. In the present study, we thought to determine the interaction between keratinocyte growth factor (KGF) administered as liposomal cDNA with other dermal and epidermal growth factors and collagen synthesis in an acute wound. Rats received an acute wound and were divided into two groups to receive weekly subcutaneous injections of liposomes plus the Lac-Z gene (0.22 microg, vehicle), or liposomes plus the KGF cDNA (2.2 microg) and Lac-Z gene (0.22 microg). Histological and immunohistochemical techniques were used to determine growth factor, collagen expression, and dermal and epidermal structure. KGF cDNA increased insulin-like growth factor-I (IGF-I), insulin-like growth factor binding protein-3 (IGFBP-3), and fibroblast growth factor (FGF), decreased transforming growth factor-beta (TGF-beta), while it had no effect on platelet-derived growth factor (PDGF) levels in the wound. KGF cDNA significantly increased collagen Type IV at both the wound edge as well as the wound bed, while it had no effect on collagen Type I and III. KGF cDNA increased re-epithelialization, improved dermal regeneration, and increased neovascularization. Exogenous administered KGF cDNA causes increases in IGF-I, IGF-BP3, FGF, and collagen IV and decreases TGF-beta concentration. KGF gene transfer accelerates wound healing without causing an increase in collagen I or III.

Sulforaphane attenuation of experimental diabetic nephropathy involves GSK-3 beta/Fyn/Nrf2 signaling pathway.

PubMed

Shang, Guoguo; Tang, Xinjun; Gao, Pan; Guo, Fanli; Liu, Hongpeng; Zhao, Zhonghua; Chen, Qi; Jiang, Tao; Zhang, Nong; Li, Hui

2015-06-01

Sulforaphane (SFN), the bioactive component of cruciferous vegetables, is a potent indirect antioxidant. Oxidative stress and activation of glycogen synthase kinase 3beta (GSK3β) are two major contributors to the pathogenesis of diabetic nephropathy (DN). Here, we investigated whether and how SFN affected GSK3β in experimental models of DN in vivo and in vitro. SFN treatment obviously prevented the increase in urine albumin excretion, matrix expansion, transforming growth factor-β1 expression, fibronectin and type IV collagen deposition in the diabetic kidney. Simultaneously, the level of 8-oxo-deoxyguanosine, an indicator of oxidative damage, was markedly lowered in SFN-treated diabetic rats, together with a significant reduction in activity of the GSK-3β/Fyn axis and an evident activation of Nrf2 signaling. Similarly, antifibrotic effects of SFN, parallel to enhanced inhibitory Ser9-phosphorylation of GSK3β and Fyn/Nrf2 nuclear export/import, were observed in the cultured rat mesangial cells (RMC) exposed to high glucose. The salutary effects of SFN on high-glucose-stimulated RMC were abolished by overexpression of GSK3β while being rescued by lithium chloride, a well-known GSK3β inhibitor. Taken together, our findings suggested that SFN ameliorated experimental diabetic nephropathy, at least in part, via GSK3β/Fyn/Nrf2 signaling pathway. Copyright © 2015 Elsevier Inc. All rights reserved.

Modeling the excitation of global Alfven modes by an external antenna in the Joint European Torus (JET)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huysmans, G.T.A.; Kerner, W.; Borba, D.

1995-05-01

The active excitation of global Alfven modes using the saddle coils in the Joint European Torus (JET) [{ital Plasma} {ital Physics} {ital and} {ital Controlled} {ital Nuclear} {ital Fusion} {ital Research} 1984, Proceedings of the 10th International Conference, London (International Atomic Energy Agency, Vienna, 1985), Vol. 1, p. 11] as the external antenna, will provide information on the damping of global modes without the need to drive the modes unstable. For the modeling of the Alfven mode excitation, the toroidal resistive magnetohydrodynamics (MHD) code CASTOR (Complex Alfven Spectrum in TORoidal geometry) [18{ital th} {ital EPS} {ital Conference} {ital On} {italmore » Controlled} {ital Fusion} {ital and} {ital Plasma} {ital Physics}, Berlin, 1991, edited by P. Bachmann and D. C. Robinson (The European Physical Society, Petit-Lancy, 1991), Vol. 15, Part IV, p. 89] has been extended to calculate the response to an external antenna. The excitation of a high-performance, high beta JET discharge is studied numerically. In particular, the influence of a finite pressure is investigated. Weakly damped low-{ital n} global modes do exist in the gaps in the continuous spectrum at high beta. A pressure-driven global mode is found due to the interaction of Alfven and slow modes. Its frequency scales solely with the plasma temperature, not like a pure Alfven mode with a density and magnetic field.« less

The rhodium catalyzed three-component reaction of diazoacetates, titanium(IV) alkoxides and aldehydes.

PubMed

Lu, Chong-Dao; Liu, Hui; Chen, Zhi-Yong; Hu, Wen-Hao; Mi, Ai-Qiao

2005-05-28

The rhodium(II)-catalyzed three-component reaction of diazoacetates, titanium alkoxides and aldehydes is shown to give alpha-alkoxyl-beta-hydroxyl acid derivatives; the novel C-C bond formation reaction is proposed to occur through oxonium ylides derived from diazo compounds and titanium alkoxides, and followed by intermolecular trapping by aldehydes.

9 CFR 113.111 - Clostridium Perfringens Type C Toxoid and Bacterin-Toxoid.

Code of Federal Regulations, 2011 CFR

2011-01-01

... mixed with one unit of Standard Antitoxin and not cause sickness or death in injected mice. (iii) L... death in at least 80 percent of injected mice. (iv) Standard antitoxin. The Beta Antitoxin preparation... toxin-antitoxin mixtures at room temperature for 1 hour and hold in ice water until injections of mice...

Markers of cartilage and synovial metabolism in joint fluid and serum of patients with chondromalacia of the patella.

PubMed

Väätäinen, U; Lohmander, L S; Thonar, E; Hongisto, T; Agren, U; Rönkkö, S; Jaroma, H; Kosma, V M; Tammi, M; Kiviranta, I

1998-03-01

To further our understanding of the pathogenesis of chondromalacia of the patella (CM), we have studied the release into knee joint fluid and serum, obtained from patients with CM, of molecules associated with the metabolism of joint cartilage matrix and synovium. Interleukin-1 alpha (IL-1 alpha), interleukin-1 beta (IL-1 beta), interleukin-6 (IL-6), stromelysin-1 (MMP-3), interstitial collagenase (MMP-1), tissue inhibitor for metalloproteinases-1 (TIMP-1), phospholipase activity A2 (PLA2), hyaluronan (HA), aggrecan fragments (AGN) and antigenic keratan sulfate (KS) were quantified in knee joint lavage fluid from 96 patients with CM; KS and HA also was measured in serum. Chondromalacia was graded on a scale of I to IV according to Outerbridge (1961). The histopathology of the synovial membrane close to the patellofemoral joint was evaluated. Control samples were obtained from nine patients with knee pain presenting with arthroscopically normal knee joints. The concentrations of MMP-3, MMP-1 and TIMP-1 proteins in joint lavage fluid were increased in advanced (grade IV) CM, compared with controls. Levels of MMP-1 in lavage fluid correlated with the severity of CM (r = 0.38, P < 0.01) and MMP-1 and MMP-3 concentrations correlated with each other (r = 0.45, P < 0.001). TIMP-1 was elevated in grade IV CM compared with grades II and III CM (P < 0.02, P < 0.01). Interleukins (IL-1 alpha, IL-1 beta and IL-6) showed no significant change in CM. The lavage fluid level of PLA2 increased with the severity of CM (r = 0.40, P < 0.001). Serum KS was higher in CM IV than in controls (P = 0.05), while lavage fluid KS concentration was elevated in CM I (P = 0.04). There were no differences in the lavage fluid levels of AGN and HA between the different study groups. Synovium showed slight or moderate histological signs of inflammation in 9% of CM patients. The changes in the release and activity of these marker molecules from serum and synovial fluid may reflect changes in the metabolism of articular cartilage and synovium in CM, that are consistent with those observed in early-stage tibiofemoral cartilage changes in OA.

Tanks Versus Infantry in a Smoke Environment (TISE)

DTIC Science & Technology

1978-08-01

maneuvering toward stationary armor vehicles in an attempt to detect and recognize them. Finally, Part IV trials were limited free - play , two-sided...long. Each armor vehicle lane (average 40 meters in width) was marked on the ground by white tape. These markings were removed for part IV free - play trials...recognize them. Data were collected from both sides. (4) Part IV was free - play , force-on-force engagement trials. Defensive positions were tactically

A role for human MUC4 mucin gene, the ErbB2 ligand, as a target of TGF-beta in pancreatic carcinogenesis.

PubMed

Jonckheere, Nicolas; Perrais, Michaël; Mariette, Christophe; Batra, Surinder K; Aubert, Jean-Pierre; Pigny, Pascal; Van Seuningen, Isabelle

2004-07-29

MUC4: encodes a large transmembrane mucin that is overexpressed in pancreatic adenocarcinomas. The molecular mechanisms responsible for that altered pattern of expression are unknown. TGF-beta, a pleiotropic cytokine, regulates numerous genes involved in pancreatic carcinogenesis via activation of the Smads proteins and MUC4 promoter is rich in Smad-binding elements. Our aim was to study whether the regulation of MUC4 expression by TGF-beta in pancreatic cancer cells was strictly dependent on Smad4 activity. Three pancreatic cancer cell lines, CAPAN-1 (MUC4+/Smad4-), CAPAN-2 (MUC4+/Smad4+) and PANC-1 (MUC4-/Smad4+), were used. By RT-PCR, transfection assays and immunohistochemistry, we show that (i) both MUC4 mRNA and apomucin expression are upregulated by TGF-beta, (ii) Smad2 positively cooperates with Smad4 to activate the promoter, (iii) activation of Smad4 by exogenous TGF-beta induces Smad4 binding to the promoter, (iv) Smad7 and c-ski both inhibit activation by Smad4. When Smad4 is mutated and inactive, TGF-beta activates MUC4 expression via MAPK, PI3K and PKA signaling pathways. Absence of expression in PANC-1 cells is due to histone deacetylation. Altogether, these results indicate that upregulation of MUC4 by TGF-beta is restricted to well-differentiated pancreatic cancer cells, and point out a novel mechanism for TGF-beta as a key molecule in targeting MUC4 overexpression in pancreatic adenocarcinomas.

Biodegradation of pharmaceuticals and endocrine disruptors with oxygen, nitrate, manganese (IV), iron (III) and sulfate as electron acceptors.

PubMed

Schmidt, Natalie; Page, Declan; Tiehm, Andreas

2017-08-01

Biodegradation of pharmaceuticals and endocrine disrupting compounds was examined in long term batch experiments for a period of two and a half years to obtain more insight into the effects of redox conditions. A mix including lipid lowering agents (e.g. clofibric acid, gemfibrozil), analgesics (e.g. diclofenac, naproxen), beta blockers (e.g. atenolol, propranolol), X-ray contrast media (e.g. diatrizoic acid, iomeprol) as well as the antiepileptic carbamazepine and endocrine disruptors (e.g. bisphenol A, 17α-ethinylestradiol) was analyzed in batch tests in the presence of oxygen, nitrate, manganese (IV), iron (III), and sulfate. Out of the 23 selected substances, 14 showed a degradation of >50% of their initial concentrations under aerobic conditions. The beta blockers propranolol and atenolol and the analgesics pentoxifylline and naproxen showed a removal of >50% under anaerobic conditions. In particular naproxen proved to be degradable with oxygen and under most anaerobic conditions, i.e. with manganese (IV), iron (III), or sulfate. The natural estrogens estriol, estrone and 17β-estradiol showed complete biodegradation under aerobic and nitrate-reducing conditions, with a temporary increase of estrone during transformation of estriol and 17β-estradiol. Transformation of 17β-estradiol under Fe(III)-reducing conditions resulted in an increase of estriol as well. Concentrations of clofibric acid, carbamazepine, iopamidol and diatrizoic acid, known for their recalcitrance in the environment, remained unchanged. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Jacalin and peanut agglutinin (PNA) bindings in the taste bud cells of the rat: new reliable markers for type IV cells of the rat taste buds.

PubMed

Taniguchi, Ryo; Shi, Lei; Fujii, Masae; Ueda, Katsura; Honma, Shiho; Wakisaka, Satoshi

2005-12-01

Lectin histochemistry of Jacalin (Artocarpus integrifolia) and peanut agglutinin (PNA), specific lectins for galactosyl (beta-1, 3) N-acetylgalactosamine (galactosyl (beta-1, 3) GalNAc), was applied to the gustatory epithelium of the adult rat. In the ordinary lingual epithelium, Jacalin and PNA labeled the cell membrane from the basal to granular cell layer. They also bound membranes of rounded-cells at the basal portion of taste buds, but the number of PNA labeled cells was smaller than that of Jacalin labeled cells. There was no apparent difference in the binding patterns of Jacalin and PNA among the taste buds of the lingual papillae and those of the palatal epithelium. Occasionally, a few spindle-shaped cells were labeled with Jacalin, but not with PNA. Double labeling of Jacalin and alpha-gustducin, a specific marker for type II cells, revealed that Jacalin-labeled spindle-shaped taste cells were immunonegative for alpha-gustducin. Spindle-shaped cells expressing protein gene product 9.5 (PGP 9.5) immunoreactivity lacked Jacalin labeling. During the development of taste buds in circumvallate papillae, the binding pattern of Jacalin became almost identical from postnatal day 5. The present results indicate that rounded cells at the basal portion of the taste buds cells (type IV cells) bind to Jacalin and PNA, and these lectins are specific markers for type IV cells of the rat taste cells.

Efficacy and Tolerability of Travoprost 0.004%/Timolol 0.5% Fixed-Dose Combination for the Treatment of Primary Open-Angle Glaucoma or Ocular Hypertension Inadequately Controlled with Beta-Blocker Monotherapy.

PubMed

Lerner, Simon Fabian; Park, Ki Ho; Hubatsch, Douglas A; Erichev, Valeriy; Paczka, Jose A; Roberts, Timothy V

2017-01-01

Objective . To evaluate the efficacy and tolerability of travoprost 0.004%/timolol 0.5% fixed-dose combination (TTFC) in patients with open-angle glaucoma (OAG) or ocular hypertension (OHT) inadequately controlled on beta-blocker monotherapy. Methods . In this phase IV, open-label study, 156 patients on beta-blocker monotherapy with mean intraocular pressure (IOP) between 18 and 32 mmHg were randomized (no washout period) to receive TTFC for 8 weeks (TTFC group) or to continue beta-blocker monotherapy for 4 weeks followed by TTFC for the remaining 4 weeks (beta-blocker group). Results . The mean IOP (±standard deviation) at baseline in the TTFC and beta-blocker groups was 22.5 ± 2.5 mmHg and 22.2 ± 2.3 mmHg, respectively, and at weeks 4 and 8, was 16.7 ± 3.1 mmHg and 16.1 ± 3.1 mmHg, respectively, in TTFC group and 21.1 ± 3.1 mmHg and 16.1 ± 2.8 mmHg, respectively, in the beta-blocker group. There was a significant least squares mean difference between TTFC and beta-blocker in 8 a.m. IOP at week 4 (-4.6 mmHg; one-sided 95% confidence interval [-inf, -3.9]; p < 0.0001 [primary endpoint]); the upper bound of the 95% confidence interval was within the prespecified limit (<0). Both treatments were well tolerated. Conclusion . Superior IOP control was achieved with TTFC in patients with OAG or OHT previously uncontrolled with beta-blockers. No new safety findings were identified. This trial is registered with ClinicalTrials.gov NCT02003391.

Effect of (R)-2-(2-aminothiazol-4-yl)-4'-{2-[(2-hydroxy-2-phenylethyl)amino]ethyl} acetanilide (YM178), a novel selective beta3-adrenoceptor agonist, on bladder function.

PubMed

Takasu, Toshiyuki; Ukai, Masashi; Sato, Shuichi; Matsui, Tetsuo; Nagase, Itsuro; Maruyama, Tatsuya; Sasamata, Masao; Miyata, Keiji; Uchida, Hisashi; Yamaguchi, Osamu

2007-05-01

We evaluated the pharmacological characteristics of (R)-2-(2-aminothiazol-4-yl)-4'-{2-[(2-hydroxy-2-phenylethyl)amino]-ethyl} acetanilide (YM178). YM178 increased cyclic AMP accumulation in Chinese hamster ovary (CHO) cells expressing human beta3-adrenoceptor (AR). The half-maximal effective concentration (EC50) value was 22.4 nM. EC50 values of YM178 for human beta1- and beta2-ARs were 10,000 nM or more, respectively. The ratio of intrinsic activities of YM178 versus maximal response induced by isoproterenol (nonselective beta-AR agonist) was 0.8 for human beta3-ARs, 0.1 for human beta1-ARs, and 0.1 for human beta2-ARs. The relaxant effects of YM178 were evaluated in rats and humans bladder strips precontracted with carbachol (CCh) and compared with those of isoproterenol and 4-[3-[(1,1-dimethylethyl)amino]-2-hydroxypropoxy]-1,3-dihydro-2H-benzimidazol-2-one hydrochloride (CGP-12177A) (beta3-AR agonist). EC50 values of YM178 and isoproterenol in rat bladder strips precontracted with 10(-6) M CCh were 5.1 and 1.4 microM, respectively, whereas those in human bladder strips precontracted with 10(-7) M CCh were 0.78 and 0.28 microM, respectively. In in vivo study, YM178 at a dose of 3 mg/kg i.v. decreased the frequency of rhythmic bladder contraction induced by intravesical filling with saline without suppressing its amplitude in anesthetized rats. These findings suggest the suitability of YM178 as a therapeutic drug for the treatment of symptoms of overactive bladder such as urinary frequency, urgency, and urge incontinence.

High accuracy prediction of beta-turns and their types using propensities and multiple alignments.

PubMed

Fuchs, Patrick F J; Alix, Alain J P

2005-06-01

We have developed a method that predicts both the presence and the type of beta-turns, using a straightforward approach based on propensities and multiple alignments. The propensities were calculated classically, but the way to use them for prediction was completely new: starting from a tetrapeptide sequence on which one wants to evaluate the presence of a beta-turn, the propensity for a given residue is modified by taking into account all the residues present in the multiple alignment at this position. The evaluation of a score is then done by weighting these propensities by the use of Position-specific score matrices generated by PSI-BLAST. The introduction of secondary structure information predicted by PSIPRED or SSPRO2 as well as taking into account the flanking residues around the tetrapeptide improved the accuracy greatly. This latter evaluated on a database of 426 reference proteins (previously used on other studies) by a sevenfold crossvalidation gave very good results with a Matthews Correlation Coefficient (MCC) of 0.42 and an overall prediction accuracy of 74.8%; this places our method among the best ones. A jackknife test was also done, which gave results within the same range. This shows that it is possible to reach neural networks accuracy with considerably less computional cost and complexity. Furthermore, propensities remain excellent descriptors of amino acid tendencies to belong to beta-turns, which can be useful for peptide or protein engineering and design. For beta-turn type prediction, we reached the best accuracy ever published in terms of MCC (except for the irregular type IV) in the range of 0.25-0.30 for types I, II, and I' and 0.13-0.15 for types VIII, II', and IV. To our knowledge, our method is the only one available on the Web that predicts types I' and II'. The accuracy evaluated on two larger databases of 547 and 823 proteins was not improved significantly. All of this was implemented into a Web server called COUDES (French acronym for: Chercher Ou Une Deviation Existe Surement), which is available at the following URL: http://bioserv.rpbs.jussieu.fr/Coudes/index.html within the new bioinformatics platform RPBS.

The biosynthesis of 4-hydroxycoumarin and dicoumarol by Aspergillus fumigatus Fresenius.

PubMed

Bye, A; King, H K

1970-04-01

A strain of Aspergillus fumigatus Fresenius, isolated from spoiled hay, converts melilotic acid (o-hydroxyphenylpropionic acid) and o-coumaric acid into 4-hydroxycoumarin and dicoumarol. The sequence is shown to be melilotic acid (I) [Formula: see text] coumaric acid (IV) [Formula: see text] beta-hydroxymelilotic acid (II) [Formula: see text] beta-oxomelilotic acid (III) [Formula: see text] 4-hydroxycoumarin (VI), on the basis of (1) studies on the formation of postulated intermediates, (2) experiments with isotopically labelled materials and (3) sequential enzyme induction. In the presence of semicarbazide, o-coumaraldehyde is formed from o-coumaric acid: there is no evidence, however, that this lies on the normal metabolic pathway.

40 CFR Appendix IV to Part 600 - Sample Fuel Economy Labels for 2008 Through 2012 Model Year Vehicles

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 31 2013-07-01 2013-07-01 false Sample Fuel Economy Labels for 2008 Through 2012 Model Year Vehicles IV Appendix IV to Part 600 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND GREENHOUSE GAS EXHAUST EMISSIONS OF MOTOR...

40 CFR Appendix IV to Part 600 - Sample Fuel Economy Labels for 2008 Through 2012 Model Year Vehicles

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 31 2012-07-01 2012-07-01 false Sample Fuel Economy Labels for 2008 Through 2012 Model Year Vehicles IV Appendix IV to Part 600 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND GREENHOUSE GAS EXHAUST EMISSIONS OF MOTOR...

40 CFR Appendix IV to Part 261 - Reserved

Code of Federal Regulations, 2010 CFR

2010-07-01

... AND LISTING OF HAZARDOUS WASTE Financial Requirements for Management of Excluded Hazardous Secondary Materials Wording of the instruments. Appendix IV to Part 261 [Reserved for Radioactive Waste Test Methods] ...

40 CFR 85.2114 - Basis of certification.

Code of Federal Regulations, 2010 CFR

2010-07-01

... an alternative, the aftermarket part manufacturer may use a different durability procedure if it can..., appendix IV. As an alternative, the aftermarket part manufacturer may use a different durability procedure..., appendix IV can be used. As an alternative, the aftermarket part manufacturer may use a different...

Differential effects of five 'classical' scorpion {beta}-toxins on rNa{sub v}1.2a and DmNav1 provide clues on species-selectivity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bosmans, Frank; Martin-Eauclaire, Marie-France; Tytgat, Jan

2007-01-01

In general, scorpion {beta}-toxins have been well examined. However, few in-depth studies have been devoted to species selectivity and affinity comparisons on the different voltage-activated Na{sup +} channels since they have become available as cloned channels that can be studied in heterologous expression systems. As a result, their classification is largely historical and dates from early in vivo experiments on mice and cockroach and fly larvae. In this study, we aimed to provide an updated overview of selectivity and affinity of scorpion {beta}-toxins towards voltage-activated Na{sup +} channels of vertebrates or invertebrates. As pharmacological tools, we used the classic {beta}-toxinsmore » AaHIT, Css II, Css IV, Css VI and Ts VII and tested them on the neuronal vertebrate voltage-activated Na{sup +} channel, rNa{sub v}1.2a. For comparison, its invertebrate counterpart, DmNav1, was also tested. Both these channels were expressed in Xenopus laevis oocytes and the currents measured with the two-electrode voltage-clamp technique. We supplemented this data with several binding displacement studies on rat brain synaptosomes. The results lead us to propose a general classification and a novel nomenclature of scorpion {beta}-toxins based on pharmacological activity.« less

Enhanced rectal absorption and reduced local irritation of the anti-inflammatory drug ethyl 4-biphenylylacetate in rats by complexation with water-soluble beta-cyclodextrin derivatives and formulation as oleaginous suppository.

PubMed

Arima, H; Kondo, T; Irie, T; Uekama, K

1992-11-01

To improve the rectal delivery of ethyl 4-biphenylylacetate (EBA), a prodrug of the anti-inflammatory drug 4-biphenylylacetic acid (BPAA), the use of highly water-soluble 2-hydroxypropyl-beta-cyclodextrin (HP-beta-CyD) and heptakis(2,6-di-O-methyl)-beta-cyclodextrin (DM-beta-CyD) was investigated and compared with the use of the parent beta-cyclodextrin (beta-CyD). Among the three beta-CyDs, HP-beta-CyD was best at improving the rectal bioavailability of EBA in rats after single and multiple administrations of oleaginous suppositories (Witepsol H-5) containing the complexes. To gain insight into the enhancing effect of beta-CyDs, the absorption behaviors of EBA (observed by monitoring BPAA as an active metabolite of EBA) and beta-CyDs themselves were examined in vitro, in situ, and in vivo. The in situ recirculation study revealed that the complexed form of EBA was less absorbable from the rectal lumen in the solution state, but this disadvantageous effect of beta-CyDs was compensated in part by the inhibition of the bioconversion of EBA to BPAA. When beta-CyDs were coadministered with EBA in vivo, however, rather high amounts of HP-beta-CyD (approximately 26% of dose) and DM-beta-CyD (approximately 21% of dose), compared with beta-CyD (approximately 5% of dose), were absorbed from the rat rectum. Thus, the enhancement of rectal absorption of EBA in vivo can be explained by the facts that the hydrophilic beta-CyDs increased the release rate of EBA from the vehicle and stabilized EBA in the rectal lumen and that the drug was partly absorbed in the form of the complex.(ABSTRACT TRUNCATED AT 250 WORDS)

[Study on chemical constituents of Orobanche coerulescens].

PubMed

Zhao, Jun; Yan, Ming; Huang, Yi; He, Wen-yi; Zhao, Yu

2007-10-01

Six compounds were isolated and purified from Orobanche coerulescens by extraction and different kinds of column chromatography. The structures were determined on the basis of spectral analysis. The structures were elucidated as D-mannitol(I), beta-sitosterol(II), succinic acid(III), caffeic acid(IV), protocatechuic aldehyde(V) and daucosterol(VI). All compounds are obtained from this plant for the first time.

Phenylethanoid glycosides from Phlomis integrifolia Hub.-Mor.

PubMed

Saracoglu, Iclal; Varel, Mehtap; Hada, Junko; Hada, Noriyasu; Takeda, Tadahiro; Donmez, Ali A; Calis, Ihsan

2003-01-01

Two new phenylethanoid glycosides integrifoliosides A (2) and B (3), along with a known phenylethanoid glycoside alyssonoside (1) and a flavone glucoside chrysoeriol-7-O-beta-D-glucopyranoside (4) were isolated from the aerial parts of Phlomis integrifolia. The structures of the new compounds were identified as 3,4-dihydroxy-beta-phenylethoxy-O-beta-D-apiofuranosyl-(1 --> 4)-alpha-L-rhamnopyranosyl-(1 --> 3)-4-O-feruloyl-beta-D-glucopyranoside (2) and 3-hydroxy-4-methoxy-beta-phenylethoxy-O-beta-D-apiofuranosyl-(1 --> 4)-alpha-L-rhamnopyranosyl-(1 --> 3)-4-O-feruloyl-beta-D-glucopyranoside (3), on the basis of spectroscopic (UV, IR, 1D- and 2D-NMR, and HR-FABMS) methods.

20 CFR 410.591 - Eligibility for services and supplies under part C of title IV of the act.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 20 Employees' Benefits 2 2011-04-01 2011-04-01 false Eligibility for services and supplies under part C of title IV of the act. 410.591 Section 410.591 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Payment of...

40 CFR Appendix IV to Part 600 - Sample Fuel Economy Labels for 2008 and Later Model Year Vehicles

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 30 2011-07-01 2011-07-01 false Sample Fuel Economy Labels for 2008... PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND CARBON-RELATED EXHAUST EMISSIONS OF MOTOR VEHICLES Pt. 600, App. IV Appendix IV to Part 600—Sample Fuel Economy Labels for 2008 and Later Model Year...

10 CFR Appendix IV to Part 960 - Types of Information for the Nomination of Sites as Suitable for Characterization

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 4 2010-01-01 2010-01-01 false Types of Information for the Nomination of Sites as Suitable for Characterization IV Appendix IV to Part 960 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR..., diapirism, tilting, subsidence, faulting, and volcanism. • Estimate of the geothermal gradient. • Estimate...

40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

Code of Federal Regulations, 2013 CFR

2013-07-01

... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 28 2013-07-01 2013-07-01 false Wastes Excluded From Lab Packs Under...

40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

Code of Federal Regulations, 2012 CFR

2012-07-01

... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 28 2012-07-01 2012-07-01 false Wastes Excluded From Lab Packs Under...

40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

Code of Federal Regulations, 2011 CFR

2011-07-01

... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 27 2011-07-01 2011-07-01 false Wastes Excluded From Lab Packs Under...

40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

Code of Federal Regulations, 2010 CFR

2010-07-01

... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Wastes Excluded From Lab Packs Under...

40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

Code of Federal Regulations, 2014 CFR

2014-07-01

... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 27 2014-07-01 2014-07-01 false Wastes Excluded From Lab Packs Under...

Barley and oat beta-glucan content measured by calcofluor fluorescence in a microplate assay

USDA-ARS?s Scientific Manuscript database

Beta-glucan levels in grains, particularly barley and oats, are receiving increased interest in part due to their recognized benefits to human health. While a number of methods to determine grain beta-glucan levels are available, each suffers from significant drawbacks for routine implementation. ...

Six new C21 steroidal glycosides from Asclepias curassavica L.

PubMed

Li, Jun-Zhu; Liu, Hai-Yang; Lin, Yi-Ju; Hao, Xiao-Jiang; Ni, Wei; Chen, Chang-Xiang

2008-07-01

Six new C(21) steroidal glycosides, named curassavosides A-F (3-8), were obtained from the aerial parts of Asclepias curassavica (Asclepiadaceae), along with two known oxypregnanes, 12-O-benzoyldeacylmetaplexigenin (1) and 12-O-benzoylsarcostin (2). By spectroscopic methods, the structures of the six new compounds were determined as 12-O-benzoyldeacylmetaplexigenin 3-O-beta-D-oleandropyranosyl-(1-->4)-beta-D-digitoxopyranoside (3), 12-O-benzoylsarcostin 3-O-beta-D-oleandropyranosyl-(1-->4)-beta-D-digitoxopyranoside (4), sarcostin 3-O-beta-D-oleandropyranosyl-(1-->4)-beta-D-canaropyranosyl-(1-->4)-beta-D-oleandropyranosyl-(1-->4)-beta-D-digitoxopyranoside (5), sarcostin 3-O-beta-D-oleandropyranosyl-(1-->4)-beta-D-canaropyranosyl-(1-->4)-beta-D-canaropyranosyl-(1-->4)-beta-D-digitoxopyranoside (6), 12-O-benzoyldeacylmetaplexigenin 3-O-beta-D-glucopyranosyl-(1-->4)-beta-D-oleandropyranosyl-(1-->4)-beta-D-canaropyranosyl-(1-->4)-beta-d-oleandropyranosyl-(1-->4)-beta-D-digitoxopyranoside (7), and 12-O-benzoylsarcostin 3-O-beta-D-glucopyranosyl-(1-->4)-beta-D-oleandropyranosyl-(1-->4)-beta-d-canaropyranosyl-(1-->4)-beta-D-oleandropyranosyl-(1-->4)-beta-D-digitoxopyranoside (8), respectively. All compounds (1-8) were tested for in vitro cytotoxicity; only compound 3 showed weak inhibitory activity against Raji and AGZY cell lines.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shaw, R.S.; Myers, B.R.; Vella, M.C.

Representative spectral data from T IV-a are compared with data from T IV-c obtained under similar conditions; i.e., 15 kV cusp bank voltage, 30 kV preionizer bank voltage, 2 kV bias bank voltage and 50 m Torr gas fill pressure. Two spectral lines, HeII 4686 A and D..beta.. 4861 A are studied. Line of sight data from the two devices, taken using a light pipe and mirror arrangement, are compared. The data were also used as inputs to a computer assisted tomogrphic reconstruction, the results of which are discussed. Comparison was made on the basis of the intensity and shapemore » of the spectral lines as functions of position and time.« less

Beta-endorphin-induced inhibition and stimulation of insulin secretion in normal humans is glucose dependent.

PubMed

Giugliano, D; Cozzolino, D; Salvatore, T; Torella, R; D'Onofrio, F

1988-09-01

This study evaluated the effect of human beta-endorphin on pancreatic hormone levels and their responses to nutrient challenges in normal subjects. Infusion of 0.5 mg/h beta-endorphin caused a significant rise in plasma glucose concentrations preceded by a significant increase in peripheral glucagon levels. No changes occurred in the plasma concentrations of insulin and C-peptide. Acute insulin and C-peptide responses to intravenous pulses of different glucose amounts (0.33 g/kg and 5 g) and arginine (3 g) were significantly reduced by beta-endorphin infusion (P less than .01). This effect was associated with a significant reduction of the glucose disappearance rates, suggesting that the inhibition of insulin was of biological relevance. beta-Endorphin also inhibited glucose suppression of glucagon levels and augmented the glucagon response to arginine. To verify whether the modification of prestimulus glucose level could be important in these hormonal responses to beta-endorphin, basal plasma glucose concentrations were raised by a primed (0.5 g/kg) continuous (20 mg kg-1.min-1) glucose infusion. After stabilization of plasma glucose levels (350 +/- 34 mg/dl, t = 120 min), beta-endorphin infusion caused an immediate and marked increase in plasma insulin level (peak response 61 +/- 9 microU/ml, P less than .01), which remained elevated even after the discontinuation of opioid infusion. Moreover, the acute insulin response to a glucose pulse (0.33 g/kg i.v.) given during beta-endorphin infusion during hyperglycemia was significantly higher than the response obtained during euglycemia (171 +/- 32 vs. 41 +/- 7 microU/ml, P less than .01).(ABSTRACT TRUNCATED AT 250 WORDS)

45 CFR 310.0 - What does this part cover?

Code of Federal Regulations, 2010 CFR

2010-10-01

... COMPUTERIZED TRIBAL IV-D SYSTEMS AND OFFICE AUTOMATION General Provisions § 310.0 What does this part cover... and Office Automation including: (a) The automated systems options for comprehensive Tribal IV-D... and Office Automation in § 310.15 of this part; (d) The conditions for funding the installation...

Corrections for Exchange and Screening Effects in Low-energy Beta Decays

NASA Astrophysics Data System (ADS)

Mougeot, X.; Bé, M.-M.; Bisch, C.; Loidl, M.

2014-06-01

The beta spectra of 241Pu and 63Ni have been recently measured using metallic magnetic calorimeters. This powerful experimental technique allows theoretical beta spectra calculations to be tested at low energy with an accuracy never before achievable. Their comparison with classical beta calculations exhibits a significant deviation below 4 keV for 241Pu and 8 keV for 63Ni. The atomic exchange effect explains the main part of this deviation in the 63Ni beta spectrum. This effect has a significant contribution, equivalent to the magnitude of the screening, in the 241Pu beta spectrum.

[Study on the chemical constituents of aerial part of Ligusticum jeholense].

PubMed

Sun, Jia-ming; Zhang, Bo; Chang, Ren-long; Ye, Dou-dan; Zhang, Hui

2011-07-01

To study the chemical constituents of the aerial part of Ligusticum jeholense. The constituents were isolated by sillica gel column chromatography, Sephadex LH-20 column chromatography and their structures were elucidated by spectral analysis. Seven compounds were separated from the EtOH extracts. Their structures were identified as psoralen (1), beta-sitosterol (2), daucosterol (3), kaempferol-3-O-(2",4"-di-E-p-coumaroyl)-alpha-L-rhamnoside (4), kaempferol-3-O-beta-D-galactoside (5), quercetin-3-O-beta-D-galactoside (6), sucrose (7). Compounds 1, 4, 5 and 6 are isolated from the genus for the first time. Compounds 2, 3 and 7 are isolated from the aerial part of the plant for the first time.

Xanthanolides and xanthane epoxide derivatives from Xanthium strumarium.

PubMed

Mahmoud, A A

1998-12-01

From the aerial parts of Xanthium strumarium, three new xanthanolide and xanthane-type sesquiterpenoids, 11alpha,13-dihydroxanthatin, 4beta,5beta-epoxyxanthatin-1alpha,4alpha-endoperoxide, and 1beta,4beta,4alpha,5alpha-diepoxyxanth-11(13)-en-12-oic acid have been isolated, together with seven known compounds. The structures were determined by spectroscopic methods, particularly high resolution 1D, 2D NMR spectroscopy and NOE experiments.

Multiwavelength monitoring of the dwarf nova VW Hydri. IV - Voyager observations

NASA Technical Reports Server (NTRS)

Polidan, R. S.; Holberg, J. B.

1987-01-01

Results from Voyager far-ultraviolet (500-1200 A) observations of the dwarf nova VW Hyi are presented as part of a coordinated, multiwavelength program. Data from one normal outburst and one superoutburst are discussed in detail. Far-ultraviolet (1050 A) light curves are produced showing a significant delay (0.5 day) in the rise to maximum at 1050 A with respect to optical wavelength, followed by a simultaneous decline. The superoutburst data show a distinct double-peaked light curve with the first rise and decline closely resembling that of a normal outburst. These data suggest that the rise to supermaximum in the far-ultraviolet is also delayed with respect to optical wavelengths. The spectral distribution of VW Hyi shows the steeply falling spectrum shortward of 1200 A, characteristic of dwarf novae in outburst and absorption features at 985 (N III, C III and Ly gamma) and 1030 (Ly beta and O VI). No flux shortward of 912 A was detected in VW Hyi.

Interrelationships of metal transfer factor under wastewater reuse and soil pollution.

PubMed

Papaioannou, D; Kalavrouziotis, I K; Koukoulakis, P H; Papadopoulos, F; Psoma, P

2018-06-15

The transfer of heavy metals under soil pollution wastewater reuse was studied in a Greenhouse experiment using a randomized block design, including 6 treatments of heavy metals mixtures composed of Zn, Mn, Cd, Co, Cu, Cr, Ni, and Pb, where each metal was taking part in the mixture with 0, 10, 20, 30, 40, 50 mg/kg respectively, in four replications. The Beta vulgaris L (beet) was used as a test plant. It was found that the metal transfer factors were statistically significantly related to the: (i) DTPA extractable soil metals, (ii) the soil pollution level as assessed by the pollution indices, (iii) the soil pH, (iv) the beet dry matter yield and (v) the interactions between the heavy metals in the soil. It was concluded that the Transfer Factor is subjected to multifactor effects and its real nature is complex, and there is a strong need for further study for the understanding of its role in metal-plant relationships. Copyright © 2017 Elsevier Ltd. All rights reserved.

Chimeras of the integrin beta subunit mid-region reveal regions required for heterodimer formation and for activation.

PubMed

Hyland, R H; Douglass, W A; Tan, S M; Law, S K

2001-01-01

A central region of the beta2 integrin subunit, RN (residues D300 to C459), was replaced by the equivalent sequences from beta1 and beta7 to give the chimeras beta2RN1 and beta2RN7. Whilst the former construct failed to form heterodimer at the cell surface with alphaL, the later of these could be expressed together with the alphaL subunit to form a variant LFA-1. Based on recent modelling work, the RN region consists of two parts, one is the C-terminal end of the putative A-domain (RB, residues D300 to A359), and the other the mid-region (BN, residues Y360 to C459). Chimeras exchanging the two component regions were made. Of the four resultant chimeras, only the beta2RB1 chimera failed to support LFA-1 expression. Thus the beta1 specific residues of this region affect the interaction with the alphaL subunit. Whereas the alphaL/beta2RB7 LFA-1 variant is wildtype like with respect to ICAM-1 adhesion, the alphaLbeta2BN1 and alphaLbeta2BN7, as well as the alphaLbeta2RN7, variants are more adhesive than the wildtype. These results suggest that an authentic beta2 mid-region is, in part, required for maintaining the LFA-1 in a resting state.

Cloning and expression of a novel UDP-GlcNAc:alpha-D-mannoside beta1,2-N-acetylglucosaminyltransferase homologous to UDP-GlcNAc:alpha-3-D-mannoside beta1,2-N-acetylglucosaminyltransferase I.

PubMed Central

Zhang, Wenli; Betel, Doron; Schachter, Harry

2002-01-01

A TBLASTN search with human UDP-GlcNAc:alpha-3-d-mannoside beta-1,2-N-acetylglucosaminyltransferase I (GnT I; EC 2.4.1.101) as a probe identified human and mouse Unigenes encoding a protein similar to human GnT I (34% identity over 340 amino acids). The recombinant protein converted Man(alpha1-6)[Man(alpha1-3)]Man(beta1-)O-octyl to Man(alpha1-6)[GlcNAc(beta1-2)Man(alpha1-3)]Man(beta1-)O-octyl, the reaction catalysed by GnT I. The enzyme also added GlcNAc to Man(alpha1-6)[GlcNAc(beta1-2)Man(alpha1-3)]Man(beta1-)O-octyl (the substrate for beta-1,2-N-acetylglucosaminyltransferase II), Man(alpha1-)O-benzyl [with K(m) values of approximately 0.3 and >30 mM for UDP-GlcNAc and Man(alpha1-)O-benzyl respectively] and the glycopeptide CYA[Man(alpha1-)O-T]AV (K(m) approximately 12 mM). The product formed with Man(alpha1-)O-benzyl was identified as GlcNAc(beta1-2)Man(alpha1-)O-benzyl by proton NMR spectroscopy. The enzyme was named UDP-GlcNAc:alpha-d-mannoside beta-1,2-N-acetylglucosaminyltransferase I.2 (GnT I.2). The human gene mapped to chromosome 1. Northern-blot analysis showed a 3.3 kb message with a wide tissue distribution. The cDNA has a 1980 bp open reading frame encoding a 660 amino acid protein with a type-2 domain structure typical of glycosyltransferases. Man(beta1-)O-octyl, Man(beta1-)O-p-nitrophenyl and GlcNAc(beta1-2)Man(alpha1-6)[GlcNAc(beta1-2)Man(alpha1-3)]Man(beta1-4)GlcNAc(beta1-4)GlcNAc(beta1-)O-Asn were not acceptors, indicating that GnT I.2 is specific for alpha-linked terminal Man and does not have N-acetylglucosaminyltransferase III, IV, V, VII or VIII activities. CYA[Man(alpha1-)O-T]AV was between three and seven times more effective as an acceptor than the other substrates, suggesting that GnT I.2 may be responsible for the synthesis of the GlcNAc(beta1-2)Man(alpha1-)O-Ser/Thr moiety on alpha-dystroglycan and other O-mannosylated proteins. PMID:11742540

Features of current-voltage characteristic of nonequilibrium trench MOS barrier Schottky diode

NASA Astrophysics Data System (ADS)

Mamedov, R. K.; Aslanova, A. R.

2018-06-01

The trench MOS barrier Schottky diodes (TMBS diode) under the influence of the voltage drop of the additional electric field (AEF) appearing in the near-contact region of the semiconductor are in a nonequilibrium state and their closed external circuit flows currents in the absence of an external voltage. When an external voltage is applied to the TMBS diode, the current transmission is described by the thermionic emission theory with a specific feature. Both forward and reverse I-V characteristics of the TMBS diode consist of two parts. In the initial first part of the forward I-V characteristic there are no forward currents, but reverse saturation currents flow, in its subsequent second part the currents increase exponentially with the voltage. In the initial first part of the reverse I-V characteristic, the currents increase in an abrupt way and in the subsequent second part the saturation currents flow under the action of the image force. The mathematical expressions for forward and reverse I-V characteristic of the TMBS diode and also narrow or nanostructure Schottky diode are proposed, which are in good agreement with the results of experimental and calculated I-V characteristics.

Beta-lactam antibiotics during pregnancy: a cross-sectional comparative study Zagreb-Novi Sad.

PubMed

Erić, M; Leppée, M; Sabo, A; Culig, J

2012-01-01

During pregnancy, a number of changes occur in women's body, and some medications are safe and some are not. The aim of our study was to establish the possible correlation between use of beta-lactam antibiotics in pregnancy and occurrence of congenital malformations. The study included 893 pregnant women from Zagreb and 6099 pregnant women from Novi Sad. 527 pregnant women used beta-lactams. First part of the study (one month study) was performed at four maternity hospitals in Zagreb, Croatia. Second part were collected as a part of the study analysing the teratogenicity of drugs used in pregnancy, a longitudinal study performed in Novi Sad district. Pregnant women most frequently used antibacterial agents in the first trimester of pregnancy. They used 15 different antibacterial medications, most often beta-lactams. In Zagreb arm, out of the total number of pregnant women that used medications during pregnancy (859), 231 (26.9%) used beta-lactam antibiotics. Malformations were detected in 8 (3.5%) cases. The prevalence of malformations in newborns whose mothers did not take beta-lactam antibiotics in pregnancy (662) was 2.7% (18 newborns with malformations). In Novi Sad arm, out of the total number of pregnant women that used medications during pregnancy (2013), 296 (14.7%) used beta-lactam antibiotics. Malformations were detected in 14 (4.7%) cases. The prevalence of malformations in newborns whose mothers did not take beta-lactam antibiotics in pregnancy (5803) was 1.7% (99 newborns with malformations). The results show possible teratogenic potential even with those antibacterials which are considered safe (amoxicillin) but as those are usually minor malformations they often pass undetected. International pharmacoepidemiological studies of drug use in pregnancy could substantially contribute to the improvement of pharmacotherapy, and could be of great help in assessing the fetal risks.

Placental lactogen secretion during prolonged-pregnancy in the rat: the ovary plays a pivotal role in the control of placental function.

PubMed

Shiota, K; Furuyama, N; Takahashi, M

1991-10-01

The serum of rats at mid-pregnancy contains at least 2 distinct placental lactogen (PL)-like substances tentatively termed placental lactogen-alpha (PL-alpha) and placental lactogen-beta (PL-beta) (Endocrinol Japon 38: 533-540, 1991). We have investigated the secretory patterns of three placental lactogens (PL-alpha, PL-beta and placental lactogen-II) during normal pregnancy and in two prolonged-pregnancy models. Pregnancy was prolonged by the introduction of new corpora lutea by inducing ovulation on day 15 of pregnancy by successive treatments with PMSG (30 IU/rat, sc on day 12) and hCG (10 IU/rat, iv on day 14), and in the second model by progesterone implants on day 15 of pregnancy. During normal pregnancy, each of the 3 PLs exhibited only one secretory peak in the serum; PL-alpha and PL-beta on day 12 and placental lactogen II (PL-II) on day 20. Interestingly, in the rats with new sets of corpora lutea, serum PL-alpha and PL-beta levels began to increase again on day 18 and showed peaks on day 20 for PL-alpha and on day 22 for PL-beta. In this model, the initiation of PL-II secretion was not affected, but high levels were maintained until day 26, when parturition occurred. In rats receiving either PMSG or hCG, the secretory patterns of the PLs were similar to as those during normal pregnancy.(ABSTRACT TRUNCATED AT 250 WORDS)

Development of SYN-004, an oral beta-lactamase treatment to protect the gut microbiome from antibiotic-mediated damage and prevent Clostridium difficile infection.

PubMed

Kaleko, Michael; Bristol, J Andrew; Hubert, Steven; Parsley, Todd; Widmer, Giovanni; Tzipori, Saul; Subramanian, Poorani; Hasan, Nur; Koski, Perrti; Kokai-Kun, John; Sliman, Joseph; Jones, Annie; Connelly, Sheila

2016-10-01

The gut microbiome, composed of the microflora that inhabit the gastrointestinal tract and their genomes, make up a complex ecosystem that can be disrupted by antibiotic use. The ensuing dysbiosis is conducive to the emergence of opportunistic pathogens such as Clostridium difficile. A novel approach to protect the microbiome from antibiotic-mediated dysbiosis is the use of beta-lactamase enzymes to degrade residual antibiotics in the gastrointestinal tract before the microflora are harmed. Here we present the preclinical development and early clinical studies of the beta-lactamase enzymes, P3A, currently referred to as SYN-004, and its precursor, P1A. Both P1A and SYN-004 were designed as orally-delivered, non-systemically available therapeutics for use with intravenous beta-lactam antibiotics. SYN-004 was engineered from P1A, a beta-lactamase isolated from Bacillus licheniformis, to broaden its antibiotic degradation profile. SYN-004 efficiently hydrolyses penicillins and cephalosporins, the most widely used IV beta-lactam antibiotics. In animal studies, SYN-004 degraded ceftriaxone in the GI tract of dogs and protected the microbiome of pigs from ceftriaxone-induced changes. Phase I clinical studies demonstrated SYN-004 safety and tolerability. Phase 2 studies are in progress to assess the utility of SYN-004 for the prevention of antibiotic-associated diarrhea and Clostridium difficile disease. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Variability of the needle essential oils of Pinus heldreichii from different populations in Montenegro and Serbia.

PubMed

Nikolić, Biljana; Ristić, Mihailo; Bojović, Srdjan; Marin, Petar D

2007-05-01

The essential-oil compositions of Pinus heldreichii Christ. from Montenegro and Serbia are reported at the population level. Whitebark pine is a sub-endemic high-mountain Balkan pine relict of an anthropogenically reduced area, with large morphological diversity and insufficiently clear taxonomic position. In the pine-needle terpene profile from three populations from Montenegro, and one from Serbia, 101 compounds were detected, 72 of which could be identified (Table 3). The dominant constituents are limonene (26.3%), alpha-pinene (17.5%), germacrene D (13.5%), and beta-caryophyllene (10.4%), comprising ca. 67.7% of the essential oil. Medium-to-high contents (0.5-10%) of the following 16 additional components were found: beta-pinene, beta-myrcene, alpha-humulene, delta-cadinene, alpha-muurolene, (E)-hex-2-enal, beta-gurjunene, gamma-muurolene, isopimarol, camphene, gamma-cadinene, aromadendrene, beta-bisabolene, trans-beta-farnesene, alpha-cadinene, and (Z)-hex-3-en-1-ol. The similarity of the populations and the within-population variability was visualized by principle-component analysis (PCA) of eleven selected terpenes in 97 tree samples. Cluster and genetic analyses suggest closest connection between the two spatially most-distant populations I (Montenegro) and IV (Serbia). Based on the profile of the main sesquiterpene components, the studied populations from Montenegro and Serbia are more similar to the populations from Greece and the Central Balkan peninsula (Bosnia and Serbia-Kosovo) than to those on the furthest eastern margin of their natural range (Bulgaria).

Exocomet Signatures Around the A-shell Star Phi Leonis

NASA Technical Reports Server (NTRS)

Eiroa, C.; Rebollido, I.; Montesinos, B.; Villaver, E.; Absil, O.; Henning, Th.; Bayo, A.; Canovas, H.; Carmona, A.; Chen, Ch.;

[Development of an orphan drug to treat a genetic disease: the paradigm of agalsidase beta].

PubMed

Germain, Dominique P; Benistan, Karelle

2007-03-01

Preclinical and phase I/II studies gave the proof of principle of enzyme replacement therapy (ERT) with recombinant alpha-galactosidase A through the demonstration of the clearance of the accumulated subtrate from plasma and tissues. In a multicenter, randomized, placebo-controlled, double-blind phase Ill study, the biological efficacy of recombinant alpha-galactosidose A (agalsidase beta 1 mg/kg/714 days) was demonstrated on the basis of complete clearance of accumulated globotriaosylceramide from the endothelia of the kidney, heart and skin. The phase III extension study data gives additional results: kidney function appears to be stabilized after 54 to 60 months of treatment with agolsidase beta in most patients. Intent-to-treat analysis of a double-blind, randomized, placebo-controlled, phase IV study, showed that, adjusted for on imbalance in baseline proteinuria, agalsidase beta significantly reduces by 53% the risk of a first clinical event (renal, cardiac and cerebrovascular), compared with placebo. Clinical benefits of ERT depend on patients' clinical status at baseline, therefore prompting for onset of ERT before irreversible damage occur and underlying the need to stratify patients' populations to better understand the outcome of ERT.

Human Rehabilitation Techniques. Project Papers. Volume IV, Part B.

ERIC Educational Resources Information Center

Dudek, R. A.; And Others

Volume IV, Part B of a six-volume final report (which covers the findings of a research project on policy and technology related to rehabilitation of disabled individuals) presents a continuation of papers (Part A) giving an overview of project methodology, much of the data used in projecting consequences and policymaking impacts in project…

Two new triterpenoid saponins from Dianthus superbus L.

PubMed

Chen, Xia; Luo, Jian-Guang; Kong, Ling-Yi

2010-06-01

Two new triterpenoid saponins (1 and 2) were isolated from the dried aerial parts of Dianthus superbus L. (Caryophyllaceae). Their structures were elucidated on the basis of spectral data to be 3-O-beta-D-glucopyranosyl olean-9(11),12-diene-23,28-dioic acid 28-O-beta-D-glucopyranoside (1) and 3-O-beta-D-glucopyranosyl olean-11,13(18)-diene-23,28-dioic acid 28-O-beta-D-glucopyranoside (2).

Coordinator(a) de Servicios Clinicos. Parte I (Unidad I-IV). Parte II (Unidad V-VI). Guia. Documento de Trabajo (Clinical Services Coordinator. Part I. Units I-IV. Part II. Units V-VI. Guide. Working Document).

ERIC Educational Resources Information Center

Puerto Rico State Dept. of Education, Hato Rey. Area for Vocational and Technical Education.

This guide is intended for instructing secondary students in the occupation of clinical services coordinator in a hospital. The first part contains four units on the following subjects: the occupation of clinical services coordinator; interpersonal relationships; ethical/legal aspects; and communications (telephone, intercom, and others). For each…

[Individual Types Reactivity of EEG Oscillations in Effective Heart Rhythm Biofeedback Parameters in Adolescents and Young People in the North].

PubMed

Krivonogova, E V; Poskotinova, L V; Demin, D B

2015-01-01

A single session of heart rate variability (HRV) biofeedback in apparently healthy young people and adolescents aged 14-17 years in order to increase vagal effects on heart rhythm and also electroencephalograms were carried out. Different variants of EEG spectral power during the successful HRV biofeedback session were identified. In the case of I variant of EEG activity the increase of power spectrum of alpha-, betal-, theta-components takes place in all parts of the brain. In the case of II variant of EEG activity the reduction of power spectrum of alpha-, betal-, theta-activity in all parts of the brain was observed. I and II variants of EEG activity cause more intensive regime of cortical-subcortical interactions. During the III variant of EEG activity the successful biofeedback is accompanied by increase of alpha activity in the central, front and anteriofrontal brain parts and so indicates the formation of thalamocortical relations of neural network in order to optimize the vegetal regulation of heart function. There was an increase in alpha- and beta1-activity in the parietal, central, frontal and temporal brain parts during the IV variant of EEG activity and so that it provides the relief of neural networks communication for information processing. As a result of V variance of EEG activity there was the increase of power spectrum of theta activity in the central and frontal parts of both cerebral hemispheres, so it was associated with the cortical-hippocampal interactions to achieve a successful biofeedback.

Origin of a sensitive dependence of calculated {beta}{beta}-decay amplitudes on the particle-particle residual interaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rodin, Vadim; Faessler, Amand

2011-07-15

In the present work the sensitivity of calculated {beta}{beta}-decay amplitudes to a realistic residual interaction is analyzed in the framework of the approach of O. A. Rumyantsev and M. H. Urin, Phys. Lett. B 443, 51 (1998). and V. A. Rodin, M. H. Urin, and A. Faessler, Nucl. Phys. A 747, 297 (2005). Both the Gamow-Teller (GT) and Fermi (F) matrix elements M{sup 2}{nu} for two-neutrino {beta}{beta} decay (2{nu}{beta}{beta} decay), along with the monopole transition contributions to the total matrix elements M{sup 0{nu}} of neutrinoless {beta}{beta} decay (0{nu}{beta}{beta} decay), are calculated within the quasiparticle random-phase approximation (QRPA). In the aforementionedmore » approach decompositions of M{sup 2{nu}} and M{sup 0{nu}} can be obtained in terms of the corresponding energy-weighted sum rules S. It is shown that in most of the cases almost the whole dependence of M{sup 2{nu}} and M{sup 0{nu}} on the particle-particle (p-p) renormalization parameter g{sub pp} is accounted for by the g{sub pp} dependence of the corresponding sum rules S. General expressions relating S to a realistic residual particle-particle interaction are derived, which show a pronounced sensitivity of S to the singlet-channel interaction in the case of F transitions and to the triplet-channel interaction in the case of GT transitions. Thus, the sensitivity of M{sup 2{nu}} and M{sup 0{nu}} to the SU(4)-symmetry-breaking part of the p-p residual interaction is dictated by the generic structure of the {beta}{beta}-decay amplitudes. Therefore, a choice of this part in a particular calculation needs a special caution. Finally, a better isospin-consistent way of renormalization of a realistic residual p-p interaction to use in QRPA calculations is suggested.« less

Medicinal foodstuffs. XXVII. Saponin constituents of gotu kola (2): structures of new ursane- and oleanane-type triterpene oligoglycosides, centellasaponins B, C, and D, from Centella asiatica cultivated in Sri Lanka.

PubMed

Matsuda, H; Morikawa, T; Ueda, H; Yoshikawa, M

2001-10-01

Ursane- and oleanane-type triterpene oligoglycosides, centellasaponins B, C, and D, were isolated from the aerial parts of Centella asiatica (L.) Urban cultivated in Sri Lanka together with madecassoside, asiaticoside, asiaticoside B, and sceffoleoside A. The chemical structures of centellasaponins B, C, and D were determined on the basis of chemical and physicochemical evidence to be madecassic acid 28-O-beta-D-glucopyranosyl(1-->6)-beta-D-glucopyranoside, madasiatic acid 28-O-alpha-L-rhamnopyranosyl(1-->4)-beta-D-glucopyranosyl(1-->6)-beta-D-glucopyranoside, and 3beta,6beta,23-trihydroxyolean-12-en-28-oic acid 28-O-alpha-L-rhamnopyranosyl(1-->4)-beta-D-glucopyranosyl(1-->6)-beta-D-glucopyranoside, respectively.

Bridging the gap between protein carboxyl methylation and phospholipid methylation to understand glucose-stimulated insulin secretion from the pancreatic beta cell.

PubMed

Kowluru, Anjaneyulu

2008-01-15

Recent findings have implicated post-translational modifications at C-terminal cysteines [e.g., methylation] of specific proteins [e.g., G-proteins] in glucose-stimulated insulin secretion [GSIS]. Furthermore, methylation at the C-terminal leucine of the catalytic subunit of protein phosphatase 2A [PP2Ac] has also been shown to be relevant for GSIS. In addition to these two classes of protein methyl transferases, a novel class of glucose-activated phospholipid methyl transferases have also been identified in the beta cell. These enzymes catalyze three successive methylations of phosphatidylethanolamine to yield phosphatidylcholine. The "newly formed" phosphatidylcholine is felt to induce alterations in the membrane fluidity, which might favor vesicular fusion with the plasma membrane for the exocytosis of insulin. The objectives of this commentary are to: (i) review the existing evidence on the regulation, by glucose and other insulin secretagogues, of post-translational carboxylmethylation [CML] of specific proteins in the beta cell; (ii) discuss the experimental evidence, which implicates regulation, by glucose and other insulin secretagogues, of phosphatidylethanolamine methylation in the islet beta cell; (iii) propose a model for potential cross-talk between the protein and lipid methylation pathways in the regulation of GSIS and (iv) highlight potential avenues for future research, including the development of specific pharmacological inhibitors to further decipher regulatory roles for these methylation reactions in islet beta cell function.

The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

PubMed

Leem, S H; Ropp, P A; Sugino, A

1994-08-11

We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.

Studies on the chemical constituents from the stem and leaves of Tagetes erecta.

PubMed

Zhang, Yu; Zhang, Ting-Ting

2010-09-01

To investigate the chemical constituents of the stem and leaves of Tagetes erecta. The materials extracted with ethanol were first purified with D101 resin and then separated by repeated silica gel column chromatography as well as recrystallization to get single compounds. The chemical structures of the compounds were elucidated on the basis of physicochemical properties, spectroscopic analysis and comparing with standard sample and literatures. Six compounds were identified as 4'-methoxy-eupatolitin-3-O-glucoside (I), kaempferitrin (II), rutin (III), beta-sitosterol (IV), daucosterol (V) and gallic acid (VI). Compounds I, II, III are isolated from the plant for the first time; the compounds IV, V, VI are isolated from the stem and leaves of the plant for the first time.

Long-term absorption of beta-tricalcium phosphate poly-L-lactic acid interference screws.

PubMed

Barber, F Alan; Dockery, William D

2008-04-01

The purpose of this study was to evaluate the long-term in vivo degradation of biodegradable interference screws made of poly-L-lactic acid (PLLA) and beta-tricalcium phosphate (beta-TCP). Twenty patients undergoing patellar tendon autograft anterior cruciate ligament reconstruction fixed at both the femur and tibia with beta-TCP-PLLA screws at least 44 months earlier were evaluated by physical, radiographic, and computed tomography (CT) evaluations. This study was approved by the institutional review board. Lysholm, Tegner, Cincinnati, and International Knee Documentation Committee scores were also obtained. CT data were measured in Hounsfield units. We evaluated 13 male and 7 female patients at a mean of 50 months after surgery (range, 44 to 56 months). CT scans and radiographs showed the bone plug fused to the tunnel wall with no beta-TCP-PLLA screw remaining. The screws were replaced with clearly calcified non-trabecular material, denser than soft tissue. Osteoconductivity was present in 75% of the tunnels and complete in 10%. No positive pivot-shift tests were found. Lysholm, Tegner, and Cincinnati scores improved from 60.4, 3.7, and 53.3, respectively, preoperatively to 90.8, 5.8, and 86.4, respectively, at follow-up. The mean side-to-side difference determined by use of the KT arthrometer (MEDmetric, San Diego, CA) was 0.4 mm. The beta-TCP-PLLA interference screw (Bilok; ArthroCare, Sunnyvale, CA) completely degraded, and no remnant was present 4 years after insertion. Osteoconductivity was confirmed by CT scans at 75% of the screw sites and completely filled the site in 10%. The addition of beta-TCP to PLLA results in a biocomposite interference screw that is osteoconductive. Level IV, therapeutic case series.

The role of beta-arrestin2 in shaping fMRI BOLD responses to dopaminergic stimulation.

PubMed

Sahlholm, Kristoffer; Ielacqua, Giovanna D; Xu, Jinbin; Jones, Lynne A; Schlegel, Felix; Mach, Robert H; Rudin, Markus; Schroeter, Aileen

2017-07-01

The dopamine D 2 receptor (D 2 R) couples to inhibitory G i/o proteins and is targeted by antipsychotic and antiparkinsonian drugs. Beta-arrestin2 binds to the intracellular regions of the agonist-occupied D 2 R to terminate G protein activation and promote internalization, but also to initiate downstream signaling cascades which have been implicated in psychosis. Functional magnetic resonance imaging (fMRI) has proven valuable for measuring dopamine receptor-mediated changes in neuronal activity, and might enable beta-arrestin2 function to be studied in vivo. The present study examined fMRI blood oxygenation level dependent (BOLD) signal changes elicited by a dopamine agonist in wild-type (WT) and beta-arrestin2 knockout (KO) mice, to investigate whether genetic deletion of beta-arrestin2 prolongs or otherwise modifies D 2 R-dependent responses. fMRI BOLD data were acquired on a 9.4 T system. During scans, animals received 0.2 mg/kg apomorphine, i.v. In a subset of experiments, animals were pretreated with 2 mg/kg of the D 2 R antagonist, eticlopride. Following apomorphine administration, BOLD signal decreases were observed in caudate/putamen of WT and KO animals. The time course of response decay in caudate/putamen was significantly slower in KO vs. WT animals. In cingulate cortex, an initial BOLD signal decrease was followed by a positive response component in WT but not in KO animals. Eticlopride pretreatment significantly reduced apomorphine-induced BOLD signal changes. The prolonged striatal response decay rates in KO animals might reflect impaired D 2 R desensitization, consistent with the known function of beta-arrestin2. Furthermore, the apomorphine-induced positive response component in cingulate cortex may depend on beta-arrestin2 signaling downstream of D 2 R.

Facts about Sickle Cell Disease

MedlinePlus

... from many parts of the world? HbS beta thalassemia People who have this form of SCD inherit ... from one parent and one gene for beta thalassemia, another type of anemia, from the other parent. ...

Adventures in Topological Field Theory

NASA Astrophysics Data System (ADS)

Horne, James H.

1990-01-01

This thesis consists of 5 parts. In part I, the topological Yang-Mills theory and the topological sigma model are presented in a superspace formulation. This greatly simplifies the field content of the theories, and makes the Q-invariance more obvious. The Feynman rules for the topological Yang -Mills theory are derived. We calculate the one-loop beta-functions of the topological sigma model in superspace. The lattice version of these theories is presented. The self-duality constraints of both models lead to spectrum doubling. In part II, we show that conformally invariant gravity in three dimensions is equivalent to the Yang-Mills gauge theory of the conformal group in three dimensions, with a Chern-Simons action. This means that conformal gravity is finite and exactly soluble. In part III, we derive the skein relations for the fundamental representations of SO(N), Sp(2n), Su(m| n), and OSp(m| 2n). These relations can be used recursively to calculate the expectation values of Wilson lines in three-dimensional Chern-Simons gauge theory with these gauge groups. A combination of braiding and tying of Wilson lines completely describes the skein relations. In part IV, we show that the k = 1 two dimensional gravity amplitudes at genus 3 agree precisely with the results from intersection theory on moduli space. Predictions for the genus 4 intersection numbers follow from the two dimensional gravity theory. In part V, we discuss the partition function in two dimensional gravity. For the one matrix model at genus 2, we use the partition function to derive a recursion relation. We show that the k = 1 amplitudes completely determine the partition function at arbitrary genus. We present a conjecture for the partition function for the arbitrary topological field theory coupled to topological gravity.

MetroBeta: Beta Spectrometry with Metallic Magnetic Calorimeters in the Framework of the European Program of Ionizing Radiation Metrology

NASA Astrophysics Data System (ADS)

Loidl, M.; Beyer, J.; Bockhorn, L.; Enss, C.; Györi, D.; Kempf, S.; Kossert, K.; Mariam, R.; Nähle, O.; Paulsen, M.; Rodrigues, M.; Schmidt, M.

2018-05-01

MetroBeta is a European project aiming at the improvement of the knowledge of the shapes of beta spectra, both in terms of theoretical calculations and measurements. It is part of a common European program of ionizing radiation metrology. Metallic magnetic calorimeters (MMCs) with the beta emitter embedded in the absorber have in the past proven to be among the best beta spectrometers, in particular for low-energy beta transitions. Within this project, new designs of MMCs optimized for five different beta energy ranges were developed. A new detector module with thermal decoupling of MMC and SQUID chips was designed. An important aspect of the research and development concerns the source/absorber preparation techniques. Four beta spectra with maximum energies ranging from 76 to 709 keV will be measured. Improved theoretical calculation methods and complementary measurement techniques complete the project.

20 CFR 634.3 - Eligible recipients.

Code of Federal Regulations, 2010 CFR

2010-04-01

... Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR LABOR MARKET INFORMATION PROGRAMS UNDER TITLE IV, PART E OF THE JOB TRAINING PARTNERSHIP ACT Comprehensive Labor Market Information System § 634.3 Eligible recipients. (a) For funds appropriated pursuant to JTPA title IV, part E...

P. aeruginosa PilT Structures with and without Nucleotide Reveal a Dynamic Type IV Pilus Retraction Motor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Misic, Ana M.; Satyshur, Kenneth A.; Forest, Katrina T.

Type IV pili are bacterial extracellular filaments that can be retracted to create force and motility. Retraction is accomplished by the motor protein PilT. Crystal structures of Pseudomonas aeruginosa PilT with and without bound {beta},{gamma}-methyleneadenosine-5{prime}-triphosphate have been solved at 2.6 {angstrom} and 3.1 {angstrom} resolution, respectively, revealing an interlocking hexamer formed by the action of a crystallographic 2-fold symmetry operator on three subunits in the asymmetric unit and held together by extensive ionic interactions. The roles of two invariant carboxylates, Asp Box motif Glu163 and Walker B motif Glu204, have been assigned to Mg{sup 2+} binding and catalysis, respectively. Themore » nucleotide ligands in each of the subunits in the asymmetric unit of the {beta},{gamma}-methyleneadenosine-5{prime}-triphosphate-bound PilT are not equally well ordered. Similarly, the three subunits in the asymmetric unit of both structures exhibit differing relative conformations of the two domains. The 12{sup o} and 20{sup o} domain rotations indicate motions that occur during the ATP-coupled mechanism of the disassembly of pili into membrane-localized pilin monomers. Integrating these observations, we propose a three-state 'Ready, Active, Release' model for the action of PilT.« less

Analysis of class II (hydrolytic) and class I (beta-lyase) apurinic/apyrimidinic endonucleases with a synthetic DNA substrate.

PubMed Central

Levin, J D; Demple, B

1990-01-01

We have developed simple and sensitive assays that distinguish the main classes of apurinic/apyrimidinic (AP) endonucleases: Class I enzymes that cleave on the 3' side of AP sites by beta-elimination, and Class II enzymes that cleave by hydrolysis on the 5' side. The distinction of the two types depends on the use of a synthetic DNA polymer that contains AP sites with 5'-[32P]phosphate residues. Using this approach, we now show directly that Escherichia coli endonuclease IV and human AP endonuclease are Class II enzymes, as inferred previously on the basis of indirect assays. The assay method does not exhibit significant interference by nonspecific nucleases or primary amines, which allows the ready determination of different AP endonuclease activities in crude cell extracts. In this way, we show that virtually all of the Class II AP endonuclease activity in E. coli can be accounted for by two enzymes: exonuclease III and endonuclease IV. In the yeast Saccharomyces cerevisiae, the Class II AP endonuclease activity is totally dependent on a single enzyme, the Apn1 protein, but there are probably multiple Class I enzymes. The versatility and ease of our approach should be useful for characterizing this important class of DNA repair enzymes in diverse systems. PMID:1698278

COPD predicts mortality in HF: the Norwegian Heart Failure Registry.

PubMed

De Blois, Jonathan; Simard, Serge; Atar, Dan; Agewall, Stefan

2010-03-01

Chronic obstructive pulmonary disease (COPD) and chronic heart failure (HF) are common clinical conditions that share tobacco as a risk factor. Our aim was to evaluate the prognostic impact of COPD on HF patients. The Norwegian Heart Failure Registry was used. The study included 4132 HF patients (COPD, n = 699) from 22 hospitals (mean follow-up, 13.3 months). COPD patients were older, more often smokers and diabetics, less often on beta-blockers and had a higher heart rate. They were more often in New York Heart Association (NYHA) Class III or IV (COPD, 63%; no COPD, 51%), although left ventricular ejection fraction (LVEF) distribution was similar. COPD independently predicted death (adjusted hazard ratio [HR], 1.188; 95% CI: 1.015 to 1.391; P = 0.03) along with age, creatinine, NYHA Class III/IV (HR, 1.464; 95% CI: 1.286 to 1.667) and diabetes. beta-blockers at baseline were associated with improved survival in patients with LVEF < or =40% independently of COPD. COPD is associated with a poorer survival in HF patients. COPD patients are overrated in terms of NYHA class in comparison with patients with similar LVEF. Nonetheless, NYHA class remains the strongest predictor of death in these patients. Copyright (c) 2010 Elsevier Inc. All rights reserved.

Heart Failure in Africa, Asia, the Middle East and South America: The INTER-CHF study.

PubMed

Dokainish, Hisham; Teo, Koon; Zhu, Jun; Roy, Ambuj; AlHabib, Khalid F; ElSayed, Ahmed; Palileo-Villaneuva, Lia; Lopez-Jaramillo, Patricio; Karaye, Kamilu; Yusoff, Khalid; Orlandini, Andres; Sliwa, Karen; Mondo, Charles; Lanas, Fernando; Prabhakaran, Dorairaj; Badr, Amr; Elmaghawry, Mohamed; Damasceno, Albertino; Tibazarwa, Kemi; Belley-Cote, Emilie; Balasubramanian, Kumar; Yacoub, Magdi H; Huffman, Mark D; Harkness, Karen; Grinvalds, Alex; McKelvie, Robert; Yusuf, Salim

2016-02-01

There are few data on heart failure (HF) patients from Africa, Asia, the Middle East and South America. INTER-CHF is a prospective study that enrolled HF patients in 108 centers in 16 countries from 2012 to 2014. Consecutive ambulatory or hospitalized adult patients with HF were enrolled. Baseline data were recorded on sociodemographics, clinical characteristics, HF etiology and treatments. Age- and sex-adjusted results are reported. We recruited 5813 HF patients: mean(SE) age=59(0.2)years, 39% female, 65% outpatients, 31% from rural areas, 26% with HF with preserved ejection fraction, with 1294 from Africa, 2661 from Asia, 1000 from the Middle-East, and 858 from South America. Participants from Africa-closely followed by Asians-were younger, had lower literacy levels, and were less likely to have health or medication insurance or be on beta-blockers compared with participants from other regions, but were most likely to be in NYHA class IV. Participants from South America were older, had higher insurance and literacy levels, and, along with Middle Eastern participants, were more likely to be on beta-blockers, but had the lowest proportion in NYHA IV. Ischemic heart disease was the most common HF etiology in all regions except Africa where hypertensive heart disease was most common. INTER-CHF describes significant regional variability in socioeconomic and clinical factors, etiologies and treatments in HF patients from Africa, Asia, the Middle East and South America. Opportunities exist for improvement in health/medication insurance rates and proportions of patients on beta blockers, particularly in Africa and Asia. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Antidiabetic Property of Symplocos cochinchinensis Is Mediated by Inhibition of Alpha Glucosidase and Enhanced Insulin Sensitivity

PubMed Central

Antu, Kalathookunnel Antony; Riya, Mariam Philip; Mishra, Arvind; Anilkumar, Karunakaran S.; Chandrakanth, Chandrasekharan K.; Tamrakar, Akhilesh K.; Srivastava, Arvind K.; Raghu, K. Gopalan

2014-01-01

The study is designed to find out the biochemical basis of antidiabetic property of Symplocos cochinchinensis (SC), the main ingredient of ‘Nisakathakadi’ an Ayurvedic decoction for diabetes. Since diabetes is a multifactorial disease, ethanolic extract of the bark (SCE) and its fractions (hexane, dichloromethane, ethyl acetate and 90% ethanol) were evaluated by in vitro methods against multiple targets relevant to diabetes such as the alpha glucosidase inhibition, glucose uptake, adipogenic potential, oxidative stress, pancreatic beta cell proliferation, inhibition of protein glycation, protein tyrosine phosphatase-1B (PTP-1B) and dipeptidyl peptidase-IV (DPP-IV). Among the extracts, SCE exhibited comparatively better activity like alpha glucosidase inhibition (IC50 value-82.07±2.10 µg/mL), insulin dependent glucose uptake (3 fold increase) in L6 myotubes, pancreatic beta cell regeneration in RIN-m5F (3.5 fold increase) and reduced triglyceride accumulation (22% decrease) in 3T3L1 cells, protection from hyperglycemia induced generation of reactive oxygen species in HepG2 cells (59.57% decrease) with moderate antiglycation and PTP-1B inhibition. Chemical characterization by HPLC revealed the superiority of SCE over other extracts due to presence and quantity of bioactives (beta-sitosterol, phloretin 2′glucoside, oleanolic acid) in addition to minerals like magnesium, calcium, potassium, sodium, zinc and manganese. So SCE has been subjected to oral sucrose tolerance test to evaluate its antihyperglycemic property in mild diabetic and diabetic animal models. SCE showed significant antihyperglycemic activity in in vivo diabetic models. We conclude that SC mediates the antidiabetic activity mainly via alpha glucosidase inhibition, improved insulin sensitivity, with moderate antiglycation and antioxidant activity. PMID:25184241

The effect of altered 5-hydroxytryptamine levels on beta-endorphin

NASA Technical Reports Server (NTRS)

Soliman, Karam F. A.; Mash, Deborah C.; Walker, Charles A.

1986-01-01

The purpose of the present study was to examine the effect of altering the concentration of 5-hydroxytryptamine (5-HT) on beta-endorphin (beta-Ep) content in the hypothalamus, thalamus, and periaqueductal gray (PAG)-rostral pons regions of the rat brain. The selective 5-HT reuptake inhibitor, fluoxetine (10 mg/kg), significantly lowered beta-Ep content in the hypothalamus and the PAG. Parachlorophenylalanine, which inhibits 5-HT synthesis, significantly elevated beta-Ep in all brain parts studied. Intracisternal injections of the neurotoxin 5-prime, 7-prime-dihydroxytryptamine with desmethylimipramine pretreatment significantly increased beta-Ep content in the hypothalamus and the PAG. In adrenalectomized rats, fluoxetine significantly decreased beta-Ep levels in the hypothalamus and increased the levels in the PAG. The results indicate that 5-HT may modulate the levels of brain beta-Ep.

Composition of the essential oil of Helichrysum chasmolycicum growing wild in Turkey.

PubMed

Chalchat, J C; Ozcan, M M

2006-01-01

The chemical compositions of the essential oil obtained from the aerial parts of Helichrysum chasmolycicum were analyzed by gas chromatography and gas chromatography-mass spectrometry. From the 57 identified constituents, representing 66.55% of the oil, the main constituents of the oil were beta-caryophyllene (27.6%), beta-selinene (8.9%), alpha-selinene (8.4%), caryophyllene oxide (7.3%), and carvacrol (2.4%). The essential oil was almost totally characterized by sesquiterpene hydrocarbons such as beta-caryophyllene and alpha- and beta-selinene.

Two new flavonol glycosides from Gymnema sylvestre and Euphorbia ebracteolata.

PubMed

Liu, Xin; Ye, Wencai; Yu, Biao; Zhao, Shouxun; Wu, Houming; Che, Chuntao

2004-03-15

Two new flavonol glycosides, namely kaempferol 3-O-beta-D-glucopyranosyl-(1-->4)-alpha-L-rhamnopyranosyl-(1-->6)-beta-D-galactopyranoside (1) and quercetin 3-O-6"-(3-hydroxyl-3-methylglutaryl)-beta-D-glucopyranoside (2), have been isolated from the aerial parts of Gymnema sylvestre and Euphorbia ebracteolata, respectively. Their structures were determined on the basis of chemical and spectroscopic methods.

Cumene oxidation by cis-[RuIV(bpy)2(py)(O)]2+, revisited.

PubMed

Bryant, Jasmine R; Matsuo, Takashi; Mayer, James M

2004-02-23

cis-[RuIV(bpy)2(py)(O)]2+ oxidizes cumene (2-phenylpropane) in acetonitrile solution primarily to cumyl alcohol (2-phenyl-2-propanol), alpha-methylstyrene, and acetophenone. Contrary to a prior report, the rate of the reaction is not accelerated by added nucleophiles. There is thus no evidence for the hydride transfer mechanism originally proposed. Instead, the results are consistent with a mechanism of initial hydrogen atom transfer from cumene to the ruthenium oxo group. This is indicated by the correlation of rate with C-H bond strength and by the various products observed. The formation of acetophenone, with one carbon less than cumene, is suggested to occur via a multistep pathway involving decarbonylation of the acyl radical from 2-phenylpropanal. An alternative mechanism involving beta-scission of cumyloxyl radical is deemed unlikely because of the difficulty of generating alkoxyl radicals under anaerobic conditions and the lack of rearranged products in the oxidation of triphenylmethane by cis-[RuIV(bpy)2(py)(O)]2+.

76 FR 22878 - Defense Transportation Regulation, Part IV

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-25

... Military Services, DFAS and SDDC. In addition, the proposed electronic billing processes will compliment... in the Defense Transportation Regulation (DTR) Part IV (DTR 4500.9R). This process proposes mandatory... Transportation Service Providers (TSP). Implementation of electronic payments for NTS at all Military Services...

Dielectric Constant and Loss Data Part 2

DTIC Science & Technology

1975-12-01

fluoride, single crystal, Melamine - formaldehyde resins , Columbia Univ., P.R.-75 IV-21,22,112; V-8,88 Manganese-magnesium ferrite, Melamine GMG, IV-2i...butylperoxy) Urea - formaldehyde resins , IV-23 hexane, P.R.-197 U.S. Army Engineering Research and War Dept., Picatinny Arsenal, see Dev. Lab., Fort...IV.-36 irradiated, P.R,-161 "Bakelite" polyvinyl chloride- "Amplifilm," IV-14; V-74 acetate, see "Vinylites" Axiiliine- formaldehyde resins , IV-21

Role of the nitric oxide/cyclic GMP/Ca2+ signaling pathway in the pyrogenic effect of interleukin-1beta.

PubMed

Palmi, Mitri; Meini, Antonella

2002-04-01

Interleukin-1beta (IL-1beta) has a wide spectrum of inflammatory, metabolic, haemopoietic, and immunological properties. Because it produces fever when injected into animals and humans, it is considered an endogenous pyrogen. There is evidence to suggest that Ca2+ plays a critical role in the central mechanisms of thermoregulation, and in the intracellular signaling pathways controlling fever induced by IL-1beta and other pyrogens. Data from different labs indicate that Ca2+ and Na+ determine the temperature set point in the posterior hypothalamus (PH) of various mammals and that changes in Ca2+ and PGE2 concentrations in the cerebrospinal fluid (CSF) of these animals are associated with IL-1beta-induced fever. Antipyretic drugs such as acetylsalicylic acid, dexamethasone, and lipocortin 5-(204-212) peptide counteract IL-1beta-induced fever and abolish changes in Ca2+ and PGE2 concentrations in CSF. In vitro studies have established that activation of the nitric oxide (NO)/cyclic GMP (cGMP) pathway is part of the signaling cascade transducing Ca2+ mobilization in response to IL-1beta and that the ryanodine (RY)- and inositol-(1,4,5)-trisphosphate (IP3)-sensitive pools are the main source of the mobilized Ca2+. It is concluded that the NO/cGMP/Ca2+ pathway is part of the signaling cascade subserving some of the multiple functions of IL-1beta.

40 CFR Appendix B to Part 503 - Pathogen Treatment Processes

Code of Federal Regulations, 2011 CFR

2011-07-01

... 55 to 60 degrees Celsius. 5. Beta ray irradiation—Sewage sludge is irradiated with beta rays from an... irradiation—Sewage sludge is irradiated with gamma rays from certain isotopes, such as 60 Cobalt and 137...

40 CFR Appendix B to Part 503 - Pathogen Treatment Processes

Code of Federal Regulations, 2013 CFR

2013-07-01

... 55 to 60 degrees Celsius. 5. Beta ray irradiation—Sewage sludge is irradiated with beta rays from an... irradiation—Sewage sludge is irradiated with gamma rays from certain isotopes, such as 60 Cobalt and 137...

40 CFR Appendix B to Part 503 - Pathogen Treatment Processes

Code of Federal Regulations, 2014 CFR

2014-07-01

... 55 to 60 degrees Celsius. 5. Beta ray irradiation—Sewage sludge is irradiated with beta rays from an... irradiation—Sewage sludge is irradiated with gamma rays from certain isotopes, such as 60 Cobalt and 137...

40 CFR Appendix B to Part 503 - Pathogen Treatment Processes

Code of Federal Regulations, 2010 CFR

2010-07-01

... 55 to 60 degrees Celsius. 5. Beta ray irradiation—Sewage sludge is irradiated with beta rays from an... irradiation—Sewage sludge is irradiated with gamma rays from certain isotopes, such as 60 Cobalt and 137...

40 CFR Appendix B to Part 503 - Pathogen Treatment Processes

Code of Federal Regulations, 2012 CFR

2012-07-01

... 55 to 60 degrees Celsius. 5. Beta ray irradiation—Sewage sludge is irradiated with beta rays from an... irradiation—Sewage sludge is irradiated with gamma rays from certain isotopes, such as 60 Cobalt and 137...

48 CFR 1315.204-570 - Part IV representations and instructions.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Part IV representations and instructions. 1315.204-570 Section 1315.204-570 Federal Acquisition Regulations System DEPARTMENT.... Contracting officers shall tailor the provision to suit their acquisition. (3) The contracting officer shall...

48 CFR 1315.204-570 - Part IV representations and instructions.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Part IV representations and instructions. 1315.204-570 Section 1315.204-570 Federal Acquisition Regulations System DEPARTMENT.... Contracting officers shall tailor the provision to suit their acquisition. (3) The contracting officer shall...

48 CFR 1315.204-570 - Part IV representations and instructions.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 5 2011-10-01 2011-10-01 false Part IV representations and instructions. 1315.204-570 Section 1315.204-570 Federal Acquisition Regulations System DEPARTMENT.... Contracting officers shall tailor the provision to suit their acquisition. (3) The contracting officer shall...

48 CFR 1315.204-570 - Part IV representations and instructions.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false Part IV representations and instructions. 1315.204-570 Section 1315.204-570 Federal Acquisition Regulations System DEPARTMENT.... Contracting officers shall tailor the provision to suit their acquisition. (3) The contracting officer shall...

48 CFR 1315.204-570 - Part IV representations and instructions.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 5 2012-10-01 2012-10-01 false Part IV representations and instructions. 1315.204-570 Section 1315.204-570 Federal Acquisition Regulations System DEPARTMENT.... Contracting officers shall tailor the provision to suit their acquisition. (3) The contracting officer shall...

Enter the Madcap Prince of Wales: Students Directing "Henry IV, Part I."

ERIC Educational Resources Information Center

Earthman, Elise Ann

1993-01-01

Argues that William Shakespeare's "Henry IV, Part I" is an appropriate and useful text for secondary English classrooms. Shows how the play lends itself to performance-based instruction. Outlines ways of accomplishing student engagement, using film versions, and assigning written work. (HB)

Antiproteinuric therapy and fabry nephropathy: sustained reduction of proteinuria in patients receiving enzyme replacement therapy with agalsidase-beta.

PubMed

Tahir, Hindia; Jackson, Leslie L; Warnock, David G

2007-09-01

This report describes an open-label, nonrandomized, prospective evaluation of the effects of angiotensin-converting enzyme inhibitor and angiotensin receptor blocker therapy on patients who have Fabry disease and also received enzyme replacement therapy with agalsidase-beta, given at 1 mg/kg body wt every 2 wk. Previous placebo-controlled phase III and phase IV trials with agalsidase-beta demonstrated clearing of globotriaosylceramide from vascular endothelia but little effect on proteinuria or progressive loss of kidney function in patients with Fabry disease and severe chronic kidney disease marked by overt proteinuria and/or estimated GFR <60 ml/min per 1.73 m2. Angiotensin-converting enzyme inhibitor and/or angiotensin receptor blocker therapy is the standard of care for patients with proteinuric kidney diseases, but their use is challenging in patients with Fabry disease and low or low-normal baseline systemic BP. A group of patients with Fabry disease were treated with antiproteinuric therapy, in conjunction with agalsidase-beta; sustained reductions in proteinuria with stabilization of kidney function were achieved in a group of six patients who had severe Fabry nephropathy; the progression rate was -0.23 +/- 1.12 ml/min per 1.73 m2 per yr with 30 mo of follow-up.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

The aCORN backscatter-suppressed beta spectrometer

DOE PAGES

Hassan, M. T.; Bateman, F.; Collett, B.; ...

2017-06-16

Backscatter of electrons from a beta detector, with incomplete energy deposition, can lead to undesirable effects in many types of experiments. We present and discuss the design and operation of a backscatter-suppressed beta spectrometer that was developed as part of a program to measure the electron–antineutrino correlation coefficient in neutron beta decay (aCORN). An array of backscatter veto detectors surrounds a plastic scintillator beta energy detector. The spectrometer contains an axial magnetic field gradient, so electrons are efficiently admitted but have a low probability for escaping back through the entrance after backscattering. Lastly, the design, construction, calibration, and performance ofmore » the spectrometer are discussed.« less

AE activity during transient beta drops in high poloidal beta discharges

NASA Astrophysics Data System (ADS)

Huang, J.; Gong, X. Z.; Ren, Q. L.; Ding, S. Y.; Qian, J. P.; Pan, C. K.; Li, G. Q.; Heidbrink, W. W.; Garofalo, A. M.; McClenaghan, J.

2016-10-01

Enhanced AE activity has been observed during transient beta drops in high poloidal beta DIII-D discharges with internal transport barriers (ITBs). These drops in beta are believed to be caused by n=1 external kink modes. In some discharges, beta recovers within 200 ms but, in others, beta stays suppressed. A typical discharge has βP 3, qmin 3, and q95 12. The drop in beta affects both fast ions and thermal particles, and a drop is also observed in the density and rotation. The enhanced AE activity follows the instability that causes the beta drop, is largest at the lowest beta, and subsides as beta recovers. MHD stability analysis is planned. A database study of the plasma conditions associated with the collapse will be also presented. Supported in part by the US Department of Energy under DE-FC02-04ER54698, DE-AC05-06OR23100, and by the National Natural Science Foundation of China 11575249, and the National Magnetic Confinement Fusion Program of China No. 2015GB110005.

EEG resolutions in detecting and decoding finger movements from spectral analysis

PubMed Central

Xiao, Ran; Ding, Lei

2015-01-01

Mu/beta rhythms are well-studied brain activities that originate from sensorimotor cortices. These rhythms reveal spectral changes in alpha and beta bands induced by movements of different body parts, e.g., hands and limbs, in electroencephalography (EEG) signals. However, less can be revealed in them about movements of different fine body parts that activate adjacent brain regions, such as individual fingers from one hand. Several studies have reported spatial and temporal couplings of rhythmic activities at different frequency bands, suggesting the existence of well-defined spectral structures across multiple frequency bands. In the present study, spectral principal component analysis (PCA) was applied on EEG data, obtained from a finger movement task, to identify cross-frequency spectral structures. Features from identified spectral structures were examined in their spatial patterns, cross-condition pattern changes, detection capability of finger movements from resting, and decoding performance of individual finger movements in comparison to classic mu/beta rhythms. These new features reveal some similar, but more different spatial and spectral patterns as compared with classic mu/beta rhythms. Decoding results further indicate that these new features (91%) can detect finger movements much better than classic mu/beta rhythms (75.6%). More importantly, these new features reveal discriminative information about movements of different fingers (fine body-part movements), which is not available in classic mu/beta rhythms. The capability in decoding fingers (and hand gestures in the future) from EEG will contribute significantly to the development of non-invasive BCI and neuroprosthesis with intuitive and flexible controls. PMID:26388720

78 FR 18325 - Defense Transportation Regulation, Part IV

Federal Register 2010, 2011, 2012, 2013, 2014

2013-03-26

... received in connection with the Defense Personal Property Program (DP3) Phase III Direct Procurement Method... at http://www.transcom.mil/dtr/part-iv/phaseiii.cfm (DPM SECTION). All identified changes will be... Defense Personal Property System (DPS) Phase III programming projected for FY17. FOR FURTHER INFORMATION...

20 CFR 410.101 - Introduction.

Code of Federal Regulations, 2010 CFR

2010-04-01

... Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV.... The regulations in this part 410 (Regulation No. 10 of the Social Security Administration) relate to the provisions of part B (Black Lung Benefits) of title IV of the Federal Coal Mine Health and Safety...

Sensitivity Analysis of Geometrical Parameters on the Aerodynamic Performance of Closed-Box Girder Bridges.

PubMed

Yang, Yongxin; Zhou, Rui; Ge, Yaojun; Du, Yanliang; Zhang, Lihai

2018-06-27

In this study, the influence of two critical geometrical parameters (i.e., angles of wind fairing, α; and lower inclined web, β) in the aerodynamic performance of closed-box girder bridges was systematically investigated through conducting a theoretical analysis and wind tunnel testing using laser displacement sensors. The results show that, for a particular inclined web angle β, a closed-box girder with a sharper wind fairing angle of α = 50° has better flutter and vortex-induced vibration (VIV) performance than that with α = 60°, while an inclined web angle of β = 14° produces the best VIV performance. In addition, the results from particle image velocimetry (PIV) tests indicate that a wind fairing angle of α = 50° produces a better flutter performance by inducing a single vortex structure and a balanced distribution of the strength of vorticity in both upper and lower parts of the wake region. Furthermore, two-dimensional three-degrees-of-freedom (2D-3DOF) analysis results demonstrate that the absolute values of Part A (with a reference of flutter derivative A ₂ * ) and Part D (with a reference of A ₁ * H ₃ * ) generally decrease with the increase of β, while the change of the participation level of heaving degrees of freedom (DOF) in torsion-dominated coupled flutter initially increases, reaches its peak, and then decreases with the increase of β.

The Role of beta-TrCP Ubiquitin Ligase Receptor in the Development of Breast Cancer

DTIC Science & Technology

2007-06-01

34 The expression of insecticide resistance -related cytochrome P450 forms is regulated by molting hormone in Drosophila melanogaster. BBRC, 232, 304...34Molting hormone induces insecticide resistance -related forms of cytochrome p-450 in Drosophila melanogaster." In: ൒th International Symposium on...307, 1997. 10. Spiegelman V.S.*, Budunova I.V., Carbajal S., Slaga T.J. Resistance of transformed mouse keratinocytes to growth inhibition by

45 CFR 310.40 - What requirements apply for accessing systems and records for monitoring Computerized Tribal IV-D...

Code of Federal Regulations, 2010 CFR

2010-10-01

... records for monitoring Computerized Tribal IV-D Systems and Office Automation? 310.40 Section 310.40... COMPUTERIZED TRIBAL IV-D SYSTEMS AND OFFICE AUTOMATION Accountability and Monitoring Procedures for... monitoring Computerized Tribal IV-D Systems and Office Automation? In accordance with Part 95 of this title...

Xe isotope detection and discrimination using beta spectroscopy with coincident gamma spectroscopy

NASA Astrophysics Data System (ADS)

Reeder, P. L.; Bowyer, T. W.

1998-02-01

Beta spectroscopic techniques show promise of significant improvements for a beta-gamma coincidence counter that is part of a system for analyzing Xe automatically separated from air. The previously developed counting system for 131mXe, 133mXe, 133gXe, and 135gXe can be enhanced to give additional discrimination between these Xe isotopes by using the plastic scintillation sample cell as a beta spectrometer to resolve the conversion electron peaks. The automated system will be a key factor in monitoring the Comprehensive Test Ban Treaty.

Escherichia coli FtsH (HflB) degrades a membrane-associated TolAI-II-beta-lactamase fusion protein under highly denaturing conditions.

PubMed

Cooper, K W; Baneyx, F

2001-03-01

TolAI--II--beta-lactamase, a fusion protein consisting of the inner membrane and transperiplasmic domains of TolA followed by TEM--beta-lactamase associated with the inner membrane but remained confined to the cytoplasm when expressed at high level in Escherichia coli. Although the fusion protein was resistant to proteolysis in vivo, it was hydrolyzed during preparative SDS-polyacrylamide electrophoresis and when insoluble cellular fractions unfolded with 5 M urea were subjected to microdialysis. Inhibitor profiling studies revealed that both a metallo- and serine protease were involved in TolAI--II--beta-lactamase degradation under denaturing conditions. The in vitro degradation rates of the fusion protein were not affected when insoluble fractions were harvested from a strain lacking protease IV, but were significantly reduced when microdialysis experiments were conducted with material isolated from an isogenic ftsH1 mutant. Adenine nucleotides were not required for degradation, and ATP supplementation did not accelerate the apparent rate of TolAI--II--beta-lactamase hydrolysis under denaturing conditions. Our results indicate that the metalloprotease active site of FtsH remains functional in the presence of 3--5 M urea and suggest that the ATPase and proteolytic activities of FtsH can be uncoupled if the substrate is sufficiently unstructured. Thus, a key role of the FtsH AAA module appears to be the net unfolding of bound substrates so that they can be efficiently engaged by the protease active site. Copyright 2001 Academic Press.

Estrogen attenuates the cardiovascular and ventilatory responses to central command in cats.

PubMed

Hayes, Shawn G; Moya Del Pino, Nicolas B; Kaufman, Marc P

2002-04-01

Static exercise is well known to increase heart rate, arterial blood pressure, and ventilation. These increases appear to be less in women than in men, a difference that has been attributed to an effect of estrogen on neuronal function. In decerebrate male cats, we examined the effect of estrogen (17beta-estradiol; 0.001, 0.01, 0.1, and 1.0 microg/kg iv) on the cardiovascular and ventilatory responses to central command and the exercise pressor reflex, the two neural mechanisms responsible for evoking the autonomic and ventilatory responses to exercise. We found that 17beta-estradiol, in each of the three doses tested, attenuated the pressor, cardioaccelerator, and phrenic nerve responses to electrical stimulation of the mesencephalic locomotor region (i.e., central command). In contrast, none of the doses of 17beta-estradiol had any effect on the pressor, cardioaccelerator, and ventilatory responses to static contraction or stretch of the triceps surae muscles. We conclude that, in decerebrate male cats, estrogen injected intravenously attenuates cardiovascular and ventilatory responses to central command but has no effect on responses to the exercise pressor reflex.

Quality assurance, an administrative means to a managerial end: Part IV.

PubMed

Clark, G B

1992-01-01

This is the fourth and final part of a series of articles on laboratory quality surveillance. Part I addressed the historical background of medical quality assurance. Part II covered surveillance guidelines of the Joint Commission on Accreditation of Healthcare Organizations (JCAHO) and the College of American Pathologists with emphasis on quality assurance (QA) and the ten-step process. Part III focused on the JCAHO transition from QA to quality assessment and improvement. Part IV concludes the series by discussing the systematic identification of quality indicators in the total quality management and continuous quality improvement environment.

Extracorporeal Membrane Oxygenation in Drug Overdose: A Clinical Case Series

PubMed Central

Vignesh, C.; Kumar, Madhan; Venkataraman, Ramesh; Rajagopal, Senthilkumar; Ramakrishnan, Nagarajan; Abraham, Babu K.

2018-01-01

Overdose of cardiovascular medications such as beta blockers and calcium channel blockers cause impaired cardiac contractility, vasoplegia, and/or rhythm disturbances. In addition to conventional management of limiting absorption, increasing elimination and hemodynamic support intravenous (IV) calcium infusion, hyperinsulinemia-euglycemia therapy, glucagon infusion, and IV lipid emulsion have been tried. Extracorporeal circulatory assist device support has been reported as a rescue therapy in overdose refractory to maximal medical therapy. We report three patients with cardiovascular medication overdose presenting with profound cardiovascular instability refractory to medical therapy. Venoarterial extracorporeal membrane oxygenation support (VA ECMO) was initiated to provide hemodynamic support. Despite the occurrence of device-associated complications, the outcome was good and all patients survived. VA ECMO may be considered in patients with severe refractory shock due to cardiotoxic medication overdose. PMID:29531453

Extracorporeal Membrane Oxygenation in Drug Overdose: A Clinical Case Series.

PubMed

Vignesh, C; Kumar, Madhan; Venkataraman, Ramesh; Rajagopal, Senthilkumar; Ramakrishnan, Nagarajan; Abraham, Babu K

2018-02-01

Overdose of cardiovascular medications such as beta blockers and calcium channel blockers cause impaired cardiac contractility, vasoplegia, and/or rhythm disturbances. In addition to conventional management of limiting absorption, increasing elimination and hemodynamic support intravenous (IV) calcium infusion, hyperinsulinemia-euglycemia therapy, glucagon infusion, and IV lipid emulsion have been tried. Extracorporeal circulatory assist device support has been reported as a rescue therapy in overdose refractory to maximal medical therapy. We report three patients with cardiovascular medication overdose presenting with profound cardiovascular instability refractory to medical therapy. Venoarterial extracorporeal membrane oxygenation support (VA ECMO) was initiated to provide hemodynamic support. Despite the occurrence of device-associated complications, the outcome was good and all patients survived. VA ECMO may be considered in patients with severe refractory shock due to cardiotoxic medication overdose.

[Glycosides from flowers of Jasminum officinale L. var. grandiflorum].

PubMed

Zhao, Gui-qin; Xia, Jing-jing; Dong, Jun-xing

2007-10-01

To study the chemical constituents of the flower of Jasminum officinale L. var. grandiflorum. The compounds were isolated and purified by re-crystallization and chromatography on silica gel and Sephadex LH-20 column. Their structures were elucidated on the physicochemical properties and spectral analysis. Seven glycosides were identified as kaempferol-3-O-alpha-L-rhamnopyranosyl (1-->3)-[alpha-L-rhamnopyranosyl (1-->6)]-beta-D-galactopyranoside (I), kaempferol-3-O-rutinoside (II), 7-ketologanin (III), oleoside-11-methyl ester (IV), 7-glucosyl-l1-methyl oleoside (V), ligstroside (VI), oleuropein (VII). Compound I is a new compound. Compounds III and V were isolated from the family of Jasminum for the first time and compounds II, IV and VI were isolated from Jasminum officinale L. var. grandiflorum for the first time.

40 CFR 52.2465 - Original identification of plan section.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., 2FSD, and pre-dryer 3FSD from Part IV, Rule EX-4, Section 4.41(i) until December 15, 1981, submitted on...) Appendix K (7) Appendix N (8) Appendix P (9) Appendix R I., II.B., II.D., II.E., II.F., II.G., II.H., II.I...) Amendments to Part I, Subpart 1.01 (Certain Terms Defined) and to Part IV, Section 4.52 (former Section 4.705...

Mitochondrial proteomic profile of complex IV deficiency fibroblasts: rearrangement of oxidative phosphorylation complex/supercomplex and other metabolic pathways.

PubMed

Salvador-Severo, Karina; Gómez-Caudillo, Leopoldo; Quezada, Héctor; García-Trejo, José de Jesús; Cárdenas-Conejo, Alan; Vázquez-Memije, Martha Elisa; Minauro-Sanmiguel, Fernando

Mitochondriopathies are multisystem diseases affecting the oxidative phosphorylation (OXPHOS) system. Skin fibroblasts are a good model for the study of these diseases. Fibroblasts with a complex IV mitochondriopathy were used to determine the molecular mechanism and the main affected functions in this disease. Skin fibroblast were grown to assure disease phenotype. Mitochondria were isolated from these cells and their proteome extracted for protein identification. Identified proteins were validated with the MitoMiner database. Disease phenotype was corroborated on skin fibroblasts, which presented a complex IV defect. The mitochondrial proteome of these cells showed that the most affected proteins belonged to the OXPHOS system, mainly to the complexes that form supercomplexes or respirosomes (I, III, IV, and V). Defects in complex IV seemed to be due to assembly issues, which might prevent supercomplexes formation and efficient substrate channeling. It was also found that this mitochondriopathy affects other processes that are related to DNA genetic information flow (replication, transcription, and translation) as well as beta oxidation and tricarboxylic acid cycle. These data, as a whole, could be used for the better stratification of these diseases, as well as to optimize management and treatment options. Copyright © 2017 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

Mariner IV Mission to Mars. Part I

NASA Technical Reports Server (NTRS)

James, Jack N.

1965-01-01

This technical report is a series of individual papers documenting the Mariner-Mars project from its beginning in 1962 following the successful Mariner-Venus mission. Part I is pre-encounter data. It includes papers on the design, development, and testing of Mariner IV, as well as papers detailing methods of maintaining communication with and obtaining data from the spacecraft during flight, and expected results during encounter with Mars. Part 11, post-encounter data, to be published later, will consist of documentation of the events taking place during Mariner IV's encounter with Mars and thereafter. The Mariner-Mars mission, the culmination of an era of spacecraft development, has contributed much new technology to be used in future projects.

Clonal population of adult stem cells: life span and differentiation potential.

PubMed

Seruya, Mitchel; Shah, Anup; Pedrotty, Dawn; du Laney, Tracey; Melgiri, Ryan; McKee, J Andrew; Young, Henry E; Niklason, Laura E

2004-01-01

Adult stem cells derived from bone marrow, connective tissue, and solid organs can exhibit a range of differentiation potentials. Some controversy exists regarding the classification of mesenchymal stem cells as bona fide stem cells, which is in part derived from the limited ability to propagate true clonal populations of precursor cells. We isolated putative mesenchymal stem cells from the connective tissue of an adult rat (rMSC), and generated clonal populations via three rounds of dilutional cloning. The replicative potential of the clonal rMSC line far exceeded Hayflick's limit of 50-70 population doublings. The high capacity for self-renewal in vitro correlated with telomerase activity, as demonstrated by telomerase repeat amplification protocol (TRAP) assay. Exposure to nonspecific differentiation culture medium revealed multilineage differentiation potential of rMSC clones. Immunostaining confirmed the appearance of mesodermal phenotypes, including adipocytes possessing lipid-rich vacuoles, chondrocytes depositing pericellular type II collagen, and skeletal myoblasts expressing MyoD1. Importantly, the spectrum of differentiation capability was sustained through repeated passaging. Furthermore, serum-free conditions that led to high-efficiency smooth muscle differentiation were identified. rMSCs plated on collagen IV-coated surfaces and exposed to transforming growth factor-beta1 (TGF-beta1) differentiated into a homogeneous population expressing alpha-actin and calponin. Hence, clonogenic analysis confirmed the presence of a putative MSC population derived from the connective tissue of rat skeletal muscle. The ability to differentiate into a smooth muscle cell (SMC) phenotype, combined with a high proliferative capacity, make such a connective tissue-derived MSC population ideal for applications in vascular tissue construction.

77 FR 41891 - Airworthiness Directives; Gulfstream Aerospace Corporation Airplanes

Federal Register 2010, 2011, 2012, 2013, 2014

2012-07-17

....regulations.gov ; or in person at the Docket Management Facility between 9 a.m. and 5 p.m., Monday through... surface (ailerons, rudder, and elevator) and corrective actions if necessary. The customer bulletins also... mils). For Model G-IV airplanes: Gulfstream IV Customer Bulletin 223, including Part I and Part II...

Shunt resistance and saturation current determination in CdTe and CIGS solar cells. Part 2: application to experimental IV measurements and comparison with other methods

NASA Astrophysics Data System (ADS)

Rangel-Kuoppa, Victor-Tapio; Albor-Aguilera, María-de-Lourdes; Hérnandez-Vásquez, César; Flores-Márquez, José-Manuel; Jiménez-Olarte, Daniel; Sastré-Hernández, Jorge; González-Trujillo, Miguel-Ángel; Contreras-Puente, Gerardo-Silverio

2018-04-01

In this Part 2 of this series of articles, the procedure proposed in Part 1, namely a new parameter extraction technique of the shunt resistance (R sh ) and saturation current (I sat ) of a current-voltage (I-V) measurement of a solar cell, within the one-diode model, is applied to CdS-CdTe and CIGS-CdS solar cells. First, the Cheung method is used to obtain the series resistance (R s ) and the ideality factor n. Afterwards, procedures A and B proposed in Part 1 are used to obtain R sh and I sat . The procedure is compared with two other commonly used procedures. Better accuracy on the simulated I-V curves used with the parameters extracted by our method is obtained. Also, the integral percentage errors from the simulated I-V curves using the method proposed in this study are one order of magnitude smaller compared with the integral percentage errors using the other two methods.

Fibronectin-mediation cell adhesion is required for induction of 92-kDa type IV collagenase/gelatinase (MMP-9) gene expression during macrophage differentiation : the signaling role of protein kinase C-{beta}.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, B.; Laouar, A.; Huberman, E.

1998-05-08

Induction of the 92-kDa gelatinase (MMP-9) gene expression is associated with macrophage differentiation. In this study, we explored the regulatory mechanisms underlying this differentiation-associated MMP-9 gene expression in human HL-60 myeloid leukemia cells and human peripheral blood monocytes. Phorbol 12-myristate 13-acetate (PMA) markedly induced MMP-9 gene expression in HL-60 cells; the induction closely paralleled the timing and extent of PMA-induced cell adhesion and spreading, a hallmark of macrophage differentiation. Similarly, treatment with PMA or macrophage-colony stimulating factor stimulated adherence and spreading of blood monocytes with a concurrent 7- or 5-fold increase in MMP-9 production, respectively. In protein kinase C (PKC)-betamore » -deficient HL-60 variant cells (HL-525), PMA failed to induce cell adhesion and MMP-9 gene expression. Transfecting HL-525 cells with a PKC-beta expression plasmid restored PKC-beta levels and PMA inducibility of cell adhesion and spreading as well as MMP-9 gene expression. Induction of cell adhesion and MMP-9 gene expression in HL-60 cells and blood monocytes was strongly inhibited by neutralizing monoclonal antibodies to fibronectin (FN) and its receptor {alpha}5{beta}1 integrin. HL-525 cells, which constitutively display high levels of surface {alpha}5{beta}1 integrin, adhered and spread on immobilized FN with concomitant induction of MMP-9 gene expression. Cytochalasins B and D were each a potent inhibitor of MMP-9 production. Our results suggest that {alpha}5{beta}1 integrin-mediated interaction of immature hematopoietic cells with FN plays a critical role in modulating matrix-degrading activities during macrophage differentiation.« less

Joint capsule treatment with enkephalin-encoding HSV-1 recombinant vector reduces inflammatory damage and behavioural sequelae in rat CFA monoarthritis.

PubMed

Lu, Ying; McNearney, Terry A; Wilson, Steven P; Yeomans, David C; Westlund, Karin N

2008-03-01

This study assessed enkephalin expression induced by intra-articular application of recombinant, enkephalin-encoding herpes virus (HSV-1) and the impact of expression on nociceptive behaviours and synovial lining inflammation in arthritic rats. Replication-conditional HSV-1 recombinant vectors with cDNA encoding preproenkephalin (HSV-ENK), or control transgene beta-galactosidase cDNA (HSV-beta-gal; control) were injected into knee joints with complete Freund's adjuvant (CFA). Joint temperatures, circumferences and nociceptive behaviours were monitored on days 0, 7, 14 and 21 post CFA and vector treatments. Lumbar (L4-6) dorsal root ganglia (DRG) and spinal cords were immunostained for met-enkephalin (met-ENK), beta-gal, HSV-1 proteins and Fos. Joint tissues were immunostained for met-ENK, HSV-1 proteins, and inflammatory mediators Regulated on Activation, Normal T-cell Expressed and Secreted (RANTES) and cyclo-oxygenase-2, or stained with haematoxylin and eosin for histopathology. Compared to exuberant synovial hypertrophy and inflammatory cell infiltration seen in arthritic rats treated with CFA only or CFA and HSV-beta-gal, the CFA- and HSV-ENK-treated arthritic rats had: (i) striking preservation of synovial membrane cytoarchitecture with minimal inflammatory cell infiltrates; (ii) significantly improved nociceptive behavioural responses to mechanical and thermal stimuli; (iii) normalized Fos staining in lumbar dorsal horn; and (iv) significantly increased met-ENK staining in ipsilateral synovial tissue, lumbar DRG and spinal cord. The HSV-1 and transgene product expression were confined to ipsilateral lumbar DRG (HSV-1, met-ENK, beta-gal). Only transgene product (met-ENK and beta-gal) was seen in lumbar spinal cord sections. Targeted delivery of enkephalin-encoding HSV-1 vector generated safe, sustained opioid-induced analgesia with protective anti-inflammatory blunting in rat inflammatory arthritis.

A map-based determination of the nature of Beta Delphini

NASA Technical Reports Server (NTRS)

Gatewood, George; Castelaz, Michael; Persinger, Timothy; Stein, John; Demarque, Pierre

1989-01-01

The Beta Delphini binary system presents a stringent test of the theory of stellar evolution. Improved parallax and component masses are found for its giant (F5 III and F5 IV) stars. A study of the evolutionary status of the system indicates it to be 1.9 Gyr (1.9 billion years) old and to have a metallicity of approximately 1.5 times that of the Sun. The perturbation due to the 26.6 yr orbital motion is clearly shown in this 2.2 yr study and allows the most precise determination of the relative masses of the component stars to date. The next few months present an unusual opportunity for orbital study as the system passes through periastron. Two of the reference stars are found to have distances of less than 100 parsecs.

Comparison of Observed Beta Cloth Interactions with Simulated and Actual Space Environment

NASA Technical Reports Server (NTRS)

Kamenetzy, R. R.; Finckenor, M. M.

1999-01-01

A common component of multilayer insulation blankets is beta cloth, a woven fiberglass cloth impregnated with Teflon(TM). It is planned for extensive use on the International Space Station. The Environmental Etl'ects Group of the Marshall Space Flight Center Materials, Processing, and Manufacturing Department has investigated the impact of atomic oxygen (AO) and ultraviolet (UV) radiation on the optical properties of plain and aluminized beta cloth. both in the laboratory and as part of long-duration flight experiments. These investigations indicate that beta cloth is susceptible to darkening in the presence of UV radiation, dependent on the additives used. AO interactions resulted in bleaching of the beta cloth.

The H,K-ATPase beta-subunit can act as a surrogate for the beta-subunit of Na,K-pumps.

PubMed

Horisberger, J D; Jaunin, P; Reuben, M A; Lasater, L S; Chow, D C; Forte, J G; Sachs, G; Rossier, B C; Geering, K

1991-10-15

Na,K-ATPase and H,K-ATPase are the only members of the P-type ATPases in which a glycosylated beta-subunit is part of the purified active enzyme. In this study, we have followed the synthesis and the posttranslational processing of the beta-subunit of H,K-ATPase (beta HK) in Xenopus oocytes injected with beta HK cRNA and have tested whether it can act as a surrogate for the beta-subunit of Na,K-ATPase (beta NaK) to support the functional expression of Na,K-pumps. In Xenopus oocytes, beta HK is processed from an Endo H-sensitive 51-kDa coreglycosylated form to an Endo H-resistant 71-kDa fully glycosylated form. Similar to beta NaK, beta HK can stabilize and increase the trypsin resistance of alpha-subunits of Na,K-ATPase (alpha NaK). Finally, expression of beta HK together with alpha NaK leads to an increased number of ouabain binding sites at the plasma membrane accompanied by an increased Rb+ uptake and Na,K-pump current. Our data suggest that beta HK, similar to beta NaK, can assemble to alpha NaK, support the structural maturation and the intracellular transport of catalytic alpha NaK, and ultimately form active alpha NaK-beta HK complexes with Na,K-pump transport properties.

45 CFR 309.150 - What start-up costs are allowable for Tribal IV-D programs carried out under § 309.65(b) of this...

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 2 2010-10-01 2010-10-01 false What start-up costs are allowable for Tribal IV-D... ENFORCEMENT (IV-D) PROGRAM Tribal IV-D Program Funding § 309.150 What start-up costs are allowable for Tribal IV-D programs carried out under § 309.65(b) of this part? Federal funds are available for costs of...

[Studies on the chemical constituents of Gueldenstaedtia stenophylla].

PubMed

Wei, You-xia; Chen, Li; Wang, Jun-xian

2007-08-01

To study the chemical constituents of Gueldenstaeditia stenophylla. The constituents were isolated by alcohol extraction, column chromatography on silica gel. Their structures were elucidated by chemical and spectroscopic methods. Six compounds were obtained, and five of them were identified as n-hexadecanioc acid (I), beta-sitosterol (II), daucosterol (III), apigenin (IV), D-fructose (VI). Compound V was being determined. Five compounds are isolated from Gueldenstaedtia stenophylla and compounds I, III are extracted from Gueldenstaedtia Fisch for the first time.

The Use of Nitrone Cycloadditions in the Synthesis of Beta-Amino Aldehydes and Unsaturated Amines.

DTIC Science & Technology

1986-01-01

with alkenes (dipolarophiles) to produce isoxazolidines (2) in a fashion similar to the (4+2] Diels - Alder reaction.’ The cycloaddition results in...structures to study enzyme inhibition, and they serve as useful intermediates in the synthesis of $-lactams. 3 3 Table IV summarizes attempts to oxidize p...84% yield (Table V, entry 3). Due to the mechanistic imperative, acid catalyzed elimination always yielded the allylic amine in which the alkene

Effect of Interleukin-1beta and Tumor Necrosis Factor-alpha on Gene Expression in Human Endothelial Cells

DTIC Science & Technology

2003-06-01

type Ill, alpha 1 ( Ehlers - Danlos syndrome type IV, autosomal dominant) T98612 multimerin AA423867 ribonuclease, RNase A family, 1 (pancreatic...tax-responsive enhancer element 967) AA600217 jagged1 (Alagille syndrome ) R70685 TNF receptor-associated factor 1 R71691 glycyl-tRNA synthetase...in patients succumbing to sepsis and systemic inflamma- tion. The effects of removing one syndrome -causing agent may be compensated by others with

HNF1(beta) is required for mesoderm induction in the Xenopus embryo.

PubMed

Vignali, R; Poggi, L; Madeddu, F; Barsacchi, G

2000-04-01

XHNF1(&bgr;) is a homeobox-containing gene initially expressed at the blastula stage in the vegetal part of the Xenopus embryo. We investigated its early role by functional ablation, through mRNA injection of an XHNF1(beta)/engrailed repressor fusion construct (XHNF1(beta)/EngR). Dorsal injections of XHNF1(beta)/EngR mRNA abolish dorsal mesoderm formation, leading to axial deficiencies; ventral injections disrupt ventral mesoderm formation without affecting axial development. XHNF1(beta)/EngR phenotypic effects specifically depend on the DNA-binding activity of its homeodomain and are fully rescued by coinjection of XHNF1(beta) mRNA. Vegetal injection of XHNF1(beta)/EngR mRNA blocks the mesoderm-inducing ability of vegetal explants. Both B-Vg1 and VegT maternal determinants trigger XHNF1(beta) expression in animal caps. XHNF1(beta)/EngR mRNA blocks B-Vg1-mediated, but not by eFGF-mediated, mesoderm induction in animals caps. However, wild-type XHNF1(beta) mRNA does not trigger Xbra expression in animal caps. We conclude that XHNF1(beta) function is essential, though not sufficient, for mesoderm induction in the Xenopus embryo.

Reduced Expression of the Liver/Beta-Cell Glucose Transporter Isoform in Glucose-Insensitive Pancreatic Beta Cells of Diabetic Rats

NASA Astrophysics Data System (ADS)

Thorens, Bernard; Weir, Gordon C.; Leahy, John L.; Lodish, Harvey F.; Bonner-Weir, Susan

1990-09-01

Rats injected with a single dose of streptozocin at 2 days of age develop non-insulin-dependent diabetes 6 weeks later. The pancreatic beta islet cells of these diabetic rats display a loss of glucose-induced insulin secretion while maintaining sensitivity to other secretagogues such as arginine. We analyzed the level of expression of the liver/beta-cell glucose transporter isoform in diabetic islets by immunofluorescence staining of pancreas sections and by Western blotting of islet lysates. Islets from diabetic animals have a reduced expression of this beta-cell-specific glucose transporter isoform and the extent of reduction is correlated with the severity of hyperglycemia. In contrast, expression of this transporter isoform in liver is minimally modified by the diabetes. Thus a decreased expression of the liver/beta-cell glucose transporter isoform in beta cells is associated with the impaired glucose sensing characteristic of diabetic islets; our data suggest that this glucose transporter may be part of the beta-cell glucose sensor.

24 CFR Appendix IV to Subpart B of... - Promissory Note for Payment upon Resale by Homebuyer at Profit

Code of Federal Regulations, 2011 CFR

2011-04-01

... Turnkey III Program Description Pt. 904, Subpt. B, App. IV Appendix IV to Subpart B of Part 904—Promissory... of (1) the Homeowner's purchase price, (2) the costs incidental to his acquisition of ownership, (3...

24 CFR Appendix IV to Subpart B of... - Promissory Note for Payment upon Resale by Homebuyer at Profit

Code of Federal Regulations, 2010 CFR

2010-04-01

... Turnkey III Program Description Pt. 904, Subpt. B, App. IV Appendix IV to Subpart B of Part 904—Promissory... of (1) the Homeowner's purchase price, (2) the costs incidental to his acquisition of ownership, (3...

Osteocalcin protects pancreatic beta cell function and survival under high glucose conditions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kover, Karen, E-mail: kkover@cmh.edu; University of Missouri-Kansas City School of Medicine, Kansas City, MO 64108; Yan, Yun

Diabetes is characterized by progressive beta cell dysfunction and loss due in part to oxidative stress that occurs from gluco/lipotoxicity. Treatments that directly protect beta cell function and survival in the diabetic milieu are of particular interest. A growing body of evidence suggests that osteocalcin, an abundant non-collagenous protein of bone, supports beta cell function and proliferation. Based on previous gene expression data by microarray, we hypothesized that osteocalcin protects beta cells from glucose-induced oxidative stress. To test our hypothesis we cultured isolated rat islets and INS-1E cells in the presence of normal, high, or high glucose ± osteocalcin for up tomore » 72 h. Oxidative stress and viability/mitochondrial function were measured by H{sub 2}O{sub 2} assay and Alamar Blue assay, respectively. Caspase 3/7 activity was also measured as a marker of apoptosis. A functional test, glucose stimulated insulin release, was conducted and expression of genes/protein was measured by qRT-PCR/western blot/ELISA. Osteocalcin treatment significantly reduced high glucose-induced H{sub 2}O{sub 2} levels while maintaining viability/mitochondrial function. Osteocalcin also significantly improved glucose stimulated insulin secretion and insulin content in rat islets after 48 h of high glucose exposure compared to untreated islets. As expected sustained high glucose down-regulated gene/protein expression of INS1 and BCL2 while increasing TXNIP expression. Interestingly, osteocalcin treatment reversed the effects of high glucose on gene/protein expression. We conclude that osteocalcin can protect beta cells from the negative effects of glucose-induced oxidative stress, in part, by reducing TXNIP expression, thereby preserving beta cell function and survival. - Highlights: • Osteocalcin reduces glucose-induced oxidative stress in beta cells. • Osteocalcin preserves beta cell function and survival under stress conditions. • Osteocalcin reduces glucose-induced TXNIP expression in beta cells.« less

[Studies on chemical constituents of aerial parts of Ammopiptanthus mongolicus].

PubMed

Tian, Xiao-Ming; Chen, Shi-Zhong; Tu, Peng-Fei; Lei, Lian-Di

2008-10-01

To investigate the chemical constituents of the aerial parts of Ammopiptanthus mongolicus. The chemical constituents were isolated by various column chromatographic methods. The structures were identified by spectral data. Ten compounds were isolated and identified as m-hydroxybenzoic acid (1), 1-(4-hydroxyphenyl) ethanone (2), beta-sitosterol (3), (-)-syringaresinol (4), (+)-lariciresinol (5), blumenol A (6), blumenol B (7), beta-daucosterol (8), coniferin (9), syringin (10). The ten compounds were obtained from the genus Ammopiptanthus for the first time.

76 FR 5811 - Adjusted Federal Medical Assistance Percentage (FMAP) Rate for the First Quarter of Fiscal Year...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-02

.... The increased FMAP is available for expenditures under part E of title IV (including Foster Care... temporary increase in FMAP rates for Medicaid and title IV-E Foster Care, Adoption Assistance and... are not part of the calculation process. Expenditures for which the increased FMAP is not available...

Tin Whisker Risk Assessment of TDRSS IV Transponder Units 101 and 102

NASA Technical Reports Server (NTRS)

Zellitti, Ron; Royse, Jeff; Jackson, Steve

2000-01-01

This report documents the plating requirements for the electrical and mechanical parts used in the TDRSS IV transponder manufactured by MOTOROLA, INC., SSG, SSSD. The intent of this report is to identify any electrical, electromechanical or mechanical part that does not have adequate requirements to prevent the use of a pure tin finish.

77 FR 70373 - Cost of Living Adjustment to Satellite Carrier Compulsory License Royalty Rates

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-26

... ROYALTY FEES FOR SECONDARY TRANSMISSIONS BY SATELLITE CARRIERS 0 1. The authority citation for part 386... revising paragraphs (b)(1)(iv) and (b)(2)(iv) as follows: Sec. 386.2 Royalty fee for secondary transmission... LIBRARY OF CONGRESS Copyright Royalty Board 37 CFR Part 386 [Docket No. 2012-8 CRB Satellite COLA...

Actively Experiencing Shakespeare: Students "Get on Their Feet" for "Henry IV, Part One."

ERIC Educational Resources Information Center

Meyer, Herbert M.; Thomsen, Lee

1999-01-01

Discusses how a literature and multimedia course for 11th and 12th graders used active-learning experiences to engage students with Shakespeare's "Henry IV, Part One." Describes how shouting Hal's soliloquy; constructing a chart of character relations; rewriting a scene in their own words; performing, filming, and critiquing a scene; and…

Projects and Programs: Libraries and Learning Resources-1978-1979. Standards ESEA IV, PART B.

ERIC Educational Resources Information Center

New York State Education Dept., Albany. Bureau of School Libraries.

These standards are intended to assist local school districts in New York State in selecting educational resources and audiovisual equipment and in providing for testing, guidance, and counseling services under Title IV, Part B of the Elementary and Secondary Education Act. The main purpose of the standards is to establish qualitative and…

Dipeptidyl peptidase IV (DPP-IV) inhibition prevents fibrosis in adipose tissue of obese mice.

PubMed

Marques, Ana Patrícia; Cunha-Santos, Janete; Leal, Helena; Sousa-Ferreira, Lígia; Pereira de Almeida, Luís; Cavadas, Cláudia; Rosmaninho-Salgado, Joana

2018-03-01

During the development of obesity the expansion of white adipose tissue (WAT) leads to a dysregulation and an excessive remodeling of extracellular matrix (ECM), leading to fibrosis formation. These ECM changes have high impact on WAT physiology and may change obesity progression. Blocking WAT fibrosis may have beneficial effects on the efficacy of diet regimen or therapeutical approaches in obesity. Since dipeptidyl peptidase IV (DPP-IV) inhibitors prevent fibrosis in tissues, such as heart, liver and kidney, the objective of this study was to assess whether vildagliptin, a DPP-IV inhibitor, prevents fibrosis in WAT in a mouse model of obesity, and to investigate the mechanisms underlying this effect. We evaluated the inhibitory effect of vildagliptin on fibrosis markers on WAT of high-fat diet (HFD)-induced obese mice and on 3T3-L1 cell line of mouse adipocytes treated with a fibrosis inducer, transforming growth factor beta 1 (TGFβ1). Vildagliptin prevents the increase of fibrosis markers in WAT of HFD-fed mice and reduces blood glucose, serum triglycerides, total cholesterol and leptin levels. In the in vitro study, the inhibition of DPP-IV with vildagliptin, neuropeptide Y (NPY) treatment and NPY Y 1 receptor activation prevents ECM deposition and fibrosis markers increase induced by TGFβ1 treatment. Vildagliptin prevents fibrosis formation in adipose tissue in obese mice, at least partially through NPY and NPY Y 1 receptor activation. This study highlights the importance of vildagliptin in the treatment of fibrosis that occur in obesity. Copyright © 2017 Elsevier B.V. All rights reserved.

PM101: a cyclodextrin-based intravenous formulation of amiodarone devoid of adverse hemodynamic effects.

PubMed

Cushing, Daniel J; Kowey, Peter R; Cooper, Warren D; Massey, Bill W; Gralinski, Michael R; Lipicky, Raymond J

2009-04-01

Intravenous amiodarone (Amiodarone i.v.) is widely used to treat cardiac arrhythmias. The most frequent clinical adverse event associated with Amiodarone i.v. administration is systemic hypotension which has been attributed to the cosolvents used in the formulation, polysorbate 80 and benzyl alcohol. To minimize hypotension Amiodarone i.v. is diluted in 5% dextrose in water prior to administration and slowly infused. PM101 is a novel intravenous formulation that uses sulfobutylether-7-beta-cyclodextrin to solubilize amiodarone, and thus should be devoid of the untoward hemodynamic effects associated with polysorbate 80 and benzyl alcohol. Beagle dogs (n=7/group) were anesthetized with morphine and alpha-chloralose and instrumented to assess aortic blood pressure, cardiac output, cardiac contractility, and heart rate. Animals were treated with the U.S. approved human-equivalent loading dose (2.14 mg/kg) of Amiodarone i.v., PM101, and their respective vehicle controls. Administration of Amiodarone i.v. rapidly and significantly decreased mean aortic pressure, cardiac output, and cardiac contractility. A significant increase in heart rate was also observed as was a transient, but not significant, decrease in systemic vascular resistance. A similar pattern of rapid and significant hemodynamic changes was produced by the Amiodarone i.v. Vehicle (polysorbate 80/benzyl alcohol) alone. In marked contrast, PM101 and its vehicle produced no significant hemodynamic effects. This study provides a useful model for the continued search for a safe and effective intravenous amiodarone formulation devoid of the hypotensive risk associated with the current commercial formulation.

Erythropoietin affords additional cardioprotection to preconditioned hearts by enhanced phosphorylation of glycogen synthase kinase-3 beta.

PubMed

Nishihara, Masahiro; Miura, Tetsuji; Miki, Takayuki; Sakamoto, Jun; Tanno, Masaya; Kobayashi, Hironori; Ikeda, Yoshihiro; Ohori, Katsuhiko; Takahashi, Akari; Shimamoto, Kazuaki

2006-08-01

The aim of this study was to determine whether erythropoietin (EPO) affords additional cardioprotection to the preconditioned myocardium by enhanced phosphorylation of Akt, STAT3, or glycogen synthase kinase-3beta (GSK-3 beta). Preconditioning (PC) with 5-min ischemia/5-min reperfusion and EPO (5,000 U/kg iv) reduced infarct size (as % of area at risk, %IS/AR) after 20-min ischemia in rat hearts in situ from 56.5 +/- 1.8% to 25.2 +/- 2.1% and to 36.2 +/- 2.8%, respectively. PC-induced protection was significantly inhibited by a protein kinase C inhibitor, chelerythrine (5 mg/kg), and slightly blunted by a phosphatidylinositol-3-kinase inhibitor, wortmannin (15 microg/kg). The opposite pattern of inhibition was observed for EPO-induced protection. The combination of PC and EPO further reduced %IS/AR to 8.9 +/- 1.9%, and this protection was inhibited by chelerythrine and wortmannin. The additive effects of PC and EPO on infarct size were mirrored by their effects on the level of phosphorylated GSK-3 beta at 5 min after reperfusion but not their effects on the level of phospho-Akt or phospho-STAT3. To mimic phosphorylation-induced inhibition of GSK-3 beta activity, SB-216763 (SB), a GSK-3 beta inhibitor, was administered before ischemia or 5 min before reperfusion. Infarct size was significantly reduced by preischemic injection (%IS/AR = 40.4 +/- 2.2% by 0.6 mg/kg SB and 34.0 +/- 1.8% by 1.2 mg/kg SB) and also by prereperfusion injection (%IS/AR = 32.0 +/- 2.0% by 1.2 mg/kg SB). These results suggest that EPO and PC afford additive infarct size-limiting effects by additive phosphorylation of GSK-3beta at the time of reperfusion by Akt-dependent and -independent mechanisms.

Availability and Use of Medical Isotopes in Canada - Performed as part of a Radiological Terrorism Risk Assessment

DTIC Science & Technology

2004-12-01

placenta localization 1. Chromic chloride 2. Chromium disodium edetate 3. Labeled human serum albumin 4. Sodium chromate labeled red blood cells...orally 4. Iodinated fibrinogen, i.v. or in vitro 5. Iodinated human serum albumin (IHSA) 6. Iodinated levothyroxine , i.v. or in vitro 7...Iodinated liothyronine, in vitro 8. Iodinated povidone, i.v. 9. Iodinated rose Bengal, i.v. 10. Sodium iodide, orally or i.v. 5. 0.74 MBq (0.02 mCi

Molecular investigations of β-thalassemic children in Erbil governorate

NASA Astrophysics Data System (ADS)

Hasan, Ahmad N.; Al-Attar, Mustafa S.

2017-09-01

The present work studies the molecular investigation of 40 thalassemic carriers using polymerase chain reaction. Forty thalassemic carriers who were registered and treated at Erbil thalassemic center and twenty apparently healthy children have been included in the present study. Ages of both groups ranged between 1-18 years. Four primers used to detect four different beta thalassemia mutations they were codon 8/9, codon 8, codon 41/42 and IVS-1-5. The two most common mutations detected among thalassemia group were Cd8/9 with 8 cases (20%) and Cd-8 with 6 cases (15%) followed by codon 41/42 with 4 cases (10%) which investigated and detected for the first time in Erbil governorate through the present study and finally IVS-1-5 with 3 cases (7.5%), while no any cases detected among control group.

Self-transcendence and emotional well-being in women with advanced breast cancer.

PubMed

Coward, D D

1991-07-01

Self-transcendence has been associated, in previous studies, with stressful life events and emotional well-being. This study examined the relationships among self-transcendence, emotional well-being, and illness-related distress in women with advanced breast cancer. The study employed a cross-sectional correlational design in a convenience sample (n = 107) of women with Stage IIIb and Stage IV breast cancer. Subjects completed a questionnaire that included Reed's Self-Transcendence Scale; Bradburn's Affect Balance Scale (ABS); a Cognitive Well-Being (CWB) Scale based on work by Campbell, Converse, and Rogers; McCorkle and Young's Symptom Distress Scale (SDS); and the Karnofsky Performance Scale (KPS). Data were analyzed using factor analytic structural equations modeling. Self-transcendence decreased illness distress (assessed by the SDS and the KPS) through the mediating effect of emotional well-being (assessed by the ABS and the CWB Scale). Self-transcendence directly affected emotional well-being (beta = 0.69), and emotional well-being had a strong negative effect on illness distress (beta = -0.84). A direct path from self-transcendence to illness distress (beta = -0.31) became nonsignificant (beta = -0.08) when controlling for emotional well-being. Further research using longitudinal data will seek to validate these relationships and to explain how nurses can promote self-transcendence in women with advanced breast cancer, as well as in others with life-threatening illnesses.

Anti-dopamine beta-hydroxylase immunotoxin-induced sympathectomy in adult rats

NASA Technical Reports Server (NTRS)

Picklo, M. J.; Wiley, R. G.; Lonce, S.; Lappi, D. A.; Robertson, D.

1995-01-01

Anti-dopamine beta-hydroxylase immunotoxin (DHIT) is an antibody-targeted noradrenergic lesioning tool comprised of a monoclonal antibody against the noradrenergic enzyme, dopamine beta-hydroxylase, conjugated to saporin, a ribosome-inactivating protein. Noradrenergic-neuron specificity and completeness and functionality of sympathectomy were assessed. Adult, male Sprague-Dawley rats were given 28.5, 85.7, 142 or 285 micrograms/kg DHIT i.v. Three days after injection, a 6% to 73% decrease in the neurons was found in the superior cervical ganglia of the animals. No loss of sensory, nodose and dorsal root ganglia, neurons was observed at the highest dose of DHIT. In contrast, the immunotoxin, 192-saporin (142 micrograms/kg), lesioned all three ganglia. To assess the sympathectomy, 2 wk after treatment (285 micrograms/kg), rats were anesthetized with urethane (1 g/kg) and cannulated in the femoral artery and vein. DHIT-treated animals' basal systolic blood pressure and heart rate were significantly lower than controls. Basal plasma norepinephrine levels were 41% lower in DHIT-treated animals than controls. Tyramine-stimulated release of norepinephrine in DHIT-treated rats was 27% of controls. Plasma epinephrine levels of DHIT animals were not reduced. DHIT-treated animals exhibited a 2-fold hypersensitivity to the alpha-adrenergic agonist phenylephrine. We conclude that DHIT selectively delivered saporin to noradrenergic neurons resulting in destruction of these neurons. Anti-dopamine beta-hydroxylase immunotoxin administration produces a rapid, irreversible sympathectomy.

Flavonoids and terpenoids from Luma gayana (Barn.) Burret.

PubMed

Wächter, G A; Wangmaneerat, A; Caple, K M; Montenegro, G; Timmermann, B N

1999-12-01

The flavonoids 5-hydroxy-7-methoxyflavanone, 6,8-dimethyl-5,7-dihydroxyflavanone and 2',4'-dihydroxy-6'-methoxy-3',5'-dimethylchalcone, a mixture of alkyl esters of p-coumaric acid, the triterpenoids oleanolic acid and maslinic acid, the monoterpenoid 1 alpha,2 beta,4 beta-trihydroxy-p-menthane, the sesquiterpenoid clovandiol and beta-sitosterol were isolated from the aerial parts of Luma gayana (Barn.) Burret. This is the first report on the chemistry of this species.

Light-induced yellowing of selectively 13C-enriched dehydrogenation polymers (DHPs). Part 1, Side-chain 13C-enriched DHP ([alpha], [beta], and [gamma]-13C)

Treesearch

Jim Parkas; Magnus Paulsson; Terashima Noritsugu; Ulla Westermark; Sally Ralph

2004-01-01

Light-induced yellowing has been studied using side-chain ([alpha], [beta], and [gamma]) 13C-enriched DHP (dehydrogenation polymer) and quantitative solution state 13C NMR spectroscopy. The DHP was formed from 13C-enriched coniferin using an enzymatic system consisting of [beta]-glucosidase, glucose oxidase, and peroxidase in a pH 6 buffer solution. The DHP was applied...

Contrasting species and functional beta diversity in montane ant assemblages.

PubMed

Bishop, Tom R; Robertson, Mark P; van Rensburg, Berndt J; Parr, Catherine L

2015-09-01

Beta diversity describes the variation in species composition between sites and can be used to infer why different species occupy different parts of the globe. It can be viewed in a number of ways. First, it can be partitioned into two distinct patterns: turnover and nestedness. Second, it can be investigated from either a species identity or a functional-trait point of view. We aim to document for the first time how these two aspects of beta diversity vary in response to a large environmental gradient. Maloti-Drakensberg Mountains, southern Africa. We sampled ant assemblages along an extensive elevational gradient (900-3000 m a.s.l.) twice yearly for 7 years, and collected functional-trait information related to the species' dietary and habitat-structure preferences. We used recently developed methods to partition species and functional beta diversity into their turnover and nestedness components. A series of null models were used to test whether the observed beta diversity patterns differed from random expectations. Species beta diversity was driven by turnover, but functional beta diversity was composed of both turnover and nestedness patterns at different parts of the gradient. Null models revealed that deterministic processes were likely to be responsible for the species patterns but that the functional changes were indistinguishable from stochasticity. Different ant species are found with increasing elevation, but they tend to represent an increasingly nested subset of the available functional strategies. This finding is unique and narrows down the list of possible factors that control ant existence across elevation. We conclude that diet and habitat preferences have little role in structuring ant assemblages in montane environments and that some other factor must be driving the non-random patterns of species turnover. This finding also highlights the importance of distinguishing between different kinds of beta diversity.

Influence of detergent concentration on aggregation and spectroscopic properties of light-harvesting complex II.

PubMed

Voigt, Bernd; Krikunova, Maria; Lokstein, Heiko

2008-01-01

Aggregation of photosynthetic light-harvesting complexes strongly influences their spectroscopic properties. Fluorescence yield and excited state lifetimes of the main light-harvesting complex (LHC II) of higher plants strongly depend on its aggregation state. Detergents are commonly used to solubilize membrane proteins and/or to circumvent their aggregation in aqueous environments. Nonlinear polarization spectroscopy in the frequency domain (NLPF) was performed with LHC II over a wide concentration range of the mild detergent n-dodecyl beta-D: -maltoside (beta-DM). Additionally, conventional absorption-, fluorescence- and circular dichroism-spectra were measured.The results indicate that: (i) conventional spectroscopic techniques are not well suited to investigate aggregation effects. NLPF provides a novel approach to overcome this problem: NLPF spectra display dramatic alterations upon even minor beta-DM concentration changes. (ii) Commonly used detergent concentrations (around or slightly above the critical micellar concentration) apparently do not lead to complete trimerization of LHC II. A long-wavelength species in the NLPF spectra (peaking at about 685 nm), indicative of residual aggregation, persists up to DM-concentrations of 0.06%. (iii) High-resolution NLPF spectra indicate the existence of a species with a considerably shortened excited state lifetime. (iv) No indication of denaturation was found even at the highest beta-DM concentrations used. (v) A specific change in interaction between certain chlorophyll(s) b and a xanthophyll molecule, probably neoxanthin, was detected upon aggregation as well as at higher beta-DM concentrations. The results are discussed with respect to the still elusive mechanism of nonradiative dissipation of excess excitation energy in the antenna system.

DIVWAG Model Documentation. Volume II. Programmer/Analyst Manual. Part 4.

DTIC Science & Technology

1976-07-01

Model Constant Data Deck Structure . .. .... IV-13-A-40 Appendix B. Movement Model Program Descriptions . .. .. . .IV-13-B-1 1. Introduction...Data ................ IV-15-A-17 11. Airmobile Constant Data Deck Structure .. ...... .. IV-15-A-30 Appendix B. Airmobile Model Program Descriptions...Make no changes. 12. AIRMOBILE CONSTANT DATA DECK STRUCTURE . The deck structure required by the Airmobile Model constant data load program and the data

[Crops: Classifying, Selecting, Harvesting, Grading, and Packing.] Student Materials. V.A. III. [IV-B-1 through IV-B-2; IV-C-1 through IV-C-2].

ERIC Educational Resources Information Center

Texas A and M Univ., College Station. Vocational Instructional Services.

Part of a series of eight student learning modules in vocational agriculture, this booklet deals with crop-related activities. The first section is on harvesting methods and equipment. The following portions address the handling, grading, and packing of crops; and the classification and selection of fruits, vegetables, and ornamental plants. There…

Helping General Physical Educators and Adapted Physical Educators Address the Office of Civil Rights Dear Colleague Guidance Letter: Part IV--Sport Groups

ERIC Educational Resources Information Center

Lieberman, Lauren; Lucas, Mark; Jones, Jeffery; Humphreys, Dan; Cody, Ann; Vaughn, Bev; Storms, Tommie

2013-01-01

"Helping General Physical Educators and Adapted Physical Educators Address the Office of Civil Rights Dear Colleague Guidance Letter: Part IV--Sport Groups" provides the the following articles: (1) "Sport Programming Offered by Camp Abilities and the United States Association for Blind Athletes" (Lauren Lieberman and Mark…

Extraction of Carbon Dioxide and Hydrogen from Seawater by an Electrochemical Acidification Cell. Part 4. Electrode Compartments of Cell Modified and Tested in Scaled-Up Mobile Unit

DTIC Science & Technology

2013-09-03

Electrochemical Acidification Cell Part IV: Electrode Compartments of Cell Modified and Tested in Scaled-Up Mobile Unit September 3, 2013 Approved for public...OF ABSTRACT Extraction of Carbon Dioxide and Hydrogen from Seawater by an Electrochemical Acidification Cell Part IV: Electrode Compartments of Cell...Electrochemical acidification cell Carbon dioxide Hydrogen Polarity reversal An electrochemical acidification cell was scaled-up and integrated into a

Synthesis, structure, and thermal properties of soluble hydrazinium germanium(IV) and tin(IV) selenide salts.

PubMed

Mitzi, David B

2005-05-16

The crystal structures of two hydrazinium-based germanium(IV) and tin(IV) selenide salts are determined. (N(2)H(5))(4)Ge(2)Se(6) (1) [I4(1)cd, a = 12.708(1) Angstroms, c = 21.955(2) Angstroms, Z = 8] and (N(2)H(4))(3)(N(2)H(5))(4)Sn(2)Se(6) (2) [P, a = 6.6475(6) Angstroms, b = 9.5474(9) Angstroms, c = 9.8830(10) Angstroms, alpha = 94.110(2) degrees, beta = 99.429(2) degrees, gamma = 104.141(2) degrees, Z = 1] each consist of anionic dimers of edge-sharing metal selenide tetrahedra, M(2)Se(6)(4-) (M = Ge or Sn), separated by hydrazinium cations and, for 2, additional neutral hydrazine molecules. Substantial hydrogen bonding exists among the hydrazine/hydrazinium molecules as well as between the hydrazinium cations and the selenide anions. Whereas the previously reported tin(IV) sulfide system, (N(2)H(5))(4)Sn(2)S(6), decomposes cleanly to microcrystalline SnS(2) when heated to 200 degrees C in an inert atmosphere, higher temperatures (>300 degrees C) are required to dissociate selenium from 1 and 2 for the analogous preparations of single-phase metal selenides. The metal chalcogenide salts are highly soluble in hydrazine, as well as in a variety of amines and DMSO, highlighting the potential usefulness of these compounds as precursors for the solution deposition of the corresponding metal chalcogenide films.

49 CFR 572.120 - Incorporation by reference.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Child Test Dummy, Beta Version § 572.120 Incorporation by reference. (a) The following materials are... List and Drawings, Hybrid III Six-year-old Child Test Dummy (H-III6C, Beta Version) (June 2002... (vii) The Hybrid III Six-year-old Child Parts/Drawing List. (2) A procedures manual entitled...

E-Combretastatin and E-Resveratrol Structural Modifications: Antimicrobial and Cancer Cell Growth Inhibitory Beta-E-Nitrostyrenes

USDA-ARS?s Scientific Manuscript database

As part of a broad-based SAR investigation of E-resveratrol (strong sirtuin activator and antineoplastic) and the anticancer vascular-targeting combretastatin-type stilbenes, a series of twenty-three beta-E-nitrostyrenes was synthesized in order to evaluate potential antineoplastic, antitubulin poly...

Composition of PLGA and PEI/DNA nanoparticles improves ultrasound-mediated gene delivery in solid tumors in vivo.

PubMed

Chumakova, Olga V; Liopo, Anton V; Andreev, Valery G; Cicenaite, Inga; Evers, B Mark; Chakrabarty, Shilla; Pappas, Todd C; Esenaliev, Rinat O

2008-03-18

The goal of this study was to enhance gene delivery and tumor cell transfection in vivo by using a combination of ultrasonication with complex nanoparticles consisting of two types of nanoparticles: PEI/DNA beta-gal plasmid with highly positive zeta-potential and air-filled poly (lactic-co-glycolic acid) (PLGA) particles (with negative zeta-potential) manufactured in our laboratory. The PLGA/PEI/DNA nanoparticles were a colloid with positive zeta-potential and injected i.v. in nude mice with DU145 human prostate tumors. We found that the combination of PLGA/PEI/DNA nanoparticles with ultrasonication substantially enhanced tumor cell transfection in vivo. The overexpression of beta-gal gene was evaluated histochemically and by Western blot analysis. At least an 8-fold increase of the cell transfection efficacy was obtained in irradiated tumors compared to non-irradiated controls, while little to no cell death was produced by ultrasonication.

Antagonism of methoxyflurane-induced anesthesia in rats by benzodiazepine inverse agonists.

PubMed

Miller, D W; Yourick, D L; Tessel, R E

1989-11-28

Injection of the partial benzodiazepine inverse agonist Ro15-4513 (1-32 mg/kg i.p.) or nonconvulsant i.v. doses of the full benzodiazepine inverse agonist beta-CCE immediately following cessation of exposure of rats to an anesthetic concentration of methoxyflurane significantly antagonized the duration of methoxyflurane anesthesia as measured by recovery of the righting reflex and/or pain sensitivity. This antagonism was inhibited by the benzodiazepine antagonist Ro15-1788 at doses which alone did not alter the duration of methoxyflurane anesthesia. In addition, high-dose Ro15-4513 pretreatment (32 mg/kg) antagonized the induction and duration of methoxyflurane anesthesia but was unable to prevent methoxyflurane anesthesia or affect the induction or duration of anesthesia induced by the dissociative anesthetic ketamine (100 mg/kg). These findings indicate that methoxyflurane anesthesia can be selectively antagonized by the inverse agonistic action of Ro15-4513 and beta-CCE.

Chronic alcohol abuse and the acute sedative and neurophysiologic effects of midazolam.

PubMed

Bauer, L O; Gross, J B; Meyer, R E; Greenblatt, D J

1997-10-01

The aim of the present investigation was to examine benzodiazepine sensitivity in abstinent alcoholics. For this purpose, two escalating doses of the benzodiazepine midazolam were i.v. administered to nine alcohol-dependent patients after 2-3 weeks of abstinence and 12 healthy, non-alcoholic volunteers. A variety of dependent measures were examined, including the power spectrum of the resting electroencephalogram (EEG) and evoked EEG responses, saccadic eye movements, self-reported sedation, and vigilance task performance. Analyses revealed a significant association between plasma midazolam levels and changes in EEG beta power, pattern shift visual evoked potential amplitude, heart rate, and saccade amplitude and velocity. The patient and control groups differed significantly in the onset latencies of their saccadic eye movements, and marginally in EEG beta power, both before and after midazolam. However, no differences were detected between the groups in the dose of midazolam required to produce sedation or in midazolam's neurophysiological effects.

Tarantula huwentoxin-IV inhibits neuronal sodium channels by binding to receptor site 4 and trapping the domain ii voltage sensor in the closed configuration.

PubMed

Xiao, Yucheng; Bingham, Jon-Paul; Zhu, Weiguo; Moczydlowski, Edward; Liang, Songping; Cummins, Theodore R

2008-10-03

Peptide toxins with high affinity, divergent pharmacological functions, and isoform-specific selectivity are powerful tools for investigating the structure-function relationships of voltage-gated sodium channels (VGSCs). Although a number of interesting inhibitors have been reported from tarantula venoms, little is known about the mechanism for their interaction with VGSCs. We show that huwentoxin-IV (HWTX-IV), a 35-residue peptide from tarantula Ornithoctonus huwena venom, preferentially inhibits neuronal VGSC subtypes rNav1.2, rNav1.3, and hNav1.7 compared with muscle subtypes rNav1.4 and hNav1.5. Of the five VGSCs examined, hNav1.7 was most sensitive to HWTX-IV (IC(50) approximately 26 nM). Following application of 1 microm HWTX-IV, hNav1.7 currents could only be elicited with extreme depolarizations (>+100 mV). Recovery of hNav1.7 channels from HWTX-IV inhibition could be induced by extreme depolarizations or moderate depolarizations lasting several minutes. Site-directed mutagenesis analysis indicated that the toxin docked at neurotoxin receptor site 4 located at the extracellular S3-S4 linker of domain II. Mutations E818Q and D816N in hNav1.7 decreased toxin affinity for hNav1.7 by approximately 300-fold, whereas the reverse mutations in rNav1.4 (N655D/Q657E) and the corresponding mutations in hNav1.5 (R812D/S814E) greatly increased the sensitivity of the muscle VGSCs to HWTX-IV. Our data identify a novel mechanism for sodium channel inhibition by tarantula toxins involving binding to neurotoxin receptor site 4. In contrast to scorpion beta-toxins that trap the IIS4 voltage sensor in an outward configuration, we propose that HWTX-IV traps the voltage sensor of domain II in the inward, closed configuration.

Multimodal treatment, including interferon beta, of nasopharyngeal carcinoma in children and young adults: preliminary results from the prospective, multicenter study NPC-2003-GPOH/DCOG.

PubMed

Buehrlen, Martina; Zwaan, Christian Michel; Granzen, Bernd; Lassay, Lisa; Deutz, Peter; Vorwerk, Peter; Staatz, Gundula; Gademann, Günther; Christiansen, Hans; Oldenburger, Foppe; Tamm, Miriam; Mertens, Rolf

2012-10-01

The authors report preliminary results from a prospective multicenter study (Nasopharyngeal Carcinoma [NPC] 2003 German Society of Pediatric Oncology and Hematology/German Children's Oncology Group [NPC-2003-GPOH/DCOG]). From 2003 to 2010, 45 patients (ages 8-20 years), including 1 patient with stage II NPC and 44 patients with stage III/IV NPC, were recruited to the study. The patient with stage II disease received radiotherapy (59.4 grays [Gy]). The patients with stage III/IV disease received 3 courses of neoadjuvant chemotherapy with cisplatin, 5-fluorouracil, and folinic acid. The cumulative irradiation dose was 54 Gy in 5 patients, who achieved complete remission after neoadjuvant chemotherapy, and 59.4 Gy in the remaining 40 patients. All patients received concomitant cisplatin during the first week and last week of irradiation. After irradiation, all patients received interferon beta for 6 months. Tumor response was evaluated by magnetic resonance imaging studies and positron emission tomography scans. After the completion of treatment, 43 of 45 patients were in complete remission. In 2 patients, only a partial response was achieved, followed by distant metastases (1 patient) or local progression and distant metastases (1 patient), 6 months and 10 months after diagnosis, respectively. Another patient developed a solitary pelvic bone metastasis 21 months after diagnosis. After a median follow-up of 30 months (range, 6-95 months), the event-free survival rate was 92.4%, and the overall survival was 97.1%. Acute toxicity consisted mainly of leucopenia, mucositis, and nausea; and late toxicity consisted of hearing loss and hypothyroidism. Combined therapy with neoadjuvant chemotherapy, radiochemotherapy, and interferon beta was well tolerated and resulted in a very good outcome that was superior to the outcomes of published results from all other pediatric NPC study groups. Copyright © 2012 American Cancer Society.

Gaucher disease: A G[sup +1][yields]A[sup +1] IVS2 splice donor site mutation causing exon 2 skipping in the acid [beta]-glucosidase mRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Guo-Shun; Grabowski, G.A.

1992-10-01

Gaucher disease is the most frequent lysosomal storage disease and the most prevalent Jewish genetic disease. About 30 identified missense mutations are causal to the defective activity of acid [beta]-glucosidase in this disease. cDNAs were characterized from a moderately affected 9-year-old Ashkenazi Jewish Gaucher disease type 1 patient whose 80-years-old, enzyme-deficient, 1226G (Asn[sup 370][yields]Ser [N370S]) homozygous grandfather was nearly asymptomatic. Sequence analyses revealed four populations of cDNAs with either the 1226G mutation, an exact exon 2 ([Delta] EX2) deletion, a deletion of exon 2 and the first 115 bp of exon 3 ([Delta] EX2-3), or a completely normal sequence. Aboutmore » 50% of the cDNAs were the [Delta] EX2, the [Delta] EX2-3, and the normal cDNAs, in a ratio of 6:3:1. Specific amplification and characterization of exon 2 and 5[prime] and 3[prime] intronic flanking sequences from the structural gene demonstrated clones with either the normal sequence or with a G[sup +1][yields]A[sup +1] transition at the exon 2/intron 2 boundary. This mutation destroyed the splice donor consensus site (U1 binding site) for mRNA processing. This transition also was present at the corresponding exon/intron boundary of the highly homologous pseudogene. This new mutation, termed [open quotes]IVS2 G[sup +1],[close quotes] is the first in the Ashkenazi Jewish population. The occurrence of this [open quotes]pseudogene[close quotes]-type mutation in the structural gene indicates the role of acid [beta]-glucosidase pseudogene and structural gene rearrangements in the pathogenesis of this disease. 33 refs., 8 figs., 1 tab.« less

A novel member of the split betaalphabeta fold: Solution structure of the hypothetical protein YML108W from Saccharomyces cerevisiae.

PubMed

Pineda-Lucena, Antonio; Liao, Jack C C; Cort, John R; Yee, Adelinda; Kennedy, Michael A; Edwards, Aled M; Arrowsmith, Cheryl H

2003-05-01

As part of the Northeast Structural Genomics Consortium pilot project focused on small eukaryotic proteins and protein domains, we have determined the NMR structure of the protein encoded by ORF YML108W from Saccharomyces cerevisiae. YML108W belongs to one of the numerous structural proteomics targets whose biological function is unknown. Moreover, this protein does not have sequence similarity to any other protein. The NMR structure of YML108W consists of a four-stranded beta-sheet with strand order 2143 and two alpha-helices, with an overall topology of betabetaalphabetabetaalpha. Strand beta1 runs parallel to beta4, and beta2:beta1 and beta4:beta3 pairs are arranged in an antiparallel fashion. Although this fold belongs to the split betaalphabeta family, it appears to be unique among this family; it is a novel arrangement of secondary structure, thereby expanding the universe of protein folds.

Adrenal 11-beta hydroxysteroid dehydrogenase activity in response to stress.

PubMed

Zallocchi, Marisa; Matković, Laura; Damasco, María C

2004-06-01

This work studied the effect of stresses produced by simulated gavage or gavage with 200 mmol/L HCl two hours before adrenal extraction, on the activities of the 11beta-hydroxysteroid dehydrogenase 1 and 11beta-hydroxysteroid dehydrogenase 2 isoforms present in the rat adrenal gland. These activities were determined on immediately prepared adrenal microsomes following incubations with 3H-corticosterone and NAD+ or NADP+. 11-dehydrocorticosterone was measured as an end-product by TLC, and controls were adrenal microsomes from rats kept under basal (unstressed) conditions. 11beta-hydroxysteroid dehydrogenase 1 activity, but not 11beta-hydroxysteroid dehydrogenase 2 activity, was increased under both stress-conditions. Homeostatically, the stimulation of 11beta-hydroxysteroid dehydrogenase 1 activity would increase the supply of glucocorticoids. These, in turn, would activate the enzyme phenylethanolamine N-methyl transferase, thereby improving the synthesis of epinephrine as part of the stress-response.

[A new eremophilane derivative from Senecio dianthus].

PubMed

Han, He-Dong; Hu, Hai-Qing; Li, Yan; Wang, Xiao-Ling

2013-10-01

A new eremophilane derivative, 4,5,11-trimethyl-9( 10), 7 ( 11) -eremophiladien-8-keto-12-carboxylic acid-beta-D-glucopyranoside( which named dianthuside A) 1 and four known compounds, 5,7,4'-trihydroxy-flavonone-3-0-beta-D-glucoside (2), quercetin-3-0-beta-D-glucoside(3) ,hyperin(4) and rutin(5) have been isolated from the aerial part of Senecio dianthus. Their structures were elucidated by physicochemical properties and spectroscopic data analysis. Compounds 2, 4 and 5 were isolated from this plant for the first time.

Study of a large Anglo-Saxon family with beta-thalassaemia trait.

PubMed

Raik, E; Powell, E; Gordon, S

1976-01-01

Study of a large Anglo-Saxon family with beta-thalassaemia trait revealed evidence of consanguinity, moreover both branches of the family shared a Spanish ancestor. The manifestations of the disorder were varied in severity and yet the degree of severity appeared to breed true within any individual part of the family. Our explanation for the inheritance pattern observed in the family was to postulate the existence of two non-allelic genes influencing the rate of beta-chain synthesis.

Pregnancy Specific Glycoprotein 23 binds to CD151 and Induces the Secretion of IL-10 and TGF-beta1 in Murine Macrophages

DTIC Science & Technology

2007-07-11

levels of trophoblast-specific beta-1-globulin (SP1) and alpha -1- fetoprotein (AFP) in pregnant women with rheumatoid arthritis]. Cesk Gynekol, 1991...transforming growth factor-beta TNF-": tumor necrosis factor- alpha TXA: thromboxane A2 uNK: uterine natural killer cell 1 PART ONE...specific glycoprotein, pregnancy-associated plasma protein A, "- fetoprotein , as well as an array of cytokines, including IL-6, and TGF-! [95

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vitiello, Giuseppe; CSGI; Grimaldi, Manuela

Highlights: Black-Right-Pointing-Pointer iA{beta}5p shows a significant tendency to deeply penetrates the hydrophobic core of lipid membrane. Black-Right-Pointing-Pointer A{beta}(25-35) locates in the external region of the membrane causing a re-positioning of CHOL. Black-Right-Pointing-Pointer iA{beta}5p withholds cholesterol in the inner hydrophobic core of the lipid membrane. Black-Right-Pointing-Pointer iA{beta}5p prevents the A{beta}(25-35) release from the lipid membrane. -- Abstract: Alzheimer's disease is characterized by the deposition of aggregates of the {beta}-amyloid peptide (A{beta}) in the brain. A potential therapeutic strategy for Alzheimer's disease is the use of synthetic {beta}-sheet breaker peptides, which are capable of binding A{beta} but unable to become part ofmore » a {beta}-sheet structure, thus inhibiting the peptide aggregation. Many studies suggest that membranes play a key role in the A{beta} aggregation; consequently, it is strategic to investigate the interplay between {beta}-sheet breaker peptides and A{beta} in the presence of lipid bilayers. In this work, we focused on the effect of the {beta}-sheet breaker peptide acetyl-LPFFD-amide, iA{beta}5p, on the interaction of the A{beta}(25-35) fragment with lipid membranes, studied by Electron Spin Resonance spectroscopy, using spin-labeled membrane components (either phospholipids or cholesterol). The ESR results show that iA{beta}5p influences the A{beta}(25-35) interaction with the bilayer through a cholesterol-mediated mechanism: iA{beta}5p withholds cholesterol in the inner hydrophobic core of the bilayer, making the interfacial region more fluid and capable to accommodate A{beta}(25-35). As a consequence, iA{beta}5p prevents the A{beta}(25-35) release from the lipid membrane, which is the first step of the {beta}-amyloid aggregation process.« less

Phi is not beta, and why Wertheimer's discovery launched the Gestalt revolution.

PubMed

Steinman, R M; Pizlo, Z; Pizlo, F J

2000-01-01

Max Wertheimer (1880-1943), the founder of the Gestalt School of Psychology, published a monograph on the perception of apparent motion in 1912, which initiated a new direction for a great deal of subsequent perceptual theory and research. Wertheimer's research was inspired by a serendipitous observation of a pure apparent movement, which he called the phi-phenomenon to distinguish it from optimal apparent movement (beta), which resembles real movement. Wertheimer called his novel observation 'pure' because it was perceived in the absence of any object being seen to change its position in space. The phi-phenomenon, as well as the best conditions for seeing it, were not described clearly in this monograph, leading to considerable subsequent confusion about its appearance and occurrence. We review the history leading to the discovery of the phi-phenomenon, and then describe: (i) a likely source for the confusion evident in most contemporary research on the phi-phenomenon; (ii) the best conditions for seeing the phi-phenomenon; (iii) new conditions that provide a particularly vivid phi-phenomenon; and (iv) two lines of thought that may provide explanations of the phi-phenomenon and also distinguish phi from beta.

Evaluation of beta-cell sensitivity to glucose and first-phase insulin secretion in obese dogs.

PubMed

Verkest, Kurt R; Fleeman, Linda M; Rand, Jacquie S; Morton, John M

2011-03-01

To compare beta-cell sensitivity to glucose, first-phase insulin secretion, and glucose tolerance between dogs with naturally occurring obesity of > 2 years' duration and lean dogs. 17 client-owned obese or lean dogs. Frequently sampled IV glucose tolerance tests were performed with minimal model analysis on 6 obese dogs and matched controls. Glucagon stimulation tests were performed on 5 obese dogs and matched controls. Obese dogs were half as sensitive to the effects of insulin as lean dogs. Plasma glucose concentrations after food withholding did not differ significantly between groups; plasma insulin concentrations were 3 to 4 times as great in obese as in lean dogs. Obese dogs had plasma insulin concentrations twice those of lean dogs after administration of glucose and 4 times as great after administration of glucagon. First-phase insulin secretion was greater in obese dogs. Obese dogs compensated for obesity-induced insulin resistance by secreting more insulin. First-phase insulin secretion and beta-cell glucose sensitivity were not lost despite years of obesity-induced insulin resistance and compensatory hyperinsulinemia. These findings help explain why dogs, unlike cats and humans, have not been documented to develop type 2 diabetes mellitus.

Enhanced cytokine synthesis of leukocytes by a beta-glucan preparation, SCG, extracted from a medicinal mushroom, Sparassis crispa.

PubMed

Nameda, Sachiko; Harada, Toshie; Miura, Noriko N; Adachi, Yoshiyuki; Yadomae, Toshiro; Nakajima, Mitsuhiro; Ohno, Naohito

2003-08-01

Sparassis crispa is edible mushroom recently cultivable in Japan. It contains significantly high content (approximately 40%) of 6-branched 1,3-beta-D-glucan showing antitumor activity in mice. We recently purified a beta-glucan preparation designated as "SCG." It was considered worth while to test SCG in vitro with whole blood collected from human volunteers. The present study is focusing on the cytokine productivity of SCG in an in vitro human system. The following results were observed: (i) SCG dose dependently enhanced IL-8 synthesis of whole blood cell culture of human peripheral blood. (ii) IL-8 synthesis was enhanced in both PBMC and PMN cultures. (iii) IL-8 synthesis was induced in the culture with autologous plasma, but significantly reduced after 56 degrees C treatment. (iv) The activity was also weak in heat inactivated fetal calf serum (FCS). (v) A complement fragment, C5a, was released by SCG dependently upon dose and kinetics. (vi) Anti-SCG natural antibody was detected in human plasma. From these facts, SCG was observed to have the capacity to activate human leukocytes and related immune system.

IFN-{gamma} sensitizes MIN6N8 insulinoma cells to TNF-{alpha}-induced apoptosis by inhibiting NF-{kappa}B-mediated XIAP upregulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Hun Sik; Kim, Sunshin; Lee, Myung-Shik

2005-10-28

Although X-linked inhibitor of apoptosis protein (XIAP) is an important intracellular suppressor of apoptosis in a variety of cell types, its role in cytokine-induced pancreatic {beta}-cell apoptosis remains unclear. Here, we found that: (i) XIAP level was inversely correlated with tumor necrosis factor (TNF)-{alpha}-induced apoptosis in MIN6N8 insulinoma cells; (ii) adenoviral XIAP overexpression abrogated the TNF-{alpha}-induced apoptosis through inhibition of caspase activity; (iii) downregulation of XIAP by antisense oligonucleotide or Smac peptide sensitized MIN6N8 cells to TNF-{alpha}-induced apoptosis; (iv) XIAP expression was induced by TNF-{alpha} through a nuclear factor-{kappa}B (NF-{kappa}B)-dependent pathway, and interferon (IFN)-{gamma} prevented such an induction in amore » manner independent of NF-{kappa}B, which presents a potential mechanism underlying cytotoxic IFN-{gamma}/TNF-{alpha} synergism. Taken together, our results suggest that XIAP is an important modulator of TNF-{alpha}-induced apoptosis of MIN6N8 cells, and XIAP regulation in pancreatic {beta}-cells might play an important role in pancreatic {beta}-cell apoptosis and in the pathogenesis of type 1 diabetes.« less

Metalloporphyrin probes for antimalarial drug action.

PubMed

Ziegler, James; Pasierb, Lisa; Cole, Kelly A; Wright, David W

2003-09-01

Metal-substituted protoporphyrin IXs (Co(III)PPIX (1), Cr(III)PPIX (2), Mn(III)PPIX (3), Cu(II)PPIX (4), Mg(II)PPIX (5), Zn(II)PPIX (6) and Sn(IV)PPIX (7)), phthalocyanine tetrasulfonates (PcS (8) and Ni(II)PcS (9)), and anionic and cationic porphyrins (meso-tetra(4-sulfonatophenyl)porphine (TPPS4, 10), meso-tetra(4-carboxyphenyl)porphine (TPPC4, 11), tetrakis(4-N-trimethylaminophenyl)porphine (TMAP, 12) and meso-tetra(N-methyl-4-pyridyl)porphine (TMPyP4, 13)) have been used as probes to compare two different assays for the inhibition of beta-hematin formation. The results demonstrate that the efficacy of these probes in either the beta-hematin inhibition assay (9, 7, 6, 5>4>11, 3>10, 8>2, 1; 12 and 13 did not inhibit.) or the bionucleating template assay (8>1>11>9, 2>4>3>7>10>5>6; 12 and 13 did not inhibit.) differ significantly. These differences are examined in light of possible interactions between the inhibitor probes, heme, beta-hematin and the bionucleating template. This detailed analysis highlights the fact that while dominant modes of interactions may be occasionally identified, the precise mechanism of inhibition undoubtedly consists of the interplay between multiple interactions.

[The effects of nicergoline on the heart rate in the normotensive or spontaneously hypertensive rat. Possible participation of central alpha-1 receptors].

PubMed

Huchet, A M; Schmitt, H

1986-01-01

The cardiovascular effects of nicergoline, a preferential alpha 1-adrenoceptor blocking drug, were studied in anaesthetized normotensive or spontaneously hypertensive (SH) rats. Nicergoline (300 micrograms/kg, i.v.) significantly reduced blood pressure and heart rate in control, bivagotomized or beta-blocked normotensive or SH rats. In bilaterally vagotomized and beta-blocked rats, nicergoline reduced mean blood pressure but did no longer modify heart rate. Thus, it is postulated that nicergoline could reduce the sympathetic tone and increase the vagal nerve activity, possibly by inhibiting central alpha 1-adrenoceptors. The nicergoline--induced bradycardia was greater in bivagotomized SHR than in normotensive ones. Intracerebroventricular injections of nicergoline (30 micrograms/kg) did not modify heart rate in normotensive control, bivagotomized or beta-blocked rats. On the contrary, nicergoline (30 micrograms/kg) injected into the cisterna magna induced a significant bradycardia in the three groups of normotensive rats. Blood pressure was reduced in the same way in all groups centrally treated by nicergoline. In conclusion, it seems that nicergoline reduces blood pressure by peripheral alpha-adrenoceptor blockade and modulates the autonomic nervous activity by inhibiting alpha 1-adrenoceptors mainly localized in the brainstem.

Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.

PubMed Central

Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W

1987-01-01

Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706

Functionally essential, invariant glutamate near the C-terminus of strand beta 5 in various (alpha/beta)8-barrel enzymes as a possible indicator of their evolutionary relatedness.

PubMed

Janecek, S; Baláz, S

1995-08-01

Twelve different (alpha/beta)8-barrel enzymes belonging to three structurally distinct families were found to contain, near the C-terminus of their strand beta 5, a conserved invariant glutamic acid residue that plays an important functional role in each of these enzymes. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif owing to their mutual evolutionary relatedness. For this purpose, the sequence region around the well conserved fifth beta-strand of alpha-amylase containing catalytic glutamate (Glu230, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The isolated sequence stretches of the 12 (alpha/beta)8-barrels are discussed from both the sequence-structural and the evolutionary point of view, the invariant glutamate residue being proposed to be a joining feature of the studied group of enzymes remaining from their ancestral (alpha/beta)8-barrel.

Molecular cloning of a small prostate protein, known as beta-microsemenoprotein, PSP94 or beta-inhibin, and demonstration of transcripts in non-genital tissues.

PubMed

Ulvsbäck, M; Lindström, C; Weiber, H; Abrahamsson, P A; Lilja, H; Lundwall, A

1989-11-15

In order to study the gene expression of the seminal plasma protein beta-microseminoprotein, also known as PSP94 and beta-inhibin, clones encoding this protein were isolated from a cDNA library constructed in lambda gt11. Nucleotide sequencing confirmed the structure of a previously cloned cDNA. By northern blot analysis identical sized transcripts were demonstrated in the prostate, the respiratory (tracheal, bronchial and lung) tissues and the antrum part of the gastric mucosa. Thus, the protein is not primarily associated with male reproductive function. Although probably of no physiological significance, a slight structural similarity to the ovarian inhibin beta-chains was identified in the C-terminal half of the molecule.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Hae Jin; Park, Joongkyu; Seo, Su Ryeon

Down syndrome is mainly caused by a trisomy of chromosome 21. The Down syndrome critical region 2 (DSCR2) gene is located within a part of chromosome 21, the Down syndrome critical region (DSCR). To investigate the function of DSCR2, we sought to identify DSCR2-interacting proteins using yeast two-hybrid assays. A human fetal brain cDNA library was screened, and DSCR2 was found to interact with a member of the nuclear receptor superfamily, peroxisome proliferator-activated receptor {beta}, (PPAR{beta}). A co-immunoprecipitation assay demonstrated that DSCR2 physically interacts with PPAR{beta} in mammalian HEK293 cells. DSCR2 also inhibited the ligand-induced transcriptional activity of PPAR{beta}. Furthermore,more » PPAR{beta} also decreased the solubility of DSCR2, which increased levels of insoluble DSCR2.« less

20 CFR 410.591 - Eligibility for services and supplies under part C of title IV of the act.

Code of Federal Regulations, 2010 CFR

2010-04-01

... ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Payment of... DOL regulations covering the time period in which the miner must file with DOL for these benefits are published at 20 CFR part 725. (Sec. 411, Federal Coal Mine Health and Safety Act of 1969, as amended; 85...

Financial Analysis and Mathematics of Business: Part IV in a Series--Preparation for Certified Professional Secretary Examination. An Instructor's Guide for an Adult Course.

ERIC Educational Resources Information Center

Gonyea, Adrian C.

The instructor's guide provides a review for those preparing to take Part IV of the Certified Professional Secretary (CPS) examination. Course content can also help secretaries update their skills in accounting and business mathematics. Organized into lessons with objectives, content outline, and teaching suggestions and references, the units…

Positive interaction of the novel beta2-agonist carmoterol and tiotropium bromide in the control of airway changes induced by different challenges in guinea-pigs.

PubMed

Rossoni, Giuseppe; Manfredi, Barbara; Razzetti, Roberta; Civelli, Maurizio; Berti, Ferruccio

2007-01-01

This study evaluated the bronchodilating activity of the beta(2)-agonist carmoterol and the muscarinic M(3)-antagonist tiotropium, given intratracheally alone or in combination in anaesthetized artificially ventilated normal and actively sensitized guinea-pigs. Carmoterol (0.3-100pmol) and tiotropium (10-1000pmol) were superfused (0.01ml/min) for 5min before challenges with acetylcholine (20mug/kg i.v.), histamine (10mug/kg i.v.) or ovalbumin (5mg/kg i.v.). Both compounds given alone were markedly active against all the challenges. Tiotropium resulted more effective towards cholinergic challenge and carmoterol was very potent against histamine and ovalbumin-induced reaction, being effective already at 1pmol. In the presence of tiotropium, the bronchodilating activity of carmoterol was significantly augmented. The ED(50) value of carmoterol on the acetylcholine challenge was reduced by about 10 and 28 times (0.1 and 0.3pmol of tiotropium), that on the histamine one by 4.5 and 13 times (1 and 3pmol of tiotropium) and that on the ovalbumin-induced one by 8 and 25 times (10 and 30pmol of tiotropium). A positive interaction was also evident when other parameters were evaluated. The histamine-induced release of thromboxane B(2) was markedly reduced (56%, P<0.001) by combining completely ineffective doses of the two drugs (0.3 and 3pmol for carmoterol and tiotropium, respectively). In ovalbumin-challenged animals the time to death, amounting in control animals to 7.2+/-0.9min, was dose-dependently prolonged up to achieve complete protection from death with combination of 1 and 30pmol of carmoterol and tiotropium, respectively. The favorable interaction between carmoterol and tiotropium can represent a good option in the control of bronchopulmonary diseases marked by an increase of airway resistances.

Toxicokinetics of lambda-cyhalothrin in rats.

PubMed

Anadón, A; Martínez, M; Martínez, M A; Díaz, M J; Martínez-Larrañaga, M R

2006-08-01

The toxicokinetics of lambda-cyhalothrin after single 20 mg kg(-1) oral and 3 mg kg(-1) intravenous doses were studied in rats. Serial blood samples were obtained after oral and intravenous administration. Liver, brain, spinal cord, sciatic nerve, vas deferens, anococcygeus and myenteric plexus tissue samples were also collected. Plasma, liver, hypothalamus, cerebellum, medulla oblongata, frontal cortex, striatum, hippocampus, midbrain, spinal cord, vas deferens, anococcygeus, myenteric plexus and sciatic nerve concentrations of lambda-cyhalothrin were determined by HPLC. The plasma and tissue concentration-time data for lambda-cyhalothrin were found to fit a two-compartment open model. For lambda-cyhalothrin, the elimination half-life (T1/2beta) and the mean residence time from plasma were 7.55 and 8.55 h after i.v. and 10.27 and 14.43 h after oral administration. The total plasma clearance was not influenced by dose concentration or route and reached a value of 0.060l h(-1)kg(-1). After i.v. administration, the apparent volume of distribution and at steady state were 0.68 and 0.53l kg(-1), suggesting a diffusion of the pyrethroid into tissue. After oral administration, lambda-cyhalothrin was extensively but slowly absorbed (Tmax, 2.69 h). The oral bioavailability was found to be 67.37%. Significant differences in the kinetic parameters between nervous tissues and plasma was observed. The maximum concentrations in hypothalamus (Cmax, 24.12 microg g(-1)) and myenteric plexus (Cmax, 25.12 microg g(-1)) were about 1.5 times higher than in plasma (Cmax, 15.65 microg ml(-1)) and 1.3 times higher than in liver (Cmax, 18.42 microg ml(-1)). Nervous tissue accumulation of lambda-cyhalothrin was also reflected by the area under the concentration curve ratios of tissue/plasma (liver). The T1/2beta for lambda-cyhalothrin was significantly greater for the nerve tissues, including neuromuscular fibres, (range 12-26 and 15-34 h, after i.v. and oral doses) than for plasma (7.55 and 10.27 h, respectively).

20 CFR Appendix IV to Subpart C of... - Earnings Needed for a Year of Coverage After 1950

Code of Federal Regulations, 2010 CFR

2010-04-01

... 1950 IV Appendix IV to Subpart C of Part 404 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Computing Primary Insurance Amounts Pt. 404... Minimum Social Security Earnings to Qualify for a Year of Coverage After 1950 for Purposes of the— Year...

Convergent synthesis of a trisaccharide as its 2-(trimethylsilyl)ethyl glycoside related to the flavonoid triglycoside from Gymnema sylvestre.

PubMed

Mukhopadhyay, Balaram; Field, Robert A

2006-07-24

The glycone part of the flavonoid triglycoside, kaempferol 3-O-beta-D-glucopyranosyl-(1-->4)-alpha-L-rhamnopyranosyl-(1-->6)-beta-D-galactopyranoside, has been synthesized in good yield and stereoselectivity using N-iodosuccinimide and HClO4-silica promoted glycosylations of thioglycoside donors.

Teaching Elementary Particle Physics, Part II

ERIC Educational Resources Information Center

Hobson, Art

2011-01-01

In order to explain certain features of radioactive beta decay, Wolfgang Pauli suggested in 1930 that the nucleus emitted, in addition to a beta particle, another particle of an entirely new type. The hypothesized particle, dubbed the neutrino, would not be discovered experimentally for another 25 years. It's not easy to detect neutrinos, because…

Engagement of groups in family medicine board maintenance of certification.

PubMed

Fisher, Dena M; Brenner, Christopher J; Cheren, Mark; Stange, Kurt C

2013-01-01

The American Board of Medical Specialties' Performance in Practice ("Part IV") portion of Maintenance of Certification (MOC) requirement provides an opportunity for practicing physicians to demonstrate quality improvement (QI) competence. However, specialty boards' certification of one physician at a time does not tap into the potential of collective effort. This article shares learning from a project to help family physicians work in groups to meet their Part IV MOC requirement. A year-long implementation and evaluation project was conducted. Initially, 348 members of a regional family physician organization were invited to participate. A second path was established through 3 health care systems and a county-wide learning collaborative. Participants were offered (1) a basic introduction to QI methods, (2) the option of an alternative Part IV MOC module using a patient experience survey to guide QI efforts, (3) practice-level improvement coaching, (4) support for collaboration and co-learning, and (5) provision of QI resources. More physicians participated through group (66) than individual (12) recruitment, for a total of 78 physicians in 20 practices. Participation occurred at 3 levels: individual, intrapractice, and interpractice. Within the 1-year time frame, intrapractice collaboration occurred most frequently. Interpractice and system-level collaboration has begun and continues to evolve. Physicians felt that they benefited from access to a practice coach and group process. Practice-level collaboration, access to a practice coach, flexibility in choosing and focusing improvement projects, tailored support, and involvement with professional affiliations can enhance the Part IV MOC process. Specialty boards are likely to discover productive opportunities from working with practices, professional organizations, and health care systems to support intra- and interpractice collaborative QI work that uses Part IV MOC requirements to motivate practice improvement.

Basal and glucagon-stimulated plasma C-peptide concentrations in healthy dogs, dogs with diabetes mellitus, and dogs with hyperadrenocorticism.

PubMed

Montgomery, T M; Nelson, R W; Feldman, E C; Robertson, K; Polonsky, K S

1996-01-01

Serum glucose and plasma C-peptide response to i.v. glucagon administration was evaluated in 24 healthy dogs, 12 dogs with untreated diabetes mellitus, 30 dogs with insulin-treated diabetes mellitus, and 8 dogs with naturally acquired hyperadrenocorticism. Serum insulin response also was evaluated in all dogs, except 20 insulin-treated diabetic dogs. Blood samples for serum glucose, serum insulin, and plasma C-peptide determinations were collected immediately before and 5, 10, 20, 30, and (for healthy dogs) 60 minutes after i.v. administration of 1 mg glucagon per dog. In healthy dogs, the patterns of glucagon-stimulated changes in plasma C-peptide and serum insulin concentrations were identical, with single peaks in plasma C-peptide and serum insulin concentrations observed approximately 15 minutes after i.v. glucagon administration. Mean plasma C-peptide and serum insulin concentrations in untreated diabetic dogs, and mean plasma C-peptide concentration in insulin-treated diabetic dogs did not increase significantly after i.v. glucagon administration. The validity of serum insulin concentration results was questionable in 10 insulin-treated diabetic dogs, possibly because of anti-insulin antibody interference with the insulin radioimmunoassay. Plasma C-peptide and serum insulin concentrations were significantly increased (P < .001) at all blood sampling times after glucagon administration in dogs with hyperadrenocorticism, compared with healthy dogs, and untreated and insulin-treated diabetic dogs. Five-minute C-peptide increment, C-peptide peak response, total C-peptide secretion, and, for untreated diabetic dogs, insulin peak response and total insulin secretion were significantly lower (P < .00l) in diabetic dogs, compared with healthy dogs, whereas these same parameters were significantly increased (P < .01) in dogs with hyperadrenocorticism, compared with healthy dogs, and untreated and insulin-treated diabetic dogs. Although not statistically significant, there was a trend for higher plasma C-peptide concentrations in untreated diabetic dogs compared with insulin-treated diabetic dogs during the glucagon stimulation test. Baseline C-peptide concentrations also were significantly higher (P < .05) in diabetic dogs treated with insulin for less than 6 months, compared with diabetic dogs treated for longer than 1 year. Finally, 7 of 42 diabetic dogs had baseline plasma C-peptide concentrations greater than 2 SD (ie, > 0.29 pmol/mL) above the normal mean plasma C-peptide concentration; values that were significantly higher, compared with the results in healthy dogs (P < .001) and with the other 35 diabetic dogs (P < .001). In summary, measurement of plasma C-peptide concentration during glucagon stimulation testing allowed differentiation among healthy dogs, dogs with impaired beta-cell function (ie, diabetes mellitus), and dogs with increased beta-cell responsiveness to glucagon (ie, insulin resistance). Plasma C-peptide concentrations during glucagon stimulation testing were variable in diabetic dogs and may represent dogs with type-1 and type-2 diabetes or, more likely, differences in severity of beta-cell loss in dogs with type-1 diabetes.

Bypass of Aflatoxin B[subscript 1] Adducts by the Sulfolobus solfataricus DNA Polymerase IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Surajit; Brown, Kyle L.; Egli, Martin

Aflatoxin B{sub 1} (AFB{sub 1}) is oxidized to an epoxide in vivo, which forms an N7-dG DNA adduct (AFB{sub 1}-N7-dG). The AFB{sub 1}-N7-dG can rearrange to a formamidopyrimidine (AFB{sub 1}-FAPY) derivative. Both AFB{sub 1}-N7-dG and the {beta}-anomer of the AFB{sub 1}-FAPY adduct yield G {yields} T transversions in Escherichia coli, but the latter is more mutagenic. We show that the Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) bypasses AFB{sub 1}-N7-dG in an error-free manner but conducts error-prone replication past the AFB{sub 1}-FAPY adduct, including misinsertion of dATP, consistent with the G {yields} T mutations observed in E. coli. Three ternarymore » (Dpo4-DNA-dNTP) structures with AFB{sub 1}-N7-dG adducted template:primers have been solved. These demonstrate insertion of dCTP opposite the AFB{sub 1}-N7-dG adduct, and correct vs incorrect insertion of dATP vs dTTP opposite the 5'-template neighbor dT from a primed AFB{sub 1}-N7-dG:dC pair. The insertion of dTTP reveals hydrogen bonding between the template N3 imino proton and the O{sup 2} oxygen of dTTP, and between the template T O{sup 4} oxygen and the N3 imino proton of dTTP, perhaps explaining why this polymerase does not efficiently catalyze phosphodiester bond formation from this mispair. The AFB{sub 1}-N7-dG maintains the 5'-intercalation of the AFB{sub 1} moiety observed in DNA. The bond between N7-dG and C8 of the AFB{sub 1} moiety remains in plane with the alkylated guanine, creating a 16{sup o} inclination of the AFB{sub 1} moiety with respect to the guanine. A binary (Dpo4-DNA) structure with an AFB{sub 1}-FAPY adducted template:primer also maintains 5'-intercalation of the AFB{sub 1} moiety. The {beta}-deoxyribose anomer is observed. Rotation about the FAPY C5-N{sup 5} bond orients the bond between N{sup 5} and C8 of the AFB{sub 1} moiety out of plane in the 5'-direction, with respect to the FAPY base. The formamide group extends in the 3'-direction. This improves stacking of the AFB{sub 1} moiety above the 5'-face of the FAPY base, as compared to the AFB{sub 1}-N7-dG adduct. Ternary structures with AFB{sub 1}-{beta}-FAPY adducted template:primers show correct vs incorrect insertion of dATP vs dTTP opposite the 5'-template neighbor dT from a primed AFB{sub 1}-{beta}-FAPY:dC pair. For dATP, the oxygen atom of the FAPY formamide group participates in a water-mediated hydrogen bond with Arg332. The insertion of dTTP yields a structure similar to that observed for the AFB{sub 1}-N7-dG adduct. The differential accommodation of these AFB{sub 1} adducts within the active site may, in part, modulate lesion bypass.« less

Organic/Inorganic Hybrid p-n Junction with PEDOT Nanoparticles for Light-Emitting Diode

NASA Astrophysics Data System (ADS)

Kim, M. S.; Jin, S. M.; Cho, M. Y.; Choi, H. Y.; Kim, G. S.; Jeon, S. M.; Yim, K. G.; Kim, H. G.; Shim, K. B.; Kang, B. K.; Kim, Y.; Lee, D. Y.; Kim, J. S.; Kim, J. S.; Leem, J. Y.

2011-12-01

A heavily Si-doped GaN/polymer hybrid structure with p-type poly(3,4-ethylene-dioxythiophene):beta-1,3-glucan (PEDOT nanoparticle) interface layer has been fabricated. The Si-doped GaN thin film with carrier concentration of 1×1019 cm-3 was grown by metal-organic chemical vapor deposition (MOCVD). The PEDOT nanoparticle with various sizes ranging from 60 to 120 nm was synthesized via a miniemulsion polymerization process. The electrical conductivity of the PEDOT nanoparticle is less than 1.2 S/cm. The current-voltage (I-V) characteristic of the hybrid structure shows diode-like behavior. The I-V characteristic was examined in the framework of the thermionic emission model. The ideality factor and barrier height of the hybrid structure were obtained as 5.6 and 0.41 eV, respectively. The value of ideality factor is decreased by inserting the PEDOT nanoparticle interface layer.

The utility of quantitative electroencephalography and Integrated Visual and Auditory Continuous Performance Test as auxiliary tools for the Attention Deficit Hyperactivity Disorder diagnosis.

PubMed

Kim, JunWon; Lee, YoungSik; Han, DougHyun; Min, KyungJoon; Kim, DoHyun; Lee, ChangWon

2015-03-01

This study investigated the clinical utility of quantitative electroencephalography (QEEG) and the Integrated Visual and Auditory Continuous Performance Test (IVA+CPT) as auxiliary tools for assessing Attention Deficit Hyperactivity Disorder (ADHD). All of 157 subjects were assessed using the Korean version of the Diagnostic Interview Schedule for Children Version IV (DISC-IV). We measured EGG absolute power in 21 channels and conducted IVA+CPT. We analyzed QEEG according to the Hz range: delta (1-4Hz), theta (4-8Hz), slow alpha (8-10Hz), fast alpha (10-13.5Hz), and beta (13.5-30Hz). To remove artifacts, independent component analysis was conducted (ICA), and the tester confirmed the results again. All of the IVA+CPT quotients showed significant differences between the ADHD and control groups. The ADHD group showed significantly increased delta and theta activity compared with the control group. The z-scores of theta were negatively correlated with the scores of IVA+CPT in ADHD combined type, and those of beta were positively correlated. IVA+CPT and QEEG significantly discriminated between ADHD and control groups. The commission error of IVA+CPT showed an accuracy of 82.1%, and the omission error of IVA+CPT showed an accuracy of 78.6%. The IVA+CPT and QEEG are expected to be valuable tools for aiding ADHD diagnosis accurately. Copyright © 2014 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

Is high pressure liquid chromatography an effective screening tool for characterization of molecular defects in hemoglobinopathies?

PubMed

Moorchung, Nikhil; Phillip, Joseph; Sarkar, Ravi Shankar; Prasad, Rupesh; Dutta, Vibha

2013-01-01

Hemoglobinopathies constitute entities that are generated by either abnormal hemoglobin or thalassemias. high pressure liquid chromatography (HPLC) is one of the best methods for screening and detection of various hemoglobinopathies but it has intrinsic interpretive problems. The study was designed to evaluate the different mutations seen in cases of hemoglobinopathies and compare the same with screening tests. 68 patients of hemoglobinopathies were screened by HPLC. Mutation studies in the beta globin gene was performed using the polymerase chain reaction (PCR)-based allele-specific Amplification Refractory Mutation System (ARMS). Molecular analysis for the sickle cell mutation was done by standard methods. The IVS 1/5 mutation was the commonest mutation seen and it was seen in 26 (38.23%) of the cases. This was followed by the IVS 1/1, codon 41/42, codon 8/9, del 22 mutation, codon 15 mutation and the -619 bp deletion. No mutation was seen in eight cases. There was a 100% concordance between the sickle cell trait as diagnosed by HPLC and genetic testing. Our study underlies the importance of molecular testing in all cases of hemoglobinopathies. Although HPLC is a useful screening tool, molecular testing is very useful in accurately diagnosing the mutations. Molecular testing is especially applicable in cases with an abnormal hemoglobin (HbD, HbE and HbS) because there may be a concomitant inheritance of a beta thalassemia mutation. Molecular testing is the gold standard when it comes to the diagnosis of hemoglobinopathies.

International VLBI Service for Geodesy and Astrometry 2012 Annual Report

NASA Technical Reports Server (NTRS)

Baver, Karen D.; Behrend, Dirk; Armstrong, Kyla L.

2013-01-01

This volume of reports is the 2012 Annual Report of the International VLBI Service for Geodesy and Astrometry (IVS). The individual reports were contributed by VLBI groups in the international geodetic and astrometric community who constitute the permanent components of IVS. The IVS 2012 Annual Report documents the work of the IVS components for the calendar year 2012, our fourteenth year of existence. The reports describe changes, activities, and progress ofthe IVS. Many thanks to all IVS components who contributed to this Annual Report. With the exception of the first section and parts of the last section (described below), the contents of this Annual Report also appear on the IVS Web site athttp:ivscc.gsfc.nasa.gov/publications/ar2012

Education as Power. Report of Americans for Indian Opportunity Title IV, Part A, Technical Assistance Conference (Albuquerque, New Mexico, October 4-6, 1977).

ERIC Educational Resources Information Center

Americans for Indian Opportunity, Inc., Albuquerque, NM.

Included in this report on the 1977 Title IV Part A Technical Assistance conference held in Albuquerque are: (1) a descriptive narrative of conference events; (2) a summary of the 120 evaluation responses; and (3) the resolutions adopted by conference participants as a specific vehicle to make their concerns known to the Office of Indian Education…

Flight Attendant Fatigue. Part IV. Analysis of Incident Reports

DTIC Science & Technology

2009-12-01

Flight Attendant Fatigue, Part IV: Analysis of Incident Reports Kali Holcomb Katrina Avers Lena Dobbins Joy Banks Lauren Blackwell Thomas Nesthus...Incident Reports 6. Performing Organization Code 7. Author(s) 8. Performing Organization Report No. Holcomb K, Avers K, Dobbins L, Banks J...observed by erC members of the flight attendant ASAP programs, a survey was developed. Surveys were distributed via e -Mail to 23 participants for

[Medical supports for the diagnosis of infectious diseases; the role and responsibilities of clinical pathologist and microbiology technologist. Acute purulent meningitis; the position of the technologists in microbiology laboratory].

PubMed

Misawa, Shigeki

2002-07-01

The features and limitations of microbiology processes for the diagnosis of bacterial meningitis were summarized. Requests for physicians were also emphasized. The microbiology laboratory should be responsible for providing highly reliable and concordant data with a variety of clinical settings. Technologists in a microbiology laboratory should perform following subjects: i) Direct smear examination: Presumptive identification by the observers with abundant experience and sufficient training. ii) Rapid bacterial antigen detection tests: Active utilize alone in combination with the direct microscopy. iii) Culture: Cost effective utilize for appropriate media and culture condition based on the bacteriological statistics. Report with bacteriological interpretations and with additional proper comments, if necessary. iv) Antimicrobial susceptibility tests: Determination of penicillin resistance among the strains of penicillin-resistant or-intermediate Streptococcus pneumoniae (PI or PRSP) should be confirmed by MIC procedures; Detection of beta-lactamase producing Haemophilus influenzae (BLP) could detect by beta-lactamase tests, but not clearly identify for beta-lactamase-negative ampicillin-resistant isolates (BLNAR). In addition, a laboratory should provide appropriate information by using the accumulated routine clinical microbiology data, which may help to physicians in selecting an empiric therapy and to the microbiology technologists in processing the routine microbiology. In recent status, the most common organisms isolated from patients with bacterial meningitis continue to be S. pneumoniae and H. influenzae. Among S. pneumoniae strains, penicillin-intermediate(PISP) and--resistant(PRSP) strains had exceeded 50%, and the strains of beta-lactamase producing H. influenzae (BLP) had decreased with less than 10% and beta-lactamase negative ampicillin-resistant strains (BLNAR) have increasing. To providing rapid and accurate results, a laboratory should require the clinical information, including patient's age, major presenting symptoms, and receive antimicrobials prior to specimen collection.

17 CFR Table IV to Subpart E of... - Civil Monetary Penalty Inflation Adjustments

Code of Federal Regulations, 2010 CFR

2010-04-01

... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Civil Monetary Penalty Inflation Adjustments IV Table IV to Subpart E of Part 201 Commodity and Securities Exchanges SECURITIES AND... Securities and Exchange Commission: 15 U.S.C. 77t(d) For natural person 2001 $6,500 $7,500 For any other...

A novel nonsteroidal antifibrotic oligo decoy containing the TGF-beta element found in the COL1A1 gene which regulates murine schistosomiasis liver fibrosis.

PubMed

Boros, D L; Singh, K P; Gerard, H C; Hudson, A P; White, S L; Cutroneo, K R

2005-08-01

Schistosomiasis mansoni disseminated worm eggs in mice and humans induce granulomatous inflammations and cumulative fibrosis causing morbidity and possibly mortality. In this study, intrahepatic and I.V. injections of a double-stranded oligodeoxynucleotide decoy containing the TGF-beta regulatory element found in the distal promoter of the COL1A1 gene into worm-infected mice suppressed TGF-beta1, COL1A1, tissue inhibitor of metalloproteinase-1, and decreased COL3A1 mRNAs to a lesser extent. Sequence comparisons within the mouse genome found homologous sequences within the COL3A1, TGF-beta1, and TIMP-1 5' flanking regions. Cold competition gel mobility shift assays using these homologous sequences with 5' and 3' flanking regions found in the natural COL1A1 gene showed competition. Competitive gel mobility assays in a separate experiment showed no competition using a 5-base mutated or scrambled sequence. Explanted liver granulomas from saline-injected mice incorporated 10.45 +/- 1.7% (3)H-proline into newly synthesized collagen, whereas decoy-treated mice showed no collagen synthesis. Compared with the saline control schistosomiasis mice phosphorothioate double-stranded oligodeoxynucleotide treatment decreased total liver collagen content (i.e. hydroxy-4-proline) by 34%. This novel molecular approach has the potential to be employed as a novel antifibrotic treatment modality. (c) 2005 Wiley-Liss, Inc.

Phenotypic Characterization of Multidrug-resistant Escherichia Coli with Special Reference to Extended-spectrum-beta-lactamases and Metallo-beta-lactamases in a Tertiary Care Center.

PubMed

Shrestha, B; Shrestha, S; Mishra, S K; Kattel, H P; Tada, T; Ohara, H; Kirikae, T; Rijal, B P; Sherchand, J B; Pokhrel, B M

2015-01-01

The increasing reports on extended-spectrum-beta-lactamase and metallo-beta-lactamase producing Escherichia coli have addressed a potential threat to global health since it is found to be highly resistance to most of the currently available antibiotics including carbapenems. The present study was aimed to determine the antibiogram of extended-spectrum-beta-lactamase and metallo-beta-lactamase producing MDR E. coli isolates from various clinical samples. This was a cross-sectional study conducted over a period of seven months from December 2013 to July 2014 at bacteriology laboratory of Tribhuvan University Teaching Hospital. A total of 250 clinical specimens (urine, pus, sputum, blood, body fluid, bile, tissue and central venous pressure line tip) were processed from inpatients, with multidrug-resistant Escherichia coli infections. Standard microbiological techniques were used for isolation and identification of the isolates. The presence of extended-spectrum-beta-lactamase was detected by phenotypic confirmatory test recommended by Clinical and Laboratory Standards Institute and imipenem (IMP) /EDTA combined disc method was performed to detect metallo-beta-lactamase mediated resistance mechanism. We found high level of beta lactamase mediated resistance mechanism as part of multidrug resistance. Among 250 MDR isolates, 60% isolates were extended-spectrum-beta-lactamase producers and 17.2% isolates were metallo-beta-lactamase producers. Co-existence of extended-spectrum-beta-lactamase and metallo-beta-lactamase identified in 6.8% isolates. Beta-lactamase mediated resistance mechanisms are accounting very high in the multidrug resistant isolates of E. coli. Therefore, early detection of beta lactamase mediated resistant strains and their current antibiotic susceptibility pattern is necessary to avoid treatment failure and prevent the spread of MDR.

Nonsalt-losing congenital adrenal hyperplasia due to 3 beta-hydroxysteroid dehydrogenase deficiency with normal glomerulosa function.

PubMed

Pang, S; Levine, L S; Stoner, E; Opitz, J M; Pollack, M S; Dupont, B; New, M I

1983-04-01

In studies of a 6-yr-old boy and his non-HLA identical 8-yr-old sister, we demonstrated 3 beta-hydroxysteroid dehydrogenase (3 beta-HSD) deficiency in the biosynthetic pathways of glucocorticoids and androgens, but not mineralocorticoids. The sister did not manifest abnormal genital development at birth, but developed premature adrenarche at the age of 4 yr, with clitoromegaly and advanced bone age. The brother had perineal hypospadias at birth and developed premature adrenarche at the age of 6 yr. In both siblings, baseline and ACTH-stimulated delta 5 steroids were markedly elevated. The baseline and ACTH-stimulated ratios of delta 5 to delta 4 steroids remained extremely high, and all steroids promptly suppressed with dexamethasone (DEX). Normal baseline PRA and serum and urinary aldosterone (Aldo) levels increased after stimulation with a low Na+ diet. Renal Na+ conservation was normal after dietary Na+ deprivation with and without DEX administration. The PRA to pH 1 Aldo ratio remained normal with normal and low Na+ diets, regardless of DEX administration, indicating normal glomerulosa function with renin stimulation. In both siblings, ACTH increased PRA and Aldo levels, maintaining the PRA to pH 1 Aldo ratio unchanged from the baseline value. In contrast, in control children, PRA was suppressed, while Aldo increased, resulting in a fall of the PRA to pH 1 Aldo ratio. The increase in PRA with exogenous ACTH in these siblings suggests there may be an ACTH-stimulable mineralocorticoid antagonist. During prolonged DEX administration, hCG administration caused a slight increase in 17-hydroxypregnenolone and dehydroepiandrosterone in both the siblings, while testosterone (T) rose poorly in the brother, and estradiol did not rise at all in the sister. These results suggest the possibility of a deficiency of 3 beta-HSD in the gonads as well as the adrenals. After [3H]dehydroepiandrosterone iv infusion, there was normal conversion to [3H]-conjugated testosterone glucuronide, suggesting the presence of normal peripheral 3 beta-HSD activity. We propose that in these siblings, there is a deficiency of 3 beta-HSD in the adrenal zona fasciculata and zona reticularis, whereas 3 beta-HSD activity is intact in the zona glomerulosa. In addition, in these siblings, 3 beta-HSD deficiency was present in the gonads, while peripheral 3 beta-HSD activity appeared to be intact. These cases demonstrate further the heterogeneity of congenital adrenal hyperplasia due to 3 beta-HSD deficiency.

The insulin and islet amyloid polypeptide genes contain similar cell-specific promoter elements that bind identical beta-cell nuclear complexes.

PubMed Central

German, M S; Moss, L G; Wang, J; Rutter, W J

1992-01-01

The pancreatic beta cell makes several unique gene products, including insulin, islet amyloid polypeptide (IAPP), and beta-cell-specific glucokinase (beta GK). The functions of isolated portions of the insulin, IAPP, and beta GK promoters were studied by using transient expression and DNA binding assays. A short portion (-247 to -197 bp) of the rat insulin I gene, the FF minienhancer, contains three interacting transcriptional regulatory elements. The FF minienhancer binds at least two nuclear complexes with limited tissue distribution. Sequences similar to that of the FF minienhancer are present in the 5' flanking DNA of the human IAPP and rat beta GK genes and also the rat insulin II and mouse insulin I and II genes. Similar minienhancer constructs from the insulin and IAPP genes function as cell-specific transcriptional regulatory elements and compete for binding of the same nuclear factors, while the beta GK construct competes for protein binding but functions poorly as a minienhancer. These observations suggest that the patterns of expression of the beta-cell-specific genes result in part from sharing the same transcriptional regulators. Images PMID:1549125

Agglutination of like-charged red blood cells induced by binding of beta2-glycoprotein I to outer cell surface.

PubMed

Lokar, Marusa; Urbanija, Jasna; Frank, Mojca; Hägerstrand, Henry; Rozman, Blaz; Bobrowska-Hägerstrand, Malgorzata; Iglic, Ales; Kralj-Iglic, Veronika

2008-08-01

Plasma protein-mediated attractive interaction between membranes of red blood cells (RBCs) and phospholipid vesicles was studied. It is shown that beta(2)-glycoprotein I (beta(2)-GPI) may induce RBC discocyte-echinocyte-spherocyte shape transformation and subsequent agglutination of RBCs. Based on the observed beta(2)-GPI-induced RBC cell shape transformation it is proposed that the hydrophobic portion of beta(2)-GPI molecule protrudes into the outer lipid layer of the RBC membrane and increases the area of this layer. It is also suggested that the observed agglutination of RBCs is at least partially driven by an attractive force which is of electrostatic origin and depends on the specific molecular shape and internal charge distribution of membrane-bound beta(2)-GPI molecules. The suggested beta(2)-GPI-induced attractive electrostatic interaction between like-charged RBC membrane surfaces is qualitatively explained by using a simple mathematical model within the functional density theory of the electric double layer, where the electrostatic attraction between the positively charged part of the first domains of bound beta(2)-GPI molecules and negatively charged glycocalyx of the adjacent RBC membrane is taken into account.

Islets of Langerhans in the parakeet, Psittacula krameri.

PubMed

Gupta, Y K; Kumar, S

1980-01-01

The pancreatic gland of Psittacula krameri is divisible into 4 lobes i.e. dorsal, ventral, third and splenic. The endocrine part is composed of alpha 1-, alpha 2- and beta-cells. The islets are of 4 kinds viz., alpha islets (having alpha 1- and alpha 2-cells), beta islets (having beta- and alpha 1-cells), pure beta islets (consisting of beta-cells exclusively) and mixed islets (with beta-, alpha 1- and alpha 2-cells). The distribution of alpha islets is mostly restricted to the splenic and third lobes whereas the beta islets are found in all 4 lobes. Though the alpha islets are only few in the dorsal lobe, their size is best developed in the third and dorsal lobes. Sometimes beta and alpha islets are present in very close proximity but their cells never mingle. An interesting feature was the complete absence of alpha islets from the ventral lobe.A relative abundance of alpha 2- cells in this bird seems to be associated with its comparatively higher blood glucose level and frugivorous habit. Tinctorial reactions suggest that the insulin content of the endocrine pancreas is low. There were no seasonal changes in the islet tissue of P. krameri.

[Quantitive study of interleukin 1beta in periapical exudates of chronic periapical periodontitis in the course of root canal therapy].

PubMed

Yan, Pei-fang; Liang, Jing-ping; Chen, Wei-min; Gu, Shen-sheng

2007-06-01

To evaluate the relationship between IL-1beta and clinical findings of chronic apical periodontitis and to explore the function of IL-1beta during the endodontic interappointment flare-ups. Periapical exudates samples were obtained from 19 teeth suffering from endodontic flare-ups after root canal preparation and 20 teeth without any symptoms and signs at the second visit after root canal preparation. The levels of IL-1beta were determined by ELISA and the data was analyzed by SAS6.12 software package. Significantly higher levels of IL-1beta were found in periapical exudates from teeth suffering from endodontic flare-ups than that before canal preparation(P<0.001). The mean IL-1beta levels significantly decreased following the endodontic therapy if there were no symptom at the second visit (P<0.001). The level of IL-1beta in the exudates of root canals were related with the exist of infection which might take an active part in the occurrence of endodontic interappointment flare-up.

MEN15596, a novel nonpeptide tachykinin NK2 receptor antagonist.

PubMed

Cialdai, Cecilia; Tramontana, Manuela; Patacchini, Riccardo; Lecci, Alessandro; Catalani, Claudio; Catalioto, Rose-Marie; Meini, Stefania; Valenti, Claudio; Altamura, Maria; Giuliani, Sandro; Maggi, Carlo Alberto

2006-11-07

The pharmacological profile of MEN15596 or (6-methyl-benzo[b]thiophene-2-carboxylic acid [1-(2-phenyl-1R-{[1-(tetrahydropyran-4-ylmethyl)-piperidin-4-ylmethyl]-carbamoyl}-ethylcarbamoyl)-cyclopentyl]-amide), a novel potent and selective tachykinin NK2 receptor antagonist endowed with oral activity, is described. At the human recombinant tachykinin NK2 receptor, MEN15596 showed subnanomolar affinity (pKi 10.1) and potently antagonized (pKB 9.1) the neurokinin A-induced intracellular calcium release. MEN15596 selectivity for the tachykinin NK2 receptor was assessed by binding studies at the recombinant tachykinin NK1 (pKi 6.1) and NK3 (pKi 6.4) receptors, and at a number of 34 molecular targets including receptors, transporters and ion channels. In isolated smooth muscle preparations MEN15596 showed a marked species selectivity at the tachykinin NK2 receptor with the highest antagonist potency in guinea-pig colon, human and pig bladder (pKB 9.3, 9.2 and 8.8, respectively) whereas it was three orders of magnitude less potent in the rat and mouse urinary bladder (pKB 6.3 and 5.8, respectively). In agreement with binding experiments, MEN15596 showed low potency in blocking selective NK1 or NK3 receptor agonist-induced contractions of guinea-pig ileum preparations (pA2

Emission lines in the long period Cepheid l Carinae

NASA Technical Reports Server (NTRS)

Boehm-Vitense, Erika; Love, Stanley G.

1991-01-01

For the Cepheid (l) Carinae with a pulsation period of 35.5 days we have studied the emission line fluxes as a function of pulsational phase in order to find out whether we see chromosphere and transition layer emission or whether we see emission due to an outward moving shock. All emission lines show a steep increase in flux shortly before maximum light suggestive of a shock moving through the surface layers. The large ratio of the C IV to C II line fluxes shows that these are not transition layer lines. During maximum light the large ratio of the C IV to C II line fluxes also suggests that we see emission from a shock with velocities greater than 100 km/sec such that C IV emission can be excited. With such velocities mass outflow appears possible. The variations seen in the Mg II line profiles show that there is an internal absorption over a broad velocity band independent of the pulsational phase. We attribute this absorption to a circumstellar 'shell'. This 'shell' appears to be seen also as spatially extended emission in the O I line at 1300 angstrom, which is probably excited by resonance with Ly beta.

Temsirolimus and Bevacizumab in Treating Patients With Advanced Endometrial, Ovarian, Liver, Carcinoid, or Islet Cell Cancer

ClinicalTrials.gov

2017-07-10

Adult Hepatocellular Carcinoma; Advanced Adult Hepatocellular Carcinoma; Endometrial Serous Adenocarcinoma; Localized Non-Resectable Adult Liver Carcinoma; Lung Carcinoid Tumor; Malignant Pancreatic Gastrinoma; Malignant Pancreatic Glucagonoma; Malignant Pancreatic Insulinoma; Malignant Pancreatic Somatostatinoma; Metastatic Digestive System Neuroendocrine Tumor G1; Ovarian Carcinosarcoma; Ovarian Endometrioid Adenocarcinoma; Ovarian Seromucinous Carcinoma; Ovarian Serous Surface Papillary Adenocarcinoma; Pancreatic Alpha Cell Adenoma; Pancreatic Beta Cell Adenoma; Pancreatic Delta Cell Adenoma; Pancreatic G-Cell Adenoma; Pancreatic Polypeptide Tumor; Recurrent Adult Liver Carcinoma; Recurrent Digestive System Neuroendocrine Tumor G1; Recurrent Fallopian Tube Carcinoma; Recurrent Ovarian Carcinoma; Recurrent Pancreatic Neuroendocrine Carcinoma; Recurrent Primary Peritoneal Carcinoma; Recurrent Uterine Corpus Carcinoma; Regional Digestive System Neuroendocrine Tumor G1; Stage IIIA Fallopian Tube Cancer; Stage IIIA Ovarian Cancer; Stage IIIA Primary Peritoneal Cancer; Stage IIIA Uterine Corpus Cancer; Stage IIIB Fallopian Tube Cancer; Stage IIIB Ovarian Cancer; Stage IIIB Primary Peritoneal Cancer; Stage IIIB Uterine Corpus Cancer; Stage IIIC Fallopian Tube Cancer; Stage IIIC Ovarian Cancer; Stage IIIC Primary Peritoneal Cancer; Stage IIIC Uterine Corpus Cancer; Stage IV Fallopian Tube Cancer; Stage IV Ovarian Cancer; Stage IV Primary Peritoneal Cancer; Stage IVA Uterine Corpus Cancer; Stage IVB Uterine Corpus Cancer; Uterine Carcinosarcoma

High Integrity Castings: Proceedings of the Conference on Advances in High Integrity Castings Held in Conjunction with the 1988 World Materials Congress, Chicago, Illinois, USA, 24-30 September 1988

DTIC Science & Technology

1988-01-01

above design requirements. The The first cast parts used in this higher strength standard chemistry parts application were of the Extra Low...present work was to study the use of beta THE HIGH COST OF TITANIUM alloys can limit their titanium alloys in the cast form. Beta or use to applications ...refractory as was is intended to achieve a pouring stream su- used with the nozzles for steel applications . perior to conventional nozzle designs , and this

Functional cloning of the proto-oncogene brain factor-1 (BF-1) as a Smad-binding antagonist of transforming growth factor-beta signaling.

PubMed

Rodriguez, C; Huang, L J; Son, J K; McKee, A; Xiao, Z; Lodish, H F

2001-08-10

Using the plasminogen activator inhibitor (PAI) promoter to drive the expression of a reporter gene (mouse CD2), we devised a system to clone negative regulators of the transforming growth factor-beta (TGF-beta) signaling pathway. We infected a TGF-beta-responsive cell line (MvLu1) with a retroviral cDNA library, selecting by fluorescence-activated cell sorter single cells displaying low PAI promoter activity in response to TGF-beta. Using this strategy we cloned the proto-oncogene brain factor-1 (BF-1). BF-1 represses the PAI promoter in part by associating with both unphosphorylated Smad3 (in the cytoplasm) and phosphorylated Smad3 (in the nucleus), thus preventing its binding to DNA. BF-1 also associates with Smad1, -2, and -4; the Smad MH2 domain binds to BF-1, and the C-terminal segment of BF-1 is uniquely and solely required for binding to Smads. Further, BF-1 represses another TGF-beta-induced promoter (p15), it up-regulates a TGF-beta-repressed promoter (Cyclin A), and it reverses the growth arrest caused by TGF-beta. Our results suggest that BF-1 is a general inhibitor of TGF-beta signaling and as such may play a key role during brain development.

Radiation Monitor,IV-TEPC

NASA Image and Video Library

2012-12-30

View of radiation monitor,Intra-Vehicular Tissue Equivalent Proportional Counter (IV-TEPC),relocated to NOD2 P3,Part Number (P/N): SEG33120960-301,Serial Number (S/N): 1002,in the Node 2. Photo was taken during Expedition 34.

Considerations of Alloy 617 Application in the Gen IV Nuclear Reactor Systems - Part I: Mechanical Property Challenges

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Weiju

2010-01-01

Alloy 617 is currently considered as a leading candidate material for high temperature components in the Gen IV Nuclear Reactor Systems. Because of the unprecedented severe working conditions beyond its commercial service experience required by the Gen IV systems, the alloy faces various challenges in both mechanical and metallurgical properties. This paper, as Part I of the discussion, is focused on the challenges and issues in the mechanical properties of Alloy 617 for the intended nuclear application. Considerations are given in details in its mechanical property data scatter, low creep strength in the desired high temperature range, lack of longtermmore » creep curves, high loading rate dependency, and preponderant tertiary creep. Some research and development activities are suggested with discussions on their viability to satisfy the Gen IV Nuclear Reactor System needs in near future and in the long run.« less

Studies of insulin secretory responses and of arachidonic acid incorporation into phospholipids of stably transfected insulinoma cells that overexpress group VIA phospholipase A2 (iPLA2beta ) indicate a signaling rather than a housekeeping role for iPLA2beta.

PubMed

Ma, Z; Ramanadham, S; Wohltmann, M; Bohrer, A; Hsu, F F; Turk, J

2001-04-20

A cytosolic 84-kDa group VIA phospholipase A(2) (iPLA(2)beta) that does not require Ca(2+) for catalysis has been cloned from several sources, including rat and human pancreatic islet beta-cells and murine P388D1 cells. Many potential iPLA(2)beta functions have been proposed, including a signaling role in beta-cell insulin secretion and a role in generating lysophosphatidylcholine acceptors for arachidonic acid incorporation into P388D1 cell phosphatidylcholine (PC). Proposals for iPLA(2)beta function rest in part on effects of inhibiting iPLA(2)beta activity with a bromoenol lactone (BEL) suicide substrate, but BEL also inhibits phosphatidate phosphohydrolase-1 and a group VIB phospholipase A(2). Manipulation of iPLA(2)beta expression by molecular biologic means is an alternative approach to study iPLA(2)beta functions, and we have used a retroviral construct containing iPLA(2)beta cDNA to prepare two INS-1 insulinoma cell clonal lines that stably overexpress iPLA(2)beta. Compared with parental INS-1 cells or cells transfected with empty vector, both iPLA(2)beta-overexpressing lines exhibit amplified insulin secretory responses to glucose and cAMP-elevating agents, and BEL substantially attenuates stimulated secretion. Electrospray ionization mass spectrometric analyses of arachidonic acid incorporation into INS-1 cell PC indicate that neither overexpression nor inhibition of iPLA(2)beta affects the rate or extent of this process in INS-1 cells. Immunocytofluorescence studies with antibodies directed against iPLA(2)beta indicate that cAMP-elevating agents increase perinuclear fluorescence in INS-1 cells, suggesting that iPLA(2)beta associates with nuclei. These studies are more consistent with a signaling than with a housekeeping role for iPLA(2)beta in insulin-secreting beta-cells.

Canine serum protein patterns using high-resolution electrophoresis (HRE).

PubMed

Abate, O; Zanatta, R; Malisano, T; Dotta, U

2000-03-01

Serum protein values were determined in 26 healthy dogs using agarose gel electrophoresis (SPE), splitting the electrophoretic separation into six regions: albumin, alpha(1), alpha(2), beta(1), beta(2)and gamma globulins. High-resolution electrophoresis (HRE) was used to separate single proteins. Serum proteins from dogs (26 healthy and 20 affected by various diseases) were then characterized by electrophoretic immunofixation (IFE) and Sudan black staining on HRE film. Haemoglobin and normal canine plasma and serum were used to identify haptoglobin and fibrinogen, respectively. In the standard pattern, determined by HRE, the following proteins were identified: albumin, alpha(1)-lipoprotein (alpha(1)-region), haptoglobin and alpha(2)-macroglobulin (alpha(2)-region), beta -lipoprotein and C3 (beta(1)-region), transferrin and IgM (beta(2)-region), IgG (mostly in gamma -region and partly in beta(2)-region). The HRE pattern shown by healthy dogs could be compared with those of dogs affected by various diseases to obtain clinical information. Copyright 2000 Harcourt Publishers Ltd.

The Mediterranean Crucible, 1942-1943: Did Technology or Tenets Achieve Air Superiority

DTIC Science & Technology

2012-06-01

messages of critical Luftwaffe communications. The decryption, analysis, and dissemination of messages from the German Enigma coding machine, facilitated...the ability to “read the Luftwaffe [Enigma] keys in North Africa from the first day of their introduction” in the theater.5 This system, code ...IRIS no. 118168, in USAF Collection, AFHRA, Part IV, 1. 21 AWPD-42, Part IV, 1. superiority which enables its possessor to conduct air

Education as Experimentation: A Planned Variation Model. Volume IV-B: Effects of Follow Through Models. Volume IV-C: Appendices, Part I and Part II.

ERIC Educational Resources Information Center

Bock, Geoffrey; And Others

This segment of the national evaluation study of the Follow Through Planned Variation Model describes each of the 17 models represented in the study and reports the results of analyses of 4 years of student performance data for each model. First a purely descriptive synthesis of findings is presented for each model, with interpretation of the data…

Activities and sources of beta-lactamase in sputum from patients with bronchiectasis.

PubMed Central

Dragicevic, P; Hill, S L; Burnett, D; Merrikin, D; Stockley, R A

1989-01-01

beta-Lactamase activity was measured in secretions from patients with bronchiectasis. Of 28 sputum samples, 23 contained measurable amounts of activity; values were significantly higher (P less than 0.01) in purulent samples than in mucoid or mucopurulent samples. beta-Lactamase activity was usually present in saliva collected before and between sputum expectorations, although values for sputum were higher than for either group of saliva samples (P less than 0.025 and P less than 0.005, respectively). This difference suggests that at least part of sputum beta-lactamase activity originates in the bronchial tree. Detailed microbiological study of a further eight specimens (seven were beta-lactamase positive) led to the isolation of Haemophilus influenzae from six, although only two of these isolates were beta-lactamase positive. Several other beta-lactamase-producing organisms were also isolated, including Staphylococcus aureus (n = 3), Escherichia coli (n = 1), Proteus spp. (n = 1), and Bacteroides spp. (n = 3). Size-exclusion high-performance liquid chromatography of the sputum showed several peaks of beta-lactamase activity which usually coeluted in fractions similar to those of their beta-lactamase-positive isolates. Therefore, sources of sputum beta-lactamases are often bacteria not considered truly pathogenic or not isolated during routine bacteriological assessment. These observations should be considered when embarking on antimicrobial therapy in bronchiectatic patients and suggest that increased dosages of penicillins are indicated. PMID:2663911

[Chemical constituents of Cocculus orbiculatus var. mollis root].

PubMed

Liao, Jing; Lei, Yu; Wang, Jian-Zhong

2014-02-01

To study the chemical constituents in the root of Cocculus orbiculatus var. mollis. The compounds were isolated by silica gel chromatography, their structures were established by spectroscopic methods. Eleven compounds were isolated and identified as wattisine A (I), O-methylcocsoline (II), (+) cocsoline (III), (+) cocsuline (IV), magnoflorine (V), sino-coculine (VI), isosinococuline (VII), (-) coclaurine (VIII), daucosterol (IX), beta-sitosterol (X) and 1-oleioyl-3-(9Z, 12Z-arachoyl) glycerol (XI). Compound I is isolated from this genus for the first time,and compound II - XI are isolated from this plant for the first time.

[Study on the chemical constituents of the fruit handles from Schizandra chinensis].

PubMed

Shi, Lin; He, Xiao-Xia; Pan, Ying; Han, Ling; Yang, Xiao-Ou; Zhao, Yu-Qing

2009-07-01

To study the chemical constituents of the fruit handles from Schizandra chinensis. Compounds from the 85% ethanol extracts were isolated by silica gel, Sephadex LH-20, recrystal, etc., and their structures were identified by the spectral analysis and chemical evidence. Eight compounds were isolated and identified as wuweizisu C (I), ganwuweizic acid(II), beta-sitosterol(III), gomisin A(IV), schizandrin(V), daucosterol(VI), wuweizisu A(VII), gamma-schizandrin (VIII). Compounds I - VIII are isolated from the fruit handles of Schizandra chinensis for the first time.

[Studies on the chemical constituents from Cissus pteroclada].

PubMed

Chi, Cui-Yun; Wang, Feng; Lei, Ting; Xu, Shao-Yu; Hong, Ai-Hua; Cen, Ying-Zhou

2010-10-01

To study the chemical constituents of Yao Medicine Cissus pteroclada. The compounds were isolated and purified by column chromatography with silica gel, TLC and recrystallization. Their structures were elucidated on the basis of physicochemical properties and spectra analysis. Six compounds were isolated and identified as beta-sitosterol (I), bergenin (II), 11-O-galloylbergenin (III), 11-O-(4-hydroxy benzoyl) bergenin (IV), gallic acid (V), daucosterol (VI). Compounds III and NIV are obtained from the genus for the first time. All the compounds are isolated from this plant for the first time except the compound II.

Identification of Novel Human Dipeptidyl Peptidase-IV Inhibitors of Natural Origin (Part II): In Silico Prediction in Antidiabetic Extracts

PubMed Central

Guasch, Laura; Sala, Esther; Ojeda, María José; Valls, Cristina; Bladé, Cinta; Mulero, Miquel; Blay, Mayte; Ardévol, Anna; Garcia-Vallvé, Santiago; Pujadas, Gerard

2012-01-01

Background Natural extracts play an important role in traditional medicines for the treatment of diabetes mellitus and are also an essential resource for new drug discovery. Dipeptidyl peptidase IV (DPP-IV) inhibitors are potential candidates for the treatment of type 2 diabetes mellitus, and the effectiveness of certain antidiabetic extracts of natural origin could be, at least partially, explained by the inhibition of DPP-IV. Methodology/Principal Findings Using an initial set of 29,779 natural products that are annotated with their natural source and an experimentally validated virtual screening procedure previously developed in our lab (Guasch et al.; 2012) [1], we have predicted 12 potential DPP-IV inhibitors from 12 different plant extracts that are known to have antidiabetic activity. Seven of these molecules are identical or similar to molecules with described antidiabetic activity (although their role as DPP-IV inhibitors has not been suggested as an explanation for their bioactivity). Therefore, it is plausible that these 12 molecules could be responsible, at least in part, for the antidiabetic activity of these extracts through their inhibitory effect on DPP-IV. In addition, we also identified as potential DPP-IV inhibitors 6 molecules from 6 different plants with no described antidiabetic activity but that share the same genus as plants with known antidiabetic properties. Moreover, none of the 18 molecules that we predicted as DPP-IV inhibitors exhibits chemical similarity with a group of 2,342 known DPP-IV inhibitors. Conclusions/Significance Our study identified 18 potential DPP-IV inhibitors in 18 different plant extracts (12 of these plants have known antidiabetic properties, whereas, for the remaining 6, antidiabetic activity has been reported for other plant species from the same genus). Moreover, none of the 18 molecules exhibits chemical similarity with a large group of known DPP-IV inhibitors. PMID:23028712

Two Photon Absorption in a Novel Nano-optical Material Based on the Nonconjugated Conductive Polymer, Poly(beta-pinene)

NASA Astrophysics Data System (ADS)

Titus, Jitto; Thakur, Mrinal

2006-03-01

As recently reported, the electrical conductivity of the nonconjugated polymer, poly(beta-pinene) increases by more than ten orders of magnitude upon doping with iodine [1]. The FTIR, optical absorption and EPR measurements have shown that radical cations are formed upon doping and charge-transfer involving the isolated double-bond in poly(beta-pinene). In this report, exceptionally large two-photon absorption in iodine-doped poly(beta-pinene) will be discussed. The linear absorption spectrum of medium-doped poly(beta-pinene) have peaks at about 4 eV and 3.1 eV. The first peak is due to the radical cation and the second due to the charge-transfer between the double bond and the dopant. The two-photon absorption of the medium-doped polymer has been measured at 730-860 nm using open-aperture z-scan with 150 femtosecond pulses from a Ti:Sapphire laser. A two-photon peak at about 1.5 eV with a magnitude of more than 1 cm/MW has been observed. The large magnitude of the two-photon absorption coefficient which is proportional to the imaginary part of the third order susceptibility has been attributed to the special structure of the radical cation and the confinement within a sub-nanometer dimension. [1] Vippa, Rajagopalan and Thakur, J. Poly. Sci. Part B: Poly. Phys., 43, 3695 (2005).

Correlation between cortical beta power and gait speed is suppressed in a parkinsonian model, but restored by therapeutic deep brain stimulation.

PubMed

Polar, Christian A; Gupta, Rahul; Lehmkuhle, Mark J; Dorval, Alan D

2018-05-30

The motor cortex and subthalamic nucleus (STN) of patients with Parkinson's disease (PD) exhibit abnormally high levels of electrophysiological oscillations in the ~12-35 Hz beta-frequency range. Recent studies have shown that beta is partly carried forward to regulate future motor states in the healthy condition, suggesting that steady state beta power is lower when a sequence of movements occurs in a short period of time, such as during fast gait. However, whether this relationship between beta power and motor states persists upon parkinsonian onset or in response to effective therapy is unclear. Using a 6-hydroxy dopamine (6-OHDA) rat model of PD and a custom-built behavioral and neurophysiological recording system, we aimed to elucidate a better understanding of the mechanisms underlying cortical beta power and PD symptoms. In addition to elevated levels of beta oscillations, we show that parkinsonian onset was accompanied by a decoupling of movement intensity - quantified as gait speed - from cortical beta power. Although subthalamic deep brain stimulation (DBS) reduced general levels of beta oscillations in the cortex of all PD animals, the brain's capacity to regulate steady state levels of beta power as a function of movement intensity was only restored in animals with therapeutic DBS. We propose that, in addition to lowering general levels of cortical beta power, restoring the brain's ability to maintain this inverse relationship is critical for effective symptom suppression. Copyright © 2017. Published by Elsevier Inc.

OGLE-IV Transient Search report 31 December 2016, part 1

NASA Astrophysics Data System (ADS)

Wyrzykowski, L.; Hamanowicz, A.; Kostrzewa-Rutkowska, Z.; Klencki, J.; Sitek, M.; Udalski, A.; Kozlowski, S.; Ulaczyk, K.; Soszynski, I.; Mroz, P.; Szymanski, M. K.; Poleski, R.; Pietrukowicz, P.; Pawlak, M.; Skowron, J.

2016-12-01

The OGLE-IV Transient Detection System (Wyrzykowski et al. 2014, AcA,64,197; Kozlowski et al. 2013; Klencki et al. 2016, AcA, 66,15) announces discovery of 52 transients discovered in last three months.

OGLE-IV Transient Search report 31 December 2016, part 2

NASA Astrophysics Data System (ADS)

Wyrzykowski, L.; Hamanowicz, A.; Kostrzewa-Rutkowska, Z.; Klencki, J.; Sitek, M.; Udalski, A.; Kozlowski, S.; Ulaczyk, K.; Soszynski, I.; Mroz, P.; Szymanski, M. K.; Poleski, R.; Pietrukowicz, P.; Pawlak, M.; Skowron, J.

2016-12-01

The OGLE-IV Transient Detection System (Wyrzykowski et al. 2014, AcA,64,197; Kozlowski et al. 2013; Klencki et al. 2016, AcA, 66,15) announces discovery of 46 transients discovered in last three months.

Teaching Elementary Particle Physics, Part II

NASA Astrophysics Data System (ADS)

Hobson, Art

2011-03-01

In order to explain certain features of radioactive beta decay, Wolfgang Pauli suggested in 1930 that the nucleus emitted, in addition to a beta particle, another particle of an entirely new type. The hypothesized particle, dubbed the neutrino, would not be discovered experimentally for another 25 years. It's not easy to detect neutrinos, because they respond to neither the EM force nor the strong force. For example, the mean free path (average penetration distance before it interacts) of a typical beta-decay neutrino moving through solid lead is about 1.5 light years! Enrico Fermi argued that neutrinos indicated a new force was at work. During the 1930s, he quickly adapted ideas from the developing new theory of QED to this new force, dubbed the weak force. Fermi's theory was able to predict the half-lives of beta-emitting nuclei and the range of energies of the emitted beta particles.

Cytotoxicity of cardenolides and cardenolide glycosides from Asclepias curassavica.

PubMed

Li, Jun-Zhu; Qing, Chen; Chen, Chang-Xiang; Hao, Xiao-Jiang; Liu, Hai-Yang

2009-04-01

A new cardenolide, 12beta,14beta-dihydroxy-3beta,19-epoxy-3alpha-methoxy-5alpha-card-20(22)-enolide (6), and a new doubly linked cardenolide glycoside, 12beta-hydroxycalotropin (13), together with eleven known compounds, coroglaucigenin (1), 12beta-hydroxycoroglaucigenin (2), calotropagenin (3), desglucouzarin (4), 6'-O-feruloyl-desglucouzarin (5), calotropin (7), uscharidin (8), asclepin (9), 16alpha-hydroxyasclepin (10), 16alpha-acetoxycalotropin (11), and 16alpha-acetoxyasclepin (12), were isolated from the aerial part of ornamental milkweed, Asclepias curassavica and chemically elucidated through spectral analyses. All the isolates were evaluated for their cytotoxic activity against HepG2 and Raji cell lines. The results showed that asclepin (9) had the strongest cytotoxic activity with an IC(50) value of 0.02 microM against the two cancer cell lines and the new compound 13 had significant cytotoxic activity with IC(50) values of 0.69 and 1.46 microM, respectively.

Astrocytes express specific variants of CaM KII delta and gamma, but not alpha and beta, that determine their cellular localizations.

PubMed

Vallano, M L; Beaman-Hall, C M; Mathur, A; Chen, Q

2000-04-01

Multiple isoforms of type II Ca(2+)-calmodulin-dependent kinase (CaM KII) are composed of two major neuron-specific subunits, designated alpha and beta, and two less well-characterized subunits that are also expressed in non-neuronal tissues, designated delta and gamma. Regulated expression of these 4 gene products, and several variants produced by alternative splicing, shows temporal and regional specificity and influences intracellular targeting. We used immunoblotting and RT-PCR to analyze subunit and variant expression and distribution in cultured cerebellar astrocytes and neurons, and whole cerebellar cortex from rodent brain. The data indicate that: (i) astrocytes express a single splice variant of delta, namely delta(2); (ii) like neurons, astrocytes express two forms of CaM KII gamma; gamma(B) and gamma(A); (iii) these CaM KII variants are enriched in the supernate fraction in astrocytes, and the particulate fraction in neurons; (iv) unlike neurons, astrocytes do not express detectable levels of alpha or beta subunits or their respective splice variants. The results indicate that neurons and astrocytes express distinct CaM KII subunits and variants that localize to distinct subcellular compartments and, by inference, exert distinct cellular functions. Copyright 2000 Wiley-Liss, Inc.

Colloidal systems and interfaces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ross, S.; Morrison, E.D.

1988-01-01

This book is an excellent, four-part introductory text and sourcebook for those who want to acquire a quick background in , or brush up on, the physical properties and behavior of colloidal dispersions and interfaces. Part I covers properties of particles and techniques for determining particle size and surface area. Part II concentrates on the properties of interfaces, with brief subsections on insoluble monolayers, surface active solutes in aqueous and non-aqueous media, and the thermodynamics of adsorption at interfaces. Part III considers attractive and repulsive interactions, colloid stability (DLVO theory), and kinetics of coagulation. Part IV applies these concepts tomore » emulsions, foams, and suspensions. The sections on colloid rheology, interfacial tensions, Marangoni effects, and calculation of Hamaker constants are particularly good, as are Part IV and the numerous examples of practical applications used throughout the book to illustrate the concepts.« less

Structural model of the amyloid fibril formed by beta(2)-microglobulin #21-31 fragment based on vibrational spectroscopy.

PubMed

Hiramatsu, Hirotsugu; Goto, Yuji; Naiki, Hironobu; Kitagawa, Teizo

2005-06-08

A structural model of amyloid fibril formed by the #21-31 fragment of beta2-microglobulin is proposed from microscope IR measurements on specifically 13C-labeled peptide fibrils and Raman spectra of the dispersed fibril solution. The 13C-shifted amide frequency indicated the secondary structure of the labeled residues. The IR spectra have demonstrated that the region between F22 and V27 forms the core part with the extended beta-sheet structure. Raman spectra indicated the formation of a dimer with a disulfide bridge between C25 residues.

Spectral Irradiance Calibration in the Infrared. Part 4; 1.2 - 35 microns Spectra of Six Standard Stars

NASA Technical Reports Server (NTRS)

Cohen, Martin; Witteborn, Fred C.; Walker, Russell G.; Bregman, Jesse D.; Wooden, Diane H.

1995-01-01

We present five new absolutely calibrated continuous stellar spectra from 1.2 to 35 microns, constructed as far as possible from actual observed spectral fragments taken from the ground, the Kuiper Airborne Observatory (KAO), and the IRAS Low Resolution Spectrometer (LRS). These stars- beta Peg, alpha Boo, beta And, beta Gem, and alpha Hya-augment our already created complete absolutely calibrated spectrum for alpha Tau. All these spectra have a common calibration pedigree. The wavelength coverage is ideal for calibration of many existing and proposed ground-based, airborne, and satellite sensors.

Physocalycoside, a new phenylethanoid glycoside from Phlomis physocalyx Hub.-Mor.

PubMed

Ersöz, Tayfun; Alipieva, Kalina Iv; Yalçin, Funda Nuray; Akbay, Pinar; Handjieva, Nedjalka; Dönmez, Ali A; Popov, Simeon; Caliş, Ihsan

2003-01-01

A new phenylethanoid tetraglycoside, physocalycoside (2), was isolated from the aerial parts of Phlomis physocalyx. Its structure was identified as 3-hydroxy-4-methoxy-beta-phenylethoxy-O-[alpha-L-rhamnopyranosyl-(1-->2)-alpha-L-rhamnopyranosyl-(1-->3)]-4-O-feruloyl-[beta-D-glucopyranosyl-(1-->6)]-beta-D-glucopyranoside, on the basis of spectroscopic evidence. In addition, one known iridoid glucoside, lamiide (1) and five known phenylethanoid glycosides, wiedemannioside C (3), verbascoside (= acteoside) (4), leucosceptoside A (5), martynoside (6), and forsythoside B (7) were also characterized. Compounds 2-7 demonstrated radical scavenging properties towards the 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical.

Shunt resistance and saturation current determination in CdTe and CIGS solar cells. Part 1: a new theoretical procedure and comparison with other methodologies

NASA Astrophysics Data System (ADS)

Rangel-Kuoppa, Victor-Tapio; Albor-Aguilera, María-de-Lourdes; Hérnandez-Vásquez, César; Flores-Márquez, José-Manuel; González-Trujillo, Miguel-Ángel; Contreras-Puente, Gerardo-Silverio

2018-04-01

A new proposal for the extraction of the shunt resistance (R sh ) and saturation current (I sat ) of a current-voltage (I-V) measurement of a solar cell, within the one-diode model, is given. First, the Cheung method is extended to obtain the series resistance (R s ), the ideality factor (n) and an upper limit for I sat . In this article which is Part 1 of two parts, two procedures are proposed to obtain fitting values for R sh and I sat within some voltage range. These two procedures are used in two simulated I-V curves (one in darkness and the other one under illumination) to recover the known solar cell parameters R sh , R s , n, I sat and the light current I lig and test its accuracy. The method is compared with two different common parameter extraction methods. These three procedures are used and compared in Part 2 in the I-V curves of CdS-CdTe and CIGS-CdS solar cells.

Random variations in the ultraviolet spectrum of Beta Lyrae

NASA Technical Reports Server (NTRS)

Bless, R. C.; Eaton, J. A.; Meade, M. R.

1977-01-01

Spectrophotometric scans of Beta Lyrae over the wavelength range from 1100 to 3700 A are analyzed which were obtained at different times with different resolutions by the OAO 2 satellite and from the ground. A model atmosphere with normal H and He abundances, an electron temperature of 11,000 K, and log g of 3.0 is found to fit the visual region of the spectrum well but to be a poor representation in the Balmer continuum. It is shown that a large complex emission feature dominates the spectrum from about 1700 to 2200 A, that there is a very pronounced strengthening of the spectrum just shortward of the 1550-A C IV feature at phase 0.69, and that the overall level of the spectrum shortward of 1400 A is quite high in comparison with the broad emission feature. A model is discussed in which the light from a disk-shaped secondary is highly concentrated toward the polar regions.

Acid-base balance and cardiac index in SO2-bronchitic, papaine-emphysematous and paraquat-fibrotic rats after isoproterenol treatment.

PubMed

Vértes, K; Debreczeni, L A

1990-01-01

SO2-bronchitis, papaine-emphysema and paraquat fibrosis were induced in Wistar rats. Blood pressure, cardiac index, total peripheral resistance, arterial blood gas values, parameters of acid-base balance were determined. Effects of 0.1 and 0.3 microgram.-1.min-1 isoproterenol iv. infusion were examined. Morphologic alterations of the lungs were verified by histopathological examinations. All the parameters investigated were found to be normal in the control rats. The treated groups differed from the normal ones: an increased blood pressure was observed in emphysema and fibrosis. A decreased cardiac index was characteristic of chronic bronchitis, high cardiac index of emphysema, high TPR of bronchitis and arterial hypoxaemy of fibrosis. The groups reacted differently to beta adrenergic stimulation: in bronchitic and fibrotic rats the cardiac index was augmented, whereas in emphysematous ones the increase proved to be smaller. The effects of isoproterenol infusion can be related to the altered beta-receptor function in the various experimental pulmonary diseases.

Glucose intolerance in dairy goats with pregnancy toxemia: Lack of correlation between blood pH and beta hydroxybutyric acid values

PubMed Central

Lima, Miguel S.; Cota, João B.; Vaz, Yolanda M.; Ajuda, Inês G.; Pascoal, Rita A.; Carolino, Nuno; Hjerpe, Charles A.

2016-01-01

This study assessed the response to a glucose tolerance test in dairy goats with pregnancy toxemia (PT), in healthy, pregnant, non-lactating dairy goats in the last month of gestation (HP), and in healthy, lactating, non-pregnant, dairy goats in mid-lactation (HL). A 500 mL volume of a 5% glucose solution was administered by the IV route. Blood glucose concentrations returned to pre-infusion levels by 90 min in all 8 HL goats, and by 180 min in all 8 HP goats. In contrast, concentrations of blood glucose were still significantly above pre-infusion levels at 180 min post-infusion in all 8 PT goats. Thus, marked glucose intolerance was demonstrated in the PT goats, and mild intolerance was noted in the HP goats. In 25 goats diagnosed with PT and having blood beta hydroxybutyric acid (BHBA) values ≥ 2.9 mmol/L, the correlation coefficient for BHBA with blood pH was non-significant. PMID:27247464

Modulation of irinotecan-induced diarrhea by cotreatment with neomycin in cancer patients.

PubMed

Kehrer, D F; Sparreboom, A; Verweij, J; de Bruijn, P; Nierop, C A; van de Schraaf, J; Ruijgrok, E J; de Jonge, M J

2001-05-01

This study was designed to evaluate irinotecan (CPT-11) disposition and pharmacodynamics in the presence and absence of the broad-spectrum antibiotic neomycin. Seven evaluable cancer patients experiencing diarrhea graded > or =2 after receiving CPT-11 alone (350 mg/m(2) i.v. once every 3 weeks) received the same dose combined with oral neomycin at 1000 mg three times per day (days -2 to 5) in the second course. Neomycin had no effect on the systemic exposure of CPT-11 and its major metabolites (P > or = 0.22). However, it changed fecal beta-glucuronidase activity from 7.03 +/- 1.76 microg/h/mg (phenolphthalein assay) to undetectable levels and decreased fecal concentrations of the pharmacologically active metabolite SN-38. Although neomycin had no significant effect on hematological toxicity (P > 0.05), diarrhea ameliorated in six of seven patients (P = 0.033). Our findings indicate that bacterial beta-glucuronidase plays a crucial role in CPT-11-induced diarrhea without affecting enterocycling and systemic SN-38 levels.

Therapeutic effects of arotinolol, a beta-adrenergic blocker, on tremor in MPTP-induced parkinsonian monkeys.

PubMed

Kuno, S; Mizuta, E; Nishida, J; Takechi, M

1992-10-01

The effect of arotinolol, a peripherally acting beta-adrenergic-blocking agent, on postural or kinetic tremor was studied in monkeys with 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced parkinsonism. Male cynomolgus monkeys (Macaca fascicularis) were treated with three injections of MPTP hydrochloride (0.3 mg/kg, i.v.) at an interval of 3-4 days, followed by several injections of the same dose every 7 days. Four monkeys with persistent parkinsonian symptoms manifested for greater than 1 year were used. The animals developed mild to moderate degrees of postural or kinetic tremor, and their motor activity was reduced. Arotinolol (20-30 mg/kg, s.c.) significantly suppressed postural tremor in a dose-dependent manner. Propranolol (20-30 mg/kg) was also effective in suppressing the tremor. However, the application of propranolol induced emesis, whereas arotinolol had no adverse effects. These results suggest that arotinolol is a useful adjunct to dopaminergic therapy for tremor in Parkinson's disease.

Transforming growth factor-beta stimulates wound healing and modulates extracellular matrix gene expression in pig skin. I. Excisional wound model.

PubMed

Quaglino, D; Nanney, L B; Kennedy, R; Davidson, J M

1990-09-01

The effect of transforming growth factor-beta 1 (TGF-beta 1) on matrix gene expression has been investigated during the process of wound repair, where the formation of new connective tissue represents a critical step in restoring tissue integrity. Split-thickness excisional wounds in the pig were studied by in situ hybridization in order to obtain subjective findings on the activity and location of cells involved in matrix gene expression after the administration of recombinant TGF-beta 1. Data focus on the stimulatory role of this growth factor in granulation tissue formation, on the enhanced mRNA content of collagen types I and III, fibronectin, TGF-beta 1 itself, and on the reduction in stromelysin mRNA, suggesting that increased matrix formation measured after treatment with TGF-beta 1 is due to fibroplasia regulated by the abundance of mRNAs for several different structural, matrix proteins as well as inhibition of proteolytic phenomena elicited by metalloproteinases. These studies reveal elastin mRNA early in the repair process, and elastin mRNA expression is enhanced by administration of TGF-beta 1. Moreover, we show that TGF-beta 1 was auto-stimulating in wounds, accounting, at least in part, for the persistent effects of single doses of this multipotential cytokine.

Sequence specificity, statistical potentials, and three-dimensional structure prediction with self-correcting distance geometry calculations of beta-sheet formation in proteins.

PubMed Central

Zhu, H.; Braun, W.

1999-01-01

A statistical analysis of a representative data set of 169 known protein structures was used to analyze the specificity of residue interactions between spatial neighboring strands in beta-sheets. Pairwise potentials were derived from the frequency of residue pairs in nearest contact, second nearest and third nearest contacts across neighboring beta-strands compared to the expected frequency of residue pairs in a random model. A pseudo-energy function based on these statistical pairwise potentials recognized native beta-sheets among possible alternative pairings. The native pairing was found within the three lowest energies in 73% of the cases in the training data set and in 63% of beta-sheets in a test data set of 67 proteins, which were not part of the training set. The energy function was also used to detect tripeptides, which occur frequently in beta-sheets of native proteins. The majority of native partners of tripeptides were distributed in a low energy range. Self-correcting distance geometry (SECODG) calculations using distance constraints sets derived from possible low energy pairing of beta-strands uniquely identified the native pairing of the beta-sheet in pancreatic trypsin inhibitor (BPTI). These results will be useful for predicting the structure of proteins from their amino acid sequence as well as for the design of proteins containing beta-sheets. PMID:10048326

Host-Associated Genomic Features of the Novel Uncultured Intracellular Pathogen Ca. Ichthyocystis Revealed by Direct Sequencing of Epitheliocysts

PubMed Central

Qi, Weihong; Vaughan, Lloyd; Katharios, Pantelis; Schlapbach, Ralph; Seth-Smith, Helena M.B.

2016-01-01

Advances in single-cell and mini-metagenome sequencing have enabled important investigations into uncultured bacteria. In this study, we applied the mini-metagenome sequencing method to assemble genome drafts of the uncultured causative agents of epitheliocystis, an emerging infectious disease in the Mediterranean aquaculture species gilthead seabream. We sequenced multiple cyst samples and constructed 11 genome drafts from a novel beta-proteobacterial lineage, Candidatus Ichthyocystis. The draft genomes demonstrate features typical of pathogenic bacteria with an obligate intracellular lifestyle: a reduced genome of up to 2.6 Mb, reduced G + C content, and reduced metabolic capacity. Reconstruction of metabolic pathways reveals that Ca. Ichthyocystis genomes lack all amino acid synthesis pathways, compelling them to scavenge from the fish host. All genomes encode type II, III, and IV secretion systems, a large repertoire of predicted effectors, and a type IV pilus. These are all considered to be virulence factors, required for adherence, invasion, and host manipulation. However, no evidence of lipopolysaccharide synthesis could be found. Beyond the core functions shared within the genus, alignments showed distinction into different species, characterized by alternative large gene families. These comprise up to a third of each genome, appear to have arisen through duplication and diversification, encode many effector proteins, and are seemingly critical for virulence. Thus, Ca. Ichthyocystis represents a novel obligatory intracellular pathogenic beta-proteobacterial lineage. The methods used: mini-metagenome analysis and manual annotation, have generated important insights into the lifestyle and evolution of the novel, uncultured pathogens, elucidating many putative virulence factors including an unprecedented array of novel gene families. PMID:27190004

Inhibition of tracheal vascular extravasation by liposome-encapsulated albuterol in rats.

PubMed

Zhang, W; Guo, L; Nadel, J A; Papahadjopoulos, D

1998-03-01

To develop a liposome-based system for systemic delivery of anti-inflammatory drugs to airways and other inflamed tissues. Postcapillary venular gap junctions open during airway inflammation and allow fluid accumulation and permit molecules (e.g. complement, kininogen) to enter tissues, initiating inflammatory cascades. Beta-adrenergic agonists prevent inflammatory plasma extravasation, but because of their deleterious side effects, they are not used intravenously. When sterically stabilized "stealth" liposomes are injected i.v., they remain in the circulation for long periods. Inflammatory mediators [e.g., substance P(SP)] open postcapillary venular gaps and allow liposomes and their contents to be deposited selectively in the inflamed tissue. We hypothesized that liposomes encapsulating a beta-adrenergic agonist, such as albuterol, would deposit selectively in inflamed airway tissue, where the drug would slowly leak out of the liposomes, resulting in closure of the gaps, thus preventing subsequent inflammatory extravasation. To test this hypothesis, we delivered albuterol-loaded liposomes i.v. in rats. Then we injected SP to open the venular gaps and allow accumulation of the drug-loaded liposomes in airway tissue. We examined whether this treatment resulted in inhibition of subsequent plasma extravasation induced by SP. The results indicate that liposome-encapsulated albuterol inhibits subsequent extravasation, presumably by leaking out of liposomes in airway tissue. This inhibition occurs for prolonged periods of time and with limited side effects compared to the effect of free albuterol. We conclude that liposomes loaded with appropriate drugs, by migrating to inflamed tissue and subsequently inhibiting inflammatory cascades, may be of therapeutic value in inflammatory diseases.

A new common mutation in the cardiac beta-myosin heavy chain gene in Finnish patients with hypertrophic cardiomyopathy.

PubMed

Jääskeläinen, Pertti; Heliö, Tiina; Aalto-Setälä, Katriina; Kaartinen, Maija; Ilveskoski, Erkki; Hämäläinen, Liisa; Melin, John; Kärkkäinen, Satu; Peuhkurinen, Keijo; Nieminen, Markku S; Laakso, Markku; Kuusisto, Johanna

2014-09-01

In the nationwide FinHCM Study including 306 Finnish patients with hypertrophic cardiomyopathy (HCM), we have previously identified two founder mutations in the alpha-tropomyosin (TPM1-D175N) and myosin-binding protein C (MYBPC3-Q1061X) genes, accounting for 18% of all cases. Objective. To screen additional mutations, previously identified in eastern Finnish cohorts with HCM, in the FinHCM Study population. Ten mutations in the beta-myosin heavy chain gene (MYH7), TPM1, and MYBPC3 were screened. MYH7-R1053Q was found in 17 of 306 patients (5.6%). No carriers of MYH7-R719W or N696S were found. A novel TPM1-D175G mutation was found in a single patient. MYBPC3 mutations were found in 14 patients: IVS5-2A-C in two, IVS14-13G-A in two, K811del in six, and A851insT in four patients. Altogether, a HCM-causing mutation was identified in 32 patients, accounting for 10.5% of all cases. In addition, two MYBPC3 variants R326Q and V896M with uncertain pathogenicity were found in eight and in 10 patients, respectively. Combining the present findings with our previous results, a causative mutation was identified in 28% of the FinHCM cohort. MYH7-R1053Q was the third most common mutation, and should be screened in all new cases of HCM in Finland.

C-glycosylflavones from the aerial parts of Eleusine indica inhibit LPS-induced mouse lung inflammation.

PubMed

De Melo, Giany O; Muzitano, Michelle F; Legora-Machado, Alexandre; Almeida, Thais A; De Oliveira, Daniela B; Kaiser, Carlos R; Koatz, Vera Lucia G; Costa, Sônia S

2005-04-01

The infusion of aerial parts (EI) of Eleusine indica Gaertn (Poaceae) is used in Brazil against airway inflammatory processes like influenza and pneumonia. Pre-treatment with 400 mg/kg of crude extract inhibited 98% of lung neutrophil recruitment in mice exposed to aerosols of lipopolysaccharide (LPS) from Gram-negative bacteria, in a dose-dependent manner. At 400 microg/kg, schaftoside (6-C-beta-glucopyranosyl-8-C-alpha-arabinopyranosylapigenin) and vitexin (8-C-beta-glucopyranosylapigenin), isolated from EI, inhibited 62% and 80% of lung neutrophil influx, respectively. These results may justify the popular use of E. indica against airway inflammatory processes.

OGLE-IV Transient Search report 25 September 2017 part 2

NASA Astrophysics Data System (ADS)

Wyrzykowski, L.; Gromadzki, M.; Hamanowicz, A.; Rybicki, K.; Klencki, J.; Kozlowski, S.; Udalski, A.; Poleski, R.; Szymanski, M. K.; Skowron, J.; Ulaczyk, K.; Pawlak, M.; Mroz, P.; Soszynski, I.; Pietrukowicz, P.; Sitek, M.; Ihanec, N.

2017-09-01

The OGLE-IV Transient Detection System (Wyrzykowski et al. 2014, AcA,64,197; Kozlowski et al. 2013; Klencki et al. 2016, AcA, 66,15) announces discovery of 49 new on-going and recently finished transients discovered since Jan 2017.

OGLE-IV Transient Search report 25 September 2017 part 1

NASA Astrophysics Data System (ADS)

Wyrzykowski, L.; Gromadzki, M.; Hamanowicz, A.; Rybicki, K.; Klencki, J.; Kozlowski, S.; Udalski, A.; Poleski, R.; Szymanski, M. K.; Skowron, J.; Ulaczyk, K.; Pawlak, M.; Mroz, P.; Soszynski, I.; Pietrukowicz, P.; Sitek, M.; Ihanec, N.

2017-09-01

The OGLE-IV Transient Detection System (Wyrzykowski et al. 2014, AcA,64,197; Kozlowski et al. 2013; Klencki et al. 2016, AcA, 66,15) announces discovery of 50 new on-going and recently finished transients discovered since Jan 2017.

Principles of gross alpha and beta radioactivity detection in water.

PubMed

Semkow, T M; Parekh, P P

2001-11-01

A simultaneous detection of gross alpha and beta radioactivity was studied using gas proportional counting. This measurement is a part of a method mandated by US Environmental Protection Agency to screen for alpha and beta radioactivity in drinking water. Responses of a gas proportional detector to alpha and beta particles from several radionuclides were determined in drop and electroplated geometries. It is shown that, while the alpha radioactivity can be measured accurately in the presence of beta radioactivity, the opposite is not typically true due to alpha-to-beta crosstalk. The crosstalk, originating from the emission of conversion and Auger electrons as well as x rays, is shown to be dependent primarily on the particular alpha-decay scheme while the dependence on alpha energy is small but negligible. It was measured at 28-35% for 241Am, 22-24% for 230Th, and 4.9-6.5% for 239Pu. For 210Po, the crosstalk of 1.2-1.6% was observed mostly due to energy retardation. A method of reducing the crosstalk to a <3% level is proposed by absorbing the atomic electrons in a 6.2 mg cm(-2) Al absorber, at the same time decreasing the beta efficiency by 16-31%.

Role of astrocytes in reproduction and neuroprotection.

PubMed

Mahesh, Virendra B; Dhandapani, Krishnan M; Brann, Darrell W

2006-02-26

Hypothalamic astrocytes secrete TGF-beta and 3 alpha,5 alpha-tetrahydro progesterone (3 alpha,5 alpha-THP) in culture. When the astrocyte-conditioned medium (ACM) was incubated with the hypothalamic cell line GT1-7, it resulted in the secretion of GnRH. Immunoneutralization with TGF-beta antibody or ultra-filteration with a 10 kDa cut off filter resulted in attenuation of the GnRH releasing ability of ACM, indicating that TGF-beta was a major factor involved with GnRH release. Treatment with estrogens increases TGF-beta secretion. These observations indicate a significant role of astrocytes in GnRH secretion. Serum-deprivation results in the death of GT1-7 neurons in culture and addition of ACM or TGF-beta to the culture, attenuates cell death. The mechanism of protection from cell death appears to involve phosphorylation of MKK4, JNK, c-Jun(Ser63), and enhancement of AP-1 binding. Co-administration of JNK inhibitors, but not MEK inhibitors attenuated ACM or TGF-beta-induced c-Jun(Ser63) phosphorylation and their neuroprotective effects. These studies suggest that astrocytes can protect neurons, at least in part, by the release of TGF-beta and activation of a c-Jun/AP-1 protective pathway.

Isolation and characterization of a cDNA from Cuphea lanceolata encoding a beta-ketoacyl-ACP reductase.

PubMed

Klein, B; Pawlowski, K; Höricke-Grandpierre, C; Schell, J; Töpfer, R

1992-05-01

A cDNA encoding beta-ketoacyl-ACP reductase (EC 1.1.1.100), an integral part of the fatty acid synthase type II, was cloned from Cuphea lanceolata. This cDNA of 1276 bp codes for a polypeptide of 320 amino acids with 63 N-terminal residues presumably representing a transit peptide and 257 residues corresponding to the mature protein of 27 kDa. The encoded protein shows strong homology with the amino-terminal sequence and two tryptic peptides from avocado mesocarp beta-ketoacyl-ACP reductase, and its total amino acid composition is highly similar to those of the beta-ketoacyl-ACP reductases of avocado and spinach. Amino acid sequence homologies to polyketide synthase, beta-ketoreductases and short-chain alcohol dehydrogenases are discussed. An engineered fusion protein lacking most of the transit peptide, which was produced in Escherichia coli, was isolated and proved to possess beta-ketoacyl-ACP reductase activity. Hybridization studies revealed that in C. lanceolata beta-ketoacyl-ACP reductase is encoded by a small family of at least two genes and that members of this family are expressed in roots, leaves, flowers and seeds.

Newly proposed hormonal criteria via genotypic proof for type II 3beta-hydroxysteroid dehydrogenase deficiency.

PubMed

Lutfallah, Chantal; Wang, Weihua; Mason, J Ian; Chang, Ying Tai; Haider, Anzar; Rich, Barry; Castro-Magana, Mariano; Copeland, Kenneth C; David, Raphael; Pang, Songya

2002-06-01

To define the hormonal criteria via genotypic proof for 3beta-hydroxysteroid dehydrogenase (3beta-HSD) deficiency in the adrenals and gonads, we investigated the type II 3beta-HSD genotype in 55 patients with clinical and/or hormonal presentation suggesting compromised adrenal with or without gonadal 3beta-HSD activity. Fourteen patients (11 males and 3 females) had ambiguous genitalia with or without salt wasting and with or without premature pubarche. One female neonate had salt wasting only. Twenty-five children (4 males and 21 females) had premature pubarche only. Fifteen adolescent and adult females had hirsutism with or without menstrual disorder. The type II 3beta-HSD gene, including the promoter region up to -1053 base, all exons I, II, III, IV, and exon and intron boundaries, was sequenced in all subjects. Eight patients had a proven or predictably deleterious mutation in both alleles of the type II 3beta-HSD gene, and 47 patients had no apparent mutation in the gene. ACTH-stimulated (1 h post iv bolus of 250 microg Cortrosyn) serum 17-hydroxypregnenolone (Delta5-17P) levels and basal and ACTH-stimulated ratios of Delta5-17P to cortisol (F) in the genotypic proven patients were unequivocally higher than those of age-matched or pubic hair stage matched genotype-normal patients or control subjects (n = 7-30 for each group). All other baseline and ACTH-stimulated hormone parameters, including dehydroepiandrosterone (DHEA) levels, ratios of Delta5-17P to 17-OHP and DHEA to androstenedione in the genotype-proven patients, overlapped with the genotype-normal patients or control subjects. The hormonal findings in the genotype-proven patients suggest that the following hormonal criteria are compatible with 3beta-HSD deficiency congenital adrenal hyperplasia (numeric and graphic reference standards from infancy to adulthood are provided): ACTH-stimulated Delta5-17P levels in 1) neonatal infants with ambiguous genitalia at or greater than 378 nmol/liter equivalent to or greater than 5.3 SD above the control mean level [95 +/- 53 (SD) nmol/liter]; 2) Tanner I children with ambiguous genitalia at or greater than 165 nmol/liter equivalent to or greater than 35 SD above the control mean level [12 +/- 4.3 (SD) nmol/liter]; 3) children with premature pubarche at or greater than 294 nmol/liter equivalent to or greater than 54 SD above Tanner II pubic hair stage matched control mean level [17 +/- 5 (SD) nmol/liter]; and 4) adults with at or greater than 289 nmol/liter equivalent to or greater than 21 SD above the normal mean level [25 +/- 12 (SD) nmol/liter]. ACTH-stimulated ratio of Delta5-17P to F in 1) neonatal infants at or greater than 434 equivalent to or greater than 6.4 SD above the control mean ratio [88 +/- 54 (SD)]; 2) Tanner I children at or greater than 216 equivalent to or greater than 23 SD above the control mean ratio [12 +/- 9 (SD)]; 3) children with premature pubarche at or greater than 363 equivalent to or greater than 38 SD above the control mean ratio [20 +/- 9 (SD)]; and 4) adults at or greater than 4010 equivalent to or greater than 221 SD above the normal mean ratio [29 +/- 18 (SD)]. Conversely, the hormonal data in the genotype-normal patients suggest the following hormonal criteria are not consistent with 3beta-HSD deficiency congenital adrenal hyperplasia: ACTH-stimulated Delta5-17P levels in children with premature pubarche up to 72 nmol/liter equivalent to up to 11 SD above the control mean level, and in hirsute females up to 150 nmol/liter equivalent to up to 12 SD above the normal female mean level [28 +/- 10 (SD) nmol/liter]; and ACTH-stimulated Delta5-17P to F ratio in children with premature pubarche up to 67 equivalent to up to 5 SD above the control mean ratio, and in hirsute females up to 151 equivalent to up to 10 SD above the normal mean ratio [32 +/- 12 (SD)]. These findings help define newly proposed hormonal criteria to accurately predict inherited 3beta-HSD deficiency.

Downregulation of miR-133 and miR-590 contributes to nicotine-induced atrial remodelling in canines.

PubMed

Shan, Hongli; Zhang, Yong; Lu, Yanjie; Zhang, Ying; Pan, Zhenwei; Cai, Benzhi; Wang, Ning; Li, Xuelian; Feng, Tieming; Hong, Yuan; Yang, Baofeng

2009-08-01

The present study was designed to decipher molecular mechanisms underlying nicotine's promoting atrial fibrillation (AF) by inducing atrial structural remodelling. The canine model of AF was successfully established by nicotine administration and rapid pacing. The atrial fibroblasts isolated from healthy dogs were treated with nicotine. The role of microRNAs (miRNAs) on the expression and regulation of transforming growth factor-beta1 (TGF-beta1), TGF-beta receptor type II (TGF-betaRII), and collagen production was evaluated in vivo and in vitro. Administration of nicotine for 30 days increased AF vulnerability by approximately eight- to 15-fold in dogs. Nicotine stimulated remarkable collagen production and atrial fibrosis both in vitro in cultured canine atrial fibroblasts and in vivo in atrial tissues. Nicotine produced significant upregulation of expression of TGF-beta1 and TGF-betaRII at the protein level, and a 60-70% decrease in the levels of miRNAs miR-133 and miR-590. This downregulation of miR-133 and miR-590 partly accounts for the upregulation of TGF-beta1 and TGF-betaRII, because our data established TGF-beta1 and TGF-betaRII as targets for miR-133 and miR-590 repression. Transfection of miR-133 or miR-590 into cultured atrial fibroblasts decreased TGF-beta1 and TGF-betaRII levels and collagen content. These effects were abolished by the antisense oligonucleotides against miR-133 or miR-590. The effects of nicotine were prevented by an alpha7 nicotinic acetylcholine receptor antagonist. We conclude that the profibrotic response to nicotine in canine atrium is critically dependent upon downregulation of miR-133 and miR-590.

Hemodynamic actions of systemically injected pituitary adenylate cyclase activating polypeptide-27 in the rat

NASA Technical Reports Server (NTRS)

Whalen, E. J.; Johnson, A. K.; Lewis, S. J.

1999-01-01

The aims of this study were (1) to characterize the hemodynamic mechanisms underlying the hypotensive effects of pituitary adenylate cyclase activating polypeptide-27 (PACAP-27 0.1-2.0 nmol/kg, i.v.) in pentobarbital-anesthetized rats, and (2) to determine the roles of the autonomic nervous system, adrenal catecholamines and endothelium-derived nitric oxide (NO) in the expression of PACAP-27-mediated effects on hemodynamic function. PACAP-27 produced dose-dependent decreases in mean arterial blood pressure and hindquarter and mesenteric vascular resistances in saline-treated rats. PACAP-27 also produced pronounced falls in mean arterial blood pressure in rats treated with the ganglion blocker, chlorisondamine (5 mg/kg, i.v.). The hypotensive and vasodilator actions of PACAP-27 were not attenuated by the beta-adrenoceptor antagonist, propranolol (1 mg/kg, i.v.), or the NO synthase inhibitor, N(G)-nitro-L-arginine methyl ester (L-NAME 50 micromol/kg, i.v.). PACAP-27 produced dose-dependent increases in heart rate whereas the hypotensive response produced by the nitrovasodilator, sodium nitroprusside (10 microg/kg, i.v.), was associated with a minimal tachycardia. The PACAP-27-induced tachycardia was unaffected by chlorisondamine, but was virtually abolished by propranolol. These results suggest that the vasodilator effects of PACAP-27 are due to actions in the microcirculation rather than to the release of adrenal catecholamines and that this vasodilation may not involve the release of endothelium-derived NO. These results also suggest that PACAP-27 produces tachycardia by directly releasing norepinephrine from cardiac sympathetic nerve terminals rather than by direct or baroreceptor reflex-mediated increases in sympathetic nerve activity.

The role of erythropoiesis stimulating agents and intravenous (IV) iron in the cardio renal anemia syndrome.

PubMed

Silverberg, Donald S

2011-11-01

Anemia is common in Congestive Heart Failure (CHF) and is associated with an increased mortality, morbidity and progressive renal failure. The most common causes of the anemia in CHF are (1) the associated Chronic Kidney Disease (CKD), which causes depression of erythropoietin (EPO) production in the kidney, and (2) excessive cytokine production in CHF, which can cause both depression of erythropoietin production in the kidney and depression of erythropoietin response in the bone marrow. The cytokines can also induce iron deficiency by increasing hepcidin production from the liver, which both reduces gastrointestinal iron absorption and reduces iron release from iron stores located in the macrophages and hepatocytes. It appears that iron deficiency is very common in CHF and is rarely recognized or treated. The iron deficiency can cause a thrombocytosis that might contribute to cardiovascular complications in both CHF and CKD and is reversible with iron treatment. Thus, attempts to control this anemia in CHF will have to take into consideration both the use of both Erythropoiesis Stimulating Agents (ESA) such as EPO and oral and, probably more importantly, intravenous (IV) iron. Many studies of anemia in CHF with ESA and oral or IV iron and even with IV iron without ESA have shown a positive effect on hospitalization, New York Heart Association functional class, cardiac and renal function, quality of life, exercise capacity and reduced Beta Natriuretic Peptide and have not demonstrated an increase in cardiovascular damage related to the therapy. However, adequately powered long-term placebo-controlled studies of ESA and of IV iron in CHF are still needed and are currently being carried out.

A negative feedback control of transforming growth factor-beta signaling by glycogen synthase kinase 3-mediated Smad3 linker phosphorylation at Ser-204.

PubMed

Millet, Caroline; Yamashita, Motozo; Heller, Mary; Yu, Li-Rong; Veenstra, Timothy D; Zhang, Ying E

2009-07-24

Through the action of its membrane-bound type I receptor, transforming growth factor-beta (TGF-beta) elicits a wide range of cellular responses that regulate cell proliferation, differentiation, and apo ptosis. Many of these signaling responses are mediated by Smad proteins. As such, controlling Smad activity is crucial for proper signaling by TGF-beta and its related factors. Here, we show that TGF-beta induces phosphorylation at three sites in the Smad3 linker region in addition to the two C-terminal residues, and glycogen synthase kinase 3 is responsible for phosphorylation at one of these sites, namely Ser-204. Alanine substitution at Ser-204 and/or the neighboring Ser-208, the priming site for glycogen synthase kinase 3 in vivo activity, strengthened the affinity of Smad3 to CREB-binding protein, suggesting that linker phosphorylation may be part of a negative feedback loop that modulates Smad3 transcriptional activity. Thus, our findings reveal a novel aspect of the Smad3 signaling mechanism that controls the final amplitude of cellular responses to TGF-beta.

The Beta Pictoris Phenomenon in A-Shell Stars: Detection of Accreting Gas

NASA Technical Reports Server (NTRS)

Grady, C. A.; Perez, Mario R.; Talavera, A.; McCollum, B.; Rawley, L. A.; England, M. N.; Schlegel, M.

1996-01-01

We present the results of an expanded survey of A-shell stars using IUE high-dispersion spectra and find accreting, circumstellar gas in the line of sight to nine stars, in addition to the previously identified beta Pic, HR 10, and 131 Tau, which can be followed to between +70 and 100 km/s relative to the star. Two of the program stars, HD 88195 and HD 148283, show variable high-velocity gas. Given the small number of IUE spectra for our program stars, detection of high-velocity, accreting gas in 2/3 of the A-shell stars sampled indicates that accretion is an intrinsic part of the A-shell phenomenon and that beta Pic is not unique among main-sequence A stars in exhibiting such activity. Our program stars, as a group, have smaller column densities of high-velocity gas and smaller near-IR excesses compared with beta Pic. These features are consistent with greater central clearing of a remnant debris disk, compared with beta Pic, and suggest that the majority of field A-shell stars are older than beta Pic.

78 FR 9057 - Medicare Program; Request for Information on the Use of Clinical Quality Measures (CQMs) Reported...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-02-07

... Part II: Lifelong Learning and Self-Assessment Part III: Cognitive Expertise Part IV: Practice...: Licensure and Professional Standing Part II: Lifelong Learning and Self-Assessment Part III: Cognitive...\\ The MOC assesses physicians' commitment to lifelong learning according to the following six core...

49 CFR 383.113 - Required skills.

Code of Federal Regulations, 2014 CFR

2014-10-01

... inspected to ensure a safe operating condition of each part, including: (i) Engine compartment; (ii) Cab/engine start; (iii) Steering; (iv) Suspension; (v) Brakes; (vi) Wheels; (vii) Side of vehicle; (viii... they will activate in emergency situations; (iv) With the engine running, make sure that the system...

49 CFR 383.113 - Required skills.

Code of Federal Regulations, 2012 CFR

2012-10-01

... inspected to ensure a safe operating condition of each part, including: (i) Engine compartment; (ii) Cab/engine start; (iii) Steering; (iv) Suspension; (v) Brakes; (vi) Wheels; (vii) Side of vehicle; (viii... they will activate in emergency situations; (iv) With the engine running, make sure that the system...

49 CFR 383.113 - Required skills.

Code of Federal Regulations, 2013 CFR

2013-10-01

... inspected to ensure a safe operating condition of each part, including: (i) Engine compartment; (ii) Cab/engine start; (iii) Steering; (iv) Suspension; (v) Brakes; (vi) Wheels; (vii) Side of vehicle; (viii... they will activate in emergency situations; (iv) With the engine running, make sure that the system...

49 CFR 383.113 - Required skills.

Code of Federal Regulations, 2011 CFR

2011-10-01

... inspected to ensure a safe operating condition of each part, including: (i) Engine compartment; (ii) Cab/engine start; (iii) Steering; (iv) Suspension; (v) Brakes; (vi) Wheels; (vii) Side of vehicle; (viii... they will activate in emergency situations; (iv) With the engine running, make sure that the system...

Eclipsing and density effects on the spectral behavior of Beta Lyrae binary system in the UV

NASA Astrophysics Data System (ADS)

Sanad, M. R.

2010-01-01

We analyze both long and short high resolution ultraviolet spectrum of Beta Lyrae eclipsing binary system observed with the International Ultraviolet Explorer (IUE) between 1980 and 1989. The main spectral features are P Cygni profiles originating from different environments of Beta Lyrae. A set of 23 Mg II k&h spectral lines at 2800 Å, originating from the extended envelope [Hack, M., 1980. IAUS, 88, 271H], have been identified and measured to determine their fluxes and widths. We found that there is spectral variability for these physical parameters with phase, similar to that found for the light curve [Kondo, Y., McCluskey, G.E., Jeffery, M.M.S., Ronald, S.P., Carolina, P.S. McCluskey, Joel, A.E., 1994. ApJ, 421, 787], which we attribute to the eclipse effects [Ak, H., Chadima, P., Harmanec, P., Demircan, O., Yang, S., Koubský, P., Škoda, P., Šlechta, M., Wolf, M., Božić, H., 2007. A&A, 463, 233], in addition to the changes of density and temperature of the region from which these lines are coming, as a result of the variability of mass loss from the primary star to the secondary [Hoffman, J.L., Nordsieck, K.H., Fox, G.K., 1998. AJ, 115, 1576; Linnell, A.P., Hubeny, I., Harmanec, P., 1998. ApJ, 509, 379]. Also we present a study of Fe II spectral line at 2600 Å, originating from the atmosphere of the primary star [Hack, M., 1980. IAUS, 88, 271H]. We found spectral variability of line fluxes and line widths with phase similar to that found for Mg II k&h lines. Finally we present a study of Si IV spectral line at 1394 Å, originating from the extended envelope [Hack, M., 1980. IAUS, 88, 271H]. A set of 52 Si IV spectral line at 1394 Å have been identified and measured to determine their fluxes and widths. Also we found spectral variability of these physical parameters with phase similar to that found for Mg II k&h and Fe II spectral lines.

Dopamine transporter occupancy by RTI-55 determined using labeled cocaine, and displacement of RTI-55 with unlabeled cocaine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gatley, S.J.; Volkow, N.D.; Fowler, J.S.

We have previously visualized dopamine transporters (DAT) in human and baboon striatum using PET and C-11 cocaine. Cocaine analogs such as 3{beta}-(4-iodophenyl) tropane-2{beta}-carboxylic acid methyl ester (RTI-55 or {beta}CIT) with a higher affinity for the DAT may be potentially useful in interfering with cocaine`s actions in brain. We evaluated the time course of the effects of RTI-55 on C-11 cocaine binding in baboon brain prior to and 90 minutes, 24 hours, 4-5 days and 11-13 days after RTI-55(0.3 mg/kg iv). RTI-55 significantly inhibited C-11 cocaine binding at 90 minutes and 24 hours after administration. The half life for the clearancemore » of RTI-55 from the DAT was estimated to be 2 to 3 days in the baboon brain. Parallel studies with H-3 cocaine and RTI-55 (0.5 mg/kg iv or 2 mg/kg ip) were performed in mice, where RTI-55 significantly inhibited 5 minute striatum-to-cerebellium ratios (S/C) at 60 and 180 minutes after administration, and recovery was obtained at 12 hours. However, unlabeled cocaine (20 mg/Kg, i/p) given 60 minutes after RTI-55 led to a greater recovery of H-3 cocaine uptake measured at 180 minutes (S/C = 1.23 {plus_minus} 0.07, n= 5), than in control animals given saline after RTI-55 (S/C = 9.5{plus_minus}0.08). Animals given saline instead of RTI-55 had S/C = 1.45{plus_minus}0.04. These results document long lasting inhibition of cocaine binding by RTI-55 and corroborate the assumption that the binding kinetics of RTI-55 in striatum observed in SPECT imaging studies with I-123 RTI-55 represents binding to DAT`s. However, a pharmacological dose of cocaine is able to displace a fraction of the previously bound RTI-55 from the DAT. These findings have implications for drug development strategies for cocaine abuse.« less

Nanocomposites of zeolite-titanium(IV) oxides: Preparation, characterization, adsorption, photocatalytic and bactericidal properties

NASA Astrophysics Data System (ADS)

Domoroshchina, Elena; Kravchenko, Galina; Kuz'micheva, Galina

2017-06-01

NT/zeolite nanocomposites (NT - nanosized titanium(IV) oxides: η-phase and Hombifine N with anatase; zeolite: Beta(25), ZSM-5 with different modules Si/Al, MOR, or Y) have been obtained by two methods: modified cold-impregnation method (method 1) and in situ method of introduction of zeolites into the reaction mixture during the synthesis of NT by hydrolysis of TiOSO4×xH2SO4×yH2O or TiOSO4×2H2O aqueous solutions (method 2), performed for the first time. According to the X-ray data, the following differences in the NT:zeolite systems under investigation have been revealed: the mixture of zeolites and NT in nanocrystalline (Hombifine N/zeolite) or amorphous states (η-phase/zeolite, except for η-phase/MOR, where NT peaks are absent) (method 1), and the mixture of Y-zeolite and amorphous NT or only Y-zeolite without NT (method 2), which indicates the different levels of interaction between NT and zeolites in the systems studied. The best characteristics of properties (photocatalytic, adsorption, and antibacterial) have been revealed in the nanocomposites synthesized by the method 2. The correlation between the photoreaction rate constant (the k value) under UV irradiation in the presence of nanocomposites (kmax for NT/ZSM-5(12)) and the type of precursor, its pH, synthesis duration, NT:zeolite ratio, organic dye composition (methyl orange or Rhodamine G) has been established. The highest degree of extraction of P(V) ions from model aqueous systems has been observed in the presence of nanocomposites with the largest total surface area of all particles (Rmax = 99.48% for NT/MOR). The correlation between the sorption degree of P(V) ions and the modulus of zeolite is possible. Antibacterial activity in the dark towards Escherichia coli has been found for Y and Beta(25) zeolites and nanocomposites on their basis (methods 1 and 2) with the maximum diameter of bacterial growth inhibition (18 mm) obtained for NT/Beta(25) (method 2) synthesized only from TiOSO4×xH2SO4×yH2O precursor.

The absorption spectrum of the QSO PKS 2126-158 (z_em =3.27) at high resolution

NASA Astrophysics Data System (ADS)

D'Odorico, V.; Cristiani, S.; D'Odorico, S.; Fontana, A.; Giallongo, E.

1998-01-01

Spectra of the z_em = 3.268 quasar PKS 2126-158 have been obtained in the range lambda lambda 4300-6620 Angstroms with a resolution Rsmallimeq27000 and an average signal-to-noise ratio s/nsmallimeq 25 per resolution element. The list of the identified absorption lines is given together with their fitted column densities and Doppler widths. The modal value of the Doppler parameter distribution for the Lyalpha lines is smallimeq 25 km s(-1) . The column density distribution can be described by a power-law dn / dN ~ N(-beta ) with beta smallimeq 1.5. 12 metal systems have been identified, two of which were previously unknown. In order to make the column densities of the intervening systems compatible with realistic assumptions about the cloud sizes and the silicon to carbon overabundance, it is necessary to assume a jump beyond the He II edge in the spectrum of the UV ionizing background at z smallim 3 a factor 10 larger than the standard predictions for the integrated quasar contribution. An enlarged sample of C IV absorptions (71 doublets) has been used to analyze the statistical properties of this class of absorbers strictly related to galaxies. The column density distribution is well described by a single power-law, with beta =1.64 and the Doppler parameter distribution shows a modal value b_CIV smallimeq 14 km s(-1) . The two point correlation function has been computed in the velocity space for the individual components of C IV features. A significant signal is obtained for scales smaller than 200- 300 km s(-1) , xi (30< Delta v < 90 km\\ s(-1) ) = 33 +/- 3. A trend of decreasing clustering amplitude with decreasing column density is apparent, analogously to what has been observed for Lyalpha lines. Based on observations collected at the European Southern Observatory, La Silla, Chile (ESO No. 2-013-49K). Table 2 is only available in electronic from via anonymous ftp 130.79.128.5 or http://cdsweb.u-strasbg.fr/Abstract.html

State of the Art in Beta Titanium Alloys for Airframe Applications

NASA Astrophysics Data System (ADS)

Cotton, James D.; Briggs, Robert D.; Boyer, Rodney R.; Tamirisakandala, Sesh; Russo, Patrick; Shchetnikov, Nikolay; Fanning, John C.

2015-06-01

Beta titanium alloys were recognized as a distinct materials class in the 1950s, and following the introduction of Ti-13V-11Cr-3Al in the early 1960s, intensive research occurred for decades thereafter. By the 1980s, dozens of compositions had been explored and sufficient work had been accomplished to warrant the first major conference in 1983. Metallurgists of the time recognized beta alloys as highly versatile and capable of remarkable property development at much lower component weights than steels, coupled with excellent corrosion resistance. Although alloys such as Ti-15V-3Al-3Sn-3Cr, Ti-10V-2Fe-3Al and Ti-3AI-8V-6Cr-4Mo-4Zr (Beta C) were commercialized into well-known airframe systems by the 1980s, Ti-13V-11Cr-3Al was largely discarded following extensive employment on the SR-71 Blackbird. The 1990s saw the implementation of specialty beta alloys such as Beta 21S and Alloy C, in large part for their chemical and oxidation resistance. It was also predicted that by the 1990s, cost would be the major limitation on expansion into new applications. This turned out to be true and is part of the reason for some stagnation in commercialization of new such compositions over the past two decades, despite a good understanding of the relationships among chemistry, processing, and performance and some very attractive offerings. Since then, only a single additional metastable beta alloy, Ti-5Al-5V-5Mo-3Cr-0.5Fe, has been commercialized in aerospace, although low volumes of other chemistries have found a place in the biomedical implant market. This article examines the evolution of this important class of materials and the current status in airframe applications. It speculates on challenges for expanding their use.

Analysis of Voyager spectra of the beta Cephei star nu Eridani

NASA Technical Reports Server (NTRS)

Porri, A.; Stalio, R.; Ali, B.; Polidan, R. S.; Morossi, C.

1994-01-01

Voyager 500-1700 A spectrophotometric observations of the beta Cephei star nu Eri are presented and discussed. The Voyager observations were obtained in 1981 and cover six pulsation cycles of the star. These data are supplemented with a set of nine International Ultraviolet Explorer (IUE) SWP high-resolution observations covering one, earlier epoch, pulsation cycle. Light curves are derived from the Voyager data at 1055 and 1425 A. These light curves are found to be consistent in both shape and period with published optical curves. The 1055 A light curve also exhibits a phenomenon not seen in the optical curves: a small but highly significant systematic increase in the flux of the maximum light phases while maintaining a constant minimum light level over the interval of observation. Substantially larger errors in the longer wavelength data preclude discussion of this phenomenon in the 1425 A light curve. Examination of the far-UV continuum in nu Eri during this period shows that the color temperature is lower for the brighter maxima. Analysis of the far-UV continuum at maximum and minimum light yields an effective temperature difference between these two phases of 2200 + or - 750 K. Spectroscopically, three prominent features are seen in the Voyager data: a feature at 985 A mostly due to a blend of C III 977 A, H I Ly gamma 972 A, and N III 990 A; a feature at 1030 A due to H I Ly beta 1026 A and C II 1037 A; and the Si IV resonance doublet near 1400 A. A comparison of the 912-1700 A spectral region in nu Eri with a set of standard, i.e., nonpulsating stars, shows that nu Eri closely resembles the standard both in continuum shape and spectral line strengths with the possible exception of a slight flux excess between 912 and 975 A. The equivalent width of the 985 A feature is shown to vary in strength over the pulsation cycle in antiphase with the light curve and variations seen in the C IV 1548-1551 lines from the IUE data. This behavior of the 985 A feature is most likely caused by variations in the strength of the Ly gamma component of the blend. Comparisons are also made between nu Eri and the only other beta Cephei star studied in the far-UV, BW Vul, with the most notable differences between the two stars being the much larger delta(T(sub eff)) for BW Vul and the almost total absence of abnormalities in observed spectrum of nu Eri.

The re-incarnation, re-interpretation and re-demise of the transition probability model.

PubMed

Koch, A L

1999-05-28

There are two classes of models for the cell cycle that have both a deterministic and a stochastic part; they are the transition probability (TP) models and sloppy size control (SSC) models. The hallmark of the basic TP model are two graphs: the alpha and beta plots. The former is the semi-logarithmic plot of the percentage of cell divisions yet to occur, this results in a horizontal line segment at 100% corresponding to the deterministic phase and a straight line sloping tail corresponding to the stochastic part. The beta plot concerns the differences of the age-at-division of sisters (the beta curve) and gives a straight line parallel to the tail of the alpha curve. For the SC models the deterministic part is the time needed for the cell to accumulate a critical amount of some substance(s). The variable part differs in the various variants of the general model, but they do not give alpha and beta curves with linear tails as postulated by the TP model. This paper argues against TP and for an elaboration of SSC type of model. The main argument against TP is that it assumes that the probability of the transition from the stochastic phase is time invariant even though it is certain that the cells are growing and metabolizing throughout the cell cycle; a fact that should make the transition probability be variable. The SSC models presume that cell division is triggered by the cell's success in growing and not simply the result of elapsed time. The extended model proposed here to accommodate the predictions of the SSC to the straight tailed parts of the alpha and beta plots depends on the existence of a few percent of the cell in a growing culture that are not growing normally, these are growing much slower or are temporarily quiescent. The bulk of the cells, however, grow nearly exponentially. Evidence for a slow growing component comes from experimental analyses of population size distributions for a variety of cell types by the Collins-Richmond technique. These subpopulations existence is consistent with the new concept that there are a large class of rapidly reversible mutations occurring in many organisms and at many loci serving a large range of purposes to enable the cell to survive environmental challenges. These mutations yield special subpopulations of cells within a population. The reversible mutational changes, relevant to the elaboration of SSC models, produce slow-growing cells that are either very large or very small in size; these later revert to normal growth and division. The subpopulations, however, distort the population distribution in such a way as to fit better the exponential tails of the alpha and beta curves of the TP model.

Invariant glycines and prolines flanking in loops the strand beta 2 of various (alpha/beta)8-barrel enzymes: a hidden homology?

PubMed Central

Janecek, S.

1996-01-01

The question of parallel (alpha/beta)8-barrel fold evolution remains unclear, owing mainly to the lack of sequence homology throughout the amino acid sequences of (alpha/beta)8-barrel enzymes. The "classical" approaches used in the search for homologies among (alpha/beta)8-barrels (e.g., production of structurally based alignments) have yielded alignments perfect from the structural point of view, but the approaches have been unable to reveal the homologies. These are proposed to be "hidden" in (alpha/beta)8-barrel enzymes. The term "hidden homology" means that the alignment of sequence stretches proposed to be homologous need not be structurally fully satisfactory. This is due to the very long evolutionary history of all (alpha/beta)8-barrels. This work identifies so-called hidden homology around the strand beta 2 that is flanked by loops containing invariant glycines and prolines in 17 different (alpha/beta)8-barrel enzymes, i.e., roughly in half of all currently known (alpha/beta)8-barrel proteins. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif, given their mutual evolutionary relatedness. For this purpose, the sequence region around the well-conserved second beta-strand of alpha-amylase flanked by the invariant glycine and proline (56_GFTAIWITP, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The proposal that the second beta-strand of (alpha/beta)8-barrel fold is important from the evolutionary point of view is strongly supported by the increasing trend of the observed beta 2-strand structural similarity for the pairs of (alpha/beta)8-barrel enzymes: alpha-amylase and the alpha-subunit of tryptophan synthase, alpha-amylase and mandelate racemase, and alpha-amylase and cyclodextrin glycosyltransferase. This trend is also in agreement with the existing evolutionary division of the entire family of (alpha/beta)8-barrel proteins. PMID:8762144

Invariant glycines and prolines flanking in loops the strand beta 2 of various (alpha/beta)8-barrel enzymes: a hidden homology?

PubMed

Janecek, S

1996-06-01

The question of parallel (alpha/beta)8-barrel fold evolution remains unclear, owing mainly to the lack of sequence homology throughout the amino acid sequences of (alpha/beta)8-barrel enzymes. The "classical" approaches used in the search for homologies among (alpha/beta)8-barrels (e.g., production of structurally based alignments) have yielded alignments perfect from the structural point of view, but the approaches have been unable to reveal the homologies. These are proposed to be "hidden" in (alpha/beta)8-barrel enzymes. The term "hidden homology" means that the alignment of sequence stretches proposed to be homologous need not be structurally fully satisfactory. This is due to the very long evolutionary history of all (alpha/beta)8-barrels. This work identifies so-called hidden homology around the strand beta 2 that is flanked by loops containing invariant glycines and prolines in 17 different (alpha/beta)8-barrel enzymes, i.e., roughly in half of all currently known (alpha/beta)8-barrel proteins. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif, given their mutual evolutionary relatedness. For this purpose, the sequence region around the well-conserved second beta-strand of alpha-amylase flanked by the invariant glycine and proline (56_GFTAIWITP, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The proposal that the second beta-strand of (alpha/beta)8-barrel fold is important from the evolutionary point of view is strongly supported by the increasing trend of the observed beta 2-strand structural similarity for the pairs of (alpha/beta)8-barrel enzymes: alpha-amylase and the alpha-subunit of tryptophan synthase, alpha-amylase and mandelate racemase, and alpha-amylase and cyclodextrin glycosyltransferase. This trend is also in agreement with the existing evolutionary division of the entire family of (alpha/beta)8-barrel proteins.

Model for the alpha and beta shear-mechanical properties of supercooled liquids and its comparison to squalane data

NASA Astrophysics Data System (ADS)

Hecksher, Tina; Olsen, Niels Boye; Dyre, Jeppe C.

2017-04-01

This paper presents data for supercooled squalane's frequency-dependent shear modulus covering frequencies from 10 mHz to 30 kHz and temperatures from 168 K to 190 K; measurements are also reported for the glass phase down to 146 K. The data reveal a strong mechanical beta process. A model is proposed for the shear response of the metastable equilibrium liquid phase of supercooled liquids. The model is an electrical equivalent-circuit characterized by additivity of the dynamic shear compliances of the alpha and beta processes. The nontrivial parts of the alpha and beta processes are each represented by a "Cole-Cole retardation element" defined as a series connection of a capacitor and a constant-phase element, resulting in the Cole-Cole compliance function well-known from dielectrics. The model, which assumes that the high-frequency decay of the alpha shear compliance loss varies with the angular frequency as ω-1 /2, has seven parameters. Assuming time-temperature superposition for the alpha and beta processes separately, the number of parameters varying with temperature is reduced to four. The model provides a better fit to the data than an equally parametrized Havriliak-Negami type model. From the temperature dependence of the best-fit model parameters, the following conclusions are drawn: (1) the alpha relaxation time conforms to the shoving model; (2) the beta relaxation loss-peak frequency is almost temperature independent; (3) the alpha compliance magnitude, which in the model equals the inverse of the instantaneous shear modulus, is only weakly temperature dependent; (4) the beta compliance magnitude decreases by a factor of three upon cooling in the temperature range studied. The final part of the paper briefly presents measurements of the dynamic adiabatic bulk modulus covering frequencies from 10 mHz to 10 kHz in the temperature range from 172 K to 200 K. The data are qualitatively similar to the shear modulus data by having a significant beta process. A single-order-parameter framework is suggested to rationalize these similarities.

Model for the alpha and beta shear-mechanical properties of supercooled liquids and its comparison to squalane data.

PubMed

Hecksher, Tina; Olsen, Niels Boye; Dyre, Jeppe C

2017-04-21

This paper presents data for supercooled squalane's frequency-dependent shear modulus covering frequencies from 10 mHz to 30 kHz and temperatures from 168 K to 190 K; measurements are also reported for the glass phase down to 146 K. The data reveal a strong mechanical beta process. A model is proposed for the shear response of the metastable equilibrium liquid phase of supercooled liquids. The model is an electrical equivalent-circuit characterized by additivity of the dynamic shear compliances of the alpha and beta processes. The nontrivial parts of the alpha and beta processes are each represented by a "Cole-Cole retardation element" defined as a series connection of a capacitor and a constant-phase element, resulting in the Cole-Cole compliance function well-known from dielectrics. The model, which assumes that the high-frequency decay of the alpha shear compliance loss varies with the angular frequency as ω -1/2 , has seven parameters. Assuming time-temperature superposition for the alpha and beta processes separately, the number of parameters varying with temperature is reduced to four. The model provides a better fit to the data than an equally parametrized Havriliak-Negami type model. From the temperature dependence of the best-fit model parameters, the following conclusions are drawn: (1) the alpha relaxation time conforms to the shoving model; (2) the beta relaxation loss-peak frequency is almost temperature independent; (3) the alpha compliance magnitude, which in the model equals the inverse of the instantaneous shear modulus, is only weakly temperature dependent; (4) the beta compliance magnitude decreases by a factor of three upon cooling in the temperature range studied. The final part of the paper briefly presents measurements of the dynamic adiabatic bulk modulus covering frequencies from 10 mHz to 10 kHz in the temperature range from 172 K to 200 K. The data are qualitatively similar to the shear modulus data by having a significant beta process. A single-order-parameter framework is suggested to rationalize these similarities.

Phase I and pharmacokinetic evaluation of floxuridine/leucovorin given on the Roswell Park weekly regimen.

PubMed

Creaven, P J; Rustum, Y M; Petrelli, N J; Meropol, N J; Raghavan, D; Rodriguez-Bigas, M; Levine, E G; Frank, C; Udvary-Nagy, S; Proefrock, A

1994-01-01

A phase I and pharmacokinetics study was carried out of floxuridine (FdUrd) modulated by leucovorin (LV) given on the Roswell Park regimen (LV given at 500 mg/m2 by 2-h infusion and FdUrd given by i.v. push at 1 h after the start of LV infusion, treatment being given weekly x 6). The dose-limiting toxicity was diarrhea; the MTD and recommended dose for phase II studies was 1,650 mg/m2 per week of FdUrd. The dose-response curve was steep, with 3/3 patients treated at a dose of 1,750 mg/m2 developing grade IV diarrhea. With this schedule there was no significant mucositis. Pharmacokinetic parameters showed very wide interpatient variability. Plasma decay was biphasic with a t1/2 beta of approximately 2 h. Plasma clearance was high (> 200 1 h-1). No correlation between pharmacokinetic parameters and toxicity could be identified.

Campaign best practice in intravenous therapy.

PubMed

Baldwin, Wayne; Murphy, Jayne; Shakespeare, David; Kelly, Chris; Fox, Louise; Kelly, Matthew

Intravenous therapy is an integral part of nursing care but is associated with a high risk of infection. This article outlines a campaign that aimed to increase awareness of best practice for IV therapy and reduce the risks of healthcare-associated IV infections in hospital and community settings.

Spectral Irradiance Calibration in the Infrared. Part 4; 1.2-35 micrometer Spectra of Six Standard Stars

NASA Technical Reports Server (NTRS)

Cohen, Martin; Witteborn, Fred C.; Walker, Russell, G.; Bregman, Jesse D.; Wooden, Diane H.

1995-01-01

Five new absolutely calibrated continuous stellar spectra from 1.2 to 35 microns are presented. The spectra were constructed as far as possible from actual observed spectral fragments taken from the ground, the Kuiper Airborne Observatory (KAO), and the IRAS Low Resolution Spectrometer (LRS). These stars (beta Peg, alpha Boo, beta And, beta Gem, and alpha Hya) augment the author's already created complete absolutely calibrated spectrum for alpha Tau. All these spectra have a common calibration pedigree. The wavelength coverage is ideal for calibration of many existing and proposed ground-based, airborne, and satellite sensors.

[Study on the chemical constituents from Melicope ptelefolia].

PubMed

Xie, Yu-Feng; Liang, Yue; Du, Qing-Tao; Guo, Li-Bing

2011-03-01

To study the chemical constituents from Melicope ptelefolia. Several chromatographic methods were applied to isolate and purify compounds. Their structures were identified on the basis of physicochemical properties and spectroscopic data. Seven compounds were isolated and elucidated as n-octadecanyl palmitate (I), beta-sitosterol (II), palmitic acid (III), 3, 5,3'-trihydroxy-8,4'-dimethoxy-7-(3-methylbut-2-enyloxy) flavone (IV), daucosterol (V), salylic acid (VI), kaempferol-3-O-alpha-D-arabinpyranoside (VII). Compound VII is isolated from the genus for the first time, Compounds V and VI are isolated from Melicope ptelefolia for the first time.

Fat and Sugar Metabolism During Exercise in Patients With Metabolic Myopathy

ClinicalTrials.gov

2017-08-31

Metabolism, Inborn Errors; Lipid Metabolism, Inborn Errors; Carbohydrate Metabolism, Inborn Errors; Long-Chain 3-Hydroxyacyl-CoA Dehydrogenase Deficiency; Glycogenin-1 Deficiency (Glycogen Storage Disease Type XV); Carnitine Palmitoyl Transferase 2 Deficiency; VLCAD Deficiency; Medium-chain Acyl-CoA Dehydrogenase Deficiency; Multiple Acyl-CoA Dehydrogenase Deficiency; Carnitine Transporter Deficiency; Neutral Lipid Storage Disease; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Muscle Phosphofructokinase Deficiency; Phosphoglucomutase 1 Deficiency; Phosphoglycerate Mutase Deficiency; Phosphoglycerate Kinase Deficiency; Phosphorylase Kinase Deficiency; Beta Enolase Deficiency; Lactate Dehydrogenase Deficiency; Glycogen Synthase Deficiency

[Nutritional value of daily diets prepared in several regions of the country. Part VI. Value of retinol, beta-carotene and vitamin E].

PubMed

Nadolna, I; Okolska, G; Kunachowicz, H

1992-01-01

Determinations of retinol, beta-carotene and vitamin E were carried out in daily diets of manual and mental workers with medium incomes. The diets were prepared on the basis of the analysis of the Central Statistical Office in 1986 under laboratory conditions in five regions of Poland (Warszawa, Lublin, Olsztyn, Poznań, Wrocław). It was found that these diets contained respectively: vitamin A (retinol and beta-carotene) 844 and 859 micrograms, retinol 466 and 496 micrograms, beta-carotene 2267 and 2167 micrograms and vitamin E 4.82 and 5.12 mg per day. In relation to the realization of daily recommended dietary allowances by these diets, for vitamin A were met respectively 102 and 104% and for vitamin E 58 and 61%. There were considerable differences in the content of beta-carotene and vitamin E between diets prepared in all five regions of Poland.

Different small, acid-soluble proteins of the alpha/beta type have interchangeable roles in the heat and UV radiation resistance of Bacillus subtilis spores.

PubMed Central

Mason, J M; Setlow, P

1987-01-01

Spores of Bacillus subtilis strains which carry deletion mutations in one gene (sspA) or two genes (sspA and sspB) which code for major alpha/beta-type small, acid-soluble spore proteins (SASP) are known to be much more sensitive to heat and UV radiation than wild-type spores. This heat- and UV-sensitive phenotype was cured completely or in part by introduction into these mutant strains of one or more copies of the sspA or sspB genes themselves; multiple copies of the B. subtilis sspD gene, which codes for a minor alpha/beta-type SASP; or multiple copies of the SASP-C gene, which codes for a major alpha/beta-type SASP of Bacillus megaterium. These findings suggest that alpha/beta-type SASP play interchangeable roles in the heat and UV radiation resistance of bacterial spores. Images PMID:3112127

Analytical Modelling and Optimization of the Temperature-Dependent Dynamic Mechanical Properties of Fused Deposition Fabricated Parts Made of PC-ABS.

PubMed

Mohamed, Omar Ahmed; Masood, Syed Hasan; Bhowmik, Jahar Lal

2016-11-04

Fused deposition modeling (FDM) additive manufacturing has been intensively used for many industrial applications due to its attractive advantages over traditional manufacturing processes. The process parameters used in FDM have significant influence on the part quality and its properties. This process produces the plastic part through complex mechanisms and it involves complex relationships between the manufacturing conditions and the quality of the processed part. In the present study, the influence of multi-level manufacturing parameters on the temperature-dependent dynamic mechanical properties of FDM processed parts was investigated using IV-optimality response surface methodology (RSM) and multilayer feed-forward neural networks (MFNNs). The process parameters considered for optimization and investigation are slice thickness, raster to raster air gap, deposition angle, part print direction, bead width, and number of perimeters. Storage compliance and loss compliance were considered as response variables. The effect of each process parameter was investigated using developed regression models and multiple regression analysis. The surface characteristics are studied using scanning electron microscope (SEM). Furthermore, performance of optimum conditions was determined and validated by conducting confirmation experiment. The comparison between the experimental values and the predicted values by IV-Optimal RSM and MFNN was conducted for each experimental run and results indicate that the MFNN provides better predictions than IV-Optimal RSM.

Analytical Modelling and Optimization of the Temperature-Dependent Dynamic Mechanical Properties of Fused Deposition Fabricated Parts Made of PC-ABS

PubMed Central

Mohamed, Omar Ahmed; Masood, Syed Hasan; Bhowmik, Jahar Lal

2016-01-01

Fused deposition modeling (FDM) additive manufacturing has been intensively used for many industrial applications due to its attractive advantages over traditional manufacturing processes. The process parameters used in FDM have significant influence on the part quality and its properties. This process produces the plastic part through complex mechanisms and it involves complex relationships between the manufacturing conditions and the quality of the processed part. In the present study, the influence of multi-level manufacturing parameters on the temperature-dependent dynamic mechanical properties of FDM processed parts was investigated using IV-optimality response surface methodology (RSM) and multilayer feed-forward neural networks (MFNNs). The process parameters considered for optimization and investigation are slice thickness, raster to raster air gap, deposition angle, part print direction, bead width, and number of perimeters. Storage compliance and loss compliance were considered as response variables. The effect of each process parameter was investigated using developed regression models and multiple regression analysis. The surface characteristics are studied using scanning electron microscope (SEM). Furthermore, performance of optimum conditions was determined and validated by conducting confirmation experiment. The comparison between the experimental values and the predicted values by IV-Optimal RSM and MFNN was conducted for each experimental run and results indicate that the MFNN provides better predictions than IV-Optimal RSM. PMID:28774019

Intellectual Profile of Adolescents with Headache: A Case–Control Study Using the WISC-IV

PubMed Central

Chiappedi, Matteo; Mensi, Martina; Antonaci, Eliana; Zavani, Elena; Tronconi, Livio; Termine, Cristiano; Balottin, Umberto

2018-01-01

There are few literature evidences about the intellectual profile of adolescents with headache and no study has used the fourth edition of the Wechsler Intelligence Scale for Children (WISC-IV) in patients with a diagnosis of headache according to the ICHD-III-beta. We recruited 30 patients (age 11–14 years; male:female = 1:2) seen for headache in a tertiary center in Northern Italy and 30 healthy controls matched for age and sex, recruited in a public school from the same geographic area. The diagnosis of headache was done according to the ICHD-III criteria (beta version): the case group was composed of 16 patients with migraine and 14 with tension-type headache. Cognitive functioning was assessed using the WISC-IV. Recruited patients with idiopathic headache diagnosis had on average a cognitive function within the normal range. We found no statistically significant differences in the total Intellective Quotient comparing patients with headache and controls; the Working Memory Index was, however, lower in patients with headache (p = 0.012), and in particular, we found a lower Digit Span (p < 0.001). We also found a borderline statistical difference (p = 0.051) between case and controls Verbal Comprehension Index (CVI), which was due to a lower score in the Similarities subtest (p < 0.001). Our results suggest that, although within normal limits, cognitive functioning of adolescents with headache differs from that of healthy peers regarding memory and verbal skills. The Working Memory Index is related to the subject’s ability to store new information and keep them in short-term memory, to maintain focused attention and to manipulate them to find solutions. The difference in Similarities is also important because it provides a measure of the level of verbal reasoning and concept formation; it is also a measure of verbal abstract thinking skills relevant for language development, lexical knowledge, auditory comprehension, memory, and ability to discriminate between essential and non-essential characteristics. Our data, in keep with previous findings, suggest the need for further researches to better understand the pathogenesis of these difficulties and obtain ideas for an adequate rehabilitative treatment. PMID:29559952

A new flavonoid from the aerial parts of Tridax procumbens.

PubMed

Ali, M; Ravinder, E; Ramachandram, R

2001-03-01

A new flavonoid (procumbenetin), isolated from the aerial parts of Tridax procumbens, has been characterised as 3,6-dimethoxy-5,7,2',3',4'-pentahydroxyflavone 7-O-beta-D-glucopyranoside (1) on the basis of spectroscopic techniques and by chemical means.

The paradox of MHC-DRB exon/intron evolution: alpha-helix and beta-sheet encoding regions diverge while hypervariable intronic simple repeats coevolve with beta-sheet codons.

PubMed

Schwaiger, F W; Weyers, E; Epplen, C; Brün, J; Ruff, G; Crawford, A; Epplen, J T

1993-09-01

Twenty-one different caprine and 13 ovine MHC-DRB exon 2 sequences were determined including part of the adjacent introns containing simple repetitive (gt)n(ga)m elements. The positions for highly polymorphic DRB amino acids vary slightly among ungulates and other mammals. From man and mouse to ungulates the basic (gt)n(ga)m structure is fixed in evolution for 7 x 10(7) years whereas ample variations exist in the tandem (gt)n and (ga)m dinucleotides and especially their "degenerated" derivatives. Phylogenetic trees for the alpha-helices and beta-pleated sheets of the ungulate DRB sequences suggest different evolutionary histories. In hoofed animals as well as in humans DRB beta-sheet encoding sequences and adjacent intronic repeats can be assembled into virtually identical groups suggesting coevolution of noncoding as well as coding DNA. In contrast alpha-helices and C-terminal parts of the first DRB domain evolve distinctly. In the absence of a defined mechanism causing specific, site-directed mutations, double-recombination or gene-conversion-like events would readily explain this fact. The role of the intronic simple (gt)n(ga)m repeat is discussed with respect to these genetic exchange mechanisms during evolution.

A novel beta-glucosidase from the cell wall of maize (Zea mays L.): rapid purification and partial characterization

NASA Technical Reports Server (NTRS)

Nematollahi, W. P.; Roux, S. J.

1999-01-01

Plants have a variety of glycosidic conjugates of hormones, defense compounds, and other molecules that are hydrolyzed by beta-glucosidases (beta-D-glucoside glucohydrolases, E.C. 3.2.1.21). Workers have reported several beta-glucosidases from maize (Zea mays L.; Poaceae), but have localized them mostly by indirect means. We have purified and partly characterized a 58-Ku beta-glucosidase from maize, which we conclude from a partial sequence analysis, from kinetic data, and from its localization is not identical to any of those already reported. A monoclonal antibody, mWP 19, binds this enzyme, and localizes it in the cell walls of maize coleoptiles. An earlier report showed that mWP19 inhibits peroxidase activity in crude cell wall extracts and can immunoprecipitate peroxidase activity from these extracts, yet purified preparations of the 58 Ku protein had little or no peroxidase activity. The level of sequence similarity between beta-glucosidases and peroxidases makes it unlikely that these enzymes share epitopes in common. Contrary to a previous conclusion, these results suggest that the enzyme recognized by mWP19 is not a peroxidase, but there is a wall peroxidase closely associated with the 58 Ku beta-glucosidase in crude preparations. Other workers also have co-purified distinct proteins with beta-glucosidases. We found no significant charge in the level of immunodetectable beta-glucosidase in mesocotyls or coleoptiles that precedes the red light-induced changes in the growth rate of these tissues.

Bmi-1 extends the life span of normal human oral keratinocytes by inhibiting the TGF-{beta} signaling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Reuben H., E-mail: rkim@dentistry.ucla.edu; UCLA Dental Research Institute, Los Angeles, CA 90095; UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095

2010-10-01

We previously demonstrated that Bmi-1 extended the in vitro life span of normal human oral keratinocytes (NHOK). We now report that the prolonged life span of NHOK by Bmi-1 is, in part, due to inhibition of the TGF-{beta} signaling pathway. Serial subculture of NHOK resulted in replicative senescence and terminal differentiation and activation of TGF-{beta} signaling pathway. This was accompanied with enhanced intracellular and secreted TGF-{beta}1 levels, phosphorylation of Smad2/3, and increased expression of p15{sup INK4B} and p57{sup KIP2}. An ectopic expression of Bmi-1 in NHOK (HOK/Bmi-1) decreased the level of intracellular and secreted TGF-{beta}1 induced dephosphorylation of Smad2/3, andmore » diminished the level of p15{sup INK4B} and p57{sup KIP2}. Moreover, Bmi-1 expression led to the inhibition of TGF-{beta}-responsive promoter activity in a dose-specific manner. Knockdown of Bmi-1 in rapidly proliferating HOK/Bmi-1 and cancer cells increased the level of phosphorylated Smad2/3, p15{sup INK4B}, and p57{sup KIP2}. In addition, an exposure of senescent NHOK to TGF-{beta} receptor I kinase inhibitor or anti-TGF-{beta} antibody resulted in enhanced replicative potential of cells. Taken together, these data suggest that Bmi-1 suppresses senescence of cells by inhibiting the TGF-{beta} signaling pathway in NHOK.« less

Elevated plasma TGF-beta1 in renal diseases: cause or consequence?

PubMed

Junker, U; Haufe, C C; Nuske, K; Rebstock, K; Steiner, T; Wunderlich, H; Junker, K; Reinhold, D

2000-07-01

We previously reported elevated levels of TGF-beta1 in patients with renal carcinoma. Certain aspects led us to ask whether they might be caused by chronic damage to the kidney(s). Here we report on an extended set of patients with various renal diseases, lung cancer, humoral immunodeficiency and controls. For latent TGF-beta1 in plasma, we find that the control, immunodeficiency, lung cancer and kidney transplant groups do not differ significantly (means, 7.0-8.8 ng/ml). Also, acute short-term renal stress (extracorporal lithotrypsy) does not lead to an increase of TGF-beta1. However, the pyelonephritis patients present with levels of 19.0 ng/ml, chronic extracorporal dialysis patients with 15.5 ng/ml, and renal cell carcinoma patients with 22.8 ng/ml. For active TGF-beta1 these findings are exactly recovered. For serum levels, only the renal carcinoma group presents with significantly elevated levels of TGF-beta1. Kidney transplantation seems to normalize TGF-beta1 levels, while in the kidney cancer patients surgery has an effect only in part of the group. We conclude that elevated plasma TGF-beta1 levels are common in at least two chronic renal disease conditions, and that it normalizes with restoration of renal function. It is tempting to speculate that chronic elevation of TGF-beta1 in these patients may be critically involved in these conditions predisposing to renal cancer. Copyright 2000 Academic Press.

Selective stimulation and blockade of beta-adrenergic receptors in the mandibular gland of the red kangaroo, Macropus rufus.

PubMed

Beal, A M

2000-12-01

Intracarotid infusions of noradrenaline (0.15 nmol x kg(-1) x min(-1)) either alone or accompanied by phentolamine (1.5 nmol x kg(-1) x min(-1)) caused similar-sized increases in salivary protein, magnesium and bicarbonate, and decreases in osmolality, sodium, potassium and chloride whereas intravenous noradrenaline stimulated much smaller responses. Concurrent infusions of the beta1-antagonist, CGP20712A, blocked these noradrenaline-induced changes in salivary composition more effectively than equimolar infusions of the beta2-antagonist, ICI118551, thereby confirming the presence of beta1-adrenoceptors. Intracarotid infusion of salbutamol at 0.15, 0.3 and 1.5 nmol x kg(-1) x min(-1) caused increasing but qualitatively similar changes in salivary composition, sodium excepted, to intracarotid noradrenaline with 0.3 nmol being most similar quantitatively. Intravenous infusion of salbutamol caused larger changes in salivary composition than equimolar intravenous noradrenaline thereby indicating that the response to salbutamol may, in part, be mediated by reflex increases in general sympathetic tone triggered by lowered blood pressure. Eliminating this hypotensive effect by concurrent intravenous and intracarotid infusions of beta1-(CGP or atenolol) and beta2-(ICII18551) antagonists with intracarotid salbutamol showed that IC1118551 was more potent than the beta1-antagonists thereby demonstrating the presence of beta2-receptors. It was concluded that the kangaroo mandibular has functional beta1- and beta2-adrenoceptor subtypes in both endpieces and excurrent ducts and that the duct system has two populations of cells, each expressing one receptor subtype.

National Water Infrastructure Adaptation Assessment, Part I: Climate Change Adaptation Readiness Analysis

EPA Science Inventory

The report “National Water Infrastructure Adaptation Assessment” is comprised of four parts (Part I to IV), each in an independent volume. The Part I report presented herein describes a preliminary regulatory and technical analysis of water infrastructure and regulations in the ...

Involvement of DNA polymerase beta in repairing oxidative damages induced by antitumor drug adriamycin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu Shukun; Wu Mei; Zhang Zunzhen, E-mail: zhangzunzhen@163.co

2010-08-01

Adriamycin (ADM) is a widely used antineoplastic drug. However, the increasing cellular resistance has become a serious limitation to ADM clinical application. The most important mechanism related to ADM-induced cell death is oxidative DNA damage mediated by reactive oxygen species (ROS). Base excision repair (BER) is a major pathway in the repair of DNA single strand break (SSB) and oxidized base. In this study, we firstly applied the murine embryo fibroblasts wild-type (pol {beta} +/+) and homozygous pol {beta} null cell (pol {beta} -/-) as a model to investigate ADM DNA-damaging effects and the molecular basis underlying these effects. Here,more » cellular sensitivity to ADM was examined using colorimetric assay and colony forming assay. ADM-induced cellular ROS level and the alteration of superoxide dismutase (SOD) activity were measured by commercial kits. Further, DNA strand break, chromosomal damage and gene mutation were assessed by comet assay, micronucleus test and hprt gene mutation assay, respectively. The results showed that pol {beta} -/- cells were more sensitive to ADM compared with pol {beta} +/+ cells and more severe SSB and chromosomal damage as well as higher hprt gene mutation frequency were observed in pol {beta} -/- cells. ROS level in pol {beta} -/- cells increased along with decreased activity of SOD. These results demonstrated that pol {beta} deficiency could enable ROS accumulation with SOD activity decrease, further elevate oxidative DNA damage, and subsequently result in SSB, chromosome cleavage as well as gene mutation, which may be partly responsible for the cytotoxicity of ADM and the hypersensitivity of pol {beta} -/- cells to ADM. These findings suggested that pol {beta} is vital for repairing oxidative damage induced by ADM.« less

A proteomics strategy to discover beta-glucosidases from Aspergillus fumigatus with two-dimensional page in-gel activity assay and tandem mass spectrometry.

PubMed

Kim, Kee-Hong; Brown, Kimberly M; Harris, Paul V; Langston, James A; Cherry, Joel R

2007-12-01

Economically competitive production of ethanol from lignocellulosic biomass by enzymatic hydrolysis and fermentation is currently limited, in part, by the relatively high cost and low efficiency of the enzymes required to hydrolyze cellulose to fermentable sugars. Discovery of novel cellulases with greater activity could be a critical step in overcoming this cost barrier. beta-Glucosidase catalyzes the final step in conversion of glucose polymers to glucose. Despite the importance, only a few beta-glucosidases are commercially available, and more efficient ones are clearly needed. We developed a proteomics strategy aiming to discover beta-glucosidases present in the secreted proteome of the cellulose-degrading fungus Aspergillus fumigatus. With the use of partial or complete protein denaturing conditions, the secretory proteome was fractionated in a 2DGE format and beta-glucosidase activity was detected in the gel after infusion with a substrate analogue that fluoresces upon hydrolysis. Fluorescing spots were subjected to tryptic-digestion, and identification as beta-glucosidases was confirmed by tandem mass spectrometry. Two novel beta-glucosidases of A. fumigatus were identified by this in situ activity staining method, and the gene coding for a novel beta-glucosidase ( EAL88289 ) was cloned and heterologously expressed. The expressed beta-glucosidase showed far superior heat stability to the previously characterized beta-glucosidases of Aspergillus niger and Aspergillus oryzae. Improved heat stability is important for development of the next generation of saccharifying enzymes capable of performing fast cellulose hydrolysis reactions at elevated temperatures, thereby lowering the cost of bioethanol production. The in situ activity staining approach described here would be a useful tool for cataloguing and assessing the efficiency of beta-glucosidases in a high throughput fashion.

Chondrocyte heterogeneity: immunohistologically defined variation of integrin expression at different sites in human fetal knees.

PubMed

Salter, D M; Godolphin, J L; Gourlay, M S

1995-04-01

During development and at maturity different forms of cartilage vary in morphology and macromolecular content. This reflects heterogeneity of chondrocyte activity, in part involving differential interactions with the adjacent extracellular matrix via specialized cell surface receptors such as integrins. We undertook an immunohistological study on a series of human fetal knee joints to assess variation in the expression of integrins by chondrocytes and potential matrix ligands in articular, epiphyseal, growth plate, and meniscal cartilage. The results show that articular chondrocytes (beta 1+, beta 5 alpha V+, alpha 1+, alpha 2+/-, alpha 5+, weakly alpha 6+, alpha V+) differed from epiphyseal (beta 1+, beta 5 alpha V+, alpha 1+/-, alpha 2+/-, alpha 5+, alpha 6+, alpha V+) growth plate (beta 1+, beta 5 alpha V+, alpha 1-, alpha 2-, alpha 5+, alpha 6+, alpha V+), and meniscal cells (beta 1+, beta 5 alpha V+, alpha 1+, strongly alpha 2+, alpha 5+, alpha 6+, alpha V+ in expression of integrin subunits. There was no expression of beta 3, beta 4, beta 6, or alpha 3 by chondrocytes. These results differ from previous reports on the expression of integrins by adult articular cartilage, where alpha 2 and alpha 6 are not seen. Variation in distribution of matrix ligands was also seen. Fibronectin, laminin and Type VI collagen were expressed in all cartilages but there was restricted expression of tenascin, ED-A and ED-B fibronectin isoforms (articular cartilage and meniscus), and vitronectin (absent from growth plate cartilage). Regulated expression of integrins by chondrocytes, associated with changes in the pericellular matrix composition, is of potential importance in control of cartilage differentiation and function in health and disease.

Genetic models rule out a major role of beta cell glycogen in the control of glucose homeostasis.

PubMed

Mir-Coll, Joan; Duran, Jordi; Slebe, Felipe; García-Rocha, Mar; Gomis, Ramon; Gasa, Rosa; Guinovart, Joan J

2016-05-01

Glycogen accumulation occurs in beta cells of diabetic patients and has been proposed to partly mediate glucotoxicity-induced beta cell dysfunction. However, the role of glycogen metabolism in beta cell function and its contribution to diabetes pathophysiology remain poorly understood. We investigated the function of beta cell glycogen by studying glucose homeostasis in mice with (1) defective glycogen synthesis in the pancreas; and (2) excessive glycogen accumulation in beta cells. Conditional deletion of the Gys1 gene and overexpression of protein targeting to glycogen (PTG) was accomplished by Cre-lox recombination using pancreas-specific Cre lines. Glucose homeostasis was assessed by determining fasting glycaemia, insulinaemia and glucose tolerance. Beta cell mass was determined by morphometry. Glycogen was detected histologically by periodic acid-Schiff's reagent staining. Isolated islets were used for the determination of glycogen and insulin content, insulin secretion, immunoblots and gene expression assays. Gys1 knockout (Gys1 (KO)) mice did not exhibit differences in glucose tolerance or basal glycaemia and insulinaemia relative to controls. Insulin secretion and gene expression in isolated islets was also indistinguishable between Gys1 (KO) and controls. Conversely, despite effective glycogen overaccumulation in islets, mice with PTG overexpression (PTG(OE)) presented similar glucose tolerance to controls. However, under fasting conditions they exhibited lower glycaemia and higher insulinaemia. Importantly, neither young nor aged PTG(OE) mice showed differences in beta cell mass relative to age-matched controls. Finally, a high-fat diet did not reveal a beta cell-autonomous phenotype in either model. Glycogen metabolism is not required for the maintenance of beta cell function. Glycogen accumulation in beta cells alone is not sufficient to trigger the dysfunction or loss of these cells, or progression to diabetes.

Regulation of the mRNA-binding protein AUF1 by activation of the beta-adrenergic receptor signal transduction pathway.

PubMed

Pende, A; Tremmel, K D; DeMaria, C T; Blaxall, B C; Minobe, W A; Sherman, J A; Bisognano, J D; Bristow, M R; Brewer, G; Port, J

1996-04-05

In both cell culture based model systems and in the failing human heart, beta-adrenergic receptors ( beta-AR) undergo agonist-mediated down-regulation. This decrease correlates closely with down-regulation of its mRNA, an effect regulated in part by changes in mRNA stability. Regulation of mRNA stability has been associated with mRNA-binding proteins that recognize A + U-rich elements within the 3'-untranslated regions of many mRNAs encoding proto-oncogene and cytokine mRNAs. We demonstrate here that the mRNA-binding protein, AUF1, is present in both human heart and in hamster DDT1-MF2 smooth muscle cells and that its abundance is regulated by beta-AR agonist stimulation. In human heart, AUF1 mRNA and protein was significantly increased in individuals with myocardial failure, a condition associated with increases in the beta-adrenergic receptor agonist norepinephrine. In the same hearts, there was a significant decrease (approximately 50%) in the abundance of beta1-AR mRNA and protein. In DDT1-MF2 cells, where agonist-mediated destabilization of beta2-AR mRNA was first described, exposure to beta-AR agonist resulted in a significant increase in AUF1 mRNA and protein (approximately 100%). Conversely, agonist exposure significantly decreased (approximately 40%) beta2-adrenergic receptor mRNA abundance. Last, we demonstrate that AUF1 can be immunoprecipitated from polysome-derived proteins following UV cross-linking to the 3'-untranslated region of the human beta1-AR mRNA and that purified, recombinant p37AUF1 protein also binds to beta1-AR 3'-untranslated region mRNA.

Fibrinogen variant B[beta]D432A has normal polymerization but does not bind knob 'B'

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bowley, Sheryl R.; Lord, Susan T.; UNC)

2009-10-23

Fibrinogen residue B{beta}432Asp is part of hole 'b' that interacts with knob 'B,' whose sequence starts with Gly-His-Arg-Pro-amide (GHRP). Because previous studies showed B{beta}D432A has normal polymerization, we hypothesized that B{beta}432Asp is not critical for knob 'B' binding and that new knob-hole interactions would compensate for the loss of this Asp residue. To test this hypothesis, we solved the crystal structure of fragment D from B{beta}D432A. Surprisingly, the structure (rfD-B{beta}D432A+GH) showed the peptide GHRP was not bound to hole 'b.' We then re-evaluated the polymerization of this variant by examining clot turbidity, clot structure, and the rate of FXIIIa cross-linking.more » The turbidity and the rate of - dimer formation for B{beta}D432A were indistinguishable compared with normal fibrinogen. Scanning electron microscopy showed no significant differences between the clots of B{beta}D432A and normal, but the thrombin-derived clots had thicker fibers than clots obtained from batroxobin, suggesting that cleavage of FpB is more important than 'B:b' interactions. We conclude that hole 'b' and 'B:b' knob-hole binding per se have no influence on fibrin polymerization.« less

Existence of a regulatory loop between MCP-1 and TGF-beta in glomerular immune injury.

PubMed

Wolf, Gunter; Jocks, Thomas; Zahner, Gunther; Panzer, Ulf; Stahl, Rolf A K

2002-11-01

Glomerular upregulation of monocyte chemotactic protein-1 (MCP-1), followed by an influx of monocytes resulting eventually in extracellular matrix deposition is a common sequel of many types of glomerulonephritis. However, it is not entirely clear how early expression of MCP-1 is linked to the later development of glomerulosclerosis. Because transforming growth factor-beta (TGF-beta) is a key regulator of extracellular matrix proteins, we hypothesized that there might be a regulatory loop between early glomerular MCP-1 induction and subsequent TGF-beta expression. To avoid interference with other cytokines that may be released from infiltrating monocytes, isolated rat kidneys were perfused with a polyclonal anti-thymocyte-1 antiserum (ATS) and rat serum (RS) as a complement source to induce glomerular injury. Renal TGF-beta protein and mRNA expressions were strongly stimulated after perfusion with ATS-RS. This effect was attenuated by coperfusion with a neutralizing anti-MCP-1 but was partly mimicked by perfusion with recombinant MCP-1 protein. On the other hand, renal MCP-1 expression and production were stimulated by administration of ATS-RS. Additional perfusion with an anti-TGF-beta antibody further aggravated this increase, whereas application of recombinant TGF-beta protein reduced MCP-1 formation. Our data demonstrate an intrinsic regulatory loop in which increased MCP-1 levels stimulate TGF-beta formation in resident glomerular cells in the absence of infiltrating immune competent cells.

Willis Lamb, Jr., the Hydrogen Atom, and the Lamb Shift

Science.gov Websites

1955, Lamb won the Nobel Prize in Physics for his discoveries concerning "the fine structure of , May 7 - September 30, 1979 Fine Structure of the Hydrogen Atom, Part I; Part II; Part III; Part IV ; Part V; Part VI (from Physical Review 1950-1953) Microwave Technique for Determining the Fine Structure

Societal cost of subcutaneous and intravenous trastuzumab for HER2-positive breast cancer - An observational study prospectively recording resource utilization in a Swedish healthcare setting.

PubMed

Olofsson, Sara; Norrlid, Hanna; Karlsson, Eva; Wilking, Ulla; Ragnarson Tennvall, Gunnel

2016-10-01

Trastuzumab is part of the standard treatment for HER2-positive breast cancer. The aim of this study was to estimate the societal value of trastuzumab administered through subcutaneous (SC) injection compared to intravenous (IV) infusion. Female patients with HER2-positive breast cancer receiving SC or IV trastuzumab were consecutively enrolled from five Swedish oncology clinics from 2013 to 2015. Data on time and resource utilization was collected prospectively using patient and nurse questionnaires. Societal costs were calculated by multiplying the resource use by its corresponding unit price, including direct medical costs (pharmaceuticals, materials, nurse time, etc.), direct non-medical costs (transportation) and indirect costs (production loss, lost leisure time). Costs were reported separately for patients receiving trastuzumab for the first time and non-first time ("subsequent treatment"). In total, 101 IV and 94 SC patients were included in the study. The societal costs were lower with SC administration. For subsequent treatments the cost difference was €117 (IV €2099; SC €1983), partly explained by a higher time consumption both for nurses (14 min) and patients (23 min) with IV administration. Four IV and 16 SC patients received trastuzumab for the first time and were analysed separately, resulting in a difference in societal costs of €897 per treatment. A majority of patients preferred SC to IV administration. SC administration resulted in both less direct medical costs and indirect costs, and was consequently less costly than IV administration from a societal perspective in a Swedish setting. Copyright © 2016 Elsevier Ltd. All rights reserved.

Both conditional ablation and overexpression of E2 SUMO-conjugating enzyme (UBC9) in mouse pancreatic beta cells result in impaired beta cell function.

PubMed

He, Xiaoyu; Lai, Qiaohong; Chen, Cai; Li, Na; Sun, Fei; Huang, Wenting; Zhang, Shu; Yu, Qilin; Yang, Ping; Xiong, Fei; Chen, Zhishui; Gong, Quan; Ren, Boxu; Weng, Jianping; Eizirik, Décio L; Zhou, Zhiguang; Wang, Cong-Yi

2018-04-01

Post-translational attachment of a small ubiquitin-like modifier (SUMO) to the lysine (K) residue(s) of target proteins (SUMOylation) is an evolutionary conserved regulatory mechanism. This modification has previously been demonstrated to be implicated in the control of a remarkably versatile regulatory mechanism of cellular processes. However, the exact regulatory role and biological actions of the E2 SUMO-conjugating enzyme (UBC9)-mediated SUMOylation function in pancreatic beta cells has remained elusive. Inducible beta cell-specific Ubc9 (also known as Ube2i) knockout (KO; Ubc9 Δbeta ) and transgenic (Ubc9 Tg ) mice were employed to address the impact of SUMOylation on beta cell viability and functionality. Ubc9 deficiency or overexpression was induced at 8 weeks of age using tamoxifen. To study the mechanism involved, we closely examined the regulation of the transcription factor nuclear factor erythroid 2-related factor 2 (NRF2) through SUMOylation in beta cells. Upon induction of Ubc9 deficiency, Ubc9 Δbeta islets exhibited a 3.5-fold higher accumulation of reactive oxygen species (ROS) than Ubc9 f/f control islets. Islets from Ubc9 Δbeta mice also had decreased insulin content and loss of beta cell mass after tamoxifen treatment. Specifically, at day 45 after Ubc9 deletion only 40% of beta cell mass remained in Ubc9 Δbeta mice, while 90% of beta cell mass was lost by day 75. Diabetes onset was noted in some Ubc9 Δbeta mice 8 weeks after induction of Ubc9 deficiency and all mice developed diabetes by 10 weeks following tamoxifen treatment. In contrast, Ubc9 Tg beta cells displayed an increased antioxidant ability but impaired insulin secretion. Unlike Ubc9 Δbeta mice, which spontaneously developed diabetes, Ubc9 Tg mice preserved normal non-fasting blood glucose levels without developing diabetes. It was noted that SUMOylation of NRF2 promoted its nuclear expression along with enhanced transcriptional activity, thereby preventing ROS accumulation in beta cells. SUMOylation function is required to protect against oxidative stress in beta cells; this mechanism is, at least in part, carried out by the regulation of NRF2 activity to enhance ROS detoxification. Homeostatic SUMOylation is also likely to be essential for maintaining beta cell functionality.

Advancement Of Tritium Powered Betavoltaic Battery Systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Staack, G.; Gaillard, J.; Hitchcock, D.

2015-10-14

Due to their decades-long service life and reliable power output under extreme conditions, betavoltaic batteries offer distinct advantages over traditional chemical batteries, especially in applications where frequent battery replacement is hazardous, or cost prohibitive. Although many beta emitting isotopes exist, tritium is considered ideal in betavoltaic applications for several reasons: 1) it is a “pure” beta emitter, 2) the beta is not energetic enough to damage the semiconductor, 3) it has a moderately long half-life, and 4) it is readily available. Unfortunately, the widespread application of tritium powered betavoltaics is limited, in part, by their low power output. This researchmore » targets improving the power output of betavoltaics by increasing the flux of beta particles to the energy conversion device (the p-n junction) through the use of low Z nanostructured tritium trapping materials.« less

Quantitative EEG in Children and Adults With Attention Deficit Hyperactivity Disorder: Comparison of Absolute and Relative Power Spectra and Theta/Beta Ratio.

PubMed

Markovska-Simoska, Silvana; Pop-Jordanova, Nada

2017-01-01

In recent decades, resting state electroencephalographic (EEG) measures have been widely used to document underlying neurophysiological dysfunction in attention deficit hyperactivity disorder (ADHD). Although most EEG studies focus on children, there is a growing interest in adults with ADHD too. The aim of this study was to objectively assess and compare the absolute and relative EEG power as well as the theta/beta ratio in children and adults with ADHD. The evaluated sample comprised 30 male children and 30 male adults with ADHD diagnosed according to DSM-IV criteria. They were compared with 30 boys and 30 male adults matched by age. The mean age (±SD) of the children's group was 9 (±2.44) years and the adult group 35.8 (±8.65) years. EEG was recorded during an eyes-open condition. Spectral analysis of absolute (μV 2 ) and relative power (%) was carried out for 4 frequency bands: delta (2-4 Hz), theta (4-8 Hz), alpha (8-13 Hz), and beta (13-21 Hz). The findings obtained for ADHD children are increased absolute power of slow waves (theta and delta), whereas adults exhibited no differences compared with normal subjects. For the relative power spectra there were no differences between the ADHD and control groups. Across groups, the children showed greater relative power than the adults in the delta and theta bands, but for the higher frequency bands (alpha and beta) the adults showed more relative power than children. Only ADHD children showed greater theta/beta ratio compared to the normal group. Classification analysis showed that ADHD children could be differentiated from the control group by the absolute theta values and theta/beta ratio at Cz, but this was not the case with ADHD adults. The question that should be further explored is if these differences are mainly due to maturation processes or if there is a core difference in cortical arousal between ADHD children and adults. © EEG and Clinical Neuroscience Society (ECNS) 2016.

34 CFR 668.26 - End of an institution's participation in the Title IV, HEA programs.

Code of Federal Regulations, 2010 CFR

2010-07-01

... institution's students; (2) The institution loses its institutional eligibility under 34 CFR part 600; (3) The...) All financial, performance, and other reports required by appropriate Title IV, HEA program... Aid Report to the institution or when an institution has received a valid institutional student...

12 CFR Appendix A to Part 1720 - Policy Guidance; Minimum Safety and Soundness Requirements

Code of Federal Regulations, 2011 CFR

2011-01-01

... effectively and to model the effect of differing interest rate scenarios on the Enterprise's financial... liquidity under varying scenarios. IV. Information technology. An Enterprise should establish and implement... functions; iv. Adequate testing and review of audited areas together with adequate documentation of findings...

Title IV Indian Education Program Evaluation 1986-87.

ERIC Educational Resources Information Center

Albuquerque Public Schools, NM. Planning, Research and Accountability.

Albuquerque (New Mexico) public schools used a Title IV Part A grant to improve academic and behavioral functioning of American Indian elementary and secondary school students. The program's focus was tutoring provided to 899 Indian students from Canoncito Navajo Reservation, the Isleta Pueblo, and the city. A project coordinator, a resource…

Title IV Indian Education Program Evaluation, 1985-86.

ERIC Educational Resources Information Center

Albuquerque Public Schools, NM. Planning, Research and Accountability.

Public schools in Albuquerque, New Mexico, used a Title IV Part A grant to assist American Indian elementary and secondary school students in receiving passing grades and improving school-related behaviors. Canoncito Navajo Reservation, the Isleta Pueblo, and urban Indian students in Albuquerque participated in the program. Personnel consisted of…

14 CFR 61.5 - Certificates and ratings issued under this part.

Code of Federal Regulations, 2010 CFR

2010-01-01

.... (iii) Glider. (iv) Lighter-than-air. (v) Powered-lift. (vi) Powered parachute. (vii) Weight-shift...—Airplane. (ii) Instrument—Helicopter. (iii) Instrument—Powered-lift. (c) The following ratings are placed.... (iii) Glider. (iv) Powered-lift. (2) Airplane class ratings— (i) Single-engine. (ii) Multiengine. (3...

14 CFR 61.5 - Certificates and ratings issued under this part.

Code of Federal Regulations, 2011 CFR

2011-01-01

.... (iii) Glider. (iv) Lighter-than-air. (v) Powered-lift. (vi) Powered parachute. (vii) Weight-shift...—Airplane. (ii) Instrument—Helicopter. (iii) Instrument—Powered-lift. (c) The following ratings are placed.... (iii) Glider. (iv) Powered-lift. (2) Airplane class ratings— (i) Single-engine. (ii) Multiengine. (3...

45 CFR 309.01 - What does this part cover?

Code of Federal Regulations, 2011 CFR

2011-10-01

... Public Welfare Regulations Relating to Public Welfare OFFICE OF CHILD SUPPORT ENFORCEMENT (CHILD SUPPORT... CHILD SUPPORT ENFORCEMENT (IV-D) PROGRAM Tribal IV-D Program: General Provisions § 309.01 What does this... Social Security Act. Section 455(f) of the Act authorizes direct grants to Indian Tribes and Tribal...

Targeting Cellular Calcium Homeostasis to Prevent Cytokine-Mediated Beta Cell Death.

PubMed

Clark, Amy L; Kanekura, Kohsuke; Lavagnino, Zeno; Spears, Larry D; Abreu, Damien; Mahadevan, Jana; Yagi, Takuya; Semenkovich, Clay F; Piston, David W; Urano, Fumihiko

2017-07-17

Pro-inflammatory cytokines are important mediators of islet inflammation, leading to beta cell death in type 1 diabetes. Although alterations in both endoplasmic reticulum (ER) and cytosolic free calcium levels are known to play a role in cytokine-mediated beta cell death, there are currently no treatments targeting cellular calcium homeostasis to combat type 1 diabetes. Here we show that modulation of cellular calcium homeostasis can mitigate cytokine- and ER stress-mediated beta cell death. The calcium modulating compounds, dantrolene and sitagliptin, both prevent cytokine and ER stress-induced activation of the pro-apoptotic calcium-dependent enzyme, calpain, and partly suppress beta cell death in INS1E cells and human primary islets. These agents are also able to restore cytokine-mediated suppression of functional ER calcium release. In addition, sitagliptin preserves function of the ER calcium pump, sarco-endoplasmic reticulum Ca 2+ -ATPase (SERCA), and decreases levels of the pro-apoptotic protein thioredoxin-interacting protein (TXNIP). Supporting the role of TXNIP in cytokine-mediated cell death, knock down of TXNIP in INS1-E cells prevents cytokine-mediated beta cell death. Our findings demonstrate that modulation of dynamic cellular calcium homeostasis and TXNIP suppression present viable pharmacologic targets to prevent cytokine-mediated beta cell loss in diabetes.

Monitoring dediazoniation product formation by high-performance liquid chromatography after derivatization.

PubMed

Bravo-Díaz, Carlos; González-Romero, Elisa

2003-03-14

A derivatization protocol that exploits the rapid reaction between arenediazonium ions and a suitable coupling agent followed by high-performance liquid chromatography analyses of the reaction mixture was employed to determine the product distribution, the rate constants for product formation and the association constant of 4-nitrobenzenediazonium, PNBD, ion with beta-cyclodextrin, beta-CD. The derivatization of PNBD with the coupling agent leads to the formation of a stable azo dye that prevents by-side reactions of PNBD with the solvents of the mobile phase, including water, or the metallic parts of the chromatographic system that would eventually lead to erroneous identification and quantification of dediazoniation products. The results show that in the presence of beta-CD, nitrobenzene is formed at the expense of 4-nitrophenol, which is the major product in its absence. The observed rate constants for the interaction between PNBD and beta-CD increase upon increasing [beta-CD] showing a saturation profile indicative of the formation of an inclusion complex between PNBD and beta-CD. By fitting the experimental data to a simplified Lineaweaver-Burk equation, the corresponding association constant and the maximum acceleration rate of beta-CD towards PNBD were estimated. The protocol is applicable under a variety of experimental conditions provided that the rate of the coupling reaction is much faster than that of dediazoniation.

Learning curves of theta/beta neurofeedback in children with ADHD.

PubMed

Janssen, Tieme W P; Bink, Marleen; Weeda, Wouter D; Geladé, Katleen; van Mourik, Rosa; Maras, Athanasios; Oosterlaan, Jaap

2017-05-01

Neurofeedback is widely applied as non-pharmacological intervention aimed at reducing symptoms of ADHD, even though efficacy has not been unequivocally established. Neuronal changes during the neurofeedback intervention that resemble learning can provide crucial evidence for the feasibility and specificity of this intervention. A total of 38 children (aged between 7 and 13 years) with a DSM-IV-TR diagnosis of ADHD, completed on average 29 sessions of theta (4-8 Hz)/beta (13-20 Hz) neurofeedback training. Dependent variables included training-related measures as well as theta and beta power during baseline and training runs for each session. Learning effects were analyzed both within and between sessions. To further specify findings, individual learning curves were explored and correlated with behavioral changes in ADHD symptoms. Over the course of the training, there was a linear increase in participants' mean training level, highest obtained training level and the number of earned credits (range b = 0.059, -0.750, p < 0.001). Theta remained unchanged over the course of the training, while beta activity increased linearly within training sessions (b = 0.004, 95% CI = [0.0013-0.0067], p = 0.005) and over the course of the intervention (b = 0.0052, 95% CI = [0.0039-0.0065], p < 0.001). In contrast to the group analyses, significant individual learning curves were found for both theta and beta over the course of the intervention in 39 and 53%, respectively. Individual learning curves were not significantly correlated with behavioral changes. This study shows that children with ADHD can gain control over EEG states during neurofeedback, although a lack of behavioral correlates may indicate insufficient transfer to daily functioning, or to confounding reinforcement of electromyographic activity. This trial is registered at the US National Institutes of Health (ClinicalTrials.gov, ref. no: NCT01363544); https://clinicaltrials.gov/show/NCT01363544 .

Inhibition of intestinal microflora beta-glucuronidase modifies the distribution of the active metabolite of the antitumor agent, irinotecan hydrochloride (CPT-11) in rats.

PubMed

Takasuna, K; Hagiwara, T; Hirohashi, M; Kato, M; Nomura, M; Nagai, E; Yokoi, T; Kamataki, T

1998-01-01

SN-38, a metabolite of irinotecan hydrochloride (CPT-11), is considered to play a key role in the development of diarrhea as well as in the antitumor activity of CPT-11. We have previously found that the inhibition of beta-glucuronidase, which hydrolyzes detoxified SN-38 (SN-38 glucuronide) to reform SN-38, in the lumen by eliminating the intestinal microflora with antibiotics, markedly ameliorates the intestinal toxicity of CPT-11 in rats. In this study we compared the disposition of CPT-11 and its metabolites in rats treated with and without antibiotics. Rats were given drinking water containing 1 mg/ml penicillin and 2 mg/ml streptomycin from 5 days before the administration of CPT-11 (60 mg/kg i.v.) and throughout the experiment. CPT-11, SN-38 glucuronide and SN-38 concentrations in the blood, intestinal tissues and intestinal luminal contents were determined by HPLC. Antibiotics had little or no effect on the pharmacokinetics of CPT-11, SN-38 glucuronide or SN-38 in the blood, or in the tissues or contents of the small intestine, which has less beta-glucuronidase activity in its luminal contents. In contrast, antibiotics markedly reduced the AUC1-24 h of SN-38 (by about 85%) in the large intestine tissue without changing that of CPT-11, and this was accompanied by a complete inhibition of the deconjugation of SN-38 glucuronide in the luminal contents. These results suggest that SN-38, which results from the hydrolysis of SN-38 glucuronide by beta-glucuronidase in the intestinal microflora, contributes considerably to the distribution of SN-38 in the large intestine tissue, and that inhibition of the beta-glucuronidase activity by antibiotics results in decreased accumulation of SN-38 in the large intestine.

Chemistry and Biology of Aflatoxin-DNA Adducts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stone, Michael P.; Banerjee, Surajit; Brown, Kyle L.

Aspergillus flavus is a fungal contaminant of stored rice, wheat, corn, and other grainstuffs, and peanuts. This is of concern to human health because it produces the mycotoxin aflatoxin B{sub 1} (AFB{sub 1}), which is genotoxic and is implicated in the etiology of liver cancer. AFB{sub 1} is oxidized in vivo by cytochrome P450 to form aflatoxin B{sub 1} epoxide, which forms an N7-dG adduct (AFB{sub 1}-N7-dG) in DNA. The latter rearranges to a formamidopyrimidine (AFB{sub 1}-FAPY) derivative that equilibrates between {alpha} and {beta} anomers of the deoxyribose. In DNA, both the AFB{sub 1}-N7-dG and AFB{sub 1}-{beta}-FAPY adducts intercalate abovemore » the 5'-face of the damaged guanine. Each produces G {yields} T transversions in Escherichia coli, but the AFB{sub 1}-{beta}-FAPY adduct is more mutagenic. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) provides a model for understanding error-prone bypass of the AFB{sub 1}-N7-dG and AFB{sub 1}-{beta}-FAPY adducts. It bypasses the AFB{sub 1}-N7-dG adduct, but it conducts error-prone replication past the AFB{sub 1}-FAPY adduct, including mis-insertion of dATP, consistent with the G {yields} T mutations characteristic of AFB{sub 1} mutagenesis in E. coli. Crystallographic analyses of a series of binary and ternary complexes with the Dpo4 polymerase revealed differing orientations of the N7-C8 bond of the AFB{sub 1}-N7-dG adduct as compared to the N{sup 5}-C8 bond in the AFB{sub 1}-{beta}-FAPY adduct, and differential accommodation of the intercalated AFB{sub 1} moieties within the active site. These may modulate AFB{sub 1} lesion bypass by this polymerase.« less

Theory of Holors

NASA Astrophysics Data System (ADS)

Hiram Moon, Parry; Eberle Spencer, Domina

2005-09-01

Preface; Nomenclature; Historical introduction; Part I. Holors: 1. Index notation; 2. Holor algebra; 3. Gamma products; Part II. Transformations: 4. Tensors; 5. Akinetors; 6. Geometric spaces; Part III. Holor Calculus: 7. The linear connection; 8. The Riemann-Christoffel tensors; Part IV. Space Structure: 9. Non-Riemannian spaces; 10. Riemannian space; 11. Euclidean space; References; Index.

Quality evaluation of Radix Astragali through a simultaneous determination of six major active isoflavonoids and four main saponins by high-performance liquid chromatography coupled with diode array and evaporative light scattering detectors.

PubMed

Qi, Lian-Wen; Yu, Qing-Tao; Li, Ping; Li, Song-Lin; Wang, Yu-Xia; Sheng, Liang-Hong; Yi, Ling

2006-11-17

A method, high-performance liquid chromatography coupled with diode array and evaporative light scattering detectors (HPLC-DAD-ELSD), was developed to evaluate the quality of Radix Astragali through a simultaneous determination of six major active isoflavonoids and four main saponins. The wavelength at 280 nm was chosen to determine six isoflavonoids: calycosin-7-O-beta-D-glucoside (1), ononin (2), (6alphaR, 11alphaR)-9,10-dimethoxypterocarpan-3-O-beta-D-glucoside (3), (3R)-2'-hydroxy-3',4'-dimethoxyisoflavan-7-O-beta-D-glucoside (4), calycosin (5), and formononetin (6); and ELSD connected after DAD was employed to determine four saponins: astragaloside IV (7), astragaloside II (8), astragaloside I (9), and acetylastragaloside I (10). This assay was fully validated with respect to precision, repeatability and accuracy. The proposed method was successfully applied to quantify the ten components in eleven samples from different localities in China; significant variations were demonstrated in the content of these compounds in the samples from different areas. This simple, rapid, low-cost and reliable HPLC-DAD-ELSD method is suitable for routine quantitative analysis and quality control of traditional Chinese medicines (TCMs) consisting of bioactive multi-components with different structures such as Radix Astragali.

Adherence to subcutaneous interferon beta-1a treatment using an electronic injection device: a prospective open-label Scandinavian noninterventional study (the ScanSmart study)

PubMed Central

Pedersen, Elena Didenko; Stenager, Egon; Vadgaard, JL; Jensen, MB; Schmid, R; Meland, N; Magnussen, G; Frederiksen, Jette L

2018-01-01

Background Disease modifying drugs help control the course of relapsing remitting multiple sclerosis (RRMS); however, good adherence is needed for long-term outcomes. Objective To evaluate patient adherence to treatment with subcutaneous interferon beta-1a using RebiSmart® and assess injection-site reactions and treatment satisfaction. Methods This prospective, single-arm, open-label, noninterventional multicenter Phase IV trial included disease modifying drug-experienced mobile patients with RRMS. Adherence was measured over 12 weeks. Items 13–23, 35, 37, and 38 of the Multiple Sclerosis Treatment Concerns Questionnaire (injection-site reactions and treatment satisfaction) were recorded at 12 weeks. Results Sixty patients were recruited (mean age 43.7 [±SD 7.9] years; 83% female; mean years since multiple sclerosis diagnosis 6.7 [SD 4.5]). Adherence data were obtained in 54 patients only due to technical problems with six devices. Over 12 weeks, 89% (n=48) of patients had ≥90% adherence to treatment. Most patients experienced mild influenza-like symptoms and injection-site reactions, and global side effects were minimal. Most patients (78%) rated the convenience as the most important aspect of the device, and most experienced no or mild pain. Conclusion RRMS patients treated with subcutaneous interferon beta-1a, administered with RebiSmart, demonstrated generally good adherence, and the treatment was generally well tolerated. PMID:29720872

Adherence to subcutaneous interferon beta-1a treatment using an electronic injection device: a prospective open-label Scandinavian noninterventional study (the ScanSmart study).

PubMed

Pedersen, Elena Didenko; Stenager, Egon; Vadgaard, J L; Jensen, M B; Schmid, R; Meland, N; Magnussen, G; Frederiksen, Jette L

2018-01-01

Disease modifying drugs help control the course of relapsing remitting multiple sclerosis (RRMS); however, good adherence is needed for long-term outcomes. To evaluate patient adherence to treatment with subcutaneous interferon beta-1a using RebiSmart ® and assess injection-site reactions and treatment satisfaction. This prospective, single-arm, open-label, noninterventional multicenter Phase IV trial included disease modifying drug-experienced mobile patients with RRMS. Adherence was measured over 12 weeks. Items 13-23, 35, 37, and 38 of the Multiple Sclerosis Treatment Concerns Questionnaire (injection-site reactions and treatment satisfaction) were recorded at 12 weeks. Sixty patients were recruited (mean age 43.7 [±SD 7.9] years; 83% female; mean years since multiple sclerosis diagnosis 6.7 [SD 4.5]). Adherence data were obtained in 54 patients only due to technical problems with six devices. Over 12 weeks, 89% (n=48) of patients had ≥90% adherence to treatment. Most patients experienced mild influenza-like symptoms and injection-site reactions, and global side effects were minimal. Most patients (78%) rated the convenience as the most important aspect of the device, and most experienced no or mild pain. RRMS patients treated with subcutaneous interferon beta-1a, administered with RebiSmart, demonstrated generally good adherence, and the treatment was generally well tolerated.

Role of local sequence in the folding of cellular retinoic abinding protein I: structural propensities of reverse turns.

PubMed

Rotondi, Kenneth S; Gierasch, Lila M

2003-07-08

The experiments described here explore the role of local sequence in the folding of cellular retinoic acid binding protein I (CRABP I). This is a 136-residue, 10-stranded, antiparallel beta-barrel protein with seven beta-hairpins and is a member of the intracellular lipid binding protein (iLBP) family. The relative roles of local and global sequence information in governing the folding of this class of proteins are not well-understood. In question is whether the beta-turns are locally defined by short-range interactions within their sequences, and are thus able to play an active role in reducing the conformational space available to the folding chain, or whether the turns are passive, relying upon global forces to form. Short (six- and seven-residue) peptides corresponding to the seven CRABP I turns were analyzed by circular dichroism and NMR for their tendencies to take up the conformations they adopt in the context of the native protein. The results indicate that two of the peptides, encompassing turns III and IV in CRABP I, have a strong intrinsic bias to form native turns. Intriguingly, these turns are on linked hairpins in CRABP I and represent the best-conserved turns in the iLBP family. These results suggest that local sequence may play an important role in narrowing the conformational ensemble of CRABP I during folding.