Silencing of Agamma-globin gene expression during adult definitive erythropoiesis mediated by GATA-1-FOG-1-Mi2 complex binding at the -566 GATA site.

PubMed

Harju-Baker, Susanna; Costa, Flávia C; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R

2008-05-01

Autonomous silencing of gamma-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the (A)gamma-globin gene was identified between -730 and -378 relative to the mRNA start site. A marked copy of the (A)gamma-globin gene inserted between locus control region 5' DNase I-hypersensitive site 1 and the epsilon-globin gene was transcriptionally silenced in adult beta-globin locus yeast artificial chromosome (beta-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the -566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low gamma-globin levels, whereas only a weak signal was detected when gamma-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from beta-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the (A)gamma-globin -566 or (G)gamma-globin -567 GATA site when gamma-globin expression was low (day 18) but not when gamma-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, gamma-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the -566/-567 GATA sites of the proximal gamma-globin promoters.

A majority of mice show long-term expression of a human. beta. -globin gene after retrovirus transfer into hematopoietic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bender, M.A.; Gelinas, R.E.; Miller

1989-04-01

Murine bone marrow was infected with a high-titer retrovirus vector containing the human {beta}-globin and neomycin phosphotransferase genes. Anemic W/W/sup v/ mice were transplanted with infected marrow which in some cases had been exposed to the selective agent G418. Human {beta}-globin expression was monitored in transplanted animals by using a monoclonal antibody specific for human {beta}-globin polypeptide, and hematopoietic reconstitution was monitored by using donor and recipient mice which differed in hemoglobin type. In some experiments all transplanted mice expressed the human {beta}-globin polypeptide for over 4 months, and up to 50% of peripheral erythrocytes contained detectable levels of polypeptide.more » DNA analysis of transplanted animals revealed that virtually every myeloid cell contained a provirus. Integration site analysis and reconstitution of secondary marrow recipients suggested that every mouse was reconstituted with at least one infected stem cell which had extensive repopulation capability. The ability to consistently transfer an active {beta}-globin gene into mouse hematopoietic cells improves the feasibility of using these techniques for somatic cell gene therapy in humans.« less

Acute chest syndrome is associated with single nucleotide polymorphism-defined beta globin cluster haplotype in children with sickle cell anaemia

PubMed Central

Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.

2013-01-01

Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145

Beta-globin locus activation regions: conservation of organization, structure, and function.

PubMed Central

Li, Q L; Zhou, B; Powers, P; Enver, T; Stamatoyannopoulos, G

1990-01-01

The human beta-globin locus activation region (LAR) comprises four erythroid-specific DNase I hypersensitive sites (I-IV) thought to be largely responsible for activating the beta-globin domain and facilitating high-level erythroid-specific globin gene expression. We identified the goat beta-globin LAR, determined 10.2 kilobases of its sequence, and demonstrated its function in transgenic mice. The human and goat LARs share 6.5 kilobases of homologous sequences that are as highly conserved as the epsilon-globin gene promoters. Furthermore, the overall spatial organization of the two LARs has been conserved. These results suggest that the functionally relevant regions of the LAR are large and that in addition to their primary structure, the spatial relationship of the conserved elements is important for LAR function. Images PMID:2236034

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thein, S.L.; Weatherall, D.J.; Sampietro, M.

[open quotes]Heterocellular hereditary persistence of fetal hemoglobin[close quotes] (HPFH) is the term used to describe the genetically determined persistence of fetal hemoglobin (Hb F) production into adult life, in the absence of any related hematological disorder. Whereas some forms are caused by mutations in the [beta]-globin gene cluster on chromosome 11, others segregate independently. While the latter are of particular interest with respect to the regulation of globin gene switching, it has not been possible to determine their chromosomal location, mainly because their mode of inheritance is not clear, but also because several other factors are known to modify Hbmore » F production. The authors have examined a large Asian Indian pedigree which includes individuals with heterocellular HPFH associated with [beta]-thalassemia and/or [alpha]-thalassemia. Segregation analysis was conducted on the HPFH trait FC, defined to be the percentage of Hb F-containing cells (F-cells), using the class D regressive model. The results provide evidence for the presence of a major gene, dominant or codominant, which controls the FC values with residual familial correlations. The major gene was detected when the effects of genetic modifiers, notably [beta]-thalassemia and the XmnI-[sup G][gamma] polymorphism, are accounted for in this analysis. Linkage with the [beta]-globin gene cluster is excluded. The transmission of the FC values in this pedigree is informative enough to allow detection of linkage with an appropriate marker(s). The analytical approach outlined in this study, using simple regression to allow for genetic modifiers and thus allowing the mode of inheritance of a trait to be dissected out, may be useful as a model for segregation and linkage analyses of other complex phenotypes. 39 refs., 4 figs., 6 tabs.« less

Diagnostic difficulty of beta-thalassemia syndrome in a multi-transfused patient: contribution of myelogram and studying parents.

PubMed

Trawinski, Élisabeth; Fenneteau, Odile; Le Mouel, Lou; Ithier, Ghislaine; Couque, Nathalie

2017-10-01

We report the case of a 5 year old, initially followed for congenital sideroblastic anemia, whose explorations reveal a complex family hemoglobinopathy. Myelogram performed in children, reveals dystrophic mature erythroblasts with hemoglobinization defect and basophil punctuations. These abnormalities point towards an abnormal synthesis of heme or globin chains. Iterative transfusions in child do not allow interpreting a search for abnormal hemoglobin. However, the analysis carried out in his parents, with increased HBA2 rate and microcytosis concluded in beta-thalassemia trait for father and mother. Knowing that beta-thalassemia syndrome is a genetic condition, usually recessive, the presence of beta-thalassemia trait in parents is in favor of a beta-thalassemia syndrome in child. This diagnostic hypothesis is confirmed by molecular study of globin genes that will reveal a complex hemoglobinopathie for all family's members. The parents are carriers for heterozygous mutation of β + thalassemia that the sick child presents in homozygous state supporting the diagnosis of beta-thalassemia syndrome. Moreover, a triple α globin gene is present respectively at heterozygous state for mother and at homozygous state for father and child. The triple α globin gene is a known factor of aggravation of beta-thalassemia and this clinical case with continuum observed, perfectly illustrates the intricacies between α and β globin genes.

Amelioration of murine beta-thalassemia through drug selection of hematopoietic stem cells transduced with a lentiviral vector encoding both gamma-globin and the MGMT drug-resistance gene.

PubMed

Zhao, Huifen; Pestina, Tamara I; Nasimuzzaman, Md; Mehta, Perdeep; Hargrove, Phillip W; Persons, Derek A

2009-06-04

Correction of murine models of beta-thalassemia has been achieved through high-level globin lentiviral vector gene transfer into mouse hematopoietic stem cells (HSCs). However, transduction of human HSCs is less robust and may be inadequate to achieve therapeutic levels of genetically modified erythroid cells. We therefore developed a double gene lentiviral vector encoding both human gamma-globin under the transcriptional control of erythroid regulatory elements and methylguanine methyltransferase (MGMT), driven by a constitutive cellular promoter. MGMT expression provides cellular resistance to alkylator drugs, which can be administered to kill residual untransduced, diseased HSCs, whereas transduced cells are protected. Mice transplanted with beta-thalassemic HSCs transduced with a gamma-globin/MGMT vector initially had subtherapeutic levels of red cells expressing gamma-globin. To enrich gamma-globin-expressing cells, transplanted mice were treated with the alkylator agent 1,3-bis-chloroethyl-1-nitrosourea. This resulted in significant increases in the number of gamma-globin-expressing red cells and the amount of fetal hemoglobin, leading to resolution of anemia. Selection of transduced HSCs was also obtained when cells were drug-treated before transplantation. Mice that received these cells demonstrated reconstitution with therapeutic levels of gamma-globin-expressing cells. These data suggest that MGMT-based drug selection holds promise as a modality to improve gene therapy for beta-thalassemia.

A novel mutation of the beta-globin gene promoter (-102 C>A) and pitfalls in family screening.

PubMed

Aguilar-Martinez, Patricia; Jourdan, Eric; Brun, Sophie; Cunat, Séverine; Giansily-Blaizot, Muriel; Pissard, Serge; Schved, Jean-François

2007-12-01

We describe a family with beta-thalassemia in which several pitfalls of genetic diagnoses were present. These include coherent family phenotypes with discrepancies in molecular findings because of nonpaternity, and a false beta-globin gene homozygous genotype due to a large deletion in the second locus. These findings underline the difficulties of family genetic studies and the need for tight relationship between professionals involved in laboratory studies and those in-charge of the clinical follow-up and genetic counselling. In this family, we also report a new silent beta-thalassemia mutation, -102 (C>A), in the distal CACCC box of the beta-globin gene promoter.

Factor IX gene haplotypes in Amerindians.

PubMed

Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S

1997-02-01

We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.

The beta -globin locus control region (LCR) functions primarily by enhancing the transition from transcription initiation to elongation.

PubMed

Sawado, Tomoyuki; Halow, Jessica; Bender, M A; Groudine, Mark

2003-04-15

To investigate the molecular basis of beta-globin gene activation, we analyzed factor recruitment and histone modification at the adult beta-globin gene in wild-type (WT)/locus control region knockout (DeltaLCR) heterozygous mice and in murine erythroleukemia (MEL) cells. Although histone acetylation and methylation (Lys 4) are high before and after MEL differentiation, recruitment of the erythroid-specific activator NF-E2 to the promoter and preinitiation complex (PIC) assembly occur only after differentiation. We reported previously that targeted deletion of the LCR reduces beta-globin gene expression to 1%-4% of WT without affecting promoter histone acetylation. Here, we report that NF-E2 is recruited equally efficiently to the adult beta-globin promoters of the DeltaLCR and WT alleles. Moreover, the LCR deletion reduces PIC assembly only twofold, but has a dramatic effect on Ser 5 phosphorylation of RNA polymerase II and transcriptional elongation. Our results suggest at least three distinct stages in beta-globin gene activation: (1) an LCR-independent chromatin opening stage prior to NF-E2 recruitment to the promoter and PIC assembly; (2) an intermediate stage in which NF-E2 binding (LCR-independent) and PIC assembly (partially LCR-dependent) occur; and (3) an LCR-dependent fully active stage characterized by efficient pol II elongation. Thus, in its native location the LCR functions primarily downstream of activator recruitment and PIC assembly.

Molecular basis of length polymorphism in the human zeta-globin gene complex.

PubMed Central

Goodbourn, S E; Higgs, D R; Clegg, J B; Weatherall, D J

1983-01-01

The length polymorphism between the human zeta-globin gene and its pseudogene is caused by an allele-specific variation in the copy number of a tandemly repeating 36-base-pair sequence. This sequence is related to a tandemly repeated 14-base-pair sequence in the 5' flanking region of the human insulin gene, which is known to cause length polymorphism, and to a repetitive sequence in intervening sequence (IVS) 1 of the pseudo-zeta-globin gene. Evidence is presented that the latter is also of variable length, probably because of differences in the copy number of the tandem repeat. The homology between the three length polymorphisms may be an indication of the presence of a more widespread group of related sequences in the human genome, which might be useful for generalized linkage studies. PMID:6308667

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Popp, D.M.; Johnson, F.M.

Mice homozygous for a spontaneous mutation, in which the ..beta..-major globin gene is deleted, have clinical symptoms of ..beta..-thalassemia. These mice have a hypocellular, hypochromic, microcytic anemia that becomes more severe with increasing age. The defective red cell morphology, decreased osmotic fragility of erythrocytes and shortened red cell life span found in ..beta..-thalassemic mice are similar to those observed in human ..beta..-thalassemia. Synthesis of ..beta..-globin is depressed but not as much as might be expected because the expression of the..beta..-minor globin gene is enhanced to encode two to three times more globin than in normal mice. Splenomegaly, an enlarged poolmore » of stem cells for erythropoiesis, and iron overloading occur in older mice. The fact that these mice remain moderately healthy makes them a very suitable animal model in which to develop and test alternative techniques of gene therapy that could be successfully applied to the treatment of human thalassemia. Homozygous ..beta..-thalassemic mice have large deposits of iron in their tissues, which might make these mice also useful for in vivo tests of the effectiveness and possible long-term side effects for newly developed iron chelators.« less

H3 K79 dimethylation marks developmental activation of the beta-globin gene but is reduced upon LCR-mediated high-level transcription.

PubMed

Sawado, Tomoyuki; Halow, Jessica; Im, Hogune; Ragoczy, Tobias; Bresnick, Emery H; Bender, M A; Groudine, Mark

2008-07-15

Genome-wide analyses of the relationship between H3 K79 dimethylation and transcription have revealed contradictory results. To clarify this relationship at a single locus, we analyzed expression and H3 K79 modification levels of wild-type (WT) and transcriptionally impaired beta-globin mutant genes during erythroid differentiation. Analysis of fractionated erythroid cells derived from WT/Delta locus control region (LCR) heterozygous mice reveals no significant H3 K79 dimethylation of the beta-globin gene on either allele prior to activation of transcription. Upon transcriptional activation, H3 K79 di-methylation is observed along both WT and DeltaLCR alleles, and both alleles are located in proximity to H3 K79 dimethylation nuclear foci. However, H3 K79 di-methylation is significantly increased along the DeltaLCR allele compared with the WT allele. In addition, analysis of a partial LCR deletion mutant reveals that H3 K79 dimethylation is inversely correlated with beta-globin gene expression levels. Thus, while our results support a link between H3 K79 dimethylation and gene expression, high levels of this mark are not essential for high level beta-globin gene transcription. We propose that H3 K79 dimethylation is destabilized on a highly transcribed template.

Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals

PubMed Central

Patel, Vidushi S; Cooper, Steven JB; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer AM

2008-01-01

Background Vertebrate alpha (α)- and beta (β)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the α- and β-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil β-globin gene (ω) in the marsupial α-cluster, however, suggested that duplication of the α-β cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous α- and β-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. Results The platypus α-globin cluster (chromosome 21) contains embryonic and adult α- globin genes, a β-like ω-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-ζ-ζ'-αD-α3-α2-α1-ω-GBY-3'. The platypus β-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-ε-β-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate α-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal β-globin clusters are embedded in olfactory genes. Thus, the mammalian α- and β-globin clusters are orthologous to the bird α- and β-globin clusters respectively. Conclusion We propose that α- and β-globin clusters evolved from an ancient MPG-C16orf35-α-β-GBY-LUC7L arrangement 410 million years ago. A copy of the original β (represented by ω in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of β-globin genes with different expression profiles in different lineages. PMID:18657265

Sickle cell disease caused by heterozygosity for Hb S and novel LCR deletion: Report of two patients.

PubMed

Koenig, Sara C; Becirevic, Esmira; Hellberg, Miriam S C; Li, Michael Y; So, Jason C C; Hankins, Jane S; Ware, Russell E; McMahon, Lillian; Steinberg, Martin H; Luo, Hong-Yuan; Chui, David H K

2009-09-01

The b-globin gene LCR is located approximately 6 kb upstream of the embryonic epsilon-globin gene, and is made up of five DNase I hypersensitive sites (HSs), HS 1-5. LCR plays a pivotal role in regulating the expression of downstream epsilon-, (G)gamma-, (A)gamma-, delta-, and beta-globin genes in cis [1]. Deletions removing the LCR and parts of the downstream beta-globin gene cluster in patients have been described [2]. These individuals present with a (gammadeltabeta)0-thalassemia carrier phenotype. We now report two patients with severe sickle cell disease who were compound heterozygous for Hb S mutation and novel LCR deletion. In one case, HS 1-3 were deleted; in the other, HS 1-5 were deleted. In both cases, the b-like globin genes in cis to the LCR deletions were intact. Genotypically, both patients appeared to have sickle cell trait. Coinherited with either LCR deletion, these individuals presented as sickle cell disease patients. The breakpoints of these LCR deletions were defined. These results affirm that HS 2 and 3 are primarily responsible for conferring erythroid specific high-level expression of cis-linked beta-like globin genes. Furthermore, LCR deletions might cause hemolytic disease of newborns.

Structural polymorphism exhibited by a quasipalindrome present in the locus control region (LCR) of the human beta-globin gene cluster.

PubMed

Kaushik, Mahima; Kukreti, Shrikant

2006-01-01

Structural polymorphism of DNA is a widely accepted property. A simple addition to this perception has been our recent finding, where a single nucleotide polymorphism (SNP) site present in a quasipalindromic sequence of beta-globin LCR exhibited a hairpin-duplex equilibrium. Our current studies explore that secondary structures adopted by individual complementary strands compete with formation of a perfect duplex. Using gel-electrophoresis, ultraviolet (UV)-thermal denaturation, circular dichroism (CD) techniques, we have demonstrated the structural transitions within a perfect duplex containing 11 bp quasipalindromic stretch (TGGGG(G/C)CCCCA), to hairpins and bulge duplex forms. The extended version of the 11 bp duplex, flanked by 5 bp on both sides also demonstrated conformational equilibrium between duplex and hairpin species. Gel-electrophoresis confirms that the duplex coexists with hairpin and bulge duplex/cruciform species. Further, in CD spectra of duplexes, presence of two overlapping positive peaks at 265 and 285 nm suggest the features of A- as well as B-type DNA conformation and show oligomer concentration dependence, manifested in A --> B transition. This indicates the possibility of an architectural switching at quasipalindromic region between linear duplex to a cruciform structure. Such DNA structural variations are likely to be found in the mechanics of molecular recognition and manipulation by proteins.

Triplication of a four-gene set during evolution of the goat beta-globin locus produced three genes now expressed differentially during development.

PubMed Central

Townes, T M; Fitzgerald, M C; Lingrel, J B

1984-01-01

Distinct hemoglobins are synthesized in goats at different stages of development, similar to humans. Embryonic hemoglobins (zeta 2 epsilon 2 and alpha 2 epsilon 2) are synthesized initially and are followed sequentially by fetal (alpha 2 beta F2), preadult (alpha 2 beta C2), and adult (alpha 2 beta A2) hemoglobins. To help understand the basis of these switches, the genes of the beta-globin locus have been cloned and their linkage arrangement has been determined by the isolation of lambda phage carrying overlapping inserts of genomic goat DNA. The locus extends over 120 kilobase pairs and consists of 12 genes arranged in the following order: epsilon I-epsilon II-psi beta X-beta C-epsilon III-epsilon IV-psi beta Z-beta A-epsilon V-epsilon VI-psi beta Y-beta F. Comparison of the nucleotide sequence of the 12 genes shows that the locus is organized into three homologous four-gene sets that presumably evolved by the triplication of an ancestral set of four genes (epsilon-epsilon-psi beta-beta). Interestingly, the three genes (beta C, beta A, and beta F) located at the ends of the four-gene sets are expressed at different stages of development. Therefore, the goat beta F-, beta C-, and beta A-globin genes appear to have evolved by a mechanism that includes the triplication of 40-50 kilobase pairs of DNA and the recruitment of newly formed genes for expression in fetal, preadult, and adult life. PMID:6593719

Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.

PubMed

Pallister, Jackie A; Halliday, Damien C T; Robinson, Anthony J; Venables, Daryl; Voysey, Rhonda D; Boyle, Donna G; Shanmuganathan, Thayalini; Hardy, Christopher M; Siddon, Nicole A; Hyatt, Alex D

2011-01-25

The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pirastu, M.; Galanello, R.; Doherty, M.A.

The predominant ..beta..-thalassemia in Sardinia is the ..beta../sup 0/ type in which no ..beta..-globin chains are synthesized in the homozygous state. The authors determined the ..beta..-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same ..beta../sup 39(CAG..-->..TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the ..beta..-globin gene region.

Altitudinal Variation at Duplicated β-Globin Genes in Deer Mice: Effects of Selection, Recombination, and Gene Conversion

PubMed Central

Storz, Jay F.; Natarajan, Chandrasekhar; Cheviron, Zachary A.; Hoffmann, Federico G.; Kelly, John K.

2012-01-01

Spatially varying selection on a given polymorphism is expected to produce a localized peak in the between-population component of nucleotide diversity, and theory suggests that the chromosomal extent of elevated differentiation may be enhanced in cases where tandemly linked genes contribute to fitness variation. An intriguing example is provided by the tandemly duplicated β-globin genes of deer mice (Peromyscus maniculatus), which contribute to adaptive differentiation in blood–oxygen affinity between high- and low-altitude populations. Remarkably, the two β-globin genes segregate the same pair of functionally distinct alleles due to a history of interparalog gene conversion and alleles of the same functional type are in perfect coupling-phase linkage disequilibrium (LD). Here we report a multilocus analysis of nucleotide polymorphism and LD in highland and lowland mice with different genetic backgrounds at the β-globin genes. The analysis of haplotype structure revealed a paradoxical pattern whereby perfect LD between the two β-globin paralogs (which are separated by 16.2 kb) is maintained in spite of the fact that LD within both paralogs decays to background levels over physical distances of less than 1 kb. The survey of nucleotide polymorphism revealed that elevated levels of altitudinal differentiation at each of the β-globin genes drop away quite rapidly in the external flanking regions (upstream of the 5′ paralog and downstream of the 3′ paralog), but the level of differentiation remains unexpectedly high across the intergenic region. Observed patterns of diversity and haplotype structure are difficult to reconcile with expectations of a two-locus selection model with multiplicative fitness. PMID:22042573

Developmental regulation of DNA replication timing at the human beta globin locus.

PubMed

Simon, I; Tenzen, T; Mostoslavsky, R; Fibach, E; Lande, L; Milot, E; Gribnau, J; Grosveld, F; Fraser, P; Cedar, H

2001-11-01

The human beta globin locus replicates late in most cell types, but becomes early replicating in erythroid cells. Using FISH to map DNA replication timing around the endogenous beta globin locus and by applying a genetic approach in transgenic mice, we have demonstrated that both the late and early replication states are controlled by regulatory elements within the locus control region. These results also show that the pattern of replication timing is set up by mechanisms that work independently of gene transcription.

Gene Addition Strategies for β-Thalassemia and Sickle Cell Anemia.

PubMed

Dong, Alisa C; Rivella, Stefano

2017-01-01

Beta-thalassemia and sickle cell anemia are two of the most common diseases related to the hemoglobin protein. In these diseases, the beta-globin gene is mutated, causing severe anemia and ineffective erythropoiesis. Patients can additionally present with a number of life-threatening co-morbidities, such as stroke or spontaneous fractures. Current treatment involves transfusion and iron chelation; allogeneic bone marrow transplant is the only curative option, but is limited by the availability of matching donors and graft-versus-host disease. As these two diseases are monogenic diseases, they make an attractive setting for gene therapy. Gene therapy aims to correct the mutated beta-globin gene or add back a functional copy of beta- or gamma-globin. Initial gene therapy work was done with oncoretroviral vectors, but has since shifted to lentiviral vectors. Currently, there are a few clinical trials underway to test the curative potential of some of these lentiviral vectors. This review will highlight the work done thus far, and present the challenges still facing gene therapy, such as genome toxicity concerns and achieving sufficient transgene expression to cure those with the most severe forms of thalassemia.

Assessment of Virally Vectored Autoimmunity as a Biocontrol Strategy for Cane Toads

PubMed Central

Robinson, Anthony J.; Venables, Daryl; Voysey, Rhonda D.; Boyle, Donna G.; Shanmuganathan, Thayalini; Hardy, Christopher M.; Siddon, Nicole A.; Hyatt, Alex D.

2011-01-01

Background The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. Methodology/Principal Findings The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. Conclusions/Significance While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach. PMID:21283623

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.

PubMed

Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P

2009-12-01

Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baserga, S.J.; Benz, E.J. Jr.

A number of premature translation termination mutations (nonsense mutations) have been described in the human {alpha}- and {beta}-globin genes. Studies on mRNA isolated from patients with {beta}{sup 0}-thalassemia have shown that for both the {beta}-17 and the {beta}-39 mutations less than normal levels of {beta}-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human {beta}-globin mRNA). In vitro studies using the cloned {beta}-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. Themore » authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human {beta}-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation.« less

Estimating the age of Hb G-Coushatta [β22(B4)Glu→Ala] mutation by haplotypes of β-globin gene cluster in Denizli, Turkey.

PubMed

Ozturk, Onur; Arikan, Sanem; Atalay, Ayfer; Atalay, Erol O

2018-05-01

Hb G-Coushatta variant was reported from various populations' parts of the world such as Thai, Korea, Algeria, Thailand, China, Japan and Turkey. In our study, we aimed to discuss the possible historical relationships of the Hb G-Coushatta mutation with the possible migration routes of the world. For this purpose, associated haplotypes were determined using polymorphic loci in the beta globin gene cluster of hemoglobin G-Coushatta and normal populations in Denizli, Turkey. We performed statistical analysis such as haplotype analysis, Hardy-Weinberg equilibrium, measurement of genetic diversity and population differentiation parameters, analysis of molecular variance using F-statistics, historical-demographic analyses, mismatch distribution analysis of both populations and applied the test statistics in Arlequin ver. 3.5 software program. The diversity of haplotypes has been shown to indicate different genetic origins for two populations. However, AMOVA results, molecular diversity parameters and population demographic expansion times showed that the Hb G-Coushatta mutation develops on the normal population gene pool. Our estimated τ values showed the average time since the demographic expansion for normal and Hb G-Coushatta populations ranged from approximately 42,000 to 38,000 ybp, respectively. Our data suggest that Hb G-Coushatta population originate in normal population in Denizli, Turkey. These results support the hypothesis that the multiple origin of Hb G-Coushatta and indicate that mutation may have been triggered the formation of new variants on beta globin haplotypes. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Distinct modes of gene regulation by a cell-specific transcriptional activator.

PubMed

Sengupta, Tanushri; Cohet, Nathalie; Morlé, François; Bieker, James J

2009-03-17

The architectural layout of a eukaryotic RNA polymerase II core promoter plays a role in general transcriptional activation. However, its role in tissue-specific expression is not known. For example, differing modes of its recognition by general transcription machinery can provide an additional layer of control within which a single tissue-restricted transcription factor may operate. Erythroid Kruppel-like factor (EKLF) is a hematopoietic-specific transcription factor that is critical for the activation of subset of erythroid genes. We find that EKLF interacts with TATA binding protein-associated factor 9 (TAF9), which leads to important consequences for expression of adult beta-globin. First, TAF9 functionally supports EKLF activity by enhancing its ability to activate the beta-globin gene. Second, TAF9 interacts with a conserved beta-globin downstream promoter element, and ablation of this interaction by beta-thalassemia-causing mutations decreases its promoter activity and disables superactivation. Third, depletion of EKLF prevents recruitment of TAF9 to the beta-globin promoter, whereas depletion of TAF9 drastically impairs beta-promoter activity. However, a TAF9-independent mode of EKLF transcriptional activation is exhibited by the alpha-hemoglobin-stabilizing protein (AHSP) gene, which does not contain a discernable downstream promoter element. In this case, TAF9 does not enhance EKLF activity and depletion of TAF9 has no effect on AHSP promoter activation. These studies demonstrate that EKLF directs different modes of tissue-specific transcriptional activation depending on the architecture of its target core promoter.

The 87-kD A gamma-globin enhancer-binding protein is a product of the HOXB2(HOX2H) locus.

PubMed

Sengupta, P K; Lavelle, D E; DeSimone, J

1994-03-01

Developmental regulation of globin gene expression may be controlled by developmental stage-specific nuclear proteins that influence interactions between the locus control region and local regulatory sequences near individual globin genes. We previously isolated an 87-kD nuclear protein from K562 cells that bound to DNA sequences in the beta-globin locus control region, gamma-globin promoter, and A gamma-globin enhancer. The presence of this protein in fetal globin-expressing cells and its absence in adult globin-expressing cells suggested that it may be a developmental stage-specific factor. A lambda gt11 K562 cDNA clone encoding a portion of the HOXB2 (formerly HOX2H) homeobox gene was isolated on the basis of the ability of its beta-galactosidase fusion protein to bind to the same DNA sequences as the 87-kD K562 protein. Because no other relationship had been established between the 87-kD K562 protein and the HOXB2 protein other than their ability to bind ot the same DNA sequences, we have investigated whether the two proteins are related antigenically. Our data show that antisera produced against the HOXB2-beta-gal fusion protein and a synthetic HOXB2 decapeptide react specifically with an 87-kD protein from K562 nuclear extract, showing that the 87-kD K562 nuclear protein is a product of the HOXB2 locus, and is the first demonstration of cellular HOXB2 protein.

Synergistic and additive properties of the beta-globin locus control region (LCR) revealed by 5'HS3 deletion mutations: implication for LCR chromatin architecture.

PubMed

Fang, Xiangdong; Sun, Jin; Xiang, Ping; Yu, Man; Navas, Patrick A; Peterson, Kenneth R; Stamatoyannopoulos, George; Li, Qiliang

2005-08-01

Deletion of the 234-bp core element of the DNase I hypersensitive site 3 (5'HS3) of the locus control region (LCR) in the context of a human beta-globin locus yeast artificial chromosome (beta-YAC) results in profound effects on globin gene expression in transgenic mice. In contrast, deletion of a 2.3-kb 5'HS3 region, which includes the 234-bp core sequence, has a much milder phenotype. Here we report the effects of these deletions on chromatin structure in the beta-globin locus of adult erythroblasts. The 234-bp 5'HS3 deletion abolished histone acetylation throughout the beta-globin locus; recruitment of RNA polymerase II (pol II) to the LCR and beta-globin gene promoter was reduced to a basal level; and formation of all the 5' DNase I hypersensitive sites of the LCR was disrupted. The 2.3-kb 5'HS3 deletion mildly reduced the level of histone acetylation but did not change the profile across the whole locus; the 5' DNase I hypersensitive sites of the LCR were formed, but to a lesser extent; and recruitment of pol II was reduced, but only marginally. These data support the hypothesis that the LCR forms a specific chromatin structure and acts as a single entity. Based on these results we elaborate on a model of LCR chromatin architecture which accommodates the distinct phenotypes of the 5'HS3 and HS3 core deletions.

Dexamethasone facilitates erythropoiesis in murine embryonic stem cells differentiating into hematopoietic cells in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srivastava, Anand S.; Kaushal, Sharmeela; Mishra, Rangnath

2006-07-28

Differentiating embryonic stem (ES) cells are increasingly emerging as an important source of hematopoietic progenitors with a potential to be useful for both basic and clinical research applications. It has been suggested that dexamethasone facilitates differentiation of ES cells towards erythrocytes but the mechanism responsible for sequential expression of genes regulating this process are not well-understood. Therefore, we in vitro induced differentiation of murine ES cells towards erythropoiesis and studied the sequential expression of a set of genes during the process. We hypothesized that dexamethasone-activates its cognate nuclear receptors inducing up-regulation of erythropoietic genes such as GATA-1, Flk-1, Epo-R, andmore » direct ES cells towards erythropoietic differentiation. ES cells were cultured in primary hematopoietic differentiation media containing methyl-cellulose, IMDM, IL-3, IL-6, and SCF to promote embryoid body (EB) formation. Total RNA of day 3, 5, and 9-old EBs was isolated for gene expression studies using RT-PCR. Cells from day 9 EBs were subjected to secondary differentiation using three different cytokines and growth factors combinations: (1) SCF, EPO, dexamethasone, and IGF; (2) SCF, IL-3, IL-6, and TPO; and (3) SCF IL-3, IL-6, TPO, and EPO. Total RNA from day 12 of secondary differentiated ES cells was isolated to study the gene expression pattern during this process. Our results demonstrate an up-regulation of GATA-1, Flk-1, HoxB-4, Epo-R, and globin genes ({alpha}-globin, {beta}H-1 globin, {beta}-major globin, {epsilon} -globin, and {zeta}-globin) in the 9-day-old EBs, whereas, RNA from 5-day-old EBs showed expression of HoxB-4, {epsilon}-globin, {gamma}-globin, {beta}H1-globin, and Flk-1. Three-day-old EBs showed only HoxB-4 and Flk-1 gene expression and lacked expression of all globin genes. These findings indicate that erythropoiesis-specific genes are activated later in the course of differentiation. Gene expression studies on the ES cells of secondary EB origin cultured in media containing dexamethasone showed a down-regulation of GATA-3 and an up-regulation of GATA-1, Flk-1, and Epo-R in comparison to the two other cytokines and growth factor combinations containing media. The secondary differentiation also showed an enhanced production of erythrocytic precursors in dexamethasone containing media in comparison to that in the control media. Our results indicate that dexamethasone can prove to be an effective agent which can be employed to enhance differentiation towards erythrocytic progenitors from ES cells.« less

Thalassemia

MedlinePlus

... disorder that affects the way the body makes hemoglobin. Hemoglobin is the part of red blood cells that ... alpha globin and beta globin; these proteins make hemoglobin. In thalassemia, a gene that makes these proteins ...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Marsh, C.L.; Skow, L.C.

Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous ..cap alpha..-thalassemic embryos, expression of EI (x/sub 2/y/sub 2/) and EII (..cap alpha../sub 2/y/sub 2/) is deficient because the x- and ..cap alpha..-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- andmore » ..cap alpha..-globin genes indicates that these genes must be closely linked. Reduced x- and ..cap alpha..-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y/sub 4/ hemoglobin also appears in ..beta..-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and ..beta..-globin genes. In double heterozygotes, which have a single functional allele of x- and ..cap alpha..-globin genes and three functional alleles of y- and ..beta..-globin genes, synthesis of ..cap alpha.. and non-..cap alpha.. chains is severely imbalanced and half of the total hemoglobin is y/sub 4/. Mouse y/sub 4/ has a high affinity for oxygen, P/sub 50/ of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues.« less

Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.

PubMed

Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca

2015-01-01

β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.

In Silico Analysis of Single Nucleotide Polymorphism (SNPs) in Human β-Globin Gene

PubMed Central

Alanazi, Mohammed; Abduljaleel, Zainularifeen; Khan, Wajahatullah; Warsy, Arjumand S.; Elrobh, Mohamed; Khan, Zahid; Amri, Abdullah Al; Bazzi, Mohammad D.

2011-01-01

Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies- the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB) gene mutations, such as that producing sickle cell hemoglobin (HbS), HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT) server we have searched for the SNPs, which showed that 200 (80%) non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40%) non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K), HbD (E→Q), HbE (E→K) and HbS (E→V). Atomic Non-Local Environment Assessment (ANOLEA), Yet Another Scientific Artificial Reality Application (YASARA), CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref) of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid residues were determined and secondary structures were observed for solvent accessibility to confirm the protein stability. The functional study in this investigation may be a good model for additional future studies. PMID:22028795

Genetic heterogeneity of Beta thalassemia in Lebanon reflects historic and recent population migration.

PubMed

Makhoul, N J; Wells, R S; Kaspar, H; Shbaklo, H; Taher, A; Chakar, N; Zalloua, P A

2005-01-01

Beta thalassemia is an autosomal recessive disorder characterized by reduced (beta(+)) or absent (beta(0)) beta-globin chain synthesis. In Lebanon it is the most predominant genetic defect. In this study we investigated the religious and geographic distribution of the beta-thalassemia mutations identified in Lebanon, and traced their precise origins. A total of 520 beta-globin chromosomes from patients of different religious and regional backgrounds was studied. Beta thalassemia mutations were identified using Amplification Refractory Mutation System (ARMS) PCR or direct gene sequencing. Six (IVS-I-110, IVS-I-1, IVS-I-6, IVS-II-1, cd 5 and the C > T substitution at cd 29) out of 20 beta-globin defects identified accounted for more than 86% of the total beta-thalassemia chromosomes. Sunni Muslims had the highest beta-thalassemia carrier rate and presented the greatest heterogeneity, with 16 different mutations. Shiite Muslims followed closely with 13 mutations, whereas Maronites represented 11.9% of all beta-thalassemic subjects and carried 7 different mutations. RFLP haplotype analysis showed that the observed genetic diversity originated from both new mutational events and gene flow from population migration. This study provides information about the types and distribution of beta-thalassemia mutations within each religious group and geographic region, which is essential for the implementation of screening and prevention programs.

Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

PubMed

Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

2015-07-01

The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

PubMed

Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

2017-12-30

Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

Cooperativeness of the higher chromatin structure of the beta-globin locus revealed by the deletion mutations of DNase I hypersensitive site 3 of the LCR.

PubMed

Fang, Xiangdong; Xiang, Ping; Yin, Wenxuan; Stamatoyannopoulos, George; Li, Qiliang

2007-01-05

High-level transcription of the globin genes requires the enhancement by a distant element, the locus control region (LCR). Such long-range regulation in vivo involves spatial interaction between transcriptional elements, with intervening chromatin looping out. It has been proposed that the clustering of the HS sites of the LCR, the active globin genes, as well as the remote 5' hypersensitive sites (HSs) (HS-60/-62 in mouse, HS-110 in human) and 3'HS1 forms a specific spatial chromatin structure, termed active chromatin hub (ACH). Here we report the effects of the HS3 deletions of the LCR on the spatial chromatin structure of the beta-globin locus as revealed by the chromatin conformation capture (3C) technology. The small HS3 core deletion (0.23 kb), but not the large HS3 deletion (2.3 kb), disrupted the spatial interactions among all the HS sites of the LCR, the beta-globin gene and 3'HS1. We have previously demonstrated that the large HS3 deletion barely impairs the structure of the LCR holocomplex, while the structure is significantly disrupted by the HS3 core deletion. Taken together, these results suggest that the formation of the ACH is dependent on a largely intact LCR structure. We propose that the ACH indeed is an extension of the LCR holocomplex.

Relationship of the Interaction Between Two Quantitative Trait Loci with γ-Globin Expression in β-Thalassemia Intermedia Patients.

PubMed

NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran

2018-05-10

Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.

Genetic therapy for beta-thalassemia: from the bench to the bedside.

PubMed

Arumugam, Paritha; Malik, Punam

2010-01-01

Beta-thalassemia is a genetic disorder with mutations in the β-globin gene that reduce or abolish β-globin protein production. Patients with β-thalassemia major (Cooley's anemia) become severely anemic by 6 to 18 months of age, and are transfusion dependent for life, while those with thalassemia intermedia, a less-severe form of thalassemia, are intermittently or rarely transfused. An allogeneically matched bone marrow transplant is curative, although it is restricted to those with matched donors. Gene therapy holds the promise of "fixing" one's own bone marrow cells by transferring the normal β-globin or γ-globin gene into hematopoietic stem cells (HSCs) to permanently produce normal red blood cells. Requirements for effective gene transfer for the treatment of β-thalassemia are regulated, erythroid-specific, consistent, and high-level β-globin or γ-globin expression. Gamma retroviral vectors have had great success with immune-deficiency disorders, but due to vector-associated limitations, they have limited utility in hemoglobinopathies. Lentivirus vectors, on the other hand, have now been shown in several studies to correct mouse and animal models of thalassemia. The immediate challenges of the field as it moves toward clinical trials are to optimize gene transfer and engraftment of a high proportion of genetically modified HSCs and to minimize the adverse consequences that can result from random integration of vectors into the genome by improving current vector design or developing novel vectors. This article discusses the current state of the art in gene therapy for β-thalassemia and some of the challenges it faces in human trials.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Filon, D.; Oron, V.; Krichevski, S.

The authors characterized nearly 500 [beta]-thalassemia genes from the Israeli population representing a variety of ethnic subgroups. They found 28 different mutations in the [beta]-globin gene, including three mutations ([beta][sup S], [beta][sup C], and [beta][sup O-Arab]) causing hemoglobinopathies. Marked genetic heterogeneity was observed in both the Arab (20 mutations) and Jewish (17 mutations) populations. On the other hand, two ethnic isolates - Druze and Samaritans - had a single mutation each. Fifteen of the [beta]-thalassemia alleles are Mediterranean in type, 5 originated in Kurdistan, 2 are of Indian origin, and 2 sporadic alleles came from Europe. Only one mutant allele-nonsensemore » codon 37-appears to be indigenous to Israel. While human habitation in Israel dates back to early prehistory, the present-day spectrum of [beta]-globin mutations can be largely explained by migration events that occurred in the past millennium. 26 refs., 2 figs., 3 tabs.« less

Sequential changes in chromatin structure during transcriptional activation in the beta globin LCR and its target gene.

PubMed

Kim, Kihoon; Kim, AeRi

2010-09-01

Chromatin structure is modulated during transcriptional activation. The changes include the association of transcriptional activators, formation of hypersensitive sites and covalent modifications of histones. To understand the order of the various changes accompanying transcriptional activation, we analyzed the mouse beta globin gene, which is transcriptionally inducible in erythroid MEL cells over a time course of HMBA treatment. Transcription of the globin genes requires the locus control region (LCR) consisting of several hypersensitive sites (HSs). Erythroid specific transcriptional activators such as NF-E2, GATA-1, TAL1 and EKLF were associated with the LCR in the uninduced state before transcriptional activation. The HSs of the LCR were formed in this state as revealed by high sensitivity to DNase I and MNase attack. However the binding of transcriptional activators and the depletion of histones were observed in the promoter of the beta globin gene only after transcriptional activation. In addition, various covalent histone modifications were sequentially detected in lysine residues of histone H3 during the activation. Acetylation of K9, K36 and K27 was notable in both LCR HSs and gene after induction but before transcriptional initiation. Inactive histone marks such as K9me2, K36me2 and K27me2 were removed coincident with transcriptional initiation in the gene region. Taken together, these results indicate that LCR has a substantially active structure in the uninduced state while transcriptional activation serially adds active marks, including histone modifications, and removes inactive marks in the target gene of the LCR. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study

PubMed Central

Boonyawat, Boonchai; Monsereenusorn, Chalinee; Traivaree, Chanchai

2014-01-01

Background Beta-thalassemia is one of the most common genetic disorders in Thailand. Clinical phenotype ranges from silent carrier to clinically manifested conditions including severe beta-thalassemia major and mild beta-thalassemia intermedia. Objective This study aimed to characterize the spectrum of beta-globin gene mutations in pediatric patients who were followed-up in Phramongkutklao Hospital. Patients and methods Eighty unrelated beta-thalassemia patients were enrolled in this study including 57 with beta-thalassemia/hemoglobin E, eight with homozygous beta-thalassemia, and 15 with heterozygous beta-thalassemia. Mutation analysis was performed by multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene, and gap polymerase chain reaction for 3.4 kb deletion detection, respectively. Results A total of 13 different beta-thalassemia mutations were identified among 88 alleles. The most common mutation was codon 41/42 (-TCTT) (37.5%), followed by codon 17 (A>T) (26.1%), IVS-I-5 (G>C) (8%), IVS-II-654 (C>T) (6.8%), IVS-I-1 (G>T) (4.5%), and codon 71/72 (+A) (2.3%), and all these six common mutations (85.2%) were detected by M-ARMS. Six uncommon mutations (10.2%) were identified by DNA sequencing including 4.5% for codon 35 (C>A) and 1.1% initiation codon mutation (ATG>AGG), codon 15 (G>A), codon 19 (A>G), codon 27/28 (+C), and codon 123/124/125 (-ACCCCACC), respectively. The 3.4 kb deletion was detected at 4.5%. The most common genotype of beta-thalassemia major patients was codon 41/42 (-TCTT)/codon 26 (G>A) or betaE accounting for 40%. Conclusion All of the beta-thalassemia alleles have been characterized by a combination of techniques including M-ARMS, DNA sequencing, and gap polymerase chain reaction for 3.4 kb deletion detection. Thirteen mutations account for 100% of the beta-thalassemia genes among the pediatric patients in our study. PMID:25525381

Histone- and protamine-DNA association: conservation of different patterns within the beta-globin domain in human sperm.

PubMed

Gardiner-Garden, M; Ballesteros, M; Gordon, M; Tam, P P

1998-06-01

Most DNA in human sperm is bound to highly basic proteins called protamines, but a small proportion is complexed with histones similar to those found in active chromatin. This raises the intriguing possibility that histones in sperm are marking sets of genes that will be preferentially activated during early development. We have examined the chromatin structure of members of the beta-globin gene family, which are expressed at different times in development, and the protamine 2 gene, which is expressed in spermatids prior to the widespread displacement of histones by transition proteins. The genes coding for epsilon and gamma globin, which are active in the embryonic yolk sac, contain regions which are histone associated in the sperm. No histone-associated regions are present at the sites tested within the beta- and delta-globin genes which are silent in the embryonic yolk sac. The trends of histone or protamine association are consistent for samples from the same person, and no significant between-subject variations in these trends are found for 13 of the 15 fragments analyzed in the two donors. The results suggest that sperm chromatin structures are generally similar in different men but that the length of the histone-associated regions can vary. The association of sperm DNA with histones or protamines sometimes changes within as little as 400 bp of DNA, suggesting that there is fine control over the retention of histones.

Alternative options for DNA-based experimental therapy of β-thalassemia.

PubMed

Gambari, Roberto

2012-04-01

Beta-thalassemias are caused by more than 200 mutations of the β-globin gene, leading to low or absent production of adult hemoglobin. Achievements have been made with innovative therapeutic strategies for β-thalassemias, based on research conducted at the levels of gene structure, transcription, mRNA processing and protein synthesis. The objective of this review is to describe the development of therapeutic strategies employing viral and non-viral DNA-based approaches for treatment of β-thalassemia. Modification of β-globin gene expression in β-thalassemia cells has been achieved by gene therapy, correction of the mutated β-globin gene and RNA repair. In addition, cellular therapy has been proposed for β-thalassemia, including reprogramming of somatic cells to generate induced pluripotent stem cells to be genetically corrected. Based on the concept that increased production of fetal hemoglobin (HbF) is beneficial in β-thalassemia, DNA-based approaches to increase HbF production have been optimized, including treatment of target cells with lentiviral vectors carrying γ-globin genes. Finally, DNA-based targeting of α-globin gene expression has been applied to reduce the excess of α-globin production by β-thalassemia cells, one of the major causes of the clinical phenotype.

Alpha-globin gene haplotypes in South American Indians.

PubMed

Zago, M A; Melo Santos, E J; Clegg, J B; Guerreiro, J F; Martinson, J J; Norwich, J; Figueiredo, M S

1995-08-01

The haplotypes of the alpha-globin gene cluster were determined for 99 Indians from the Brazilian Amazon region who belong to 5 tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Three predominant haplotypes were identified: Ia (present in 38.9% of chromosomes), IIIa (25.8%), and IIe (22.1%). The only alpha-globin gene rearrangement detected was alpha alpha alpha 3.7 I gene triplication associated with haplotype IIIa, found in high frequencies (5.6% and 10.6%) in two tribes and absent in the others. alpha-Globin gene deletions that cause alpha-thalassemia were not seen, supporting the argument that malaria was absent in these populations until recently. The heterogeneous distribution of alpha-globin gene haplotypes and rearrangements among the different tribes differs markedly from the homogeneous distribution of beta-globin gene cluster haplotypes and reflects the action of various genetic mechanisms (genetic drift, founder effect, consanguinity) on small isolated population groups with a complicated history of divergence-fusion events. The alpha-globin gene haplotype distribution has some similarities to distributions observed in Southeast Asian and Pacific Island populations, indicating that these populations have considerable genetic affinities. However, the absence of several features of the alpha-globin gene cluster that are consistently present among the Pacific Islanders suggests that the similarity of haplotypes between Brazilian Indians and people from Polynesia, Micronesia, and Melanesia is more likely to result of ancient common ancestry rather than the consequence of recent direct genetic contribution through immigration.

β-globin gene cluster haplotypes in ethnic minority populations of southwest China

PubMed Central

Sun, Hao; Liu, Hongxian; Huang, Kai; Lin, Keqin; Huang, Xiaoqin; Chu, Jiayou; Ma, Shaohui; Yang, Zhaoqing

2017-01-01

The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5′ sites and 3′ sites of the β-globin gene cluster. 5′ haplotypes 2 (+−−−), 6 (−++−+), 9 (−++++) and 3′ haplotype FW3 (−+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China. PMID:28205625

Heterozygous Hb Hope [beta136(H14)Gly --> Asp] in association with heterozygous beta0-thalassemia with apparent homozygous expression, in a Spanish patient.

PubMed

Beneitez, David; Carrera, Alícia; Duran-Suárez, Joan Ramón; Paz, Victoria; León, Antonio; García Talavera, Juan

2006-01-01

Hb Hope [beta136(H14)Gly --> Asp (GGT --> GAT)] has been found alone or in combination with other globin gene mutations in several African-American families, as well as in Japanese, Thai, Laotian, Cuban and Mauritanian families. We report the hematological and molecular characteristics of a heterozygous association of Hb Hope with beta0-thalassemia (thal) in a Spanish patient, in whom the level of expression of abnormal hemoglobin (Hb) by cation exchange high performance liquid chromatography (HPLC) and electrophoresis suggested initially a homozygous expression of the abnormal Hb, although sequencing of the polymerase chain reaction (PCR)-amplified beta-globin gene demonstrated a heterozygous genotype for Hb Hope. To the best of our knowledge, this is the first description of a case of Hb Hope in a Spanish family.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Lalley, P.A.; Whitney, J.B.

A genetic polymorphism for a Bgl I endonuclease site near the ..cap alpha..-globin-like pseudogene ..cap alpha..-4 of C57BL/6 and C3H/HeN mice was used to show that ..cap alpha..-4 was not affected by three independent mutations in which the adult globin genes ..cap alpha..-1 and ..cap alpha..-2 were deleted. These results indicated that ..cap alpha..-4 might not be located adjacent to the adult ..cap alpha..-globin genes on chromosome 11. Restriction endonuclease analysis of DNA of a primary clone of a Chinese hamster-mouse somatic cell hybrid that had lost mouse chromosomes 11 and 18 showed that this clone lacked the adult murinemore » globin genes ..cap alpha..-1 and ..cap alpha..-2 but it did contain the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4. These results indicated that the adult ..cap alpha..-globin genes and ..cap alpha..-globin-like pseudogenes are not located on the same chromosome. Similar analyses of several other Chinese hamster-mouse somatic cell hybrids that had segregated other mouse chromosomes indicated that the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4 are located on mouse chromosomes 15 and 17, respectively. These data explain why ..cap alpha..-3 and ..cap alpha..-4 were not affected by the three independently induced deletion-type mutations that cause ..cap alpha..-thalassemia in the mouse.« less

Sickle cell disease caused by Hb S/Québec-CHORI: treatment with hydroxyurea and response.

PubMed

Tubman, Venée N; Bennett, Carolyn M; Luo, Hong-yuan; Chui, David H K; Heeney, Matthew M

2007-08-01

Sickle hemoglobin (Hb S;betaGlu 6 Val) is due to an A>T transversion in codon 6 of the beta-globin gene. Other variant hemoglobins mimic Hb A, S, or C on newborn screening and clinical laboratory diagnostic tools, thus making their correct identification potentially difficult. Sickling disorders can result in individuals who are compound heterozygous for beta-globin mutations (e.g., Hb SC, HbSO(Arab)). The authors report a second case of HbS/Québec-CHORI, a severe compound heterozygous sickling disorder and their experience managing this patient with hydroxyurea.

Hb Alesha [beta67(E11)Val-->Met, GTG-->ATG] in an Argentinean girl.

PubMed

Eberle, Silvia Eandi; Noguera, Nélida I; Sciuccati, Gabriela; Bonduel, Mariana; Díaz, Lilian; Staciuk, Raquel; Targovnik, Héctor M; Feliu-Torres, Aurora

2007-01-01

Hb Alesha is caused by a GTG-->ATG mutation at codon 67 of the beta-globin gene, resulting in abnormal beta-globin chains in which the normal beta67(E11) valine is changed to methionine. This hemoglobin (Hb) is also known as Hb Bristol, the first unstable Hb described, since in a fraction of the variant the methionine is modified into an aspartic acid by a posttranslational modification. This replacement disrupts the apolar bonds between the valine and the heme group, producing an unstable Hb and severe hemolysis. We have identified this rare hemoglobinopathy in an Argentinean girl with severe hemolytic anemia, splenomegaly and frequent requirement for red blood cell transfusions.

Real-time PCR assays using internal controls for quantitation of HPV-16 and beta-globin DNA in cervicovaginal lavages.

PubMed

Lefevre, Jonas; Hankins, Catherine; Pourreaux, Karina; Voyer, Hélène; Coutlée, François

2003-12-01

High-risk human papillomavirus 16 (HPV-16) DNA viral load has been measured with real-time PCR assays by amplifying HPV-16 and a human gene. However, these assays have not used internal controls (ICs) to screen for the presence of inhibitors contained in samples. To quantitate HPV-16 DNA and cell content with real-time PCR, ICs for HPV-16 DNA and beta-globin were synthesised and used to control for inhibition. The assays were sensitive and linear over 5 logs. Good reproducibility was achieved with inter-run coefficients of variation of 23% (10(2) HPV-16 copies), 12% (10(4) HPV-16 copies), 17% (274 beta-globin DNA copies) and 7% (27,400 beta-globin DNA copies). Samples containing 56,800,000, 306,000, 18,000, and 4,070 HPV-16 copies/microg of cellular DNA were tested blindly and estimated to contain 48,800,000, 479,000, 20,300, and 6,620 HPV-16 copies/microg of DNA (mean ratio of measured to expected viral load of 1.27+/-0.32). Inhibition of amplification of HPV-16 and beta-globin ICs by six samples known to contain PCR inhibitors was variable: four inhibited both ICs while two inhibited only the HPV-16 IC. The use of internal controls with real-time PCR for HPV-16 quantitation allows to screen for the presence of inhibitors that do not affect equally primer-driven genomic amplification.

Correlation of MFOLD-predicted DNA secondary structures with separation patterns obtained by capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis.

PubMed

Glavac, Damjan; Potocnik, Uros; Podpecnik, Darja; Zizek, Teofil; Smerkolj, Sava; Ravnik-Glavac, Metka

2002-04-01

We have studied 57 different mutations within three beta-globin gene promoter fragments with sizes 52 bp, 77 bp, and 193 bp by fluorescent capillary electrophoresis CE-SSCP analysis. For each mutation and wild type, energetically most-favorable predicted secondary structures were calculated for sense and antisense strands using the MFOLD DNA-folding algorithm in order to investigate if any correlation exists between predicted DNA structures and actual CE migration time shifts. The overall CE-SSCP detection rate was 100% for all mutations in three studied DNA fragments. For shorter 52 bp and 77 bp DNA fragments we obtained a positive correlation between the migration time shifts and difference in free energy values of predicted secondary structures at all temperatures. For longer 193 bp beta-globin gene fragments with 46 mutations MFOLD predicted different secondary structures for 89% of mutated strands at 25 degrees C and 40 degrees C. However, the magnitude of the mobility shifts did not necessarily correlate with their secondary structures and free energy values except for the sense strand at 40 degrees C where this correlation was statistically significant (r = 0.312, p = 0.033). Results of this study provided more direct insight into the mechanism of CE-SSCP and showed that MFOLD prediction could be helpful in making decisions about the running temperatures and in prediction of CE-SSCP data patterns, especially for shorter (50-100 bp) DNA fragments. Copyright 2002 Wiley-Liss, Inc.

High-Density SNP Genotyping to Define β-Globin Locus Haplotypes

PubMed Central

Liu, Li; Muralidhar, Shalini; Singh, Manisha; Sylvan, Caprice; Kalra, Inderdeep S.; Quinn, Charles T.; Onyekwere, Onyinye C.; Pace, Betty S.

2014-01-01

Five major β-globin locus haplotypes have been established in individuals with sickle cell disease (SCD) from the Benin, Bantu, Senegal, Cameroon, and Arab-Indian populations. Historically, β-haplotypes were established using restriction fragment length polymorphism (RFLP) analysis across the β-locus, which consists of five functional β-like globin genes located on chromosome 11. Previous attempts to correlate these haplotypes as robust predictors of clinical phenotypes observed in SCD have not been successful. We speculate that the coverage and distribution of the RFLP sites located proximal to or within the globin genes are not sufficiently dense to accurately reflect the complexity of this region. To test our hypothesis, we performed RFLP analysis and high-density single nucleotide polymorphism (SNP) genotyping across the β-locus using DNA samples from either healthy African Americans with normal hemoglobin A (HbAA) or individuals with homozygous SS (HbSS) disease. Using the genotyping data from 88 SNPs and Haploview analysis, we generated a greater number of haplotypes than that observed with RFLP analysis alone. Furthermore, a unique pattern of long-range linkage disequilibrium between the locus control region and the β-like globin genes was observed in the HbSS group. Interestingly, we observed multiple SNPs within the HindIII restriction site located in the Gγ-globin intervening sequence II which produced the same RFLP pattern. These findings illustrated the inability of RFLP analysis to decipher the complexity of sequence variations that impacts genomic structure in this region. Our data suggest that high density SNP mapping may be required to accurately define β-haplotypes that correlate with the different clinical phenotypes observed in SCD. PMID:18829352

Interaction of Hb South Florida (codon 1; GTG-->ATG) and HbE, with beta-thalassemia (IVS1-1; G-->A): expression of different clinical phenotypes.

PubMed

Tan, Jin-Ai Mary Anne; Tan, Kim-Lian; Omar, Khairul Zaman; Chan, Lee-Lee; Wee, Yong-Chui; George, Elizabeth

2009-09-01

Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A). HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia. Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA. The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.

Axolotl hemoglobin: cDNA-derived amino acid sequences of two alpha globins and a beta globin from an adult Ambystoma mexicanum.

PubMed

Shishikura, Fumio; Takeuchi, Hiro-aki; Nagai, Takatoshi

2005-11-01

Erythrocytes of the adult axolotl, Ambystoma mexicanum, have multiple hemoglobins. We separated and purified two kinds of hemoglobin, termed major hemoglobin (Hb M) and minor hemoglobin (Hb m), from a five-year-old male by hydrophobic interaction column chromatography on Alkyl Superose. The hemoglobins have two distinct alpha type globin polypeptides (alphaM and alpham) and a common beta globin polypeptide, all of which were purified in FPLC on a reversed-phase column after S-pyridylethylation. The complete amino acid sequences of the three globin chains were determined separately using nucleotide sequencing with the assistance of protein sequencing. The mature globin molecules were composed of 141 amino acid residues for alphaM globin, 143 for alpham globin and 146 for beta globin. Comparing primary structures of the five kinds of axolotl globins, including two previously established alpha type globins from the same species, with other known globins of amphibians and representatives of other vertebrates, we constructed phylogenetic trees for amphibian hemoglobins and tetrapod hemoglobins. The molecular trees indicated that alphaM, alpham, beta and the previously known alpha major globin were adult types of globins and the other known alpha globin was a larval type. The existence of two to four more globins in the axolotl erythrocyte is predicted.

The Role of CREB in CML

DTIC Science & Technology

2008-02-01

Feng YQ et al. Anti-beta s- ribozyme reduces beta s mRNA levels in transgenic mice: Potential application to the gene therapy of sickle cell anemia... ribozymes . RNA 2003;9:1254–1263. 13 Pace BS, Qian X, Ofori-Acquah SF. Selective inhibition of beta-globin RNA transcripts by antisense RNA molecules. Cell

Combination of a triple alpha-globin gene with beta-thalassemia in a gypsy family: importance of the genetic testing in the diagnosis and search for a donor for bone marrow transplantation for one of their children.

PubMed

Yus Cebrian, Flor; Recasens Flores, María del Valle; Izquierdo Álvarez, Silvia; Parra Salinas, Ingrid; Rodriguez-Vigil Iturrate, Carmen

2016-04-14

The simultaneous presence of a heterozygous β-thalassemia with α-gene triplication may cause anything from a thalassemia trait to thalassemia intermedia of mild to moderate severity. An 8-month-old ethnic Gypsy male infant with failure to thrive from birth, mild jaundice and splenomegaly. Clinical signs were compatible with severe microcytic anemia requiring bi-monthly blood transfusions. The β-thalassemia gene analysis found homozygous mutation IVS-I-110 (G>A) (c.93-21G>A) in intron 1 of the hemoglobin beta globin gene and a non-pathogenic sequence variant (single nucleotide polimorfism (SNP) Rs1609812). In addition, the patient had α gene triplication (ααα(anti 3.7)/αα) caused by double heterozygosity for a 3.7 kb fragment that contained only the hemoglobin alpha globin gene-2 gene. This finding led to screening and follow up in first-degree relatives, twin brothers and a sister and parents to provide them with appropriate genetic counseling. Nowadays, new horizons could open a new therapeutic management until definitive cure of these diseases through gene therapy or mutation-specific genome editing. Genetic testing can provide an early diagnosis and facilitates the search for a suitable donor for transplantation.

The higher structure of chromatin in the LCR of the beta-globin locus changes during development.

PubMed

Fang, Xiangdong; Yin, Wenxuan; Xiang, Ping; Han, Hemei; Stamatoyannopoulos, George; Li, Qiliang

2009-11-27

The beta-globin locus control region (LCR) is able to enhance the expression of all globin genes throughout the course of development. However, the chromatin structure of the LCR at the different developmental stages is not well defined. We report DNase I and micrococcal nuclease hypersensitivity, chromatin immunoprecipitation analyses for histones H2A, H2B, H3, and H4, and 3C (chromatin conformation capture) assays of the normal and mutant beta-globin loci, which demonstrate that nucleosomes at the DNase I hypersensitive sites of the LCR could be either depleted or retained depending on the stages of development. Furthermore, MNase sensitivity and 3C assays suggest that the LCR chromatin is more open in embryonic erythroblasts than in definitive erythroblasts at the primary- and secondary-structure levels; however, the LCR chromatin is packaged more tightly in embryonic erythroblasts than in definitive erythroblasts at the tertiary chromatin level. Our study provides the first evidence that the occupancy of nucleosomes at a DNase I hypersensitive site is a developmental stage-related event and that embryonic and adult cells possess distinct chromatin structures of the LCR.

A genome-editing strategy to treat β-hemoglobinopathies that recapitulates a mutation associated with a benign genetic condition.

PubMed

Traxler, Elizabeth A; Yao, Yu; Wang, Yong-Dong; Woodard, Kaitly J; Kurita, Ryo; Nakamura, Yukio; Hughes, Jim R; Hardison, Ross C; Blobel, Gerd A; Li, Chunliang; Weiss, Mitchell J

2016-09-01

Disorders resulting from mutations in the hemoglobin subunit beta gene (HBB; which encodes β-globin), mainly sickle cell disease (SCD) and β-thalassemia, become symptomatic postnatally as fetal γ-globin expression from two paralogous genes, hemoglobin subunit gamma 1 (HBG1) and HBG2, decreases and adult β-globin expression increases, thereby shifting red blood cell (RBC) hemoglobin from the fetal (referred to as HbF or α2γ2) to adult (referred to as HbA or α2β2) form. These disorders are alleviated when postnatal expression of fetal γ-globin is maintained. For example, in hereditary persistence of fetal hemoglobin (HPFH), a benign genetic condition, mutations attenuate γ-globin-to-β-globin switching, causing high-level HbF expression throughout life. Co-inheritance of HPFH with β-thalassemia- or SCD-associated gene mutations alleviates their clinical manifestations. Here we performed CRISPR-Cas9-mediated genome editing of human blood progenitors to mutate a 13-nt sequence that is present in the promoters of the HBG1 and HBG2 genes, thereby recapitulating a naturally occurring HPFH-associated mutation. Edited progenitors produced RBCs with increased HbF levels that were sufficient to inhibit the pathological hypoxia-induced RBC morphology found in SCD. Our findings identify a potential DNA target for genome-editing-mediated therapy of β-hemoglobinopathies.

Hemoglobin genetics: recent contributions of GWAS and gene editing

PubMed Central

Smith, Elenoe C.; Orkin, Stuart H.

2016-01-01

The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226

HbVar: A relational database of human hemoglobin variants and thalassemia mutations at the globin gene server.

PubMed

Hardison, Ross C; Chui, David H K; Giardine, Belinda; Riemer, Cathy; Patrinos, George P; Anagnou, Nicholas; Miller, Webb; Wajcman, Henri

2002-03-01

We have constructed a relational database of hemoglobin variants and thalassemia mutations, called HbVar, which can be accessed on the web at http://globin.cse.psu.edu. Extensive information is recorded for each variant and mutation, including a description of the variant and associated pathology, hematology, electrophoretic mobility, methods of isolation, stability information, ethnic occurrence, structure studies, functional studies, and references. The initial information was derived from books by Dr. Titus Huisman and colleagues [Huisman et al., 1996, 1997, 1998]. The current database is updated regularly with the addition of new data and corrections to previous data. Queries can be formulated based on fields in the database. Tables of common categories of variants, such as all those involving the alpha1-globin gene (HBA1) or all those that result in high oxygen affinity, are maintained by automated queries on the database. Users can formulate more precise queries, such as identifying "all beta-globin variants associated with instability and found in Scottish populations." This new database should be useful for clinical diagnosis as well as in fundamental studies of hemoglobin biochemistry, globin gene regulation, and human sequence variation at these loci. Copyright 2002 Wiley-Liss, Inc.

Sickle cell anemia - Nitric oxide related genetic modifiers of hematological and biochemical parameters.

PubMed

Aguiar, Laura; Matos, Andreia; Gil, Ângela; Afonso, Conceição; Almeida, Salomé; Braga, Lígia; Lavinha, João; Kjollerstrom, Paula; Faustino, Paula; Bicho, Manuel; Inácio, Ângela

2016-01-01

Sickle cell anemia (SCA) is an inherited blood disorder. SCA patients present clinical and hematologic variability that cannot be only explained by the single mutation in the beta-globin gene. Others genetic modifiers and environmental effects are important for the clinical phenotype. SCA patients present arginine deficiency that contributes to a lower nitric oxide (NO) bioactivity. The aim of this work is to determine the association between hematological and biochemical parameters and genetic variants from eNOS gene, in pediatric SCA patients. 26 pediatric SCA patients were genotyped using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) techniques in three important eNOS gene polymorphisms - rs2070744, rs1799983 and intron 4 VNTR. Results from this study show a significant statistical association between some parameters and genetic variants: an increased reticulocyte count and high serum lactate dehydrogenase levels were associated with both the rs2070744_TT and the rs1799983_GG genotypes at eNOS gene and high levels of neutrophils were associated with the eNOS4a allele at intron 4 VNTR. Our results reinforce the importance of NO bioactivity in SCA. We presume that NO, and its precursors might be used as therapy to improve the quality of life of SCA patients.

The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.

PubMed

Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N

1985-01-01

The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.

Pathophysiologically based drug treatment of sickle cell disease.

PubMed

Steinberg, Martin H

2006-04-01

Sickle cell disease is a systemic disorder that is caused by a mutation (Glu6Val) in the gene that encodes beta globin. The sickle hemoglobin molecule (HbS) is a tetramer of two alpha-globin chains and two sickle beta-globin chains, and has the tendency to polymerize when deoxygenated. HbS facilitates abnormal interactions between the sickle erythrocyte and leukocytes and endothelial cells, which trigger a complex pathobiology. This multifaceted pathophysiology provides the opportunity to interrupt the disease at multiple sites, including polymerization of HbS, erythrocyte density and cell-cell interactions. For example, it is possible to induce higher concentrations of fetal hemoglobin, which disrupts the pathology-initiating step of HbS polymerization. Furthermore, it is possible to improve the hydration of sickle erythrocytes and it might be feasible to counteract the endothelial, inflammatory and oxidative abnormalities of sickle cell disease. A therapeutic approach that targets several sites of pathobiology might be most promising.

Novel Inducers of Fetal Globin Identified through High Throughput Screening (HTS) Are Active In Vivo in Anemic Baboons and Transgenic Mice.

PubMed

Boosalis, Michael S; Sangerman, Jose I; White, Gary L; Wolf, Roman F; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H; Li, Biaoru; Pace, Betty S; Nouraie, Mehdi; Faller, Douglas V; Perrine, Susan P

2015-01-01

High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies.

Genetics Home Reference: sickle cell disease

MedlinePlus

... of beta-globin; this abnormality is called beta thalassemia . In people with sickle cell disease , at least ... globin. If mutations that produce hemoglobin S and beta thalassemia occur together, individuals have hemoglobin S- beta thalassemia (HbSBetaThal) ...

Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

PubMed

Jorgez, Carolina J; Bischoff, Farideh Z

2009-01-01

Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

Compound heterozygosity for Hb S [beta6(A3)GluVal, GAG-->GTG] and a new thalassemic mutation [beta132(H10)Lys-->term, AAA-->TAA] detected in a family from West Africa.

PubMed

Frischknecht, Hannes; Troxler, Heinz; Greiner, Jeanette; Hengartner, Heinz; Dutly, Fabrizio

2008-01-01

We describe a Hb S/beta-thalassemia (beta-thal) mutation involving an AT transition at codon 132 of the beta-globin gene. The mutation, in the heterozygous state, unlike several other mutations in exon 3, shows no signs of dominant thalassemia but those of a typical beta(0) carrier. Compound heterozygosity with Hb S [beta6(A3)GluVal, GAGGTG] showed a severe clinical picture.

Pathophysiology and Clinical Manifestations of the β-Thalassemias

PubMed Central

Nienhuis, Arthur W.; Nathan, David G.

2012-01-01

The β-thalassemia syndromes reflect deficient or absent β-globin synthesis usually owing to a mutation in the β-globin locus. The relative excess of α-globin results in the formation of insoluble aggregates leading to ineffective erythropoiesis and shortened red cell survival. A relatively high capacity for fetal hemoglobin synthesis is a major genetic modifier of disease severity, with polymorphisms in other genes also having a significant role. Iron overload secondary to enhanced absorption and red cell transfusions causes an increase in liver iron and in various other tissues, leading to endocrine and cardiac dysfunction. Modern chelation regimens are effective in removing iron and preserving or restoring organ function. PMID:23209183

Beta-globin LCR and intron elements cooperate and direct spatial reorganization for gene therapy.

PubMed

Buzina, Alla; Lo, Mandy Y M; Moffett, Angela; Hotta, Akitsu; Fussner, Eden; Bharadwaj, Rikki R; Pasceri, Peter; Garcia-Martinez, J Victor; Bazett-Jones, David P; Ellis, James

2008-04-11

The Locus Control Region (LCR) requires intronic elements within beta-globin transgenes to direct high level expression at all ectopic integration sites. However, these essential intronic elements cannot be transmitted through retrovirus vectors and their deletion may compromise the therapeutic potential for gene therapy. Here, we systematically regenerate functional beta-globin intron 2 elements that rescue LCR activity directed by 5'HS3. Evaluation in transgenic mice demonstrates that an Oct-1 binding site and an enhancer in the intron cooperate to increase expression levels from LCR globin transgenes. Replacement of the intronic AT-rich region with the Igmu 3'MAR rescues LCR activity in single copy transgenic mice. Importantly, a combination of the Oct-1 site, Igmu 3'MAR and intronic enhancer in the BGT158 cassette directs more consistent levels of expression in transgenic mice. By introducing intron-modified transgenes into the same genomic integration site in erythroid cells, we show that BGT158 has the greatest transcriptional induction. 3D DNA FISH establishes that induction stimulates this small 5'HS3 containing transgene and the endogenous locus to spatially reorganize towards more central locations in erythroid nuclei. Electron Spectroscopic Imaging (ESI) of chromatin fibers demonstrates that ultrastructural heterochromatin is primarily perinuclear and does not reorganize. Finally, we transmit intron-modified globin transgenes through insulated self-inactivating (SIN) lentivirus vectors into erythroid cells. We show efficient transfer and robust mRNA and protein expression by the BGT158 vector, and virus titer improvements mediated by the modified intron 2 in the presence of an LCR cassette composed of 5'HS2-4. Our results have important implications for the mechanism of LCR activity at ectopic integration sites. The modified transgenes are the first to transfer intronic elements that potentiate LCR activity and are designed to facilitate correction of hemoglobinopathies using single copy vectors.

High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

PubMed

Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

2018-01-02

Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and electrophortic indices in order to avoid false positive and false negative results.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thein, S.L.; Hesketh, C.; Wood, W.G.

Analysis of the molecular basis of dominantly inherited {beta}-thalassemia in four families has revealed different mutations involving exon 3 of the {beta}-globin gene. It is suggested that the phenotypic difference between this condition and the more common recessive forms of {beta}-thalassemia lies mainly in the length and stability of the abnormal translation products that are synthesized and, in particular, whether they are capable of binding heme and producing aggregations that are relatively resistant to proteolytic degradation.

Comparison of the DNA extraction methods for polymerase chain reaction amplification from formalin-fixed and paraffin-embedded tissues.

PubMed

Sato, Y; Sugie, R; Tsuchiya, B; Kameya, T; Natori, M; Mukai, K

2001-12-01

To obtain an adequate quality and quantity of DNA from formalin-fixed and paraffin-embedded tissue, six different DNA extraction methods were compared. Four methods used deparaffinization by xylene followed by proteinase K digestion and phenol-chloroform extraction. The temperature of the different steps was changed to obtain higher yields and improved quality of extracted DNA. The remaining two methods used microwave heating for deparaffinization. The best DNA extraction method consisted of deparaffinization by microwave irradiation, protein digestion with proteinase K at 48 degrees C overnight, and no further purification steps. By this method, the highest DNA yield was obtained and the amplification of a 989-base pair beta-globin gene fragment was achieved. Furthermore, DNA extracted by means of this procedure from five gastric carcinomas was successfully used for single strand conformation polymorphism and direct sequencing assays of the beta-catenin gene. Because the microwave-based DNA extraction method presented here is simple, has a lower contamination risk, and results in a higher yield of DNA compared with the ordinary organic chemical reagent-based extraction method, it is considered applicable to various clinical and basic fields.

Novel Inducers of Fetal Globin Identified through High Throughput Screening (HTS) Are Active In Vivo in Anemic Baboons and Transgenic Mice

PubMed Central

Boosalis, Michael S.; Sangerman, Jose I.; White, Gary L.; Wolf, Roman F.; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H.; Li, Biaoru; Pace, Betty S.; Nouraie, Mehdi; Faller, Douglas V.; Perrine, Susan P.

2015-01-01

High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies. PMID:26713848

Molecular Epidemiological Survey of Glucose-6-Phosphate Dehydrogenase Deficiency and Thalassemia in Uygur and Kazak Ethnic Groups in Xinjiang, Northwest China.

PubMed

Han, Luhao; Su, Hai; Wu, Hao; Jiang, Weiying; Chen, Suqin

2016-06-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency and thalassemia occur frequently in tropical and subtropical regions, while the prevalence of relationship between the two diseases in Xinjiang has not been reported. We aimed to determine the prevalence of these diseases and clarify the relationship between genotypes and phenotypes of the two diseases in the Uygur and Kazak ethnic groups in Xinjiang. We measured G6PD activity by G6PD:6PGD (glucose acid-6-phosphate dehydrogenase) ratio, identified the gene variants of G6PD and α- and β-globin genes by polymerase chain reaction (PCR)-DNA sequencing and gap-PCR and compared these variants in different ethnic groups in Xinjiang with those adjacent to it. Of the 149 subjects with molecular analysis of G6PD deficiency conducted, a higher prevalence of the combined mutations c.1311C > T/IVSXI + 93T > C and IVSXI + 93T > C, both with normal enzymatic activities, were observed in the Uygur and Kazak subjects. A case of rare mutation HBB: c.135delC [codon 44 (-C) in the heterozygous state], a heterozygous case of HBB: c.68A > G [Hb G-Taipei or β22(B4)Glu→Gly] and several common single nucleotide polymorphisms (SNPs) were found on the β-globin gene. In conclusion, G6PD deficiency with pathogenic mutations and three common α-thalassemia (α-thal) [- -(SEA), -α(3.7) (rightward), -α(4.2) (leftward)] deletions and point mutations of the α-globin gene were not detected in the present study. The average incidence of β-thalassemia (β-thal) in Uygurs was 1.45% (2/138) in Xinjiang. The polymorphisms of G6PD and β-globin genes might be useful genetic markers to trace the origin and migration of the Uygur and Kazak in Xinjiang.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ngo, K.Y.; Liu, D.; Lee, J.

During the past two years we have tested 2,300 Southeast Asians for alpha- and beta-thaleassemia mutations. We found the incidence of hemoglobin E ({beta}{sup 26}) to be 47% among Laotians and 38% among Cambodians. The incidence of beta thalassemia trait is 9% for Laotians and 6% for Cambodians. Thus, the risk for hemoglobin E/{beta}{sup 26} thalassemia, a transfusion-dependent disorder, is increased in these two population groups. Denaturing gradient gel electrophoresis (DGGE) has proven to be useful in testing for beta-thalassemia carriers and identifying new mutations in the beta globin gene. DNA was extracted from venous blood obtained from patients withmore » elevated Hgb A2 (>4%). Five DNA fragments, encompassing the beta globin gene cluster, were amplified by PCR and analyzed, along with known beta gene mutations as controls, by DGGE using different denaturing gradient concentrations. Different mutations at the same nucleotide position can be distinguished by migration pattern on the DGGE (e.g., in IVS-I-1, G{r_arrow}A and T). Compound heterozygotes for {beta}-thalassemia can be detected on the same gel (e.g., HbE/mutation codon 17). New mutations are identified by their migration pattern compared with controls and determined by subsequent sequencing. We have identified three new mutations: codon 82 CAA{r_arrow}AAA in one Cambodian patient; IVS-II-667, T{r_arrow}C and IVS-II-672, A{r_arrow}C in two Laotian patients. When the parent`s genotypes are known, prenatal diagnosis can be obtained within 24 hours. Thus, PCR/DGGE combination is a rapid and reliable diagnostic approach to clinically significant {beta}-thalassemia. The most important steps are carefully designed primers and predetermined gradient concentrations for DGGE.« less

Glucocorticoids inhibit coordinated translation of. cap alpha. - and. beta. -globin mRNAs in Friend erythroleukemia cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Papaconstantinou, J.; Stewart, J.A.; Rabek, J.P.

The dimethylsulfoxide (Me/sub 2/SO)-mediated induction of hemoglobin synthesis in Friend erythroleukemia cells is inhibited by the glucocorticoids hydrocortisone, dexamethasone, and fluocinolone acetonide; hydrocortisone, at concentrations of 10/sup -5/ to 10/sup -8/ M inhibits by 90-30% and fluocinolone acetonide at concentrations of 10/sup -8/ to 10/sup -11/ M shows a greater than 90% inhibition. At these concentrations the hormones have no effect on cell growth or viability. In this study it has been shown that there is a group of proteins, including the ..cap alpha..- and ..beta..-globins, whose regulation is associated with the induction of Friend erythroleukemia cell differentiation, and thatmore » the expression of these, in addition to ..cap alpha..- and ..beta..-globin, is affected by glucocorticoids. It is concluded that, although the translation of ..cap alpha..- and ..beta..-globin mRNA is a major site of inhibition by glucocorticoids, there is a detectable amount of ..cap alpha..- and ..beta..-globin mRNA translation which results in unequal amounts of globin synthesis and an overall more potent inhibition of hemoglobin formation.« less

Analysis of α1 and α2 globin genes among patients with hemoglobin Adana in Malaysia.

PubMed

Lee, T Y; Lai, M I; Ismail, P; Ramachandran, V; Tan, J A M A; Teh, L K; Othman, R; Hussein, N H; George, E

2016-04-07

Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.

β-Globin chain abnormalities with coexisting α-thalassemia mutations

PubMed Central

Canataroglu, Abdullah; Unsal, Cagatay; Yildiz, Sule Menziletoglu; Turhan, Ferda Tekin; Bozdogan, Sevcan Tug; Dincer, Suleyman; Erkman, Hakan

2012-01-01

Introduction The frequency of hemoglobinopathies is still high in Adana, the biggest city of the Cukurova Region that is located in the southern part of Turkey. Our aim was to identify the concomitant mutations in α- and β-globin genes which lead to complex hemoglobinopathies and to establish an appropriate plan of action for each subject, particularly when prenatal diagnosis is necessary. Material and methods We studied the association between the β-globin gene and α-thalassemia genotypes. The reverse hybridization technique was employed to perform molecular analysis, and the results were confirmed by amplification refractory mutation system (ARMS) or restriction fragment length polymorphism (RFLP) technique. Results We evaluated 36 adult subjects (28 female and 8 male; age range: 18-52 years) with concomitant mutations in their α- and β-globin genes. The –α3.7/αα deletion was the commonest defect in the α-chain as expected, followed by α3.7/–α3.7 deletion. Twenty-five of 36 cases were sickle cell trait with coexisting α-thalassemia, while seven Hb S/S patients had concurrent mutations in their α-genes. The coexistence of αPolyA-2α/αα with Hb A/D and with Hb S/D, which is very uncommon, was also detected. There was a subject with compound heterozygosity for β-globin chain (–α3.7/αα with IVSI.110/S), and also a case who had –α3.7/αα deletion with IVSI.110/A. Conclusions Although limited, our data suggest that it would be valuable to study coexisting α-globin mutations in subjects with sickle cell disease or β-thalassemia trait during the screening programs for premarital couples, especially in populations with a high frequency of hemoglobinopathies. PMID:23056075

Integrating Evolutionary and Functional Tests of Adaptive Hypotheses: A Case Study of Altitudinal Differentiation in Hemoglobin Function in an Andean Sparrow, Zonotrichia capensis

PubMed Central

Cheviron, Zachary A.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Eddy, Douglas K.; Jones, Jennifer; Carling, Matthew D.; Witt, Christopher C.; Moriyama, Hideaki; Weber, Roy E.; Fago, Angela; Storz, Jay F.

2014-01-01

In air-breathing vertebrates, the physiologically optimal blood-O2 affinity is jointly determined by the prevailing partial pressure of atmospheric O2, the efficacy of pulmonary O2 transfer, and internal metabolic demands. Consequently, genetic variation in the oxygenation properties of hemoglobin (Hb) may be subject to spatially varying selection in species with broad elevational distributions. Here we report the results of a combined functional and evolutionary analysis of Hb polymorphism in the rufous-collared sparrow (Zonotrichia capensis), a species that is continuously distributed across a steep elevational gradient on the Pacific slope of the Peruvian Andes. We integrated a population genomic analysis that included all postnatally expressed Hb genes with functional studies of naturally occurring Hb variants, as well as recombinant Hb (rHb) mutants that were engineered through site-directed mutagenesis. We identified three clinally varying amino acid polymorphisms: Two in the αA-globin gene, which encodes the α-chain subunits of the major HbA isoform, and one in the αD-globin gene, which encodes the α-chain subunits of the minor HbD isoform. We then constructed and experimentally tested single- and double-mutant rHbs representing each of the alternative αA-globin genotypes that predominate at different elevations. Although the locus-specific patterns of altitudinal differentiation suggested a history of spatially varying selection acting on Hb polymorphism, the experimental tests demonstrated that the observed amino acid mutations have no discernible effect on respiratory properties of the HbA or HbD isoforms. These results highlight the importance of experimentally validating the hypothesized effects of genetic changes in protein function to avoid the pitfalls of adaptive storytelling. PMID:25135942

Hb Molfetta [beta126(H4)Val-->Leu, GTG-->CTG]: a new, silent, neutral beta chain variant found in an Italian woman.

PubMed

Qualtieri, Antonio; Le, Pera Maria; Pedace, Vera; Magariello, Angela; Brancati, Carlo

2002-02-01

We have identified a new neutral hemoglobin variant in a pregnant Italian woman, that resulted from a GTG-->CTG replacement at codon 126 of the beta chain, corresponding to a Val-->Leu amino acid change at position beta126(H4). Thermal and isopropanol stability tests were normal and there were no abnormal clinical features. Routine electrophoretic and ion exchange chromatographic methods for hemoglobin separation failed to show this variant, but reversed phase high performance liquid chromatography revealed an abnormal peak eluting near the normal beta chain. No abnormal tryptic peptide was revealed on the high performance liquid chromatographic elution pattern of the total globin digest. The mutation was determined at the DNA level by amplification of the three beta exons by polymerase chain reaction and direct sequencing of one exon that showed an abnormal migration on single strand conformational polymorphism analysis.

Comparison of different methods for erythroid differentiation in the K562 cell line.

PubMed

Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

2016-08-01

To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

Molecular evolution of globin genes in Gymnotiform electric fishes: relation to hypoxia tolerance.

PubMed

Tian, Ran; Losilla, Mauricio; Lu, Ying; Yang, Guang; Zakon, Harold

2017-02-13

Nocturnally active gymnotiform weakly electric fish generate electric signals for communication and navigation, which can be energetically taxing. These fish mainly inhabit the Amazon basin, where some species prefer well-oxygenated waters and others live in oxygen-poor, stagnant habitats. The latter species show morphological, physiological, and behavioral adaptations for hypoxia-tolerance. However, there have been no studies of hypoxia tolerance on the molecular level. Globins are classic respiratory proteins. They function principally in oxygen-binding and -delivery in various tissues and organs. Here, we investigate the molecular evolution of alpha and beta hemoglobins, myoglobin, and neuroglobin in 12 gymnotiforms compared with other teleost fish. The present study identified positively selected sites (PSS) on hemoglobin (Hb) and myoglobin (Mb) genes using different maximum likelihood (ML) methods; some PSS fall in structurally important protein regions. This evidence for the positive selection of globin genes suggests that the adaptive evolution of these genes has helped to enhance the capacity for oxygen storage and transport. Interestingly, a substitution of a Cys at a key site in the obligate air-breathing electric eel (Electrophorus electricus) is predicted to enhance oxygen storage of Mb and contribute to NO delivery during hypoxia. A parallel Cys substitution was also noted in an air-breathing African electric fish (Gymnarchus niloticus). Moreover, the expected pattern under normoxic conditions of high expression of myoglobin in heart and neuroglobin in the brain in two hypoxia-tolerant species suggests that the main effect of selection on these globin genes is on their sequence rather than their basal expression patterns. Results indicate a clear signature of positive selection in the globin genes of most hypoxia-tolerant gymnotiform fishes, which are obligate or facultative air breathers. These findings highlight the critical role of globin genes in hypoxia tolerance evolution of Gymnotiform electric fishes.

Frequency and origin of haplotypes associated with the beta-globin gene cluster in individuals with trait and sickle cell anemia in the Atlantic and Pacific coastal regions of Colombia

PubMed Central

Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo

2013-01-01

Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events. PMID:24385850

Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.

PubMed

Guerreiro, J F; Figueiredo, M S; Zago, M A

1994-01-01

We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

PubMed

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Hb L'Aquila [beta106(G8)Leu-->Val, CTG-->GTG]: a novel thalassemic hemoglobin variant.

PubMed

Amato, Antonio; Cappabianca, Maria Pia; Ponzini, Donatella; Rinaldi, Silvana; Biagio, Paola Di; Foglietta, Enrica; Grisanti, Paola; Mastropietro, Fabrizio

2007-01-01

A new beta-globin variant at codon 106 (CTG-->GTG), and which we named Hb L'Aquila [beta106(G8)Leu-->Val], was detected by DNA analysis. The proband and her father presented with the features of a mild beta(+)-thalassemia (thal), confirmed by their alpha/beta-globin chain biosynthesis ratios.

Laboratory investigation of hemoglobinopathies and thalassemias: review and update.

PubMed

Clarke, G M; Higgins, T N

2000-08-01

Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

PubMed

Kaushik, Mahima; Kukreti, Shrikant

2015-01-01

Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

Molecular analysis of Hb Q-H disease and Hb Q-Hb E in a Singaporean family.

PubMed

Tan, J; Tay, J S; Wong, Y C; Kham, S K; Bte Abd Aziz, N; Teo, S H; Wong, H B

1995-01-01

Hb Q (alpha 74Asp-His) results from a mutation in the alpha-gene such that abnormal alpha Q-chains are synthesized. The alpha Q-chains combine with the normal Beta A-chains to form abnormal Hb alpha 2Q beta 2A (Hb Q). Hb Q-H disease is rare, and has been reported only in the Chinese. We report here a Chinese family, were the mother diagnosed with Hb Q-H disease and the father with Hb E heterozygosity and a child with Hb Q-E-thalassemia. Thalassemia screening of the mother's blood revealed a Hb level of 6.8g/dl with low MCV and MCH. Her blood film was indicative of thalassemia. Cellulose acetate electrophoresis showed Hb H and Hb Q with the absence of Hb A. Globin chain biosynthesis was carried out and alpha Q- and beta-chains were detected. Normal alpha- chains were absent. Digestion of the mother's DNA with Bam HI and Bgl II followed by hybridization with the 1.5 kb alpha-Pst probe showed a two alpha-gene deletion on one chromosome and the -alpha Q chain mutant with the -alpha 4.2 defect on the other chromosome. DNA amplification studies indicated the two-gene deletion to be of the -SEA/ defect. The patient was concluded to possess Hb Q-H disease (--SEA/-alpha 4.2Q). Cellulose acetate electrophoresis of the father's blood showed the presence of Hb A, F and E. Molecular analysis of the father's DNA confirmed an intact set of alpha-genes (alpha alpha/alpha alpha). Globin chain biosynthesis of fetal blood of their child showed gamma, beta A, beta E, alpha A and alpha Q-chains. Molecular analysis of the child's DNA showed one alpha-gene deletion, thus giving a genotype of alpha alpha/-alpha 4.2Q beta beta E.

High-resolution melting analysis for prenatal diagnosis of beta-thalassemia in northern Thailand.

PubMed

Charoenkwan, Pimlak; Sirichotiyakul, Supatra; Phusua, Arunee; Suanta, Sudjai; Fanhchaksai, Kanda; Sae-Tung, Rattika; Sanguansermsri, Torpong

2017-12-01

High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.

Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations.

PubMed

Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

2007-08-10

The sickle (betas) mutation in the beta-globin gene (HBB) occurs on five "classical" betas haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the betas allele - a consequence of protection from severe malarial infection afforded by heterozygotes - has been associated with a high degree of extended haplotype similarity. The relationship between classical betas haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical betas haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). The most common betas sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the betas mutation. Two different classical betas haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of betas haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle cell disease, could lie considerable distances away from beta-globin.

A comprehensive review of the prevalence of beta globin gene variations and the co-inheritance of related gene variants in Saudi Arabians with beta-thalassemia

PubMed Central

Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis

2018-01-01

Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482

Uterine leiomyoma is associated with a polymorphism in the interleukin 1-beta gene.

PubMed

Pietrowski, Detlef; Thewes, Roberta; Sator, Michael; Denschlag, Dominik; Keck, Christoph; Tempfer, Clemens

2009-08-01

To investigate whether polymorphisms in the interleukin-1beta (IL-1beta) gene are associated with uterine leiomyoma. Case-control study in a collective of 131 patients and 280 controls. Genotyping of the IL-1beta-511 and IL-1beta-3954 polymorphism was performed by PCR amplification and subsequent RFLP analysis. A significant difference in the allele frequencies of the IL-1beta-511 C

Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

PubMed

Kho, S L; Chua, K H; George, E; Tan, J A M A

2013-07-15

Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

PubMed Central

Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

1995-01-01

The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

Polymorphisms of the IL-1beta and IL-1beta-inducible genes in ulcerative colitis.

PubMed

Nohara, Hiroaki; Saito, Yuki; Higaki, Singo; Okayama, Naoko; Hamanaka, Yuichiro; Okita, Kiwamu; Hinoda, Yuji

2002-11-01

Ulcerative colitis (UC) is a chronic disorder of undetermined etiology, but a genetic predisposition to UC is well recognized. Among cytokines induced in UC, interleukin 1 (IL-1) appears to have a central role because of its immunological upregulatory and proinflammatory activities. The aim of this study was to assess whether UC is associated with polymorphisms of the IL-1beta gene and three additional genes inducible with IL-1beta in Japanese subjects. A total of 96 patients with UC and 106 ethnically matched controls were genotyped at polymorphic sites in IL-1beta, matrix metalloproteinase 1 (MMP-1), matrix metalloproteinase 3 (MMP-3), and inducible nitric oxide synthase (iNOS) genes, using polymerase chain reaction (PCR)-based methods. There was no significant difference in genotype distributions of IL-1beta, MMP-1, MMP-3, and iNOS genes between controls and UC patients in a Japanese population. Also, no significant association of those polymorphisms with various clinical parameters of the patients was found. However, concerning association of age at onset with clinical factors in UC, the frequency of pancolitis was significantly higher in UC patients with age at onset being less than 30 years than in those more than 30 years of age (P = 0.049). No association of the IL-1beta and three IL-1beta-inducible gene polymorphisms with UC was observed in a Japanese population.

The population genetics of the alpha-2 globin locus of orangutans (Pongo pygmaeus).

PubMed

Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

2005-03-01

In this study, the molecular population genetics of the orangutan's alpha-2 globin (HBA2) gene were investigated in order to test for the action of natural selection. Haplotypes from 28 orangutan chromosomes were collected from a 1.46-kilobase region of the alpha-2 globin locus. While many aspects of the data were consistent with neutrality, the observed heterogeneous distribution of polymorphisms was inconsistent with neutral expectations. Furthermore, a single amino acid variant, found in both the Bornean and the Sumatran orangutan subspecies, was associated with different alternative synonymous variants in each subspecies, suggesting that the allele may have spread separately through the two subspecies after two distinct origination events. This variant is not in Hardy-Weinberg equilibrium (HWE). These observations are consistent with neutral models that incorporate population structure and models that invoke selection. The orangutan Plasmodium parasite is a plausible selective agent that may underlie the variation at alpha-2 globin in orangutans.

Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

PubMed Central

Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

2016-01-01

Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

Number and location of mouse mammary tumor virus proviral DNA in mouse DNA of normal tissue and of mammary tumors.

PubMed Central

Groner, B; Hynes, N E

1980-01-01

The Southern DNA filter transfer technique was used to characterize the genomic location of the mouse mammary tumor proviral DNA in different inbred strains of mice. Two of the strains (C3H and CBA) arose from a cross of a Bagg albino (BALB/c) mouse and a DBA mouse. The mouse mammary tumor virus-containing restriction enzyme DNA fragments of these strains had similar patterns, suggesting that the proviruses of these mice are in similar genomic locations. Conversely, the pattern arising from the DNA of the GR mouse, a strain genetically unrelated to the others, appeared different, suggesting that its mouse mammary tumor proviruses are located in different genomic sites. The structure of another gene, that coding for beta-globin, was also compared. The mice strains which we studied can be categorized into two classes, expressing either one or two beta-globin proteins. The macroenvironment of the beta-globin gene appeared similar among the mice strains belonging to one genetic class. Female mice of the C3H strain exogenously transmit mouse mammary tumor virus via the milk, and their offspring have a high incidence of mammary tumor occurrence. DNA isolated from individual mammary tumors taken from C3H mice or from BALB/c mice foster nursed on C3H mothers was analyzed by the DNA filter transfer technique. Additional mouse mammary tumor virus-containing fragments were found in the DNA isolated from each mammary tumor. These proviral sequences were integrated into different genomic sites in each tumor. Images PMID:6245257

The effects of old and recent migration waves in the distribution of HBB*S globin gene haplotypes

PubMed Central

Lindenau, Juliana D.; Wagner, Sandrine C.; de Castro, Simone M.; Hutz, Mara H.

2016-01-01

Abstract Sickle cell hemoglobin is the result of a mutation at the sixth amino acid position of the beta (β) globin chain. The HBB*S gene is in linkage disequilibrium with five main haplotypes in the β-globin-like gene cluster named according to their ethnic and geographic origins: Bantu (CAR), Benin (BEN), Senegal (SEN), Cameroon (CAM) and Arabian-Indian (ARAB). These haplotypes demonstrated that the sickle cell mutation arose independently at least five times in human history. The distribution of βS haplotypes among Brazilian populations showed a predominance of the CAR haplotype. American populations were clustered in two groups defined by CAR or BEN haplotype frequencies. This scenario is compatible with historical records about the slave trade in the Americas. When all world populations where the sickle cell gene occurs were analyzed, three clusters were disclosed based on CAR, BEN or ARAB haplotype predominance. These patterns may change in the next decades due to recent migrations waves. Since these haplotypes show different clinical characteristics, these recent migrations events raise the necessity to develop optimized public health programs for sickle cell disease screening and management. PMID:27706371

Cytokine gene polymorphisms in bullous pemphigoid in a Chinese population.

PubMed

Chang, Y T; Liu, H N; Yu, C W; Lin, M W; Huang, C H; Chen, C C; Liu, M T; Lee, D D; Wang, W J; Tsai, S F

2006-01-01

Bullous pemphigoid (BP) is an autoimmune bullous disease mostly associated with autoantibodies to the hemidesmosomal BP autoantigens BP180 and BP230. High levels of interleukin (IL)-1beta, IL-4, IL-5, IL-6, IL-8, IL-10, IL-13, tumour necrosis factor (TNF)-alpha and interferon (IFN)-gamma have been detected in skin lesions or sera of patients with BP. Cytokine gene polymorphisms may affect cytokine production and contribute to susceptibility to autoimmune diseases. Until now, no cytokine gene polymorphism study has been conducted on patients with BP. We aimed to determine whether the genetic polymorphisms of the cytokine genes might influence the development of BP. DNA samples were obtained from 96 BP patients and 174 control subjects. Using direct sequencing and microsatellite genotyping, we examined 23 polymorphisms in 11 cytokine genes including the IL-1alpha, IL-1beta, IL-1 receptor antagonist, IL-4, IL-6, IL-8, IL-10, IL-13, IL-4 receptor, TNF-alpha and IFN-gamma genes. Although the BP patients were more likely to carry the -511T and -31C alleles of the IL-1beta gene (P = 0.04), the significance disappeared after correction for multiple testing (Pc). There was complete linkage disequilibrium between the -511T and -31C alleles of the IL-1beta gene. In female patients with BP, the associations with IL-1beta (-511T) and (-31C) alleles were much stronger (68% vs. 40.6%, odds ratio = 3.11, Pc = 0.006). No significantly different allelic and genotypic distributions of other cytokine gene polymorphisms could be found between the patients with BP and controls. Moreover, no association with the extent of disease involvement (localized or generalized) was observed. The IL-1beta (-511) and (-31) polymorphisms were significantly associated with BP in women. The other genetic polymorphisms of cytokine genes that we analysed do not appear to be associated with BP susceptibility in our Chinese population.

Beta 2 adrenergic receptor gene restriction fragment length polymorphism and bronchial asthma.

PubMed Central

Ohe, M.; Munakata, M.; Hizawa, N.; Itoh, A.; Doi, I.; Yamaguchi, E.; Homma, Y.; Kawakami, Y.

1995-01-01

BACKGROUND--Beta 2 adrenergic dysfunction may be one of the underlying mechanisms responsible for atopy and bronchial asthma. The gene encoding the human beta 2 adrenergic receptor (beta 2ADR) has recently been isolated and sequenced. In addition, a two allele polymorphism of this receptor gene has been identified in white people. A study was carried out to determine whether this polymorphism is functionally important and has any relation to airways responsiveness, atopy, or asthma. METHODS--The subjects studied were 58 family members of four patients with atopic asthma. Restriction fragment length polymorphism (RFLP) with Ban-I digestion of the beta 2ADR gene was detected by a specific DNA probe with Southern blot analysis. Airways responses to inhaled methacholine and the beta 2 agonist salbutamol, the skin prick test, and serum IgE levels were also examined and correlated to the beta 2ADR gene RFLP. In addition, measurements of cAMP responses to isoproterenol in peripheral mononuclear cells were performed in 22 healthy subjects whose genotype for beta 2ADR was known. RESULTS--A two allele polymorphism (2.3 kb and 2.1 kb) of the beta 2ADR gene was detected in the Japanese population. Family members without allele 2.3 kb (homozygote of allele 2.1 kb) had lower airways responses to inhaled salbutamol than those with allele 2.3 kb. The incidence of asthma was higher in those without allele 2.3 kb than in those with allele 2.3 kb. The beta 2ADR gene RFLP had no relation to airways responses to methacholine and atopic status. cAMP responses in peripheral mononuclear cells of the subjects without allele 2.3 kb tended to be lower than those of the subjects with allele 2.3 kb. CONCLUSIONS--These results suggest that Ban-I RFLP of the beta 2ADR gene may have some association with the airways responses to beta 2 agonists and the incidence of bronchial asthma. Images PMID:7785006

Evidence for a large expansion and subfunctionalisation of globin genes in sea anemones.

PubMed

Smith, Hayden L; Pavasovic, Ana; Surm, Joachim M; Phillips, Matthew J; Prentis, Peter J

2018-06-27

The globin gene superfamily has been well-characterised in vertebrates, however, there has been limited research in early-diverging lineages, such as phylum Cnidaria. This study aimed to identify globin genes in multiple cnidarian lineages, and use bioinformatic approaches to characterise the evolution, structure and expression of these genes. Phylogenetic analyses and in silico protein predictions showed that all cnidarians have undergone an expansion of globin genes, which likely have a hexacoordinate protein structure. Our protein modelling has also revealed the possibility of a single pentacoordinate globin lineage in anthozoan species. Some cnidarian globin genes displayed tissue and development specific expression with very few orthologous genes similarly expressed across species. Our phylogenetic analyses also revealed that eumetazoan globin genes form a polyphyletic relationship with vertebrate globin genes. Overall, our analyses suggest that a Ngb-like and GbX-like gene were most likely present in the globin gene repertoire for the last common ancestor of eumetazoans. The identification of a large-scale expansion and subfunctionalisation of globin genes in actiniarians provides an excellent starting point to further our understanding of the evolution and function of the globin gene superfamily in early-diverging lineages.

Integrating evolutionary and functional tests of adaptive hypotheses: a case study of altitudinal differentiation in hemoglobin function in an Andean Sparrow, Zonotrichia capensis.

PubMed

Cheviron, Zachary A; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Eddy, Douglas K; Jones, Jennifer; Carling, Matthew D; Witt, Christopher C; Moriyama, Hideaki; Weber, Roy E; Fago, Angela; Storz, Jay F

2014-11-01

In air-breathing vertebrates, the physiologically optimal blood-O2 affinity is jointly determined by the prevailing partial pressure of atmospheric O2, the efficacy of pulmonary O2 transfer, and internal metabolic demands. Consequently, genetic variation in the oxygenation properties of hemoglobin (Hb) may be subject to spatially varying selection in species with broad elevational distributions. Here we report the results of a combined functional and evolutionary analysis of Hb polymorphism in the rufous-collared sparrow (Zonotrichia capensis), a species that is continuously distributed across a steep elevational gradient on the Pacific slope of the Peruvian Andes. We integrated a population genomic analysis that included all postnatally expressed Hb genes with functional studies of naturally occurring Hb variants, as well as recombinant Hb (rHb) mutants that were engineered through site-directed mutagenesis. We identified three clinally varying amino acid polymorphisms: Two in the α(A)-globin gene, which encodes the α-chain subunits of the major HbA isoform, and one in the α(D)-globin gene, which encodes the α-chain subunits of the minor HbD isoform. We then constructed and experimentally tested single- and double-mutant rHbs representing each of the alternative α(A)-globin genotypes that predominate at different elevations. Although the locus-specific patterns of altitudinal differentiation suggested a history of spatially varying selection acting on Hb polymorphism, the experimental tests demonstrated that the observed amino acid mutations have no discernible effect on respiratory properties of the HbA or HbD isoforms. These results highlight the importance of experimentally validating the hypothesized effects of genetic changes in protein function to avoid the pitfalls of adaptive storytelling. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Analysis of common transforming growth factor beta-1 gene polymorphisms in gastric and duodenal ulcer disease: pilot study.

PubMed

Polonikov, Alexey V; Ivanov, Vladimir P; Belugin, Dmitry A; Khoroshaya, Irina V; Kolchanova, Inessa O; Solodilova, Mariya A; Tutochkina, Margarita P; Stepchenko, Alexander A

2007-04-01

Transforming growth factor-beta1 (TGF-beta1) has been shown to be an important cytokine that plays a role in cell proliferation, differentiation, tissue injury repair and ulcer healing. The purpose of this pilot study was to investigate if common polymorphisms Leu10Pro, Arg25Pro and C-509T within the TGF-beta1 gene are associated with susceptibility to gastric and duodenal ulcer disease in Russians. Blood samples from 377 unrelated patients with gastric and duodenal ulcer disease and 226 sex- and age-matched healthy controls were used to determine TGF-beta1 gene polymorphisms by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Leu10Pro substitution in the signal peptide of TGF-beta1 has been found to be associated with susceptibility to gastric ulcer (odds ratio [OR] 1.76, 95% confidence interval [CI] 1.12-2.77). A genotype combination of 10Leu/Leu x 25Arg/Arg x -509C/C was also associated with susceptibility to gastric ulcer disease (OR 1.81, P = 0.01). In addition, the frequency of a combination of genotypes 10Pro/Pro x 25Arg/Pro x -509C/T was statistically lower in patients with duodenal ulcer than in controls (OR 0.42, P = 0.05). A significant difference (P = 0.04) in the distribution of rare haplotypes of the TGF-beta1 gene between patients with duodenal ulcer and healthy controls has been found. Polymorphism Leu10Pro was in positive linkage disequilibrium with C-509T polymorphism (coefficient D = 0.191; P < 0.0001). These findings indicate that the Leu10Pro and C-509T polymorphisms may be involved in the modulation of expression of the TGF-beta1 gene, and therefore a predisposition to peptic ulcer disease could be linked to particular alleles of this gene. In particular, a possible role of TGF-beta1 in the pathogenesis of gastric ulcer disease is discussed.

Interleukin-1beta gene polymorphisms in Taiwanese patients with gout.

PubMed

Chen, Man-Ling; Huang, Chung-Ming; Tsai, Chang-Hai; Tsai, Fuu-Jen

2005-04-01

The purpose of this study was to examine whether interleukin-1 beta (IL-1beta) promoter and exon 5 gene polymorphisms are markers of susceptibility or clinical manifestations in Taiwanese patients with gout. The study included 196 patients in addition to 103 unrelated healthy control subjects living in central Taiwan. From genomic DNA, polymorphisms of the gene for IL-1beta promoter and IL-1beta exon 5 were typed. Allelic frequencies were compared between the two groups, and the relationship between allelic frequencies and clinical manifestations of gout was evaluated. No significant differences were observed in the allelic frequencies of the IL-1beta promoter between patients with gout and healthy control subjects. Additionally, we did not detect any association of the IL-1beta promoter genotype with the clinical and laboratory profiles of gout patients. However, there was a significant difference between the two groups in terms of hypertriglyceridemia (P=0.0004, chi(2)=12.52, OR 7.14, 95%CI 0.012-0.22). There was also a significant difference in the genotype of IL-1beta exon 5 polymorphism between patients with and without hypertriglyceridemia. Results of the present study suggest that polymorphisms of the IL-1beta promoter and IL-1beta exon 5 are not related to gout patients in central Taiwan.

Total alpha-globin gene cluster deletion has high frequency in Filipinos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunt, J.A.; Haruyama, A.Z.; Chu, B.M.

1994-09-01

Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms;more » {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).« less

Trp64Arg polymorphism in beta3-adrenergic receptor gene is associated with decreased fat oxidation both in resting and aerobic exercise in the Japanese male.

PubMed

Morita, Emiko; Taniguchi, Hiroshi; Sakaue, Motoyoshi

2009-01-01

The purpose of our study was to investigate whether the Trp64Arg polymorphism in beta3-AR gene and the -3826A/G polymorphism in the UCP1 gene were associated with the reduction in energy expenditure and fat oxidation both in resting and aerobic exercise in Japanese. Eighty-six nonobese young healthy Japanese were recruited. Energy expenditure was measured using indirect calorimetry. The subjects performed an aerobic exercise program at 60% of their maximal heart rate for 30 minutes. The level of fat oxidation at rest and aerobic exercise of the male subjects with Trp/Arg of the beta3-AR gene was significantly lower than that of the Trp/Trp genotype. No difference in FO(0-30) was observed in the female subjects. There was no association between UCP-1 polymorphism and energy expenditure during aerobic exercise. It was revealed that the Trp64Arg polymorphism in beta3-AR gene is associated with reduction of fat oxidation both in resting and aerobic exercise in healthy, young Japanese males.

Mutation Screening of the Krüppel-like Factor 1 Gene in Individuals With Increased Fetal Hemoglobin Referred for Hemoglobinopathy Investigation in South of Iran.

PubMed

Hamid, Mohammad; Ershadi Oskouei, Sanaz; Shariati, Gholamreza; Babaei, Esmaeil; Galehdari, Hamid; Saberi, Alihossein; Sedaghat, Alireza

2018-04-01

Any mutation in the Krüppel-like factor 1 (KLF1) gene may interfere with its proper related function in the erythropoiesis process and lead to alterations in proper activation of its downstream protein through globin switching, which results in an increase in fetal hemoglobin (HbF). This study aimed to investigate whether KLF1 mutation can associate with high level of HbF in individuals with increased fetal hemoglobin referred for screening of hemoglobinopathies in south of Iran. The human KLF1 gene was amplified via the polymerase chain reaction procedure, and sequencing was used to determine any mutation in these patients. Moreover, XmnI polymorphisms in the position of -158 of γ-globin gene promoter were analyzed in all patients by polymerase chain reaction restriction fragment length polymorphism. Analysis of sequencing revealed a missense mutation in the KLF1 gene, p.Ser102Pro (c.304T>C), which was detectable in 10 of 23 cases with elevated HbF level. This mutation was only detected in individuals who had a HbF level between 3.1% and 25.6%. Statistical analysis showed that the frequency of C allele is significantly correlated with a high level of HbF (P<0.05). The allele frequency of positive result of XmnI polymorphism in individuals with increased HbF level was also significant, which showed an association with increased HbF level (P<0.05). To the best of our knowledge, this is the first report of p.Ser102Pro (c.304T>C) in the KLF1 gene in β-thalassemia patients with increased level of fetal hemoglobin. According to statistical results of p.Ser102Pro mutation and XmnI polymorphism, it has been strongly suggested that both polymorphisms have an association with increased HbF samples. These nucleotide changes alone may not be the only elements raising the level of HbF, and other regulatory and modifying factors also play a role in HbF production.

[RDBH-method and big DyeTM terminator technology in accurate diagnosis of β-thalassemia and the allelic polymorphism of β-globin cluster].

PubMed

Akperova, G A

2014-11-01

IThe purpose of this study was to evaluate of the efficiency of RDBH-method and Big DyeTM Terminator technology in an accurate diagnosis of β-thalassemia and the allelic polymorphism of β-globin cluster. It was done a complete hematology analysis (HB, MCH, MCV, MCHC, RBC, Hct, HbA2, HbF, Serum iron, Serum ferritin at four children (males, 6-10 years old) and their parents. Molecular analysis included Reverse Dot-Blot Hybridization StripAssay (RDBH) and DNA sequencing on ABI PRISM Big DyeTM Terminator. Hematologic and molecular parameters were contradictory. The homozygosity for β0-thalassemia (β0IVS2.1[G>A] and β0codon 8[-AA]) at three boys with the mild clinical manifestation and heterozygosity of their parents for mutations, and the absence of β-globin mutations at parents and a boy who holds monthly transfusion was established by RDBH-analysis. DNA sequencing by technology Big DyeTM Terminator showed polymorphism at positions -551 and -521 of Cap5'-region (-650-250) - (AT)7(T)7 and (AT)8(T)5. Application of the integrated clinical-molecular approach is an ideal method for an accurate diagnosis, identification of asymptomatic carriers and a reduce of the risk of complications from β-thalassemia, moreover screening of γG-gene and the level of fetal hemoglobin in early childhood will help manage of β-thalassemia clinic and prevent heavy consequences of the disease.

LCR 5' hypersensitive site specificity for globin gene activation within the active chromatin hub.

PubMed

Peterson, Kenneth R; Fedosyuk, Halyna; Harju-Baker, Susanna

2012-12-01

The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (β(m)), coupled to an intact LCR, a 5'HS3 complete deletion (5'ΔHS3) or a 5'HS3 core deletion (5'ΔHS3c). The 5'ΔHS3c mice expressed β(m)-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5'HS3 core was not required for β(m)-globin expression, previous work showed that the 5'HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5'HS complete deletion mice, except β(m)-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinell, J.; Whitney, J.B.; Popp, R.A.

Three types of mice with globin gene mutations, called 352HB, 27HB, and Hba/sup th-J/, appear to be true animal models of human thalassemia. Expression of the ..cap alpha..-globin genes in three stocks of mice, each one heterozygous for one of the ..cap alpha..-globin mutations, was examined at the polypeptide, RNA, and DNA levels. ..cap alpha..-globin polypeptide chains, relative to ..gamma..-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of ..cap alpha..-globin to ..gamma..-globin RNA sequences are also 75 to 80% normal, exactly reflecting the ..cap alpha..-globin to ..gamma..-globin chain ratios. In the case ofmore » mutant 352HB, at least one ..cap alpha..-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their ..cap alpha..-globin genes.« less

Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

PubMed Central

Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

2011-01-01

Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

Ancient Duplications and Expression Divergence in the Globin Gene Superfamily of Vertebrates: Insights from the Elephant Shark Genome and Transcriptome

PubMed Central

Opazo, Juan C.; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F.

2015-01-01

Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about ancestral functions of vertebrate globins. PMID:25743544

Copy number variations of six and seven α-globin genes in a family with intermedia and major thalassemia phenotypes.

PubMed

Farashi, Samaneh; Vakili, Shadi; Faramarzi Garous, Negin; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-10-01

Copy number variations in α-globin genes are results of unequal crossover between homologous segments in the α-globin gene cluster that misalign during the meiosis phase of the gametogenesis process. Reduction or augmentation of α-globin genes leads to imbalance of α/β chains in hemoglobin tetramer and consequently attenuate or worsen the β-thal clinical symptoms, respectively. Multiplications in α-globin genes have been found in some populations, justifying unexpected severe phenotype of β-thal carriers. Unexpected severe phenotype in the family members may result from coexistence of extra α-globin genes, which is an important factor in the causation of thalassemia intermedia and major in heterozygous β-thalassemia. We described different multiplications in α-globin locus in an Iranian family with one, two or three extra α-globin genes (ααα/αα, αααα/αα and αααα/ααα). The excess α-globin gene/genes cause increment in β/α chain imbalance and leads to worsening pathophysiology and clinical severity of β-thalassemia carriers.

A phased SNP-based classification of sickle cell anemia HBB haplotypes.

PubMed

Shaikho, Elmutaz M; Farrell, John J; Alsultan, Abdulrahman; Qutub, Hatem; Al-Ali, Amein K; Figueiredo, Maria Stella; Chui, David H K; Farrer, Lindsay A; Murphy, George J; Mostoslavsky, Gustavo; Sebastiani, Paola; Steinberg, Martin H

2017-08-11

Sickle cell anemia causes severe complications and premature death. Five common β-globin gene cluster haplotypes are each associated with characteristic fetal hemoglobin (HbF) levels. As HbF is the major modulator of disease severity, classifying patients according to haplotype is useful. The first method of haplotype classification used restriction fragment length polymorphisms (RFLPs) to detect single nucleotide polymorphisms (SNPs) in the β-globin gene cluster. This is labor intensive, and error prone. We used genome-wide SNP data imputed to the 1000 Genomes reference panel to obtain phased data distinguishing parental alleles. We successfully haplotyped 813 sickle cell anemia patients previously classified by RFLPs with a concordance >98%. Four SNPs (rs3834466, rs28440105, rs10128556, and rs968857) marking four different restriction enzyme sites unequivocally defined most haplotypes. We were able to assign a haplotype to 86% of samples that were either partially or misclassified using RFLPs. Phased data using only four SNPs allowed unequivocal assignment of a haplotype that was not always possible using a larger number of RFLPs. Given the availability of genome-wide SNP data, our method is rapid and does not require high computational resources.

Genotype–phenotype correlation among beta-thalassemia and beta-thalassemia/HbE disease in Thai children: predictable clinical spectrum using genotypic analysis

PubMed Central

Traivaree, Chanchai; Monsereenusorn, Chalinee; Rujkijyanont, Piya; Prasertsin, Warakorn; Boonyawat, Boonchai

2018-01-01

Introduction Beta-thalassemia is a group of inherited hemolytic anemias and one of the most common genetic disorders in Thailand. The clinical spectrum of beta-thalassemia disease ranges from mild to severe clinical symptoms including mild beta-thalassemia intermedia (TI) and severe beta-thalassemia major (TM). Objective This study aimed to determine the correlation between beta-globin gene (HBB) mutations and their phenotypic manifestations by evaluating patients’ clinical characteristics, transfusion requirements, growth and hematologic parameters, and hemoglobin typing among pediatric patients treated at Phramongkutklao Hospital. Materials and methods Seventy beta-thalassemia patients, including 63 with beta-thalassemia/hemoglobin E (HbE) and 7 with either homozygous or compound heterozygous beta-thalassemia, were enrolled in this study. Their clinical presentation, growth parameters and laboratory findings were reviewed and analyzed. The mean follow-up time was 10.52±5.62 years. Mutation analysis in each individual was performed using multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene and gap PCR for 3.4 kb deletion detection. Results All 7 homozygous and compound heterozygous beta-thalassemia patients were classified in TM. Among 63 patients with beta-thalassemia/HbE, 58 were classified in TM and 4 were classified in TI. Mean age at diagnosis was 0.8±0.49 years for homozygous or compound heterozygous beta-thalassemia and 3.43±3.5 years for beta-thalassemia/HbE. The most common HBB mutation was HBB:c.126_129delCTTT [codon 41/42 (-TCTT)] found in 34 alleles (48.6%). The height for age was also lower in homozygous beta-thalassemia patients (<3rd percentile) compared to compound heterozygous beta-thalassemia patients (25–50th percentile). Conclusion This study revealed a genotype–phenotype correlation of the most prevalent beta-thalassemia in Thai children using diagnostic capacity in genotypic analysis of HBB mutation. Our findings can provide a better prediction of clinical manifestation and severity by early identification of the type of the HBB mutations. PMID:29695942

[Main regulatory element (MRE) of the Danio rerio α/β-globin gene domain exerts enhancer activity toward the promoters of the embryonic-larval and adult globin genes].

PubMed

Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V

2016-01-01

In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.

The hematopoietic regulator TAL1 is required for chromatin looping between the β-globin LCR and human γ-globin genes to activate transcription

PubMed Central

Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi

2014-01-01

TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the Gγ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the Gγ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes. PMID:24470145

The hematopoietic regulator TAL1 is required for chromatin looping between the β-globin LCR and human γ-globin genes to activate transcription.

PubMed

Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi

2014-04-01

TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the (G)γ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the (G)γ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes.

VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

1994-09-01

The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception ofmore » closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.« less

Silencing of Aγ-Globin Gene Expression during Adult Definitive Erythropoiesis Mediated by GATA-1-FOG-1-Mi2 Complex Binding at the −566 GATA Site▿ †

PubMed Central

Harju-Baker, Susanna; Costa, Flávia C.; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R.

2008-01-01

Autonomous silencing of γ-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the Aγ-globin gene was identified between −730 and −378 relative to the mRNA start site. A marked copy of the Aγ-globin gene inserted between locus control region 5′ DNase I-hypersensitive site 1 and the ɛ-globin gene was transcriptionally silenced in adult β-globin locus yeast artificial chromosome (β-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the −566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low γ-globin levels, whereas only a weak signal was detected when γ-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from β-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the Aγ-globin −566 or Gγ-globin −567 GATA site when γ-globin expression was low (day 18) but not when γ-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, γ-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the −566/−567 GATA sites of the proximal γ-globin promoters. PMID:18347053

LCR 5′ hypersensitive site specificity for globin gene activation within the active chromatin hub

PubMed Central

Peterson, Kenneth R.; Fedosyuk, Halyna; Harju-Baker, Susanna

2012-01-01

The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (βm), coupled to an intact LCR, a 5′HS3 complete deletion (5′ΔHS3) or a 5′HS3 core deletion (5′ΔHS3c). The 5′ΔHS3c mice expressed βm-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5′HS3 core was not required for βm-globin expression, previous work showed that the 5′HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5′HS complete deletion mice, except βm-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction. PMID:23042246

Chromatin structure of the LCR in the human β-globin locus transcribing the adult δ- and β-globin genes.

PubMed

Kim, Seoyeon; Kim, Yea Woon; Shim, Sung Han; Kim, Chul Geun; Kim, Aeri

2012-03-01

The β-like globin genes are transcribed in a developmental stage specific fashion in erythroid cells. The specific transcription of globin genes is conferred by the locus control region (LCR), but the chromatin structure of the LCR in the human adult β-globin locus transcribing the δ- and β-globin genes is not clear. Here, we employed hybrid MEL cells that contain a human chromosome 11. The δ- and β-globin genes were highly transcribed in hybrid MEL/ch11 cells after transcriptional induction. LCR HS3 and HS2 were strongly occupied by erythroid specific transcriptional activators and co-factors in the induced locus. These HSs, but not HS4 and HS1, were in close proximity with the active globin genes as revealed by high resolution 3C experiments. The active features at HS3 were markedly established after transcriptional induction, while HS2 was in a relatively active conformation before the induction. Unexpectedly, HS1 did not show notable active features except histone hyperacetylation. Taken together, the LCR of the human β-globin locus transcribing the adult δ- and β-globin genes has HS specific chromatin structure. The structure at each HS, which is different from the locus transcribing the fetal globin genes, might relate to its role in transcribing the adult genes. Copyright © 2011 Elsevier Ltd. All rights reserved.

Genetic variants of estrogen beta and leptin receptors may cause gynecomastia in adolescent.

PubMed

Eren, Erdal; Edgunlu, Tuba; Korkmaz, Huseyin Anil; Cakir, Esra Deniz Papatya; Demir, Korcan; Cetin, Esin Sakalli; Celik, Sevim Karakas

2014-05-15

Gynecomastia is a benign breast enlargement in males that affects approximately one-third of adolescents. The exact mechanism is not fully understood; however, it has been proposed that estrogen receptors and aromatase enzyme activity may play important roles in the pathogenesis of gynecomastia. While many studies have reported that aromatase enzyme (CYP19) gene polymorphism is associated with gynecomastia, only one study has shown a relationship between estrogen receptor (ER) alpha and beta gene polymorphism and gynecomastia. Thus, the aim of this study was to evaluate the relationships between CYP19 (rs2414096), ER alpha (rs2234693), ER beta (rs4986938), leptin (rs7799039), and leptin receptor (rs1137101) gene polymorphisms and gynecomastia. This study included 107 male adolescents with gynecomastia and 97 controls. Total serum testosterone (T) and estradiol (E2) levels were measured, and DNA was extracted from whole blood using the PCR-RFLP technique. The polymorphic distributions of CYP19, ER alpha, ER beta, leptin and leptin receptor genes were compared. The median E2 level was 12.41 (5.00-65.40) pg/ml in the control group and 16.86 (2.58-78.47) pg/ml in the study group (p<0.001). The median T level was 2.19 (0.04-7.04) ng/ml in the control group and 1.46 (0.13-12.02) ng/ml in the study group (p=0.714). There was a significant relationship between gynecomastia and leptin receptor rs1137101 (p=0.002) and ER beta receptor rs4986938 gene polymorphisms (p=0.002). According to our results, increased E2 level and ER beta gene rs4986938 polymorphism might explain why some adolescents have gynecomastia. Leptin receptor gene rs1137101 polymorphism might affect susceptibility to gynecomastia. Copyright © 2014 Elsevier B.V. All rights reserved.

Molecular Characterization and Expression of α-Globin and β-Globin Genes in the Euryhaline Flounder (Platichthys flesus)

PubMed Central

Lu, Weiqun; Mayolle, Aurelie; Cui, Guoqiang; Luo, Lei; Balment, Richard J.

2011-01-01

In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were both 447 bp. Although the head kidney (pronephros) is the predicted major site of haematopoiesis, real-time PCR revealed that expression of α-globin and β-globin in kidney (mesonephros) was 1.5 times higher than in head kidney. Notably, the α1-globin and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits were higher in freshwater- (FW-) than in seawater- (SW-)adapted fish kidney. If globins do play a role in salinity adaptation, this is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which occur in SW. PMID:21969841

Successful application of preimplantation genetic diagnosis for beta-thalassaemia and sickle cell anaemia in Italy.

PubMed

Chamayou, S; Alecci, C; Ragolia, C; Giambona, A; Siciliano, S; Maggio, A; Fichera, M; Guglielmino, A

2002-05-01

In Italy, the autosomal recessive diseases beta-thalassaemia and sickle cell anaemia are so widespread that in some regions they can be defined as 'social diseases'. In this study, nine clinical applications of preimplantation genetic diagnosis (PGD) were performed for beta-thalassaemia and sickle cell anaemia on seven Sicilian couples and carriers of beta-globin gene mutations. The studied mutations were: Cd39, HbS, IVS1 nt1, IVS1 nt6 and IVS1 nt110. ICSI was performed with partner's sperm on 131 out of 147 retrieved oocytes, and this resulted in 72 zygotes; 32 embryos were successfully biopsied on day 3. The biopsied blastomeres were lysed and the beta-globin alleles amplified by nested PCR. The mutation diagnosis was performed by restriction enzyme digestion and reverse dot-blot. The amplification efficacy was 97.2%. The genotype study of non-transferred and surplus embryos showed that the allele drop-out rate was 8.6%. Seventeen embryos were transferred in utero on day 4. All couples received an embryo transfer; of the four pregnancies obtained, three resulted in live births and one miscarried at 11 weeks. Prenatal diagnosis at the 11th week and miscarriage material analysis confirmed the PGD results. These studies represent the first successful application of PGD for beta-thalassaemia and sickle cell anaemia in Italy.

The phylogenetic and evolutionary history of a novel alpha-globin-type gene in orangutans (Pongo pygmaeus).

PubMed

Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

2006-07-01

The alpha-globin genes are implicated in human resistance to malaria, a disease caused by Plasmodium parasites. This study is the first to analyze DNA sequences from a novel alpha-globin-type gene in orangutans, a species affected by Plasmodium. Phylogenetic methods show that the gene is a duplication of an alpha-globin gene and is located 5' of alpha-2 globin. The alpha-globin-type gene is notable for having four amino acid replacements relative to the orangutan's alpha-1 and alpha-2 globin genes, with no synonymous differences. Pairwise K(a)/K(s) methods and likelihood ratio tests (LRTs) revealed that the evolutionary history of the alpha-globin-type gene has been marked by either neutral or positive evolution, but not purifying selection. A comparative analysis of the amino acid replacements of the alpha-globin-type gene with human hemoglobinopathies and hemoglobin structure showed that two of the four replaced sites are members of the same molecular bond, one that is crucial to the proper functioning of the hemoglobin molecule. This suggested an adaptive evolutionary change. Functionally, this locus may result in a thalassemia-like phenotype in orangutans, possibly as an adaptation to combat Plasmodium.

Ancient Duplications and Expression Divergence in the Globin Gene Superfamily of Vertebrates: Insights from the Elephant Shark Genome and Transcriptome.

PubMed

Opazo, Juan C; Lee, Alison P; Hoffmann, Federico G; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F

2015-07-01

Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about ancestral functions of vertebrate globins. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Towards β-globin gene-targeting with integrase-defective lentiviral vectors.

PubMed

Inanlou, Davoud Nouri; Yakhchali, Bagher; Khanahmad, Hossein; Gardaneh, Mossa; Movassagh, Hesam; Cohan, Reza Ahangari; Ardestani, Mehdi Shafiee; Mahdian, Reza; Zeinali, Sirous

2010-11-01

We have developed an integrase-defective lentiviral (LV) vector in combination with a gene-targeting approach for gene therapy of β-thalassemia. The β-globin gene-targeting construct has two homologous stems including sequence upstream and downstream of the β-globin gene, a β-globin gene positioned between hygromycin and neomycin resistant genes and a herpes simplex virus type 1 thymidine kinase (HSVtk) suicide gene. Utilization of integrase-defective LV as a vector for the β-globin gene increased the number of selected clones relative to non-viral methods. This method represents an important step toward the ultimate goal of a clinical gene therapy for β-thalassemia.

Globin gene structure in a reptile supports the transpositional model for amniote α- and β-globin gene evolution.

PubMed

Patel, Vidushi S; Ezaz, Tariq; Deakin, Janine E; Graves, Jennifer A Marshall

2010-12-01

The haemoglobin protein, required for oxygen transportation in the body, is encoded by α- and β-globin genes that are arranged in clusters. The transpositional model for the evolution of distinct α-globin and β-globin clusters in amniotes is much simpler than the previously proposed whole genome duplication model. According to this model, all jawed vertebrates share one ancient region containing α- and β-globin genes and several flanking genes in the order MPG-C16orf35-(α-β)-GBY-LUC7L that has been conserved for more than 410 million years, whereas amniotes evolved a distinct β-globin cluster by insertion of a transposed β-globin gene from this ancient region into a cluster of olfactory receptors flanked by CCKBR and RRM1. It could not be determined whether this organisation is conserved in all amniotes because of the paucity of information from non-avian reptiles. To fill in this gap, we examined globin gene organisation in a squamate reptile, the Australian bearded dragon lizard, Pogona vitticeps (Agamidae). We report here that the α-globin cluster (HBK, HBA) is flanked by C16orf35 and GBY and is located on a pair of microchromosomes, whereas the β-globin cluster is flanked by RRM1 on the 3' end and is located on the long arm of chromosome 3. However, the CCKBR gene that flanks the β-globin cluster on the 5' end in other amniotes is located on the short arm of chromosome 5 in P. vitticeps, indicating that a chromosomal break between the β-globin cluster and CCKBR occurred at least in the agamid lineage. Our data from a reptile species provide further evidence to support the transpositional model for the evolution of β-globin gene cluster in amniotes.

β-Globin locus control region HS2 and HS3 interact structurally and functionally

PubMed Central

Jackson, David A.; McDowell, Jennifer C.; Dean, Ann

2003-01-01

The overall structure of the DNase I hypersensitive sites (HSs) that comprise the β-globin locus control region (LCR) is highly conserved among mammals, implying that the HSs have conserved functions. However, it is not well understood how the LCR HSs, either individually or collectively, activate transcription. We analyzed the interactions of HS2, HS3 and HS4 with the human ε- and β-globin genes in chromatinized episomes in fetal/embryonic K562 cells. Only HS2 activates transcription of the ε-globin gene, while all three HSs activate the β-globin gene. HS3 stimulates the β-globin gene constitutively, but HS2 and HS4 transactivation requires expression of the transcription factor EKLF, which is not present in K562 cells but is required for β-globin expression in vivo. To begin addressing how the individual HSs may interact with one another in a complex, we linked the β-globin gene to both the HS2 and HS3. HS2 and HS3 together resulted in synergistic stimulation of β-globin transcription. Unexpectedly, mutated, inactive forms of HS2 impeded the activation of the β-globin gene by HS3. Thus, there appear to be distinct interactions among the HSs and between the HSs and the globin genes. These preferential, non-exclusive interactions may underlie an important structural and functional cooperativity among the regulatory sequences of the β-globin locus in vivo. PMID:12582237

Effect of polymorphic variants of GH, Pit-1, and beta-LG genes on milk production of Holstein cows.

PubMed

Heidari, M; Azari, M A; Hasani, S; Khanahmadi, A; Zerehdaran, S

2012-04-01

Effect of polymorphic variants of growth hormone (GH), beta-lactoglobulin (beta-LG), and Pit-1 genes on milk yield was analyzed in a Holstein herd. Genotypes of the cows for these genes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Allele frequencies were 0.884 and 0.116 for L and V variants of GH, 0.170 and 0.830 for A and B variants of Pit-1, and 0.529 and 0.471 for A and B variants of beta-LG, respectively. GLM procedure of SAS software was used to test the effects of these genes on milk yield. Results indicated significant effects of these genes on milk yield (P < 0.05). Cows with LL genotype of GH produced more milk than cows with LVgenotype (P < 0.05). Also, for Pit-1 gene, animals with AB genotype produced more milk than BB genotype (P < 0.05). In the case of beta-LG gene, milk yield of animals with AA genotype was more than BB genotype (P < 0.01). Therefore, it might be concluded that homozygote genotypes of GH (LL) and beta-LG (AA) were superior compared to heterozygote genotypes, whereas, the heterozygote genotype of Pit-1 gene (AB) was desirable.

Investigating alpha-globin structural variants: a retrospective review of 135,000 Brazilian individuals

PubMed Central

Kimura, Elza Miyuki; Oliveira, Denise Madureira; Jorge, Susan Elisabeth; Ribeiro, Daniela Maria; Zaccariotto, Tânia Regina; Santos, Magnun Nueldo Nunes; Almeida, Vanessa; Albuquerque, Dulcinéia Martins; Costa, Fernando Ferreira; Sonati, Maria de Fátima

2015-01-01

Background Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC) and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC). Mutations were identified by molecular analyses, and the oxygen affinity, heme–heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations. PMID:25818820

Three 3D graphical representations of DNA primary sequences based on the classifications of DNA bases and their applications.

PubMed

Xie, Guosen; Mo, Zhongxi

2011-01-21

In this article, we introduce three 3D graphical representations of DNA primary sequences, which we call RY-curve, MK-curve and SW-curve, based on three classifications of the DNA bases. The advantages of our representations are that (i) these 3D curves are strictly non-degenerate and there is no loss of information when transferring a DNA sequence to its mathematical representation and (ii) the coordinates of every node on these 3D curves have clear biological implication. Two applications of these 3D curves are presented: (a) a simple formula is derived to calculate the content of the four bases (A, G, C and T) from the coordinates of nodes on the curves; and (b) a 12-component characteristic vector is constructed to compare similarity among DNA sequences from different species based on the geometrical centers of the 3D curves. As examples, we examine similarity among the coding sequences of the first exon of beta-globin gene from eleven species and validate similarity of cDNA sequences of beta-globin gene from eight species. Copyright © 2010 Elsevier Ltd. All rights reserved.

Hb Chile [beta28(B10)Leu-->Met]: an unstable hemoglobin associated with chronic methemoglobinemia and sulfonamide or methylene blue-induced hemolytic anemia.

PubMed

Hojas-Bernal, R; McNab-Martin, P; Fairbanks, V F; Holmes, M W; Hoyer, J D; McCormick, D J; Kubik, K S

1999-05-01

Among the causes of life-long cyanosis are congenital methemoglobinemia due to M hemoglobins, congenital methemoglobinemia due to methemoglobin reductase deficiency, a small number of low oxygen affinity hemoglobins, and a small number of unstable hemoglobins that spontaneously form methemoglobin in vivo at an accelerated rate. We report an unstable hemoglobin with these characteristics that was observed in a family of indigenous (native American) origin living near Santiago, Chile. This variant has the substitution beta28(B10)Leu-->Met, unambiguously corresponding to the DNA mutation of CTG-->ATG in beta-globin gene codon 28.

Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

PubMed

Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

2017-07-11

In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing topologically associating domain.

Butyrate Infusions in the Ovine Fetus Delay the Biologic Clock for Globin Gene Switching

NASA Astrophysics Data System (ADS)

Perrine, Susan P.; Rudolph, Abraham; Faller, Douglas V.; Roman, Christine; Cohen, Ruth A.; Chen, Shao-Jing; Kan, Yuet Wai

1988-11-01

The switch from fetal to adult hemoglobin expression is regulated in many mammalian species by a developmental clock-like mechanism and determined by the gestational age of the fetus. Prolonging fetal globin gene expression is of considerable interest for therapeutic potential in diseases caused by abnormal β -globin genes. Butyric acid, which is found in increased plasma concentrations in infants of diabetic mothers who have delayed globin gene switching, was infused into catheterized fetal lambs in utero during the time of the normal globin gene switch period. The globin gene switch was significantly delayed in three of four butyrate-treated fetuses compared with controls and was entirely prevented in one fetus in whom the infusion was begun before the globin switch was under way. These data provide a model for investigating and arresting the biologic clock of hemoglobin switching.

Eos Negatively Regulates Human γ-globin Gene Transcription during Erythroid Differentiation

PubMed Central

Yu, Hai-Chuan; Zhao, Hua-Lu; Wu, Zhi-Kui; Zhang, Jun-Wu

2011-01-01

Background Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Methodology/Principal Findings Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Conclusions/Significance Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation. PMID:21829552

Polymorphism of Trp64Arg in beta3-adrenergic receptor gene among Bolivian people in rural areas at high and low altitudes.

PubMed

Karasaki, Yuji; Kashiwazaki, Hiroshi

2004-01-01

To investigate whether population differences in food and/or lifestyle could affect the distribution frequencies of polymorphism in the gene for beta3-adrenergic receptor (beta3-AR), the frequency of Trp64Arg polymorphism was studied among Bolivian people living in rural areas of high (about 4000 m above sea level) and low (about 300 m above sea level) altitudes. Genomic DNA samples of Bolivian subjects (n=508) were amplified by polymerase chain reaction (PCR) for part of the beta3-AR gene. The amplified PCR products were digested with restriction enzyme NciI and analysed by agarose gel electrophoresis. We found no significant difference in the frequency of Arg allele in the beta3-AR gene between 331 native low-altitude Bolivian subjects (18.1%) and 177 native high-altitude Bolivian subjects (17.5%). Body mass index was not associated with Trp64Arg polymorphism among native Bolivian adults. The frequency of this allele in the complete Bolivian population (18%) was lower than that reported in Pima Indians (32%), is comparable to the Japanese (19%) and is higher than several ethnic groups, including Finns (12%) and French (4%). Our data indicate that the altitude-related lifestyle of a population has had little influence on the frequency of Trp64Arg polymorphism and obesity in Bolivian natives.

Genetic polymorphism of the beta-2 adrenergic receptor in atopic and non-atopic subjects.

PubMed

Potter, P C; Van Wyk, L; Martin, M; Lentes, K U; Dowdle, E B

1993-10-01

To investigate a possible genetic basis for reported differences in beta-2 receptor expression in atopic subjects, DNA from 42 atopic children (22 asthmatics and 22 with allergic rhinitis) and 30 non-atopic subjects was Southern blotted and Ban-1 restriction fragment polymorphisms (RFLPS) were studied using a 2.6 kb probe of the human beta-2 receptor gene. Two alleles 3.1 kb and 2.9 kb were identified. Homozygotes and heterozygotes for the two alleles were found with equal frequency in the atopic patients who had asthma and in those who had allergic rhinitis only. The gene frequencies for the upper and lower alleles were 0.45 and 0.55 respectively. Our studies do not provide evidence for an association between a particular polymorphic form of the human beta-2 receptor gene and atopy.

Are genetic variants in the platelet-derived growth factor [beta] gene associated with chronic pancreatitis?

PubMed

Muddana, Venkata; Park, James; Lamb, Janette; Yadav, Dhiraj; Papachristou, Georgios I; Hawes, Robert H; Brand, Randall; Slivka, Adam; Whitcomb, David C

2010-11-01

Platelet-derived growth factor [beta] (PDGF-[beta]) is a major signal in proliferation and matrix synthesis through activated pancreatic stellate cells, leading to fibrosis of the pancreas. Recurrent acute pancreatitis (RAP) seems to predispose to chronic pancreatitis (CP) in some patients but not others. We tested the hypothesis that 2 known PDGF-[beta] polymorphisms are associated with progression from RAP to CP. We also tested the hypothesis that PDGF-[beta] polymorphisms in combination with environmental risk factors such as alcohol and smoking are associated with CP. Three hundred eighty-two patients with CP (n = 176) and RAP (n = 206) and 251 controls were evaluated. Platelet-derived growth factor [beta] polymorphisms +286 A/G (rs#1800818) seen in 5'-UTR and +1135 A/C (rs#1800817) in first intron were genotyped using single-nucleotide polymorphism polymerase chain reaction approach and confirmed by DNA sequencing. The genotypic frequencies for PDGF-[beta] polymorphisms in positions +286 and +1135 were found to be similar in controls and patients with RAP and CP. There was no difference in genotypic frequencies among RAP, CP, and controls in subjects in the alcohol and smoking subgroups. Known variations in the PDGF-[beta] gene do not have a significant effect on promoting or preventing fibrogenesis in pancreatitis. Further evaluation of this important pathway is warranted.

Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

PubMed Central

Laimins, L; Holmgren-König, M; Khoury, G

1986-01-01

The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

Postnatal and non-invasive prenatal detection of β-thalassemia mutations based on Taqman genotyping assays

PubMed Central

Breveglieri, Giulia; Travan, Anna; D’Aversa, Elisabetta; Cosenza, Lucia Carmela; Pellegatti, Patrizia; Guerra, Giovanni; Gambari, Roberto

2017-01-01

The β-thalassemias are genetic disorder caused by more than 200 mutations in the β-globin gene, resulting in a total (β0) or partial (β+) deficit of the globin chain synthesis. The most frequent Mediterranean mutations for β-thalassemia are: β039, β+IVSI-110, β+IVSI-6 and β0IVSI-1. Several molecular techniques for the detection of point mutations have been developed based on the amplification of the DNA target by polymerase chain reaction (PCR), but they could be labor-intensive and technically demanding. On the contrary, TaqMan® genotyping assays are a simple, sensitive and versatile method suitable for the single nucleotide polymorphism (SNP) genotyping affecting the human β-globin gene. Four TaqMan® genotyping assays for the most common β-thalassemia mutations present in the Mediterranean area were designed and validated for the genotype characterization of genomic DNA extracted from 94 subjects comprising 25 healthy donors, 33 healthy carriers and 36 β-thalassemia patients. In addition, 15 specimens at late gestation (21–39 gestational weeks) and 11 at early gestation (5–18 gestational weeks) were collected from pregnant women, and circulating cell-free fetal DNAs were extracted and analyzed with these four genotyping assays. We developed four simple, inexpensive and versatile genotyping assays for the postnatal and prenatal identification of the thalassemia mutations β039, β+IVSI-110, β+IVSI-6, β0IVSI-1. These genotyping assays are able to detect paternally inherited point mutations in the fetus and could be efficiently employed for non-invasive prenatal diagnosis of β-globin gene mutations, starting from the 9th gestational week. PMID:28235086

Assessing the relative stabilities of engineered hemoglobins using electrospray mass spectrometry.

PubMed

Apostol, I

1999-07-15

An ion trap mass spectrometer equipped with an electrospray source was used to examine the relative thermodynamic stabilities of various hemoglobins with respect to both tetramer dissociation and hemin dissociation. The results demonstrated that the stability of hemoglobin molecules can be differentiated by the amount of applied collision-induced dissociation (CID) energy necessary to break up the intact tetramer into its constituent globins. The stability of the intact tetramer was affected by single mutations in the beta-globins. The stabilities of the constituent hologlobins were assessed via trap CID of selected ions. The results demonstrated the importance of the contributions of the hologlobin components to the stability of the intact tetramer. Genetic fusion of two alpha-globins, through the introduction of a single glycine residue between the C-terminus of one alpha-chain and the N-terminus of the second, significantly increased the stability of the hemoglobin pseudo-tetramer. Chemical crosslinking of the beta-globins in addition to genetic fusion of alpha-globins further stabilized the hemoglobin molecule. A dihemoglobin molecule produced by the genetic fusion of two di-alpha-globins with a flexible linker demonstrated a decreased stability relative to the corresponding monohemoglobin. Copyright 1999 Academic Press.

Removing peroxide impurities from ether improves the quality of globin chains for biosynthetic studies.

PubMed

Mirzazadeh, Roghieh; Khatami, Shohreh; Bayat, Parastoo; Zamani, Zahra; Sadeghi, Sedigheh; Roohi, Soghra; Saidi, Parinaz

2005-01-01

The diagnosis of the different forms of thalassemia is one of the important applications of analysis of globin chains. These analyses are done by high performance liquid chromatography (HPLC) using a MONO-S cation exchange column and ether is used for washing the globin powder in the final step. The presence of peroxide impurities in ether could change the structure of the globin chains. In the chromatograms, these modified globins appear as separated peaks next to the unmodified globin peaks. In these cases, the alpha/beta ratio exceed by artifact the correct value. Our study demonstrates that diagnostic centers should ensure that the ether they use is pure.

Correction of Murine Sickle Cell Disease Using γ-Globin Lentiviral Vectors to Mediate High-level Expression of Fetal Hemoglobin

PubMed Central

Pestina, Tamara I; Hargrove, Phillip W; Jay, Dennis; Gray, John T; Boyd, Kelli M; Persons, Derek A

2008-01-01

Increased levels of red cell fetal hemogloblin, whether due to hereditary persistence of expression or from induction with hydroxyurea therapy, effectively ameliorate sickle cell disease (SCD). Therefore, we developed erythroid-specific, γ-globin lentiviral vectors for hematopoietic stem cell (HSC)-targeted gene therapy with the goal of permanently increasing fetal hemoglobin (HbF) production in sickle red cells. We evaluated two different γ-globin lentiviral vectors for therapeutic efficacy in the BERK sickle cell mouse model. The first vector, V5, contained the γ-globin gene driven by 3.1 kb of β-globin regulatory sequences and a 130-bp β-globin promoter. The second vector, V5m3, was identical except that the γ-globin 3′-untranslated region (3′-UTR) was replaced with the β-globin 3′-UTR. Adult erythroid cells have β-globin mRNA 3′-UTR-binding proteins that enhance β-globin mRNA stability and we postulated this design might enhance γ-globin expression. Stem cell gene transfer was efficient and nearly all red cells in transplanted mice expressed human γ-globin. Both vectors demonstrated efficacy in disease correction, with the V5m3 vector producing a higher level of γ-globin mRNA which was associated with high-level correction of anemia and secondary organ pathology. These data support the rationale for a gene therapy approach to SCD by permanently enhancing HbF using a γ-globin lentiviral vector. PMID:19050697

Prevalence of βS-globin gene haplotypes, α-thalassemia (3.7 kb deletion) and redox status in patients with sickle cell anemia in the state of Paraná, Brazil

PubMed Central

Shimauti, Eliana LitsukoTomimatsu; Silva, Danilo Grunig Humberto; de Souza, Eniuce Menezes; de Almeida, Eduardo Alves; Leal, Francismar Prestes; Bonini-Domingos, Claudia Regina

2015-01-01

The aim of this study was to determine the frequency of beta S-globin gene (βS globin) haplotypes and alpha thalassemia with 3.7 kb deletion (−α3.7kb thalassemia) in the northwest region of Paraná state, and to investigate the oxidative and clinical-hematological profile of βS globin carriers in this population. Of the 77 samples analyzed, 17 were Hb SS, 30 were Hb AS and 30 were Hb AA. The βSglobin haplotypes and −α3.7kb thalassemia were identified using polymerase chain reaction.Trolox equivalent antioxidant capacity (TEAC) and lipid peroxidation (LPO) were assessed spectophotometrically. Serum melatonin levels were determined using high-performance liquid chromatography coupled to coulometric electrochemical detection. The haplotype frequencies in the SS individuals were as follows: Bantu- 21 (62%), Benin - 11 (32%) and Atypical- 2 (6%). Bantu/Benin was the most frequent genotype. Of the 47 SS and AS individuals assessed, 17% (n = 8) had the −α3.7kb mutation. Clinical manifestations, as well as serum melatonin, TEAC and LPO levels did not differ between Bantu/Bantu and Bantu/Benin individuals (p > 0.05). Both genotypes were associated with high LPO and TEAC levels and decreased melatonin concentration. These data suggest that the level of oxidative stress in patients with Bantu/Bantu and Bantu/Benin genotypes may overload the antioxidant capacity. PMID:26500435

Polymorphism of the beta3-adrenergic receptor gene affects basal metabolic rate in obese Finns.

PubMed

Sipiläinen, R; Uusitupa, M; Heikkinen, S; Rissanen, A; Laakso, M

1997-01-01

Low basal metabolic rate (BMR) is a risk factor for weight gain and obesity. The polymorphism at codon 64 of the beta3-adrenergic receptor gene has been suggested to be associated with BMR. We investigated the frequency of the Trp64Arg of the beta3-adrenergic receptor gene and the effects of this polymorphism on BMR in obese Finns. Altogether, 170 obese subjects (29 men, 141 women, BMI 34.7 +/- 3.8 kg/m2, mean +/- SD) participated in the study. The frequency of the Trp64Arg polymorphism was 19%. None of the obese subjects were homozygous for the Arg-encoding allele. The frequency of the Trp64Arg polymorphism in obese Finns did not differ from nonobese and normoglycemic control subjects. BMR adjusted for lean body mass and age was lower in subjects with the Trp64Arg polymorphism (n = 20) than in normal homozygotes Trp64Trp (n = 99) (1,569 +/- 73 vs. 1,635 +/- 142 kcal/day, P = 0.004). For the female group (n = 98), the respective values were 1,501 +/- 66 kcal/day vs. 1,568 +/- 127 kcal/day (P = 0.004). There were no significant differences in weight, BMI, waist-to-hip ratio, lean body mass, percentage of fat, and respiratory quotient between the groups with or without the Trp64Arg polymorphism. Neither serum glucose nor insulin levels differed between the two groups. We conclude that the Trp64Arg polymorphism of the beta3-adrenergic receptor gene affects basal metabolic rate in obese Finns but does not have significant effect on glucose metabolism.

Characterization of the transcriptome profiles related to globin gene switching during in vitro erythroid maturation

PubMed Central

2012-01-01

Background The fetal and adult globin genes in the human β-globin cluster on chromosome 11 are sequentially expressed to achieve normal hemoglobin switching during human development. The pharmacological induction of fetal γ-globin (HBG) to replace abnormal adult sickle βS-globin is a successful strategy to treat sickle cell disease; however the molecular mechanism of γ-gene silencing after birth is not fully understood. Therefore, we performed global gene expression profiling using primary erythroid progenitors grown from human peripheral blood mononuclear cells to characterize gene expression patterns during the γ-globin to β-globin (γ/β) switch observed throughout in vitro erythroid differentiation. Results We confirmed erythroid maturation in our culture system using cell morphologic features defined by Giemsa staining and the γ/β-globin switch by reverse transcription-quantitative PCR (RT-qPCR) analysis. We observed maximal γ-globin expression at day 7 with a switch to a predominance of β-globin expression by day 28 and the γ/β-globin switch occurred around day 21. Expression patterns for transcription factors including GATA1, GATA2, KLF1 and NFE2 confirmed our system produced the expected pattern of expression based on the known function of these factors in globin gene regulation. Subsequent gene expression profiling was performed with RNA isolated from progenitors harvested at day 7, 14, 21, and 28 in culture. Three major gene profiles were generated by Principal Component Analysis (PCA). For profile-1 genes, where expression decreased from day 7 to day 28, we identified 2,102 genes down-regulated > 1.5-fold. Ingenuity pathway analysis (IPA) for profile-1 genes demonstrated involvement of the Cdc42, phospholipase C, NF-Kβ, Interleukin-4, and p38 mitogen activated protein kinase (MAPK) signaling pathways. Transcription factors known to be involved in γ-and β-globin regulation were identified. The same approach was used to generate profile-2 genes where expression was up-regulated over 28 days in culture. IPA for the 2,437 genes with > 1.5-fold induction identified the mitotic roles of polo-like kinase, aryl hydrocarbon receptor, cell cycle control, and ATM (Ataxia Telangiectasia Mutated Protein) signaling pathways; transcription factors identified included KLF1, GATA1 and NFE2 among others. Finally, profile-3 was generated from 1,579 genes with maximal expression at day 21, around the time of the γ/β-globin switch. IPA identified associations with cell cycle control, ATM, and aryl hydrocarbon receptor signaling pathways. Conclusions The transcriptome analysis completed with erythroid progenitors grown in vitro identified groups of genes with distinct expression profiles, which function in metabolic pathways associated with cell survival, hematopoiesis, blood cells activation, and inflammatory responses. This study represents the first report of a transcriptome analysis in human primary erythroid progenitors to identify transcription factors involved in hemoglobin switching. Our results also demonstrate that the in vitro liquid culture system is an excellent model to define mechanisms of global gene expression and the DNA-binding protein and signaling pathways involved in globin gene regulation. PMID:22537182

The Full Globin Repertoire of Turtles Provides Insights into Vertebrate Globin Evolution and Functions.

PubMed

Schwarze, Kim; Singh, Abhilasha; Burmester, Thorsten

2015-06-15

Globins are small heme proteins that play an important role in oxygen supply, but may also have other functions. Globins offer a unique opportunity to study the functional evolution of genes and proteins. We have characterized the globin repertoire of two different turtle species: the Chinese softshell turtle (Pelodiscus sinensis) and the western painted turtle (Chrysemys picta bellii). In the genomes of both species, we have identified eight distinct globin types: hemoglobin (Hb), myoglobin, neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Therefore, along with the coelacanth, turtles are so far the only known vertebrates with a full globin repertoire. This fact allows for the first time a comparative analysis of the expression of all eight globins in a single species. Phylogenetic analysis showed an early divergence of neuroglobin and globin X before the radiation of vertebrates. Among the other globins, cytoglobin diverged first, and there is a close relationship between myoglobin and globin E; the position of globin Y is not resolved. The globin E gene was selectively lost in the green anole, and the genes coding for globin X and globin Y were deleted in chicken. Quantitative real-time reverse transcription polymerase chain reaction experiments revealed that myoglobin, neuroglobin, and globin E are highly expressed with tissue-specific patterns, which are in line with their roles in the oxidative metabolism of the striated muscles, the brain, and the retina, respectively. Histochemical analyses showed high levels of globin E in the pigment epithelium of the eye. Globin E probably has a myoglobin-like role in transporting O2 across the pigment epithelium to supply in the metabolically highly active retina. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

A new gene deletion in the alpha-like globin gene cluster as the molecular basis for the rare alpha-thalassemia-1(--/alpha alpha) in blacks: HbH disease in sickle cell trait.

PubMed

Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P

1986-02-01

A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.

Production of Gene-Corrected Adult Beta Globin Protein in Human Erythrocytes Differentiated from Patient iPSCs After Genome Editing of the Sickle Point Mutation.

PubMed

Huang, Xiaosong; Wang, Ying; Yan, Wei; Smith, Cory; Ye, Zhaohui; Wang, Jing; Gao, Yongxing; Mendelsohn, Laurel; Cheng, Linzhao

2015-05-01

Human induced pluripotent stem cells (iPSCs) and genome editing provide a precise way to generate gene-corrected cells for disease modeling and cell therapies. Human iPSCs generated from sickle cell disease (SCD) patients have a homozygous missense point mutation in the HBB gene encoding adult β-globin proteins, and are used as a model system to improve strategies of human gene therapy. We demonstrate that the CRISPR/Cas9 system designer nuclease is much more efficient in stimulating gene targeting of the endogenous HBB locus near the SCD point mutation in human iPSCs than zinc finger nucleases and TALENs. Using a specific guide RNA and Cas9, we readily corrected one allele of the SCD HBB gene in human iPSCs by homologous recombination with a donor DNA template containing the wild-type HBB DNA and a selection cassette that was subsequently removed to avoid possible interference of HBB transcription and translation. We chose targeted iPSC clones that have one corrected and one disrupted SCD allele for erythroid differentiation assays, using an improved xeno-free and feeder-free culture condition we recently established. Erythrocytes from either the corrected or its parental (uncorrected) iPSC line were generated with similar efficiencies. Currently ∼6%-10% of these differentiated erythrocytes indeed lacked nuclei, characteristic of further matured erythrocytes called reticulocytes. We also detected the 16-kDa β-globin protein expressed from the corrected HBB allele in the erythrocytes differentiated from genome-edited iPSCs. Our results represent a significant step toward the clinical applications of genome editing using patient-derived iPSCs to generate disease-free cells for cell and gene therapies. Stem Cells 2015;33:1470-1479. © 2015 AlphaMed Press.

Understanding α-globin gene regulation and implications for the treatment of β-thalassemia.

PubMed

Mettananda, Sachith; Gibbons, Richard J; Higgs, Douglas R

2016-03-01

Over the past three decades, a vast amount of new information has been uncovered describing how the globin genes are regulated. This knowledge has provided significant insights into the general understanding of the regulation of human genes. It is now known that molecular defects within and around the α- and β-globin genes, as well as in the distant regulatory elements, can cause thalassemia. Unbalanced production of globin chains owing to defective synthesis of one, and the continued unopposed synthesis of another, is the central causative factor in the cellular pathology and pathophysiology of thalassemia. A large body of clinical, genetic, and experimental evidence suggests that altering globin chain imbalance by reducing the production of α-globin synthesis ameliorates the disease severity in patients with β-thalassemia. With the development of new genetic-based therapeutic tools that have a potential to decrease the expression of a selected gene in a tissue-specific manner, the possibility of decreasing expression of the α-globin gene to improve the clinical severity of β-thalassemia could become a reality. © 2015 New York Academy of Sciences.

Meta-analysis of genetic studies from journals published in China of ischemic stroke in the Han Chinese population.

PubMed

Xu, Xiaowei; Li, Jiejie; Sheng, Wenli; Liu, Lin

2008-01-01

The aim of this study was to confirm the nature and number of genes contributing to stroke risk and qualify the genetic risk of each susceptibility gene in the Han Chinese population. After collecting all case-control studies related to DNA polymorphism of any candidate gene for ischemic stroke in Han Chinese, strict selection criteria and exclusion criteria were determined and different effect models were used according to the difference in heterogeneity. Meta-analyses were carried out by Revman 4.0 software and the publication bias was further evaluated through calculation of fail-safe numbers in the included gene polymorphisms. Seventy-six studies were included in the meta-analyses which were all published in mainland China and referred to 6 candidate genes and 7 polymorphisms. Among the gene polymorphisms tested in the study, association of gene polymorphisms with increasing risk of ischemic stroke was confirmed in 6 polymorphisms including angiotensin-converting enzyme insertion/deletion (ACE I/D; OR = 1.87, 95% CI = 1.45-2.42), methylenetetrahydrofolate reductase (MTHFR) C677T (OR = 1.55, 95% CI = 1.26-1.90), plasminogen activator inhibitor 1 (PAI-1) 4G/5G (OR = 1.79, 95% CI = 1.20-2.67), beta-fibrinogen (beta-Fg) -455A/G (OR = 1.48, 95% CI = 1.14-1.92), beta-Fg -148T/C (OR = 1.72, 95% CI = 1.42-2.07), apolipoprotein E (ApoE) epsilon2-4 (OR = 2.39, 95% CI = 1.94-2.95). Because of the obvious publication bias, the association between paraoxonase 1 (PON-1) polymorphisms and stroke risk was not established although the OR of the meta-analysis suggested a positive result (OR = 1.14, 95% CI = 1.01-1.35). ACE D/I, MTHFR C677T, beta-Fg -455A/G, beta-Fg -148T/C, PAI-1 4G/5G, and ApoE epsilon2-4 were associated with risk of ischemic stroke in Han Chinese. (c) 2008 S. Karger AG, Basel

Role of XmnIgG Polymorphism in Hydroxyurea Treatment and Fetal Hemoglobin Level at Isfahanian Intermediate β-Thalassemia Patients.

PubMed

Motovali-Bashi, Majid; Ghasemi, Tayyebeh

2015-01-01

β-thalassemia is the most common monogenic disorder in human. The (C-->T) polymorphism at -158 upstream region of the γG-globin gene and pharmacological factors such as hydroxyurea have been reported to influence γ-globin gene expression and the severity of clinical symptoms of β-thalassemia. In the present study, 51 β-thalassemia intermediate patients were studied. Xmn1γG polymorphism genotype was determined using Tetra-Primer ARMS-PCR technique. Hemoglobin (Hb) and fetal hemoglobin (HbF) levels were determined by gel electrophoresis. Of 51 patients, 35 (68.6%) patients were heterozygous (CT) and 16 (31.4%) patients were homozygous (CC). Of 30 patients under treatment by hydroxyurea, 20 (66.7%) patients were heterozygous (CT) and 10 (33.3%) patients were homozygous (CC). Our results demonstrated that in the heterozygous (CT) genotype, the Hb (9.58 ± 1.25 gm/dl) and HbF (89.30 ± 21.87) levels were significantly higher in comparison with homozygous (CC) genotype (7.94 ± 1.34 gm/dl and 70.32 ± 40.56, respectively). Furthermore, we observed that after drug usage, the Hb and HbF levels in patients with heterozygous (CT) genotype (0.7 ± 1.26 gm/dl and 5.95 ± 14.8, respectively) raised more in comparison with homozygous (CC) genotype (0.26 ± 1.43 gm/dl and 0.8 ± 1.31, respectively). Hb and HbF levels in the patients carrying T allele are increased significantly, and they also response to hydroxyurea treatment.

Context-dependent EKLF responsiveness defines the developmental specificity of the human ɛ-globin gene in erythroid cells of YAC transgenic mice

PubMed Central

Tanimoto, Keiji; Liu, Qinghui; Grosveld, Frank; Bungert, Jörg; Engel, James Douglas

2000-01-01

We explored the mechanism of definitive-stage ɛ-globin transcriptional inactivity within a human β-globin YAC expressed in transgenic mice. We focused on the globin CAC and CAAT promoter motifs, as previous laboratory and clinical studies indicated a pivotal role for these elements in globin gene activation. A high-affinity CAC-binding site for the erythroid krüppel-like factor (EKLF) was placed in the ɛ-globin promoter at a position corresponding to that in the adult β-globin promoter, thereby simultaneously ablating a direct repeat (DR) element. This mutation led to EKLF-independent ɛ-globin transcription during definitive erythropoiesis. A second 4-bp substitution in the ɛ-globin CAAT sequence, which simultaneously disrupts a second DR element, further enhanced ectopic definitive erythroid activation of ɛ-globin transcription, which surprisingly became EKLF dependent. We finally examined factors in nuclear extracts prepared from embryonic or adult erythroid cells that bound these elements in vitro, and we identified a novel DR-binding protein (DRED) whose properties are consistent with those expected for a definitive-stage ɛ-globin repressor. We conclude that the suppression of ɛ-globin transcription during definitive erythropoiesis is mediated by the binding of a repressor that prevents EKLF from activating the ɛ-globin gene. PMID:11069894

Illegitimate transcription: transcription of any gene in any cell type.

PubMed Central

Chelly, J; Concordet, J P; Kaplan, J C; Kahn, A

1989-01-01

Using in vitro amplification of cDNA by the polymerase chain reaction, we have detected spliced transcripts of various tissue-specific genes (genes for anti-Müllerian hormone, beta-globin, aldolase A, and factor VIIIc) in human nonspecific cells, such as fibroblasts, hepatoma cells, and lymphoblasts. In rats, erythroid- and liver-type pyruvate kinase transcripts were also detected in brain, lung, and muscle. The abundance of these "illegitimate" transcripts is very low; yet, their existence and the possibility of amplifying them by the cDNA polymerase chain reaction provide a powerful tool to analyze pathological transcripts of any tissue-specific gene by using any accessible cell. Images PMID:2495532

Evolution and Expression of Tissue Globins in Ray-Finned Fishes.

PubMed

Gallagher, Michael D; Macqueen, Daniel J

2017-01-01

The globin gene family encodes oxygen-binding hemeproteins conserved across the major branches of multicellular life. The origins and evolutionary histories of complete globin repertoires have been established for many vertebrates, but there remain major knowledge gaps for ray-finned fish. Therefore, we used phylogenetic, comparative genomic and gene expression analyses to discover and characterize canonical “non-blood” globin family members (i.e., myoglobin, cytoglobin, neuroglobin, globin-X, and globin-Y) across multiple ray-finned fish lineages, revealing novel gene duplicates (paralogs) conserved from whole genome duplication (WGD) and small-scale duplication events. Our key findings were that: (1) globin-X paralogs in teleosts have been retained from the teleost-specific WGD, (2) functional paralogs of cytoglobin, neuroglobin, and globin-X, but not myoglobin, have been conserved from the salmonid-specific WGD, (3) triplicate lineage-specific myoglobin paralogs are conserved in arowanas (Osteoglossiformes), which arose by tandem duplication and diverged under positive selection, (4) globin-Y is retained in multiple early branching fish lineages that diverged before teleosts, and (5) marked variation in tissue-specific expression of globin gene repertoires exists across ray-finned fish evolution, including several previously uncharacterized sites of expression. In this respect, our data provide an interesting link between myoglobin expression and the evolution of air breathing in teleosts. Together, our findings demonstrate great-unrecognized diversity in the repertoire and expression of nonblood globins that has arisen during ray-finned fish evolution.

Zebrafish globin switching occurs in two developmental stages and is controlled by the LCR.

PubMed

Ganis, Jared J; Hsia, Nelson; Trompouki, Eirini; de Jong, Jill L O; DiBiase, Anthony; Lambert, Janelle S; Jia, Zhiying; Sabo, Peter J; Weaver, Molly; Sandstrom, Richard; Stamatoyannopoulos, John A; Zhou, Yi; Zon, Leonard I

2012-06-15

Globin gene switching is a complex, highly regulated process allowing expression of distinct globin genes at specific developmental stages. Here, for the first time, we have characterized all of the zebrafish globins based on the completed genomic sequence. Two distinct chromosomal loci, termed major (chromosome 3) and minor (chromosome 12), harbor the globin genes containing α/β pairs in a 5'-3' to 3'-5' orientation. Both these loci share synteny with the mammalian α-globin locus. Zebrafish globin expression was assayed during development and demonstrated two globin switches, similar to human development. A conserved regulatory element, the locus control region (LCR), was revealed by analyzing DNase I hypersensitive sites, H3K4 trimethylation marks and GATA1 binding sites. Surprisingly, the position of these sites with relation to the globin genes is evolutionarily conserved, despite a lack of overall sequence conservation. Motifs within the zebrafish LCR include CACCC, GATA, and NFE2 sites, suggesting functional interactions with known transcription factors but not the same LCR architecture. Functional homology to the mammalian α-LCR MCS-R2 region was confirmed by robust and specific reporter expression in erythrocytes of transgenic zebrafish. Our studies provide a comprehensive characterization of the zebrafish globin loci and clarify the regulation of globin switching. Copyright © 2012 Elsevier Inc. All rights reserved.

A 21 Nucleotide Duplication on the α1- and α2-Globin Genes Involves a Variety of Hypochromic Microcytic Anemias, From Mild to Hb H Disease.

PubMed

Farashi, Samaneh; Faramarzi Garous, Negin; Zeinali, Fatemeh; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Najmabadi, Hossein; Azarkeivan, Azita; Tamaddoni, Ahmad

2015-01-01

α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects in the α-globin gene cluster can result in α-thal that may develop into a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. Loss of one functional α gene, indicated as heterozygous α(+)-thal, shows minor hematological abnormalities. Homozygosity for α(+)- or heterozygosity for α(0)-thal have more severe hematological abnormalities due to a markedly reduced α chain output. At the molecular level, the absence of three α-globin genes resulting from the compound heterozygous state for α(0)- and α(+)-thal, lead to Hb H disease. Here we present a 21 nucleotide (nt) duplication consisting of six amino acids and 3 bp of intronic sequence at the exon-intron boundary, in both the α-globin genes, detected by direct DNA sequencing. This duplication was identified in three patients originating from two different Iranian ethnic groups and one Arab during more than 12 years. The clinical presentation of these individuals varies widely from a mild asymptomatic anemia (heterozygote in α1-globin gene) to a severely anemic state, diagnosed as an Hb H individual requiring blood transfusion (duplication on the α2-globin gene in combination with the - -(MED) double α-globin gene deletion). The third individual, who was homozygous for this nt duplication on the α1-globin gene, showed severe hypochromic microcytic anemia and splenomegaly. In the last decade, numerous α-globin mutations have demonstrated the necessity of prenatal diagnosis (PND) for α-thal, and this study has contributed another mutation as important enough that needs to be considered.

[The effect of DNA hydroxymethylase Tet2 on γ globin activation in the treatment of β-thalassemia].

PubMed

Li, W X; Ma, Q W; Zeng, F Y

2018-03-01

Objective: To study the function of ten-eleven translocation 2 (Tet2) in γ globin gene expression in patients with β- thalassemia. Methods: Gamma globin expression was induced by 5-azacytidine and Tet2 gene expression was knocked down by short hairpin RNA (shRNA) in a human immortalized myelogenous leukemia K562 cell line. The global 5-hydroxymethylcytosine (5hmC) level was measured by an ELISA kit. 5hmC level of γ globin gene was quantified by sulfite sequencing. The mRNA level of Tet2, γ globin, and related transcription factors Nfe4 and Klf1 were quantified by real-time PCR. Results: Tet2 knockdown resulted in a decreased global 5hmC level from 0.14% to 0.03% as of the control group in K562 cells. The expression of γ globin was enhanced after 5-azacytidine treatment in vitro. However, γ globin mRNA level in Tet2 knockdown cells was only 55% as that in control group. The CG sites on γ globin gene were unmethylated. As Tet2 was down-regulated, the expression levels of Nfe4 and Klf1 decreased by about 80% and increased to 3.5 folds, respectively. Conclusions: Tet2 appears to maintain 5hmC level and facilitates γ globin gene activation. Moreover, Tet2 more likely regulates γ globin expression via affecting transcription factors rather than the gene itself. Thus, Tet2 could be a potential therapeutic target for β thalassemias.

Prediction of exercise-mediated changes in metabolic markers by gene polymorphism.

PubMed

Kahara, Toshio; Takamura, Toshinari; Hayakawa, Tetsuo; Nagai, Yukihiro; Yamaguchi, Hiromi; Katsuki, Tatsuo; Katsuki, Ken-ichi; Katsuki, Michio; Kobayashi, Ken-ichi

2002-08-01

The effects of regular physical exercise on obesity-associated metabolic abnormalities vary for each individual. In this study, we investigated whether genotypes of genes associated with obesity can predict the effects of exercise on changes in metabolic markers in healthy men. Healthy Japanese men (n=106) performed the exercise program at 50% of their maximal heart rate for 20-60 min a day, 2-3 days each week for 3 months. The levels of fasting plasma glucose (FPG) and serum leptin significantly decreased after the exercise program. Polymorphisms of the beta3-adrenergic receptor (beta3AR) and uncoupling protein-1 (UCP-1) genes were analyzed with RFLP methods. In the Trp/Trp genotype of the beta3AR gene, the levels of serum leptin, FPG and fructosamine (FrAm) decreased significantly after the exercise program, but not in the Arg/Arg genotype. In the AG heterozygote and the GG homozygote of the UCP-1 gene, FPG and FrAm levels were significantly reduced, respectively. In conclusion, gene polymorphism of the beta3AR and UCP-1 was found to be associated with the exercise-mediated improvement in glucose tolerance and leptin resistance in healthy Japanese men.

A polymorphism of the interleukin-1 beta gene is associated with sperm pathology in humans.

PubMed

Bentz, Eva-Katrin; Hefler, Lukas A; Denschlag, Dominik; Pietrowski, Detlef; Buerkle, Bernd; Tempfer, Clemens B

2007-09-01

In a prospective case-control study of 127 normozoospermic and 435 non-normozoospermic Caucasian men, the genotype frequencies of a polymorphism of the interleukin-1 beta gene (IL-1beta Taq C-->T) were statistically significantly different between groups (homozygous wild-type C/C [57%], heterozygous C/T [42%], and homozygous mutant T/T [1%] vs. C/C [57%], C/T [36%], T/T [7%] for normozoospermic and non-normozoospermic men, respectively; odds ratio, 4.8; 95% confidence interval, 1.13 to 20.28). This association was restricted to men with the oligoasthenoteratozoospermia (OAT) syndrome. We conclude that the investigated polymorphism is associated with sperm pathology in Caucasians.

Human beta-globin mRNAs that harbor a nonsense codon are degraded in murine erythroid tissues to intermediates lacking regions of exon I or exons I and II that have a cap-like structure at the 5' termini.

PubMed Central

Lim, S K; Maquat, L E

1992-01-01

Previous studies have demonstrated that nonsense codons within beta zero-thalassemic or in vitro-mutagenized human beta-globin transgenes result in the production of mRNAs that are degraded abnormally rapidly in the cytoplasm of murine erythroid cells. As a consequence, three RNA degradative intermediates are formed that lack sequences from either exon I or exons I and II. We show here that the intermediates, like the full-length mRNA from which they derive and the endogenous murine beta maj-globin mRNA, bind to the anticap monoclonal antibody H-20 in a way that is competed by the cap analogue m7G and eliminated by prior exposure to tobacco acid pyrophosphatase. Furthermore, the intermediates, like the two full-length mRNAs, are resistant to a 5'----3' exonuclease activity isolated from HeLa cell nuclei that degrades uncapped but not capped ribopolymers. Based on these observations, the intermediates appear to possess a structure that is indistinguishable from the cap at the 5' end of mRNA, i.e. a methylated nucleoside that is linked to the RNA by a 5'-5' phosphodiester bond. Detection of the intermediates during murine development was concomitant with detection of full-length thalassemic mRNA. Intermediate production appears to be influenced by RNA structure as indicated by the products that derive from a beta zero-thalassemic beta-globin transgene harboring a structural alteration (a 4 bp deletion) that was larger than any of those previously studied. Images PMID:1324170

Association of an α-globin gene cluster duplication and heterozygous β-thalassemia in a patient with a severe thalassemia syndrome.

PubMed

Jiang, Hua; Liu, Sha; Zhang, Yong-Ling; Wan, Jun-Hui; Li, Ru; Li, Dong-Zhi

2015-01-01

We describe a new case of a β-thalassemia (β-thal) heterozygote with the mutation IVS-II-654 (C>T) presenting with a transfusion-dependent phenotype. Multiplex ligation-dependent probe amplification (MLPA) and array comparative genomic hybridization (CGH) analyses of the α-globin gene cluster revealed a full duplication of the α-globin genes including the upstream regulatory element. The duplicated allele and the normal allele in trans resulted in a total of six active α-globin genes. The severe clinical phenotype seemed to be related to the considerable excess of the α- and β-globin deficit caused by the presence of the β-thal. α-Globin cluster duplication should be considered in patients heterozygous for β-thal who show a more severe phenotype than β-thal trait.

Inhibition of G9a methyltransferase stimulates fetal hemoglobin production by facilitating LCR/γ-globin looping.

PubMed

Krivega, Ivan; Byrnes, Colleen; de Vasconcellos, Jaira F; Lee, Y Terry; Kaushal, Megha; Dean, Ann; Miller, Jeffery L

2015-07-30

Induction of fetal hemoglobin (HbF) production in adult erythrocytes can reduce the severity of sickle cell disease and β-thalassemia. Transcription of β-globin genes is regulated by the distant locus control region (LCR), which is brought into direct gene contact by the LDB1/GATA-1/TAL1/LMO2-containing complex. Inhibition of G9a H3K9 methyltransferase by the chemical compound UNC0638 activates fetal and represses adult β-globin gene expression in adult human hematopoietic precursor cells, but the underlying mechanisms are unclear. Here we studied UNC0638 effects on β-globin gene expression using ex vivo differentiation of CD34(+) erythroid progenitor cells from peripheral blood of healthy adult donors. UNC0638 inhibition of G9a caused dosed accumulation of HbF up to 30% of total hemoglobin in differentiated cells. Elevation of HbF was associated with significant activation of fetal γ-globin and repression of adult β-globin transcription. Changes in gene expression were associated with widespread loss of H3K9me2 in the locus and gain of LDB1 complex occupancy at the γ-globin promoters as well as de novo formation of LCR/γ-globin contacts. Our findings demonstrate that G9a establishes epigenetic conditions preventing activation of γ-globin genes during differentiation of adult erythroid progenitor cells. In this view, manipulation of G9a represents a promising epigenetic approach for treatment of β-hemoglobinopathies.

Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

PubMed

Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

2006-01-01

The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

mNotch1 signaling and erythropoietin cooperate in erythroid differentiation of multipotent progenitor cells and upregulate beta-globin.

PubMed

Henning, Konstanze; Schroeder, Timm; Schwanbeck, Ralf; Rieber, Nikolaus; Bresnick, Emery H; Just, Ursula

2007-09-01

In many developing tissues, signaling mediated by activation of the transmembrane receptor Notch influences cell-fate decisions, differentiation, proliferation, and cell survival. Notch receptors are expressed on hematopoietic cells and cognate ligands on bone marrow stromal cells. Here, we investigate the role of mNotch1 signaling in the control of erythroid differentiation of multipotent progenitor cells. Multipotent FDCP-mix cell lines engineered to permit the conditional induction of the constitutively active intracellular domain of mNotch1 (mN1(IC)) by the 4-hydroxytamoxifen (OHT)-inducible system were used to analyze the effects of activated mNotch1 on erythroid differentiation and on expression of Gata1, Fog1, Eklf, NF-E2, and beta-globin. Expression was analyzed by Northern blotting and real-time polymerase chain reaction. Enhancer activity of reporter constructs was determined with the dual luciferase system in transient transfection assays. Induction of mN1(IC) by OHT resulted in increased and accelerated differentiation of FDCP-mix cells along the erythroid lineage. Erythroid maturation was induced by activated Notch1 also under conditions that normally promote self-renewal, but required the presence of erythropoietin for differentiation to proceed. While induction of Notch signaling rapidly upregulated Hes1 and Hey1 expression, the expression of Gata1, Fog1, Eklf, and NF-E2 remained unchanged. Concomitantly with erythroid differentiation, activated mNotch1 upregulated beta-globin RNA. Notch signaling transactivated a reporter construct harboring a conserved RBP-J (CBF1) binding site in the hypersensitive site 2 (HS2) of human beta-globin. Transactivation by activated Notch was completely abolished when this RBP-J site was mutated to prevent RBP-J binding. Our results show that activation of mNotch1 induces erythroid differentiation in cooperation with erythropoietin and upregulates beta-globin expression.

Hb Hope [beta136(H14)Gly-->Asp (GGT-->GAT)]: interactions with Hb S [beta6(A3)Glu-->Val (GAG-->GTG)], other variant hemoglobins and thalassemia.

PubMed

Ingle, John; Adewoye, Adeboye; Dewan, Robert; Okoli, Michael; Rollins, Lamarr; Eung, Shawn H; Luo, Hong-Yuan; Chui, David H K; Steinberg, Martin H

2004-01-01

Hb Hope [beta136(H14)Gly-->Asp (GGT-->GAT)] was first described in an African-American family in 1965. Since then, it has been found in combination with several different globin gene mutations in many other families of divergent ethnic backgrounds. The basis for its relatively frequent occurrences remains unexplained. This variant hemoglobin (Hb) is mildly unstable and has reduced oxygen affinity, but is generally innocuous clinically. This variant Hb can present as a confounding factor in arriving at a correct diagnosis by either electrophoresis or high performance liquid chromatography (HPLC), particularly during the neonatal period. DNA-based diagnostics can help solve this potential problem.

Surface plasmon resonance-based molecular detection of Hb S [beta6(A3)Glu-->Val, GAG-->GTG] at the gene level.

PubMed

Atalay, Erol O; Ustel, Emre; Yildiz, Sanem; Atalay, Ayfer

2006-01-01

The surface plasmon resonance (SPR) approach, being a relatively novel biophysical method, is used to detect many different targets by biomolecular interaction. The SPR system uses optical and evanescent wave phenomenon. This approach does not need any labels, such as enzymes or isotopes, and the monitored interactions are in real time. In DNA-DNA interaction, the SPR approach is Tm-independent. Here we report our preliminary results for the molecular detection of the Hb S (GAG -->GTG) mutation at codon 6 of the human beta-globin gene. Our preliminary results show that the SPR approach could be applied as an inexpensive and fast routine test system for the molecular diagnosis of abnormal hemoglobins (Hbs), especially in premarital screening programs.

Evolution and Expression of Tissue Globins in Ray-Finned Fishes

PubMed Central

Gallagher, Michael D.

2017-01-01

The globin gene family encodes oxygen-binding hemeproteins conserved across the major branches of multicellular life. The origins and evolutionary histories of complete globin repertoires have been established for many vertebrates, but there remain major knowledge gaps for ray-finned fish. Therefore, we used phylogenetic, comparative genomic and gene expression analyses to discover and characterize canonical “non-blood” globin family members (i.e., myoglobin, cytoglobin, neuroglobin, globin-X, and globin-Y) across multiple ray-finned fish lineages, revealing novel gene duplicates (paralogs) conserved from whole genome duplication (WGD) and small-scale duplication events. Our key findings were that: (1) globin-X paralogs in teleosts have been retained from the teleost-specific WGD, (2) functional paralogs of cytoglobin, neuroglobin, and globin-X, but not myoglobin, have been conserved from the salmonid-specific WGD, (3) triplicate lineage-specific myoglobin paralogs are conserved in arowanas (Osteoglossiformes), which arose by tandem duplication and diverged under positive selection, (4) globin-Y is retained in multiple early branching fish lineages that diverged before teleosts, and (5) marked variation in tissue-specific expression of globin gene repertoires exists across ray-finned fish evolution, including several previously uncharacterized sites of expression. In this respect, our data provide an interesting link between myoglobin expression and the evolution of air breathing in teleosts. Together, our findings demonstrate great-unrecognized diversity in the repertoire and expression of nonblood globins that has arisen during ray-finned fish evolution. PMID:28173090

Expression of transcription factors during sodium phenylacetate induced erythroid differentiation in K562 cells.

PubMed

Rath, A V; Schmahl, G E; Niemeyer, C M

1997-01-01

During 15 days of treatment of K562 cells with sodium phenylacetate, we observed an increase in the cellular hemoglobin concentration with a similar increase in the expression of gamma-globin mRNA. Morphological studies demonstrated characteristic features of erythroid differentiation and maturation. At the same time there was no change in the level of expression of the cell surface antigenes CD33, CD34, CD45, CD71 and glycophorin A. Likewise, the level of expression of the erythroid transcription factors GATA-1, GATA-2, NF-E2, SCL and RBTN2, all expressed in untreated K562 cells, did not increase during sodium phenylacetate induced erythroid differentiation. The expression of the nuclear factors Evi-1 and c-myb, known to inhibit erythroid differentiation, did not decrease. We conclude that sodium phenylacetate treatment of K562 cells increases gamma-globin mRNA and induces cell maturation as judged by morphology without affecting the expression of the erythroid transcription factors, some of which are known to be involved in the regulation of beta-like globin genes.

Mutations on the α2-Globin Gene That May Trigger α(+)-Thalassemia.

PubMed

Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

In the present study, a total of 11 individuals with hypochromic microcytic anemia who did not reveal the most common α-thalassemia (α-thal) deletions or mutations, were subjected to more investigations by DNA sequencing of the α-globin genes. Seven novel nondeletional α-thal mutations localized on the α2-globin gene in the heterozygous state were identified. These mutations either corrupted regulatory splice sites and consequently affected RNA processing or created unstable hemoglobin (Hb) variants. The mutations described here produced globin gene variants that lead to amino acid changes in critical regions of the globin chain. The clinical presentation of most patients was a persistent mild microcytic anemia similar to an α(+)-thal. In the last decade, numerous α-globin mutations have been observed leading to an α-thal phenotype and these studies have been considered to be important as discussed here.

Amoebozoa Possess Lineage-Specific Globin Gene Repertoires Gained by Individual Horizontal Gene Transfers

PubMed Central

Dröge, Jasmin; Buczek, Dorota; Suzuki, Yutaka; Makałowski, Wojciech

2014-01-01

The Amoebozoa represent a clade of unicellular amoeboid organisms that display a wide variety of lifestyles, including free-living and parasitic species. For example, the social amoeba Dictyostelium discoideum has the ability to aggregate into a multicellular fruiting body upon starvation, while the pathogenic amoeba Entamoeba histolytica is a parasite of humans. Globins are small heme proteins that are present in almost all extant organisms. Although several genomes of amoebozoan species have been sequenced, little is known about the phyletic distribution of globin genes within this phylum. Only two flavohemoglobins (FHbs) of D. discoideum have been reported and characterized previously while the genomes of Entamoeba species are apparently devoid of globin genes. We investigated eleven amoebozoan species for the presence of globin genes by genomic and phylogenetic in silico analyses. Additional FHb genes were identified in the genomes of four social amoebas and the true slime mold Physarum polycephalum. Moreover, a single-domain globin (SDFgb) of Hartmannella vermiformis, as well as two truncated hemoglobins (trHbs) of Acanthamoeba castellanii were identified. Phylogenetic evidence suggests that these globin genes were independently acquired via horizontal gene transfer from some ancestral bacteria. Furthermore, the phylogenetic tree of amoebozoan FHbs indicates that they do not share a common ancestry and that a transfer of FHbs from bacteria to amoeba occurred multiple times. PMID:25013378

Influence of the IL-1Ra gene polymorphism on in vivo synthesis of IL-1Ra and IL-1beta after live yellow fever vaccination.

PubMed

Hacker, U T; Erhardt, S; Tschöp, K; Jelinek, T; Endres, S

2001-09-01

The inflammatory response in infectious and autoimmune diseases is regulated by the balance between pro- and anti-inflammatory cytokines. The IL-1 complex contains polymorphic genes coding for IL-1alpha, IL-1beta and IL-1Ra. The IL-1Ra (variable number of tanden repeat) VNTR polymorphism has been shown to influence the capacity to produce IL-1beta and IL-1Ra after in vitro stimulation. Allele 2 of this polymorphism is associated with a number of inflammatory diseases. To determine the impact of the IL-1Ra polymorphism on in vivo human cytokine synthesis, we used a yellow fever vaccination model for the induction of cytokine synthesis in healthy volunteers. Two different yellow fever vaccines were used. After administration of the RKI vaccine (34 volunteers), plasma TNF-alpha concentration increased from 13.4 +/- 0.9 pg/ml to 23.3 +/- 1.1 pg/ml (P < 0.001), and plasma IL-1Ra concentration increased from 308 +/- 25 pg/ml to 1019 +/- 111 pg/ml (P < 0.001), on day 2. Using Stamaril vaccine, no increase in the plasma concentrations of either TNF-alpha or IL-1Ra could be detected (n = 17). Only the RKI vaccine induced TNF-alpha synthesis after in vitro stimulation of MNC. Carriers of allele 2 of the IL-1Ra polymorphism had increased baseline concentrations of IL-1Ra (350 +/- 32 pg/ml) compared with non-carriers (222 +/- 18 pg/ml, P < 0.001), and decreased concentrations of IL-1beta (0.9 +/- 0.2 pg/ml for carriers versus 2.8 +/- 0.7 pg/ml for non-carriers, P = 0.017). After yellow fever vaccination (RKI vaccine), no significant differences in the increase of IL-1Ra plasma levels were detected between carriers and non-carriers of allele 2 of the IL-1Ra gene polymorphism. This is the first study to examine the influence of this genetic polymorphism on in vivo-induced human IL-1beta and IL-1Ra synthesis. Baseline concentrations of IL-1Ra and IL-1beta were significantly influenced by the IL-1Ra polymorphism. No influence of the IL-1Ra polymorphism on the in vivo-induced production of IL-1Ra and IL-1beta could be detected.

Conservation of globin genes in the "living fossil" Latimeria chalumnae and reconstruction of the evolution of the vertebrate globin family.

PubMed

Schwarze, Kim; Burmester, Thorsten

2013-09-01

The (hemo-)globins are among the best-investigated proteins in biomedical sciences. These small heme-proteins play an important role in oxygen supply, but may also have other functions. In addition to well known hemoglobin and myoglobin, six other vertebrate globin types have been identified in recent years: neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Analyses of the genome of the "living fossil" Latimeria chalumnae show that the coelacanth is the only known vertebrate that includes all eight globin types. Thus, Latimeria can also be considered as a "globin fossil". Analyses of gene synteny and phylogenetic reconstructions allow us to trace the evolution and the functional changes of the vertebrate globin family. Neuroglobin and globin X diverged from the other globin types before the separation of Protostomia and Deuterostomia. The cytoglobins, which are unlikely to be involved in O2 supply, form the earliest globin branch within the jawed vertebrates (Gnathostomata), but do not group with the agnathan hemoglobins, as it has been proposed before. There is strong evidence from phylogenetic reconstructions and gene synteny that the eye-specific globin E and muscle-specific myoglobin constitute a common clade, suggesting a similar role in intracellular O2 supply. Latimeria possesses two α- and two β-hemoglobin chains, of which one α-chain emerged prior to the divergence of Actinopterygii and Sarcopterygii, but has been retained only in the coelacanth. Notably, the embryonic hemoglobin α-chains of Gnathostomata derive from a common ancestor, while the embryonic β-chains - with the exception of a more complex pattern in the coelacanth and amphibians - display a clade-specific evolution. Globin Y is associated with the hemoglobin gene cluster, but its phylogenetic position is not resolved. Our data show an early divergence of distinct globin types in the vertebrate evolution before the emergence of tetrapods. The subsequent loss of globins in certain taxa may be associated with changes in the oxygen-dependent metabolism. This article is part of a Special Issue entitled: Oxygen Binding and Sensing Proteins. Copyright © 2013 Elsevier B.V. All rights reserved.

Erythroid activator NF-E2, TAL1 and KLF1 play roles in forming the LCR HSs in the human adult β-globin locus.

PubMed

Kim, Yea Woon; Yun, Won Ju; Kim, AeRi

2016-06-01

The β-like globin genes are developmental stage specifically transcribed in erythroid cells. The transcription of the β-like globin genes requires erythroid specific activators such as GATA-1, NF-E2, TAL1 and KLF1. However, the roles of these activators have not fully elucidated in transcription of the human adult β-globin gene. Here we employed hybrid MEL cells (MEL/ch11) where a human chromosome containing the β-globin locus is present and the adult β-globin gene is highly transcribed by induction. The roles of erythroid specific activators were analyzed by inhibiting the expression of NF-E2, TAL1 or KLF1 in MEL/ch11 cells. The loss of each activator decreased the transcription of human β-globin gene, locus wide histone hyperacetylation and the binding of other erythroid specific activators including GATA-1, even though not affecting the expression of other activators. Notably, sensitivity to DNase I was reduced in the locus control region (LCR) hypersensitive sites (HSs) with the depletion of activators. These results indicate that NF-E2, TAL1 and KLF1, all activators play a primary role in HSs formation in the LCR. It might contribute to the transcription of human adult β-globin gene by allowing the access of activators and cofactors. The roles of activators in the adult β-globin locus appear to be different from the roles in the early fetal locus. Copyright © 2016 Elsevier Ltd. All rights reserved.

Disorders of Human Hemoglobin

NASA Astrophysics Data System (ADS)

Bank, Arthur; Mears, J. Gregory; Ramirez, Francesco

1980-02-01

Studies of the human hemoglobin system have provided new insights into the regulation of expression of a group of linked human genes, the γ -δ -β globin gene complex in man. In particular, the thalassemia syndromes and related disorders of man are inherited anemias that provide mutations for the study of the regulation of globin gene expression. New methods, including restriction enzyme analysis and cloning of cellular DNA, have made it feasible to define more precisely the structure and organization of the globin genes in cellular DNA. Deletions of specific globin gene fragments have already been found in certain of these disorders and have been applied in prenatal diagnosis.

Molecular analysis of globin gene expression in different thalassaemia disorders: individual variation of β(E) pre-mRNA splicing determine disease severity.

PubMed

Tubsuwan, Alisa; Munkongdee, Thongperm; Jearawiriyapaisarn, Natee; Boonchoy, Chanikarn; Winichagoon, Pranee; Fucharoen, Suthat; Svasti, Saovaros

2011-09-01

Thalassaemia is characterized by the reduced or absent production of globins in the haemoglobin molecule leading to imbalanced α-globin/non α-globin chains. HbE, the result of a G to A mutation in codon 26 of the HBB (β-globin) gene, activates a cryptic 5' splice site in codon 25 leading to a reduction of correctly spliced β(E) -globin (HBB:c.79G>A) mRNA and consequently β(+) -thalassaemia. A wide range of clinical severities in bothα- and β-thalassaemia syndromes, from nearly asymptomatic to transfusion-dependent, has been observed. The correlation between clinical heterogeneity in various genotypes of thalassaemia and the levels of globin gene expression and β(E) -globin pre-mRNA splicing were examined using multiplex quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) and allele-specific RT-qPCR. The α-globin/non α-globin mRNA ratio was demonstrated to be a good indicator for disease severity among different thalassaemia disorders. However, the α-globin/non α-globin mRNA ratio ranged widely in β-thalassaemia/HbE patients, with no significant difference between mild and severe phenotypes. Interestingly, the correctly to aberrantly spliced β(E) -globin mRNA ratio in 30% of mild β-thalassaemia/HbE patients was higher than that of the severe patients. The splicing process of β(E) -globin pre-mRNA differs among β-thalassaemia/HbE patients and serves as one of the modifying factors for disease severity. © 2011 Blackwell Publishing Ltd.

Multiple displacement amplification on single cell and possible PGD applications.

PubMed

Hellani, Ali; Coskun, Serdar; Benkhalifa, Moncef; Tbakhi, Abelghani; Sakati, Nadia; Al-Odaib, Ali; Ozand, Pinar

2004-11-01

Multiple displacement amplification (MDA) is a technique used in the amplification of very low amounts of DNA and reported to yield large quantities of high-quality DNA. We used MDA to amplify the whole genome directly from a single cell. The most common techniques used in PGD are PCR and fluorescent in-situ hybridization (FISH). There are many limitations to these techniques including, the number of chromosomes diagnosed for FISH or the quality of DNA issued from a single cell PCR. This report shows, for the first time, use of MDA for single cell whole genome amplification. A total of 16 short tandem repeats (STRs) were amplified successfully with a similar pattern to the genomic DNA. Furthermore, allelic drop out (ADO) derived from MDA was assessed in 40 single cells by analysing (i) heterozygosity for a known beta globin mutation (IVSI-5 C-G) and by studying (ii) the heterozygous loci present in the STRs. ADO turned out to be 10.25% for the beta globin gene sequencing and 5% for the fluorescent PCR analysis of STRs. Moreover, the amplification accuracy of MDA permitted the detection of trisomy 21 on a single cell using comparative genome hybridization-array. Altogether, these data suggest that MDA can be used for single cell molecular karyotyping and the diagnosis of any single gene disorder in PGD.

Coexistence of Southeast Asian ovalocytosis and beta-thalassemia: a molecular and hematological analysis.

PubMed

Fucharoen, Goonnapa; Fucharoen, Supan; Singsanan, Sanita; Sanchaisuriya, Kanokwan

2007-05-01

We describe hematological and molecular characterization of a Thai female who had Southeast Asian ovalocytosis (SAO) associated with beta+-thalassemia trait. The proband had mild microcytosis with Hb 12.9 g/dl, Hct 35.8%, MCV 74.4 fl, MCH 26.8 pg, MCHC 36.0 g/dl, and elevated Hb A2 (5.6%), characteristics of beta-thalassemia trait. Peripheral blood film examination revealed prominent ovalocytosis. However, a one-tube osmotic fragility (OF) test commonly used for thalassemia screening was negative and a normal OF curve was observed. Further polymerase chain reaction (PCR) analyses identified the beta(-28A-G) mutation in the beta-globin gene and a 27 bp deletion in erythrocyte band 3 protein gene, indicating a genetically compound heterozygote. Hematological data of the proband was comparatively presented with those of eight female and 15 male carriers of pure beta-thalassemia with the same mutation. The finding demonstrates that although the association of the SAO and beta-thalassemia does not produce a more severe clinical picture, this could lead to a mis-screening of beta-thalassemia using an OF test as a primary screening test. Additional blood film examination followed by PCR could help in the detection of this unusual genetic interaction in the region. (c) 2006 Wiley-Liss, Inc.

The polymorphism rs3024505 proximal to IL-10 is associated with risk of ulcerative colitis and Crohns disease in a Danish case-control study.

PubMed

Andersen, Vibeke; Ernst, Anja; Christensen, Jane; Østergaard, Mette; Jacobsen, Bent A; Tjønneland, Anne; Krarup, Henrik B; Vogel, Ulla

2010-05-28

Crohn's disease (CD) and ulcerative colitis (UC) are characterized by a dysregulated inflammatory response to normal constituents of the intestinal flora in the genetically predisposed host. Heme oxygenase-1 (HO-1/HMOX1) is a powerful anti-inflammatory and anti-oxidant enzyme, whereas the pro-inflammatory interleukin 1 beta (IL-1 beta/IL1B) and anti-inflammatory interleukin 10 (IL-10/IL10) are key modulators for the initiation and maintenance of inflammation. We investigated whether single nucleotide polymorphisms (SNPs) in the IL-1 beta, IL-10, and HO-1 genes, together with smoking, were associated with risk of CD and UC. Allele frequencies of the IL-1 beta T-31C (rs1143627), and IL-10 rs3024505, G-1082A (rs1800896), C-819T (rs1800871), and C-592A (rs1800872) and HO-1 A-413T (rs2071746) SNPs were assessed using a case-control design in a Danish cohort of 336 CD and 498 UC patients and 779 healthy controls. Odds ratio (OR) and 95% confidence interval (95% CI) were estimated by logistic regression models. Carriers of rs3024505, a marker polymorphism flanking the IL-10 gene, were at increased risk of CD (OR = 1.40, 95% CI: 1.06-1.85, P = 0.02) and UC (OR = 1.43, 95% CI: 1.12-1.82, P = 0.004) and, furthermore, with risk of a diagnosis of CD and UC at young age (OR = 1.47, 95% CI: 1.10-1.96) and OR = 1.35, 95% CI: 1.04-1.76), respectively). No association was found between the IL-1 beta, IL-10 G-1082A, C-819T, C-592A, and HO-1 gene polymorphisms and CD or UC. No consistent interactions between smoking status and CD or UC genotypes were demonstrated. The rs3024505 marker polymorphism flanking the IL-10 gene was significantly associated with risk of UC and CD, whereas no association was found between IL-1 beta or HO-1 gene polymorphisms and risk of CD and UC in this Danish study, suggesting that IL-10, but not IL-1 beta or HO-1, has a role in IBD etiology in this population.

Molecular basis of beta-thalassemia in the Maldives.

PubMed

Furuumi, H; Firdous, N; Inoue, T; Ohta, H; Winichagoon, P; Fucharoen, S; Fukumaki, Y

1998-03-01

We have systematically analyzed beta-thalassemia genes using polymerase chain reaction-related techniques, dot-blot hybridization with oligonucleotide probes, allele specific-polymerase chain reaction, and sequencing of amplified DNA fragments from 41 unrelated patients, including 37 beta-thalassemia homozygotes, three with beta-thalassemia/Hb E, and one with beta-thalassemia/Hb S. Four different beta-thalassemia mutations were detected in 78 alleles. These are the IVS-I-5 (G-->C), codon 30 (AGG-->ACG) [also indicated as IVS-I (-1)], IVS-I-1 (G-->A), and codons 41/42 (-TTCT) mutations. The distribution of the beta-thalassemia mutations in the Maldives is 58 alleles (74.3%) with the IVS-I-5 (G-->C) mutation, 12 (15.4%) with the codon 30 (AGG-->ACG) mutation, seven (9%) with the IVS-I-1 (G-->A) mutation, and one with the codons 41/42 (-TTCT) mutation. The first three mutations account for 98.7% of the total number of beta-thalassemia chromosomes studied. These mutations are clustered in the region spanning 6 bp around the junction of exon 1 and the first intervening sequence of the beta-globin gene. These observations have significant implications for setting up a thalassemia prevention and control program in the Maldives. Analysis of haplotypes and frameworks of chromosomes bearing each beta-thalassemia mutation suggested that the origin and spread of these mutations were reflected by the historical record.

Mi2β Is Required for γ-Globin Gene Silencing: Temporal Assembly of a GATA-1-FOG-1-Mi2 Repressor Complex in β-YAC Transgenic Mice

PubMed Central

Costa, Flávia C.; Fedosyuk, Halyna; Chazelle, Allen M.; Neades, Renee Y.; Peterson, Kenneth R.

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the −566 GATA motif of the Aγ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of Aγ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the −566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1–mediated repressor complex was disrupted by the −566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting −566 Aγ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis. PMID:23284307

Mi2β is required for γ-globin gene silencing: temporal assembly of a GATA-1-FOG-1-Mi2 repressor complex in β-YAC transgenic mice.

PubMed

Costa, Flávia C; Fedosyuk, Halyna; Chazelle, Allen M; Neades, Renee Y; Peterson, Kenneth R

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the -566 GATA motif of the (A)γ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of (A)γ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the -566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1-mediated repressor complex was disrupted by the -566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting -566 (A)γ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis.

A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

PubMed

Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

2016-10-01

The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

NASA Astrophysics Data System (ADS)

Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

1996-11-01

In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

Association of ghrelin receptor gene polymorphism with bulimia nervosa in a Japanese population.

PubMed

Miyasaka, K; Hosoya, H; Sekime, A; Ohta, M; Amono, H; Matsushita, S; Suzuki, K; Higuchi, S; Funakoshi, A

2006-09-01

Eating disorders (EDs) have a highly heterogeneous etiology and multiple genetic factors might contribute to their pathogenesis. Ghrelin, a novel growth hormone-releasing peptide, enhances appetite and increases food intake, and human ghrelin plasma levels are inversely correlated with body mass index. In the present study, we examined the 171T/C polymorphism of the ghrelin receptor (growth hormone secretagogue receptor, GHSR) gene in patients diagnosed with EDs, because the subjects having ghrelin gene polymorphism (Leu72Met) was not detected in a Japanese population, previously. In addition, beta3 adrenergic receptor gene polymorphism (Try64Arg) and cholecystokinin (CCK)-A receptor (R) gene polymorphism (-81A/G, -128G/T), which are both associated with obesity, were investigated. The subjects consisted of 228 Japanese patients with EDs [96 anorexia nervosa (AN), 116 bulimia nervosa (BN) and 16 not otherwise specified (NOS)]. The age- and gender-matched control group consisted of 284 unrelated Japanese subjects. The frequency of the CC type of the GHSR gene was significantly higher in BN subjects than in control subjects (chi(2) = 4.47, p = 0.035, odds ratio = 2.05, Bonferroni correction: p = 0.070), while the frequency in AN subjects was not different from that in controls. The distribution of neither beta3 adrenergic receptor gene nor CCK-AR polymorphism differed between EDs and control subjects. Therefore, the CC type of GHSR gene polymorphism (171T/C) is a risk factor for BN, but not for AN.

A Practical Platform for Blood Biomarker Study by Using Global Gene Expression Profiling of Peripheral Whole Blood

PubMed Central

Schmid, Patrick; Yao, Hui; Galdzicki, Michal; Berger, Bonnie; Wu, Erxi; Kohane, Isaac S.

2009-01-01

Background Although microarray technology has become the most common method for studying global gene expression, a plethora of technical factors across the experiment contribute to the variable of genome gene expression profiling using peripheral whole blood. A practical platform needs to be established in order to obtain reliable and reproducible data to meet clinical requirements for biomarker study. Methods and Findings We applied peripheral whole blood samples with globin reduction and performed genome-wide transcriptome analysis using Illumina BeadChips. Real-time PCR was subsequently used to evaluate the quality of array data and elucidate the mode in which hemoglobin interferes in gene expression profiling. We demonstrated that, when applied in the context of standard microarray processing procedures, globin reduction results in a consistent and significant increase in the quality of beadarray data. When compared to their pre-globin reduction counterparts, post-globin reduction samples show improved detection statistics, lowered variance and increased sensitivity. More importantly, gender gene separation is remarkably clearer in post-globin reduction samples than in pre-globin reduction samples. Our study suggests that the poor data obtained from pre-globin reduction samples is the result of the high concentration of hemoglobin derived from red blood cells either interfering with target mRNA binding or giving the pseudo binding background signal. Conclusion We therefore recommend the combination of performing globin mRNA reduction in peripheral whole blood samples and hybridizing on Illumina BeadChips as the practical approach for biomarker study. PMID:19381341

Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

PubMed Central

Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina

2018-01-01

The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, S.D.; Cooper, P.; Fung, J.

Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression ofmore » human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.« less

Hemoglobins emerging roles in mental disorders. Metabolical, genetical and immunological aspects.

PubMed

Altinoz, Meric A; Ince, Bahri

2017-10-01

Hemoglobin (Hb) expression in the central nervous system is recently shown. Cooccurences of mental disorders (mainly bipolar disorder (BD) and tic disorders) with β- or α-thalassemia trait or erythrocytosis were witnessed, which may be due to peripheral or central hypoxia/hyperoxia or haplotypal gene interactions. β-Globin genes reside at 11p15.5 close to tyrosine hydroxylase, dopamine receptor DRD4 and Brain Derived Neurotrophic Factor, which involve in psychiatric diseases. α-Globin genes reside at 16p13.3 which associates with BD, tic disorders, ATR-16 Syndrome and Rubinstein Taybi Syndrome (RTS). CREB-Binding Protein (CEBBP)-gene is mutated in RTS, which commonly associates with mood disorders. 16p13.3 region also contains GRIN2A gene encoding N-methyl-d-aspartate receptor-2A and SSTR5 (Somatostatin Receptor-5), again involving in mental disorders. We demonstrated a protective role of minor HbA2 against post-partum episodes in BD and association of higher minor HbF (fetal hemoglobin) levels with family history of psychosis in a BD-patient cohort. HbA2 increases in cardiac ischemia and in mountain dwellers indicating its likely protection against ischemia/hypoxia. HMGIY, a repressive transcription factor of δ-globin chain of HbA2 is increased in lymphocytes of schizophrenics. In autism, deletional mutations were found in BCL11A gene, which cause persistence of HbF at high levels in adulthood. Also, certain polymorphisms in BCL11A strongly associate with schizophrenia. Further, many drugs from anabolic steroids to antimalarial agents elevate HbF and may cause mania. We ascribe a protective role to HbA2 and a maladaptive detrimental role to HbF in psychopathology. We believe that future studies on hemoglobins may pave to discover novel pathogenesis mechanisms in mental disorders. Copyright © 2017 ISDN. Published by Elsevier Ltd. All rights reserved.

The developmental genetics of human hemoglobin.

PubMed

Weatherall, D J; Wood, W G; Jones, R W; Clegg, J B

1985-01-01

Clearly, it is impossible to combine the diverse information briefly outlined in this review to provide a coherent model of the regulation of globin gene expression during development. One of the great difficulties in this field is uncertainty as to whether the mutations which are associated with persistent gamma chain production or, for the matter, the experimental models which have been used to study the differential expression of the fetal and adult globin genes, have any real relevance to an understanding of the normal switching process. Probably they do, but only with respect to one aspect of what must be an extremely complex multi-step regulatory system. The consistent changes in chromatin and methylation state of the beta globin gene cluster which are associated with activation of the different gene loci at different stages of development provide an anatomical explanation for the activity of these loci but tell us nothing about their mode of regulation. However, the gene or chromosome transfer experiments suggest that there may be developmental-stage specific trans regulatory factors which may be involved in the regulation of these genes, presumably by interacting in some way with chromatin. This is a very promising lead. Equally interesting is the possibility that the upstream mutations which are being found in some of the forms of non-deletion HPFH could provide a clue as to the site of these interactions. Thus at least we have an indication of what might be the most productive area of investigation for trying to characterize the mechanisms of regulation at the chromosomal level. This may be as far as we can go in the immediate future. The central question remains, however. How is the differential expression of the globin genes during development actually timed? All we know at the moment is that it is related fairly closely to gestational age. The only experimental data relating to this question is derived from the sheep transplant model, and suggests that there might be some form of "developmental clock' built into the hemopoietic stem cell. Here we are in considerable difficulties because we don't have an obvious experimental model with which to analyze time-related events. None of the forms of HPFH is, strictly speaking, a heterochronic mutation.(ABSTRACT TRUNCATED AT 400 WORDS)

Stabilization and cytoskeletal-association of LDL receptor mRNA are mediated by distinct domains in its 3' untranslated region.

PubMed

Wilson, G M; Vasa, M Z; Deeley, R G

1998-05-01

The mRNA encoding the human low density lipoprotein (LDL) receptor is transiently stabilized after phorbol ester treatment of HepG2 cells and has been shown to associate with components of the cytoskeleton in this cell line (G. M. Wilson, E. A. Roberts, and R. G. Deeley, J. Lipid Res. 1997. 38: 437-446). Using an episomal expression system, fragments of the 3' untranslated region (3'UTR) of LDL receptor mRNA were transcribed in fusion with the coding region of beta-globin mRNA in HepG2 cells. Analyses of the decay kinetics of these beta-globin-LDL receptor fusion mRNA deletion mutants showed that sequences in the proximal 3'UTR of LDL receptor mRNA including several AU-rich elements (AREs) were sufficient to confer short constitutive mRNA half-life in the heterologous system. Stabilization of LDL receptor mRNA in the presence of PMA required sequences in the distal 3'UTR, at or near three Alu-like repetitive elements. Furthermore, the 3'UTR of LDL receptor mRNA conferred cytoskeletal association on the otherwise unassociated beta-globin mRNA, by a mechanism involving at least two distinct RNA elements. Comparisons of decay kinetics and subcellular localization of endogenous LDL receptor mRNA and beta-globin-LDL receptor mRNA fusions in HepG2 cells have demonstrated that several cis-acting elements in the receptor 3'UTR contribute to post-transcriptional regulation of receptor expression, and provide further support for involvement of the cytoskeleton in the regulation of LDL receptor mRNA turnover.

Developing an algorithm of informative markers for evaluation of chimerism after allogeneic bone marrow transplantation.

PubMed

Sellathamby, S; Balasubramanian, P; Sivalingam, S; Shaji, R V; Mathews, V; George, B; Viswabandya, A; Srivastava, A; Chandy, M

2006-04-01

Analysis of chimerism by polymerase chain reaction amplification of STR or VNTR has become a routine procedure for the evaluation of engraftment after allogeneic stem cell transplantation. Knowledge of the frequency of different STR or VNTR alleles in unrelated individuals in a population is useful for forensic work. In the context of HLA identical sibling bone marrow transplantation the informativeness of these markers needs to be evaluated. We evaluated five STRs (THO1, VWA, FES, ACTBP2, and F13A1) and 1 VNTR (APOB) for informativeness in stem cell transplants from HLA identical sibling donors. All four markers used individually allowed us to discriminate 20-56% of the patient donor pairs. Using a combination of all these markers along with a polymorphic marker in the beta-globin gene and the sex chromosome specific amelogenin marker, we were able to discriminate 99% of the patient donor pairs. We have established an algorithm for evaluating chimerism following HLA identical sibling donor transplants in the Indian population using molecular markers in 310 patients. Analysis of heterozygote frequencies in different populations is similar suggesting that this algorithm can be used universally for transplant centers to evaluate chimerism following allogeneic bone marrow transplantation.

Nanoparticles for Site Specific Genome Editing

NASA Astrophysics Data System (ADS)

McNeer, Nicole Ali

Triplex-forming peptide nucleic acids (PNAs) can be used to coordinate the recombination of short 50-60 by "donor DNA" fragments into genomic DNA, resulting in site-specific correction of genetic mutations or the introduction of advantageous genetic modifications. Site-specific gene editing in hematopoietic stem and progenitor cells (HSPCs) could result in treatment or cure of inherited disorders of the blood such as beta-thalassemia. Gene editing in HSPCs and differentiated T cells could help combat HIV/AIDs by modifying receptors, such as CCR5, necessary for R5-tropic HIV entry. However, translation of genome modification technologies to clinical practice is limited by challenges in intracellular delivery, especially in difficult-to-transfect hematolymphoid cells. In vivo gene editing could also provide novel treatment for systemic monogenic disorders such as cystic fibrosis, an autosomal recessive disorder caused by mutations in the cystic fibrosis transmembrane receptor. Here, we have engineered biodegradable nanoparticles to deliver oligonucleotides for site-specific genome editing of disease-relevant genes in human cells, with high efficiency, low toxicity, and editing of clinically relevant cell types. We designed nanoparticles to edit the human beta-globin and CCR5 genes in hematopoietic cells. We show that poly(lactic-co-glycolic acid) (PLGA) nanoparticles can delivery PNA and donor DNA for site-specific gene modification in human hematopoietic cells in vitro and in vivo in NOD-scid IL2rgammanull mice. Nanoparticles delivered by tail vein localized to hematopoietic compartments in the spleen and bone marrow of humanized mice, resulting in modification of the beta-globin and CCR5 genes. Modification frequencies ranged from 0.005 to 20% of cells depending on the organ and cell type, without detectable toxicity. This project developed highly versatile methods for delivery of therapeutics to hematolymphoid cells and hematopoietic stem cells, and will help to translate gene therapies for diseases of the blood and immune system to clinical practice. In addition, we have expanded the use of this technology to an additional nonhematopoietic model system: correction of the human cystic fibrosis transmembrane receptor gene in human bronchial epithelial cells. The work presented here represents (1) the first use of biodegradable nanoparticles for PNA delivery, (2) the first direct in vivo site-specific genome modification in human cells, and (3) the first use of triplex-PNA technology for site-specific genome editing in cystic fibrosis.

A polymorphic region in the human transcription factor AP-2beta gene is associated with specific personality traits.

PubMed

Damberg, M; Garpenstrand, H; Alfredsson, J; Ekblom, J; Forslund, K; Rylander, G; Oreland, L

2000-03-01

Transcription factor AP-2beta is implicated in playing an important role during embryonic development of different parts of the brain, eg, midbrain, hindbrain, spinal cord, dorsal and cranial root ganglia.1,2 The gene encoding AP-2beta contains a polymorphic region which includes a tetranucleotide repeat of [CAAA] four or five times, located in intron 2 between nucleotides 12593 and 12612.3 Since the midbrain contains structures important for variables such as mood and personality, we have investigated if the AP-2beta genotype is associated with personality traits estimated by the Karolinska Scales of Personality (KSP). Identification of transcription factor genes as candidate genes in psychiatric disorders is a novel approach to further elucidate the genetic factors that, together with environmental factors, are involved in the expression of specific psychiatric phenotypes. The AP-2beta genotype and KSP scores were determined for 137 Caucasian volunteers (73 females and 64 males). The personality traits muscular tension, guilt, somatic anxiety, psychastenia and indirect aggression were significantly associated with the specific AP-2beta genotype, albeit with significant difference between genders. Based on this result the human AP-2beta gene seems to be an important candidate gene for personality disorders. Moreover, the present results suggest that the structure of the intron 2 region of the AP-2beta gene is one factor that contributes to development of the constitutional component of specific personality traits.

Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.

PubMed

Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein

2016-10-01

β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.

Splice-Site Mutations Cause Rrp6-Mediated Nuclear Retention of the Unspliced RNAs and Transcriptional Down-Regulation of the Splicing-Defective Genes

PubMed Central

Eberle, Andrea B.; Hessle, Viktoria; Helbig, Roger; Dantoft, Widad; Gimber, Niclas; Visa, Neus

2010-01-01

Background Eukaryotic cells have developed surveillance mechanisms to prevent the expression of aberrant transcripts. An early surveillance checkpoint acts at the transcription site and prevents the release of mRNAs that carry processing defects. The exosome subunit Rrp6 is required for this checkpoint in Saccharomyces cerevisiae, but it is not known whether Rrp6 also plays a role in mRNA surveillance in higher eukaryotes. Methodology/Principal Findings We have developed an in vivo system to study nuclear mRNA surveillance in Drosophila melanogaster. We have produced S2 cells that express a human β-globin gene with mutated splice sites in intron 2 (mut β-globin). The transcripts encoded by the mut β-globin gene are normally spliced at intron 1 but retain intron 2. The levels of the mut β-globin transcripts are much lower than those of wild type (wt) ß-globin mRNAs transcribed from the same promoter. We have compared the expression of the mut and wt β-globin genes to investigate the mechanisms that down-regulate the production of defective mRNAs. Both wt and mut β-globin transcripts are processed at the 3′, but the mut β-globin transcripts are less efficiently cleaved than the wt transcripts. Moreover, the mut β-globin transcripts are less efficiently released from the transcription site, as shown by FISH, and this defect is restored by depletion of Rrp6 by RNAi. Furthermore, transcription of the mut β-globin gene is significantly impaired as revealed by ChIP experiments that measure the association of the RNA polymerase II with the transcribed genes. We have also shown that the mut β-globin gene shows reduced levels of H3K4me3. Conclusions/Significance Our results show that there are at least two surveillance responses that operate cotranscriptionally in insect cells and probably in all metazoans. One response requires Rrp6 and results in the inefficient release of defective mRNAs from the transcription site. The other response acts at the transcription level and reduces the synthesis of the defective transcripts through a mechanism that involves histone modifications. PMID:20634951

A Polymorphism Within the Promoter of the TGF{beta}1 Gene Is Associated With Radiation Sensitivity Using an Objective Radiologic Endpoint

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kelsey, Chris R., E-mail: kelse003@mc.duke.edu; Jackson, Lauren; Langdon, Scott

2012-02-01

Purpose: To evaluate whether single nucleotide polymorphisms (SNPs) in the transforming growth factor-{beta}1 (TGF{beta}1) gene are associated with radiation sensitivity using an objective radiologic endpoint. Methods and Materials: Preradiation therapy and serial postradiation therapy single photon emission computed tomography (SPECT) lung perfusion scans were obtained in patients undergoing treatment for lung cancer. Serial blood samples were obtained to measure circulating levels of TGF{beta}1. Changes in regional perfusion were related to regional radiation dose yielding a patient-specific dose-response curve, reflecting the patient's inherent sensitivity to radiation therapy. Six TGF{beta}1 SNPs (-988, -800, -509, 869, 941, and 1655) were assessed using high-resolutionmore » melting assays and DNA sequencing. The association between genotype and slope of the dose-response curve, and genotype and TGF{beta}1 ratio (4-week/preradiation therapy), was analyzed using the Kruskal-Wallis test. Results: 39 white patients with preradiation therapy and {>=}6-month postradiation therapy SPECT scans and blood samples were identified. Increasing slope of the dose-response curve was associated with the C(-509)T SNP (p = 0.035), but not the other analyzed SNPs. This SNP was also associated with higher TGF{beta}1 ratios. Conclusions: This study suggests that a polymorphism within the promoter of the TGF{beta}1 gene is associated with increased radiation sensitivity (defined objectively by dose-dependent changes in SPECT lung perfusion).« less

The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

PubMed Central

Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

2017-01-01

Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

CD34+ cells from dental pulp stem cells with a ZFN-mediated and homology-driven repair-mediated locus-specific knock-in of an artificial β-globin gene.

PubMed

Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K

2017-07-01

In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.

High Fractional Occupancy of a Tandem Maf Recognition Element and Its Role in Long-Range β-Globin Gene Regulation

PubMed Central

Stees, Jared R.; Hossain, Mir A.; Sunose, Tomoki; Kudo, Yasushi; Pardo, Carolina E.; Nabilsi, Nancy H.; Darst, Russell P.; Poudyal, Rosha; Igarashi, Kazuhiko; Kladde, Michael P.

2015-01-01

Enhancers and promoters assemble protein complexes that ultimately regulate the recruitment and activity of RNA polymerases. Previous work has shown that at least some enhancers form stable protein complexes, leading to the formation of enhanceosomes. We analyzed protein-DNA interactions in the murine β-globin gene locus using the methyltransferase accessibility protocol for individual templates (MAPit). The data show that a tandem Maf recognition element (MARE) in locus control region (LCR) hypersensitive site 2 (HS2) reveals a remarkably high degree of occupancy during differentiation of mouse erythroleukemia cells. Most of the other transcription factor binding sites in LCR HS2 or in the adult β-globin gene promoter regions exhibit low fractional occupancy, suggesting highly dynamic protein-DNA interactions. Targeting of an artificial zinc finger DNA-binding domain (ZF-DBD) to the HS2 tandem MARE caused a reduction in the association of MARE-binding proteins and transcription complexes at LCR HS2 and the adult βmajor-globin gene promoter but did not affect expression of the βminor-globin gene. The data demonstrate that a stable MARE-associated footprint in LCR HS2 is important for the recruitment of transcription complexes to the adult βmajor-globin gene promoter during erythroid cell differentiation. PMID:26503787

The search for mutations in the gene for the beta subunit of the cGMP phosphodiesterase (PDEB) in patients with autosomal recessive retinitis pigmentosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Riess, O.; Weber, B.; Hayden, M.R.

1992-10-01

The finding of a mutation in the beta subunit of the cyclic GMP (cGMP) phosphodiesterase gene causing retinal degeneration in mice (the Pdeb gene) prompted a search for disease-causing mutations in the human phosphodiesterase gene (PDEB gene) in patients with retinitis pigmentosa. All 22 exons including 196 bp of the 5[prime] region of the PDEB gene have been assessed for mutations by using single-strand conformational polymorphism analysis in 14 patients from 13 unrelated families with autosomal recessive retinitis pigmentosa (ARRP). No disease-causing mutations were found in this group of affected individuals of seven different ancestries. However, a frequent intronic andmore » two exonic polymorphisms (Leu[sup 489][yields]Gln and Gly[sup 842][yields]Gly) were identified. Segregation analysis using these polymorphic sites excludes linkage of ARRP to the PDEB gene in a family with two affected children. 43 refs., 3 figs., 2 tabs.« less

[Regulation of the β-globin gene family expression, useful in the search for new therapeutic targets for hemoglobinopathies].

PubMed

Scheps, Karen G; Varela, Viviana

Different hemoglobin isoforms are expressed during the embryonic, fetal and postnatal stages. They are formed by combination of polypeptide chains synthesized from the α- and β-globin gene clusters. Based on the fact that the presence of high hemoglobin F levels is beneficial in both sickle cell disease and severe thalassemic syndromes, a revision of the regulation of the β-globin cluster expression is proposed, especially regarding the genes encoding the y-globin chains (HBG1 and HBG2). In this review we describe the current knowledge about transcription factors and epigenetic regulators involved in the switches of the β-globin cluster. It is expected that the consolidation of knowledge in this field will allow finding new therapeutic targets for the treatment of hemoglobinopathies.

Gene-gene interaction between PPAR gamma 2 and ADR beta 3 increases obesity risk in children and adolescents.

PubMed

Ochoa, M C; Marti, A; Azcona, C; Chueca, M; Oyarzábal, M; Pelach, R; Patiño, A; Moreno-Aliaga, M J; Martínez-González, M A; Martínez, J A

2004-11-01

Multiple genes are likely to be involved in obesity and these genes may interact with environmental factors to influence obesity risk. Our aim was to explore the synergistic contribution of the two polymorphisms: Pro12Ala of the PPAR gamma 2 gene and Trp64Arg of the ADR beta 3 gene to obesity risk in a Spanish children and adolescent population. We designed a sex- and age-matched case-control study. Participants were 185 obese and 185 control children (aged 5-18 y) from the Navarra region, recruited through Departments of Pediatrics (Hospital Virgen del Camino, Navarra University Clinic and several Primary Health Centers). The obesity criterion (case definition) was BMI above the 97th percentile according to Spanish BMI reference data for age and gender. Anthropometric parameters were measured by standard protocols. The genotype was assessed by PCR-RFLP after digestion with BstUI for PPAR gamma 2 mutation and BstNI for ADR beta 3 variants. Face-to-face interviews were conducted to assess the physical activity. Using a validated physical activity questionnaire, we computed an activity metabolic equivalent index (METs h/week), which represents the physical exercise during the week for each participant. Statistical analysis was performed by conditional logistic regression, taking into account the matching between cases and controls. Carriers of the polymorphism Pro12Ala of the PPAR gamma 2 gene had a significantly higher obesity risk than noncarriers (odds ratio (OR)=2.18, 95% CI=1.09-4.36) when we adjusted for sex, age and physical activity. Moreover, the risk of obesity was higher (OR=2.59, 95% CI=1.17-5.34) when family history of obesity was also taken into account in the model. The OR for obesity linked to both polymorphisms (PPAR gamma 2 and ADR beta 3) was 5.30 (95% CI=1.08-25.97) when we adjusted for sex, age and physical activity. After adjustment for family history of obesity, the OR for carriers of both polymorphisms was 19.5 (95% CI=2.43-146.8). A synergistic effect between polymorphism Pro12Ala of the PPAR gamma 2 gene and Trp64Arg of the ADR beta 3 gene for obesity risk was found in a case-control study including children and adolescents.

Sequence Divergence in the 3′ Untranslated Regions of Human ζ- and α-Globin mRNAs Mediates a Difference in Their Stabilities and Contributes to Efficient α-to-ζ Gene Developmental Switching

PubMed Central

Russell, J. Eric; Morales, Julia; Makeyev, Aleksandr V.; Liebhaber, Stephen A.

1998-01-01

The developmental stage-specific expression of human globin proteins is characterized by a switch from the coexpression of ζ- and α-globin in the embryonic yolk sac to exclusive expression of α-globin during fetal and adult life. Recent studies with transgenic mice demonstrate that in addition to transcriptional control elements, full developmental silencing of the human ζ-globin gene requires elements encoded within the transcribed region. In the current work, we establish that these latter elements operate posttranscriptionally by reducing the relative stability of ζ-globin mRNA. Using a transgenic mouse model system, we demonstrate that human ζ-globin mRNA is unstable in adult erythroid cells relative to the highly stable human α-globin mRNA. A critical determinant of the difference between α- and ζ-globin mRNA stability is mapped by in vivo expression studies to their respective 3′ untranslated regions (3′UTRs). In vitro messenger ribonucleoprotein (mRNP) assembly assays demonstrate that the α- and ζ-globin 3′UTRs assemble a previously described mRNP stability-determining complex, the α-complex, with distinctly different affinities. The diminished efficiency of α-complex assembly on the ζ 3′UTR results from a single C→G nucleotide substitution in a crucial polypyrimidine tract contained by both the human α- and ζ-globin mRNA 3′UTRs. A potential pathway for accelerated ζ-globin mRNA decay is suggested by the observation that its 3′UTR encodes a shortened poly(A) tail. Based upon these data, we propose a model for ζ-globin gene silencing in fetal and adult erythroid cells in which posttranscriptional controls play a central role by providing for accelerated clearance of ζ-globin transcripts. PMID:9528789

A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

PubMed

Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

2014-07-01

In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

Association of transforming growth factor-beta1 gene polymorphism in the development of Epstein-Barr virus-related hematologic diseases.

PubMed

Hatta, Kanako; Morimoto, Akira; Ishii, Eiichi; Kimura, Hiroshi; Ueda, Ikuyo; Hibi, Shigeyoshi; Todo, Shinjiro; Sugimoto, Tohru; Imashuku, Shinsaku

2007-11-01

Epstein-Barr virus (EBV) is etiologically associated with various hematologic disorders, including primary acute infectious mononucleosis (IM), hemophagocytic lymphohistiocytosis (EBV-HLH), chronic active EBV infection (CAEBV) and malignant lymphomas. Although cytokines play a central role in EBV-related immune responses, the exact mechanisms causing different clinical responses remain unclear. In this study, the pattern of cytokine gene polymorphisms was comparatively analyzed in EBV-related diseases. Eighty-nine patients with EBV-related disease were analyzed; 30 with IM, 28 with EBV-HLH and 31 with CAEBV. Eighty-one EBV-seropositive healthy adults were also used as controls. Associations with polymorphisms of various cytokines, including interleukin (IL)-1 alpha and IL-1 beta were evaluated. The gene polymorphisms were typed by polymerase chain reaction with sequence-specific primers. A significant difference of polymorphisms was found for transforming growth factor (TGF)-beta1; the frequency of TGF-beta1 codon 10 C allele was significantly higher in patients with EBV-related diseases than in controls (p<0.001). The difference was significant in patients with IM or HLH (p<0.001), but not in those with CAEBV (p=0.127), compared with controls. As regards other cytokines, the frequency of the IL-1 alpha -889 C allele was significantly lower in patients with IM than in controls (p<0.05). Our results suggests that TGF-beta1 codon 10 C allele plays a role in the development of EBV-related diseases and that the IL-1 alpha -889 C allele may be involved in response failure and sequential progression into the development of HLH.

Gene Therapy in a Patient with Sickle Cell Disease.

PubMed

Ribeil, Jean-Antoine; Hacein-Bey-Abina, Salima; Payen, Emmanuel; Magnani, Alessandra; Semeraro, Michaela; Magrin, Elisa; Caccavelli, Laure; Neven, Benedicte; Bourget, Philippe; El Nemer, Wassim; Bartolucci, Pablo; Weber, Leslie; Puy, Hervé; Meritet, Jean-François; Grevent, David; Beuzard, Yves; Chrétien, Stany; Lefebvre, Thibaud; Ross, Robert W; Negre, Olivier; Veres, Gabor; Sandler, Laura; Soni, Sandeep; de Montalembert, Mariane; Blanche, Stéphane; Leboulch, Philippe; Cavazzana, Marina

2017-03-02

Sickle cell disease results from a homozygous missense mutation in the β-globin gene that causes polymerization of hemoglobin S. Gene therapy for patients with this disorder is complicated by the complex cellular abnormalities and challenges in achieving effective, persistent inhibition of polymerization of hemoglobin S. We describe our first patient treated with lentiviral vector-mediated addition of an antisickling β-globin gene into autologous hematopoietic stem cells. Adverse events were consistent with busulfan conditioning. Fifteen months after treatment, the level of therapeutic antisickling β-globin remained high (approximately 50% of β-like-globin chains) without recurrence of sickle crises and with correction of the biologic hallmarks of the disease. (Funded by Bluebird Bio and others; HGB-205 ClinicalTrials.gov number, NCT02151526 .).

Evolutionary context for the association of γ-globin, serum uric acid, and hypertension in African Americans.

PubMed

Shriner, Daniel; Kumkhaek, Chutima; Doumatey, Ayo P; Chen, Guanjie; Bentley, Amy R; Charles, Bashira A; Zhou, Jie; Adeyemo, Adebowale; Rodgers, Griffin P; Rotimi, Charles N

2015-11-05

Hyperuricemia and associated cardio-metabolic disorders are more prevalent in African Americans than in European Americans. We used genome-wide admixture mapping and association testing to identify loci with ancestry effects on serum uric acid levels. We analyzed 1,976 African Americans from Washington, D.C, including 1,322 individuals from 328 pedigrees and 654 unrelated individuals, enrolled in the Howard University Family Study. We performed admixture mapping and genome-wide association testing using ~800 k autosomal single-nucleotide polymorphisms (SNPs). We performed fine mapping by dense genotyping. We assessed functionality by a combination of bioinformatic annotation, reporter gene assays, and gel shift experiments. We also analyzed 12,641 individuals enrolled in the National Health and Nutrition Examination Survey. We detected a genome-wide significant locus on chromosome 11p15.4 at which serum uric acid levels increased with increasing African ancestry, independent of kidney function. Fine-mapping identified two independent signals in the β-globin locus. The ancestral allele at SNP rs2855126, located upstream of the hemoglobin, gamma A gene HBG1, was associated with increased serum uric acid levels and higher expression of a reporter gene relative to the derived allele. Hyperuricemia was associated with increased risk of hypertension in 3,767 African Americans (Odds Ratio = 2.48, p = 2.71 × 10(-19)). Given that increased expression of γ-globin leads to increased levels of fetal hemoglobin which confers protection against malaria, we hypothesize that evolution in Africa of protection against malaria may have occurred at the cost of increased serum uric acid levels, contributing to the high rates of hyperuricemia and associated cardio-metabolic disorders observed in African Americans.

Annotated definition of BCL11A and HMIP-2 haplotypes through the analysis of sicilian β-thalassemia patients with high levels of fetal hemoglobin.

PubMed

Buccheri, Maria A; Spina, Sonia; Ruberto, Concetta; Lombardo, Turi; Labie, Dominique; Ragusa, And Angela

2013-01-01

Fetal hemoglobin (Hb F) is the principal ameliorating factor of β-thalassemia (β-thal) and sickle cell disease. Persistent production in adult life is a quantitative trait regulated by loci inside or outside the β-globin gene cluster. From genome-wide association studies, principal quantitative trait loci (QTL) (accounting for 50.0% of Hb F variability in different populations) have been identified in the BCL11A gene, HBS1L-MYB intergenic polymorphism and the β-globin gene cluster itself. In this study, we analyzed quantitative trait haplotypes in two Sicilian families with extremely mild β-thal and unusually high Hb F expression, in order to examine possible genetic background variations in a similar β-thalassemic phenotype. This study redefines the linkage disequilibrium blocks at these loci, but also shows slight differences between probands in haplotype combinations which could reflect different mechanisms of high Hb F production in patients with β-thal. We proposed a haplotype-based approach as a useful tool for the understanding of β-thal phenotype variation in patients with similar β-thalassemic backgrounds in an attempt to answer the recurring question of why patients with the same β-thalassemic genotype show different phenotypes.

Therapeutic levels of fetal hemoglobin in erythroid progeny of β-thalassemic CD34+ cells after lentiviral vector-mediated gene transfer

PubMed Central

Wilber, Andrew; Hargrove, Phillip W.; Kim, Yoon-Sang; Riberdy, Janice M.; Sankaran, Vijay G.; Papanikolaou, Eleni; Georgomanoli, Maria; Anagnou, Nicholas P.; Orkin, Stuart H.; Nienhuis, Arthur W.

2011-01-01

β-Thalassemia major results from severely reduced or absent expression of the β-chain of adult hemoglobin (α2β2;HbA). Increased levels of fetal hemoglobin (α2γ2;HbF), such as occurs with hereditary persistence of HbF, ameliorate the severity of β-thalassemia, raising the potential for genetic therapy directed at enhancing HbF. We used an in vitro model of human erythropoiesis to assay for enhanced production of HbF after gene delivery into CD34+ cells obtained from mobilized peripheral blood of normal adults or steady-state bone marrow from patients with β-thalassemia major. Lentiviral vectors encoding (1) a human γ-globin gene with or without an insulator, (2) a synthetic zinc-finger transcription factor designed to interact with the γ-globin gene promoters, or (3) a short-hairpin RNA targeting the γ-globin gene repressor, BCL11A, were tested. Erythroid progeny of normal CD34+ cells demonstrated levels of HbF up to 21% per vector copy. For β-thalassemic CD34+ cells, similar gene transfer efficiencies achieved HbF production ranging from 45% to 60%, resulting in up to a 3-fold increase in the total cellular Hb content. These observations suggest that both lentiviral-mediated γ-globin gene addition and genetic reactivation of endogenous γ-globin genes have potential to provide therapeutic HbF levels to patients with β-globin deficiency. PMID:21156846

Interaction of an α-Globin Gene Triplication with β-Globin Gene Mutations in Iranian Patients with β-Thalassemia Intermedia.

PubMed

Farashi, Samaneh; Bayat, Nooshin; Faramarzi Garous, Negin; Ashki, Mehri; Montajabi Niat, Mona; Vakili, Shadi; Imanian, Hashem; Zeinali, Sirous; Najmabadi, Hossein; Azarkeivan, Azita

2015-01-01

The 3.7 kb triplicated α-globin gene (ααα(anti 3.7)) mutation has been found in most populations. It results from an unequal crossover between misaligned homologous segments in the α-globin gene cluster during meiosis. The pathophysiology and clinical severity of β-thalassemia (β-thal) are associated with the degree of α chain imbalance. The excess of α-globin chains plays an important role in the pathophysiology of β-thal. When heterozygous/homozygous β-thal coexists with an α gene numerical alteration, the clinical and hematological phenotype of thalassemia could change to mild anemia in case of an α deletion (-α/αα) or severe anemia in the case of an α triplication (αα/ααα). The coexistence of an ααα(anti 3.7) triplication is considered an important factor in the severity of β-thal, exacerbating the phenotypic severity of β-thal by causing more globin chain imbalance. This study shows that the ααα(anti 3.7) triplication is an important factor in the causation of β-thal intermedia (β-TI) in heterozygous β-thal. This type of phenotype modification has rarely been observed and reported in the Iranian population. Here we report the coinheritance of a triplicated α-globin gene arrangement and heterozygous/homozygous β-thal in 23 cases, presenting with a β-TI or β-thal major (β-TM) phenotype. Some of these patients were considered to have a mild β-TI phenotype as they needed no blood transfusions; some occasionally received blood transfusions in their lifetime (for example on delivery) but some are dependent on regular blood transfusions (every 20 to 40 days). Our study was focused on the importance of detecting the α-globin gene triplication in genotype/phenotype prediction in Iranian thalassemia patients.

Restriction fragment length polymorphism among Israeli Holstein-Friesian dairy bulls.

PubMed

Beckmann, J S; Kashi, Y; Hallerman, E M; Nave, A; Soller, M

1986-01-01

Israeli Holstein-Friesian dairy bulls were screened for restriction fragment length polymorphisms by hybridizing cloned DNA probes for bovine growth hormone, for chymosin, and for rat muscle beta-actin to restriction endonuclease-digested DNA immobilized on nitrocellulose filters. The population proved to be polymorphic at the growth hormone locus, with evidence consistent with the phenotypes being inherited in allelic fashion. A low level of polymorphism was also observed at one of the beta-actin gene family loci. The chymosin locus was monomorphic with the restriction enzymes utilized. The results illustrate the power of restriction fragment length polymorphism methodology in visualizing genetic variability in dairy cattle populations.

A Functional Element Necessary for Fetal Hemoglobin Silencing

PubMed Central

Sankaran, Vijay G.; Xu, Jian; Byron, Rachel; Greisman, Harvey A.; Fisher, Chris; Weatherall, David J.; Sabath, Daniel E.; Groudine, Mark; Orkin, Stuart H.; Premawardhena, Anuja; Bender, M.A.

2011-01-01

BACKGROUND An improved understanding of the regulation of the fetal hemoglobin genes holds promise for the development of targeted therapeutic approaches for fetal hemoglobin induction in the β-hemoglobinopathies. Although recent studies have uncovered trans-acting factors necessary for this regulation, limited insight has been gained into the cis-regulatory elements involved. METHODS We identified three families with unusual patterns of hemoglobin expression, suggestive of deletions in the locus of the β-globin gene (β-globin locus). We performed array comparative genomic hybridization to map these deletions and confirmed breakpoints by means of polymerase-chain-reaction assays and DNA sequencing. We compared these deletions, along with previously mapped deletions, and studied the trans-acting factors binding to these sites in the β-globin locus by using chromatin immunoprecipitation. RESULTS We found a new (δβ)0-thalassemia deletion and a rare hereditary persistence of fetal hemoglobin deletion with identical downstream breakpoints. Comparison of the two deletions resulted in the identification of a small intergenic region required for γ-globin (fetal hemoglobin) gene silencing. We mapped a Kurdish β0-thalassemia deletion, which retains the required intergenic region, deletes other surrounding sequences, and maintains fetal hemoglobin silencing. By comparing these deletions and other previously mapped deletions, we elucidated a 3.5-kb intergenic region near the 5′ end of the δ-globin gene that is necessary for γ-globin silencing. We found that a critical fetal hemoglobin silencing factor, BCL11A, and its partners bind within this region in the chromatin of adult erythroid cells. CONCLUSIONS By studying three families with unusual deletions in the β-globin locus, we identified an intergenic region near the δ-globin gene that is necessary for fetal hemoglobin silencing. (Funded by the National Institutes of Health and others.) PMID:21879898

Clinical, genetic and fertility studies of Indians with beta S-globin gene and the influence of Hb S on Plasmodium falciparum malaria infection.

PubMed

Joishy, S K; Hassan, K; Lopes, M; Lie-Injo, L E

1988-01-01

Clinical studies were carried out on mild Indian sickle cell anaemia in Malaysia, and genetic and fertility studies were carried out on 101 families with and without sickle-cell haemoglobin (Hb S). The Indian sickle cell anaemia patients reached adulthood, and pregnancies and deliveries were uneventful without blood transfusion. There was no foetal wastage and the number of children produced was not significantly different from that in families without Hb S. 28 Indian patients hospitalized with Plasmodium falciparum malaria infection were also examined for their beta S genotype. P. falciparum malaria infection occurred much more frequently in individuals without Hb S than in Hb S carriers.

Diverse hematological phenotypes of β-thalassemia carriers.

PubMed

Luo, Hong-Yuan; Chui, David H K

2016-03-01

Most β-thalassemia carriers have mild anemia, low mean corpuscular volume and mean corpuscular hemoglobin, and elevated hemoglobin α2 (HbA2 ). However, there is considerable variability resulting from coinheritance with α- and/or δ-globin gene mutations, dominant inheritance of β-thalassemia mutations, highly unstable variant globin chains, large deletions removing part or all of the β-globin gene cluster, loss of heterozygosity of the β-globin gene cluster during development, or concomitant erythroid enzyme or membrane protein abnormalities. Recognition of the specific abnormality and correct diagnosis can allay anxiety and unnecessary investigation, help formulate treatment programs, and deliver appropriate genetic and family counseling. © 2016 New York Academy of Sciences.

Association of GSK3beta polymorphisms with brain structural changes in major depressive disorder.

PubMed

Inkster, Becky; Nichols, Thomas E; Saemann, Philipp G; Auer, Dorothee P; Holsboer, Florian; Muglia, Pierandrea; Matthews, Paul M

2009-07-01

Indirect evidence suggests that the glycogen synthase kinase-3beta (GSK3beta) gene might be implicated in major depressive disorder (MDD). We evaluated 15 GSK3beta single-nucleotide polymorphisms (SNPs) to test for associations with regional gray matter (GM) volume differences in patients with recurrent MDD. We then used the defined regions of interest based on significant associations to test for MDD x genotype interactions by including a matched control group without any psychiatric disorder, including MDD. General linear model with nonstationary cluster-based inference. Munich, Germany. Patients with recurrent MDD (n = 134) and age-, sex-, and ethnicity-matched healthy controls (n = 143). Associations between GSK3beta polymorphisms and regional GM volume differences. Variation in GM volume was associated with GSK3beta polymorphisms; the most significant associations were found for rs6438552, a putative functional intronic SNP that showed 3 significant GM clusters in the right and left superior temporal gyri and the right hippocampus (P < .001, P = .02, and P = .02, respectively, corrected for multiple comparisons across the whole brain). Similar results were obtained with rs12630592, an SNP in high linkage disequilibrium. A significant SNP x MDD status interaction was observed for the effect on GM volumes in the right hippocampus and superior temporal gyri (P < .001 and P = .01, corrected, respectively). The GSK3beta gene may have a role in determining regional GM volume differences of the right hippocampus and bilateral superior temporal gyri. The association between genotype and brain structure was specific to the patients with MDD, suggesting that GSK3beta genotypes might interact with MDD status. We speculate that this is a consequence of regional neocortical, glial, or neuronal growth or survival. In considering core cognitive features of MDD, the association of GSK3beta polymorphisms with structural variation in the temporal lobe and hippocampus is of particular interest in the context of other evidence for structural and functional abnormalities in the hippocampi of patients with MDD.

The genomic similarities with linguistic difference: a study among the Oraon and Munda tribes of the Ranchi district, Jharkhand, India.

PubMed

Mondal, Prakash Ranjan; Saksena, Deepti; Sachdeva, Mohinder Pal; Murry, Benrithung; Meitei, Khangembam Somibabu; Samtani, Ratika; Saraswathy, Kallur Nava

2011-06-01

The present study was conducted on two tribal communities, the Oraon and Munda, inhabiting the Ranchi district of Jharkhand state, India. The study was designed to elucidate genetic similarity, if any, shared between these tribes as they belong to the common Proto-Australoid stock but bear different linguistic affiliations. For this, a total of 98 intravenous blood samples (48 Oraon and 50 Munda) were collected from unrelated individuals of either sex up to first cousins, with their prior informed written consent. The DNA was extracted and studied for a total of 20 autosomal markers, including 7 Alu Indels, 3 DRD2 TaqI sites, 3 β-globin sites, and 7 restriction site polymorphisms. All the 20 studied molecular markers were found to be polymorphic in both the tribal population groups and showed similarities with respect to allele frequencies, with a low coefficient of gene differentiation (G(ST)) value. Moreover, sharing and distribution patterns of haplotypes of the β-globin gene cluster suggest that the Oraon and Munda share a common ancestry. However, small differences between them with reference to the linkage disequilibrium (LD) pattern indicate that the Munda might have emerged as a result of admixture between Proto-Australoids and Austro-Asiatic-speaking Mongoloids as supported by the principal co-ordinate analysis, wherein the Munda are closely placed with the Dravidian-speaking Proto-Australoid tribes of India. A common genetic substratum (Proto-Australoid stock) of the Oraon and Munda was evident in the present study, although these tribes are distinct linguistically.

Mapping of the serotonin 5-HT{sub 1D{beta}} autoreceptor gene on chromosome 6 and direct analysis for sequence variants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lappalainen, J.; Dean, M.; Virkkunen, M.

1995-04-24

Abnormal brain serotonin function may be characteristic of several neuropsychiatric disorders. Thus, it is important to identify polymorphic genes and screen for functional variants at loci coding for genes that control normal serotonin functions. 5-HT{sub 1D{beta}} is a terminal serotonin autoreceptor which may play a role in regulating serotonin synthesis and release. Using an SSCP technique we screened for 5-HT{sub 1D{beta}} coding sequence variants in psychiatrically interviewed populations, which included controls, alcoholics, and alcoholic arsonists and alcoholic violent offenders with low CSF concentrations of the main serotonin metabolite 5-HIAA. A common polymorphism was identified in the 5-HT{sub 1D{beta}} gene withmore » allele frequencies of 0.72 and 0.28. The SSCP variant was caused by a silent G to C substitution at nucleotide 861 of the coding region. This polymorphism could also be detected as a HincII RFLP of amplified DNA. DNAs from informative CEPH families were typed for the HincII RFLP and analyzed with respect to 20 linked markers on chromosome 6. Multipoint analysis placed the 5-HT{sub 1D{beta}} receptor gene between markers D6S286 and D6S275. A maximum two-point lod score of 10.90 was obtained to D6S26, which had been previously localized on 6q14-15. Chromosomal aberrations involving this region have been previously shown to cause retinal anomalies, developmental delay, and abnormal brain development. This region also contains the gene for North Carolina-type macular dystrophy. 34 refs., 3 figs., 1 tab.« less

Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus

PubMed Central

Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi

2015-01-01

Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer–promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them. PMID:25588787

[Possible pathogenetic role of 11 beta-hydroxysteroid dehydrogenase type 1 (11betaHSD1) gene polymorphisms in arterial hypertension].

PubMed

Morales, Mauricio A; Carvajal, Cristián A; Ortiz, Eugenia; Mosso, Lorena M; Artigas, Rocío A; Owen, Gareth I; Fardella, Carlos E

2008-06-01

Cortisol has been implicated in hypertension and lately reported to be regulated at the pre-receptor level by the 11betaHSD1 enzyme, which converts cortisone (E) to cortisol (F). Over-expression of this enzyme in adipose tissue could determine an increase in available cortisol that interacts with the mineralocorticoid receptor (MR) in renal, brain and heart tissue, leading to similar hypertensive effects as in 11betaHSD2 impaired patients. Several polymorphisms have been reported in HSDl IB 1 gene (CAI5, CAI9 and InsA83557), which could modify HSDl IB 1 gene expression or activity. To determine the distribution and prevalence of CAI5, CAI9 and InsA83557 in the HSDl IBl gene, and to correlate these results with biochemical parameters in cortisol/ ACTH (HPA) and renin-angiotensin-aldosterone (RAA) axis in patients with essential hypertension (EH). We studied 113 EH patients (76 non-obese and 37 obese, with a body mass índex >30 kg/m(2)) and 30 normotensive adults (NT). In each patient, we measured serum levels of E E, serum aldosterone (SA), plasma renin activity (PRA), adrenocorticotrophic hormone (ACTH), the urinary free cortisol/creatinine (UFF/Cr), F/ACTH and SA/PRA ratios. Each polymorphism was studied by PCR and 8% polyacrylamide gel electrophoresis. Statistical associations were evaluated by Pearson correlations and the genetic equilibrium by the Hardy-Weinberg (H-W) equation. We found all three polymorphisms in the EH and the NT group, both in genetic equilibrium. In obese essential hypertensives, the CAI5 polymorphism showed association with SA/PRA ratio (r =0.189, p =0.012) and F/ACTH (r =0.301, p 0.048); CA19 also showed correlation with F/ACTH in obese EH (r = 0.220, p 0.009). The InsA83557polymorphism correlated with UFF/Cr in both EH (r =0.206; p =0.03), and in obese EH (r =0.354; p =0.05). The CAI5 and CAI9 polymorphism correlated with changes in biochemical parameters in HPA and RAA axis of obese essential hypertensives. These changes may result in modifications in the expression of 11betaHSD1, leading to increased cortisol and aldosterone levels independent of ACTH and renin control, respectively.

Clinical and hematological response to hydroxyurea in a patient with Hb Lepore/beta-thalassemia.

PubMed

Rigano, P; Manfré, L; La Galla, R; Renda, D; Renda, M C; Calabrese, A; Calzolari, R; Maggio, A

1997-05-01

The possibility of increasing Hb F in vivo using drugs like 5-azacytidine, hydroxyurea, and butyrate has been established. However, in many cases this does not entail an increase in total hemoglobin. We report on a patient with Hb Lepore/beta-thalassemia being treated with hydroxyurea (30 mg/Kg/day) because of the presence of erythroid extramedullary masses with severe neurological abnormalities. During therapy the patient showed a remarkable improvement in neurological signs due to the reduction in extra-medullary masses, a significant increase in both total hemoglobin (from 5.8 to 9.7 g/dl) and Hb F (from 4.9 g/dl to 9.1 g/dl). The marked improvement in hemoglobin level in our patient with Hb Lepore/beta-thalassemia suggests gamma-globin gene activation due to the DNA structure determined by the crossover event.

Roles of beta2-adrenergic receptor gene polymorphisms in a Turkish population with obstructive sleep apnea syndrome or obesity.

PubMed

Gök, I; Celebi, I; Hüseyinoğlu, N; Ozic, C

2014-10-20

We determined the distribution of the Arg16Gly and Gln27Glu polymorphisms of the beta-2 adrenergic receptor gene (ADRB2) in patients with obstructive sleep apnea syndrome as well as a control group in Northeastern Turkey. A total of 52 patients diagnosed with obstructive sleep apnea in a sleep laboratory and 78 control subjects were examined. Peripheral blood samples were taken from patients diagnosed with obstructive sleep apnea by polysomnography. DNA was extracted from blood samples and amplified using polymerase chain reaction. Amplification products were digested with restriction enzymes to investigate gene polymorphisms. Restriction products were extracted from agarose gel electrophoresis and polymorphisms were analyzed using gel images. The Arg16Gly polymorphism was observed in 18 of 52 patients and in 23 of 78 controls. The Gln27Glu polymorphism was observed in 21 of 52 patients and in 28 of 78 controls. In conclusion, there was no correlation among polymorphic frequencies between patient and control groups. Based on the results, these polymorphisms do not contribute to the clinical diagnosis of this syndrome. However, the distribution of Arg16Gly vs Gln27Glu polymorphisms may contribute to obesity in patients with a body mass index greater than 30 (P < 0.05). Different results may be obtained if the parameters of obstructive sleep apnea disease are changed.

Phytomedicines and Nutraceuticals: Alternative Therapeutics for Sickle Cell Anemia

PubMed Central

Imaga, Ngozi Awa

2013-01-01

Sickle cell anemia is a genetically inherited disease in which the “SS” individual possesses an abnormal beta globin gene. A single base substitution in the gene encoding the human β-globin subunit results in replacement of β6 glutamic acid by valine, leading to the devastating clinical manifestations of sickle cell disease. This substitution causes drastic reduction in the solubility of sickle cell hemoglobin (HbS) when deoxygenated. Under these conditions, the HbS molecules polymerize to form long crystalline intracellular mass of fibers which are responsible for the deformation of the biconcave disc shaped erythrocyte into a sickle shape. First-line clinical management of sickle cell anemia include, use of hydroxyurea, folic acid, amino acids supplementation, penicillinprophylaxis, and antimalarial prophylaxis to manage the condition and blood transfusions to stabilize the patient's hemoglobin level. These are quite expensive and have attendant risk factors. However, a bright ray of hope involving research into antisickling properties of medicinal plants has been rewarding. This alternative therapy using phytomedicines has proven to not only reduce crisis but also reverse sickling (in vitro). The immense benefits of phytomedicines and nutraceuticals used in the management of sickle cell anemia are discussed in this paper. PMID:23476125

MBD2 is a critical component of a methyl cytosine-binding protein complex isolated from primary erythroid cells

PubMed Central

Kransdorf, Evan P.; Wang, Shou Zhen; Zhu, Sheng Zu; Langston, Timothy B.; Rupon, Jeremy W.; Ginder, Gordon D.

2006-01-01

The chicken embryonic β-type globin gene, ρ, is a member of a small group of vertebrate genes whose developmentally regulated expression is mediated by DNA methylation. Previously, we have shown that a methyl cytosine-binding complex binds to the methylated ρ-globin gene in vitro. We have now chromatographically purified and characterized this complex from adult chicken primary erythroid cells. Four components of the MeCP1 transcriptional repression complex were identified: MBD2, RBAP48, HDAC2, and MTA1. These 4 proteins, as well as the zinc-finger protein p66 and the chromatin remodeling factor Mi2, were found to coelute by gel-filtration analysis and pull-down assays. We conclude that these 6 proteins are components of the MeCPC. In adult erythrocytes, significant enrichment for MBD2 is seen at the inactive ρ-globin gene by chromatin immunoprecipitation assay, whereas no enrichment is observed at the active βA-globin gene, demonstrating MBD2 binds to the methylated and transcriptionally silent ρ-globin gene in vivo. Knock-down of MBD2 resulted in up-regulation of a methylated ρ-gene construct in mouse erythroleukemic (MEL)-ρ cells. These results represent the first purification of a MeCP1-like complex from a primary cell source and provide support for a role for MBD2 in developmental gene regulation. PMID:16778143

Systematic study of association of four GABAergic genes: glutamic acid decarboxylase 1 gene, glutamic acid decarboxylase 2 gene, GABA(B) receptor 1 gene and GABA(A) receptor subunit beta2 gene, with schizophrenia using a universal DNA microarray.

PubMed

Zhao, Xu; Qin, Shengying; Shi, Yongyong; Zhang, Aiping; Zhang, Jing; Bian, Li; Wan, Chunling; Feng, Guoyin; Gu, Niufan; Zhang, Guangqi; He, Guang; He, Lin

2007-07-01

Several studies have suggested the dysfunction of the GABAergic system as a risk factor in the pathogenesis of schizophrenia. In the present study, case-control association analysis was conducted in four GABAergic genes: two glutamic acid decarboxylase genes (GAD1 and GAD2), a GABA(A) receptor subunit beta2 gene (GABRB2) and a GABA(B) receptor 1 gene (GABBR1). Using a universal DNA microarray procedure we genotyped a total of 20 SNPs on the above four genes in a study involving 292 patients and 286 controls of Chinese descent. Statistically significant differences were observed in the allelic frequencies of the rs187269C/T polymorphism in the GABRB2 gene (P=0.0450, chi(2)=12.40, OR=1.65) and the -292A/C polymorphism in the GAD1 gene (P=0.0450, chi(2)=14.64 OR=1.77). In addition, using an electrophoretic mobility shift assay (EMSA), we discovered differences in the U251 nuclear protein binding to oligonucleotides representing the -292 SNP on the GAD1 gene, which suggests that the -292C allele has reduced transcription factor binding efficiency compared with the 292A allele. Using the multifactor-dimensionality reduction method (MDR), we found that the interactions among the rs187269C/T polymorphism in the GABRB2 gene, the -243A/G polymorphism in the GAD2 gene and the 27379C/T and 661C/T polymorphisms in the GAD1 gene revealed a significant association with schizophrenia (P<0.001). These findings suggest that the GABRB2 and GAD1 genes alone and the combined effects of the polymorphisms in the four GABAergic system genes may confer susceptibility to the development of schizophrenia in the Chinese population.

Replication of the Chicken β-Globin Locus: Early-Firing Origins at the 5′ HS4 Insulator and the ρ- and βA-Globin Genes Show Opposite Epigenetic Modifications

PubMed Central

Prioleau, Marie-Noëlle; Gendron, Marie-Claude; Hyrien, Olivier

2003-01-01

Chromatin structure is believed to exert a strong effect on replication origin function. We have studied the replication of the chicken β-globin locus, whose chromatin structure has been extensively characterized. This locus is delimited by hypersensitive sites (HSs) that mark the position of insulator elements. A stretch of condensed chromatin and another HS separate the β-globin domain from an adjacent folate receptor (FR) gene. We demonstrate here that in erythroid cells that express the FR but not the globin genes, replication initiates at four sites within the β-globin domain, one at the 5′ HS4 insulator and the other three near the ρ- and βA-globin genes. Three origins consist of G+C-rich sequences enriched in CpG dinucleotides. The fourth origin is A+T rich. Together with previous work, these data reveal that the insulator origin has unmethylated CpGs, hyperacetylated histones H3 and H4, and lysine 4-methylated histone H3. In contrast, opposite modifications are observed at the other G+C-rich origins. We also show that the whole region, including the stretch of condensed chromatin, replicates early in S phase in these cells. Therefore, different early-firing origins within the same locus may have opposite patterns of epigenetic modifications. The role of insulator elements in DNA replication is discussed. PMID:12724412

Therapeutic fetal-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms.

PubMed

Dai, Yan; Sangerman, Jose; Luo, Hong Yuan; Fucharoen, Suthat; Chui, David H K; Faller, Douglas V; Perrine, Susan P

2016-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ-globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. Copyright © 2015 Elsevier Inc. All rights reserved.

Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

PubMed Central

Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

2015-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

[Association between Fok I vitamin D receptor (VDR) gene polymorphism and plasmatic concentrations of transforming growth factor-beta1 and interferon gamma in type 1 diabetes mellitus].

PubMed

López, Tatiana; García, Diego; Angel, Bárbara; Carrasco, Elena; Codner, Ethel; Ugarte, Francisca; Pérez-Bravo, Francisco

2008-02-02

In order to assess whether Fok I vitamin D receptor gene (VDR) polymorphism is involved in the genetic susceptibility of type 1 diabetes, a case-control study was conducted and VDR genotypes were related to serum concentrations of 25(OH) vitamin D and cytokines transforming growth factor beta1 (TGF-beta1) and interferon gamma (INF-gamma). 151 incident cases of type 1 diabetes and 182 non related healthy controls from Santiago were studied for VDR polymorphisms in peripheral blood DNA. Exon 2 (Fok I) segments were amplified by polimerase chain reaction and analyzed by means of restriction fragment length polymorphism to determine each corresponding genotype. Differences for allele, genotype and serological markers as 25(OH) vitamin D, TGF-beta1 and INF-gamma levels distribution between patients and controls were analyzed. Fok I polymorphism distribution analysis showed no differences between patients and controls. Among diabetics, higher levels of TGF-beta1 (median, 282.6 pg/ml; range, 131.8-3,031.4) were observed compared with healthy children (median, 232.2 pg/ml; range, 135.7-506.5) (p < 0.0038). Similar results were observed for INF-gamma concentrations (median, 121.1 pg/ml, and range, 5.3-228.8, in cases, and median, 89.6 pg/ml, and range, 10.9-117.2 in controls) (p < 0.0004). The diabetic carriers of the ff genotype showed low levels of 25(OH) vitamin D compared with the carriers of the F allele: mean (standard deviation), 23.1 (5.9) versus 27.9 (10.3) ng/ml (p < 0.03). A similar result was observed for TGF-beta1 concentrations in diabetic carriers of ff genotype and patients carriers of the F allele (298.5 versus 276.6; p < 0.05). Fok I polymorphism of VDR could have a marginal role in the immunologic disturbance in type 1 diabetes.

Erythrocyte phosphofructokinase in rat strains with genetically determined differences in 2,3-diphosphoglycerate levels.

PubMed

Noble, N A; Tanaka, K R

1981-02-01

We have studied the erythrocyte enzyme phosphofructokinase (PFK) from two strains of Long-Evans rats with genetically determined differences in erythrocyte 2,3-diphosphoglycerate (DPG) levels. The DPG difference is due to two alleles at one locus. With one probable exception, the genotype at this locus is always associated with the hemoglobin (Hb) electrophoretic phenotype, due to a polymorphism at the III beta-globin locus. The enzyme PFK has been implicated in the DPG difference because glycolytic intermediate levels suggest that this enzyme has a higher in vivo activity in High-DPG strain rats, although the total PFK activity does not differ. We report here that partially purified erythrocyte PFK from Low-DPG strain cells is inhibited significantly more at physiological levels of DPG (P less than 0.01) than PFK from High-DPG strain erythrocytes. Citrate and adenosine triphosphate also inhibit the Low-DPG enzyme more than the High-DPG enzyme. Therefore, a structurally different PFK, with a greater sensitivity to inhibitors, may explain the lower DPG and ATP levels observed in Low-DPG strain animals. These data support a two-locus (Hb and PFK) hypothesis and provide a gene marker to study the underlying genetic and physiologic relationships of these loci.

Versatile Cosmid Vectors for the Isolation, Expression, and Rescue of Gene Sequences: Studies with the Human α -globin Gene Cluster

NASA Astrophysics Data System (ADS)

Lau, Yun-Fai; Kan, Yuet Wai

1983-09-01

We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.

Novel mutations responsible for α-thalassemia in Iranian families.

PubMed

Bayat, Nooshin; Farashi, Samaneh; Hafezi-Nejad, Nima; Faramarzi, Negin; Ashki, Mehri; Vakili, Shadi; Imanian, Hashem; Khosravi, Mohsen; Azar-Keivan, Azita; Najmabadi, Hossein

2013-01-01

α-Thalassemia (α-thal) is usually caused by deletions on the α-globin gene cluster and the role of point mutations is less well investigated. In the present study, a total of 1048 individuals with hypochromic microcytic anemia, who did not present the most common α-thal deletions, were referred for α-globin gene DNA sequencing. The nucleotide changes were studied and a total of five new mutations was identified, of which three were located on the α2 gene [codon7 (Lys→Stop), codon 34 (Leu→Pro) and codon 83 (Leu→Arg)] and two on the α1 gene [IVS-I-116 (A>G) and codon 44 (+C)]. These novel mutations not only explain new findings by molecular analysis of the α-globin gene but also have clinical importance due to their changes in α-globin production in means of decreased hemoglobin (Hb) related values. Moreover, considerations of its role in combination with other mutations, and the possibility of causing Hb H (β4) are yet to be studied.

[Prevalence survey and molecular characterization of alpha and beta thalassemia in Liuzhou city of Guangxi].

PubMed

Cai, Ren; Li, Liyan; Liang, Xin; Liu, Zhongying; Su, Liu; Li, Wenjun; Zhu, Qiangui; Mo, Qiuhua; Pan, Lizhen; Ouyang, Hong; Huang, Lihua; Xu, Xiangmin

2002-08-01

To investigate the gene frequencies and mutation patterns of alpha thalassemia (alpha-thal) and beta thalassemia (beta-thal) in Liuzhou city of Guangxi Zhuang Autonomous Region. Cluster sampling was used. A total of 1 028 of umbilical blood samples were collected for a prevalence study of alpha-thal and a total of 1 312 healthy young people when receiving pre-marriage consultation were recruited for a beta-thal prevalence survey. Individuals live in city or town area of Liuzhou. A complete blood count as well as hemoglobin electrophoresis analysis were done in all of samples for phenotyping of alpha and beta-thals. Those with Hb Bart's for alpha-thal indicator and those with both microcytosis (MCV < 85 fl) and elevated levels of Hb A(2) (>/=4.0%) for beta-thal were further studied by DNA analysis. PCR-based methodologies were used to characterize the mutation contributions of alpha and beta-thals. All the subjects were tested for the state of carrying beta-thala alleles for evaluating the situation of the compound heterozygotes of alpha-thal with beta-thal. Of 1 028 random samples of umbilical blood screened, 112 of subjects were defined to be the gene carriers of alpha-thal. The alpha-thal carrier rate was as high as 11.19% including 3 compound heterozygotes. Five well-known types of alpha-thal alleles were detected with gene contributions of 37.4% (--(SEA) deletion), 31.3% (-alpha(3.7) deletion), 17.4% (-alpha(4.2) deletion), 12.1% (alpha(CS)alpha mutation), and 0.9% (alpha(QS)alpha mutation), successively. Of the 1 312 adult specimens studied, 89 with beta-thal including 14 of the compound higher Hb F subjects were detected. All of the 89 phenotypic beta-thal carriers had the mutations in the beta-globin gene, making the overall prevalence 6.78%. The commonly seen three mutations, beta CD41 - 42 (-CTTT) frameshift, beta CD17 (T-A) nonsense mutation and beta-28 (A-G) promoter variation were accounted for 90% of the beta-thal alleles in Liuzhou. Of these beta-thal subjects, 16 (accounting for 18%) were found to be the compound heterozygosity for a beta-thal and an alpha-thal with 9 different types of gene defects with a detection rate 1.22%. Data from ecidation of alpha and beta-thal gene frequencies and mutation spectrum in Liuzhou city was useful for genetic counselling and prenatal diagnosis of this disease.

Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

PubMed Central

Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

2012-01-01

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

PubMed

Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

2012-11-02

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

Relationship between subclinical rejection and genotype, renal messenger RNA, and plasma protein transforming growth factor-beta1 levels.

PubMed

Hueso, Miguel; Navarro, Estanis; Moreso, Francesc; Beltrán-Sastre, Violeta; Ventura, Francesc; Grinyó, Josep M; Serón, Daniel

2006-05-27

Transforming growth factor (TGF)-beta(1) is increased in allograft rejection and its production is associated with single nucleotide polymorphisms (SNPs). The contribution of SNPs at codons 10 and 25 of the TGF-beta(1) gene to renal allograft damage was assessed in 6-month protocol biopsies and their association with TGF-beta(1) production. TGF-beta(1) genotypes were evaluated by polymerase chain reaction (PCR)/restriction fragment length polymorphism. Intragraft TGF-beta(1) messenger RNA (mRNA) was measured by real-time PCR and TGF-beta(1) plasma levels were assessed by enzyme-linked immunosorbent assay. Eighty consecutive patients were included. Allele T at codon 10 (risk ratio, 6.7; P = 0.02) and an episode of acute rejection before protocol biopsy (risk ratio, 6.2; P = 0.01) were independent predictors of subclinical rejection (SCR). TGF-beta(1) plasma levels, but not those of TGF-beta(1) mRNA, were increased in patients with SCR (2.59 ng/mL +/- 0.91 [n = 22] vs. 2.05 ng/mL +/- 0.76 [n = 43]; P = 0.01). There was no association between allele T and TGF-beta(1) plasma or intragraft levels. Allele T at codon 10 of the TGF-beta(1) gene is associated with a higher incidence of SCR.

Role of beta-adrenergic receptor gene polymorphisms in the long-term effects of beta-blockade with carvedilol in patients with chronic heart failure.

PubMed

Metra, Marco; Covolo, Loredana; Pezzali, Natalia; Zacà, Valerio; Bugatti, Silvia; Lombardi, Carlo; Bettari, Luca; Romeo, Alessia; Gelatti, Umberto; Giubbini, Raffaele; Donato, Francesco; Dei Cas, Livio

2010-02-01

Beta-blockers are mainstay of current treatment of heart failure (HF). Beta-adrenergic receptors (AR) single nucleotide gene polymorphisms (SNPs) may influence the sensitivity and density of beta-AR. We assessed the relation between three common beta-AR SNPs and the response to carvedilol administration. We studied 183 consecutive patients with chronic HF due to ischemic or nonischemic cardiomyopathy, a LV ejection fraction (LVEF) < or = 0.35, not previously treated with beta-blockers. Each patient underwent gated-SPECT radionuclide ventriculography, cardiopulmonary exercise testing and invasive hemodynamic monitoring at baseline and after 12 months of carvedilol administration at maintenance dosages. The beta1-AR gene Arg389Gly and the beta2-AR gene Arg16Gly SNPs were not related to the response to carvedilol administration. Homozygotes for the Glu27Glu allele showed a greater increase in the LVEF, compared to the other patients (+13.0 +/- 12.2% versus +7.1 +/- 8.1% in the Gln27Gln homozygotes, and 8.3 +/- 11.4% units in the Gln27Glu heterozygotes; p = 0.022 by ANOVA). Glu27Glu homozygotes also showed a greater decline in the pulmonary wedge pressure both at rest and at peak exercise. Gln27Glu SNP was selected amongst the determinants of the LVEF response to carvedilol at multivariable analysis, in addition to the cause of cardiomyopathy, baseline systolic blood pressure and the dose of carvedilol administered. Beta1-AR Arg389Gly and beta2-AR Arg16Gly SNPs are not related to the response to carvedilol therapy. In contrast, the Gln27Glu SNP is a determinant of the LVEF response to this agent in patients with chronic HF.

Possible roles for products of polymorphic MHC and linked olfactory receptor genes during selection processes in reproduction.

PubMed

Ziegler, Andreas; Dohr, Gotrfried; Uchanska-Ziegler, Barbara

2002-07-01

Polymorphic genes of the human major histocompatibility complex [MHC; human leukocyte antigen (HLA)] are probably important in determining resistance to parasites and avoidance of inbreeding. We investigated whether HLA-associated sexual selection could also involve HLA-linked olfactory receptor (OR) genes, which might not only participate in olfaction-guided mate choice, but also in selection processes within the testis. The testicular expression status of HLA class I molecules (by immunohistology) and HLA-linked OR genes (by transcriptional analysis) was determined. Various HLA class I heavy chains, but not beta2-microglobulin (beta2m), were expressed, mainly at the spermatocyte I stage. Of 17 HLA-linked OR genes analyzed, eight were found to be transcribed in the testis. They exhibited varying numbers of 5'- or 3'-non-coding exons as well as differential splicing. We suggest that testis-expressed polymorphic HLA and OR proteins are functionally connected and serve the selection of spermatozoa, enabling them to distinguish 'self from 'non-self [the sperm-receptor-selection (SRS) hypothesis].

Polymorphism of the MHC class II Eb gene determines the protection against collagen-induced arthritis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gonzalez-Gay, M.A.; Zanelli, E.; Krco, C.J.

1995-05-01

Collagen-induced arthritis (CIA) is an animal model of auto immune polyarthritis, sharing similarities with rheumatoid arthritis (RA). Paradoxally, susceptibility to mouse CIA is controlled by the H2A loci (DQ homologous) while RA is linked to HLA.DR genes (H2E homologous). We recently showed that the E{beta}{sup d} molecule prevents CIA development in susceptible H2{sup q} mice. We addressed the question of whether H2Eb polymorphism will influence CIA incidence as HLA.DRB1 polymorphism does in RA. In F{sub 1} mice, only H2Eb{sup d} and H2Eb{sup s} molecules showed protection. Using recombinant B10.RDD (Eb{sup d/b}) mice, we found that CIA protection was mediated bymore » the first domain of the E{beta}{sup d} molecule. Using peptides covering the third hypervariable region of the E{beta} chain, we found a perfect correlation between presentation of E{beta} peptides by the H2A{sup q} molecule and protection on CIA. Therefore, the mechanism by which H2Eb protects against CIA seems to rely on the affinity of E{beta} peptides for the H2A{sup q} molecule. 35 refs., 2 figs., 3 tabs.« less

Intraspecific Polymorphism, Interspecific Divergence, and the Origins of Function-Altering Mutations in Deer Mouse Hemoglobin

PubMed Central

Natarajan, Chandrasekhar; Hoffmann, Federico G.; Lanier, Hayley C.; Wolf, Cole J.; Cheviron, Zachary A.; Spangler, Matthew L.; Weber, Roy E.; Fago, Angela; Storz, Jay F.

2015-01-01

Major challenges for illuminating the genetic basis of phenotypic evolution are to identify causative mutations, to quantify their functional effects, to trace their origins as new or preexisting variants, and to assess the manner in which segregating variation is transduced into species differences. Here, we report an experimental analysis of genetic variation in hemoglobin (Hb) function within and among species of Peromyscus mice that are native to different elevations. A multilocus survey of sequence variation in the duplicated HBA and HBB genes in Peromyscus maniculatus revealed that function-altering amino acid variants are widely shared among geographically disparate populations from different elevations, and numerous amino acid polymorphisms are also shared with closely related species. Variation in Hb-O2 affinity within and among populations of P. maniculatus is attributable to numerous amino acid mutations that have individually small effects. One especially surprising feature of the Hb polymorphism in P. maniculatus is that an appreciable fraction of functional standing variation in the two transcriptionally active HBA paralogs is attributable to recurrent gene conversion from a tandemly linked HBA pseudogene. Moreover, transpecific polymorphism in the duplicated HBA genes is not solely attributable to incomplete lineage sorting or introgressive hybridization; instead, it is mainly attributable to recurrent interparalog gene conversion that has occurred independently in different species. Partly as a result of concerted evolution between tandemly duplicated globin genes, the same amino acid changes that contribute to variation in Hb function within P. maniculatus also contribute to divergence in Hb function among different species of Peromyscus. In the case of function-altering Hb mutations in Peromyscus, there is no qualitative or quantitative distinction between segregating variants within species and fixed differences between species. PMID:25556236

Bergamot (Citrus bergamia Risso) fruit extracts as γ-globin gene expression inducers: phytochemical and functional perspectives.

PubMed

Guerrini, Alessandra; Lampronti, Ilaria; Bianchi, Nicoletta; Zuccato, Cristina; Breveglieri, Giulia; Salvatori, Francesca; Mancini, Irene; Rossi, Damiano; Potenza, Rocco; Chiavilli, Francesco; Sacchetti, Gianni; Gambari, Roberto; Borgatti, Monica

2009-05-27

Epicarps of Citrus bergamia fruits from organic farming were extracted with the objective of obtaining derived products differently rich in coumarins and psoralens. The extracts were chemically characterized by (1)H nuclear magnetic resonance (NMR), gas chromatography-flame ionization detection (GC-FID), gas chromatography-mass spectrometry (GC-MS), and high-pressure liquid chromatography (HPLC) for detecting and quantifying the main constituents. Both bergamot extracts and chemical standards corresponding to the main constituents detected were then assayed for their capacity to increase erythroid differentiation of K562 cells and expression of γ-globin genes in human erythroid precursor cells. Three experimental cell systems were employed: (a) the human leukemic K562 cell line, (b) K562 cell clones stably transfected with a pCCL construct carrying green-enhanced green fluorescence protein (EGFP) under the γ-globin gene promoter, and (c) the two-phase liquid culture of human erythroid progenitors isolated from healthy donors. The results suggest that citropten and bergapten are powerful inducers of differentiation and γ-globin gene expression in human erythroid cells. These data could have practical relevance, because pharmacologically mediated regulation of human γ-globin gene expression, with the consequent induction of fetal hemoglobin, is considered to be a potential therapeutic approach in hematological disorders, including β-thalassemia and sickle cell anemia.

TNF-alpha and IL-10 gene polymorphisms show a weak association with pemphigus vulgaris in the Slovak population.

PubMed

Javor, J; Chmurova, N; Parnicka, Z; Ferencik, S; Grosse-Wilde, H; Buc, M; Svecova, D

2010-01-01

Pemphigus vulgaris is a rare chronic autoimmune disease of skin and mucous membranes, with several cytokines participating in its development. The role of their gene polymorphisms in susceptibility to the disease is, however, not fully understood. The aim of our case-control study was to investigate whether some of 22 single nucleotide polymorphisms (SNPs) in 13 cytokine genes (IL-1alpha, IL-1beta, IL-1RI, IL-1Ra, IL-4Ralpha, IL-12, IFN-gamma, TGF-beta1, TNF-alpha, IL-2, IL-4, IL-6 and IL-10) are associated with pemphigus vulgaris in the Slovak population. DNA samples were obtained from 34 pemphigus vulgaris patients and 140 healthy controls of Slovak origin. Cytokine gene SNPs were determined using the polymerase chain reaction with sequence-specific primers (PCR-SSP) method. Results We found a weak association between pemphigus vulgaris and polymorphic variants in TNF-alpha and IL-10 genes only, with haplotypes TNF-alpha-308G/-238G and IL-10 -1082A/-819C/-592C being significantly overrepresented in pemphigus vulgaris patients (TNF-alpha GG: 94.12% vs. 82.86%, P = 0.0216; IL-10 ACC: 44.12% vs. 30.00%, P = 0.0309). Our preliminary results suggest that certain TNF-alpha and IL-10 gene polymorphisms might contribute to genetic susceptibility to pemphigus vulgaris; however, their overall impact on disease development will be rather limited.

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

PubMed Central

Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2015-01-01

Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

Cytokine polymorphism in patients with migraine: some suggestive clues of migraine and inflammation.

PubMed

Yilmaz, Ibrahim Arda; Ozge, Aynur; Erdal, Mehmet Emin; Edgünlü, Tuba Gökdoğan; Cakmak, Sema Erol; Yalin, Osman Ozgür

2010-04-01

There are contrasting results obtained in migraineurs concerning the levels and the role of both pro-inflammatory and anti-inflammatory cytokines. In this study, the association of the occurrence and clinical characteristics of migraine with the polymorphisms of tumor necrosis factor alpha (TNF-alpha) -308 G/A (rs1800629), interleukin-1alpha (IL-1alpha) +4845 G/T (rs17561), IL-1beta+3953 C/T (rs1143634) and interleukin-1 receptor antagonist variable number tandem repeat (IL-1RA VNTR) genes were studied. We also investigated the genetic linkage between these genes. Sixty-seven patients with migraine without aura (MwoA) and 96 unrelated, age- and sex-matched migraine-free, healthy control subjects from the same geographic area were investigated. We observed significant differences in the genotypic distribution of the TNF-alpha-308 G/A and IL-1beta+3953 C/T polymorphism for migraineurs compared with controls (P = 0.004). Frequency of the TNF-alpha-308 GG genotype was higher in the control group than MwoA group (82.1% vs 55.2%). Differences in the distribution of the allele frequencies were also observed, being the TNF-alpha-308 G allele overrepresented in control group and TNF-alpha-308 A allele in MwoA group. In addition, there was a significant increase of the IL-1beta+3953 T allele in MwoA cases compared with controls (P = 0.004). In conclusion, the present results indicate the possible contribution of TNF-alpha and IL-1beta gene polymorphisms to migraine headache generation in MwoA patients.

Genetic modulation of sickle cell anemia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steinberg, M.H.

1995-05-01

Sickle cell anemia, a common disorder associated with reduced life span of the red blood cell and vasoocclusive events, is caused by a mutation in the {Beta}-hemoglobin gene. Yet, despite this genetic homogeneity, the phenotype of the disease is heterogeneous. This suggests the modulating influence of associated inherited traits. Some of these may influence the accumulation of fetal hemoglobin, a hemoglobin type that interferes with the polymerization of sickle hemoglobin. Another inherited trait determines the accumulation of {alpha}-globin chains. This review focuses on potential genetic regulators of the phenotype of sickle cell anemia. 125 refs., 6 figs., 3 tabs.

Inflammatory Gene Polymorphisms in Lung Cancer Susceptibility.

PubMed

Eaton, Keith D; Romine, Perrin E; Goodman, Gary E; Thornquist, Mark D; Barnett, Matt J; Petersdorf, Effie W

2018-05-01

Chronic inflammation has been implicated in carcinogenesis, with increasing evidence of its role in lung cancer. We aimed to evaluate the role of genetic polymorphisms in inflammation-related genes in the risk for development of lung cancer. A nested case-control study design was used, and 625 cases and 625 well-matched controls were selected from participants in the β-Carotene and Retinol Efficacy Trial, which is a large, prospective lung cancer chemoprevention trial. The association between lung cancer incidence and survival and 23 polymorphisms descriptive of 11 inflammation-related genes (interferon gamma gene [IFNG], interleukin 10 gene [IL10], interleukin 1 alpha gene [IL1A], interleukin 1 beta gene [IL1B], interleukin 2 gene [IL2], interleukin 4 receptor gene [IL4R], interleukin 4 gene [IL4], interleukin 6 gene [IL6], prostaglandin-endoperoxide synthase 2 gene [PTGS2] (also known as COX2), transforming growth factor beta 1 gene [TGFB1], and tumor necrosis factor alpha gene [TNFA]) was evaluated. Of the 23 polymorphisms, two were associated with risk for lung cancer. Compared with individuals with the wild-type (CC) variant, individuals carrying the minor allele variants of the IL-1β-511C>T promoter polymorphism (rs16944) (CT and TT) had decreased odds of lung cancer (OR = 0.74, [95% confidence interval (CI): 0.58-0.94] and OR = 0.71 [95% CI: 0.50-1.01], respectively, p = 0.03). Similar results were observed for the IL-1β-1464 C>G promoter polymorphism (rs1143623), with presence of the minor variants CG and CC having decreased odds of lung cancer (OR = 0.75 [95% CI: 0.59-0.95] and OR = 0.69 [95% CI: 0.46-1.03], respectively, p = 0.03). Survival was not influenced by genotype. This study provides further evidence that IL1B promoter polymorphisms may modulate the risk for development of lung cancer. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

Gene cooption and convergent evolution of oxygen transport hemoglobins in jawed and jawless vertebrates

PubMed Central

Hoffmann, Federico G.; Opazo, Juan C.; Storz, Jay F.

2010-01-01

Natural selection often promotes evolutionary innovation by coopting preexisting genes for new functions, and this process may be greatly facilitated by gene duplication. Here we report an example of cooptive convergence where paralogous members of the globin gene superfamily independently evolved a specialized O2 transport function in the two deepest branches of the vertebrate family tree. Specifically, phylogenetic evidence demonstrates that erythroid-specific O2 transport hemoglobins evolved independently from different ancestral precursor proteins in jawed vertebrates (gnathostomes) and jawless fish (cyclostomes, represented by lamprey and hagfish). A comprehensive phylogenetic analysis of the vertebrate globin gene superfamily revealed that the erythroid hemoglobins of cyclostomes are orthologous to the cytoglobin protein of gnathostome vertebrates, a hexacoordinate globin that has no O2 transport function and that is predominantly expressed in fibroblasts and related cell types. The phylogeny reconstruction also revealed that vertebrate-specific globins are grouped into four main clades: (i) cyclostome hemoglobin + cytoglobin, (ii) myoglobin + globin E, (iii) globin Y, and (iv) the α- and β-chain hemoglobins of gnathostomes. In the hemoglobins of gnathostomes and cyclostomes, multisubunit quaternary structures provide the basis for cooperative O2 binding and allosteric regulation by coupling the effects of ligand binding at individual subunits with interactions between subunits. However, differences in numerous structural details belie their independent origins. This example of convergent evolution of protein function provides an impressive demonstration of the ability of natural selection to cobble together complex design solutions by tinkering with different variations of the same basic protein scaffold. PMID:20660759

Genetic variations in the beta-tubulin gene and the internal transcribed spacer 2 region of Trichuris species from man and baboons.

PubMed

Hansen, Tina V A; Thamsborg, Stig M; Olsen, Annette; Prichard, Roger K; Nejsum, Peter

2013-08-12

The whipworm Trichuris trichiura has been estimated to infect 604 - 795 million people worldwide. The current control strategy against trichuriasis using the benzimidazoles (BZs) albendazole (400 mg) or mebendazole (500 mg) as single-dose treatment is not satisfactory. The occurrence of single nucleotide polymorphisms (SNPs) in codons 167, 198 or 200 of the beta-tubulin gene has been reported to convey BZ-resistance in intestinal nematodes of veterinary importance. It was hypothesised that the low susceptibility of T. trichiura to BZ could be due to a natural occurrence of such SNPs. The aim of this study was to investigate whether these SNPs were present in the beta-tubulin gene of Trichuris spp. from humans and baboons. As a secondary objective, the degree of identity between T. trichiura from humans and Trichuris spp. from baboons was evaluated based on the beta-tubulin gene and the internal transcribed spacer 2 region (ITS2). Nucleotide sequences of the beta-tubulin gene were generated by PCR using degenerate primers, specific primers and DNA from worms and eggs of T. trichiura and worms of Trichuris spp. from baboons. The ITS2 region was amplified using adult Trichuris spp. from baboons. PCR products were sequenced and analysed. The beta-tubulin fragments were studied for SNPs in codons 167, 198 or 200 and the ITS2 amplicons were compared with GenBank records of T. trichiura. No SNPs in codons 167, 198 or 200 were identified in any of the analysed Trichuris spp. from humans and baboons. Based on the ITS2 region, the similarity between Trichuris spp. from baboons and GenBank records of T. trichiura was found to be 98 - 99%. Single nucleotide polymorphisms in codon 167, 198 and 200, known to confer BZ-resistance in other nematodes, were absent in the studied material. This study does not provide data that could explain previous reports of poor BZ treatment efficacy in terms of polymorphism in these codons of beta-tubulin. Based on a fragment of the beta-tubulin gene and the ITS2 region sequenced, it was found that T. trichiura from humans and Trichuris spp. isolated from baboons are closely related and may be the same species.

Genetic variations in the beta-tubulin gene and the internal transcribed spacer 2 region of Trichuris species from man and baboons

PubMed Central

2013-01-01

Background The whipworm Trichuris trichiura has been estimated to infect 604 – 795 million people worldwide. The current control strategy against trichuriasis using the benzimidazoles (BZs) albendazole (400 mg) or mebendazole (500 mg) as single-dose treatment is not satisfactory. The occurrence of single nucleotide polymorphisms (SNPs) in codons 167, 198 or 200 of the beta-tubulin gene has been reported to convey BZ-resistance in intestinal nematodes of veterinary importance. It was hypothesised that the low susceptibility of T. trichiura to BZ could be due to a natural occurrence of such SNPs. The aim of this study was to investigate whether these SNPs were present in the beta-tubulin gene of Trichuris spp. from humans and baboons. As a secondary objective, the degree of identity between T. trichiura from humans and Trichuris spp. from baboons was evaluated based on the beta-tubulin gene and the internal transcribed spacer 2 region (ITS2). Methods Nucleotide sequences of the beta-tubulin gene were generated by PCR using degenerate primers, specific primers and DNA from worms and eggs of T. trichiura and worms of Trichuris spp. from baboons. The ITS2 region was amplified using adult Trichuris spp. from baboons. PCR products were sequenced and analysed. The beta-tubulin fragments were studied for SNPs in codons 167, 198 or 200 and the ITS2 amplicons were compared with GenBank records of T. trichiura. Results No SNPs in codons 167, 198 or 200 were identified in any of the analysed Trichuris spp. from humans and baboons. Based on the ITS2 region, the similarity between Trichuris spp. from baboons and GenBank records of T. trichiura was found to be 98 – 99%. Conclusions Single nucleotide polymorphisms in codon 167, 198 and 200, known to confer BZ-resistance in other nematodes, were absent in the studied material. This study does not provide data that could explain previous reports of poor BZ treatment efficacy in terms of polymorphism in these codons of beta-tubulin. Based on a fragment of the beta-tubulin gene and the ITS2 region sequenced, it was found that T. trichiura from humans and Trichuris spp. isolated from baboons are closely related and may be the same species. PMID:23938038

Nuclear proteins that bind the human gamma-globin gene promoter: alterations in binding produced by point mutations associated with hereditary persistence of fetal hemoglobin.

PubMed Central

Gumucio, D L; Rood, K L; Gray, T A; Riordan, M F; Sartor, C I; Collins, F S

1988-01-01

The molecular mechanisms responsible for the human fetal-to-adult hemoglobin switch have not yet been elucidated. Point mutations identified in the promoter regions of gamma-globin genes from individuals with nondeletion hereditary persistence of fetal hemoglobin (HPFH) may mark cis-acting sequences important for this switch, and the trans-acting factors which interact with these sequences may be integral parts in the puzzle of gamma-globin gene regulation. We have used gel retardation and footprinting strategies to define nuclear proteins which bind to the normal gamma-globin promoter and to determine the effect of HPFH mutations on the binding of a subset of these proteins. We have identified five proteins in human erythroleukemia cells (K562 and HEL) which bind to the proximal promoter region of the normal gamma-globin gene. One factor, gamma CAAT, binds the duplicated CCAAT box sequences; the -117 HPFH mutation increases the affinity of interaction between gamma CAAT and its cognate site. Two proteins, gamma CAC1 and gamma CAC2, bind the CACCC sequence. These proteins require divalent cations for binding. The -175 HPFH mutation interferes with the binding of a fourth protein, gamma OBP, which binds an octamer sequence (ATGCAAAT) in the normal gamma-globin promoter. The HPFH phenotype of the -175 mutation indicates that the octamer-binding protein may play a negative regulatory role in this setting. A fifth protein, EF gamma a, binds to sequences which overlap the octamer-binding site. The erythroid-specific distribution of EF gamma a and its close approximation to an apparent repressor-binding site suggest that it may be important in gamma-globin regulation. Images PMID:2468996

Specific repression of β-globin promoter activity by nuclear ferritin

PubMed Central

Broyles, Robert H.; Belegu, Visar; DeWitt, Christina R.; Shah, Sandeep N.; Stewart, Charles A.; Pye, Quentin N.; Floyd, Robert A.

2001-01-01

Developmental hemoglobin switching involves sequential globin gene activations and repressions that are incompletely understood. Earlier observations, described herein, led us to hypothesize that nuclear ferritin is a repressor of the adult β-globin gene in embryonic erythroid cells. Our data show that a ferritin-family protein in K562 cell nuclear extracts binds specifically to a highly conserved CAGTGC motif in the β-globin promoter at −153 to −148 bp from the cap site, and mutation of the CAGTGC motif reduces binding 20-fold in competition gel-shift assays. Purified human ferritin that is enriched in ferritin-H chains also binds the CAGTGC promoter segment. Expression clones of ferritin-H markedly repress β-globin promoter-driven reporter gene expression in cotransfected CV-1 cells in which the β-promoter has been stimulated with the transcription activator erythroid Krüppel-like factor (EKLF). We have constructed chloramphenicol acetyltransferase reporter plasmids containing either a wild-type or mutant β-globin promoter for the −150 CAGTGC motif and have compared the constructs for susceptibility to repression by ferritin-H in cotransfection assays. We find that stimulation by cotransfected EKLF is retained with the mutant promoter, whereas repression by ferritin-H is lost. Thus, mutation of the −150 CAGTGC motif not only markedly reduces in vitro binding of nuclear ferritin but also abrogates the ability of expressed ferritin-H to repress this promoter in our cell transfection assay, providing a strong link between DNA binding and function, and strong support for our proposal that nuclear ferritin-H is a repressor of the human β-globin gene. Such a repressor could be helpful in treating sickle cell and other genetic diseases. PMID:11481480

Coexistence of multiple globin genes conferring protection against nitrosative stress to the Antarctic bacterium Pseudoalteromonas haloplanktis TAC125.

PubMed

Coppola, Daniela; Giordano, Daniela; Milazzo, Lisa; Howes, Barry D; Ascenzi, Paolo; di Prisco, Guido; Smulevich, Giulietta; Poole, Robert K; Verde, Cinzia

2018-02-28

Despite the large number of globins recently discovered in bacteria, our knowledge of their physiological functions is restricted to only a few examples. In the microbial world, globins appear to perform multiple roles in addition to the reversible binding of oxygen; all these functions are attributable to the heme pocket that dominates functional properties. Resistance to nitrosative stress and involvement in oxygen chemistry seem to be the most prevalent functions for bacterial globins, although the number of globins for which functional roles have been studied via mutation and genetic complementation is very limited. The acquisition of structural information has considerably outpaced the physiological and molecular characterisation of these proteins. The genome of the Antarctic cold-adapted bacterium Pseudoalteromonas haloplanktis TAC125 (PhTAC125) contains genes encoding three distinct single-chain 2/2 globins, supporting the hypothesis of their crucial involvement in a number of functions, including protection against oxidative and nitrosative stress in the cold and O 2 -rich environment. In the genome of PhTAC125, the genes encoding 2/2 globins are constitutively transcribed, thus suggesting that these globins are not functionally redundant in their physiological function in PhTAC125. In the present study, the physiological role of one of the 2/2 globins, Ph-2/2HbO-2217, was investigated by integrating in vivo and in vitro results. This role includes the involvement in the detoxification of reactive nitrogen and O 2 species including NO by developing two in vivo and in vitro models to highlight the protective role of Ph-2/2HbO-2217 against reactive nitrogen species. The PSHAa2217 gene was cloned and over-expressed in the flavohemoglobin-deficient mutant of Escherichia coli and the growth properties and O 2 uptake in the presence of NO of the mutant carrying the PSHAa2217 gene were analysed. The ferric form of Ph-2/2HbO-2217 is able to catalyse peroxynitrite isomerisation in vitro, indicating its potential role in the scavenging of reactive nitrogen species. Here we present in vitro evidence for the detoxification of NO by Ph-2/2HbO-2217. Copyright © 2017. Published by Elsevier Inc.

Plasmodium falciparum malaria skews globin gene expression balance in in-vitro haematopoietic stem cell culture system: Its implications in malaria associated anemia.

PubMed

Pathak, Vrushali; Colah, Roshan; Ghosh, Kanjaksha

2018-02-01

Understanding the pathophysiology and associated host parasite interactions of the malaria infection is the prerequisite for developing effective prevention and treatment strategies. The exact mechanism underlying malaria associated ineffective and dyserythropoiesis is not yet fully understood. Being an important protein, haemoglobin serves as the main amino acid reservoir available to the intra-erythrocytic plasmodium. It is important to check the expression profiling of globin genes which may help us to understand host parasite interactions and its potential contribution to both infection and disease. Here, an in-vitro culture system was used to study the effect of different doses of Plasmodium falciparum on haematopoietic stem cell expansion, differentiation and expression of globin genes. Upon exposure to the different doses of P. falciparum parasites of strains 3D7, Dd2 and RKL9 (intact and lysed form) at different stages of erythroid development, cells demonstrated suppression in growth and differentiation. At almost all stages of erythroid development upon parasite exposure, the γ globin gene was found to be downregulated and the α/β as well as α/non- α globin mRNA ratios in late stage erythroid cells were found to be reduced (p < .01) compared to the untreated controls. The imbalance in globin chain expression might be considered as one of the factors involved in malaria associated inappropriate erythropoietic responses. Copyright © 2018 Elsevier Inc. All rights reserved.

Characterization of Homozygous Hb Setif (HBA2: c.283G>T) in the Iranian Population.

PubMed

Farashi, Samaneh; Garous, Negin F; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2016-01-01

Hemoglobin (Hb) variants are abnormalities resulting from point mutations in either of the two α-globin genes (HBA2 or HBA1) or the β-globin gene (HBB). Various reports of Hb variants have been described in Iran and other countries around the world. Hb Setif (or HBA2: c.283G>T) is one of these variants with a mutation at codon 94 of of the α2-globin gene that is characterized in clinically normal heterozygous individuals. We here report clinical and hematological findings in two homozygous cases of Iranian origin for this unstable Hb variant.

Improved hematopoietic differentiation efficiency of gene-corrected beta-thalassemia induced pluripotent stem cells by CRISPR/Cas9 system.

PubMed

Song, Bing; Fan, Yong; He, Wenyin; Zhu, Detu; Niu, Xiaohua; Wang, Ding; Ou, Zhanhui; Luo, Min; Sun, Xiaofang

2015-05-01

The generation of beta-thalassemia (β-Thal) patient-specific induced pluripotent stem cells (iPSCs), subsequent homologous recombination-based gene correction of disease-causing mutations/deletions in the β-globin gene (HBB), and their derived hematopoietic stem cell (HSC) transplantation offers an ideal therapeutic solution for treating this disease. However, the hematopoietic differentiation efficiency of gene-corrected β-Thal iPSCs has not been well evaluated in the previous studies. In this study, we used the latest gene-editing tool, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9), to correct β-Thal iPSCs; gene-corrected cells exhibit normal karyotypes and full pluripotency as human embryonic stem cells (hESCs) showed no off-targeting effects. Then, we evaluated the differentiation efficiency of the gene-corrected β-Thal iPSCs. We found that during hematopoietic differentiation, gene-corrected β-Thal iPSCs showed an increased embryoid body ratio and various hematopoietic progenitor cell percentages. More importantly, the gene-corrected β-Thal iPSC lines restored HBB expression and reduced reactive oxygen species production compared with the uncorrected group. Our study suggested that hematopoietic differentiation efficiency of β-Thal iPSCs was greatly improved once corrected by the CRISPR/Cas9 system, and the information gained from our study would greatly promote the clinical application of β-Thal iPSC-derived HSCs in transplantation.

Interaction between beta2 adrenergic receptor polymorphisms determines the extent of isoproterenol-induced vasodilatation ex vivo.

PubMed

Khalaila, Jawad M; Elami, Amir; Caraco, Yoseph

2007-10-01

Single nucleotide polymorphisms at nucleotides 46, 79 and 491 of the beta2 adrenergic receptor (beta2AR) gene modify its pharmacological properties and may alter the response to agonists. The purpose of this study was to evaluate the role played by beta2AR polymorphisms on isoproterenol-induced relaxation of internal mammary arteries ex vivo. Internal mammary leftover segments were collected from 96 patients undergoing coronary artery bypass operation. Vascular rings were allowed to reach equilibrium with physiological Krebs solution before precontraction with U46619. Using the organ bath technique, cumulative dose-response curve of isoproterenol was constructed and average EC50 calculated. beta2AR genotyping was performed using a PCR-RFLP analysis. Arterial segments obtained from Gly16 homozygotes displayed reduced sensitivity to isoproterenol compared with carriers of Arg16 allele(s) [Mean (-log) EC50+/-SD, 6.42+/-0.24, 95% confidence interval (CI) 6.32-6.53 vs. 6.67+/-0.25, 95% CI 6.62-6.73, P<0.001]. Among Gly16 homozygotes, the presence of two Glu27 alleles restored vascular response to the level noted among Arg16 carriers (6.58+/-0.17, 95% CI 6.41-6.76). The least response to isoproterenol was noted in a single patient carrying the Gly16Gly-Gln27Glu-Thr164Ile combined genotype requiring almost six-fold higher isoproterenol concentration than carriers of the wild-type genotype to achieve half the maximal arterial dilatation (17.78 x 10(-7) vs. 3.01 x 10(-7) +/- 2.62 x 10(-7) mol/l). Vascular dilatation by isoproterenol is determined by a complex interaction between polymorphisms at nucleotides 46, 79 and 491 of the beta2AR gene. Further studies are warranted to evaluate the effect of additional polymorphisms in the coding and noncoding regions on vascular reactivity.

Enterobacter cloacae with a novel variant of ACT AmpC beta-lactamase originating from glaucous gull (Larus hyperboreus) in Svalbard.

PubMed

Literak, Ivan; Manga, Ivan; Wojczulanis-Jakubas, Katarzyna; Chroma, Magdalena; Jamborova, Ivana; Dobiasova, Hana; Sedlakova, Miroslava Htoutou; Cizek, Alois

2014-07-16

We aimed at Escherichia coli and Enterobacter cloacae isolates resistant to cephalosporins and fluoroquinolones and Salmonella isolates in wild birds in Arctic Svalbard, Norway. Cloacal swabs of little auks (Alle alle, n=215) and samples of faeces of glaucous gulls (Larus hyperboreus, n=15) were examined. Inducible production of AmpC enzyme was detected in E. cloacae KW218 isolate. Sequence analysis of the 1146 bp PCR product of the ampC gene from this isolate revealed 99% sequence homology with the blaACT-14 and blaACT-5 AmpC beta-lactamase genes. Four, respectively six of the identified single nucleotide polymorphisms generated amino acid substitutions in the amino acid chain. As the ampC sequence polymorphism in the investigated E. cloacae strain was identified as unique, we revealed a novel variant of the ampC beta-lactamase gene blaACT-23. Copyright © 2014 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rund, D.; Cohen, T.; Filon, D.

{beta}-Thalassemia is a hereditary disease caused by any of 90 different point mutations in the {beta}-globin gene. Specific populations generally carry a small number of mutations, the most common of which are those that are widely distributed regionally. The present study constitutes an extensive molecular characterization of this disease in a small, highly inbred ethnic group with a high incidence of {beta}-thalassemia-the Jews of Kurdistan. An unusual mutational diversity was observed. In 42 sibships 13 different mutations were identified, of which 3 are newly discovered. Four of the mutations are unique to Kurdish Jews and have not been discovered inmore » any other population. A fifth was found outside Kurdish Jews only in an Iranian from Khuzistan, a region bordering Kurdistan. Two-thirds of the mutant chromosomes carry the mutations unique to Kurdish Jews. The authors traced the origin of the mutations to specific geographic regions within Kurdistan. This information, supported by haplotype analysis, suggests that thalassemia in central Kurdistan (northern Iraq) has evolved primarily from multiple mutational events. They conclude that several evolutionary mechanisms contributed to the evolution of {beta}-thalassemia in this small ethnic isolate.« less

Associations between a polymorphism in the hydroxysteroid (11-beta) dehydrogenase 1 gene, neuroticism and postpartum depression.

PubMed

Iliadis, S I; Comasco, E; Hellgren, C; Kollia, N; Sundström Poromaa, I; Skalkidou, A

2017-01-01

This study examined the association between a single nucleotide polymorphism in the hydroxysteroid (11-beta) dehydrogenase 1 gene and neuroticism, as well as the possible mediatory role of neuroticism in the association between the polymorphism and postpartum depressive symptoms. 769 women received questionnaires containing the Edinburgh Postnatal Depression Scale (EPDS) at six weeks postpartum and demographic data at pregnancy week 17 and 32 and at six weeks postpartum, as well as the Swedish universities Scales of Personality at pregnancy week 32. Linear regression models showed an association between the GG genotype and depressive symptoms. When neuroticism was introduced in the model, it was associated with EPDS score, whereas the association between the GG genotype and EPDS became borderline significant. A path analysis showed that neuroticism had a mediatory role in the association between the polymorphism and EPDS score. The use of the EPDS, which is a self-reporting instrument. Neuroticism was associated with the polymorphism and had a mediatory role in the association between the polymorphism and postpartum depression. This finding elucidates the genetic background of neuroticism and postpartum depression. Copyright © 2016 Elsevier B.V. All rights reserved.

The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming

2012-11-15

Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catecholmore » enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.« less

[Perissodactyla: the primary structure of hemoglobins from the lowland tapir (Tapirus terrestris): glutamic acid in position 2 of the beta chains].

PubMed

Mazur, G; Braunitzer, G

1984-09-01

The hemoglobins from a lowland tapir (Tapirus terrestris) were analysed and the complete primary structure is described. The globin chains were separated on CM cellulose column in 8M urea and the amino-acid sequences were determined in the liquid phase sequenator. The results show that globin consists of two alpha chains (alpha I and alpha II) and beta major and beta minor components. The alpha chains differ only at one position: alpha I contains aspartic acid and alpha II glycine. The beta chains are heterogeneous: aspartic and glutamic acid were found at position beta 21 and beta 73 of the beta major components and asparagine and serine at position beta 139. In the beta minor components four positions were found with more than one amino acid, namely beta 2, beta 4, beta 6 and beta 56. The sequences are compared with those of man, horse and rhinoceros. Four residues of horse methemoglobin, which are involved in the alpha 1 beta 1 contacts are substituted in tapir hemoglobins. In the alpha chains: alpha 107(G14)Ser----Val, alpha 111-(G18) Val----Leu, alpha 115(GH3) Asn----Asp or Gly; in the beta chains: beta 116(G18) Arg----Gln. The amino acid at beta 2 of the major components is glutamic acid while glutamine and histidine are found in the minor components. Although glutamic acid, a binding site for ATP, does not interact with 2,3-bisphosphoglycerate, glutamine and histidine in the minor components are responsible for the slight effect of 2,3-bisphosphoglycerate on tapir hemoglobin.

Proinflammatory genotype of interleukin-1 and interleukin-1 receptor antagonist is associated with ESRD in proteinase 3-ANCA vasculitis patients.

PubMed

Borgmann, Stefan; Endisch, Georg; Hacker, Ulrich T; Song, Bong-Seok; Fricke, Harald

2003-05-01

Small-vessel vasculitides are associated with antineutrophil cytoplasmic antibodies (ANCAs). Cytoplasmic ANCAs are targeted mainly against proteinase 3 (PR3), whereas myeloperoxidase (MPO) is the major antigen of perinuclear ANCAs. These relapsing vasculitides show heterogeneous clinical pictures, and disease severity may vary broadly from mild local organ manifestation to acute organ failure (eg, renal failure). We tested whether two cytokine polymorphisms in the interleukin-1beta (IL-1beta) and IL-1 receptor antagonist (IL-1ra) genes, known to determine cytokine secretion, are associated with clinical manifestations and outcome of ANCA-associated vasculitides. Polymerase chain reaction and restriction fragment length polymorphism analyses were performed to determine polymorphisms in the IL-1beta and IL-1ra genes in 79 patients with PR3-ANCA, 30 patients with MPO-ANCA vasculitis, and 196 healthy controls. The frequency of the so-called proinflammatory genotype, characterized by high secretion of IL-1beta and low secretion of its antagonist IL-1ra, was increased significantly in patients with PR3-ANCA with end-stage renal disease. Patients with a renal manifestation of PR3-ANCA vasculitis have an increased risk for developing end-stage renal disease when carrying the proinflammatory IL-1beta/IL-1ra genotype. Anti-inflammatory therapy specifically antagonizing the proinflammatory effect of IL-1beta may be a promising treatment for patients with Wegener's granulomatosis with renal manifestations.

Relaxed functional constraints on triplicate α-globin gene in the bank vole suggest a different evolutionary history from other rodents

PubMed Central

Marková, S; Searle, J B; Kotlík, P

2014-01-01

Gene duplication plays an important role in the origin of evolutionary novelties, but the mechanisms responsible for the retention and functional divergence of the duplicated copy are not fully understood. The α-globin genes provide an example of a gene family with different numbers of gene duplicates among rodents. Whereas Rattus and Peromyscus each have three adult α-globin genes (HBA-T1, HBA-T2 and HBA-T3), Mus has only two copies. High rates of amino acid evolution in the independently derived HBA-T3 genes of Peromyscus and Rattus have been attributed to positive selection. Using RACE PCR, reverse transcription-PCR (RT–PCR) and RNA-seq, we show that another rodent, the bank vole Clethrionomys glareolus, possesses three transcriptionally active α-globin genes. The bank vole HBA-T3 gene is distinguished from each HBA-T1 and HBA-T2 by 20 amino acids and is transcribed 23- and 4-fold lower than HBA-T1 and HBA-T2, respectively. Polypeptides corresponding to all three genes are detected by electrophoresis, demonstrating that the translated products of HBA-T3 are present in adult erythrocytes. Patterns of codon substitution and the presence of low-frequency null alleles suggest a postduplication relaxation of purifying selection on bank vole HBA-T3. PMID:24595364

[Association between polymorphism in DVWA and IL-1beta and Kashin-Beck disease].

PubMed

Y U, Min; Guo, Xiong; Gao, Xiao-Yun; Lai, Jiang-Hua; Tu, Qian-Qian

2010-07-01

To investigate the association between IL-1beta and DVWA gene and Kashin-Beck disease (KBD). Peripheral genomic DNA were extracted from 105 patients with KBD and 98 healthy controls. PCR-RFLP were performed to detect SNP loci of IL-1beta gene and DVWA gene. The patients with KBD had significantly higher frequency of rs16944 (IL-1beta) locus (chi2 = 24.28, P < 0.001) and single allele frequency of rs16944 (chi2 = 5.683, P = 0.0171) than the healthy controls. There were no significant differences in genotype frequencies,single allele frequencies and haplotypes in rs4685241 and rs1143627 between the patients with KBD and the healthy controls. rs16944 (IL-1beta) is associated with KBD.

No significant association between the genetic polymorphisms in the GSK-3 beta gene and schizophrenia in the Chinese population.

PubMed

Meng, Junwei; Shi, Yongyong; Zhao, Xinzhi; Zhou, Jian; Zheng, Yonglan; Tang, Ruqi; Ma, Gang; Zhu, Xuming; He, Zangdong; Wang, Zhe; Xu, Yifeng; Feng, Guoyin; He, Lin

2008-04-01

The GSK-3 beta gene encodes a protein kinase which is abundant in the brain, and its product is involved in signal transduction cascades of neuronal cell development, energy metabolism and body pattern formation. Previous studies have suggested that GSK-3 beta might act as a potential candidate locus for schizophrenia susceptibility. We genotyped six SNPs within the gene and conducted a case-control study involving 329 schizophrenic patients and 288 healthy subjects in the Chinese population. We examined allele and genotype frequencies and haplotype distributions in the subtype of paranoid schizophrenic patients as well as schizophrenic subjects in general. Our results fail to replicate the association of the GSK-3 beta gene with susceptibility to schizophrenia in the Chinese population.

Polymorphism in beta fibrinogen -455 g/a gene was associated with diabetic in severe ischemic stroke patients

NASA Astrophysics Data System (ADS)

Ritarwan, Kiking; Kadri, Alfansuri; Juwita Sembiring, Rosita

2018-03-01

There is a association of polymorphism in the promoter region of the beta fibrinogen gene -455 G/A with enhancement plasma fibrinogen level. Diabetes mellitus is a risk factor for early neurologic deterioration in acute ischemic stroke. The prothrombotic fibrinogen protein is frequently elevated in patients with diabetes and may be association with poorer prognosis. This study evaluated the association of beta fibrinogen gene -455 G/A promoter polymorphism on modified Ranking Scale of Ischemic Stroke patients treated with diabetic and nondiabetic group. In a Cohort study design comprises 200 consecutive patients diabetic and a nondiabetic who, three months using completed a detailed outcome stroke. Of 200 samples genotype distribution were 27.1% for GG+GA and 0% for AA with diabetic and than 4.4% for GG+GA and 0.05% diabetic patients. Fibrinogen levels were higher in diabetic than nondiabetic group patients (307.7 + 106.3 vs 278 + 84 gr/dl, p=0.002). Fibrinogen level was found to be an independent predictor for diabetic patients. On Genotype GG+GA were associated wth diabetic and nondiabetic group patients. Modified Rankin Scale on day 90 were found associated with diabetic and nondiabetic patients. Conclusion: Elevated fibrinogen level is dose-dependently associated with 90 days outcome severity stroke with diabetic following ischemic stroke

Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

PubMed Central

Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2013-01-01

In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

Individual specific DNA fingerprints from a hypervariable region probe: alpha-globin 3'HVR.

PubMed

Fowler, S J; Gill, P; Werrett, D J; Higgs, D R

1988-06-01

A probe detecting a hypervariable region (HVR) 3' to the alpha globin locus on chromosome 16 has been used to produce DNA fingerprints. Segregation analysis has revealed multiple, randomly dispersed DNA fragments inherited in a Mendelian fashion with minimal allelism and linkage. The fingerprints are highly polymorphic (probability of chance association between random individuals much less than 10(-14]. The probe is, therefore, a powerful discriminating tool: it is envisaged that this probe will have forensic applications, including paternity cases, and will be informative in linkage analysis.

Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations

PubMed Central

Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

2007-01-01

Background The sickle (βs) mutation in the beta-globin gene (HBB) occurs on five "classical" βs haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the βs allele – a consequence of protection from severe malarial infection afforded by heterozygotes – has been associated with a high degree of extended haplotype similarity. The relationship between classical βs haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical βs haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). Results The most common βs sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the βs mutation. Conclusion Two different classical βs haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of βs haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle cell disease, could lie considerable distances away from β-globin. PMID:17688704

Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

PubMed

Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein

2018-03-01

β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

β-thalassemias: paradigmatic diseases for scientific discoveries and development of innovative therapies.

PubMed

Rivella, Stefano

2015-04-01

β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.

Codon 62 (GTG>GCG, Val→Ala) (α1) (HBA1: c.188T>C) causing nondeletional α-thalassemia in a Chinese family.

PubMed

Liao, Can; Tang, Hai-Shen; Li, Ru; Li, Dong-Zhi

2013-01-01

We report a novel α-globin gene point mutation detected during newborn screening for hemoglobinopathies. Sequence analyses identified a GTG>GCG substitution at codon 62 of the α1-globin gene. This mutation causes a silent α-thalassemia (α-thal).

A space-efficient algorithm for local similarities.

PubMed

Huang, X Q; Hardison, R C; Miller, W

1990-10-01

Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.

Two complement receptor one alleles have opposing associations with cerebral malaria and interact with α+thalassaemia.

PubMed

Opi, D Herbert; Swann, Olivia; Macharia, Alexander; Uyoga, Sophie; Band, Gavin; Ndila, Carolyne M; Harrison, Ewen M; Thera, Mahamadou A; Kone, Abdoulaye K; Diallo, Dapa A; Doumbo, Ogobara K; Lyke, Kirsten E; Plowe, Christopher V; Moulds, Joann M; Shebbe, Mohammed; Mturi, Neema; Peshu, Norbert; Maitland, Kathryn; Raza, Ahmed; Kwiatkowski, Dominic P; Rockett, Kirk A; Williams, Thomas N; Rowe, J Alexandra

2018-04-25

Malaria has been a major driving force in the evolution of the human genome. In sub-Saharan African populations, two neighbouring polymorphisms in the Complement Receptor One ( CR1 ) gene, named Sl2 and McC b , occur at high frequencies, consistent with selection by malaria. Previous studies have been inconclusive. Using a large case-control study of severe malaria in Kenyan children and statistical models adjusted for confounders, we estimate the relationship between Sl2 and McC b and malaria phenotypes, and find they have opposing associations. The Sl2 polymorphism is associated with markedly reduced odds of cerebral malaria and death, while the McC b polymorphism is associated with increased odds of cerebral malaria. We also identify an apparent interaction between Sl2 and α + thalassaemia, with the protective association of Sl2 greatest in children with normal α-globin. The complex relationship between these three mutations may explain previous conflicting findings, highlighting the importance of considering genetic interactions in disease-association studies. © 2018, Opi et al.

A Luciferase Reporter Gene System for High-Throughput Screening of γ-Globin Gene Activators.

PubMed

Xie, Wensheng; Silvers, Robert; Ouellette, Michael; Wu, Zining; Lu, Quinn; Li, Hu; Gallagher, Kathleen; Johnson, Kathy; Montoute, Monica

2016-01-01

Luciferase reporter gene assays have long been used for drug discovery due to their high sensitivity and robust signal. A dual reporter gene system contains a gene of interest and a control gene to monitor non-specific effects on gene expression. In our dual luciferase reporter gene system, a synthetic promoter of γ-globin gene was constructed immediately upstream of the firefly luciferase gene, followed downstream by a synthetic β-globin gene promoter in front of the Renilla luciferase gene. A stable cell line with the dual reporter gene was cloned and used for all assay development and HTS work. Due to the low activity of the control Renilla luciferase, only the firefly luciferase activity was further optimized for HTS. Several critical factors, such as cell density, serum concentration, and miniaturization, were optimized using tool compounds to achieve maximum robustness and sensitivity. Using the optimized reporter assay, the HTS campaign was successfully completed and approximately 1000 hits were identified. In this chapter, we also describe strategies to triage hits that non-specifically interfere with firefly luciferase.

Novel numerical and graphical representation of DNA sequences and proteins.

PubMed

Randić, M; Novic, M; Vikić-Topić, D; Plavsić, D

2006-12-01

We have introduced novel numerical and graphical representations of DNA, which offer a simple and unique characterization of DNA sequences. The numerical representation of a DNA sequence is given as a sequence of real numbers derived from a unique graphical representation of the standard genetic code. There is no loss of information on the primary structure of a DNA sequence associated with this numerical representation. The novel representations are illustrated with the coding sequences of the first exon of beta-globin gene of half a dozen species in addition to human. The method can be extended to proteins as is exemplified by humanin, a 24-aa peptide that has recently been identified as a specific inhibitor of neuronal cell death induced by familial Alzheimer's disease mutant genes.

Type 2 diabetes mellitus: association study of five candidate genes in an Indian population of Guadeloupe, genetic contribution of FABP2 polymorphism.

PubMed

Boullu-Sanchis, S; Leprêtre, F; Hedelin, G; Donnet, J P; Schaffer, P; Froguel, P; Pinget, M

1999-06-01

We studied by PCR-RFLP 6 polymorphisms in these 5 candidate genes: Ala54Thr in the fatty acid binding protein 2 gene (FABP2), A to G substitution in the uncoupling protein type 1 gene (UCP1), Asp905Tyr in the protein phosphatase type 1 gene (PP1G), Trp64Arg in the human beta 3 adrenergic receptor gene (beta 3AR) and 2 RFLP sites of the vitamin D receptor (VDR) gene (VDRTaq1 and VDRApa1). This study was conducted among 89 cases and 100 controls matched according to age, gender and absence of first degree family link (11 triplets with 2 controls for 1 case and 78 pairs with 1 control for 1 case). Cases and controls were taken among a sample of 429 individuals selected for the study of the prevalence of diabetes in this ethnic group from Guadeloupe. By conditional logistic regression analysis, there was a significant relation (p = 0.02) between the Ala54Thr FABP2 polymorphism and Type 2 DM. Multivariate analysis discriminate the FABP2 polymorphism (p = 0.10), a triglyceridemia over 2 g/l (p < 10(-3)) and high blood pressure (p = 10(-2)) as variables associated with Type 2 DM in this population. These findings suggest that FABP2 does not represent a major gene for Type 2 DM in this migrant Indian population living in Guadeloupe, but seems to be related to the metabolic insulin resistance syndrome.

Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.

PubMed

Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun

α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.

Combining suppressive subtractive hybridization and cDNA microarrays to identify dietary phosphorus-responsive genes of the rainbow trout (Oncorhynchus mykiss) kidney.

PubMed

Lake, Jennifer; Gravel, Catherine; Koko, Gabriel Koffi D; Robert, Claude; Vandenberg, Grant W

2010-03-01

Phosphorus (P)-responsive genes and how they regulate renal adaptation to phosphorous-deficient diets in animals, including fish, are not well understood. RNA abundance profiling using cDNA microarrays is an efficient approach to study nutrient-gene interactions and identify these dietary P-responsive genes. To test the hypothesis that dietary P-responsive genes are differentially expressed in fish fed varying P levels, rainbow trout were fed a practical high-P diet (R20: 0.96% P) or a low-P diet (R0: 0.38% P) for 7 weeks. The differentially-expressed genes between dietary groups were identified and compared from the kidney by combining suppressive subtractive hybridization (SSH) with cDNA microarray analysis. A number of genes were confirmed by real-time PCR, and correlated with plasma and bone P concentrations. Approximately 54 genes were identified as potential dietary P-responsive after 7 weeks on a diet deficient in P according to cDNA microarray analysis. Of 18 selected genes, 13 genes were confirmed to be P-responsive at 7 weeks by real-time PCR analysis, including: iNOS, cytochrome b, cytochrome c oxidase subunit II , alpha-globin I, beta-globin, ATP synthase, hyperosmotic protein 21, COL1A3, Nkef, NDPK, glucose phosphate isomerase 1, Na+/H+ exchange protein and GDP dissociation inhibitor 2. Many of these dietary P-responsive genes responded in a moderate way (R0/R20 ratio: <2-3 or >0.5) and in a transient manner to dietary P limitation. In summary, renal adaptation to dietary P deficiency in trout involves changes in the expression of several genes, suggesting a profile of metabolic stress, since many of these differentially-expressed candidates are associated with the cellular adaptative responses. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.

Comparative inhibition of rabbit globin mRNA translation by modified antisense oligodeoxynucleotides.

PubMed Central

Cazenave, C; Stein, C A; Loreau, N; Thuong, N T; Neckers, L M; Subasinghe, C; Hélène, C; Cohen, J S; Toulmé, J J

1989-01-01

We have studied the translation of rabbit globin mRNA in cell free systems (reticulocyte lysate and wheat germ extract) and in microinjected Xenopus oocytes in the presence of anti-sense oligodeoxynucleotides. Results obtained with the unmodified all-oxygen compounds were compared with those obtained when phosphorothioate or alpha-DNA was used. In the wheat germ system a 17-mer sequence targeted to the coding region of beta-globin mRNA was specifically inhibitory when either the unmodified phosphodiester oligonucleotide or its phosphorothioate analogue were used. In contrast no effect was observed with the alpha-oligomer. These results were ascribed to the fact that phosphorothioate oligomers elicit an RNase-H activity comparable to the all-oxygen congeners, while alpha-DNA/mRNA hybrids were a poor substrate. Microinjected Xenopus oocytes followed a similar pattern. The phosphorothioate oligomer was more efficient to prevent translation than the unmodified 17-mer. Inhibition of beta-globin synthesis was observed in the nanomolar concentration range. This result can be ascribed to the nuclease resistance of phosphorothioates as compared to natural phosphodiester linkages, alpha-oligomers were devoid of any inhibitory effect up to 30 microM. Phosphorothioate oligodeoxyribonucleotides were shown to be non-specific inhibitors of protein translation, at concentrations in the micromolar range, in both cell-free systems and oocytes. Non-specific inhibition of translation was dependent on the length of the phosphorothioate oligomer. These non-specific effects were not observed with the unmodified or the alpha-oligonucleotides. Images PMID:2472605

Recent trends in the gene therapy of β-thalassemia

PubMed Central

Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto

2015-01-01

The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.

PubMed Central

Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W

1987-01-01

Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706

Association between alcoholism and the genetic polymorphisms of the GABAA receptor genes on chromosome 5q33-34 in Korean population.

PubMed

Park, Chul-Soo; Park, So-Young; Lee, Chul-Soon; Sohn, Jin-Wook; Hahn, Gyu-Hee; Kim, Bong-Jo

2006-06-01

Family, twin, and adoption studies have demonstrated that genes play an important role in the development of alcoholism. We investigated the association between alcoholism and the genetic polymorphisms of the GABAA receptor genes on chromosome 5q33-34 in Korean population. The genotype of the GABAA receptor gene polymorphisms were determined by performing polymerase chain reaction genotyping for 172 normal controls and 162 male alcoholics who are hospitalized in alcoholism treatment institute. We found a significant association between the genetic polymorphisms of the GABAA alpha1 and GABAA alpha6 receptor gene and alcoholism. The GG genotype of the GABAA alpha1 receptor gene was associated with the onset age of alcoholism and alcohol withdrawal symptoms, and a high score on the Korean version of the ADS. However, there was no association between the genetic polymorphisms of the GABAA beta2 and gamma2 receptor gene and alcoholisms. Our finding suggest that genetic polymorphisms of the GABAA alpha1 and GABAA alpha6 receptor gene may be associated with the development of alcoholism and that the GG genotype of the GABAA alpha1 receptor gene play an important role in the development of the early onset and the severe type of alcoholism.

Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis.

PubMed

Hallur, V; Sehgal, R; Khurana, S

2015-01-01

The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR) inhibitors thus, undermining the confidence of a laboratory physician. We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.

TGF-Beta Gene Polymorphisms in Food Allergic versus Non-Food Allergic Eosinophilic Esophagitis

DTIC Science & Technology

2012-10-01

successful EoE therapy in 60-98% of subjects. Indeed, th e majority of children with EoE have specific IgE to foods but they often continue to ingest...sensitized children with EoE and the TGFb1 genes. W e hypothesize that in EoE there is a gene polymorphism (TGFb1) environment (food) interaction that...esophageal stricture form ation is an im portant complication of remodeling in EoE (6-12% of children ; 33% of adults), identif ying genetic polym orphisms in

Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

PubMed

Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

2014-05-09

The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

[Influence of interleukin-1 beta gene polymorphism and childhood maltreatment on antidepressant treatment].

PubMed

Chen, Ying; Zhang, Zhijun; Xu, Zhi; Pu, Mengjia; Geng, Leiyu

2015-12-01

To explore the influence of interleukin-1 beta (IL1B) gene polymorphism and childhood maltreatment on antidepressant treatment. Two hundred and four patients with major depressive disorder (MDD) have received treatment with single antidepressant drugs and were followed up for 8 weeks. Hamilton depression scale-17 (HAMD-17) was used to evaluate the severity of depressive symptoms and therapeutic effect. Childhood maltreatment was assessed using Childhood Trauma Questionnaire, a 28-item Short Form (CTQ-SF). Single nucleotide polymorphism (SNP) of the IL1B gene was determined using a SNaPshot method. Correlation of rs16944 gene polymorphism with response to treatment was analyzed using Unphased 3.0.13 software. The main and interactive effects of SNP and childhood maltreatment on the antidepressant treatment were analyzed using Logistic regression analysis. No significant difference of gender, age, year of education, family history, episode time, and antidepressant agents was detected between the remitters and non-remitters. Association analysis has found that the SNP rs16944 in the IL1B AA genotype carriers antidepressant response was poorer (χ2=3.931, P=0.047). No significant difference was detected in the CTQ scores between the two groups. Genetic and environmental interaction analysis has demonstrated a significant correlation between rs16944 AA genotype and childhood maltreatment and poorer response to antidepressant treatment. The SNP rs16944 in the IL1B gene and its interaction with childhood maltreatment may influence the effect of antidepressant treatment for patients with MDD.

G-protein beta 3 subunit polymorphisms and essential hypertension: a case-control association study in northern Han Chinese

PubMed Central

Li, Mei; Zhang, Bei; Li, Chuang; Liu, Jie-Lin; Wang, Li-Juan; Liu, Ya; Wang, Zuo-Guang; Wen, Shao-Jun

2015-01-01

Objective To explore the association between the three polymorphisms [ C825T, C1429T and G(-350)A] of the gene encoding the G protein beta 3 subunit (GNB3) and hypertension by performing a case-control study in the northern Han Chinese population. Methods We recruited 731 hypertensive patients and 673 control subjects (the calculated power value was > 0.8). Genotyping was performed to identify C825T, C1429T and G(-350)A polymorphisms using the TaqMan assay. Comparisons of allelic and genotypic frequencies between cases and controls were made by using the chi-square test. Logistic regression analyses were performed to investigate the relationships between the three polymorphisms of GNB3 gene under different genetic models (additive, dominant and recessive models). Results The genotype distribution and allele frequencies of C825T, C1429T and G(-350)A polymorphisms did not differ significantly between hypertensive patients and control subjects, either when the full sample was assessed, or when the sample was stratified by gender. No significant association was observed between C825T, C1429T and G(-350)A polymorphisms and the risk of essential hypertension in any genetic model. Linkage disequilibrium was only detected between C825T and C1429T polymorphisms. Haplotype analyses observed that none of the three estimated haplotypes significantly increased the risk of hypertension. Conclusions Our study suggested that the GNB3 gene polymorphisms [C825T, C1429T and G(-350)A] were not significantly associated with essential hypertension in northern Han Chinese population. PMID:25870615

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

PubMed

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

IVS-II-648/649 (-T) (HBB: c.316-202del) Triggers a Novel β-Thalassemia Phenotype.

PubMed

Azimi, Azam; Alibakhshi, Reza; Hayati, Hasibeh; Tahmasebi, Soosan; Alimoradi, Sasan

2017-01-01

Thalassemia is the most common inherited disorder in Iran. There are approximately 800 different genomic alterations of the β-globin gene described in the HbVar database. In this study, we identified a novel mutation in a 21-year-old woman [IVS-II-648/649 (-T); HBB: c.316-202del)] and describe its clinical implications. Two other members of this family, all with hematological and clinical features associated with β-thalassemia (β-thal), also carried this mutation. The molecular diagnosis of the β-globin gene mutation was performed by direct sequencing. Based on the observed β-thal phenotype and in silico analysis results, we concluded that this novel β-globin gene mutation was associated with the mild phenotype of β-thal.

β-Thalassemia.

PubMed

Origa, Raffaella

2017-06-01

β-Thalassemia is caused by reduced (β + ) or absent (β 0 ) synthesis of the β-globin chains of hemoglobin. Three clinical and hematological conditions of increasing severity are recognized: the β-thalassemia carrier state, thalassemia intermedia, and thalassemia major, a severe transfusion-dependent anemia. The severity of disease expression is related mainly to the degree of α-globin chain excess, which precipitates in the red blood cell precursors, causing both mechanic and oxidative damage (ineffective erythropoiesis). Any mechanism that reduces the number of unbound α-globin chains in the red cells may ameliorate the detrimental effects of excess α-globin chains. Factors include the inheritance of mild/silent β-thalassemia mutations, the coinheritance of α-thalassemia alleles, and increased γ-globin chain production. The clinical severity of β-thalassemia syndromes is also influenced by genetic factors unlinked to globin genes as well as environmental conditions and management. Transfusions and oral iron chelation therapy have dramatically improved the quality of life for patients with thalassemia major. Previously a rapidly fatal disease in early childhood, β-thalassemia is now a chronic disease with a greater life expectancy. At present, the only definitive cure is bone marrow transplantation. Therapies undergoing investigation are modulators of erythropoiesis and stem cell gene therapy.Genet Med advance online publication 03 November 2016.

Association of polymorphisms in nicotinic acetylcholine receptor alpha 4 subunit gene (CHRNA4), mu-opioid receptor gene (OPRM1), and ethanol-metabolizing enzyme genes with alcoholism in Korean patients.

PubMed

Kim, Soon Ae; Kim, Jong-Woo; Song, Ji-Young; Park, Sunny; Lee, Hee Jae; Chung, Joo-Ho

2004-01-01

Findings obtained from several studies indicate that ethanol enhances the activity of alpha4beta2 neuronal nicotinic acetylcholine receptor and support the possibility that a polymorphism of the nicotinic acetylcholine receptor alpha4 subunit gene (CHRNA4) modulates enhancement of nicotinic receptor function by ethanol. To identify the association between the CfoI polymorphism of the CHRNA4 and alcoholism, we examined distribution of genotypes and allele frequencies in Korean patients diagnosed with alcoholism (n = 127) and Korean control subjects without alcoholism (n = 185) with polymerase chain reaction-restriction fragment length polymorphism methods. We were able to detect the association between the CfoI polymorphism of the CHRNA4 and alcoholism in Korean patients (genotype P = .023; allele frequency P = .047). The genotypes and allele frequencies of known polymorphisms in other alcoholism candidate genes, such as alcohol metabolism-related genes [alcohol dehydrogenase 2 (ADH2), aldehyde dehydrogenase 2 (ALDH2), alcohol dehydrogenase 3 (ADH3), and cytochrome P450 2E1 (CYP2E1)] and mu-opioid receptor gene (OPRM1), were studied. The polymorphisms of ADH2, ALDH2, and CYP2E1 were significantly different in Korean patients with alcoholism and Korean control subjects without alcoholism, but ADH3 and OPRM1 did not differ between the two groups.

Genetics Home Reference: methemoglobinemia, beta-globin type

MedlinePlus

... American Society of Hematology Resource List from the University of Kansas Medical Center: ... Melarkode K, Prinzhausen H. Hemoglobin M variant and congenital methemoglobinemia: methylene blue will not be effective in the presence of hemoglobin M. Can J ...

The Molecular Epidemiology of Malaria in Western Kenya

DTIC Science & Technology

2002-09-01

including tumor necrosis factor alpha (TNF- α), interleukin-10 (IL-10), transforming growth factor beta (TGF-β), interleukin-6 (IL-6), and interferon gamma...Ricard S, Troesch A, Mallet C, Generenaz L, Evans A, Arveiler D, Luc G, Ruidavets JB, Poirier O. Polymorphisms of the transforming growth factor- beta 1...transforming growth factor- beta 1 and tumour necrosis factor-alpha genes: a technical report. Transpl Immunol 1998 6(3): 193-7. 36. Olomolaiye OO

Psoriasis is associated with increased beta-defensin genomic copy number

PubMed Central

Hollox, Edward J.; Huffmeier, Ulrike; Zeeuwen, Patrick L.J.M.; Palla, Raquel; Lascorz, Jesús; Rodijk-Olthuis, Diana; van de Kerkhof, Peter C.M.; Traupe, Heiko; de Jongh, Gys; den Heijer, Martin; Reis, André; Armour, John A.L.; Schalkwijk, Joost

2008-01-01

Psoriasis is a common inflammatory skin disease with a strong genetic component. We have analysed the genomic copy number polymorphism of the beta-defensin region on human chromosome 8 in 179 Dutch psoriasis patients and 272 controls, and in 319 German psoriasis patients and 305 controls. Comparisons in both cohorts show a significant association between higher genomic copy number for beta-defensin genes and the risk of psoriasis. PMID:18059266

Association of a beta-2 adrenoceptor (ADRB2) gene variant with a blunted in vivo lipolysis and fat oxidation.

PubMed

Jocken, J W E; Blaak, E E; Schiffelers, S; Arner, P; van Baak, M A; Saris, W H M

2007-05-01

Obesity is associated with a blunted beta-adrenoceptor-mediated lipolysis and fat oxidation. We investigated whether polymorphisms in codon 16, 27 and 164 of the beta (2)-adrenoceptor gene (ADRB2) and exon 10 of the G protein beta (3)-subunit gene (GNB3) are associated with alterations in in vivo lipolysis and fat oxidation. Sixty-five male and 43 female overweight and obese subjects (body mass index (BMI) range: 26.1-48.4 kg/m(2)) were included. Energy expenditure (EE), respiratory quotient (RQ), circulating free fatty acid (FFA) and glycerol levels were determined after stepwise infusion of increasing doses of the non-selective beta-agonist isoprenaline (ISO). In women, the Arg16 allele of the ADRB2 gene was associated with a blunted increase in circulating FFA, glycerol and a decreased fat oxidation during ISO stimulation. In men, the Arg16 allele was significantly associated with a blunted increase in FFA but not in glycerol or fat oxidation. These results suggest that genetic variation in the ADRB2 gene is associated with disturbances in in vivo beta-adrenoceptor-mediated lipolysis and fat oxidation during beta-adrenergic stimulation in overweight and obese subjects; these effects are influenced by gene-gender interactions.

TGF{beta}1 polymorphisms and late clinical radiosensitivity in patients treated for gynecologic tumors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ruyck, Kim de; Van Eijkeren, Marc; Claes, Kathleen

2006-07-15

Purpose: To investigate the association between six transforming growth factor {beta}1 gene (TGF{beta}1) polymorphisms (-1.552delAGG, -800G>A, -509C>T, Leu10Pro, Arg25Pro, Thr263Ile) and the occurrence of late normal tissue reactions after gynecologic radiotherapy (RT). Methods and Materials: Seventy-eight women with cervical or endometrial cancer and 140 control individuals were included in the study. According to the Common Terminology Criteria for Adverse Events version 3.0 (CTCAEv3.0) scale, 25 patients showed late adverse RT reactions (CTC2+), of whom 11 had severe complications (CTC3+). Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), single base extension and genotyping assays were performed to examine the polymorphic sites inmore » TGF{beta}1. Results: Homozygous variant -1.552delAGG, -509TT, and 10Pro genotypes were associated with the risk of developing late severe RT reactions. Triple (variant) homozygous patients had a 3.6 times increased risk to develop severe RT reactions (p = 0.26). Neither the -800A allele, nor the 25Pro allele or the 263Ile allele were associated with clinical radiosensitivity. There was perfect linkage disequilibrium (LD) between the -1.552delAGG and the -509C>T polymorphisms, and tight LD between the -1.552/-509 and the Leu10Pro polymorphisms. Haplotype analysis revealed two major haplotypes but could not distinguish radiosensitive from nonradiosensitive patients. Conclusions: The present study shows that homozygous variant TGF{beta}1 -1.552delAGG, -509TT, and 10Pro genotypes may be associated with severe clinical radiosensitivity after gynecologic RT.« less

The effect of histone deacetylase inhibitors on AHSP expression

PubMed Central

Ziari, Katayoun; Ranjbaran, Reza; Nikouyan, Negin

2018-01-01

Alpha-hemoglobin stabilizing protein (AHSP) is a molecular chaperone that can reduce the damage caused by excess free α-globin to erythroid cells in patients with impaired β-globin chain synthesis. We assessed the effect of sodium phenylbutyrate and sodium valproate, two histone deacetylase inhibitors (HDIs) that are being studied for the treatment of hemoglobinopathies, on the expression of AHSP, BCL11A (all isoforms), γ-globin genes (HBG1/2), and some related transcription factors including GATA1, NFE2, EKLF, KLF4, and STAT3. For this purpose, the K562 cell line was cultured for 2, 4, and 6 days in the presence and absence of sodium phenylbutyrate and sodium valproate. Relative real-time qRT-PCR analysis of mRNA levels was performed to determine the effects of the two compounds on gene expression. Expression of all target mRNAs increased significantly (p < 0.05), except for the expression of BCL11A, which was down-regulated (p < 0.05) in the cells treated with both compounds relative to the levels measured for untreated cells. The findings indicated that sodium valproate had a more considerable effect than sodium phenylbutyrate (p < 0.0005) on BCL11A repression and the up-regulation of other studied genes. γ-Globin and AHSP gene expression continuously increased during the culture period in the treated cells, with the highest gene expression observed for 1 mM sodium valproate after 6 days. Both compounds repressed the expression of BCL11A (-XL, -L, -S) and up-regulated GATA1, NFE2, EKLF, KLF4, STAT3, AHSP, and γ-globin genes expression. Moreover, sodium valproate showed a stronger effect on repressing BCL11A and escalating the expression of other target genes. The findings of this in vitro experiment could be considered in selecting drugs for clinical use in patients with β-hemoglobinopathies. PMID:29389946

A Comprehensive, Ethnically Diverse Library of Sickle Cell Disease-Specific Induced Pluripotent Stem Cells.

PubMed

Park, Seonmi; Gianotti-Sommer, Andreia; Molina-Estevez, Francisco Javier; Vanuytsel, Kim; Skvir, Nick; Leung, Amy; Rozelle, Sarah S; Shaikho, Elmutaz Mohammed; Weir, Isabelle; Jiang, Zhihua; Luo, Hong-Yuan; Chui, David H K; Figueiredo, Maria Stella; Alsultan, Abdulraham; Al-Ali, Amein; Sebastiani, Paola; Steinberg, Martin H; Mostoslavsky, Gustavo; Murphy, George J

2017-04-11

Sickle cell anemia affects millions of people worldwide and is an emerging global health burden. As part of a large NIH-funded NextGen Consortium, we generated a diverse, comprehensive, and fully characterized library of sickle-cell-disease-specific induced pluripotent stem cells (iPSCs) from patients of different ethnicities, β-globin gene (HBB) haplotypes, and fetal hemoglobin (HbF) levels. iPSCs stand to revolutionize the way we study human development, model disease, and perhaps eventually, treat patients. Here, we describe this unique resource for the study of sickle cell disease, including novel haplotype-specific polymorphisms that affect disease severity, as well as for the development of patient-specific therapeutics for this phenotypically diverse disorder. As a complement to this library, and as proof of principle for future cell- and gene-based therapies, we also designed and employed CRISPR/Cas gene editing tools to correct the sickle hemoglobin (HbS) mutation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Gene expression profiling of whole blood: Comparison of target preparation methods for accurate and reproducible microarray analysis

PubMed Central

Vartanian, Kristina; Slottke, Rachel; Johnstone, Timothy; Casale, Amanda; Planck, Stephen R; Choi, Dongseok; Smith, Justine R; Rosenbaum, James T; Harrington, Christina A

2009-01-01

Background Peripheral blood is an accessible and informative source of transcriptomal information for many human disease and pharmacogenomic studies. While there can be significant advantages to analyzing RNA isolated from whole blood, particularly in clinical studies, the preparation of samples for microarray analysis is complicated by the need to minimize artifacts associated with highly abundant globin RNA transcripts. The impact of globin RNA transcripts on expression profiling data can potentially be reduced by using RNA preparation and labeling methods that remove or block globin RNA during the microarray assay. We compared four different methods for preparing microarray hybridization targets from human whole blood collected in PAXGene tubes. Three of the methods utilized the Affymetrix one-cycle cDNA synthesis/in vitro transcription protocol but varied treatment of input RNA as follows: i. no treatment; ii. treatment with GLOBINclear; or iii. treatment with globin PNA oligos. In the fourth method cDNA targets were prepared with the Ovation amplification and labeling system. Results We find that microarray targets generated with labeling methods that reduce globin mRNA levels or minimize the impact of globin transcripts during hybridization detect more transcripts in the microarray assay compared with the standard Affymetrix method. Comparison of microarray results with quantitative PCR analysis of a panel of genes from the NF-kappa B pathway shows good correlation of transcript measurements produced with all four target preparation methods, although method-specific differences in overall correlation were observed. The impact of freezing blood collected in PAXGene tubes on data reproducibility was also examined. Expression profiles show little or no difference when RNA is extracted from either fresh or frozen blood samples. Conclusion RNA preparation and labeling methods designed to reduce the impact of globin mRNA transcripts can significantly improve the sensitivity of the DNA microarray expression profiling assay for whole blood samples. While blockage of globin transcripts during first strand cDNA synthesis with globin PNAs resulted in the best overall performance in this study, we conclude that selection of a protocol for expression profiling studies in blood should depend on several factors, including implementation requirements of the method and study design. RNA isolated from either freshly collected or frozen blood samples stored in PAXGene tubes can be used without altering gene expression profiles. PMID:19123946

Convergent evolution of hemoglobin switching in jawed and jawless vertebrates.

PubMed

Rohlfing, Kim; Stuhlmann, Friederike; Docker, Margaret F; Burmester, Thorsten

2016-02-01

During development, humans and other jawed vertebrates (Gnathostomata) express distinct hemoglobin genes, resulting in different hemoglobin tetramers. Embryonic and fetal hemoglobin have higher oxygen affinities than the adult hemoglobin, sustaining the oxygen demand of the developing organism. Little is known about the expression of hemoglobins during development of jawless vertebrates (Agnatha). We identified three hemoglobin switches in the life cycle of the sea lamprey. Three hemoglobin genes are specifically expressed in the embryo, four genes in the filter feeding larva (ammocoete), and nine genes correspond to the adult hemoglobin chains. During the development from the parasitic to the reproductive adult, the composition of hemoglobin changes again, with a massive increase of chain aHb1. A single hemoglobin chain is expressed constitutively in all stages. We further showed the differential expression of other globin genes: Myoglobin 1 is most highly expressed in the reproductive adult, myoglobin 2 expression peaks in the larva. Globin X1 is restricted to the embryo; globin X2 was only found in the reproductive adult. Cytoglobin is expressed at low levels throughout the life cycle. Because the hemoglobins of jawed and jawless vertebrates evolved independently from a common globin ancestor, hemoglobin switching must also have evolved convergently in these taxa. Notably, the ontogeny of sea lamprey hemoglobins essentially recapitulates their phylogeny, with the embryonic hemoglobins emerging first, followed by the evolution of larval and adult hemoglobins.

Haemoglobin Fontainebleau (HBA2: c. 64G>C) in Oman: molecular and haematological characteristics and interaction with various haemoglobinopathies.

PubMed

Daar, Shahina; Al Zadjali, Shoaib; Alkindi, Salam; Wali, Yasser; Al-Rawas, Abdulhakeem; Al-Haddabi, Humood; Al-Riyami, Arwa Z

2018-04-01

To describe the laboratory features of haemoglobin Fontainebleau (Hb FB) and its interactions with various α and β globin gene mutations in the Omani population. Over a period of 10 years, a total of 94 blood samples were suspected to have an α variant on HPLC at the Sultan Qaboos University Hospital, Muscat, Oman. Molecular testing was performed using PCR based techniques to define the variant and to analyse other interacting mutations in either α or β globin genes. Of 94 subjects, molecular analysis confirmed the Hb FB variant in 55 samples (38 non-cord and 17 cord blood). A total of 36/38 non-cord samples were heterozygous for the variant, while all 17 cord blood samples were heterozygotes. A total of 43/55 individuals had a concomitant α and/or β globin gene mutation. Hb FB is the the most common α variant in the Omani population. We report the different HPLC profiles of this variant that we observed, with and without other haemoglobinopathies in non-cord and cord blood samples. This is the first report describing the HPLC profiles of this α globin chain variant on 1 year follow-up testing of cord blood samples. With careful analysis by HPLC, it is possible not only to identify Hb FB but also to predict any concomitant α and/or β globin gene mutations. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Blunted beta-adrenoceptor-mediated fat oxidation in overweight subjects: a role for the hormone-sensitive lipase gene.

PubMed

Jocken, Johan W E; Blaak, Ellen E; van der Kallen, Carla J H; van Baak, Marleen A; Saris, Wim H M

2008-03-01

Obesity is associated with blunted beta-adrenoceptor-mediated lipolysis and fat oxidation, which persist after weight reduction. We investigated whether dinucleotide (CA)(n) repeat polymorphisms in intron 6 (i6) or 7 (i7) and a C-60G promoter substitution of the hormone-sensitive lipase (HSL) gene are associated with a blunted in vivo beta-adrenoceptor-mediated increase in circulating fatty acids and glycerol (estimation of lipolytic response) and fat oxidation in overweight-obese subjects. A total of 103 overweight (25 kg/m(2) < or = body mass index < 30 kg/m(2)) and obese (body mass index > or =30 kg/m(2)) subjects (62 men, 41 women) were included. Energy expenditure, respiratory quotient (RQ), and circulating fatty acid and glycerol were determined after stepwise infusion of increasing doses of the nonselective beta-agonist isoprenaline. The i6, i7 (CA)(n) repeat polymorphisms were determined by size-resolved capillary electrophoresis; and a C-60G promoter substitution was determined by restriction enzyme digestion assay. Female noncarriers of allele 184 i7 (n = 18) and female carriers of allele 240 i6 (n = 12) showed an overall reduced fat oxidation (as indicated by changes in RQ) after beta-adrenoceptor-mediated stimulation, explaining, respectively, 6.9% and 20.8% of the variance in RQ. These effects were not seen in male subjects. In conclusion, our results suggest that variation in i7 and i6 of the HSL gene might be associated with a physiological effect on in vivo beta-adrenoceptor-mediated fat oxidation, at least in overweight-obese female subjects.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Epstein, N.; Than, K.A. Culp, K.M.

Alpha-thalassemia (alpha-thal) is characterized by the absence or reduction in synthesis of the alpha-globin chain due to either deletions or other abnormalities involving the alpha-globin genes located on the short arm of chromosome 16. The diploid cells have four alpha chain genes. The deletion of one, two, three or all four of these genes could result in mild to a complete alpha chain deficiency known as the Hydrops fetalis syndrome or alpha-thal-1, which causes fetal death. It is important to develop a sensitive test to detect carriers of alpha-thal-1 trait for genetic counseling. It has recently been observed that themore » presence of minute amounts of zeta-globin chains (0.01-1%) could serve as a biological marker of alpha-thal carriers. Because high sensitivity is required, we constructed a monoclonal antibody-based immunoassay which can be analyzed either by colorimetric or fluorimetric methods. By testing blood samples from individuals of Southeast Asian ancestry, we were able to show that various forms and combinations of deletions or inactivations of two or three alpha-globin genes results in alpha-thalassemia conditions that have elevated levels of the zeta-chain. Sensitivity achieved in these tests was < 0.1% zeta chain, or as low as 5 ng zeta-chain. Data correlate with results from reversed phase HPLC.« less

DNA variation in the genes of the Na,K-adenosine triphosphatase and its relation with resting metabolic rate, respiratory quotient, and body fat.

PubMed

Dériaz, O; Dionne, F; Pérusse, L; Tremblay, A; Vohl, M C; Côté, G; Bouchard, C

1994-02-01

The aim of this study was to investigate in 261 subjects from 58 families the association between DNA variation at the genes coding for the Na,K-ATPase peptides and resting metabolic rate (RMR), respiratory quotient (RQ), and percent body fat (%FAT). Five restriction fragment length polymorphisms (RFLP) at three Na,K-ATPase genes were determined: one at the alpha 1 locus (BglII), and two at the beta locus (beta MspI and beta PvuII). Haplotypes were determined from the two variable sites of the alpha 2 gene (alpha 2 haplotypes) and the beta gene (beta haplotypes). There was a strong trend for %FAT to be related to the RFLP generated by BglII at the alpha 2 exons 21-22 in males (P = 0.06) and females (P = 0.05). RQ was (a) associated with the BglII RFLP at the alpha 2 exon 1 (P = 0.02) and with the alpha 2 8.0 kb/4.3 kb haplotype (P = 0.04) and (b) linked with the beta gene MspI marker (P = 0.04) and with the beta 5.3 kb/5.1 kb haplotype (P = 0.008) based on sib-pair analysis. The present study suggests that the genes encoding Na,K-ATPase may be associated or linked with RQ and perhaps with %FAT but not with RMR.

Subunit assembly of hemoglobin: an important determinant of hematologic phenotype.

PubMed

Bunn, H F

1987-01-01

Hemoglobin's physiologic properties depend on the orderly assembly of its subunits in erythropoietic cells. The biosynthesis of alpha- and beta-globin polypeptide chains is normally balanced. Heme rapidly binds to the globin subunit, either during translation or shortly thereafter. The formation of the alpha beta-dimer is facilitated by electrostatic attraction of a positively charged alpha-subunit to a negatively charged beta-subunit. The alpha beta-dimer dissociates extremely slowly. The difference between the rate of dissociation of alpha beta- and alpha gamma-dimers with increasing pH explains the well-known alkaline resistance of Hb F. Two dimers combine to form the functioning alpha 2 beta 2-tetramer. This model of hemoglobin assembly explains the different levels of positively charged and negatively charged mutant hemoglobins that are encountered in heterozygotes and the effect of alpha-thalassemia and heme deficiency states in modifying the level of the variant hemoglobin as well as Hb A2. Electrostatic interactions also affect the binding of hemoglobin to the cytoplasmic surface of the red cell membrane and may underlie the formation of target cells. Enhanced binding of positively charged variants such as S and C trigger a normally dormant pathway for potassium and water loss. Thus, the positive charge on beta c is responsible for the two major contributors to the pathogenesis of Hb SC disease: increased proportion of Hb S and increased intracellular hemoglobin concentration. It is likely that electrostatic interactions play an important role in the assembly of a number of other multisubunit macromolecules, including membrane receptors, cytoskeletal proteins, and DNA binding proteins.

Association study of IL10, IL1beta, and IL1RN and schizophrenia using tag SNPs from a comprehensive database: suggestive association with rs16944 at IL1beta.

PubMed

Shirts, Brian H; Wood, Joel; Yolken, Robert H; Nimgaonkar, Vishwajit L

2006-12-01

Genetic association studies of several candidate cytokine genes have been motivated by evidence of immune dysfunction among patients with schizophrenia. Intriguing but inconsistent associations have been reported with polymorphisms of three positional candidate genes, namely IL1beta, IL1RN, and IL10. We used comprehensive sequencing data from the Seattle SNPs database to select tag SNPs that represent all common polymorphisms in the Caucasian population at these loci. Associations with 28 tag SNPs were evaluated in 478 cases and 501 unscreened control individuals, while accounting for population sub-structure using the genomic control method. The samples were also stratified by gender, diagnostic category, and exposure to infectious agents. Significant association was not detected after correcting for multiple comparisons. However, meta-analysis of our data combined with previously published association studies of rs16944 (IL1beta -511) suggests that the C allele confers modest risk for schizophrenia among individuals reporting Caucasian ancestry, but not Asians (Caucasians, n=819 cases, 1292 controls; p=0.0013, OR=1.24, 95% CI 1.09, 1.41).

Trp64Arg Polymorphism in Beta3-Adrenergic Receptor Gene Is Associated with Decreased Fat Oxidation Both in Resting and Aerobic Exercise in the Japanese Male

PubMed Central

Morita, Emiko; Taniguchi, Hiroshi; Sakaue, Motoyoshi

2009-01-01

The purpose of our study was to investigate whether the Trp64Arg polymorphism in β3-AR gene and the −3826A/G polymorphism in the UCP1 gene were associated with the reduction in energy expenditure and fat oxidation both in resting and aerobic exercise in Japanese. Eighty-six nonobese young healthy Japanese were recruited. Energy expenditure was measured using indirect calorimetry. The subjects performed an aerobic exercise program at 60% of their maximal heart rate for 30 minutes. The level of fat oxidation at rest and aerobic exercise of the male subjects with Trp/Arg of the β3-AR gene was significantly lower than that of the Trp/Trp genotype. No difference in FO0−30 was observed in the female subjects. There was no association between UCP-1 polymorphism and energy expenditure during aerobic exercise. It was revealed that the Trp64Arg polymorphism in β3-AR gene is associated with reduction of fat oxidation both in resting and aerobic exercise in healthy, young Japanese males. PMID:20069060

Inflammatory bowel disease: the role of inflammatory cytokine gene polymorphisms.

PubMed Central

Balding, Joanna; Livingstone, Wendy J; Conroy, Judith; Mynett-Johnson, Lesley; Weir, Donald G; Mahmud, Nasir; Smith, Owen P

2004-01-01

The mechanisms responsible for development of inflammatory bowel disease (IBD) have not been fully elucidated, although the main cause of disease pathology is attributed to up-regulated inflammatory processes. The aim of this study was to investigate frequencies of polymorphisms in genes encoding pro-inflammatory and anti-inflammatory markers in IBD patients and controls. We determined genotypes of patients with IBD (n= 172) and healthy controls (n= 389) for polymorphisms in genes encoding various cytokines (interleukin (IL)-1beta, IL-6, tumour necrosis factor (TNF), IL-10, IL-1 receptor antagonist). Association of these genotypes to disease incidence and pathophysiology was investigated. No strong association was found with occurrence of IBD. Variation was observed between the ulcerative colitis study group and the control population for the TNF-alpha-308 polymorphism (p= 0.0135). There was also variation in the frequency of IL-6-174 and TNF-alpha-308 genotypes in the ulcerative colitis group compared with the Crohn's disease group (p= 0.01). We concluded that polymorphisms in inflammatory genes are associated with variations in IBD phenotype and disease susceptibility. Whether the polymorphisms are directly involved in regulating cytokine production, and consequently pathophysiology of IBD, or serve merely as markers in linkage disequilibrium with susceptibility genes remains unclear. PMID:15223609

Identification of Mutations Causing Aberrant Termination and Deficient Splice Donor Site on the HBA1 Gene.

PubMed

Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Forouzesh Pour, Fatemeh; Zeinali, Fatemeh; Rad, Fariba; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2016-01-01

α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects on the α-globin gene cluster can result in α-thal that may develop a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. In the present study, four Iranian individuals with hypochromic microcytic anemia, who revealed none of the known mutations responsible for α-thal, were subjected for further investigations. The thalassemic phenotype of these patients resulted from abnormal RNA splicing sites owing to a missense at the splice donor site, a truncated protein or hemoglobin (Hb) variants as a result of two different substitutions on the α1-globin gene. The clinical presentation of mild anemia in these individuals showed the contribution of these novel mutations in α-thal in spite of the dominantly expressed α2-globin gene. This study describes hematological manifestations of subjects carrying some novel mutations comparable to the reported phenotype of α(+)-thal trait.

Specific BACE1 genotypes provide additional risk for late-onset Alzheimer disease in APOE epsilon 4 carriers.

PubMed

Gold, Gabriel; Blouin, Jean-Louis; Herrmann, François R; Michon, Agnès; Mulligan, Reinhild; Duriaux Saïl, Geneviève; Bouras, Constantin; Giannakopoulos, Panteleimon; Antonarakis, Stylianos E

2003-05-15

Alzheimer disease (AD) is characterized neuropathologically by neurofibrillary tangles and senile plaques. A key component of plaques is A beta, a polypeptide derived from A beta-precursor protein (APP) through proteolytic cleavage catalyzed by beta and gamma-secretase. We hypothesized that sequence variation in genes BACE1 (on chromosome 11q23.3) and BACE2 (on chromosome 21q22.3), which encode two closely related proteases that seem to act as the APP beta-secretase, may represent a genetic risk factor for AD. We analyzed the frequencies of single nucleotide polymorphisms (SNPs) in BACE1 and BACE2 genes in a community-based sample of 96 individuals with late-onset AD and 170 controls selected randomly among residents of the same community. The genotype data in both study groups did not demonstrate any association between AD and BACE1 or BACE2. After stratification for APOE status, however, an association between a BACE1 polymorphism located within codon V262 and AD in APOE epsilon 4 carriers was observed (P = 0.03). We conclude that sequence variation in the BACE1 or BACE 2 gene is not a significant risk factor for AD; however, a combination of a specific BACE1 allele and APOE epsilon 4 may increase the risk for Alzheimer disease over and above that attributed to APOE epsilon 4 alone. Copyright 2003 Wiley-Liss, Inc.

Homozygosity for the AATAAA > AATA- - Polyadenylation Site Mutation on the α2-Globin Gene Causing Transfusion-Dependent Hb H Disease in an Iranian Patient: A Case Report.

PubMed

Farashi, Samaneh; Garous, Negin F; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemeh; Imanian, Hashem; Azarkeivan, Azita; Giordano, Piero C; Najmabadi, Hossein

2015-01-01

We describe a case of Hb H disease associated with homozygosity for a two nucleotide deletion in the polyadenylation signal of the α2-globin gene (HBA2: c.*93_*94delAA). The patient, a 27-year-old son of a consanguineous couple, needs regular blood transfusions every 6 months.

Removal of inhibitor(s) of the polymerase chain reaction from formalin fixed, paraffin wax embedded tissues.

PubMed

An, S F; Fleming, K A

1991-11-01

A problem associated with use of the polymerase chain reaction to amplify specific DNA fragments from formalin fixed, paraffin wax embedded tissues is the not infrequent failure of amplification. One possible reason for this could be the presence of inhibitor(s), which interfere with the activity of the reaction. It has been shown that such inhibitor(s) exist when amplifying the human beta globin gene (which exists in human genomic DNA as a single copy gene) from routine clinical samples. A variety of methods to remove such inhibitor(s) were investigated. The results indicate that inhibitor(s) are removed by proteinase K digestion, followed by purification with phenol/chloroform, and centrifugation through a Centricon-30 membrane (30,000 molecular weight cut off). Other factors, including the length and concentration of the DNA sequence to be amplified, can also affect amplification.

The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

PubMed

Case, S S; Huber, P; Lloyd, J A

1999-11-01

A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

Insulators to improve expression of a 3(')IgH LCR-driven reporter gene in transgenic mouse models.

PubMed

Guglielmi, Laurence; Le Bert, Marc; Truffinet, Véronique; Cogné, Michel; Denizot, Yves

2003-08-01

A locus control region (LCR) containing four transcriptional enhancers lies downstream of the IgH chain locus. We studied transgenes carrying a 3(')IgH LCR-driven GFP reporter gene for expression and B cell differentiation stage specificity. We also compared transgenes that were or were not flanked by two copies of the beta-globin HS4 insulator, an element defined by its ability to protect transgenes from the influences of surrounding genes at the insertion site. Results indicate that insulators are instrumental in sustaining GFP expression in GFP-3(')LCR transgenic mice when they were included. Flow cytometry experiments reported a strictly B cell specific GFP expression from pre-B cells in bone marrow to mature B cells in spleen. Despite addition of 5(')HS4 insulators to the GFP-3(')LCR construct, complete transgene silencing occurred in some transgenic lines and was systematically observed in ageing animals from all lines.

Association study of schizophrenia and IL-2 receptor {beta} chain gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nimgaonkar, V.L.; Yang, Z.W.; Zhang, X.R.

1995-10-09

A case-control association study was conducted in Caucasian patients with schizophrenia (DSM-III-R, n = 42) and unaffected controls (n = 47) matched for ethnicity and area of residence. Serum interleukin-2 receptor (IL-2R) concentrations, as well as a dinucleotide repeat polymorphism in the IL-2RP chain gene, were examined in both groups. No significant differences in IL-2R concentrations or in the distribution of the polymorphism were noted. This study does not support an association between schizophrenia and the IL-2RP gene locus, contrary to the suggestive evidence from linkage analysis in multicase families. 17 refs., 2 tabs.

A Phylogenetic Analysis of the Globins in Fungi

PubMed Central

Hoogewijs, David; Dewilde, Sylvia; Vierstraete, Andy; Moens, Luc; Vinogradov, Serge N.

2012-01-01

Background All globins belong to one of three families: the F (flavohemoglobin) and S (sensor) families that exhibit the canonical 3/3 α-helical fold, and the T (truncated 3/3 fold) globins characterized by a shortened 2/2 α-helical fold. All eukaryote 3/3 hemoglobins are related to the bacterial single domain F globins. It is known that Fungi contain flavohemoglobins and single domain S globins. Our aims are to provide a census of fungal globins and to examine their relationships to bacterial globins. Results Examination of 165 genomes revealed that globins are present in >90% of Ascomycota and ∼60% of Basidiomycota genomes. The S globins occur in Blastocladiomycota and Chytridiomycota in addition to the phyla that have FHbs. Unexpectedly, group 1 T globins were found in one Blastocladiomycota and one Chytridiomycota genome. Phylogenetic analyses were carried out on the fungal globins, alone and aligned with representative bacterial globins. The Saccharomycetes and Sordariomycetes with two FHbs form two widely divergent clusters separated by the remaining fungal sequences. One of the Saccharomycete groups represents a new subfamily of FHbs, comprising a previously unknown N-terminal and a FHb missing the C-terminal moiety of its reductase domain. The two Saccharomycete groups also form two clusters in the presence of bacterial FHbs; the surrounding bacterial sequences are dominated by Proteobacteria and Bacilli (Firmicutes). The remaining fungal FHbs cluster with Proteobacteria and Actinobacteria. The Sgbs cluster separately from their bacterial counterparts, except for the intercalation of two Planctomycetes and a Proteobacterium between the Fungi incertae sedis and the Blastocladiomycota and Chytridiomycota. Conclusion Our results are compatible with a model of globin evolution put forward earlier, which proposed that eukaryote F, S and T globins originated via horizontal gene transfer of their bacterial counterparts to the eukaryote ancestor, resulting from the endosymbiotic events responsible for the origin of mitochondria and chloroplasts. PMID:22384087

Variability of esterase patterns in adult flies of the saltans species group of Drosophila (subgenus Sophophora).

PubMed

Bernardo, Alessandra Augusta; Bicudo, Hermione Elly Melara de Campos

2009-09-01

Esterases are known for their involvement in several physiological processes and high degree of polymorphism, in many organisms. Such polymorphism has been used to characterize species and species groups and to study genetic changes occurred in their evolutionary history. In the present study, the esterase patterns of 19 strains from 10 species representative of the five subgroups of the saltans species group were analyzed using polyacrylamide gel electrophoresis and alpha- and beta- naphthyl acetates as substrates. Fifty-one esterase bands were detected and classified as 31 alpha-esterases, 18 beta-esterases and two alpha/beta-esterases. On the basis of the inhibition patterns using Malathion and eserine sulfate, 34 bands were classified as carboxylesterases, 14 as acethylesterases and three as cholinesterases. Ten gene loci were tentatively established on the basis of data on band position in the gel, substrate preference and inhibition pattern. Twenty bands were species-specific, the remaining being shared by species from the same or different subgroups. Bands detected exclusively in males and bands with a different frequency or degree of expression between sexes were also detected. In the gels prepared for analysis of gene expression in the body parts (head, thorax and abdomen), the degree of expression of the beta-esterases was higher in the thorax, while the alpha-esterases were expressed predominantly in the abdomen and thorax. A global view of the data available at present on the esterases of the species from the saltans group and their degree of polymorphism are presented, as well as the possibility of using some beta-esterases, because of their characteristics in the gels, as markers for species identification.

High Frequency of Hb E-Saskatoon (HBB: c.67G > A) in Brazilians: A New Genetic Origin?

PubMed

Wagner, Sandrine C; Lindenau, Juliana D; Castro, Simone M de; Santin, Ana Paula; Zaleski, Carina F; Azevedo, Laura A; Ribeiro Dos Santos, Ândrea K C; Dos Santos, Sidney E B; Hutz, Mara H

2016-08-01

Hb E-Saskatoon [β22(B4)Glu→Lys, HBB: c.67G > A] is a rare, nonpathological β-globin variant that was first described in a Canadian woman of Scottish and Dutch ancestry and has since then been detected in several populations. The aim of the present study was to identify the origin of Hb E-Saskatoon in Brazil using β-globin haplotypes and genetic ancestry in carriers of this hemoglobin (Hb) variant. Blood samples were investigated by isoelectric focusing (IEF) and high performance liquid chromatography (HPLC) using commercial kits. Hb E-Saskatoon was confirmed by amplification of the HBB gene, followed by sequence analysis. Haplotypes of the β-globin gene were determined by polymerase chain reaction (PCR), followed by digestion with specific restriction enzymes. Individual ancestry was estimated with 48 biallelic insertion/deletions using three 16-plex PCR amplifications. The IEF pattern was similar to Hbs C (HBB: c.19G > A) and Hb E (HBB: c.79G > A) [isoelectric point (pI): 7.59-7.65], and HPLC results showed an elution in the Hb S (HBB: c.20A > T) window [retention time (RT): 4.26-4.38]. DNA sequencing of the amplified β-globin gene showed a mutation at codon 22 (GAA>AAA) corresponding to Hb E-Saskatoon. A total of 11 cases of this variant were identified. In nine unrelated individuals, Hb E-Saskatoon was in linkage disequilibrium with haplotype 2 [+ - - - -]. All subjects showed a high degree of European contribution (mean = 0.85). Hb E-Saskatoon occurred on the β-globin gene of haplotype 2 in all Brazilian carriers. These findings suggest a different genetic origin for this Hb variant from that previously described.

DNA extraction from formalin-fixed, paraffin-embedded tissues: protein digestion as a limiting step for retrieval of high-quality DNA.

PubMed

Díaz-Cano, S J; Brady, S P

1997-12-01

Several DNA extraction methods have been used for formalin-fixed, paraffin-embedded tissues, with variable results being reported regarding the suitability of DNA obtained from such sources to serve as template in polymerase chain reaction (PCR)-based genetic analyses. We present a method routinely used for archival material in our laboratory that reliably yields DNA of sufficient quality for PCR studies. This method is based on extended proteinase K digestion (250 micrograms/ml in an EDTA-free calcium-containing buffer supplemented with mussel glycogen) followed by phenol-chloroform extraction. Agarose gel electrophoresis of both digestion buffer aliquots and PCR amplification of the beta-globin gene tested the suitability of the retrieved DNA for PCR amplification.

The New Self-Inactivating Lentiviral Vector for Thalassemia Gene Therapy Combining Two HPFH Activating Elements Corrects Human Thalassemic Hematopoietic Stem Cells

PubMed Central

Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios

2012-01-01

Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313

Prenatal diagnosis of hemoglobinopathies: evaluation of techniques for analysing globin-chain synthesis in blood samples obtained by fetoscopy.

PubMed Central

Congote, L. F.; Hamilton, E. F.; Chow, J. C.; Perry, T. B.

1982-01-01

Three techniques for analysing hemoglobin synthesis in blood samples obtained by fetoscopy were evaluated. Of the fetuses studied, 12 were not at risk of genetic disorders, 10 were at risk of beta-thalassemia, 2 were at risk of sickle cell anemia and 1 was at risk of both diseases. The conventional method of prenatal diagnosis of hemoglobinopathies, involving the separation of globin chains labelled with a radioactive isotope on carboxymethyl cellulose (CMC) columns, was compared with a method involving globin-chain separation by high-pressure liquid chromatography (HPLC) and with direct analysis of labelled hemoglobin tetramers obtained from cell lysates by chromatography on ion-exchange columns. The last method is technically the simplest and can be used for diagnosing beta-thalassemia and sickle cell anemia. However, it gives spuriously high levels of adult hemoglobin in samples containing nonlabelled adult hemoglobin. HPLC is the fastest method for prenatal diagnosis of beta-thalassemia and may prove as reliable as the CMC method. Of the 13 fetuses at risk for hemoglobinopathies, 1 was predicted to be affected, and the diagnosis was confirmed in the abortus. Of 12 predicted to be unaffected, 1 was aborted spontaneously and was unavailable for confirmatory studies, as were 3 of the infants; however, the diagnosis was confirmed in seven cases and is awaiting confirmation when the infant in 6 months old in one case. Couples at risk of bearing a child with a hemoglobinopathy should be referred for genetic counselling before pregnancy or, at the latest, by the 12th week of gestation so that prenatal diagnosis can be attempted by amniocentesis, safer procedure, with restriction endonuclease analysis of the amniotic fluid cells. PMID:7139502

Transforming growth factor beta-1 (TGF-β1) gene single nucleotide polymorphisms (SNPs) and susceptibility to pre-eclampsia in Iranian women: A case-control study.

PubMed

Khani, Masood; Amani, Davar; Taheripanah, Robabeh; Sanadgol, Nima; Feizollahzadeh, Sadegh; Rahmani, Zahra

2015-10-01

Pre-eclampsia (PE) is a disorder of pregnancy characterized by high blood pressure and proteinuria. Transforming growth factor beta-1 (TGF-β1) is an important replicated PE candidate gene, and few studies have evaluated the direct association of TGF-β polymorphisms and risk to PE. The aim of this study was to investigate the association between three SNPs of TGF-β1 and serum level of this cytokine in PE patients and controls. In this study the polymorphisms of the TGF-β1 gene at the coding region, and positions 29T→C (Leu 10 Pro), 74G→C (Arg 25 Pro) and 788C→T (Thr 263 Ile) were studied in 123 PE and 120 normal subjects using PCR-restriction fragment length polymorphism PCR-(RFLP) and amplification refractory mutation system (ARMS)-PCR methods. Moreover, serum TGF-β1 was determined by enzyme-linked immunosorbent assay (ELISA) technique. At positions 74G→C and 29T→C the genotypes and allele frequencies showed no significant differences between PE patients and normal controls (P=0.3 and P=0.5 respectively). While in the case of position 788C→T both genotypes and allele frequencies were significantly different between PE patients and controls (P=0.02). Haplotype analysis on three polymorphic sites showed no significant differences between PE and control individuals (P=0.8). TGC and CGC haplotypes were the most frequent in both studied groups. The mean serum TGF-β1 level was significantly higher (62.73ng/ml) in PE patients compared with pregnant (47.01ng/ml) and non-pregnant (40.68ng/ml) control groups (P=0.0001). The results of this study suggest that TGF-β1 gene 788C→T polymorphism is an important factor mediating the casual pathway of preeclampsia. Copyright © 2015 International Society for the Study of Hypertension in Pregnancy. Published by Elsevier B.V. All rights reserved.

A Novel Frameshift Mutation at Codons 138/139 (HBB: c.417_418insT) on the β-Globin Gene Leads to β-Thalassemia.

PubMed

Jiang, Fan; Huang, Lv-Yin; Chen, Gui-Lan; Zhou, Jian-Ying; Xie, Xing-Mei; Li, Dong-Zhi

2017-01-01

We describe a new β-thalassemic mutation in a Chinese subject. This allele develops by insertion of one nucleotide (+T) between codons 138 and 139 in the third exon of the β-globin gene. The mutation causes a frameshift that leads to a termination codon at codon 139. In the heterozygote, this allele has the phenotype of classical β-thalassemia (β-thal) minor.

Development and characterization of K562 cell clones expressing BCL11A-XL: Decreased hemoglobin production with fetal hemoglobin inducers and its rescue with mithramycin

PubMed Central

Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto

2015-01-01

Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. PMID:26342260

Transduction of cultured fish cells with recombinant baculoviruses.

PubMed

Leisy, Douglas J; Lewis, Teresa D; Leong, Jo-Ann C; Rohrmann, George F

2003-05-01

Five fish cell lines were tested for their ability to be transduced by Ac-CAlacZ, a recombinant baculovirus that is capable of expressing a beta-galactosidase reporter gene from the CAG promoter (consisting of a cytomegalovirus enhancer element, a chicken actin promoter and rabbit beta-globin termination sequences). TO (Tilapia ovary), EPC (carp), CHH-1 (Chum salmon heart fibroblast) and CHSE-214 (chinook salmon embryo) cells were transducible, as demonstrated by an in situ beta-galactosidase assay, whereas RTG-2 (rainbow trout gonad) cells were not. The EPC cell line was used for more detailed studies on baculovirus transduction. The transduction frequency was found to be higher at 28 degrees C than at 21 degrees C. Addition of the histone deacetylase inhibitor sodium butyrate increased the number of blue cells detected 5- to 7-fold. The m.o.i. was positively correlated with transduction frequency, although the relationship did not appear to be strictly linear, as has been observed with mammalian cells. The temperature at which baculoviruses were adsorbed to EPC cells did not affect levels of beta-galactosidase expression. We also examined expression levels of beta-galactosidase in EPC cells after infection with a baculovirus construct that overexpresses the vesicular stomatitis virus G protein and displays it on the virion surface. Expression levels with this virus were approximately 15-fold higher than were observed with Ac-CAlacZ.

DNA variation in the genes of the Na,K-adenosine triphosphatase and its relation with resting metabolic rate, respiratory quotient, and body fat.

PubMed Central

Dériaz, O; Dionne, F; Pérusse, L; Tremblay, A; Vohl, M C; Côté, G; Bouchard, C

1994-01-01

The aim of this study was to investigate in 261 subjects from 58 families the association between DNA variation at the genes coding for the Na,K-ATPase peptides and resting metabolic rate (RMR), respiratory quotient (RQ), and percent body fat (%FAT). Five restriction fragment length polymorphisms (RFLP) at three Na,K-ATPase genes were determined: one at the alpha 1 locus (BglII), and two at the beta locus (beta MspI and beta PvuII). Haplotypes were determined from the two variable sites of the alpha 2 gene (alpha 2 haplotypes) and the beta gene (beta haplotypes). There was a strong trend for %FAT to be related to the RFLP generated by BglII at the alpha 2 exons 21-22 in males (P = 0.06) and females (P = 0.05). RQ was (a) associated with the BglII RFLP at the alpha 2 exon 1 (P = 0.02) and with the alpha 2 8.0 kb/4.3 kb haplotype (P = 0.04) and (b) linked with the beta gene MspI marker (P = 0.04) and with the beta 5.3 kb/5.1 kb haplotype (P = 0.008) based on sib-pair analysis. The present study suggests that the genes encoding Na,K-ATPase may be associated or linked with RQ and perhaps with %FAT but not with RMR. PMID:7509349

Gene-gene interactions among genetic variants from obesity candidate genes for nonobese and obese populations in type 2 diabetes.

PubMed

Lin, Eugene; Pei, Dee; Huang, Yi-Jen; Hsieh, Chang-Hsun; Wu, Lawrence Shih-Hsin

2009-08-01

Recent studies indicate that obesity may play a key role in modulating genetic predispositions to type 2 diabetes (T2D). This study examines the main effects of both single-locus and multilocus interactions among genetic variants in Taiwanese obese and nonobese individuals to test the hypothesis that obesity-related genes may contribute to the etiology of T2D independently and/or through such complex interactions. We genotyped 11 single nucleotide polymorphisms for 10 obesity candidate genes including adrenergic beta-2-receptor surface, adrenergic beta-3-receptor surface, angiotensinogen, fat mass and obesity associated gene, guanine nucleotide binding protein beta polypeptide 3 (GNB3), interleukin 6 receptor, proprotein convertase subtilisin/kexin type 1 (PCSK1), uncoupling protein 1, uncoupling protein 2, and uncoupling protein 3. There were 389 patients diagnosed with T2D and 186 age- and sex-matched controls. Single-locus analyses showed significant main effects of the GNB3 and PCSK1 genes on the risk of T2D among the nonobese group (p = 0.002 and 0.047, respectively). Further, interactions involving GNB3 and PCSK1 were suggested among the nonobese population using the generalized multifactor dimensionality reduction method (p = 0.001). In addition, interactions among angiotensinogen, fat mass and obesity associated gene, GNB3, and uncoupling protein 3 genes were found in a significant four-locus generalized multifactor dimensionality reduction model among the obese population (p = 0.001). The results suggest that the single nucleotide polymorphisms from the obesity candidate genes may contribute to the risk of T2D independently and/or in an interactive manner according to the presence or absence of obesity.

Androgen receptor repeat length polymorphism associated with male-to-female transsexualism.

PubMed

Hare, Lauren; Bernard, Pascal; Sánchez, Francisco J; Baird, Paul N; Vilain, Eric; Kennedy, Trudy; Harley, Vincent R

2009-01-01

There is a likely genetic component to transsexualism, and genes involved in sex steroidogenesis are good candidates. We explored the specific hypothesis that male-to-female transsexualism is associated with gene variants responsible for undermasculinization and/or feminization. Specifically, we assessed the role of disease-associated repeat length polymorphisms in the androgen receptor (AR), estrogen receptor beta (ERbeta), and aromatase (CYP19) genes. Subject-control analysis included 112 male-to-female transsexuals and 258 non-transsexual males. Associations and interactions were investigated between CAG repeat length in the AR gene, CA repeat length in the ERbeta gene, and TTTA repeat length in the CYP19 gene and male-to-female transsexualism. A significant association was identified between transsexualism and the AR allele, with transsexuals having longer AR repeat lengths than non-transsexual male control subjects (p=.04). No associations for transsexualism were evident in repeat lengths for CYP19 or ERbeta genes. Individuals were then classified as short or long for each gene polymorphism on the basis of control median polymorphism lengths in order to further elucidate possible combined effects. No interaction associations between the three genes and transsexualism were identified. This study provides evidence that male gender identity might be partly mediated through the androgen receptor.

Impact of obesity-related genes in Spanish population

PubMed Central

2013-01-01

Background The objective was to investigate the association between BMI and single nucleotide polymorphisms previously identified of obesity-related genes in two Spanish populations. Forty SNPs in 23 obesity-related genes were evaluated in a rural population characterized by a high prevalence of obesity (869 subjects, mean age 46 yr, 62% women, 36% obese) and in an urban population (1425 subjects, mean age 54 yr, 50% women, 19% obese). Genotyping was assessed by using SNPlex and PLINK for the association analysis. Results Polymorphisms of the FTO were significantly associated with BMI, in the rural population (beta 0.87, p-value <0.001). None of the other SNPs showed significant association after Bonferroni correction in the two populations or in the pooled analysis. A weighted genetic risk score (wGRS) was constructed using the risk alleles of the Tag-SNPs with a positive Beta parameter in both populations. From the first to the fifth quintile of the score, the BMI increased 0.45 kg/m2 in Hortega and 2.0 kg/m2 in Pizarra. Overall, the obesity predictive value was low (less than 1%). Conclusion The risk associated with polymorphisms is low and the overall effect on BMI or obesity prediction is minimal. A weighted genetic risk score based on genes mainly acting through central nervous system mechanisms was associated with BMI but it yields minimal clinical prediction for the obesity risk in the general population. PMID:24267414

Impact of obesity-related genes in Spanish population.

PubMed

Martínez-García, Fernando; Mansego, María L; Rojo-Martínez, Gemma; De Marco-Solar, Griselda; Morcillo, Sonsoles; Soriguer, Federico; Redón, Josep; Pineda Alonso, Monica; Martín-Escudero, Juan C; Cooper, Richard S; Chaves, Felipe J

2013-11-23

The objective was to investigate the association between BMI and single nucleotide polymorphisms previously identified of obesity-related genes in two Spanish populations. Forty SNPs in 23 obesity-related genes were evaluated in a rural population characterized by a high prevalence of obesity (869 subjects, mean age 46 yr, 62% women, 36% obese) and in an urban population (1425 subjects, mean age 54 yr, 50% women, 19% obese). Genotyping was assessed by using SNPlex and PLINK for the association analysis. Polymorphisms of the FTO were significantly associated with BMI, in the rural population (beta 0.87, p-value <0.001). None of the other SNPs showed significant association after Bonferroni correction in the two populations or in the pooled analysis. A weighted genetic risk score (wGRS) was constructed using the risk alleles of the Tag-SNPs with a positive Beta parameter in both populations. From the first to the fifth quintile of the score, the BMI increased 0.45 kg/m2 in Hortega and 2.0 kg/m2 in Pizarra. Overall, the obesity predictive value was low (less than 1%). The risk associated with polymorphisms is low and the overall effect on BMI or obesity prediction is minimal. A weighted genetic risk score based on genes mainly acting through central nervous system mechanisms was associated with BMI but it yields minimal clinical prediction for the obesity risk in the general population.

The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.

PubMed

Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel

2012-01-01

Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.

Arg25Pro polymorphism of transforming growth factor-beta1 and its role in the pathogenesis of essential hypertension in Russian population of the Central Chernozem Region.

PubMed

Ivanov, V P; Solodilova, M A; Polonnikov, A V; Belugin, D A; Shestakov, A M; Ushachev, D V; Khoroshaya, I V; Katargina, L N; Kozhukhov, M A; Kolesnikova, O E

2007-07-01

We studied the relationship between Arg25Pro polymorphism of TGFbeta1 gene and predisposition to essential hypertension in the Russian population of Central Chernozem Region (n=402). An association was found between 25Pro allele and 25ArgPro genotype with low risk of essential hypertension in male individuals.

Cultural consonance, a 5HT2A receptor polymorphism, and depressive symptoms: a longitudinal study of gene x culture interaction in urban Brazil.

PubMed

Dressler, William W; Balieiro, Mauro C; Ribeiro, Rosane P; Dos Santos, José Ernesto

2009-01-01

In this study in urban Brazil we examine, as a predictor of depressive symptoms, the interaction between a single nucleotide polymorphism in the 2A receptor in the serotonin system (-1438G/A) and cultural consonance in family life, a measure of the degree to which an individual perceives her family as corresponding to a widely shared cultural model of the prototypical family. A community sample of 144 adults was followed over a 2-year-period. Cultural consonance in family life was assessed by linking individuals' perceptions of their own families with a shared cultural model of the family derived from cultural consensus analysis. The -1438G/A polymorphism in the 2A serotonin receptor was genotyped using a standard protocol for DNA extracted from leukocytes. Covariates included age, sex, socioeconomic status, and stressful life events. Cultural consonance in family life was prospectively associated with depressive symptoms. In addition, the interaction between genotype and cultural consonance in family life was significant. For individuals with the A/A variant of the -1438G/A polymorphism of the 2A receptor gene, the effect of cultural consonance in family life on depressive symptoms over a 2-year-period was larger (beta = -0.533, P < 0.01) than those effects for individuals with either the G/A (beta = -0.280, P < 0.10) or G/G (beta = -0.272, P < 0.05) variants. These results are consistent with a process in which genotype moderates the effects of culturally meaningful social experience on depressive symptoms. (c) 2008 Wiley-Liss, Inc.

beta3-Adrenergic receptor Trp64Arg polymorphism and increased body mass index in sleep apnoea.

PubMed

Piérola, J; Barceló, A; de la Peña, M; Barbé, F; Soriano, J B; Sánchez Armengol, A; Martínez, C; Agustí, A

2007-10-01

Obesity is an important risk factor for obstructive sleep apnoea syndrome (OSAS), insulin resistance and cardiovascular disease. The substitution of tryptophan 64 with arginine (Trp64Arg) polymorphism (Arg variant) of the beta(3)-adrenergic receptor (ADRB3) has been associated with obesity. In this study, the prevalence of the Trp64Arg ADRB3 polymorphism in a large group of patients with OSAS and its association with body mass index (BMI), insulin resistance and hypertension were evaluated. ADRB3 genotype was determined in 387 patients with OSAS and 137 healthy subjects recruited from three Spanish tertiary hospitals. The distributions of the ADRB3 genotypes were similar in OSAS and controls, and, in a multivariate model, the risk of OSAS was not associated with the presence of the Arg variant of the ADRB3 gene. However, BMI was higher in those patients with OSAS who carried this genetic variant than in those with the Trp variant. Furthermore, a linear trend for higher BMI was found in those with the Arg variant (56, 75 and 100% for Trp/Trp, Trp/Arg and Arg/Arg, respectively). Insulin resistance, blood pressures and serum levels of lipids and glucose were not associated with the presence of the Arg variant of the ADRB3 gene. The presence of the arginine 64 allele of the beta(3)-adrenergic receptor gene does not increase the risk of obstructive sleep apnoea syndrome, but is associated with the development of obesity in those patients who suffer obstructive sleep apnoea syndrome.

Opioid system genes in alcoholism: a case-control study in Croatian population.

PubMed

Cupic, B; Stefulj, J; Zapletal, E; Matosic, A; Bordukalo-Niksic, T; Cicin-Sain, L; Gabrilovac, J

2013-10-01

Due to their involvement in dependence pathways, opioid system genes represent strong candidates for association studies investigating alcoholism. In this study, single nucleotide polymorphisms within the genes for mu (OPRM1) and kappa (OPRK1) opioid receptors and precursors of their ligands - proopiomelanocortin (POMC), coding for beta-endorphin and prodynorphin (PDYN) coding for dynorphins, were analyzed in a case-control study that included 354 male alcohol-dependent and 357 male control subjects from Croatian population. Analysis of allele and genotype frequencies of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN revealed no differences between the tested groups. The same was true when alcohol-dependent persons were subdivided according to the Cloninger's criteria into type-1 and type-2 groups, known to differ in the extent of genetic control. Thus, the data obtained suggest no association of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN with alcoholism in Croatian population. Copyright © 2013 Elsevier Ltd. All rights reserved.

Metabolism and gene polymorphisms of the folate pathway in Brazilian women with history of recurrent abortion.

PubMed

Boas, Wendell Vilas; Gonçalves, Rozana Oliveira; Costa, Olívia Lúcia Nunes; Goncalves, Marilda Souza

2015-02-01

To investigate the association between polymorphisms in genes that encode enzymes involved in folate- and vitamin B12-dependent homocysteine metabolism and recurrent spontaneous abortion (RSA). We investigated the C677T and A1298C polymorphisms of the methylenetetrahydrofalate reductase gene (MTHFR), the A2756G polymorphism of the methionine synthase gene (MS) and the 844ins68 insertion of the cystathionine beta synthetase gene (CBS). The PCR technique followed by RFLP was used to assess the polymorphisms; the serum levels of homocysteine, vitamin B12 and folate were investigated by chemiluminescence. The EPI Info Software version 6.04 was used for statistical analysis. Parametric variables were compared by Student's t-test and nonparametric variables by the Wilcoxon rank sum test. The frequencies of gene polymorphisms in 89 women with a history of idiopathic recurrent miscarriage and 150 controls were 19.1 and 19.6% for the C677T, insertion, 20.8 and 26% for the A1298C insertion, 14.2 and 21.9% for the A2756G insertion, and 16.4 and 18% for the 844ins68 insertion, respectively. There were no significant differences between case and control groups in any of the gene polymorphisms investigated. However, the frequency of the 844ins68 insertion in the CBS gene was higher among women with a history of loss during the third trimester of pregnancy (p=0.003). Serum homocysteine, vitamin B12 and folate levels id not differ between the polymorphisms studied in the case and control groups. However, linear regression analysis showed a dependence of serum folate levels on the maintenance of tHcy levels. The investigated gene polymorphisms and serum homocysteine, vitamin B12 and folate levels were not associated with idiopathic recurrent miscarriage in the present study. Further investigations are needed in order to confirm the role of the CBS 844ins68 insertion in recurrent miscarriage.

Pituitary resistance to thyroid hormone associated with a base mutation in the hormone-binding domain of the human 3,5,3'-triiodothyronine receptor-beta.

PubMed

Sasaki, S; Nakamura, H; Tagami, T; Miyoshi, Y; Nogimori, T; Mitsuma, T; Imura, H

1993-05-01

Point mutations in the human T3 receptor-beta (TR beta) gene causing single amino acid substitutions have been identified in several different kindreds with generalized resistance to thyroid hormone. Until now, no study has been reported on the TR gene in cases of pituitary resistance (PRTH). In the present study, we analyzed the TR beta gene in a 30-yr-old Japanese female with PRTH. She exhibited clinical features of hyperthyroidism, elevated serum thyroid hormone levels accompanied by inappropriately increased secretion of TSH, mildly elevated basal metabolic rate, and increased urinary excretion of hydroxyproline. No pituitary tumor was detected. DNA fragments of exons 3-8 of the genomic TR beta gene were generated by the polymerase chain reaction and analyzed by a single stranded conformation polymorphism method. Exon 7 of the patient's TR beta gene showed an abnormal band, suggesting the existence of mutation(s). By subcloning and sequencing the DNA, a point mutation was identified in one allele at nucleotide 1297 (C to T), which altered the 333rd amino acid, arginine, to tryptophan. Neither of her apparently normal parents had any mutations of the TR beta gene. In vitro translation products of the mutant TR beta gene showed remarkably decreased T3-binding activity (Ka, 2.1 x 10(8) M-1; normal TR beta Ka, 1.1 x 10(10) M-1). Since the molecular defect detected in a patient with PRTH is similar to that seen in subjects with generalized resistance to thyroid hormone, both types of the syndrome may represent a continuous spectrum of the same etiological defect with variable tissue resistance to thyroid hormone.

Beta-2 adrenergic receptor (ADRB2) gene polymorphisms and the risk of asthma: a meta-analysis of case-control studies.

PubMed

Liang, Si-Qiao; Chen, Xiao-Li; Deng, Jing-Min; Wei, Xuan; Gong, Chen; Chen, Zhang-Rong; Wang, Zhi-Bo

2014-01-01

A number of studies have assessed the relationship between beta-2 adrenergic receptor (ADRB2) gene polymorphisms and asthma risk. However, the results are inconsistent. A meta-analysis that focused on the association between asthma and all ADRB2 polymorphisms with at least three case-control studies was thus performed. A literature search of the PubMed, Embase, Web of Science, CNKI, and Wangfang databases was conducted. Odds ratios with 95% confidence intervals were used to assess the strength of associations. Arg16Gly, Gln27Glu, Thr164Ile, and Arg19Cys single nucleotide polymorphisms (SNPs) were identified in 46 case-control studies. The results showed that not all of the SNPs were associated with asthma in the overall population. Significant associations were found for the Arg16Gly polymorphism in the South American population via dominant model comparison (OR = 1.754, 95% CI = 1.179-2.609, I2 = 16.9%, studies  = 2, case  = 314, control  = 237) in an analysis stratified by ethnicity. For the Gln27Glu polymorphism, a protective association was found in children via recessive model comparison (OR = 0.566, 95% CI = 0.417-0.769, I2 = 0.0%, studies  = 11, case  = 1693, control  =  502) and homozygote genotype comparison (OR = 0.610, 95% CI = 0.434-0.856, I2 = 0.0%, studies  = 11, case  = 1693, control  = 1502), and in adults via dominant model comparison (OR = 0.864, 95% CI = 0.768-0.971, I2 = 46.9%, n = 18, case  = 3160, control  = 3433). None of the ADRB2 gene polymorphisms were reproducibly associated with a risk of asthma across ethnic groups in the general population.

Polymorphisms in the ghrelin gene are associated with serum high-density lipoprotein cholesterol level and not with type 2 diabetes mellitus in Koreans.

PubMed

Choi, Hyung Jin; Cho, Young Min; Moon, Min Kyong; Choi, Hye Hun; Shin, Hyoung Doo; Jang, Hak Chul; Kim, Seong Yeon; Lee, Hong Kyu; Park, Kyong Soo

2006-11-01

Ghrelin is known to play a role in glucose metabolism and in beta-cell function. There are controversies regarding the role of ghrelin polymorphisms in diabetes and diabetes-related phenotypes. The objective of this study was to examine polymorphisms of the ghrelin gene in a Korean cohort and investigate associations between them and susceptibility to type 2 diabetes and its related phenotypes. The ghrelin gene was sequenced to identify polymorphisms in 24 DNA samples. Common variants were then genotyped in 760 type 2 diabetic patients and 641 nondiabetic subjects. Genetic associations with diabetes-related phenotypes were also analyzed. Nine polymorphisms were identified, and four common polymorphisms [g.-1500C>G, g.-1062G > C, g.-994C > T, g.+408C > A (Leu72Met)] were genotyped in a larger study. The genotype distributions of these four common polymorphisms in type 2 diabetes patients were similar to those of normal nondiabetic controls. However, these four common polymorphisms were variably associated with several diabetes-related phenotypes, such as high-density lipoprotein (HDL) cholesterol, fasting plasma glucose, and homeostasis model assessment of insulin resistance. In particular, subjects harboring g.-1062C were associated with a lower serum HDL cholesterol level after adjusting for other variables (P = 0.0004 or 0.01 after Bonferroni correction for 24 tests). The aforementioned four common polymorphisms in the ghrelin gene were not found to be significantly associated with susceptibility to type 2 diabetes mellitus in the Korean population. However, the common polymorphism g.-1062G > C in the promoter region of the ghrelin gene was found to be significantly associated with serum HDL cholesterol levels.

α-Globin as a molecular target in the treatment of β-thalassemia

PubMed Central

Mettananda, Sachith; Gibbons, Richard J.

2015-01-01

The thalassemias, together with sickle cell anemia and its variants, are the world’s most common form of inherited anemia, and in economically undeveloped countries, they still account for tens of thousands of premature deaths every year. In developed countries, treatment of thalassemia is also still far from ideal, requiring lifelong transfusion or allogeneic bone marrow transplantation. Clinical and molecular genetic studies over the course of the last 50 years have demonstrated how coinheritance of modifier genes, which alter the balance of α-like and β-like globin gene expression, may transform severe, transfusion-dependent thalassemia into relatively mild forms of anemia. Most attention has been paid to pathways that increase γ-globin expression, and hence the production of fetal hemoglobin. Here we review the evidence that reduction of α-globin expression may provide an equally plausible approach to ameliorating clinically severe forms of β-thalassemia, and in particular, the very common subgroup of patients with hemoglobin E β-thalassemia that makes up approximately half of all patients born each year with severe β-thalassemia. PMID:25869286

Genome-wide association study of red blood cell traits in Hispanics/Latinos: The Hispanic Community Health Study/Study of Latinos

PubMed Central

Morrison, Jean V.; Brown, Lisa; Schurmann, Claudia; Chen, Diane D.; Liu, Yong Mei; Auer, Paul L.; Taylor, Kent D.; Papanicolaou, George; Kurita, Ryo; Nakamura, Yukio; Loos, Ruth J. F.; North, Kari E.; Thornton, Timothy A.; Pankratz, Nathan; Bauer, Daniel E.

2017-01-01

Prior GWAS have identified loci associated with red blood cell (RBC) traits in populations of European, African, and Asian ancestry. These studies have not included individuals with an Amerindian ancestral background, such as Hispanics/Latinos, nor evaluated the full spectrum of genomic variation beyond single nucleotide variants. Using a custom genotyping array enriched for Amerindian ancestral content and 1000 Genomes imputation, we performed GWAS in 12,502 participants of Hispanic Community Health Study and Study of Latinos (HCHS/SOL) for hematocrit, hemoglobin, RBC count, RBC distribution width (RDW), and RBC indices. Approximately 60% of previously reported RBC trait loci generalized to HCHS/SOL Hispanics/Latinos, including African ancestral alpha- and beta-globin gene variants. In addition to the known 3.8kb alpha-globin copy number variant, we identified an Amerindian ancestral association in an alpha-globin regulatory region on chromosome 16p13.3 for mean corpuscular volume and mean corpuscular hemoglobin. We also discovered and replicated three genome-wide significant variants in previously unreported loci for RDW (SLC12A2 rs17764730, PSMB5 rs941718), and hematocrit (PROX1 rs3754140). Among the proxy variants at the SLC12A2 locus we identified rs3812049, located in a bi-directional promoter between SLC12A2 (which encodes a red cell membrane ion-transport protein) and an upstream anti-sense long-noncoding RNA, LINC01184, as the likely causal variant. We further demonstrate that disruption of the regulatory element harboring rs3812049 affects transcription of SLC12A2 and LINC01184 in human erythroid progenitor cells. Together, these results reinforce the importance of genetic study of diverse ancestral populations, in particular Hispanics/Latinos. PMID:28453575

Thalassaemia.

PubMed

Higgs, Douglas R; Engel, James Douglas; Stamatoyannopoulos, George

2012-01-28

Thalassaemia is one of the most common genetic diseases worldwide, with at least 60,000 severely affected individuals born every year. Individuals originating from tropical and subtropical regions are most at risk. Disorders of haemoglobin synthesis (thalassaemia) and structure (eg, sickle-cell disease) were among the first molecular diseases to be identified, and have been investigated and characterised in detail over the past 40 years. Nevertheless, treatment of thalassaemia is still largely dependent on supportive care with blood transfusion and iron chelation. Since 1978, scientists and clinicians in this specialty have met regularly in an international effort to improve the management of thalassaemia, with the aim of increasing the expression of unaffected fetal genes to improve the deficiency in adult β-globin synthesis. In this Seminar we discuss important advances in the understanding of the molecular and cellular basis of normal and abnormal expression of globin genes. We will summarise new approaches to the development of tailored pharmacological agents to alter regulation of globin genes, the first trial of gene therapy for thalassaemia, and future prospects of cell therapy. Copyright © 2012 Elsevier Ltd. All rights reserved.

Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

PubMed

Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

2015-05-15

Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

Development and characterization of K562 cell clones expressing BCL11A-XL: Decreased hemoglobin production with fetal hemoglobin inducers and its rescue with mithramycin.

PubMed

Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto

2015-12-01

Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

[Association of beta 3-adrenergic receptor gene with obesity in patients with type 2 diabetes mellitus].

PubMed

Chen, Y; Xu, Y; Zhou, L

2001-09-01

To investigate the association between the mutation of beta 3-adrenergoc receptor gene and obesity in patients with type 2 diabetes. Body mass, waist-hip ratio, blood pressure and blood lipids were measured in 154 type 2 diabetic patients. Polymerase chain reaction and the restriction fragment length polymorphism analysis were used to determine the wild, heterozygous and homozygous forms of beta 3-adrenergoc receptor gene. The frequency of the Trp64Arg mutation was 42.5% and the frequency of Arg64 allele was 22.6%. The mutation frequency of the genetic types was significantly different between the obese and non-obese type 2 diabetes mellitus patients. The body mass, systolic blood pressure, diastolic blood pressure, HDL-cholesterol were significantly different, when those with Trp64Arg heterozygous were compared with those with Trp64 homozygous. The genetic mutation of beta 3-adrenegoc receptor in patients with type 2 diabetes is probably related to obesity.

Problem-Solving Test: The Mechanism of Protein Synthesis

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: protein synthesis, ribosomes, amino acids, peptides, peptide bond, polypeptide chain, N- and C-terminus, hemoglobin, [alpha]- and [beta]-globin chains, radioactive labeling, [[to the third power]H] and [[to the fourteenth power]C]leucine, cytosol, differential centrifugation, density…

Modulation of cortisol responses to the DEX/CRH test by polymorphisms of the interleukin-1beta gene in healthy adults.

PubMed

Sasayama, Daimei; Hori, Hiroaki; Iijima, Yoshimi; Teraishi, Toshiya; Hattori, Kotaro; Ota, Miho; Fujii, Takashi; Higuchi, Teruhiko; Amano, Naoji; Kunugi, Hiroshi

2011-07-05

Recently, hypothalamus-pituitary-adrenal (HPA) axis function assessed with the combined dexamethasone (DEX)/corticotropin releasing hormone (CRH) test has been shown to be associated with response to antidepressant treatment. A polymorphism (rs16944) in the interleukin-1beta (IL-1β) gene has also been reported to be associated with the medication response in depression. These findings prompted us to examine the possible association between IL-1β gene polymorphisms and HPA axis function assessed with the DEX/CRH test. DEX/CRH test was performed in 179 healthy volunteers (45 males: mean age 40.5 ± 15.8 years; 134 females: mean age 47.1 ± 13.2 years). Five tagging single nucleotide polymorphisms (SNPs) of IL-1β gene (rs2853550, rs1143634, rs1143633, rs1143630, rs16944) were selected at an r2 threshold of 0.80 with a minor allele frequency > 0.1. Genotyping was performed by the TaqMan allelic discrimination assay. A two-way factorial analysis of variance (ANOVA) was performed with the DEX/CRH test results as the dependent variable and genotype and gender as independent variables. To account for multiple testing, P values < 0.01 were considered statistically significant for associations between the genotypes and the cortisol levels. The cortisol levels after DEX administration (DST-Cortisol) showed significant associations with the genotypes of rs16944 (P = 0.00049) and rs1143633 (P = 0.0060), with no significant gender effect or genotype × gender interaction. On the other hand, cortisol levels after CRH administration (DEX/CRH-Cortisol) were affected by gender but were not significantly influenced by the genotype of the examined SNPs, with no significant genotype × gender interaction. Our results suggest that genetic variations in the IL-1β gene contribute to the HPA axis alteration assessed by DST-Cortisol in healthy subjects. On the other hand, no significant associations of the IL-1β gene polymorphisms with the DEX/CRH-Cortisol were observed. Confirmation of our findings in futures studies may add new insight into the communication between the immune system and the HPA axis.

Modulation of cortisol responses to the DEX/CRH test by polymorphisms of the interleukin-1beta gene in healthy adults

PubMed Central

2011-01-01

Background Recently, hypothalamus-pituitary-adrenal (HPA) axis function assessed with the combined dexamethasone (DEX)/corticotropin releasing hormone (CRH) test has been shown to be associated with response to antidepressant treatment. A polymorphism (rs16944) in the interleukin-1beta (IL-1β) gene has also been reported to be associated with the medication response in depression. These findings prompted us to examine the possible association between IL-1β gene polymorphisms and HPA axis function assessed with the DEX/CRH test. Methods DEX/CRH test was performed in 179 healthy volunteers (45 males: mean age 40.5 ± 15.8 years; 134 females: mean age 47.1 ± 13.2 years). Five tagging single nucleotide polymorphisms (SNPs) of IL-1β gene (rs2853550, rs1143634, rs1143633, rs1143630, rs16944) were selected at an r2 threshold of 0.80 with a minor allele frequency > 0.1. Genotyping was performed by the TaqMan allelic discrimination assay. A two-way factorial analysis of variance (ANOVA) was performed with the DEX/CRH test results as the dependent variable and genotype and gender as independent variables. To account for multiple testing, P values < 0.01 were considered statistically significant for associations between the genotypes and the cortisol levels. Results The cortisol levels after DEX administration (DST-Cortisol) showed significant associations with the genotypes of rs16944 (P = 0.00049) and rs1143633 (P = 0.0060), with no significant gender effect or genotype × gender interaction. On the other hand, cortisol levels after CRH administration (DEX/CRH-Cortisol) were affected by gender but were not significantly influenced by the genotype of the examined SNPs, with no significant genotype × gender interaction. Conclusions Our results suggest that genetic variations in the IL-1β gene contribute to the HPA axis alteration assessed by DST-Cortisol in healthy subjects. On the other hand, no significant associations of the IL-1β gene polymorphisms with the DEX/CRH-Cortisol were observed. Confirmation of our findings in futures studies may add new insight into the communication between the immune system and the HPA axis. PMID:21726461

Association of -31T>C and -511 C>T polymorphisms in the interleukin 1 beta (IL1B) promoter in Korean keratoconus patients.

PubMed

Kim, So-Hee; Mok, Jee-Won; Kim, Hyun-Seok; Joo, C K

2008-01-01

To investigate the genetic association between unrelated Korean keratoconus patients and interleukin 1 alpha (IL1A), interleukin 1 beta (IL1B), and IL1 receptor antagonist (IL1RN) gene polymorphisms. We investigated the association between IL1A (rs1800587, rs2071376, and rs17561), IL1B (rs1143627, rs16944, rs1143634, and rs1143633), and IL1RN (rs419598, rs423904, rs424078, and rs315952, variable number tandem repeat [VNTR]) polymorphisms in 100 unrelated Korean keratoconus patients. One hundred control individuals without any corneal disease were selected from the general population. Polymerase chain reaction (PCR) - restriction fragment length polymorphism (RFLP) analysis and direct sequencing were used to screen for genetic variations in the IL1 gene cluster. Haplotypes for the IL1 gene cluster were constructed using Haploview version 4.0. We analyzed a total of 12 polymorphic sites in the IL1 gene cluster. Among them, the -511 (rs16944) and -31 (rs1143627) positions in the promoter region of IL1B were significantly different between patient and control groups. The C allele of rs16944 (-511C>T, p=0.022, odds ratio of risk [OR]=1.46, 95% confidence intervals [CI] 0.94<2.27) and the T allele of rs1143627 (-31T>C, p=0.025, OR=1.43, 95% CI 0.92<2.22) were associated with a significantly increased risk of keratoconus in Korean patients. Linkage of the two alleles, -31*C and -511*T, was associated with an increased risk for keratoconus with OR=2.38 (p=0.012, 95% CI=1.116-5.046). The *C/*A genotype of rs2071376 in IL1A intron 6 was significantly different between the keratoconus patients and control subjects (p=0.034, OR=0.59, 95% CI 0.32<1.11). Other polymorphisms did not show an association with keratoconus risk. This is the first report of IL1 gene cluster mutation screening in Korean keratoconus patients. Significant differences in allelic frequency of IL1B between keratoconus patients and the control group suggest that IL1B polymorphisms may play a role in the susceptibility of unrelated Koreans to develop keratoconus.

Temporal regulation of Stat5 activity in determination of cell differentiation program

PubMed Central

Hoshino, Akemi; Fujii, Hodaka

2007-01-01

Although Stat5 is activated by various cytokines, only ethrytopoietin (Epo) and a small number of cytokines induce Stat5-dependent erythroid differentiation. Here, by using a reporter gene system to monitor transcriptional activity of Stat5, we showed that Epo but not interleukin (IL)-3 supports sustained activation of Stat5, which induces globin gene expression. IL-3 or IL-2 stimulation inhibits Epo-induced globin gene expression. The acidic region of the IL-2 receptor β chain was essential for this inhibition. These results underscore the importance of temporal regulation of Stat activity for regulation of cytokine-specific cell differentiation. PMID:17511959

Analysis of alpha hemoglobin stabilizing protein overexpression in murine β-thalassemia

PubMed Central

Nasimuzzaman, Md; Khandros, Eugene; Wang, Xiaomei; Kong, Yi; Zhao, Huifen; Weiss, David; Rivella, Stefano; Weiss, Mitchell J.; Persons, Derek A.

2013-01-01

Excess free α-globin is cytotoxic and contributes to the pathophysiology of β-thalassemia. Alpha hemoglobin stabilizing protein (AHSP) is a molecular chaperone that binds free α-globin to promote its folding and inhibit its ability to produce damaging reactive oxygen species. Reduced AHSP levels correlate with increased severity of β-thalassemia in some human cohorts, but causal mechanistic relationships are not established for these associations. We used transgenic and lentiviral gene transfer methods to investigate whether supraphysiologic AHSP levels could mitigate the severity of β-thalassemia intermedia by providing an increased sink for the excess pool of α-globin chains. We tested wild-type AHSP and two mutant versions with amino acid substitutions that confer 3- or 13-fold higher affinity for α-globin. Erythroid overexpression of these AHSP proteins up to 11-fold beyond endogenous levels had no major effects on hematologic parameters in β-thalassemic animals. Our results demonstrate that endogenous AHSP is not limiting for α-globin detoxification in a murine model of β-thalassemia. PMID:20815047

11beta-Hydroxysteroid dehydrogenase Type 1: genetic polymorphisms are associated with Type 2 diabetes in Pima Indians independently of obesity and expression in adipocyte and muscle.

PubMed

Nair, S; Lee, Y H; Lindsay, R S; Walker, B R; Tataranni, P A; Bogardus, C; Baier, L J; Permana, P A

2004-06-01

The enzyme 11beta-hydroxysteroid dehydrogenase type 1 (11beta-HSD1) modulates tissue-specific glucocorticoid concentrations by generating active cortisol. We have shown that adipose tissue 11beta-HSD1 mRNA levels were associated with adiposity and insulinaemia. Here we conducted further expression and genetic association studies in Pima Indians. The 11beta-HSD1 mRNA concentrations were measured in abdominal subcutaneous adipocytes (n=61) and skeletal muscle tissues (n=64). Single nucleotide polymorphisms in the HSD11B1 gene were genotyped in a larger group of full-blooded Pima Indians. Two representative SNPs (SNP1, n=706; SNP5, n=839) were associated with Type 2 diabetes mellitus (p=0.01), although neither SNP was associated with obesity. Among subjects with normal glucose tolerance, SNP1 (n=127) and SNP5 (n=159) were associated with insulin-mediated glucose uptake rates (p=0.03 and p=0.04), and SNP1 was further associated with fasting, 30-min, and 2-h plasma insulin concentrations (p=0.002, p=0.002 and p=0.03). Adipocyte 11beta-HSD1 mRNA concentrations were correlated positively with adiposity and insulinaemia, and were additionally negatively correlated with insulin-mediated glucose uptake rates; nevertheless, the adipocyte 11beta-HSD1 expression did not correlate with genotypes of the donors. The muscle 11beta-HSD1 mRNA concentrations did not correlate with any anthropometric or metabolic variables. We confirmed that adipocyte 11beta-HSD1 mRNA concentrations were associated with adiposity, and showed that genetic variations in the HSD11B1 gene were associated with Type 2 diabetes mellitus, plasma insulin concentrations and insulin action, independent of obesity. The variable adipose expression might not be a primary consequence of these HSD11B1 SNPs. Therefore, it is possible that the HSD11B1 gene is under tissue-specific regulation, and has tissue-specific consequences.

Mathematical modeling of erythrocyte chimerism informs genetic intervention strategies for sickle cell disease.

PubMed

Altrock, Philipp M; Brendel, Christian; Renella, Raffaele; Orkin, Stuart H; Williams, David A; Michor, Franziska

2016-09-01

Recent advances in gene therapy and genome-engineering technologies offer the opportunity to correct sickle cell disease (SCD), a heritable disorder caused by a point mutation in the β-globin gene. The developmental switch from fetal γ-globin to adult β-globin is governed in part by the transcription factor (TF) BCL11A. This TF has been proposed as a therapeutic target for reactivation of γ-globin and concomitant reduction of β-sickle globin. In this and other approaches, genetic alteration of a portion of the hematopoietic stem cell (HSC) compartment leads to a mixture of sickling and corrected red blood cells (RBCs) in periphery. To reverse the sickling phenotype, a certain proportion of corrected RBCs is necessary; the degree of HSC alteration required to achieve a desired fraction of corrected RBCs remains unknown. To address this issue, we developed a mathematical model describing aging and survival of sickle-susceptible and normal RBCs; the former can have a selective survival advantage leading to their overrepresentation. We identified the level of bone marrow chimerism required for successful stem cell-based gene therapies in SCD. Our findings were further informed using an experimental mouse model, where we transplanted mixtures of Berkeley SCD and normal murine bone marrow cells to establish chimeric grafts in murine hosts. Our integrative theoretical and experimental approach identifies the target frequency of HSC alterations required for effective treatment of sickling syndromes in humans. Our work replaces episodic observations of such target frequencies with a mathematical modeling framework that covers a large and continuous spectrum of chimerism conditions. Am. J. Hematol. 91:931-937, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Two genetic markers closely linked to adult polycystic kidney disease on chromosome 16.

PubMed Central

Reeders, S T; Breuning, M H; Corney, G; Jeremiah, S J; Meera Khan, P; Davies, K E; Hopkinson, D A; Pearson, P L; Weatherall, D J

1986-01-01

The genetic locus for autosomal dominant adult polycystic kidney disease was recently assigned to chromosome 16 by the finding of genetic linkage to the alpha globin gene cluster. Further study showed that the phosphoglycolate phosphatase locus is also closely linked to both the locus for adult polycystic kidney disease and the alpha globin gene cluster. These findings have important implications for the prenatal and presymptomatic diagnosis of adult polycystic kidney disease and for a better understanding of its pathogenesis. Images FIG 1 PMID:3008903

Correlation of low levels of nitrite and high levels of fetal hemoglobin in patients with sickle cell disease at baseline

PubMed Central

Elias, Darcielle Bruna Dias; Rocha, Lilianne Brito da Silva; Cavalcante, Maritza Barbosa; Pedrosa, Alano Martins; Justino, Izabel Cristina Bandeira; Gonçalves, Romélia Pinheiro

2012-01-01

Background Sickle cell disease is a hemoglobinopathy characterized by hemolytic anemia, increased susceptibility to infections and recurrent vaso-occlusive crises that reduces the quality of life of sufferers. Objective To evaluate the correlation of the levels of lactate dehydrogenase, malonaldehyde and nitrite to fetal hemoglobin in patients with sickle cell disease not under treatment with hydroxyurea in outpatients at a university hospital in Fortaleza, Ceará, Brazil. Methods Forty-four patients diagnosed with sickle cell disease were enrolled at baseline. Diagnosis was confirmed by evaluating the beta globin gene using polymerase chain reaction-restriction fragment length polymorphism. The concentration of fetal hemoglobin was obtained by high-performance liquid chromatography. Serum levels of nitrite, malonaldehyde and lactate dehydrogenase were measured by biochemical methods. Results Significantly higher levels of lactate dehydrogenase, nitrite and malonaldehyde were observed in patients with sickle cell disease compared to a control group. The study of the correlation between fetal hemoglobin levels and these variables showed a negative correlation with nitrite levels. No correlation was found between fetal hemoglobin and malonaldehyde or lactate dehydrogenase. When the study population was stratified according to fetal hemoglobin levels, a decrease in the levels of nitrite was observed with higher levels of fetal hemoglobin (p-value = 0.0415). Conclusion The results show that, similar to fetal hemoglobin levels, the concentration of nitrite can predict the clinical course of the disease, but should not be used alone as a modulator of prognosis in patients with sickle cell disease. PMID:23049438

Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia.

PubMed

Cavazzana-Calvo, Marina; Payen, Emmanuel; Negre, Olivier; Wang, Gary; Hehir, Kathleen; Fusil, Floriane; Down, Julian; Denaro, Maria; Brady, Troy; Westerman, Karen; Cavallesco, Resy; Gillet-Legrand, Beatrix; Caccavelli, Laure; Sgarra, Riccardo; Maouche-Chrétien, Leila; Bernaudin, Françoise; Girot, Robert; Dorazio, Ronald; Mulder, Geert-Jan; Polack, Axel; Bank, Arthur; Soulier, Jean; Larghero, Jérôme; Kabbara, Nabil; Dalle, Bruno; Gourmel, Bernard; Socie, Gérard; Chrétien, Stany; Cartier, Nathalie; Aubourg, Patrick; Fischer, Alain; Cornetta, Kenneth; Galacteros, Frédéric; Beuzard, Yves; Gluckman, Eliane; Bushman, Frederick; Hacein-Bey-Abina, Salima; Leboulch, Philippe

2010-09-16

The β-haemoglobinopathies are the most prevalent inherited disorders worldwide. Gene therapy of β-thalassaemia is particularly challenging given the requirement for massive haemoglobin production in a lineage-specific manner and the lack of selective advantage for corrected haematopoietic stem cells. Compound β(E)/β(0)-thalassaemia is the most common form of severe thalassaemia in southeast Asian countries and their diasporas. The β(E)-globin allele bears a point mutation that causes alternative splicing. The abnormally spliced form is non-coding, whereas the correctly spliced messenger RNA expresses a mutated β(E)-globin with partial instability. When this is compounded with a non-functional β(0) allele, a profound decrease in β-globin synthesis results, and approximately half of β(E)/β(0)-thalassaemia patients are transfusion-dependent. The only available curative therapy is allogeneic haematopoietic stem cell transplantation, although most patients do not have a human-leukocyte-antigen-matched, geno-identical donor, and those who do still risk rejection or graft-versus-host disease. Here we show that, 33 months after lentiviral β-globin gene transfer, an adult patient with severe β(E)/β(0)-thalassaemia dependent on monthly transfusions since early childhood has become transfusion independent for the past 21 months. Blood haemoglobin is maintained between 9 and 10 g dl(-1), of which one-third contains vector-encoded β-globin. Most of the therapeutic benefit results from a dominant, myeloid-biased cell clone, in which the integrated vector causes transcriptional activation of HMGA2 in erythroid cells with further increased expression of a truncated HMGA2 mRNA insensitive to degradation by let-7 microRNAs. The clonal dominance that accompanies therapeutic efficacy may be coincidental and stochastic or result from a hitherto benign cell expansion caused by dysregulation of the HMGA2 gene in stem/progenitor cells.

Precision Genome Editing for Treating Single-gene Disorders

NASA Astrophysics Data System (ADS)

Bao, Gang

There are an estimated 6,000 human single-gene disorders, most of them have no cure. This imposes a significant burden on human health worldwide. The recent advent in developing engineered nucleases, especially CRISPR/Cas9 (clustered, regularly interspaced, short palindromic repeats and CRISPR-associated protein 9) systems provides a powerful tool for precisely modifying the human genome, thus revolutionizing the treatment of single-gene disorders. In this talk, I will present recent work in my lab on developing new tools and methods for the design and optimization of CRISPR/Cas9 systems, and the efforts in developing a clinically applicable gene correction strategy for treating sickle cell disease (SCD), which is the first single-gene disorder with molecular understanding. We optimized CRISPR/Cas9 systems targeting the beta-globin gene, and systematically evaluated their on- and off-target cleavage in different cells. We also quantified the nuclease-induced gene modification rates in CD34+ cells from SCD patients, and demonstrated that CRISPR/Cas9 based genome editing is effective in generating normal hemoglobin (HbA) and reducing sickling hemoglobin (HbS). These studies significantly facilitated our pre-clinical investigation of SCD treatment using CRISPR/Cas9 and donor templates. The opportunities and challenges in developing nuclease-based genome editing strategies for treating single-gene disorders are discussed.

PGC-1 Coactivator Activity Is Required for Murine Erythropoiesis

PubMed Central

Cui, Shuaiying; Tanabe, Osamu; Lim, Kim-Chew; Xu, H. Eric; Zhou, X. Edward; Lin, Jiandie D.; Shi, Lihong; Schmidt, Lindsay; Campbell, Andrew; Shimizu, Ritsuko; Yamamoto, Masayuki

2014-01-01

Peroxisome proliferator-activated receptor gamma (PPARγ) coactivator 1α (PGC-1α) and PGC-1β have been shown to be intimately involved in the transcriptional regulation of cellular energy metabolism as well as other biological processes, but both coactivator proteins are expressed in many other tissues and organs in which their function is, in essence, unexplored. Here, we found that both PGC-1 proteins are abundantly expressed in maturing erythroid cells. PGC-1α and PGC-1β compound null mutant (Pgc-1c) animals express less β-like globin mRNAs throughout development; consequently, neonatal Pgc-1c mice exhibit growth retardation and profound anemia. Flow cytometry shows that the number of mature erythrocytes is markedly reduced in neonatal Pgc-1c pups, indicating that erythropoiesis is severely compromised. Furthermore, hematoxylin and eosin staining revealed necrotic cell death and cell loss in Pgc-1c livers and spleen. Chromatin immunoprecipitation studies revealed that both PGC-1α and -1β, as well as two nuclear receptors, TR2 and TR4, coordinately bind to the various globin gene promoters. In addition, PGC-1α and -1β can interact with TR4 to potentiate transcriptional activation. These data provide new insights into our understanding of globin gene regulation and raise the interesting possibility that the PGC-1 coactivators can interact with TR4 to elicit differential stage-specific effects on globin gene transcription. PMID:24662048

Erythroid differentiation ability of butyric acid analogues: identification of basal chemical structures of new inducers of foetal haemoglobin.

PubMed

Bianchi, Nicoletta; Chiarabelli, Cristiano; Zuccato, Cristina; Lampronti, Ilaria; Borgatti, Monica; Amari, Gabriele; Delcanale, Maurizio; Chiavilli, Francesco; Prus, Eugenia; Fibach, Eitan; Gambari, Roberto

2015-04-05

Several investigations have demonstrated a mild clinical status in patients with β-globin disorders and congenital high persistence of foetal haemoglobin. This can be mimicked by a pharmacological increase of foetal γ-globin genes expression and foetal haemoglobin production. Our goal was to apply a multistep assay including few screening methods (benzidine staining, RT-PCR and HPLC analyses) and erythroid cellular model systems (the K562 cell line and erythroid precursors collected from peripheral blood) to select erythroid differentiation agents with foetal haemoglobin inducing potential. With this methodology, we have identified a butyric acid derivative, namely the 4174 cyclopropanecarboxylic acid compound, able to induce erythroid differentiation without antiproliferative effect in K562 cells and increase of γ-globin gene expression in erythroid precursor cells. The results are relevant for pharmacological treatments of haemoglobinopathies, including β-thalassaemia and sickle cell anaemia. Copyright © 2015 Elsevier B.V. All rights reserved.

Interleukin-1 gene cluster variants in hemodialysis patients with end stage renal disease: An association and meta-analysis

PubMed Central

Tripathi, G.; Rangaswamy, D.; Borkar, M.; Prasad, N.; Sharma, R. K.; Sankhwar, S. N.; Agrawal, S.

2015-01-01

We evaluated whether polymorphisms in interleukin (IL-1) gene cluster (IL-1 alpha [IL-1A], IL-1 beta [IL-1B], and IL-1 receptor antagonist [IL-1RN]) are associated with end stage renal disease (ESRD). A total of 258 ESRD patients and 569 ethnicity matched controls were examined for IL-1 gene cluster. These were genotyped for five single-nucleotide gene polymorphisms in the IL-1A, IL-1B and IL-1RN genes and a variable number of tandem repeats (VNTR) in the IL-1RN. The IL-1B − 3953 and IL-1RN + 8006 polymorphism frequencies were significantly different between the two groups. At IL-1B, the T allele of − 3953C/T was increased among ESRD (P = 0.0001). A logistic regression model demonstrated that two repeat (240 base pair [bp]) of the IL-1Ra VNTR polymorphism was associated with ESRD (P = 0.0001). The C/C/C/C/C/1 haplotype was more prevalent in ESRD = 0.007). No linkage disequilibrium (LD) was observed between six loci of IL-1 gene. We further conducted a meta-analysis of existing studies and found that there is a strong association of IL-1 RN VNTR 86 bp repeat polymorphism with susceptibility to ESRD (odds ratio = 2.04, 95% confidence interval = 1.48-2.82; P = 0.000). IL-1B − 5887, +8006 and the IL-1RN VNTR polymorphisms have been implicated as potential risk factors for ESRD. The meta-analysis showed a strong association of IL-1RN 86 bp VNTR polymorphism with susceptibility to ESRD. PMID:25684870

Tetra primer ARMS-PCR relates folate/homocysteine pathway genes and ACE gene polymorphism with coronary artery disease.

PubMed

Masud, Rizwan; Qureshi, Irfan Zia

2011-09-01

Cardiovascular disorders and coronary artery disease (CAD) are significant contributors to morbidity and mortality in heart patients. As genes of the folate/homocysteine pathway have been linked with the vascular disease, we investigated association of these gene polymorphisms with CAD/myocardial infarction (MI) using the novel approach of tetraprimer ARMS-PCR. A total of 230 participants (129 MI cases, 101 normal subjects) were recruited. We genotyped rs1801133 and rs1801131 SNPs in 5'10' methylenetetrahydrofolate reductase (MTHFR), rs1805087 SNP in 5' methyltetrahydrofolate homocysteine methyltransferase (MTR), rs662 SNP in paroxanse1 (PON1), and rs5742905 polymorphism in cystathionine beta synthase (CBS). Angiotensin converting enzyme (ACE) insertion/deletion polymorphism was detected through conventional PCR. Covariates included blood pressure, fasting blood sugar, serum cholesterol, and creatinine concentrations. Our results showed allele frequencies at rs1801133, rs1801131, rs1805087 and the ACE insertion/deletion (I/D) polymorphism varied between cases and controls. Logistic regression, after adjusting for covariates, demonstrated significant associations of rs1801133 and rs1805087 with CAD in the additive, dominant, and genotype model. In contrast, ACE I/D polymorphism was significantly related with CAD where recessive model was applied. Gene-gene interaction against the disease status revealed two polymorphism groups: rs1801133, rs662, and rs1805087; and rs1801131, rs662, and ACE I/D. Only the latter interaction maintained significance after adjusted for covariates. Our study concludes that folate pathway variants exert contributory influence on susceptibility to CAD. We further suggest that tetraprimer ARMS-PCR successfully resolves the genotypes in selected samples and might prove to be a superior technique compared to the conventional approach.

Development of an adenoviral vector with robust expression driven by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

2008-02-05

Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

Alterations in cholesterol metabolism-related genes in sporadic Alzheimer's disease.

PubMed

Picard, Cynthia; Julien, Cédric; Frappier, Josée; Miron, Justin; Théroux, Louise; Dea, Doris; Breitner, John C S; Poirier, Judes

2018-06-01

Genome-wide association studies have identified several cholesterol metabolism-related genes as top risk factors for late-onset Alzheimer's disease (LOAD). We hypothesized that specific genetic variants could act as disease-modifying factors by altering the expression of those genes. Targeted association studies were conducted with available genomic, transcriptomic, proteomic, and histopathological data from 3 independent cohorts: the Alzheimer's Disease Neuroimaging Initiative (ADNI), the Quebec Founder Population (QFP), and the United Kingdom Brain Expression Consortium (UKBEC). First, a total of 273 polymorphisms located in 17 cholesterol metabolism-related loci were screened for associations with cerebrospinal fluid LOAD biomarkers beta amyloid, phosphorylated tau, and tau (from the ADNI) and with amyloid plaque and tangle densities (from the QFP). Top polymorphisms were then contrasted with gene expression levels measured in 134 autopsied healthy brains (from the UKBEC). In the end, only SREBF2 polymorphism rs2269657 showed significant dual associations with LOAD pathological biomarkers and gene expression levels. Furthermore, SREBF2 expression levels measured in LOAD frontal cortices inversely correlated with age at death; suggesting a possible influence on survival rate. Copyright © 2018 Elsevier Inc. All rights reserved.

[Expression and purification of a novel thermophilic bacterial single-stranded DNA-binding protein and enhancement the synthesis of DNA and cDNA].

PubMed

Jia, Xiao-Wei; Zhang, Guo-Hui; Shi, Hai-Yan

2012-12-01

Express a novel species of single-stranded DNA-binding protein (SSB) derived from Thermococcus kodakarensis KOD1, abbreviated kod-ssb. And evaluate the effect of kod-ssb on PCR-based DNA amplification and reverse transcription. We express kod-ssb with the Transrtta (DE3), and kod-ssb was purified by affinity chromatography on a Ni2+ Sepharose column, detected by SDS-PAGE. To evaluate the effect of kod-ssb on PCR-based DNA amplification, the human beta globin gene was used as template to amplify a 5-kb, 9-kb and 13-kb. And to detect the effect of kod-ssb on reverse transcription, we used RNA from flu cell culture supernatant extraction as templates to implement qRT-PCR reaction. The plasmid pET11a-kod was transformed into Transetta (DE3) and the recombinant strain Transetta (pET11 a-kod) was obtained. The kod-ssb was highly expressed when the recombinant strain Transetta(pET11a-kod) was induced by IPTG. The specific protein was detected by SDS-PAGE. To confirm that kod-ssb can enhance target DNA synthesis and reduce PCR by-products, 5-, 9-, and 13-kb human beta globin gene fragments were used as templates for PCR. When PCR reactions did not include SSB proteins, the specific PCR product was contaminated with non-specific products. When kod -ssb was added, kod-ssb significantly enhanced amplification of the 5-, 9-and 13-kb target product and minimised the non-specific PCR products. To confirm that kod-ssb can enhance target cDNA synthesis, RNA from flu cell culture supernatant extraction was used as templates for qRT-PCR reaction. The results was that when kod-ssb was added, kod-ssb significantly enhanced the synthesis of cDNA, average Ct value is 19.42, and the average Ct value without kod-ssb is 22.15. kod-ssb may in future be used to enhance DNA and cDNA amplification.

Human papillomavirus in normal conjunctival tissue and in conjunctival papilloma: types and frequencies in a large series.

PubMed

Sjö, Nicolai Christian; von Buchwald, Christian; Cassonnet, Patricia; Norrild, Bodil; Prause, Jan Ulrik; Vinding, Troels; Heegaard, Steffen

2007-08-01

To examine conjunctival papilloma and normal conjunctival tissue for the presence of human papillomavirus (HPV). Archival paraffin wax-embedded tissue from 165 conjunctival papillomas and from 20 histological normal conjunctival biopsy specimens was analysed for the presence of HPV by PCR. Specimens considered HPV positive using consensus primers, but with a negative or uncertain PCR result using type-specific HPV probes, were analysed with DNA sequencing. HPV was present in 86 of 106 (81%) beta-globin-positive papillomas. HPV type 6 was positive in 80 cases, HPV type 11 was identified in 5 cases and HPV type 45 was present in a single papilloma. All the 20 normal conjunctival biopsy specimens were beta-globin positive and HPV negative. There is a strong association between HPV and conjunctival papilloma. The study presents the largest material of conjunctival papilloma investigated for HPV and the first investigation of HPV in normal conjunctival tissue. HPV types 6 and 11 are the most common HPV types in conjunctival papilloma. This also is the first report of HPV type 45 in conjunctival papilloma.

Genetic polymorphisms variants in interleukin-6 and interleukin-1beta patients with obstructive sleep apnea syndrome in East Northern Turkey.

PubMed

Gok, Ilhami; Huseyinoglu, Nergiz; Ilhan, Dogan

2015-08-01

To investigate the relationship of IL-1β and IL-6 cytokine gene polymorphisms with obstructive sleep apnea syndrome (OSAS) in 61 patients admitted to the neurology clinic in Kafkas University Hospital with insomnia problem who were diagnosed with OSAS in sleeping labs, and 80 healthy subjects not associated with the syndrome. METHODS :Blood samples were taken to isolate DNA from patients diagnosed with OSAS based on polysomnography results and healthy controls. DNA amplification of the genes was performed with PCR. Amplification products were cut with the restriction enzymes in order to determine IL-1 gene (TaqI) and IL-6 gene (Lwel) polymorphisms. The cut DNA fragments were carried out in agarose gel electrophoresis, and RFLP analysis was performed by utilizing the images with gel imaging system. PCR products were sequenced with an Applied Biosystems Automated Sequencer. Polymorphic changes were observed for IL-1β gene in 26 of 62 patients (41.9%), and 16 of the 80 (25.8%) in the control group. The incidence of polymorphic changes in IL-6 gene was in seen in seven (of the 62 patients) (11.3%), and in the 16 (20%) controls. The findings on the genomic level in OSAS may provide an important contribution to diagnosis of obstructive sleep apnea syndrome in clinical practice, as well as it helps to obtain the results easily about environmental and genetic interaction of OSAS patients. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.

Hb Dartmouth (HBA2: c.200T>C): An α2-Globin Gene Associated with Hb H Disease in One Homozygous Patient.

PubMed

Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.

LDB1-mediated enhancer looping can be established independent of mediator and cohesin.

PubMed

Krivega, Ivan; Dean, Ann

2017-08-21

Mechanistic studies in erythroid cells indicate that LDB1, as part of a GATA1/TAL1/LMO2 complex, brings erythroid-expressed genes into proximity with enhancers for transcription activation. The role of co-activators in establishing this long-range interaction is poorly understood. Here we tested the contributions of the RNA Pol II pre-initiation complex (PIC), mediator and cohesin to establishment of locus control region (LCR)/β-globin proximity. CRISPR/Cas9 editing of the β-globin promoter to eliminate the RNA Pol II PIC by deleting the TATA-box resulted in loss of transcription, but enhancer-promoter interaction was unaffected. Additional deletion of the promoter GATA1 site eliminated LDB1 complex and mediator occupancy and resulted in loss of LCR/β-globin proximity. To separate the roles of LDB1 and mediator in LCR looping, we expressed a looping-competent but transcription-activation deficient form of LDB1 in LDB1 knock down cells: LCR/β-globin proximity was restored without mediator core occupancy. Further, Cas9-directed tethering of mutant LDB1 to the β-globin promoter forced LCR loop formation in the absence of mediator or cohesin occupancy. Moreover, ENCODE data and our chromatin immunoprecipitation results indicate that cohesin is almost completely absent from validated and predicted LDB1-regulated erythroid enhancer-gene pairs. Thus, lineage specific factors largely mediate enhancer-promoter looping in erythroid cells independent of mediator and cohesin. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

Sickle cell disease in the Kurdish population of northern Iraq.

PubMed

Al-Allawi, Nasir A S; Jalal, Sana D; Nerwey, Farida F; Al-Sayan, Galawezh O O; Al-Zebari, Sahima S M; Alshingaly, Awny A; Markous, Raji D; Jubrael, Jaladet M S; Hamamy, Hanan

2012-01-01

Epidemiological studies have revealed that sickle cell disease patients are clustered in two geographical areas in Iraq, one among the Arabs in the extreme south, another among the Kurdish population in the extreme north, where they constitute major health problems. However, no studies have focused on the genotypes responsible for sickle cell disease or the β-globin gene haplotypes associated with it. For the latter purpose, a total of 103 unrelated Kurdish sickle cell disease patients were evaluated by restriction fragment length polymorphism (RFLP) for the sickle cell mutation, followed by multiplex polymerase chain reaction (PCR) and reverse hybridization for β- and α-thalassemia (β- and α-thal) mutations, whenever indicated. Results showed that the most common genotype was sickle cell anemia (68.0%) followed by Hb S/β(0)-thal and Hb S/β(+)-thal at frequencies of 24.2 and 7.8%, respectively. Eight β-thal mutations were associated with the latter two genotypes including: IVS-II-1 (G>A), IVS-I-110 (G>A), codon 8 (-AA), codon 44 (-C), codon 22 (-7 bp), IVS-I-1 (G>A), codon 30 (G>C) and IVS-I-6 (T>C). In Hb SS patients, the -α(3.7) deletion was documented in 10.0% and was the only α-thal mutation detected. Furthermore, 5' β-globin gene cluster haplotyping of 128 β(S) chromosomes revealed that the most common haplotype seen in 69.5% was the Benin haplotype, followed by the Arab-Indian haplotype in 12.5%. These latter findings closely resemble reports from neighboring Turkey, Syria, Jordan, Lebanon and Mediterranean countries, suggesting a possible common origin, but are in contrast to findings from the Eastern Arabian Peninsula and Iran.

Directional and balancing selection in human beta-defensins.

PubMed

Hollox, Edward J; Armour, John A L

2008-04-16

In primates, infection is an important force driving gene evolution, and this is reflected in the importance of infectious disease in human morbidity today. The beta-defensins are key components of the innate immune system, with antimicrobial and cell signalling roles, but also reproductive functions. Here we examine evolution of beta-defensins in catarrhine primates and variation within different human populations. We show that five beta-defensin genes that do not show copy number variation in humans show evidence of positive selection in catarrhine primates, and identify specific codons that have been under selective pressure. Direct haplotyping of DEFB127 in humans suggests long-term balancing selection: there are two highly diverged haplotype clades carrying different variants of a codon that, in primates, is positively selected. For DEFB132, we show that extensive diversity, including a four-state amino acid polymorphism (valine, isoleucine, alanine and threonine at position 93), is present in hunter-gatherer populations, both African and non-African, but not found in samples from agricultural populations. Some, but not all, beta-defensin genes show positive selection in catarrhine primates. There is suggestive evidence of different selective pressures on these genes in humans, but the nature of the selective pressure remains unclear and is likely to differ between populations.

Effects of polymorphisms in beta1-adrenoceptor and alpha-subunit of G protein on heart rate and blood pressure during exercise test. The Finnish Cardiovascular Study.

PubMed

Nieminen, Tuomo; Lehtimäki, Terho; Laiho, Jarno; Rontu, Riikka; Niemelä, Kari; Kööbi, Tiit; Lehtinen, Rami; Viik, Jari; Turjanmaa, Väinö; Kähönen, Mika

2006-02-01

We tested whether the Arg389Gly and Ser49Gly polymorphisms of the beta1-adrenergic receptor gene ADRB1 and the T393C polymorphism of the G protein alpha-subunit gene GNAS1 modulate heart rate (HR) and blood pressure responses during an exercise stress test. The study population comprised 890 participants (563 men and 327 women, mean age 58.1 +/- 12.6 yr) of the Finnish Cardiovascular Study. Their HR, systolic (SAP), and diastolic arterial pressures (DAP) at rest, during exercise, and 4 min after the test were measured and analyzed by repeated-measurement ANOVA (RANOVA). Genotypes were detected by TaqMan 5' nuclease assay. In all subjects, and in men and women separately, the T393C of GNAS1 was the only polymorphism with genotype x time interaction in HR over the three study phases (P = 0.04, RANOVA). None of the polymorphisms presented genotype x time interaction in SAP or DAP responses (P > 0.10, RANOVA). In all subjects at rest, the Ser49Gly polymorphism of ADRB1 tended (P = 0.06, ANOVA) to differentiate HR. Arg389Gly polymorphism of ADRB1 affected maximal SAP during exercise (P = 0.04, ANOVA) and the change in SAP from rest to maximal (P = 0.03, ANOVA). Arg389 homozygotes, particularly men, were less likely to have ventricular extrasystoles during the exercise (odds ratio = 0.68, 95% confidence interval = 0.51-0.91, P = 0.009, and odds ratio = 0.60, 95% confidence interval = 0.42-0.86, P = 0.006, respectively) than did Gly389 carriers. In conclusion, polymorphisms examined appear to have modulatory effects on hemodynamics in a clinical exercise test setting. However, the effects in absolute numbers were minor and clinically possibly insignificant.

Genetic association between Alzheimer disease and the alpha-synuclein gene.

PubMed

Matsubara, M; Yamagata, H; Kamino, K; Nomura, T; Kohara, K; Kondo, I; Miki, T

2001-01-01

alpha-Synuclein has been isolated as a component of amyloid in addition to the major A beta peptide in Alzheimer disease (AD). However, there are conflicting reports regarding the association of alpha-synuclein gene polymorphism with AD. Using a novel and common polymorphism in intron 3, we examined the relationship between AD and alpha-synuclein and apolipoprotein E (ApoE) genes in 183 Japanese AD patients and 210 controls. Carriers of the alpha-synuclein deletion (D) allele had a 2.2-fold increased risk of developing AD than noncarriers in women. The odds ratio for the ApoE epsilon 4 and the alpha-synuclein D allele was 11.4 in women. The results showed that the alpha-synuclein gene is associated with sporadic AD in women, independent of ApoE epsilon 4 status. Copyright 2001 S. Karger AG, Basel

Incorporating Single-nucleotide Polymorphisms Into the Lyman Model to Improve Prediction of Radiation Pneumonitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tucker, Susan L., E-mail: sltucker@mdanderson.org; Li Minghuan; Xu Ting

2013-01-01

Purpose: To determine whether single-nucleotide polymorphisms (SNPs) in genes associated with DNA repair, cell cycle, transforming growth factor-{beta}, tumor necrosis factor and receptor, folic acid metabolism, and angiogenesis can significantly improve the fit of the Lyman-Kutcher-Burman (LKB) normal-tissue complication probability (NTCP) model of radiation pneumonitis (RP) risk among patients with non-small cell lung cancer (NSCLC). Methods and Materials: Sixteen SNPs from 10 different genes (XRCC1, XRCC3, APEX1, MDM2, TGF{beta}, TNF{alpha}, TNFR, MTHFR, MTRR, and VEGF) were genotyped in 141 NSCLC patients treated with definitive radiation therapy, with or without chemotherapy. The LKB model was used to estimate the risk ofmore » severe (grade {>=}3) RP as a function of mean lung dose (MLD), with SNPs and patient smoking status incorporated into the model as dose-modifying factors. Multivariate analyses were performed by adding significant factors to the MLD model in a forward stepwise procedure, with significance assessed using the likelihood-ratio test. Bootstrap analyses were used to assess the reproducibility of results under variations in the data. Results: Five SNPs were selected for inclusion in the multivariate NTCP model based on MLD alone. SNPs associated with an increased risk of severe RP were in genes for TGF{beta}, VEGF, TNF{alpha}, XRCC1 and APEX1. With smoking status included in the multivariate model, the SNPs significantly associated with increased risk of RP were in genes for TGF{beta}, VEGF, and XRCC3. Bootstrap analyses selected a median of 4 SNPs per model fit, with the 6 genes listed above selected most often. Conclusions: This study provides evidence that SNPs can significantly improve the predictive ability of the Lyman MLD model. With a small number of SNPs, it was possible to distinguish cohorts with >50% risk vs <10% risk of RP when they were exposed to high MLDs.« less

Polymorphism of the beta 3-adrenergic receptor gene in morbid obesity.

PubMed

Oksanen, L; Mustajoki, P; Kaprio, J; Kainulainen, K; Jänne, O; Peltonen, L; Kontula, K

1996-12-01

The Trp64-->Arg allele of the beta 3-adrenergic receptor gene was recently proposed to be associated with an earlier onset of non-insulin-dependent diabetes mellitus (NIDDM), features of insulin resistance and a tendency to gain weight. We investigated whether the Arg64 allele predisposes to severe obesity. A genetic association study of 254 subjects with morbid obesity [body-mass index (BMI) > or = 40; mean 42.8 +/- 7.0] and 151 lean healthy control subjects [BMI < or = 25; mean BMI 22.3 +/- 1.9]. beta 3-adrenergic receptor genotyping was carried out with a solid-phase minisequencing technique. Serum lipids, glucose and insulin levels in the obese subjects were also determined. The frequency of the Arg64 did not significantly differ in the morbidly obese patients (9.1%) and lean controls (8.9%), nor was there any statistically significant association between the mean BMI values and the beta 3-adrenergic receptor genotype. However, obese subjects carrying the Arg64 allele developed obesity more often before the age of 15 y than those without it (P < 0.05, adjusted for multiple comparisons). The frequency of the Arg64 allele was similar in nondiabetic and diabetic patients; the mean age at the onset of NIDDM did not differ according to the beta 3-adrenergic receptor genotype. There was no significant association between the receptor genotype and the level of the serum cholesterol, HDL-cholesterol, triglyceride, glucose or insulin, nor was this polymorphism associated with the behavioural or psychopathological characteristics of the morbidly obese subjects. Response to a 16 w treatment program including a very-low calorie diet (VLCD) regimen, dietary and exercise counseling, as well as behavioural modifications, did not differ according to the genotype. Our data do not support a significant role for the codon 64 polymorphism of the beta 3-adrenergic receptor as a genetic marker of morbid obesity. Although there was an association between the Arg64 allele and an earlier onset of obesity in individuals subsequently developing morbid obesity, this allele was not associated with the actual BMI gained or response to weight-loss therapy on a hypocaloric diet.

Allele related mutation specific-polymerase chain reaction for rapid diagnosis of Hb New York (beta 113 (G15) Val-->Glu, beta(CD113 GTG-->GAG)).

PubMed

Viprakasit, Vip; Tachavanich, Kalaya; Suwantol, Lerlugsn; Pung-Amritt, Parichat; Chinchang, Worawut; Tanphaichitr, Voravarn S

2002-08-01

Hemoglobin New York (beta 113 (G15) Val-->Glu), a beta-globin variant, was first reported in a Chinese family living in New York. Subsequently, this abnormal hemoglobin was reported in many Chinese descendants from several groups and it was also known as Hb Kaohsiung. The subtle change in alpha1beta1 contact region apart from the heme group connecting area by Val-->Glu substitution has minor changes in both the electrophoretic mobility and stability making this hemoglobin variant difficult to distinguish from Hb A using routine hemoglobin analysis. The authors described a case of heterozygosity of Hb New York diagnosed by a molecular technique and revealed a mutation in beta(CD113 GTG-->GAG). A novel Allele Related Mutation Specific-Polymerase Chain Reaction (ARMS-PCR) for rapid diagnosis of this mutation has been proposed.

GABA-A receptor beta3 and alpha5 subunit gene cluster on chromosome 15q11-q13 and bipolar disorder: a genetic association study.

PubMed

Papadimitriou, G N; Dikeos, D G; Karadima, G; Avramopoulos, D; Daskalopoulou, E G; Stefanis, C N

2001-05-08

There is accumulated evidence that the genes coding for the receptor of gamma aminobutyric acid (GABA), the most important inhibitory neurotransmitter in the CNS, may be involved in the pathogenesis of affective disorders. In a previous study, we have found a genetic association between the GABA-A receptor alpha5 subunit gene locus (GABRA5) on chromosome 15q11-of 13 and bipolar affective disorder. The aim of the present study was to examine the same subjects to see if there exists a genetic association between bipolar affective disorder and the GABA receptor beta3 subunit gene (GABRB3), which is located within 100 kb from GABRA5. The sample consisted of 48 bipolar patients compared to 44 controls (blood donors). All subjects were Greek, unrelated, and personally interviewed. Diagnosis was based on DSM-IV and ICD-10 criteria. The marker used was a dinucleotide (CA) repeat polymorphism with 12 alleles 179 to 201 bp long; genotyping was successful in all patients and 43 controls. The distribution of GABRB3 genotypes among the controls did not deviate significantly from the Hardy-Weinberg equilibrium. No differences in allelic frequencies between bipolar patients and controls were found for GABRB3, while this locus and GABRA5 did not seem to be in significant linkage disequilibrium. In conclusion, the GABRB3 CA-repeat polymorphism we investigated does not present the observed association between bipolar affective illness and GABRA5. This could be due to higher mutation rate in the GABRB3 CA-repeat polymorphism, but it might also signify that GABRA5 is the gene actually associated with the disease. Copyright 2001 Wiley-Liss, Inc.

Possible association between Interleukin-1beta gene and schizophrenia in a Japanese population

PubMed Central

2011-01-01

Background Several lines of evidence have implicated the pro-inflammatory cytokine interleukin-1beta (IL-1β) in the etiology of schizophrenia. Although a number of genetic association studies have been reported, very few have systematically examined gene-wide tagging polymorphisms. Methods A total of 533 patients with schizophrenia (302 males: mean age ± standard deviation 43.4 ± 13.0 years; 233 females; mean age 44.8 ± 15.3 years) and 1136 healthy controls (388 males: mean age 44.6 ± 17.3 years; 748 females; 46.3 ± 15.6 years) were recruited for this study. All subjects were biologically unrelated Japanese individuals. Five tagging polymorphisms of IL-1β gene (rs2853550, rs1143634, rs1143633, rs1143630, rs16944) were examined for association with schizophrenia. Results Significant difference in allele distribution was found between patients with schizophrenia and controls for rs1143633 (P = 0.0089). When the analysis was performed separately in each gender, significant difference between patients and controls in allele distribution of rs1143633 was observed in females (P = 0.0073). A trend towards association was also found between rs16944 and female patients with schizophrenia (P = 0.032). Conclusions The present study shows the first evidence that the IL-1β gene polymorphism rs1143633 is associated with schizophrenia susceptibility in a Japanese population. The results suggest the possibility that the influence of IL-1β gene variations on susceptibility to schizophrenia may be greater in females than in males. Findings of the present study provide further support for the role of IL-1β in the etiology of schizophrenia. PMID:21843369

Epistatic effect of plasminogen activator inhibitor 1 and beta-fibrinogen genes on risk of glomerular microthrombosis in lupus nephritis: interaction with environmental/clinical factors.

PubMed

Gong, Rujun; Liu, Zhihong; Li, Leishi

2007-05-01

Glomerular microthrombosis (GMT) is not uncommon in lupus nephritis and has been associated with active renal injury and progressive kidney destruction. We undertook this study to determine whether genetic variations of hemostasis factors, such as plasminogen activator inhibitor 1 (PAI-1) and fibrinogen, affect the risk of GMT. A cross-sectional cohort of 101 lupus nephritis patients with or without GMT was genotyped for PAI-1 -675 4G/5G and beta-fibrinogen (FGB) -455 G/A gene polymorphisms and analyzed. PAI-1 4G/4G homozygotes and FGB A allele carriers were both at increased risk for GMT. When the data were stratified for both gene polymorphisms, an epistatic effect was detected. The PAI-1 4G/4G genotype was found to predispose to GMT not equally in all lupus nephritis patients, but only in FGB A allele carriers. Likewise, the association between the FGB A allele and GMT was restricted to lupus nephritis patients homozygous for the PAI-1 4G allele. This epistatic effect was revalidated by the multifactor dimensionality reduction (MDR) analysis and further assessed by incorporating a variety of environmental and clinical factors into the MDR analysis. The most parsimonious model that had a cross-validation consistency of 100% included joint effects of PAI-1 and FGB gene polymorphisms and anticardiolipin antibody (aCL) status and yielded the best prediction of GMT, with 66.6% accuracy. Our findings suggest that risk of GMT in lupus nephritis is attributable, at least in part, to an epistatic effect of PAI-1 and FGB genes, likely via an interaction with environmental/clinical factors, such as aCL.

Trans activation of plasmid-borne promoters by adenovirus and several herpes group viruses.

PubMed Central

Everett, R D; Dunlop, M

1984-01-01

This paper describes experiments to test the ability of a number of viruses of the Herpes group, and also Adenovirus-2 and SV40, to activate transcription from the Herpes simplex virus-1 glycoprotein D and the rabbit beta-globin promoters. Plasmids containing these genes were transfected into HeLa cells which were then infected with various viruses. Transcriptional activation in trans of the plasmid-borne promoters was monitored by quantitative S1 nuclease analysis of total cytoplasmic RNA isolated after infection. The results showed that Herpes simplex viruses 1 and 2, Pseudorabies virus, Variella Zoster virus, Human Cytomegalovirus, Equine herpes virus-1 and Adenovirus-2 activate transcription from both promoters tested. In contrast, SV40 did not activate transcription in trans in this assay. The possible mechanisms of this activation are discussed. Images PMID:6089105

No detection of SV40 DNA in mesothelioma tissues from a high incidence area in Sweden.

PubMed

Lundstig, Annika; Dejmek, Annika; Eklund, Carina; Filinic, Ivo; Dillner, Joakim

2007-01-01

Simian virus 40 (SV40), a polyoma virus of the rhesus macaque was discovered in 1960 as a contaminant of human polio vaccines produced in monkey cells. A number of studies have reported the detection of SV40 nucleotide sequences in human tumors, mainly mesotheliomas, but the reports have not been consistent. The presence of SV40 in 26 consecutive cases of malignant mesothelioma of biphasic type was investigated using a SV40 quantitative real time polymerase chain reaction (PCR) with a sensitivity of 10 copies of viral DNA per sample. All the samples were also tested for amplifiability using a real-time PCR for the beta-globin gene. Eighteen tumors were amplifiable, but none contained SV40 DNA. The results do not support an association between mesothelioma and SV40.

Polymorphisms in the circadian expressed genes PER3 and ARNTL2 are associated with diurnal preference and GNβ3 with sleep measures

PubMed Central

Parsons, Michael J; Lester, Kathryn J; Barclay, Nicola L; Archer, Simon N; Nolan, Patrick M; Eley, Thalia C; Gregory, Alice M

2014-01-01

Sleep and circadian rhythms are intrinsically linked, with several sleep traits, including sleep timing and duration, influenced by both sleep homeostasis and the circadian phase. Genetic variation in several circadian genes has been associated with diurnal preference (preference in timing of sleep), although there has been limited research on whether they are associated with other sleep measurements. We investigated whether these genetic variations were associated with diurnal preference (Morningness–Eveningness Questionnaire) and various sleep measures, including: the global Pittsburgh Sleep Quality index score; sleep duration; and sleep latency and sleep quality. We genotyped 10 polymorphisms in genes with circadian expression in participants from the G1219 sample (n = 966), a British longitudinal population sample of young adults. We conducted linear regressions using dominant, additive and recessive models of inheritance to test for associations between these polymorphisms and the sleep measures. We found a significant association between diurnal preference and a polymorphism in period homologue 3 (PER3) (P < 0.005, recessive model) and a novel nominally significant association between diurnal preference and a polymorphism in aryl hydrocarbon receptor nuclear translocator-like 2 (ARNTL2) (P < 0.05, additive model). We found that a polymorphism in guanine nucleotide binding protein beta 3 (GNβ3) was associated significantly with global sleep quality (P < 0.005, recessive model), and that a rare polymorphism in period homologue 2 (PER2) was associated significantly with both sleep duration and quality (P < 0.0005, recessive model). These findings suggest that genes with circadian expression may play a role in regulating both the circadian clock and sleep homeostasis, and highlight the importance of further studies aimed at dissecting the specific roles that circadian genes play in these two interrelated but unique behaviours. PMID:24635757

Electron transfer function versus oxygen delivery: a comparative study for several hexacoordinated globins across the animal kingdom.

PubMed

Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C

2011-01-01

Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.

Screening of Israeli Holstein-Friesian cattle for restriction fragment length polymorphisms using homologous and heterologous deoxyribonucleic acid probes.

PubMed

Hallerman, E M; Nave, A; Soller, M; Beckmann, J S

1988-12-01

Genomic DNA of Israeli Holstein-Friesian dairy cattle were screened with a battery of 17 cloned or subcloned DNA probes in an attempt to document restriction fragment length polymorphisms at a number of genetic loci. Restriction fragment length polymorphisms were observed at the chymosin, oxytocin-neurophysin I, lutropin beta, keratin III, keratin VI, keratin VII, prolactin, and dihydrofolate reductase loci. Use of certain genomic DNA fragments as probes produced hybridization patterns indicative of satellite DNA at the respective loci. Means for distinguishing hybridizations to coding sequences for unique genes from those to satellite DNA were developed. Results of this study are discussed in terms of strategy for the systematic development of large numbers of bovine genomic polymorphisms.

Low bone mineral density and vitamin d deficiency correlated with genetics and other bone markers in female Turkish immigrants in Germany.

PubMed

Tastan, Yasemin; Kann, Peter Herbert; Tinneberg, Hans-Rudolf; Hadji, Peyman; Müller-Ladner, Ulf; Lange, Uwe

2016-11-01

Patients with osteoporosis have a low bone mass resulting in an increased risk for bone fractures, morbidity and mortality. One hundred thirty-one female pre-menopausal participants (98 Turkish immigrants living in Germany in comparison with 33 age-matched healthy Germans) were recruited for this study which explored vitamin D deficiency and specific genetic modifications of bone metabolism. The subjects were investigated for their femoral and lumbar bone mineral density (BMD) by dual-energy X-ray absorptiometry (DEXA) of the right total femur and the lumbar spine. Serum levels of osteologic parameters were determined: parathormone (PTH), calcium (Ca), osteocalcin (OC), phosphate (P), alkaline phosphatase (AP), beta-crossLaps (CL), tartrate-resistant acid phosphatase isoform 5b (TRAP5b), and 25-vitamin D 3 (25-OH D 3 ). The Bsml- and Fokl-polymorphisms of the vitamin D receptor (VDR) gene and the collagen type I alpha 1 (COLIA1)-gene polymorphism were also genotyped. An extremely high prevalence of vitamin D deficiency could be found in the immigrant cohort (87.8 %). Osteoporosis but not osteopenia was more prevalent in this group. Among immigrants with osteoporosis, TRAP5b was elevated in 42.9 % and beta-CL in 28.6 %. Only the Fokl FF-genotype of the VDR polymorphism was significantly more prevalent among the Turkish women, Ff-genotyped immigrants showed significantly decreased BMD. A significant correlation between the COLIA1-gene polymorphism and BMD could not be identified in the two groups. Vitamin D deficiency and osteoporosis appear to be dominant and unrecognized problem among female Turkish immigrants in Germany. Therefore, in this population, osteologic parameters and BMD should be routinely analyzed and deficiencies be treated immediately.

Some mutations of exon-7 in cytochrome P450 gene 3A4 and their effect on 6beta-hydroxylation of cortisol.

PubMed

Shchepotina, E G; Vavilin, V A; Goreva, O B; Lyakhovich, V V

2006-06-01

Analysis of variants of exon 7 sequences in cytochrome P450 gene 3A4 in a sample of Caucasoid persons was carried out. The effect of these variants on activity of CYP3A was assessed by the level of cortisol 6beta-hydroxylation. Alleles CYP3A4*5 and *17 were not detected: probably, these mutations are rare and consequently they have little effect on the character of polymorphic distribution of CYP3A4 activity in this population. The incidence of CYP3A4*2 was 5.26%. The 6betaOH-cortisol/cortisol ratio in an individual with CYP3A4*2/*2 genotype was 7.408, which corresponded to "slow metabolizer" phenotype in this sample.

Folate and One-Carbon Metabolism Gene Polymorphisms and Their Associations With Oral Facial Clefts

PubMed Central

Boyles, Abee L.; Wilcox, Allen J.; Taylor, Jack A.; Meyer, Klaus; Fredriksen, Åse; Ueland, Per Magne; Drevon, Christian A.; Vollset, Stein Emil; Lie, Rolv Terje

2008-01-01

Folate metabolism plays a critical role in embryonic development. Prenatal folate supplementation reduces the risk of neural tube defects and probably oral facial clefts. Previous studies of related metabolic genes have associated polymorphisms in cystathionine-beta-synthase (CBS) and 5,10-methylenetetrahydrofolate reductase (MTHFR) with cleft risk. We explored associations between genes related to one-carbon metabolism and clefts in a Norwegian population-based study that included 362 families with cleft lip with or without cleft palate (CL/P) and 191 families with cleft palate only (CPO). We previously showed a 39% reduction in risk of CL/P with folic acid supplementation in this population. In the present study we genotyped 12 polymorphisms in nine genes related to one-carbon metabolism and looked for associations of clefting risk with fetal polymorphisms, maternal polymorphisms, as well as parent-of-origin effects, using combined likelihood-ratio tests (LRT). We also stratified by maternal periconceptional intake of folic acid (>400 μg) to explore gene-exposure interactions. We found a reduced risk of CL/P with mothers who carried the CBS C699T variant (rs234706); relative risk was 0.94 with one copy of the T allele (95% CI 0.63-1.4) and 0.50 (95% CI 0.26-0.96) with two copies (P = 0.008). We found no evidence of interaction of this variant with folate status. We saw no evidence of risk from the MTHFR C677T variant (rs1801133) either overall or after stratifying by maternal folate intake. No associations were found between any of the polymorphisms and CPO. Genetic variations in the nine metabolic genes examined here do not confer a substantial degree of risk for clefts. Published 2008 Wiley-Liss, Inc.† PMID:18203168

Whole-Genome Duplication and the Functional Diversification of Teleost Fish Hemoglobins

PubMed Central

Opazo, Juan C.; Butts, G. Tyler; Nery, Mariana F.; Storz, Jay F.; Hoffmann, Federico G.

2013-01-01

Subsequent to the two rounds of whole-genome duplication that occurred in the common ancestor of vertebrates, a third genome duplication occurred in the stem lineage of teleost fishes. This teleost-specific genome duplication (TGD) is thought to have provided genetic raw materials for the physiological, morphological, and behavioral diversification of this highly speciose group. The extreme physiological versatility of teleost fish is manifest in their diversity of blood–gas transport traits, which reflects the myriad solutions that have evolved to maintain tissue O2 delivery in the face of changing metabolic demands and environmental O2 availability during different ontogenetic stages. During the course of development, regulatory changes in blood–O2 transport are mediated by the expression of multiple, functionally distinct hemoglobin (Hb) isoforms that meet the particular O2-transport challenges encountered by the developing embryo or fetus (in viviparous or oviparous species) and in free-swimming larvae and adults. The main objective of the present study was to assess the relative contributions of whole-genome duplication, large-scale segmental duplication, and small-scale gene duplication in producing the extraordinary functional diversity of teleost Hbs. To accomplish this, we integrated phylogenetic reconstructions with analyses of conserved synteny to characterize the genomic organization and evolutionary history of the globin gene clusters of teleosts. These results were then integrated with available experimental data on functional properties and developmental patterns of stage-specific gene expression. Our results indicate that multiple α- and β-globin genes were present in the common ancestor of gars (order Lepisoteiformes) and teleosts. The comparative genomic analysis revealed that teleosts possess a dual set of TGD-derived globin gene clusters, each of which has undergone lineage-specific changes in gene content via repeated duplication and deletion events. Phylogenetic reconstructions revealed that paralogous genes convergently evolved similar functional properties in different teleost lineages. Consistent with other recent studies of globin gene family evolution in vertebrates, our results revealed evidence for repeated evolutionary transitions in the developmental regulation of Hb synthesis. PMID:22949522

Effect of polymorphism of the beta(2)-adrenergic receptor on response to regular use of albuterol in asthma.

PubMed

Israel, E; Drazen, J M; Liggett, S B; Boushey, H A; Cherniack, R M; Chinchilli, V M; Cooper, D M; Fahy, J V; Fish, J E; Ford, J G; Kraft, M; Kunselman, S; Lazarus, S C; Lemanske, R F; Martin, R J; McLean, D E; Peters, S P; Silverman, E K; Sorkness, C A; Szefler, S J; Weiss, S T; Yandava, C N

2001-01-01

Regular use of inhaled beta-adrenergic agonists may have adverse effects in some asthma patients. Polymorphisms of the beta(2)-adrenergic receptor (beta(2)-AR) can affect its regulation; however, results of smaller studies of the effects of such polymorphisms on response to beta-agonist therapy have been inconsistent. We examined the possible effects of polymorphisms at codons 16 (beta(2)-AR-16) and 27 (beta(2)-AR-27) on response to albuterol by genotyping 190 asthmatics who had participated in a trial of regular versus as-needed albuterol use. During the 16-week treatment period, patients homozygous for arginine (Arg/Arg) at beta(2)-AR-16 who used albuterol regularly had a small decline in morning peak expiratory flow (AM PEF). This effect was magnified during a 4-week run-out period, when all patients returned to as-needed albuterol only. By the end of the study, Arg/Arg subjects who had used albuterol regularly had an AM PEF 30.5 +/- 12.1 liters/min lower (p = 0.012) than Arg/Arg patients who had used albuterol as needed only. Subjects homozygous for glycine at beta(2)-AR-16 showed no such decline. Evening PEF also declined in the Arg/Arg regular but not in as-need albuterol users. No significant differences between regular and as-needed treatment were associated with polymorphisms at beta(2)-AR-27. Polymorphisms of the beta(2)-AR may influence airway responses to regular inhaled beta-agonist treatment. Copyright 2001 S. Karger AG, Basel

Genetic Basis and Genetic Modifiers of β-Thalassemia and Sickle Cell Disease.

PubMed

Thein, Swee Lay

2017-01-01

β-thalassemia and sickle cell disease (SCD) are prototypical Mendelian single gene disorders, both caused by mutations affecting the adult β-globin gene. Despite the apparent genetic simplicity, both disorders display a remarkable spectrum of phenotypic severity and share two major genetic modifiers-α-globin genotype and innate ability to produce fetal hemoglobin (HbF, α 2 γ 2 ).This article provides an overview of the genetic basis for SCD and β-thalassemia, and genetic modifiers identified through phenotype correlation studies. Identification of the genetic variants modifying HbF production in combination with α-globin genotype provide some prediction of disease severity for β-thalassemia and SCD but generation of a personalized genetic risk score to inform prognosis and guide management requires a larger panel of genetic modifiers yet to be discovered.Nonetheless, genetic studies have been successful in characterizing some of the key variants and pathways involved in HbF regulation, providing new therapeutic targets for HbF reactivation.

Hb Mozhaisk [β92(F8)His→Arg; HBB: c.278A>G] as a De Novo Mutation in a Child of Mixed Ethnic Origins.

PubMed

Benzoni, Elena; Giannone, Valentina; Michetti, Laura; Seia, Manuela; Cavalleri, Laura; Curcio, Cristina

Approximately 150 variants described in the HbVar database have been found to be unstable and about 80.0% of these are on the β-globin gene. We describe the case of a 3-year-old child who presented at the emergency room with fever and asthenia. Hematological data suggested severe hemolytic anemia. Sequencing of the β-globin gene revealed the mutation HBB: c.278A>G at codon 92 in a heterozygous state, reported as Hb Mozhaisk in the HbVar database. Other family members did not have Hb Mozhaisk, thus, this variant is due to a de novo mutation. Because of the rarity of this globin variant, we believe it is important to report similar cases, to have a more complete phenotype description of the pathology and define an adequate reproductive risk for couples, considering the dominant inheritance pattern (hence an inheritance risk of 50.0%).

The structure of the human interferon alpha/beta receptor gene.

PubMed

Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G

1992-02-05

Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.

VNTR internal structure mapping at the {alpha}-globin 3{prime}HVR locus reveals a hierachy of related lineages in oceania

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

1994-09-01

Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. Wemore » have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.« less

TGF-beta(1) gene-race interactions for resting and exercise blood pressure in the HERITAGE Family Study.

PubMed

Rivera, M A; Echegaray, M; Rankinen, T; Pérusse, L; Rice, T; Gagnon, J; Leon, A S; Skinner, J S; Wilmore, J H; Rao, D C; Bouchard, C

2001-10-01

We examined the possible association between a transforming growth factor (TGF)-beta(1) gene polymorphism in codon 10 and blood pressure (BP) at rest, in acute response to exercise in the pretrained (sedentary) and trained states, as well as in its training response (Delta) to 20 wk of endurance exercise. Subjects were 257 black and 480 white, healthy sedentary normotensive subjects from the HERITAGE Family Study. The polymorphism was detected by polymerase chain reaction and digestion with the Msp A1 I endonuclease yielding a wild (leucine-10) and a mutant (proline-10) allele. Resting and exercise [50 W plus 60, 80, and 100% maximal oxygen consumption (VO(2)(max))] BP were determined before and after training. Significant (P < 0.05) race-genotype interactions were found for systolic (S) BP in both the sedentary and trained states. Among whites but not in blacks, the TGF-beta(1) genotypes were significantly (P < 0.05) associated with sedentary-state SBP at rest, at 50 W, and at 60 and 100% VO(2)(max)as well as with trained-state SBP at rest and at 80 and 100% VO(2)(max). The leucine-10 homozygotes had significantly (P < 0.05) lower SBP than proline-10 homozygotes. DeltaBP was not significantly associated with genotype. These results support the hypothesis of an association between the TGF-beta(1) marker in codon 10 and SBP at rest and in response to acute exercise in whites but not in blacks.

Characterization of class II alpha genes and DLA-D region allelic associations in the dog.

PubMed

Sarmiento, U M; Storb, R F

1988-10-01

Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the alpha genes of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (BamHI, EcoRI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I and Bgl II), separated by agarose gel electrophoresis and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabelled HLA cDNA probes corresponding to DQ, DP, DZ and DR alpha genes. Clear evidence was obtained for the canine homologues of DQ and DR alpha genes with simple bi- or tri-allelic polymorphism respectively. Evidence for a single, nonpolymorphic DP alpha gene was also obtained. However, the presence of a DZ alpha gene could not be clearly demonstrated in canine genomic DNA. This report extends our previous RFLP analysis documenting polymorphism of DLA class II beta genes in the same panel of homozygous typing cell dogs, and provides the basis for DLA-D genotyping at a population level. This study also characterizes the RFLP-defined preferential allelic associations across the DLA-D region in nine different homozygous typing cell specificities.

Different frequencies and effects of ABCB1 T3435C polymorphism on clinical and laboratory features of B cell chronic lymphocytic leukemia in Kurdish patients.

PubMed

Maroofi, Farzad; Amini, Sabrieh; Roshani, Daem; Ghaderi, Bayazid; Abdi, Mohammad

2015-04-01

Finding the effects of gene polymorphism on cancer pathogenesis is very desirable. The ATP-binding cassette is involved in drug metabolism, and the polymorphism of this gene may be an important risk factor in B cell chronic lymphocytic leukemia (B-CLL) or progression and/or response to chemotherapy agents. For the first time, the present study was aimed to evaluate the probable effects of ABCB1 T3435C polymorphism on clinical and laboratory features of Kurdish patients with B-CLL. This descriptive analytical case-control study was performed on 50 B-CLL patients and 100 healthy subjects. Serum levels of beta-2-microglobulin (B2M) and lactate dehydrogenase (LDH) and blood WBC, RBC, Plt and ESR were measured. The T3435C polymorphism of the ABCB1 gene was determined by PCR-RFLP. Concentration of serum and blood markers was significantly higher in the malignant group than in the benign subjects. The CC genotype had the highest frequency (66%) in the patient groups. There are no significant differences between the genotypes and type of treatment. Our results demonstrate the high frequency of C allele of ABCB1 T3435C in B-CLL patients with Kurdish ethnicity. We also show that this polymorphism has a significant risk factor in B-CLL. However, the effect of this polymorphism on clinical and laboratory characteristics of B-CLL patients was not significant.

Enrichment of human hematopoietic stem/progenitor cells facilitates transduction for stem cell gene therapy.

PubMed

Baldwin, Kismet; Urbinati, Fabrizia; Romero, Zulema; Campo-Fernandez, Beatriz; Kaufman, Michael L; Cooper, Aaron R; Masiuk, Katelyn; Hollis, Roger P; Kohn, Donald B

2015-05-01

Autologous hematopoietic stem cell (HSC) gene therapy for sickle cell disease has the potential to treat this illness without the major immunological complications associated with allogeneic transplantation. However, transduction efficiency by β-globin lentiviral vectors using CD34-enriched cell populations is suboptimal and large vector production batches may be needed for clinical trials. Transducing a cell population more enriched for HSC could greatly reduce vector needs and, potentially, increase transduction efficiency. CD34(+) /CD38(-) cells, comprising ∼1%-3% of all CD34(+) cells, were isolated from healthy cord blood CD34(+) cells by fluorescence-activated cell sorting and transduced with a lentiviral vector expressing an antisickling form of beta-globin (CCL-β(AS3) -FB). Isolated CD34(+) /CD38(-) cells were able to generate progeny over an extended period of long-term culture (LTC) compared to the CD34(+) cells and required up to 40-fold less vector for transduction compared to bulk CD34(+) preparations containing an equivalent number of CD34(+) /CD38(-) cells. Transduction of isolated CD34(+) /CD38(-) cells was comparable to CD34(+) cells measured by quantitative PCR at day 14 with reduced vector needs, and average vector copy/cell remained higher over time for LTC initiated from CD34(+) /38(-) cells. Following in vitro erythroid differentiation, HBBAS3 mRNA expression was similar in cultures derived from CD34(+) /CD38(-) cells or unfractionated CD34(+) cells. In vivo studies showed equivalent engraftment of transduced CD34(+) /CD38(-) cells when transplanted in competition with 100-fold more CD34(+) /CD38(+) cells. This work provides initial evidence for the beneficial effects from isolating human CD34(+) /CD38(-) cells to use significantly less vector and potentially improve transduction for HSC gene therapy. © 2015 AlphaMed Press.

Contrasting roles of donor and recipient TGFB1 and IFNG gene polymorphic variants in chronic kidney transplant rejection.

PubMed

Coelho, Verônica Porto Carreiro de Vasconcellos; Ioschpe, Rafael; Caldas, Cristina; Spadafora-Ferreira, Monica; Fonseca, João Americo; Cardoso, Maria Regina Alves; Palacios, Selma Aliotti; Kalil, Jorge; Goldberg, Anna Carla

2011-03-01

To assess the long-term impact (minimum of 3 years follow-up) of polymorphisms in cytokine genes in donor:recipient pairs on the results of the transplant. We compared genetic cytokine polymorphisms and the primary factors of risk for the development of chronic rejection in paired groups of renal transplant patients with and without chronic allograft nephropathy [CAN]. Multivariate analysis indicated that the presence of the high-production TT genotype (codon 10) of the transforming growth factor beta-1 (TGFB1) was protective in receptors (p=0.017), contrasting with the increased risk when present in donor samples (p=0.049). On the other hand, in the case of the gamma interferon studied, the greater frequency of the high production allele was protective in the analysis of the donor group (p=0.013), increasing the risk of chronic nephropathy of the allograft when present in the recipients (p=0.036). Our results highlight the importance of TGFB1 genotyping in donors, and indicate that polymorphisms in the gene of this cytokine in donor cells might contribute to the development of chronic allograft nephropathy.

Monomethylfumarate Induces γ-Globin Expression and Fetal Hemoglobin Production in Cultured Human Retinal Pigment Epithelial (RPE) and Erythroid Cells, and in Intact Retina

PubMed Central

Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B.; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S.; Martin, Pamela M.

2014-01-01

Purpose. Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Methods. Human globin gene expression was evaluated by RT–quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase–qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous βs mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Results. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. Conclusions. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. PMID:24825111

A Family-Based Association Study of CYP11A1 and CYP11B1 Gene Polymorphisms With Autism in Chinese Trios.

PubMed

Deng, Hong-Zhu; You, Cong; Xing, Yu; Chen, Kai-Yun; Zou, Xiao-Bing

2016-05-01

Autism spectrum disorder is a group of neurodevelopmental disorders with the higher prevalence in males. Our previous studies have indicated lower progesterone levels in the children with autism spectrum disorder, suggesting involvement of the cytochrome P-450scc gene (CYP11A1) and cytochrome P-45011beta gene (CYP11B1) as candidate genes in autism spectrum disorder. The aim of this study was to investigate the family-based genetic association between single-nucleotide polymorphisms, rs2279357 in the CYP11A1 gene and rs4534 and rs4541 in the CYP11B1 gene and autism spectrum disorder in Chinese children, which were selected according to the location in the coding region and 5' and 3' regions and minor allele frequencies of greater than 0.05 in the Chinese populations. The transmission disequilibrium test and case-control association analyses were performed in 100 Chinese Han autism spectrum disorder family trios. The genotype and allele frequency of the 3 single-nucleotide polymorphisms had no statistical difference between the children with autism spectrum disorder and their parents (P> .05). Transmission disequilibrium test analysis showed transmission disequilibrium of CYP11A1 gene rs2279357 single-nucleotide polymorphisms (χ(2)= 5.038,P< .001). Our findings provide further support for the hypothesis that a susceptibility gene for autism spectrum disorder exists within or near the CYP11A1 gene in the Han Chinese population. © The Author(s) 2015.

Cross-talk of WNT and FGF signaling pathways at GSK3beta to regulate beta-catenin and SNAIL signaling cascades.

PubMed

Katoh, Masuko; Katoh, Masaru

2006-09-01

WNT and FGF signaling pathways cross-talk during a variety of cellular processes, such as human colorectal carcinogenesis, mouse mammary tumor virus (MMTV)-induced carcinogenesis, E2A-Pbx-induced leukemogenesis, early embryogenesis, body-axis formation, limb-bud formation, and neurogenesis. Canonical WNT signals are transduced through Frizzled receptor and LRP5/6 coreceptor to downregulate GSK3beta (GSK3B) activity not depending on Ser 9 phosphorylation. FGF signals are transduced through FGF receptor to the FRS2-GRB2-GAB1-PI3K-AKT signaling cascade to downregulate GSK3beta activity depending on Ser 9 phosphorylation. Because GSK3beta-dependent phosphorylation of beta-catenin and SNAIL leads to FBXW1 (betaTRCP)-mediated ubiquitination and degradation, GSK3beta downregulation results in the stabilization and the nuclear accumulation of beta-catenin and SNAIL. Nuclear beta-catenin is complexed with TCF/LEF, Legless (BCL9 or BCL9L) and PYGO (PYGO1 or PYGO2) to activate transcription of CCND1, MYC, FGF18 and FGF20 genes for the cell-fate determination. Nuclear SNAIL represses transcription of CDH1 gene, encoding E-cadherin, to induce the epithelial-mesenchymal transition (EMT). Mammary carcinogenesis in MMTV-Wnt1 transgenic mice is accelerated by MMTV infection due to MMTV integration around Fgf3-Fgf4 or Fgf8 loci, and mammary carcinogenesis in MMTV-Fgf3 transgenic mice due to MMTV integration around Wnt1-Wnt10b locus. Coactivation of WNT and FGF signaling pathways in tumors leads to more malignant phenotypes. Single nucleotide polymorphism (SNP) and copy number polymorphism (CNP) of WNT and FGF signaling molecules could be utilized as screening method of cancer predisposition. cDNA-PCR, microarray or ELISA reflecting aberrant activation of WNT and FGF signaling pathways could be developed as novel cancer-related biomarkers for diagnosis, prognosis, and therapy. Cocktail therapy using WNT and FGF inhibitors, such as small-molecule compounds and human neutralizing antibodies, should be developed to increase the efficacy of chemotherapy through the inhibition of recurrence by destructing cancer stem cells.

TGF-Beta Gene Polymorphisms in Food Allergic versus Non-Food Allergic Eosinophilic Esophagitis

DTIC Science & Technology

2013-10-01

our EE subjects are male, Caucasian, and have another atopic disorder (asthma, allergy, eczema and/or food allergy) (n=142, analysis is ongoing...Rhinitis (%) Eczema (%) 43% 66% 30% Table 3: Food IgE Sensitization Pattern Food Antigen IgE Positive (% patients, 95% CI) (n=122-129) Egg 39

Estrogen receptor-Beta variants are associated with increased risk of Alzheimer's disease in women with down syndrome.

PubMed

Zhao, Qi; Lee, Joseph H; Pang, Deborah; Temkin, Alexis; Park, Naeun; Janicki, Sarah C; Zigman, Warren B; Silverman, Wayne; Tycko, Benjamin; Schupf, Nicole

2011-01-01

Genetic variants that affect estrogen activity may influence the risk of Alzheimer's disease (AD). We examined the relation of polymorphisms in the gene for the estrogen receptor-beta (ESR2) to the risk of AD in women with Down syndrome. Two hundred and forty-nine women with Down syndrome, 31-70 years of age and nondemented at baseline, were followed at 14- to 18-month intervals for 4 years. Women were genotyped for 13 single-nucleotide polymorphisms (SNPs) in the ESR2 gene, and their association with AD incidence was examined. Among postmenopausal women, we found a 2-fold increase in the risk of AD for women carrying 1 or 2 copies of the minor allele at 3 SNPs in introns seven (rs17766755) and six (rs4365213 and rs12435857) and 1 SNP in intron eight (rs4986938) of ESR2. These findings support a role for estrogen and its major brain receptors in modulating susceptibility to AD in women. Copyright © 2011 S. Karger AG, Basel.

Genetics of Iranian Alpha-Thalassemia Patients: A Comprehensive Original Study.

PubMed

Keikhaei, Bijan; Slehi-Fard, Pejman; Shariati, Gholamreza; Khosravi, Abbas

2018-04-07

Alpha thalassemia is the most prevalent monogenic gene disorder in the world, especially in Mediterranean countries. In the current hematological phenotype of patients with different genotypes, the effects of missense mutations on the protein function and also stability were evaluated in a large cohort study. A total of 1,560 subjects were enrolled in the study and divided into two groups: 259 normal subjects; and 1301 alpha-thalassemia carriers. Genomic DNA was extracted and analyzed using ARMS PCR, Multiplex Gap, and direct sequencing. The effects of single nucleotide change on the protein function and stability were predicted by freely available databases of human polymorphisms. Sixty-three different genotypes were seen in the patients. The more prevalent was heterozygote form of -α3.7 (41.4%) followed by -α3.7 homozygote (11.6%) and -MED (3.8%). The significant differences were seen in mean hemoglobin level [F = 20.5, p < 0.001] between the Alpha-globin genotypes, when adjusted for gender. Moreover, 28 different mutations were found in our study. A significant relationship was seen between ethnicity and the alpha-globin mutation frequency χ 2 (df;8) = 38.36, p < 0.0001). Different genotypes could display as different phenotypes. The mutation frequency distributions in our region are different from those of other parts of Iran. Significant differences are seen in the spectrum of mutation frequency among various ethnicities. Finally, some missense mutations might not have considerable effect on the proteins, and they could be neutral mutations.

Genetic polymorphisms of beta1 adrenergic receptor and their influence on the cardiovascular responses to metoprolol in a South Indian population.

PubMed

Mahesh Kumar, Koratagere Nagaraju; Ramu, Periasamy; Rajan, Subramanian; Shewade, Deepak Gopal; Balachander, Jayaraman; Adithan, Chandrasekaran

2008-11-01

Beta-blockers show interindividual and interethnic variability in their response. Such variability might be due to the polymorphic variations in the beta1 adrenergic receptor genes viz, Ser49Gly and Arg389Gly. The study evaluated the influence of Ser49Gly and Arg389Gly polymorphisms on the cardiovascular responses to metoprolol in a South Indian population. Forty-one genetically prescreened healthy male volunteers participated in the study. They were divided on the basis of genotype of each polymorphism: Ser49Ser, Ser49Gly, and Gly49Gly and Arg389Arg, Arg389Gly, and Gly389Gly. They were also grouped into combination genotypes viz, S49S R389R, S49G R389R, G49G R389R, S49S R389G, S49S G389G, and S49G R389G. They were subjected to treadmill exercise testing, and cardiovascular parameters were measured before and after metoprolol administration. Metoprolol concentration was determined by reversed phase high-performance liquid chromatography method. The diastolic blood pressure (DBP) was significantly lower in S49S/G389G group when compared to S49S/A389A group. The cardiac parameters were significantly increased in all the genotype groups during treadmill exercise test done for a period of 9 minutes. During predrug treadmill exercise at the end of third and sixth minute, Gly49Gly showed a higher increase in heart rate and volume of oxygen consumption compared to Ser49Ser. Same group showed a higher increase of volume of oxygen consumption at the end of ninth minute of exercise compared to the Ser49Ser. Systolic and diastolic blood pressures were not different between Ser49Gly polymorphisms. However, there was no statistical difference between the genotype groups of both polymorphisms at any stage of post-drug treadmill exercise. The analysis of combination of genotypes showed no significant difference during predrug and postdrug exercise testing. The increase in cardiac responses to treadmill test was influenced by Ser49Gly polymorphism. Nevertheless, the above polymorphisms did not alter the beta-blocker response during treadmill exercise in South Indian population.

MAOA, MTHFR, and TNF-β genes polymorphisms and personality traits in the pathogenesis of migraine.

PubMed

Ishii, Masakazu; Shimizu, Shunichi; Sakairi, Yuki; Nagamine, Ayumu; Naito, Yuika; Hosaka, Yukiko; Naito, Yuko; Kurihara, Tatsuya; Onaya, Tomomi; Oyamada, Hideto; Imagawa, Atsuko; Shida, Kenji; Takahashi, Johji; Oguchi, Katsuji; Masuda, Yutaka; Hara, Hajime; Usami, Shino; Kiuchi, Yuji

2012-04-01

Migraine is a multifactorial disease with various factors, such as genetic polymorphisms and personality traits, but the contribution of those factors is not clear. To clarify the pathogenesis of migraine, the contributions of genetic polymorphisms and personality traits were simultaneously investigated using multivariate analysis. Ninety-one migraine patients and 119 non-headache healthy volunteers were enrolled. The 12 gene polymorphisms analysis and NEO-FFI personality test were performed. At first, the univariate analysis was performed to extract the contributing factors to pathogenesis of migraine. We then extracted the factors that independently contributed to the pathogenesis of migraine using multivariate stepwise logistic regression analysis. Using the multivariate analysis, three gene polymorphisms including monoamine oxidase A (MAOA) T941G, methylenetetrahydrofolate reductase (MTHFR) C677T, and tumor necrosis factor beta (TNF-β) G252Α, and the neuroticism and conscientiousness scores in NEO-FFI were selected as significant factors that independently contributed to the pathogenesis of migraine. Their odds ratios were 1.099 (per point of neuroticism score), 1.080 (per point of conscientiousness score), 2.272 (T and T/T or T/G vs G and G/G genotype of MAOA), 1.939 (C/T or T/T vs C/C genotype of MTHFR), and 2.748 (G/A or A/A vs G/G genotype of TNF-β), respectively. We suggested that multiple factors, such as gene polymorphisms and personality traits, contribute to the pathogenesis of migraine. The contribution of polymorphisms, such as MAOA T941G, MTHFR C677T, and TNF-β G252A, were more important than personality traits in the pathogenesis of migraine, a multifactorial disorder.

Globin haplotypes of human T-cell lymphotropic virus type I-infected individuals in Salvador, Bahia, Brazil, suggest a post-Columbian African origin of this virus.

PubMed

Alcantara, Luiz Carlos; Van Dooren, Sonia; Gonçalves, Marilda Souza; Kashima, Simone; Costa, Maria Cristina Ramos; Santos, Fred Luciano Neves; Bittencourt, Achilea Lisboa; Dourado, Inês; Filho, Antonio Andrade; Covas, Dimas Tadeu; Vandamme, Anne-Mieke; Galvão-Castro, Bernardo

2003-08-01

The city of Salvador, Bahia, Brazil, has sociodemographic characteristics similar to some African cities. Up to now, it has had the highest prevalence of human T-cell lymphotropic virus type I (HTLV-I) infection (1.74%) in the country. To investigate which strains of HTLV-I are circulating in Salvador, we studied isolates from 82 patients infected with HTLV-I: 19 from the general population, 21 from pregnant women, 16 from intravenous drug users, and 26 from patients and their family attending a neurologic clinic. Phylogenetic analysis from part of the LTR fragments showed that most of these isolates belonged to the Transcontinental subgroup of the Cosmopolitan subtype (HTLV-Ia). Only one sample from a pregnant woman was closely related to the Japanese subgroup, suggesting recent introduction of a Japanese HTLV-I lineage into Salvador. betaA-Globin haplotypes were examined in 34 infected individuals and found to be atypical, confirming the racial heterogeneity of this population. A total of 20 chromosomes were characterized as Central African Republic (CAR) haplotype (29.4%), 31 (45.6%) were characterized as Benin (BEN) haplotype, and 17 (25%) were characterized as Senegal (SEN) haplotype. Five patients' genotypes (14.7%) were CAR/CAR; 10 (29,4%), BEN/BEN; 9 (26.5%), CAR/BEN; 2 (5.9%), BEN/SEN; and 7 (20.6%), SEN/SEN. One patient's genotype (2.9%) was CAR/SEN. The betaA-globin haplotype distribution in Salvador is unusual compared with other Brazilian states. Our data support the hypothesis of multiple post-Columbian introductions of African HTLV-Ia strains in Salvador, Bahia, Brazil.

The Helicobacter pylori duodenal ulcer promoting gene, dupA in China.

PubMed

Zhang, Zhiyu; Zheng, Qing; Chen, Xiaoyu; Xiao, Shudong; Liu, Wenzhong; Lu, Hong

2008-10-25

The prevalence of H. pylori is as high as 60-70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA) gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU), gastric ulcer (GU), or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1beta polymorphism was investigated using restriction fragment length polymorphism. Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360) and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P < 0.05). Patients infected with dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058). The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1beta polymorphisms. In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.

Frequency of haemoglobinopathies and glucose-6-phosphate dehydrogenase deficiency in Basra.

PubMed

Hassan, M K; Taha, J Y; Al-Naama, L M; Widad, N M; Jasim, S N

2003-01-01

Basra, southern Iraq, was mapped for haemoglobinopathies and glucose-6-phosphate dehydrogenase (G6PD) deficiency. Of 1064 couples aged 14-60 years recruited from the Public Health Laboratory, 49 had beta-thalassaemia trait, 69 had sickle-cell trait, 2 had haemoglobin D trait, 2 had haemoglobin C trait and 1 had high persistent fetal haemoglobin. Carriers of major beta-globin disorders comprised 11.48%. G6PD deficiency was detected in 133 individuals (12.5%). Only 10 couples (0.94%) were at risk of having children affected with either sickle-cell disease or beta-thalassaemia major. These defects constitute a real health problem and necessitate a management plan and public health education for early diagnosis and therapy.

Sickle cell anemia in northern Israel: screening and prevention.

PubMed

Koren, Ariel; Zalman, Lucia; Palmor, Haya; Zamir, Ronit Bril; Levin, Carina; Openheim, Ariella; Daniel-Spiegel, Etty; Shalev, Stavit; Filon, Dvora

2009-04-01

Sickle cell anemia is a hemolytic anemia caused by a single mutation in position 6 of the beta globin molecule. About 80 patients with SCA in northern Israel are currently receiving treatment. To assess a screening program in northern Israel aimed at detecting couples at risk for having offspring with SCA. Since 1987, screening for beta thalassemia in pregnant women in northern Israel has been conducted, and from 1999 all the samples were also tested for hemoglobin S, Hgb C, Hgb D, Hgb O Arab and others. During the 20 year period 1987-2006 a total of 69,340 women were screened; 114 couples who carried Hgb S were detected and 187 prenatal diagnoses were performed in couples at risk for having an offspring with Hgb S. The mean gestational age was 13 +/- 4 weeks. Fifty-four of those diagnoses revealed affected fetuses and in 4 cases the couple declined to perform therapeutic abortion. The economic burden to the health services for treating SCA patients is about U.S.$ 7000 per year, and the institution of prevention programs has proven cost-effective in populations with a high frequency of carriers. Since our program is aimed to also detect beta thalassemia, a disease that is more frequent in this area (> 2.5%), the added cost for the prevention of SCA is less significant despite the low incidence of the S gene in our population, namely < 1%.

Transforming growth factor beta1 gene variation Leu10Pro affects secretion and function in hepatic cells.

PubMed

Gu, Xing; Ji, Xin; Shi, Le-Hua; Yi, Chang-Hong; Zhao, Yun-Peng; Wang, Ai-Hua; Lu, Lun-Gen; Yu, Wen-Bo; Gao, Chun-Fang

2012-11-01

Our previous work revealed transforming growth factor beta1 (TGFβ1) gene polymorphisms are associated with susceptibility to hepatocellular carcinoma and liver cirrhosis. However, no further study of functional substitution in hepatic cells has yet been reported. This study was designed to uncover the functional mechanisms of TGFβ1 gene polymorphisms in the pathogenesis of liver diseases. Two recombinant TGFβ1 expression plasmids containing TGFβ1 codon 10 Leu/Pro variation were constructed with CMV promoter and transfected into human hepatoma cell lines (HepG2 and SMMU 7721), hepatic stellate cells (LX-2), and immortalized hepatocytes (L02). The secretion capacities of TGFβ1 protein in the transfected cells were determined by ELISA. Apoptosis, proliferative activity, and expression of CD 105, CD83, and CD80 were also measured by use of flow cytometry. The ELISA results showed that cells transfected with CMV-Pro10 were more capable of TGFβ1 secretion than those transfected with CMV-Leu10. Functionally, CMV-Pro10 was more apoptosis-protective and induced more proliferation than CMV-Leu10 in transfected hepatic cells. Pro10 up-regulated expression of CD105 and down-regulated expression of CD83. TGFβ1 gene Leu10Pro variation in signal peptide has significant effects on TGFβ1 secretion and functions in hepatic cells.

The effect of polymorphisms of the beta(2)-adrenergic receptor on the response to regular use of albuterol in asthma.

PubMed

Israel, E; Drazen, J M; Liggett, S B; Boushey, H A; Cherniack, R M; Chinchilli, V M; Cooper, D M; Fahy, J V; Fish, J E; Ford, J G; Kraft, M; Kunselman, S; Lazarus, S C; Lemanske, R F; Martin, R J; McLean, D E; Peters, S P; Silverman, E K; Sorkness, C A; Szefler, S J; Weiss, S T; Yandava, C N

2000-07-01

Inhaled beta-adrenergic agonists are the most commonly used medications for the treatment of asthma although there is evidence that regular use may produce adverse effects in some patients. Polymorphisms of the beta(2)-adrenergic receptor (beta(2)-AR) can affect regulation of the receptor. Smaller studies examining the effects of such polymorphisms on the response to beta-agonist therapy have produced inconsistent results. We examined whether polymorphisms at codon 16 (beta(2)-AR-16) and codon 27 (beta(2)-AR-27) of the beta(2)-AR might affect the response to regular versus as-needed use of albuterol by genotyping the 190 asthmatics who had participated in a trial examining the effects of regular versus as needed albuterol use. During the 16-wk treatment period there was a small decline in morning peak expiratory flow in patients homozygous for arginine at B(2)-AR-16 (Arg/Arg) who used albuterol regularly. This effect was magnified during a 4-wk run out period, during which all patients returned to using as-needed albuterol, so that by the end of the study Arg Arg patients who had regularly used albuterol had a morning peak expiratory flow 30. 5 +/- 12.1 L/min lower (p = 0.012) than Arg/Arg patients who had used albuterol on an as needed basis. There was no decline in peak flow with regular use of albuterol in patients who were homozygous for glycine at beta(2)-AR-16. Evening peak expiratory flow also declined in the Arg/Arg patients who used albuterol regularly but not in those who used albuterol on an as-needed basis. No significant differences in outcomes between regular and as-needed treatment were associated with polymorphisms at position 27 of the beta(2)-AR. No other differences in asthma outcomes that we investigated occurred in relation to these beta(2)-AR polymorphisms. Polymorphisms of the beta(2)-AR may influence airway responses to regular inhaled beta-agonist treatment.

Mithramycin encapsulated in polymeric micelles by microfluidic technology as novel therapeutic protocol for beta-thalassemia

PubMed Central

Capretto, Lorenzo; Mazzitelli, Stefania; Brognara, Eleonora; Lampronti, Ilaria; Carugo, Dario; Hill, Martyn; Zhang, Xunli; Gambari, Roberto; Nastruzzi, Claudio

2012-01-01

This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH), based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF) accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of β-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying β-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol for β-thalassemia. PMID:22287841

A new stable alpha chain variant: Hb Basel [alpha14(A12)Trp-->Leu (alpha1)].

PubMed

Hergersberg, Martin; Brunner-Agten, Saskia; Kühne, Thomas; Paulussen, Michael; Huber, Andreas R

2010-06-01

We describe a heterozygosity for a new missense mutation on the alpha1-globin gene of an 18-year-old woman of Portuguese ancestry with severe hypochromic anemia and iron deficiency. Hemoglobin (Hb) analysis by high performance liquid chromatography (HPLC) found a prominent peak constituting about 12% of total Hb. Sequencing of the globin genes of the index patient found the mutation alpha14(A12)Trp-->Leu (alpha1), HBA1:c.44G

A Hemoglobin Variant Associated with Neonatal Cyanosis and Anemia

PubMed Central

Crowley, Moira A.; Mollan, Todd L.; Abdulmalik, Osheisa Y.; Butler, Andrew D.; Goodwin, Emily F.; Sarkar, Arindam; Stolle, Catherine A.; Gow, Andrew J.; Olson, John S.; Weiss, Mitchell J.

2013-01-01

SUMMARY Globin-gene mutations are a rare but important cause of cyanosis. We identified a missense mutation in the fetal G γ-globin gene (HBG2) in a father and daughter with transient neonatal cyanosis and anemia. This new mutation modifies the ligand-binding pocket of fetal hemoglobin by means of two mechanisms. First, the relatively large side chain of methionine decreases both the affinity of oxygen for binding to the mutant hemoglobin subunit and the rate at which it does so. Second, the mutant methionine is converted to aspartic acid post-translationally, probably through oxidative mechanisms. The presence of this polar amino acid in the heme pocket is predicted to enhance hemoglobin denaturation, causing anemia. PMID:21561349

IGF-I gene variability is associated with an increased risk for AD.

PubMed

Vargas, Teo; Martinez-Garcia, Ana; Antequera, Desiree; Vilella, Elisabet; Clarimon, Jordi; Mateo, Ignacio; Sanchez-Juan, Pascual; Rodriguez-Rodriguez, Eloy; Frank, Ana; Rosich-Estrago, Marcel; Lleo, Alberto; Molina-Porcel, Laura; Blesa, Rafael; Gomez-Isla, Teresa; Combarros, Onofre; Bermejo-Pareja, Felix; Valdivieso, Fernando; Bullido, Maria Jesus; Carro, Eva

2011-03-01

Insulin-like growth factor I (IGF-I), a neuroprotective factor with a wide spectrum of actions in the adult brain, is involved in the pathogenesis of Alzheimer's disease (AD). Circulating levels of IGF-I change in AD patients and are implicated in the clearance of brain amyloid beta (Aβ) complexes. To investigate this hypothesis, we screened the IGF-I gene for various well known single nucleotide polymorphisms (SNPs) covering % of the gene variability in a population of 2352 individuals. Genetic analysis indicated different distribution of genotypes of 1 single nucleotide polymorphism, and 1 extended haplotype in the AD population compared with healthy control subjects. In particular, the frequency of rs972936 GG genotype was significantly greater in AD patients than in control subjects (63% vs. 55%). The rs972936 GG genotype was associated with an increased risk for disease, independently of apolipoprotein E genotype, and with enhanced circulating levels of IGF-I. These findings suggest that polymorphisms within the IGF-I gene could infer greater risk for AD through their effect on IGF-I levels, and confirm the physiological role IGF-I in the pathogenesis of AD. Copyright © 2011 IBRO. Published by Elsevier Inc. All rights reserved.

A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

PubMed

Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

2017-02-10

Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (P<0.01), particularly when the disease was homozygous or double heterozygous with another α- or β-thalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the application of MS/MS for thalassemia screening, when combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Copyright © 2016. Published by Elsevier B.V.

Structural characterization of hemoglobins from Monilifera and Frenulata tubeworms (Siboglinids): first discovery of giant hexagonal-bilayer hemoglobin in the former "Pogonophora" group.

PubMed

Meunier, Cédric; Andersen, Ann C; Bruneaux, Matthieu; Le Guen, Dominique; Terrier, Peran; Leize-Wagner, Emmanuelle; Zal, Franck

2010-01-01

Siboglinids are symbiotic polychete annelids having hemoglobins as essential oxygen- and sulfide-carriers for their endosymbiotic bacteria. We analyzed the structure of the hemoglobins from two species of siboglinids: the monilifera Sclerolinum contortum and the frenulata Oligobrachia webbi (i.e. haakonmosbiensis) from Norwegian cold seeps. Measured by Multi-Angle Laser Light Scattering (MALLS), Sclerolinum shows a 3190+/-50 kDa hexagonal bilayer hemoglobin (HBL-Hb) and a 461+/-46 kDa ring-Hb, just as vestimentifera, whereas Oligobrachia has a 409+/-3.7 kDa ring-Hb only. Electrospray Ionization-Mass Spectrometry (ESI-MS) showed Sclerolinum HBL-Hb composed of seven monomeric globins (15-16 kDa), three disulfide-bonded globin heterodimers and three linkers. The heterodimers always contain globin-b (15814.4+/-1.5 Da). Sclerolinum ring-Hb is composed of globins and dimers with identical masses as its HBL-Hb, but lacks linkers. Oligobrachia ring-Hb has three globin monomers (14-15 kDa) only, with no disulfide-bonded dimers. Comparison of Sclerolinum hemoglobins between Storegga and Haakon Mosby Mud Volcano, using the normalized height of deconvoluted ESI-MS peaks, shows differences in globin monomers abundances that could reflect genetic differences or differential gene expression between distinct seep populations. The discovery of HBL-Hb in Sclerolinum is a new element supporting the hypothesis of monilifera being phylogenetically more closely related to vestimentifera, than to frenulata.

A randomized Phase I/II Trial of HQK-1001, an oral fetal globin gene inducer, in β–thalassaemia intermedia and HbE/β–thalassaemia

PubMed Central

Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.

2014-01-01

β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969

Potentially Therapeutic Levels of Anti-Sickling Globin Gene Expression Following Lentivirus-mediated Gene Transfer in Sickle Cell Disease Bone Marrow CD34+ Cells

PubMed Central

Urbinati, Fabrizia; Hargrove, Philip W.; Geiger, Sabine; Romero, Zulema; Wherley, Jennifer; Kaufman, Michael L.; Hollis, Roger P.; Chambers, Christopher B.; Persons, Derek A.; Kohn, Donald B.; Wilber, Andrew

2015-01-01

Sickle cell disease (SCD) can be cured by allogeneic hematopoietic stem cell (HSC) transplant. However, this is only possible when a matched donor is available making the development of gene therapy using autologous HSCs a highly desired alternative. We used a culture model of human erythropoiesis to directly compare two insulated, self-inactivating, and erythroid-specific lentiviral vectors, encoding for γ-globin (V5m3-400) or a modified β-globin (βAS3-FB) for production of anti-sickling hemoglobin (Hb) and correction of red cell deformability after deoxygenation. Bone marrow CD34+ cells from three SCD patients were transduced using V5m3-400 or βAS3-FB and compared to mock transduced SCD or healthy donor CD34+ cells. Lentiviral transduction did not impair cell growth or differentiation, as gauged by proliferation and acquisition of erythroid markers. Vector copy number averaged ~1 copy per cell and corrective globin mRNA levels were increased more than 7-fold over mock-transduced controls. Erythroblasts derived from healthy donor and mock-transduced SCD cells produced a low level of HbF that was increased to 23.6 ± 4.1% per vector copy for cells transduced with V5m3-400. Equivalent levels of modified HbA of 17.6 ± 3.8% per vector copy were detected for SCD cells transduced with βAS3-FB. These levels of anti-sickling Hb production were sufficient to reduce sickling of terminal stage RBCs upon deoxygenation. We conclude that the achieved levels of HbF and modified HbA would likely prove therapeutic to SCD patients who lack matched donors. PMID:25681747

The Prevalence and Molecular Spectrum of α- and β-Globin Gene Mutations in 14,332 Families of Guangdong Province, China

PubMed Central

Xu, Longchang; Wu, Li; Zhang, Liang; Ma, Yuanzhu; Chen, Tingting; Gao, Shuang; Liang, Juqing; Guo, Hao; Qin, Danqing; Wang, Jicheng; Yuan, Tenglong; Wang, Yixia; Huang, Wei-wei; He, Wen-Fei; Zhang, Yanxia; Liu, Chang; Xia, Sujian; Chen, Qingshan; Zhao, Qingguo; Zhang, Xiaozhuang

2014-01-01

Objective To reveal the familial prevalence and molecular variation of α- and β-globin gene mutations in Guangdong Province. Methods A total of 40,808 blood samples from 14,332 families were obtained and analyzed for both hematological and molecular parameters. Results A high prevalence of α- and β-globin gene mutations was found. Overall, 17.70% of pregnant women, 15.94% of their husbands, 16.03% of neonates, and 16.83% of couples (pregnant women and their husbands) were heterozygous carriers of α- or β-thalassemia. The regions with the highest prevalence were the mountainous and western regions, followed by the Pearl River Delta; the region with the lowest prevalence was Chaoshan. The total familial carrier rate (both spouses were α- or β-thalassemia carriers) was 1.87%, and the individual carrier rates of α- and β-thalassemia were 1.68% and 0.20%, respectively. The total rate of moderate-to-severe fetal thalassemia was 12.78% among couples in which both parents were carriers. Conclusions There was a high prevalence of α- and β-thalassemia in Guangdong Province. This study will contribute to the development of thalassemia prevention and control strategies in Guangdong Province. PMID:24587075

Association of Neuropeptide-Y (NPY) and Interleukin-1beta (IL1B), Genotype-Phenotype Correlation and Plasma Lipids with Type-II Diabetes

PubMed Central

Mansuri, Mohmmad Shoab; Ansarullah; Laddha, Naresh C.; Thakker, Ami; Ramachandran, A. V.; Begum, Rasheedunnisa

2016-01-01

Background Neuropeptide Y (NPY) is known to play a role in the regulation of satiety, energy balance, body weight, and insulin release. Interleukin-1beta (IL1B) has been associated with loss of beta-cell mass in type-II diabetes (TIID). Objectives The present study attempts to investigate the association of NPY exon2 +1128 T/C (Leu7Pro; rs16139), NPY promoter -399 T/C (rs16147) and IL1B -511 C/T (rs16944) polymorphisms with TIID and their correlation with plasma lipid levels, BMI, and IL1B transcript levels. Methods PCR-RFLP was used for genotyping these polymorphisms in a case-control study involving 558 TIID patients and 1085 healthy age-matched controls from Gujarat. Linkage disequilibrium and haplotype analysis of the NPY polymorphic sites were performed to assess their association with TIID. IL1B transcript levels in PBMCs were also assessed in 108 controls and 101 patients using real-time PCR. Results Our results show significant association of both structural and promoter polymorphisms of NPY (p<0.0001 and p<0.0001 respectively) in patients with TIID. However, the IL1B C/T polymorphism did not show any association (p = 0.3797) with TIID patients. Haplotype analysis revealed more frequent association of CC and CT haplotypes (p = 3.34 x 10−5, p = 6.04 x 10−9) in diabetics compared to controls and increased the risk of diabetes by 3.02 and 2.088 respectively. Transcript levels of IL1B were significantly higher (p<0.0001) in patients as compared to controls. Genotype-phenotype correlation of IL1B polymorphism did not show any association with its higher transcript levels. In addition, NPY +1128 T/C polymorphism was found to be associated with increased plasma LDL levels (p = 0.01). Conclusion The present study provides an evidence for a strong correlation between structural and promoter polymorphisms of NPY gene and upregulation of IL1B transcript levels with susceptibility to TIID and altering the lipid metabolism in Gujarat population. PMID:27749914

Association of Neuropeptide-Y (NPY) and Interleukin-1beta (IL1B), Genotype-Phenotype Correlation and Plasma Lipids with Type-II Diabetes.

PubMed

Patel, Roma; Dwivedi, Mitesh; Mansuri, Mohmmad Shoab; Ansarullah; Laddha, Naresh C; Thakker, Ami; Ramachandran, A V; Begum, Rasheedunnisa

2016-01-01

Neuropeptide Y (NPY) is known to play a role in the regulation of satiety, energy balance, body weight, and insulin release. Interleukin-1beta (IL1B) has been associated with loss of beta-cell mass in type-II diabetes (TIID). The present study attempts to investigate the association of NPY exon2 +1128 T/C (Leu7Pro; rs16139), NPY promoter -399 T/C (rs16147) and IL1B -511 C/T (rs16944) polymorphisms with TIID and their correlation with plasma lipid levels, BMI, and IL1B transcript levels. PCR-RFLP was used for genotyping these polymorphisms in a case-control study involving 558 TIID patients and 1085 healthy age-matched controls from Gujarat. Linkage disequilibrium and haplotype analysis of the NPY polymorphic sites were performed to assess their association with TIID. IL1B transcript levels in PBMCs were also assessed in 108 controls and 101 patients using real-time PCR. Our results show significant association of both structural and promoter polymorphisms of NPY (p<0.0001 and p<0.0001 respectively) in patients with TIID. However, the IL1B C/T polymorphism did not show any association (p = 0.3797) with TIID patients. Haplotype analysis revealed more frequent association of CC and CT haplotypes (p = 3.34 x 10-5, p = 6.04 x 10-9) in diabetics compared to controls and increased the risk of diabetes by 3.02 and 2.088 respectively. Transcript levels of IL1B were significantly higher (p<0.0001) in patients as compared to controls. Genotype-phenotype correlation of IL1B polymorphism did not show any association with its higher transcript levels. In addition, NPY +1128 T/C polymorphism was found to be associated with increased plasma LDL levels (p = 0.01). The present study provides an evidence for a strong correlation between structural and promoter polymorphisms of NPY gene and upregulation of IL1B transcript levels with susceptibility to TIID and altering the lipid metabolism in Gujarat population.

Moisture induced polymorphic transition of mannitol and its morphological transformation.

PubMed

Yoshinari, Tomohiro; Forbes, Robert T; York, Peter; Kawashima, Yoshiaki

2002-10-24

The effects of moisture on the polymorphic transition of crystalline mannitol were investigated. Mannitol has three polymorphic forms, and was classified as alpha, beta, and delta form, respectively, by Walter-Lévy (C.R. Acad. Sc. Paris Ser. C (1968) 267, 1779). The water uptake of delta form crystalline was greater than that of the beta form when each crystalline form was stored at 97%RH (25 degrees C). The different powder X-ray diffraction patterns obtained before and after humidification confirmed that a moisture induced polymorphic transition from the delta to beta form had occurred. Morphological changes were also observed with an increase in the specific surface area of the delta sample from 0.4 to 2.3 m(2)/g being found on exposure to humidity. Thus it was suggested that the observed higher hygroscopicity of the newly formed beta form arose from the gradual increase in the surface area with the polymorphic transition from the delta to beta form. When considering the mechanism of this polymorphic transition, the results from molecular modelling, cross-polarisation/magic angle spinning (CP/MAS) solid-state NMR spectra and scanning electron-micrographs suggest that water molecules act as a molecular loosener to facilitate conversion from delta to the beta form as a result of multi-nucleation. Copyright 2002 Elsevier Science B.V.

Transforming growth factor-β and toll-like receptor-4 polymorphisms are not associated with fibrosis in haemochromatosis

PubMed Central

Wood, Marnie J; Powell, Lawrie W; Dixon, Jeannette L; Subramaniam, V Nathan; Ramm, Grant A

2013-01-01

AIM: To investigate the role of genetic polymorphisms in the progression of hepatic fibrosis in hereditary haemochromatosis. METHODS: A cohort of 245 well-characterised C282Y homozygous patients with haemochromatosis was studied, with all subjects having liver biopsy data and DNA available for testing. This study assessed the association of eight single nucleotide polymorphisms (SNPs) in a total of six genes including toll-like receptor 4 (TLR4), transforming growth factor-beta (TGF-β), oxoguanine DNA glycosylase, monocyte chemoattractant protein 1, chemokine C-C motif receptor 2 and interleukin-10 with liver disease severity. Genotyping was performed using high resolution melt analysis and sequencing. The results were analysed in relation to the stage of hepatic fibrosis in multivariate analysis incorporating other cofactors including alcohol consumption and hepatic iron concentration. RESULTS: There were significant associations between the cofactors of male gender (P = 0.0001), increasing age (P = 0.006), alcohol consumption (P = 0.0001), steatosis (P = 0.03), hepatic iron concentration (P < 0.0001) and the presence of hepatic fibrosis. Of the candidate gene polymorphisms studied, none showed a significant association with hepatic fibrosis in univariate or multivariate analysis incorporating cofactors. We also specifically studied patients with hepatic iron loading above threshold levels for cirrhosis and compared the genetic polymorphisms between those with no fibrosis vs cirrhosis however there was no significant effect from any of the candidate genes studied. Importantly, in this large, well characterised cohort of patients there was no association between SNPs for TGF-β or TLR4 and the presence of fibrosis, cirrhosis or increasing fibrosis stage in multivariate analysis. CONCLUSION: In our large, well characterised group of haemochromatosis subjects we did not demonstrate any relationship between candidate gene polymorphisms and hepatic fibrosis or cirrhosis. PMID:24409064

Transforming growth factor-β and toll-like receptor-4 polymorphisms are not associated with fibrosis in haemochromatosis.

PubMed

Wood, Marnie J; Powell, Lawrie W; Dixon, Jeannette L; Subramaniam, V Nathan; Ramm, Grant A

2013-12-28

To investigate the role of genetic polymorphisms in the progression of hepatic fibrosis in hereditary haemochromatosis. A cohort of 245 well-characterised C282Y homozygous patients with haemochromatosis was studied, with all subjects having liver biopsy data and DNA available for testing. This study assessed the association of eight single nucleotide polymorphisms (SNPs) in a total of six genes including toll-like receptor 4 (TLR4), transforming growth factor-beta (TGF-β), oxoguanine DNA glycosylase, monocyte chemoattractant protein 1, chemokine C-C motif receptor 2 and interleukin-10 with liver disease severity. Genotyping was performed using high resolution melt analysis and sequencing. The results were analysed in relation to the stage of hepatic fibrosis in multivariate analysis incorporating other cofactors including alcohol consumption and hepatic iron concentration. There were significant associations between the cofactors of male gender (P = 0.0001), increasing age (P = 0.006), alcohol consumption (P = 0.0001), steatosis (P = 0.03), hepatic iron concentration (P < 0.0001) and the presence of hepatic fibrosis. Of the candidate gene polymorphisms studied, none showed a significant association with hepatic fibrosis in univariate or multivariate analysis incorporating cofactors. We also specifically studied patients with hepatic iron loading above threshold levels for cirrhosis and compared the genetic polymorphisms between those with no fibrosis vs cirrhosis however there was no significant effect from any of the candidate genes studied. Importantly, in this large, well characterised cohort of patients there was no association between SNPs for TGF-β or TLR4 and the presence of fibrosis, cirrhosis or increasing fibrosis stage in multivariate analysis. In our large, well characterised group of haemochromatosis subjects we did not demonstrate any relationship between candidate gene polymorphisms and hepatic fibrosis or cirrhosis.

[Beta thalassemia major and pregnancy during adolescence: report of two cases].

PubMed

Trigo, Lucas Augusto Monteiro Castro; Surita, Fernanda Garanhani; Parpinelli, Mary Angela; Pereira, Belmiro Gonçalves; Fertrin, Kleber Yotsumoto; Costa, Maria Laura

2015-06-01

Beta thalassemia major is a rare hereditary blood disease in which impaired synthesis of beta globin chains causes severe anemia. Medical treatment consists of chronic blood transfusions and iron chelation. We describe two cases of adolescents with beta thalassemia major with unplanned pregnancies and late onset of prenatal care. One had worsening of anemia with increased transfusional requirement, fetal growth restriction, and placental senescence. The other was also diagnosed with hypothyroidism and low maternal weight, and was admitted twice during pregnancy due to dengue shock syndrome and influenza H1N1-associated respiratory infection. She also developed fetal growth restriction and underwent vaginal delivery at term complicated by uterine hypotonia. Both patients required blood transfusions after birth and chose medroxyprogesterone as a contraceptive method afterwards. This report highlights the importance of medical advice on contraceptive methods for these women and the role of a specialized prenatal follow-up in association with a hematologist.

Arg16/Gly beta2-adrenergic receptor polymorphism alters the cardiac output response to isometric exercise.

PubMed

Eisenach, John H; Barnes, Sunni A; Pike, Tasha L; Sokolnicki, Lynn A; Masuki, Shizue; Dietz, Niki M; Rehfeldt, Kent H; Turner, Stephen T; Joyner, Michael J

2005-11-01

Normotensive adults homozygous for glycine (Gly) of the Arg16/Gly beta2-adrenergic-receptor polymorphism have 1) greater forearm beta2-receptor mediated vasodilation and 2) a higher heart rate (HR) response to isometric handgrip than arginine (Arg) homozygotes. To test the hypothesis that the higher HR response in Gly16 subjects serves to maintain the pressor response [increased cardiac output (CO)] in the setting of augmented peripheral vasodilation to endogenous catecholamines, we measured continuous HR (ECG), arterial pressure (Finapres), and CO (transthoracic echocardiography) during isometric, 40% submaximal handgrip to fatigue in healthy subjects homozygous for Gly (n = 30; mean age +/- SE: 30 +/- 1.2, 13 women) and Arg (n = 17, age 30 +/- 1.6, 11 women). Resting data were similar between groups. Handgrip produced similar increases in arterial pressure and venous norepinephrine and epinephrine concentrations; however, HR increased more in the Gly group (60.1 +/- 4.3% increase from baseline vs. 45.5 +/- 3.9%, P = 0.03), and this caused CO to be higher (Gly: 7.6 +/- 0.3 l/m vs. Arg: 6.5 +/- 0.3 l/m, P = 0.03), whereas the decrease in systemic vascular resistance in the Gly group did not reach significance (P = 0.09). We conclude that Gly16 homozygotes generate a higher CO to maintain the pressor response to handgrip. The influence of polymorphic variants in the beta2-adrenergic receptor gene on the cardiovascular response to sympathoexcitation may have important implications in the development of hypertension and heart failure.

Candidate gene association analysis for milk yield, composition, urea nitrogen and somatic cell scores in Brown Swiss cows.

PubMed

Cecchinato, A; Ribeca, C; Chessa, S; Cipolat-Gotet, C; Maretto, F; Casellas, J; Bittante, G

2014-07-01

The aim of this study was to investigate 96 single-nucleotide polymorphisms (SNPs) from 54 candidate genes, and test the associations of the polymorphic SNPs with milk yield, composition, milk urea nitrogen (MUN) content and somatic cell score (SCS) in individual milk samples from Italian Brown Swiss cows. Milk and blood samples were collected from 1271 cows sampled once from 85 herds. Milk production, quality traits (i.e. protein, casein, fat and lactose percentages), MUN and SCS were measured for each milk sample. Genotyping was performed using a custom Illumina VeraCode GoldenGate approach. A Bayesian linear animal model that considered the effects of herd, days in milk, parity, SNP genotype and additive polygenic effect was used for the association analysis. Our results showed that 14 of the 51 polymorphic SNPs had relevant additive effects on at least one of the aforementioned traits. Polymorphisms in the glucocorticoid receptor DNA-binding factor 1 (GRLF1), prolactin receptor (PRLR) and chemokine ligand 2 (CCL2) were associated with milk yield; an SNP in the stearoyl-CoA desaturase (SCD-1) was related to fat content; SNPs in the caspase recruitment domain 15 protein (CARD15) and lipin 1 (LPIN1) affected the protein and casein contents; SNPs in growth hormone 1 (GH1), lactotransferrin (LTF) and SCD-1 were relevant for casein number; variants in beta casein (CSN2), GH1, GRLF1 and LTF affected lactose content; SNPs in beta-2 adrenergic receptor (ADRB2), serpin peptidase inhibitor (PI) and SCD-1 were associated with MUN; and SNPs in acetyl-CoA carboxylase alpha (ACACA) and signal transducer and activator of transcription 5A (STAT5A) were relevant in explaining the variation of SCS. Although further research is needed to validate these SNPs in other populations and breeds, the association between these markers and milk yield, composition, MUN and SCS could be exploited in gene-assisted selection programs for genetic improvement purposes.

Association between Oxidative Stress, Genetic Factors, and Clinical Severity in Children with Sickle Cell Anemia.

PubMed

Renoux, Céline; Joly, Philippe; Faes, Camille; Mury, Pauline; Eglenen, Buse; Turkay, Mine; Yavas, Gokce; Yalcin, Ozlem; Bertrand, Yves; Garnier, Nathalie; Cuzzubbo, Daniela; Gauthier, Alexandra; Romana, Marc; Möckesch, Berenike; Cannas, Giovanna; Antoine-Jonville, Sophie; Pialoux, Vincent; Connes, Philippe

2018-04-01

To investigate the associations between several sickle cell disease genetic modifiers (beta-globin haplotypes, alpha-thalassemia, and glucose-6-phosphate dehydrogenase deficiency) and the level of oxidative stress and to evaluate the association between oxidative stress and the rates of vaso-occlusive events. Steady-state oxidative and nitrosative stress markers, biological variables, genetic modulators, and vaso-occlusive crisis events requiring emergency admissions were measured during a 2-year period in 62 children with sickle cell anemia (58 SS and 4 Sβ 0 ). Twelve ethnic-matched children without sickle cell anemia also participated as healthy controls (AA) for oxidative and nitrosative stress level measurement. Oxidative and nitrosative stress were greater in patients with sickle cell anemia compared with control patients, but the rate of vaso-occlusive crisis events in sickle cell anemia was not associated with the level of oxidative stress. The presence of alpha-thalassemia, but not glucose-6-phosphate dehydrogenase deficiency or beta-globin haplotype, modulated the level of oxidative stress in children with sickle cell anemia. Mild hemolysis in children with alpha-thalassemia may limit oxidative stress and could explain the protective role of alpha-thalassemia in hemolysis-related sickle cell complications. Copyright © 2017 Elsevier Inc. All rights reserved.

Iron-heme-Bach1 axis is involved in erythroblast adaptation to iron deficiency.

PubMed

Kobayashi, Masahiro; Kato, Hiroki; Hada, Hiroshi; Itoh-Nakadai, Ari; Fujiwara, Tohru; Muto, Akihiko; Inoguchi, Yukihiro; Ichiyanagi, Kenji; Hojo, Wataru; Tomosugi, Naohisa; Sasaki, Hiroyuki; Harigae, Hideo; Igarashi, Kazuhiko

2017-03-01

Iron plays the central role in oxygen transport by erythrocytes as a constituent of heme and hemoglobin. The importance of iron and heme is also to be found in their regulatory roles during erythroblast maturation. The transcription factor Bach1 may be involved in their regulatory roles since it is deactivated by direct binding of heme. To address whether Bach1 is involved in the responses of erythroblasts to iron status, low iron conditions that induced severe iron deficiency in mice were established. Under iron deficiency, extensive gene expression changes and mitophagy disorder were induced during maturation of erythroblasts. Bach1 -/- mice showed more severe iron deficiency anemia in the developmental phase of mice and a retarded recovery once iron was replenished when compared with wild-type mice. In the absence of Bach1, the expression of globin genes and Hmox1 (encoding heme oxygenase-1) was de-repressed in erythroblasts under iron deficiency, suggesting that Bach1 represses these genes in erythroblasts under iron deficiency to balance the levels of heme and globin. Moreover, an increase in genome-wide DNA methylation was observed in erythroblasts of Bach1 -/- mice under iron deficiency. These findings reveal the principle role of iron as a regulator of gene expression in erythroblast maturation and suggest that the iron-heme-Bach1 axis is important for a proper adaptation of erythroblast to iron deficiency to avoid toxic aggregates of non-heme globin. Copyright© Ferrata Storti Foundation.

Linkage study of nonsyndromic cleft lip with or without cleft palate using candidate genes and mapped polymorphic markers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stein, J.D.; Nelson, L.D.; Conner, B.J.

1994-09-01

Nonsyndromic cleft lip with or without cleft palate (CL(P)) involves fusion or growth failure of facial primordia during development. Complex segregation analysis of clefting populations suggest that an autosomal dominant gene may play a role in this common craniofacial disorder. We have ascertained 16 multigenerational families with CL(P) and tested linkage to 29 candidate genes and 139 mapped short tandem repeat markers. The candidate genes were selected based on their expression in craniofacial development or were identified through murine models. These include: TGF{alpha}, TGF{beta}1, TGF{beta}2, TGF{beta}3, EGF, EGFR, GRAS, cMyc, FGFR, Jun, JunB, PDFG{alpha}, PDGF{beta}, IGF2R, GCR Hox7, Hox8, Hox2B,more » twirler, 5 collagen and 3 extracellular matrix genes. Linkage was tested assuming an autosomal dominant model with sex-specific decreased penetrance. Linkage to all of the candidate loci was excluded in 11 families. RARA was tested and was not informative. However, haplotype analysis of markers flanking RARA on 17q allowed exclusion of this candidate locus. We have previously excluded linkage to 61 STR markers in 11 families. Seventy-eight mapped short tandem repeat markers have recently been tested in 16 families and 30 have been excluded. The remaining are being analyzed and an exclusion map is being developed based on the entire study results.« less

Single-molecule RNA observation in vivo reveals dynamics of co-transcriptional splicing

NASA Astrophysics Data System (ADS)

Ferguson, M. L.; Coulon, A.; de Turris, V.; Palangat, M.; Chow, C. C.; Singer, R. H.; Larson, D. R.

2013-03-01

The synthesis of pre-mRNA and the splicing of that pre-mRNA to form completed transcripts requires coordination between two large multi-subunit complexes (the transcription elongation complex and the spliceosome). How this coordination occurs in vivo is unknown. Here we report the first experimental observation of transcription and splicing occurring at the same gene in living cells. By utilizing the PP7/MS2 fluorescent RNA reporter system, we can directly observe two distinct regions of the nascent RNA, allowing us to measure the rise and fall time of the intron and exon of a reporter gene stably integrated into a human cell line. The reporter gene consists of a beta globin gene where we have inserted a 24 RNA hairpin cassette into the intron/exon. Upon synthesis, the RNA hairpins are tightly bound by fluorescently-labeled PP7/MS2 bacteriophage coat proteins. After gene induction, a single locus of active transcription in the nucleus shows fluorescence intensity changes characteristic of the synthesis and excision of the intron/exon. Using fluctuation analysis, we determine the elongation rate to be 1.5 kb/min. From the temporal cross correlation function, we determine that splicing of this gene must be co-transcriptional with a splicing time of ~100 seconds before termination and a ~200 second pause at termination. We propose that dual-color RNA imaging may be extended to investigate other mechanisms of transcription, gene regulation, and RNA processing.

Genetic variation in the beta 3-adrenoreceptor gene (Trp64Arg polymorphism) and its influence on anthropometric parameters and insulin resistance under a high monounsaturated versus a high polyunsaturated fat hypocaloric diet.

PubMed

de Luis, D A; Aller, R; Izaola, O; Conde, R; Eiros Bouza, J M

2013-01-01

The aim of our study was to investigate the role of Trp64Arg polymorphism of the beta 3-adrenergic receptor (beta 3-AR) gene on metabolic changes and weight loss secondary to a high monounsaturated fat versus a high polyunsaturated fat hypocaloric diet in obese subjects. A population of 260 obese subjects was analyzed. In the basal visit, patients were randomly allocated for 3 months to either diet M (high monounsaturated fat hypocaloric diet) or diet P (high polyunsaturated fat hypocaloric diet). There were no significant differences between the positive effects (on weight, body mass index, waist circumference, fat mass) in either genotype group with both diets. With diet P and in genotype Trp64Trp, glucose levels (-6.7 ± 12.1 vs. -1.2 ± 2.2 mg/dl; p < 0.05), total cholesterol (-11.2 ± 8.1 vs. -1.0 ± 7.1 mg/dl; p < 0.05), low-density lipoprotein (LDL) cholesterol (-9.7 ± 10.1 vs. -2.2 ± 8.1 mg/dl; p < 0.05), triglycerides (-11.7 ± 13.1 vs. +1.7 ± 10.3 mg/dl; p < 0.05), homeostasis model assessment for insulin resistance (HOMA-R; -0.7 ± 1.1 vs. -0.3 ± 2.1 units; p < 0.05) and insulin levels (-1.8 ± 4.6 vs. -1.0 ± 9.1 mIU/l; p < 0.05) decreased. The metabolic effect of weight reduction by the two hypocaloric diets is greatest in subjects with the normal homozygous beta 3-AR gene. Improvements in total cholesterol, LDL cholesterol, triglyceride, glucose, insulin and HOMA-R levels were better than in the heterozygous group. Copyright © 2013 S. Karger AG, Basel.

Association of interleukin-1 beta (-511C/T) polymorphisms with osteoporosis in postmenopausal women.

PubMed

Chao, Tai-Hung; Yu, Hsing-Ning; Huang, Chi-Chuan; Liu, Wen-Shen; Tsai, Ya-Wen; Wu, Wen-Tung

2010-01-01

Osteoporosis is a common disease of the elderly, in which genetic and clinical factors contribute to the disease phenotype. Since the production of interleukin-1 (IL-1) has been implicated in the bone mass and skeletal disorders, we investigated whether IL-1 system gene polymorphisms are associated with the pathogenesis of osteoporosis in postmenopausal Taiwanese women. Osteoporosis is diagnosed by dual-energy x-ray absorptiometry, which measures bone mineral density (BMD) at multiple skeletal sites. We studied the IL-1α (-889C/T), IL-1β (-511C/T) and the 86 base pair variable number tandem repeat (VNTR) in intron 2 of the IL-1 receptor antagonist (IL-1ra) gene in 117 postmenopausal women with osteoporosis and 135 control subjects without a history of symptomatic osteoporosis. These gene polymorphisms were analyzed by polymerase chain reaction and restriction fragment length polymerase. Blood sugar and other risk factors were also determined. The frequencies of IL-1β (-511C/T) genotypes (P=.022, odds ratio=1.972) and alleles (P=.02, odds ratio=2.909) showed a statistically significant difference between the two groups. However, we did not find any statistically significant difference in IL-1β and IL-1ra polymorphisms (P>.05). We also observed a positive relationship between osteoporosis and cholesterol and a weak inverse relationship between blood sugar and osteoporosis in postmenopausal women. These experimental results suggest that the pathogenesis of osteoporosis is associated with IL-1β (-511C/T) polymorphism in postmenopausal women. This polymorphism is an independent risk factor for osteoporosis.

Systematic documentation and analysis of human genetic variation in hemoglobinopathies using the microattribution approach.

PubMed

Giardine, Belinda; Borg, Joseph; Higgs, Douglas R; Peterson, Kenneth R; Philipsen, Sjaak; Maglott, Donna; Singleton, Belinda K; Anstee, David J; Basak, A Nazli; Clark, Barnaby; Costa, Flavia C; Faustino, Paula; Fedosyuk, Halyna; Felice, Alex E; Francina, Alain; Galanello, Renzo; Gallivan, Monica V E; Georgitsi, Marianthi; Gibbons, Richard J; Giordano, Piero C; Harteveld, Cornelis L; Hoyer, James D; Jarvis, Martin; Joly, Philippe; Kanavakis, Emmanuel; Kollia, Panagoula; Menzel, Stephan; Miller, Webb; Moradkhani, Kamran; Old, John; Papachatzopoulou, Adamantia; Papadakis, Manoussos N; Papadopoulos, Petros; Pavlovic, Sonja; Perseu, Lucia; Radmilovic, Milena; Riemer, Cathy; Satta, Stefania; Schrijver, Iris; Stojiljkovic, Maja; Thein, Swee Lay; Traeger-Synodinos, Jan; Tully, Ray; Wada, Takahito; Waye, John S; Wiemann, Claudia; Zukic, Branka; Chui, David H K; Wajcman, Henri; Hardison, Ross C; Patrinos, George P

2011-03-20

We developed a series of interrelated locus-specific databases to store all published and unpublished genetic variation related to hemoglobinopathies and thalassemia and implemented microattribution to encourage submission of unpublished observations of genetic variation to these public repositories. A total of 1,941 unique genetic variants in 37 genes, encoding globins and other erythroid proteins, are currently documented in these databases, with reciprocal attribution of microcitations to data contributors. Our project provides the first example of implementing microattribution to incentivise submission of all known genetic variation in a defined system. It has demonstrably increased the reporting of human variants, leading to a comprehensive online resource for systematically describing human genetic variation in the globin genes and other genes contributing to hemoglobinopathies and thalassemias. The principles established here will serve as a model for other systems and for the analysis of other common and/or complex human genetic diseases.

Transcriptional regulation of fetal to adult hemoglobin switching: new therapeutic opportunities

PubMed Central

Wilber, Andrew; Nienhuis, Arthur W.

2011-01-01

In humans, embryonic, fetal, and adult hemoglobins are sequentially expressed in developing erythroblasts during ontogeny. For the past 40 years, this process has been the subject of intensive study because of its value to enlighten the biology of developmental gene regulation and because fetal hemoglobin can significantly ameliorate the clinical manifestations of both sickle cell disease and β-thalassemia. Understanding the normal process of loss of fetal globin expression and activation of adult globin expression could potentially lead to new therapeutic approaches for these hemoglobin disorders. Herein, we briefly review the history of the study of hemoglobin switching and then focus on recent discoveries in the field that now make new therapeutic approaches seem feasible in the future. Erythroid-specific knockdown of fetal gene repressors or enforced expression of fetal gene activators may provide clinically applicable approaches for genetic treatment of hemoglobin disorders that would benefit from increased fetal hemoglobin levels. PMID:21321359

A Comprehensive Molecular Investigation of α-Thalassemia in an Iranian Cohort from Different Provinces of North Iran.

PubMed

Eftekhari, Hajar; Tamaddoni, Ahmad; Mahmoudi Nesheli, Hassan; Vakili, Mohsen; Sedaghat, Sadegh; Banihashemi, Ali; Azizi, Mandana; Youssefi Kamangar, Reza; Akhavan-Niaki, Haleh

2017-01-01

α-Thalassemia (α-thal) is the most common monogenic disease that is caused by the absence or reduced expression of α-globin genes. The aim of this study was to investigate common α-globin mutations and their associated haplotypes in four northern provinces of Iran (Gilan, Mazandaran, Golestan, Khorasan). One thousand, one hundred and ninety-one persons were tested for α-thal mutations by gap-polymerase chain reaction (PCR), reverse dot-blot hybridization, restriction fragment length polymorphism (RFLP) analysis and sequencing. Of the nine different mutations found, the most frequent were -α 3.7 (rightward deletion) (45.6%), polyadenylation site (α p ° lyA2 α) (α2) (AATAAA>AATGAA; HBA2: c.*92 A>G) (15.27%), - - MED (Mediterranean deletion) (6.86%), -α 4.2 (leftward deletion), (6.17%), α CS α [Hb Constant Spring (Hb CS) (HBA2: c.427 T>C)] (4.62%), -α -5 nt (HBA2: c.95+2_95+6delTGAGG) (3.70%). All chromosomes bearing an α-globin point mutation [α p ° lyA2 α, -α -5 nt α, α CS α, α p ° lyA1 α (AATAAA> AATAAG; HBA2: c.*94 A>G)] showed only one haplotype that was present in most normal chromosomes, while the -α 3.7 deletion was associated with three distinct haplotypes. Our results indicate that α-thal mutations are heterogeneous and -α 3.7 and α p ° lyA2 α are the most prevalent mutations in this region. The presence of -α 3.7 with three different haplotypes suggests an older history for this mutation. The high prevalence of α p ° lyA2 α in Mazandaran Province, Iran compared to other parts of the country and the world, suggests a founder effect. Altogether, we here provide further data confirming the heterogeneity of the northern population of Iran. These data may contribute to the establishment of a national mutation database, more accurate genetic counseling and prenatal diagnosis (PND).

[Obesity studies in candidate genes].

PubMed

Ochoa, María del Carmen; Martí, Amelia; Martínez, J Alfredo

2004-04-17

There are more than 430 chromosomic regions with gene variants involved in body weight regulation and obesity development. Polymorphisms in genes related to energy expenditure--uncoupling proteins (UCPs), related to adipogenesis and insulin resistance--hormone-sensitive lipase (HLS), peroxisome proliferator-activated receptor gamma (PPAR gamma), beta adrenergic receptors (ADRB2,3), and alfa tumor necrosis factor (TNF-alpha), and related to food intake--ghrelin (GHRL)--appear to be associated with obesity phenotypes. Obesity risk depends on two factors: a) genetic variants in candidate genes, and b) biographical exposure to environmental risk factors. It is necessary to perform new studies, with appropriate control groups and designs, in order to reach relevant conclusions with regard to gene/environmental (diet, lifestyle) interactions.

Genetic effect of interleukin-1 beta (C-511T) polymorphism on the structural covariance network and white matter integrity in Alzheimer's disease.

PubMed

Huang, Chi-Wei; Hsu, Shih-Wei; Tsai, Shih-Jen; Chen, Nai-Ching; Liu, Mu-En; Lee, Chen-Chang; Huang, Shu-Hua; Chang, Weng-Neng; Chang, Ya-Ting; Tsai, Wan-Chen; Chang, Chiung-Chih

2017-01-18

Inflammatory processes play a pivotal role in the degenerative process of Alzheimer's disease. In humans, a biallelic (C/T) polymorphism in the promoter region (position-511) (rs16944) of the interleukin-1 beta gene has been significantly associated with differences in the secretory capacity of interleukin-1 beta. In this study, we investigated whether this functional polymorphism mediates the brain networks in patients with Alzheimer's disease. We enrolled a total of 135 patients with Alzheimer's disease (65 males, 70 females), and investigated their gray matter structural covariance networks using 3D T1 magnetic resonance imaging and their white matter macro-structural integrities using fractional anisotropy. The patients were classified into two genotype groups: C-carriers (n = 108) and TT-carriers (n = 27), and the structural covariance networks were constructed using seed-based analysis focusing on the default mode network medial temporal or dorsal medial subsystem, salience network and executive control network. Neurobehavioral scores were used as the major outcome factors for clinical correlations. There were no differences between the two genotype groups in the cognitive test scores, seed, or peak cluster volumes and white matter fractional anisotropy. The covariance strength showing C-carriers > TT-carriers was the entorhinal-cingulum axis. There were two peak clusters (Brodmann 6 and 10) in the salience network and four peak clusters (superior prefrontal, precentral, fusiform, and temporal) in the executive control network that showed C-carriers < TT-carriers in covariance strength. The salience network and executive control network peak clusters in the TT group and the default mode network peak clusters in the C-carriers strongly predicted the cognitive test scores. Interleukin-1 beta C-511 T polymorphism modulates the structural covariance strength on the anterior brain network and entorhinal-interconnected network which were independent of the white matter tract integrity. Depending on the specific C-511 T genotype, different network clusters could predict the cognitive tests.

Single-nucleotide polymorphism in the human mu opioid receptor gene alters beta-endorphin binding and activity: possible implications for opiate addiction.

PubMed

Bond, C; LaForge, K S; Tian, M; Melia, D; Zhang, S; Borg, L; Gong, J; Schluger, J; Strong, J A; Leal, S M; Tischfield, J A; Kreek, M J; Yu, L

1998-08-04

Opioid drugs play important roles in the clinical management of pain, as well as in the development and treatment of drug abuse. The mu opioid receptor is the primary site of action for the most commonly used opioids, including morphine, heroin, fentanyl, and methadone. By sequencing DNA from 113 former heroin addicts in methadone maintenance and 39 individuals with no history of drug or alcohol abuse or dependence, we have identified five different single-nucleotide polymorphisms (SNPs) in the coding region of the mu opioid receptor gene. The most prevalent SNP is a nucleotide substitution at position 118 (A118G), predicting an amino acid change at a putative N-glycosylation site. This SNP displays an allelic frequency of approximately 10% in our study population. Significant differences in allele distribution were observed among ethnic groups studied. The variant receptor resulting from the A118G SNP did not show altered binding affinities for most opioid peptides and alkaloids tested. However, the A118G variant receptor binds beta-endorphin, an endogenous opioid that activates the mu opioid receptor, approximately three times more tightly than the most common allelic form of the receptor. Furthermore, beta-endorphin is approximately three times more potent at the A118G variant receptor than at the most common allelic form in agonist-induced activation of G protein-coupled potassium channels. These results show that SNPs in the mu opioid receptor gene can alter binding and signal transduction in the resulting receptor and may have implications for normal physiology, therapeutics, and vulnerability to develop or protection from diverse diseases including the addictive diseases.

Molecular analysis and association with clinical and laboratory manifestations in children with sickle cell anemia

PubMed Central

Camilo-Araújo, Roberta Faria; Amancio, Olga Maria Silverio; Figueiredo, Maria Stella; Cabanãs-Pedro, Ana Carolina; Braga, Josefina Aparecida Pellegrini

2014-01-01

Objectives To analyze the frequency of βS-globin haplotypes and alpha-thalassemia, and their influence on clinical manifestations and the hematological profile of children with sickle cell anemia. Method The frequency of βS-globin haplotypes and alpha-thalassemia and any association with clinical and laboratorial manifestations were determined in 117 sickle cell anemia children aged 3–71 months. The confirmation of hemoglobin SS and determination of the haplotypes were achieved by polymerase chain reaction-restriction fragment length polymorphism, and alpha-thalassemia genotyping was by multiplex polymerase chain reaction (single-tube multiplex-polymerase chain reaction). Results The genotype distribution of haplotypes was 43 (36.7%) Central African Republic/Benin, 41 (35.0%) Central African Republic/Central African Republic, 20 (17.0%) Rare/atypical, and 13 (11.1%) Benin/Benin. The frequency of the α3.7 deletion was 1.71% as homozygous (−α3.7/−α3.7) and 11.9% as heterozygous (−α3.7/αα). The only significant association in respect to haplotypes was related to the mean corpuscular volume. The presence of alpha-thalassemia was significantly associated to decreases in mean corpuscular volume, mean corpuscular hemoglobin and reticulocyte count and to an increase in the red blood cell count. There were no significant associations of βS-globin haplotypes and alpha-thalassemia with clinical manifestations. Conclusions In the study population, the frequency of alpha-thalassemia was similar to published data in Brazil with the Central African Republic haplotype being the most common, followed by the Benin haplotype. βS-globin haplotypes and interaction between alpha-thalassemia and sickle cell anemia did not influence fetal hemoglobin concentrations or the number of clinical manifestations. PMID:25305165

Evaluation of Glutathione-S-Transferase P1 Polymorphism and its Relation to Bone Mineral Density in Egyptian Children and Adolescents with Beta-Thalassemia Major

PubMed Central

Ragab, Seham M.; Badr, Eman A.; Ibrahim, Ahmed S.

2016-01-01

Background Osteoporosis is a major complication of beta thalassemia major (TM). Increased oxidative stress and its controlling genes were linked to osteoporosis. Ile105 Val variant is a functional polymorphism of Glutathione S-transferase P1 (GSTP1), with reduced anti-oxidative property. No data are available about this variant or its association with osteoporosis among thalassemia patients yet. Objectives To investigate Ile105Val polymorphism and its possible association with bone mineral density (BMD) values in a group of TM children. Methods Thirty five TM children and 30 age and sex matched healthy controls were included. Liver and renal functions, serum ferritin, calcium, phosphorous, alkaline phosphatase and osteocalcin were assayed. BMD was determined by DXA with calculation of Z-scores at lumbar spine (LS) and femoral neck (FN). Height for age Z- score (HAZ) adjusted BMD Z-scores were calculated. GSTP1 Ile105Val polymorphism was studied by polymerase chain reaction-restriction fragment length polymorphism. Results The relative frequency of 105 Val allele was significantly higher in TM patients than the controls (p<0.0001). Significant association between genotype subgroups and BMD parameters was detected. Compared to wild homozygotes, polymorphic homozygotes had lower LS-BMD (p =0.029), LS-BMD Z –score (p=0.008 ), LS- BMD haz - Z-score (p=0.011), FN- BMD (p= 0.001), FN- BMD Z –score (p=0.02) and FN-BMD haz - Z-score (p=0.001). They exhibited higher osteocalcin levels compared to heterozygotes and wild homozygotes (p=0.012, p=0.013, respectively). Conclusion Ile105Val polymorphism was frequent among TM patients and could increase their susceptibility to reduced BMD. Large sample studies are required to confirm these findings. PMID:26740865

Inflammatory Pathway Genes Associated with Inter-Individual Variability in the Trajectories of Morning and Evening Fatigue in Patients Receiving Chemotherapy

PubMed Central

Wright, Fay; Hammer, Marilyn; Paul, Steven M.; Aouizerat, Bradley E.; Kober, Kord M.; Conley, Yvette P.; Cooper, Bruce A.; Dunn, Laura B.; Levine, Jon D.; Melkus, Gail DEramo; Miaskowski, Christine

2017-01-01

Fatigue, a highly prevalent and distressing symptom during chemotherapy (CTX), demonstrates diurnal and interindividual variability in severity. Little is known about the associations between variations in genes involved in inflammatory processes and morning and evening fatigue severity during CTX. The purposes of this study, in a sample of oncology patients (N=543) with breast, gastrointestinal (GI), gynecological (GYN), or lung cancer who received two cycles of CTX, were to determine whether variations in genes involved in inflammatory processes were associated with inter-individual variability in initial levels as well as in the trajectories of morning and evening fatigue. Patients completed the Lee Fatigue Scale to determine morning and evening fatigue severity a total of six times over two cycles of CTX. Using a whole exome array, 309 single nucleotide polymorphisms among the 64 candidate genes that passed all quality control filters were evaluated using hierarchical linear modeling (HLM). Based on the results of the HLM analyses, the final SNPs were evaluated for their potential impact on protein function using two bioinformational tools. The following inflammatory pathways were represented: chemokines (3 genes); cytokines (12 genes); inflammasome (11 genes); Janus kinase/signal transducers and activators of transcription (JAK/STAT, 10 genes); mitogen-activated protein kinase/jun amino-terminal kinases (MAPK/JNK, 3 genes); nuclear factor-kappa beta (NFkB, 18 genes); and NFkB and MAP/JNK (7 genes). After controlling for self-reported and genomic estimates of race and ethnicity, polymorphisms in six genes from the cytokine (2 genes); inflammasome (2 genes); and NFkB (2 genes) pathways were associated with both morning and evening fatigue. Polymorphisms in six genes from the inflammasome (1 gene); JAK/STAT (1 gene); and NFkB (4 genes) pathways were associated with only morning fatigue. Polymorphisms in three genes from the inflammasome (2 genes) and the NFkB (1 gene) pathways were associated with only evening fatigue. Taken together, these findings add to the growing body of evidence that suggests that morning and evening fatigue are distinct symptoms. PMID:28110208

Polymorphisms in the phosducin (PDC) gene on chromosome 1q25-32

DOE Office of Scientific and Technical Information (OSTI.GOV)

Humphries, P.; Mansergh, F.C.; Farrar, G.J.

1994-09-01

Phosducin (33 kDa protein or MEKA) is a principal water-soluble phosphoprotein in the rod and cone photoreceptor cells and pinealocytes. This protein modulates the phototransduction cascade by binding to the beta and gamma subunit complexes of transducin. The PDC gene has been mapped to 1q25-32, the region of linkage of two hereditary retinal degenerative disorders; autosomal dominant juvenile-onset open-angle glaucoma and one form of autosomal recessive RP. Using previously published sequence data, PCR primers were designed to amplify the coding and 5{prime} flanking regions of the PDC gene. Direct sequencing revealed three polymorphisms in the 5{prime} flanking region, two ofmore » which were in regions highly homologous between humans and mice. Analysis of the polymorphisms was then extended to larger population samples using SSCPE and denaturing gel analysis. The first polymorphism PDC1 resulted from an insertion of a G residue at position -653/4. Allele frequencies were determined to be 0.51 (insG) and 0.49 (normal) giving a PIC value of 0.50. A deletion of a T residue at position -488 was the basis of the PDC2 polymorphism with allele frequencies of 0.88 (normal) and 0.12 (delT) and a PIC value of 0.21. Interestingly, the allele with an inserted G residue in PDC1 always segregrated with the deleted T allele in PDC2. The third polymorphism PDC3 was caused by a T or G residue at position -1083. Allele frequencies of 0.26 (G residue) and 0.74 (T residue) were determined from an analysis of 80 individuals with an overall PIC value of 0.39. The identification of these three polymorphisms in the PDC gene will be useful for future genetic linkage studies of chromosome 1q in inherited retinopathies.« less

Generation of Mice Deficient in both KLF3/BKLF and KLF8 Reveals a Genetic Interaction and a Role for These Factors in Embryonic Globin Gene Silencing

PubMed Central

Funnell, Alister P. W.; Mak, Ka Sin; Twine, Natalie A.; Pelka, Gregory J.; Norton, Laura J.; Radziewic, Tania; Power, Melinda; Wilkins, Marc R.; Bell-Anderson, Kim S.; Fraser, Stuart T.; Perkins, Andrew C.; Tam, Patrick P.; Pearson, Richard C. M.

2013-01-01

Krüppel-like factors 3 and 8 (KLF3 and KLF8) are highly related transcriptional regulators that bind to similar sequences of DNA. We have previously shown that in erythroid cells there is a regulatory hierarchy within the KLF family, whereby KLF1 drives the expression of both the Klf3 and Klf8 genes and KLF3 in turn represses Klf8 expression. While the erythroid roles of KLF1 and KLF3 have been explored, the contribution of KLF8 to this regulatory network has been unknown. To investigate this, we have generated a mouse model with disrupted KLF8 expression. While these mice are viable, albeit with a reduced life span, mice lacking both KLF3 and KLF8 die at around embryonic day 14.5 (E14.5), indicative of a genetic interaction between these two factors. In the fetal liver, Klf3 Klf8 double mutant embryos exhibit greater dysregulation of gene expression than either of the two single mutants. In particular, we observe derepression of embryonic, but not adult, globin expression. Taken together, these results suggest that KLF3 and KLF8 have overlapping roles in vivo and participate in the silencing of embryonic globin expression during development. PMID:23716600

The tyrosine B10 hydroxyl is crucial for oxygen avidity of Ascaris hemoglobin.

PubMed

Kloek, A P; Yang, J; Mathews, F S; Frieden, C; Goldberg, D E

1994-01-28

The parasitic nematode Ascaris suum has a gene encoding a two-domain hemoglobin with remarkable oxygen avidity. The strong interaction with oxygen is a consequence of a particularly slow oxygen off-rate. The single polypeptide chain consists of two domains, each of which can be expressed separately in Escherichia coli as a globin-like protein exhibiting oxygen binding characteristics comparable with the native molecule. Site-directed mutagenesis was performed on the gene segment encoding domain one. The E7 position, involved in forming a hydrogen bond with the liganded oxygen in vertebrate globins, is a glutamine in both Ascaris domains. Conversion of this residue to leucine or alanine produced a hemoglobin variant with an oxygen off-rate 5- or 60-fold faster than that of unaltered domain one. Replacement of the tyrosine B10 with either phenylalanine or leucine (as found in vertebrate globins) yielded hemoglobin mutants with oxygen off-rates 280- or 570-fold faster, approaching rates found with vertebrate myoglobins. The data suggest that the distal glutamine hydrogen bonds with the liganded oxygen and that the tyrosine B10 hydroxyl contributes an additional hydrogen bond that appears substantially responsible for the extreme oxygen avidity of Ascaris hemoglobin.

Physical function is weakly associated with angiotensin-converting enzyme gene I/D polymorphism in elderly Japanese subjects.

PubMed

Yoshihara, A; Tobina, T; Yamaga, T; Ayabe, M; Yoshitake, Y; Kimura, Y; Shimada, M; Nishimuta, M; Nakagawa, N; Ohashi, M; Hanada, N; Tanaka, H; Kiyonaga, A; Miyazaki, H

2009-01-01

The turning point in the deterioration of physical function seems to occur between the ages of 70 and 80 years. In particular, muscle strength may decline even more in subjects older than 75. A recent study found that the angiotensin-converting enzyme (ACE) genotype also affects physiological left ventricular hypertrophy. A very limited number of papers have examined genetic differences in resistance and endurance forms of a single sporting discipline. The purpose of this study was to evaluate the relationship between ACE genotype and physical function by controlling the known confounding factors including dental status. We selected 431 subjects who were aged 76 years and did not require special care for their daily activities. We conducted a medical examination, followed by 5 physical function tests, as follows: (1) maximum hand grip strength, (2) maximal isometric knee extensor strength, (3) maximal stepping rate for 10 s, (4) one-leg standing time with eyes open and (5) 10-meter maximum walking speed. Subjects were genotyped for the ACE intron 16 Alu insertion. In addition, serum concentrations of total cholesterol, total protein, IgA and IgG were measured at a commercial laboratory. The Eichner index was used as an indicator of occlusal condition. Multiple linear regression analysis was performed to evaluate the relationship between the ACE gene insertion/deletion (I/D) polymorphism and physical function considering confounding factors. The ACE gene I/D polymorphism was positively associated with hand grip strength and 10-meter maximum walking speed. Betas of hand grip strength were 0.09 for I/D (p = 0.022) and 0.12 for insertion/insertion (I/I; p = 0.004). Betas of 10-meter walking speed were -0.11 for I/D (p = 0.093) and -0.14 for I/I (p = 0.039). Dental status such as Eichner index class C was significantly associated with one-leg standing time with eyes open (beta -0.11; p = 0.028). This study suggests that there is a significant relationship between ACE genotype and physical function. In particular, subjects with the ACE deletion/deletion genotype were associated with upper extremities. Copyright 2009 S. Karger AG, Basel.

Circulating DNA: a potential marker of sickle cell crisis.

PubMed

Vasavda, Nisha; Ulug, Pinar; Kondaveeti, Sheila; Ramasamy, Karthik; Sugai, Taku; Cheung, Gordon; Rees, David C; Awogbade, Moji; Bannister, Sybil; Cunningham, Juliette; Menzel, Stephan; Thein, Swee Lay

2007-10-01

Free circulating DNA is present in the plasma of healthy subjects, and is elevated in conditions characterized by increased cell death, such as cancer and physical trauma. Analysis of circulating DNA in plasma could provide a useful biomarker in sickle cell disease (SCD) in view of the increased cell turnover through chronic ongoing haemolysis, recurrent vaso-occlusion and inflammation. Plasma DNA was determined by real-time quantitative polymerase chain reaction (PCR) amplification of the beta-globin gene (HBB) in 154 patients with SCD [105 haemoglobin (Hb)SS, 46 HbSC and three HbS/beta(0) thalassaemia] and 53 ethnically matched controls. Blood samples were obtained from all patients in steady state; 21 of the 154 patients were also sampled during admission to hospital for acute pain. Median concentration of circulating plasma DNA in acute pain was more than 10-fold that in steady state and in controls - 10070 vs. 841 and 10070 vs. 933 genome equivalents/ml respectively (P < 0.0001, in both cases). During steady state, patients had plasma DNA levels similar to controls. Plasma DNA levels in SCD correlated with C-reactive protein levels (P < 0.005) and total white cell counts (P < 0.05) in steady state. The study shows that plasma DNA concentration may have potential as a biomarker in sickle cell patients.

Pseudoreticulocytosis in a patient with hemoglobin Köln due to autofluorescent erythrocytes enumerated as reticulocytes by the Cell-Dyn 4000.

PubMed

Sato, Shoko; Hirayama, Koichi; Koyama, Akio; Harano, Teruo; Nagasawa, Toshiro; Ninomiya, Haruhiko

2004-01-01

Pseudoreticulocytosis in a 25-year-old female patient with hemoglobin Köln is reported. The abnormal hemoglobin, hemoglobin Köln (beta chain, Val98-->Met), had previously been confirmed in the patient at the age of 21 years, as well as in her mother, by polymerase chain reaction-based direct sequence analysis of the beta globin gene. The patient underwent splenectomy at the age of 22 years. On her admission to our hospital for treatment of an immunoglobulin A nephropathy, an analysis by an automated hematology analyzer, the Abbott Cell-Dyn 4000 (CD4000), reported a marked reticulocytosis. Staining by the Brecher method with new methylene blue indicated a moderate reticulocytosis (5.7%) of a lesser extent than that indicated by the CD4000 (51.1%). The frequencies of red blood cells (RBC) with Pappenheimer bodies (13.8%), Heinz bodies (32.7%), and Howell-Jolly bodies (0.3%) were increased. The CD4000 detects RBC with RNA fluorescently stained with CD4K530 as reticulocytes. Autofluorescence of RBC with hemoglobin Köln, as we demonstrated by flow cytometry and fluorescent microscopy, was considered to have caused the pseudoreticulocytosis on the fully automated reticulocyte enumeration by the CD4000.

Haplotypes in the gene encoding protein kinase c-beta (PRKCB1) on chromosome 16 are associated with autism.

PubMed

Philippi, A; Roschmann, E; Tores, F; Lindenbaum, P; Benajou, A; Germain-Leclerc, L; Marcaillou, C; Fontaine, K; Vanpeene, M; Roy, S; Maillard, S; Decaulne, V; Saraiva, J P; Brooks, P; Rousseau, F; Hager, J

2005-10-01

Autism is a developmental disorder characterized by impairments in social interaction and communication associated with repetitive patterns of interest or behavior. Autism is highly influenced by genetic factors. Genome-wide linkage and candidate gene association approaches have been used to try and identify autism genes. A few loci have repeatedly been reported linked to autism. Several groups reported evidence for linkage to a region on chromosome 16p. We have applied a direct physical identity-by-descent (IBD) mapping approach to perform a high-density (0.85 megabases) genome-wide linkage scan in 116 families from the AGRE collection. Our results confirm linkage to a region on chromosome 16p with autism. High-resolution single-nucleotide polymorphism (SNP) genotyping and analysis of this region show that haplotypes in the protein kinase c-beta gene are strongly associated with autism. An independent replication of the association in a second set of 167 trio families with autism confirmed our initial findings. Overall, our data provide evidence that the PRKCB1 gene on chromosome 16p may be involved in the etiology of autism.

Sequence variations of the alpha-globin genes: scanning of high CG content genes with DHPLC and DG-DGGE.

PubMed

Lacerra, Giuseppina; Fiorito, Mirella; Musollino, Gennaro; Di Noce, Francesca; Esposito, Maria; Nigro, Vincenzo; Gaudiano, Carlo; Carestia, Clementina

2004-10-01

The alpha-globin chains are encoded by two duplicated genes (HBA2 and HBA1, 5'-3') showing overall sequence homology >96% and average CG content >60%. alpha-Thalassemia, the most prevalent worldwide autosomal recessive disorder, is a hereditary anemia caused by sequence variations of these genes in about 25% of carriers. We evaluated the overall sensitivity and suitability of DHPLC and DG-DGGE in scanning both the alpha-globin genes by carrying out a retrospective analysis of 19 variant alleles in 29 genotypes. The HBA2 alleles c.1A>G, c.79G>A, and c.281T>G, and the HBA1 allele c.475C>A were new. Three pathogenic sequence variations were associated in cis with nonpathogenic variations in all families studied; they were the HBA2 variation c.2T>C associated with c.-24C>G, and the HBA2 variations c.391G>C and c.427T>C, both associated with c.565G>A. We set up original experimental conditions for DHPLC and DG-DGGE and analyzed 10 normal subjects, 46 heterozygotes, seven homozygotes, seven compound heterozygotes, and six compound heterozygotes for a hybrid gene. Both the methodologies gave reproducible results and no false-positive was detected. DHPLC showed 100% sensitivity and DG-DGGE nearly 90%. About 100% of the sequence from the cap site to the polyA addition site could be scanned by DHPLC, about 87% by DG-DGGE. It is noteworthy that the three most common pathogenic sequence variations (HBA2 alleles c.2T>C, c.95+2_95+6del, and c.523A>G) were unambiguously detected by both the methodologies. Genotype diagnosis must be confirmed with PCR sequencing of single amplicons or with an allele-specific method. This study can be helpful for scanning genes with high CG content and offers a model suitable for duplicated genes with high homology. Copyright 2004 Wiley-Liss, Inc.

CRAWview: for viewing splicing variation, gene families, and polymorphism in clusters of ESTs and full-length sequences.

PubMed

Chou, A; Burke, J

1999-05-01

DNA sequence clustering has become a valuable method in support of gene discovery and gene expression analysis. Our interest lies in leveraging the sequence diversity within clusters of expressed sequence tags (ESTs) to model gene structure for the study of gene variants that arise from, among other things, alternative mRNA splicing, polymorphism, and divergence after gene duplication, fusion, and translocation events. In previous work, CRAW was developed to discover gene variants from assembled clusters of ESTs. Most importantly, novel gene features (the differing units between gene variants, for example alternative exons, polymorphisms, transposable elements, etc.) that are specialized to tissue, disease, population, or developmental states can be identified when these tools collate DNA source information with gene variant discrimination. While the goal is complete automation of novel feature and gene variant detection, current methods are far from perfect and hence the development of effective tools for visualization and exploratory data analysis are of paramount importance in the process of sifting through candidate genes and validating targets. We present CRAWview, a Java based visualization extension to CRAW. Features that vary between gene forms are displayed using an automatically generated color coded index. The reporting format of CRAWview gives a brief, high level summary report to display overlap and divergence within clusters of sequences as well as the ability to 'drill down' and see detailed information concerning regions of interest. Additionally, the alignment viewing and editing capabilities of CRAWview make it possible to interactively correct frame-shifts and otherwise edit cluster assemblies. We have implemented CRAWview as a Java application across windows NT/95 and UNIX platforms. A beta version of CRAWview will be freely available to academic users from Pangea Systems (http://www.pangeasystems.com). Contact :

Interactions between environmental factors and maternal-fetal genetic variations: strategies to elucidate risks of preterm birth.

PubMed

Pereyra, Silvana; Bertoni, Bernardo; Sapiro, Rossana

2016-07-01

Preterm birth (PTB) is a complex disease in which medical, social, cultural, and hereditary factors contribute to the pathogenesis of this adverse event. Interactions between genes and environmental factors may complicate our understanding of the relative influence of both effects on PTB. To overcome this, we combined data obtained from a cohort of newborns and their mothers with multiplex analysis of inflammatory-related genes and several environmental risk factors of PTB to describe the environmental-genetic influence on PTB. The study aimed to investigate the association between maternal and fetal genetic variations in genes related to the inflammation pathway with PTB and to assess the interaction between environmental factors with these variations. We conducted a case-control study at the Pereira Rossell Hospital Center, Montevideo, Uruguay. The study included 143 mother-offspring dyads who delivered at preterm (gestational age<37 weeks) and 108 mother-offspring dyads who delivered at term. We used real-time PCR followed by a high-resolution melting analysis to simultaneously identify gene variations involved in inflammatory pathways in the context of environmental variables. The genes analyzed were: Toll-like receptor 4 (TLR4), Interleukin 6 (IL6), Interleukin 1 beta (IL1B) and Interleukin 12 receptor beta (IL12RB). We detected a significant interaction between IL1B rs16944 polymorphism in maternal samples and IL6 rs1800795 polymorphism in newborns, emphasizing the role of the interaction of maternal and fetal genomes in PTB. In addition, smoke exposure and premature rupture of membranes (PROM) were significantly different between the premature group and controls. IL1B and IL6 polymorphisms in mothers were significantly associated with PTB when controlling for smoke exposure. TLR4 polymorphism and PROM were significantly associated with PTB when controlling for PROM, but only in the case of severe PTB. Interactions between maternal and fetal genomes may influence the timing of birth. By incorporating environmental data, we revealed genetic associations with PTB, a finding not found when we analyzed genetic data alone. Our results stress the importance of studying the effect of genotype interactions between mothers and children in the context of environmental factors because they substantially contribute to phenotype variability. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Conversion events in gene clusters

PubMed Central

2011-01-01

Background Gene clusters containing multiple similar genomic regions in close proximity are of great interest for biomedical studies because of their associations with inherited diseases. However, such regions are difficult to analyze due to their structural complexity and their complicated evolutionary histories, reflecting a variety of large-scale mutational events. In particular, conversion events can mislead inferences about the relationships among these regions, as traced by traditional methods such as construction of phylogenetic trees or multi-species alignments. Results To correct the distorted information generated by such methods, we have developed an automated pipeline called CHAP (Cluster History Analysis Package) for detecting conversion events. We used this pipeline to analyze the conversion events that affected two well-studied gene clusters (α-globin and β-globin) and three gene clusters for which comparative sequence data were generated from seven primate species: CCL (chemokine ligand), IFN (interferon), and CYP2abf (part of cytochrome P450 family 2). CHAP is freely available at http://www.bx.psu.edu/miller_lab. Conclusions These studies reveal the value of characterizing conversion events in the context of studying gene clusters in complex genomes. PMID:21798034

Genetic dissection of the α-globin super-enhancer in vivo

PubMed Central

Hay, Deborah; Hughes, Jim R.; Rode, Christina; Li, Pik-Shan; Pennacchio, Len A.; Sloane-Stanley, Jacqueline A.; Ayyub, Helena; Butler, Sue; Sauka-Spengler, Tatjana; Gibbons, Richard J.; Smith, Andrew J.H.; Wood, William G.; Higgs, Douglas R.

2016-01-01

Many genes determining cell identity are regulated by clusters of mediator-bound enhancer elements collectively referred to as super-enhancers. These have been proposed to manifest higher-order properties important in development and disease. Here, we report a comprehensive functional dissection of one of the strongest putative super-enhancers in erythroid cells. By generating a series of mouse models, deleting each of the five regulatory elements of the α-globin super-enhancer singly and in informative combinations, we demonstrate that each constituent enhancer appears to act independently and in an additive fashion with respect to hematologic phenotype, gene expression, chromatin structure and chromosome conformation, without clear evidence of synergistic or higher-order effects. Our study highlights the importance of functional genetic analyses for the identification of new concepts in transcriptional regulation. PMID:27376235

Electromobility Shift Assay Reveals Evidence in Favor of Allele-Specific Binding of RUNX1 to the 5' Hypersensitive Site 4-Locus Control Region.

PubMed

Dehghani, Hossein; Ghobakhloo, Sepideh; Neishabury, Maryam

2016-08-01

In our previous studies on the Iranian β-thalassemia (β-thal) patients, we identified an association between the severity of the β-thal phenotype and the polymorphic palindromic site at the 5' hypersensitive site 4-locus control region (5'HS4-LCR) of the β-globin gene cluster. Furthermore, a linkage disequilibrium was observed between this region and XmnI-HBG2 in the patient population. Based on this data, it was suggested that the well-recognized phenotype-ameliorating role assigned to positive XmnI could be associated with its linked elements in the LCR. To investigate the functional significance of polymorphisms at the 5'HS4-LCR, we studied its influence on binding of transcription factors. Web-based predictions of transcription factor binding revealed a binding site for runt-related transcription factor 1 (RUNX1), when the allele at the center of the palindrome (TGGGG(A/G)CCCCA) was A but not when it was G. Furthermore, electromobility shift assay (EMSA) presented evidence in support of allele-specific binding of RUNX1 to 5'HS4. Considering that RUNX1 is a well-known regulator of hematopoiesis, these preliminary data suggest the importance of further studies to confirm this interaction and consequently investigate its functional and phenotypical relevance. These studies could help us to understand the molecular mechanism behind the phenotype modifying role of the 5'HS4-LCR polymorphic palindromic region (rs16912979), which has been observed in previous studies.

G protein polymorphisms do not predict weight loss and improvement of hypertension in severely obese patients.

PubMed

Potoczna, Natascha; Wertli, Maria; Steffen, Rudolph; Ricklin, Thomas; Lentes, Klaus-Ulrich; Horber, Fritz F

2004-11-01

Both the gene encoding the alpha subunit of G stimulatory proteins (GNAS1) and the beta3 subunit gene (GNB3) of G proteins are associated with obesity and/or hypertension. Moreover, the TT/TC825 polymorphism of GNB3 predicts greater weight loss than the CC825 polymorphism in obese patients (mean body mass index, 35 kg/m2) undergoing a structured nonpharmacologic weight loss program. Gastric banding enforces a low-calorie diet by diminishing the need for volitional adherence. It is unknown whether these polymorphisms predict the variable weight loss in patients after bariatric surgery. Three hundred and four severely obese patients (mean +/- SEM age, 42 +/- 1 years; 245 women and 59 men; mean +/- SEM body mass index, 43.9 +/- 0.3 kg/m2) followed prospectively for at least 3 years after surgery were genotyped for the GNB3 C825T, G814A, and GNAS1 T393 polymorphisms. All analyses were performed blinded to the phenotypic characteristics of the study group. Frequencies of polymorphisms were comparable to those previously published. No polymorphism studied predicted 3-year weight loss or was associated with high blood pressure in severely obese patients after gastric banding. Multivariate analysis of potentially confounding factors such as reoperation rate or use of sibutramine or orlistat revealed similar results (P > 0.1). Regardless of the mechanism(s) involved for these discordant findings, GNB3 C825T, G814A, and GNAS1 T393C polymorphisms do not seem to be reliable predictors of long-term weight loss.

Gene-gene interactions of CYP2A6 and MAOA polymorphisms on smoking behavior in Chinese male population.

PubMed

Tang, Xun; Guo, Song; Sun, Hongqiang; Song, Xuemei; Jiang, Zuonin; Sheng, Lixiang; Zhou, Dongfeng; Hu, Yonghua; Chen, Dafang

2009-05-01

Nicotine is the major psychoactive ingredient in tobacco, and is responsible for dependence through the nicotine-stimulated reward pathway mediated by the central dopaminergic system. Consequently, genetic polymorphisms in both nicotine metabolism and dopamine catabolism genes may influence smoking behavior, and interact with each other resulting in risk modulation. In this study, we investigated the association and multilocus gene-gene interactions of cytochrome P450 2A6 (CYP2A6), dopamine beta-hydroxylase (DBH), catechol O-methyl transferase (COMT), and monoamine oxidase A (MAOA) polymorphisms with smoking behavior in a community-based Chinese male population. The polymorphisms were genotyped in 203 current smokers, 66 former smokers, and 102 never smokers. Multivariate logistic regression models and the multifactor dimensionality reduction method were used to analyze the association and multilocus gene-gene interactions. Statistically significant trends were shown for increased risk of smoking initiation in participants with CYP2A6*1B/CYP2A6*1B genotypes compared with those with CYP2A6*1A/CYP2A6*1A genotypes [odds ratio (OR)=3.5, 95% confidence interval (CI)= 1.5-8.1], and participants with CYP2A6*1/CYP2A6*1 genotypes were at higher risk of smoking initiation (OR=2.4, 95% CI=1.2-4.5) and smoking persistence (OR=4.0, 95% CI=1.5-10.3) than those who have CYP2A6*4C genotypes. Moreover, the best model involved a gene-gene interaction between MAOA and CYP2A6 was characterized by the multifactor dimensionality reduction method (64.11% accuracy, P<0.001), and indicated that carriers of the combined 1460 T/O genotype for MAOA EcoRV and CYP2A6*1/CYP2A6*1 genotypes were at higher risk of smoking (OR=15.4, 95% CI=4.5-52.5). These findings suggested a substantial influence of CYP2A6 polymorphism as well as the interaction with MAOA resulting in risk modulation on smoking behavior in Chinese male population.

Association of glutathione S-transferase Ω 1-1 polymorphisms (A140D and E208K) with the expression of interleukin-8 (IL-8), transforming growth factor beta (TGF-β), and apoptotic protease-activating factor 1 (Apaf-1) in humans chronically exposed to arsenic in drinking water.

PubMed

Escobar-García, D M; Del Razo, L M; Sanchez-Peña, L C; Mandeville, P B; Lopez-Campos, C; Escudero-Lourdes, Claudia

2012-06-01

Human exposure to arsenicals is associated with inflammatory-related diseases including different kinds of cancer as well as non-cancerous diseases like neuro-degenerative diseases, atherosclerosis, hypertension, and diabetes. Interindividual susceptibility has been mainly addressed by evaluating the role of genetic polymorphism in metabolic enzymes in inorganic arsenic (iAs) metabolism. Glutathione S-transferase omega 1-1 (GSTO1-1), which had been associated with iAs metabolism, is also known to participate in inflammatory and apoptotic cellular responses. The polymorphism A140D of GSTO1-1 has been not only associated with distinct urinary profile of arsenic metabolites in populations chronically exposed to iAs in drinking water, but also with higher risk of childhood leukemia and lung disease in non-exposed populations, suggesting that GSTO1-1 involvement in other physiologic processes different from toxics metabolism could be more relevant than is thought. We evaluated the association of the presence of A140D and E208K polymorphisms of GSTO1-1 gene with the expression of genes codifying for proteins involved in the inflammatory and apoptotic response in a human population chronically exposed to iAs through drinking water. A140D polymorphism was associated with higher expression of genes codifying for IL-8 and Apaf-1 mainly in heterozygous individuals, while E208K was associated with higher expression of IL-8 and TGF- gene, in both cases, the association was independently of iAs exposure level; however, the exposure to iAs increased slightly but significantly the influence of A140D and E208K polymorphisms on such genes expression. These results suggest an important role of GSTO1-1 in the inflammatory response and the apoptotic process and indicate that A140D and E208K polymorphisms could increase the risk of developing inflammatory and apoptosis-related diseases in As-exposed populations.

Transforming growth factor- 1 C-509T polymorphism, oxidant stress, and early-onset childhood asthma.

PubMed

Salam, Muhammad T; Gauderman, W James; McConnell, Rob; Lin, Pi-Chu; Gilliland, Frank D

2007-12-15

Transforming growth factor (TGF)-beta1 is involved in airway inflammation and remodeling, two key processes in asthma pathogenesis. Tobacco smoke and traffic emissions induce airway inflammation and modulate TGF-beta1 gene expression. We hypothesized that the effects of functional TGF-beta1 variants on asthma occurrence vary by these exposures. We tested these hypotheses among 3,023 children who participated in the Children's Health Study. Tagging single-nucleotide polymorphisms rs4803457 C>T and C-509T (a functional promoter polymorphism) accounted for 94% of the haplotype diversity of the upstream region. Exposure to maternal smoking in utero was based on smoking by biological mother during pregnancy. Residential distance from nearest freeway was calculated based on residential address at study entry. Children with the -509TT genotype had a 1.8-fold increased risk of early persistent asthma (95% confidence interval [CI], 1.11-2.95). This association varied marginally significantly by in utero exposure to maternal smoking. Compared with children with the -509CC/CT genotype with no in utero exposure to maternal smoking, those with the -509TT genotype with such exposure had a 3.4-fold increased risk of early persistent asthma (95% CI, 1.46-7.80; interaction, P = 0.11). The association between TGF-beta1 C-509T and lifetime asthma varied by residential proximity to freeways (interaction P = 0.02). Children with the -509TT genotype living within 500 m of a freeway had over three-fold increased lifetime asthma risk (95% CI, 1.29-7.44) compared with children with CC/CT genotype living > 1500 m from a freeway. Children with the TGF-beta1 -509TT genotype are at increased risk of asthma when they are exposed to maternal smoking in utero or to traffic-related emissions.

Homogeneous real-time detection of single-nucleotide polymorphisms by strand displacement amplification on the BD ProbeTec ET system.

PubMed

Wang, Sha-Sha; Thornton, Keith; Kuhn, Andrew M; Nadeau, James G; Hellyer, Tobin J

2003-10-01

The BD ProbeTec ET System is based on isothermal strand displacement amplification (SDA) of target nucleic acid coupled with homogeneous real-time detection using fluorescent probes. We have developed a novel, rapid method using this platform that incorporates a universal detection format for identification of single-nucleotide polymorphisms (SNPs) and other genotypic variations. The system uses a common pair of fluorescent Detector Probes in conjunction with unlabeled allele-specific Adapter Primers and a universal buffer chemistry to permit analysis of multiple SNP loci under generic assay conditions. We used Detector Probes labeled with different dyes to facilitate differentiation of two alternative alleles in a single reaction with no postamplification manipulation. We analyzed six SNPs within the human beta(2)-adrenergic receptor (beta(2)AR) gene, using whole blood, buccal swabs, and urine samples, and compared results with those obtained by DNA sequencing. Unprocessed whole blood was successfully genotyped with as little as 0.1-1 micro L of sample per reaction. All six beta(2)AR assays were able to accommodate >/==" BORDER="0">20 micro L of unprocessed whole blood. For the 14 individuals tested, genotypes determined with the six beta(2)AR assays agreed with DNA sequencing results. SDA-based allelic differentiation on the BD ProbeTec ET System can detect SNPs rapidly, using whole blood, buccal swabs, or urine.

Beta 2 adrenergic receptor polymorphisms, at codons 16 and 27, and bronchodilator responses in adult Venezuelan asthmatic patients.

PubMed

Larocca, Nancy; Moreno, Dolores; Garmendia, Jenny Valentina; Velasquez, Olga; Martin-Rojo, Joana; Talamo, Carlos; Garcia, Alexis; De Sanctis, Juan Bautista

2013-12-01

One of the gene polymorphisms often studied in asthmatic patients is the β2 adrenergic receptor (ADRβ2). Even though in the Venezuelan Mestizo population there is a high incidence of asthma, there are no direct reports of ADRβ2 gene polymorphism, and treatment response. The aim of this study was to assess, in this population, the gene frequency of ADRβ2 polymorphisms at codons 16 Arg/Gly and 27 Gln/Glu, allergen sensitization, and its relationship to bronchodilator response. Purified genomic DNA was obtained form 105 Mestizo asthmatic and 100 Mestizo healthy individuals from Venezuela. The two polymorphisms were assessed by PCR-RFLP. Patient sensitization to aeroallergens and their response to bronchodilatation were correlated. Significant differences between patients and controls were recorded in: 1) the prevalence of Arg/Arg at codon 16 (28.6% in patients vs. 47% in controls, P<0.01), 2) the frequency of heterozygotes Arg/Gly (55% in patients vs. 35% in controls, P<0.01). Conversely, no differences in polymorphism frequencies were found at codon 27. The haplotypes Arg/Gly-Gln/Gln were more common in patients than controls (P <0.01), whereas the Arg/Arg-Gln/Glu combination prevailed in the control group (P<0.01). The Arg/Gly and Gln/Glu genotypes were associated with better responses after salbutamol. The asthmatic homozygotes Arg/Arg have higher sensitivity to aeroallergens. The difference in Arg/Arg frequency between groups suggests that this could be a protective genotype although the asthmatic group had a higher sensitivity to aeroallergens. The asthmatic heterozygotes had better bronchodilator responses than the homozygotes.

Mapping a quantitative trait locus for the concentration of beta-lactoglobulin in milk, and the effect of beta-lactoglobulin genetic variants on the composition of milk from Holstein-Friesian x Jersey crossbred cows.

PubMed

Berry, S D; Lopez-Villalobos, N; Beattie, E M; Davis, S R; Adams, L F; Thomas, N L; Ankersmit-Udy, A E; Stanfield, A M; Lehnert, K; Ward, H E; Arias, J A; Spelman, R J; Snell, R G

2010-02-01

To identify quantitative trait loci (QTL) affecting the concentration of beta-lactoglobulin in milk, and to evaluate the effect of beta-lactoglobulin genetic variants on the concentration of fat, protein and casein in bovine milk. A herd of 850 F2 Holstein-Friesian x Jersey crossbred cows was produced through mating six Holstein-Friesian x Jersey F1 bulls of high genetic merit with F1 cows from the national herd. A total of 1,610 herd-test records from 556 second-parity crossbreds were analysed. The concentration of fat, protein and casein in milk was measured at peak, mid- and late lactation, during the production seasons of 2003-2004 and 2004-2005. Liveweight was measured daily. DNA from the F2 animals, their F1 dams and sires, and selected grandsires was genotyped across the genome, initially with 285 microsatellite markers, and subsequently with 6,634 single nucleotide polymorphisms (SNP). A highly significant QTL for the concentration of beta-lactoglobulin in milk was identified, which coincided with the position of the beta-lactoglobulin gene on bovine Chromosome 11. No other consistently significant QTL for the concentration of beta-lactoglobulin in milk were detected. Cows with the BB beta-lactoglobulin genotype produced milk with a 30% lower concentration of beta-lactoglobulin than cows with the AA genotype. The beta-lactoglobulin polymorphism also explained variation in the proportion of casein in total protein. In addition, the percentage of fat was higher for BB than AA animals, whereas the percentage of total protein, mean daily milk yield and liveweight did not differ between AA and BB animals. A significant QTL determining the concentration of beta-lactoglobulin in milk was identified. Selection of animals for the beta-lactoglobulin B-allele may enable the production of milk naturally enriched for casein, thus allowing a potential increase in the yield of cheese. There may be additional future value in production of bovine milk more like human milk, where decreasing the concentration of beta-lactoglobulin is desirable.

The conserved Phe GH5 of importance for hemoglobin intersubunit contact is mutated in gadoid fish

PubMed Central

2014-01-01

Background Functionality of the tetrameric hemoglobin molecule seems to be determined by a few amino acids located in key positions. Oxygen binding encompasses structural changes at the interfaces between the α1β2 and α2β1 dimers, but also subunit interactions are important for the oxygen binding affinity and stability. The latter packing contacts include the conserved Arg B12 interacting with Phe GH5, which is replaced by Leu and Tyr in the αA and αD chains, respectively, of birds and reptiles. Results Searching all known hemoglobins from a variety of gnathostome species (jawed vertebrates) revealed the almost invariant Arg B12 coded by the AGG triplet positioned at an exon-intron boundary. Rare substitutions of Arg B12 in the gnathostome β globins were found in pig, tree shrew and scaled reptiles. Phe GH5 is also highly conserved in the β globins, except for the Leu replacement in the β1 globin of five marine gadoid species, gilthead seabream and the Comoran coelacanth, while Cys and Ile were found in burbot and yellow croaker, respectively. Atlantic cod β1 globin showed a Leu/Met polymorphism at position GH5 dominated by the Met variant in northwest-Atlantic populations that was rarely found in northeast-Atlantic cod. Site-specific analyses identified six consensus codons under positive selection, including 122β(GH5), indicating that the amino acid changes identified at this position may offer an adaptive advantage. In fact, computational mutation analysis showed that the replacement of Phe GH5 with Leu or Cys decreased the number of van der Waals contacts essentially in the deoxy form that probably causes a slight increase in the oxygen binding affinity. Conclusions The almost invariant Arg B12 and the AGG codon seem to be important for the packing contacts and pre-mRNA processing, respectively, but the rare mutations identified might be beneficial. The Leu122β1(GH5)Met and Met55β1(D6)Val polymorphisms in Atlantic cod hemoglobin modify the intradimer contacts B12-GH5 and H2-D6, while amino acid replacements at these positions in avian hemoglobin seem to be evolutionary adaptive in air-breathing vertebrates. The results support the theory that adaptive changes in hemoglobin functions are caused by a few substitutions at key positions. PMID:24655798

Polymorphism of follicle stimulating hormone beta (FSHβ) subunit gene and its association with litter traits in giant panda.

PubMed

Huang, Xiaoyu; Li, Desheng; Wang, Jiwen; Huang, Yan; Han, Chunchun; Zhang, Guiquan; Huang, Zhi; Wu, Honglin; Wei, Ming; Wang, Guosong; Hu, Haiping; Deng, Tao; He, Tao; Zhou, Yingming; Song, Shixian; Luo, Bo; Zhang, Heming

2013-11-01

The different SSCP patterns of the follicle stimulating hormone beta (FSHβ) gene amplified by three pairs of primers were sequenced. Comparisons among the three nucleotide sequences of three genotypes indicated that three base substitutions (A213T, A91G, and A89C) were detected in FSHβ gene, which A213T substitution led to one amino acids mutation (Lys > Met), and the other two substitutions were synonymous mutations. The AA, AB and BB genotypes patterns obtained by FSHβ primer1 had evident relation with the litter traits, but the SSCP genotypes patterns obtained by FSHβ primer2 and primer3 had no evident relation with the litter traits in giant panda. The giant panda with AA and AB genotype had the largest litter size and multiparity rate compared with the BB genotypes (P < 0.05). We speculated that the giant pandas with the A allele have better litter traits than those with the B allele.

Real-time monitoring of stress erythropoiesis in vivo using Gata1 and beta-globin LCR luciferase transgenic mice.

PubMed

Suzuki, Mikiko; Ohneda, Kinuko; Hosoya-Ohmura, Sakie; Tsukamoto, Saho; Ohneda, Osamu; Philipsen, Sjaak; Yamamoto, Masayuki

2006-07-15

Erythroid progenitors have the potential to proliferate rapidly in response to environmental stimuli. This process is referred to as stress erythropoiesis, with erythropoietin (EPO) playing central roles in its promotion. In this study, we wanted to elucidate the molecular mechanisms governing the regulation of stress erythropoiesis and the maintenance of red-cell homeostasis. This was achieved by our development of a noninvasive real-time monitoring system for erythropoiesis using transgenic mouse lines expressing luciferase under the control of the mouse Gata1 hematopoietic regulatory domain (G1-HRD-luc) or human beta-globin locus control region (Hbb-LCR-luc). Optical bioluminescence images revealed that the luciferase was specifically expressed in spleen and bone marrow and was induced rapidly in response to anemia and hypoxia stimuli. The G1-HRD-luc activity tracked the emergence and disappearance of proerythroblast-stage progenitors, whereas the Hbb-LCR-luc activity tracked erythroblasts and later stage erythroid cells. Increased plasma EPO concentration preceded an increase in G1-HRD-luc, supporting our contention that EPO acts as the key upstream signal in stress erythropoiesis. Hence, we conclude that G1-HRD-luc and Hbb-LCR-luc reporters are differentially activated during stress erythropoiesis and that the transgenic mouse lines used serve as an important means for understanding the homeostatic regulation of erythropoiesis.

IL-1 polymorphism and periimplantitis. A literature review.

PubMed

Bormann, Kai-Hendrik; Stühmer, Constantin; Z'Graggen, Marcel; Kokemöller, Horst; Rücker, Martin; Gellrich, Nils-Claudius

2010-01-01

The most important factor leading to periimplantitis with bone loss appears to be an inflammatory process due to plaque accumulation. The object of this article was to present a review of the literature on a possible correlation between IL-1 polymorphism and periimplantitis. Research was carried out in the PUBMED and WEB OF KNOWLEDGE literature databases and 27 relevant articles were found. Of these articles, 4 groups of authors came to the conclusion that no correlation exists between IL-1 polymorphism and periimplantitis. In 5 articles by 4 groups of authors, the influence of IL-1 polymorphism on periimplantitis is unclear. 9 studies prove a correlation between IL-1 polymorphism and periimplantitis, and 6 studies also document a direct linkage between gene polymorphism and periimplantitis, if certain cofactors are present. IL-1 polymorphism is frequently connected with "noninfectious periimplant bone loss". Other studies prove that the inflammatory mediators and IL-1beta were significantly elevated in the gingival crevicular fluid (GCF) of infected implants. Many studies document that IL-1 polymorphism alone cannot be considered a risk factor for bone loss, but in combination with smoking, it is closely associated with periimplant bone loss. More studies are needed to discover possible correlations between IL-1 polymorphism and periimplantitis.

Candidate genes for Alzheimer's disease are associated with individual differences in plasma levels of beta amyloid peptides in adults with Down syndrome.

PubMed

Schupf, Nicole; Lee, Annie; Park, Naeun; Dang, Lam-Ha; Pang, Deborah; Yale, Alexander; Oh, David Kyung-Taek; Krinsky-McHale, Sharon J; Jenkins, Edmund C; Luchsinger, José A; Zigman, Warren B; Silverman, Wayne; Tycko, Benjamin; Kisselev, Sergey; Clark, Lorraine; Lee, Joseph H

2015-10-01

We examined the contribution of candidates genes for Alzheimer's disease (AD) to individual differences in levels of beta amyloid peptides in adults with Down syndrom, a population at high risk for AD. Participants were 254 non-demented adults with Down syndrome, 30-78 years of age. Genomic deoxyribonucleic acid was genotyped using an Illumina GoldenGate custom array. We used linear regression to examine differences in levels of Aβ peptides associated with the number of risk alleles, adjusting for age, sex, level of intellectual disability, race and/or ethnicity, and the presence of the APOE ε4 allele. For Aβ42 levels, the strongest gene-wise association was found for a single nucleotide polymorphism (SNP) on CAHLM1; for Aβ40 levels, the strongest gene-wise associations were found for SNPs in IDE and SOD1, while the strongest gene-wise associations with levels of the Aβ42/Aβ40 ratio were found for SNPs in SORCS1. Broadly classified, variants in these genes may influence amyloid precursor protein processing (CALHM1, IDE), vesicular trafficking (SORCS1), and response to oxidative stress (SOD1). Copyright © 2015 Elsevier Inc. All rights reserved.

Common variants in the G protein beta3 subunit gene and thyroid disorders in a formerly iodine-deficient population.

PubMed

Völzke, Henry; Bornhorst, Alexa; Rimmbach, Christian; Petersenn, Holger; Geissler, Ingrid; Nauck, Matthias; Wallaschofski, Henri; Kroemer, Heyo K; Rosskopf, Dieter

2009-10-01

Heterotrimeric G proteins are key mediators of signals from membrane receptors-including the thyroid-stimulating hormone (TSH) receptor-to cellular effectors. Gain-of-function mutations in the TSH receptor and the Galpha(S) subunit occur frequently in hyperfunctioning thyroid nodules and differentiated thyroid carcinomas, whereby the T allele of a common polymorphism (825C>T, rs5443) in the G protein beta3 subunit gene (GNB3) is associated with increased G protein-mediated signal transduction and a complex phenotype. The aim of this study was to investigate whether this common polymorphism affects key parameters of thyroid function and morphology and influences the pathogenesis of thyroid diseases in the general population. The population-based cross-sectional Study of Health in Pomerania is a general health survey with focus on thyroid diseases in northeast Germany, a formerly iodine-deficient area. Data from 3428 subjects (1800 men and 1628 women) were analyzed for an association of the GNB3 genotype with TSH, free triiodothyronine and thyroxine levels, urine iodine and thiocyanate excretion, and thyroid ultrasound morphology including thyroid volume, presence of goiter, and thyroid nodules. There was no association between GNB3 genotype status and the functional or morphological thyroid parameters investigated, neither in crude analyses nor upon multivariable analyses including known confounders of thyroid disorders. Based on the data from this large population-based survey, we conclude that the GNB3 825C>T polymorphism does not affect key parameters of thyroid function and morphology in the general population of a formerly iodine-deficient area.

Genome-wide association analysis of red blood cell traits in African Americans: the COGENT Network

PubMed Central

Chen, Zhao; Tang, Hua; Qayyum, Rehan; Schick, Ursula M.; Nalls, Michael A.; Handsaker, Robert; Li, Jin; Lu, Yingchang; Yanek, Lisa R.; Keating, Brendan; Meng, Yan; van Rooij, Frank J.A.; Okada, Yukinori; Kubo, Michiaki; Rasmussen-Torvik, Laura; Keller, Margaux F.; Lange, Leslie; Evans, Michele; Bottinger, Erwin P.; Linderman, Michael D.; Ruderfer, Douglas M.; Hakonarson, Hakon; Papanicolaou, George; Zonderman, Alan B.; Gottesman, Omri; Thomson, Cynthia; Ziv, Elad; Singleton, Andrew B.; Loos, Ruth J.F.; Sleiman, Patrick M.A.; Ganesh, Santhi; McCarroll, Steven; Becker, Diane M.; Wilson, James G.; Lettre, Guillaume; Reiner, Alexander P.

2013-01-01

Laboratory red blood cell (RBC) measurements are clinically important, heritable and differ among ethnic groups. To identify genetic variants that contribute to RBC phenotypes in African Americans (AAs), we conducted a genome-wide association study in up to ∼16 500 AAs. The alpha-globin locus on chromosome 16pter [lead SNP rs13335629 in ITFG3 gene; P < 1E−13 for hemoglobin (Hgb), RBC count, mean corpuscular volume (MCV), MCH and MCHC] and the G6PD locus on Xq28 [lead SNP rs1050828; P < 1E − 13 for Hgb, hematocrit (Hct), MCV, RBC count and red cell distribution width (RDW)] were each associated with multiple RBC traits. At the alpha-globin region, both the common African 3.7 kb deletion and common single nucleotide polymorphisms (SNPs) appear to contribute independently to RBC phenotypes among AAs. In the 2p21 region, we identified a novel variant of PRKCE distinctly associated with Hct in AAs. In a genome-wide admixture mapping scan, local European ancestry at the 6p22 region containing HFE and LRRC16A was associated with higher Hgb. LRRC16A has been previously associated with the platelet count and mean platelet volume in AAs, but not with Hgb. Finally, we extended to AAs the findings of association of erythrocyte traits with several loci previously reported in Europeans and/or Asians, including CD164 and HBS1L-MYB. In summary, this large-scale genome-wide analysis in AAs has extended the importance of several RBC-associated genetic loci to AAs and identified allelic heterogeneity and pleiotropy at several previously known genetic loci associated with blood cell traits in AAs. PMID:23446634

β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil.

PubMed

Dos Santos Silva, Wellington; de Nazaré Klautau-Guimarães, Maria; Grisolia, Cesar Koppe

2010-07-01

Five restriction site polymorphisms in the β-globin gene cluster (HincII-5' ε, HindIII-(G) γ, HindIII-(A) γ, HincII- ψβ1 and HincII-3' ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the β(A) chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.

β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil

PubMed Central

2010-01-01

Five restriction site polymorphisms in the β-globin gene cluster (HincII-5‘ ε, HindIII-G γ, HindIII-A γ, HincII- ψβ1 and HincII-3‘ ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the “quilombo community”, from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the βA chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil. PMID:21637405