Sample records for beta-globin locus control

  1. Developmental regulation of DNA replication timing at the human beta globin locus.

    PubMed

    Simon, I; Tenzen, T; Mostoslavsky, R; Fibach, E; Lande, L; Milot, E; Gribnau, J; Grosveld, F; Fraser, P; Cedar, H

    2001-11-01

    The human beta globin locus replicates late in most cell types, but becomes early replicating in erythroid cells. Using FISH to map DNA replication timing around the endogenous beta globin locus and by applying a genetic approach in transgenic mice, we have demonstrated that both the late and early replication states are controlled by regulatory elements within the locus control region. These results also show that the pattern of replication timing is set up by mechanisms that work independently of gene transcription.

  2. Synergistic and additive properties of the beta-globin locus control region (LCR) revealed by 5'HS3 deletion mutations: implication for LCR chromatin architecture.

    PubMed

    Fang, Xiangdong; Sun, Jin; Xiang, Ping; Yu, Man; Navas, Patrick A; Peterson, Kenneth R; Stamatoyannopoulos, George; Li, Qiliang

    2005-08-01

    Deletion of the 234-bp core element of the DNase I hypersensitive site 3 (5'HS3) of the locus control region (LCR) in the context of a human beta-globin locus yeast artificial chromosome (beta-YAC) results in profound effects on globin gene expression in transgenic mice. In contrast, deletion of a 2.3-kb 5'HS3 region, which includes the 234-bp core sequence, has a much milder phenotype. Here we report the effects of these deletions on chromatin structure in the beta-globin locus of adult erythroblasts. The 234-bp 5'HS3 deletion abolished histone acetylation throughout the beta-globin locus; recruitment of RNA polymerase II (pol II) to the LCR and beta-globin gene promoter was reduced to a basal level; and formation of all the 5' DNase I hypersensitive sites of the LCR was disrupted. The 2.3-kb 5'HS3 deletion mildly reduced the level of histone acetylation but did not change the profile across the whole locus; the 5' DNase I hypersensitive sites of the LCR were formed, but to a lesser extent; and recruitment of pol II was reduced, but only marginally. These data support the hypothesis that the LCR forms a specific chromatin structure and acts as a single entity. Based on these results we elaborate on a model of LCR chromatin architecture which accommodates the distinct phenotypes of the 5'HS3 and HS3 core deletions.

  3. DNase I hypersensitivity and epsilon-globin transcriptional enhancement are separable in locus control region (LCR) HS1 mutant human beta-globin YAC transgenic mice.

    PubMed

    Shimotsuma, Motoshi; Okamura, Eiichi; Matsuzaki, Hitomi; Fukamizu, Akiyoshi; Tanimoto, Keiji

    2010-05-07

    Expression of the five beta-like globin genes (epsilon, Ggamma, Agamma, delta, beta) in the human beta-globin locus depends on enhancement by the locus control region, which consists of five DNase I hypersensitive sites (5'HS1 through 5'HS5). We report here a novel enhancer activity in 5'HS1 that appears to be potent in transfected K562 cells. Deletion analyses identified a core activating element that bound to GATA-1, and a two-nucleotide mutation that disrupted GATA-1 binding in vitro abrogated 5'HS1 enhancer activity in transfection experiments. To determine the in vivo role of this GATA site, we generated multiple lines of human beta-globin YAC transgenic mice bearing the same two-nucleotide mutation. In the mutant mice, epsilon-, but not gamma-globin, gene expression in primitive erythroid cells was severely attenuated, while adult beta-globin gene expression in definitive erythroid cells was unaffected. Interestingly, DNaseI hypersensitivity near the 5'HS1 mutant sequence was eliminated in definitive erythroid cells, whereas it was only mildly affected in primitive erythroid cells. We therefore conclude that, although the GATA site in 5'HS1 is critical for efficient epsilon-globin gene expression, hypersensitive site formation per se is independent of 5'HS1 function, if any, in definitive erythroid cells.

  4. All of the human beta-type globin genes compete for LCR enhancer activity in embryonic erythroid cells of yeast artificial chromosome transgenic mice.

    PubMed

    Okamura, Eiichi; Matsuzaki, Hitomi; Campbell, Andrew D; Engel, James Douglas; Fukamizu, Akiyoshi; Tanimoto, Keiji

    2009-12-01

    In primitive erythroid cells of human beta-globin locus transgenic mice (TgM), the locus control region (LCR)-proximal epsilon- and gamma-globin genes are transcribed, whereas the distal delta- and beta-globin genes are silent. It is generally accepted that the beta-globin gene is competitively suppressed by gamma-globin gene expression at this developmental stage. Previously, however, we observed that epsilon-globin gene expression was severely attenuated when its distance from the LCR was extended, implying that beta-globin gene might also be silenced because of its great distance from the LCR. Here, to clarify the beta-globin gene silencing mechanism, we established TgM lines carrying either gamma- or epsilon- plus gamma-globin promoter deletions, without significantly altering the distance between the beta-globin gene and the LCR. Precocious expression of delta- and beta-globin genes was observed in primitive erythroid cells of mutant, but not wild-type TgM, which was most evident when both the epsilon and gamma promoters were deleted. Thus, we clearly demonstrated that the repression of the delta- and beta-globin genes in primitive erythroid cells is dominated by competitive silencing by the epsilon- and gamma-globin gene promoters, and that epsilon- and the other beta-like globin genes might be activated by two distinct mechanisms by the LCR.

  5. Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

    PubMed

    Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

    2006-08-15

    The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

  6. Activation of beta-major globin gene transcription is associated with recruitment of NF-E2 to the beta-globin LCR and gene promoter.

    PubMed

    Sawado, T; Igarashi, K; Groudine, M

    2001-08-28

    The mouse beta-globin gene locus control region (LCR), located upstream of the beta-globin gene cluster, is essential for the activated transcription of genes in the cluster. The LCR contains multiple binding sites for transactivators, including Maf-recognition elements (MAREs). However, little is known about the specific proteins that bind to these sites or the time at which they bind during erythroid differentiation. We have performed chromatin immunoprecipitation experiments to determine the recruitment of the erythroid-specific transactivator p45 NF-E2/MafK (p18 NF-E2) heterodimer and small Maf proteins to various regions in the globin gene locus before and after the induction of murine erythroleukemia (MEL) cell differentiation. We report that, before induction, the LCR is occupied by small Maf proteins, and, on erythroid maturation, the NF-E2 complex is recruited to the LCR and the active globin promoters, even though the promoters do not contain MAREs. This differentiation-coupled recruitment of NF-E2 complex correlates with a greater than 100-fold increase in beta-major globin transcription, but is not associated with a significant change in locus-wide histone H3 acetylation. These findings suggest that the beta-globin gene locus exists in a constitutively open chromatin conformation before terminal differentiation, and we speculate that recruitment of NF-E2 complex to the LCR and active promoters may be a rate-limiting step in the activation of beta-globin gene expression.

  7. The 87-kD A gamma-globin enhancer-binding protein is a product of the HOXB2(HOX2H) locus.

    PubMed

    Sengupta, P K; Lavelle, D E; DeSimone, J

    1994-03-01

    Developmental regulation of globin gene expression may be controlled by developmental stage-specific nuclear proteins that influence interactions between the locus control region and local regulatory sequences near individual globin genes. We previously isolated an 87-kD nuclear protein from K562 cells that bound to DNA sequences in the beta-globin locus control region, gamma-globin promoter, and A gamma-globin enhancer. The presence of this protein in fetal globin-expressing cells and its absence in adult globin-expressing cells suggested that it may be a developmental stage-specific factor. A lambda gt11 K562 cDNA clone encoding a portion of the HOXB2 (formerly HOX2H) homeobox gene was isolated on the basis of the ability of its beta-galactosidase fusion protein to bind to the same DNA sequences as the 87-kD K562 protein. Because no other relationship had been established between the 87-kD K562 protein and the HOXB2 protein other than their ability to bind ot the same DNA sequences, we have investigated whether the two proteins are related antigenically. Our data show that antisera produced against the HOXB2-beta-gal fusion protein and a synthetic HOXB2 decapeptide react specifically with an 87-kD protein from K562 nuclear extract, showing that the 87-kD K562 nuclear protein is a product of the HOXB2 locus, and is the first demonstration of cellular HOXB2 protein.

  8. MafK/NF-E2 p18 is required for beta-globin genes activation by mediating the proximity of LCR and active beta-globin genes in MEL cell line.

    PubMed

    Du, Mei-Jun; Lv, Xiang; Hao, De-Long; Zhao, Guo-Wei; Wu, Xue-Song; Wu, Feng; Liu, De-Pei; Liang, Chih-Chuan

    2008-01-01

    Evidences indicate that locus control region (LCR) of beta-globin spatially closes to the downstream active gene promoter to mediate the transcriptional activation by looping. DNA binding proteins may play an important role in the looping formation. NF-E2 is one of the key transcription factors in beta-globin gene transcriptional activation. To shed light on whether NF-E2 is involved in this process, DS19MafKsiRNA cell pools were established by specifically knocked down the expression of MafK/NF-E2 p18, one subunit of NF-E2 heterodimer. In the above cell pools, it was observed that the occupancy efficiency of NF-E2 on beta-globin gene locus and the expression level of beta-globin genes were decreased. H3 acetylation, H3-K4 methylation and the deposition of RNA polymerase II, but not the recruitment of GATA-1, were also found reduced at the beta-globin gene cluster. Chromosome Conformation Capture (3C) assay showed that the cross-linking frequency between the main NF-E2 binding site HS2 and downstream structural genes was reduced compared to the normal cell. This result demonstrated that MafK/NF-E2 p18 recruitment was involved in the physical proximity of LCR and active beta-globin genes upon beta-globin gene transcriptional activation.

  9. Silencing of Agamma-globin gene expression during adult definitive erythropoiesis mediated by GATA-1-FOG-1-Mi2 complex binding at the -566 GATA site.

    PubMed

    Harju-Baker, Susanna; Costa, Flávia C; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R

    2008-05-01

    Autonomous silencing of gamma-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the (A)gamma-globin gene was identified between -730 and -378 relative to the mRNA start site. A marked copy of the (A)gamma-globin gene inserted between locus control region 5' DNase I-hypersensitive site 1 and the epsilon-globin gene was transcriptionally silenced in adult beta-globin locus yeast artificial chromosome (beta-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the -566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low gamma-globin levels, whereas only a weak signal was detected when gamma-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from beta-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the (A)gamma-globin -566 or (G)gamma-globin -567 GATA site when gamma-globin expression was low (day 18) but not when gamma-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, gamma-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the -566/-567 GATA sites of the proximal gamma-globin promoters.

  10. Structural polymorphism at LCR and its role in beta-globin gene regulation.

    PubMed

    Kukreti, Shrikant; Kaur, Harpreet; Kaushik, Mahima; Bansal, Aparna; Saxena, Sarika; Kaushik, Shikha; Kukreti, Ritushree

    2010-09-01

    Information on the secondary structures and conformational manifestations of eukaryotic DNA and their biological significance with reference to gene regulation and expression is limited. The human beta-globin gene Locus Control Region (LCR), a dominant regulator of globin gene expression, is a contiguous piece of DNA with five tissue-specific DNase I-hypersensitive sites (HSs). Since these HSs have a high density of transcription factor binding sites, structural interdependencies between HSs and different promoters may directly or indirectly regulate LCR functions. Mutations and SNPs may stabilize or destabilize the local secondary structures, affecting the gene expression by changes in the protein-DNA recognition patterns. Various palindromic or quasi-palindromic segments within LCR, could cause structural polymorphism and geometrical switching of DNA. This emphasizes the importance of understanding of the sequence-dependent variations of the DNA structure. Such structural motifs might act as regulatory elements. The local conformational variability of a DNA segment or action of a DNA specific protein is key to create and maintain active chromatin domains and affect transcription of various tissue specific beta-globin genes. We, summarize here the current status of beta-globin LCR structure and function. Further structural studies at molecular level and functional genomics might solve the regulatory puzzles that control the beta-globin gene locus. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.

  11. The beta -globin locus control region (LCR) functions primarily by enhancing the transition from transcription initiation to elongation.

    PubMed

    Sawado, Tomoyuki; Halow, Jessica; Bender, M A; Groudine, Mark

    2003-04-15

    To investigate the molecular basis of beta-globin gene activation, we analyzed factor recruitment and histone modification at the adult beta-globin gene in wild-type (WT)/locus control region knockout (DeltaLCR) heterozygous mice and in murine erythroleukemia (MEL) cells. Although histone acetylation and methylation (Lys 4) are high before and after MEL differentiation, recruitment of the erythroid-specific activator NF-E2 to the promoter and preinitiation complex (PIC) assembly occur only after differentiation. We reported previously that targeted deletion of the LCR reduces beta-globin gene expression to 1%-4% of WT without affecting promoter histone acetylation. Here, we report that NF-E2 is recruited equally efficiently to the adult beta-globin promoters of the DeltaLCR and WT alleles. Moreover, the LCR deletion reduces PIC assembly only twofold, but has a dramatic effect on Ser 5 phosphorylation of RNA polymerase II and transcriptional elongation. Our results suggest at least three distinct stages in beta-globin gene activation: (1) an LCR-independent chromatin opening stage prior to NF-E2 recruitment to the promoter and PIC assembly; (2) an intermediate stage in which NF-E2 binding (LCR-independent) and PIC assembly (partially LCR-dependent) occur; and (3) an LCR-dependent fully active stage characterized by efficient pol II elongation. Thus, in its native location the LCR functions primarily downstream of activator recruitment and PIC assembly.

  12. Beta-globin locus activation regions: conservation of organization, structure, and function.

    PubMed Central

    Li, Q L; Zhou, B; Powers, P; Enver, T; Stamatoyannopoulos, G

    1990-01-01

    The human beta-globin locus activation region (LAR) comprises four erythroid-specific DNase I hypersensitive sites (I-IV) thought to be largely responsible for activating the beta-globin domain and facilitating high-level erythroid-specific globin gene expression. We identified the goat beta-globin LAR, determined 10.2 kilobases of its sequence, and demonstrated its function in transgenic mice. The human and goat LARs share 6.5 kilobases of homologous sequences that are as highly conserved as the epsilon-globin gene promoters. Furthermore, the overall spatial organization of the two LARs has been conserved. These results suggest that the functionally relevant regions of the LAR are large and that in addition to their primary structure, the spatial relationship of the conserved elements is important for LAR function. Images PMID:2236034

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liebhaber, S.A.; Weiss, I.; Cash, F.E.

    Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

  14. Deletion of the human beta-globin LCR 5'HS4 or 5'HS1 differentially affects beta-like globin gene expression in beta-YAC transgenic mice.

    PubMed

    Fedosyuk, Halyna; Peterson, Kenneth R

    2007-01-01

    A 213 kb human beta-globin locus yeast artificial chromosome (beta-YAC) was modified by homologous recombination to delete 2.9 kb of cross-species conserved sequence similarity encompassing the LCR 5' hypersensitive site (HS) 4 (Delta5'HS4 beta-YAC). In three transgenic mouse lines, completion of the gamma- to beta-globin switch during definitive erythropoiesis was delayed relative to wild-type beta-YAC mice. In addition, quantitative per-copy human beta-like globin mRNA levels were similar to wild-type beta-YAC transgenic lines, although beta-globin gene expression was slightly decreased in the day 12 fetal liver of Delta5'HS4 beta-YAC mice. A 0.8 kb 5'HS1 fragment was similarly deleted in the YAC. Three Delta5'HS1 beta-YAC transgenic lines were established. epsilon-globin gene expression was markedly reduced, approximately 16 fold, during primitive erythropoiesis compared to wild-type beta-YAC mice, but gamma-globin expression levels were unaffected. However, during the fetal stage of definitive erythropoiesis, gamma-globin gene expression was decreased approximately 4 fold at day 12 and approximately 5 fold at day 14. Temporal developmental expression profiles of the beta-like globin genes were unaffected by deletion of 5'HS1. Decreased expression of the epsilon- and gamma-globin genes is the first phenotype ascribed to a 5'HS1 mutation in the human beta-globin locus, suggesting that this HS does indeed have a role in LCR function beyond simply a combined synergism with the other LCR HSs.

  15. Cooperativeness of the higher chromatin structure of the beta-globin locus revealed by the deletion mutations of DNase I hypersensitive site 3 of the LCR.

    PubMed

    Fang, Xiangdong; Xiang, Ping; Yin, Wenxuan; Stamatoyannopoulos, George; Li, Qiliang

    2007-01-05

    High-level transcription of the globin genes requires the enhancement by a distant element, the locus control region (LCR). Such long-range regulation in vivo involves spatial interaction between transcriptional elements, with intervening chromatin looping out. It has been proposed that the clustering of the HS sites of the LCR, the active globin genes, as well as the remote 5' hypersensitive sites (HSs) (HS-60/-62 in mouse, HS-110 in human) and 3'HS1 forms a specific spatial chromatin structure, termed active chromatin hub (ACH). Here we report the effects of the HS3 deletions of the LCR on the spatial chromatin structure of the beta-globin locus as revealed by the chromatin conformation capture (3C) technology. The small HS3 core deletion (0.23 kb), but not the large HS3 deletion (2.3 kb), disrupted the spatial interactions among all the HS sites of the LCR, the beta-globin gene and 3'HS1. We have previously demonstrated that the large HS3 deletion barely impairs the structure of the LCR holocomplex, while the structure is significantly disrupted by the HS3 core deletion. Taken together, these results suggest that the formation of the ACH is dependent on a largely intact LCR structure. We propose that the ACH indeed is an extension of the LCR holocomplex.

  16. H3 K79 dimethylation marks developmental activation of the beta-globin gene but is reduced upon LCR-mediated high-level transcription.

    PubMed

    Sawado, Tomoyuki; Halow, Jessica; Im, Hogune; Ragoczy, Tobias; Bresnick, Emery H; Bender, M A; Groudine, Mark

    2008-07-15

    Genome-wide analyses of the relationship between H3 K79 dimethylation and transcription have revealed contradictory results. To clarify this relationship at a single locus, we analyzed expression and H3 K79 modification levels of wild-type (WT) and transcriptionally impaired beta-globin mutant genes during erythroid differentiation. Analysis of fractionated erythroid cells derived from WT/Delta locus control region (LCR) heterozygous mice reveals no significant H3 K79 dimethylation of the beta-globin gene on either allele prior to activation of transcription. Upon transcriptional activation, H3 K79 di-methylation is observed along both WT and DeltaLCR alleles, and both alleles are located in proximity to H3 K79 dimethylation nuclear foci. However, H3 K79 di-methylation is significantly increased along the DeltaLCR allele compared with the WT allele. In addition, analysis of a partial LCR deletion mutant reveals that H3 K79 dimethylation is inversely correlated with beta-globin gene expression levels. Thus, while our results support a link between H3 K79 dimethylation and gene expression, high levels of this mark are not essential for high level beta-globin gene transcription. We propose that H3 K79 dimethylation is destabilized on a highly transcribed template.

  17. The higher structure of chromatin in the LCR of the beta-globin locus changes during development.

    PubMed

    Fang, Xiangdong; Yin, Wenxuan; Xiang, Ping; Han, Hemei; Stamatoyannopoulos, George; Li, Qiliang

    2009-11-27

    The beta-globin locus control region (LCR) is able to enhance the expression of all globin genes throughout the course of development. However, the chromatin structure of the LCR at the different developmental stages is not well defined. We report DNase I and micrococcal nuclease hypersensitivity, chromatin immunoprecipitation analyses for histones H2A, H2B, H3, and H4, and 3C (chromatin conformation capture) assays of the normal and mutant beta-globin loci, which demonstrate that nucleosomes at the DNase I hypersensitive sites of the LCR could be either depleted or retained depending on the stages of development. Furthermore, MNase sensitivity and 3C assays suggest that the LCR chromatin is more open in embryonic erythroblasts than in definitive erythroblasts at the primary- and secondary-structure levels; however, the LCR chromatin is packaged more tightly in embryonic erythroblasts than in definitive erythroblasts at the tertiary chromatin level. Our study provides the first evidence that the occupancy of nucleosomes at a DNase I hypersensitive site is a developmental stage-related event and that embryonic and adult cells possess distinct chromatin structures of the LCR.

  18. Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals.

    PubMed

    Patel, Vidushi S; Cooper, Steven J B; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer A M

    2008-07-25

    Vertebrate alpha (alpha)- and beta (beta)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the alpha- and beta-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil beta-globin gene (omega) in the marsupial alpha-cluster, however, suggested that duplication of the alpha-beta cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous alpha- and beta-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. The platypus alpha-globin cluster (chromosome 21) contains embryonic and adult alpha- globin genes, a beta-like omega-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-zeta-zeta'-alphaD-alpha3-alpha2-alpha1-omega-GBY-3'. The platypus beta-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-epsilon-beta-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate alpha-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal beta-globin clusters are embedded in olfactory genes. Thus, the mammalian alpha- and beta-globin clusters are orthologous to the bird alpha- and beta-globin clusters respectively. We propose that alpha- and beta-globin clusters evolved from an ancient MPG-C16orf35-alpha-beta-GBY-LUC7L arrangement 410 million years ago. A copy of the original beta (represented by omega in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of beta-globin genes with different expression profiles in different lineages.

  19. Triplication of a four-gene set during evolution of the goat beta-globin locus produced three genes now expressed differentially during development.

    PubMed Central

    Townes, T M; Fitzgerald, M C; Lingrel, J B

    1984-01-01

    Distinct hemoglobins are synthesized in goats at different stages of development, similar to humans. Embryonic hemoglobins (zeta 2 epsilon 2 and alpha 2 epsilon 2) are synthesized initially and are followed sequentially by fetal (alpha 2 beta F2), preadult (alpha 2 beta C2), and adult (alpha 2 beta A2) hemoglobins. To help understand the basis of these switches, the genes of the beta-globin locus have been cloned and their linkage arrangement has been determined by the isolation of lambda phage carrying overlapping inserts of genomic goat DNA. The locus extends over 120 kilobase pairs and consists of 12 genes arranged in the following order: epsilon I-epsilon II-psi beta X-beta C-epsilon III-epsilon IV-psi beta Z-beta A-epsilon V-epsilon VI-psi beta Y-beta F. Comparison of the nucleotide sequence of the 12 genes shows that the locus is organized into three homologous four-gene sets that presumably evolved by the triplication of an ancestral set of four genes (epsilon-epsilon-psi beta-beta). Interestingly, the three genes (beta C, beta A, and beta F) located at the ends of the four-gene sets are expressed at different stages of development. Therefore, the goat beta F-, beta C-, and beta A-globin genes appear to have evolved by a mechanism that includes the triplication of 40-50 kilobase pairs of DNA and the recruitment of newly formed genes for expression in fetal, preadult, and adult life. PMID:6593719

  20. Acute chest syndrome is associated with single nucleotide polymorphism-defined beta globin cluster haplotype in children with sickle cell anaemia

    PubMed Central

    Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.

    2013-01-01

    Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145

  1. NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

    PubMed Central

    Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

    1995-01-01

    The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

  2. A novel mutation of the beta-globin gene promoter (-102 C>A) and pitfalls in family screening.

    PubMed

    Aguilar-Martinez, Patricia; Jourdan, Eric; Brun, Sophie; Cunat, Séverine; Giansily-Blaizot, Muriel; Pissard, Serge; Schved, Jean-François

    2007-12-01

    We describe a family with beta-thalassemia in which several pitfalls of genetic diagnoses were present. These include coherent family phenotypes with discrepancies in molecular findings because of nonpaternity, and a false beta-globin gene homozygous genotype due to a large deletion in the second locus. These findings underline the difficulties of family genetic studies and the need for tight relationship between professionals involved in laboratory studies and those in-charge of the clinical follow-up and genetic counselling. In this family, we also report a new silent beta-thalassemia mutation, -102 (C>A), in the distal CACCC box of the beta-globin gene promoter.

  3. The locus control region is required for association of the murine β-globin locus with engaged transcription factories during erythroid maturation

    PubMed Central

    Ragoczy, Tobias; Bender, M.A.; Telling, Agnes; Byron, Rachel; Groudine, Mark

    2006-01-01

    We have examined the relationship between nuclear localization and transcriptional activity of the endogenous murine β-globin locus during erythroid differentiation. Murine fetal liver cells were separated into distinct erythroid maturation stages by fluorescence-activated cell sorting, and the nuclear position of the locus was determined at each stage. We find that the β-globin locus progressively moves away from the nuclear periphery with increasing maturation. Contrary to the prevailing notion that the nuclear periphery is a repressive compartment in mammalian cells, βmajor-globin expression begins at the nuclear periphery prior to relocalization. However, relocation of the locus to the nuclear interior with maturation is accompanied by an increase in βmajor-globin transcription. The distribution of nuclear polymerase II (Pol II) foci also changes with erythroid differentiation: Transcription factories decrease in number and contract toward the nuclear interior. Moreover, both efficient relocalization of the β-globin locus from the periphery and its association with hyperphosphorylated Pol II transcription factories require the locus control region (LCR). These results suggest that the LCR-dependent association of the β-globin locus with transcriptionally engaged Pol II foci provides the driving force for relocalization of the locus toward the nuclear interior during erythroid maturation. PMID:16705039

  4. Sequence change in the HS2-LCR and Ggamma-globin gene promoter region of sickle cell anemia patients.

    PubMed

    Adorno, E V; Moura-Neto, J P; Lyra, I; Zanette, A; Santos, L F O; Seixas, M O; Reis, M G; Goncalves, M S

    2008-02-01

    The fetal hemoglobin (HbF) levels and betaS-globin gene haplotypes of 125 sickle cell anemia patients from Brazil were investigated. We sequenced the Ggamma- and Agamma-globin gene promoters and the DNase I-2 hypersensitive sites in the locus control regions (HS2-LCR) of patients with HbF level disparities as compared to their betaS haplotypes. Sixty-four (51.2%) patients had CAR/Ben genotype; 36 (28.8%) Ben/Ben; 18 (14.4%) CAR/CAR; 2 (1.6%) CAR/Atypical; 2 (1.6%) Ben/Cam; 1 (0.8%) CAR/Cam; 1 (0.8%) CAR/Arab-Indian, and 1 (0.8%) Sen/Atypical. The HS2-LCR sequence analyses demonstrated a c.-10.677G>A change in patients with the Ben haplotype and high HbF levels. The Gg gene promoter sequence analyses showed a c.-157T>C substitution shared by all patients, and a c.-222_-225del related to the Cam haplotype. These results identify new polymorphisms in the HS2-LCR and Gg-globin gene promoter. Further studies are required to determine the correlation between HbF synthesis and the clinical profile of sickle cell anemia patients.

  5. Beta-globin LCR and intron elements cooperate and direct spatial reorganization for gene therapy.

    PubMed

    Buzina, Alla; Lo, Mandy Y M; Moffett, Angela; Hotta, Akitsu; Fussner, Eden; Bharadwaj, Rikki R; Pasceri, Peter; Garcia-Martinez, J Victor; Bazett-Jones, David P; Ellis, James

    2008-04-11

    The Locus Control Region (LCR) requires intronic elements within beta-globin transgenes to direct high level expression at all ectopic integration sites. However, these essential intronic elements cannot be transmitted through retrovirus vectors and their deletion may compromise the therapeutic potential for gene therapy. Here, we systematically regenerate functional beta-globin intron 2 elements that rescue LCR activity directed by 5'HS3. Evaluation in transgenic mice demonstrates that an Oct-1 binding site and an enhancer in the intron cooperate to increase expression levels from LCR globin transgenes. Replacement of the intronic AT-rich region with the Igmu 3'MAR rescues LCR activity in single copy transgenic mice. Importantly, a combination of the Oct-1 site, Igmu 3'MAR and intronic enhancer in the BGT158 cassette directs more consistent levels of expression in transgenic mice. By introducing intron-modified transgenes into the same genomic integration site in erythroid cells, we show that BGT158 has the greatest transcriptional induction. 3D DNA FISH establishes that induction stimulates this small 5'HS3 containing transgene and the endogenous locus to spatially reorganize towards more central locations in erythroid nuclei. Electron Spectroscopic Imaging (ESI) of chromatin fibers demonstrates that ultrastructural heterochromatin is primarily perinuclear and does not reorganize. Finally, we transmit intron-modified globin transgenes through insulated self-inactivating (SIN) lentivirus vectors into erythroid cells. We show efficient transfer and robust mRNA and protein expression by the BGT158 vector, and virus titer improvements mediated by the modified intron 2 in the presence of an LCR cassette composed of 5'HS2-4. Our results have important implications for the mechanism of LCR activity at ectopic integration sites. The modified transgenes are the first to transfer intronic elements that potentiate LCR activity and are designed to facilitate correction of hemoglobinopathies using single copy vectors.

  6. Chromatin structure of the LCR in the human β-globin locus transcribing the adult δ- and β-globin genes.

    PubMed

    Kim, Seoyeon; Kim, Yea Woon; Shim, Sung Han; Kim, Chul Geun; Kim, Aeri

    2012-03-01

    The β-like globin genes are transcribed in a developmental stage specific fashion in erythroid cells. The specific transcription of globin genes is conferred by the locus control region (LCR), but the chromatin structure of the LCR in the human adult β-globin locus transcribing the δ- and β-globin genes is not clear. Here, we employed hybrid MEL cells that contain a human chromosome 11. The δ- and β-globin genes were highly transcribed in hybrid MEL/ch11 cells after transcriptional induction. LCR HS3 and HS2 were strongly occupied by erythroid specific transcriptional activators and co-factors in the induced locus. These HSs, but not HS4 and HS1, were in close proximity with the active globin genes as revealed by high resolution 3C experiments. The active features at HS3 were markedly established after transcriptional induction, while HS2 was in a relatively active conformation before the induction. Unexpectedly, HS1 did not show notable active features except histone hyperacetylation. Taken together, the LCR of the human β-globin locus transcribing the adult δ- and β-globin genes has HS specific chromatin structure. The structure at each HS, which is different from the locus transcribing the fetal globin genes, might relate to its role in transcribing the adult genes. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. The hematopoietic regulator TAL1 is required for chromatin looping between the β-globin LCR and human γ-globin genes to activate transcription

    PubMed Central

    Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi

    2014-01-01

    TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the Gγ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the Gγ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes. PMID:24470145

  8. The hematopoietic regulator TAL1 is required for chromatin looping between the β-globin LCR and human γ-globin genes to activate transcription.

    PubMed

    Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi

    2014-04-01

    TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the (G)γ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the (G)γ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes.

  9. Erythroid activator NF-E2, TAL1 and KLF1 play roles in forming the LCR HSs in the human adult β-globin locus.

    PubMed

    Kim, Yea Woon; Yun, Won Ju; Kim, AeRi

    2016-06-01

    The β-like globin genes are developmental stage specifically transcribed in erythroid cells. The transcription of the β-like globin genes requires erythroid specific activators such as GATA-1, NF-E2, TAL1 and KLF1. However, the roles of these activators have not fully elucidated in transcription of the human adult β-globin gene. Here we employed hybrid MEL cells (MEL/ch11) where a human chromosome containing the β-globin locus is present and the adult β-globin gene is highly transcribed by induction. The roles of erythroid specific activators were analyzed by inhibiting the expression of NF-E2, TAL1 or KLF1 in MEL/ch11 cells. The loss of each activator decreased the transcription of human β-globin gene, locus wide histone hyperacetylation and the binding of other erythroid specific activators including GATA-1, even though not affecting the expression of other activators. Notably, sensitivity to DNase I was reduced in the locus control region (LCR) hypersensitive sites (HSs) with the depletion of activators. These results indicate that NF-E2, TAL1 and KLF1, all activators play a primary role in HSs formation in the LCR. It might contribute to the transcription of human adult β-globin gene by allowing the access of activators and cofactors. The roles of activators in the adult β-globin locus appear to be different from the roles in the early fetal locus. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. β-Globin locus control region HS2 and HS3 interact structurally and functionally

    PubMed Central

    Jackson, David A.; McDowell, Jennifer C.; Dean, Ann

    2003-01-01

    The overall structure of the DNase I hypersensitive sites (HSs) that comprise the β-globin locus control region (LCR) is highly conserved among mammals, implying that the HSs have conserved functions. However, it is not well understood how the LCR HSs, either individually or collectively, activate transcription. We analyzed the interactions of HS2, HS3 and HS4 with the human ε- and β-globin genes in chromatinized episomes in fetal/embryonic K562 cells. Only HS2 activates transcription of the ε-globin gene, while all three HSs activate the β-globin gene. HS3 stimulates the β-globin gene constitutively, but HS2 and HS4 transactivation requires expression of the transcription factor EKLF, which is not present in K562 cells but is required for β-globin expression in vivo. To begin addressing how the individual HSs may interact with one another in a complex, we linked the β-globin gene to both the HS2 and HS3. HS2 and HS3 together resulted in synergistic stimulation of β-globin transcription. Unexpectedly, mutated, inactive forms of HS2 impeded the activation of the β-globin gene by HS3. Thus, there appear to be distinct interactions among the HSs and between the HSs and the globin genes. These preferential, non-exclusive interactions may underlie an important structural and functional cooperativity among the regulatory sequences of the β-globin locus in vivo. PMID:12582237

  11. Sequential changes in chromatin structure during transcriptional activation in the beta globin LCR and its target gene.

    PubMed

    Kim, Kihoon; Kim, AeRi

    2010-09-01

    Chromatin structure is modulated during transcriptional activation. The changes include the association of transcriptional activators, formation of hypersensitive sites and covalent modifications of histones. To understand the order of the various changes accompanying transcriptional activation, we analyzed the mouse beta globin gene, which is transcriptionally inducible in erythroid MEL cells over a time course of HMBA treatment. Transcription of the globin genes requires the locus control region (LCR) consisting of several hypersensitive sites (HSs). Erythroid specific transcriptional activators such as NF-E2, GATA-1, TAL1 and EKLF were associated with the LCR in the uninduced state before transcriptional activation. The HSs of the LCR were formed in this state as revealed by high sensitivity to DNase I and MNase attack. However the binding of transcriptional activators and the depletion of histones were observed in the promoter of the beta globin gene only after transcriptional activation. In addition, various covalent histone modifications were sequentially detected in lysine residues of histone H3 during the activation. Acetylation of K9, K36 and K27 was notable in both LCR HSs and gene after induction but before transcriptional initiation. Inactive histone marks such as K9me2, K36me2 and K27me2 were removed coincident with transcriptional initiation in the gene region. Taken together, these results indicate that LCR has a substantially active structure in the uninduced state while transcriptional activation serially adds active marks, including histone modifications, and removes inactive marks in the target gene of the LCR. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  12. Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus

    PubMed Central

    Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi

    2015-01-01

    Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer–promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them. PMID:25588787

  13. LCR 5' hypersensitive site specificity for globin gene activation within the active chromatin hub.

    PubMed

    Peterson, Kenneth R; Fedosyuk, Halyna; Harju-Baker, Susanna

    2012-12-01

    The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (β(m)), coupled to an intact LCR, a 5'HS3 complete deletion (5'ΔHS3) or a 5'HS3 core deletion (5'ΔHS3c). The 5'ΔHS3c mice expressed β(m)-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5'HS3 core was not required for β(m)-globin expression, previous work showed that the 5'HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5'HS complete deletion mice, except β(m)-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction.

  14. Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals

    PubMed Central

    Patel, Vidushi S; Cooper, Steven JB; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer AM

    2008-01-01

    Background Vertebrate alpha (α)- and beta (β)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the α- and β-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil β-globin gene (ω) in the marsupial α-cluster, however, suggested that duplication of the α-β cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous α- and β-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. Results The platypus α-globin cluster (chromosome 21) contains embryonic and adult α- globin genes, a β-like ω-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-ζ-ζ'-αD-α3-α2-α1-ω-GBY-3'. The platypus β-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-ε-β-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate α-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal β-globin clusters are embedded in olfactory genes. Thus, the mammalian α- and β-globin clusters are orthologous to the bird α- and β-globin clusters respectively. Conclusion We propose that α- and β-globin clusters evolved from an ancient MPG-C16orf35-α-β-GBY-LUC7L arrangement 410 million years ago. A copy of the original β (represented by ω in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of β-globin genes with different expression profiles in different lineages. PMID:18657265

  15. Zebrafish globin switching occurs in two developmental stages and is controlled by the LCR.

    PubMed

    Ganis, Jared J; Hsia, Nelson; Trompouki, Eirini; de Jong, Jill L O; DiBiase, Anthony; Lambert, Janelle S; Jia, Zhiying; Sabo, Peter J; Weaver, Molly; Sandstrom, Richard; Stamatoyannopoulos, John A; Zhou, Yi; Zon, Leonard I

    2012-06-15

    Globin gene switching is a complex, highly regulated process allowing expression of distinct globin genes at specific developmental stages. Here, for the first time, we have characterized all of the zebrafish globins based on the completed genomic sequence. Two distinct chromosomal loci, termed major (chromosome 3) and minor (chromosome 12), harbor the globin genes containing α/β pairs in a 5'-3' to 3'-5' orientation. Both these loci share synteny with the mammalian α-globin locus. Zebrafish globin expression was assayed during development and demonstrated two globin switches, similar to human development. A conserved regulatory element, the locus control region (LCR), was revealed by analyzing DNase I hypersensitive sites, H3K4 trimethylation marks and GATA1 binding sites. Surprisingly, the position of these sites with relation to the globin genes is evolutionarily conserved, despite a lack of overall sequence conservation. Motifs within the zebrafish LCR include CACCC, GATA, and NFE2 sites, suggesting functional interactions with known transcription factors but not the same LCR architecture. Functional homology to the mammalian α-LCR MCS-R2 region was confirmed by robust and specific reporter expression in erythrocytes of transgenic zebrafish. Our studies provide a comprehensive characterization of the zebrafish globin loci and clarify the regulation of globin switching. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Silencing of Aγ-Globin Gene Expression during Adult Definitive Erythropoiesis Mediated by GATA-1-FOG-1-Mi2 Complex Binding at the −566 GATA Site▿ †

    PubMed Central

    Harju-Baker, Susanna; Costa, Flávia C.; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R.

    2008-01-01

    Autonomous silencing of γ-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the Aγ-globin gene was identified between −730 and −378 relative to the mRNA start site. A marked copy of the Aγ-globin gene inserted between locus control region 5′ DNase I-hypersensitive site 1 and the ɛ-globin gene was transcriptionally silenced in adult β-globin locus yeast artificial chromosome (β-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the −566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low γ-globin levels, whereas only a weak signal was detected when γ-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from β-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the Aγ-globin −566 or Gγ-globin −567 GATA site when γ-globin expression was low (day 18) but not when γ-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, γ-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the −566/−567 GATA sites of the proximal γ-globin promoters. PMID:18347053

  17. LCR 5′ hypersensitive site specificity for globin gene activation within the active chromatin hub

    PubMed Central

    Peterson, Kenneth R.; Fedosyuk, Halyna; Harju-Baker, Susanna

    2012-01-01

    The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (βm), coupled to an intact LCR, a 5′HS3 complete deletion (5′ΔHS3) or a 5′HS3 core deletion (5′ΔHS3c). The 5′ΔHS3c mice expressed βm-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5′HS3 core was not required for βm-globin expression, previous work showed that the 5′HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5′HS complete deletion mice, except βm-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction. PMID:23042246

  18. Molecular analysis of the beta-thalassemia phenotype associated with inheritance of hemoglobin E (alpha 2 beta2(26)Glu leads to Lys).

    PubMed Central

    Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G

    1981-01-01

    Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with Hb E-beta-thalassemia and Hb E trait. The initial rate of beta-globin synthesis (betaE/alpha=0.20-0.34) was less than expected on the basis of gene dosage, or comparable studies of other compound heterozygous states for beta-thalassemia and structurally abnormal beta-chains. betaE-globin synthesis was not only reduced during short-term incubations (1-5 min), but also remained relatively unchanged during long-term pulse or chase incubations up to 5h. Analysis of globin mRNA by cell-free translation and molecular hybridization confirmed that the unexpectedly low levels of betaE-globin synthesis were associated with comparable reduction in the levels of beta-globin mRNA. In Hb E-beta-thalassemia the betaA + betaE (alpha globin nRNA ratio observed were substantially lower than those obtained from reticulocytes of patients with heterozygous beta-thalassemia, or Hb S-betaO-thalassemia, while in Hb E trait, the betaA + betaE/alpha mRNA ratio was in the ranged observed for beta-thalassemia trait. The betaE-globin gene specifies reduced accumulation of betaE-globin mRNA, a property characteristic of other forms of beta-thalassemia. The beta-thalassemia phenotype associated with inheritance of Hb E is thus determined at the level of beta-globin mRNA metabolism. PMID:6166632

  19. Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.

    PubMed

    Pallister, Jackie A; Halliday, Damien C T; Robinson, Anthony J; Venables, Daryl; Voysey, Rhonda D; Boyle, Donna G; Shanmuganathan, Thayalini; Hardy, Christopher M; Siddon, Nicole A; Hyatt, Alex D

    2011-01-25

    The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.

  20. High-Density SNP Genotyping to Define β-Globin Locus Haplotypes

    PubMed Central

    Liu, Li; Muralidhar, Shalini; Singh, Manisha; Sylvan, Caprice; Kalra, Inderdeep S.; Quinn, Charles T.; Onyekwere, Onyinye C.; Pace, Betty S.

    2014-01-01

    Five major β-globin locus haplotypes have been established in individuals with sickle cell disease (SCD) from the Benin, Bantu, Senegal, Cameroon, and Arab-Indian populations. Historically, β-haplotypes were established using restriction fragment length polymorphism (RFLP) analysis across the β-locus, which consists of five functional β-like globin genes located on chromosome 11. Previous attempts to correlate these haplotypes as robust predictors of clinical phenotypes observed in SCD have not been successful. We speculate that the coverage and distribution of the RFLP sites located proximal to or within the globin genes are not sufficiently dense to accurately reflect the complexity of this region. To test our hypothesis, we performed RFLP analysis and high-density single nucleotide polymorphism (SNP) genotyping across the β-locus using DNA samples from either healthy African Americans with normal hemoglobin A (HbAA) or individuals with homozygous SS (HbSS) disease. Using the genotyping data from 88 SNPs and Haploview analysis, we generated a greater number of haplotypes than that observed with RFLP analysis alone. Furthermore, a unique pattern of long-range linkage disequilibrium between the locus control region and the β-like globin genes was observed in the HbSS group. Interestingly, we observed multiple SNPs within the HindIII restriction site located in the Gγ-globin intervening sequence II which produced the same RFLP pattern. These findings illustrated the inability of RFLP analysis to decipher the complexity of sequence variations that impacts genomic structure in this region. Our data suggest that high density SNP mapping may be required to accurately define β-haplotypes that correlate with the different clinical phenotypes observed in SCD. PMID:18829352

  1. Design of retrovirus vectors for transfer and expression of the human. beta. -globin gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, A.D.; Bender, M.A.; Harris, E.A.S.

    1988-11-01

    Regulated expression of the human ..beta..-globin gene has been demonstrated in cultured murine erythroleukemia cells and in mice after retrovirus-mediated gene transfer. However, the low titer of recombinant viruses described to date results in relatively inefficient gene transfer, which limits their usefulness for animal studies and for potential gene therapy in humans for diseases involving defective ..beta..-globin genes. The authors found regions that interfered with virus production within intron 2 of the ..beta..-globin gene and on both sides of the gene. The flanking regions could be removed, but intron 2 was required for ..beta..-globin expression. Inclusion of ..beta..-globin introns necessitatesmore » an antisense orientation of the gene within the retrovirus vector. However, they found no effect of the antisense ..beta..-globin transcription on virus production. A region downstream of the ..beta..-globin gene that stimulates expression of the gene in transgenic mice was included in the viruses without detrimental effects on virus titer. Virus titers of over 10/sup 6/ CFU/ml were obtained with the final vector design, which retained the ability to direct regulated expression of human ..beta..-globin in murine erythroleukemia cells. The vector also allowed transfer and expression of the human ..beta..-globin gene in hematopoietic cells (CFU-S cells) in mice.« less

  2. Real-time PCR assays using internal controls for quantitation of HPV-16 and beta-globin DNA in cervicovaginal lavages.

    PubMed

    Lefevre, Jonas; Hankins, Catherine; Pourreaux, Karina; Voyer, Hélène; Coutlée, François

    2003-12-01

    High-risk human papillomavirus 16 (HPV-16) DNA viral load has been measured with real-time PCR assays by amplifying HPV-16 and a human gene. However, these assays have not used internal controls (ICs) to screen for the presence of inhibitors contained in samples. To quantitate HPV-16 DNA and cell content with real-time PCR, ICs for HPV-16 DNA and beta-globin were synthesised and used to control for inhibition. The assays were sensitive and linear over 5 logs. Good reproducibility was achieved with inter-run coefficients of variation of 23% (10(2) HPV-16 copies), 12% (10(4) HPV-16 copies), 17% (274 beta-globin DNA copies) and 7% (27,400 beta-globin DNA copies). Samples containing 56,800,000, 306,000, 18,000, and 4,070 HPV-16 copies/microg of cellular DNA were tested blindly and estimated to contain 48,800,000, 479,000, 20,300, and 6,620 HPV-16 copies/microg of DNA (mean ratio of measured to expected viral load of 1.27+/-0.32). Inhibition of amplification of HPV-16 and beta-globin ICs by six samples known to contain PCR inhibitors was variable: four inhibited both ICs while two inhibited only the HPV-16 IC. The use of internal controls with real-time PCR for HPV-16 quantitation allows to screen for the presence of inhibitors that do not affect equally primer-driven genomic amplification.

  3. Amelioration of murine beta-thalassemia through drug selection of hematopoietic stem cells transduced with a lentiviral vector encoding both gamma-globin and the MGMT drug-resistance gene.

    PubMed

    Zhao, Huifen; Pestina, Tamara I; Nasimuzzaman, Md; Mehta, Perdeep; Hargrove, Phillip W; Persons, Derek A

    2009-06-04

    Correction of murine models of beta-thalassemia has been achieved through high-level globin lentiviral vector gene transfer into mouse hematopoietic stem cells (HSCs). However, transduction of human HSCs is less robust and may be inadequate to achieve therapeutic levels of genetically modified erythroid cells. We therefore developed a double gene lentiviral vector encoding both human gamma-globin under the transcriptional control of erythroid regulatory elements and methylguanine methyltransferase (MGMT), driven by a constitutive cellular promoter. MGMT expression provides cellular resistance to alkylator drugs, which can be administered to kill residual untransduced, diseased HSCs, whereas transduced cells are protected. Mice transplanted with beta-thalassemic HSCs transduced with a gamma-globin/MGMT vector initially had subtherapeutic levels of red cells expressing gamma-globin. To enrich gamma-globin-expressing cells, transplanted mice were treated with the alkylator agent 1,3-bis-chloroethyl-1-nitrosourea. This resulted in significant increases in the number of gamma-globin-expressing red cells and the amount of fetal hemoglobin, leading to resolution of anemia. Selection of transduced HSCs was also obtained when cells were drug-treated before transplantation. Mice that received these cells demonstrated reconstitution with therapeutic levels of gamma-globin-expressing cells. These data suggest that MGMT-based drug selection holds promise as a modality to improve gene therapy for beta-thalassemia.

  4. Assessment of Virally Vectored Autoimmunity as a Biocontrol Strategy for Cane Toads

    PubMed Central

    Robinson, Anthony J.; Venables, Daryl; Voysey, Rhonda D.; Boyle, Donna G.; Shanmuganathan, Thayalini; Hardy, Christopher M.; Siddon, Nicole A.; Hyatt, Alex D.

    2011-01-01

    Background The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. Methodology/Principal Findings The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. Conclusions/Significance While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach. PMID:21283623

  5. Three mouse models of human thalassemia.

    PubMed Central

    Martinell, J; Whitney, J B; Popp, R A; Russell, L B; Anderson, W F

    1981-01-01

    Three types of mice with globin gene mutations, called 352HB, 27HB, and Hbath-J, appear to be true animal models of human thalassemia. Expression of the alpha-globin genes in three stocks of mice, each one heterozygous for one of the alpha-globin mutations, was examined at the polypeptide, RNA, and DNA levels. alpha-Globin polypeptide chains, relative to beta-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of alpha-globin to beta-globin RNA sequences are also 75-80% of normal, exactly reflecting the alpha-globin to beta-globin chain ratios. In the case of mutant 352HB, at least one alpha-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their alpha-globin genes. Images PMID:6946454

  6. Axolotl hemoglobin: cDNA-derived amino acid sequences of two alpha globins and a beta globin from an adult Ambystoma mexicanum.

    PubMed

    Shishikura, Fumio; Takeuchi, Hiro-aki; Nagai, Takatoshi

    2005-11-01

    Erythrocytes of the adult axolotl, Ambystoma mexicanum, have multiple hemoglobins. We separated and purified two kinds of hemoglobin, termed major hemoglobin (Hb M) and minor hemoglobin (Hb m), from a five-year-old male by hydrophobic interaction column chromatography on Alkyl Superose. The hemoglobins have two distinct alpha type globin polypeptides (alphaM and alpham) and a common beta globin polypeptide, all of which were purified in FPLC on a reversed-phase column after S-pyridylethylation. The complete amino acid sequences of the three globin chains were determined separately using nucleotide sequencing with the assistance of protein sequencing. The mature globin molecules were composed of 141 amino acid residues for alphaM globin, 143 for alpham globin and 146 for beta globin. Comparing primary structures of the five kinds of axolotl globins, including two previously established alpha type globins from the same species, with other known globins of amphibians and representatives of other vertebrates, we constructed phylogenetic trees for amphibian hemoglobins and tetrapod hemoglobins. The molecular trees indicated that alphaM, alpham, beta and the previously known alpha major globin were adult types of globins and the other known alpha globin was a larval type. The existence of two to four more globins in the axolotl erythrocyte is predicted.

  7. Real-time monitoring of stress erythropoiesis in vivo using Gata1 and beta-globin LCR luciferase transgenic mice.

    PubMed

    Suzuki, Mikiko; Ohneda, Kinuko; Hosoya-Ohmura, Sakie; Tsukamoto, Saho; Ohneda, Osamu; Philipsen, Sjaak; Yamamoto, Masayuki

    2006-07-15

    Erythroid progenitors have the potential to proliferate rapidly in response to environmental stimuli. This process is referred to as stress erythropoiesis, with erythropoietin (EPO) playing central roles in its promotion. In this study, we wanted to elucidate the molecular mechanisms governing the regulation of stress erythropoiesis and the maintenance of red-cell homeostasis. This was achieved by our development of a noninvasive real-time monitoring system for erythropoiesis using transgenic mouse lines expressing luciferase under the control of the mouse Gata1 hematopoietic regulatory domain (G1-HRD-luc) or human beta-globin locus control region (Hbb-LCR-luc). Optical bioluminescence images revealed that the luciferase was specifically expressed in spleen and bone marrow and was induced rapidly in response to anemia and hypoxia stimuli. The G1-HRD-luc activity tracked the emergence and disappearance of proerythroblast-stage progenitors, whereas the Hbb-LCR-luc activity tracked erythroblasts and later stage erythroid cells. Increased plasma EPO concentration preceded an increase in G1-HRD-luc, supporting our contention that EPO acts as the key upstream signal in stress erythropoiesis. Hence, we conclude that G1-HRD-luc and Hbb-LCR-luc reporters are differentially activated during stress erythropoiesis and that the transgenic mouse lines used serve as an important means for understanding the homeostatic regulation of erythropoiesis.

  8. Inhibition of G9a methyltransferase stimulates fetal hemoglobin production by facilitating LCR/γ-globin looping.

    PubMed

    Krivega, Ivan; Byrnes, Colleen; de Vasconcellos, Jaira F; Lee, Y Terry; Kaushal, Megha; Dean, Ann; Miller, Jeffery L

    2015-07-30

    Induction of fetal hemoglobin (HbF) production in adult erythrocytes can reduce the severity of sickle cell disease and β-thalassemia. Transcription of β-globin genes is regulated by the distant locus control region (LCR), which is brought into direct gene contact by the LDB1/GATA-1/TAL1/LMO2-containing complex. Inhibition of G9a H3K9 methyltransferase by the chemical compound UNC0638 activates fetal and represses adult β-globin gene expression in adult human hematopoietic precursor cells, but the underlying mechanisms are unclear. Here we studied UNC0638 effects on β-globin gene expression using ex vivo differentiation of CD34(+) erythroid progenitor cells from peripheral blood of healthy adult donors. UNC0638 inhibition of G9a caused dosed accumulation of HbF up to 30% of total hemoglobin in differentiated cells. Elevation of HbF was associated with significant activation of fetal γ-globin and repression of adult β-globin transcription. Changes in gene expression were associated with widespread loss of H3K9me2 in the locus and gain of LDB1 complex occupancy at the γ-globin promoters as well as de novo formation of LCR/γ-globin contacts. Our findings demonstrate that G9a establishes epigenetic conditions preventing activation of γ-globin genes during differentiation of adult erythroid progenitor cells. In this view, manipulation of G9a represents a promising epigenetic approach for treatment of β-hemoglobinopathies.

  9. Structural polymorphism exhibited by a quasipalindrome present in the locus control region (LCR) of the human beta-globin gene cluster.

    PubMed

    Kaushik, Mahima; Kukreti, Shrikant

    2006-01-01

    Structural polymorphism of DNA is a widely accepted property. A simple addition to this perception has been our recent finding, where a single nucleotide polymorphism (SNP) site present in a quasipalindromic sequence of beta-globin LCR exhibited a hairpin-duplex equilibrium. Our current studies explore that secondary structures adopted by individual complementary strands compete with formation of a perfect duplex. Using gel-electrophoresis, ultraviolet (UV)-thermal denaturation, circular dichroism (CD) techniques, we have demonstrated the structural transitions within a perfect duplex containing 11 bp quasipalindromic stretch (TGGGG(G/C)CCCCA), to hairpins and bulge duplex forms. The extended version of the 11 bp duplex, flanked by 5 bp on both sides also demonstrated conformational equilibrium between duplex and hairpin species. Gel-electrophoresis confirms that the duplex coexists with hairpin and bulge duplex/cruciform species. Further, in CD spectra of duplexes, presence of two overlapping positive peaks at 265 and 285 nm suggest the features of A- as well as B-type DNA conformation and show oligomer concentration dependence, manifested in A --> B transition. This indicates the possibility of an architectural switching at quasipalindromic region between linear duplex to a cruciform structure. Such DNA structural variations are likely to be found in the mechanics of molecular recognition and manipulation by proteins.

  10. High Fractional Occupancy of a Tandem Maf Recognition Element and Its Role in Long-Range β-Globin Gene Regulation

    PubMed Central

    Stees, Jared R.; Hossain, Mir A.; Sunose, Tomoki; Kudo, Yasushi; Pardo, Carolina E.; Nabilsi, Nancy H.; Darst, Russell P.; Poudyal, Rosha; Igarashi, Kazuhiko; Kladde, Michael P.

    2015-01-01

    Enhancers and promoters assemble protein complexes that ultimately regulate the recruitment and activity of RNA polymerases. Previous work has shown that at least some enhancers form stable protein complexes, leading to the formation of enhanceosomes. We analyzed protein-DNA interactions in the murine β-globin gene locus using the methyltransferase accessibility protocol for individual templates (MAPit). The data show that a tandem Maf recognition element (MARE) in locus control region (LCR) hypersensitive site 2 (HS2) reveals a remarkably high degree of occupancy during differentiation of mouse erythroleukemia cells. Most of the other transcription factor binding sites in LCR HS2 or in the adult β-globin gene promoter regions exhibit low fractional occupancy, suggesting highly dynamic protein-DNA interactions. Targeting of an artificial zinc finger DNA-binding domain (ZF-DBD) to the HS2 tandem MARE caused a reduction in the association of MARE-binding proteins and transcription complexes at LCR HS2 and the adult βmajor-globin gene promoter but did not affect expression of the βminor-globin gene. The data demonstrate that a stable MARE-associated footprint in LCR HS2 is important for the recruitment of transcription complexes to the adult βmajor-globin gene promoter during erythroid cell differentiation. PMID:26503787

  11. Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

    PubMed

    Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth

    2006-10-01

    In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.

  12. A molecular study of a family with Greek hereditary persistence of fetal hemoglobin and beta-thalassemia.

    PubMed Central

    Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U

    1984-01-01

    A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198

  13. Replication of the Chicken β-Globin Locus: Early-Firing Origins at the 5′ HS4 Insulator and the ρ- and βA-Globin Genes Show Opposite Epigenetic Modifications

    PubMed Central

    Prioleau, Marie-Noëlle; Gendron, Marie-Claude; Hyrien, Olivier

    2003-01-01

    Chromatin structure is believed to exert a strong effect on replication origin function. We have studied the replication of the chicken β-globin locus, whose chromatin structure has been extensively characterized. This locus is delimited by hypersensitive sites (HSs) that mark the position of insulator elements. A stretch of condensed chromatin and another HS separate the β-globin domain from an adjacent folate receptor (FR) gene. We demonstrate here that in erythroid cells that express the FR but not the globin genes, replication initiates at four sites within the β-globin domain, one at the 5′ HS4 insulator and the other three near the ρ- and βA-globin genes. Three origins consist of G+C-rich sequences enriched in CpG dinucleotides. The fourth origin is A+T rich. Together with previous work, these data reveal that the insulator origin has unmethylated CpGs, hyperacetylated histones H3 and H4, and lysine 4-methylated histone H3. In contrast, opposite modifications are observed at the other G+C-rich origins. We also show that the whole region, including the stretch of condensed chromatin, replicates early in S phase in these cells. Therefore, different early-firing origins within the same locus may have opposite patterns of epigenetic modifications. The role of insulator elements in DNA replication is discussed. PMID:12724412

  14. The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.

    PubMed

    Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N

    1985-01-01

    The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.

  15. A Functional Element Necessary for Fetal Hemoglobin Silencing

    PubMed Central

    Sankaran, Vijay G.; Xu, Jian; Byron, Rachel; Greisman, Harvey A.; Fisher, Chris; Weatherall, David J.; Sabath, Daniel E.; Groudine, Mark; Orkin, Stuart H.; Premawardhena, Anuja; Bender, M.A.

    2011-01-01

    BACKGROUND An improved understanding of the regulation of the fetal hemoglobin genes holds promise for the development of targeted therapeutic approaches for fetal hemoglobin induction in the β-hemoglobinopathies. Although recent studies have uncovered trans-acting factors necessary for this regulation, limited insight has been gained into the cis-regulatory elements involved. METHODS We identified three families with unusual patterns of hemoglobin expression, suggestive of deletions in the locus of the β-globin gene (β-globin locus). We performed array comparative genomic hybridization to map these deletions and confirmed breakpoints by means of polymerase-chain-reaction assays and DNA sequencing. We compared these deletions, along with previously mapped deletions, and studied the trans-acting factors binding to these sites in the β-globin locus by using chromatin immunoprecipitation. RESULTS We found a new (δβ)0-thalassemia deletion and a rare hereditary persistence of fetal hemoglobin deletion with identical downstream breakpoints. Comparison of the two deletions resulted in the identification of a small intergenic region required for γ-globin (fetal hemoglobin) gene silencing. We mapped a Kurdish β0-thalassemia deletion, which retains the required intergenic region, deletes other surrounding sequences, and maintains fetal hemoglobin silencing. By comparing these deletions and other previously mapped deletions, we elucidated a 3.5-kb intergenic region near the 5′ end of the δ-globin gene that is necessary for γ-globin silencing. We found that a critical fetal hemoglobin silencing factor, BCL11A, and its partners bind within this region in the chromatin of adult erythroid cells. CONCLUSIONS By studying three families with unusual deletions in the β-globin locus, we identified an intergenic region near the δ-globin gene that is necessary for fetal hemoglobin silencing. (Funded by the National Institutes of Health and others.) PMID:21879898

  16. Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

    PubMed

    Jorgez, Carolina J; Bischoff, Farideh Z

    2009-01-01

    Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

  17. Relationship of the Interaction Between Two Quantitative Trait Loci with γ-Globin Expression in β-Thalassemia Intermedia Patients.

    PubMed

    NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran

    2018-05-10

    Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.

  18. Genetics Home Reference: sickle cell disease

    MedlinePlus

    ... of beta-globin; this abnormality is called beta thalassemia . In people with sickle cell disease , at least ... globin. If mutations that produce hemoglobin S and beta thalassemia occur together, individuals have hemoglobin S- beta thalassemia (HbSBetaThal) ...

  19. Insulators to improve expression of a 3(')IgH LCR-driven reporter gene in transgenic mouse models.

    PubMed

    Guglielmi, Laurence; Le Bert, Marc; Truffinet, Véronique; Cogné, Michel; Denizot, Yves

    2003-08-01

    A locus control region (LCR) containing four transcriptional enhancers lies downstream of the IgH chain locus. We studied transgenes carrying a 3(')IgH LCR-driven GFP reporter gene for expression and B cell differentiation stage specificity. We also compared transgenes that were or were not flanked by two copies of the beta-globin HS4 insulator, an element defined by its ability to protect transgenes from the influences of surrounding genes at the insertion site. Results indicate that insulators are instrumental in sustaining GFP expression in GFP-3(')LCR transgenic mice when they were included. Flow cytometry experiments reported a strictly B cell specific GFP expression from pre-B cells in bone marrow to mature B cells in spleen. Despite addition of 5(')HS4 insulators to the GFP-3(')LCR construct, complete transgene silencing occurred in some transgenic lines and was systematically observed in ageing animals from all lines.

  20. A majority of mice show long-term expression of a human. beta. -globin gene after retrovirus transfer into hematopoietic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bender, M.A.; Gelinas, R.E.; Miller

    1989-04-01

    Murine bone marrow was infected with a high-titer retrovirus vector containing the human {beta}-globin and neomycin phosphotransferase genes. Anemic W/W/sup v/ mice were transplanted with infected marrow which in some cases had been exposed to the selective agent G418. Human {beta}-globin expression was monitored in transplanted animals by using a monoclonal antibody specific for human {beta}-globin polypeptide, and hematopoietic reconstitution was monitored by using donor and recipient mice which differed in hemoglobin type. In some experiments all transplanted mice expressed the human {beta}-globin polypeptide for over 4 months, and up to 50% of peripheral erythrocytes contained detectable levels of polypeptide.more » DNA analysis of transplanted animals revealed that virtually every myeloid cell contained a provirus. Integration site analysis and reconstitution of secondary marrow recipients suggested that every mouse was reconstituted with at least one infected stem cell which had extensive repopulation capability. The ability to consistently transfer an active {beta}-globin gene into mouse hematopoietic cells improves the feasibility of using these techniques for somatic cell gene therapy in humans.« less

  1. Glucocorticoids inhibit coordinated translation of. cap alpha. - and. beta. -globin mRNAs in Friend erythroleukemia cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Papaconstantinou, J.; Stewart, J.A.; Rabek, J.P.

    The dimethylsulfoxide (Me/sub 2/SO)-mediated induction of hemoglobin synthesis in Friend erythroleukemia cells is inhibited by the glucocorticoids hydrocortisone, dexamethasone, and fluocinolone acetonide; hydrocortisone, at concentrations of 10/sup -5/ to 10/sup -8/ M inhibits by 90-30% and fluocinolone acetonide at concentrations of 10/sup -8/ to 10/sup -11/ M shows a greater than 90% inhibition. At these concentrations the hormones have no effect on cell growth or viability. In this study it has been shown that there is a group of proteins, including the ..cap alpha..- and ..beta..-globins, whose regulation is associated with the induction of Friend erythroleukemia cell differentiation, and thatmore » the expression of these, in addition to ..cap alpha..- and ..beta..-globin, is affected by glucocorticoids. It is concluded that, although the translation of ..cap alpha..- and ..beta..-globin mRNA is a major site of inhibition by glucocorticoids, there is a detectable amount of ..cap alpha..- and ..beta..-globin mRNA translation which results in unequal amounts of globin synthesis and an overall more potent inhibition of hemoglobin formation.« less

  2. Distinct modes of gene regulation by a cell-specific transcriptional activator.

    PubMed

    Sengupta, Tanushri; Cohet, Nathalie; Morlé, François; Bieker, James J

    2009-03-17

    The architectural layout of a eukaryotic RNA polymerase II core promoter plays a role in general transcriptional activation. However, its role in tissue-specific expression is not known. For example, differing modes of its recognition by general transcription machinery can provide an additional layer of control within which a single tissue-restricted transcription factor may operate. Erythroid Kruppel-like factor (EKLF) is a hematopoietic-specific transcription factor that is critical for the activation of subset of erythroid genes. We find that EKLF interacts with TATA binding protein-associated factor 9 (TAF9), which leads to important consequences for expression of adult beta-globin. First, TAF9 functionally supports EKLF activity by enhancing its ability to activate the beta-globin gene. Second, TAF9 interacts with a conserved beta-globin downstream promoter element, and ablation of this interaction by beta-thalassemia-causing mutations decreases its promoter activity and disables superactivation. Third, depletion of EKLF prevents recruitment of TAF9 to the beta-globin promoter, whereas depletion of TAF9 drastically impairs beta-promoter activity. However, a TAF9-independent mode of EKLF transcriptional activation is exhibited by the alpha-hemoglobin-stabilizing protein (AHSP) gene, which does not contain a discernable downstream promoter element. In this case, TAF9 does not enhance EKLF activity and depletion of TAF9 has no effect on AHSP promoter activation. These studies demonstrate that EKLF directs different modes of tissue-specific transcriptional activation depending on the architecture of its target core promoter.

  3. Analyzing 5'HS3 and 5'HS4 LCR core regions and NF-E2 in Iranian thalassemia intermedia patients with normal or carrier status for beta-globin mutations.

    PubMed

    Neishabury, Maryam; Azarkeivan, Azita; Oberkanins, Christian; Abedini, Seyedeh Sedigheh; Zamani, Shahbaz; Najmabadi, Hossein

    2011-03-15

    Our data on 114 Iranian individuals with thalassemia intermedia phenotype revealed homozygous or compound heterozygous beta-globin mutations to be the predominant disease factor in 86.2% of cases. However, 8.2% of these individuals were found to be heterozygous or wild type for beta-globin mutations. In search for determinants outside of the beta-globin gene, which could be responsible for the unexpected thalassemia intermedia phenotype in these subjects, we screened the alpha-globin genes, the 5'HS3 and 5'HS4 regions of the beta-globin LCR, and the NF-E2 transcription factor for sequence variations in selected individuals. The -3.7 deletion was the only alpha-globin mutation detected, and no alterations were found in 5'HS3 and NF-E2. Sequence analysis of the 5'HS4 LCR core region identified three known SNPs in a single patient, who required irregular blood transfusions. The A/G polymorphism in the 5'HS4 palindromic region was also observed to be variable. Family studies were carried out on a female G/G homozygous patient, who received irregular blood transfusions. Her father, who had the same heterozygous IVSII-1 beta-globin mutation but the A/G genotype at the 5'HS4 palindromic site, presented with mild anemia and no requirement for blood transfusions. This suggests an impact of SNPs in the 5'HS4 LCR core region on the thalassemia phenotype and offers an interesting subject for further investigations in the Iranian population. Copyright © 2010 Elsevier Inc. All rights reserved.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Louie, E.; Dietz, L.; Shafer, F.

    A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, whichmore » would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.« less

  5. Diagnostic difficulty of beta-thalassemia syndrome in a multi-transfused patient: contribution of myelogram and studying parents.

    PubMed

    Trawinski, Élisabeth; Fenneteau, Odile; Le Mouel, Lou; Ithier, Ghislaine; Couque, Nathalie

    2017-10-01

    We report the case of a 5 year old, initially followed for congenital sideroblastic anemia, whose explorations reveal a complex family hemoglobinopathy. Myelogram performed in children, reveals dystrophic mature erythroblasts with hemoglobinization defect and basophil punctuations. These abnormalities point towards an abnormal synthesis of heme or globin chains. Iterative transfusions in child do not allow interpreting a search for abnormal hemoglobin. However, the analysis carried out in his parents, with increased HBA2 rate and microcytosis concluded in beta-thalassemia trait for father and mother. Knowing that beta-thalassemia syndrome is a genetic condition, usually recessive, the presence of beta-thalassemia trait in parents is in favor of a beta-thalassemia syndrome in child. This diagnostic hypothesis is confirmed by molecular study of globin genes that will reveal a complex hemoglobinopathie for all family's members. The parents are carriers for heterozygous mutation of β + thalassemia that the sick child presents in homozygous state supporting the diagnosis of beta-thalassemia syndrome. Moreover, a triple α globin gene is present respectively at heterozygous state for mother and at homozygous state for father and child. The triple α globin gene is a known factor of aggravation of beta-thalassemia and this clinical case with continuum observed, perfectly illustrates the intricacies between α and β globin genes.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, S.D.; Cooper, P.; Fung, J.

    Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression ofmore » human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.« less

  7. Two genetic markers closely linked to adult polycystic kidney disease on chromosome 16.

    PubMed Central

    Reeders, S T; Breuning, M H; Corney, G; Jeremiah, S J; Meera Khan, P; Davies, K E; Hopkinson, D A; Pearson, P L; Weatherall, D J

    1986-01-01

    The genetic locus for autosomal dominant adult polycystic kidney disease was recently assigned to chromosome 16 by the finding of genetic linkage to the alpha globin gene cluster. Further study showed that the phosphoglycolate phosphatase locus is also closely linked to both the locus for adult polycystic kidney disease and the alpha globin gene cluster. These findings have important implications for the prenatal and presymptomatic diagnosis of adult polycystic kidney disease and for a better understanding of its pathogenesis. Images FIG 1 PMID:3008903

  8. Hb L'Aquila [beta106(G8)Leu-->Val, CTG-->GTG]: a novel thalassemic hemoglobin variant.

    PubMed

    Amato, Antonio; Cappabianca, Maria Pia; Ponzini, Donatella; Rinaldi, Silvana; Biagio, Paola Di; Foglietta, Enrica; Grisanti, Paola; Mastropietro, Fabrizio

    2007-01-01

    A new beta-globin variant at codon 106 (CTG-->GTG), and which we named Hb L'Aquila [beta106(G8)Leu-->Val], was detected by DNA analysis. The proband and her father presented with the features of a mild beta(+)-thalassemia (thal), confirmed by their alpha/beta-globin chain biosynthesis ratios.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Popp, R.A.; Popp, D.M.; Johnson, F.M.

    Mice homozygous for a spontaneous mutation, in which the ..beta..-major globin gene is deleted, have clinical symptoms of ..beta..-thalassemia. These mice have a hypocellular, hypochromic, microcytic anemia that becomes more severe with increasing age. The defective red cell morphology, decreased osmotic fragility of erythrocytes and shortened red cell life span found in ..beta..-thalassemic mice are similar to those observed in human ..beta..-thalassemia. Synthesis of ..beta..-globin is depressed but not as much as might be expected because the expression of the..beta..-minor globin gene is enhanced to encode two to three times more globin than in normal mice. Splenomegaly, an enlarged poolmore » of stem cells for erythropoiesis, and iron overloading occur in older mice. The fact that these mice remain moderately healthy makes them a very suitable animal model in which to develop and test alternative techniques of gene therapy that could be successfully applied to the treatment of human thalassemia. Homozygous ..beta..-thalassemic mice have large deposits of iron in their tissues, which might make these mice also useful for in vivo tests of the effectiveness and possible long-term side effects for newly developed iron chelators.« less

  10. Human beta-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old.

    PubMed

    Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M

    1995-12-01

    Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible.

  11. mNotch1 signaling and erythropoietin cooperate in erythroid differentiation of multipotent progenitor cells and upregulate beta-globin.

    PubMed

    Henning, Konstanze; Schroeder, Timm; Schwanbeck, Ralf; Rieber, Nikolaus; Bresnick, Emery H; Just, Ursula

    2007-09-01

    In many developing tissues, signaling mediated by activation of the transmembrane receptor Notch influences cell-fate decisions, differentiation, proliferation, and cell survival. Notch receptors are expressed on hematopoietic cells and cognate ligands on bone marrow stromal cells. Here, we investigate the role of mNotch1 signaling in the control of erythroid differentiation of multipotent progenitor cells. Multipotent FDCP-mix cell lines engineered to permit the conditional induction of the constitutively active intracellular domain of mNotch1 (mN1(IC)) by the 4-hydroxytamoxifen (OHT)-inducible system were used to analyze the effects of activated mNotch1 on erythroid differentiation and on expression of Gata1, Fog1, Eklf, NF-E2, and beta-globin. Expression was analyzed by Northern blotting and real-time polymerase chain reaction. Enhancer activity of reporter constructs was determined with the dual luciferase system in transient transfection assays. Induction of mN1(IC) by OHT resulted in increased and accelerated differentiation of FDCP-mix cells along the erythroid lineage. Erythroid maturation was induced by activated Notch1 also under conditions that normally promote self-renewal, but required the presence of erythropoietin for differentiation to proceed. While induction of Notch signaling rapidly upregulated Hes1 and Hey1 expression, the expression of Gata1, Fog1, Eklf, and NF-E2 remained unchanged. Concomitantly with erythroid differentiation, activated mNotch1 upregulated beta-globin RNA. Notch signaling transactivated a reporter construct harboring a conserved RBP-J (CBF1) binding site in the hypersensitive site 2 (HS2) of human beta-globin. Transactivation by activated Notch was completely abolished when this RBP-J site was mutated to prevent RBP-J binding. Our results show that activation of mNotch1 induces erythroid differentiation in cooperation with erythropoietin and upregulates beta-globin expression.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baserga, S.J.; Benz, E.J. Jr.

    A number of premature translation termination mutations (nonsense mutations) have been described in the human {alpha}- and {beta}-globin genes. Studies on mRNA isolated from patients with {beta}{sup 0}-thalassemia have shown that for both the {beta}-17 and the {beta}-39 mutations less than normal levels of {beta}-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human {beta}-globin mRNA). In vitro studies using the cloned {beta}-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. Themore » authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human {beta}-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation.« less

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pirastu, M.; Galanello, R.; Doherty, M.A.

    The predominant ..beta..-thalassemia in Sardinia is the ..beta../sup 0/ type in which no ..beta..-globin chains are synthesized in the homozygous state. The authors determined the ..beta..-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same ..beta../sup 39(CAG..-->..TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the ..beta..-globin gene region.

  14. Eos Negatively Regulates Human γ-globin Gene Transcription during Erythroid Differentiation

    PubMed Central

    Yu, Hai-Chuan; Zhao, Hua-Lu; Wu, Zhi-Kui; Zhang, Jun-Wu

    2011-01-01

    Background Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Methodology/Principal Findings Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Conclusions/Significance Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation. PMID:21829552

  15. The population genetics of the alpha-2 globin locus of orangutans (Pongo pygmaeus).

    PubMed

    Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

    2005-03-01

    In this study, the molecular population genetics of the orangutan's alpha-2 globin (HBA2) gene were investigated in order to test for the action of natural selection. Haplotypes from 28 orangutan chromosomes were collected from a 1.46-kilobase region of the alpha-2 globin locus. While many aspects of the data were consistent with neutrality, the observed heterogeneous distribution of polymorphisms was inconsistent with neutral expectations. Furthermore, a single amino acid variant, found in both the Bornean and the Sumatran orangutan subspecies, was associated with different alternative synonymous variants in each subspecies, suggesting that the allele may have spread separately through the two subspecies after two distinct origination events. This variant is not in Hardy-Weinberg equilibrium (HWE). These observations are consistent with neutral models that incorporate population structure and models that invoke selection. The orangutan Plasmodium parasite is a plausible selective agent that may underlie the variation at alpha-2 globin in orangutans.

  16. [Locus of control and self-concept in interpersonal conflict resolution approaches].

    PubMed

    Hisli Sahin, Nesrin; Basim, H Nejat; Cetin, Fatih

    2009-01-01

    The purpose of this study was to investigate the relationship between self-concept and locus of control in interpersonal conflict resolution approaches and to determine the predictors of conflict resolution approach choices. The study included 345 students aged between 18 and 28 years that were studying at universities in Ankara. Data were collected using the Interpersonal Conflict Resolution Approaches Scale to measure conflict resolution approaches, the Social Comparison Scale to measure self-concept, and the Internal-External Locus of Control Scale to measure locus of control. It was observed that confrontation approach to interpersonal conflict was predicted by self-concept (beta = 0.396, P < 0.001) Moreover, self-concept was related to self-disclosure (beta = 0.180, P < 0.01) and emotional expression (beta = 0.196, P < 0.001) approaches. Locus of control played a role in the choice of all resolution approaches. In addition to these findings, it was observed that females used self-disclosure (beta = -0.163, P < 0.01) and emotional expression (beta = -0.219, P < 0.001), while males used approach (beta = 0.395, P < 0.001) and public behavior (beta = 0.270, P < 0.001) approaches in the resolution processes. Self-concept and locus of control were related to the behaviors adopted in the interpersonal conflict resolution process. Individuals with a positive self-concept and an internal locus of control adopted solutions to interpersonal conflict resolution that were more effective and constructive.

  17. Dexamethasone facilitates erythropoiesis in murine embryonic stem cells differentiating into hematopoietic cells in vitro

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Srivastava, Anand S.; Kaushal, Sharmeela; Mishra, Rangnath

    2006-07-28

    Differentiating embryonic stem (ES) cells are increasingly emerging as an important source of hematopoietic progenitors with a potential to be useful for both basic and clinical research applications. It has been suggested that dexamethasone facilitates differentiation of ES cells towards erythrocytes but the mechanism responsible for sequential expression of genes regulating this process are not well-understood. Therefore, we in vitro induced differentiation of murine ES cells towards erythropoiesis and studied the sequential expression of a set of genes during the process. We hypothesized that dexamethasone-activates its cognate nuclear receptors inducing up-regulation of erythropoietic genes such as GATA-1, Flk-1, Epo-R, andmore » direct ES cells towards erythropoietic differentiation. ES cells were cultured in primary hematopoietic differentiation media containing methyl-cellulose, IMDM, IL-3, IL-6, and SCF to promote embryoid body (EB) formation. Total RNA of day 3, 5, and 9-old EBs was isolated for gene expression studies using RT-PCR. Cells from day 9 EBs were subjected to secondary differentiation using three different cytokines and growth factors combinations: (1) SCF, EPO, dexamethasone, and IGF; (2) SCF, IL-3, IL-6, and TPO; and (3) SCF IL-3, IL-6, TPO, and EPO. Total RNA from day 12 of secondary differentiated ES cells was isolated to study the gene expression pattern during this process. Our results demonstrate an up-regulation of GATA-1, Flk-1, HoxB-4, Epo-R, and globin genes ({alpha}-globin, {beta}H-1 globin, {beta}-major globin, {epsilon} -globin, and {zeta}-globin) in the 9-day-old EBs, whereas, RNA from 5-day-old EBs showed expression of HoxB-4, {epsilon}-globin, {gamma}-globin, {beta}H1-globin, and Flk-1. Three-day-old EBs showed only HoxB-4 and Flk-1 gene expression and lacked expression of all globin genes. These findings indicate that erythropoiesis-specific genes are activated later in the course of differentiation. Gene expression studies on the ES cells of secondary EB origin cultured in media containing dexamethasone showed a down-regulation of GATA-3 and an up-regulation of GATA-1, Flk-1, and Epo-R in comparison to the two other cytokines and growth factor combinations containing media. The secondary differentiation also showed an enhanced production of erythrocytic precursors in dexamethasone containing media in comparison to that in the control media. Our results indicate that dexamethasone can prove to be an effective agent which can be employed to enhance differentiation towards erythrocytic progenitors from ES cells.« less

  18. Sickle cell disease caused by heterozygosity for Hb S and novel LCR deletion: Report of two patients.

    PubMed

    Koenig, Sara C; Becirevic, Esmira; Hellberg, Miriam S C; Li, Michael Y; So, Jason C C; Hankins, Jane S; Ware, Russell E; McMahon, Lillian; Steinberg, Martin H; Luo, Hong-Yuan; Chui, David H K

    2009-09-01

    The b-globin gene LCR is located approximately 6 kb upstream of the embryonic epsilon-globin gene, and is made up of five DNase I hypersensitive sites (HSs), HS 1-5. LCR plays a pivotal role in regulating the expression of downstream epsilon-, (G)gamma-, (A)gamma-, delta-, and beta-globin genes in cis [1]. Deletions removing the LCR and parts of the downstream beta-globin gene cluster in patients have been described [2]. These individuals present with a (gammadeltabeta)0-thalassemia carrier phenotype. We now report two patients with severe sickle cell disease who were compound heterozygous for Hb S mutation and novel LCR deletion. In one case, HS 1-3 were deleted; in the other, HS 1-5 were deleted. In both cases, the b-like globin genes in cis to the LCR deletions were intact. Genotypically, both patients appeared to have sickle cell trait. Coinherited with either LCR deletion, these individuals presented as sickle cell disease patients. The breakpoints of these LCR deletions were defined. These results affirm that HS 2 and 3 are primarily responsible for conferring erythroid specific high-level expression of cis-linked beta-like globin genes. Furthermore, LCR deletions might cause hemolytic disease of newborns.

  19. Laboratory investigation of hemoglobinopathies and thalassemias: review and update.

    PubMed

    Clarke, G M; Higgins, T N

    2000-08-01

    Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

  20. Genetic heterogeneity of Beta thalassemia in Lebanon reflects historic and recent population migration.

    PubMed

    Makhoul, N J; Wells, R S; Kaspar, H; Shbaklo, H; Taher, A; Chakar, N; Zalloua, P A

    2005-01-01

    Beta thalassemia is an autosomal recessive disorder characterized by reduced (beta(+)) or absent (beta(0)) beta-globin chain synthesis. In Lebanon it is the most predominant genetic defect. In this study we investigated the religious and geographic distribution of the beta-thalassemia mutations identified in Lebanon, and traced their precise origins. A total of 520 beta-globin chromosomes from patients of different religious and regional backgrounds was studied. Beta thalassemia mutations were identified using Amplification Refractory Mutation System (ARMS) PCR or direct gene sequencing. Six (IVS-I-110, IVS-I-1, IVS-I-6, IVS-II-1, cd 5 and the C > T substitution at cd 29) out of 20 beta-globin defects identified accounted for more than 86% of the total beta-thalassemia chromosomes. Sunni Muslims had the highest beta-thalassemia carrier rate and presented the greatest heterogeneity, with 16 different mutations. Shiite Muslims followed closely with 13 mutations, whereas Maronites represented 11.9% of all beta-thalassemic subjects and carried 7 different mutations. RFLP haplotype analysis showed that the observed genetic diversity originated from both new mutational events and gene flow from population migration. This study provides information about the types and distribution of beta-thalassemia mutations within each religious group and geographic region, which is essential for the implementation of screening and prevention programs.

  1. VNTR internal structure mapping at the {alpha}-globin 3{prime}HVR locus reveals a hierachy of related lineages in oceania

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

    1994-09-01

    Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. Wemore » have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.« less

  2. Histone- and protamine-DNA association: conservation of different patterns within the beta-globin domain in human sperm.

    PubMed

    Gardiner-Garden, M; Ballesteros, M; Gordon, M; Tam, P P

    1998-06-01

    Most DNA in human sperm is bound to highly basic proteins called protamines, but a small proportion is complexed with histones similar to those found in active chromatin. This raises the intriguing possibility that histones in sperm are marking sets of genes that will be preferentially activated during early development. We have examined the chromatin structure of members of the beta-globin gene family, which are expressed at different times in development, and the protamine 2 gene, which is expressed in spermatids prior to the widespread displacement of histones by transition proteins. The genes coding for epsilon and gamma globin, which are active in the embryonic yolk sac, contain regions which are histone associated in the sperm. No histone-associated regions are present at the sites tested within the beta- and delta-globin genes which are silent in the embryonic yolk sac. The trends of histone or protamine association are consistent for samples from the same person, and no significant between-subject variations in these trends are found for 13 of the 15 fragments analyzed in the two donors. The results suggest that sperm chromatin structures are generally similar in different men but that the length of the histone-associated regions can vary. The association of sperm DNA with histones or protamines sometimes changes within as little as 400 bp of DNA, suggesting that there is fine control over the retention of histones.

  3. Copy number variations of six and seven α-globin genes in a family with intermedia and major thalassemia phenotypes.

    PubMed

    Farashi, Samaneh; Vakili, Shadi; Faramarzi Garous, Negin; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

    2015-10-01

    Copy number variations in α-globin genes are results of unequal crossover between homologous segments in the α-globin gene cluster that misalign during the meiosis phase of the gametogenesis process. Reduction or augmentation of α-globin genes leads to imbalance of α/β chains in hemoglobin tetramer and consequently attenuate or worsen the β-thal clinical symptoms, respectively. Multiplications in α-globin genes have been found in some populations, justifying unexpected severe phenotype of β-thal carriers. Unexpected severe phenotype in the family members may result from coexistence of extra α-globin genes, which is an important factor in the causation of thalassemia intermedia and major in heterozygous β-thalassemia. We described different multiplications in α-globin locus in an Iranian family with one, two or three extra α-globin genes (ααα/αα, αααα/αα and αααα/ααα). The excess α-globin gene/genes cause increment in β/α chain imbalance and leads to worsening pathophysiology and clinical severity of β-thalassemia carriers.

  4. Thalassemia

    MedlinePlus

    ... disorder that affects the way the body makes hemoglobin. Hemoglobin is the part of red blood cells that ... alpha globin and beta globin; these proteins make hemoglobin. In thalassemia, a gene that makes these proteins ...

  5. Erythrocyte phosphofructokinase in rat strains with genetically determined differences in 2,3-diphosphoglycerate levels.

    PubMed

    Noble, N A; Tanaka, K R

    1981-02-01

    We have studied the erythrocyte enzyme phosphofructokinase (PFK) from two strains of Long-Evans rats with genetically determined differences in erythrocyte 2,3-diphosphoglycerate (DPG) levels. The DPG difference is due to two alleles at one locus. With one probable exception, the genotype at this locus is always associated with the hemoglobin (Hb) electrophoretic phenotype, due to a polymorphism at the III beta-globin locus. The enzyme PFK has been implicated in the DPG difference because glycolytic intermediate levels suggest that this enzyme has a higher in vivo activity in High-DPG strain rats, although the total PFK activity does not differ. We report here that partially purified erythrocyte PFK from Low-DPG strain cells is inhibited significantly more at physiological levels of DPG (P less than 0.01) than PFK from High-DPG strain erythrocytes. Citrate and adenosine triphosphate also inhibit the Low-DPG enzyme more than the High-DPG enzyme. Therefore, a structurally different PFK, with a greater sensitivity to inhibitors, may explain the lower DPG and ATP levels observed in Low-DPG strain animals. These data support a two-locus (Hb and PFK) hypothesis and provide a gene marker to study the underlying genetic and physiologic relationships of these loci.

  6. The phylogenetic and evolutionary history of a novel alpha-globin-type gene in orangutans (Pongo pygmaeus).

    PubMed

    Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

    2006-07-01

    The alpha-globin genes are implicated in human resistance to malaria, a disease caused by Plasmodium parasites. This study is the first to analyze DNA sequences from a novel alpha-globin-type gene in orangutans, a species affected by Plasmodium. Phylogenetic methods show that the gene is a duplication of an alpha-globin gene and is located 5' of alpha-2 globin. The alpha-globin-type gene is notable for having four amino acid replacements relative to the orangutan's alpha-1 and alpha-2 globin genes, with no synonymous differences. Pairwise K(a)/K(s) methods and likelihood ratio tests (LRTs) revealed that the evolutionary history of the alpha-globin-type gene has been marked by either neutral or positive evolution, but not purifying selection. A comparative analysis of the amino acid replacements of the alpha-globin-type gene with human hemoglobinopathies and hemoglobin structure showed that two of the four replaced sites are members of the same molecular bond, one that is crucial to the proper functioning of the hemoglobin molecule. This suggested an adaptive evolutionary change. Functionally, this locus may result in a thalassemia-like phenotype in orangutans, possibly as an adaptation to combat Plasmodium.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Patrick, N.; Miyakawa, F.; Hunt, J.A.

    The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5more » of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].« less

  8. Assessing the relative stabilities of engineered hemoglobins using electrospray mass spectrometry.

    PubMed

    Apostol, I

    1999-07-15

    An ion trap mass spectrometer equipped with an electrospray source was used to examine the relative thermodynamic stabilities of various hemoglobins with respect to both tetramer dissociation and hemin dissociation. The results demonstrated that the stability of hemoglobin molecules can be differentiated by the amount of applied collision-induced dissociation (CID) energy necessary to break up the intact tetramer into its constituent globins. The stability of the intact tetramer was affected by single mutations in the beta-globins. The stabilities of the constituent hologlobins were assessed via trap CID of selected ions. The results demonstrated the importance of the contributions of the hologlobin components to the stability of the intact tetramer. Genetic fusion of two alpha-globins, through the introduction of a single glycine residue between the C-terminus of one alpha-chain and the N-terminus of the second, significantly increased the stability of the hemoglobin pseudo-tetramer. Chemical crosslinking of the beta-globins in addition to genetic fusion of alpha-globins further stabilized the hemoglobin molecule. A dihemoglobin molecule produced by the genetic fusion of two di-alpha-globins with a flexible linker demonstrated a decreased stability relative to the corresponding monohemoglobin. Copyright 1999 Academic Press.

  9. Removing peroxide impurities from ether improves the quality of globin chains for biosynthetic studies.

    PubMed

    Mirzazadeh, Roghieh; Khatami, Shohreh; Bayat, Parastoo; Zamani, Zahra; Sadeghi, Sedigheh; Roohi, Soghra; Saidi, Parinaz

    2005-01-01

    The diagnosis of the different forms of thalassemia is one of the important applications of analysis of globin chains. These analyses are done by high performance liquid chromatography (HPLC) using a MONO-S cation exchange column and ether is used for washing the globin powder in the final step. The presence of peroxide impurities in ether could change the structure of the globin chains. In the chromatograms, these modified globins appear as separated peaks next to the unmodified globin peaks. In these cases, the alpha/beta ratio exceed by artifact the correct value. Our study demonstrates that diagnostic centers should ensure that the ether they use is pure.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ngo, K.Y.; Liu, D.; Lee, J.

    During the past two years we have tested 2,300 Southeast Asians for alpha- and beta-thaleassemia mutations. We found the incidence of hemoglobin E ({beta}{sup 26}) to be 47% among Laotians and 38% among Cambodians. The incidence of beta thalassemia trait is 9% for Laotians and 6% for Cambodians. Thus, the risk for hemoglobin E/{beta}{sup 26} thalassemia, a transfusion-dependent disorder, is increased in these two population groups. Denaturing gradient gel electrophoresis (DGGE) has proven to be useful in testing for beta-thalassemia carriers and identifying new mutations in the beta globin gene. DNA was extracted from venous blood obtained from patients withmore » elevated Hgb A2 (>4%). Five DNA fragments, encompassing the beta globin gene cluster, were amplified by PCR and analyzed, along with known beta gene mutations as controls, by DGGE using different denaturing gradient concentrations. Different mutations at the same nucleotide position can be distinguished by migration pattern on the DGGE (e.g., in IVS-I-1, G{r_arrow}A and T). Compound heterozygotes for {beta}-thalassemia can be detected on the same gel (e.g., HbE/mutation codon 17). New mutations are identified by their migration pattern compared with controls and determined by subsequent sequencing. We have identified three new mutations: codon 82 CAA{r_arrow}AAA in one Cambodian patient; IVS-II-667, T{r_arrow}C and IVS-II-672, A{r_arrow}C in two Laotian patients. When the parent`s genotypes are known, prenatal diagnosis can be obtained within 24 hours. Thus, PCR/DGGE combination is a rapid and reliable diagnostic approach to clinically significant {beta}-thalassemia. The most important steps are carefully designed primers and predetermined gradient concentrations for DGGE.« less

  11. Sickle cell disease caused by Hb S/Québec-CHORI: treatment with hydroxyurea and response.

    PubMed

    Tubman, Venée N; Bennett, Carolyn M; Luo, Hong-yuan; Chui, David H K; Heeney, Matthew M

    2007-08-01

    Sickle hemoglobin (Hb S;betaGlu 6 Val) is due to an A>T transversion in codon 6 of the beta-globin gene. Other variant hemoglobins mimic Hb A, S, or C on newborn screening and clinical laboratory diagnostic tools, thus making their correct identification potentially difficult. Sickling disorders can result in individuals who are compound heterozygous for beta-globin mutations (e.g., Hb SC, HbSO(Arab)). The authors report a second case of HbS/Québec-CHORI, a severe compound heterozygous sickling disorder and their experience managing this patient with hydroxyurea.

  12. Hb Alesha [beta67(E11)Val-->Met, GTG-->ATG] in an Argentinean girl.

    PubMed

    Eberle, Silvia Eandi; Noguera, Nélida I; Sciuccati, Gabriela; Bonduel, Mariana; Díaz, Lilian; Staciuk, Raquel; Targovnik, Héctor M; Feliu-Torres, Aurora

    2007-01-01

    Hb Alesha is caused by a GTG-->ATG mutation at codon 67 of the beta-globin gene, resulting in abnormal beta-globin chains in which the normal beta67(E11) valine is changed to methionine. This hemoglobin (Hb) is also known as Hb Bristol, the first unstable Hb described, since in a fraction of the variant the methionine is modified into an aspartic acid by a posttranslational modification. This replacement disrupts the apolar bonds between the valine and the heme group, producing an unstable Hb and severe hemolysis. We have identified this rare hemoglobinopathy in an Argentinean girl with severe hemolytic anemia, splenomegaly and frequent requirement for red blood cell transfusions.

  13. Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

    PubMed

    Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

    2015-07-01

    The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

  14. Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

    PubMed

    Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

    2017-12-30

    Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

  15. Gene Addition Strategies for β-Thalassemia and Sickle Cell Anemia.

    PubMed

    Dong, Alisa C; Rivella, Stefano

    2017-01-01

    Beta-thalassemia and sickle cell anemia are two of the most common diseases related to the hemoglobin protein. In these diseases, the beta-globin gene is mutated, causing severe anemia and ineffective erythropoiesis. Patients can additionally present with a number of life-threatening co-morbidities, such as stroke or spontaneous fractures. Current treatment involves transfusion and iron chelation; allogeneic bone marrow transplant is the only curative option, but is limited by the availability of matching donors and graft-versus-host disease. As these two diseases are monogenic diseases, they make an attractive setting for gene therapy. Gene therapy aims to correct the mutated beta-globin gene or add back a functional copy of beta- or gamma-globin. Initial gene therapy work was done with oncoretroviral vectors, but has since shifted to lentiviral vectors. Currently, there are a few clinical trials underway to test the curative potential of some of these lentiviral vectors. This review will highlight the work done thus far, and present the challenges still facing gene therapy, such as genome toxicity concerns and achieving sufficient transgene expression to cure those with the most severe forms of thalassemia.

  16. Human beta-globin mRNAs that harbor a nonsense codon are degraded in murine erythroid tissues to intermediates lacking regions of exon I or exons I and II that have a cap-like structure at the 5' termini.

    PubMed Central

    Lim, S K; Maquat, L E

    1992-01-01

    Previous studies have demonstrated that nonsense codons within beta zero-thalassemic or in vitro-mutagenized human beta-globin transgenes result in the production of mRNAs that are degraded abnormally rapidly in the cytoplasm of murine erythroid cells. As a consequence, three RNA degradative intermediates are formed that lack sequences from either exon I or exons I and II. We show here that the intermediates, like the full-length mRNA from which they derive and the endogenous murine beta maj-globin mRNA, bind to the anticap monoclonal antibody H-20 in a way that is competed by the cap analogue m7G and eliminated by prior exposure to tobacco acid pyrophosphatase. Furthermore, the intermediates, like the two full-length mRNAs, are resistant to a 5'----3' exonuclease activity isolated from HeLa cell nuclei that degrades uncapped but not capped ribopolymers. Based on these observations, the intermediates appear to possess a structure that is indistinguishable from the cap at the 5' end of mRNA, i.e. a methylated nucleoside that is linked to the RNA by a 5'-5' phosphodiester bond. Detection of the intermediates during murine development was concomitant with detection of full-length thalassemic mRNA. Intermediate production appears to be influenced by RNA structure as indicated by the products that derive from a beta zero-thalassemic beta-globin transgene harboring a structural alteration (a 4 bp deletion) that was larger than any of those previously studied. Images PMID:1324170

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Filon, D.; Oron, V.; Krichevski, S.

    The authors characterized nearly 500 [beta]-thalassemia genes from the Israeli population representing a variety of ethnic subgroups. They found 28 different mutations in the [beta]-globin gene, including three mutations ([beta][sup S], [beta][sup C], and [beta][sup O-Arab]) causing hemoglobinopathies. Marked genetic heterogeneity was observed in both the Arab (20 mutations) and Jewish (17 mutations) populations. On the other hand, two ethnic isolates - Druze and Samaritans - had a single mutation each. Fifteen of the [beta]-thalassemia alleles are Mediterranean in type, 5 originated in Kurdistan, 2 are of Indian origin, and 2 sporadic alleles came from Europe. Only one mutant allele-nonsensemore » codon 37-appears to be indigenous to Israel. While human habitation in Israel dates back to early prehistory, the present-day spectrum of [beta]-globin mutations can be largely explained by migration events that occurred in the past millennium. 26 refs., 2 figs., 3 tabs.« less

  18. Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

    PubMed Central

    Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina

    2018-01-01

    The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430

  19. Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

    PubMed Central

    Laimins, L; Holmgren-König, M; Khoury, G

    1986-01-01

    The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

  20. CD34+ cells from dental pulp stem cells with a ZFN-mediated and homology-driven repair-mediated locus-specific knock-in of an artificial β-globin gene.

    PubMed

    Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K

    2017-07-01

    In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.

  1. VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

    1994-09-01

    The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception ofmore » closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.« less

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thein, S.L.; Weatherall, D.J.; Sampietro, M.

    [open quotes]Heterocellular hereditary persistence of fetal hemoglobin[close quotes] (HPFH) is the term used to describe the genetically determined persistence of fetal hemoglobin (Hb F) production into adult life, in the absence of any related hematological disorder. Whereas some forms are caused by mutations in the [beta]-globin gene cluster on chromosome 11, others segregate independently. While the latter are of particular interest with respect to the regulation of globin gene switching, it has not been possible to determine their chromosomal location, mainly because their mode of inheritance is not clear, but also because several other factors are known to modify Hbmore » F production. The authors have examined a large Asian Indian pedigree which includes individuals with heterocellular HPFH associated with [beta]-thalassemia and/or [alpha]-thalassemia. Segregation analysis was conducted on the HPFH trait FC, defined to be the percentage of Hb F-containing cells (F-cells), using the class D regressive model. The results provide evidence for the presence of a major gene, dominant or codominant, which controls the FC values with residual familial correlations. The major gene was detected when the effects of genetic modifiers, notably [beta]-thalassemia and the XmnI-[sup G][gamma] polymorphism, are accounted for in this analysis. Linkage with the [beta]-globin gene cluster is excluded. The transmission of the FC values in this pedigree is informative enough to allow detection of linkage with an appropriate marker(s). The analytical approach outlined in this study, using simple regression to allow for genetic modifiers and thus allowing the mode of inheritance of a trait to be dissected out, may be useful as a model for segregation and linkage analyses of other complex phenotypes. 39 refs., 4 figs., 6 tabs.« less

  3. Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study

    PubMed Central

    Boonyawat, Boonchai; Monsereenusorn, Chalinee; Traivaree, Chanchai

    2014-01-01

    Background Beta-thalassemia is one of the most common genetic disorders in Thailand. Clinical phenotype ranges from silent carrier to clinically manifested conditions including severe beta-thalassemia major and mild beta-thalassemia intermedia. Objective This study aimed to characterize the spectrum of beta-globin gene mutations in pediatric patients who were followed-up in Phramongkutklao Hospital. Patients and methods Eighty unrelated beta-thalassemia patients were enrolled in this study including 57 with beta-thalassemia/hemoglobin E, eight with homozygous beta-thalassemia, and 15 with heterozygous beta-thalassemia. Mutation analysis was performed by multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene, and gap polymerase chain reaction for 3.4 kb deletion detection, respectively. Results A total of 13 different beta-thalassemia mutations were identified among 88 alleles. The most common mutation was codon 41/42 (-TCTT) (37.5%), followed by codon 17 (A>T) (26.1%), IVS-I-5 (G>C) (8%), IVS-II-654 (C>T) (6.8%), IVS-I-1 (G>T) (4.5%), and codon 71/72 (+A) (2.3%), and all these six common mutations (85.2%) were detected by M-ARMS. Six uncommon mutations (10.2%) were identified by DNA sequencing including 4.5% for codon 35 (C>A) and 1.1% initiation codon mutation (ATG>AGG), codon 15 (G>A), codon 19 (A>G), codon 27/28 (+C), and codon 123/124/125 (-ACCCCACC), respectively. The 3.4 kb deletion was detected at 4.5%. The most common genotype of beta-thalassemia major patients was codon 41/42 (-TCTT)/codon 26 (G>A) or betaE accounting for 40%. Conclusion All of the beta-thalassemia alleles have been characterized by a combination of techniques including M-ARMS, DNA sequencing, and gap polymerase chain reaction for 3.4 kb deletion detection. Thirteen mutations account for 100% of the beta-thalassemia genes among the pediatric patients in our study. PMID:25525381

  4. LDB1-mediated enhancer looping can be established independent of mediator and cohesin.

    PubMed

    Krivega, Ivan; Dean, Ann

    2017-08-21

    Mechanistic studies in erythroid cells indicate that LDB1, as part of a GATA1/TAL1/LMO2 complex, brings erythroid-expressed genes into proximity with enhancers for transcription activation. The role of co-activators in establishing this long-range interaction is poorly understood. Here we tested the contributions of the RNA Pol II pre-initiation complex (PIC), mediator and cohesin to establishment of locus control region (LCR)/β-globin proximity. CRISPR/Cas9 editing of the β-globin promoter to eliminate the RNA Pol II PIC by deleting the TATA-box resulted in loss of transcription, but enhancer-promoter interaction was unaffected. Additional deletion of the promoter GATA1 site eliminated LDB1 complex and mediator occupancy and resulted in loss of LCR/β-globin proximity. To separate the roles of LDB1 and mediator in LCR looping, we expressed a looping-competent but transcription-activation deficient form of LDB1 in LDB1 knock down cells: LCR/β-globin proximity was restored without mediator core occupancy. Further, Cas9-directed tethering of mutant LDB1 to the β-globin promoter forced LCR loop formation in the absence of mediator or cohesin occupancy. Moreover, ENCODE data and our chromatin immunoprecipitation results indicate that cohesin is almost completely absent from validated and predicted LDB1-regulated erythroid enhancer-gene pairs. Thus, lineage specific factors largely mediate enhancer-promoter looping in erythroid cells independent of mediator and cohesin. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  5. Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

    PubMed

    Kim, Yea Woon; Kim, AeRi

    2017-07-20

    Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

  6. Pathophysiology and Clinical Manifestations of the β-Thalassemias

    PubMed Central

    Nienhuis, Arthur W.; Nathan, David G.

    2012-01-01

    The β-thalassemia syndromes reflect deficient or absent β-globin synthesis usually owing to a mutation in the β-globin locus. The relative excess of α-globin results in the formation of insoluble aggregates leading to ineffective erythropoiesis and shortened red cell survival. A relatively high capacity for fetal hemoglobin synthesis is a major genetic modifier of disease severity, with polymorphisms in other genes also having a significant role. Iron overload secondary to enhanced absorption and red cell transfusions causes an increase in liver iron and in various other tissues, leading to endocrine and cardiac dysfunction. Modern chelation regimens are effective in removing iron and preserving or restoring organ function. PMID:23209183

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Popp, R.A.; Marsh, C.L.; Skow, L.C.

    Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous ..cap alpha..-thalassemic embryos, expression of EI (x/sub 2/y/sub 2/) and EII (..cap alpha../sub 2/y/sub 2/) is deficient because the x- and ..cap alpha..-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- andmore » ..cap alpha..-globin genes indicates that these genes must be closely linked. Reduced x- and ..cap alpha..-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y/sub 4/ hemoglobin also appears in ..beta..-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and ..beta..-globin genes. In double heterozygotes, which have a single functional allele of x- and ..cap alpha..-globin genes and three functional alleles of y- and ..beta..-globin genes, synthesis of ..cap alpha.. and non-..cap alpha.. chains is severely imbalanced and half of the total hemoglobin is y/sub 4/. Mouse y/sub 4/ has a high affinity for oxygen, P/sub 50/ of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues.« less

  8. Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.

    PubMed

    Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P

    2009-12-01

    Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.

  9. Heterozygous Hb Hope [beta136(H14)Gly --> Asp] in association with heterozygous beta0-thalassemia with apparent homozygous expression, in a Spanish patient.

    PubMed

    Beneitez, David; Carrera, Alícia; Duran-Suárez, Joan Ramón; Paz, Victoria; León, Antonio; García Talavera, Juan

    2006-01-01

    Hb Hope [beta136(H14)Gly --> Asp (GGT --> GAT)] has been found alone or in combination with other globin gene mutations in several African-American families, as well as in Japanese, Thai, Laotian, Cuban and Mauritanian families. We report the hematological and molecular characteristics of a heterozygous association of Hb Hope with beta0-thalassemia (thal) in a Spanish patient, in whom the level of expression of abnormal hemoglobin (Hb) by cation exchange high performance liquid chromatography (HPLC) and electrophoresis suggested initially a homozygous expression of the abnormal Hb, although sequencing of the polymerase chain reaction (PCR)-amplified beta-globin gene demonstrated a heterozygous genotype for Hb Hope. To the best of our knowledge, this is the first description of a case of Hb Hope in a Spanish family.

  10. Novel Inducers of Fetal Globin Identified through High Throughput Screening (HTS) Are Active In Vivo in Anemic Baboons and Transgenic Mice.

    PubMed

    Boosalis, Michael S; Sangerman, Jose I; White, Gary L; Wolf, Roman F; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H; Li, Biaoru; Pace, Betty S; Nouraie, Mehdi; Faller, Douglas V; Perrine, Susan P

    2015-01-01

    High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies.

  11. Stabilization and cytoskeletal-association of LDL receptor mRNA are mediated by distinct domains in its 3' untranslated region.

    PubMed

    Wilson, G M; Vasa, M Z; Deeley, R G

    1998-05-01

    The mRNA encoding the human low density lipoprotein (LDL) receptor is transiently stabilized after phorbol ester treatment of HepG2 cells and has been shown to associate with components of the cytoskeleton in this cell line (G. M. Wilson, E. A. Roberts, and R. G. Deeley, J. Lipid Res. 1997. 38: 437-446). Using an episomal expression system, fragments of the 3' untranslated region (3'UTR) of LDL receptor mRNA were transcribed in fusion with the coding region of beta-globin mRNA in HepG2 cells. Analyses of the decay kinetics of these beta-globin-LDL receptor fusion mRNA deletion mutants showed that sequences in the proximal 3'UTR of LDL receptor mRNA including several AU-rich elements (AREs) were sufficient to confer short constitutive mRNA half-life in the heterologous system. Stabilization of LDL receptor mRNA in the presence of PMA required sequences in the distal 3'UTR, at or near three Alu-like repetitive elements. Furthermore, the 3'UTR of LDL receptor mRNA conferred cytoskeletal association on the otherwise unassociated beta-globin mRNA, by a mechanism involving at least two distinct RNA elements. Comparisons of decay kinetics and subcellular localization of endogenous LDL receptor mRNA and beta-globin-LDL receptor mRNA fusions in HepG2 cells have demonstrated that several cis-acting elements in the receptor 3'UTR contribute to post-transcriptional regulation of receptor expression, and provide further support for involvement of the cytoskeleton in the regulation of LDL receptor mRNA turnover.

  12. Interaction of Hb South Florida (codon 1; GTG-->ATG) and HbE, with beta-thalassemia (IVS1-1; G-->A): expression of different clinical phenotypes.

    PubMed

    Tan, Jin-Ai Mary Anne; Tan, Kim-Lian; Omar, Khairul Zaman; Chan, Lee-Lee; Wee, Yong-Chui; George, Elizabeth

    2009-09-01

    Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A). HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia. Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA. The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.

  13. Fever of unclear origin and cytopenia because of acute splenic sequestration in a young immunocompetent carrier of beta-globin mutation for Hb Valletta.

    PubMed

    Parrinello, Gaspare; Torres, Daniele; Paterna, Salvatore; Di Pasquale, Pietro; Licata, Giuseppe

    2008-12-01

    Fever of unclear origin is a clinical challenge in medical practice. Infectious diseases, neoplasms, and collagen vascular illnesses are its main causes in adults and children. Acute splenic sequestration crises, a known potentially fatal complication of sickle cell disease and sickle beta-thalassemia, are uncommon in beta-heterozygosis. We describe a case of prolonged recurrent episodes of fever with spontaneous resolution, commencing at age 10 in a 15-year-old boy with a history of hypochromic microcytic anemia attributed to a thalassemic trait. He was admitted twice to our university hospital for continuous-remittent fever with a pruritic, macular evanescent Still's skin rash, severe splenomegaly, leucopenia, thrombocytopenia, and sudden aggravation of anemia. Infectious, rheumatologic, autoimmune, and hematologic illnesses were excluded. A genetic-based study revealed heterozygosis of the beta-globin gene for a A>C (Thr>Pro) substitution at position 87 called Hemoglobin Valletta (alpha 2 beta 2 87 PRO) with a C>G transition in homozygosis in beta-globin intronic polymorphism intervening sequence 2 at nucleotide 745. After a follow-up period of 1 year without treatment, the young patient remains apyretic and in good general clinical health with persistent microcythemia and hepatosplenomegaly. Acute splenic sequestration crisis and related cytopenia may be an unusual complication of fever of unclear origin in a beta-thalassemic carrier of a Hemoglobin Valletta mutation and polymorphism in homozygosis of intervening sequence 2 at nucleotide 745. This hemoglobinopathy may predispose to a clinical phenotype of minor or intermediate thalassemia and, during a febrile illness, to hemoglobin instability and splenic sequestration.

  14. Production of Gene-Corrected Adult Beta Globin Protein in Human Erythrocytes Differentiated from Patient iPSCs After Genome Editing of the Sickle Point Mutation.

    PubMed

    Huang, Xiaosong; Wang, Ying; Yan, Wei; Smith, Cory; Ye, Zhaohui; Wang, Jing; Gao, Yongxing; Mendelsohn, Laurel; Cheng, Linzhao

    2015-05-01

    Human induced pluripotent stem cells (iPSCs) and genome editing provide a precise way to generate gene-corrected cells for disease modeling and cell therapies. Human iPSCs generated from sickle cell disease (SCD) patients have a homozygous missense point mutation in the HBB gene encoding adult β-globin proteins, and are used as a model system to improve strategies of human gene therapy. We demonstrate that the CRISPR/Cas9 system designer nuclease is much more efficient in stimulating gene targeting of the endogenous HBB locus near the SCD point mutation in human iPSCs than zinc finger nucleases and TALENs. Using a specific guide RNA and Cas9, we readily corrected one allele of the SCD HBB gene in human iPSCs by homologous recombination with a donor DNA template containing the wild-type HBB DNA and a selection cassette that was subsequently removed to avoid possible interference of HBB transcription and translation. We chose targeted iPSC clones that have one corrected and one disrupted SCD allele for erythroid differentiation assays, using an improved xeno-free and feeder-free culture condition we recently established. Erythrocytes from either the corrected or its parental (uncorrected) iPSC line were generated with similar efficiencies. Currently ∼6%-10% of these differentiated erythrocytes indeed lacked nuclei, characteristic of further matured erythrocytes called reticulocytes. We also detected the 16-kDa β-globin protein expressed from the corrected HBB allele in the erythrocytes differentiated from genome-edited iPSCs. Our results represent a significant step toward the clinical applications of genome editing using patient-derived iPSCs to generate disease-free cells for cell and gene therapies. Stem Cells 2015;33:1470-1479. © 2015 AlphaMed Press.

  15. Genome-wide association study of red blood cell traits in Hispanics/Latinos: The Hispanic Community Health Study/Study of Latinos

    PubMed Central

    Morrison, Jean V.; Brown, Lisa; Schurmann, Claudia; Chen, Diane D.; Liu, Yong Mei; Auer, Paul L.; Taylor, Kent D.; Papanicolaou, George; Kurita, Ryo; Nakamura, Yukio; Loos, Ruth J. F.; North, Kari E.; Thornton, Timothy A.; Pankratz, Nathan; Bauer, Daniel E.

    2017-01-01

    Prior GWAS have identified loci associated with red blood cell (RBC) traits in populations of European, African, and Asian ancestry. These studies have not included individuals with an Amerindian ancestral background, such as Hispanics/Latinos, nor evaluated the full spectrum of genomic variation beyond single nucleotide variants. Using a custom genotyping array enriched for Amerindian ancestral content and 1000 Genomes imputation, we performed GWAS in 12,502 participants of Hispanic Community Health Study and Study of Latinos (HCHS/SOL) for hematocrit, hemoglobin, RBC count, RBC distribution width (RDW), and RBC indices. Approximately 60% of previously reported RBC trait loci generalized to HCHS/SOL Hispanics/Latinos, including African ancestral alpha- and beta-globin gene variants. In addition to the known 3.8kb alpha-globin copy number variant, we identified an Amerindian ancestral association in an alpha-globin regulatory region on chromosome 16p13.3 for mean corpuscular volume and mean corpuscular hemoglobin. We also discovered and replicated three genome-wide significant variants in previously unreported loci for RDW (SLC12A2 rs17764730, PSMB5 rs941718), and hematocrit (PROX1 rs3754140). Among the proxy variants at the SLC12A2 locus we identified rs3812049, located in a bi-directional promoter between SLC12A2 (which encodes a red cell membrane ion-transport protein) and an upstream anti-sense long-noncoding RNA, LINC01184, as the likely causal variant. We further demonstrate that disruption of the regulatory element harboring rs3812049 affects transcription of SLC12A2 and LINC01184 in human erythroid progenitor cells. Together, these results reinforce the importance of genetic study of diverse ancestral populations, in particular Hispanics/Latinos. PMID:28453575

  16. Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations.

    PubMed

    Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

    2007-08-10

    The sickle (betas) mutation in the beta-globin gene (HBB) occurs on five "classical" betas haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the betas allele - a consequence of protection from severe malarial infection afforded by heterozygotes - has been associated with a high degree of extended haplotype similarity. The relationship between classical betas haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical betas haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). The most common betas sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the betas mutation. Two different classical betas haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of betas haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle cell disease, could lie considerable distances away from beta-globin.

  17. Pathophysiologically based drug treatment of sickle cell disease.

    PubMed

    Steinberg, Martin H

    2006-04-01

    Sickle cell disease is a systemic disorder that is caused by a mutation (Glu6Val) in the gene that encodes beta globin. The sickle hemoglobin molecule (HbS) is a tetramer of two alpha-globin chains and two sickle beta-globin chains, and has the tendency to polymerize when deoxygenated. HbS facilitates abnormal interactions between the sickle erythrocyte and leukocytes and endothelial cells, which trigger a complex pathobiology. This multifaceted pathophysiology provides the opportunity to interrupt the disease at multiple sites, including polymerization of HbS, erythrocyte density and cell-cell interactions. For example, it is possible to induce higher concentrations of fetal hemoglobin, which disrupts the pathology-initiating step of HbS polymerization. Furthermore, it is possible to improve the hydration of sickle erythrocytes and it might be feasible to counteract the endothelial, inflammatory and oxidative abnormalities of sickle cell disease. A therapeutic approach that targets several sites of pathobiology might be most promising.

  18. Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

    PubMed

    Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

    2017-07-11

    In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing topologically associating domain.

  19. Novel Inducers of Fetal Globin Identified through High Throughput Screening (HTS) Are Active In Vivo in Anemic Baboons and Transgenic Mice

    PubMed Central

    Boosalis, Michael S.; Sangerman, Jose I.; White, Gary L.; Wolf, Roman F.; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H.; Li, Biaoru; Pace, Betty S.; Nouraie, Mehdi; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies. PMID:26713848

  20. Genetic therapy for beta-thalassemia: from the bench to the bedside.

    PubMed

    Arumugam, Paritha; Malik, Punam

    2010-01-01

    Beta-thalassemia is a genetic disorder with mutations in the β-globin gene that reduce or abolish β-globin protein production. Patients with β-thalassemia major (Cooley's anemia) become severely anemic by 6 to 18 months of age, and are transfusion dependent for life, while those with thalassemia intermedia, a less-severe form of thalassemia, are intermittently or rarely transfused. An allogeneically matched bone marrow transplant is curative, although it is restricted to those with matched donors. Gene therapy holds the promise of "fixing" one's own bone marrow cells by transferring the normal β-globin or γ-globin gene into hematopoietic stem cells (HSCs) to permanently produce normal red blood cells. Requirements for effective gene transfer for the treatment of β-thalassemia are regulated, erythroid-specific, consistent, and high-level β-globin or γ-globin expression. Gamma retroviral vectors have had great success with immune-deficiency disorders, but due to vector-associated limitations, they have limited utility in hemoglobinopathies. Lentivirus vectors, on the other hand, have now been shown in several studies to correct mouse and animal models of thalassemia. The immediate challenges of the field as it moves toward clinical trials are to optimize gene transfer and engraftment of a high proportion of genetically modified HSCs and to minimize the adverse consequences that can result from random integration of vectors into the genome by improving current vector design or developing novel vectors. This article discusses the current state of the art in gene therapy for β-thalassemia and some of the challenges it faces in human trials.

  1. Individual specific DNA fingerprints from a hypervariable region probe: alpha-globin 3'HVR.

    PubMed

    Fowler, S J; Gill, P; Werrett, D J; Higgs, D R

    1988-06-01

    A probe detecting a hypervariable region (HVR) 3' to the alpha globin locus on chromosome 16 has been used to produce DNA fingerprints. Segregation analysis has revealed multiple, randomly dispersed DNA fragments inherited in a Mendelian fashion with minimal allelism and linkage. The fingerprints are highly polymorphic (probability of chance association between random individuals much less than 10(-14]. The probe is, therefore, a powerful discriminating tool: it is envisaged that this probe will have forensic applications, including paternity cases, and will be informative in linkage analysis.

  2. The Role of CREB in CML

    DTIC Science & Technology

    2008-02-01

    Feng YQ et al. Anti-beta s- ribozyme reduces beta s mRNA levels in transgenic mice: Potential application to the gene therapy of sickle cell anemia... ribozymes . RNA 2003;9:1254–1263. 13 Pace BS, Qian X, Ofori-Acquah SF. Selective inhibition of beta-globin RNA transcripts by antisense RNA molecules. Cell

  3. The New Self-Inactivating Lentiviral Vector for Thalassemia Gene Therapy Combining Two HPFH Activating Elements Corrects Human Thalassemic Hematopoietic Stem Cells

    PubMed Central

    Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios

    2012-01-01

    Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313

  4. High-resolution melting analysis for prenatal diagnosis of beta-thalassemia in northern Thailand.

    PubMed

    Charoenkwan, Pimlak; Sirichotiyakul, Supatra; Phusua, Arunee; Suanta, Sudjai; Fanhchaksai, Kanda; Sae-Tung, Rattika; Sanguansermsri, Torpong

    2017-12-01

    High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.

  5. Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.

    PubMed

    Guerreiro, J F; Figueiredo, M S; Zago, M A

    1994-01-01

    We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.

  6. Association between Oxidative Stress, Genetic Factors, and Clinical Severity in Children with Sickle Cell Anemia.

    PubMed

    Renoux, Céline; Joly, Philippe; Faes, Camille; Mury, Pauline; Eglenen, Buse; Turkay, Mine; Yavas, Gokce; Yalcin, Ozlem; Bertrand, Yves; Garnier, Nathalie; Cuzzubbo, Daniela; Gauthier, Alexandra; Romana, Marc; Möckesch, Berenike; Cannas, Giovanna; Antoine-Jonville, Sophie; Pialoux, Vincent; Connes, Philippe

    2018-04-01

    To investigate the associations between several sickle cell disease genetic modifiers (beta-globin haplotypes, alpha-thalassemia, and glucose-6-phosphate dehydrogenase deficiency) and the level of oxidative stress and to evaluate the association between oxidative stress and the rates of vaso-occlusive events. Steady-state oxidative and nitrosative stress markers, biological variables, genetic modulators, and vaso-occlusive crisis events requiring emergency admissions were measured during a 2-year period in 62 children with sickle cell anemia (58 SS and 4 Sβ 0 ). Twelve ethnic-matched children without sickle cell anemia also participated as healthy controls (AA) for oxidative and nitrosative stress level measurement. Oxidative and nitrosative stress were greater in patients with sickle cell anemia compared with control patients, but the rate of vaso-occlusive crisis events in sickle cell anemia was not associated with the level of oxidative stress. The presence of alpha-thalassemia, but not glucose-6-phosphate dehydrogenase deficiency or beta-globin haplotype, modulated the level of oxidative stress in children with sickle cell anemia. Mild hemolysis in children with alpha-thalassemia may limit oxidative stress and could explain the protective role of alpha-thalassemia in hemolysis-related sickle cell complications. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Compound heterozygosity for Hb S [beta6(A3)GluVal, GAG-->GTG] and a new thalassemic mutation [beta132(H10)Lys-->term, AAA-->TAA] detected in a family from West Africa.

    PubMed

    Frischknecht, Hannes; Troxler, Heinz; Greiner, Jeanette; Hengartner, Heinz; Dutly, Fabrizio

    2008-01-01

    We describe a Hb S/beta-thalassemia (beta-thal) mutation involving an AT transition at codon 132 of the beta-globin gene. The mutation, in the heterozygous state, unlike several other mutations in exon 3, shows no signs of dominant thalassemia but those of a typical beta(0) carrier. Compound heterozygosity with Hb S [beta6(A3)GluVal, GAGGTG] showed a severe clinical picture.

  8. Alternative options for DNA-based experimental therapy of β-thalassemia.

    PubMed

    Gambari, Roberto

    2012-04-01

    Beta-thalassemias are caused by more than 200 mutations of the β-globin gene, leading to low or absent production of adult hemoglobin. Achievements have been made with innovative therapeutic strategies for β-thalassemias, based on research conducted at the levels of gene structure, transcription, mRNA processing and protein synthesis. The objective of this review is to describe the development of therapeutic strategies employing viral and non-viral DNA-based approaches for treatment of β-thalassemia. Modification of β-globin gene expression in β-thalassemia cells has been achieved by gene therapy, correction of the mutated β-globin gene and RNA repair. In addition, cellular therapy has been proposed for β-thalassemia, including reprogramming of somatic cells to generate induced pluripotent stem cells to be genetically corrected. Based on the concept that increased production of fetal hemoglobin (HbF) is beneficial in β-thalassemia, DNA-based approaches to increase HbF production have been optimized, including treatment of target cells with lentiviral vectors carrying γ-globin genes. Finally, DNA-based targeting of α-globin gene expression has been applied to reduce the excess of α-globin production by β-thalassemia cells, one of the major causes of the clinical phenotype.

  9. Alpha-globin gene haplotypes in South American Indians.

    PubMed

    Zago, M A; Melo Santos, E J; Clegg, J B; Guerreiro, J F; Martinson, J J; Norwich, J; Figueiredo, M S

    1995-08-01

    The haplotypes of the alpha-globin gene cluster were determined for 99 Indians from the Brazilian Amazon region who belong to 5 tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Three predominant haplotypes were identified: Ia (present in 38.9% of chromosomes), IIIa (25.8%), and IIe (22.1%). The only alpha-globin gene rearrangement detected was alpha alpha alpha 3.7 I gene triplication associated with haplotype IIIa, found in high frequencies (5.6% and 10.6%) in two tribes and absent in the others. alpha-Globin gene deletions that cause alpha-thalassemia were not seen, supporting the argument that malaria was absent in these populations until recently. The heterogeneous distribution of alpha-globin gene haplotypes and rearrangements among the different tribes differs markedly from the homogeneous distribution of beta-globin gene cluster haplotypes and reflects the action of various genetic mechanisms (genetic drift, founder effect, consanguinity) on small isolated population groups with a complicated history of divergence-fusion events. The alpha-globin gene haplotype distribution has some similarities to distributions observed in Southeast Asian and Pacific Island populations, indicating that these populations have considerable genetic affinities. However, the absence of several features of the alpha-globin gene cluster that are consistently present among the Pacific Islanders suggests that the similarity of haplotypes between Brazilian Indians and people from Polynesia, Micronesia, and Melanesia is more likely to result of ancient common ancestry rather than the consequence of recent direct genetic contribution through immigration.

  10. Association in Long-Evans hooded rats of red cell 2,3-diphosphoglycerate levels with hemoglobin types.

    PubMed

    Brewer, G; Gilman, J; Noble, N; Crews, V

    1978-08-01

    Two sublines of commercially available Long-Evans hooded rats have been developed by genetic selection. These sublines have widely differing levels of erythrocyte 2,3-diphosphoglycerate (DPG) due to different alleles at a single genetic locus. In the present work, it is shown that rats from the commercial population are also polymorphic at a hemoglobin locus, probably involving two alleles of the IIIbeta-globin chain locus. Particular hemoglobin types have been found to be strongly associated with certain DPG types, not only in the high-DPG and low-DPG lines but also in the commercial population. Two explanations for this association are considered. One is a single-locus hypothesis, with hemoglobin allelic variation causing DPG variation, and the other is a two-locus hypothesis, with marked linkage disequilibrium.

  11. [Perissodactyla: the primary structure of hemoglobins from the lowland tapir (Tapirus terrestris): glutamic acid in position 2 of the beta chains].

    PubMed

    Mazur, G; Braunitzer, G

    1984-09-01

    The hemoglobins from a lowland tapir (Tapirus terrestris) were analysed and the complete primary structure is described. The globin chains were separated on CM cellulose column in 8M urea and the amino-acid sequences were determined in the liquid phase sequenator. The results show that globin consists of two alpha chains (alpha I and alpha II) and beta major and beta minor components. The alpha chains differ only at one position: alpha I contains aspartic acid and alpha II glycine. The beta chains are heterogeneous: aspartic and glutamic acid were found at position beta 21 and beta 73 of the beta major components and asparagine and serine at position beta 139. In the beta minor components four positions were found with more than one amino acid, namely beta 2, beta 4, beta 6 and beta 56. The sequences are compared with those of man, horse and rhinoceros. Four residues of horse methemoglobin, which are involved in the alpha 1 beta 1 contacts are substituted in tapir hemoglobins. In the alpha chains: alpha 107(G14)Ser----Val, alpha 111-(G18) Val----Leu, alpha 115(GH3) Asn----Asp or Gly; in the beta chains: beta 116(G18) Arg----Gln. The amino acid at beta 2 of the major components is glutamic acid while glutamine and histidine are found in the minor components. Although glutamic acid, a binding site for ATP, does not interact with 2,3-bisphosphoglycerate, glutamine and histidine in the minor components are responsible for the slight effect of 2,3-bisphosphoglycerate on tapir hemoglobin.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thein, S.L.; Hesketh, C.; Wood, W.G.

    Analysis of the molecular basis of dominantly inherited {beta}-thalassemia in four families has revealed different mutations involving exon 3 of the {beta}-globin gene. It is suggested that the phenotypic difference between this condition and the more common recessive forms of {beta}-thalassemia lies mainly in the length and stability of the abnormal translation products that are synthesized and, in particular, whether they are capable of binding heme and producing aggregations that are relatively resistant to proteolytic degradation.

  13. Comparative inhibition of rabbit globin mRNA translation by modified antisense oligodeoxynucleotides.

    PubMed Central

    Cazenave, C; Stein, C A; Loreau, N; Thuong, N T; Neckers, L M; Subasinghe, C; Hélène, C; Cohen, J S; Toulmé, J J

    1989-01-01

    We have studied the translation of rabbit globin mRNA in cell free systems (reticulocyte lysate and wheat germ extract) and in microinjected Xenopus oocytes in the presence of anti-sense oligodeoxynucleotides. Results obtained with the unmodified all-oxygen compounds were compared with those obtained when phosphorothioate or alpha-DNA was used. In the wheat germ system a 17-mer sequence targeted to the coding region of beta-globin mRNA was specifically inhibitory when either the unmodified phosphodiester oligonucleotide or its phosphorothioate analogue were used. In contrast no effect was observed with the alpha-oligomer. These results were ascribed to the fact that phosphorothioate oligomers elicit an RNase-H activity comparable to the all-oxygen congeners, while alpha-DNA/mRNA hybrids were a poor substrate. Microinjected Xenopus oocytes followed a similar pattern. The phosphorothioate oligomer was more efficient to prevent translation than the unmodified 17-mer. Inhibition of beta-globin synthesis was observed in the nanomolar concentration range. This result can be ascribed to the nuclease resistance of phosphorothioates as compared to natural phosphodiester linkages, alpha-oligomers were devoid of any inhibitory effect up to 30 microM. Phosphorothioate oligodeoxyribonucleotides were shown to be non-specific inhibitors of protein translation, at concentrations in the micromolar range, in both cell-free systems and oocytes. Non-specific inhibition of translation was dependent on the length of the phosphorothioate oligomer. These non-specific effects were not observed with the unmodified or the alpha-oligonucleotides. Images PMID:2472605

  14. HbVar: A relational database of human hemoglobin variants and thalassemia mutations at the globin gene server.

    PubMed

    Hardison, Ross C; Chui, David H K; Giardine, Belinda; Riemer, Cathy; Patrinos, George P; Anagnou, Nicholas; Miller, Webb; Wajcman, Henri

    2002-03-01

    We have constructed a relational database of hemoglobin variants and thalassemia mutations, called HbVar, which can be accessed on the web at http://globin.cse.psu.edu. Extensive information is recorded for each variant and mutation, including a description of the variant and associated pathology, hematology, electrophoretic mobility, methods of isolation, stability information, ethnic occurrence, structure studies, functional studies, and references. The initial information was derived from books by Dr. Titus Huisman and colleagues [Huisman et al., 1996, 1997, 1998]. The current database is updated regularly with the addition of new data and corrections to previous data. Queries can be formulated based on fields in the database. Tables of common categories of variants, such as all those involving the alpha1-globin gene (HBA1) or all those that result in high oxygen affinity, are maintained by automated queries on the database. Users can formulate more precise queries, such as identifying "all beta-globin variants associated with instability and found in Scottish populations." This new database should be useful for clinical diagnosis as well as in fundamental studies of hemoglobin biochemistry, globin gene regulation, and human sequence variation at these loci. Copyright 2002 Wiley-Liss, Inc.

  15. Successful application of preimplantation genetic diagnosis for beta-thalassaemia and sickle cell anaemia in Italy.

    PubMed

    Chamayou, S; Alecci, C; Ragolia, C; Giambona, A; Siciliano, S; Maggio, A; Fichera, M; Guglielmino, A

    2002-05-01

    In Italy, the autosomal recessive diseases beta-thalassaemia and sickle cell anaemia are so widespread that in some regions they can be defined as 'social diseases'. In this study, nine clinical applications of preimplantation genetic diagnosis (PGD) were performed for beta-thalassaemia and sickle cell anaemia on seven Sicilian couples and carriers of beta-globin gene mutations. The studied mutations were: Cd39, HbS, IVS1 nt1, IVS1 nt6 and IVS1 nt110. ICSI was performed with partner's sperm on 131 out of 147 retrieved oocytes, and this resulted in 72 zygotes; 32 embryos were successfully biopsied on day 3. The biopsied blastomeres were lysed and the beta-globin alleles amplified by nested PCR. The mutation diagnosis was performed by restriction enzyme digestion and reverse dot-blot. The amplification efficacy was 97.2%. The genotype study of non-transferred and surplus embryos showed that the allele drop-out rate was 8.6%. Seventeen embryos were transferred in utero on day 4. All couples received an embryo transfer; of the four pregnancies obtained, three resulted in live births and one miscarried at 11 weeks. Prenatal diagnosis at the 11th week and miscarriage material analysis confirmed the PGD results. These studies represent the first successful application of PGD for beta-thalassaemia and sickle cell anaemia in Italy.

  16. A genome-editing strategy to treat β-hemoglobinopathies that recapitulates a mutation associated with a benign genetic condition.

    PubMed

    Traxler, Elizabeth A; Yao, Yu; Wang, Yong-Dong; Woodard, Kaitly J; Kurita, Ryo; Nakamura, Yukio; Hughes, Jim R; Hardison, Ross C; Blobel, Gerd A; Li, Chunliang; Weiss, Mitchell J

    2016-09-01

    Disorders resulting from mutations in the hemoglobin subunit beta gene (HBB; which encodes β-globin), mainly sickle cell disease (SCD) and β-thalassemia, become symptomatic postnatally as fetal γ-globin expression from two paralogous genes, hemoglobin subunit gamma 1 (HBG1) and HBG2, decreases and adult β-globin expression increases, thereby shifting red blood cell (RBC) hemoglobin from the fetal (referred to as HbF or α2γ2) to adult (referred to as HbA or α2β2) form. These disorders are alleviated when postnatal expression of fetal γ-globin is maintained. For example, in hereditary persistence of fetal hemoglobin (HPFH), a benign genetic condition, mutations attenuate γ-globin-to-β-globin switching, causing high-level HbF expression throughout life. Co-inheritance of HPFH with β-thalassemia- or SCD-associated gene mutations alleviates their clinical manifestations. Here we performed CRISPR-Cas9-mediated genome editing of human blood progenitors to mutate a 13-nt sequence that is present in the promoters of the HBG1 and HBG2 genes, thereby recapitulating a naturally occurring HPFH-associated mutation. Edited progenitors produced RBCs with increased HbF levels that were sufficient to inhibit the pathological hypoxia-induced RBC morphology found in SCD. Our findings identify a potential DNA target for genome-editing-mediated therapy of β-hemoglobinopathies.

  17. Hemoglobin genetics: recent contributions of GWAS and gene editing

    PubMed Central

    Smith, Elenoe C.; Orkin, Stuart H.

    2016-01-01

    The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226

  18. Altitudinal Variation at Duplicated β-Globin Genes in Deer Mice: Effects of Selection, Recombination, and Gene Conversion

    PubMed Central

    Storz, Jay F.; Natarajan, Chandrasekhar; Cheviron, Zachary A.; Hoffmann, Federico G.; Kelly, John K.

    2012-01-01

    Spatially varying selection on a given polymorphism is expected to produce a localized peak in the between-population component of nucleotide diversity, and theory suggests that the chromosomal extent of elevated differentiation may be enhanced in cases where tandemly linked genes contribute to fitness variation. An intriguing example is provided by the tandemly duplicated β-globin genes of deer mice (Peromyscus maniculatus), which contribute to adaptive differentiation in blood–oxygen affinity between high- and low-altitude populations. Remarkably, the two β-globin genes segregate the same pair of functionally distinct alleles due to a history of interparalog gene conversion and alleles of the same functional type are in perfect coupling-phase linkage disequilibrium (LD). Here we report a multilocus analysis of nucleotide polymorphism and LD in highland and lowland mice with different genetic backgrounds at the β-globin genes. The analysis of haplotype structure revealed a paradoxical pattern whereby perfect LD between the two β-globin paralogs (which are separated by 16.2 kb) is maintained in spite of the fact that LD within both paralogs decays to background levels over physical distances of less than 1 kb. The survey of nucleotide polymorphism revealed that elevated levels of altitudinal differentiation at each of the β-globin genes drop away quite rapidly in the external flanking regions (upstream of the 5′ paralog and downstream of the 3′ paralog), but the level of differentiation remains unexpectedly high across the intergenic region. Observed patterns of diversity and haplotype structure are difficult to reconcile with expectations of a two-locus selection model with multiplicative fitness. PMID:22042573

  19. Genetics Home Reference: methemoglobinemia, beta-globin type

    MedlinePlus

    ... American Society of Hematology Resource List from the University of Kansas Medical Center: ... Melarkode K, Prinzhausen H. Hemoglobin M variant and congenital methemoglobinemia: methylene blue will not be effective in the presence of hemoglobin M. Can J ...

  20. Adipocytokine concentrations in children with different types of beta-thalassemia.

    PubMed

    Enli, Yaşar; Balci, Yasemin I; Gönen, Cafer; Uzun, Ebru; Polat, Aziz

    2014-06-01

    Beta-thalassemia is an inherited blood disorder. It results from the impaired production of β-globin chains, leading to a relative excess of alpha-globin chains. Clinical severity separates this disease into three main subtypes: β- thalassemia major, β-thalassemia intermedia and β-thalassemia minor, the former two being clinically more significant. Inflammatory processes may play an important role in some of the complications of thalassemia. Adipose tissue is one of the most important endocrine and secretory organs that release adipocytokines like adiponectin, resistin and visfatin. The aim of our study was to analyze adipocytokine concentrations (adiponectin, resistin and visfatin) in different types of β-thalassemia patients and determine any possible correlations with disease severity. We recruited 29 patients who were transfusion-dependent β-thalassemia-major patients, 17 patients with β-thalassemia intermedia, 30 β-thalassemia minor patients. The control group consisted of 30 healthy children. Anthropometric measurements, complete blood count, biochemical parameters, serum concentrations of adiponectin, resistin, visfatin were performed for all subjects. Resistin and visfatin concentrations were significantly higher in β-thalassemia minor patients than in controls. Adiponetin, resistin and visfatin concentrations were significantly higher in both β-thalassemia intermedia and major patients than in controls. The concentrations of adiponectin, resistin and visfatin were significantly higher in both β-thalassemia intermedia and major patients than in β-thalassemia minor patients. There was no significant difference between β-thalassemia intermedia and β-thalassemia major patients for adipocytokines concentrations. We speculate that these adipocytokines may play a role in the development of complications in β-thalassaemia.

  1. Number and location of mouse mammary tumor virus proviral DNA in mouse DNA of normal tissue and of mammary tumors.

    PubMed Central

    Groner, B; Hynes, N E

    1980-01-01

    The Southern DNA filter transfer technique was used to characterize the genomic location of the mouse mammary tumor proviral DNA in different inbred strains of mice. Two of the strains (C3H and CBA) arose from a cross of a Bagg albino (BALB/c) mouse and a DBA mouse. The mouse mammary tumor virus-containing restriction enzyme DNA fragments of these strains had similar patterns, suggesting that the proviruses of these mice are in similar genomic locations. Conversely, the pattern arising from the DNA of the GR mouse, a strain genetically unrelated to the others, appeared different, suggesting that its mouse mammary tumor proviruses are located in different genomic sites. The structure of another gene, that coding for beta-globin, was also compared. The mice strains which we studied can be categorized into two classes, expressing either one or two beta-globin proteins. The macroenvironment of the beta-globin gene appeared similar among the mice strains belonging to one genetic class. Female mice of the C3H strain exogenously transmit mouse mammary tumor virus via the milk, and their offspring have a high incidence of mammary tumor occurrence. DNA isolated from individual mammary tumors taken from C3H mice or from BALB/c mice foster nursed on C3H mothers was analyzed by the DNA filter transfer technique. Additional mouse mammary tumor virus-containing fragments were found in the DNA isolated from each mammary tumor. These proviral sequences were integrated into different genomic sites in each tumor. Images PMID:6245257

  2. Strong linkage disequilibrium of a HbE variant with the (AT)9(T)5 repeat in the BP1 binding site upstream of the beta-globin gene in the Thai population.

    PubMed

    Ohashi, Jun; Naka, Izumi; Patarapotikul, Jintana; Hananantachai, Hathairad; Brittenham, Gary; Looareesuwan, Sornchai; Clark, Andrew G; Tokunaga, Katsushi

    2005-01-01

    A binding site for the repressor protein BP1, which contains a tandem (AT)x(T)y repeat, is located approximately 530 bp 5' to the human beta-globin gene (HBB). There is accumulating evidence that BP1 binds to the (AT)9(T)5 allele more strongly than to other alleles, thereby reducing the expression of HBB. In this study, we investigated polymorphisms in the (AT)x(T)y repeat in 57 individuals living in Thailand, including three homozygotes for the hemoglobin E variant (HbE; beta26Glu-->Lys), 22 heterozygotes, and 32 normal homozygotes. We found that (AT)9(T)5 and (AT)7(T)7 alleles were predominant in the studied population and that the HbE variant is in strong linkage disequilibrium with the (AT)9(T)5 allele, which can explain why the betaE chain is inefficiently synthesized compared to the normal betaA chain. Moreover, the mildness of the HbE disease compared to other hemoglobinopathies in Thai may be due, in part, to the presence of the (AT)9(T)5 repeat on the HbE chromosome. In addition, a novel (AC)n polymorphism adjacent to the (AT)x(T)y repeat (i.e., (AC)3(AT)7(T)5) was found through the variation screening in this study.

  3. High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

    PubMed

    Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

    2018-01-02

    Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and electrophortic indices in order to avoid false positive and false negative results.

  4. Subunit assembly of hemoglobin: an important determinant of hematologic phenotype.

    PubMed

    Bunn, H F

    1987-01-01

    Hemoglobin's physiologic properties depend on the orderly assembly of its subunits in erythropoietic cells. The biosynthesis of alpha- and beta-globin polypeptide chains is normally balanced. Heme rapidly binds to the globin subunit, either during translation or shortly thereafter. The formation of the alpha beta-dimer is facilitated by electrostatic attraction of a positively charged alpha-subunit to a negatively charged beta-subunit. The alpha beta-dimer dissociates extremely slowly. The difference between the rate of dissociation of alpha beta- and alpha gamma-dimers with increasing pH explains the well-known alkaline resistance of Hb F. Two dimers combine to form the functioning alpha 2 beta 2-tetramer. This model of hemoglobin assembly explains the different levels of positively charged and negatively charged mutant hemoglobins that are encountered in heterozygotes and the effect of alpha-thalassemia and heme deficiency states in modifying the level of the variant hemoglobin as well as Hb A2. Electrostatic interactions also affect the binding of hemoglobin to the cytoplasmic surface of the red cell membrane and may underlie the formation of target cells. Enhanced binding of positively charged variants such as S and C trigger a normally dormant pathway for potassium and water loss. Thus, the positive charge on beta c is responsible for the two major contributors to the pathogenesis of Hb SC disease: increased proportion of Hb S and increased intracellular hemoglobin concentration. It is likely that electrostatic interactions play an important role in the assembly of a number of other multisubunit macromolecules, including membrane receptors, cytoskeletal proteins, and DNA binding proteins.

  5. Comparison of different methods for erythroid differentiation in the K562 cell line.

    PubMed

    Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

    2016-08-01

    To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

  6. Molecular mapping within the mouse albino-deletion complex.

    PubMed Central

    Johnson, D K; Hand, R E; Rinchik, E M

    1989-01-01

    Induced germ-line deletion mutations in the mouse provide a malleable experimental system for in-depth molecular and functional analysis of large segments of the mammalian genome. To obtain an initial bank of molecular probes for the region of mouse chromosome 7 associated with the albino-deletion complex, random anonymous DNA clones, derived from a library constructed from flow-sorted chromosomes, were screened on DNAs from Mus musculus-Mus spretus F1 hybrids carrying large, multilocus, lethal albino deletions. Clones falling within a given deletion interval can easily be recognized because hybridization bands that represent restriction fragment length polymorphisms specific for the mutant (deleted) chromosome inherited from the M. musculus parent will be absent. Among 72 informative clones used as probes, one, which defines the locus D7OR1, mapped within two deletions that are 6-11 centimorgans in length. Submapping of this anonymous clone across a panel of 27 smaller deletions localized D7OR1 distal to a chromosomal subregion important for survival of the preimplantation embryo, proximal to globin [beta-chain (Hbb)], and near the shaker-1 (sh-1) locus. The results of these deletion-mapping experiments were also confirmed by standard three-point linkage analysis. This strategy for selection and rapid mapping of anonymous DNA probes to chromosomal segments corresponding to germ-line deletion mutations should contribute to the generation of more detailed physical and functional maps of genomic regions associated with mutant developmental phenotypes. Images PMID:2813427

  7. Evolutionary context for the association of γ-globin, serum uric acid, and hypertension in African Americans.

    PubMed

    Shriner, Daniel; Kumkhaek, Chutima; Doumatey, Ayo P; Chen, Guanjie; Bentley, Amy R; Charles, Bashira A; Zhou, Jie; Adeyemo, Adebowale; Rodgers, Griffin P; Rotimi, Charles N

    2015-11-05

    Hyperuricemia and associated cardio-metabolic disorders are more prevalent in African Americans than in European Americans. We used genome-wide admixture mapping and association testing to identify loci with ancestry effects on serum uric acid levels. We analyzed 1,976 African Americans from Washington, D.C, including 1,322 individuals from 328 pedigrees and 654 unrelated individuals, enrolled in the Howard University Family Study. We performed admixture mapping and genome-wide association testing using ~800 k autosomal single-nucleotide polymorphisms (SNPs). We performed fine mapping by dense genotyping. We assessed functionality by a combination of bioinformatic annotation, reporter gene assays, and gel shift experiments. We also analyzed 12,641 individuals enrolled in the National Health and Nutrition Examination Survey. We detected a genome-wide significant locus on chromosome 11p15.4 at which serum uric acid levels increased with increasing African ancestry, independent of kidney function. Fine-mapping identified two independent signals in the β-globin locus. The ancestral allele at SNP rs2855126, located upstream of the hemoglobin, gamma A gene HBG1, was associated with increased serum uric acid levels and higher expression of a reporter gene relative to the derived allele. Hyperuricemia was associated with increased risk of hypertension in 3,767 African Americans (Odds Ratio = 2.48, p = 2.71 × 10(-19)). Given that increased expression of γ-globin leads to increased levels of fetal hemoglobin which confers protection against malaria, we hypothesize that evolution in Africa of protection against malaria may have occurred at the cost of increased serum uric acid levels, contributing to the high rates of hyperuricemia and associated cardio-metabolic disorders observed in African Americans.

  8. Genotype–phenotype correlation among beta-thalassemia and beta-thalassemia/HbE disease in Thai children: predictable clinical spectrum using genotypic analysis

    PubMed Central

    Traivaree, Chanchai; Monsereenusorn, Chalinee; Rujkijyanont, Piya; Prasertsin, Warakorn; Boonyawat, Boonchai

    2018-01-01

    Introduction Beta-thalassemia is a group of inherited hemolytic anemias and one of the most common genetic disorders in Thailand. The clinical spectrum of beta-thalassemia disease ranges from mild to severe clinical symptoms including mild beta-thalassemia intermedia (TI) and severe beta-thalassemia major (TM). Objective This study aimed to determine the correlation between beta-globin gene (HBB) mutations and their phenotypic manifestations by evaluating patients’ clinical characteristics, transfusion requirements, growth and hematologic parameters, and hemoglobin typing among pediatric patients treated at Phramongkutklao Hospital. Materials and methods Seventy beta-thalassemia patients, including 63 with beta-thalassemia/hemoglobin E (HbE) and 7 with either homozygous or compound heterozygous beta-thalassemia, were enrolled in this study. Their clinical presentation, growth parameters and laboratory findings were reviewed and analyzed. The mean follow-up time was 10.52±5.62 years. Mutation analysis in each individual was performed using multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene and gap PCR for 3.4 kb deletion detection. Results All 7 homozygous and compound heterozygous beta-thalassemia patients were classified in TM. Among 63 patients with beta-thalassemia/HbE, 58 were classified in TM and 4 were classified in TI. Mean age at diagnosis was 0.8±0.49 years for homozygous or compound heterozygous beta-thalassemia and 3.43±3.5 years for beta-thalassemia/HbE. The most common HBB mutation was HBB:c.126_129delCTTT [codon 41/42 (-TCTT)] found in 34 alleles (48.6%). The height for age was also lower in homozygous beta-thalassemia patients (<3rd percentile) compared to compound heterozygous beta-thalassemia patients (25–50th percentile). Conclusion This study revealed a genotype–phenotype correlation of the most prevalent beta-thalassemia in Thai children using diagnostic capacity in genotypic analysis of HBB mutation. Our findings can provide a better prediction of clinical manifestation and severity by early identification of the type of the HBB mutations. PMID:29695942

  9. Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

    PubMed

    Kaushik, Mahima; Kukreti, Shrikant

    2015-01-01

    Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

  10. Prenatal diagnosis of hemoglobinopathies: evaluation of techniques for analysing globin-chain synthesis in blood samples obtained by fetoscopy.

    PubMed Central

    Congote, L. F.; Hamilton, E. F.; Chow, J. C.; Perry, T. B.

    1982-01-01

    Three techniques for analysing hemoglobin synthesis in blood samples obtained by fetoscopy were evaluated. Of the fetuses studied, 12 were not at risk of genetic disorders, 10 were at risk of beta-thalassemia, 2 were at risk of sickle cell anemia and 1 was at risk of both diseases. The conventional method of prenatal diagnosis of hemoglobinopathies, involving the separation of globin chains labelled with a radioactive isotope on carboxymethyl cellulose (CMC) columns, was compared with a method involving globin-chain separation by high-pressure liquid chromatography (HPLC) and with direct analysis of labelled hemoglobin tetramers obtained from cell lysates by chromatography on ion-exchange columns. The last method is technically the simplest and can be used for diagnosing beta-thalassemia and sickle cell anemia. However, it gives spuriously high levels of adult hemoglobin in samples containing nonlabelled adult hemoglobin. HPLC is the fastest method for prenatal diagnosis of beta-thalassemia and may prove as reliable as the CMC method. Of the 13 fetuses at risk for hemoglobinopathies, 1 was predicted to be affected, and the diagnosis was confirmed in the abortus. Of 12 predicted to be unaffected, 1 was aborted spontaneously and was unavailable for confirmatory studies, as were 3 of the infants; however, the diagnosis was confirmed in seven cases and is awaiting confirmation when the infant in 6 months old in one case. Couples at risk of bearing a child with a hemoglobinopathy should be referred for genetic counselling before pregnancy or, at the latest, by the 12th week of gestation so that prenatal diagnosis can be attempted by amniocentesis, safer procedure, with restriction endonuclease analysis of the amniotic fluid cells. PMID:7139502

  11. Frequency and origin of haplotypes associated with the beta-globin gene cluster in individuals with trait and sickle cell anemia in the Atlantic and Pacific coastal regions of Colombia

    PubMed Central

    Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo

    2013-01-01

    Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events. PMID:24385850

  12. Combination of a triple alpha-globin gene with beta-thalassemia in a gypsy family: importance of the genetic testing in the diagnosis and search for a donor for bone marrow transplantation for one of their children.

    PubMed

    Yus Cebrian, Flor; Recasens Flores, María del Valle; Izquierdo Álvarez, Silvia; Parra Salinas, Ingrid; Rodriguez-Vigil Iturrate, Carmen

    2016-04-14

    The simultaneous presence of a heterozygous β-thalassemia with α-gene triplication may cause anything from a thalassemia trait to thalassemia intermedia of mild to moderate severity. An 8-month-old ethnic Gypsy male infant with failure to thrive from birth, mild jaundice and splenomegaly. Clinical signs were compatible with severe microcytic anemia requiring bi-monthly blood transfusions. The β-thalassemia gene analysis found homozygous mutation IVS-I-110 (G>A) (c.93-21G>A) in intron 1 of the hemoglobin beta globin gene and a non-pathogenic sequence variant (single nucleotide polimorfism (SNP) Rs1609812). In addition, the patient had α gene triplication (ααα(anti 3.7)/αα) caused by double heterozygosity for a 3.7 kb fragment that contained only the hemoglobin alpha globin gene-2 gene. This finding led to screening and follow up in first-degree relatives, twin brothers and a sister and parents to provide them with appropriate genetic counseling. Nowadays, new horizons could open a new therapeutic management until definitive cure of these diseases through gene therapy or mutation-specific genome editing. Genetic testing can provide an early diagnosis and facilitates the search for a suitable donor for transplantation.

  13. Molecular basis of beta-thalassemia in the Maldives.

    PubMed

    Furuumi, H; Firdous, N; Inoue, T; Ohta, H; Winichagoon, P; Fucharoen, S; Fukumaki, Y

    1998-03-01

    We have systematically analyzed beta-thalassemia genes using polymerase chain reaction-related techniques, dot-blot hybridization with oligonucleotide probes, allele specific-polymerase chain reaction, and sequencing of amplified DNA fragments from 41 unrelated patients, including 37 beta-thalassemia homozygotes, three with beta-thalassemia/Hb E, and one with beta-thalassemia/Hb S. Four different beta-thalassemia mutations were detected in 78 alleles. These are the IVS-I-5 (G-->C), codon 30 (AGG-->ACG) [also indicated as IVS-I (-1)], IVS-I-1 (G-->A), and codons 41/42 (-TTCT) mutations. The distribution of the beta-thalassemia mutations in the Maldives is 58 alleles (74.3%) with the IVS-I-5 (G-->C) mutation, 12 (15.4%) with the codon 30 (AGG-->ACG) mutation, seven (9%) with the IVS-I-1 (G-->A) mutation, and one with the codons 41/42 (-TTCT) mutation. The first three mutations account for 98.7% of the total number of beta-thalassemia chromosomes studied. These mutations are clustered in the region spanning 6 bp around the junction of exon 1 and the first intervening sequence of the beta-globin gene. These observations have significant implications for setting up a thalassemia prevention and control program in the Maldives. Analysis of haplotypes and frameworks of chromosomes bearing each beta-thalassemia mutation suggested that the origin and spread of these mutations were reflected by the historical record.

  14. Discrimination of Pathogenic Versus Non-Pathogenic Yersinia Pestis and Escherichia Coli Using Proteomics Mass Spectrometry

    DTIC Science & Technology

    2010-05-01

    protein 1b (lb;c) thiol peroxidase attachment invasion locus protein trigger factor 50S ribosomal protein L9 urease (urea amidohydrolase) beta...subunit attachment invasion locus protein urease (urea amidohydrolase) beta subunit attachment invasion locus protein hypothetical protein y2159

  15. Sequence Divergence in the 3′ Untranslated Regions of Human ζ- and α-Globin mRNAs Mediates a Difference in Their Stabilities and Contributes to Efficient α-to-ζ Gene Developmental Switching

    PubMed Central

    Russell, J. Eric; Morales, Julia; Makeyev, Aleksandr V.; Liebhaber, Stephen A.

    1998-01-01

    The developmental stage-specific expression of human globin proteins is characterized by a switch from the coexpression of ζ- and α-globin in the embryonic yolk sac to exclusive expression of α-globin during fetal and adult life. Recent studies with transgenic mice demonstrate that in addition to transcriptional control elements, full developmental silencing of the human ζ-globin gene requires elements encoded within the transcribed region. In the current work, we establish that these latter elements operate posttranscriptionally by reducing the relative stability of ζ-globin mRNA. Using a transgenic mouse model system, we demonstrate that human ζ-globin mRNA is unstable in adult erythroid cells relative to the highly stable human α-globin mRNA. A critical determinant of the difference between α- and ζ-globin mRNA stability is mapped by in vivo expression studies to their respective 3′ untranslated regions (3′UTRs). In vitro messenger ribonucleoprotein (mRNP) assembly assays demonstrate that the α- and ζ-globin 3′UTRs assemble a previously described mRNP stability-determining complex, the α-complex, with distinctly different affinities. The diminished efficiency of α-complex assembly on the ζ 3′UTR results from a single C→G nucleotide substitution in a crucial polypyrimidine tract contained by both the human α- and ζ-globin mRNA 3′UTRs. A potential pathway for accelerated ζ-globin mRNA decay is suggested by the observation that its 3′UTR encodes a shortened poly(A) tail. Based upon these data, we propose a model for ζ-globin gene silencing in fetal and adult erythroid cells in which posttranscriptional controls play a central role by providing for accelerated clearance of ζ-globin transcripts. PMID:9528789

  16. Characterization of arrangement and expression of the beta-2 microglobulin locus in the sandbar and nurse shark.

    PubMed

    Chen, Hao; Kshirsagar, Sarika; Jensen, Ingvill; Lau, Kevin; Simonson, Caitlin; Schluter, Samuel F

    2010-02-01

    Beta 2 microglobulin (beta2m) is an essential subunit of major histocompatibility complex (MHC) type I molecules. In this report, beta2m cDNAs were identified and sequenced from sandbar shark spleen cDNA library. Sandbar shark beta2m gene encodes one amino acid less than most teleost beta2m genes, and 3 amino acids less than mammal beta2m genes. Although sandbar shark beta2m protein contains one beta sheet less than that of human in the predicted protein structure, the overall structure of beta2m proteins is conserved during evolution. Germline gene for the beta2m in sandbar and nurse shark is present as a single locus. It contains three exons and two introns. CpG sites are evenly distributed in the shark beta2m loci. Several DNA repeat elements were also identified in the shark beta2m loci. Sequence analysis suggests that the beta2m locus is not linked to the MHC I loci in the shark genome.

  17. Chromosomal arrangement of leghemoglobin genes in soybean.

    PubMed Central

    Lee, J S; Brown, G G; Verma, D P

    1983-01-01

    A cluster of four different leghemoglobin (Lb) genes was isolated from AluI-HaeIII and EcoRI genomic libraries of soybean in a set of overlapping clones which together include 45 kilobases (kb) of contiguous DNA. These four genes, including a pseudogene, are present in the same orientation and are arranged in the order: 5'-Lba-Lbc1-Lb psi-Lbc3-3'. The intergenic regions average 2.5 kb. In addition to this main Lb locus, there are other Lb genes which do not appear to be contiguous to this locus. A sequence probably common to the 3' region of Lb loci was found flanking the Lbc3 gene. The 3' flanking region of the main Lb locus also contains a sequence that appears to be expressed more abundantly in root tissue. Another sequence which is primarily expressed in root and leaf is found 5' to two Lb loci. Overall, the main leghemoglobin locus is similar in structure to the mammalian globin gene loci. Images PMID:6310504

  18. A Brg1 mutation that uncouples ATPase activity from chromatin remodeling reveals an essential role for SWI/SNF-related complexes in β-globin expression and erythroid development

    PubMed Central

    Bultman, Scott J.; Gebuhr, Thomas C.; Magnuson, Terry

    2005-01-01

    The Brg1 catalytic subunit of SWI/SNF-related complexes has been implicated in many developmental and physiological processes, but null homozygotes die as blastocysts prior to implantation. To circumvent this early embryonic lethality, we performed an ENU mutagenesis screen and generated a Brg1 hypomorph mutation in the ATPase domain. The mutant Brg1 protein is stable, assembles into SWI/SNF-related complexes, and exhibits normal ATPase activity but is unable to establish DNase I hypersensitivity sites characteristic of open chromatin. Mutant embryos develop normally until midgestation but then exhibit a distinct block in the development of the erythroid lineage, leading to anemia and death. The mutant Brg1 protein is recruited to the β-globin locus, but chromatin remodeling and transcription are perturbed. Histone acetylation and DNA methylation are also affected. To our knowledge, Brg1 is the first chromatin-modifying factor shown to be required for β-globin regulation and erythropoiesis in vivo. Not only does this mutation establish a role for Brg1 during organogenesis, it also demonstrates that ATPase activity can be uncoupled from chromatin remodeling. PMID:16287714

  19. [Association between polymorphism in DVWA and IL-1beta and Kashin-Beck disease].

    PubMed

    Y U, Min; Guo, Xiong; Gao, Xiao-Yun; Lai, Jiang-Hua; Tu, Qian-Qian

    2010-07-01

    To investigate the association between IL-1beta and DVWA gene and Kashin-Beck disease (KBD). Peripheral genomic DNA were extracted from 105 patients with KBD and 98 healthy controls. PCR-RFLP were performed to detect SNP loci of IL-1beta gene and DVWA gene. The patients with KBD had significantly higher frequency of rs16944 (IL-1beta) locus (chi2 = 24.28, P < 0.001) and single allele frequency of rs16944 (chi2 = 5.683, P = 0.0171) than the healthy controls. There were no significant differences in genotype frequencies,single allele frequencies and haplotypes in rs4685241 and rs1143627 between the patients with KBD and the healthy controls. rs16944 (IL-1beta) is associated with KBD.

  20. Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

    PubMed Central

    Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

    2016-01-01

    Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

  1. Problem-Solving Test: The Mechanism of Protein Synthesis

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: protein synthesis, ribosomes, amino acids, peptides, peptide bond, polypeptide chain, N- and C-terminus, hemoglobin, [alpha]- and [beta]-globin chains, radioactive labeling, [[to the third power]H] and [[to the fourteenth power]C]leucine, cytosol, differential centrifugation, density…

  2. Systematic documentation and analysis of human genetic variation in hemoglobinopathies using the microattribution approach.

    PubMed

    Giardine, Belinda; Borg, Joseph; Higgs, Douglas R; Peterson, Kenneth R; Philipsen, Sjaak; Maglott, Donna; Singleton, Belinda K; Anstee, David J; Basak, A Nazli; Clark, Barnaby; Costa, Flavia C; Faustino, Paula; Fedosyuk, Halyna; Felice, Alex E; Francina, Alain; Galanello, Renzo; Gallivan, Monica V E; Georgitsi, Marianthi; Gibbons, Richard J; Giordano, Piero C; Harteveld, Cornelis L; Hoyer, James D; Jarvis, Martin; Joly, Philippe; Kanavakis, Emmanuel; Kollia, Panagoula; Menzel, Stephan; Miller, Webb; Moradkhani, Kamran; Old, John; Papachatzopoulou, Adamantia; Papadakis, Manoussos N; Papadopoulos, Petros; Pavlovic, Sonja; Perseu, Lucia; Radmilovic, Milena; Riemer, Cathy; Satta, Stefania; Schrijver, Iris; Stojiljkovic, Maja; Thein, Swee Lay; Traeger-Synodinos, Jan; Tully, Ray; Wada, Takahito; Waye, John S; Wiemann, Claudia; Zukic, Branka; Chui, David H K; Wajcman, Henri; Hardison, Ross C; Patrinos, George P

    2011-03-20

    We developed a series of interrelated locus-specific databases to store all published and unpublished genetic variation related to hemoglobinopathies and thalassemia and implemented microattribution to encourage submission of unpublished observations of genetic variation to these public repositories. A total of 1,941 unique genetic variants in 37 genes, encoding globins and other erythroid proteins, are currently documented in these databases, with reciprocal attribution of microcitations to data contributors. Our project provides the first example of implementing microattribution to incentivise submission of all known genetic variation in a defined system. It has demonstrably increased the reporting of human variants, leading to a comprehensive online resource for systematically describing human genetic variation in the globin genes and other genes contributing to hemoglobinopathies and thalassemias. The principles established here will serve as a model for other systems and for the analysis of other common and/or complex human genetic diseases.

  3. [The effect of DNA hydroxymethylase Tet2 on γ globin activation in the treatment of β-thalassemia].

    PubMed

    Li, W X; Ma, Q W; Zeng, F Y

    2018-03-01

    Objective: To study the function of ten-eleven translocation 2 (Tet2) in γ globin gene expression in patients with β- thalassemia. Methods: Gamma globin expression was induced by 5-azacytidine and Tet2 gene expression was knocked down by short hairpin RNA (shRNA) in a human immortalized myelogenous leukemia K562 cell line. The global 5-hydroxymethylcytosine (5hmC) level was measured by an ELISA kit. 5hmC level of γ globin gene was quantified by sulfite sequencing. The mRNA level of Tet2, γ globin, and related transcription factors Nfe4 and Klf1 were quantified by real-time PCR. Results: Tet2 knockdown resulted in a decreased global 5hmC level from 0.14% to 0.03% as of the control group in K562 cells. The expression of γ globin was enhanced after 5-azacytidine treatment in vitro. However, γ globin mRNA level in Tet2 knockdown cells was only 55% as that in control group. The CG sites on γ globin gene were unmethylated. As Tet2 was down-regulated, the expression levels of Nfe4 and Klf1 decreased by about 80% and increased to 3.5 folds, respectively. Conclusions: Tet2 appears to maintain 5hmC level and facilitates γ globin gene activation. Moreover, Tet2 more likely regulates γ globin expression via affecting transcription factors rather than the gene itself. Thus, Tet2 could be a potential therapeutic target for β thalassemias.

  4. Hb Chile [beta28(B10)Leu-->Met]: an unstable hemoglobin associated with chronic methemoglobinemia and sulfonamide or methylene blue-induced hemolytic anemia.

    PubMed

    Hojas-Bernal, R; McNab-Martin, P; Fairbanks, V F; Holmes, M W; Hoyer, J D; McCormick, D J; Kubik, K S

    1999-05-01

    Among the causes of life-long cyanosis are congenital methemoglobinemia due to M hemoglobins, congenital methemoglobinemia due to methemoglobin reductase deficiency, a small number of low oxygen affinity hemoglobins, and a small number of unstable hemoglobins that spontaneously form methemoglobin in vivo at an accelerated rate. We report an unstable hemoglobin with these characteristics that was observed in a family of indigenous (native American) origin living near Santiago, Chile. This variant has the substitution beta28(B10)Leu-->Met, unambiguously corresponding to the DNA mutation of CTG-->ATG in beta-globin gene codon 28.

  5. Human papillomavirus in normal conjunctival tissue and in conjunctival papilloma: types and frequencies in a large series.

    PubMed

    Sjö, Nicolai Christian; von Buchwald, Christian; Cassonnet, Patricia; Norrild, Bodil; Prause, Jan Ulrik; Vinding, Troels; Heegaard, Steffen

    2007-08-01

    To examine conjunctival papilloma and normal conjunctival tissue for the presence of human papillomavirus (HPV). Archival paraffin wax-embedded tissue from 165 conjunctival papillomas and from 20 histological normal conjunctival biopsy specimens was analysed for the presence of HPV by PCR. Specimens considered HPV positive using consensus primers, but with a negative or uncertain PCR result using type-specific HPV probes, were analysed with DNA sequencing. HPV was present in 86 of 106 (81%) beta-globin-positive papillomas. HPV type 6 was positive in 80 cases, HPV type 11 was identified in 5 cases and HPV type 45 was present in a single papilloma. All the 20 normal conjunctival biopsy specimens were beta-globin positive and HPV negative. There is a strong association between HPV and conjunctival papilloma. The study presents the largest material of conjunctival papilloma investigated for HPV and the first investigation of HPV in normal conjunctival tissue. HPV types 6 and 11 are the most common HPV types in conjunctival papilloma. This also is the first report of HPV type 45 in conjunctival papilloma.

  6. Butyrate Infusions in the Ovine Fetus Delay the Biologic Clock for Globin Gene Switching

    NASA Astrophysics Data System (ADS)

    Perrine, Susan P.; Rudolph, Abraham; Faller, Douglas V.; Roman, Christine; Cohen, Ruth A.; Chen, Shao-Jing; Kan, Yuet Wai

    1988-11-01

    The switch from fetal to adult hemoglobin expression is regulated in many mammalian species by a developmental clock-like mechanism and determined by the gestational age of the fetus. Prolonging fetal globin gene expression is of considerable interest for therapeutic potential in diseases caused by abnormal β -globin genes. Butyric acid, which is found in increased plasma concentrations in infants of diabetic mothers who have delayed globin gene switching, was infused into catheterized fetal lambs in utero during the time of the normal globin gene switch period. The globin gene switch was significantly delayed in three of four butyrate-treated fetuses compared with controls and was entirely prevented in one fetus in whom the infusion was begun before the globin switch was under way. These data provide a model for investigating and arresting the biologic clock of hemoglobin switching.

  7. Optimized Lentiviral Vector Design Improves Titer and Transgene Expression of Vectors Containing the Chicken β-Globin Locus HS4 Insulator Element

    PubMed Central

    Hanawa, Hideki; Yamamoto, Motoko; Zhao, Huifen; Shimada, Takashi; Persons, Derek A

    2009-01-01

    Hematopoietic cell gene therapy using retroviral vectors has achieved success in clinical trials. However, safety issues regarding vector insertional mutagenesis have emerged. In two different trials, vector insertion resulted in the transcriptional activation of proto-oncogenes. One strategy for potentially diminishing vector insertional mutagenesis is through the use of self-inactivating lentiviral vectors containing the 1.2-kb insulator element derived from the chicken β-globin locus. However, use of this element can dramatically decrease both vector titer and transgene expression, thereby compromising its practical use. Here, we studied lentiviral vectors containing either the full-length 1.2-kb insulator or the smaller 0.25-kb core element in both orientations in the partially deleted long-terminal repeat. We show that use of the 0.25-kb core insulator rescued vector titer by alleviating a postentry block to reverse transcription associated with the 1.2-kb element. In addition, in an orientation-dependent manner, the 0.25-kb core element significantly increased transgene expression from an internal promoter due to improved transcriptional termination. This element also demonstrated barrier activity, reducing variability of expression due to position effects. As it is known that the 0.25-kb core insulator has enhancer-blocking activity, this particular insulated lentiviral vector design may be useful for clinical application. PMID:19223867

  8. Investigating alpha-globin structural variants: a retrospective review of 135,000 Brazilian individuals

    PubMed Central

    Kimura, Elza Miyuki; Oliveira, Denise Madureira; Jorge, Susan Elisabeth; Ribeiro, Daniela Maria; Zaccariotto, Tânia Regina; Santos, Magnun Nueldo Nunes; Almeida, Vanessa; Albuquerque, Dulcinéia Martins; Costa, Fernando Ferreira; Sonati, Maria de Fátima

    2015-01-01

    Background Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC) and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC). Mutations were identified by molecular analyses, and the oxygen affinity, heme–heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations. PMID:25818820

  9. Molecular analysis of Hb Q-H disease and Hb Q-Hb E in a Singaporean family.

    PubMed

    Tan, J; Tay, J S; Wong, Y C; Kham, S K; Bte Abd Aziz, N; Teo, S H; Wong, H B

    1995-01-01

    Hb Q (alpha 74Asp-His) results from a mutation in the alpha-gene such that abnormal alpha Q-chains are synthesized. The alpha Q-chains combine with the normal Beta A-chains to form abnormal Hb alpha 2Q beta 2A (Hb Q). Hb Q-H disease is rare, and has been reported only in the Chinese. We report here a Chinese family, were the mother diagnosed with Hb Q-H disease and the father with Hb E heterozygosity and a child with Hb Q-E-thalassemia. Thalassemia screening of the mother's blood revealed a Hb level of 6.8g/dl with low MCV and MCH. Her blood film was indicative of thalassemia. Cellulose acetate electrophoresis showed Hb H and Hb Q with the absence of Hb A. Globin chain biosynthesis was carried out and alpha Q- and beta-chains were detected. Normal alpha- chains were absent. Digestion of the mother's DNA with Bam HI and Bgl II followed by hybridization with the 1.5 kb alpha-Pst probe showed a two alpha-gene deletion on one chromosome and the -alpha Q chain mutant with the -alpha 4.2 defect on the other chromosome. DNA amplification studies indicated the two-gene deletion to be of the -SEA/ defect. The patient was concluded to possess Hb Q-H disease (--SEA/-alpha 4.2Q). Cellulose acetate electrophoresis of the father's blood showed the presence of Hb A, F and E. Molecular analysis of the father's DNA confirmed an intact set of alpha-genes (alpha alpha/alpha alpha). Globin chain biosynthesis of fetal blood of their child showed gamma, beta A, beta E, alpha A and alpha Q-chains. Molecular analysis of the child's DNA showed one alpha-gene deletion, thus giving a genotype of alpha alpha/-alpha 4.2Q beta beta E.

  10. [Main regulatory element (MRE) of the Danio rerio α/β-globin gene domain exerts enhancer activity toward the promoters of the embryonic-larval and adult globin genes].

    PubMed

    Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V

    2016-01-01

    In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.

  11. Expression of transcription factors during sodium phenylacetate induced erythroid differentiation in K562 cells.

    PubMed

    Rath, A V; Schmahl, G E; Niemeyer, C M

    1997-01-01

    During 15 days of treatment of K562 cells with sodium phenylacetate, we observed an increase in the cellular hemoglobin concentration with a similar increase in the expression of gamma-globin mRNA. Morphological studies demonstrated characteristic features of erythroid differentiation and maturation. At the same time there was no change in the level of expression of the cell surface antigenes CD33, CD34, CD45, CD71 and glycophorin A. Likewise, the level of expression of the erythroid transcription factors GATA-1, GATA-2, NF-E2, SCL and RBTN2, all expressed in untreated K562 cells, did not increase during sodium phenylacetate induced erythroid differentiation. The expression of the nuclear factors Evi-1 and c-myb, known to inhibit erythroid differentiation, did not decrease. We conclude that sodium phenylacetate treatment of K562 cells increases gamma-globin mRNA and induces cell maturation as judged by morphology without affecting the expression of the erythroid transcription factors, some of which are known to be involved in the regulation of beta-like globin genes.

  12. Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

    PubMed

    Kho, S L; Chua, K H; George, E; Tan, J A M A

    2013-07-15

    Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

  13. Hb Molfetta [beta126(H4)Val-->Leu, GTG-->CTG]: a new, silent, neutral beta chain variant found in an Italian woman.

    PubMed

    Qualtieri, Antonio; Le, Pera Maria; Pedace, Vera; Magariello, Angela; Brancati, Carlo

    2002-02-01

    We have identified a new neutral hemoglobin variant in a pregnant Italian woman, that resulted from a GTG-->CTG replacement at codon 126 of the beta chain, corresponding to a Val-->Leu amino acid change at position beta126(H4). Thermal and isopropanol stability tests were normal and there were no abnormal clinical features. Routine electrophoretic and ion exchange chromatographic methods for hemoglobin separation failed to show this variant, but reversed phase high performance liquid chromatography revealed an abnormal peak eluting near the normal beta chain. No abnormal tryptic peptide was revealed on the high performance liquid chromatographic elution pattern of the total globin digest. The mutation was determined at the DNA level by amplification of the three beta exons by polymerase chain reaction and direct sequencing of one exon that showed an abnormal migration on single strand conformational polymorphism analysis.

  14. Allele related mutation specific-polymerase chain reaction for rapid diagnosis of Hb New York (beta 113 (G15) Val-->Glu, beta(CD113 GTG-->GAG)).

    PubMed

    Viprakasit, Vip; Tachavanich, Kalaya; Suwantol, Lerlugsn; Pung-Amritt, Parichat; Chinchang, Worawut; Tanphaichitr, Voravarn S

    2002-08-01

    Hemoglobin New York (beta 113 (G15) Val-->Glu), a beta-globin variant, was first reported in a Chinese family living in New York. Subsequently, this abnormal hemoglobin was reported in many Chinese descendants from several groups and it was also known as Hb Kaohsiung. The subtle change in alpha1beta1 contact region apart from the heme group connecting area by Val-->Glu substitution has minor changes in both the electrophoretic mobility and stability making this hemoglobin variant difficult to distinguish from Hb A using routine hemoglobin analysis. The authors described a case of heterozygosity of Hb New York diagnosed by a molecular technique and revealed a mutation in beta(CD113 GTG-->GAG). A novel Allele Related Mutation Specific-Polymerase Chain Reaction (ARMS-PCR) for rapid diagnosis of this mutation has been proposed.

  15. Estimating the age of Hb G-Coushatta [β22(B4)Glu→Ala] mutation by haplotypes of β-globin gene cluster in Denizli, Turkey.

    PubMed

    Ozturk, Onur; Arikan, Sanem; Atalay, Ayfer; Atalay, Erol O

    2018-05-01

    Hb G-Coushatta variant was reported from various populations' parts of the world such as Thai, Korea, Algeria, Thailand, China, Japan and Turkey. In our study, we aimed to discuss the possible historical relationships of the Hb G-Coushatta mutation with the possible migration routes of the world. For this purpose, associated haplotypes were determined using polymorphic loci in the beta globin gene cluster of hemoglobin G-Coushatta and normal populations in Denizli, Turkey. We performed statistical analysis such as haplotype analysis, Hardy-Weinberg equilibrium, measurement of genetic diversity and population differentiation parameters, analysis of molecular variance using F-statistics, historical-demographic analyses, mismatch distribution analysis of both populations and applied the test statistics in Arlequin ver. 3.5 software program. The diversity of haplotypes has been shown to indicate different genetic origins for two populations. However, AMOVA results, molecular diversity parameters and population demographic expansion times showed that the Hb G-Coushatta mutation develops on the normal population gene pool. Our estimated τ values showed the average time since the demographic expansion for normal and Hb G-Coushatta populations ranged from approximately 42,000 to 38,000 ybp, respectively. Our data suggest that Hb G-Coushatta population originate in normal population in Denizli, Turkey. These results support the hypothesis that the multiple origin of Hb G-Coushatta and indicate that mutation may have been triggered the formation of new variants on beta globin haplotypes. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  16. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

    PubMed

    Harano, K; Harano, T; Kushida, Y; Ueda, S

    1991-08-01

    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  17. Molecular evolution of globin genes in Gymnotiform electric fishes: relation to hypoxia tolerance.

    PubMed

    Tian, Ran; Losilla, Mauricio; Lu, Ying; Yang, Guang; Zakon, Harold

    2017-02-13

    Nocturnally active gymnotiform weakly electric fish generate electric signals for communication and navigation, which can be energetically taxing. These fish mainly inhabit the Amazon basin, where some species prefer well-oxygenated waters and others live in oxygen-poor, stagnant habitats. The latter species show morphological, physiological, and behavioral adaptations for hypoxia-tolerance. However, there have been no studies of hypoxia tolerance on the molecular level. Globins are classic respiratory proteins. They function principally in oxygen-binding and -delivery in various tissues and organs. Here, we investigate the molecular evolution of alpha and beta hemoglobins, myoglobin, and neuroglobin in 12 gymnotiforms compared with other teleost fish. The present study identified positively selected sites (PSS) on hemoglobin (Hb) and myoglobin (Mb) genes using different maximum likelihood (ML) methods; some PSS fall in structurally important protein regions. This evidence for the positive selection of globin genes suggests that the adaptive evolution of these genes has helped to enhance the capacity for oxygen storage and transport. Interestingly, a substitution of a Cys at a key site in the obligate air-breathing electric eel (Electrophorus electricus) is predicted to enhance oxygen storage of Mb and contribute to NO delivery during hypoxia. A parallel Cys substitution was also noted in an air-breathing African electric fish (Gymnarchus niloticus). Moreover, the expected pattern under normoxic conditions of high expression of myoglobin in heart and neuroglobin in the brain in two hypoxia-tolerant species suggests that the main effect of selection on these globin genes is on their sequence rather than their basal expression patterns. Results indicate a clear signature of positive selection in the globin genes of most hypoxia-tolerant gymnotiform fishes, which are obligate or facultative air breathers. These findings highlight the critical role of globin genes in hypoxia tolerance evolution of Gymnotiform electric fishes.

  18. Clinical features of early onset, familial Alzheimer`s disease linked to chromosome 14

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mullan, M.; Bennett, C.; Figueredo, C.

    1995-02-27

    Early onset familial Alzheimer`s disease (AD) has an autosomal dominant mode of inheritance. Two genes are responsible for the majority of cases of this subtype of AD. Mutations in the {beta}-amyloid precursor protein ({beta}APP) gene on chromosome 21 have been shown to completely cosegregate with the disease. We and others have previously described the clinical features of families with {beta}APP mutations at the codon 717 locus in an attempt to define the phenotype associated with a valine to isoleucine (Val {r_arrow} Ile) or a valine to glycine (Val {r_arrow} Gly) change. More recently, a second locus for very early onsetmore » disease has been localized to chromosome 14. The results of linkage studies in some families suggesting linkage to both chromosomes have been explained by the suggestion of a second (centromeric) locus on chromosome 21. Here we report the clinical features and genetic analysis of a British pedigree (F74) with early onset AD in which neither the {beta}APP locus nor any other chromosome 21 locus segregates with the disease, but in which good evidence is seen for linkage on the long arm of chromosome 14. In particular we report marker data suggesting that the chromosome 14 disease locus is close to D14S43 and D14S77. Given the likelihood that F74 represents a chromosome 14 linked family, we describe the clinical features and make a limited clinical comparison with the {beta}APP717 Val {r_arrow} Ile and {beta}APP717 Val {r_arrow} Gly encoded families that have been previously described. We conclude that although several previously reported clinical features occur to excess in early onset familial AD, no single clinical feature demarcates either the chromosome 14 or {beta}APP codon 717 mutated families except mean age of onset. 52 refs., 2 figs., 5 tabs.« less

  19. Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

    Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee aremore » more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.« less

  20. Correction of the sickle cell disease mutation in human hematopoietic stem/progenitor cells.

    PubMed

    Hoban, Megan D; Cost, Gregory J; Mendel, Matthew C; Romero, Zulema; Kaufman, Michael L; Joglekar, Alok V; Ho, Michelle; Lumaquin, Dianne; Gray, David; Lill, Georgia R; Cooper, Aaron R; Urbinati, Fabrizia; Senadheera, Shantha; Zhu, Allen; Liu, Pei-Qi; Paschon, David E; Zhang, Lei; Rebar, Edward J; Wilber, Andrew; Wang, Xiaoyan; Gregory, Philip D; Holmes, Michael C; Reik, Andreas; Hollis, Roger P; Kohn, Donald B

    2015-04-23

    Sickle cell disease (SCD) is characterized by a single point mutation in the seventh codon of the β-globin gene. Site-specific correction of the sickle mutation in hematopoietic stem cells would allow for permanent production of normal red blood cells. Using zinc-finger nucleases (ZFNs) designed to flank the sickle mutation, we demonstrate efficient targeted cleavage at the β-globin locus with minimal off-target modification. By co-delivering a homologous donor template (either an integrase-defective lentiviral vector or a DNA oligonucleotide), high levels of gene modification were achieved in CD34(+) hematopoietic stem and progenitor cells. Modified cells maintained their ability to engraft NOD/SCID/IL2rγ(null) mice and to produce cells from multiple lineages, although with a reduction in the modification levels relative to the in vitro samples. Importantly, ZFN-driven gene correction in CD34(+) cells from the bone marrow of patients with SCD resulted in the production of wild-type hemoglobin tetramers. © 2015 by The American Society of Hematology.

  1. Impact of radio frequency electromagnetic radiation on DNA integrity in the male germline.

    PubMed

    Aitken, R J; Bennetts, L E; Sawyer, D; Wiklendt, A M; King, B V

    2005-06-01

    Concern has arisen over human exposures to radio frequency electromagnetic radiation (RFEMR), including a recent report indicating that regular mobile phone use can negatively impact upon human semen quality. These effects would be particularly serious if the biological effects of RFEMR included the induction of DNA damage in male germ cells. In this study, mice were exposed to 900 MHz RFEMR at a specific absorption rate of approximately 90 mW/kg inside a waveguide for 7 days at 12 h per day. Following exposure, DNA damage to caudal epididymal spermatozoa was assessed by quantitative PCR (QPCR) as well as alkaline and pulsed-field gel electrophoresis. The treated mice were overtly normal and all assessment criteria, including sperm number, morphology and vitality were not significantly affected. Gel electrophoresis revealed no gross evidence of increased single- or double-DNA strand breakage in spermatozoa taken from treated animals. However, a detailed analysis of DNA integrity using QPCR revealed statistically significant damage to both the mitochondrial genome (p < 0.05) and the nuclear beta-globin locus (p < 0.01). This study suggests that while RFEMR does not have a dramatic impact on male germ cell development, a significant genotoxic effect on epididymal spermatozoa is evident and deserves further investigation.

  2. Three 3D graphical representations of DNA primary sequences based on the classifications of DNA bases and their applications.

    PubMed

    Xie, Guosen; Mo, Zhongxi

    2011-01-21

    In this article, we introduce three 3D graphical representations of DNA primary sequences, which we call RY-curve, MK-curve and SW-curve, based on three classifications of the DNA bases. The advantages of our representations are that (i) these 3D curves are strictly non-degenerate and there is no loss of information when transferring a DNA sequence to its mathematical representation and (ii) the coordinates of every node on these 3D curves have clear biological implication. Two applications of these 3D curves are presented: (a) a simple formula is derived to calculate the content of the four bases (A, G, C and T) from the coordinates of nodes on the curves; and (b) a 12-component characteristic vector is constructed to compare similarity among DNA sequences from different species based on the geometrical centers of the 3D curves. As examples, we examine similarity among the coding sequences of the first exon of beta-globin gene from eleven species and validate similarity of cDNA sequences of beta-globin gene from eight species. Copyright © 2010 Elsevier Ltd. All rights reserved.

  3. Normal T lymphocytes can express two different T cell receptor beta chains: implications for the mechanism of allelic exclusion

    PubMed Central

    1995-01-01

    We have examined the extent of allelic exclusion at the T cell receptor (TCR) beta locus using monoclonal antibodies specific for V beta products. A small proportion (approximately 1%) of human peripheral blood T cells express two V beta as determined by flow cytometric analysis, isolation of representative clones, and sequencing of the corresponding V beta chains. Dual beta T cells are present in both the CD45R0+ and CD45R0- subset. These results indicate that dual beta expression is compatible with both central and peripheral selection. They also suggest that the substantial degree of TCR beta allelic exclusion is dependent only on asynchronous rearrangements at the beta locus, whereas the role of the pre-TCR is limited to signaling the presence of at least one functional beta protein. PMID:7699339

  4. Globin haplotypes of human T-cell lymphotropic virus type I-infected individuals in Salvador, Bahia, Brazil, suggest a post-Columbian African origin of this virus.

    PubMed

    Alcantara, Luiz Carlos; Van Dooren, Sonia; Gonçalves, Marilda Souza; Kashima, Simone; Costa, Maria Cristina Ramos; Santos, Fred Luciano Neves; Bittencourt, Achilea Lisboa; Dourado, Inês; Filho, Antonio Andrade; Covas, Dimas Tadeu; Vandamme, Anne-Mieke; Galvão-Castro, Bernardo

    2003-08-01

    The city of Salvador, Bahia, Brazil, has sociodemographic characteristics similar to some African cities. Up to now, it has had the highest prevalence of human T-cell lymphotropic virus type I (HTLV-I) infection (1.74%) in the country. To investigate which strains of HTLV-I are circulating in Salvador, we studied isolates from 82 patients infected with HTLV-I: 19 from the general population, 21 from pregnant women, 16 from intravenous drug users, and 26 from patients and their family attending a neurologic clinic. Phylogenetic analysis from part of the LTR fragments showed that most of these isolates belonged to the Transcontinental subgroup of the Cosmopolitan subtype (HTLV-Ia). Only one sample from a pregnant woman was closely related to the Japanese subgroup, suggesting recent introduction of a Japanese HTLV-I lineage into Salvador. betaA-Globin haplotypes were examined in 34 infected individuals and found to be atypical, confirming the racial heterogeneity of this population. A total of 20 chromosomes were characterized as Central African Republic (CAR) haplotype (29.4%), 31 (45.6%) were characterized as Benin (BEN) haplotype, and 17 (25%) were characterized as Senegal (SEN) haplotype. Five patients' genotypes (14.7%) were CAR/CAR; 10 (29,4%), BEN/BEN; 9 (26.5%), CAR/BEN; 2 (5.9%), BEN/SEN; and 7 (20.6%), SEN/SEN. One patient's genotype (2.9%) was CAR/SEN. The betaA-globin haplotype distribution in Salvador is unusual compared with other Brazilian states. Our data support the hypothesis of multiple post-Columbian introductions of African HTLV-Ia strains in Salvador, Bahia, Brazil.

  5. Frequency of haemoglobinopathies and glucose-6-phosphate dehydrogenase deficiency in Basra.

    PubMed

    Hassan, M K; Taha, J Y; Al-Naama, L M; Widad, N M; Jasim, S N

    2003-01-01

    Basra, southern Iraq, was mapped for haemoglobinopathies and glucose-6-phosphate dehydrogenase (G6PD) deficiency. Of 1064 couples aged 14-60 years recruited from the Public Health Laboratory, 49 had beta-thalassaemia trait, 69 had sickle-cell trait, 2 had haemoglobin D trait, 2 had haemoglobin C trait and 1 had high persistent fetal haemoglobin. Carriers of major beta-globin disorders comprised 11.48%. G6PD deficiency was detected in 133 individuals (12.5%). Only 10 couples (0.94%) were at risk of having children affected with either sickle-cell disease or beta-thalassaemia major. These defects constitute a real health problem and necessitate a management plan and public health education for early diagnosis and therapy.

  6. Hb Hope [beta136(H14)Gly-->Asp (GGT-->GAT)]: interactions with Hb S [beta6(A3)Glu-->Val (GAG-->GTG)], other variant hemoglobins and thalassemia.

    PubMed

    Ingle, John; Adewoye, Adeboye; Dewan, Robert; Okoli, Michael; Rollins, Lamarr; Eung, Shawn H; Luo, Hong-Yuan; Chui, David H K; Steinberg, Martin H

    2004-01-01

    Hb Hope [beta136(H14)Gly-->Asp (GGT-->GAT)] was first described in an African-American family in 1965. Since then, it has been found in combination with several different globin gene mutations in many other families of divergent ethnic backgrounds. The basis for its relatively frequent occurrences remains unexplained. This variant hemoglobin (Hb) is mildly unstable and has reduced oxygen affinity, but is generally innocuous clinically. This variant Hb can present as a confounding factor in arriving at a correct diagnosis by either electrophoresis or high performance liquid chromatography (HPLC), particularly during the neonatal period. DNA-based diagnostics can help solve this potential problem.

  7. Prevalence of βS-globin gene haplotypes, α-thalassemia (3.7 kb deletion) and redox status in patients with sickle cell anemia in the state of Paraná, Brazil

    PubMed Central

    Shimauti, Eliana LitsukoTomimatsu; Silva, Danilo Grunig Humberto; de Souza, Eniuce Menezes; de Almeida, Eduardo Alves; Leal, Francismar Prestes; Bonini-Domingos, Claudia Regina

    2015-01-01

    The aim of this study was to determine the frequency of beta S-globin gene (βS globin) haplotypes and alpha thalassemia with 3.7 kb deletion (−α3.7kb thalassemia) in the northwest region of Paraná state, and to investigate the oxidative and clinical-hematological profile of βS globin carriers in this population. Of the 77 samples analyzed, 17 were Hb SS, 30 were Hb AS and 30 were Hb AA. The βSglobin haplotypes and −α3.7kb thalassemia were identified using polymerase chain reaction.Trolox equivalent antioxidant capacity (TEAC) and lipid peroxidation (LPO) were assessed spectophotometrically. Serum melatonin levels were determined using high-performance liquid chromatography coupled to coulometric electrochemical detection. The haplotype frequencies in the SS individuals were as follows: Bantu- 21 (62%), Benin - 11 (32%) and Atypical- 2 (6%). Bantu/Benin was the most frequent genotype. Of the 47 SS and AS individuals assessed, 17% (n = 8) had the −α3.7kb mutation. Clinical manifestations, as well as serum melatonin, TEAC and LPO levels did not differ between Bantu/Bantu and Bantu/Benin individuals (p > 0.05). Both genotypes were associated with high LPO and TEAC levels and decreased melatonin concentration. These data suggest that the level of oxidative stress in patients with Bantu/Bantu and Bantu/Benin genotypes may overload the antioxidant capacity. PMID:26500435

  8. The effects of old and recent migration waves in the distribution of HBB*S globin gene haplotypes

    PubMed Central

    Lindenau, Juliana D.; Wagner, Sandrine C.; de Castro, Simone M.; Hutz, Mara H.

    2016-01-01

    Abstract Sickle cell hemoglobin is the result of a mutation at the sixth amino acid position of the beta (β) globin chain. The HBB*S gene is in linkage disequilibrium with five main haplotypes in the β-globin-like gene cluster named according to their ethnic and geographic origins: Bantu (CAR), Benin (BEN), Senegal (SEN), Cameroon (CAM) and Arabian-Indian (ARAB). These haplotypes demonstrated that the sickle cell mutation arose independently at least five times in human history. The distribution of βS haplotypes among Brazilian populations showed a predominance of the CAR haplotype. American populations were clustered in two groups defined by CAR or BEN haplotype frequencies. This scenario is compatible with historical records about the slave trade in the Americas. When all world populations where the sickle cell gene occurs were analyzed, three clusters were disclosed based on CAR, BEN or ARAB haplotype predominance. These patterns may change in the next decades due to recent migrations waves. Since these haplotypes show different clinical characteristics, these recent migrations events raise the necessity to develop optimized public health programs for sickle cell disease screening and management. PMID:27706371

  9. Beta-defensin genomic copy number is not a modifier locus for cystic fibrosis

    PubMed Central

    Hollox, Edward J; Davies, Jane; Griesenbach, Uta; Burgess, Juliana; Alton, Eric WFW; Armour, John AL

    2005-01-01

    Human beta-defensin 2 (DEFB4, also known as DEFB2 or hBD-2) is a salt-sensitive antimicrobial protein that is expressed in lung epithelia. Previous work has shown that it is encoded in a cluster of beta-defensin genes at 8p23.1, which varies in copy number between 2 and 12 in different individuals. We determined the copy number of this locus in 355 patients with cystic fibrosis (CF), and tested for correlation between beta-defensin cluster genomic copy number and lung disease associated with CF. No significant association was found. PMID:16336654

  10. A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

    PubMed

    Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

    2017-02-10

    Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (P<0.01), particularly when the disease was homozygous or double heterozygous with another α- or β-thalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the application of MS/MS for thalassemia screening, when combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Copyright © 2016. Published by Elsevier B.V.

  11. Characterization of the transcriptome profiles related to globin gene switching during in vitro erythroid maturation

    PubMed Central

    2012-01-01

    Background The fetal and adult globin genes in the human β-globin cluster on chromosome 11 are sequentially expressed to achieve normal hemoglobin switching during human development. The pharmacological induction of fetal γ-globin (HBG) to replace abnormal adult sickle βS-globin is a successful strategy to treat sickle cell disease; however the molecular mechanism of γ-gene silencing after birth is not fully understood. Therefore, we performed global gene expression profiling using primary erythroid progenitors grown from human peripheral blood mononuclear cells to characterize gene expression patterns during the γ-globin to β-globin (γ/β) switch observed throughout in vitro erythroid differentiation. Results We confirmed erythroid maturation in our culture system using cell morphologic features defined by Giemsa staining and the γ/β-globin switch by reverse transcription-quantitative PCR (RT-qPCR) analysis. We observed maximal γ-globin expression at day 7 with a switch to a predominance of β-globin expression by day 28 and the γ/β-globin switch occurred around day 21. Expression patterns for transcription factors including GATA1, GATA2, KLF1 and NFE2 confirmed our system produced the expected pattern of expression based on the known function of these factors in globin gene regulation. Subsequent gene expression profiling was performed with RNA isolated from progenitors harvested at day 7, 14, 21, and 28 in culture. Three major gene profiles were generated by Principal Component Analysis (PCA). For profile-1 genes, where expression decreased from day 7 to day 28, we identified 2,102 genes down-regulated > 1.5-fold. Ingenuity pathway analysis (IPA) for profile-1 genes demonstrated involvement of the Cdc42, phospholipase C, NF-Kβ, Interleukin-4, and p38 mitogen activated protein kinase (MAPK) signaling pathways. Transcription factors known to be involved in γ-and β-globin regulation were identified. The same approach was used to generate profile-2 genes where expression was up-regulated over 28 days in culture. IPA for the 2,437 genes with > 1.5-fold induction identified the mitotic roles of polo-like kinase, aryl hydrocarbon receptor, cell cycle control, and ATM (Ataxia Telangiectasia Mutated Protein) signaling pathways; transcription factors identified included KLF1, GATA1 and NFE2 among others. Finally, profile-3 was generated from 1,579 genes with maximal expression at day 21, around the time of the γ/β-globin switch. IPA identified associations with cell cycle control, ATM, and aryl hydrocarbon receptor signaling pathways. Conclusions The transcriptome analysis completed with erythroid progenitors grown in vitro identified groups of genes with distinct expression profiles, which function in metabolic pathways associated with cell survival, hematopoiesis, blood cells activation, and inflammatory responses. This study represents the first report of a transcriptome analysis in human primary erythroid progenitors to identify transcription factors involved in hemoglobin switching. Our results also demonstrate that the in vitro liquid culture system is an excellent model to define mechanisms of global gene expression and the DNA-binding protein and signaling pathways involved in globin gene regulation. PMID:22537182

  12. [Beta thalassemia major and pregnancy during adolescence: report of two cases].

    PubMed

    Trigo, Lucas Augusto Monteiro Castro; Surita, Fernanda Garanhani; Parpinelli, Mary Angela; Pereira, Belmiro Gonçalves; Fertrin, Kleber Yotsumoto; Costa, Maria Laura

    2015-06-01

    Beta thalassemia major is a rare hereditary blood disease in which impaired synthesis of beta globin chains causes severe anemia. Medical treatment consists of chronic blood transfusions and iron chelation. We describe two cases of adolescents with beta thalassemia major with unplanned pregnancies and late onset of prenatal care. One had worsening of anemia with increased transfusional requirement, fetal growth restriction, and placental senescence. The other was also diagnosed with hypothyroidism and low maternal weight, and was admitted twice during pregnancy due to dengue shock syndrome and influenza H1N1-associated respiratory infection. She also developed fetal growth restriction and underwent vaginal delivery at term complicated by uterine hypotonia. Both patients required blood transfusions after birth and chose medroxyprogesterone as a contraceptive method afterwards. This report highlights the importance of medical advice on contraceptive methods for these women and the role of a specialized prenatal follow-up in association with a hematologist.

  13. High-Efficiency Synthesis of Human α-Endorphin and Magainin in the Erythrocytes of Transgenic Mice: A Production System for Therapeutic Peptides

    NASA Astrophysics Data System (ADS)

    Sharma, Ajay; Khoury-Christianson, Anastasia M.; White, Steven P.; Dhanjal, Nirpal K.; Huang, Wen; Paulhiac, Clara; Friedman, Eric J.; Manjula, Belur N.; Kumar, Ramesh

    1994-09-01

    Chemical synthesis of peptides, though feasible, is hindered by considerations of cost, purity, and efficiency of synthesizing longer chains. Here we describe a transgenic system for producing peptides of therapeutic interest as fusion proteins at low cost and high purity. Transgenic hemoglobin expression technology using the locus control region was employed to produce fusion hemoglobins in the erythrocytes of mice. The fusion hemoglobin contains the desired peptide as an extension at the C end of human α-globin. A protein cleavage site is inserted between the C end of the α-globin chain and the N-terminal residue of the desired peptide. The peptide is recovered after cleavage of the fusion protein with enzymes that recognize this cleavage signal as their substrate. Due to the selective compartmentalization of hemoglobin in the erythrocytes, purification of the fusion hemoglobin is easy and efficient. Because of its compact and highly ordered structure, the internal sites of hemoglobin are resistant to protease digestion and the desired peptide is efficiently released and recovered. The applicability of this approach was established by producing a 16-mer α-endorphin peptide and a 26-mer magainin peptide in transgenic mice. Transgenic animals and their progeny expressing these fusion proteins remain healthy, even when the fusion protein is expressed at >25% of the total hemoglobin in the erythrocytes. Additional applications and potential improvements of this methodology are discussed.

  14. Creating a monomeric endonuclease TALE-I-SceI with high specificity and low genotoxicity in human cells.

    PubMed

    Lin, Jianfei; Chen, He; Luo, Ling; Lai, Yongrong; Xie, Wei; Kee, Kehkooi

    2015-01-01

    To correct a DNA mutation in the human genome for gene therapy, homology-directed repair (HDR) needs to be specific and have the lowest off-target effects to protect the human genome from deleterious mutations. Zinc finger nucleases, transcription activator-like effector nuclease (TALEN) and CRISPR-CAS9 systems have been engineered and used extensively to recognize and modify specific DNA sequences. Although TALEN and CRISPR/CAS9 could induce high levels of HDR in human cells, their genotoxicity was significantly higher. Here, we report the creation of a monomeric endonuclease that can recognize at least 33 bp by fusing the DNA-recognizing domain of TALEN (TALE) to a re-engineered homing endonuclease I-SceI. After sequentially re-engineering I-SceI to recognize 18 bp of the human β-globin sequence, the re-engineered I-SceI induced HDR in human cells. When the re-engineered I-SceI was fused to TALE (TALE-ISVB2), the chimeric endonuclease induced the same HDR rate at the human β-globin gene locus as that induced by TALEN, but significantly reduced genotoxicity. We further demonstrated that TALE-ISVB2 specifically targeted at the β-globin sequence in human hematopoietic stem cells. Therefore, this monomeric endonuclease has the potential to be used in therapeutic gene targeting in human cells. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

    PubMed Central

    Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2013-01-01

    In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

  16. A comprehensive review of the prevalence of beta globin gene variations and the co-inheritance of related gene variants in Saudi Arabians with beta-thalassemia

    PubMed Central

    Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis

    2018-01-01

    Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482

  17. Circulating DNA: a potential marker of sickle cell crisis.

    PubMed

    Vasavda, Nisha; Ulug, Pinar; Kondaveeti, Sheila; Ramasamy, Karthik; Sugai, Taku; Cheung, Gordon; Rees, David C; Awogbade, Moji; Bannister, Sybil; Cunningham, Juliette; Menzel, Stephan; Thein, Swee Lay

    2007-10-01

    Free circulating DNA is present in the plasma of healthy subjects, and is elevated in conditions characterized by increased cell death, such as cancer and physical trauma. Analysis of circulating DNA in plasma could provide a useful biomarker in sickle cell disease (SCD) in view of the increased cell turnover through chronic ongoing haemolysis, recurrent vaso-occlusion and inflammation. Plasma DNA was determined by real-time quantitative polymerase chain reaction (PCR) amplification of the beta-globin gene (HBB) in 154 patients with SCD [105 haemoglobin (Hb)SS, 46 HbSC and three HbS/beta(0) thalassaemia] and 53 ethnically matched controls. Blood samples were obtained from all patients in steady state; 21 of the 154 patients were also sampled during admission to hospital for acute pain. Median concentration of circulating plasma DNA in acute pain was more than 10-fold that in steady state and in controls - 10070 vs. 841 and 10070 vs. 933 genome equivalents/ml respectively (P < 0.0001, in both cases). During steady state, patients had plasma DNA levels similar to controls. Plasma DNA levels in SCD correlated with C-reactive protein levels (P < 0.005) and total white cell counts (P < 0.05) in steady state. The study shows that plasma DNA concentration may have potential as a biomarker in sickle cell patients.

  18. Cell-free fetal DNA (SRY locus) concentration in maternal plasma is directly correlated to the time elapsed from the onset of preeclampsia to the collection of blood.

    PubMed

    Farina, Antonio; Sekizawa, Akihiko; Rizzo, Nicola; Concu, Manuela; Banzola, Irina; Carinci, Paolo; Simonazzi, Giuliana; Okai, Takashi

    2004-04-01

    To determine (1) if fetal DNA (fDNA) in the maternal circulation in women affected by preeclampsia correlates with the time elapsed from the onset of symptoms to the time of blood collection, and (2) if the inclusion of this variable improves the discrimination between affected and unaffected patients by using fDNA distributions. Plasma were collected from 34 women at 33.7 +/- 3.9 weeks' gestation, affected by preeclampsia, and bearing a single male fetus. fDNA was extracted from 1.5-mL plasma samples, and the SRY and beta-globin gene were analyzed by real-time quantitative PCR. MoMs (multiple of the control median) were calculated by using a log equation of 102 normal cases. Log MoMs were then plotted against the time elapsed from onset of symptoms to blood collection (expressed in days) by means of a log-linear regression. Adjusted MoMs were then calculated. ROC curves were used to test the discrimination obtained by using adjusted MoMs. The median MoMs of controls and preeclamptic patients were 1.00 +/- 1.53 and 2.62 +/- 2.70 respectively. By plotting log MoM fDNA against the time elapsed from onset of symptoms to blood collection, we found a significant positive correlation, (p-value < 0.001, R2 = 0.55, F = 38.97, from 1 to 50 days). The adjusted median fDNA MoM was 2.66 +/- 2.50. Areas under the curves, as estimated by ROC curves, were 76.7 for unadjusted and 85.5 for adjusted MoMs respectively (p-value = 0.02). The effect of a further covariate showed that (1) fDNA passage from trophoblasts to maternal circulation for unit of time is proportional to the duration of the damage and that (2) increased discrimination can be obtained in comparison to normal subjects. Copyright 2004 John Wiley & Sons, Ltd.

  19. Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis.

    PubMed

    Hallur, V; Sehgal, R; Khurana, S

    2015-01-01

    The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR) inhibitors thus, undermining the confidence of a laboratory physician. We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.

  20. Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations

    PubMed Central

    Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

    2007-01-01

    Background The sickle (βs) mutation in the beta-globin gene (HBB) occurs on five "classical" βs haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the βs allele – a consequence of protection from severe malarial infection afforded by heterozygotes – has been associated with a high degree of extended haplotype similarity. The relationship between classical βs haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical βs haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). Results The most common βs sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the βs mutation. Conclusion Two different classical βs haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of βs haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle cell disease, could lie considerable distances away from β-globin. PMID:17688704

  1. No significant association between the genetic polymorphisms in the GSK-3 beta gene and schizophrenia in the Chinese population.

    PubMed

    Meng, Junwei; Shi, Yongyong; Zhao, Xinzhi; Zhou, Jian; Zheng, Yonglan; Tang, Ruqi; Ma, Gang; Zhu, Xuming; He, Zangdong; Wang, Zhe; Xu, Yifeng; Feng, Guoyin; He, Lin

    2008-04-01

    The GSK-3 beta gene encodes a protein kinase which is abundant in the brain, and its product is involved in signal transduction cascades of neuronal cell development, energy metabolism and body pattern formation. Previous studies have suggested that GSK-3 beta might act as a potential candidate locus for schizophrenia susceptibility. We genotyped six SNPs within the gene and conducted a case-control study involving 329 schizophrenic patients and 288 healthy subjects in the Chinese population. We examined allele and genotype frequencies and haplotype distributions in the subtype of paranoid schizophrenic patients as well as schizophrenic subjects in general. Our results fail to replicate the association of the GSK-3 beta gene with susceptibility to schizophrenia in the Chinese population.

  2. The complexity of selection at the major primate beta-defensin locus.

    PubMed

    Semple, Colin A M; Maxwell, Alison; Gautier, Philippe; Kilanowski, Fiona M; Eastwood, Hayden; Barran, Perdita E; Dorin, Julia R

    2005-05-18

    We have examined the evolution of the genes at the major human beta-defensin locus and the orthologous loci in a range of other primates and mouse. For the first time these data allow us to examine selective episodes in the more recent evolutionary history of this locus as well as the ancient past. We have used a combination of maximum likelihood based tests and a maximum parsimony based sliding window approach to give a detailed view of the varying modes of selection operating at this locus. We provide evidence for strong positive selection soon after the duplication of these genes within an ancestral mammalian genome. Consequently variable selective pressures have acted on beta-defensin genes in different evolutionary lineages, with episodes both of negative, and more rarely positive selection, during the divergence of primates. Positive selection appears to have been more common in the rodent lineage, accompanying the birth of novel, rodent-specific beta-defensin genes. These observations allow a fuller understanding of the evolution of mammalian innate immunity. In both the rodent and primate lineages, sites in the second exon have been subject to positive selection and by implication are important in functional diversity. A small number of sites in the mature human peptides were found to have undergone repeated episodes of selection in different primate lineages. Particular sites were consistently implicated by multiple methods at positions throughout the mature peptides. These sites are clustered at positions predicted to be important for the specificity of the antimicrobial or chemoattractant properties of beta-defensins. Surprisingly, sites within the prepropeptide region were also implicated as being subject to significant positive selection, suggesting previously unappreciated functional significance for this region. Identification of these putatively functional sites has important implications for our understanding of beta-defensin function and for novel antibiotic design.

  3. Development of an adenoviral vector with robust expression driven by p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

    2008-02-05

    Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

  4. The Full Globin Repertoire of Turtles Provides Insights into Vertebrate Globin Evolution and Functions.

    PubMed

    Schwarze, Kim; Singh, Abhilasha; Burmester, Thorsten

    2015-06-15

    Globins are small heme proteins that play an important role in oxygen supply, but may also have other functions. Globins offer a unique opportunity to study the functional evolution of genes and proteins. We have characterized the globin repertoire of two different turtle species: the Chinese softshell turtle (Pelodiscus sinensis) and the western painted turtle (Chrysemys picta bellii). In the genomes of both species, we have identified eight distinct globin types: hemoglobin (Hb), myoglobin, neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Therefore, along with the coelacanth, turtles are so far the only known vertebrates with a full globin repertoire. This fact allows for the first time a comparative analysis of the expression of all eight globins in a single species. Phylogenetic analysis showed an early divergence of neuroglobin and globin X before the radiation of vertebrates. Among the other globins, cytoglobin diverged first, and there is a close relationship between myoglobin and globin E; the position of globin Y is not resolved. The globin E gene was selectively lost in the green anole, and the genes coding for globin X and globin Y were deleted in chicken. Quantitative real-time reverse transcription polymerase chain reaction experiments revealed that myoglobin, neuroglobin, and globin E are highly expressed with tissue-specific patterns, which are in line with their roles in the oxidative metabolism of the striated muscles, the brain, and the retina, respectively. Histochemical analyses showed high levels of globin E in the pigment epithelium of the eye. Globin E probably has a myoglobin-like role in transporting O2 across the pigment epithelium to supply in the metabolically highly active retina. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Silver nanoparticle-induced hemoglobin decrease involves alteration of histone 3 methylation status.

    PubMed

    Qian, Yi; Zhang, Jie; Hu, Qinglin; Xu, Ming; Chen, Yue; Hu, Guoqing; Zhao, Meirong; Liu, Sijin

    2015-11-01

    Silver nanoparticles (nanosilver, AgNPs) have been shown to induce toxicity in vitro and in vivo; however, the molecular bases underlying the detrimental effects have not been thoroughly understood. Although there are numerous studies on its genotoxicity, only a few studies have investigated the epigenetic changes, even less on the changes of histone modifications by AgNPs. In the current study, we probed the AgNP-induced alterations to histone methylation that could be responsible for globin reduction in erythroid cells. AgNP treatment caused a significant reduction of global methylation level for histone 3 (H3) in erythroid MEL cells at sublethal concentrations, devoid of oxidative stress. The ChIP-PCR analyses demonstrated that methylation of H3 at lysine (Lys) 4 (H3K4) and Lys 79 (H3K79) on the β-globin locus was greatly reduced. The reduction in methylation could be attributed to decreased histone methyltransferase DOT-1L and MLL levels as well as the direct binding between AgNPs to H3/H4 that provide steric hindrance to prevent methylation as predicted by the all-atom molecular dynamics simulations. This direct interaction was further proved by AgNP-mediated pull-down assay and immunoprecipitation assay. These changes, together with decreased RNA polymerase II activity and chromatin binding at this locus, resulted in decreased hemoglobin production. By contrast, Ag ion-treated cells showed no alterations in histone methylation level. Taken together, these results showed a novel finding in which AgNPs could alter the methylation status of histone. Our study therefore opens a new avenue to study the biological effects of AgNPs at sublethal concentrations from the perspective of epigenetic mechanisms. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Genome-wide association analysis of red blood cell traits in African Americans: the COGENT Network

    PubMed Central

    Chen, Zhao; Tang, Hua; Qayyum, Rehan; Schick, Ursula M.; Nalls, Michael A.; Handsaker, Robert; Li, Jin; Lu, Yingchang; Yanek, Lisa R.; Keating, Brendan; Meng, Yan; van Rooij, Frank J.A.; Okada, Yukinori; Kubo, Michiaki; Rasmussen-Torvik, Laura; Keller, Margaux F.; Lange, Leslie; Evans, Michele; Bottinger, Erwin P.; Linderman, Michael D.; Ruderfer, Douglas M.; Hakonarson, Hakon; Papanicolaou, George; Zonderman, Alan B.; Gottesman, Omri; Thomson, Cynthia; Ziv, Elad; Singleton, Andrew B.; Loos, Ruth J.F.; Sleiman, Patrick M.A.; Ganesh, Santhi; McCarroll, Steven; Becker, Diane M.; Wilson, James G.; Lettre, Guillaume; Reiner, Alexander P.

    2013-01-01

    Laboratory red blood cell (RBC) measurements are clinically important, heritable and differ among ethnic groups. To identify genetic variants that contribute to RBC phenotypes in African Americans (AAs), we conducted a genome-wide association study in up to ∼16 500 AAs. The alpha-globin locus on chromosome 16pter [lead SNP rs13335629 in ITFG3 gene; P < 1E−13 for hemoglobin (Hgb), RBC count, mean corpuscular volume (MCV), MCH and MCHC] and the G6PD locus on Xq28 [lead SNP rs1050828; P < 1E − 13 for Hgb, hematocrit (Hct), MCV, RBC count and red cell distribution width (RDW)] were each associated with multiple RBC traits. At the alpha-globin region, both the common African 3.7 kb deletion and common single nucleotide polymorphisms (SNPs) appear to contribute independently to RBC phenotypes among AAs. In the 2p21 region, we identified a novel variant of PRKCE distinctly associated with Hct in AAs. In a genome-wide admixture mapping scan, local European ancestry at the 6p22 region containing HFE and LRRC16A was associated with higher Hgb. LRRC16A has been previously associated with the platelet count and mean platelet volume in AAs, but not with Hgb. Finally, we extended to AAs the findings of association of erythrocyte traits with several loci previously reported in Europeans and/or Asians, including CD164 and HBS1L-MYB. In summary, this large-scale genome-wide analysis in AAs has extended the importance of several RBC-associated genetic loci to AAs and identified allelic heterogeneity and pleiotropy at several previously known genetic loci associated with blood cell traits in AAs. PMID:23446634

  7. Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

    PubMed

    Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

    2006-01-01

    The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

  8. Multiple displacement amplification on single cell and possible PGD applications.

    PubMed

    Hellani, Ali; Coskun, Serdar; Benkhalifa, Moncef; Tbakhi, Abelghani; Sakati, Nadia; Al-Odaib, Ali; Ozand, Pinar

    2004-11-01

    Multiple displacement amplification (MDA) is a technique used in the amplification of very low amounts of DNA and reported to yield large quantities of high-quality DNA. We used MDA to amplify the whole genome directly from a single cell. The most common techniques used in PGD are PCR and fluorescent in-situ hybridization (FISH). There are many limitations to these techniques including, the number of chromosomes diagnosed for FISH or the quality of DNA issued from a single cell PCR. This report shows, for the first time, use of MDA for single cell whole genome amplification. A total of 16 short tandem repeats (STRs) were amplified successfully with a similar pattern to the genomic DNA. Furthermore, allelic drop out (ADO) derived from MDA was assessed in 40 single cells by analysing (i) heterozygosity for a known beta globin mutation (IVSI-5 C-G) and by studying (ii) the heterozygous loci present in the STRs. ADO turned out to be 10.25% for the beta globin gene sequencing and 5% for the fluorescent PCR analysis of STRs. Moreover, the amplification accuracy of MDA permitted the detection of trisomy 21 on a single cell using comparative genome hybridization-array. Altogether, these data suggest that MDA can be used for single cell molecular karyotyping and the diagnosis of any single gene disorder in PGD.

  9. Control of Growth Within Drosophila Peripheral Nerves by Ras and Protein Kinase A

    DTIC Science & Technology

    2009-02-01

    channel gene on behavior and axonal excitability. Genetics 124: 133– 143 . 20. Chouinard SW, Wilson GF, Schlimgen AK, Ganetzky B (1995) A potassium...channel beta subunit related to the aldo- keto reductase superfamily is encoded by the Drosophila hyperkinetic locus. Proc Natl Acad Sci U S A 92: 6763–6767

  10. Molecular Characterization and Expression of α-Globin and β-Globin Genes in the Euryhaline Flounder (Platichthys flesus)

    PubMed Central

    Lu, Weiqun; Mayolle, Aurelie; Cui, Guoqiang; Luo, Lei; Balment, Richard J.

    2011-01-01

    In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were both 447 bp. Although the head kidney (pronephros) is the predicted major site of haematopoiesis, real-time PCR revealed that expression of α-globin and β-globin in kidney (mesonephros) was 1.5 times higher than in head kidney. Notably, the α1-globin and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits were higher in freshwater- (FW-) than in seawater- (SW-)adapted fish kidney. If globins do play a role in salinity adaptation, this is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which occur in SW. PMID:21969841

  11. Therapeutic fetal-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms.

    PubMed

    Dai, Yan; Sangerman, Jose; Luo, Hong Yuan; Fucharoen, Suthat; Chui, David H K; Faller, Douglas V; Perrine, Susan P

    2016-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ-globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

    PubMed Central

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  13. Electrocardiographic Presentation, Cardiac Arrhythmias, and Their Management in β-Thalassemia Major Patients.

    PubMed

    Russo, Vincenzo; Rago, Anna; Papa, Andrea Antonio; Nigro, Gerardo

    2016-07-01

    Beta-thalassemia major (β-TM) is a genetic hemoglobin disorder characterized by an absent synthesis of globin chains that are essential for hemoglobin formation, causing chronic hemolytic anemia. Clinical management of thalassemia major consists in regular long-life red blood cell transfusions and iron chelation therapy to remove iron introduced in excess with transfusions. Iron deposition in combination with inflammatory and immunogenic factors is involved in the pathophysiology of cardiac dysfunction in these patients. Heart failure and arrhythmias, caused by myocardial siderosis, are the most important life-limiting complications of iron overload in beta-thalassemia patients. Cardiac complications are responsible for 71% of global death in the beta-thalassemia major patients. The aim of this review was to describe the most frequent electrocardiographic abnormalities and arrhythmias observed in β-TM patients, analyzing their prognostic impact and current treatment strategies. © 2016 Wiley Periodicals, Inc.

  14. Clinical and hematological response to hydroxyurea in a patient with Hb Lepore/beta-thalassemia.

    PubMed

    Rigano, P; Manfré, L; La Galla, R; Renda, D; Renda, M C; Calabrese, A; Calzolari, R; Maggio, A

    1997-05-01

    The possibility of increasing Hb F in vivo using drugs like 5-azacytidine, hydroxyurea, and butyrate has been established. However, in many cases this does not entail an increase in total hemoglobin. We report on a patient with Hb Lepore/beta-thalassemia being treated with hydroxyurea (30 mg/Kg/day) because of the presence of erythroid extramedullary masses with severe neurological abnormalities. During therapy the patient showed a remarkable improvement in neurological signs due to the reduction in extra-medullary masses, a significant increase in both total hemoglobin (from 5.8 to 9.7 g/dl) and Hb F (from 4.9 g/dl to 9.1 g/dl). The marked improvement in hemoglobin level in our patient with Hb Lepore/beta-thalassemia suggests gamma-globin gene activation due to the DNA structure determined by the crossover event.

  15. Coexistence of Southeast Asian ovalocytosis and beta-thalassemia: a molecular and hematological analysis.

    PubMed

    Fucharoen, Goonnapa; Fucharoen, Supan; Singsanan, Sanita; Sanchaisuriya, Kanokwan

    2007-05-01

    We describe hematological and molecular characterization of a Thai female who had Southeast Asian ovalocytosis (SAO) associated with beta+-thalassemia trait. The proband had mild microcytosis with Hb 12.9 g/dl, Hct 35.8%, MCV 74.4 fl, MCH 26.8 pg, MCHC 36.0 g/dl, and elevated Hb A2 (5.6%), characteristics of beta-thalassemia trait. Peripheral blood film examination revealed prominent ovalocytosis. However, a one-tube osmotic fragility (OF) test commonly used for thalassemia screening was negative and a normal OF curve was observed. Further polymerase chain reaction (PCR) analyses identified the beta(-28A-G) mutation in the beta-globin gene and a 27 bp deletion in erythrocyte band 3 protein gene, indicating a genetically compound heterozygote. Hematological data of the proband was comparatively presented with those of eight female and 15 male carriers of pure beta-thalassemia with the same mutation. The finding demonstrates that although the association of the SAO and beta-thalassemia does not produce a more severe clinical picture, this could lead to a mis-screening of beta-thalassemia using an OF test as a primary screening test. Additional blood film examination followed by PCR could help in the detection of this unusual genetic interaction in the region. (c) 2006 Wiley-Liss, Inc.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martinell, J.; Whitney, J.B.; Popp, R.A.

    Three types of mice with globin gene mutations, called 352HB, 27HB, and Hba/sup th-J/, appear to be true animal models of human thalassemia. Expression of the ..cap alpha..-globin genes in three stocks of mice, each one heterozygous for one of the ..cap alpha..-globin mutations, was examined at the polypeptide, RNA, and DNA levels. ..cap alpha..-globin polypeptide chains, relative to ..gamma..-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of ..cap alpha..-globin to ..gamma..-globin RNA sequences are also 75 to 80% normal, exactly reflecting the ..cap alpha..-globin to ..gamma..-globin chain ratios. In the case ofmore » mutant 352HB, at least one ..cap alpha..-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their ..cap alpha..-globin genes.« less

  17. Clinical, genetic and fertility studies of Indians with beta S-globin gene and the influence of Hb S on Plasmodium falciparum malaria infection.

    PubMed

    Joishy, S K; Hassan, K; Lopes, M; Lie-Injo, L E

    1988-01-01

    Clinical studies were carried out on mild Indian sickle cell anaemia in Malaysia, and genetic and fertility studies were carried out on 101 families with and without sickle-cell haemoglobin (Hb S). The Indian sickle cell anaemia patients reached adulthood, and pregnancies and deliveries were uneventful without blood transfusion. There was no foetal wastage and the number of children produced was not significantly different from that in families without Hb S. 28 Indian patients hospitalized with Plasmodium falciparum malaria infection were also examined for their beta S genotype. P. falciparum malaria infection occurred much more frequently in individuals without Hb S than in Hb S carriers.

  18. Localization of the human {beta}-catenin gene (CTNNB1) to 3p21: A region implicated in tumor development

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kraus, C.; Liehr, T.; Ballhausen, G.

    1994-09-01

    The human {beta}-catenin locus (CTNNB1) was mapped by in situ fluorescence analysis to band p21 on the short arm of chromosome 3, a region frequently affected by somatic alterations in a variety of tumors. PCR primers for the genomic amplification of {beta}-catenin sequences were selected on the basis of homology to exon 4 of the Drosophila armadillo gene. Analysis of a panel of somatic cell hybrids confirmed the localization of {beta}-catenin on human chromosome 3. Furthermore, exclusion mapping of three hybrids carrying defined fragments of the short arm of human chromosome 3 allowed us to determine the position of themore » CTNNB1 locus close to the marker D3S2 in 3p21. 22 refs., 3 figs.« less

  19. Single-molecule RNA observation in vivo reveals dynamics of co-transcriptional splicing

    NASA Astrophysics Data System (ADS)

    Ferguson, M. L.; Coulon, A.; de Turris, V.; Palangat, M.; Chow, C. C.; Singer, R. H.; Larson, D. R.

    2013-03-01

    The synthesis of pre-mRNA and the splicing of that pre-mRNA to form completed transcripts requires coordination between two large multi-subunit complexes (the transcription elongation complex and the spliceosome). How this coordination occurs in vivo is unknown. Here we report the first experimental observation of transcription and splicing occurring at the same gene in living cells. By utilizing the PP7/MS2 fluorescent RNA reporter system, we can directly observe two distinct regions of the nascent RNA, allowing us to measure the rise and fall time of the intron and exon of a reporter gene stably integrated into a human cell line. The reporter gene consists of a beta globin gene where we have inserted a 24 RNA hairpin cassette into the intron/exon. Upon synthesis, the RNA hairpins are tightly bound by fluorescently-labeled PP7/MS2 bacteriophage coat proteins. After gene induction, a single locus of active transcription in the nucleus shows fluorescence intensity changes characteristic of the synthesis and excision of the intron/exon. Using fluctuation analysis, we determine the elongation rate to be 1.5 kb/min. From the temporal cross correlation function, we determine that splicing of this gene must be co-transcriptional with a splicing time of ~100 seconds before termination and a ~200 second pause at termination. We propose that dual-color RNA imaging may be extended to investigate other mechanisms of transcription, gene regulation, and RNA processing.

  20. Integrating Evolutionary and Functional Tests of Adaptive Hypotheses: A Case Study of Altitudinal Differentiation in Hemoglobin Function in an Andean Sparrow, Zonotrichia capensis

    PubMed Central

    Cheviron, Zachary A.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Eddy, Douglas K.; Jones, Jennifer; Carling, Matthew D.; Witt, Christopher C.; Moriyama, Hideaki; Weber, Roy E.; Fago, Angela; Storz, Jay F.

    2014-01-01

    In air-breathing vertebrates, the physiologically optimal blood-O2 affinity is jointly determined by the prevailing partial pressure of atmospheric O2, the efficacy of pulmonary O2 transfer, and internal metabolic demands. Consequently, genetic variation in the oxygenation properties of hemoglobin (Hb) may be subject to spatially varying selection in species with broad elevational distributions. Here we report the results of a combined functional and evolutionary analysis of Hb polymorphism in the rufous-collared sparrow (Zonotrichia capensis), a species that is continuously distributed across a steep elevational gradient on the Pacific slope of the Peruvian Andes. We integrated a population genomic analysis that included all postnatally expressed Hb genes with functional studies of naturally occurring Hb variants, as well as recombinant Hb (rHb) mutants that were engineered through site-directed mutagenesis. We identified three clinally varying amino acid polymorphisms: Two in the αA-globin gene, which encodes the α-chain subunits of the major HbA isoform, and one in the αD-globin gene, which encodes the α-chain subunits of the minor HbD isoform. We then constructed and experimentally tested single- and double-mutant rHbs representing each of the alternative αA-globin genotypes that predominate at different elevations. Although the locus-specific patterns of altitudinal differentiation suggested a history of spatially varying selection acting on Hb polymorphism, the experimental tests demonstrated that the observed amino acid mutations have no discernible effect on respiratory properties of the HbA or HbD isoforms. These results highlight the importance of experimentally validating the hypothesized effects of genetic changes in protein function to avoid the pitfalls of adaptive storytelling. PMID:25135942

  1. Electromobility Shift Assay Reveals Evidence in Favor of Allele-Specific Binding of RUNX1 to the 5' Hypersensitive Site 4-Locus Control Region.

    PubMed

    Dehghani, Hossein; Ghobakhloo, Sepideh; Neishabury, Maryam

    2016-08-01

    In our previous studies on the Iranian β-thalassemia (β-thal) patients, we identified an association between the severity of the β-thal phenotype and the polymorphic palindromic site at the 5' hypersensitive site 4-locus control region (5'HS4-LCR) of the β-globin gene cluster. Furthermore, a linkage disequilibrium was observed between this region and XmnI-HBG2 in the patient population. Based on this data, it was suggested that the well-recognized phenotype-ameliorating role assigned to positive XmnI could be associated with its linked elements in the LCR. To investigate the functional significance of polymorphisms at the 5'HS4-LCR, we studied its influence on binding of transcription factors. Web-based predictions of transcription factor binding revealed a binding site for runt-related transcription factor 1 (RUNX1), when the allele at the center of the palindrome (TGGGG(A/G)CCCCA) was A but not when it was G. Furthermore, electromobility shift assay (EMSA) presented evidence in support of allele-specific binding of RUNX1 to 5'HS4. Considering that RUNX1 is a well-known regulator of hematopoiesis, these preliminary data suggest the importance of further studies to confirm this interaction and consequently investigate its functional and phenotypical relevance. These studies could help us to understand the molecular mechanism behind the phenotype modifying role of the 5'HS4-LCR polymorphic palindromic region (rs16912979), which has been observed in previous studies.

  2. Context-dependent EKLF responsiveness defines the developmental specificity of the human ɛ-globin gene in erythroid cells of YAC transgenic mice

    PubMed Central

    Tanimoto, Keiji; Liu, Qinghui; Grosveld, Frank; Bungert, Jörg; Engel, James Douglas

    2000-01-01

    We explored the mechanism of definitive-stage ɛ-globin transcriptional inactivity within a human β-globin YAC expressed in transgenic mice. We focused on the globin CAC and CAAT promoter motifs, as previous laboratory and clinical studies indicated a pivotal role for these elements in globin gene activation. A high-affinity CAC-binding site for the erythroid krüppel-like factor (EKLF) was placed in the ɛ-globin promoter at a position corresponding to that in the adult β-globin promoter, thereby simultaneously ablating a direct repeat (DR) element. This mutation led to EKLF-independent ɛ-globin transcription during definitive erythropoiesis. A second 4-bp substitution in the ɛ-globin CAAT sequence, which simultaneously disrupts a second DR element, further enhanced ectopic definitive erythroid activation of ɛ-globin transcription, which surprisingly became EKLF dependent. We finally examined factors in nuclear extracts prepared from embryonic or adult erythroid cells that bound these elements in vitro, and we identified a novel DR-binding protein (DRED) whose properties are consistent with those expected for a definitive-stage ɛ-globin repressor. We conclude that the suppression of ɛ-globin transcription during definitive erythropoiesis is mediated by the binding of a repressor that prevents EKLF from activating the ɛ-globin gene. PMID:11069894

  3. Correction of Murine Sickle Cell Disease Using γ-Globin Lentiviral Vectors to Mediate High-level Expression of Fetal Hemoglobin

    PubMed Central

    Pestina, Tamara I; Hargrove, Phillip W; Jay, Dennis; Gray, John T; Boyd, Kelli M; Persons, Derek A

    2008-01-01

    Increased levels of red cell fetal hemogloblin, whether due to hereditary persistence of expression or from induction with hydroxyurea therapy, effectively ameliorate sickle cell disease (SCD). Therefore, we developed erythroid-specific, γ-globin lentiviral vectors for hematopoietic stem cell (HSC)-targeted gene therapy with the goal of permanently increasing fetal hemoglobin (HbF) production in sickle red cells. We evaluated two different γ-globin lentiviral vectors for therapeutic efficacy in the BERK sickle cell mouse model. The first vector, V5, contained the γ-globin gene driven by 3.1 kb of β-globin regulatory sequences and a 130-bp β-globin promoter. The second vector, V5m3, was identical except that the γ-globin 3′-untranslated region (3′-UTR) was replaced with the β-globin 3′-UTR. Adult erythroid cells have β-globin mRNA 3′-UTR-binding proteins that enhance β-globin mRNA stability and we postulated this design might enhance γ-globin expression. Stem cell gene transfer was efficient and nearly all red cells in transplanted mice expressed human γ-globin. Both vectors demonstrated efficacy in disease correction, with the V5m3 vector producing a higher level of γ-globin mRNA which was associated with high-level correction of anemia and secondary organ pathology. These data support the rationale for a gene therapy approach to SCD by permanently enhancing HbF using a γ-globin lentiviral vector. PMID:19050697

  4. Hemoglobin switching in sheep and goats. VI. Commitment of erythroid colony-forming cells to the synthesis of betaC globin

    PubMed Central

    1976-01-01

    Bone marrow from mature goats and sheep was cultured in plasma clots, and three erythropoietin (ESF)-dependent responses-growth (colony formation), differentiation (globin production), and initiation of hemoglobin C (alpha2beta2C) synthesis--were quantitated. ESF concentrations below 0.01 U/ml supported colony growth and adult hemoglobin production in cultures of goat marrow, while maximal hemoglobin C synthesis (70%), as measured between 72 and 96 h in culture, required a 100-fold higher ESF concentration. Sheep marrow was cultured in a medium enriched to enhance growth and to permit complete maturation of colonies. These colonies active in hemoglobin synthesis between 24 and 96 h produced mainly adult hemoglobin, and only between 96 and 120 h did sheep colonies develop which produced mainly hemoglobin C (up to 70%). A similar heterogeneity may exist among goat colonies. Thus, when goat bone marrow was fractionated by unit gravity sedimentation, more hemoglobin C synthesis was observed in colonies derived from cells of intermediate sedimentation velocity than in colonies derived from the most rapidly sedimenting cells. Brief exposure of sheep (in vivo) and goat (in vitro) bone marrow to a high ESF concentration committed precursor cells to the generation of colonies which, even at low ESF concentration, produced hemoglobin C. Committment to hemoglobin phenotype appears to be an early and probably irreversible event in the development of an erythroid cell. PMID:993267

  5. Correlation of MFOLD-predicted DNA secondary structures with separation patterns obtained by capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis.

    PubMed

    Glavac, Damjan; Potocnik, Uros; Podpecnik, Darja; Zizek, Teofil; Smerkolj, Sava; Ravnik-Glavac, Metka

    2002-04-01

    We have studied 57 different mutations within three beta-globin gene promoter fragments with sizes 52 bp, 77 bp, and 193 bp by fluorescent capillary electrophoresis CE-SSCP analysis. For each mutation and wild type, energetically most-favorable predicted secondary structures were calculated for sense and antisense strands using the MFOLD DNA-folding algorithm in order to investigate if any correlation exists between predicted DNA structures and actual CE migration time shifts. The overall CE-SSCP detection rate was 100% for all mutations in three studied DNA fragments. For shorter 52 bp and 77 bp DNA fragments we obtained a positive correlation between the migration time shifts and difference in free energy values of predicted secondary structures at all temperatures. For longer 193 bp beta-globin gene fragments with 46 mutations MFOLD predicted different secondary structures for 89% of mutated strands at 25 degrees C and 40 degrees C. However, the magnitude of the mobility shifts did not necessarily correlate with their secondary structures and free energy values except for the sense strand at 40 degrees C where this correlation was statistically significant (r = 0.312, p = 0.033). Results of this study provided more direct insight into the mechanism of CE-SSCP and showed that MFOLD prediction could be helpful in making decisions about the running temperatures and in prediction of CE-SSCP data patterns, especially for shorter (50-100 bp) DNA fragments. Copyright 2002 Wiley-Liss, Inc.

  6. On measures of association among genetic variables

    PubMed Central

    Gianola, Daniel; Manfredi, Eduardo; Simianer, Henner

    2012-01-01

    Summary Systems involving many variables are important in population and quantitative genetics, for example, in multi-trait prediction of breeding values and in exploration of multi-locus associations. We studied departures of the joint distribution of sets of genetic variables from independence. New measures of association based on notions of statistical distance between distributions are presented. These are more general than correlations, which are pairwise measures, and lack a clear interpretation beyond the bivariate normal distribution. Our measures are based on logarithmic (Kullback-Leibler) and on relative ‘distances’ between distributions. Indexes of association are developed and illustrated for quantitative genetics settings in which the joint distribution of the variables is either multivariate normal or multivariate-t, and we show how the indexes can be used to study linkage disequilibrium in a two-locus system with multiple alleles and present applications to systems of correlated beta distributions. Two multivariate beta and multivariate beta-binomial processes are examined, and new distributions are introduced: the GMS-Sarmanov multivariate beta and its beta-binomial counterpart. PMID:22742500

  7. Mithramycin encapsulated in polymeric micelles by microfluidic technology as novel therapeutic protocol for beta-thalassemia

    PubMed Central

    Capretto, Lorenzo; Mazzitelli, Stefania; Brognara, Eleonora; Lampronti, Ilaria; Carugo, Dario; Hill, Martyn; Zhang, Xunli; Gambari, Roberto; Nastruzzi, Claudio

    2012-01-01

    This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH), based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF) accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of β-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying β-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol for β-thalassemia. PMID:22287841

  8. THE ANTIGENIC PROPERTIES OF GLOBIN CASEINATE

    PubMed Central

    Gay, Frederick P.; Robertson, T. Brailsford

    1913-01-01

    This study of globin and its compound with casein (globin caseinate) shows that globin fails to produce fixation antibodies in rabbits after repeated injections, thus agreeing with our own work and with that of others with similar histon bodies which are primarily toxic. When globin is combined with casein, however, it gives rise to antibodies that react not only with globin caseinate and casein but also with globin. The antibodies in antiglobin casein serum are apparently separate, one for globin and one for casein. In other words, the change in globin undergone on combination with casein has apparently rendered it antigenic. We did not succeed in demonstrating the genesis of this new antigenic property by anaphylaxis experiments. A further investigation of similar and more complex combined proteins is indicated and gives promise of more light on the nature of biological specificity. PMID:19867665

  9. Surface plasmon resonance-based molecular detection of Hb S [beta6(A3)Glu-->Val, GAG-->GTG] at the gene level.

    PubMed

    Atalay, Erol O; Ustel, Emre; Yildiz, Sanem; Atalay, Ayfer

    2006-01-01

    The surface plasmon resonance (SPR) approach, being a relatively novel biophysical method, is used to detect many different targets by biomolecular interaction. The SPR system uses optical and evanescent wave phenomenon. This approach does not need any labels, such as enzymes or isotopes, and the monitored interactions are in real time. In DNA-DNA interaction, the SPR approach is Tm-independent. Here we report our preliminary results for the molecular detection of the Hb S (GAG -->GTG) mutation at codon 6 of the human beta-globin gene. Our preliminary results show that the SPR approach could be applied as an inexpensive and fast routine test system for the molecular diagnosis of abnormal hemoglobins (Hbs), especially in premarital screening programs.

  10. Population-specific variation in haplotype composition and heterozygosity at the POLB locus.

    PubMed

    Yamtich, Jennifer; Speed, William C; Straka, Eva; Kidd, Judith R; Sweasy, Joann B; Kidd, Kenneth K

    2009-05-01

    DNA polymerase beta plays a central role in base excision repair (BER), which removes large numbers of endogenous DNA lesions from each cell on a daily basis. Little is currently known about germline polymorphisms within the POLB locus, making it difficult to study the association of variants at this locus with human diseases such as cancer. Yet, approximately thirty percent of human tumor types show variants of DNA polymerase beta. We have assessed the global frequency distributions of coding and common non-coding SNPs in and flanking the POLB gene for a total of 14 sites typed in approximately 2400 individuals from anthropologically defined human populations worldwide. We have found a marked difference between haplotype frequencies in African populations and in non-African populations.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rund, D.; Cohen, T.; Filon, D.

    {beta}-Thalassemia is a hereditary disease caused by any of 90 different point mutations in the {beta}-globin gene. Specific populations generally carry a small number of mutations, the most common of which are those that are widely distributed regionally. The present study constitutes an extensive molecular characterization of this disease in a small, highly inbred ethnic group with a high incidence of {beta}-thalassemia-the Jews of Kurdistan. An unusual mutational diversity was observed. In 42 sibships 13 different mutations were identified, of which 3 are newly discovered. Four of the mutations are unique to Kurdish Jews and have not been discovered inmore » any other population. A fifth was found outside Kurdish Jews only in an Iranian from Khuzistan, a region bordering Kurdistan. Two-thirds of the mutant chromosomes carry the mutations unique to Kurdish Jews. The authors traced the origin of the mutations to specific geographic regions within Kurdistan. This information, supported by haplotype analysis, suggests that thalassemia in central Kurdistan (northern Iraq) has evolved primarily from multiple mutational events. They conclude that several evolutionary mechanisms contributed to the evolution of {beta}-thalassemia in this small ethnic isolate.« less

  12. Molecular analysis of globin gene expression in different thalassaemia disorders: individual variation of β(E) pre-mRNA splicing determine disease severity.

    PubMed

    Tubsuwan, Alisa; Munkongdee, Thongperm; Jearawiriyapaisarn, Natee; Boonchoy, Chanikarn; Winichagoon, Pranee; Fucharoen, Suthat; Svasti, Saovaros

    2011-09-01

    Thalassaemia is characterized by the reduced or absent production of globins in the haemoglobin molecule leading to imbalanced α-globin/non α-globin chains. HbE, the result of a G to A mutation in codon 26 of the HBB (β-globin) gene, activates a cryptic 5' splice site in codon 25 leading to a reduction of correctly spliced β(E) -globin (HBB:c.79G>A) mRNA and consequently β(+) -thalassaemia. A wide range of clinical severities in bothα- and β-thalassaemia syndromes, from nearly asymptomatic to transfusion-dependent, has been observed. The correlation between clinical heterogeneity in various genotypes of thalassaemia and the levels of globin gene expression and β(E) -globin pre-mRNA splicing were examined using multiplex quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) and allele-specific RT-qPCR. The α-globin/non α-globin mRNA ratio was demonstrated to be a good indicator for disease severity among different thalassaemia disorders. However, the α-globin/non α-globin mRNA ratio ranged widely in β-thalassaemia/HbE patients, with no significant difference between mild and severe phenotypes. Interestingly, the correctly to aberrantly spliced β(E) -globin mRNA ratio in 30% of mild β-thalassaemia/HbE patients was higher than that of the severe patients. The splicing process of β(E) -globin pre-mRNA differs among β-thalassaemia/HbE patients and serves as one of the modifying factors for disease severity. © 2011 Blackwell Publishing Ltd.

  13. Validation of a standardized extraction method for formalin-fixed paraffin-embedded tissue samples.

    PubMed

    Lagheden, Camilla; Eklund, Carina; Kleppe, Sara Nordqvist; Unger, Elizabeth R; Dillner, Joakim; Sundström, Karin

    2016-07-01

    Formalin-fixed paraffin-embedded (FFPE) samples can be DNA-extracted and used for human papillomavirus (HPV) genotyping. The xylene-based gold standard for extracting FFPE samples is laborious, suboptimal and involves health hazards for the personnel involved. To compare extraction with the standard xylene method to a xylene-free method used in an HPV LabNet Global Reference Laboratory at the Centers for Disease Control (CDC); based on a commercial method with an extra heating step. Fifty FFPE samples were randomly selected from a national audit of all cervical cancer cases diagnosed in Sweden during 10 years. For each case-block, a blank-block was sectioned, as a control for contamination. For xylene extraction, the standard WHO Laboratory Manual protocol was used. For the CDC method, the manufacturers' protocol was followed except for an extra heating step, 120°C for 20min. Samples were extracted and tested in parallel with β-globin real-time PCR, HPV16 real-time PCR and HPV typing using modified general primers (MGP)-PCR and Luminex assays. For a valid result the blank-block had to be betaglobin-negative in all tests and the case-block positive for beta-globin. Overall, detection was improved with the heating method and the amount of HPV-positive samples increased from 70% to 86% (p=0.039). For all samples where HPV type concordance could be evaluated, there was 100% type concordance. A xylene-free and robust extraction method for HPV-DNA typing in FFPE material is currently in great demand. Our proposed standardized protocol appears to be generally useful. Copyright © 2016. Published by Elsevier B.V.

  14. Plasmodium falciparum malaria skews globin gene expression balance in in-vitro haematopoietic stem cell culture system: Its implications in malaria associated anemia.

    PubMed

    Pathak, Vrushali; Colah, Roshan; Ghosh, Kanjaksha

    2018-02-01

    Understanding the pathophysiology and associated host parasite interactions of the malaria infection is the prerequisite for developing effective prevention and treatment strategies. The exact mechanism underlying malaria associated ineffective and dyserythropoiesis is not yet fully understood. Being an important protein, haemoglobin serves as the main amino acid reservoir available to the intra-erythrocytic plasmodium. It is important to check the expression profiling of globin genes which may help us to understand host parasite interactions and its potential contribution to both infection and disease. Here, an in-vitro culture system was used to study the effect of different doses of Plasmodium falciparum on haematopoietic stem cell expansion, differentiation and expression of globin genes. Upon exposure to the different doses of P. falciparum parasites of strains 3D7, Dd2 and RKL9 (intact and lysed form) at different stages of erythroid development, cells demonstrated suppression in growth and differentiation. At almost all stages of erythroid development upon parasite exposure, the γ globin gene was found to be downregulated and the α/β as well as α/non- α globin mRNA ratios in late stage erythroid cells were found to be reduced (p < .01) compared to the untreated controls. The imbalance in globin chain expression might be considered as one of the factors involved in malaria associated inappropriate erythropoietic responses. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. A randomized Phase I/II Trial of HQK-1001, an oral fetal globin gene inducer, in β–thalassaemia intermedia and HbE/β–thalassaemia

    PubMed Central

    Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.

    2014-01-01

    β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969

  16. Evidence for a large expansion and subfunctionalisation of globin genes in sea anemones.

    PubMed

    Smith, Hayden L; Pavasovic, Ana; Surm, Joachim M; Phillips, Matthew J; Prentis, Peter J

    2018-06-27

    The globin gene superfamily has been well-characterised in vertebrates, however, there has been limited research in early-diverging lineages, such as phylum Cnidaria. This study aimed to identify globin genes in multiple cnidarian lineages, and use bioinformatic approaches to characterise the evolution, structure and expression of these genes. Phylogenetic analyses and in silico protein predictions showed that all cnidarians have undergone an expansion of globin genes, which likely have a hexacoordinate protein structure. Our protein modelling has also revealed the possibility of a single pentacoordinate globin lineage in anthozoan species. Some cnidarian globin genes displayed tissue and development specific expression with very few orthologous genes similarly expressed across species. Our phylogenetic analyses also revealed that eumetazoan globin genes form a polyphyletic relationship with vertebrate globin genes. Overall, our analyses suggest that a Ngb-like and GbX-like gene were most likely present in the globin gene repertoire for the last common ancestor of eumetazoans. The identification of a large-scale expansion and subfunctionalisation of globin genes in actiniarians provides an excellent starting point to further our understanding of the evolution and function of the globin gene superfamily in early-diverging lineages.

  17. Conservation of globin genes in the "living fossil" Latimeria chalumnae and reconstruction of the evolution of the vertebrate globin family.

    PubMed

    Schwarze, Kim; Burmester, Thorsten

    2013-09-01

    The (hemo-)globins are among the best-investigated proteins in biomedical sciences. These small heme-proteins play an important role in oxygen supply, but may also have other functions. In addition to well known hemoglobin and myoglobin, six other vertebrate globin types have been identified in recent years: neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Analyses of the genome of the "living fossil" Latimeria chalumnae show that the coelacanth is the only known vertebrate that includes all eight globin types. Thus, Latimeria can also be considered as a "globin fossil". Analyses of gene synteny and phylogenetic reconstructions allow us to trace the evolution and the functional changes of the vertebrate globin family. Neuroglobin and globin X diverged from the other globin types before the separation of Protostomia and Deuterostomia. The cytoglobins, which are unlikely to be involved in O2 supply, form the earliest globin branch within the jawed vertebrates (Gnathostomata), but do not group with the agnathan hemoglobins, as it has been proposed before. There is strong evidence from phylogenetic reconstructions and gene synteny that the eye-specific globin E and muscle-specific myoglobin constitute a common clade, suggesting a similar role in intracellular O2 supply. Latimeria possesses two α- and two β-hemoglobin chains, of which one α-chain emerged prior to the divergence of Actinopterygii and Sarcopterygii, but has been retained only in the coelacanth. Notably, the embryonic hemoglobin α-chains of Gnathostomata derive from a common ancestor, while the embryonic β-chains - with the exception of a more complex pattern in the coelacanth and amphibians - display a clade-specific evolution. Globin Y is associated with the hemoglobin gene cluster, but its phylogenetic position is not resolved. Our data show an early divergence of distinct globin types in the vertebrate evolution before the emergence of tetrapods. The subsequent loss of globins in certain taxa may be associated with changes in the oxygen-dependent metabolism. This article is part of a Special Issue entitled: Oxygen Binding and Sensing Proteins. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Gene-gene interactions among genetic variants from obesity candidate genes for nonobese and obese populations in type 2 diabetes.

    PubMed

    Lin, Eugene; Pei, Dee; Huang, Yi-Jen; Hsieh, Chang-Hsun; Wu, Lawrence Shih-Hsin

    2009-08-01

    Recent studies indicate that obesity may play a key role in modulating genetic predispositions to type 2 diabetes (T2D). This study examines the main effects of both single-locus and multilocus interactions among genetic variants in Taiwanese obese and nonobese individuals to test the hypothesis that obesity-related genes may contribute to the etiology of T2D independently and/or through such complex interactions. We genotyped 11 single nucleotide polymorphisms for 10 obesity candidate genes including adrenergic beta-2-receptor surface, adrenergic beta-3-receptor surface, angiotensinogen, fat mass and obesity associated gene, guanine nucleotide binding protein beta polypeptide 3 (GNB3), interleukin 6 receptor, proprotein convertase subtilisin/kexin type 1 (PCSK1), uncoupling protein 1, uncoupling protein 2, and uncoupling protein 3. There were 389 patients diagnosed with T2D and 186 age- and sex-matched controls. Single-locus analyses showed significant main effects of the GNB3 and PCSK1 genes on the risk of T2D among the nonobese group (p = 0.002 and 0.047, respectively). Further, interactions involving GNB3 and PCSK1 were suggested among the nonobese population using the generalized multifactor dimensionality reduction method (p = 0.001). In addition, interactions among angiotensinogen, fat mass and obesity associated gene, GNB3, and uncoupling protein 3 genes were found in a significant four-locus generalized multifactor dimensionality reduction model among the obese population (p = 0.001). The results suggest that the single nucleotide polymorphisms from the obesity candidate genes may contribute to the risk of T2D independently and/or in an interactive manner according to the presence or absence of obesity.

  19. Ancient Duplications and Expression Divergence in the Globin Gene Superfamily of Vertebrates: Insights from the Elephant Shark Genome and Transcriptome

    PubMed Central

    Opazo, Juan C.; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F.

    2015-01-01

    Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about ancestral functions of vertebrate globins. PMID:25743544

  20. The mechanism of chromosome 7 inversion in human lymphocytes expressing chimeric gamma beta TCR.

    PubMed

    Retière, C; Halary, F; Peyrat, M A; Le Deist, F; Bonneville, M; Hallet, M M

    1999-01-15

    Functional chimeric TCR chains, encoded by V gamma J gamma C beta or V gamma J beta C beta hybrid gene TCR, are expressed at the surface of a small fraction of alpha beta T lymphocytes in healthy individuals. Their frequency is dramatically increased in patients with ataxia-telangiectasia, a syndrome associated with inherited genomic instability. As the TCR gamma and beta loci are in an inverted orientation on chromosome 7, the generation of such hybrid genes requires at least an inversion event. Until now, neither the sequences involved in this genetic mechanism nor the number of recombinations leading to the formation of functional transcriptional units have been characterized. In this manuscript, we demonstrate that at least two rearrangements, involving classical recombination signal sequence and the V(D)J recombinase complex, lead to the formation of productive hybrid genes. A primary inversion 7 event between D beta and J gamma genic segments generates C gamma V beta and C beta V gamma hybrid loci. Within the C gamma V beta locus, secondary rearrangements between V gamma and J gamma or V gamma and J beta elements generate functional genes. Besides, our results suggest that secondary rearrangements were blocked in the C beta V gamma locus of normal but not ataxia-telangiectasia T lymphocytes. We also provide formal evidence that the same D beta-3' recombination signal sequence can be used in successive rearrangements with J gamma and J beta genic segments, thus showing that a signal joint has been involved in a secondary recombination event.

  1. Hematopoietic stem cell transplantation for people with ß-thalassaemia major.

    PubMed

    Jagannath, Vanitha A; Fedorowicz, Zbys; Al Hajeri, Amani; Sharma, Akshay

    2016-11-30

    Thalassemia is an inherited autosomal recessive blood disorder, caused by mutations in globin genes or their regulatory regions. This results in a reduced rate of synthesis of one of the globin chains that make up haemoglobin. In ß-thalassaemia major there is an underproduction of ß-globin chains combined with excess of free α-globin chains. The excess free α-globin chains precipitate in red blood cells, leading to their destruction (haemolysis) and ineffective erythropoiesis. The conventional approach to treatment is based on the correction of haemoglobin status through regular blood transfusions and iron chelation therapy for iron overload. Although conventional treatment has the capacity to improve the quality of life of people with ß-thalassaemia major, allogeneic hematopoietic stem cell transplantation is the only currently available procedure which has the curative potential. This is an update of a previously published Cochrane Review. To evaluate the effectiveness and safety of different types of allogeneic hematopoietic stem cell transplantation, in people with severe transfusion-dependant ß-thalassaemia major, ß-thalassaemia intermedia or ß0/+- thalassaemia variants requiring chronic blood transfusion. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Haemoglobinopathies Trials Register comprising references identified from comprehensive electronic database searches and handsearches of relevant journals and abstract books of conference proceedings.Date of the most recent search: 18 August 2016. Randomised controlled trials and quasi-randomised controlled trials comparing allogeneic hematopoietic stem cell transplantation with each other or with standard therapy (regular transfusion and chelation regimen). Two review authors independently screened studies and had planned to extract data and assess risk of bias using standard Cochrane methodologies but no studies were identified for inclusion. No relevant studies were retrieved after a comprehensive search of the literature. We were unable to identify any randomised controlled trials or quasi-randomised controlled trials on the effectiveness and safety of different types of allogeneic stem cell transplantation in people with severe transfusion-dependant ß-thalassaemia major or ß0/+- thalassaemia variants requiring chronic blood transfusion. The absence of high-level evidence for the effectiveness of these interventions emphasises the need for well-designed, adequately-powered, randomised controlled clinical trials.

  2. Association of High Myopia with Crystallin Beta A4 (CRYBA4) Gene Polymorphisms in the Linkage-Identified MYP6 Locus

    PubMed Central

    Ho, Daniel W. H.; Yap, Maurice K. H.; Ng, Po Wah; Fung, Wai Yan; Yip, Shea Ping

    2012-01-01

    Background Myopia is the most common ocular disorder worldwide and imposes tremendous burden on the society. It is a complex disease. The MYP6 locus at 22 q12 is of particular interest because many studies have detected linkage signals at this interval. The MYP6 locus is likely to contain susceptibility gene(s) for myopia, but none has yet been identified. Methodology/Principal Findings Two independent subject groups of southern Chinese in Hong Kong participated in the study an initial study using a discovery sample set of 342 cases and 342 controls, and a follow-up study using a replication sample set of 316 cases and 313 controls. Cases with high myopia were defined by spherical equivalent ≤ -8 dioptres and emmetropic controls by spherical equivalent within ±1.00 dioptre for both eyes. Manual candidate gene selection from the MYP6 locus was supported by objective in silico prioritization. DNA samples of discovery sample set were genotyped for 178 tagging single nucleotide polymorphisms (SNPs) from 26 genes. For replication, 25 SNPs (tagging or located at predicted transcription factor or microRNA binding sites) from 4 genes were subsequently examined using the replication sample set. Fisher P value was calculated for all SNPs and overall association results were summarized by meta-analysis. Based on initial and replication studies, rs2009066 located in the crystallin beta A4 (CRYBA4) gene was identified to be the most significantly associated with high myopia (initial study: P = 0.02; replication study: P = 1.88e-4; meta-analysis: P = 1.54e-5) among all the SNPs tested. The association result survived correction for multiple comparisons. Under the allelic genetic model for the combined sample set, the odds ratio of the minor allele G was 1.41 (95% confidence intervals, 1.21-1.64). Conclusions/Significance A novel susceptibility gene (CRYBA4) was discovered for high myopia. Our study also signified the potential importance of appropriate gene prioritization in candidate selection. PMID:22792142

  3. A Novel Heme Pocket Hemoglobin Variant Associated with Normal Hematology: Hb Zara or α91(FG3)Leu→Ile (α2) (HBA2: c.274C > A).

    PubMed

    Trova, Sandro; Mereu, Paolo; Decandia, Luca; Cocco, Elena; Masala, Bruno; Manca, Laura; Pirastru, Monica

    2015-08-13

    We report a new hemoglobin (Hb) variant on the HBA2 gene, Hb Zara [α91(FG3)Leu→Ile (α2); HBA2: c.274C > A], which was found in a Caucasian man from Croatia. It was observed by routine cation exchange chromatography as an abnormal 21.8% fraction overlapping Hb A 2 , and associated with normal hematology. It was slightly unstable by the standard isopropanol precipitation test. DNA analysis revealed the CTT > ATT mutation at codon 91 on an α2 gene of a normal α-globin gene arrangement. This new variant represents the sixth described mutation at codon α91 and fourth on the α2 locus. As a result of the slight instability due to the significant role of the α91 residue in the α1β2 contact, the level of the Hb Zara variant was lower than levels observed for several stable variants codified by the α2 locus.

  4. A Novel Heme Pocket Hemoglobin Variant Associated with Normal Hematology: Hb Zara or α91(FG3)Leu→Ile (α2) (HBA2: c.274C > A).

    PubMed

    Trova, Sandro; Mereu, Paolo; Decandia, Luca; Cocco, Elena; Masala, Bruno; Manca, Laura; Pirastru, Monica

    2015-01-01

    We report a new hemoglobin (Hb) variant on the HBA2 gene, Hb Zara [α91(FG3)Leu→Ile (α2); HBA2: c.274C > A], which was found in a Caucasian man from Croatia. It was observed by routine cation exchange chromatography as an abnormal 21.8% fraction overlapping Hb A2, and associated with normal hematology. It was slightly unstable by the standard isopropanol precipitation test. DNA analysis revealed the CTT > ATT mutation at codon 91 on an α2 gene of a normal α-globin gene arrangement. This new variant represents the sixth described mutation at codon α91 and fourth on the α2 locus. As a result of the slight instability due to the significant role of the α91 residue in the α1β2 contact, the level of the Hb Zara variant was lower than levels observed for several stable variants codified by the α2 locus.

  5. Delta: a new web-based 3D genome visualization and analysis platform.

    PubMed

    Tang, Bixia; Li, Feifei; Li, Jing; Zhao, Wenming; Zhang, Zhihua

    2018-04-15

    Delta is an integrative visualization and analysis platform to facilitate visually annotating and exploring the 3D physical architecture of genomes. Delta takes Hi-C or ChIA-PET contact matrix as input and predicts the topologically associating domains and chromatin loops in the genome. It then generates a physical 3D model which represents the plausible consensus 3D structure of the genome. Delta features a highly interactive visualization tool which enhances the integration of genome topology/physical structure with extensive genome annotation by juxtaposing the 3D model with diverse genomic assay outputs. Finally, by visually comparing the 3D model of the β-globin gene locus and its annotation, we speculated a plausible transitory interaction pattern in the locus. Experimental evidence was found to support this speculation by literature survey. This served as an example of intuitive hypothesis testing with the help of Delta. Delta is freely accessible from http://delta.big.ac.cn, and the source code is available at https://github.com/zhangzhwlab/delta. zhangzhihua@big.ac.cn. Supplementary data are available at Bioinformatics online.

  6. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

    PubMed Central

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

    2011-01-01

    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  7. Vitamin E supplement improves erythrocyte membrane fluidity of thalassemia: an ESR spin labeling study.

    PubMed

    Sutipornpalangkul, Werasak; Morales, Noppawan Phumala; Unchern, Supeenun; Sanvarinda, Yupin; Chantharaksri, Udom; Fucharoen, Suthat

    2012-01-01

    Beta-thalassemia/Hemoglobin E (beta-thal/Hb E) is prevalent in Thailand. The imbalance of globin chains in red blood cells is the primary cause of this anemic disease. The excess alpha-globin in beta-thal/Hb E causes typical damage(s) to membrane of erythroblasts and erythrocytes. By using three paramagnetic labeled compounds (5-, 12-, and 16-spin labeled stearic acids, SLS), the changes of the molecular motion in the lipid bilayer of thalassemic RBCs that have structural modification can be detected. to investigate erythrocyte membrane fluidity and the effect of vitamin E treatment in beta-thalassemia/Hemoglobin E patients by using spin labeling techniques. The erythrocyte membrane fluidity was investigated in nine splenectomized and five non-splenectomized beta-thalassemia/hemoglobin E (beta-thal/Hb E) patients using EPR spin labeling techniques. To determine the effect of vitamin E on erythrocyte membrane fluidity, only the splenectomized patients were enrolled. Patients were divided into two groups. The first group received 350 mg vitamin E daily for a period of 1 month (n = 5) and the second group received placebo for an equal period (n = 4). Three paramagnetic fatty acid, 5-, 12-, and 16-doxyl stearic acids, (5-, 12- and 16-DS) were used to label phospholipids layer near both the surface (5-DS) and the deeper hydrophobic region of membrane (12-and 16-DS). Lipid peroxidation (TBARs) was measured using a colorimetric method. Vitamin E was measured with high performance liquid chromatography (HPLC). Significantly higher values of erythrocyte membrane fluidity were revealed with 12-, 16-DS in splenectomized patients, as compared with non-splenectomized patients and normal subjects. In 3-thal/Hb E patients, fluidity values, both outer hyperfine splitting (2T(//)) and order parameter (S) of 12-DS showed inverse correlation with serum TBARs. There was no significant difference between the fluidity values measured with 5-DS. After vitamin E supplementation, the erythrocyte membrane fluidity was decreased in almost all patients. In contrast to the vitamin E supplementation group, increased erythrocyte membrane fluidity was demonstrated in the placebo group. Vitamin E supplementation also had effect on other clinical parameters such as increased plasma vitamin E, decreased serum TBARs and no change in hemoglobin. The present results suggested the abnormal motion of lipid in the deeper phospholipids region of membrane. In addition, vitamin E supplementation may have a role in the prevention of erythrocyte membrane damage of these patients.

  8. Globin gene structure in a reptile supports the transpositional model for amniote α- and β-globin gene evolution.

    PubMed

    Patel, Vidushi S; Ezaz, Tariq; Deakin, Janine E; Graves, Jennifer A Marshall

    2010-12-01

    The haemoglobin protein, required for oxygen transportation in the body, is encoded by α- and β-globin genes that are arranged in clusters. The transpositional model for the evolution of distinct α-globin and β-globin clusters in amniotes is much simpler than the previously proposed whole genome duplication model. According to this model, all jawed vertebrates share one ancient region containing α- and β-globin genes and several flanking genes in the order MPG-C16orf35-(α-β)-GBY-LUC7L that has been conserved for more than 410 million years, whereas amniotes evolved a distinct β-globin cluster by insertion of a transposed β-globin gene from this ancient region into a cluster of olfactory receptors flanked by CCKBR and RRM1. It could not be determined whether this organisation is conserved in all amniotes because of the paucity of information from non-avian reptiles. To fill in this gap, we examined globin gene organisation in a squamate reptile, the Australian bearded dragon lizard, Pogona vitticeps (Agamidae). We report here that the α-globin cluster (HBK, HBA) is flanked by C16orf35 and GBY and is located on a pair of microchromosomes, whereas the β-globin cluster is flanked by RRM1 on the 3' end and is located on the long arm of chromosome 3. However, the CCKBR gene that flanks the β-globin cluster on the 5' end in other amniotes is located on the short arm of chromosome 5 in P. vitticeps, indicating that a chromosomal break between the β-globin cluster and CCKBR occurred at least in the agamid lineage. Our data from a reptile species provide further evidence to support the transpositional model for the evolution of β-globin gene cluster in amniotes.

  9. Ancient Duplications and Expression Divergence in the Globin Gene Superfamily of Vertebrates: Insights from the Elephant Shark Genome and Transcriptome.

    PubMed

    Opazo, Juan C; Lee, Alison P; Hoffmann, Federico G; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F

    2015-07-01

    Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about ancestral functions of vertebrate globins. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. A Phylogenetic Analysis of the Globins in Fungi

    PubMed Central

    Hoogewijs, David; Dewilde, Sylvia; Vierstraete, Andy; Moens, Luc; Vinogradov, Serge N.

    2012-01-01

    Background All globins belong to one of three families: the F (flavohemoglobin) and S (sensor) families that exhibit the canonical 3/3 α-helical fold, and the T (truncated 3/3 fold) globins characterized by a shortened 2/2 α-helical fold. All eukaryote 3/3 hemoglobins are related to the bacterial single domain F globins. It is known that Fungi contain flavohemoglobins and single domain S globins. Our aims are to provide a census of fungal globins and to examine their relationships to bacterial globins. Results Examination of 165 genomes revealed that globins are present in >90% of Ascomycota and ∼60% of Basidiomycota genomes. The S globins occur in Blastocladiomycota and Chytridiomycota in addition to the phyla that have FHbs. Unexpectedly, group 1 T globins were found in one Blastocladiomycota and one Chytridiomycota genome. Phylogenetic analyses were carried out on the fungal globins, alone and aligned with representative bacterial globins. The Saccharomycetes and Sordariomycetes with two FHbs form two widely divergent clusters separated by the remaining fungal sequences. One of the Saccharomycete groups represents a new subfamily of FHbs, comprising a previously unknown N-terminal and a FHb missing the C-terminal moiety of its reductase domain. The two Saccharomycete groups also form two clusters in the presence of bacterial FHbs; the surrounding bacterial sequences are dominated by Proteobacteria and Bacilli (Firmicutes). The remaining fungal FHbs cluster with Proteobacteria and Actinobacteria. The Sgbs cluster separately from their bacterial counterparts, except for the intercalation of two Planctomycetes and a Proteobacterium between the Fungi incertae sedis and the Blastocladiomycota and Chytridiomycota. Conclusion Our results are compatible with a model of globin evolution put forward earlier, which proposed that eukaryote F, S and T globins originated via horizontal gene transfer of their bacterial counterparts to the eukaryote ancestor, resulting from the endosymbiotic events responsible for the origin of mitochondria and chloroplasts. PMID:22384087

  11. Evolution and Expression of Tissue Globins in Ray-Finned Fishes.

    PubMed

    Gallagher, Michael D; Macqueen, Daniel J

    2017-01-01

    The globin gene family encodes oxygen-binding hemeproteins conserved across the major branches of multicellular life. The origins and evolutionary histories of complete globin repertoires have been established for many vertebrates, but there remain major knowledge gaps for ray-finned fish. Therefore, we used phylogenetic, comparative genomic and gene expression analyses to discover and characterize canonical “non-blood” globin family members (i.e., myoglobin, cytoglobin, neuroglobin, globin-X, and globin-Y) across multiple ray-finned fish lineages, revealing novel gene duplicates (paralogs) conserved from whole genome duplication (WGD) and small-scale duplication events. Our key findings were that: (1) globin-X paralogs in teleosts have been retained from the teleost-specific WGD, (2) functional paralogs of cytoglobin, neuroglobin, and globin-X, but not myoglobin, have been conserved from the salmonid-specific WGD, (3) triplicate lineage-specific myoglobin paralogs are conserved in arowanas (Osteoglossiformes), which arose by tandem duplication and diverged under positive selection, (4) globin-Y is retained in multiple early branching fish lineages that diverged before teleosts, and (5) marked variation in tissue-specific expression of globin gene repertoires exists across ray-finned fish evolution, including several previously uncharacterized sites of expression. In this respect, our data provide an interesting link between myoglobin expression and the evolution of air breathing in teleosts. Together, our findings demonstrate great-unrecognized diversity in the repertoire and expression of nonblood globins that has arisen during ray-finned fish evolution.

  12. Electron paramagnetic resonance of globin proteins - a successful match between spectroscopic development and protein research

    NASA Astrophysics Data System (ADS)

    Van Doorslaer, Sabine; Cuypers, Bert

    2018-02-01

    At the start of the twenty-first century, the research into the haem-containing globins got a considerable impetus with the discovery of three new mammalian globins: neuroglobin, cytoglobin and androglobin. Globins are by now found in all kingdoms of life and, in many cases, their functions are still under debate. This revival in globin research increased the demand for adequate physico-chemical research tools to determine the structure-function relationships of these proteins. From early days onwards, electron paramagnetic resonance (EPR) has been used in globin research. In recent decades, the field of EPR has been revolutionised with the introduction of many new pulsed and high-field EPR techniques. In this review, we highlight how EPR has become an essential tool in globin research, and how globins equally provide ideal model systems to push technical developments in EPR.

  13. Large-scale production of embryonic red blood cells from human embryonic stem cells.

    PubMed

    Olivier, Emmanuel N; Qiu, Caihong; Velho, Michelle; Hirsch, Rhoda Elison; Bouhassira, Eric E

    2006-12-01

    To develop a method to produce in culture large number of erythroid cells from human embryonic stem cells. Human H1 embryonic stem cells were differentiated into hematopoietic cells by coculture with a human fetal liver cell line, and the resulting CD34-positive cells were expanded in vitro in liquid culture using a three-step method. The erythroid cells produced were then analyzed by light microscopy and flow cytometry. Globin expression was characterized by quantitative reverse-transcriptase polymerase chain reaction and by high-performance liquid chromatography. CD34-positive cells produced from human embryonic stem cells could be efficiently differentiated into erythroid cells in liquid culture leading to a more than 5000-fold increase in cell number. The erythroid cells produced are similar to primitive erythroid cells present in the yolk sac of early human embryos and did not enucleate. They are fully hemoglobinized and express a mixture of embryonic and fetal globins but no beta-globin. We have developed an experimental protocol to produce large numbers of primitive erythroid cells starting from undifferentiated human embryonic stem cells. As the earliest human erythroid cells, the nucleated primitive erythroblasts, are not very well characterized because experimental material at this stage of development is very difficult to obtain, this system should prove useful to answer a number of experimental questions regarding the biology of these cells. In addition, production of mature red blood cells from human embryonic stem cells is of great potential practical importance because it could eventually become an alternate source of cell for transfusion.

  14. The insulation of genes from external enhancers and silencing chromatin

    PubMed Central

    Burgess-Beusse, Bonnie; Farrell, Catherine; Gaszner, Miklos; Litt, Michael; Mutskov, Vesco; Recillas-Targa, Felix; Simpson, Melanie; West, Adam; Felsenfeld, Gary

    2002-01-01

    Insulators are DNA sequence elements that can serve in some cases as barriers to protect a gene against the encroachment of adjacent inactive condensed chromatin. Some insulators also can act as blocking elements to protect against the activating influence of distal enhancers associated with other genes. Although most of the insulators identified so far derive from Drosophila, they also are found in vertebrates. An insulator at the 5′ end of the chicken β-globin locus marks a boundary between an open chromatin domain and a region of constitutively condensed chromatin. Detailed analysis of this element shows that it possesses both enhancer blocking activity and the ability to screen reporter genes against position effects. Enhancer blocking is associated with binding of the protein CTCF; sites that bind CTCF are found at other critical points in the genome. Protection against position effects involves other properties that appear to be associated with control of histone acetylation and methylation. Insulators thus are complex elements that can help to preserve the independent function of genes embedded in a genome in which they are surrounded by regulatory signals they must ignore. PMID:12154228

  15. Stimulatory effect of harmane and other beta-carbolines on locus coeruleus neurons in anaesthetized rats.

    PubMed

    Ruiz-Durántez, E; Ruiz-Ortega JA; Pineda, J; Ugedo, L

    2001-08-10

    Harmane, harmaline and norharmane are beta-carboline related compounds which have been proposed to be endogenous ligands for imidazoline receptors. The effect of these compounds on the activity of locus coeruleus (LC) neurons was studied by extracellular recordings techniques. Intracerebroventricular administration of harmane and harmaline increased the firing rate of LC neurons. Systemic administration of efaroxan, a mixed alpha(2)-adrenoceptor/I(1)-imidazoline antagonist or vagotomy failed to modify the harmane effect. Furthermore, local applications of harmane and harmaline increased the firing rate of LC neurons in a dose-related manner. Finally, intravenous administration of norharmane also increased the activity of LC neurons. Our results demonstrate that beta-carbolines stimulate LC neuron activity and indicate that this stimulation occurs directly in the LC by a mechanism independent of I(1)- and I(2)-imidazoline receptors.

  16. Evolution and Expression of Tissue Globins in Ray-Finned Fishes

    PubMed Central

    Gallagher, Michael D.

    2017-01-01

    The globin gene family encodes oxygen-binding hemeproteins conserved across the major branches of multicellular life. The origins and evolutionary histories of complete globin repertoires have been established for many vertebrates, but there remain major knowledge gaps for ray-finned fish. Therefore, we used phylogenetic, comparative genomic and gene expression analyses to discover and characterize canonical “non-blood” globin family members (i.e., myoglobin, cytoglobin, neuroglobin, globin-X, and globin-Y) across multiple ray-finned fish lineages, revealing novel gene duplicates (paralogs) conserved from whole genome duplication (WGD) and small-scale duplication events. Our key findings were that: (1) globin-X paralogs in teleosts have been retained from the teleost-specific WGD, (2) functional paralogs of cytoglobin, neuroglobin, and globin-X, but not myoglobin, have been conserved from the salmonid-specific WGD, (3) triplicate lineage-specific myoglobin paralogs are conserved in arowanas (Osteoglossiformes), which arose by tandem duplication and diverged under positive selection, (4) globin-Y is retained in multiple early branching fish lineages that diverged before teleosts, and (5) marked variation in tissue-specific expression of globin gene repertoires exists across ray-finned fish evolution, including several previously uncharacterized sites of expression. In this respect, our data provide an interesting link between myoglobin expression and the evolution of air breathing in teleosts. Together, our findings demonstrate great-unrecognized diversity in the repertoire and expression of nonblood globins that has arisen during ray-finned fish evolution. PMID:28173090

  17. Fine mapping, transcriptome analysis, and marker development for Y2, the gene that conditions beta-carotene accumulation in carrot (Daucus carota L.)

    USDA-ARS?s Scientific Manuscript database

    Domesticated carrots, Daucus carota subsp. sativus, are the richest source of beta-carotene in the US diet, which when consumed is converted into vitamin A, an essential component of eye health and immunity. The Y2 locus plays a significant role in beta-carotene accumulation in carrot roots, but a c...

  18. Restriction fragment length polymorphism among Israeli Holstein-Friesian dairy bulls.

    PubMed

    Beckmann, J S; Kashi, Y; Hallerman, E M; Nave, A; Soller, M

    1986-01-01

    Israeli Holstein-Friesian dairy bulls were screened for restriction fragment length polymorphisms by hybridizing cloned DNA probes for bovine growth hormone, for chymosin, and for rat muscle beta-actin to restriction endonuclease-digested DNA immobilized on nitrocellulose filters. The population proved to be polymorphic at the growth hormone locus, with evidence consistent with the phenotypes being inherited in allelic fashion. A low level of polymorphism was also observed at one of the beta-actin gene family loci. The chymosin locus was monomorphic with the restriction enzymes utilized. The results illustrate the power of restriction fragment length polymorphism methodology in visualizing genetic variability in dairy cattle populations.

  19. The Prevalence of Human Papilloma Virus in Esophageal Squamous Cell Carcinoma

    PubMed Central

    Noori, Sadat; Monabati, Ahmad; Ghaderi, Abbasali

    2012-01-01

    Background: Carcinomas of esophagus, mostly squamous cell carcinomas, occur throughout the world. There are a number of suspected genetic or environmental etiologies. Human papilloma virus (HPV) is said to be a major etiology in areas with high incidence of esophageal carcinoma, while it is hardly detectable in low incidence regions. This study was designed to evaluate the prevalence of HPV in esophageal squamous cell carcinoma (ESCC) cases diagnosed in Pathology Department, Medical School, Shiraz University of Medical Sciences. Methods: DNA material for PCR amplification of HPV genome was extracted from formalin-fixed paraffin-embedded tissue blocks of 92 cases of ESCC, diagnosed during 20 years from 1982 to 2002. Polymerase chain reaction was performed for amplification and detection of common HPV and type specific HPV-16 and HPV-18 genomic sequences in the presence of positive control (HPV-18 and HPV positive biopsies of uterine exocervix) and additional internal controls i.e. beta-globin and cytotoxic T lymphocyte antigen 4 (CTLA4). Result: Good amplification of positive control and internal controls was observed. However, no amplification of HPV genome was observed. Conclusion: There is no association between HPV infection and the development of esophageal squamous cell carcinoma in the cases evaluated. PMID:23115442

  20. Genetic modulation of sickle cell anemia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Steinberg, M.H.

    1995-05-01

    Sickle cell anemia, a common disorder associated with reduced life span of the red blood cell and vasoocclusive events, is caused by a mutation in the {Beta}-hemoglobin gene. Yet, despite this genetic homogeneity, the phenotype of the disease is heterogeneous. This suggests the modulating influence of associated inherited traits. Some of these may influence the accumulation of fetal hemoglobin, a hemoglobin type that interferes with the polymerization of sickle hemoglobin. Another inherited trait determines the accumulation of {alpha}-globin chains. This review focuses on potential genetic regulators of the phenotype of sickle cell anemia. 125 refs., 6 figs., 3 tabs.

  1. Molecular Exploration of Beta-Lactamases in Fusarium verticillioides

    USDA-ARS?s Scientific Manuscript database

    The mycotoxigenic fungus Fusarium verticillioides (Fv) is one of the most prevalent maize fungal pathogens. Fv mycotoxins are a significant food safety issue and have given rise to exposure concerns worldwide. The FDB1 locus, a beta-lactamase-containing Fv gene cluster, was previously shown to be in...

  2. Integrating evolutionary and functional tests of adaptive hypotheses: a case study of altitudinal differentiation in hemoglobin function in an Andean Sparrow, Zonotrichia capensis.

    PubMed

    Cheviron, Zachary A; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Eddy, Douglas K; Jones, Jennifer; Carling, Matthew D; Witt, Christopher C; Moriyama, Hideaki; Weber, Roy E; Fago, Angela; Storz, Jay F

    2014-11-01

    In air-breathing vertebrates, the physiologically optimal blood-O2 affinity is jointly determined by the prevailing partial pressure of atmospheric O2, the efficacy of pulmonary O2 transfer, and internal metabolic demands. Consequently, genetic variation in the oxygenation properties of hemoglobin (Hb) may be subject to spatially varying selection in species with broad elevational distributions. Here we report the results of a combined functional and evolutionary analysis of Hb polymorphism in the rufous-collared sparrow (Zonotrichia capensis), a species that is continuously distributed across a steep elevational gradient on the Pacific slope of the Peruvian Andes. We integrated a population genomic analysis that included all postnatally expressed Hb genes with functional studies of naturally occurring Hb variants, as well as recombinant Hb (rHb) mutants that were engineered through site-directed mutagenesis. We identified three clinally varying amino acid polymorphisms: Two in the α(A)-globin gene, which encodes the α-chain subunits of the major HbA isoform, and one in the α(D)-globin gene, which encodes the α-chain subunits of the minor HbD isoform. We then constructed and experimentally tested single- and double-mutant rHbs representing each of the alternative α(A)-globin genotypes that predominate at different elevations. Although the locus-specific patterns of altitudinal differentiation suggested a history of spatially varying selection acting on Hb polymorphism, the experimental tests demonstrated that the observed amino acid mutations have no discernible effect on respiratory properties of the HbA or HbD isoforms. These results highlight the importance of experimentally validating the hypothesized effects of genetic changes in protein function to avoid the pitfalls of adaptive storytelling. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. DNA variation in the genes of the Na,K-adenosine triphosphatase and its relation with resting metabolic rate, respiratory quotient, and body fat.

    PubMed

    Dériaz, O; Dionne, F; Pérusse, L; Tremblay, A; Vohl, M C; Côté, G; Bouchard, C

    1994-02-01

    The aim of this study was to investigate in 261 subjects from 58 families the association between DNA variation at the genes coding for the Na,K-ATPase peptides and resting metabolic rate (RMR), respiratory quotient (RQ), and percent body fat (%FAT). Five restriction fragment length polymorphisms (RFLP) at three Na,K-ATPase genes were determined: one at the alpha 1 locus (BglII), and two at the beta locus (beta MspI and beta PvuII). Haplotypes were determined from the two variable sites of the alpha 2 gene (alpha 2 haplotypes) and the beta gene (beta haplotypes). There was a strong trend for %FAT to be related to the RFLP generated by BglII at the alpha 2 exons 21-22 in males (P = 0.06) and females (P = 0.05). RQ was (a) associated with the BglII RFLP at the alpha 2 exon 1 (P = 0.02) and with the alpha 2 8.0 kb/4.3 kb haplotype (P = 0.04) and (b) linked with the beta gene MspI marker (P = 0.04) and with the beta 5.3 kb/5.1 kb haplotype (P = 0.008) based on sib-pair analysis. The present study suggests that the genes encoding Na,K-ATPase may be associated or linked with RQ and perhaps with %FAT but not with RMR.

  4. Evolutionary history of linked D4Z4 and Beta satellite clusters at the FSHD locus (4q35)☆

    PubMed Central

    Giussani, Marta; Cardone, Maria Francesca; Bodega, Beatrice; Ginelli, Enrico; Meneveri, Raffaella

    2012-01-01

    We performed a detailed genomic investigation of the chimpanzee locus syntenic to human chromosome 4q35.2, associated to the facioscapulohumeral dystrophy. Two contigs of approximately 150 kb and 200 kb were derived from PTR chromosomes 4q35 and 3p12, respectively: both regions showed a very similar sequence organization, including D4Z4 and Beta satellite linked clusters. Starting from these findings, we derived a hypothetical evolutionary history of human 4q35, 10q26 and 3p12 chromosome regions focusing on the D4Z4–Beta satellite linked organization. The D4Z4 unit showed an open reading frame (DUX4) at both PTR 4q35 and 3p12 regions; furthermore some subregions of the Beta satellite unit showed a high degree of conservation between chimpanzee and humans. In conclusion, this paper provides evidence that at the 4q subtelomere the linkage between D4Z4 and Beta satellite arrays is a feature that appeared late during evolution and is conserved between chimpanzee and humans. PMID:22824653

  5. Evolutionary history of linked D4Z4 and Beta satellite clusters at the FSHD locus (4q35).

    PubMed

    Giussani, Marta; Cardone, Maria Francesca; Bodega, Beatrice; Ginelli, Enrico; Meneveri, Raffaella

    2012-11-01

    We performed a detailed genomic investigation of the chimpanzee locus syntenic to human chromosome 4q35.2, associated to the facioscapulohumeral dystrophy. Two contigs of approximately 150 kb and 200 kb were derived from PTR chromosomes 4q35 and 3p12, respectively: both regions showed a very similar sequence organization, including D4Z4 and Beta satellite linked clusters. Starting from these findings, we derived a hypothetical evolutionary history of human 4q35, 10q26 and 3p12 chromosome regions focusing on the D4Z4-Beta satellite linked organization. The D4Z4 unit showed an open reading frame (DUX4) at both PTR 4q35 and 3p12 regions; furthermore some subregions of the Beta satellite unit showed a high degree of conservation between chimpanzee and humans. In conclusion, this paper provides evidence that at the 4q subtelomere the linkage between D4Z4 and Beta satellite arrays is a feature that appeared late during evolution and is conserved between chimpanzee and humans. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Editing an α-globin enhancer in primary human hematopoietic stem cells as a treatment for β-thalassemia.

    PubMed

    Mettananda, Sachith; Fisher, Chris A; Hay, Deborah; Badat, Mohsin; Quek, Lynn; Clark, Kevin; Hublitz, Philip; Downes, Damien; Kerry, Jon; Gosden, Matthew; Telenius, Jelena; Sloane-Stanley, Jackie A; Faustino, Paula; Coelho, Andreia; Doondeea, Jessica; Usukhbayar, Batchimeg; Sopp, Paul; Sharpe, Jacqueline A; Hughes, Jim R; Vyas, Paresh; Gibbons, Richard J; Higgs, Douglas R

    2017-09-04

    β-Thalassemia is one of the most common inherited anemias, with no effective cure for most patients. The pathophysiology reflects an imbalance between α- and β-globin chains with an excess of free α-globin chains causing ineffective erythropoiesis and hemolysis. When α-thalassemia is co-inherited with β-thalassemia, excess free α-globin chains are reduced significantly ameliorating the clinical severity. Here we demonstrate the use of CRISPR/Cas9 genome editing of primary human hematopoietic stem/progenitor (CD34+) cells to emulate a natural mutation, which deletes the MCS-R2 α-globin enhancer and causes α-thalassemia. When edited CD34+ cells are differentiated into erythroid cells, we observe the expected reduction in α-globin expression and a correction of the pathologic globin chain imbalance in cells from patients with β-thalassemia. Xenograft assays show that a proportion of the edited CD34+ cells are long-term repopulating hematopoietic stem cells, demonstrating the potential of this approach for translation into a therapy for β-thalassemia.β-thalassemia is characterised by the presence of an excess of α-globin chains, which contribute to erythrocyte pathology. Here the authors use CRISP/Cas9 to reduce α-globin expression in hematopoietic precursors, and show effectiveness in xenograft assays in mice.

  7. A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

    PubMed

    Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

    2016-10-01

    The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Phytomedicines and Nutraceuticals: Alternative Therapeutics for Sickle Cell Anemia

    PubMed Central

    Imaga, Ngozi Awa

    2013-01-01

    Sickle cell anemia is a genetically inherited disease in which the “SS” individual possesses an abnormal beta globin gene. A single base substitution in the gene encoding the human β-globin subunit results in replacement of β6 glutamic acid by valine, leading to the devastating clinical manifestations of sickle cell disease. This substitution causes drastic reduction in the solubility of sickle cell hemoglobin (HbS) when deoxygenated. Under these conditions, the HbS molecules polymerize to form long crystalline intracellular mass of fibers which are responsible for the deformation of the biconcave disc shaped erythrocyte into a sickle shape. First-line clinical management of sickle cell anemia include, use of hydroxyurea, folic acid, amino acids supplementation, penicillinprophylaxis, and antimalarial prophylaxis to manage the condition and blood transfusions to stabilize the patient's hemoglobin level. These are quite expensive and have attendant risk factors. However, a bright ray of hope involving research into antisickling properties of medicinal plants has been rewarding. This alternative therapy using phytomedicines has proven to not only reduce crisis but also reverse sickling (in vitro). The immense benefits of phytomedicines and nutraceuticals used in the management of sickle cell anemia are discussed in this paper. PMID:23476125

  9. Mono-allelic expression of variegating transgene locus in the mouse.

    PubMed

    Opsahl, Margaret L; Springbett, Anthea; Lathe, Richard; Colman, Alan; McClenaghan, Margaret; Whitelaw, C Bruce A

    2003-12-01

    We have generated transgenic mice which express an ovine beta-lactoglobulin transgene during lactation. In two transgenic lines, BLG/7 and BLG/45, beta-lactoglobulin protein levels vary between siblings, reflected at the cellular level by a mosaic transgene expression pattern in the mammary tissue that is reminiscent of position effect variegation. To investigate whether this variegating expression profile can be affected by the introduction of an identical variegating locus on the homologous chromosome, we compared the beta-lactoglobulin expression profiles in mice hemizygous or homozygous for the transgene locus. In BLG/45 mice, milk protein analysis revealed that transgene expression was effectively doubled in homozygous compared to hemizygous mice. In contrast, beta-lactoglobulin protein in hemizygous and homozygous BLG/7 mice displayed a similar range; although minimum expression levels were doubled in the homozygous population, the maximum level of expression was indistinguishable between the two populations. Fluorescent in situ hybridisation (FISH) for transgene mRNA indicated that for a given protein level, the extent of cellular expression is similar in both BLG/7 populations. In homozygous mice genomic DNA and nuclear RNA FISH demonstrated that only one of the two BLG/7 loci is active in expressing cells, while two transcription foci were present in BLG/45 homozygous mice. This mono-allelic transgene expression pattern is not inherited through the germline, as hemizygous mice bred from homozygous parents expressed at the expected hemizygous population level. We discuss these observations in the context of known epigenetic events such as imprinting and trans-inactivation.

  10. A Luciferase Reporter Gene System for High-Throughput Screening of γ-Globin Gene Activators.

    PubMed

    Xie, Wensheng; Silvers, Robert; Ouellette, Michael; Wu, Zining; Lu, Quinn; Li, Hu; Gallagher, Kathleen; Johnson, Kathy; Montoute, Monica

    2016-01-01

    Luciferase reporter gene assays have long been used for drug discovery due to their high sensitivity and robust signal. A dual reporter gene system contains a gene of interest and a control gene to monitor non-specific effects on gene expression. In our dual luciferase reporter gene system, a synthetic promoter of γ-globin gene was constructed immediately upstream of the firefly luciferase gene, followed downstream by a synthetic β-globin gene promoter in front of the Renilla luciferase gene. A stable cell line with the dual reporter gene was cloned and used for all assay development and HTS work. Due to the low activity of the control Renilla luciferase, only the firefly luciferase activity was further optimized for HTS. Several critical factors, such as cell density, serum concentration, and miniaturization, were optimized using tool compounds to achieve maximum robustness and sensitivity. Using the optimized reporter assay, the HTS campaign was successfully completed and approximately 1000 hits were identified. In this chapter, we also describe strategies to triage hits that non-specifically interfere with firefly luciferase.

  11. The relationship between the INTERMED patient complexity instrument and Level of Care Utilisation System (LOCUS).

    PubMed

    Thurber, Steven; Wilson, Ann; Realmuto, George; Specker, Sheila

    2018-03-01

    To investigate the concurrent and criterion validity of two independently developed measurement instruments, INTERMED and LOCUS, designed to improve the treatment and clinical management of patients with complex symptom manifestations. Participants (N = 66) were selected from hospital records based on the complexity of presenting symptoms, with tripartite diagnoses across biological, psychiatric and addiction domains. Biopsychosocial information from hospital records were submitted to INTERMED and LOCUS grids. In addition, Global Assessment of Functioning (GAF) ratings were gathered for statistical analyses. The product moment correlation between INTERMED and LOCUS was 0.609 (p = .01). Inverse zero-order correlations for INTERMED and LOCUS total score and GAF were obtained. However, only the beta weight for LOCUS and GAF was significant. An exploratory principal components analysis further illuminated areas of convergence between the instruments. INTERMED and LOCUS demonstrated shared variance. INTERMED appeared more sensitive to complex medical conditions and severe physiological reactions, whereas LOCUS findings are more strongly related to psychiatric symptoms. Implications are discussed.

  12. Genetic determinants and stroke in children with sickle cell disease.

    PubMed

    Rodrigues, Daniela O W; Ribeiro, Luiz C; Sudário, Lysla C; Teixeira, Maria T B; Martins, Marina L; Pittella, Anuska M O L; Junior, Irtis de O Fernandes

    To verify genetic determinants associated with stroke in children with sickle cell disease (SCD). Prospective cohort with 110 children submitted to neonatal screening by the Neonatal Screening Program, between 1998 and 2007, with SCD diagnosis, followed at a regional reference public service for hemoglobinopathies. The analyzed variables were type of hemoglobinopathy, gender, coexistence with alpha thalassemia (α-thal), haplotypes of the beta globin chain cluster, and stroke. The final analysis was conducted with 66 children with sickle cell anemia (SCA), using the chi-squared test in the program SPSS ® version 14.0. Among children with SCD, 60% had SCA. The prevalence of coexistence with α-thal was 30.3% and the Bantu haplotype (CAR) was identified in 89.2%. The incidence of stroke was significantly higher in those with SCA (27.3% vs. 2.3%; p=0.001) and males (24.1% vs. 9.6%; p=0.044). The presence of α-thal (p=0.196), the CAR haplotype (p=0.543), and socioeconomic factors were not statistically significant in association with the occurrence of stroke. There is a high incidence of stroke in male children and in children with SCA. Coexistence with α-thal and haplotypes of the beta globin chain cluster did not show any significant association with stroke. The heterogeneity between previously evaluated populations, the non-reproducibility between studies, and the need to identify factors associated with stroke in patients with SCA indicate the necessity of conducting further research to demonstrate the relevance of genetic factors in stroke related to SCD. Copyright © 2016 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  13. Tangential Flow Filtration of Hemoglobin

    PubMed Central

    Sun, Guoyong; Harris, David R.

    2009-01-01

    Bovine and human hemoglobin (bHb and hHb, respectively) was purified from bovine and human red blood cells (bRBCs and hRBCs, respectively) via tangential flow filtration (TFF) in four successive stages. TFF is a fast and simple method to purify Hb from RBCs using filtration through hollow fiber (HF) membranes. Most of the Hb was retained in stage III (100 kDa HF membrane) and displayed methemoglobin levels less than 1%, yielding final concentrations of 318 and 300 mg/mL for bHb and hHb, respectively. Purified Hb exhibited much lower endotoxin levels than their respective RBCs. The purity of Hb was initially assessed via SDS-PAGE, and showed tiny impurity bands for the stage III retentate. The oxygen affinity (P50), and cooperativity coefficient (n) were regressed from the measured oxygen-RBC/Hb equilibrium curves of RBCs and purified Hb. These results suggest that TFF yielded oxygen affinities of bHb and hHb that are comparable to values in the literature. LC-MS was used to measure the molecular weight of the alpha (α) and beta (β) globin chains of purified Hb. No impurity peaks were present in the HPLC chromatograms of purified Hb. The mass of the molecular ions corresponding to the α and β globin chains agreed well with the calculated theoretical mass of the α-and β-globin chains. Taken together, our results demonstrate that HPLC grade Hb can be generated via TFF. In general, this method can be more broadly applied to purify Hb from any source of RBCs. This work is significant, since it outlines a simple method for generating Hb for synthesis and/or formulation of Hb-based oxygen carriers (HBOCs). PMID:19224583

  14. Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

    PubMed Central

    Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2015-01-01

    Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

  15. Structural and Functional Analysis of an mRNP Complex That Mediates the High Stability of Human β-Globin mRNA

    PubMed Central

    Yu, Jia; Russell, J. Eric

    2001-01-01

    Human globins are encoded by mRNAs exhibiting high stabilities in transcriptionally silenced erythrocyte progenitors. Unlike α-globin mRNA, whose stability is enhanced by assembly of a specific messenger RNP (mRNP) α complex on its 3′ untranslated region (UTR), neither the structure(s) nor the mechanism(s) that effects the high-level stability of human β-globin mRNA has been identified. The present work describes an mRNP complex assembling on the 3′ UTR of the β-globin mRNA that exhibits many of the properties of the stability-enhancing α complex. The β-globin mRNP complex is shown to contain one or more factors homologous to αCP, a 39-kDa RNA-binding protein that is integral to α-complex assembly. Sequence analysis implicates a specific 14-nucleotide pyrimidine-rich track within its 3′ UTR as the site of β-globin mRNP assembly. The importance of this track to mRNA stability is subsequently verified in vivo using mice expressing human β-globin transgenes that contain informative mutations in this region. In combination, the in vitro and in vivo analyses indicate that the high stabilities of the α- and β-globin mRNAs are maintained through related mRNP complexes that may share a common regulatory pathway. PMID:11486027

  16. Viruses and interstitial cystitis: adenovirus genomes cannot be demonstrated in urinary bladder biopsies.

    PubMed

    Hukkanen, V; Haarala, M; Nurmi, M; Klemi, P; Kiilholma, P

    1996-01-01

    Microbes may be involved in the pathogenesis of interstitial cystitis (IC). Adenoviruses and BK virus (BKV) can infect epithelial cells in urinary bladder and they are causative agents for hemorrhagic cystitis. We therefore studied the presence of adenovirus and BKV genomes in urinary bladder tissue specimens of patients with IC using polymerase chain reaction (PCR) and in situ hybridization (ISH). Controls were specimens from cases with transitional cell carcinoma of the bladder. Nucleic acids were extracted from paraffin sections of the bladder tissue for PCR. Primers detecting all adenovirus types were used. In situ hybridization was carried out for the paraffin sections using digoxigenin-labeled DNA probes for adenovirus and BKV. The adenovirus DNA PCR was able to detect one to two infected cells/specimen. All the seven IC cases studied and six controls were negative for adenovirus DNA by PCR and ISH. The ISH test for BKV genomes was also considered negative in IC cases and controls. The specimens which were negative in PCR tests yielded a signal with beta-globin primers, thus being amplifiable. We conclude that adenovirus and BKV do not play a major pathogenetic role in interstitial cystitis.

  17. Expression of the Pasteurella haemolytica leukotoxin is inhibited by a locus that encodes an ATP-binding cassette homolog.

    PubMed Central

    Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M

    1993-01-01

    Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916

  18. Characterisation of monotreme caseins reveals lineage-specific expansion of an ancestral casein locus in mammals.

    PubMed

    Lefèvre, Christophe M; Sharp, Julie A; Nicholas, Kevin R

    2009-01-01

    Using a milk-cell cDNA sequencing approach we characterised milk-protein sequences from two monotreme species, platypus (Ornithorhynchus anatinus) and echidna (Tachyglossus aculeatus) and found a full set of caseins and casein variants. The genomic organisation of the platypus casein locus is compared with other mammalian genomes, including the marsupial opossum and several eutherians. Physical linkage of casein genes has been seen in the casein loci of all mammalian genomes examined and we confirm that this is also observed in platypus. However, we show that a recent duplication of beta-casein occurred in the monotreme lineage, as opposed to more ancient duplications of alpha-casein in the eutherian lineage, while marsupials possess only single copies of alpha- and beta-caseins. Despite this variability, the close proximity of the main alpha- and beta-casein genes in an inverted tail-tail orientation and the relative orientation of the more distant kappa-casein genes are similar in all mammalian genome sequences so far available. Overall, the conservation of the genomic organisation of the caseins indicates the early, pre-monotreme development of the fundamental role of caseins during lactation. In contrast, the lineage-specific gene duplications that have occurred within the casein locus of monotremes and eutherians but not marsupials, which may have lost part of the ancestral casein locus, emphasises the independent selection on milk provision strategies to the young, most likely linked to different developmental strategies. The monotremes therefore provide insight into the ancestral drivers for lactation and how these have adapted in different lineages.

  19. Transduction of cultured fish cells with recombinant baculoviruses.

    PubMed

    Leisy, Douglas J; Lewis, Teresa D; Leong, Jo-Ann C; Rohrmann, George F

    2003-05-01

    Five fish cell lines were tested for their ability to be transduced by Ac-CAlacZ, a recombinant baculovirus that is capable of expressing a beta-galactosidase reporter gene from the CAG promoter (consisting of a cytomegalovirus enhancer element, a chicken actin promoter and rabbit beta-globin termination sequences). TO (Tilapia ovary), EPC (carp), CHH-1 (Chum salmon heart fibroblast) and CHSE-214 (chinook salmon embryo) cells were transducible, as demonstrated by an in situ beta-galactosidase assay, whereas RTG-2 (rainbow trout gonad) cells were not. The EPC cell line was used for more detailed studies on baculovirus transduction. The transduction frequency was found to be higher at 28 degrees C than at 21 degrees C. Addition of the histone deacetylase inhibitor sodium butyrate increased the number of blue cells detected 5- to 7-fold. The m.o.i. was positively correlated with transduction frequency, although the relationship did not appear to be strictly linear, as has been observed with mammalian cells. The temperature at which baculoviruses were adsorbed to EPC cells did not affect levels of beta-galactosidase expression. We also examined expression levels of beta-galactosidase in EPC cells after infection with a baculovirus construct that overexpresses the vesicular stomatitis virus G protein and displays it on the virion surface. Expression levels with this virus were approximately 15-fold higher than were observed with Ac-CAlacZ.

  20. Genealogy of the nuclear beta-fibrinogen locus in a highly structured lizard species: comparison with mtDNA and evidence for intragenic recombination in the hybrid zone.

    PubMed

    Godinho, R; Mendonça, B; Crespo, E G; Ferrand, N

    2006-06-01

    The study of nuclear genealogies in natural populations of nonmodel organisms is expected to provide novel insights into the evolutionary history of populations, especially when developed in the framework of well-established mtDNA phylogeographical scenarios. In the Iberian Peninsula, the endemic Schreiber's green lizard Lacerta schreiberi exhibits two highly divergent and allopatric mtDNA lineages that started to split during the late Pliocene. In this work, we performed a fine-scale analysis of the putative mtDNA contact zone together with a global analysis of the patterns of variation observed at the nuclear beta-fibrinogen intron 7 (beta-fibint7). Using a combination of DNA sequencing with single-strand conformational polymorphism (SSCP) analysis, we show that the observed genealogy at the beta-fibint7 locus reveals extensive admixture between two formerly isolated lizard populations while the two mtDNA lineages remain essentially allopatric. In addition, a private beta-fibint7 haplotype detected in the single population where both mtDNA lineages were found in sympatry is probably the result of intragenic recombination between the two more common and divergent beta-fibint7 haplotypes. Our results suggest that the progressive incorporation of nuclear genealogies in investigating the ancient demography and admixture dynamics of divergent genomes will be necessary to obtain a more comprehensive picture of the evolutionary history of organisms.

  1. Association of an α-globin gene cluster duplication and heterozygous β-thalassemia in a patient with a severe thalassemia syndrome.

    PubMed

    Jiang, Hua; Liu, Sha; Zhang, Yong-Ling; Wan, Jun-Hui; Li, Ru; Li, Dong-Zhi

    2015-01-01

    We describe a new case of a β-thalassemia (β-thal) heterozygote with the mutation IVS-II-654 (C>T) presenting with a transfusion-dependent phenotype. Multiplex ligation-dependent probe amplification (MLPA) and array comparative genomic hybridization (CGH) analyses of the α-globin gene cluster revealed a full duplication of the α-globin genes including the upstream regulatory element. The duplicated allele and the normal allele in trans resulted in a total of six active α-globin genes. The severe clinical phenotype seemed to be related to the considerable excess of the α- and β-globin deficit caused by the presence of the β-thal. α-Globin cluster duplication should be considered in patients heterozygous for β-thal who show a more severe phenotype than β-thal trait.

  2. DNA variation in the genes of the Na,K-adenosine triphosphatase and its relation with resting metabolic rate, respiratory quotient, and body fat.

    PubMed Central

    Dériaz, O; Dionne, F; Pérusse, L; Tremblay, A; Vohl, M C; Côté, G; Bouchard, C

    1994-01-01

    The aim of this study was to investigate in 261 subjects from 58 families the association between DNA variation at the genes coding for the Na,K-ATPase peptides and resting metabolic rate (RMR), respiratory quotient (RQ), and percent body fat (%FAT). Five restriction fragment length polymorphisms (RFLP) at three Na,K-ATPase genes were determined: one at the alpha 1 locus (BglII), and two at the beta locus (beta MspI and beta PvuII). Haplotypes were determined from the two variable sites of the alpha 2 gene (alpha 2 haplotypes) and the beta gene (beta haplotypes). There was a strong trend for %FAT to be related to the RFLP generated by BglII at the alpha 2 exons 21-22 in males (P = 0.06) and females (P = 0.05). RQ was (a) associated with the BglII RFLP at the alpha 2 exon 1 (P = 0.02) and with the alpha 2 8.0 kb/4.3 kb haplotype (P = 0.04) and (b) linked with the beta gene MspI marker (P = 0.04) and with the beta 5.3 kb/5.1 kb haplotype (P = 0.008) based on sib-pair analysis. The present study suggests that the genes encoding Na,K-ATPase may be associated or linked with RQ and perhaps with %FAT but not with RMR. PMID:7509349

  3. Open and Lys–His Hexacoordinated Closed Structures of a Globin with Swapped Proximal and Distal Sites

    PubMed Central

    Teh, Aik-Hong; Saito, Jennifer A.; Najimudin, Nazalan; Alam, Maqsudul

    2015-01-01

    Globins are haem-binding proteins with a conserved fold made up of α-helices and can possess diverse properties. A putative globin-coupled sensor from Methylacidiphilum infernorum, HGbRL, contains an N-terminal globin domain whose open and closed structures reveal an untypical dimeric architecture. Helices E and F fuse into an elongated helix, resulting in a novel site-swapped globin fold made up of helices A–E, hence the distal site, from one subunit and helices F–H, the proximal site, from another. The open structure possesses a large cavity binding an imidazole molecule, while the closed structure forms a unique Lys–His hexacoordinated species, with the first turn of helix E unravelling to allow Lys52(E10) to bind to the haem. Ligand binding induces reorganization of loop CE, which is stabilized in the closed form, and helix E, triggering a large conformational movement in the open form. These provide a mechanical insight into how a signal may be relayed between the globin domain and the C-terminal domain of HGbRL, a Roadblock/LC7 domain. Comparison with HGbI, a closely related globin, further underlines the high degree of structural versatility that the globin fold is capable of, enabling it to perform a diversity of functions. PMID:26094577

  4. Illegitimate transcription: transcription of any gene in any cell type.

    PubMed Central

    Chelly, J; Concordet, J P; Kaplan, J C; Kahn, A

    1989-01-01

    Using in vitro amplification of cDNA by the polymerase chain reaction, we have detected spliced transcripts of various tissue-specific genes (genes for anti-Müllerian hormone, beta-globin, aldolase A, and factor VIIIc) in human nonspecific cells, such as fibroblasts, hepatoma cells, and lymphoblasts. In rats, erythroid- and liver-type pyruvate kinase transcripts were also detected in brain, lung, and muscle. The abundance of these "illegitimate" transcripts is very low; yet, their existence and the possibility of amplifying them by the cDNA polymerase chain reaction provide a powerful tool to analyze pathological transcripts of any tissue-specific gene by using any accessible cell. Images PMID:2495532

  5. A space-efficient algorithm for local similarities.

    PubMed

    Huang, X Q; Hardison, R C; Miller, W

    1990-10-01

    Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.

  6. Towards β-globin gene-targeting with integrase-defective lentiviral vectors.

    PubMed

    Inanlou, Davoud Nouri; Yakhchali, Bagher; Khanahmad, Hossein; Gardaneh, Mossa; Movassagh, Hesam; Cohan, Reza Ahangari; Ardestani, Mehdi Shafiee; Mahdian, Reza; Zeinali, Sirous

    2010-11-01

    We have developed an integrase-defective lentiviral (LV) vector in combination with a gene-targeting approach for gene therapy of β-thalassemia. The β-globin gene-targeting construct has two homologous stems including sequence upstream and downstream of the β-globin gene, a β-globin gene positioned between hygromycin and neomycin resistant genes and a herpes simplex virus type 1 thymidine kinase (HSVtk) suicide gene. Utilization of integrase-defective LV as a vector for the β-globin gene increased the number of selected clones relative to non-viral methods. This method represents an important step toward the ultimate goal of a clinical gene therapy for β-thalassemia.

  7. Understanding α-globin gene regulation and implications for the treatment of β-thalassemia.

    PubMed

    Mettananda, Sachith; Gibbons, Richard J; Higgs, Douglas R

    2016-03-01

    Over the past three decades, a vast amount of new information has been uncovered describing how the globin genes are regulated. This knowledge has provided significant insights into the general understanding of the regulation of human genes. It is now known that molecular defects within and around the α- and β-globin genes, as well as in the distant regulatory elements, can cause thalassemia. Unbalanced production of globin chains owing to defective synthesis of one, and the continued unopposed synthesis of another, is the central causative factor in the cellular pathology and pathophysiology of thalassemia. A large body of clinical, genetic, and experimental evidence suggests that altering globin chain imbalance by reducing the production of α-globin synthesis ameliorates the disease severity in patients with β-thalassemia. With the development of new genetic-based therapeutic tools that have a potential to decrease the expression of a selected gene in a tissue-specific manner, the possibility of decreasing expression of the α-globin gene to improve the clinical severity of β-thalassemia could become a reality. © 2015 New York Academy of Sciences.

  8. Monomethylfumarate Induces γ-Globin Expression and Fetal Hemoglobin Production in Cultured Human Retinal Pigment Epithelial (RPE) and Erythroid Cells, and in Intact Retina

    PubMed Central

    Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B.; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S.; Martin, Pamela M.

    2014-01-01

    Purpose. Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Methods. Human globin gene expression was evaluated by RT–quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase–qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous βs mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Results. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. Conclusions. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. PMID:24825111

  9. Mutations on the α2-Globin Gene That May Trigger α(+)-Thalassemia.

    PubMed

    Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

    2015-01-01

    In the present study, a total of 11 individuals with hypochromic microcytic anemia who did not reveal the most common α-thalassemia (α-thal) deletions or mutations, were subjected to more investigations by DNA sequencing of the α-globin genes. Seven novel nondeletional α-thal mutations localized on the α2-globin gene in the heterozygous state were identified. These mutations either corrupted regulatory splice sites and consequently affected RNA processing or created unstable hemoglobin (Hb) variants. The mutations described here produced globin gene variants that lead to amino acid changes in critical regions of the globin chain. The clinical presentation of most patients was a persistent mild microcytic anemia similar to an α(+)-thal. In the last decade, numerous α-globin mutations have been observed leading to an α-thal phenotype and these studies have been considered to be important as discussed here.

  10. Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

    1996-11-01

    In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

  11. GABA-A receptor beta3 and alpha5 subunit gene cluster on chromosome 15q11-q13 and bipolar disorder: a genetic association study.

    PubMed

    Papadimitriou, G N; Dikeos, D G; Karadima, G; Avramopoulos, D; Daskalopoulou, E G; Stefanis, C N

    2001-05-08

    There is accumulated evidence that the genes coding for the receptor of gamma aminobutyric acid (GABA), the most important inhibitory neurotransmitter in the CNS, may be involved in the pathogenesis of affective disorders. In a previous study, we have found a genetic association between the GABA-A receptor alpha5 subunit gene locus (GABRA5) on chromosome 15q11-of 13 and bipolar affective disorder. The aim of the present study was to examine the same subjects to see if there exists a genetic association between bipolar affective disorder and the GABA receptor beta3 subunit gene (GABRB3), which is located within 100 kb from GABRA5. The sample consisted of 48 bipolar patients compared to 44 controls (blood donors). All subjects were Greek, unrelated, and personally interviewed. Diagnosis was based on DSM-IV and ICD-10 criteria. The marker used was a dinucleotide (CA) repeat polymorphism with 12 alleles 179 to 201 bp long; genotyping was successful in all patients and 43 controls. The distribution of GABRB3 genotypes among the controls did not deviate significantly from the Hardy-Weinberg equilibrium. No differences in allelic frequencies between bipolar patients and controls were found for GABRB3, while this locus and GABRA5 did not seem to be in significant linkage disequilibrium. In conclusion, the GABRB3 CA-repeat polymorphism we investigated does not present the observed association between bipolar affective illness and GABRA5. This could be due to higher mutation rate in the GABRB3 CA-repeat polymorphism, but it might also signify that GABRA5 is the gene actually associated with the disease. Copyright 2001 Wiley-Liss, Inc.

  12. Assignment of the structural gene for human beta glucuronidase to chromosome 7 and tetrameric association of subunits in the enzyme molecule.

    PubMed Central

    Chern, C J; Croce, C M

    1976-01-01

    The structural locus for human beta glucuronidase is assigned to chromosome 7, a localization based upon concordant segregation of the expression of the human enzyme and the presence of human chromosome 7 in somatic cell hybrid clones derived independently from fusions of different human and mouse cells. Hybrid clones containing only human chromosome 7 are included in this study. Electrophoresis of beta glucuronidase also has revealed that human beta glucuronidase has a tetrametric structure. Images Fig. 1 Fig. 2 Fig. 3 PMID:941902

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Popp, R.A.; Lalley, P.A.; Whitney, J.B.

    A genetic polymorphism for a Bgl I endonuclease site near the ..cap alpha..-globin-like pseudogene ..cap alpha..-4 of C57BL/6 and C3H/HeN mice was used to show that ..cap alpha..-4 was not affected by three independent mutations in which the adult globin genes ..cap alpha..-1 and ..cap alpha..-2 were deleted. These results indicated that ..cap alpha..-4 might not be located adjacent to the adult ..cap alpha..-globin genes on chromosome 11. Restriction endonuclease analysis of DNA of a primary clone of a Chinese hamster-mouse somatic cell hybrid that had lost mouse chromosomes 11 and 18 showed that this clone lacked the adult murinemore » globin genes ..cap alpha..-1 and ..cap alpha..-2 but it did contain the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4. These results indicated that the adult ..cap alpha..-globin genes and ..cap alpha..-globin-like pseudogenes are not located on the same chromosome. Similar analyses of several other Chinese hamster-mouse somatic cell hybrids that had segregated other mouse chromosomes indicated that the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4 are located on mouse chromosomes 15 and 17, respectively. These data explain why ..cap alpha..-3 and ..cap alpha..-4 were not affected by the three independently induced deletion-type mutations that cause ..cap alpha..-thalassemia in the mouse.« less

  14. CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes.

    PubMed

    Liang, Puping; Xu, Yanwen; Zhang, Xiya; Ding, Chenhui; Huang, Rui; Zhang, Zhen; Lv, Jie; Xie, Xiaowei; Chen, Yuxi; Li, Yujing; Sun, Ying; Bai, Yaofu; Songyang, Zhou; Ma, Wenbin; Zhou, Canquan; Huang, Junjiu

    2015-05-01

    Genome editing tools such as the clustered regularly interspaced short palindromic repeat (CRISPR)-associated system (Cas) have been widely used to modify genes in model systems including animal zygotes and human cells, and hold tremendous promise for both basic research and clinical applications. To date, a serious knowledge gap remains in our understanding of DNA repair mechanisms in human early embryos, and in the efficiency and potential off-target effects of using technologies such as CRISPR/Cas9 in human pre-implantation embryos. In this report, we used tripronuclear (3PN) zygotes to further investigate CRISPR/Cas9-mediated gene editing in human cells. We found that CRISPR/Cas9 could effectively cleave the endogenous β-globin gene (HBB). However, the efficiency of homologous recombination directed repair (HDR) of HBB was low and the edited embryos were mosaic. Off-target cleavage was also apparent in these 3PN zygotes as revealed by the T7E1 assay and whole-exome sequencing. Furthermore, the endogenous delta-globin gene (HBD), which is homologous to HBB, competed with exogenous donor oligos to act as the repair template, leading to untoward mutations. Our data also indicated that repair of the HBB locus in these embryos occurred preferentially through the non-crossover HDR pathway. Taken together, our work highlights the pressing need to further improve the fidelity and specificity of the CRISPR/Cas9 platform, a prerequisite for any clinical applications of CRSIPR/Cas9-mediated editing.

  15. Life style and biochemical adaptation in Antarctic fishes

    NASA Astrophysics Data System (ADS)

    di Prisco, Guido

    2000-12-01

    Respiration and metabolism are under investigation in Antarctic fish, in an effort to understand the interplay between ecology and biochemical and physiological processes. Fish of the dominant suborder Notothenioidei are red-blooded, except Channichthyidae (the most phyletically derived family), whose genomes retain transcriptionally inactive DNA sequences closely related to the α-globin gene of red-blooded notothenioids and have lost the β-globin locus. Our structure/function studies on 38 of the 80 red-blooded species are aimed at correlating sequence, multiplicity and oxygen binding with ecological constraints and at obtaining phylogenetic information on evolution. For comparative purposes, this work has been extended to non-Antarctic notothenioids. All sluggish bottom dwellers have a single major hemoglobin (Hb) and often a minor, functionally similar one. Three species of the family Nototheniidae have different life styles. They have uniquely specialised oxygen-transport systems, adjusted to the mode of life of each species. Artedidraconidae have a single Hb, lacking oxygen-binding cooperativity, similar to the ancestral hemoproteins of primitive organisms. The amino acid sequences are currently used in the molecular modelling approach. The study of several enzymes with key roles in metabolism (e.g. glucose-6-phosphate dehydrogenase, L-glutamate dehydrogenase, phosphorylase b, carbonic anhydrase) indicate that some aspects of the molecular structure (e.g. molecular mass, number of subunits, amino acid sequence, temperature of irreversible heat inactivation) have been conserved during development of cold adaptation. However, high catalytic efficiency, possibly due to subtle molecular changes, is observed at low temperature.

  16. Preferential mitochondrial DNA injury caused by glucose oxidase as a steady generator of hydrogen peroxide in human fibroblasts.

    PubMed

    Salazar, J J; Van Houten, B

    1997-11-01

    To test the hypothesis that mitochondrial DNA (mtDNA) is more prone to reactive oxygen species (ROS) damage than nuclear DNA, a continuous flux of hydrogen peroxide (H2O2) was produced with the glucose/glucose oxidase system. Using a horse radish peroxidase (HRPO)-based colorimetric assay to detect H2O2, glucose oxidase (GO; 12 mU/ml) produced 95 microM of H2O2 in 1 h, whereas only 46 microM of hydrogen peroxide accumulated in the presence of SV40-transformed human fibroblasts ( approximately 1 x 10(6). DNA damage was assessed in the mitochondira and three nuclear regions using a quantitative PCR assay. GO (12 mU/ml) resulted in more damage to the mitochondrial DNA (2.250 +/- 0.045 lesions/10 kb) than in any one of three nuclear targets, which included the non-expressed beta-globin locus (0.436 +/- 0.029 lesions/10 kb); and the active DNA polymerase b gene (0.442 +/- 0.037 lesions/10 kb); and the active hprt gene (0.310 +/- 0.025). Damage to the mtDNA occurred within 15 min of GO treatment, whereas nuclear damage did not appear until after 30 min, and reached a maximum after 60 min. Repair of mitochondrial damage after a 15 min GO (6 mU/ml) treatment was examined. Mitochondria repaired 50% of the damage after 1 h, and by 6 h all the damage was repaired. Higher doses of GO-generated H202, or more extended treatment periods, lead to mitochondrial DNA damage which was not repaired. Mitochondrial function was monitored using the MTT (3,(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide) assay. A 15 min treatment with 6 mU/ml of GO decreased mitochondrial activity to 80% of the control; the activity recovered completely within 1 h after damage. These data show that GO-generated H202 causes acute damage to mtDNA and function, and demonstrate that this organelle is an important site for the cellular toxicity of ROS.

  17. The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.

    PubMed

    Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel

    2012-01-01

    Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.

  18. The Effectiveness of Neurofeedback on Enhancing Cognitive Process Involved in Entrepreneurship Abilities among Primary School Students in District No. 3 Tehran.

    PubMed

    Rahmati, Narges; Rostami, Reza; Zali, Mohammad Reza; Nowicki, Stephen; Zarei, Jamilah

    2014-10-01

    The aim of this study is to investigate the entrepreneurial traits of school children in the city of Tehran. For this purpose, 48 students were selected with an average IQ between 90 and 119. Ranging from 7th to 12th grades, all the subjects were assessed using Nowicki-Strickland's Locus of Control Scale (N-SLCS), Torrance Tests of Creative Thinking (TTCT), and Hyperkinetic Syndrome Assessment Method (HKSD). The obtained results were then organized and categorized into three groups. One of the groups was randomly chosen as experimental and the other as the control group and the last play group. In this empirical study, the students received Sensory Motor Rhythm (SMR) and Beta neurofeedback for 20 sessions. The play group was assigned to play mind games for 20 sessions. At the same time, the control group received no experiments. After the end of the experiments, all the students in three groups were reassessed by Torrance Tests of Creative Thinking, Hyperkinetic Syndrome Assessment Method, and Nowicki-Strickland's Locus of Control Scale. The results from MANOVA showed that the neurofeedback group had demonstrated a meaningful change in creativity and locus of control while the adaptability of risk-taking was on a meaningful level for the experimental group. The results also indicate an improvement in creativity for the neurofeedback group in comparison with the play group on a 0.02 meaningful level. Similarly, the results suggest an improvement in creativity for the neurofeedback group on a 0.000 meaningful level in comparison with the control group. This is while the play group and the control group do not show any meaningful difference. The results also show an improvement in the internal locus of control for the neurofeedback group in comparison with the play group on a 0.032 meaningful level; while, it is meaningful on a 0.01 level for the neurofeedback group in comparison with the control group. The findings for the play group and control group do not show any meaningful difference. The paper concludes that neurofeedback training can be used for increasing the level of entrepreneurial traits in students.

  19. Oxidative stress in β-thalassaemia and sickle cell disease

    PubMed Central

    Voskou, S.; Aslan, M.; Fanis, P.; Phylactides, M.; Kleanthous, M.

    2015-01-01

    Sickle cell disease and β-thalassaemia are inherited haemoglobinopathies resulting in structural and quantitative changes in the β-globin chain. These changes lead to instability of the generated haemoglobin or to globin chain imbalance, which in turn impact the oxidative environment both intracellularly and extracellularly. The ensuing oxidative stress and the inability of the body to adequately overcome it are, to a large extent, responsible for the pathophysiology of these diseases. This article provides an overview of the main players and control mechanisms involved in the establishment of oxidative stress in these haemoglobinopathies. PMID:26285072

  20. A 21 Nucleotide Duplication on the α1- and α2-Globin Genes Involves a Variety of Hypochromic Microcytic Anemias, From Mild to Hb H Disease.

    PubMed

    Farashi, Samaneh; Faramarzi Garous, Negin; Zeinali, Fatemeh; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Najmabadi, Hossein; Azarkeivan, Azita; Tamaddoni, Ahmad

    2015-01-01

    α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects in the α-globin gene cluster can result in α-thal that may develop into a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. Loss of one functional α gene, indicated as heterozygous α(+)-thal, shows minor hematological abnormalities. Homozygosity for α(+)- or heterozygosity for α(0)-thal have more severe hematological abnormalities due to a markedly reduced α chain output. At the molecular level, the absence of three α-globin genes resulting from the compound heterozygous state for α(0)- and α(+)-thal, lead to Hb H disease. Here we present a 21 nucleotide (nt) duplication consisting of six amino acids and 3 bp of intronic sequence at the exon-intron boundary, in both the α-globin genes, detected by direct DNA sequencing. This duplication was identified in three patients originating from two different Iranian ethnic groups and one Arab during more than 12 years. The clinical presentation of these individuals varies widely from a mild asymptomatic anemia (heterozygote in α1-globin gene) to a severely anemic state, diagnosed as an Hb H individual requiring blood transfusion (duplication on the α2-globin gene in combination with the - -(MED) double α-globin gene deletion). The third individual, who was homozygous for this nt duplication on the α1-globin gene, showed severe hypochromic microcytic anemia and splenomegaly. In the last decade, numerous α-globin mutations have demonstrated the necessity of prenatal diagnosis (PND) for α-thal, and this study has contributed another mutation as important enough that needs to be considered.

  1. Association study of schizophrenia and IL-2 receptor {beta} chain gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nimgaonkar, V.L.; Yang, Z.W.; Zhang, X.R.

    1995-10-09

    A case-control association study was conducted in Caucasian patients with schizophrenia (DSM-III-R, n = 42) and unaffected controls (n = 47) matched for ethnicity and area of residence. Serum interleukin-2 receptor (IL-2R) concentrations, as well as a dinucleotide repeat polymorphism in the IL-2RP chain gene, were examined in both groups. No significant differences in IL-2R concentrations or in the distribution of the polymorphism were noted. This study does not support an association between schizophrenia and the IL-2RP gene locus, contrary to the suggestive evidence from linkage analysis in multicase families. 17 refs., 2 tabs.

  2. Hematopoietic stem cell transplantation for people with ß-thalassaemia major.

    PubMed

    Jagannath, Vanitha A; Fedorowicz, Zbys; Al Hajeri, Amani; Sharma, Akshay

    2014-10-15

    Thalassemia is an inherited blood disorder, caused by mutations in regulatory genes and transmitted as an autosomal recessive disorder, which results in a reduced rate of synthesis of one of the globin chains that make up haemoglobin. In ß-thalassaemia major there is an underproduction of ß-globin chains combined with excess of free α-globin chains. The excess free α-globin chains damage the red blood cell membranes, leading to their destruction and a phenomenon termed ineffective erythropoiesis. The conventional approach to treatment is based on the correction of haemoglobin status through regular blood transfusions and iron chelation therapy for iron overload. Although conventional treatment has the capacity to improve the quality of life of people with ß-thalassaemia major, allogeneic hematopoietic stem cell transplantation is the only currently available procedure which has the potential to definitively cure the disease. To evaluate the effectiveness and safety of different types of allogeneic hematopoietic stem cell transplantation, in people with severe transfusion-dependant ß-thalassaemia major, ß-thalassaemia intermedia or ß0/+- thalassaemia variants requiring chronic blood transfusion. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Haemoglobinopathies Trials Register comprising references identified from comprehensive electronic database searches and handsearches of relevant journals and abstract books of conference proceedings.Date of the most recent search: 11 November 2013. Randomised controlled trials and quasi-randomised controlled trials comparing allogeneic hematopoietic stem cell transplantation with each other or with standard therapy (regular transfusion and chelation regimen). Two review authors independently screened studies and had planned to extract data and assess risk of bias using standard Cochrane Collaboration methodologies but no studies were identified for inclusion. No relevant studies were retrieved after a comprehensive search of the literature. We were unable to identify any randomised controlled trials or quasi-randomised controlled trials on the effectiveness and safety of different types of allogeneic stem cell transplantation in people with severe transfusion-dependant ß-thalassaemia major or ß0/+- thalassaemia variants requiring chronic blood transfusion. The absence of high-level evidence for the effectiveness of these interventions emphasises the need for well-designed, adequately-powered, randomised controlled clinical trials.

  3. A Practical Platform for Blood Biomarker Study by Using Global Gene Expression Profiling of Peripheral Whole Blood

    PubMed Central

    Schmid, Patrick; Yao, Hui; Galdzicki, Michal; Berger, Bonnie; Wu, Erxi; Kohane, Isaac S.

    2009-01-01

    Background Although microarray technology has become the most common method for studying global gene expression, a plethora of technical factors across the experiment contribute to the variable of genome gene expression profiling using peripheral whole blood. A practical platform needs to be established in order to obtain reliable and reproducible data to meet clinical requirements for biomarker study. Methods and Findings We applied peripheral whole blood samples with globin reduction and performed genome-wide transcriptome analysis using Illumina BeadChips. Real-time PCR was subsequently used to evaluate the quality of array data and elucidate the mode in which hemoglobin interferes in gene expression profiling. We demonstrated that, when applied in the context of standard microarray processing procedures, globin reduction results in a consistent and significant increase in the quality of beadarray data. When compared to their pre-globin reduction counterparts, post-globin reduction samples show improved detection statistics, lowered variance and increased sensitivity. More importantly, gender gene separation is remarkably clearer in post-globin reduction samples than in pre-globin reduction samples. Our study suggests that the poor data obtained from pre-globin reduction samples is the result of the high concentration of hemoglobin derived from red blood cells either interfering with target mRNA binding or giving the pseudo binding background signal. Conclusion We therefore recommend the combination of performing globin mRNA reduction in peripheral whole blood samples and hybridizing on Illumina BeadChips as the practical approach for biomarker study. PMID:19381341

  4. β-Globin-Expressing Definitive Erythroid Progenitor Cells Generated from Embryonic and Induced Pluripotent Stem Cell-Derived Sacs.

    PubMed

    Fujita, Atsushi; Uchida, Naoya; Haro-Mora, Juan J; Winkler, Thomas; Tisdale, John

    2016-06-01

    Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent a potential alternative source for red blood cell transfusion. However, when using traditional methods with embryoid bodies, ES cell-derived erythroid cells predominantly express embryonic type ɛ-globin, with lesser fetal type γ-globin and very little adult type β-globin. Furthermore, no β-globin expression is detected in iPS cell-derived erythroid cells. ES cell-derived sacs (ES sacs) have been recently used to generate functional platelets. Due to its unique structure, we hypothesized that ES sacs serve as hemangioblast-like progenitors capable to generate definitive erythroid cells that express β-globin. With our ES sac-derived erythroid differentiation protocol, we obtained ∼120 erythroid cells per single ES cell. Both primitive (ɛ-globin expressing) and definitive (γ- and β-globin expressing) erythroid cells were generated from not only ES cells but also iPS cells. Primitive erythropoiesis is gradually switched to definitive erythropoiesis during prolonged ES sac maturation, concurrent with the emergence of hematopoietic progenitor cells. Primitive and definitive erythroid progenitor cells were selected on the basis of glycophorin A or CD34 expression from cells within the ES sacs before erythroid differentiation. This selection and differentiation strategy represents an important step toward the development of in vitro erythroid cell production systems from pluripotent stem cells. Further optimization to improve expansion should be required for clinical application. Stem Cells 2016;34:1541-1552. © 2016 AlphaMed Press.

  5. The developmental genetics of human hemoglobin.

    PubMed

    Weatherall, D J; Wood, W G; Jones, R W; Clegg, J B

    1985-01-01

    Clearly, it is impossible to combine the diverse information briefly outlined in this review to provide a coherent model of the regulation of globin gene expression during development. One of the great difficulties in this field is uncertainty as to whether the mutations which are associated with persistent gamma chain production or, for the matter, the experimental models which have been used to study the differential expression of the fetal and adult globin genes, have any real relevance to an understanding of the normal switching process. Probably they do, but only with respect to one aspect of what must be an extremely complex multi-step regulatory system. The consistent changes in chromatin and methylation state of the beta globin gene cluster which are associated with activation of the different gene loci at different stages of development provide an anatomical explanation for the activity of these loci but tell us nothing about their mode of regulation. However, the gene or chromosome transfer experiments suggest that there may be developmental-stage specific trans regulatory factors which may be involved in the regulation of these genes, presumably by interacting in some way with chromatin. This is a very promising lead. Equally interesting is the possibility that the upstream mutations which are being found in some of the forms of non-deletion HPFH could provide a clue as to the site of these interactions. Thus at least we have an indication of what might be the most productive area of investigation for trying to characterize the mechanisms of regulation at the chromosomal level. This may be as far as we can go in the immediate future. The central question remains, however. How is the differential expression of the globin genes during development actually timed? All we know at the moment is that it is related fairly closely to gestational age. The only experimental data relating to this question is derived from the sheep transplant model, and suggests that there might be some form of "developmental clock' built into the hemopoietic stem cell. Here we are in considerable difficulties because we don't have an obvious experimental model with which to analyze time-related events. None of the forms of HPFH is, strictly speaking, a heterochronic mutation.(ABSTRACT TRUNCATED AT 400 WORDS)

  6. Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

    PubMed Central

    Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

    1974-01-01

    Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

  7. [Regulation of the β-globin gene family expression, useful in the search for new therapeutic targets for hemoglobinopathies].

    PubMed

    Scheps, Karen G; Varela, Viviana

    Different hemoglobin isoforms are expressed during the embryonic, fetal and postnatal stages. They are formed by combination of polypeptide chains synthesized from the α- and β-globin gene clusters. Based on the fact that the presence of high hemoglobin F levels is beneficial in both sickle cell disease and severe thalassemic syndromes, a revision of the regulation of the β-globin cluster expression is proposed, especially regarding the genes encoding the y-globin chains (HBG1 and HBG2). In this review we describe the current knowledge about transcription factors and epigenetic regulators involved in the switches of the β-globin cluster. It is expected that the consolidation of knowledge in this field will allow finding new therapeutic targets for the treatment of hemoglobinopathies.

  8. A new gene deletion in the alpha-like globin gene cluster as the molecular basis for the rare alpha-thalassemia-1(--/alpha alpha) in blacks: HbH disease in sickle cell trait.

    PubMed

    Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P

    1986-02-01

    A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.

  9. β-globin gene cluster haplotypes in ethnic minority populations of southwest China

    PubMed Central

    Sun, Hao; Liu, Hongxian; Huang, Kai; Lin, Keqin; Huang, Xiaoqin; Chu, Jiayou; Ma, Shaohui; Yang, Zhaoqing

    2017-01-01

    The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5′ sites and 3′ sites of the β-globin gene cluster. 5′ haplotypes 2 (+−−−), 6 (−++−+), 9 (−++++) and 3′ haplotype FW3 (−+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China. PMID:28205625

  10. Splice-Site Mutations Cause Rrp6-Mediated Nuclear Retention of the Unspliced RNAs and Transcriptional Down-Regulation of the Splicing-Defective Genes

    PubMed Central

    Eberle, Andrea B.; Hessle, Viktoria; Helbig, Roger; Dantoft, Widad; Gimber, Niclas; Visa, Neus

    2010-01-01

    Background Eukaryotic cells have developed surveillance mechanisms to prevent the expression of aberrant transcripts. An early surveillance checkpoint acts at the transcription site and prevents the release of mRNAs that carry processing defects. The exosome subunit Rrp6 is required for this checkpoint in Saccharomyces cerevisiae, but it is not known whether Rrp6 also plays a role in mRNA surveillance in higher eukaryotes. Methodology/Principal Findings We have developed an in vivo system to study nuclear mRNA surveillance in Drosophila melanogaster. We have produced S2 cells that express a human β-globin gene with mutated splice sites in intron 2 (mut β-globin). The transcripts encoded by the mut β-globin gene are normally spliced at intron 1 but retain intron 2. The levels of the mut β-globin transcripts are much lower than those of wild type (wt) ß-globin mRNAs transcribed from the same promoter. We have compared the expression of the mut and wt β-globin genes to investigate the mechanisms that down-regulate the production of defective mRNAs. Both wt and mut β-globin transcripts are processed at the 3′, but the mut β-globin transcripts are less efficiently cleaved than the wt transcripts. Moreover, the mut β-globin transcripts are less efficiently released from the transcription site, as shown by FISH, and this defect is restored by depletion of Rrp6 by RNAi. Furthermore, transcription of the mut β-globin gene is significantly impaired as revealed by ChIP experiments that measure the association of the RNA polymerase II with the transcribed genes. We have also shown that the mut β-globin gene shows reduced levels of H3K4me3. Conclusions/Significance Our results show that there are at least two surveillance responses that operate cotranscriptionally in insect cells and probably in all metazoans. One response requires Rrp6 and results in the inefficient release of defective mRNAs from the transcription site. The other response acts at the transcription level and reduces the synthesis of the defective transcripts through a mechanism that involves histone modifications. PMID:20634951

  11. Molecular genetics of Alzheimer disease.

    PubMed

    St George-Hyslop, P H

    1999-01-01

    Epidemiological and individual case studies indicate that genetic factors play a significant role in the genesis of Alzheimer Disease (AD). To date, molecular genetic studies in families multiply affected with AD have identified three genes (Presenilin 1-PS1, Presenilin 2-PS2, and beta-amyloid precursor protein--betaAPP) associated with highly penetrant early onset AD, and one gene (Apolipoprotein E) associated with late onset AD. A fifth potential AD susceptibility locus has been mapped to a broad region of chromosome 12, but the responsible gene defect has not yet been identified. Case-control studies comparing the frequency of alleles in numerous other candidate genes have identified a number of additional potential AD genes. However, methodological difficulties and conflicting results in follow-up studies, make it unclear whether allelic variations in these genes are truly pathogenic. Nevertheless, analysis of the biochemical effects of mutations in PS1, PS2, betaAPP at least, suggest a common biochemical effect-namely disturbances in the processing of betaAPP protein. In addition to utility in defining potential therapeutic targets, in some circumstances these genes can also potentially be used as adjunctives in clinical presymptomatic, symptomatic or pharmacogenomic diagnosis.

  12. Mi2β Is Required for γ-Globin Gene Silencing: Temporal Assembly of a GATA-1-FOG-1-Mi2 Repressor Complex in β-YAC Transgenic Mice

    PubMed Central

    Costa, Flávia C.; Fedosyuk, Halyna; Chazelle, Allen M.; Neades, Renee Y.; Peterson, Kenneth R.

    2012-01-01

    Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the −566 GATA motif of the Aγ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of Aγ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the −566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1–mediated repressor complex was disrupted by the −566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting −566 Aγ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis. PMID:23284307

  13. Mi2β is required for γ-globin gene silencing: temporal assembly of a GATA-1-FOG-1-Mi2 repressor complex in β-YAC transgenic mice.

    PubMed

    Costa, Flávia C; Fedosyuk, Halyna; Chazelle, Allen M; Neades, Renee Y; Peterson, Kenneth R

    2012-01-01

    Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the -566 GATA motif of the (A)γ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of (A)γ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the -566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1-mediated repressor complex was disrupted by the -566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting -566 (A)γ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis.

  14. The zebrafish bozozok locus encodes Dharma, a homeodomain protein essential for induction of gastrula organizer and dorsoanterior embryonic structures.

    PubMed

    Fekany, K; Yamanaka, Y; Leung, T; Sirotkin, H I; Topczewski, J; Gates, M A; Hibi, M; Renucci, A; Stemple, D; Radbill, A; Schier, A F; Driever, W; Hirano, T; Talbot, W S; Solnica-Krezel, L

    1999-04-01

    The dorsal gastrula organizer plays a fundamental role in establishment of the vertebrate axis. We demonstrate that the zebrafish bozozok (boz) locus is required at the blastula stages for formation of the embryonic shield, the equivalent of the gastrula organizer and expression of multiple organizer-specific genes. Furthermore, boz is essential for specification of dorsoanterior embryonic structures, including notochord, prechordal mesendoderm, floor plate and forebrain. We report that boz mutations disrupt the homeobox gene dharma. Overexpression of boz in the extraembryonic yolk syncytial layer of boz mutant embryos is sufficient for normal development of the overlying blastoderm, revealing an involvement of extraembryonic structures in anterior patterning in fish similarly to murine embryos. Epistatic analyses indicate that boz acts downstream of beta-catenin and upstream to TGF-beta signaling or in a parallel pathway. These studies provide genetic evidence for an essential function of a homeodomain protein in beta-catenin-mediated induction of the dorsal gastrula organizer and place boz at the top of a hierarchy of zygotic genes specifying the dorsal midline of a vertebrate embryo.

  15. Genomic amplification of the human DHFR/MSH3 locus remodels mismatch recognition and repair activities.

    PubMed

    Drummond, J T

    1999-01-01

    Mismatch recognition in human cells is mediated by two heterodimers, MutS alpha and MutS beta. MutS alpha appears to shoulder primary responsibility for mismatch correction during replication, based on its relative abundance and ability to recognize a broad spectrum of base-base and base-insertion mismatches. Because MutS alpha and MutS beta share a common component, MSH2, conditions that influence the expression or degradation of MSH3 or MSH6 can redistribute the profile of mismatch recognition and repair. MSH3 is linked by a shared promoter with DHFR, connecting two pathways with key roles in DNA metabolism. In a classic example of gene amplification, the DHFR (and MSH3) locus can become amplified to several hundred copies in the presence of methotrexate. Under these conditions, MutS beta forms at the expense of MutS alpha, and the mutation rate in these tumor cells rises more than 100-fold. The implications for cancer chemotherapy include a potential increase in mutability when tumors are treated with methotrexate, which could increase the frequency of subsequent mutations that influence the tumor's drug sensitivity or aggressiveness. Because processing certain types of DNA damage by the mismatch repair pathway has also been implicated in tumor sensitivity to agents such as cisplatin, changes in expression at the DHFR/MSH3 locus may have further relevance to the outcome of multi-drug treatment regimens.

  16. Amoebozoa Possess Lineage-Specific Globin Gene Repertoires Gained by Individual Horizontal Gene Transfers

    PubMed Central

    Dröge, Jasmin; Buczek, Dorota; Suzuki, Yutaka; Makałowski, Wojciech

    2014-01-01

    The Amoebozoa represent a clade of unicellular amoeboid organisms that display a wide variety of lifestyles, including free-living and parasitic species. For example, the social amoeba Dictyostelium discoideum has the ability to aggregate into a multicellular fruiting body upon starvation, while the pathogenic amoeba Entamoeba histolytica is a parasite of humans. Globins are small heme proteins that are present in almost all extant organisms. Although several genomes of amoebozoan species have been sequenced, little is known about the phyletic distribution of globin genes within this phylum. Only two flavohemoglobins (FHbs) of D. discoideum have been reported and characterized previously while the genomes of Entamoeba species are apparently devoid of globin genes. We investigated eleven amoebozoan species for the presence of globin genes by genomic and phylogenetic in silico analyses. Additional FHb genes were identified in the genomes of four social amoebas and the true slime mold Physarum polycephalum. Moreover, a single-domain globin (SDFgb) of Hartmannella vermiformis, as well as two truncated hemoglobins (trHbs) of Acanthamoeba castellanii were identified. Phylogenetic evidence suggests that these globin genes were independently acquired via horizontal gene transfer from some ancestral bacteria. Furthermore, the phylogenetic tree of amoebozoan FHbs indicates that they do not share a common ancestry and that a transfer of FHbs from bacteria to amoeba occurred multiple times. PMID:25013378

  17. Involvement of GTA protein NC2beta in neuroblastoma pathogenesis suggests that it physiologically participates in the regulation of cell proliferation.

    PubMed

    Di Pietro, Cinzia; Ragusa, Marco; Barbagallo, Davide; Duro, Laura R; Guglielmino, Maria R; Majorana, Alessandra; Giunta, Veronica; Rapisarda, Antonella; Tricarichi, Elisa; Miceli, Marco; Angelica, Rosario; Grillo, Agata; Banelli, Barbara; Defferari, Isabella; Forte, Stefano; Laganà, Alessandro; Bosco, Camillo; Giugno, Rosalba; Pulvirenti, Alfredo; Ferro, Alfredo; Grzeschik, Karl H; Di Cataldo, Andrea; Tonini, Gian P; Romani, Massimo; Purrello, Michele

    2008-06-06

    The General Transcription Apparatus (GTA) comprises more than one hundred proteins, including RNA Polymerases, GTFs, TAFs, Mediator, and cofactors such as heterodimeric NC2. This complexity contrasts with the simple mechanical role that these proteins are believed to perform and suggests a still uncharacterized participation to important biological functions, such as the control of cell proliferation. To verify our hypothesis, we analyzed the involvement in neuroblastoma (NB) pathogenesis of GTA genes localized at 1p, one of NB critical regions: through RT-PCR of fifty eight NB biopsies, we demonstrated the statistically significant reduction of the mRNA for NC2beta (localized at 1p22.1) in 74% of samples (p = 0.0039). Transcripts from TAF13 and TAF12 (mapping at 1p13.3 and 1p35.3, respectively) were also reduced, whereas we didn't detect any quantitative alteration of the mRNAs from GTF2B and NC2alpha (localized at 1p22-p21 and 11q13.3, respectively). We confirmed these data by comparing tumour and constitutional DNA: most NB samples with diminished levels of NC2beta mRNA had also genomic deletions at the corresponding locus. Our data show that NC2beta is specifically involved in NB pathogenesis and may be considered a new NB biomarker: accordingly, we suggest that NC2beta, and possibly other GTA members, are physiologically involved in the control of cell proliferation. Finally, our studies unearth complex selective mechanisms within NB cells.

  18. Hydroxyurea for reducing blood transfusion in non-transfusion dependent beta thalassaemias.

    PubMed

    Foong, Wai Cheng; Ho, Jacqueline J; Loh, C Khai; Viprakasit, Vip

    2016-10-18

    Non-transfusion dependent beta thalassaemia is a subset of inherited haemoglobin disorders characterised by reduced production of the beta globin chain of the haemoglobin molecule leading to anaemia of varying severity. Although blood transfusion is not a necessity for survival, it is required when episodes of chronic anaemia occur. This chronic anaemia can impair growth and affect quality of life. People with non-transfusion dependent beta thalassaemia suffer from iron overload due to their body's increased capability of absorbing iron from food sources. Iron overload becomes more pronounced in those requiring blood transfusion. People with a higher foetal haemoglobin level have been found to require fewer blood transfusions. Hydroxyurea has been used to increase foetal haemoglobin level; however, its efficacy in reducing transfusion, chronic anaemia complications and its safety need to be established. To assess the effectiveness, safety and appropriate dose regimen of hydroxyurea in people with non-transfusion dependent beta thalassaemia (haemoglobin E combined with beta thalassaemia and beta thalassaemia intermedia). We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group's Haemoglobinopathies Trials Register, compiled from electronic database searches and handsearching of relevant journals. We also searched ongoing trials registries and the reference lists of relevant articles and reviews.Date of last search: 30 April 2016. Randomised or quasi-randomised controlled trials of hydroxyurea in people with non-transfusion dependent beta thalassaemia comparing hydroxyurea with placebo or standard treatment or comparing different doses of hydroxyurea. Two authors independently applied the inclusion criteria in order to select trials for inclusion. Both authors assessed the risk of bias of trials and extracted the data. A third author verified these assessments. No trials comparing hydroxyurea with placebo or standard care were found. However, we included one randomised controlled trial (n = 61) comparing 20 mg/kg/day with 10 mg/kg/day of hydroxyurea for 24 weeks.Both haemoglobin and foetal haemoglobin levels were lower at 24 weeks in the 20 mg group compared with the 10 mg group, mean difference -2.39 (95% confidence interval - 2.8 to -1.98) and mean difference -1.5 (95% confidence interval -1.83 to -1.17), respectively. Major adverse effects were significantly more common in the 20 mg group, for neutropenia risk ratio 9.93 (95% confidence interval 1.34 to 73.97) and for thrombocytopenia risk ratio 3.68 (95% confidence interval 1.13 to 12.07). No difference was reported for minor adverse effects (gastrointestinal disturbances and raised liver enzymes). The effect of hydroxyurea on transfusion frequency was not reported.The overall quality for the outcomes reported was graded as very low mainly because the outcomes were derived from only one small study with an unclear method of allocation concealment. There is no evidence from randomised controlled trials to show whether hydroxyurea has any effect compared with controls on the need for blood transfusion. Administration of 10 mg/kg/day compared to 20 mg/kg/day of hydroxyurea resulted in higher haemoglobin levels and seems safer with fewer adverse effects. It has not been reported whether hydroxyurea is capable of reducing the need for blood transfusion. Large well-designed randomised controlled trials with sufficient duration of follow up are recommended.

  19. Molecular Basis and Genetic Modifiers of Thalassemia.

    PubMed

    Mettananda, Sachith; Higgs, Douglas R

    2018-04-01

    Thalassemia is a disorder of hemoglobin characterized by reduced or absent production of one of the globin chains in human red blood cells with relative excess of the other. Impaired synthesis of β-globin results in β-thalassemia, whereas defective synthesis of α-globin leads to α-thalassemia. Despite being a monogenic disorder, thalassemia exhibits remarkable clinical heterogeneity that is directly related to the intracellular imbalance between α- and β-like globin chains. Novel insights into the genetic modifiers have contributed to the understanding of the correlation between genotype and phenotype and are being explored as therapeutic pathways to cure this life-limiting disease. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

    PubMed

    Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

    2014-07-01

    In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

  1. Disorders of Human Hemoglobin

    NASA Astrophysics Data System (ADS)

    Bank, Arthur; Mears, J. Gregory; Ramirez, Francesco

    1980-02-01

    Studies of the human hemoglobin system have provided new insights into the regulation of expression of a group of linked human genes, the γ -δ -β globin gene complex in man. In particular, the thalassemia syndromes and related disorders of man are inherited anemias that provide mutations for the study of the regulation of globin gene expression. New methods, including restriction enzyme analysis and cloning of cellular DNA, have made it feasible to define more precisely the structure and organization of the globin genes in cellular DNA. Deletions of specific globin gene fragments have already been found in certain of these disorders and have been applied in prenatal diagnosis.

  2. Target-based drug discovery for [Formula: see text]-globin disorders: drug target prediction using quantitative modeling with hybrid functional Petri nets.

    PubMed

    Mehraei, Mani; Bashirov, Rza; Tüzmen, Şükrü

    2016-10-01

    Recent molecular studies provide important clues into treatment of [Formula: see text]-thalassemia, sickle-cell anaemia and other [Formula: see text]-globin disorders revealing that increased production of fetal hemoglobin, that is normally suppressed in adulthood, can ameliorate the severity of these diseases. In this paper, we present a novel approach for drug prediction for [Formula: see text]-globin disorders. Our approach is centered upon quantitative modeling of interactions in human fetal-to-adult hemoglobin switch network using hybrid functional Petri nets. In accordance with the reverse pharmacology approach, we pose a hypothesis regarding modulation of specific protein targets that induce [Formula: see text]-globin and consequently fetal hemoglobin. Comparison of simulation results for the proposed strategy with the ones obtained for already existing drugs shows that our strategy is the optimal as it leads to highest level of [Formula: see text]-globin induction and thereby has potential beneficial therapeutic effects on [Formula: see text]-globin disorders. Simulation results enable verification of model coherence demonstrating that it is consistent with qPCR data available for known strategies and/or drugs.

  3. Discovery of phenylsulfonylfuroxan derivatives as gamma globin inducers by histone acetylation.

    PubMed

    Melo, Thais Regina Ferreira de; Kumkhaek, Chutima; Fernandes, Guilherme Felipe Dos Santos; Lopes Pires, Maria Elisa; Chelucci, Rafael Consolin; Barbieri, Karina Pereira; Coelho, Fernanda; Capote, Ticiana Sidorenko de Oliveira; Lanaro, Carolina; Carlos, Iracilda Zeppone; Marcondes, Sisi; Chegaev, Konstantin; Guglielmo, Stefano; Fruttero, Roberta; Chung, Man Chin; Costa, Fernando Ferreira; Rodgers, Griffin P; Dos Santos, Jean Leandro

    2018-05-28

    N-oxide derivatives 5(a-b), 8(a-b), and 11(a-c) were designed, synthesized and evaluated in vitro and in vivo as potential drugs that are able to ameliorate sickle cell disease (SCD) symptoms. All of the compounds demonstrated the capacity to releasing nitric oxide at different levels ranging from 0.8 to 30.1%, in vivo analgesic activity and ability to reduce TNF-α levels in the supernatants of monocyte cultures. The most active compound (8b) protected 50.1% against acetic acid-induced abdominal constrictions, while dipyrone, which was used as a control only protected 35%. Compounds 8a and 8b inhibited ADP-induced platelet aggregation by 84% and 76.1%, respectively. Both compounds increased γ-globin in K562 cells at 100 μM. The mechanisms involved in the γ-globin increase are related to the acetylation of histones H3 and H4 that is induced by these compounds. In vitro, the most promising compound (8b) was not cytotoxic, mutagenic and genotoxic. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  4. Discrimination of Pathogenic vs. Nonpathogenic Francisella tularensis and Burkholderia pseudomallei Using Proteomics Mass Spectrometry

    DTIC Science & Technology

    2011-03-01

    GroEL AhpC/TSA family protein hypothetical protein FTL0617 heat shock protein DnaK succinyl-CoA synthetase subunit beta hypothetical protein...lipoprotein chaperonin GroEL co-chaperonin GroES DNA-directed RNA polymerase subunit beta intracellular growth locus, subunit C 3.2 Differentiation...thailandensis E264 Unique Proteins Whole Cell Lysates OMPs putative lipoprotein glucan 1,4-a-glucosidase glycosy hydrolase family protein putative

  5. Nanoparticles for Site Specific Genome Editing

    NASA Astrophysics Data System (ADS)

    McNeer, Nicole Ali

    Triplex-forming peptide nucleic acids (PNAs) can be used to coordinate the recombination of short 50-60 by "donor DNA" fragments into genomic DNA, resulting in site-specific correction of genetic mutations or the introduction of advantageous genetic modifications. Site-specific gene editing in hematopoietic stem and progenitor cells (HSPCs) could result in treatment or cure of inherited disorders of the blood such as beta-thalassemia. Gene editing in HSPCs and differentiated T cells could help combat HIV/AIDs by modifying receptors, such as CCR5, necessary for R5-tropic HIV entry. However, translation of genome modification technologies to clinical practice is limited by challenges in intracellular delivery, especially in difficult-to-transfect hematolymphoid cells. In vivo gene editing could also provide novel treatment for systemic monogenic disorders such as cystic fibrosis, an autosomal recessive disorder caused by mutations in the cystic fibrosis transmembrane receptor. Here, we have engineered biodegradable nanoparticles to deliver oligonucleotides for site-specific genome editing of disease-relevant genes in human cells, with high efficiency, low toxicity, and editing of clinically relevant cell types. We designed nanoparticles to edit the human beta-globin and CCR5 genes in hematopoietic cells. We show that poly(lactic-co-glycolic acid) (PLGA) nanoparticles can delivery PNA and donor DNA for site-specific gene modification in human hematopoietic cells in vitro and in vivo in NOD-scid IL2rgammanull mice. Nanoparticles delivered by tail vein localized to hematopoietic compartments in the spleen and bone marrow of humanized mice, resulting in modification of the beta-globin and CCR5 genes. Modification frequencies ranged from 0.005 to 20% of cells depending on the organ and cell type, without detectable toxicity. This project developed highly versatile methods for delivery of therapeutics to hematolymphoid cells and hematopoietic stem cells, and will help to translate gene therapies for diseases of the blood and immune system to clinical practice. In addition, we have expanded the use of this technology to an additional nonhematopoietic model system: correction of the human cystic fibrosis transmembrane receptor gene in human bronchial epithelial cells. The work presented here represents (1) the first use of biodegradable nanoparticles for PNA delivery, (2) the first direct in vivo site-specific genome modification in human cells, and (3) the first use of triplex-PNA technology for site-specific genome editing in cystic fibrosis.

  6. Factor IX gene haplotypes in Amerindians.

    PubMed

    Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S

    1997-02-01

    We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.

  7. Globin switches in yolk sac-like primitive and fetal-like definitive red blood cells produced from human embryonic stem cells.

    PubMed

    Qiu, Caihong; Olivier, Emmanuel N; Velho, Michelle; Bouhassira, Eric E

    2008-02-15

    We have previously shown that coculture of human embryonic stem cells (hESCs) for 14 days with immortalized fetal hepatocytes yields CD34(+) cells that can be expanded in serum-free liquid culture into large numbers of megaloblastic nucleated erythroblasts resembling yolk sac-derived cells. We show here that these primitive erythroblasts undergo a switch in hemoglobin (Hb) composition during late terminal erythroid maturation with the basophilic erythroblasts expressing predominantly Hb Gower I (zeta(2)epsilon(2)) and the orthochromatic erythroblasts hemoglobin Gower II (alpha(2)epsilon(2)). This suggests that the switch from Hb Gower I to Hb Gower II, the first hemoglobin switch in humans is a maturation switch not a lineage switch. We also show that extending the coculture of the hESCs with immortalized fetal hepatocytes to 35 days yields CD34(+) cells that differentiate into more developmentally mature, fetal liver-like erythroblasts, that are smaller, express mostly fetal hemoglobin, and can enucleate. We conclude that hESC-derived erythropoiesis closely mimics early human development because the first 2 human hemoglobin switches are recapitulated, and because yolk sac-like and fetal liver-like cells are sequentially produced. Development of a method that yields erythroid cells with an adult phenotype remains necessary, because the most mature cells that can be produced with current systems express less than 2% adult beta-globin mRNA.

  8. The Effectiveness of Neurofeedback on Enhancing Cognitive Process Involved in Entrepreneurship Abilities among Primary School Students in District No. 3 Tehran

    PubMed Central

    Rahmati, Narges; Rostami, Reza; Zali, Mohammad Reza; Nowicki, Stephen; Zarei, Jamilah

    2014-01-01

    Introduction: The aim of this study is to investigate the entrepreneurial traits of school children in the city of Tehran. Methods: For this purpose, 48 students were selected with an average IQ between 90 and 119. Ranging from 7th to 12th grades, all the subjects were assessed using Nowicki-Strickland’s Locus of Control Scale (N-SLCS), Torrance Tests of Creative Thinking (TTCT), and Hyperkinetic Syndrome Assessment Method (HKSD). The obtained results were then organized and categorized into three groups. One of the groups was randomly chosen as experimental and the other as the control group and the last play group. In this empirical study, the students received Sensory Motor Rhythm (SMR) and Beta neurofeedback for 20 sessions. The play group was assigned to play mind games for 20 sessions. At the same time, the control group received no experiments. After the end of the experiments, all the students in three groups were reassessed by Torrance Tests of Creative Thinking, Hyperkinetic Syndrome Assessment Method, and Nowicki-Strickland’s Locus of Control Scale. Results: The results from MANOVA showed that the neurofeedback group had demonstrated a meaningful change in creativity and locus of control while the adaptability of risk-taking was on a meaningful level for the experimental group. The results also indicate an improvement in creativity for the neurofeedback group in comparison with the play group on a 0.02 meaningful level. Similarly, the results suggest an improvement in creativity for the neurofeedback group on a 0.000 meaningful level in comparison with the control group. This is while the play group and the control group do not show any meaningful difference. The results also show an improvement in the internal locus of control for the neurofeedback group in comparison with the play group on a 0.032 meaningful level; while, it is meaningful on a 0.01 level for the neurofeedback group in comparison with the control group. Discussion: The findings for the play group and control group do not show any meaningful difference. The paper concludes that neurofeedback training can be used for increasing the level of entrepreneurial traits in students. PMID:27284392

  9. DNA extraction from formalin-fixed, paraffin-embedded tissues: protein digestion as a limiting step for retrieval of high-quality DNA.

    PubMed

    Díaz-Cano, S J; Brady, S P

    1997-12-01

    Several DNA extraction methods have been used for formalin-fixed, paraffin-embedded tissues, with variable results being reported regarding the suitability of DNA obtained from such sources to serve as template in polymerase chain reaction (PCR)-based genetic analyses. We present a method routinely used for archival material in our laboratory that reliably yields DNA of sufficient quality for PCR studies. This method is based on extended proteinase K digestion (250 micrograms/ml in an EDTA-free calcium-containing buffer supplemented with mussel glycogen) followed by phenol-chloroform extraction. Agarose gel electrophoresis of both digestion buffer aliquots and PCR amplification of the beta-globin gene tested the suitability of the retrieved DNA for PCR amplification.

  10. Diverse hematological phenotypes of β-thalassemia carriers.

    PubMed

    Luo, Hong-Yuan; Chui, David H K

    2016-03-01

    Most β-thalassemia carriers have mild anemia, low mean corpuscular volume and mean corpuscular hemoglobin, and elevated hemoglobin α2 (HbA2 ). However, there is considerable variability resulting from coinheritance with α- and/or δ-globin gene mutations, dominant inheritance of β-thalassemia mutations, highly unstable variant globin chains, large deletions removing part or all of the β-globin gene cluster, loss of heterozygosity of the β-globin gene cluster during development, or concomitant erythroid enzyme or membrane protein abnormalities. Recognition of the specific abnormality and correct diagnosis can allay anxiety and unnecessary investigation, help formulate treatment programs, and deliver appropriate genetic and family counseling. © 2016 New York Academy of Sciences.

  11. Cognitive functioning correlates of self-esteem and health locus of control in schizophrenia

    PubMed Central

    Wang, Chien-Shu; Wu, Jo Yung-Wei; Chang, Wei-Chung; Chuang, Shu-Ping

    2013-01-01

    Aim The study aimed to investigate the relationship among sociodemographic factors, neurocognitive factors, self-esteem, and health locus of control in patients diagnosed with schizophrenia. We examined the self-esteem, internal health locus of control, and external health locus of control through sociodemographic and neurocognitive factors. Methods Forty-six schizophrenic patients and 31 healthy residents from the community or hospital were recruited as the control group. All subjects participated in the self-esteem questionnaire, health locus of control questionnaire, and a series of neuropychological measures. Results Multiple regression analysis revealed that inhibition of attention and external health locus of control were predictors for self-esteem (r=−0.30, P<0.05; r=0.41, P<0.01); inhibition of attention and external health locus of control were contributors for internal health locus of control (r=−0.43, P<0.01; r=0.61, P<0.001); and education was related to external health locus of control (r=−0.31, P<0.05). Conclusion The current study integrated background characteristics and cognitive function to better understand the impact of self-esteem and health locus of control in schizophrenia. The findings indicated that inhibition of attention, external health locus of control, and education contributed to self-esteem, internal health locus of control and external health locus of control. However, the overall predicted variance accounted for by these predictors was small; thus, further research is necessary to examine imperative variables related with self-esteem and health locus of control in schizophrenia. PMID:24194641

  12. The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

    PubMed Central

    Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

    1988-01-01

    We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

  13. The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

    PubMed Central

    Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

    2017-01-01

    Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

  14. Analysis of alpha hemoglobin stabilizing protein overexpression in murine β-thalassemia

    PubMed Central

    Nasimuzzaman, Md; Khandros, Eugene; Wang, Xiaomei; Kong, Yi; Zhao, Huifen; Weiss, David; Rivella, Stefano; Weiss, Mitchell J.; Persons, Derek A.

    2013-01-01

    Excess free α-globin is cytotoxic and contributes to the pathophysiology of β-thalassemia. Alpha hemoglobin stabilizing protein (AHSP) is a molecular chaperone that binds free α-globin to promote its folding and inhibit its ability to produce damaging reactive oxygen species. Reduced AHSP levels correlate with increased severity of β-thalassemia in some human cohorts, but causal mechanistic relationships are not established for these associations. We used transgenic and lentiviral gene transfer methods to investigate whether supraphysiologic AHSP levels could mitigate the severity of β-thalassemia intermedia by providing an increased sink for the excess pool of α-globin chains. We tested wild-type AHSP and two mutant versions with amino acid substitutions that confer 3- or 13-fold higher affinity for α-globin. Erythroid overexpression of these AHSP proteins up to 11-fold beyond endogenous levels had no major effects on hematologic parameters in β-thalassemic animals. Our results demonstrate that endogenous AHSP is not limiting for α-globin detoxification in a murine model of β-thalassemia. PMID:20815047

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vidaud, M.; Vidaud, D.; Amselem, S.

    The authors have characterized a Mediterranean {beta}-thalassemia allele containing a sequence change at codon 30 that alters both {beta}-globin pre-mRNA splicing and the structure of the homoglobin product. Presumably, this G {yields} C transversion at position {minus}1 of intron 1 reduces severely the utilization of the normal 5{prime} splice site since the level of the Arg {yields} Thr mutant hemoglobin (designated hemoglobin Kairouan) found in the erythrocytes of the patient is very low (2% of total hemoglobin). Since no natural mutations of the guanine located at position {minus}1 of the CAG/GTAAGT consensus sequence had been isolated previously. They investigated themore » role of this nucleotide in the constitution of an active 5{prime} splice site by studying the splicing of the pre-mRNA in cell-free extracts. They demonstrate that correct splicing of the mutant pre-mRNA is 98% inhibited. Their results provide further insights into the mechanisms of pre-mRNA maturation by revealing that the last residue of the exon plays a role at least equivalent to that of the intron residue at position +5.« less

  16. β-Thalassemia.

    PubMed

    Origa, Raffaella

    2017-06-01

    β-Thalassemia is caused by reduced (β + ) or absent (β 0 ) synthesis of the β-globin chains of hemoglobin. Three clinical and hematological conditions of increasing severity are recognized: the β-thalassemia carrier state, thalassemia intermedia, and thalassemia major, a severe transfusion-dependent anemia. The severity of disease expression is related mainly to the degree of α-globin chain excess, which precipitates in the red blood cell precursors, causing both mechanic and oxidative damage (ineffective erythropoiesis). Any mechanism that reduces the number of unbound α-globin chains in the red cells may ameliorate the detrimental effects of excess α-globin chains. Factors include the inheritance of mild/silent β-thalassemia mutations, the coinheritance of α-thalassemia alleles, and increased γ-globin chain production. The clinical severity of β-thalassemia syndromes is also influenced by genetic factors unlinked to globin genes as well as environmental conditions and management. Transfusions and oral iron chelation therapy have dramatically improved the quality of life for patients with thalassemia major. Previously a rapidly fatal disease in early childhood, β-thalassemia is now a chronic disease with a greater life expectancy. At present, the only definitive cure is bone marrow transplantation. Therapies undergoing investigation are modulators of erythropoiesis and stem cell gene therapy.Genet Med advance online publication 03 November 2016.

  17. Electron transfer function versus oxygen delivery: a comparative study for several hexacoordinated globins across the animal kingdom.

    PubMed

    Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C

    2011-01-01

    Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.

  18. Efficient Generation of β-Globin-Expressing Erythroid Cells Using Stromal Cell-Derived Induced Pluripotent Stem Cells from Patients with Sickle Cell Disease.

    PubMed

    Uchida, Naoya; Haro-Mora, Juan J; Fujita, Atsushi; Lee, Duck-Yeon; Winkler, Thomas; Hsieh, Matthew M; Tisdale, John F

    2017-03-01

    Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent an ideal source for in vitro modeling of erythropoiesis and a potential alternative source for red blood cell transfusions. However, iPS cell-derived erythroid cells predominantly produce ε- and γ-globin without β-globin production. We recently demonstrated that ES cell-derived sacs (ES sacs), known to express hemangioblast markers, allow for efficient erythroid cell generation with β-globin production. In this study, we generated several iPS cell lines derived from bone marrow stromal cells (MSCs) and peripheral blood erythroid progenitors (EPs) from sickle cell disease patients, and evaluated hematopoietic stem/progenitor cell (HSPC) generation after iPS sac induction as well as subsequent erythroid differentiation. MSC-derived iPS sacs yielded greater amounts of immature hematopoietic progenitors (VEGFR2 + GPA-), definitive HSPCs (CD34 + CD45+), and megakaryoerythroid progenitors (GPA + CD41a+), as compared to EP-derived iPS sacs. Erythroid differentiation from MSC-derived iPS sacs resulted in greater amounts of erythroid cells (GPA+) and higher β-globin (and βS-globin) expression, comparable to ES sac-derived cells. These data demonstrate that human MSC-derived iPS sacs allow for more efficient erythroid cell generation with higher β-globin production, likely due to heightened emergence of immature progenitors. Our findings should be important for iPS cell-derived erythroid cell generation. Stem Cells 2017;35:586-596. © 2016 AlphaMed Press.

  19. Marker-free transgenic (MFT) near-isogenic introgression lines (NIILs) of 'golden' indica rice (cv. IR64) with accumulation of provitamin A in the endosperm tissue.

    PubMed

    Baisakh, Niranjan; Rehana, Sayda; Rai, Mayank; Oliva, Norman; Tan, Jing; Mackill, David J; Khush, Gurdev S; Datta, Karabi; Datta, Swapan K

    2006-07-01

    We have developed near-isogenic introgression lines (NIILs) of an elite indica rice cultivar (IR64) with the genes for beta-carotene biosynthesis from dihaploid (DH) derivatives of golden japonica rice (cv. T309). A careful analysis of the DH lines indicated the integration of the genes of interest [phytoene synthase (psy) and phytoene desaturase (crtI)] and the selectable marker gene (hygromycin phosphotransferase, hph) in two unlinked loci. During subsequent crossing, progenies could be obtained carrying only the locus with psy and crtI, which was segregated independently from the locus containing the hph gene during meiotic segregation. The NIILs (BC(2)F(2)) showed maximum similarity with the recurrent parent cultivar IR64. Further, progenies of two NIILs were devoid of any fragments beyond the left or right border, including the chloramphenicol acetyltransferase (cat) antibiotic resistance gene of the transformation vector. Spectrophotometric readings showed the accumulation of up to 1.06 microg total carotenoids, including beta-carotene, in 1 g of the endosperm. The accumulation of beta-carotene was also evident from the clearly visible yellow colour of the polished seeds.

  20. Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.

    PubMed

    Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein

    2016-10-01

    β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.

  1. Interaction of an α-Globin Gene Triplication with β-Globin Gene Mutations in Iranian Patients with β-Thalassemia Intermedia.

    PubMed

    Farashi, Samaneh; Bayat, Nooshin; Faramarzi Garous, Negin; Ashki, Mehri; Montajabi Niat, Mona; Vakili, Shadi; Imanian, Hashem; Zeinali, Sirous; Najmabadi, Hossein; Azarkeivan, Azita

    2015-01-01

    The 3.7 kb triplicated α-globin gene (ααα(anti 3.7)) mutation has been found in most populations. It results from an unequal crossover between misaligned homologous segments in the α-globin gene cluster during meiosis. The pathophysiology and clinical severity of β-thalassemia (β-thal) are associated with the degree of α chain imbalance. The excess of α-globin chains plays an important role in the pathophysiology of β-thal. When heterozygous/homozygous β-thal coexists with an α gene numerical alteration, the clinical and hematological phenotype of thalassemia could change to mild anemia in case of an α deletion (-α/αα) or severe anemia in the case of an α triplication (αα/ααα). The coexistence of an ααα(anti 3.7) triplication is considered an important factor in the severity of β-thal, exacerbating the phenotypic severity of β-thal by causing more globin chain imbalance. This study shows that the ααα(anti 3.7) triplication is an important factor in the causation of β-thal intermedia (β-TI) in heterozygous β-thal. This type of phenotype modification has rarely been observed and reported in the Iranian population. Here we report the coinheritance of a triplicated α-globin gene arrangement and heterozygous/homozygous β-thal in 23 cases, presenting with a β-TI or β-thal major (β-TM) phenotype. Some of these patients were considered to have a mild β-TI phenotype as they needed no blood transfusions; some occasionally received blood transfusions in their lifetime (for example on delivery) but some are dependent on regular blood transfusions (every 20 to 40 days). Our study was focused on the importance of detecting the α-globin gene triplication in genotype/phenotype prediction in Iranian thalassemia patients.

  2. [Prevalence survey and molecular characterization of alpha and beta thalassemia in Liuzhou city of Guangxi].

    PubMed

    Cai, Ren; Li, Liyan; Liang, Xin; Liu, Zhongying; Su, Liu; Li, Wenjun; Zhu, Qiangui; Mo, Qiuhua; Pan, Lizhen; Ouyang, Hong; Huang, Lihua; Xu, Xiangmin

    2002-08-01

    To investigate the gene frequencies and mutation patterns of alpha thalassemia (alpha-thal) and beta thalassemia (beta-thal) in Liuzhou city of Guangxi Zhuang Autonomous Region. Cluster sampling was used. A total of 1 028 of umbilical blood samples were collected for a prevalence study of alpha-thal and a total of 1 312 healthy young people when receiving pre-marriage consultation were recruited for a beta-thal prevalence survey. Individuals live in city or town area of Liuzhou. A complete blood count as well as hemoglobin electrophoresis analysis were done in all of samples for phenotyping of alpha and beta-thals. Those with Hb Bart's for alpha-thal indicator and those with both microcytosis (MCV < 85 fl) and elevated levels of Hb A(2) (>/=4.0%) for beta-thal were further studied by DNA analysis. PCR-based methodologies were used to characterize the mutation contributions of alpha and beta-thals. All the subjects were tested for the state of carrying beta-thala alleles for evaluating the situation of the compound heterozygotes of alpha-thal with beta-thal. Of 1 028 random samples of umbilical blood screened, 112 of subjects were defined to be the gene carriers of alpha-thal. The alpha-thal carrier rate was as high as 11.19% including 3 compound heterozygotes. Five well-known types of alpha-thal alleles were detected with gene contributions of 37.4% (--(SEA) deletion), 31.3% (-alpha(3.7) deletion), 17.4% (-alpha(4.2) deletion), 12.1% (alpha(CS)alpha mutation), and 0.9% (alpha(QS)alpha mutation), successively. Of the 1 312 adult specimens studied, 89 with beta-thal including 14 of the compound higher Hb F subjects were detected. All of the 89 phenotypic beta-thal carriers had the mutations in the beta-globin gene, making the overall prevalence 6.78%. The commonly seen three mutations, beta CD41 - 42 (-CTTT) frameshift, beta CD17 (T-A) nonsense mutation and beta-28 (A-G) promoter variation were accounted for 90% of the beta-thal alleles in Liuzhou. Of these beta-thal subjects, 16 (accounting for 18%) were found to be the compound heterozygosity for a beta-thal and an alpha-thal with 9 different types of gene defects with a detection rate 1.22%. Data from ecidation of alpha and beta-thal gene frequencies and mutation spectrum in Liuzhou city was useful for genetic counselling and prenatal diagnosis of this disease.

  3. Translational Control of Hemoglobin Synthesis by an Initiation Factor Required for Recycling of Ribosomes and for their Binding to Messenger RNA

    PubMed Central

    Kaempfer, Raymond; Kaufman, Jennifer

    1972-01-01

    The continued recycling of ribosomes during protein synthesis in rabbit reticulocyte lysates at 37° requires an initiation factor whose activity is rapidly lost in the absence of added heme. Partially purified factor (i) fully maintains the polysomes; (ii) inhibits the association of 40S and 60S ribosomal subunits into single ribosomes; (iii) promotes the quantitative entry of added 60S subunits into polysomes; (iv) allows the accumulation of ribosomal subunits, instead of single ribosomes, when initiation is blocked with aurin tricarboxylate; and (v) is absolutely required for the binding of globin messenger RNA to ribosomes. These properties suggest that this mammalian initiation factor functions analogously to bacterial IF-3. In addition, the translational control of globin synthesis by heme is exerted, directly or indirectly, through this factor. PMID:4508325

  4. Gene Therapy in a Patient with Sickle Cell Disease.

    PubMed

    Ribeil, Jean-Antoine; Hacein-Bey-Abina, Salima; Payen, Emmanuel; Magnani, Alessandra; Semeraro, Michaela; Magrin, Elisa; Caccavelli, Laure; Neven, Benedicte; Bourget, Philippe; El Nemer, Wassim; Bartolucci, Pablo; Weber, Leslie; Puy, Hervé; Meritet, Jean-François; Grevent, David; Beuzard, Yves; Chrétien, Stany; Lefebvre, Thibaud; Ross, Robert W; Negre, Olivier; Veres, Gabor; Sandler, Laura; Soni, Sandeep; de Montalembert, Mariane; Blanche, Stéphane; Leboulch, Philippe; Cavazzana, Marina

    2017-03-02

    Sickle cell disease results from a homozygous missense mutation in the β-globin gene that causes polymerization of hemoglobin S. Gene therapy for patients with this disorder is complicated by the complex cellular abnormalities and challenges in achieving effective, persistent inhibition of polymerization of hemoglobin S. We describe our first patient treated with lentiviral vector-mediated addition of an antisickling β-globin gene into autologous hematopoietic stem cells. Adverse events were consistent with busulfan conditioning. Fifteen months after treatment, the level of therapeutic antisickling β-globin remained high (approximately 50% of β-like-globin chains) without recurrence of sickle crises and with correction of the biologic hallmarks of the disease. (Funded by Bluebird Bio and others; HGB-205 ClinicalTrials.gov number, NCT02151526 .).

  5. Myostatin-deficiency in mice increases global gene expression at the Dlk1-Dio3 locus in the skeletal muscle

    PubMed Central

    Hitachi, Keisuke; Tsuchida, Kunihiro

    2017-01-01

    Myostatin, a member of the transforming growth factor-beta superfamily, is a negative regulator of skeletal muscle growth and development. Myostatin inhibition leads to increased skeletal muscle mass in mammals; hence, myostatin is considered a potential therapeutic target for skeletal muscle wasting. However, downstream molecules of myostatin in the skeletal muscle have not been fully elucidated. Here, we identified the Dlk1-Dio3 locus at the mouse chromosome 12qF1, also called as the callipyge locus in sheep, as a novel downstream target of myostatin. In skeletal muscle of myostatin knockout mice, the expression of mature miRNAs at the Dlk1-Dio3 locus was significantly increased. The increased miRNA levels are caused by the transcriptional activation of the Dlk1-Dio3 locus, because a significant increase in the primary miRNA transcript was observed in myostatin knockout mice. In addition, we found increased expression of coding and non-coding genes (Dlk1, Gtl2, Rtl1/Rtl1as, and Rian) at the Dlk1-Dio3 locus in myostatin-deficient skeletal muscle. Moreover, epigenetic changes, associated with the regulation of the Dlk1-Dio3 locus, were observed in myostatin knockout mice. Taken together, this is the first report demonstrating the role of myostatin in regulating the Dlk1-Dio3 (the callipyge) locus in the skeletal muscle. PMID:27992376

  6. Myostatin-deficiency in mice increases global gene expression at the Dlk1-Dio3 locus in the skeletal muscle.

    PubMed

    Hitachi, Keisuke; Tsuchida, Kunihiro

    2017-01-24

    Myostatin, a member of the transforming growth factor-beta superfamily, is a negative regulator of skeletal muscle growth and development. Myostatin inhibition leads to increased skeletal muscle mass in mammals; hence, myostatin is considered a potential therapeutic target for skeletal muscle wasting. However, downstream molecules of myostatin in the skeletal muscle have not been fully elucidated. Here, we identified the Dlk1-Dio3 locus at the mouse chromosome 12qF1, also called as the callipyge locus in sheep, as a novel downstream target of myostatin. In skeletal muscle of myostatin knockout mice, the expression of mature miRNAs at the Dlk1-Dio3 locus was significantly increased. The increased miRNA levels are caused by the transcriptional activation of the Dlk1-Dio3 locus, because a significant increase in the primary miRNA transcript was observed in myostatin knockout mice. In addition, we found increased expression of coding and non-coding genes (Dlk1, Gtl2, Rtl1/Rtl1as, and Rian) at the Dlk1-Dio3 locus in myostatin-deficient skeletal muscle. Moreover, epigenetic changes, associated with the regulation of the Dlk1-Dio3 locus, were observed in myostatin knockout mice. Taken together, this is the first report demonstrating the role of myostatin in regulating the Dlk1-Dio3 (the callipyge) locus in the skeletal muscle.

  7. Red blood cells free α-haemoglobin pool: a biomarker to monitor the β-thalassemia intermedia variability. The ALPHAPOOL study.

    PubMed

    Vasseur, Corinne; Domingues-Hamdi, Elisa; Ledudal, Katia; Le Corvoisier, Philippe; Barau, Caroline; Ghaleh, Bijan; Rialland, Amandine; Pissard, Serge; Galactéros, Frédéric; Baudin-Creuza, Véronique

    2017-10-01

    The severity of β-thalassaemia (β-thal) intermedia is mainly correlated to the degree of imbalanced α/non α-globin chain synthesis. The phenotypic diversity of β-thal depends on this imbalance and reflects all possible combinations of α- and β-globin genotypes, levels of fetal haemoglobin (HbF) and co-inheritance of other modulating factors. This study aimed to demonstrate the validity of a new surrogate of α/non α-globin biosynthetic ratio by measuring the soluble α-Hb pool in lysed red blood cells. Our results confirm that the α-Hb pool measurement allows a good discrimination between β-thal intermedia patients, controls and α-thal patients (P < 0·003). Receiver operator characteristic analyses revealed an area under the curve of 0·978 for the α-Hb pool measurement at a threshold of 120 ng free α-Hb/mg of total Hb/ml of haemolysate (ppm) with a sensitivity and specificity of 86% and 100%, respectively, to discriminate between β-thal and not β-thal subjects. Significant correlations were observed between the α-Hb pool and biological parameters of β-thal, the most significant association being observed with red cell hexokinase activity. This study indicates that the α-Hb pool could be a new marker for assistance in diagnostic orientation of β-thal intermedia patients and may be clinically useful for monitoring the evolution of the disequilibrium of globin synthesis in response to treatments. © 2017 John Wiley & Sons Ltd.

  8. Gene expression profiling of whole blood: Comparison of target preparation methods for accurate and reproducible microarray analysis

    PubMed Central

    Vartanian, Kristina; Slottke, Rachel; Johnstone, Timothy; Casale, Amanda; Planck, Stephen R; Choi, Dongseok; Smith, Justine R; Rosenbaum, James T; Harrington, Christina A

    2009-01-01

    Background Peripheral blood is an accessible and informative source of transcriptomal information for many human disease and pharmacogenomic studies. While there can be significant advantages to analyzing RNA isolated from whole blood, particularly in clinical studies, the preparation of samples for microarray analysis is complicated by the need to minimize artifacts associated with highly abundant globin RNA transcripts. The impact of globin RNA transcripts on expression profiling data can potentially be reduced by using RNA preparation and labeling methods that remove or block globin RNA during the microarray assay. We compared four different methods for preparing microarray hybridization targets from human whole blood collected in PAXGene tubes. Three of the methods utilized the Affymetrix one-cycle cDNA synthesis/in vitro transcription protocol but varied treatment of input RNA as follows: i. no treatment; ii. treatment with GLOBINclear; or iii. treatment with globin PNA oligos. In the fourth method cDNA targets were prepared with the Ovation amplification and labeling system. Results We find that microarray targets generated with labeling methods that reduce globin mRNA levels or minimize the impact of globin transcripts during hybridization detect more transcripts in the microarray assay compared with the standard Affymetrix method. Comparison of microarray results with quantitative PCR analysis of a panel of genes from the NF-kappa B pathway shows good correlation of transcript measurements produced with all four target preparation methods, although method-specific differences in overall correlation were observed. The impact of freezing blood collected in PAXGene tubes on data reproducibility was also examined. Expression profiles show little or no difference when RNA is extracted from either fresh or frozen blood samples. Conclusion RNA preparation and labeling methods designed to reduce the impact of globin mRNA transcripts can significantly improve the sensitivity of the DNA microarray expression profiling assay for whole blood samples. While blockage of globin transcripts during first strand cDNA synthesis with globin PNAs resulted in the best overall performance in this study, we conclude that selection of a protocol for expression profiling studies in blood should depend on several factors, including implementation requirements of the method and study design. RNA isolated from either freshly collected or frozen blood samples stored in PAXGene tubes can be used without altering gene expression profiles. PMID:19123946

  9. Coexistence of multiple globin genes conferring protection against nitrosative stress to the Antarctic bacterium Pseudoalteromonas haloplanktis TAC125.

    PubMed

    Coppola, Daniela; Giordano, Daniela; Milazzo, Lisa; Howes, Barry D; Ascenzi, Paolo; di Prisco, Guido; Smulevich, Giulietta; Poole, Robert K; Verde, Cinzia

    2018-02-28

    Despite the large number of globins recently discovered in bacteria, our knowledge of their physiological functions is restricted to only a few examples. In the microbial world, globins appear to perform multiple roles in addition to the reversible binding of oxygen; all these functions are attributable to the heme pocket that dominates functional properties. Resistance to nitrosative stress and involvement in oxygen chemistry seem to be the most prevalent functions for bacterial globins, although the number of globins for which functional roles have been studied via mutation and genetic complementation is very limited. The acquisition of structural information has considerably outpaced the physiological and molecular characterisation of these proteins. The genome of the Antarctic cold-adapted bacterium Pseudoalteromonas haloplanktis TAC125 (PhTAC125) contains genes encoding three distinct single-chain 2/2 globins, supporting the hypothesis of their crucial involvement in a number of functions, including protection against oxidative and nitrosative stress in the cold and O 2 -rich environment. In the genome of PhTAC125, the genes encoding 2/2 globins are constitutively transcribed, thus suggesting that these globins are not functionally redundant in their physiological function in PhTAC125. In the present study, the physiological role of one of the 2/2 globins, Ph-2/2HbO-2217, was investigated by integrating in vivo and in vitro results. This role includes the involvement in the detoxification of reactive nitrogen and O 2 species including NO by developing two in vivo and in vitro models to highlight the protective role of Ph-2/2HbO-2217 against reactive nitrogen species. The PSHAa2217 gene was cloned and over-expressed in the flavohemoglobin-deficient mutant of Escherichia coli and the growth properties and O 2 uptake in the presence of NO of the mutant carrying the PSHAa2217 gene were analysed. The ferric form of Ph-2/2HbO-2217 is able to catalyse peroxynitrite isomerisation in vitro, indicating its potential role in the scavenging of reactive nitrogen species. Here we present in vitro evidence for the detoxification of NO by Ph-2/2HbO-2217. Copyright © 2017. Published by Elsevier Inc.

  10. Nuclear proteins that bind the human gamma-globin gene promoter: alterations in binding produced by point mutations associated with hereditary persistence of fetal hemoglobin.

    PubMed Central

    Gumucio, D L; Rood, K L; Gray, T A; Riordan, M F; Sartor, C I; Collins, F S

    1988-01-01

    The molecular mechanisms responsible for the human fetal-to-adult hemoglobin switch have not yet been elucidated. Point mutations identified in the promoter regions of gamma-globin genes from individuals with nondeletion hereditary persistence of fetal hemoglobin (HPFH) may mark cis-acting sequences important for this switch, and the trans-acting factors which interact with these sequences may be integral parts in the puzzle of gamma-globin gene regulation. We have used gel retardation and footprinting strategies to define nuclear proteins which bind to the normal gamma-globin promoter and to determine the effect of HPFH mutations on the binding of a subset of these proteins. We have identified five proteins in human erythroleukemia cells (K562 and HEL) which bind to the proximal promoter region of the normal gamma-globin gene. One factor, gamma CAAT, binds the duplicated CCAAT box sequences; the -117 HPFH mutation increases the affinity of interaction between gamma CAAT and its cognate site. Two proteins, gamma CAC1 and gamma CAC2, bind the CACCC sequence. These proteins require divalent cations for binding. The -175 HPFH mutation interferes with the binding of a fourth protein, gamma OBP, which binds an octamer sequence (ATGCAAAT) in the normal gamma-globin promoter. The HPFH phenotype of the -175 mutation indicates that the octamer-binding protein may play a negative regulatory role in this setting. A fifth protein, EF gamma a, binds to sequences which overlap the octamer-binding site. The erythroid-specific distribution of EF gamma a and its close approximation to an apparent repressor-binding site suggest that it may be important in gamma-globin regulation. Images PMID:2468996

  11. Specific repression of β-globin promoter activity by nuclear ferritin

    PubMed Central

    Broyles, Robert H.; Belegu, Visar; DeWitt, Christina R.; Shah, Sandeep N.; Stewart, Charles A.; Pye, Quentin N.; Floyd, Robert A.

    2001-01-01

    Developmental hemoglobin switching involves sequential globin gene activations and repressions that are incompletely understood. Earlier observations, described herein, led us to hypothesize that nuclear ferritin is a repressor of the adult β-globin gene in embryonic erythroid cells. Our data show that a ferritin-family protein in K562 cell nuclear extracts binds specifically to a highly conserved CAGTGC motif in the β-globin promoter at −153 to −148 bp from the cap site, and mutation of the CAGTGC motif reduces binding 20-fold in competition gel-shift assays. Purified human ferritin that is enriched in ferritin-H chains also binds the CAGTGC promoter segment. Expression clones of ferritin-H markedly repress β-globin promoter-driven reporter gene expression in cotransfected CV-1 cells in which the β-promoter has been stimulated with the transcription activator erythroid Krüppel-like factor (EKLF). We have constructed chloramphenicol acetyltransferase reporter plasmids containing either a wild-type or mutant β-globin promoter for the −150 CAGTGC motif and have compared the constructs for susceptibility to repression by ferritin-H in cotransfection assays. We find that stimulation by cotransfected EKLF is retained with the mutant promoter, whereas repression by ferritin-H is lost. Thus, mutation of the −150 CAGTGC motif not only markedly reduces in vitro binding of nuclear ferritin but also abrogates the ability of expressed ferritin-H to repress this promoter in our cell transfection assay, providing a strong link between DNA binding and function, and strong support for our proposal that nuclear ferritin-H is a repressor of the human β-globin gene. Such a repressor could be helpful in treating sickle cell and other genetic diseases. PMID:11481480

  12. Functional and genetic analysis of haplotypic sequence variation at the nicastrin genomic locus

    PubMed Central

    Hamilton, Gillian; Killick, Richard; Lambert, Jean-Charles; Amouyel, Philippe; Carrasquillo, Minerva M.; Pankratz, V. Shane; Graff-Radford, Neill R.; Dickson, Dennis W.; Petersen, Ronald C.; Younkin, Steven G.; Powell, John F.; Wade-Martins, Richard

    2013-01-01

    Nicastrin (NCSTN) is a component of the γ-secretase complex and therefore potentially a candidate risk gene for Alzheimer's disease. Here, we have developed a novel functional genomics methodology to express common locus haplotypes to assess functional differences. DNA recombination was used to engineer 5 bacterial artificial chromosomes (BACs) to each express a different haplotype of the NCSTN locus. Each NCSTN-BAC was delivered to knockout nicastrin (Ncstn−/−) cells and clonal NCSTN-BAC+/Ncstn−/− cell lines were created for functional analyses. We showed that all NCSTN-BAC haplotypes expressed nicastrin protein and rescued γ-secretase activity and amyloid beta (Aβ) production in NCSTN-BAC+/Ncstn−/− lines. We then showed that genetic variation at the NCSTN locus affected alternative splicing in human postmortem brain tissue. However, there was no robust functional difference between clonal cell lines rescued by each of the 5 different haplotypes. Finally, there was no statistically significant association of NCSTN with disease risk in the 4 cohorts. We therefore conclude that it is unlikely that common variation at the NCSTN locus is a risk factor for Alzheimer's disease. PMID:22405046

  13. Stimulation of globin synthesis: relative responsiveness of reticulocytes and nucleated erythroid cells

    PubMed Central

    Waxman, Herbert S.

    1970-01-01

    The effects of iron, cobalt, hemin, and plasma on hemoglobin synthesis by suspensions of rabbit reticulocytes and nucleated bone marrow cells were studied. L-Leucine-14C and sodium pyruvate-3-14C were employed to measure globin and heme synthesis, respectively. Normal plasma (or serum) was found to stimulate the rate of globin synthesis in both systems. The stimulatory effects of iron and hemin were additive to those of plasma or serum only in the reticulocytes. Cobaltous ion, at concentrations less than 1.0 mmole/liter, was found to stimulate globin synthesis by reticulocytes as effectively as ferrous ion; cobalt was inhibitory only at concentrations greater than 3.0-5.0 mmoles/liter. Heme synthesis by reticulocytes was inhibited at all concentrations employed (0.2-5.0 mmoles/liter). In bone marrow nucleated erythroid cells, globin synthesis was markedly enhanced by exogenous hemin. In contrast to reticulocytes, however, bone marrow cells were unresponsive to either cobalt or transferrin-bound iron. Possible implications of these findings on regulation of the rate and mechanism of iron uptake and hemoglobin synthesis in vivo are discussed. PMID:5443172

  14. β-thalassemias: paradigmatic diseases for scientific discoveries and development of innovative therapies.

    PubMed

    Rivella, Stefano

    2015-04-01

    β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.

  15. Novel numerical and graphical representation of DNA sequences and proteins.

    PubMed

    Randić, M; Novic, M; Vikić-Topić, D; Plavsić, D

    2006-12-01

    We have introduced novel numerical and graphical representations of DNA, which offer a simple and unique characterization of DNA sequences. The numerical representation of a DNA sequence is given as a sequence of real numbers derived from a unique graphical representation of the standard genetic code. There is no loss of information on the primary structure of a DNA sequence associated with this numerical representation. The novel representations are illustrated with the coding sequences of the first exon of beta-globin gene of half a dozen species in addition to human. The method can be extended to proteins as is exemplified by humanin, a 24-aa peptide that has recently been identified as a specific inhibitor of neuronal cell death induced by familial Alzheimer's disease mutant genes.

  16. Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.

    PubMed Central

    Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W

    1987-01-01

    Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706

  17. Genetic control of T cell responsiveness to the Friend murine leukemia virus envelope antigen. Identification of class II loci of the H-2 as immune response genes

    PubMed Central

    1988-01-01

    T cells primed specifically for the envelope glycoprotein of Friend murine leukemia helper virus (F-MuLV) were prepared by immunizing mice with a recombinant vaccinia virus that expressed the entire env gene of F-MuLV. Significant proliferative responses of F-MuLV envelope- specific, H-2a/b T cells were observed when the T cells were stimulated with antigen-pulsed peritoneal exudate cells (PEC) having the b allele at the K, A beta, A alpha, and E beta loci of the H-2. On the other hand, PEC having only the kappa allele at these loci did not induce the envelope-specific T cell proliferation, even when the PEC had the b allele at the E alpha, S, or D loci. F-MuLV envelope-specific proliferation of H-2a/b T cells under the stimulation of antigen- pulsed, H-2a/b PEC was specifically blocked with anti-I-Ab and anti-I- Ek mAbs but not with anti-Kb, anti-Kk, or anti-I-Ak mAbs. Moreover, (B10.MBR x A/WySn)F1 mice that have the b allele only at the K locus but not in I-A subregion were nonresponders to the envelope glycoprotein, and the bm12 mutation at the A beta locus completely abolished the T cell responsiveness to this antigen. These results indicate that proliferative T cells recognize a limited number of epitopes on F-MuLV envelope protein in the context of I-Ab, hybrid I- Ak/b, and/or hybrid I-Ek/b class II MHC molecules but fail to recognize the same envelope protein in the context of I-Ak or I-Ek molecules. This influence of the H-2I region on T cell recognition of the envelope glycoprotein appeared to control in vivo induction of protective immunity against Friend virus complex after immunization with the vaccinia-F-MuLV env vaccine. Thus, these results provide, for the first time, direct evidence for Ir gene-controlled responder/nonresponder phenotypes influencing the immune response to a pathogenic virus of mice. PMID:3141552

  18. Examining the relationship between health locus of control and God Locus of Health Control: Is God an internal or external source?

    PubMed

    Boyd, Joni M; Wilcox, Sara

    2017-11-01

    For many people, the influence of believing in a higher power can elicit powerful effects. This study examined the relationship between God control, health locus of control, and frequency of religious attendance within 838 college students through online surveys. Regression analysis showed that chance and external locus of control and frequency of religious attendance were significant and positive predictors of God Locus of Health Control. The association of powerful others external locus of control and God Locus of Health Control differed by race (stronger in non-Whites than Whites) and somewhat by gender (stronger in women than men). For some people, the role of a supreme being, or God, should be considered when designing programs for improving health behaviors.

  19. Sickle cell anemia in northern Israel: screening and prevention.

    PubMed

    Koren, Ariel; Zalman, Lucia; Palmor, Haya; Zamir, Ronit Bril; Levin, Carina; Openheim, Ariella; Daniel-Spiegel, Etty; Shalev, Stavit; Filon, Dvora

    2009-04-01

    Sickle cell anemia is a hemolytic anemia caused by a single mutation in position 6 of the beta globin molecule. About 80 patients with SCA in northern Israel are currently receiving treatment. To assess a screening program in northern Israel aimed at detecting couples at risk for having offspring with SCA. Since 1987, screening for beta thalassemia in pregnant women in northern Israel has been conducted, and from 1999 all the samples were also tested for hemoglobin S, Hgb C, Hgb D, Hgb O Arab and others. During the 20 year period 1987-2006 a total of 69,340 women were screened; 114 couples who carried Hgb S were detected and 187 prenatal diagnoses were performed in couples at risk for having an offspring with Hgb S. The mean gestational age was 13 +/- 4 weeks. Fifty-four of those diagnoses revealed affected fetuses and in 4 cases the couple declined to perform therapeutic abortion. The economic burden to the health services for treating SCA patients is about U.S.$ 7000 per year, and the institution of prevention programs has proven cost-effective in populations with a high frequency of carriers. Since our program is aimed to also detect beta thalassemia, a disease that is more frequent in this area (> 2.5%), the added cost for the prevention of SCA is less significant despite the low incidence of the S gene in our population, namely < 1%.

  20. Subcultural Determinants of Locus of Control (IE) Development. A Locus of Control (IE) Measure for Preschool-Age Children: Model, Method, and Validity.

    ERIC Educational Resources Information Center

    Stephens, Mark; Delys, Pamela

    Both papers are concerned with locus of control (of reinforcement) expectancies among young children, especially preschoolers. The first reviews a number of studies which examined the relationship between locus of control, socioeconomic status, and ethnicity. The results indicate that (1) economic status is consistently related to locus of…

  1. In Silico Analysis of Single Nucleotide Polymorphism (SNPs) in Human β-Globin Gene

    PubMed Central

    Alanazi, Mohammed; Abduljaleel, Zainularifeen; Khan, Wajahatullah; Warsy, Arjumand S.; Elrobh, Mohamed; Khan, Zahid; Amri, Abdullah Al; Bazzi, Mohammad D.

    2011-01-01

    Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies- the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB) gene mutations, such as that producing sickle cell hemoglobin (HbS), HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT) server we have searched for the SNPs, which showed that 200 (80%) non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40%) non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K), HbD (E→Q), HbE (E→K) and HbS (E→V). Atomic Non-Local Environment Assessment (ANOLEA), Yet Another Scientific Artificial Reality Application (YASARA), CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref) of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid residues were determined and secondary structures were observed for solvent accessibility to confirm the protein stability. The functional study in this investigation may be a good model for additional future studies. PMID:22028795

  2. Structural characterization of hemoglobins from Monilifera and Frenulata tubeworms (Siboglinids): first discovery of giant hexagonal-bilayer hemoglobin in the former "Pogonophora" group.

    PubMed

    Meunier, Cédric; Andersen, Ann C; Bruneaux, Matthieu; Le Guen, Dominique; Terrier, Peran; Leize-Wagner, Emmanuelle; Zal, Franck

    2010-01-01

    Siboglinids are symbiotic polychete annelids having hemoglobins as essential oxygen- and sulfide-carriers for their endosymbiotic bacteria. We analyzed the structure of the hemoglobins from two species of siboglinids: the monilifera Sclerolinum contortum and the frenulata Oligobrachia webbi (i.e. haakonmosbiensis) from Norwegian cold seeps. Measured by Multi-Angle Laser Light Scattering (MALLS), Sclerolinum shows a 3190+/-50 kDa hexagonal bilayer hemoglobin (HBL-Hb) and a 461+/-46 kDa ring-Hb, just as vestimentifera, whereas Oligobrachia has a 409+/-3.7 kDa ring-Hb only. Electrospray Ionization-Mass Spectrometry (ESI-MS) showed Sclerolinum HBL-Hb composed of seven monomeric globins (15-16 kDa), three disulfide-bonded globin heterodimers and three linkers. The heterodimers always contain globin-b (15814.4+/-1.5 Da). Sclerolinum ring-Hb is composed of globins and dimers with identical masses as its HBL-Hb, but lacks linkers. Oligobrachia ring-Hb has three globin monomers (14-15 kDa) only, with no disulfide-bonded dimers. Comparison of Sclerolinum hemoglobins between Storegga and Haakon Mosby Mud Volcano, using the normalized height of deconvoluted ESI-MS peaks, shows differences in globin monomers abundances that could reflect genetic differences or differential gene expression between distinct seep populations. The discovery of HBL-Hb in Sclerolinum is a new element supporting the hypothesis of monilifera being phylogenetically more closely related to vestimentifera, than to frenulata.

  3. Therapeutic levels of fetal hemoglobin in erythroid progeny of β-thalassemic CD34+ cells after lentiviral vector-mediated gene transfer

    PubMed Central

    Wilber, Andrew; Hargrove, Phillip W.; Kim, Yoon-Sang; Riberdy, Janice M.; Sankaran, Vijay G.; Papanikolaou, Eleni; Georgomanoli, Maria; Anagnou, Nicholas P.; Orkin, Stuart H.; Nienhuis, Arthur W.

    2011-01-01

    β-Thalassemia major results from severely reduced or absent expression of the β-chain of adult hemoglobin (α2β2;HbA). Increased levels of fetal hemoglobin (α2γ2;HbF), such as occurs with hereditary persistence of HbF, ameliorate the severity of β-thalassemia, raising the potential for genetic therapy directed at enhancing HbF. We used an in vitro model of human erythropoiesis to assay for enhanced production of HbF after gene delivery into CD34+ cells obtained from mobilized peripheral blood of normal adults or steady-state bone marrow from patients with β-thalassemia major. Lentiviral vectors encoding (1) a human γ-globin gene with or without an insulator, (2) a synthetic zinc-finger transcription factor designed to interact with the γ-globin gene promoters, or (3) a short-hairpin RNA targeting the γ-globin gene repressor, BCL11A, were tested. Erythroid progeny of normal CD34+ cells demonstrated levels of HbF up to 21% per vector copy. For β-thalassemic CD34+ cells, similar gene transfer efficiencies achieved HbF production ranging from 45% to 60%, resulting in up to a 3-fold increase in the total cellular Hb content. These observations suggest that both lentiviral-mediated γ-globin gene addition and genetic reactivation of endogenous γ-globin genes have potential to provide therapeutic HbF levels to patients with β-globin deficiency. PMID:21156846

  4. Characterization of the genetic locus responsible for the production of ABP-118, a novel bacteriocin produced by the probiotic bacterium Lactobacillus salivarius subsp. salivarius UCC118.

    PubMed

    Flynn, Sarah; van Sinderen, Douwe; Thornton, Gerardine M; Holo, Helge; Nes, Ingolf F; Collins, J Kevin

    2002-04-01

    ABP-118, a small heat-stable bacteriocin produced by Lactobacillus salivarius subsp. salivarius UCC118, a strain isolated from the ileal-caecal region of the human gastrointestinal tract, was purified to homogeneity. Using reverse genetics, a DNA fragment specifying part of ABP-118 was identified on a 10769 bp chromosomal region. Analysis of this region revealed that ABP-118 was a Class IIb two-peptide bacteriocin composed of Abp118alpha, which exhibited the antimicrobial activity, and Abp118beta, which enhanced the antimicrobial activity. The gene conferring strain UCC118 immunity to the action of ABP-118, abpIM, was identified downstream of the abp118beta gene. Located further downstream of abp118beta, several ORFs were identified whose deduced proteins resembled those of proteins involved in bacteriocin regulation and secretion. Heterologous expression of ABP-118 was achieved in Lactobacillus plantarum, Lactococcus lactis and Bacillus cereus. In addition, the abp118 locus encoded an inducing peptide, AbpIP, which was shown to play a role in the regulation of ABP-118 production. This novel bacteriocin is, to the authors' knowledge, the first to be isolated from a known human probiotic bacterium and to be characterized at the genetic level.

  5. Potentially Therapeutic Levels of Anti-Sickling Globin Gene Expression Following Lentivirus-mediated Gene Transfer in Sickle Cell Disease Bone Marrow CD34+ Cells

    PubMed Central

    Urbinati, Fabrizia; Hargrove, Philip W.; Geiger, Sabine; Romero, Zulema; Wherley, Jennifer; Kaufman, Michael L.; Hollis, Roger P.; Chambers, Christopher B.; Persons, Derek A.; Kohn, Donald B.; Wilber, Andrew

    2015-01-01

    Sickle cell disease (SCD) can be cured by allogeneic hematopoietic stem cell (HSC) transplant. However, this is only possible when a matched donor is available making the development of gene therapy using autologous HSCs a highly desired alternative. We used a culture model of human erythropoiesis to directly compare two insulated, self-inactivating, and erythroid-specific lentiviral vectors, encoding for γ-globin (V5m3-400) or a modified β-globin (βAS3-FB) for production of anti-sickling hemoglobin (Hb) and correction of red cell deformability after deoxygenation. Bone marrow CD34+ cells from three SCD patients were transduced using V5m3-400 or βAS3-FB and compared to mock transduced SCD or healthy donor CD34+ cells. Lentiviral transduction did not impair cell growth or differentiation, as gauged by proliferation and acquisition of erythroid markers. Vector copy number averaged ~1 copy per cell and corrective globin mRNA levels were increased more than 7-fold over mock-transduced controls. Erythroblasts derived from healthy donor and mock-transduced SCD cells produced a low level of HbF that was increased to 23.6 ± 4.1% per vector copy for cells transduced with V5m3-400. Equivalent levels of modified HbA of 17.6 ± 3.8% per vector copy were detected for SCD cells transduced with βAS3-FB. These levels of anti-sickling Hb production were sufficient to reduce sickling of terminal stage RBCs upon deoxygenation. We conclude that the achieved levels of HbF and modified HbA would likely prove therapeutic to SCD patients who lack matched donors. PMID:25681747

  6. eMelanoBase: an online locus-specific variant database for familial melanoma.

    PubMed

    Fung, David C Y; Holland, Elizabeth A; Becker, Therese M; Hayward, Nicholas K; Bressac-de Paillerets, Brigitte; Mann, Graham J

    2003-01-01

    A proportion of melanoma-prone individuals in both familial and non-familial contexts has been shown to carry inactivating mutations in either CDKN2A or, rarely, CDK4. CDKN2A is a complex locus that encodes two unrelated proteins from alternately spliced transcripts that are read in different frames. The alpha transcript (exons 1alpha, 2, and 3) produces the p16INK4A cyclin-dependent kinase inhibitor, while the beta transcript (exons 1beta and 2) is translated as p14ARF, a stabilizing factor of p53 levels through binding to MDM2. Mutations in exon 2 can impair both polypeptides and insertions and deletions in exons 1alpha, 1beta, and 2, which can theoretically generate p16INK4A-p14ARF fusion proteins. No online database currently takes into account all the consequences of these genotypes, a situation compounded by some problematic previous annotations of CDKN2A-related sequences and descriptions of their mutations. As an initiative of the international Melanoma Genetics Consortium, we have therefore established a database of germline variants observed in all loci implicated in familial melanoma susceptibility. Such a comprehensive, publicly accessible database is an essential foundation for research on melanoma susceptibility and its clinical application. Our database serves two types of data as defined by HUGO. The core dataset includes the nucleotide variants on the genomic and transcript levels, amino acid variants, and citation. The ancillary dataset includes keyword description of events at the transcription and translation levels and epidemiological data. The application that handles users' queries was designed in the model-view-controller architecture and was implemented in Java. The object-relational database schema was deduced using functional dependency analysis. We hereby present our first functional prototype of eMelanoBase. The service is accessible via the URL www.wmi.usyd.edu.au:8080/melanoma.html. Copyright 2002 Wiley-Liss, Inc.

  7. Modulating Vascular Hemodynamics With an Alpha Globin Mimetic Peptide (HbαX).

    PubMed

    Keller, T C Stevenson; Butcher, Joshua T; Broseghini-Filho, Gilson Brás; Marziano, Corina; DeLalio, Leon J; Rogers, Stephen; Ning, Bo; Martin, Jennifer N; Chechova, Sylvia; Cabot, Maya; Shu, Xiahong; Best, Angela K; Good, Miranda E; Simão Padilha, Alessandra; Purdy, Michael; Yeager, Mark; Peirce, Shayn M; Hu, Song; Doctor, Allan; Barrett, Eugene; Le, Thu H; Columbus, Linda; Isakson, Brant E

    2016-12-01

    The ability of hemoglobin to scavenge the potent vasodilator nitric oxide (NO) in the blood has been well established as a mechanism of vascular tone homeostasis. In endothelial cells, the alpha chain of hemoglobin (hereafter, alpha globin) and endothelial NO synthase form a macromolecular complex, providing a sink for NO directly adjacent to the production source. We have developed an alpha globin mimetic peptide (named HbαX) that displaces endogenous alpha globin and increases bioavailable NO for vasodilation. Here we show that, in vivo, HbαX administration increases capillary oxygenation and blood flow in arterioles acutely and produces a sustained decrease in systolic blood pressure in normal and angiotensin II-induced hypertensive states. HbαX acts with high specificity and affinity to endothelial NO synthase, without toxicity to liver and kidney and no effect on p50 of O 2 binding in red blood cells. In human vasculature, HbαX blunts vasoconstrictive response to cumulative doses of phenylephrine, a potent constricting agent. By binding to endothelial NO synthase and displacing endogenous alpha globin, HbαX modulates important metrics of vascular function, increasing vasodilation and flow in the resistance vasculature. © 2016 American Heart Association, Inc.

  8. Protein-expression profiles in mouse blood-plasma following acute whole-body exposure to (137)Cs gamma rays.

    PubMed

    Rithidech, Kanokporn Noy; Honikel, Louise; Rieger, Robert; Xie, Weiping; Fischer, Thomas; Simon, Sanford R

    2009-05-01

    To compare the pattern of protein-expression profiles in blood-plasma after exposure of CBA/CaJ mice to 0 or 3 Gy of (137)Cs gamma rays. Two-dimensional electrophoresis gel coupled with mass spectrometry was used to analyze blood-samples collected at days 2 and 7 post-irradiation. At each sacrifice-time, alterations in expression-level of protein spots between control- and exposed-groups were analyzed statistically by the PDQuest software using Student's t-test (at the significance level of p < 0.05). Mass spectrometry was used to identify the identity of protein-spots with significantly altered expression-level. At day 2, 18 proteins were significantly up-regulated in exposed-mice. These included: alpha-2-Heremans-Schmid (HS)-glycoprotein, apolipoprotein (Apo)-AII-precursor, Apo-E, beta-2-glycoprotein-I, clusterin, fibrinogen-alpha-chain, fibrinogen-gamma-polypeptide, fetuin-B, haptoglobin, high-molecular-weight (HMW)-kininogen (Kng), low-MW-Kng, Kng1-precursor, liver-carboxylesterase-I-precursor, major-urinary-protein-6-precursor, mannose-binding-protein-C-precursor, mannose-binding-lectin-C, and prothrombin-precursor. Gelsolin was detected in control-mice only. At day 7, high expression-levels of 14 proteins were detected in control-mice (i.e., alpha-1-antitrypsin-precursor, carboxylesterase-N, cholesterol-7-alpha-hydroxylase, contraspin, coagulation-factor-II, coagulation-factor-XIII, gelsolin, immunoglobulin-G-heavy-chain, neurexin, prothrombin-precursor, protein-phosphatase, putative-calcium-influx-channel, vitamin-D-binding-protein, and 1110018G07Rik); while 15 proteins were highly expressed in exposed-mice. These included: alpha-1-acid-glycoprotein, alpha-2-HS-glycoprotein, alpha-1-protease-inhibitor-2, ApoA-IV, ApoC-I, ApoH, beta-1-globin, clusterin, complement-component-3, fibrinogen-beta-chain, HMW-Kng, major-histocompatibility-complex-class-Ia-H2-K, serine-(cysteine)-proteinase-inhibitor, retinoblastoma-associated-protein-140, and vascular-cell-adhesion-molecule-1. Although different proteins (mostly involved in inflammatory responses) were detected in exposed-mice, alterations in expression-levels of clusterin, gelsolin, kininogen, and alpha-2-HS-glycoproteins were found at both times. Despite the need for validation, the results suggested that alterations in expression-levels of specific proteins may be indicative of radiation-exposure. The results also provided the important step in an eventual establishment of blood-based biomarkers of radiation-exposure in vivo.

  9. Adolescent Values Clarification: A Positive Influence on Perceived Locus of Control.

    ERIC Educational Resources Information Center

    James, Mark R.

    1990-01-01

    Used locus of control assessments to monitor specific aspect of adolescent chemical dependency treatment program. Used song lyric analysis activities to note short-term modifications in experimental group's (N=10) perceived locus of control. No improvements were noted in matched control group's locus of control. Findings suggest that addictions…

  10. [Expression and purification of a novel thermophilic bacterial single-stranded DNA-binding protein and enhancement the synthesis of DNA and cDNA].

    PubMed

    Jia, Xiao-Wei; Zhang, Guo-Hui; Shi, Hai-Yan

    2012-12-01

    Express a novel species of single-stranded DNA-binding protein (SSB) derived from Thermococcus kodakarensis KOD1, abbreviated kod-ssb. And evaluate the effect of kod-ssb on PCR-based DNA amplification and reverse transcription. We express kod-ssb with the Transrtta (DE3), and kod-ssb was purified by affinity chromatography on a Ni2+ Sepharose column, detected by SDS-PAGE. To evaluate the effect of kod-ssb on PCR-based DNA amplification, the human beta globin gene was used as template to amplify a 5-kb, 9-kb and 13-kb. And to detect the effect of kod-ssb on reverse transcription, we used RNA from flu cell culture supernatant extraction as templates to implement qRT-PCR reaction. The plasmid pET11a-kod was transformed into Transetta (DE3) and the recombinant strain Transetta (pET11 a-kod) was obtained. The kod-ssb was highly expressed when the recombinant strain Transetta(pET11a-kod) was induced by IPTG. The specific protein was detected by SDS-PAGE. To confirm that kod-ssb can enhance target DNA synthesis and reduce PCR by-products, 5-, 9-, and 13-kb human beta globin gene fragments were used as templates for PCR. When PCR reactions did not include SSB proteins, the specific PCR product was contaminated with non-specific products. When kod -ssb was added, kod-ssb significantly enhanced amplification of the 5-, 9-and 13-kb target product and minimised the non-specific PCR products. To confirm that kod-ssb can enhance target cDNA synthesis, RNA from flu cell culture supernatant extraction was used as templates for qRT-PCR reaction. The results was that when kod-ssb was added, kod-ssb significantly enhanced the synthesis of cDNA, average Ct value is 19.42, and the average Ct value without kod-ssb is 22.15. kod-ssb may in future be used to enhance DNA and cDNA amplification.

  11. Farsi version of the multidimensional health locus of control and God locus of health control scales: validity and reliability study among Iranian women with a family history of breast cancer.

    PubMed

    Hashemian, Masoumeh; Aminshokravi, Farkhonde; Hidarnia, Alireza; Lamyian, Minoor; Hassanpour, Kazem; Akaberi, Arash; Moshki, Mahdi

    2014-09-01

    To determine the Persian version's reliability and validity of the Multidimensional Health Locus of Control and God Health Locus of Control scales among women with family history of breast cancer. The cross-sectional study was conducted in Sabzevar, Iran, in 2012. It randomly selected women with family members affected by breast cancer. Predesigned questionnaires were completed through interviews. Content and face validity was evaluated using the opinions of a panel of experts, and construct validity was confirmed by applying confirmatory factor analysis.The instruments' reliability was assessed using Cronbach's alpha and test-retest reliability. There were 200 women in the study with their age ranging between 18 and 69 years and revealed the following; root mean square error of approximation for Multidimensional Health Locus of Control Scale = 0.013, and God Locus of Health Control Scale = 0.077; comparative fit index = 0.999, 0.998; incremental fit index = 0.999, 0.998;Tucker-Lewis fit index = 0.998, 0.998; and normed fit index = 0.983, 0.997 respectively. Cronbach's alpha was 0.61 for Internal Health Locus of Control, 0.8 for Chance Health Locus of Control, 0.68 for Power Health Locus of Control and 0.9 for God Locus Health Control. The Persian version of the subscales supported the main version.

  12. Biomonitoring of carcinogenic substances: enzymatic digestion of globin for detecting alkylated amino acids

    NASA Astrophysics Data System (ADS)

    Bader, Michael; Rauscher, Dankwart; Geibel, Kurt; Angerer, Juergen

    1993-03-01

    We report the application of proteases for the total hydrolysis of globin with subsequent determination of amino acids. Optimization of the proteolysis was made with respect to enzyme concentration, time of incubation and type of protease. Ethylene oxide modified globin was used to compare the results of the analysis of the N-terminal amino acid valine after enzymatic cleavage to those obtained from the widely used modified Edman procedure. It is shown that the cleavage is of good reproducibility and yields more alkylated amino acid than the Edman procedure.

  13. AHSP: a novel hemoglobin helper

    PubMed Central

    Bank, Arthur

    2007-01-01

    Recently, the small protein α hemoglobin–stabilizing protein (AHSP) was identified and found to specifically bind α-globin, stabilize its structure, and limit the toxic effects of excess α-globin, which are manifest in the inherited blood disorder β thalassemia. In this issue of the JCI, Yu, Weiss, and colleagues show that AHSP is also critical to the formation and stabilization of normal amounts of hemoglobin, even when α-globin is deficient, indicating unique and previously unidentified roles for this molecule (see the related article beginning on page 1856). PMID:17607349

  14. Factor Specific Differences in Locus of Control for Emotionally Disturbed and Normal Children

    ERIC Educational Resources Information Center

    Kendall, Philip C.; And Others

    1976-01-01

    Institutionalized emotionally disturbed boys and noninstitutionalized normal boys were administered the Nowicki-Strickland Locus of Control Scale for Children. Locus of control and separate factor scores were calculated. Helplessness factor scores, but not overall locus of control scores, differentiated the two groups. (BJG)

  15. Parental Locus of Control and the Assessment of Children's Personality Characteristics.

    ERIC Educational Resources Information Center

    Ollendick, Duane G.

    1979-01-01

    A study of fourth graders and their parents was conducted to determine the relationship between parents' locus of control and their children's locus of control, anxiety, intelligence, achievement, and behavioral adjustment. The relationship between mothers' locus of control and children's characteristics was more consistent than between fathers…

  16. The genetics and transcriptional profiles of the cellulose synthase-like HvCslF gene family in barley.

    PubMed

    Burton, Rachel A; Jobling, Stephen A; Harvey, Andrew J; Shirley, Neil J; Mather, Diane E; Bacic, Antony; Fincher, Geoffrey B

    2008-04-01

    Cellulose synthase-like CslF genes have been implicated in the biosynthesis of (1,3;1,4)-beta-d-glucans, which are major cell wall constituents in grasses and cereals. Seven CslF genes from barley (Hordeum vulgare) can be divided into two classes on the basis of intron-exon arrangements. Four of the HvCslF genes have been mapped to a single locus on barley chromosome 2H, in a region corresponding to a major quantitative trait locus for grain (1,3;1,4)-beta-d-glucan content. The other HvCslF genes map to chromosomes 1H, 5H, and 7H, and in two cases the genes are close to other quantitative trait loci for grain (1,3;1,4)-beta-d-glucan content. Spatial and temporal patterns of transcription of the seven genes have been defined through quantitative polymerase chain reaction. In developing barley coleoptiles HvCslF6 mRNA is most abundant. Transcript levels are maximal in 4- to 5-d coleoptiles, at a time when (1,3;1,4)-beta-d-glucan content of coleoptile cell walls also reaches maximal levels. In the starchy endosperm of developing grain, HvCslF6 and HvCslF9 transcripts predominate. Two peaks of transcription are apparent. One occurs just after endosperm cellularization, 4 to 8 d after pollination, while the second occurs much later in grain development, more than 20 d after pollination. Marked varietal differences in transcription of the HvCslF genes are observed during endosperm development. Given the commercial importance of cereal (1,3;1,4)-beta-d-glucans in human nutrition, in stock feed, and in malting and brewing, the observation that only two genes, HvCslF6 and HvCslF9, are transcribed at high levels in developing grain is of potential relevance for the future manipulation of grain (1,3;1,4)-beta-d-glucan levels.

  17. External locus of control contributes to racial disparities in memory and reasoning training gains in ACTIVE

    PubMed Central

    Zahodne, Laura B.; Meyer, Oanh L.; Choi, Eunhee; Thomas, Michael L.; Willis, Sherry L.; Marsiske, Michael; Gross, Alden L.; Rebok, George W.; Parisi, Jeanine M.

    2015-01-01

    Racial disparities in cognitive outcomes may be partly explained by differences in locus of control. African Americans report more external locus of control than non-Hispanic Whites, and external locus of control is associated with poorer health and cognition. The aims of this study were to compare cognitive training gains between African American and non-Hispanic White participants in the Advanced Cognitive Training for Independent and Vital Elderly (ACTIVE) study and determine whether racial differences in training gains are mediated by locus of control. The sample comprised 2,062 (26% African American) adults aged 65 and older who participated in memory, reasoning, or speed training. Latent growth curve models evaluated predictors of 10-year cognitive trajectories separately by training group. Multiple group modeling examined associations between training gains and locus of control across racial groups. Compared to non-Hispanic Whites, African Americans evidenced less improvement in memory and reasoning performance after training. These effects were partially mediated by locus of control, controlling for age, sex, education, health, depression, testing site, and initial cognitive ability. African Americans reported more external locus of control, which was associated with smaller training gains. External locus of control also had a stronger negative association with reasoning training gain for African Americans than for Whites. No racial difference in training gain was identified for speed training. Future intervention research with African Americans should test whether explicitly targeting external locus of control leads to greater cognitive improvement following cognitive training. PMID:26237116

  18. Comparison of the DNA extraction methods for polymerase chain reaction amplification from formalin-fixed and paraffin-embedded tissues.

    PubMed

    Sato, Y; Sugie, R; Tsuchiya, B; Kameya, T; Natori, M; Mukai, K

    2001-12-01

    To obtain an adequate quality and quantity of DNA from formalin-fixed and paraffin-embedded tissue, six different DNA extraction methods were compared. Four methods used deparaffinization by xylene followed by proteinase K digestion and phenol-chloroform extraction. The temperature of the different steps was changed to obtain higher yields and improved quality of extracted DNA. The remaining two methods used microwave heating for deparaffinization. The best DNA extraction method consisted of deparaffinization by microwave irradiation, protein digestion with proteinase K at 48 degrees C overnight, and no further purification steps. By this method, the highest DNA yield was obtained and the amplification of a 989-base pair beta-globin gene fragment was achieved. Furthermore, DNA extracted by means of this procedure from five gastric carcinomas was successfully used for single strand conformation polymorphism and direct sequencing assays of the beta-catenin gene. Because the microwave-based DNA extraction method presented here is simple, has a lower contamination risk, and results in a higher yield of DNA compared with the ordinary organic chemical reagent-based extraction method, it is considered applicable to various clinical and basic fields.

  19. The Prevalence and Molecular Spectrum of α- and β-Globin Gene Mutations in 14,332 Families of Guangdong Province, China

    PubMed Central

    Xu, Longchang; Wu, Li; Zhang, Liang; Ma, Yuanzhu; Chen, Tingting; Gao, Shuang; Liang, Juqing; Guo, Hao; Qin, Danqing; Wang, Jicheng; Yuan, Tenglong; Wang, Yixia; Huang, Wei-wei; He, Wen-Fei; Zhang, Yanxia; Liu, Chang; Xia, Sujian; Chen, Qingshan; Zhao, Qingguo; Zhang, Xiaozhuang

    2014-01-01

    Objective To reveal the familial prevalence and molecular variation of α- and β-globin gene mutations in Guangdong Province. Methods A total of 40,808 blood samples from 14,332 families were obtained and analyzed for both hematological and molecular parameters. Results A high prevalence of α- and β-globin gene mutations was found. Overall, 17.70% of pregnant women, 15.94% of their husbands, 16.03% of neonates, and 16.83% of couples (pregnant women and their husbands) were heterozygous carriers of α- or β-thalassemia. The regions with the highest prevalence were the mountainous and western regions, followed by the Pearl River Delta; the region with the lowest prevalence was Chaoshan. The total familial carrier rate (both spouses were α- or β-thalassemia carriers) was 1.87%, and the individual carrier rates of α- and β-thalassemia were 1.68% and 0.20%, respectively. The total rate of moderate-to-severe fetal thalassemia was 12.78% among couples in which both parents were carriers. Conclusions There was a high prevalence of α- and β-thalassemia in Guangdong Province. This study will contribute to the development of thalassemia prevention and control strategies in Guangdong Province. PMID:24587075

  20. Genetic Locus for Streptolysin S Production by Group A Streptococcus

    PubMed Central

    Nizet, Victor; Beall, Bernard; Bast, Darrin J.; Datta, Vivekananda; Kilburn, Laurie; Low, Donald E.; De Azavedo, Joyce C. S.

    2000-01-01

    Group A streptococcus (GAS) is an important human pathogen that causes pharyngitis and invasive infections, including necrotizing fasciitis. Streptolysin S (SLS) is the cytolytic factor that creates the zone of beta-hemolysis surrounding GAS colonies grown on blood agar. We recently reported the discovery of a potential genetic determinant involved in SLS production, sagA, encoding a small peptide of 53 amino acids (S. D. Betschel, S. M. Borgia, N. L. Barg, D. E. Low, and J. C. De Azavedo, Infect. Immun. 66:1671–1679, 1998). Using transposon mutagenesis, chromosomal walking steps, and data from the GAS genome sequencing project (www.genome.ou.edu/strep.html), we have now identified a contiguous nine-gene locus (sagA to sagI) involved in SLS production. The sag locus is conserved among GAS strains regardless of M protein type. Targeted plasmid integrational mutagenesis of each gene in the sag operon resulted in an SLS-negative phenotype. Targeted integrations (i) upstream of the sagA promoter and (ii) downstream of a terminator sequence after sagI did not affect SLS production, establishing the functional boundaries of the operon. A rho-independent terminator sequence between sagA and sagB appears to regulate the amount of sagA transcript produced versus transcript for the entire operon. Reintroduction of the nine-gene sag locus on a plasmid vector restored SLS activity to the nonhemolytic sagA knockout mutant. Finally, heterologous expression of the intact sag operon conferred the SLS beta-hemolytic phenotype to the nonhemolytic Lactococcus lactis. We conclude that gene products of the GAS sag operon are both necessary and sufficient for SLS production. Sequence homologies of sag operon gene products suggest that SLS is related to the bacteriocin family of microbial toxins. PMID:10858242

  1. HYDROGENATION OF POLYCYCLIC AROMATIC COMPOUNDS USING NI SUPPORT ON H-BETA ZEOLITE IN SUPERCRITICAL CARBON DIOXIDE

    EPA Science Inventory

    The primary rationale for use of supercritical carbon dioxide as a solvent in hydrogenation is the elimination of mass transfer limitations, through enhancement of the solubility of hydrogen at the reaction locus. Hydrogenation of anthracene was performed using NiHB-zeolite catal...

  2. Gene cooption and convergent evolution of oxygen transport hemoglobins in jawed and jawless vertebrates

    PubMed Central

    Hoffmann, Federico G.; Opazo, Juan C.; Storz, Jay F.

    2010-01-01

    Natural selection often promotes evolutionary innovation by coopting preexisting genes for new functions, and this process may be greatly facilitated by gene duplication. Here we report an example of cooptive convergence where paralogous members of the globin gene superfamily independently evolved a specialized O2 transport function in the two deepest branches of the vertebrate family tree. Specifically, phylogenetic evidence demonstrates that erythroid-specific O2 transport hemoglobins evolved independently from different ancestral precursor proteins in jawed vertebrates (gnathostomes) and jawless fish (cyclostomes, represented by lamprey and hagfish). A comprehensive phylogenetic analysis of the vertebrate globin gene superfamily revealed that the erythroid hemoglobins of cyclostomes are orthologous to the cytoglobin protein of gnathostome vertebrates, a hexacoordinate globin that has no O2 transport function and that is predominantly expressed in fibroblasts and related cell types. The phylogeny reconstruction also revealed that vertebrate-specific globins are grouped into four main clades: (i) cyclostome hemoglobin + cytoglobin, (ii) myoglobin + globin E, (iii) globin Y, and (iv) the α- and β-chain hemoglobins of gnathostomes. In the hemoglobins of gnathostomes and cyclostomes, multisubunit quaternary structures provide the basis for cooperative O2 binding and allosteric regulation by coupling the effects of ligand binding at individual subunits with interactions between subunits. However, differences in numerous structural details belie their independent origins. This example of convergent evolution of protein function provides an impressive demonstration of the ability of natural selection to cobble together complex design solutions by tinkering with different variations of the same basic protein scaffold. PMID:20660759

  3. Self-Esteem, Locus of Control, and Student Achievement.

    ERIC Educational Resources Information Center

    Sterbin, Allan; Rakow, Ernest

    The direct effects of locus of control and self-esteem on standardized test scores were studied. The relationships among the standardized test scores and measures of locus of control and self-esteem for 12,260 students from the National Education Longitudinal Study 1994 database were examined, using the same definition of locus of control and…

  4. Developmental Control of NRAMP1 (SLC11A1) Expression in Professional Phagocytes.

    PubMed

    Cellier, Mathieu F M

    2017-05-03

    NRAMP1 (SLC11A1) is a professional phagocyte membrane importer of divalent metals that contributes to iron recycling at homeostasis and to nutritional immunity against infection. Analyses of data generated by several consortia and additional studies were integrated to hypothesize mechanisms restricting NRAMP1 expression to mature phagocytes. Results from various epigenetic and transcriptomic approaches were collected for mesodermal and hematopoietic cell types and compiled for combined analysis with results of genetic studies associating single nucleotide polymorphisms (SNPs) with variations in NRAMP1 expression (eQTLs). Analyses establish that NRAMP1 is part of an autonomous topologically associated domain delimited by ubiquitous CCCTC-binding factor (CTCF) sites. NRAMP1 locus contains five regulatory regions: a predicted super-enhancer (S-E) key to phagocyte-specific expression; the proximal promoter; two intronic areas, including 3' inhibitory elements that restrict expression during development; and a block of upstream sites possibly extending the S-E domain. Also the downstream region adjacent to the 3' CTCF locus boundary may regulate expression during hematopoiesis. Mobilization of the locus 14 predicted transcriptional regulatory elements occurs in three steps, beginning with hematopoiesis; at the onset of myelopoiesis and through myelo-monocytic differentiation. Basal expression level in mature phagocytes is further influenced by genetic variation, tissue environment, and in response to infections that induce various epigenetic memories depending on microorganism nature. Constitutively associated transcription factors (TFs) include CCAAT enhancer binding protein beta (C/EBPb), purine rich DNA binding protein (PU.1), early growth response 2 (EGR2) and signal transducer and activator of transcription 1 (STAT1) while hypoxia-inducible factors (HIFs) and interferon regulatory factor 1 (IRF1) may stimulate iron acquisition in pro-inflammatory conditions. Mouse orthologous locus is generally conserved; chromatin patterns typify a de novo myelo-monocytic gene whose expression is tightly controlled by TFs Pu.1, C/ebps and Irf8; Irf3 and nuclear factor NF-kappa-B p 65 subunit (RelA) regulate expression in inflammatory conditions. Functional differences in the determinants identified at these orthologous loci imply that species-specific mechanisms control gene expression.

  5. Beta2-adrenergic receptor genotype affects the renin-angiotensin-aldosterone system response to the Dietary Approaches to Stop Hypertension (DASH) dietary pattern.

    PubMed

    Sun, Bei; Williams, Jonathan S; Svetkey, Laura P; Kolatkar, Nikheel S; Conlin, Paul R

    2010-08-01

    Beta(2)-adrenergic receptor (beta2-AR) is a susceptibility locus for hypertension, and polymorphisms at this site relate to salt sensitivity and low plasma renin activity (PRA). The Dietary Approaches to Stop Hypertension (DASH) dietary pattern lowers blood pressure and appears to interact with the renin-angiotensin-aldosterone system (RAAS). We hypothesized that the DASH diet associates with increased RAAS activity, and genotype status at beta2-AR G46A modifies this response. We genotyped participants in the DASH-Sodium study (n = 372) at beta2-AR G46A to determine the association with blood pressure, RAAS components, and consumption of the DASH diet. We used 2-way mixed linear regression and an additive model for all primary analyses. Mean (+/-SEM) PRA was significantly higher in participants in the DASH group than in participants in the control group (0.68 +/- 0.03 compared with 0.54 +/- 0.03 ng x mL(-1) x h(-1), P = 0.002). Serum aldosterone, urinary aldosterone, and urinary potassium concentrations were also significantly higher in the DASH group (P < 0.01 for all). We observed significant gene-diet interactions for changes in systolic blood pressure (SBP) and concentrations of aldosterone and urinary potassium (P for interaction = 0.048, 0.017, and 0.001 for SBP and aldosterone and urinary potassium concentrations, respectively). There was an association between the A allele of beta2-AR G46A and greater blood pressure reduction and blunted aldosterone and PRA responses to the DASH diet. Our results indicate that the DASH diet lowers blood pressure and increases PRA and aldosterone concentrations. There is an association between the G46A polymorphism of beta2-AR and blood pressure and RAAS responses to the DASH diet, which suggests that beta2-AR may be a genetic modifier of DASH-diet responsiveness. This trial was registered at clinicaltrials.gov as NCT00000608.

  6. Trans activation of plasmid-borne promoters by adenovirus and several herpes group viruses.

    PubMed Central

    Everett, R D; Dunlop, M

    1984-01-01

    This paper describes experiments to test the ability of a number of viruses of the Herpes group, and also Adenovirus-2 and SV40, to activate transcription from the Herpes simplex virus-1 glycoprotein D and the rabbit beta-globin promoters. Plasmids containing these genes were transfected into HeLa cells which were then infected with various viruses. Transcriptional activation in trans of the plasmid-borne promoters was monitored by quantitative S1 nuclease analysis of total cytoplasmic RNA isolated after infection. The results showed that Herpes simplex viruses 1 and 2, Pseudorabies virus, Variella Zoster virus, Human Cytomegalovirus, Equine herpes virus-1 and Adenovirus-2 activate transcription from both promoters tested. In contrast, SV40 did not activate transcription in trans in this assay. The possible mechanisms of this activation are discussed. Images PMID:6089105

  7. No detection of SV40 DNA in mesothelioma tissues from a high incidence area in Sweden.

    PubMed

    Lundstig, Annika; Dejmek, Annika; Eklund, Carina; Filinic, Ivo; Dillner, Joakim

    2007-01-01

    Simian virus 40 (SV40), a polyoma virus of the rhesus macaque was discovered in 1960 as a contaminant of human polio vaccines produced in monkey cells. A number of studies have reported the detection of SV40 nucleotide sequences in human tumors, mainly mesotheliomas, but the reports have not been consistent. The presence of SV40 in 26 consecutive cases of malignant mesothelioma of biphasic type was investigated using a SV40 quantitative real time polymerase chain reaction (PCR) with a sensitivity of 10 copies of viral DNA per sample. All the samples were also tested for amplifiability using a real-time PCR for the beta-globin gene. Eighteen tumors were amplifiable, but none contained SV40 DNA. The results do not support an association between mesothelioma and SV40.

  8. Arousal and Expression of Anger: A Function of Locus of Control?

    ERIC Educational Resources Information Center

    Stockin, Bruce C.

    Although psychologists have been investigating locus of control for more than two decades, few studies have examined how locus of control interacts with affective variables. To investigate the function of locus of control on arousal patterns and expressions of anger, 120 college students (60 internals, 60 externals, as measured by Rotter's (1966)…

  9. Locus of Control and Achievement of At-Risk Adolescent Black Males.

    ERIC Educational Resources Information Center

    Howerton, D. Lynn; And Others

    The relationship between locus of control and academic achievement was studied for 42 adolescent black males identified as at-risk by their teachers. The Nowicki-Strickland Locus of Control scale (NS-LOC) for children was used as a measure of locus of control. School grade average and the Stanford Achievement Test (SFAT) battery composite provided…

  10. External locus of control contributes to racial disparities in memory and reasoning training gains in ACTIVE.

    PubMed

    Zahodne, Laura B; Meyer, Oanh L; Choi, Eunhee; Thomas, Michael L; Willis, Sherry L; Marsiske, Michael; Gross, Alden L; Rebok, George W; Parisi, Jeanine M

    2015-09-01

    Racial disparities in cognitive outcomes may be partly explained by differences in locus of control. African Americans report more external locus of control than non-Hispanic Whites, and external locus of control is associated with poorer health and cognition. The aims of this study were to compare cognitive training gains between African American and non-Hispanic White participants in the Advanced Cognitive Training for Independent and Vital Elderly (ACTIVE) study and determine whether racial differences in training gains are mediated by locus of control. The sample comprised 2,062 (26% African American) adults aged 65 and older who participated in memory, reasoning, or speed training. Latent growth curve models evaluated predictors of 10-year cognitive trajectories separately by training group. Multiple group modeling examined associations between training gains and locus of control across racial groups. Compared to non-Hispanic Whites, African Americans evidenced less improvement in memory and reasoning performance after training. These effects were partially mediated by locus of control, controlling for age, sex, education, health, depression, testing site, and initial cognitive ability. African Americans reported more external locus of control, which was associated with smaller training gains. External locus of control also had a stronger negative association with reasoning training gain for African Americans than for Whites. No racial difference in training gain was identified for speed training. Future intervention research with African Americans should test whether explicitly targeting external locus of control leads to greater cognitive improvement following cognitive training. (c) 2015 APA, all rights reserved).

  11. Internal health locus of control predicts willingness to track health behaviors online and with smartphone applications.

    PubMed

    Bennett, Brooke L; Goldstein, Carly M; Gathright, Emily C; Hughes, Joel W; Latner, Janet D

    2017-12-01

    Given rising technology use across all demographic groups, digital interventions offer a potential strategy for increasing access to health information and care. Research is lacking on identifying individual differences that impact willingness to use digital interventions, which may affect patient engagement. Health locus of control, the amount of control an individual believes they have over their own health, may predict willingness to use mobile health (mHealth) applications ('apps') and online trackers. A cross-sectional study (n = 276) was conducted to assess college students' health locus of control beliefs and willingness to use health apps and online trackers. Internal and powerful other health locus of control beliefs predicted willingness to use health apps and online trackers while chance health locus of control beliefs did not. Individuals with internal and powerful other health locus of control beliefs are more willing than those with chance health locus of control beliefs to utilize a form of technology to monitor or change health behaviors. Health locus of control is an easy-to-assess patient characteristic providers can measure to identify which patients are more likely to utilize mHealth apps and online trackers.

  12. Understanding the kinetics of ligand binding to globins with molecular dynamics simulations: the necessity of multiple state models.

    PubMed

    Estarellas Martin, Carolina; Seira Castan, Constantí; Luque Garriga, F Javier; Bidon-Chanal Badia, Axel

    2015-10-01

    Residue conformational changes and internal cavity migration processes play a key role in regulating the kinetics of ligand migration and binding events in globins. Molecular dynamics simulations have demonstrated their value in the study of these processes in different haemoglobins, but derivation of kinetic data demands the use of more complex techniques like enhanced sampling molecular dynamics methods. This review discusses the different methodologies that are currently applied to study the ligand migration process in globins and highlight those specially developed to derive kinetic data. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Bergamot (Citrus bergamia Risso) fruit extracts as γ-globin gene expression inducers: phytochemical and functional perspectives.

    PubMed

    Guerrini, Alessandra; Lampronti, Ilaria; Bianchi, Nicoletta; Zuccato, Cristina; Breveglieri, Giulia; Salvatori, Francesca; Mancini, Irene; Rossi, Damiano; Potenza, Rocco; Chiavilli, Francesco; Sacchetti, Gianni; Gambari, Roberto; Borgatti, Monica

    2009-05-27

    Epicarps of Citrus bergamia fruits from organic farming were extracted with the objective of obtaining derived products differently rich in coumarins and psoralens. The extracts were chemically characterized by (1)H nuclear magnetic resonance (NMR), gas chromatography-flame ionization detection (GC-FID), gas chromatography-mass spectrometry (GC-MS), and high-pressure liquid chromatography (HPLC) for detecting and quantifying the main constituents. Both bergamot extracts and chemical standards corresponding to the main constituents detected were then assayed for their capacity to increase erythroid differentiation of K562 cells and expression of γ-globin genes in human erythroid precursor cells. Three experimental cell systems were employed: (a) the human leukemic K562 cell line, (b) K562 cell clones stably transfected with a pCCL construct carrying green-enhanced green fluorescence protein (EGFP) under the γ-globin gene promoter, and (c) the two-phase liquid culture of human erythroid progenitors isolated from healthy donors. The results suggest that citropten and bergapten are powerful inducers of differentiation and γ-globin gene expression in human erythroid cells. These data could have practical relevance, because pharmacologically mediated regulation of human γ-globin gene expression, with the consequent induction of fetal hemoglobin, is considered to be a potential therapeutic approach in hematological disorders, including β-thalassemia and sickle cell anemia.

  14. Running, swimming and diving modifies neuroprotecting globins in the mammalian brain

    PubMed Central

    Williams, Terrie M; Zavanelli, Mary; Miller, Melissa A; Goldbeck, Robert A; Morledge, Michael; Casper, Dave; Pabst, D. Ann; McLellan, William; Cantin, Lucas P; Kliger, David S

    2007-01-01

    The vulnerability of the human brain to injury following just a few minutes of oxygen deprivation with submergence contrasts markedly with diving mammals, such as Weddell seals (Leptonychotes weddellii), which can remain underwater for more than 90 min while exhibiting no neurological or behavioural impairment. This response occurs despite exposure to blood oxygen levels concomitant with human unconsciousness. To determine whether such aquatic lifestyles result in unique adaptations for avoiding ischaemic–hypoxic neural damage, we measured the presence of circulating (haemoglobin) and resident (neuroglobin and cytoglobin) oxygen-carrying globins in the cerebral cortex of 16 mammalian species considered terrestrial, swimming or diving specialists. Here we report a striking difference in globin levels depending on activity lifestyle. A nearly 9.5-fold range in haemoglobin concentration (0.17–1.62 g Hb 100 g brain wet wt−1) occurred between terrestrial and deep-diving mammals; a threefold range in resident globins was evident between terrestrial and swimming specialists. Together, these two globin groups provide complementary mechanisms for facilitating oxygen transfer into neural tissues and the potential for protection against reactive oxygen and nitrogen groups. This enables marine mammals to maintain sensory and locomotor neural functions during prolonged submergence, and suggests new avenues for averting oxygen-mediated neural injury in the mammalian brain. PMID:18089537

  15. Regional localization of the human integrin {beta}{sub 6} gene (ITGB6) to chromosome 2q24-q31

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fernandez-Ruiz, E.; Sanchez-Madrid, F.

    The heterodimer {alpha}{sub v}{beta}{sub 6} acts as a fibronectin receptor for human carcinoma cells. The authors report here the regional localization of the {beta}{sub 6} gene to 2q24-q31 by fluorescence in situ hybridization coupled with GTG-banding. This gene is located close to the region to which genes coding for the {alpha} subunits of the integrins VLA-4 and vitronectin receptor (ITGA4 and ITGAV, respectively) have been previously mapped (2q31-q32). These data suggest a proximal position of the integrin {beta}{sub 6} locus (ITGB6) on this integrin gene cluster. Futhermore, double-labeling in situ hybridization experiments performed with {alpha}{sub 4} and {alpha}{sub v} probesmore » indicated a telomeric position of ITGAV with respect to ITGA4. 22 refs., 2 figs.« less

  16. Self concepts, health locus of control and cognitive functioning associated with health-promoting lifestyles in schizophrenia.

    PubMed

    Chuang, Shu Ping; Wu, Jo Yung Wei; Wang, Chien Shu; Liu, Chia Hsuan; Pan, Li Hsiang

    2016-10-01

    The study aimed to investigate the relationship among self concepts, health locus of control, cognitive functioning and health-promoting lifestyles in patients diagnosed with schizophrenia. We examined health-promoting lifestyles through self-efficacy, self-esteem, health locus of control and neurocognitive factors. Fifty-six people with schizophrenia were enrolled in the study group. All subjects participated in the self-esteem (Rosenberg Self-Esteem Scale), self-efficacy (General Self-Efficacy Scale), health locus of control (The Multidimensional Health Locus of Control Scales), health-promoting lifestyles (Health Promotion Life-style Profile-II) and a series of neurocognitive measures. Stepwise regression analysis revealed that self-efficacy, internal health locus of control and attentional set-shifting accounted for 42% of the variance in total health-promoting lifestyles scores. Self-efficacy, self-esteem, internal and powerful others health locus of control and attentional set-shifting were significant predictors for domains of health-promoting lifestyles, respectively. Study findings can help mental health professionals maintain and improve health-promoting behaviors through a better understanding of self-esteem, self-efficacy, health locus of control and neurocognitive functioning among people with schizophrenia. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Hemoglobin adducts as biomarkers of 1,3-butadiene in occupationally low exposed Italian workers and a few diesel-exposed miners.

    PubMed

    Begemann, P; Upton, P B; Ranasinghe, A; Swenberg, J A; Soleo, L; Vimercati, L; Gelormini, A; Fustinoni, S; Zwirner-Baier, I; Neumann, H G

    2001-06-01

    Hemoglobin adducts were determined as biomarkers of 1,3-butadiene (BD) in 30 workers and 10 controls from an Italian BD plant and in 14 diesel-exposed miners. N-(2,3,4-trihydroxybutyl)valine (THBVal), an N-terminal valine globin adduct of reactive butadiene metabolites, was analyzed by gas chromatography/high resolution mass spectrometry after a modified Edman degradation and further acetylation. The BD exposure for the plant workers was 31 microg/m(3) (personal sampling). Whereas there was no detectable difference in hemoglobin adduct levels (range 17.7-61.4 pmol/g globin) between the total group of exposed and controls, slight but significant differences could be found between two subgroups of workers from different production units as well as one subgroup and controls (P<0.05), between smoking (n=13) and non-smoking exposed workers (n=17; P=0.066) as well as between smoking exposed workers and controls (P=0.055). Adduct levels of the miners (all non-smokers) were in the same range as those of the Italian BD-workers and controls. The internal exposure and strain measured by THBVal levels resulting from a very low occupational BD exposure was in the range of the contribution of moderate smoking.

  18. Erythropoiesis from Human Embryonic Stem Cells Through Erythropoietin-Independent AKT Signaling

    PubMed Central

    Kim, William S.; Zhu, Yuhua; Deng, Qiming; Chin, Chee Jia; He, Chong Bin; Grieco, Amanda J.; Dravid, Gautam G.; Parekh, Chintan; Hollis, Roger P.; Lane, Timothy F.; Bouhassira, Eric E.; Kohn, Donald B.; Crooks, Gay M.

    2014-01-01

    Unlimited self renewal capacity and differentiation potential make human pluripotent stem cells (PSC) a promising source for the ex vivo manufacture of red blood cells (RBC) for safe transfusion. Current methods to induce erythropoiesis from PSC suffer from low yields of RBCs, most of which are immature and contain embryonic and fetal rather than adult hemoglobins. We have previously shown that homo-dimerization of the intracellular component of MPL (ic-MPL) induces erythropoiesis from human cord blood progenitors. The goal of the present study was to investigate the potential of ic-MPL dimerization to induce erythropoiesis from human embryonic stem cells (hESC) and to identify the signaling pathways activated by this strategy. We present here evidence that ic-MPL dimerization induces erythropoietin (EPO)-independent erythroid differentiation from hESC by inducing the generation of erythroid progenitors and by promoting more efficient erythroid maturation with increased RBC enucleation as well as increased gamma:epsilon globin ratio and production of beta-globin protein. ic-MPL dimerization is significantly more potent than EPO in inducing erythropoiesis and its effect is additive to EPO. Signaling studies show that dimerization of ic-MPL, unlike stimulation of the wild type MPL receptor, activates AKT in the absence of JAK2/STAT5 signaling. AKT activation upregulates the GATA-1 and FOXO3 transcriptional pathways with resulting inhibition of apoptosis, modulation of cell cycle and enhanced maturation of erythroid cells. These findings open up potential new targets for the generation of therapeutically relevant RBC products from hPSC. PMID:24677652

  19. β-Globin chain abnormalities with coexisting α-thalassemia mutations

    PubMed Central

    Canataroglu, Abdullah; Unsal, Cagatay; Yildiz, Sule Menziletoglu; Turhan, Ferda Tekin; Bozdogan, Sevcan Tug; Dincer, Suleyman; Erkman, Hakan

    2012-01-01

    Introduction The frequency of hemoglobinopathies is still high in Adana, the biggest city of the Cukurova Region that is located in the southern part of Turkey. Our aim was to identify the concomitant mutations in α- and β-globin genes which lead to complex hemoglobinopathies and to establish an appropriate plan of action for each subject, particularly when prenatal diagnosis is necessary. Material and methods We studied the association between the β-globin gene and α-thalassemia genotypes. The reverse hybridization technique was employed to perform molecular analysis, and the results were confirmed by amplification refractory mutation system (ARMS) or restriction fragment length polymorphism (RFLP) technique. Results We evaluated 36 adult subjects (28 female and 8 male; age range: 18-52 years) with concomitant mutations in their α- and β-globin genes. The –α3.7/αα deletion was the commonest defect in the α-chain as expected, followed by α3.7/–α3.7 deletion. Twenty-five of 36 cases were sickle cell trait with coexisting α-thalassemia, while seven Hb S/S patients had concurrent mutations in their α-genes. The coexistence of αPolyA-2α/αα with Hb A/D and with Hb S/D, which is very uncommon, was also detected. There was a subject with compound heterozygosity for β-globin chain (–α3.7/αα with IVSI.110/S), and also a case who had –α3.7/αα deletion with IVSI.110/A. Conclusions Although limited, our data suggest that it would be valuable to study coexisting α-globin mutations in subjects with sickle cell disease or β-thalassemia trait during the screening programs for premarital couples, especially in populations with a high frequency of hemoglobinopathies. PMID:23056075

  20. Protein adducts as biomarkers of exposure to aromatic diisocyanates in workers manufacturing polyurethane (PUR) foam.

    PubMed

    Säkkinen, Kirsi; Tornaeus, Jarkko; Hesso, Antti; Hirvonen, Ari; Vainio, Harri; Norppa, Hannu; Rosenberg, Christina

    2011-04-01

    This work was undertaken to investigate the usefulness of diisocyanate-related protein adducts in blood samples as biomarkers of occupational exposure to toluene diisocyanate (TDI; 2,4- and 2,6-isomers) and 4,4'-methylenediphenyl diisocyanate (MDI). Quantification of adducts as toluene diamines (TDAs) and methylenedianiline (MDA) was performed on perfluoroacylated derivatives by gas chromatography-mass spectrometry (GC-MS/MS) in negative chemical ionisation mode. TDI-derived adducts were found in 77% of plasma and in 59% of globin samples from exposed workers manufacturing flexible polyurethane foam. The plasma levels ranged from 0.003 to 0.58 nmol mL(-1) and those in globin from 0.012 to 0.33 nmol g(-1). The 2,6-isomer amounted to about two-thirds of the sum concentration of TDA isomers. MDI-derived adducts were detected in 3.5% of plasma and in 7% of globin samples from exposed workers manufacturing rigid polyurethane foam. A good correlation was found between the sum of TDA isomers in urine and that in plasma. The relationship between globin adducts and urinary metabolites was ambiguous. Monitoring TDI-derived TDA in plasma thus appears to be an appropriate method for assessing occupational exposure. Contrary to TDI exposure, adducts in plasma or globin were not useful in assessing workers' exposure to MDI. An important outcome of the study was that no amine-related adducts were detected in globin samples from TDI- or MDI-exposed workers, alleviating concerns that TDI or MDI might pose a carcinogenic hazard. Further studies are nevertheless required to judge whether diisocyanates per se could be such a hazard.

  1. Screening of (-SEA) α-thalassaemia using an immunochromatographic strip assay for the ζ-globin chain in a population with a high prevalence and heterogeneity of haemoglobinopathies.

    PubMed

    Jomoui, Wittaya; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan

    2017-01-01

    The presence of the ζ-globin chain is a good marker of (-- SEA ) α 0 -thalassaemia. We evaluated an immunochromatographic (IC) strip assay for ζ-globin in screening for (-- SEA ) α 0 -thalassaemia in a population with a high prevalence and heterogeneity of haemoglobinopathies. The study was carried out on 300 screen positive blood samples of Thai individuals. The IC strip assay for the ζ-globin chain was performed on all samples. The results were interpreted with thalassaemia genotyping using standard haemoglobin and DNA analyses. Several thalassaemia genotypes were noted. Among the 300 subjects investigated, 79 had a positive IC strip assay for ζ-globin and (-- SEA ) α 0 -thalassaemia was identified in 40 of them. No (-- SEA ) α 0 -thalassaemia was detected in the remaining 39 samples with a positive IC strip test result or in the 221 samples with a negative IC strip test result. Further DNA analysis identified α + -thalassaemia in 25 of the 39 (-- SEA ) α 0 -thalassaemia negative samples. Using this IC strip assay in combination with a conventional screening protocol for (-- SEA ) α 0 -thalassaemia could provide sensitivity and specificity of 100% and 90.4%, respectively. IC strip assay for ζ-globin is simple, rapid and does not require sophisticated equipment. Use of this test in addition to the existing screening protocol could detect potential (-- SEA ) α 0 -thalassaemia leading to a significant reduction in the workload of DNA analysis. This could be used in areas where haemoglobinopathies are prevalent and heterogeneous but molecular testing is not available. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  2. Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

    PubMed Central

    Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

    2012-01-01

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

  3. Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

    PubMed

    Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

    2012-11-02

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

  4. Next generation tools for high-throughput promoter and expression analysis employing single-copy knock-ins at the Hprt1 locus.

    PubMed

    Yang, G S; Banks, K G; Bonaguro, R J; Wilson, G; Dreolini, L; de Leeuw, C N; Liu, L; Swanson, D J; Goldowitz, D; Holt, R A; Simpson, E M

    2009-03-01

    We have engineered a set of useful tools that facilitate targeted single copy knock-in (KI) at the hypoxanthine guanine phosphoribosyl transferase 1 (Hprt1) locus. We employed fine scale mapping to delineate the precise breakpoint location at the Hprt1(b-m3) locus allowing allele specific PCR assays to be established. Our suite of tools contains four targeting expression vectors and a complementing series of embryonic stem cell lines. Two of these vectors encode enhanced green fluorescent protein (EGFP) driven by the human cytomegalovirus immediate-early enhancer/modified chicken beta-actin (CAG) promoter, whereas the other two permit flexible combinations of a chosen promoter combined with a reporter and/or gene of choice. We have validated our tools as part of the Pleiades Promoter Project (http://www.pleiades.org), with the generation of brain-specific EGFP positive germline mouse strains.

  5. Molecular basis of maple syrup urine disease: Novel mutations at the E1[alpha] locus that impair E1([alpha][sub 2][beta][sub 2]) assembly or decrease steady-state E1[alpha] mRNA levels of branched-chain [alpha]-keto acid dehydrogenase complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chuang, J.L.; Fisher, C.R.; Chuang, D.T.

    1994-08-01

    The authors report the occurrence of three novel mutations in the E1[alpha] (BCKDHA) locus of the branched-chain [alpha]-keto acid dehydrogenase (BCKAD) complex that cause maple syrup urine disease (MSUD). An 8-bp deletion in exon 7 is present in one allele of a compound-heterozygous patient (GM-649). A single C nucleotide insertion in exon 2 occurs in one allele of an intermediate-MSUD patient (Lo). The second allele of patient Lo carries an A-to-G transition in exon 9 of the E1[alpha] gene. This missense mutation changes Tyr-368 to Cys (Y368C) in the E1[alpha] subunit. Both the 8-bp deletion and the single C insertionmore » generate a downstream nonsense codon. Both mutations appear to be associated with a low abundance of the mutant E1[alpha] mRNA, as determined by allele-specific oligonucleotide probing. Transfection studies strongly suggest that the Y368C substitution in the E1[alpha] subunit impairs its proper assembly with the normal E1[beta]. Unassembled as well as misassembled E1[alpha] and E1[beta] subunits are degraded in the cell. 32 refs., 8 figs.« less

  6. Nuclear-Cytoplasmic Conflict in Pea (Pisum sativum L.) Is Associated with Nuclear and Plastidic Candidate Genes Encoding Acetyl-CoA Carboxylase Subunits

    PubMed Central

    Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.

    2015-01-01

    In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472

  7. Relationships between locus of control and paranormal beliefs.

    PubMed

    Newby, Robert W; Davis, Jessica Boyette

    2004-06-01

    The present study investigated the associations between scores on paranormal beliefs, locus of control, and certain psychological processes such as affect and cognitions as measured by the Linguistic Inquiry and Word Count. Analysis yielded significant correlations between scores on Locus of Control and two subscales of Tobacyk's (1988) Revised Paranormal Beliefs Scale, New Age Philosophy and Traditional Paranormal Beliefs. A step-wise multiple regression analysis indicated that Locus of Control was significantly related to New Age Philosophy. Other correlations were found between Tobacyk's subscales, Locus of Control, and three processes measured by the Linguistic Inquiry and Word Count.

  8. Elements in the murine c-mos messenger RNA 5'-untranslated region repress translation of downstream coding sequences.

    PubMed

    Steel, L F; Telly, D L; Leonard, J; Rice, B A; Monks, B; Sawicki, J A

    1996-10-01

    Murine c-mos transcripts isolated from testes have 5'-untranslated regions (5'UTRs) of approximately 300 nucleotides with a series of four overlapping open reading frames (ORFs) upstream of the AUG codon that initiates the Mos ORF. Ovarian c-mos transcripts have shorter 5'UTRs (70-80 nucleotides) and contain only 1-2 of the upstream ORFs (uORFs). To test whether these 5'UTRs affect translational efficiency, we have constructed plasmids for the expression of chimeric transcripts with a mos-derived 5'UTR fused to the Escherichia coli beta-galactosidase coding region. Translational efficiency has been evaluated by measuring beta-galactosidase activity NIH3T3 cells transiently transfected with these plasmids and with plasmids where various mutations have been introduced into the 5'UTR. We show that the 5'UTR characteristic of testis-specific c-mos mRNA strongly represses translation relative to the translation of transcripts that contain a 5'UTR derived from beta-globin mRNA, and this is mainly due to the four uORFs. Each of the four upstream AUG triplets can be recognized as a start site for translation, and no single uAUG dominates the repressive effect. The uORFs repress translation by a mechanism that is not affected by the amino acid sequence in the COOH-terminal region of the uORF-encoded peptides. The very short uORF (AUGUGA) present in ovary-specific transcripts does not repress translation. Staining of testis sections from transgenic mice carrying chimeric beta-galactosidase transgene constructs, which contain a mos 5'UTR with or without the uATGs, suggests that the uORFs can dramatically change the pattern of expression in spermatogenic cells.

  9. Novel mutations responsible for α-thalassemia in Iranian families.

    PubMed

    Bayat, Nooshin; Farashi, Samaneh; Hafezi-Nejad, Nima; Faramarzi, Negin; Ashki, Mehri; Vakili, Shadi; Imanian, Hashem; Khosravi, Mohsen; Azar-Keivan, Azita; Najmabadi, Hossein

    2013-01-01

    α-Thalassemia (α-thal) is usually caused by deletions on the α-globin gene cluster and the role of point mutations is less well investigated. In the present study, a total of 1048 individuals with hypochromic microcytic anemia, who did not present the most common α-thal deletions, were referred for α-globin gene DNA sequencing. The nucleotide changes were studied and a total of five new mutations was identified, of which three were located on the α2 gene [codon7 (Lys→Stop), codon 34 (Leu→Pro) and codon 83 (Leu→Arg)] and two on the α1 gene [IVS-I-116 (A>G) and codon 44 (+C)]. These novel mutations not only explain new findings by molecular analysis of the α-globin gene but also have clinical importance due to their changes in α-globin production in means of decreased hemoglobin (Hb) related values. Moreover, considerations of its role in combination with other mutations, and the possibility of causing Hb H (β4) are yet to be studied.

  10. HPLC-ESI-MS/MS analysis of hemoglobin peptides in tryptic digests of dried-blood spot extracts detects HbS, HbC, HbD, HbE, HbO-Arab, and HbG-Philadelphia mutations.

    PubMed

    Haynes, Christopher A; Guerra, Stephanie L; Fontana, Jessalyn C; DeJesús, Víctor R

    2013-09-23

    Hemoglobinopathies are mutations resulting in abnormal globin chain structure; some have clinically significant outcomes such as anemia or reduced lifespan. Five β-globin mutations are (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), and (c.364G>A, p.E121K), resulting in HbS (sickle-cell hemoglobin), HbC, HbE, HbD-Los Angeles, and HbO-Arab, respectively. One α-globin mutation is (c.[207C>G or 207C>A], p.N68K), resulting in HbG-Philadelphia. HPLC-ESI-MS/MS analysis of dried-blood spot (DBS) punches from newborns extracted with a trypsin-containing solution provides greater than 90% coverage of α-, β-, and γ-globin amino acid sequences. Because the (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), (c.364G>A, p.E121K), and (c.[207C>G or 207C>A], p.N68K) mutations generate globin peptides with novel amino acid sequences, detecting one of these peptides in DBS extracts is indicative of the presence of a hemoglobinopathy in the newborn. The method described here can distinguish normal β-globin peptides from the mutant HbS, HbC, HbE, HbD-Los Angeles and HbO-Arab peptides, as well as normal α-globin peptide from the mutant HbG-Philadelphia peptide, allowing the identification of unaffected heterozygotes such as HbAS, and of compound heterozygotes such as HbASG-Philadelphia. This HPLC-ESI-MS/MS analytical approach provides information that is not available from traditional hemoglobin analyses such as isoelectric focusing and HPLC-UV. It is also capable of determining the amino acid sequence of hemoglobin peptides, potentially allowing the detection of numerous hemoglobinopathies resulting from point mutations. Published by Elsevier B.V.

  11. Role of α-globin H helix in the building of tetrameric human hemoglobin: interaction with α-hemoglobin stabilizing protein (AHSP) and heme molecule.

    PubMed

    Domingues-Hamdi, Elisa; Vasseur, Corinne; Fournier, Jean-Baptiste; Marden, Michael C; Wajcman, Henri; Baudin-Creuza, Véronique

    2014-01-01

    Alpha-Hemoglobin Stabilizing Protein (AHSP) binds to α-hemoglobin (α-Hb) or α-globin and maintains it in a soluble state until its association with the β-Hb chain partner to form Hb tetramers. AHSP specifically recognizes the G and H helices of α-Hb. To investigate the degree of interaction of the various regions of the α-globin H helix with AHSP, this interface was studied by stepwise elimination of regions of the α-globin H helix: five truncated α-Hbs α-Hb1-138, α-Hb1-134, α-Hb1-126, α-Hb1-123, α-Hb1-117 were co-expressed with AHSP as two glutathione-S-transferase (GST) fusion proteins. SDS-PAGE and Western Blot analysis revealed that the level of expression of each truncated α-Hb was similar to that of the wild type α-Hb except the shortest protein α-Hb1-117 which displayed a decreased expression. While truncated GST-α-Hb1-138 and GST-α-Hb1-134 were normally soluble; the shorter globins GST-α-Hb1-126 and GST-α-Hb1-117 were obtained in very low quantities, and the truncated GST-α-Hb1-123 provided the least material. Absorbance and fluorescence studies of complexes showed that the truncated α-Hb1-134 and shorter forms led to modified absorption spectra together with an increased fluorescence emission. This attests that shortening the H helix leads to a lower affinity of the α-globin for the heme. Upon addition of β-Hb, the increase in fluorescence indicates the replacement of AHSP by β-Hb. The CO binding kinetics of different truncated AHSPWT/α-Hb complexes showed that these Hbs were not functionally normal in terms of the allosteric transition. The N-terminal part of the H helix is primordial for interaction with AHSP and C-terminal part for interaction with heme, both features being required for stability of α-globin chain.

  12. Characterization of Homozygous Hb Setif (HBA2: c.283G>T) in the Iranian Population.

    PubMed

    Farashi, Samaneh; Garous, Negin F; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

    2016-01-01

    Hemoglobin (Hb) variants are abnormalities resulting from point mutations in either of the two α-globin genes (HBA2 or HBA1) or the β-globin gene (HBB). Various reports of Hb variants have been described in Iran and other countries around the world. Hb Setif (or HBA2: c.283G>T) is one of these variants with a mutation at codon 94 of of the α2-globin gene that is characterized in clinically normal heterozygous individuals. We here report clinical and hematological findings in two homozygous cases of Iranian origin for this unstable Hb variant.

  13. The Impact of Locus of Control on Language Achievement

    ERIC Educational Resources Information Center

    Nodoushan, Mohammad Ali Salmani

    2012-01-01

    This study hypothesized that students' loci of control affected their language achievement. 198 (N = 198) EFL students took the Rotter's (1966) locus of control test and were classified as locus-internal (ni = 78), and locus-external (ne = 120). They then took their ordinary courses and at the end of the semester, they were given their exams.…

  14. Reframing Student Affairs Leadership: An Analysis of Organizational Frames of Reference and Locus of Control

    ERIC Educational Resources Information Center

    Tull, Ashley; Freeman, Jerrid P.

    2011-01-01

    Examined in this study were the identified frames of reference and locus of control used by 478 student affairs administrators. Administrator responses were examined to identify frames of reference most commonly used and their preference order. Locus of control most commonly used and the relationship between frames of reference and locus of…

  15. On the Relation of Locus of Control and L2 Reading and Writing Achievement

    ERIC Educational Resources Information Center

    Ghonsooly, Behzad; Shirvan, Majid Elahi

    2011-01-01

    Locus of control, a psychological construct, has been the focus of attention in recent decades. Psychologists have discussed the effect of locus of control on achieving life goals in social/psychological interactions. While learning a foreign language involves both social interactions and psychological processes, the role and relation of locus of…

  16. EXPERIMENTAL STUDIES IN ACUTE RENAL FAILURE

    PubMed Central

    Menefee, Max G.; Mueller, C. Barber; Miller, Tracy B.; Myers, Joseph K.; Bell, Allen L.

    1964-01-01

    When purified human globin is injected intravenously into rats it produces acute renal failure characterized by tubular casts and oliguria. The globin is identifiable within vesicles and channels in the cytoplasm of the proximal tubules, through which it passes from lumen to basal side with no apparent serious effect on the cells. When a very minimal amount of globin is taken up by cells of the distal limb of Henle's loop or distal tubules (lower nephron), a markedly deleterious effect is apparent and the cells die within a short time. The mixture of cell debris and precipitated globin forms plugs within the confines of the basement membranes of the former distal limbs and distal tubules. After a number of lower nephrons are plugged a disruption of proximal tubules is found, which apparently results from the effect of back pressure in the obstructed nephrons. We suggest that any amount in excess of a low threshold of globin, either alone or combined with heme or related material, has a toxic effect on lower nephron cells. Once initiated, the toxic effect is not reversible and the resulting plug of debris and precipitate will occlude the lumen. If a sufficient number of nephrons are made non-functional the animal becomes anuric; otherwise it is oliguric. A high rate of urine flow will protect against the excess absorption of material and thus against acute renal failure. PMID:14238931

  17. MBD2 is a critical component of a methyl cytosine-binding protein complex isolated from primary erythroid cells

    PubMed Central

    Kransdorf, Evan P.; Wang, Shou Zhen; Zhu, Sheng Zu; Langston, Timothy B.; Rupon, Jeremy W.; Ginder, Gordon D.

    2006-01-01

    The chicken embryonic β-type globin gene, ρ, is a member of a small group of vertebrate genes whose developmentally regulated expression is mediated by DNA methylation. Previously, we have shown that a methyl cytosine-binding complex binds to the methylated ρ-globin gene in vitro. We have now chromatographically purified and characterized this complex from adult chicken primary erythroid cells. Four components of the MeCP1 transcriptional repression complex were identified: MBD2, RBAP48, HDAC2, and MTA1. These 4 proteins, as well as the zinc-finger protein p66 and the chromatin remodeling factor Mi2, were found to coelute by gel-filtration analysis and pull-down assays. We conclude that these 6 proteins are components of the MeCPC. In adult erythrocytes, significant enrichment for MBD2 is seen at the inactive ρ-globin gene by chromatin immunoprecipitation assay, whereas no enrichment is observed at the active βA-globin gene, demonstrating MBD2 binds to the methylated and transcriptionally silent ρ-globin gene in vivo. Knock-down of MBD2 resulted in up-regulation of a methylated ρ-gene construct in mouse erythroleukemic (MEL)-ρ cells. These results represent the first purification of a MeCP1-like complex from a primary cell source and provide support for a role for MBD2 in developmental gene regulation. PMID:16778143

  18. Effectiveness of teaching cognitive-behavioral techniques on locus of control in hemodialysis patients.

    PubMed

    Mehrtak, Mohammad; Habibzadeh, Shahram; Farzaneh, Esmaeil; Rjaei-Khiavi, Abdollah

    2017-10-01

    Many of the cognitive behavioral models and therapeutic protocols developed so far for psychological disorders and chronic diseases have proved effective through clinical research. This study aimed to determine the effectiveness of teaching cognitive-behavioral techniques on locus of control in hemodialysis patients. This controlled clinical trial study was conducted in 2015 with 76 patients selected by census and treated with a hemodialysis machine in the dialysis department of Vali-Asr Hospital in the city of Meshkinshahr. A total of four patients were excluded because of their critical conditions while the rest, who were recruited, were randomly divided into two equal groups of 36 patients as the intervention and control groups. First, the locus of control was measured in both groups through a pretest, and cognitive-behavioral techniques were then taught to the intervention group during eight 45 to 90-minute sessions. The locus of control in patients of both groups was finally re-measured through a posttest. Data were collected using Rotter's Locus of Control Inventory. The Wilcoxon test and Mann-Whitney U test were respectively used in SPSS18 for data analysis. In the pretest and posttest stages respectively, 4.8% and 14.3% of samples in the control group as well as 14.3% and 33.3% of samples in the intervention group enjoyed internal locus of control. The difference between the pretest and posttest scores of internal locus of control in the intervention group was significant (p=0.004), which indicates the positive effect of cognitive-behavioral psychotherapeutic intervention on internalization of locus of control in this group. Given the external locus of control in most of the study patients and also the positive significant effect of cognitive-behavioral psychotherapy on internalization of locus of control in this group of patients, it appears necessary to have a psychology resident present in the hemodialysis department to teach the necessary cognitive-behavioral techniques to internalize the locus of control. The trial was registered at the Thai Clinical Trial Registry (http://www.clinicaltrials.in.th) with the TCTID: TCTR20170707003. The authors received no financial support for the research, authorship, and/or publication of this article.

  19. Locus of control and peer relationships among Caucasian, Hispanic, Asian, and African American adolescents.

    PubMed

    Kang, Hannah Soo; Chang, Kyle Edward; Chen, Chuansheng; Greenberger, Ellen

    2015-01-01

    Past research has shown that locus of control plays an important role in a wide range of behaviors, such as academic achievement and positive social behaviors. However, little is known about whether locus of control plays the same role in minority adolescents' peer relationships. The current study examined ethnic differences in the associations between locus of control and peer relationships in early adolescence using samples from the Early Childhood Longitudinal Study (ECLS-K: 5,612 Caucasian, 1,562 Hispanic, 507 Asian, and 908 African-American adolescents) and the National Education Longitudinal Study (NELS: 8,484 Caucasian, 1,604 Hispanic, and 860 Asian, and 1,228 African American adolescents). Gender was approximately evenly split in both samples. The results from the two datasets were highly consistent. Significant interactions between ethnicity and locus of control indicated that having a more internal locus of control was particularly important for Caucasian students' peer relationships (ECLS-K) and social status (NELS), but less so for Asian, Hispanic, and African American students. Our findings suggest that the role of locus of control in peer relationship is contingent upon culture.

  20. Neurolinguistic programming training, trait anxiety, and locus of control.

    PubMed

    Konefal, J; Duncan, R C; Reese, M A

    1992-06-01

    Training in the neurolinguistic programming techniques of shifting perceptual position, visual-kinesthetic dissociation, timelines, and change-history, all based on experiential cognitive processing of remembered events, leads to an increased awareness of behavioral contingencies and a more sensitive recognition of environmental cues which could serve to lower trait anxiety and increase the sense of internal control. This study reports on within-person and between-group changes in trait anxiety and locus of control as measured on the Spielberger State-Trait Anxiety Inventory and Wallston, Wallston, and DeVallis' Multiple Health Locus of Control immediately following a 21-day residential training in neurolinguistic programming. Significant with-in-person decreases in trait-anxiety scores and increases in internal locus of control scores were observed as predicted. Chance and powerful other locus of control scores were unchanged. Significant differences were noted on trait anxiety and locus of control scores between European and U.S. participants, although change scores were similar for the two groups. These findings are consistent with the hypothesis that this training may lower trait-anxiety scores and increase internal locus of control scores. A matched control group was not available, and follow-up was unfortunately not possible.

  1. Correlations between oxygen affinity and sequence classifications of plant hemoglobins

    USDA-ARS?s Scientific Manuscript database

    Plants express three phylogenetic classes of hemoglobins (Hb) based on sequence analyses. Class 1 and 2 Hbs are full length globins with the classical 8 helix Mb-like fold, whereas Class 3 plant Hbs resemble the truncated globins found in bacteria. With the exception of the specialized leghemoglobin...

  2. A Study of Reward Preference in Taiwanese Gifted and Nongifted Students with Differential Locus of Control

    ERIC Educational Resources Information Center

    Wu, Su Chen; Elliott, Robert T.

    2008-01-01

    The purpose of the study was to investigate whether gifted and nongifted students' preferences for different types of reward were affected by differential locus of control. In total, 181 gifted and 107 nongifted junior high school students in Taiwan participated. The Nowicki-Strickland Locus of Control Scale was used as a measure of locus of…

  3. The Effects of Religion and Locus of Control on Perception of Mental Illness.

    PubMed

    Amedome, Sedem Nunyuia; Bedi, Innocent Kwame

    2018-06-23

    The study investigated the influence of religion and locus of control on perception of mental illness. Specifically, the study explored the relationship between religiosity and perception of mental illness, differences in perception by internals and externals, the effect of knowledge on perception of mental illness and the interactive effect of religiosity and locus of control on perception of mental illness. Data were collected from 200 participants in the Volta Region of Ghana. Three hypotheses were tested in the study using a battery of tests. It was observed that people with internal locus of control perceive mental patients positively than those with external locus of control. A significant interactive effect between religiosity and locus of control on perception of mental illness was observed. Religiosity significantly relates to perception of mental illness. The results and implications are discussed for further studies.

  4. Removal of inhibitor(s) of the polymerase chain reaction from formalin fixed, paraffin wax embedded tissues.

    PubMed

    An, S F; Fleming, K A

    1991-11-01

    A problem associated with use of the polymerase chain reaction to amplify specific DNA fragments from formalin fixed, paraffin wax embedded tissues is the not infrequent failure of amplification. One possible reason for this could be the presence of inhibitor(s), which interfere with the activity of the reaction. It has been shown that such inhibitor(s) exist when amplifying the human beta globin gene (which exists in human genomic DNA as a single copy gene) from routine clinical samples. A variety of methods to remove such inhibitor(s) were investigated. The results indicate that inhibitor(s) are removed by proteinase K digestion, followed by purification with phenol/chloroform, and centrifugation through a Centricon-30 membrane (30,000 molecular weight cut off). Other factors, including the length and concentration of the DNA sequence to be amplified, can also affect amplification.

  5. The Role of Internal Health Locus of Control in Relation to Self-Rated Health in Older Adults.

    PubMed

    Zhang, Anao; Jang, Yuri

    2017-01-01

    The present study examined how internal health locus of control is associated with older adults' self-rated health. Multivariate analyses with older participants (aged ≥ 60) in the MIDUS II (n = 1,533) showed that internal health locus of control was not only directly associated with positive ratings of health but also interacted with gender and race. The positive impact of internal health locus of control on self-rated health was particularly greater in females and Whites than their counterparts. Findings highlight the important role of internal health locus of control in the psychological mechanism of health and call attention to group-specific strategies for health promotion.

  6. Multidimensional profiles of health locus of control in Hispanic Americans

    PubMed Central

    Champagne, Brian R; Fox, Rina S; Mills, Sarah D; Sadler, Georgia Robins; Malcarne, Vanessa L

    2016-01-01

    Latent profile analysis identified health locus of control profiles among 436 Hispanic Americans who completed the Multidimensional Health Locus of Control scales. Results revealed four profiles: Internally Oriented-Weak, -Moderate, -Strong, and Externally Oriented. The profile groups were compared on sociocultural and demographic characteristics, health beliefs and behaviors, and physical and mental health outcomes. The Internally Oriented-Strong group had less cancer fatalism, religiosity, and equity health attributions, and more alcohol consumption than the other three groups; the Externally Oriented group had stronger equity health attributions and less alcohol consumption. Deriving multidimensional health locus of control profiles through latent profile analysis allows examination of the relationships of health locus of control subtypes to health variables. PMID:25855212

  7. The Impact of Prenatal Parental Locus of Control on Children's Psychological Outcomes in Infancy and Early Childhood: A Prospective 5 Year Study

    PubMed Central

    Nowicki, Stephen; Iles-Caven, Yasmin; Gregory, Steven; Ellis, Genette; Golding, Jean

    2017-01-01

    Locus of control is one of the most widely studied concepts in the history of personality psychology. In spite of its popularity and its associations with numerous relevant outcomes, the ability of locus of control to predict future behaviors involving parenting effectiveness has been under researched. The few parent locus of control children's outcome studies are characterized by cross-sectional methodologies that focus on mothers. The present study uses a prospective methodology to compare data on mothers' and fathers' locus of control with their child's behavior outcomes from a large scale research project, the Avon Longitudinal Study of Parents and Children (ALSPAC). Based on Rotter's Social Learning Theory published in 1954 and past empirical research, it was predicted and found that parent internality was associated with more positive child outcomes than parent externality. More specifically, when both parents were internal, their children had more positive outcomes in sleeping, eating, and tantrum behavior as compared to any other parent locus of control combination. However external parents had a less restrictive attitude which appeared to have a more beneficial effect on picky eating. Results confirmed how important parent locus of control is in the lives of children. Based on the findings, researchers are urged to develop interventions to change advice to parents and promote more internal locus of control among parents. PMID:28446887

  8. Locus of control and contraceptive knowledge, attitude and practice among university students.

    PubMed

    Alves, Aline Salheb; Lopes, Maria Helena Baena de Moraes

    2010-02-01

    To assess the relationship between locus of control and knowledge, attitude and practice regarding pill and condom use among university students. The inquiry was developed in Campinas, a city in Southeastern Brazil, in 2006. A total of 295 adolescent newcomers to a public university answered a structured questionnaire and Levenson's multidimensional locus of control scale. The scores of the dimensions of locus of control were calculated and Spearman's correlation coefficient was used to assess their correlation with knowledge and practice concerning pill and condom use. In order to assess the relationship between the dimensions of locus of control and sociodemographic variables and variables related to the individuals' sex life, Kruskal-Wallis and Mann-Whitney tests were used. Male adolescents had higher scores of powerful others externality when compared to female adolescents (p=0.01). Students living alone had lower internality (p=0.01). When locus of control was compared to condom use in the first intercourse, considering only the 102 students who informed the age of the beginning of sexual activity, greater internality was found among male adolescents who did not use condoms (p<0.05). When the locus of control scores were correlated with contraceptive knowledge and practice, it was found that the higher the powerful others externality locus, the lower the adequate use of contraceptive methods (r = -0.22, p=0.03). The powerful others externality locus influences the practice of contraceptive use in this group of adolescents.

  9. V(D)J recombination and allelic exclusion of a TCR beta-chain minilocus occurs in the absence of a functional promoter.

    PubMed

    Alvarez, J D; Anderson, S J; Loh, D Y

    1995-08-01

    Transcriptional activation of rearranging Ag receptor gene segments has been hypothesized to regulate their accessibility to V(D)J recombination. We analyzed the role of a functional promoter in the rearrangement of the murine TCR beta-chain locus using two transgenic minilocus constructs. These miniloci each contain an unrearranged V beta 8.3 gene. One has a wild-type V beta 8.3 gene, but the other has a V beta 8.3 gene with a promoter mutation that was previously shown to abrogate transcription in tissue culture. FACS analysis of thymus and lymph node cells from transgenic mouse lines showed that only the lines with the wild-type V beta 8.3 gene promoter express an 8.3 TCR beta-chain. Consistent with the protein expression data, V beta 8.3 gene transcripts were found only in the transgenic lines with the wild-type promoter. Using a quantitative PCR-based assay, it was shown that both types of transgenic lines recombine the V beta 8.3 gene at similar levels. Rearrangement of the transgenes was normal with respect to thymic development and junctional reading frame. Interestingly, both types of miniloci also underwent allelic exclusion in that recombination was blocked by the expression of a rearranged TCR beta-chain transgene. We conclude that a functional V beta gene promoter is not necessary for proper V(D)J recombination to occur.

  10. Relationship among prospective parents' locus of control, social desirability, and choice of psychoprophylaxis.

    PubMed

    Windwer, C

    1977-01-01

    This study sought to determine if there is a relationship among locus of control, social desirability, and choice of psychoprophylaxis (PPM). It was hypothesized that internal locus of control and low social desirability would correlate significantly with the choice of PPM by husbands and wives; that externally controlled wives who participated in PPM would have more internally controlled husbands than externally controlled wives who participated in PPM would have more internally controlled husbands than externally controlled wives who did not participate; and that locus of control and social desirability, when taken together, would be better predictors of choice of PPM than either taken separately. Ninety-eight middle-class nulliparous couples, participant and non-participant, were studied in the seventh or eighth month of the wife's pregnancy. Rotter's I-E Scale and the Marlowe-Crowne Social Desirability Scale were used to measure locus of control and social desirability. Study findings did not support the hypotheses.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gibbons, R.J.; Buckle, V.J.; Higgs, D.R.

    The authors have examined seven pedigrees that include individuals with a recently described X-linked form of severe mental retardation associated with [alpha]-thalassemia (ATR-X syndrome). Using hematologic and molecular approaches, they have shown that intellectually normal female carriers of this syndrome may be identified by the presence of rare cells containing HbH (hemoglobin H) inclusions in their peripheral blood and by an extremely skewed pattern of X inactivation seen in cells from a variety of tissues. Linkage analysis has localized the ATR-X locus to an interval of approximately 11 cM between the loci DXS106 and DXYS1X (Xq12-q21.31), with a peak LODmore » score of 5.4 (recombination fraction of 0) at DCS72. These findings provide the basis for genetic counseling, assessment of carrier risk, and prenatal diagnosis of the ATR-X syndrome. Furthermore, they represent an important step in developing strategies to understand how the mutant ATR-X allele causes mental handicap, dysmorphism, and down-regulation of the [alpha]-globin genes. 54 refs., 6 figs., 4 tabs.« less

  12. Codon 62 (GTG>GCG, Val→Ala) (α1) (HBA1: c.188T>C) causing nondeletional α-thalassemia in a Chinese family.

    PubMed

    Liao, Can; Tang, Hai-Shen; Li, Ru; Li, Dong-Zhi

    2013-01-01

    We report a novel α-globin gene point mutation detected during newborn screening for hemoglobinopathies. Sequence analyses identified a GTG>GCG substitution at codon 62 of the α1-globin gene. This mutation causes a silent α-thalassemia (α-thal).

  13. α-Globin as a molecular target in the treatment of β-thalassemia

    PubMed Central

    Mettananda, Sachith; Gibbons, Richard J.

    2015-01-01

    The thalassemias, together with sickle cell anemia and its variants, are the world’s most common form of inherited anemia, and in economically undeveloped countries, they still account for tens of thousands of premature deaths every year. In developed countries, treatment of thalassemia is also still far from ideal, requiring lifelong transfusion or allogeneic bone marrow transplantation. Clinical and molecular genetic studies over the course of the last 50 years have demonstrated how coinheritance of modifier genes, which alter the balance of α-like and β-like globin gene expression, may transform severe, transfusion-dependent thalassemia into relatively mild forms of anemia. Most attention has been paid to pathways that increase γ-globin expression, and hence the production of fetal hemoglobin. Here we review the evidence that reduction of α-globin expression may provide an equally plausible approach to ameliorating clinically severe forms of β-thalassemia, and in particular, the very common subgroup of patients with hemoglobin E β-thalassemia that makes up approximately half of all patients born each year with severe β-thalassemia. PMID:25869286

  14. Pseudoreticulocytosis in a patient with hemoglobin Köln due to autofluorescent erythrocytes enumerated as reticulocytes by the Cell-Dyn 4000.

    PubMed

    Sato, Shoko; Hirayama, Koichi; Koyama, Akio; Harano, Teruo; Nagasawa, Toshiro; Ninomiya, Haruhiko

    2004-01-01

    Pseudoreticulocytosis in a 25-year-old female patient with hemoglobin Köln is reported. The abnormal hemoglobin, hemoglobin Köln (beta chain, Val98-->Met), had previously been confirmed in the patient at the age of 21 years, as well as in her mother, by polymerase chain reaction-based direct sequence analysis of the beta globin gene. The patient underwent splenectomy at the age of 22 years. On her admission to our hospital for treatment of an immunoglobulin A nephropathy, an analysis by an automated hematology analyzer, the Abbott Cell-Dyn 4000 (CD4000), reported a marked reticulocytosis. Staining by the Brecher method with new methylene blue indicated a moderate reticulocytosis (5.7%) of a lesser extent than that indicated by the CD4000 (51.1%). The frequencies of red blood cells (RBC) with Pappenheimer bodies (13.8%), Heinz bodies (32.7%), and Howell-Jolly bodies (0.3%) were increased. The CD4000 detects RBC with RNA fluorescently stained with CD4K530 as reticulocytes. Autofluorescence of RBC with hemoglobin Köln, as we demonstrated by flow cytometry and fluorescent microscopy, was considered to have caused the pseudoreticulocytosis on the fully automated reticulocyte enumeration by the CD4000.

  15. Work stress and emotional exhaustion in nurses: the mediating role of internal locus of control.

    PubMed

    Partlak Günüşen, Neslihan; Ustün, Besti; Erdem, Sabri

    2014-01-01

    Burnout is a major problem for nursing. There is a strong relationship between work stress and emotional exhaustion. Although studies report a negative correlation between the internal locus of control and emotional exhaustion and work stress, the number of studies available on the subject is limited. This study intends to examine the extent to which the relationship between work stress and emotional exhaustion is mediated by nurses' internal locus of control. The study adopted a cross-sectional survey design. The data were analyzed using structural equation modeling techniques. The study sample consisted of 347 nurses who worked in a university hospital in Izmir, Turkey and who agreed to participate in the study. The Work-Related Strain Inventory was used to evaluate the nurses' work stress level, Maslach Burnout Inventory was used to evaluate their emotional exhaustion levels, and the Locus of Control Scale was used to evaluate the internal locus of control. The variables of the study were based on the Neuman Systems Model. Work stress was positively related to internal locus of control (β3 = .21, p < .001), which was, in turn, negatively associated with emotional exhaustion (β = -.03, p > 0.1). Internal locus of control was negatively related to emotional exhaustion (β = -.14, p < .001). Work stress is directly (β = .87, p < .001) and indirectly related to emotional exhaustion (mediated by internal locus of control β = .84, p < .001). Work stress is directly (β = .87, p < .001) and indirectly related to emotional exhaustion (mediated by internal locus of control, β = .84, p < .001). Although the relationship between emotional exhaustion and work stress was mediated, the impact of internal locus of control was limited. It is recommended that different variables be included in future studies so that they can mediate the relationship between work stress and emotional exhaustion.

  16. Effectiveness of teaching cognitive-behavioral techniques on locus of control in hemodialysis patients

    PubMed Central

    Mehrtak, Mohammad; Habibzadeh, Shahram; Farzaneh, Esmaeil; Rjaei-Khiavi, Abdollah

    2017-01-01

    Background Many of the cognitive behavioral models and therapeutic protocols developed so far for psychological disorders and chronic diseases have proved effective through clinical research. Objective This study aimed to determine the effectiveness of teaching cognitive-behavioral techniques on locus of control in hemodialysis patients. Methods This controlled clinical trial study was conducted in 2015 with 76 patients selected by census and treated with a hemodialysis machine in the dialysis department of Vali-Asr Hospital in the city of Meshkinshahr. A total of four patients were excluded because of their critical conditions while the rest, who were recruited, were randomly divided into two equal groups of 36 patients as the intervention and control groups. First, the locus of control was measured in both groups through a pretest, and cognitive-behavioral techniques were then taught to the intervention group during eight 45 to 90-minute sessions. The locus of control in patients of both groups was finally re-measured through a posttest. Data were collected using Rotter’s Locus of Control Inventory. The Wilcoxon test and Mann–Whitney U test were respectively used in SPSS18 for data analysis. Results In the pretest and posttest stages respectively, 4.8% and 14.3% of samples in the control group as well as 14.3% and 33.3% of samples in the intervention group enjoyed internal locus of control. The difference between the pretest and posttest scores of internal locus of control in the intervention group was significant (p=0.004), which indicates the positive effect of cognitive-behavioral psychotherapeutic intervention on internalization of locus of control in this group. Conclusions Given the external locus of control in most of the study patients and also the positive significant effect of cognitive-behavioral psychotherapy on internalization of locus of control in this group of patients, it appears necessary to have a psychology resident present in the hemodialysis department to teach the necessary cognitive-behavioral techniques to internalize the locus of control. Trial registration The trial was registered at the Thai Clinical Trial Registry (http://www.clinicaltrials.in.th) with the TCTID: TCTR20170707003. Funding The authors received no financial support for the research, authorship, and/or publication of this article. PMID:29238508

  17. Life events, locus of control, and behavioral problems among Chinese adolescents.

    PubMed

    Liu, X; Kurita, H; Uchiyama, M; Okawa, M; Liu, L; Ma, D

    2000-12-01

    This study examined associations of life events and locus of control with behavioral problems among 1,365 Chinese adolescents by using the Youth Self-Report (YSR), Adolescent Self-Rating Life Events Checklist (ASLEC), and the Nowicki-Strickland Locus of Control Scale for Children. Results indicated that the overall prevalence of behavioral and emotional problems was 10.7% (95% CI = 9.9-11.5%). Logistic-regression analyses showed that a total of 13 negative life events mainly coming from academic domain and interpersonal relationships, high life-stress score, and high external locus score significantly increased the risk for behavioral problems. Life stress and locus of control significantly interacted with behavioral problems. These findings support the linkage between stressful life events and psychopathology in a general population of adolescents from mainland China, and demonstrate the stress-moderating effects of locus of control on psychopathology as well.

  18. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  19. Versatile Cosmid Vectors for the Isolation, Expression, and Rescue of Gene Sequences: Studies with the Human α -globin Gene Cluster

    NASA Astrophysics Data System (ADS)

    Lau, Yun-Fai; Kan, Yuet Wai

    1983-09-01

    We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.

  20. Total alpha-globin gene cluster deletion has high frequency in Filipinos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hunt, J.A.; Haruyama, A.Z.; Chu, B.M.

    1994-09-01

    Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms;more » {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).« less

  1. Relation of organizational citizenship behavior and locus of control.

    PubMed

    Turnipseed, David L; Bacon, Calvin M

    2009-12-01

    The relation of organizational citizenship behavior and locus of control was assessed in a sample of 286 college students (52% men; M age = 24 yr.) who worked an average of 26 hr. per week. Measures were Spector's Work Locus of Control Scale and Podsakoff, et al.'s Organization Citizenship Behavior scale. Hierarchical multiple regressions indicated positive association of scores on work locus of control with scores on each of the four tested dimensions of organizational citizenship, as well as total organizational citizenship behavior.

  2. Psychosocial and behavioural factors in the regulation of weight: Self-regulation, self-efficacy and locus control.

    PubMed

    Menéndez-González, Lara; Orts-Cortés, María Isabel

    To identify the relationship and behaviour of the variables of self-control, self-efficacy and locus control in weight regulation of obese, overweight and normal weight adults. Transversal study undertaken in the Health Centre of El Coto (Gijón) from 1st April to 30th July 2015. Subjects between 18-65 years of age with a body mass index recording within the last two years. serious medical illness, eating disorders or pregnant women. Behavioural variables: self-regulation of body weight (Inventory of self-control of body weight), perceived self-efficacy in weight regulation (Inventory of perceived self-efficacy in weight regulation) and locus control in weight regulation (Inventory of locus control in weight regulation). Anthropometric variables: weight (kg) and height (m), body mass index. One hundred and six participants were included: 32 were obese, 28 overweight and 46 normal weight. Significant differences were found between the 3 study groups for total scale of self-efficacy (F=61.77; p<.01), total scale of self-regulation (F=45.97; p<.01), internal locus control (F=13.92; p=.019), other weighty influences of locus control (F=9.21; p<.01) and random locus control (F=3.50; p=.011). The relationship between body mass index and behavioural variables of self-efficacy, self-regulation and locus control, suggests the need for healthcare professionals to include psychological factors of behaviour in any preventive action and intervention directed at weight control. Copyright © 2018 Elsevier España, S.L.U. All rights reserved.

  3. The Effect of Locus of Control on Message Acceptance and Recall.

    ERIC Educational Resources Information Center

    Cole, Catherine A.; Singh, Surendra

    Locus of control is a personality trait that influences human behavior in many situations. Internal-external control reactions to a persuasive message and the recall of the message were examined in two studies. In the first study, 35 undergraduate students' locus of control was measured using Duttweiler's Internal Control Measure. On the basis of…

  4. Coordination and redox state-dependent structural changes of the heme-based oxygen sensor AfGcHK associated with intraprotein signal transduction.

    PubMed

    Stranava, Martin; Man, Petr; Skálová, Tereza; Kolenko, Petr; Blaha, Jan; Fojtikova, Veronika; Martínek, Václav; Dohnálek, Jan; Lengalova, Alzbeta; Rosůlek, Michal; Shimizu, Toru; Martínková, Markéta

    2017-12-22

    The heme-based oxygen sensor histidine kinase Af GcHK is part of a two-component signal transduction system in bacteria. O 2 binding to the Fe(II) heme complex of its N-terminal globin domain strongly stimulates autophosphorylation at His 183 in its C-terminal kinase domain. The 6-coordinate heme Fe(III)-OH - and -CN - complexes of Af GcHK are also active, but the 5-coordinate heme Fe(II) complex and the heme-free apo-form are inactive. Here, we determined the crystal structures of the isolated dimeric globin domains of the active Fe(III)-CN - and inactive 5-coordinate Fe(II) forms, revealing striking structural differences on the heme-proximal side of the globin domain. Using hydrogen/deuterium exchange coupled with mass spectrometry to characterize the conformations of the active and inactive forms of full-length Af GcHK in solution, we investigated the intramolecular signal transduction mechanisms. Major differences between the active and inactive forms were observed on the heme-proximal side (helix H5), at the dimerization interface (helices H6 and H7 and loop L7) of the globin domain and in the ATP-binding site (helices H9 and H11) of the kinase domain. Moreover, separation of the sensor and kinase domains, which deactivates catalysis, increased the solvent exposure of the globin domain-dimerization interface (helix H6) as well as the flexibility and solvent exposure of helix H11. Together, these results suggest that structural changes at the heme-proximal side, the globin domain-dimerization interface, and the ATP-binding site are important in the signal transduction mechanism of Af GcHK. We conclude that Af GcHK functions as an ensemble of molecules sampling at least two conformational states. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Predictors of Parental Locus of Control in Mothers of Pre- and Early-Adolescents

    PubMed Central

    Freed, Rachel D.; Tompson, Martha C.

    2016-01-01

    Parental locus of control refers to parents’ perceived power and efficacy in child-rearing situations. This study explored parental locus of control and its correlates in 160 mothers of children ages 8–14 cross-sectionally and 1 year later. Maternal depression, maternal expressed emotion, and child internalizing and externalizing behavior were examined, along with a number of sociodemographic factors. Cross-sectional analyses indicated that external parental locus of control was associated with child externalizing behavior, maternal depression, less maternal education, lower income, and older maternal age. Longitudinal analyses showed that child age and externalizing behavior also predicted increases in external parental locus of control 1 year later. Finally, lower income and less parental perceived control predicted increases in child externalizing behavior over time. PMID:21229447

  6. Multidimensional profiles of health locus of control in Hispanic Americans.

    PubMed

    Champagne, Brian R; Fox, Rina S; Mills, Sarah D; Sadler, Georgia Robins; Malcarne, Vanessa L

    2016-10-01

    Latent profile analysis identified health locus of control profiles among 436 Hispanic Americans who completed the Multidimensional Health Locus of Control scales. Results revealed four profiles: Internally Oriented-Weak, -Moderate, -Strong, and Externally Oriented. The profile groups were compared on sociocultural and demographic characteristics, health beliefs and behaviors, and physical and mental health outcomes. The Internally Oriented-Strong group had less cancer fatalism, religiosity, and equity health attributions, and more alcohol consumption than the other three groups; the Externally Oriented group had stronger equity health attributions and less alcohol consumption. Deriving multidimensional health locus of control profiles through latent profile analysis allows examination of the relationships of health locus of control subtypes to health variables. © The Author(s) 2015.

  7. Patients suffering from restless legs syndrome have low internal locus of control and poor psychological functioning compared to healthy controls.

    PubMed

    Brand, Serge; Beck, Johannes; Hatzinger, Martin; Holsboer-Trachsler, Edith

    2013-01-01

    Restless legs syndrome (RLS) is a disturbing sensorimotor disorder negatively influencing both sleep and psychological functioning. The aim of the present study was to assess RLS patients with respect to locus of control, sleep-related personality traits, quality of life, and sleep as compared to healthy controls. Thirty-eight patients (18 females and 20 males; mean age: 56.06 years) diagnosed with RLS and an age- and gender-matched control group (n = 42) were recruited. Participants completed a series of questionnaires related to locus of control, personality traits, quality of life, and sleep. Compared to healthy controls, RLS patients had a lower internal locus of control, unfavourable sleep-related personality traits such as low self-confidence and higher mental arousal, poorer quality of life, and more depressive symptoms. Sleep was also affected. Multiple regression analyses showed that a low internal and a high external locus of control were predicted by RLS. The pattern of results suggests that RLS is associated with a low locus of control, negative personality traits, and poor quality of life as compared to healthy controls. Copyright © 2013 S. Karger AG, Basel.

  8. Locus of Control or Self-Esteem; Which One is the Best Predictor of Academic Achievement in Iranian College Students.

    PubMed

    Hosseini, Seyyed Nasrollah; Mirzaei Alavijeh, Mehdi; Karami Matin, Behzad; Hamzeh, Behrooz; Ashtarian, Hossein; Jalilian, Farzad

    2016-03-01

    Self-esteem and behavioral consequences, which are due to external or internal locus of control, are effective on academic achievement of students. The aim of this study was to determine the prediction of locus of control and self-esteem in academic achievement among the students. This cross-sectional study was conducted on 300 college students in Kermanshah University of Medical Sciences in 2014. Data collection tools were in three sections: demographic, Rotter internal-external locus of control scale and Coopersmith self-esteem inventory. Data were analyzed using the SPSS software version 21. Results showed that 29.8% and 76.2% of the participants had internal locus of control, and high self-esteem, respectively. There was a significant correlation between self-esteem, locus of control and academic achievement of the students. Self-esteem accounted for 39.5% of the variation in academic achievement. It seems that interventions to increase self-esteem among student can help improve academic achievement among them.

  9. Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

    PubMed

    Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein

    2018-03-01

    β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

  10. The effect of microstructure on the deformation modes and mechanical properties of Ti-6Al-2Nb-1Ta-0.8Mo: Part II. Equiaxed structures

    NASA Astrophysics Data System (ADS)

    Lin, Fu-Shiong; Starke, E. A.; Gysler, A.

    1984-10-01

    The Ti-6Al-2Nb-lTa-0.8Mo alloy was processed to develop both near-basal and transverse textures. Samples were annealed at different temperatures to vary the equiaxed alpha grain size and the thick-ness of the grain boundary beta, and subsequently quenched in order to transform the beta phase to either martensite, tempered martensite, or Widmanstätten alpha + beta. The effect of microstructure and texture on tensile properties and on fracture toughness was investigated. In addition, yield locus diagrams were constructed in order to study the texture strengthening effect. The yield strength was found to be strongly dependent on the thickness and Burgers relationship of the transformed beta phase surrounding the alpha grains. A texture hardening effect as large as 60 pct was found for the basal-texture material but only 15 pct for the transverse texture material. These variations are asso-ciated with differences in deformation behavior.

  11. Getting to the core of locus of control: Is it an evaluation of the self or the environment?

    PubMed

    Johnson, Russell E; Rosen, Christopher C; Chang, Chu-Hsiang Daisy; Lin, Szu-Han Joanna

    2015-09-01

    Responding to criticisms surrounding the structural validity of the higher order core self-evaluations (CSE) construct, in the current study we examined the appropriateness of including locus of control as an indicator of CSE. Drawing from both theoretical and empirical evidence, we argue that locus of control is more heavily influenced by evaluations of the environment compared with the other CSE traits. Using data from 4 samples, we demonstrate that model fit for the higher order CSE construct is better when locus of control is excluded versus included as a trait indicator and that the shared variance between locus of control and CSE is nominal. This does not mean that locus of control is irrelevant for CSE theory though. We propose that evaluations of the environment moderate the relations that CSE has with its outcomes. To test this proposition, we collected data from 4 unique samples that included a mix of student and employee participants, self- and other-ratings, and cross-sectional and longitudinal data. Our results revealed that locus of control moderated relations of CSE with life and job satisfaction, and supervisor-rated job performance. CSE had stronger, positive relations with these outcomes when locus of control is internal versus external. These findings broaden CSE theory by demonstrating one way in which evaluations of the environment interface with evaluations of the self. (PsycINFO Database Record (c) 2015 APA, all rights reserved).

  12. Generation of a Stable Transgenic Swine Model Expressing a Porcine Histone 2B-eGFP Fusion Protein for Cell Tracking and Chromosome Dynamics Studies

    PubMed Central

    Simpson, Sean; Collins, Bruce; Sommer, Jeff; Petters, Robert M.; Caballero, Ignacio; Platt, Jeff L.

    2017-01-01

    Transgenic pigs have become an attractive research model in the field of translational research, regenerative medicine, and stem cell therapy due to their anatomic, genetic and physiological similarities with humans. The development of fluorescent proteins as molecular tags has allowed investigators to track cell migration and engraftment levels after transplantation. Here we describe the development of two transgenic pig models via SCNT expressing a fusion protein composed of eGFP and porcine Histone 2B (pH2B). This fusion protein is targeted to the nucleosomes resulting a nuclear/chromatin eGFP signal. The first model (I) was generated via random insertion of pH2B-eGFP driven by the CAG promoter (chicken beta actin promoter and rabbit Globin poly A; pCAG-pH2B-eGFP) and protected by human interferon-β matrix attachment regions (MARs). Despite the consistent, high, and ubiquitous expression of the fusion protein pH2B-eGFP in all tissues analyzed, two independently generated Model I transgenic lines developed neurodegenerative symptoms including Wallerian degeneration between 3–5 months of age, requiring euthanasia. A second transgenic model (II) was developed via CRISPR-Cas9 mediated homology-directed repair (HDR) of IRES-pH2B-eGFP into the endogenous β-actin (ACTB) locus. Model II transgenic animals showed ubiquitous expression of pH2B-eGFP on all tissues analyzed. Unlike the pCAG-pH2B-eGFP/MAR line, all Model II animals were healthy and multiple pregnancies have been established with progeny showing the expected Mendelian ratio for the transmission of the pH2B-eGFP. Expression of pH2B-eGFP was used to examine the timing of the maternal to zygotic transition after IVF, and to examine chromosome segregation of SCNT embryos. To our knowledge this is the first viable transgenic pig model with chromatin-associated eGFP allowing both cell tracking and the study of chromatin dynamics in a large animal model. PMID:28081156

  13. Assessing Locus of Control of Reinforcement in Elderly People: Evaluation of the Desired Control Measure.

    ERIC Educational Resources Information Center

    Kelly, Lynn E.; And Others

    1994-01-01

    Reid and Zeigler's Desired Control Measure (DCM); Levenson's Internal, Powerful Other, and Chance Locus of Control scales, Life Satisfaction Index; and Affect Balance Scale were completed by 363 older adults. The DCM apparently does not primarily tap locus of control and would be more appropriately used as a measure of individuals' perceptions of…

  14. Physical Attractiveness, Locus of Control, Sex Role, and Conversational Assertiveness.

    ERIC Educational Resources Information Center

    Campbell, Keith F.; And Others

    1990-01-01

    Analyzes the relationship among physical attractiveness, locus of control, sex role orientation, and assertiveness in undergraduate students. Reviews videotapes of mixed-sex student groups engaged in discussion. Finds an internal locus of control positively correlated with assertiveness. Uses a behavioral measure of assertiveness rather than…

  15. Overlapping reading frames at the LYS5 locus in the yeast Yarrowia lipolytica.

    PubMed Central

    Xuan, J W; Fournier, P; Declerck, N; Chasles, M; Gaillardin, C

    1990-01-01

    Mutants affected at the LYS5 locus of Yarrowia lipolytica lack detectable dehydrogenase (SDH) activity. The LYS5 gene has previously been cloned, and we present here the sequence of the 2.5-kilobase-pair (kb) DNA fragment complementing the lys5 mutation. Two large antiparallel open reading frames (ORF1 and ORF2) were observed, flanked by potential transcription signals. Both ORFs appear to be transcribed, but several lines of evidence suggest that only ORF2 is translated and encodes SDH. (i) The global amino acid compositions of Saccharomyces cerevisiae SDH and of the putative ORF2 product are similar and that of ORF1 is dissimilar. (ii) An in-frame translational fusion of ORF2 with the Escherichia coli lacZ gene was introduced into yeast cells and resulted in a beta-galactosidase activity regulated similarly to SDH; no beta-galactosidase activity was obtained with an in-frame fusion of ORF1 with lacZ. (iii) The introduction of a stop codon at the beginning of ORF2 prevented SDH expression in yeast cells, whereas no phenotypic effect was observed when ORF1 translation was blocked. Images PMID:2388625

  16. The amyloid precursor protein locus and very-late-onset Alzheimer disease.

    PubMed

    Olson, J M; Goddard, K A; Dudek, D M

    2001-10-01

    Although mutations in the amyloid-beta precursor protein (APP) gene are known to confer high risk of Alzheimer disease (AD) to a small percentage of families in which it has early onset, convincing evidence of a major role for the APP locus in late-onset AD has not been forthcoming. In this report, we have used a covariate-based affected-sib-pair linkage method to analyze the chromosome 21 clinical and genetic data obtained on affected sibships by the National Institute of Mental Health Alzheimer Disease Genetics Initiative. The baseline model (without covariates) gave a LOD score of 0.02, which increases to 1.43 when covariates representing the additive effects of E2 and E4 are added. Larger increases in LOD scores were found when age at last examination/death (LOD score 5.54; P=.000002) or age at onset plus disease duration (LOD score 5.63; P=.000006) were included in the linkage model. We conclude that the APP locus may predispose to AD in the very elderly.

  17. Parental interest in children's education, children's self-esteem and locus of control, and later educational attainment: twenty-six year follow-up of the 1970 British Birth Cohort.

    PubMed

    Flouri, Eirini

    2006-03-01

    Few studies have investigated if mother's interest and father's interest in child's education are linked to educational attainment via their impact on child's self-esteem and locus of control. (1) To investigate (after controlling for known confounding factors) the long-term effect of mother's and father's interest in child's education at age 10 and child's locus of control and self-esteem at age 10 in educational attainment at age 26; and (2) to explore if mother's interest and father's interest in child's education are linked to child's educational attainment via their effect in increasing child's self-esteem and internal locus of control. The study used longitudinal data from sweeps of the 1970 British Cohort Study (BCS70). The initial sample was those 1,737 men and 2,033 women with valid data on age 10 self-esteem, locus of control, father's interest, mother's interest, and age 26 educational attainment. Of these, 1,326 men and 1,578 women were included in the final analysis. The birth to age 10 factors that were controlled for were birth weight, parental social class, socio-economic disadvantage, emotional/behavioural problems, cognitive ability, and mother's educational attainment. At the multivariate level, internal locus of control and mother's interest (but not self-esteem) were significantly related to educational attainment in both men and women. Father's interest was a significant predictor of educational attainment only in women. Parent's interest was not linked to educational attainment via its impact on child's self-esteem or locus of control. Self-esteem predicted educational attainment in both genders by increasing internal locus of control, and fathers' interest predicted educational attainment in men by increasing mother's involvement. Although mothers' and fathers' interest in their children's education were not linked to educational attainment via their impact on children's self-esteem or locus of control, they were significant predictors of educational attainment especially in daughters.

  18. [Health locus of control of patients in disease management programmes].

    PubMed

    Schnee, M; Grikscheit, F

    2013-06-01

    Health locus of control beliefs plays a major role in improving self-management skills of the chronically ill - a main goal in disease management programmes (DMP). This study aims at characterising participants in disease management regarding their health locus of control. Data are based on 4 cross-sectional postal surveys between spring and autumn of 2006 and 2007 within the Health Care Monitor of the Bertelsmann Foundation. Among the 6 285 respondents, 1 266 are chronically ill and not enrolled in a DMP and 327 are participating in a DMP. A high internal locus of control (HLC) occurs significantly less often in DMP patients than in normal chronically ill patients (and healthy people) controlling for age, gender and social class. With increasing age, a high internal locus of control is also significantly less likely. When comparing healthy people, the chronically ill and the DMP participants a social gradient of a high internal locus of control belief can be observed. The weaker internal and higher doctor-related external locus of control of DMP participants should be carefully observed by the physician when trying to strengthen the patients' self-management skills. Evaluators of DMP should take into account the different baselines of DMP patients and relevant control groups and incorporate these differences into the evaluation. © Georg Thieme Verlag KG Stuttgart · New York.

  19. Grades--Who's to Blame? Student Evaluation of Teaching and Locus of Control

    ERIC Educational Resources Information Center

    Grimes, Paul W.; Millea, Meghan J.; Woodruff, Thomas W.

    2004-01-01

    The authors examine the relationship between students' locus of control and their evaluation of teaching in a traditional principles of economics course. Locus of control is a psychological construct that identifies an individual's beliefs about the degree of personal control that can be exercised over his or her environment. Students with an…

  20. Locus of control, sources of motivation, and mental boundaries as antecedents of leader-member exchange quality.

    PubMed

    Barbuto, John E; Finch, Weltmer Dayna; Pennisi, Lisa A

    2010-02-01

    In this study were examined leaders' and members' scores on locus of control, sources of motivation, and mental boundaries to predict the quality of leader-member exchanges. 80 elected officials and their 388 direct reports were sampled in a field study. Analysis indicated followers' scores on locus of control, leaders' scores of self-concept internal motivation, leaders' scores on locus of control, and followers' rated goal-internalization motivation were positively related to leader-member exchanges. Implications and directions for research are discussed.

  1. Vocational interests of adolescents: relationships between self-esteem and locus of control.

    PubMed

    Mullis, A K; Mullis, R L

    1997-12-01

    The purpose of this study was to examine relationships among scores on vocational interests, self-esteem, and locus of control for high school students. Grade and sex differences were also examined. 1364 high school students ranging in age from 14 to 19 years of age were administered the Coopersmith Self-esteem Inventory, Nowicki-Strickland Locus of Control Scale for Children, and the Strong-Campbell Interest Inventory. High school students with higher scores on self-esteem and showing an orientation toward internal locus of control expressed more interests in a variety of vocational themes than adolescents with lower scores on self-esteem and scores for external locus of control. Sex and grade differences in vocational interests of adolescents were also noted. The findings were discussed in light of theoretical and practical considerations.

  2. Social capital, political trust, and health locus of control: a population-based study.

    PubMed

    Lindström, Martin

    2011-02-01

    To investigate the association between political trust in the Riksdag and lack of belief in the possibility to influence one's own health (external locus of control), taking horizontal trust into account. The 2008 public health survey in Skåne is a cross-sectional postal questionnaire study with a 55% participation rate. A random sample of 28,198 persons aged 18-80 years participated. Logistic regression models were used to investigate the associations between political trust in the Riksdag (an aspect of vertical trust) and lack of belief in the possibility to influence one's own health (external locus of control). The multiple regression analyses included age, country of birth, education, and horizontal trust in other people. A 33.7% of all men and 31.8% of all women lack internal locus of control. Low (external) health locus of control is more common in higher age groups, among people born outside Sweden, with lower education, low horizontal trust, low political trust, and no opinion concerning political trust. Respondents with not particularly strong political trust, no political trust at all and no opinion have significantly higher odds ratios of external locus of control throughout the multiple regression analyses. Low political trust in the Riksdag seems to be independently associated with external health locus of control.

  3. Maternal Control Behavior and Locus of Control: Examining Mechanisms in the Relation between Maternal Anxiety Disorders and Anxiety Symptomatology in Children

    ERIC Educational Resources Information Center

    Becker, Kimberly D.; Ginsburg, Golda S.; Domingues, Janine; Tein, Jenn-Yun

    2010-01-01

    This study tested components of a proposed model of child anxiety and examined the mediational roles of (1) maternal control behavior, (2) maternal external locus of control, and (3) child external locus of control in the association between maternal and child anxiety. Thirty-eight clinically anxious mothers and 37 nonanxious mothers participated…

  4. Electrophoretic variation in low molecular weight lens crystallins from inbred strains of rats.

    PubMed

    Donner, M E; Skow, L C; Kunz, H W; Gill, T J

    1985-10-01

    Analysis of rat lens soluble proteins by analytical isoelectric focusing detected two inherited electrophoretic differences in low molecular weight (LM) crystallins from inbred strains of rats (Rattus norvegicus). The polymorphic lens crystallins were shown to be similar to a genetically variant LM crystallin, LEN-1, previously described in mice (Mus musculus) and encoded on chromosome 1, at a locus linked to Pep-3 (dipeptidase). Linkage analysis demonstrated that the rat crystallin locus was loosely linked to Pep-3 at a recombination distance of 38 +/- 4.5 U. These data suggest the conservation of a large chromosomal region during the evolution of Rodentia and support the hypothesis that the gamma-crystallins are evolving more rapidly than alpha- or beta-crystallins.

  5. Haemoglobin Fontainebleau (HBA2: c. 64G>C) in Oman: molecular and haematological characteristics and interaction with various haemoglobinopathies.

    PubMed

    Daar, Shahina; Al Zadjali, Shoaib; Alkindi, Salam; Wali, Yasser; Al-Rawas, Abdulhakeem; Al-Haddabi, Humood; Al-Riyami, Arwa Z

    2018-04-01

    To describe the laboratory features of haemoglobin Fontainebleau (Hb FB) and its interactions with various α and β globin gene mutations in the Omani population. Over a period of 10 years, a total of 94 blood samples were suspected to have an α variant on HPLC at the Sultan Qaboos University Hospital, Muscat, Oman. Molecular testing was performed using PCR based techniques to define the variant and to analyse other interacting mutations in either α or β globin genes. Of 94 subjects, molecular analysis confirmed the Hb FB variant in 55 samples (38 non-cord and 17 cord blood). A total of 36/38 non-cord samples were heterozygous for the variant, while all 17 cord blood samples were heterozygotes. A total of 43/55 individuals had a concomitant α and/or β globin gene mutation. Hb FB is the the most common α variant in the Omani population. We report the different HPLC profiles of this variant that we observed, with and without other haemoglobinopathies in non-cord and cord blood samples. This is the first report describing the HPLC profiles of this α globin chain variant on 1 year follow-up testing of cord blood samples. With careful analysis by HPLC, it is possible not only to identify Hb FB but also to predict any concomitant α and/or β globin gene mutations. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  6. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    PubMed

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  7. Analysis of α1 and α2 globin genes among patients with hemoglobin Adana in Malaysia.

    PubMed

    Lee, T Y; Lai, M I; Ismail, P; Ramachandran, V; Tan, J A M A; Teh, L K; Othman, R; Hussein, N H; George, E

    2016-04-07

    Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.

  8. Translational recognition of the 5'-terminal 7-methylguanosine of globin messenger RNA as a function of ionic strength.

    PubMed

    Chu, L Y; Rhoads, R E

    1978-06-13

    The translation of rabbit globin mRNA in cell-free systems derived from either wheat germ or rabbit reticulocyte was studied in the presence of various analogues of the methylated 5' terminus (cap) as a function of ionic strength. Inhibition by these analogues was strongly enhanced by increasing concentrations of KCl, K(OAc), Na(OAc), or NH4(OAc). At appropriate concentrations of K(OAc), both cell-free systems were equally sensitive to inhibition by m7GTP. At 50 mM K(OAc), the reticulocyte system was not sensitive to m7GMP or m7GTP, but at higher concentrations up to 200 mM K(OAc), both nucleotides caused strong inhibition. The compound in m7G5'ppp5'Am was inhibitory at all concentrations of K(OAc) ranging from 50 to 200 mM, although more strongly so at the higher concentrations. Over the same range of nucleotide concentrations, the compounds GMP, GTP, and G5'ppp5'Am were not inhibitors. The mobility on sodium dodecyl sulfate-polyacrylamide electrophoresis of the translation product was that of globin at all K(OAc) concentrations in the presence of m7GTP. Globin mRNA from which the terminal m7GTP group had been removed by chemical treatment (periodate-cyclohexylamine-alkaline phosphatase) or enzymatic treatment (tobacco acid pyrophosphatase-alkaline phosphatase) was translated less efficiently than untreated globin mRNA at higher K(OAc) concentrations, but retained appreciable activity at low K(OAc) concentrations.

  9. Evaluation of microbial globin promoters for oxygen-limited processes using Escherichia coli.

    PubMed

    Lara, Alvaro R; Jaén, Karim E; Sigala, Juan-Carlos; Regestein, Lars; Büchs, Jochen

    2017-01-01

    Oxygen-responsive promoters can be useful for synthetic biology applications, however, information on their characteristics is still limited. Here, we characterized a group of heterologous microaerobic globin promoters in Escherichia coli . Globin promoters from Bacillus subtilis , Campylobacter jejuni , Deinococcus radiodurans , Streptomyces coelicolor , Salmonella typhi and Vitreoscilla stercoraria were used to express the FMN-binding fluorescent protein (FbFP), which is a non-oxygen dependent marker. FbFP fluorescence was monitored online in cultures at maximum oxygen transfer capacities (OTR max ) of 7 and 11 mmol L -1  h -1 . Different FbFP fluorescence intensities were observed and the OTR max affected the induction level and specific fluorescence emission rate (the product of the specific fluorescence intensity multiplied by the specific growth rate) of all promoters. The promoter from S. typhi displayed the highest fluorescence emission yields (the quotient of the fluorescence intensity divided by the scattered light intensity at every time-point) and rate, and together with the promoters from D. radiodurans and S. coelicolor , the highest induction ratios. These results show the potential of diverse heterologous globin promoters for oxygen-limited processes using E. coli .

  10. Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.

    PubMed

    Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun

    α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.

  11. Two new γ chain variants: Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C].

    PubMed

    Kutlar, Ferdane; Ameri, Afshin; Patel, Niren H; Zhuang, Lina; Johnson, Lee E; Cheng, Michael L; Kutlar, Abdullah

    2014-01-01

    The total number of hemoglobin (Hb) variants so far reported to the HbVar database is 1598 (April 9 2014) and 130 of them are fetal Hb variants. Fetal Hb are categorized as two different subunits, (G)γ- and (A)γ-globin chains, and γ chain variants can be observed in both subunits. There are 72 (G)γ- and 58 (A)γ-globin chain variants. Most of them are clinically silent and detected during newborn screening programs in the USA and outside the USA. In this report, we discuss the molecular characteristics and diagnostic difficulties of two new γ-globin chain variants found in an African American baby with no clinical symptoms. One is a new (G)γ-globin chain variant, Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and the other one is Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C].

  12. Comparison of ligand migration and binding in heme proteins of the globin family

    NASA Astrophysics Data System (ADS)

    Karin, Nienhaus; Ulrich Nienhaus, G.

    2015-12-01

    The binding of small diatomic ligands such as carbon monoxide or dioxygen to heme proteins is among the simplest biological processes known. Still, it has taken many decades to understand the mechanistic aspects of this process in full detail. Here, we compare ligand binding in three heme proteins of the globin family, myoglobin, a dimeric hemoglobin, and neuroglobin. The combination of structural, spectroscopic, and kinetic experiments over many years by many laboratories has revealed common properties of globins and a clear mechanistic picture of ligand binding at the molecular level. In addition to the ligand binding site at the heme iron, a primary ligand docking site exists that ensures efficient ligand binding to and release from the heme iron. Additional, secondary docking sites can greatly facilitate ligand escape after its dissociation from the heme. Although there is only indirect evidence at present, a preformed histidine gate appears to exist that allows ligand entry to and exit from the active site. The importance of these features can be assessed by studies involving modified proteins (via site-directed mutagenesis) and comparison with heme proteins not belonging to the globin family.

  13. Perceived parenting style of fathers and adolescents' locus of control in a collectivist culture of Malaysia: the moderating role of fathers' education.

    PubMed

    Keshavarz, Somayeh; Baharudin, Rozumah; Mounts, Nina S

    2013-01-01

    The authors investigated the moderating role of father's education on the associations between perceived paternal parenting styles and locus of control among 382 Malaysian adolescents with an average age of 14.27. Data were collected by means of adolescents' self-report using standardized instruments (i.e., parental authority questionnaire and Nowicki-Strickland Internal-External Control Scale for Children). Results revealed that there were significant negative relationships between fathers' authoritative parenting style (r = -.243, p < .001) and authoritarian parenting style (r = -.130, p < .01) with adolescents' internal locus of control. Furthermore, the findings indicated that father's high level of education moderated the relationship between perceived paternal authoritarian parenting and locus of control (b = -0.147, p < .001). The findings underscore the need to include the role of parents' education when assessing the links between parenting styles and adolescents' locus of control.

  14. Relationship of Personality and Locus of Control With Employment Outcomes among Participants with Spinal Cord Injury

    ERIC Educational Resources Information Center

    Krause, James S.; Broderick, Lynne

    2006-01-01

    We investigated relationships among personality, locus of control, and current post-injury employment status for 1,391 participants with spinal cord injury. Participants with higher internality locus-of-control scores and activity scores (personality) reported more favorable employment outcomes. Higher scores on chance and powerful others (locus…

  15. Development of Locus of Control: A Review and Model for Further Exploration.

    ERIC Educational Resources Information Center

    Olejnik, Anthony B.

    This paper applies a developmental perspective to locus of control studies. Contingency awareness established during infancy and early childhood is viewed as the basis for the development of locus of control expectancies. Expectancies of contingent reinforcement involve a cognitive component and can be viewed in Piagetian terms as the development…

  16. Social Self-Efficacy, Academic Locus of Control, and Internet Addiction

    ERIC Educational Resources Information Center

    Iskender, Murat; Akin, Ahmet

    2010-01-01

    The purpose of this research is to examine the relationship of internet addiction, social self-efficacy, and academic locus of control. Participants were 311 university students who completed a questionnaire package that included the Online Cognition Scale, the Academic Locus of Control Scale, and the Perceived Social Self-efficacy Scale. The…

  17. Health Locus of Control and Preventive Behaviour among Students of Music

    ERIC Educational Resources Information Center

    Spahn, Claudia; Burger, Thorsten; Hildebrandt, Horst; Seidenglanz, Karin

    2005-01-01

    The present study investigated health locus of control, preventive behaviour and previous playing-related health problems of music students; 326 students of music (58% female, mean age 22 years) filled in the Locus of Control Inventory for Illness and Health (Lohaus and Schmitt, 1989) and the Epidemiological Questionnaire for Musicians (Spahn,…

  18. Criterion-Related Validity of the Nowicki-Strickland Locus of Control Scale with Academic Achievement.

    ERIC Educational Resources Information Center

    Nunn, Gary D.; And Others

    1986-01-01

    Investigated the relationships between student locus of control and academic achievement in grades five through eight. The Nowicki-Strickland Locus of Control Scale (NSLOCS) was used to measure motivation, and the Iowa Tests of Basic Skills (ITBS) to assess academic achievement. Results indicated moderate inverse relationships between level of…

  19. Competitiveness: relations with GPA, locus of control, sex, and athletic status.

    PubMed

    Frederick, C M

    2000-04-01

    A sample of college students and college athletes completed measures of competitiveness and locus of control. In addition, self-reports of GPA and sex were provided. Negative correlations among scores on competitiveness, GPA, and scores on internal locus of control were significant. Also, there were sex and athletic status differences in competitiveness.

  20. The Relationship of Locus of Control and Attribution to Depression.

    ERIC Educational Resources Information Center

    Banks, L. Morgan, III; Goggin, William C.

    Both external locus of control (i.e., a generalized expectancy that reinforcement is controlled by luck or fate instead of oneself) and internal locus of attribution (i.e., beliefs that success or failure result from an individual's actions rather than external causes) have been related to depression. To examine the relationship of attributions…

  1. Changing Locus of Control: Steelworkers Adjusting to Forced Unemployment

    ERIC Educational Resources Information Center

    Legerski, Elizabeth Miklya; Cornwall, Marie; O'Neil, Brock

    2006-01-01

    Using an abbreviated version of Levenson's (1981) locus of control scale, we examine change over time in the locus of control of displaced steelworkers. The first data collection occurred approximately six months after plant shutdown, the second occurred a year later. Utilizing a multidimensional measurement model, we test the major assumption…

  2. Locus of Control or Self-Esteem; Which One is the Best Predictor of Academic Achievement in Iranian College Students

    PubMed Central

    Hosseini, Seyyed Nasrollah; Mirzaei Alavijeh, Mehdi; Karami Matin, Behzad; Hamzeh, Behrooz; Ashtarian, Hossein; Jalilian, Farzad

    2016-01-01

    Background Self-esteem and behavioral consequences, which are due to external or internal locus of control, are effective on academic achievement of students. Objectives The aim of this study was to determine the prediction of locus of control and self-esteem in academic achievement among the students. Materials and Methods This cross-sectional study was conducted on 300 college students in Kermanshah University of Medical Sciences in 2014. Data collection tools were in three sections: demographic, Rotter internal-external locus of control scale and Coopersmith self-esteem inventory. Data were analyzed using the SPSS software version 21. Results Results showed that 29.8% and 76.2% of the participants had internal locus of control, and high self-esteem, respectively. There was a significant correlation between self-esteem, locus of control and academic achievement of the students. Self-esteem accounted for 39.5% of the variation in academic achievement. Conclusions It seems that interventions to increase self-esteem among student can help improve academic achievement among them. PMID:27284277

  3. [The assessment of the level of coping style and health locus of control in patients with coronary heart disease and hypertension].

    PubMed

    Opuchlik, Katarzyna; Wrzesińska, Magdalena; Kocur, Józef

    2009-01-01

    The assessment of the level of coping style and health locus of control in patients with coronary heart disease and hypertension. The sample studied consisted of 112 patients (81 M, 31 F) at the age of 35-65 years. Two groups participated in the study; first with coronary heart disease and hypertension and second with hypertension without other diseases. The Coping Inventory for Stressful Situation and Multidimensional Health Locus of Control Scale were used in the study. Two groups of patients used the most frequent task-oriented coping style. The significant differences were seen between groups in the external health locus of control (t = 2.113; p < 0.05); patients with coronary heart disease and hypertension revealed the strongest conviction that their health depended on other people. Patients with coronary heart disease and hypertension choose the task-oriented coping style. Patients with hypertension declare for internal health locus of control. Patients with coronary heart disease and hypertension declare for external locus of control.

  4. How does locus of control and inflated sense of responsibility relate to obsessive-compulsive symptoms in Turkish adolescents?

    PubMed

    Altin, Müjgan; Karanci, A Nuray

    2008-12-01

    This study aimed to examine the effects of responsibility attitudes, locus of control and their interactions on the general obsessive-compulsive (OC) symptomatology and the dimensions of OC symptoms in a sample of Turkish adolescents (n=385), their ages varied from 16 to 20 with a mean of 17.23 (S.D.=.68). The results of the present study revealed a significantly positive relationship between responsibility attitudes and general OC symptomatology. However, locus of control did not appear as a significant predictor of general OC symptomatology. Furthermore, results revealed that there was a significant interaction effect of responsibility attitudes with locus of control on OC symptomatology. That is, an inflated sense of responsibility and the presence of an external locus of control produced the highest level of OC symptoms. Related to the dimensions of OC symptoms, responsibility was a weak predictor of obsessive thinking symptoms, and a moderate predictor of cleanliness and checking symptoms. Locus of control and its interaction with responsibility attitudes only significantly predicted obsessional thinking symptoms.

  5. IVS-II-648/649 (-T) (HBB: c.316-202del) Triggers a Novel β-Thalassemia Phenotype.

    PubMed

    Azimi, Azam; Alibakhshi, Reza; Hayati, Hasibeh; Tahmasebi, Soosan; Alimoradi, Sasan

    2017-01-01

    Thalassemia is the most common inherited disorder in Iran. There are approximately 800 different genomic alterations of the β-globin gene described in the HbVar database. In this study, we identified a novel mutation in a 21-year-old woman [IVS-II-648/649 (-T); HBB: c.316-202del)] and describe its clinical implications. Two other members of this family, all with hematological and clinical features associated with β-thalassemia (β-thal), also carried this mutation. The molecular diagnosis of the β-globin gene mutation was performed by direct sequencing. Based on the observed β-thal phenotype and in silico analysis results, we concluded that this novel β-globin gene mutation was associated with the mild phenotype of β-thal.

  6. A Mouse β-Globin Mutant That Is an Exact Model of Hemoglobin Rainier in Man

    PubMed Central

    Peters, J.; Andrews, S. J.; Loutit, J. F.; Clegg, J. B.

    1985-01-01

    A mutation induced by ethylnitrosourea in a spermatogonial stem cell of a 101/H mouse has resulted in a structurally altered β-diffuse major globin in one of his offspring. The mutant hemoglobin is associated with polycythemia, rubor, increased oxygen affinity and decreased hem-hem interaction. The mutant haplotype has been designated Hbb d4, polycythemia. Amino acid analysis of the mutant globin has shown that a single substitution β145 Tyr → Cys has occurred, and it is proposed that ethylnitrosourea induced an A → G transition in the tyrosine codon (TAC → TGC). This murine polycythemia is homologous with hemoglobin Rainier in man, in which the amino acid substitution is also β145 Tyr → Cys and which is associated with similar physiological consequences. PMID:3839762

  7. Isolation and genetic study of p-fluoro-DL-phenylalanine-resistant mutants overproducing beta-phenethyl-alcohol in Saccharomyces cerevisiae.

    PubMed

    Fukuda, K; Watanabe, M; Asano, K; Ouchi, K; Takasawa, S

    1991-12-01

    p-Fluoro-DL-phenylalanine (PFP)-resistant mutants which produce a large amount of beta-phenethyl-alcohol, a rose-like flavor component, were isolated from the isogenic strains X2180-1A and X2180-1B of Saccharomyces cerevisiae. Cells of these mutants accumulated phenylalanine and tryptophan more than 3-fold times that of wild-type cells, while they accumulated less than half the tyrosine. The activity of prephenate dehydrogenase (PDG) (EC 1.3.1.12) was markedly decreased while that of 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 4.1.2.15) was increased. Genetic analysis revealed that the mutation occurred at the TYR1 locus, encoding PDG, and that the mutated TYR1 gene, try1-pfp, caused both PFP resistance and beta-phenethyl-alcohol overproduction. This was supported by molecular genetic studies with cloned tyr1-pfp DNA.

  8. Relationship between healthy lifestyle behaviors and health locus of control and health-specific self-efficacy in university students.

    PubMed

    Açıkgöz Çepni, Serap; Kitiş, Yeter

    2017-07-01

    To investigate the relationship between the healthy lifestyle behaviors and the health locus of control and health-specific self-efficacy in university students. The study included 572 undergraduate students of a university in the central Anatolia region of Turkey. The data were collected with the General Characteristics Form, the Health-Promoting Lifestyle Profile II, the Multidimensional Health Locus of Control Scale, and the Perceived Health Competence Scale and investigated with the structural equation model. Health-specific self-efficacy was an important predictor of healthy lifestyle behaviors. The Internal health locus of control influenced the healthy lifestyle behaviors through health-specific self-efficacy. The other dimension was the Powerful Others health locus of control that affected healthy lifestyle behaviors, both directly and indirectly, through health-specific self-efficacy. There was a chance that the health locus of control had a negative effect on healthy lifestyle behaviors through self-efficacy. Health-specific self-efficacy is an important prerequisite for changes in healthy lifestyle behaviors, which supports Pender's model. The subscales of the health locus of control vary in their effects on healthy lifestyle behaviors, which partly supports Pender's model. Nurses, by using this model, can examine ways of improving these cognitive-perceptual factors and implement health education programs that are directed towards improving them in young persons. © 2016 Japan Academy of Nursing Science.

  9. Locus of control, quality of life, anxiety, and depression among Malaysian breast cancer patients: The mediating role of uncertainty.

    PubMed

    Pahlevan Sharif, Saeed

    2017-04-01

    The main objective of this study was to investigate the mediating role of uncertainty in the relationship between locus of control with quality of life, anxiety, and depression. A descriptive and correlational survey was conducted in a private hospital in Kuala Lumpur, Malaysia. A convenience sample of 118 Malaysian breast cancer patients voluntarily participated in the study and responded to a set of questionnaires including: socio-demographic questionnaire, the short form of Locus of Control Scale, the Functional Assessment of Cancer Therapy-Breast (FACT-B), the Hospital Anxiety and Depression Scale (HADS), and the Short-Form Mishel Uncertainty in Illness Scale (SF-MUIS). The results revealed that breast cancer patients with higher internal locus of control and lower external locus of control experience a higher quality of life, lower anxiety, and lower depression. Also, uncertainty mediated the relationship between locus of control with quality of life and depression (quasi-significant). The findings indicated the need for early, targeted psychological interventions seeking to gradually shift cancer patients' locus of control from external to internal in order to improve their quality of life and reduce their depression and anxiety. Moreover, health care providers by providing relevant information to cancer patients, especially for externally oriented patients, can reduce their uncertainty which in turn would improve their quality of life. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Perception of Locus of Control as a Predictor of Attitude Toward Students' Evaluation of University Faculty. AIR Forum Paper 1978.

    ERIC Educational Resources Information Center

    Kohler, Emmett T.; Christal, Melodie E.

    Student and faculty attitudes about faculty evaluation and the relationship of the attitudes to the concept of locus of control were investigated. Student respondents consisted of 172 males and 256 females, and 108 faculty responses were received. The measure of locus of control closely resembles the Rotter Internal-External Control Scale. Student…

  11. Effect of individualized goal-setting on college biology students' locus of control

    NASA Astrophysics Data System (ADS)

    Schafer, John E.

    This study investigated the effect of Individualized Goal-Setting A-T, relative to Classic A-T, on a student's locus of control (generalized and academic). This study also examined the effect of pretesting, relative to no pretesting, on a student's locus of control. Sixty students in an introductory, Audio-Tutorial, college zoology course were randomly assigned to treatment and control groups. Control groups (Classic A-T) completed the course in the usual manner. Treatment groups (IGS A-T) completed the course in the usual manner with one exception. That is, they used a different format for Optional Minicourse mastery. This new format released greater control to students over means as well as ends of minicourse mastery. Data were collected through use of the Solomon Four-Group design, with two levels of treatment (Classic A-T, IGS A-T) and two levels of pretesting (pretest, no pretest). Instruments included the Rotter I-E and Schafer Academic I-E Locus of Control Scales. Posttest scores were analyzed by a 2 × 2 multivariate analysis of variance (MANOVA).The following conclusions were made (p < 0.10).1IGS A-T, relative to Classic A-T, has no significant effect on a student's locus of control.2Pretesting, relative to no pretesting, has no significant effect on posttest locus of control.

  12. Gene therapy for sickle cell disease: An update.

    PubMed

    Demirci, Selami; Uchida, Naoya; Tisdale, John F

    2018-05-30

    Sickle cell disease (SCD) is one of the most common life-threatening monogenic diseases affecting millions of people worldwide. Allogenic hematopietic stem cell transplantation is the only known cure for the disease with high success rates, but the limited availability of matched sibling donors and the high risk of transplantation-related side effects force the scientific community to envision additional therapies. Ex vivo gene therapy through globin gene addition has been investigated extensively and is currently being tested in clinical trials that have begun reporting encouraging data. Recent improvements in our understanding of the molecular pathways controlling mammalian erythropoiesis and globin switching offer new and exciting therapeutic options. Rapid and substantial advances in genome engineering tools, particularly CRISPR/Cas9, have raised the possibility of genetic correction in induced pluripotent stem cells as well as patient-derived hematopoietic stem and progenitor cells. However, these techniques are still in their infancy, and safety/efficacy issues remain that must be addressed before translating these promising techniques into clinical practice. Published by Elsevier Inc.

  13. Effects of Transcendental Meditation and Muscle Relaxation on Trait Anxiety, Maladjustment, Locus of Control, and Drug Use.

    ERIC Educational Resources Information Center

    Zuroff, David C.; Schwarz, J. Conrad

    1978-01-01

    Undergraduates received training in transcendental mediations (TM), training in a muscle relaxation technique, or no treatment. Measures of trait anxiety, locus of control, maladjustment, and drug use were collected before and after the treatment period. There were no differences in maladjustment, locus of control, or drug use as functions of…

  14. Using Science Activities To Internalize Locus of Control and Influence Attitudes towards Science.

    ERIC Educational Resources Information Center

    Rowland, Paul McD.

    This study investigated the relationships between science activities that emphasize cause-and-effect and a learner's locus of control. Pretests included the Nowicki-Strickland Abbreviated Scale 7-12 to measure locus of control, and a modification of the Test of Science Related Attitudes to measure attitudes toward science. The findings suggest…

  15. Maternal Locus of Control and Developmental Gain Demonstrated by High Risk Infants: A Longitudinal Analysis.

    ERIC Educational Resources Information Center

    Maisto, Albert A.; German, Michael L.

    1981-01-01

    Short- and long-term effects of a parent-infant training program for biologically handicapped infants was evaluated in terms of maternal locus of control. Results indicated that maternal locus of control accounted for a substantial portion of the variance in the infants' developmental gains following the program intervention period. (Author/RH)

  16. An Examination of Locus of Control, Epistemological Beliefs and Metacognitive Awareness in Preservice Early Childhood Teachers

    ERIC Educational Resources Information Center

    Bedel, Emine Ferda

    2012-01-01

    This study aims to explore the locus of control, epistemological beliefs and metacognitive awareness levels of preservice early childhood education teachers and to determine the interrelations among these variables. 206 teacher candidates have been asked to fill out Rotter's Internal-External Locus of Control Scale, Central Epistemological Beliefs…

  17. Anxiety, locus of control and appraisal of air pollution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Navarro, P.L.; Simpson-Housley, P.; de Man, A.F.

    1987-06-01

    100 residents of Santiago de Chile took part in a study of the relationship among locus of control, trait-anxiety, and perception of air pollution. Concern over the problem of atmospheric pollution and number of antipollution measures taken was related to trait-anxiety. Locus of control was associated with variation in awareness of pollution hazard.

  18. Locus of Control, Perceptions and Attributions of Student Teachers in Educational Situations.

    ERIC Educational Resources Information Center

    Kremer, Lya; Kurtz, Chaya

    Student teachers' perceptions of locus of control was investigated. Locus of control is defined as representing the extent of dependence upon inner or outer forces, the extent one is willing to invest in shaping the environment, and the perception of reinforcement as dependent upon those efforts, or upon random events. The specific questions were:…

  19. Predictors of Parental Locus of Control in Mothers of Pre- and Early Adolescents

    ERIC Educational Resources Information Center

    Freed, Rachel D.; Tompson, Martha C.

    2011-01-01

    Parental locus of control refers to parents' perceived power and efficacy in child-rearing situations. This study explored parental locus of control and its correlates in 160 mothers of children ages 8 to 14 cross-sectionally and 1 year later. Maternal depression, maternal expressed emotion, and child internalizing and externalizing behavior were…

  20. Personality and Locus of Control among School Children

    ERIC Educational Resources Information Center

    Pandya, Archana A.; Jogsan, Yogesh A.

    2013-01-01

    The main purpose of this investigation is to find out the sex differences in personality traits and locus of control among school children. A total 60 children (30 boys and 30 girls) were taken as a sample. The research tool for personality, children personality questionnaire was used, which was made by Cattell and Porter. Locus of control was…

Top