Science.gov

Sample records for beta-lactamase resistance genes

  1. Multidrug resistance mediated by co-carriage of extended-spectrum beta-lactamases, AmpC and New Delhi metallo-beta-lactamase-1 genes among carbapenem-resistant Enterobacteriaceae at five Indian medical centres.

    PubMed

    Manoharan, A; Barla, G S; Peter, R; Sugumar, M; Mathai, D

    2016-01-01

    In this study, we evaluated the coexistence of extended-spectrum beta-lactamases (ESBL), AmpC and New Delhi metallo-beta-lactamase-1 (NDM-1) genes among carbapenem-resistant Enterobacteriaceae (CRE) recovered prospectively from patients at multiple sites. The study included 285 CRE strains from 2782 Gram-negative Bacilli collected from multiple centres during 2007-2010, of which 87 were characterised. Standard and reference laboratory methods were used for resistance determination. Detection of blaNDM-1 , blaAmpC , blaTEM , blaSHV and blaCTX-M was done by polymerase chain reaction. High levels of antimicrobial resistance observed among study isolates. Co-carriage of ESBLs, AmpC and NDM-1 was 26.3%. Nosocomial origin among the co-carriage isolates was 64.3%, with 9.2% associated mortality. PMID:27514962

  2. Characterization of a new beta-lactamase gene from isolates of Vibrio spp. in Korea.

    PubMed

    Jun, Lyu Jin; Kim, Jae Hoon; Jin, Ji Woong; Jeong, Hyun Do

    2012-04-01

    PCR was performed to analyze the beta-lactamase genes carried by ampicillin-resistant Vibrio spp. strains isolated from marine environments in Korea between 2006 and 2009. All 36 strains tested showed negative results in PCR with the primers designed from the nucleotide sequences of various known beta-lactamase genes. This prompted us to screen new beta-lactamase genes. A novel beta-lactamase gene was cloned from Vibrio alginolyticus KV3 isolated from the aquaculture water of Geoje Island of Korea. The determined nucleotide sequence (VAK-3 beta-lactamase) revealed an open reading frame (ORF) of 852 bp, encoding a protein of 283 amino acids (aa), which displayed low homology to any other beta-lactamase genes reported in public databases. The deduced 283 aa sequence of VAK-3, consisting of a 19 aa signal peptide and a 264 aa mature protein, contained highly conserved peptide segments specific to class A beta-lactamases including the specific amino acid residues STFK (62-65), SDN (122-124), E (158), and RTG (226-228). Results from PCR performed with primers specific to the VAK-3 beta-lactamase gene identified 3 of the 36 isolated strains as V. alginolyticus, Vibrio cholerae, and Photobacterium damselae subsp. damselae, indicating the utilization of various beta-lactamase genes including unidentified ones in ampicillin-resistant Vibrio spp. strains from the marine environment. In a mating experiment, none of the isolates transfered the VAK-3 beta-lactamase gene to the Escherichia coli recipient. This lack of mobility, and the presence of a chromosomal acyl-CoA flanking sequence upstream of the VAK-3 beta- lactamase gene, led to the assumption that the location of this new beta-lactamase gene was in the chromosome, rather than the mobile plasmid. Antibiotic susceptibility of VAK-3 beta-lactamase was indicated by elevated levels of resistance to penicillins, but not to cephalosporins in the wild type and E. coli harboring recombinant plasmid pKV-3, compared with those of

  3. Extended spectrum beta-lactamase and fluoroquinolone resistance genes and plasmids among Escherichia coli isolates from zoo animals, Czech Republic.

    PubMed

    Dobiasova, Hana; Dolejska, Monika; Jamborova, Ivana; Brhelova, Eva; Blazkova, Lucie; Papousek, Ivo; Kozlova, Marketa; Klimes, Jiri; Cizek, Alois; Literak, Ivan

    2013-09-01

    Commensal Escherichia coli isolates from healthy zoo animals kept in Ostrava Zoological Garden, Czech Republic, were investigated to evaluate the dissemination of extended-spectrum beta-lactamase (ESBL) and plasmid-mediated quinolone resistance (PMQR) genes. A total of 160 faecal samples of various animal species were inoculated onto MacConkey agar with cefotaxime (2 mg L(-1)) or ciprofloxacin (0.05 mg L(-1)) to obtain ESBL- or PMQR-positive E. coli isolates. Clonality of E. coli isolates was investigated by multilocus sequence typing and pulsed-field gel electrophoresis. Plasmids carrying ESBL or PMQR genes were typed by PCR-based replicon typing, plasmid multilocus sequence typing and restriction fragment length polymorphism. Forty-nine (71%, n = 69) cefotaxime-resistant and 15 (16%, n = 94) ciprofloxacin-resistant E. coli isolates harboured ESBL or PMQR genes. Isolates were assigned to 18 sequence types (ST) and 20 clusters according to their macrorestriction patterns by pulsed-field gel electrophoresis. The genes blaCTX -M-1 and qnrS1 were detected on highly related IncI1 plasmids assigned to clonal complex 3 (ST3, ST38) and on non-related IncN plasmids of ST1 and ST3, respectively. The gene qnrS1 was located on related IncX1 plasmids. Dissemination of antibiotic resistance is associated with spreading of particular E. coli clones and plasmids of specific incompatibility groups among various animal species.

  4. beta-Lactamases in laboratory and clinical resistance.

    PubMed Central

    Livermore, D M

    1995-01-01

    beta-Lactamases are the commonest single cause of bacterial resistance to beta-lactam antibiotics. Numerous chromosomal and plasmid-mediated types are known and may be classified by their sequences or phenotypic properties. The ability of a beta-lactamase to cause resistance varies with its activity, quantity, and cellular location and, for gram-negative organisms, the permeability of the producer strain. beta-Lactamases sometimes cause obvious resistance to substrate drugs in routine tests; often, however, these enzymes reduce susceptibility without causing resistance at current, pharmacologically chosen breakpoints. This review considers the ability of the prevalent beta-lactamases to cause resistance to widely used beta-lactams, whether resistance is accurately reflected in routine tests, and the extent to which the antibiogram for an organism can be used to predict the type of beta-lactamase that it produces. PMID:8665470

  5. Molecular characterization of the gene encoding SHV-3 beta-lactamase responsible for transferable cefotaxime resistance in clinical isolates of Klebsiella pneumoniae.

    PubMed Central

    Nicolas, M H; Jarlier, V; Honore, N; Philippon, A; Cole, S T

    1989-01-01

    In Klebsiella pneumoniae 86-4, cefotaxime resistance was due to a transferable broad-spectrum beta-lactamase, SHV-3. The plasmid-borne gene encoding SHV-3 has been cloned, and the primary structure of the enzyme was deduced from its nucleotide sequence. SHV-3 differs from SHV-1 in two positions. The extended substrate profile of SHV-3 probably results from the substitution of Ser-213 for Gly, as in SHV-2, whereas replacement of Arg-180 by Leu resulted in a decrease in the pI from 7.6 to 7.0. The blashv-3 gene is highly homologous (92% DNA sequence identity) with the chromosomal gene coding for LEN-1 beta-lactamase of K. pneumoniae, suggesting that the origin of the SHV-encoding genes now present on many plasmids may be chromosomal. Images PMID:2694951

  6. Beta-lactamase gene expression in a penicillin-resistant Bacillus anthracis strain.

    PubMed

    Chen, Yahua; Tenover, Fred C; Koehler, Theresa M

    2004-12-01

    Expression of the bla1 and bla2 genes in an archetypal Bacillus anthracis strain is insufficient for penicillin resistance. In a penicillin-resistant clinical isolate, both genes are highly transcribed, but bla1 is the major contributor to high-level resistance to ampicillin. Differential expression of the bla genes is dependent upon strain background. PMID:15561870

  7. [Development of Beta-lactamase resistance in enterobacteria].

    PubMed

    Koren, Ján; Vaculíková, Alena

    2006-06-01

    Enterobacteria produce elementary chromosomal enzymes, Beta-lactamases of class A: TEM and SHV (Escherichia coli, Klebsiella pneumoniae). These can give rise to plasmid-coded broad-spectrum Beta-lactamases (ESBL) discovered in 1980 (E. coli, K. pneumoniae, Enterobacter cloacae). The first cefotaximase (CTX-M, MEN-1) was reported in Europe in 1990. This enzyme is far more active against cefotaxime than against ceftazidime and aztreonam. Chromosomal hyperpoduction of K1 Beta-lactamase differs from all other ESBLs due its sensitivity to ceftazidime (Klebsiella oxytoca). However, not all enterobacteria are resistant only because of ESBLs, but also as a result of the action of chromosomally or plasmid coded AmpC Beta-lactamase of class C (MIR-1, CMY-1, BIL-1, FOX-1, MOX-1, DHA-1, ACC-1), resistant to Beta-lactamase inhibitors and to cefoxitin (Enterobacter spp., Proteus vulgaris, Citrobacter freundii, Morganelle spp., Serratia spp.). With the loss of outside-membrane porins (OMP) they can become resistant to carbapenem an tibiotics. The 100% resistance of enterobacteria to carbapenems that so far exists in this country is elsewhere in the world compromised by the incidence of carbapenem-hydrolysing plasmid-determined Beta-lactamase of class B (IMP-1, VIM-1) and of class A (KPC-1) in K. pneumoniae, (SME-1) in Serratia marcescens and (IMI-1, NMC-A) in E. clocae. Carbapenemases in enterobacteria are only effective in the presence of impermeability and other resistance mechanisms.

  8. Nucleotide sequence of SHV-2 beta-lactamase gene

    SciTech Connect

    Garbarg-Chenon, A.; Godard, V.; Labia, R.; Nicolas, J.C. )

    1990-07-01

    The nucleotide sequence of plasmid-mediated beta-lactamase SHV-2 from Salmonella typhimurium (SHV-2pHT1) was determined. The gene was very similar to chromosomally encoded beta-lactamase LEN-1 of Klebsiella pneumoniae. Compared with the sequence of the Escherichia coli SHV-2 enzyme (SHV-2E.coli) obtained by protein sequencing, the deduced amino acid sequence of SHV-2pHT1 differed by three amino acid substitutions.

  9. beta-Lactam resistance and beta-lactamases in bacteria of animal origin.

    PubMed

    Li, Xian-Zhi; Mehrotra, Manisha; Ghimire, Shiva; Adewoye, Lateef

    2007-04-15

    beta-Lactams are among the most clinically important antimicrobials in both human and veterinary medicine. Bacterial resistance to beta-lactams has been increasingly observed in bacteria, including those of animal origin. The mechanisms of beta-lactam resistance include inaccessibility of the drugs to their target, target alterations and/or inactivation of the drugs by beta-lactamases. The latter contributes predominantly to beta-lactam resistance in Gram-negative bacteria. A variety of beta-lactamases have been identified in bacteria derived from food-producing and companion animals and may further serve as a reservoir for beta-lactamase-producing bacteria in humans. While this review mainly describes beta-lactamases from animal-derived Escherichia coli and Salmonella spp., beta-lactamases from animal-derived Campylobacter spp., Enterococcus spp., Staphylococcus spp. and other pathogens are also discussed. Of particular concern are the increasingly-isolated plasmid-encoded AmpC-type CMY and extended-spectrum CTX-M beta-lactamases, which mediate acquired resistance to extended-spectrum beta-lactams. The genes encoding these enzymes often coexist with other antimicrobial resistance determinants and can also be associated with transposons/integrons, increasing the potential enrichment of multidrug resistant bacteria by multiple antimicrobial agents as well as dissemination of the resistance determinants among bacterial species. Characterization of beta-lactam-resistant animal-derived bacteria warrants further investigation of the type and distribution of beta-lactamases in bacteria of animal origin and their potential impact on human medicine.

  10. Inhibitor-resistant TEM (IRT) beta-lactamases with different substitutions at position 244.

    PubMed Central

    Bret, L; Chaibi, E B; Chanal-Claris, C; Sirot, D; Labia, R; Sirot, J

    1997-01-01

    A novel inhibitor-resistant TEM (IRT) beta-lactamase was detected in an Escherichia coli isolate resistant to amoxicillin-clavulanate and susceptible to cephalothin. The substrate and inhibitor profiles of this beta-lactamase were similar to those of IRT-1 and IRT-2. The novel IRT's bla gene was sequenced, and the deduced amino acid sequence showed the amino acid replacement Arg for His-244 of the TEM-1 sequence. Substitutions for Arg-244 have been reported in three TEM-1 mutants: IRT-1 (which corresponds to TEM-31) (Cys), IRT-2/TEM-30 (Ser), and TEM-41 (Thr). We designated this novel beta-lactamase, which corresponds to TEM-51, IRT-15. PMID:9371365

  11. Metal resistance in Acinetobacter and its relation to beta-lactamase production.

    PubMed

    Deshpande, L M; Kapadnis, B P; Chopade, B A

    1993-01-01

    Thirty nine clinical isolates of Acinetobacter belonging to six species were tested for resistance to 20 metal ions and their ability to produce beta-lactamase. Fifty two percent of the strains produced beta-lactamase. beta-Lactamase producers and non-producers were almost equally distributed in the different species. A. baumannii was the predominant biotype and was found to be most resistant to metals. Resistance to mercury was prevalent in beta-lactamase-producing A. baumannii only. Silver resistant strains of A. baumannii produced beta-lactamase. Sensitivity and resistance to copper and cadium was equally distributed between beta-lactamase producers and non-producers. beta-Lactamase-producer and -non-producer strains were uniformly sensitive to cadmium except Acinetobacter genospecies 1.

  12. Detection of Extended Spectrum Beta-Lactamases Resistance Genes among Bacteria Isolated from Selected Drinking Water Distribution Channels in Southwestern Nigeria.

    PubMed

    Adesoji, Ayodele T; Ogunjobi, Adeniyi A

    2016-01-01

    Extended Spectrum Beta-Lactamases (ESBL) provide high level resistance to beta-lactam antibiotics among bacteria. In this study, previously described multidrug resistant bacteria from raw, treated, and municipal taps of DWDS from selected dams in southwestern Nigeria were assessed for the presence of ESBL resistance genes which include bla TEM, bla SHV, and bla CTX by PCR amplification. A total of 164 bacteria spread across treated (33), raw (66), and municipal taps (68), belonging to α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Flavobacteriia, Bacilli, and Actinobacteria group, were selected for this study. Among these bacteria, the most commonly observed resistance was for ampicillin and amoxicillin/clavulanic acid (61 isolates). Sixty-one isolates carried at least one of the targeted ESBL genes with bla TEM being the most abundant (50/61) and bla CTX being detected least (3/61). Klebsiella was the most frequently identified genus (18.03%) to harbour ESBL gene followed by Proteus (14.75%). Moreover, combinations of two ESBL genes, bla SHV + bla TEM or bla CTX + bla TEM, were observed in 11 and 1 isolate, respectively. In conclusion, classic bla TEM ESBL gene was present in multiple bacterial strains that were isolated from DWDS sources in Nigeria. These environments may serve as foci exchange of genetic traits in a diversity of Gram-negative bacteria.

  13. Detection of Extended Spectrum Beta-Lactamases Resistance Genes among Bacteria Isolated from Selected Drinking Water Distribution Channels in Southwestern Nigeria

    PubMed Central

    Ogunjobi, Adeniyi A.

    2016-01-01

    Extended Spectrum Beta-Lactamases (ESBL) provide high level resistance to beta-lactam antibiotics among bacteria. In this study, previously described multidrug resistant bacteria from raw, treated, and municipal taps of DWDS from selected dams in southwestern Nigeria were assessed for the presence of ESBL resistance genes which include blaTEM, blaSHV, and blaCTX by PCR amplification. A total of 164 bacteria spread across treated (33), raw (66), and municipal taps (68), belonging to α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Flavobacteriia, Bacilli, and Actinobacteria group, were selected for this study. Among these bacteria, the most commonly observed resistance was for ampicillin and amoxicillin/clavulanic acid (61 isolates). Sixty-one isolates carried at least one of the targeted ESBL genes with blaTEM being the most abundant (50/61) and blaCTX being detected least (3/61). Klebsiella was the most frequently identified genus (18.03%) to harbour ESBL gene followed by Proteus (14.75%). Moreover, combinations of two ESBL genes, blaSHV + blaTEM or blaCTX + blaTEM, were observed in 11 and 1 isolate, respectively. In conclusion, classic blaTEM ESBL gene was present in multiple bacterial strains that were isolated from DWDS sources in Nigeria. These environments may serve as foci exchange of genetic traits in a diversity of Gram-negative bacteria. PMID:27563674

  14. Detection of Extended Spectrum Beta-Lactamases Resistance Genes among Bacteria Isolated from Selected Drinking Water Distribution Channels in Southwestern Nigeria.

    PubMed

    Adesoji, Ayodele T; Ogunjobi, Adeniyi A

    2016-01-01

    Extended Spectrum Beta-Lactamases (ESBL) provide high level resistance to beta-lactam antibiotics among bacteria. In this study, previously described multidrug resistant bacteria from raw, treated, and municipal taps of DWDS from selected dams in southwestern Nigeria were assessed for the presence of ESBL resistance genes which include bla TEM, bla SHV, and bla CTX by PCR amplification. A total of 164 bacteria spread across treated (33), raw (66), and municipal taps (68), belonging to α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Flavobacteriia, Bacilli, and Actinobacteria group, were selected for this study. Among these bacteria, the most commonly observed resistance was for ampicillin and amoxicillin/clavulanic acid (61 isolates). Sixty-one isolates carried at least one of the targeted ESBL genes with bla TEM being the most abundant (50/61) and bla CTX being detected least (3/61). Klebsiella was the most frequently identified genus (18.03%) to harbour ESBL gene followed by Proteus (14.75%). Moreover, combinations of two ESBL genes, bla SHV + bla TEM or bla CTX + bla TEM, were observed in 11 and 1 isolate, respectively. In conclusion, classic bla TEM ESBL gene was present in multiple bacterial strains that were isolated from DWDS sources in Nigeria. These environments may serve as foci exchange of genetic traits in a diversity of Gram-negative bacteria. PMID:27563674

  15. Prevalence and distribution of beta-lactamase coding genes in third-generation cephalosporin-resistant Enterobacteriaceae from bloodstream infections in Cambodia.

    PubMed

    Vlieghe, E R; Huang, T-D; Phe, T; Bogaerts, P; Berhin, C; De Smet, B; Peetermans, W E; Jacobs, J A; Glupczynski, Y

    2015-06-01

    Resistance to third-generation cephalosporins in Gram-negative bacteria is emerging in Asia. We report the prevalence and distribution of extended-spectrum beta-lactamase (ESBL), AmpC beta-lactamase and carbapenemase-coding genes in cefotaxime-resistant Enterobacteriaceae isolates from bloodstream infections (BSI) in Cambodia. All Enterobacteriaceae isolated from BSI in adult patients at Sihanouk Hospital Centre of HOPE, Phnom Penh, Cambodia (2007-2010) were assessed. Antimicrobial susceptibility testing was carried out by disc diffusion and MicroScan according to Clinical and Laboratory Standards Institute (CLSI) guidelines. Screening for ESBL, plasmidic AmpC and carbapenemase-coding genes was performed by multiplex polymerase chain reaction (PCR) sequencing assays. Identification of the ST131 clone was performed in all CTX-M-positive Escherichia coli, using PCR targeting the papB gene. Out of 183 Enterobacteriaceae, 91 (49.7 %) isolates (84 BSI episodes) were cefotaxime-resistant: E. coli (n = 68), Klebsiella pneumoniae (n = 17) and Enterobacter spp. (n = 6). Most episodes were community-acquired (66/84; 78.3 %). ESBLs were present in 89/91 (97.8 %) cefotaxime-resistant isolates: 86 (96.6 %) were CTX-M, mainly CTX-M-15 (n = 41) and CTX-M-14 (n = 21). CTX-M of group 1 were frequently associated with TEM and/or OXA-1/30 coding genes and with phenotypic combined resistance to ciprofloxacin, sulphamethoxazole-trimethoprim and gentamicin (39/50, 78.0 %). Plasmidic AmpC (CMY-2 and DHA-1 types) were found alone (n = 2) or in combination with ESBL (n = 4). Eighteen E. coli isolates were identified as B2-ST131-O25B: 11 (61.1 %) carried CTX-M-14. No carbapenemase-coding genes were detected. ESBL among Enterobacteriaceae from BSI in Cambodia is common, mainly associated with CTX-M-15 and CTX-M-14. These findings warrant urgent action for the containment of antibiotic resistance in Cambodia.

  16. Beta-lactamase genes of the penicillin-susceptible Bacillus anthracis Sterne strain.

    PubMed

    Chen, Yahua; Succi, Janice; Tenover, Fred C; Koehler, Theresa M

    2003-02-01

    Susceptibility to penicillin and other beta-lactam-containing compounds is a common trait of Bacillus anthracis. Beta-lactam agents, particularly penicillin, have been used worldwide to treat anthrax in humans. Nonetheless, surveys of clinical and soil-derived strains reveal penicillin G resistance in 2 to 16% of isolates tested. Bacterial resistance to beta-lactam agents is often mediated by production of one or more types of beta-lactamases that hydrolyze the beta-lactam ring, inactivating the antimicrobial agent. Here, we report the presence of two beta-lactamase (bla) genes in the penicillin-susceptible Sterne strain of B. anthracis. We identified bla1 by functional cloning with Escherichia coli. bla1 is a 927-nucleotide (nt) gene predicted to encode a protein with 93.8% identity to the type I beta-lactamase gene of Bacillus cereus. A second gene, bla2, was identified by searching the unfinished B. anthracis chromosome sequence database of The Institute for Genome Research for open reading frames (ORFs) predicted to encode beta-lactamases. We found a partial ORF predicted to encode a protein with significant similarity to the carboxy-terminal end of the type II beta-lactamase of B. cereus. DNA adjacent to the 5' end of the partial ORF was cloned using inverse PCR. bla2 is a 768-nt gene predicted to encode a protein with 92% identity to the B. cereus type II enzyme. The bla1 and bla2 genes confer ampicillin resistance to E. coli and Bacillus subtilis when cloned individually in these species. The MICs of various antimicrobial agents for the E. coli clones indicate that the two beta-lactamase genes confer different susceptibility profiles to E. coli; bla1 is a penicillinase, while bla2 appears to be a cephalosporinase. The beta-galactosidase activities of B. cereus group species harboring bla promoter-lacZ transcriptional fusions indicate that bla1 is poorly transcribed in B. anthracis, B. cereus, and B. thuringiensis. The bla2 gene is strongly expressed in B

  17. Identification of a streptomycin resistance gene and a partial Tn3 transposon coding for a beta-lactamase in a periodontal strain of Eikenella corrodens.

    PubMed Central

    Lacroix, J M; Walker, C B

    1992-01-01

    The beta-lactamase gene from a periodontal strain of Eikenella corrodens, resistant to penicillins and streptomycin, was inserted into pBGS9 and transformed into Escherichia coli DH5 alpha. A 4.7-kb insert of pJML1, one of the transformants, was partially sequenced and found to contain the right section of transposon Tn3 from the middle of the TnpR resolvase gene to the right inverted repeat RI(R), including the TEM-1 gene. Sequences identical to RSF1010 were found on either side of the Tn3 sequence. pJML1 also contained a streptomycin resistance gene, probably identical to that of RSF1010. A portion of the pJML1 insert was not homologous to either Tn3 or RSF1010 but was homologous to the chromosomal DNA of E. corrodens ATCC 23834. It is assumed that the insert of pJML1 was derived from the chromosomal DNA of E. corrodens EC-38. PMID:1323951

  18. Transposition of the gene encoding a TEM-12 extended-spectrum beta-lactamase.

    PubMed Central

    Heritage, J; Hawkey, P M; Todd, N; Lewis, I J

    1992-01-01

    An isolate of Klebsiella oxytoca from the blood culture of a child with leukemia was found to produce two beta-lactamases, at least one of which conferred resistance to ceftazidime. Genes encoding both enzymes were located on a single self-transmissible 100-kb plasmid, pOZ201. This plasmid was introduced into Escherichia coli UB5201 (pACYC184), and the gene encoding one beta-lactamase was transposed onto plasmid pACYC184 by exploiting a gene dosage effect. The transposable gene was found to encode a TEM-12 enzyme as determined by nucleotide sequencing. This gene was subsequently transposed onto plasmid pUB307. The transposable element encoding the TEM-12 enzyme has been designated Tn841. Both plasmids pACYC184::Tn841 and pUB307::Tn841 were shown to encode a beta-lactamase with the same isoelectric point and substrate profile as the TEM-12 beta-lactamase. Transposon Tn841, at approximately 7 kb, is larger than TnA (4.8 kb) and transposes at a lower frequency. Although it produced a resolvase which can complement the resolvase of Tn3, its transposase function was not able to complement the transposition of a TnA element which lacked transposase. The occurrence of a gene encoding an extended-spectrum beta-lactamase on a transposable element in a clinically significant bacterium is potentially a cause for concern for the spread of resistance to the extended-spectrum cephalosporins. PMID:1329636

  19. An extracytoplasmic function sigma factor controls beta-lactamase gene expression in Bacillus anthracis and other Bacillus cereus group species.

    PubMed

    Ross, Cana L; Thomason, Kerrie S; Koehler, Theresa M

    2009-11-01

    The susceptibility of most Bacillus anthracis strains to beta-lactam antibiotics is intriguing considering that the closely related species Bacillus cereus and Bacillus thuringiensis typically produce beta-lactamases and the B. anthracis genome harbors two beta-lactamase genes, bla1 and bla2. We show that beta-lactamase activity associated with B. anthracis is affected by two genes, sigP (BA2502) and rsiP (BA2503), predicted to encode an extracytoplasmic function sigma factor and an anti-sigma factor, respectively. Deletion of the sigP-rsiP locus abolished beta-lactamase activity in a naturally occurring penicillin-resistant strain and had no effect on beta-lactamase activity in a prototypical penicillin-susceptible strain. Complementation with sigP and rsiP from the penicillin-resistant strain, but not with sigP and rsiP from the penicillin-susceptible strain, conferred constitutive beta-lactamase activity in both mutants. These results are attributed to a nucleotide deletion near the 5' end of rsiP in the penicillin-resistant strain that is predicted to result in a nonfunctional protein. B. cereus and B. thuringiensis sigP and rsiP homologues are required for inducible penicillin resistance in these species. Expression of the B. cereus or B. thuringiensis sigP and rsiP genes in a B. anthracis sigP-rsiP-null mutant confers inducible production of beta-lactamase activity, suggesting that while B. anthracis contains the genes necessary for sensing beta-lactam antibiotics, the B. anthracis sigP and rsiP gene products are not sufficient for bla induction. PMID:19717606

  20. Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A beta-lactamase isolated from Escherichia coli.

    PubMed Central

    Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H

    1995-01-01

    Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes

  1. Presence and diversity of the beta-lactamase gene in cat and dog staphylococci.

    PubMed

    Malik, Seidu; Christensen, Henrik; Peng, Haihong; Barton, Mary D

    2007-07-20

    Staphylococci are part of the normal microflora of humans and animals and some are potential pathogens that have become resistant to almost all known antibiotics. Despite the widespread reports of penicillin resistance in cat and dog staphylococci, the mechanism underlying penicillin resistance has not been examined. This study was aimed at investigating the molecular basis of resistance to penicillin in cat and dog staphylococcal isolates that showed phenotypic resistance to beta-lactam antibiotics. An 861 bp fragment of the structural blaZ gene which codes for beta-lactamase production in staphylococci was amplified by polymerase chain reaction (PCR) and the products were sequenced. Sequenced fragments were analysed by protein signature typing and sequences were compared to published blaZ sequences of human and bovine staphylococcal strains held in a public database. Four known protein signature types (1, 3, 5 and 6) and one new type (12) were identified in this study. When sequences were compared with published blaZ sequences, gene phylogenetic analysis revealed three major groups. The four variants of beta-lactamases types (A, B, C and D) belonged to each major group except for types A and D which were both in group II. These findings confirm that the blaZ gene is responsible for beta-lactamase production leading to subsequent resistance to beta-lactam antibiotics in feline and canine staphylococci and that the gene shows similar diversity and relatedness as found with blaZ sequences obtained from human and bovine staphylococci.

  2. Transposition of the carbenicillin-hydrolyzing beta-lactamase gene.

    PubMed Central

    Katsu, K; Inoue, M; Mitsuhashi, S

    1982-01-01

    We isolated a new transposon Tn2101, from plasmid Rms433 in Enterobacter cloacae. Tn2101 encoded the formation of type IV (carbenicillin-hydrolyzing) beta-lactamase and multiple resistance to streptomycin, sulfanilamide, spectinomycin, and mercury in addition to ampicillin. Tn2101 was transposable between conjugative (or nonconjugative) plasmids and the host chromosome. Transposition occurred independently of the general recombination ability of the host cell. Tn2101 had a molecular size of 9.5 x 10(6) and contained short inverted repeat terminal sequences. Images PMID:6279559

  3. Identification and characteristic analysis of the ampC gene encoding beta-lactamase from Vibrio fischeri.

    PubMed

    Weng, Shu-Fen; Chao, Yuh-Fen; Lin, Juey-Wen

    2004-02-13

    Vibrio fischeri ATCC 7744 is an ampicillin resistant (Amp(r)) marine luminous bacterium. The MIC test indicates that V. fischeri is highly resistant to penicillins, and susceptible to cephalosporins. V. fischeri ampC gene was cloned and identified. Nucleotide sequence of an unidentified ufo gene and the ampC, ppiB genes (GenBank Accession No. AY438037) has been determined; whereas the ampC gene encodes the beta-lactamase (AmpC) and the ppiB gene encodes the peptidyl-prolyl cis-trans isomerase B. Alignment and comparison show that V. fischeri beta-lactamase is homologous to the related species'. The specific amino acid residues STFK (62nd to 65th), SDN (122nd to 124th), and D (155th) located 34 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. V. fischeri ampC gene encoding beta-lactamase has a calculated M(r) 31,181 and comprises 283 amino acid residues (pI 5.35). There is a signal peptide of 18 amino acid residues MKIKPFLFGLIVLANNAI in the pro-beta-lactamase, which functioned for secretion; thus, the matured protein only has M(r) 29,197 and comprises 265 amino acid residues (pI 4.95). SDS-PAGE and the beta-lactamase functional assays elicit that the M(r) of the beta-lactamases are close to 29kDa. IEF and the beta-lactamase functional assays show that the beta-lactamases' pI are close to 4.8 as predicted. The results elucidate that V. fischeri ampC gene and the cloned ampC gene in Escherichia coli are the same one. The gene order of the ampC and the related genes is -ufo-(P*-intern)-ampC-ppiB--> (P*-intern: intern promoter for sub-regulation), whereas the P*-intern promoter displays the function to lead the ampC gene's expression for stress response. PMID:14741712

  4. Antimicrobial resistance pattern and their beta-lactamase encoding genes among Pseudomonas aeruginosa strains isolated from cancer patients.

    PubMed

    Zafer, Mai M; Al-Agamy, Mohamed H; El-Mahallawy, Hadir A; Amin, Magdy A; Ashour, Mohammed Seif El-Din

    2014-01-01

    This study was designed to investigate the prevalence of metallo-β-lactamases (MBL) and extended-spectrum β -lactamases (ESBL) in P. aeruginosa isolates collected from two different hospitals in Cairo, Egypt. Antibiotic susceptibility testing and phenotypic screening for ESBLs and MBLs were performed on 122 P. aeruginosa isolates collected in the period from January 2011 to March 2012. MICs were determined. ESBLs and MBLs genes were sought by PCR. The resistant rate to imipenem was 39.34%. The resistance rates for P. aeruginosa to cefuroxime, cefoperazone, ceftazidime, aztreonam, and piperacillin/tazobactam were 87.7%, 80.3%, 60.6%, 45.1%, and 25.4%, respectively. Out of 122 P. aeruginosa, 27% and 7.4% were MBL and ESBL, respectively. The prevalence of bla(VIM-2), bla(OXA-10(-)), bla(VEB-1), bla(NDM(-)), and bla(IMP-1)-like genes were found in 58.3%, 41.7%, 10.4%, 4.2%, and 2.1%, respectively. GIM-, SPM-, SIM-, and OXA-2-like genes were not detected in this study. OXA-10-like gene was concomitant with VIM-2 and/or VEB. Twelve isolates harbored both OXA-10 and VIM-2; two isolates carried both OXA-10 and VEB. Only one strain contained OXA-10, VIM-2, and VEB. In conclusion, bla(VIM-2)- and bla(OXA-10)-like genes were the most prevalent genes in P. aeruginosa in Egypt. To our knowledge, this is the first report of bla(VIM-2), bla(IMP-1), bla(NDM), and bla(OXA-10) in P. aeruginosa in Egypt.

  5. Cloning and characterization of the endogenous cephalosporinase gene, cepA, from Bacteroides fragilis reveals a new subgroup of Ambler class A beta-lactamases.

    PubMed Central

    Rogers, M B; Parker, A C; Smith, C J

    1993-01-01

    Bacteroides fragilis CS30 is a clinical isolate resistant to high concentrations of benzylpenicillin and cephaloridine but not to cephamycin or penem antibiotics. beta-Lactam resistance is mediated by a chromosomally encoded cephalosporinase produced at a high level. The gene encoding this beta-lactamase was cloned from genomic libraries constructed in Escherichia coli and then mated with B. fragilis 638 for identification of ampicillin-resistant (Apr) strains. Apr transconjugants contained a nitrocefin-reactive protein with the physical and enzymatic properties of the original CS30 isolate. The beta-lactamase gene (cepA) was localized by deletion analysis and subcloned, and its nucleotide sequence was determined. The 903-bp cepA open reading frame encoded a 300-amino-acid precursor protein (predicted molecular mass, 34,070 Da). A beta-lactamase-deficient mutant strain of B. fragilis 638 was constructed by insertional inactivation with the cepA gene of CS30, demonstrating strict functional homology between these chromosomal beta-lactamase genes. An extensive comparison of the CepA protein sequence by alignment with other beta-lactamases revealed the strict conservation of at least four elements common to Ambler class A. A further comparison of the CepA protein sequence with protein sequences of beta-lactamases from two other Bacteroides species indicated that they constitute their own distinct subgroup of class A beta-lactamases. Images PMID:8285623

  6. Inactivation of the ampD gene causes semiconstitutive overproduction of the inducible Citrobacter freundii beta-lactamase.

    PubMed Central

    Lindberg, F; Lindquist, S; Normark, S

    1987-01-01

    In Citrobacter freundii and Enterobacter cloacae, synthesis of AmpC beta-lactamase is inducible by the addition of beta-lactams to the growth medium. Spontaneous mutants that constitutively overproduce the enzyme occur at a high frequency. When the C. freundii ampC beta-lactamase gene is cloned into Escherichia coli together with the regulatory gene ampR, beta-lactamase expression from the clone is inducible. Spontaneous cefotaxime-resistant mutants were selected from an E. coli strain carrying the cloned C. freundii ampC and ampR genes on a plasmid. Virtually all isolates had chromosomal mutations leading to semiconstitutive overproduction of beta-lactamase. The mutation ampD2 in one such mutant was caused by an IS1 insertion into the hitherto unknown ampD gene, located between nadC and aroP at minute 2.4 on the E. coli chromosome. The wild-type ampD allele cloned on a plasmid could fully trans-complement beta-lactamase-overproducing mutants of both E. coli and C. freundii, restoring the wild-type phenotype of highly inducible enzyme synthesis. This indicates that these E. coli and C. freundii mutants have their lesions in ampD. We hypothesize that induction of beta-lactamase synthesis is caused by blocking of the AmpD function by the beta-lactam inducer and that this leads directly or indirectly to an AmpR-mediated stimulation of ampC expression. PMID:3032901

  7. Sequences of CAZ-3 and CTX-2 extended-spectrum beta-lactamase genes.

    PubMed Central

    Chanal, C; Sirot, D; Malaure, H; Poupart, M C; Sirot, J

    1994-01-01

    The nucleotide sequences of blaTEM genes coding for the extended-spectrum beta-lactamases CAZ-3 and CTX-2 were determined. The gene for CAZ-3 is identical to blaTEM-12b. The gene for CTX-2 differs from characterized blaTEM genes for extended-spectrum beta-lactamases by a new combination of already known mutations. We propose for CTX-2 the designation TEM-25. PMID:7840586

  8. Recognition and Resistance in TEM [superscript beta]-Lactamase

    SciTech Connect

    Wang, Xiaojun; Minasov, George; Blazquez, Jesus; Caselli, Emilia; Prati, Fabio; Shoichet, Brian K.

    2010-03-08

    Developing antimicrobials that are less likely to engender resistance has become an important design criterion as more and more drugs fall victim to resistance mutations. One hypothesis is that the more closely an inhibitor resembles a substrate, the more difficult it will be to develop resistant mutations that can at once disfavor the inhibitor and still recognize the substrate. To investigate this hypothesis, 10 transition-state analogues, of greater or lesser similarity to substrates, were tested for inhibition of TEM-1 beta-lactamase, the most widespread resistance enzyme to penicillin antibiotics. The inhibitors were also tested against four characteristic mutant enzymes: TEM-30, TEM-32, TEM-52, and TEM-64. The inhibitor most similar to the substrate, compound 10, was the most potent inhibitor of the WT enzyme, with a K(i) value of 64 nM. Conversely, compound 10 was the most susceptible to the TEM-30 (R244S) mutant, for which inhibition dropped by over 100-fold. The other inhibitors were relatively impervious to the TEM-30 mutant enzyme. To understand recognition and resistance to these transition-state analogues, the structures of four of these inhibitors in complex with TEM-1 were determined by X-ray crystallography. These structures suggest a structural basis for distinguishing inhibitors that mimic the acylation transition state and those that mimic the deacylation transition state; they also suggest how TEM-30 reduces the affinity of compound 10. In cell culture, this inhibitor reversed the resistance of bacteria to ampicillin, reducing minimum inhibitory concentrations of this penicillin by between 4- and 64-fold, depending on the strain of bacteria. Notwithstanding this activity, the resistance of TEM-30, which is already extant in the clinic, suggests that there can be resistance liabilities with substrate-based design.

  9. Occurrence of bacteria producing broad-spectrum beta-lactamases and qnr genes in hospital and urban wastewater samples.

    PubMed

    Röderová, Magdaléna; Sedláková, Miroslava Htoutou; Pudová, Vendula; Hricová, Kristýna; Silová, Romana; Imwensi, Peter Eghonghon Odion; Bardoň, Jan; Kolář, Milan

    2016-04-01

    The aims were to investigate the level of antibiotic-resistant bacteria in hospital and urban wastewater and to determine the similarity of isolates obtained from wastewater and hospitalized patients. Wastewater samples were collected in September 2013 and 2014. After identification using MALDI-TOF MS, beta-lactamase production was determined by relevant phenotypic tests. Genes responsible for the production of single beta-lactamase groups and Qnr proteins were established. The epidemiological relationship of the isolates from wastewater and hospitalized patients was determined by PFGE. A total of 51 isolates of enterobacteria were obtained. Overall, 45.1% of them produced broad-spectrum beta-lactamases. Genes encoding TEM, SHV, CTX-M, CIT, DHA and EBC types of enzymes and Qnr proteins were detected. No broad-spectrum beta-lactamase production was confirmed in the urban wastewater treatment plant. The most important finding was the detection of two identical isolates of K. pneumoniae in 2013, one from a patient's urinary catheter and the other from a wastewater sample. PMID:27196551

  10. Occurrence of bacteria producing broad-spectrum beta-lactamases and qnr genes in hospital and urban wastewater samples.

    PubMed

    Röderová, Magdaléna; Sedláková, Miroslava Htoutou; Pudová, Vendula; Hricová, Kristýna; Silová, Romana; Imwensi, Peter Eghonghon Odion; Bardoň, Jan; Kolář, Milan

    2016-04-01

    The aims were to investigate the level of antibiotic-resistant bacteria in hospital and urban wastewater and to determine the similarity of isolates obtained from wastewater and hospitalized patients. Wastewater samples were collected in September 2013 and 2014. After identification using MALDI-TOF MS, beta-lactamase production was determined by relevant phenotypic tests. Genes responsible for the production of single beta-lactamase groups and Qnr proteins were established. The epidemiological relationship of the isolates from wastewater and hospitalized patients was determined by PFGE. A total of 51 isolates of enterobacteria were obtained. Overall, 45.1% of them produced broad-spectrum beta-lactamases. Genes encoding TEM, SHV, CTX-M, CIT, DHA and EBC types of enzymes and Qnr proteins were detected. No broad-spectrum beta-lactamase production was confirmed in the urban wastewater treatment plant. The most important finding was the detection of two identical isolates of K. pneumoniae in 2013, one from a patient's urinary catheter and the other from a wastewater sample.

  11. A novel class C beta-lactamase (FOX-2) in Escherichia coli conferring resistance to cephamycins.

    PubMed Central

    Bauernfeind, A; Wagner, S; Jungwirth, R; Schneider, I; Meyer, D

    1997-01-01

    An Escherichia coli strain resistant to a broad spectrum of beta-lactams, including cephamycins, was isolated from a patient suffering from urinary tract infection. A resistance plasmid (pMVP-7) was transferred from the clinical isolate to an Escherichia coli recipient. Both strains produce a cefoxitin-hydrolyzing beta-lactamase focusing at pI 6.7. The phenotype was similar to that of a Klebsiella pneumoniae strain producing cephamycinase FOX-1, so primers were selected from the FOX-1 sequence to amplify the bla gene of the transconjugant. The PCR product obtained was sequenced. The percentage of identity of the deduced amino acid sequence with sequences of other AmpC-type beta-lactamases was 96.9% with FOX-1, 74.9% with CMY-1, and 67.7% with MOX-1. This new plasmid-mediated enzyme is most closely related to FOX-1 (11 amino acid exchanges). We therefore propose the designation FOX-2. PMID:9303413

  12. CFE-1, a novel plasmid-encoded AmpC beta-lactamase with an ampR gene originating from Citrobacter freundii.

    PubMed

    Nakano, Ryuichi; Okamoto, Ryoichi; Nakano, Yumiko; Kaneko, Kenichi; Okitsu, Naohiro; Hosaka, Yoshio; Inoue, Matsuhisa

    2004-04-01

    A clinical isolate of Escherichia coli from a patient in Japan, isolate KU6400, was found to produce a plasmid-encoded beta-lactamase that conferred resistance to extended-spectrum cephalosporins and cephamycins. Resistance arising from production of a beta-lactamase could be transferred by either conjugation or transformation with plasmid pKU601 into E. coli ML4947. The substrate and inhibition profiles of this enzyme resembled those of the AmpC beta-lactamase. The resistance gene of pKU601, which was cloned and expressed in E. coli, proved to contain an open reading frame showing 99.8% DNA sequence identity with the ampC gene of Citrobacter freundii GC3. DNA sequence analysis also identified a gene upstream of ampC whose sequence was 99.0% identical to the ampR gene from C. freundii GC3. In addition, a fumarate operon (frdABCD) and an outer membrane lipoprotein (blc) surrounding the ampR-ampC genes in C. freundii were identified, and insertion sequence (IS26) elements were observed on both sides of the sequences identified (forming an IS26 composite transposon); these results confirm the evidence of the translocation of a beta-lactamase-associated gene region from the chromosome to a plasmid. Finally, we describe a novel plasmid-encoded AmpC beta-lactamase, CFE-1, with an ampR gene derived from C. freundii.

  13. Cloning of a Chryseobacterium (Flavobacterium) meningosepticum chromosomal gene (blaA(CME)) encoding an extended-spectrum class A beta-lactamase related to the Bacteroides cephalosporinases and the VEB-1 and PER beta-lactamases.

    PubMed

    Rossolini, G M; Franceschini, N; Lauretti, L; Caravelli, B; Riccio, M L; Galleni, M; Frère, J M; Amicosante, G

    1999-09-01

    In addition to the BlaB metallo-beta-lactamase, Chryseobacterium (Flavobacterium) meningosepticum CCUG 4310 (NCTC 10585) constitutively produces a 31-kDa active-site serine beta-lactamase, named CME-1, with an alkaline isoelectric pH. The blaA(CME) gene that encodes the latter enzyme was isolated from a genomic library constructed in the Escherichia coli plasmid vector pACYC184 by screening for cefuroxime-resistant clones. Sequence analysis revealed that the CME-1 enzyme is a new class A beta-lactamase structurally divergent from the other members of this class, being most closely related to the VEB-1 (also named CEF-1) and PER beta-lactamases and the Bacteroides chromosomal cephalosporinases. The blaA(CME) determinant is located on the chromosome and exhibits features typical of those of C. meningosepticum resident genes. The CME-1 protein was purified from an E. coli strain that overexpresses the cloned gene via a T7-based expression system by means of an anion-exchange chromatography step followed by a gel permeation chromatography step. Kinetic parameters for several substrates were determined. CME-1 is a clavulanic acid-susceptible extended-spectrum beta-lactamase that hydrolyzes most cephalosporins, penicillins, and monobactams but that does not hydrolyze cephamycins and carbapenems. The enzyme exhibits strikingly different kinetic parameters for different classes of beta-lactams, with both K(m) and k(cat) values much higher for cephalosporins than for penicillins and monobactams. However, the variability of both kinetic parameters resulted in overall similar acylation rates (k(cat)/K(m) ratios) for all types of beta-lactam substrates.

  14. Cephalosporin resistance in Pseudomonas aeruginosa, with special reference to the proposed trapping of antibiotics by beta-lactamase.

    PubMed

    Livermore, D M; Williams, J D; Davy, K W

    1985-02-01

    Resistance of Pseudomonas aeruginosa strains to newer cephalosporins is often associated with stable derepression of synthesis of the chromosomal beta-lactamase. Similar resistance is developed by enzyme inducible (i.e. normal) strains in response to beta-lactamase inducers. By comparing the responses of otherwise isogenic P. aeruginosa beta-lactamase inducibility mutants to antipseudomonal cephalosporins alone or in combination with potent beta-lactamase inducers we confirmed that resistance to cefotaxime, ceftriaxone, cefoperazone, and ceftazidime and latamoxef was caused by beta-lactamase action. The low-level resistance to carbenicillin and cefsulodin which was exhibited by some fully beta-lactamase derepressed strains was not confirmed to be beta-lactamase determined and may have reflected concurrent target or permeability changes. The mechanism whereby the enzyme protected the cell against cefotaxime and ceftriaxone was also investigated. These agents are reportedly stable to the enzyme and some workers have suggested that resistance entails their being trapped rather than hydrolysed. However, the use of a novel model of cellular beta-lactamase function indicated that a hydrolytic resistance mechanism remained likely.

  15. Hospital outbreak of Klebsiella pneumoniae resistant to broad-spectrum cephalosporins and beta-lactam-beta-lactamase inhibitor combinations by hyperproduction of SHV-5 beta-lactamase.

    PubMed Central

    French, G L; Shannon, K P; Simmons, N

    1996-01-01

    An aminoglycoside- and ceftazidime-resistant strain of Klebsiella pneumoniae K2 producing the extended-spectrum beta-lactamase SHV-5 infected or colonized 14 pediatric patients at Guy's Hospital. The patients were mostly neonates recovering from cardiac surgery for congenital defects. The organism was also isolated from a nurse and from the father of one of the children. Four patients had septicemia, and two septicemic neonates with postoperative renal failure died. Aminoglycoside and cephalosporin resistance transferred to Escherichia coli in vitro on a 160-kb plasmid, and a similar resistant E. coli strain was isolated from the stools of one of the affected children. The epidemic organism colonized the bowel and skin and was probably transmitted via staff hands. Five wards were involved because of extensive patient movements. The outbreak was controlled by patient isolation and attention to handwashing. All of the isolates of the outbreak strain were identical by phage typing, ribotyping, plasmid profiling, and biochemical and serological testing, but they varied in their production of SHV-5. Some isolates produced normal amounts of SHV-5 and were susceptible to beta-lactam-beta-lactamase inhibitor combinations. Others, including the single isolate of multiresistant E. coli, produced up to five times as much enzyme as "normal" isolates. This hyperproduction resulted in increased resistance to several penicillins and cephalosporins and to the beta-lactam-beta-lactamase inhibitor combinations amoxicillin-clavulanic acid, ampicillin-sulbactam, piperacillin-tazobactam, and ceftazidime-clavulanic acid. The hyperproduction of SHV-5 by K. pneumoniae and E. coli seen in this outbreak suggests that beta-lactam-beta-lactamase inhibitor combinations may be unreliable for the treatment of organisms producing extended-spectrum beta-lactamases. PMID:8789016

  16. Resistance to oxyimino beta-lactams due to a mutation of chromosomal beta-lactamase in Citrobacter freundii.

    PubMed

    Haruta, S; Nukaga, M; Taniguchi, K; Sawai, T

    1998-01-01

    The duplicative mutation of an Ala-Val-Arg sequence at positions 208 to 210 in the loop structure of Enterobacter cloacae class C beta-lactamase caused substrate specificity extension to oxyimino beta-lactam antibiotics and this chromosomal mutation provided bacterial cells with high resistance to the beta-lactams (M. Nukaga et al, 1995, J. Biol. Chem. 270, 5729-5735). In order to confirm the universality of this phenomenon among other class C beta-lactamases, the duplicative mutation was applied to a class C beta-lactamase of Citrobacter freundii, which has 74% homology to the E. cloacae beta-lactamase amino acid sequence. The counterpart sequence to the Ala-Val-Arg of the E. cloacae enzyme in C. freundii beta-lactamase was identified to be Pro-Val-His. A Pro-Val-His sequence was inserted just after the native Pro-Val-His sequence at positions 208 to 210 in the C. freundii beta-lactamase. The resulting mutant of C. freundii beta-lactamase obtained a striking characteristic that we expected, showing substrate specificity extension to oxyimino beta-lactams. Nearly the same result was obtained with the insertion of an Ala-Val-Arg sequence after the native Pro-Val-His sequence. These results indicate that structural modification of this locus commonly induces modification of the substrate specificity to unfavorable substrates for many chromosomal class C beta-lactamases produced by gram-negative bacteria.

  17. Novel extended-spectrum TEM-type beta-lactamase from an Escherichia coli isolate resistant to ceftazidime and susceptible to cephalothin.

    PubMed Central

    Chanal-Claris, C; Sirot, D; Bret, L; Chatron, P; Labia, R; Sirot, J

    1997-01-01

    A novel extended-spectrum TEM-type beta-lactamase was detected in an Escherichia coli isolate which was resistant to ceftazidime and susceptible to cephalothin. The corresponding bla gene was sequenced. The deduced amino acid sequence showed the following three amino acid replacements with respect to the TEM-2 sequence: Glu-->Lys-104, Arg-->Ser-164, and Glu-->Lys-240. Since it confers a ceftazidimase-type resistance phenotype, we propose for this novel enzyme the designation CAZ-9, corresponding to TEM-46 in the sequential numbering scheme of TEM beta-lactamases. PMID:9056022

  18. Phenotypic detection and molecular characterization of beta-lactamase genes among Citrobacter species in a tertiary care hospital

    PubMed Central

    Praharaj, Ashok Kumar; Khajuria, Atul; Kumar, Mahadevan; Grover, Naveen

    2016-01-01

    Objective: To examine the distribution, emergence, and spread of genes encoding beta-lactamase resistance in Citrobacter species isolated from hospitalized patients in a tertiary care hospital. Methods: A prospective study was conducted in a 1000-bed tertiary care center in Pune, India from October 2010 to October 2013. A total of 221 Citrobacter spp. isolates were recovered from clinical specimens from different patients (one isolate per patient) admitted to the surgical ward, medical ward and medical and surgical Intensive Care Units. Polymerase chain reaction (PCR) assays and sequencing were used to determine the presence of beta-lactamase encoding genes. Conjugation experiments were performed to determine their transferability. Isolate relatedness were determined by repetitive element based-PCR, enterobacterial repetitive intergenic consensus-PCR and randomly amplified polymorphic DNA. Results: Among 221 tested isolates of Citrobacter spp. recovered from various clinical specimens, 179 (80.9%) isolates showed minimum inhibitory concentration (MIC) >4 μg/ml against meropenem and imipenem. One hundred and forty-five isolates with increased MICs value against carbapenems were further processed for molecular characterization of beta-lactamase genes. Susceptibility profiling of the isolates indicated that 100% retained susceptibility to colistin. Conjugation experiments indicated that blaNDM-1 was transferable via a plasmid. Conclusion: The ease of NDM-1 plasmid transmissibility may help their dissemination among the Citrobacter species as well as to others in Enterobacteriaceae. Early detection, antimicrobial stewardship and adequate infection control measures will help in limiting the spread of these organisms. PMID:26952135

  19. Seawater is a reservoir of multi-resistant Escherichia coli, including strains hosting plasmid-mediated quinolones resistance and extended-spectrum beta-lactamases genes

    PubMed Central

    Alves, Marta S.; Pereira, Anabela; Araújo, Susana M.; Castro, Bruno B.; Correia, António C. M.; Henriques, Isabel

    2014-01-01

    The aim of this study was to examine antibiotic resistance (AR) dissemination in coastal water, considering the contribution of different sources of fecal contamination. Samples were collected in Berlenga, an uninhabited island classified as Natural Reserve and visited by tourists for aquatic recreational activities. To achieve our aim, AR in Escherichia coli isolates from coastal water was compared to AR in isolates from two sources of fecal contamination: human-derived sewage and seagull feces. Isolation of E. coli was done on Chromocult agar. Based on genetic typing 414 strains were established. Distribution of E. coli phylogenetic groups was similar among isolates of all sources. Resistances to streptomycin, tetracycline, cephalothin, and amoxicillin were the most frequent. Higher rates of AR were found among seawater and feces isolates, except for last-line antibiotics used in human medicine. Multi-resistance rates in isolates from sewage and seagull feces (29 and 32%) were lower than in isolates from seawater (39%). Seawater AR profiles were similar to those from seagull feces and differed significantly from sewage AR profiles. Nucleotide sequences matching resistance genes blaTEM, sul1, sul2, tet(A), and tet(B), were present in isolates of all sources. Genes conferring resistance to 3rd generation cephalosporins were detected in seawater (blaCTX-M-1 and blaSHV-12) and seagull feces (blaCMY-2). Plasmid-mediated determinants of resistance to quinolones were found: qnrS1 in all sources and qnrB19 in seawater and seagull feces. Our results show that seawater is a relevant reservoir of AR and that seagulls are an efficient vehicle to spread human-associated bacteria and resistance genes. The E. coli resistome recaptured from Berlenga coastal water was mainly modulated by seagulls-derived fecal pollution. The repertoire of resistance genes covers antibiotics critically important for humans, a potential risk for human health. PMID:25191308

  20. [Qnr-type quinolone resistance in extended-spectrum beta-lactamase producing enterobacteria in Abidjan, Ivory Coast].

    PubMed

    Guessennd, N; Bremont, S; Gbonon, V; Kacou-Ndouba, A; Ekaza, E; Lambert, T; Dosso, M; Courvalin, P

    2008-01-01

    The aim of the study was to show the emergence of the qnr genes in extended spectrum beta-lactamases producing enterobacteria in Abidjan between 2005 and 2006. The whole of 151 strains of extended spectrum beta-lactamases producing enterobacteria were studied: 64 Escherichia coli, 66 Klebsiella pneumoniae, seven Klebsiella oxytoca and 14 Enterobacter spp. isolated from various biological products and from in- and out-patients. The techniques of disks diffusion, double-disk synergy, E-test were respectively used for the antimicrobial susceptibility test, the detection of extended spectrum beta-lactamases and the minimal inhibiting concentration. The bla genes(SHV, TEM, CTXM groups 1, 2, 8, 9), and AmpC were determined by PCR and characterized by sequencing. A global prevalence of 27,2 % (41/151) and rates of 9,9, 14,6, 2,7 % for the qnr genes A, B, A and S were observed. The distribution was 42,9 % for Enterobacter spp, 31,2 % for Escherichia coli, 20,5 % for Klebsiella; 30 strains expressed at least two bla genes; four strains were associated with AmpC. The strains were resistant to the cotrimoxazole (97,6 %), to the céfépime (73,2 %), to the céfoxitine (56,1 %), to the imipénème (0 %) and 43,9 % to all the aminosides. This high qnr gene prevalence associated with several types of bla genes in epidemic matter, the high level of resistance to antibiotics make fear a high risk of the transmission of multi-resistants bacteria and challenge the authorities for a resistance monitoring policy.

  1. Beta-lactamase characterization in Escherichia coli isolates with diminished susceptibility or resistance to extended-spectrum cephalosporins recovered from sick animals in Spain.

    PubMed

    Briñas, Laura; Moreno, Miguel Angel; Teshager, Tirushet; Zarazaga, Myriam; Sáenz, Yolanda; Porrero, Concepción; Dominguez, Lucas; Torres, Carmen

    2003-01-01

    A total of 1439 Escherichia coli isolates from sick animals were received from the Spanish Network of Veterinary Antimicrobial Resistance Surveillance (VAV) from 1997 to 2001. Antimicrobial susceptibility tests were performed and diminished susceptibility to cefotaxime and ceftazidime was identified in 2.5% and 2.8% of the isolates, respectively. Beta-lactamase characterization was carried out in the group of 20 E. coli isolates with both characteristics. The MIC ranges of different beta-lactams showed by these 20 isolates were as follows (in microg/ml): ampicillin (64-->256), amoxicillin-clavulanic acid (4-64), ticarcillin (8-->128), cefazolin (32-->256), cefoxitin (4-->128), cefotaxime (1-64), ceftazidime (2-->64), ceftriaxone (0.5-64), imipenem (< or = 0.06-0.25), and aztreonam (2-->32). TEM, SHV, CMY, and FOX beta-lactamase genes were analyzed by PCR and sequencing. The beta-lactamase genes detected were the following ones (number of isolates): bla(TEM-1b) (3), bla(TEM-1a) (1), bla(TEM-30f) (2), bla(TEM-1b) + bla(CMY-2) (2), and bla(SHV-12) (1). Sequences of the promoter and/or attenuator region of the chromosomal ampC gene were studied in all the 20 isolates. Mutations at position -42 or -32 were detected in 16 isolates and these mutations were associated with the presence of a TEM type beta-lactamase in 6 isolates. Besides, a high variety of plasmidic beta-lactamases was detected including TEM-30 and CMY-2. To our knowledge, this is the first time that TEM-30 beta-lactamase has been detected in E. coli isolates of animal origin.

  2. A common system controls the induction of very different genes. The class-A beta-lactamase of Proteus vulgaris and the enterobacterial class-C beta-lactamase.

    PubMed

    Datz, M; Joris, B; Azab, E A; Galleni, M; Van Beeumen, J; Frère, J M; Martin, H H

    1994-11-15

    Among the Enterobacteriaceae, Proteus vulgaris is exceptional in the inducible production of a 29-kDa beta-lactamase (cefuroximase) with an unusually high activity towards the beta-lactamase-stable oximino-cephalosporins (e.g. cefuroxime and cefotaxime). Sequencing of the corresponding gene, cumA, showed that the derived CumA beta-lactamase belonged to the molecular class A. The structural gene was under the direct control of gene cumR, which was transcribed backwards and whose initiation codon was 165 bp away from that of the beta-lactamase gene. This resembled the arrangement of structural and regulator genes ampC and ampR of the 39-kDa molecular-class-C beta-lactamase AmpC present in many enterobacteria. Moreover, cloned genes ampD and ampG for negative modulation and signal transduction of AmpC beta-lactamase induction, respectively, were also able to restore constitutively CumA overproducing and non-inducible P. vulgaris mutants to the inducible, wild-type phenotype. The results indicate that controls of the induction phenomena are equivalent for the CumA and AmpC beta-lactamase. Very different structural genes can thus be under the control of identical systems.

  3. Emergence of a cefepime- and cefpirome-resistant Citrobacter freundii clinical isolate harbouring a novel chromosomally encoded AmpC beta-lactamase, CMY-37.

    PubMed

    Ahmed, Ashraf M; Shimamoto, Tadashi

    2008-09-01

    Citrobacter freundii strain 4306 was isolated from a urine specimen of a patient in March 2006 in Palestine. This strain showed a unique multidrug resistance phenotype, as it was resistant both to 7-alpha-methoxy- and oxyimino-cephalosporins, including cefepime, cefpirome and monobactams, in addition to quinolones, streptomycin and trimethoprim/sulfamethoxazole. Clavulanic acid did not act synergistically with cephalosporins by the double-disk synergy test. Molecular characterisation showed that the resistance to 7-alpha-methoxy- and oxyimino-cephalosporins was due to a novel AmpC beta-lactamase, designated CMY-37, with an isoelectric point of approximately 9.0. CMY-37 is a variant of C. freundii chromosomal AmpC enzymes with at least seven amino acid substitutions. One of these substitutions, L316I, is located within the R2 loop that is considered the hotspot region responsible for the extended substrate spectrum in class C beta-lactamases. The blaCMY-37 gene was cloned and expressed in Escherichia coli TG1. CMY-37 is chromosomally encoded and is not associated with ISEcp1-like element. Phylogenetic analysis suggested that CMY-37 is the origin of many plasmid-mediated AmpC beta-lactamases. This study highlights the emergence of cefepime and cefpirome resistance in C. freundii owing to a new type of AmpC beta-lactamase.

  4. In vivo development of carbapenem resistance in clinical isolates of Enterobacter aerogenes producing multiple beta-lactamases.

    PubMed

    Chen, Ya-Gang; Zhang, Ying; Yu, Yun-Song; Qu, Ting-Ting; Wei, Ze-Qing; Shen, Ping; Li, Lan-Juan

    2008-10-01

    Four clinical strains of extended-spectrum beta-lactamase- and AmpC-producing Enterobacter aerogenes were isolated successively from a liver transplantation patient. Isolates C(1) and C(2) were isolated prior to carbapenem therapy, whilst isolates C(3) and C(4) were recovered after 40 days of carbapenem therapy. The homology of these strains was analysed by pulsed-field gel electrophoresis (PFGE). beta-Lactamases were analysed by isoelectric focusing, polymerase chain reaction (PCR) and sequencing. Outer membrane proteins were analysed by PCR, sequencing, sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blot. Disruption of OmpE36 in C(1) in vitro was also performed by homologous gene recombination. The isolates demonstrated an indistinguishable PFGE pattern. Molecular characterisation revealed that, in addition to the pre-existing multiple beta-lactamases (DHA-1, TEM-1, SHV-5, CTX-M-3 and CTX-M-14) found in C(1) and C(2), isolates C(3) and C(4) failed to express OmpE36 owing to insertional inactivation by an IS903-like insertion sequence. Other resistance mechanisms, such as production of carbapenem-hydrolysing enzymes or expression of chromosomal efflux, were apparently not involved. Completely replacing OmpE36 by the kanamycin resistance gene (kan) resulted in a significant increase in carbapenem minimum inhibitory concentrations of an ompE36 mutant. Thus, C(3) and C(4) were apparently derived from the previously imipenem-susceptible isolates C(1) and C(2). Following carbapenem exposure, depletion of OmpE36 expression resulted in the collateral effect of carbapenem resistance.

  5. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  6. Extended-Spectrum-Beta-Lactamases, AmpC Beta-Lactamases and Plasmid Mediated Quinolone Resistance in Klebsiella spp. from Companion Animals in Italy

    PubMed Central

    Donati, Valentina; Feltrin, Fabiola; Hendriksen, Rene S.; Svendsen, Christina Aaby; Cordaro, Gessica; García-Fernández, Aurora; Lorenzetti, Serena; Lorenzetti, Raniero; Battisti, Antonio; Franco, Alessia

    2014-01-01

    We report the genetic characterization of 15 Klebsiella pneumoniae (KP) and 4 isolates of K. oxytoca (KO) from clinical cases in dogs and cats and showing extended-spectrum cephalosporin (ESC) resistance. Extended spectrum beta-lactamase (ESBL) and AmpC genes, plasmid-mediated quinolone resistance (PMQR) and co-resistances were investigated. Among KP isolates, ST101 clone was predominant (8/15, 53%), followed by ST15 (4/15, 27%). ST11 and ST340, belonging to Clonal Complex (CC)11, were detected in 2012 (3/15, 20%). MLST on KP isolates corresponded well with PFGE results, with 11 different PFGE patterns observed, including two clusters of two (ST340) and four (ST101) indistinguishable isolates, respectively. All isolates harbored at least one ESBL or AmpC gene, all carried on transferable plasmids (IncR, IncFII, IncI1, IncN), and 16/19 were positive for PMQR genes (qnr family or aac(6′)-Ib-cr). The most frequent ESBL was CTX-M-15 (11/19, 58%), detected in all KP ST101, in one KP ST15 and in both KP ST340. blaCTX-M-15 was carried on IncR plasmids in all but one KP isolate. All KP ST15 isolates harbored different ESC resistance genes and different plasmids, and presented the non-transferable blaSHV-28 gene, in association with blaCTX-M-15, blaCTX-M-1 (on IncR, or on IncN), blaSHV-2a (on IncR) or blaCMY-2 genes (on IncI1). KO isolates were positive for blaCTX-M-9 gene (on IncHI2), or for the blaSHV-12 and blaDHA-1 genes (on IncL/M). They were all positive for qnr genes, and one also for the aac(6′)-Ib-cr gene. All Klebsiella isolates showed multiresistance towards aminoglycosides, sulfonamides, tetracyclines, trimethoprim and amphenicols, mediated by strA/B, aadA2, aadB, ant (2")-Ia, aac(6′)-Ib, sul, tet, dfr and cat genes in various combinations. The emergence in pets of multidrug-resistant Klebsiella with ESBL, AmpC and PMQR determinants, poses further and serious challenges in companion animal therapy and raise concerns for possible bi-directional transmission

  7. Extended-spectrum-beta-lactamases, AmpC beta-lactamases and plasmid mediated quinolone resistance in klebsiella spp. from companion animals in Italy.

    PubMed

    Donati, Valentina; Feltrin, Fabiola; Hendriksen, Rene S; Svendsen, Christina Aaby; Cordaro, Gessica; García-Fernández, Aurora; Lorenzetti, Serena; Lorenzetti, Raniero; Battisti, Antonio; Franco, Alessia

    2014-01-01

    We report the genetic characterization of 15 Klebsiella pneumoniae (KP) and 4 isolates of K. oxytoca (KO) from clinical cases in dogs and cats and showing extended-spectrum cephalosporin (ESC) resistance. Extended spectrum beta-lactamase (ESBL) and AmpC genes, plasmid-mediated quinolone resistance (PMQR) and co-resistances were investigated. Among KP isolates, ST101 clone was predominant (8/15, 53%), followed by ST15 (4/15, 27%). ST11 and ST340, belonging to Clonal Complex (CC)11, were detected in 2012 (3/15, 20%). MLST on KP isolates corresponded well with PFGE results, with 11 different PFGE patterns observed, including two clusters of two (ST340) and four (ST101) indistinguishable isolates, respectively. All isolates harbored at least one ESBL or AmpC gene, all carried on transferable plasmids (IncR, IncFII, IncI1, IncN), and 16/19 were positive for PMQR genes (qnr family or aac(6')-Ib-cr). The most frequent ESBL was CTX-M-15 (11/19, 58%), detected in all KP ST101, in one KP ST15 and in both KP ST340. blaCTX-M-15 was carried on IncR plasmids in all but one KP isolate. All KP ST15 isolates harbored different ESC resistance genes and different plasmids, and presented the non-transferable blaSHV-28 gene, in association with blaCTX-M-15, blaCTX-M-1 (on IncR, or on IncN), blaSHV-2a (on IncR) or blaCMY-2 genes (on IncI1). KO isolates were positive for blaCTX-M-9 gene (on IncHI2), or for the blaSHV-12 and blaDHA-1 genes (on IncL/M). They were all positive for qnr genes, and one also for the aac(6')-Ib-cr gene. All Klebsiella isolates showed multiresistance towards aminoglycosides, sulfonamides, tetracyclines, trimethoprim and amphenicols, mediated by strA/B, aadA2, aadB, ant (2")-Ia, aac(6')-Ib, sul, tet, dfr and cat genes in various combinations. The emergence in pets of multidrug-resistant Klebsiella with ESBL, AmpC and PMQR determinants, poses further and serious challenges in companion animal therapy and raise concerns for possible bi-directional transmission

  8. Use of a non-radioactive hybridisation assay for direct detection of gram-negative bacteria carrying TEM beta-lactamase genes in infected urine.

    PubMed

    Carter, G I; Towner, K J; Pearson, N J; Slack, R C

    1989-02-01

    DNA in infected urines from 81 patients with urinary tract infection was hybridised directly with a non-radioactive DNA probe specific for bacterial genes coding for TEM-type beta-lactamase. The results were assessed by means of a computerised image analysis system and compared with those obtained following isolation of the infecting organism, conventional sensitivity testing and isoelectric focusing (IEF) procedures for the detection of TEM-type beta-lactamase. Of the 27 ampicillin-resistant gram-negative organisms isolated in pure culture from the urines, 14 were shown by both hybridisation and IEF to carry a gene for TEM beta-lactamase production. Only four discordant results were obtained: three "false positive" direct hybridisation results, one due to urine pigmentation, and one, possibly, to a TEM beta-lactamase gene which was not being expressed, and one "false negative" result due to insufficient cell numbers in the urine. The system is capable of screening large numbers of samples and is applicable to any gene for which a suitable DNA probe is available.

  9. Metallo-beta-lactamases of Pseudomonas aeruginosa--a novel mechanism resistance to beta-lactam antibiotics.

    PubMed

    Sacha, Paweł; Wieczorek, Piotr; Hauschild, Tomasz; Zórawski, Marcin; Olszańska, Dorota; Tryniszewska, Elzbieta

    2008-01-01

    Since about twenty years, following the introduction into therapeutic of news beta-lactam antibiotics (broad-spectrum cephalosporins, monobactams and carbapenems), a very significant number of new beta-lactamases appeared. These enzymes confer to the bacteria which put them, the means of resisting new molecules. The genetic events involved in this evolution are of two types: evolution of old enzymes by mutation and especially appearance of new genes coming for some, from bacteria of the environment. Numerous mechanisms of enzymatic resistance to the carbapenems have been described in Pseudomonas aeruginosa. The important mechanism of inactivation carbapenems is production variety of b-lactam hydrolysing enzymes associated to carbapenemases. The metallo-beta-enzymes (IMP, VIM, SPM, GIM types) are the most clinically significant carbapenemases. P. aeruginosa posses MBLs and seem to have acquired them through transmissible genetic elements (plasmids or transposons associated with integron) and can be transmission to other bacteria. They have reported worldwide but mostly from South East Asia and Europe. The enzymes, belonging to the molecular class B family, are the most worrisome of all beta-lactamases because they confer resistance to carbapenems and all the beta-lactams (with the exception of aztreonam) and usually to aminoglycosides and quinolones. The dissemination of MBLs genes is thought to be driven by regional consumption of extended--spectrum antibiotics (e.g. cephalosporins and carbapenems), and therefore care must be taken that these drugs are not used unnecessarily.

  10. Antibiotic resistance pattern and evaluation of metallo-beta lactamase genes (VIM and IMP) in Pseudomonas aeruginosa strains producing MBL enzyme, isolated from patients with secondary immunodeficiency

    PubMed Central

    Shirani, Kiana; Ataei, Behrouz; Roshandel, Fardad

    2016-01-01

    Background: One of the most common causes of hospital-acquired secondary infections in hospitalized patients is Pseudomonas aeruginosa. The aim of this study is to evaluate the expression of IMP and VIM in Pseudomonas aeruginosa strains (carbapenem resistant and producer MBL enzyme) in patients with secondary immunodeficiency. Materials and Methods: In a cross sectional study, 96 patients with secondary immunodeficiency hospitalized in the Al-Zahra hospital were selected. Carbapenem resistant strains isolated and modified Hodge test was performed in order to confirm the presence of the metallo carbapenemase enzyme. Under the standard conditions they were sent to the central laboratory for investigating nosocomial infection Multiplex PCR. Results: Of 96 samples 28.1% were IMP positive, 5.2% VIM positive and 3.1% both VIM and IMP positive. The prevalence of multidrug resistance in the IMP and/or VIM negative samples was 29%, while all 5 VIM positive samples have had multidrug resistance. Also the prevalence of multi-drug resistance in IMP positive samples were 96.3% and in IMP and VIM positive samples were 100%. According to Fisher’s test, the prevalence of multi-drug resistance based on gene expression has significant difference (P < 0.001). Conclusion: Based on the results of this study it can be concluded that, a significant percentage of patients with secondary immunodeficiency that suffer nosocomial infections with multidrug resistance, especially Pseudomonas aeruginosa, are probably MBL-producing gene positive. Therefore the cause of infection should be considered in the hospital care system to identify their features, the presence of genes involved in the development of multi-drug resistance and antibiotic therapy. PMID:27563634

  11. Antibacterial activities of multi drug resistant Myroides odoratimimus bacteria isolated from adult flesh flies (Diptera: sarcophagidae) are independent of metallo beta-lactamase gene

    PubMed Central

    Dharne, M.S.; Gupta, A.K.; Rangrez, A.Y.; Ghate, H.V.; Patole, M.S.; Shouche, Y.S.

    2008-01-01

    Flesh flies (Diptera: Sarcophagidae) are well known cause of myiasis and their gut bacteria have never been studied for antimicrobial activity against bacteria. Antimicrobial studies of Myroides spp. are restricted to nosocomial strains. A Gram-negative bacterium, Myroides sp., was isolated from the gut of adult flesh flies (Sarcophaga sp.) and submitted to evaluation of nutritional parameters using Biolog GN, 16S rRNA gene sequencing, susceptibility to various antimicrobials by disc diffusion method and detection of metallo β-lactamase genes (TUS/MUS). The antagonistic effects were tested on Gram-negative and Gram-positive bacteria isolated from human clinical specimens, environmental samples and insect mid gut. Bacterial species included were Aeromonas hydrophila, A. culicicola, Morganella morganii subsp. sibonii, Ochrobactrum anthropi, Weissella confusa, Escherichia coli, Ochrobactrum sp., Serratia sp., Kestersia sp., Ignatzschineria sp., Bacillus sp. The Myroides sp. strain was resistant to penicillin-G, erythromycin, streptomycin, amikacin, kanamycin, gentamycin, ampicillin, trimethoprim and tobramycin. These strain showed antibacterial action against all bacterial strains except W. confusa, Ignatzschineria sp., A. hydrophila and M. morganii subsp. sibonii. The multidrug resistance of the strain was similar to the resistance of clinical isolates, inhibiting growth of bacteria from clinical, environmental and insect gut samples. The metallo β-lactamase (TUS/MUS) genes were absent, and resistance due to these genes was ruled out, indicating involvement of other secretion machinery. PMID:24031236

  12. Multidrug resistance found in extended-spectrum beta-lactamase-producing Enterobacteriaceae from rural water reservoirs in Guantao, China.

    PubMed

    Zhang, Hongna; Zhou, Yufa; Guo, Shuyuan; Chang, Weishan

    2015-01-01

    Extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae have been isolated from humans and animals across the world. However, data on prevalence of ESBL-producing Enterobacteriaceae from rural water reservoirs is limited. This study aimed to isolate and characterize ESBL-producing Enterobacteriaceae in rural water reservoirs in Guantao, China. ESBL-producing Enterobacteriaceae were found in 5 (16.7%) of 30 sampled rural water reservoirs. Sixty-six individual isolates expressing an ESBL phenotype were obtained in the present study. Species identification showed that 42 representatives of Escherichia coli, 17 Klebsiella pneumoniae, 4 Raoultella planticola, and 3 Enterobacter cloacae. Twenty isolates contained a single bla gene, including CTX-M (17 strains), TEM (2 strains), and SHV (1 strain). Forty-six isolates contained more than one type of beta-lactamase genes. ESBL-producing Enterobacteriaceae isolated in this study were all multidrug resistant. These findings indicated that the serious contamination of ESBL-producing Enterobacteriaceae in rural water reservoirs existed in Guantao, China. PMID:25873918

  13. Multidrug resistance found in extended-spectrum beta-lactamase-producing Enterobacteriaceae from rural water reservoirs in Guantao, China

    PubMed Central

    Zhang, Hongna; Zhou, Yufa; Guo, Shuyuan; Chang, Weishan

    2015-01-01

    Extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae have been isolated from humans and animals across the world. However, data on prevalence of ESBL-producing Enterobacteriaceae from rural water reservoirs is limited. This study aimed to isolate and characterize ESBL-producing Enterobacteriaceae in rural water reservoirs in Guantao, China. ESBL-producing Enterobacteriaceae were found in 5 (16.7%) of 30 sampled rural water reservoirs. Sixty-six individual isolates expressing an ESBL phenotype were obtained in the present study. Species identification showed that 42 representatives of Escherichia coli, 17 Klebsiella pneumoniae, 4 Raoultella planticola, and 3 Enterobacter cloacae. Twenty isolates contained a single bla gene, including CTX-M (17 strains), TEM (2 strains), and SHV (1 strain). Forty-six isolates contained more than one type of beta-lactamase genes. ESBL-producing Enterobacteriaceae isolated in this study were all multidrug resistant. These findings indicated that the serious contamination of ESBL-producing Enterobacteriaceae in rural water reservoirs existed in Guantao, China. PMID:25873918

  14. Novel, plasmid-encoded, TEM-derived extended-spectrum beta-lactamase in Klebsiella pneumoniae conferring higher resistance to aztreonam than to extended-spectrum cephalosporins.

    PubMed Central

    Arlet, G; Rouveau, M; Fournier, G; Lagrange, P H; Philippon, A

    1993-01-01

    A clinical isolate of Klebsiella pneumoniae was more resistant to aztreonam than to cefotaxime and ceftazidime. It produced a clavulanate-susceptible beta-lactamase with an isoelectric point of 6.3 which readily hydrolyzed penicillins, cefotaxime, and ceftazidime, but which hydrolyzed aztreonam poorly. The enzyme was encoded by a gene on a 15-kb plasmid; the gene hybridized with an intragenic DNA probe of blaTEM. Images PMID:8239625

  15. [A new method for evaluation of beta-lactamase production of resistant enterobacteriaceae strains (author's transl)].

    PubMed

    Schassan, H H

    1978-01-01

    Resistant strains of Enterobacteriaceae were investigated with a chemical and microbiological test on beta-lactamase activity. The chemical method was needed as screening-test basing on the enzymatic hydrolysis of the chromogenic cephalosporin compound 87/312. The microbiological test is a modified cup plate method using Staph. aureus SG 511 as sensitive test strain for penicillins and cephalosporins. In one of the two cups of the blood agar plate 20 microliter of the beta-lactam antibiotic, in the other cup 20 microliter of the supernatant of the 24 h broth of the bacterial strain was pipettet. If the lactamase in the supernatant neutralises the antibiotic, a halfemoonlike blank is forming on the left site of the inhibition zone. An unchangeable inhibition zone demonstrates stability of the antibiotic to the enzyme. Each of 10 ampicillin- and/or cephalothin-resistant strains of E. coli, Klebsiella, Enterobacter and Serratia were investigated against 6 penicillins (penicillin G, ampicillin, ticarcillin, mezlocillin, azlocillin, bay k 4999) and 6 cephalosporins (cefoxitin, cefuroxime, cefamandol, cephalothin, cefazolin, cefradine). The microbiological method allows the statement, against which beta-lactam antibiotic the enzyme is effective. A correlation between the beta-lactamase activity and the MIC values in Enterobacteriaceae was not found. PMID:371259

  16. Biochemical properties of a carbapenem-hydrolyzing beta-lactamase from Enterobacter cloacae and cloning of the gene into Escherichia coli.

    PubMed Central

    Nordmann, P; Mariotte, S; Naas, T; Labia, R; Nicolas, M H

    1993-01-01

    A clinical isolate of Enterobacter cloacae, strain NOR-1, exhibited resistance to imipenem and remained susceptible to extended-spectrum cephalosporins. Clavulanic acid partially restored the susceptibility of the strain to imipenem. Two beta-lactamases with isoelectric points (pI) of 6.9 and > 9.2 were detected in strain E. cloacae NOR-1; the higher pI corresponded to AmpC cephalosporinase. Plasmid DNA was not detected in E. cloacae NOR-1 and imipenem resistance could not be transferred into Escherichia coli JM109. The carbapenem-hydrolyzing beta-lactamase gene was cloned into plasmid pACYC184. One recombinant plasmid, pPTN1, harbored a 5.3-kb Sau3A fragment from E. cloacae NOR-1 expressing the carbapenem-hydrolyzing beta-lactamase. This enzyme (pI 6.9) hydrolyzed ampicillin, cephalothin, and imipenem more rapidly than it did meropenem and aztreonam, but it hydrolyzed extended-spectrum cephalosporins only weakly and did not hydrolyze cefoxitin. Hydrolytic activity was partially inhibited by clavulanic acid, sulbactam, and tazobactam, was nonsusceptible to chelating agents such as EDTA and 1,10-o-phenanthroline, and was independent of the presence of ZnCl2. Its relative molecular mass was 30,000 Da. Induction experiments concluded that the carbapenem-hydrolyzing beta-lactamase biosynthesis was inducible by cefoxitin and imipenem. Subcloning experiments with HindIII partial digests of pPTN1 resulted in a recombinant plasmid, designated pPTN2, which contained a 1.3-kb insert from pPTN1 and which conferred resistance to beta-lactam antibiotics. Hybridization studies performed with a 1.2-kb HindIII fragment from pPtN2 failed to determine any homology with ampC of E. cloacae, with other known beta-lactamase genes commonly found in members of the family Enterobacteriaceae (bla(TEM-1)) and bla(SHV-3) derivatives), and with previously described carbapenemase genes such as those from Xanthomonas maltophilia, Bacillus cereus, Bacteroides fragilis (cfiA), and Aeromonas

  17. Detection of genes mediating beta-lactamase production in isolates of enterobacteria recovered from wild pets in Saudi Arabia

    PubMed Central

    Hassan, Sabry A.; Shobrak, Mohammed Y.

    2015-01-01

    Aim: To determine the genetic basis and types of beta-lactamase encountered among enterobacterial isolates of wild pets from the animal exhibit. Materials and Methods: A total of 17 beta-lactamase-producing enterobacteria recovered from fecal samples of wild pet animals were analyzed for a selected beta-lactamase gene by polymerase chain reaction. Results: Molecular analysis identified one or more β-lactamase-encoding genes in 14 enterobacterial isolates as a single or gene combination. The most frequent extended-spectrum β-lactamases types were TEM and CTX-M, and the most common AmpC enzymes were CMY-2 and DHA types. Conclusions: The study is the first in Saudi Arabia, have established the presence of β-lactamase-encoding genes in the fecal isolates of wild pets. PMID:27047051

  18. Studies of Antibiotic Resistance of Beta-Lactamase Bacteria under Different Nutrition Limitations at the Single-Cell Level

    PubMed Central

    Wang, Ying; Ran, Min; Wang, Jun; Ouyang, Qi; Luo, Chunxiong

    2015-01-01

    Drug resistance involves many biological processes, including cell growth, cell communication, and cell cooperation. In the last few decades, bacterial drug resistance studies have made substantial progress. However, a major limitation of the traditional resistance study still exists: most of the studies have concentrated on the average behavior of enormous amounts of cells rather than surveying single cells with different phenotypes or genotypes. Here, we report our study of beta-lactamase bacterial drug resistance in a well-designed microfluidic device, which allows us to conduct more controllable experiments, such as controlling the nutrient concentration, switching the culture media, performing parallel experiments, observing single cells, and acquiring time-lapse images. By using GFP as a beta-lactamase indicator and acquiring time-lapse images at the single-cell level, we observed correlations between the bacterial heterogeneous phenotypes and their behavior in different culture media. The feedback loop between the growth rate and the beta-lactamase production suggests that the beta-lactamase bacteria are more resistant in a rich medium than in a relatively poor medium. In the poorest medium, the proportion of dormant cells may increase, which causes a lower death rate in the same generation. Our work may contribute to assaying the antibiotic resistance of pathogenic bacteria in heterogeneous complex media. PMID:25993008

  19. Beta-Lactamase Repressor BlaI Modulates Staphylococcus aureus Cathelicidin Antimicrobial Peptide Resistance and Virulence

    PubMed Central

    Pence, Morgan A.; Haste, Nina M.; Meharena, Hiruy S.; Olson, Joshua; Gallo, Richard L.; Nizet, Victor; Kristian, Sascha A.

    2015-01-01

    BlaI is a repressor of BlaZ, the beta-lactamase responsible for penicillin resistance in Staphylococcus aureus. Through screening a transposon library in S. aureus Newman for susceptibility to cathelicidin antimicrobial peptide, we discovered BlaI as a novel cathelicidin resistance factor. Additionally, through integrational mutagenesis in S. aureus Newman and MRSA Sanger 252 strains, we confirmed the role of BlaI in resistance to human and murine cathelidicin and showed that it contributes to virulence in human whole blood and murine infection models. We further demonstrated that BlaI could be a target for innate immune-based antimicrobial therapies; by removing BlaI through subinhibitory concentrations of 6-aminopenicillanic acid, we were able to sensitize S. aureus to LL-37 killing. PMID:26305782

  20. First characterization of inhibitor-resistant TEM (IRT) beta-lactamases in Klebsiella pneumoniae strains.

    PubMed Central

    Lemozy, J; Sirot, D; Chanal, C; Huc, C; Labia, R; Dabernat, H; Sirot, J

    1995-01-01

    Two clinical strains of Klebsiella pneumoniae, TP 01 and TP 02, presented resistance to amoxicillin-clavulanate and were fully susceptible to cephalothin. These strains produced two beta-lactamases, SHV-1 and a TEM enzyme with a pI of 5.2. The previously described changes Arg-244-->Cys and Arg-244-->Ser in IRT-1 and IRT-2 (A. Belaaouaj, C. Lapoumeroulie, M. M. Caniça, G. Vedel, P. Nevot, R. Krishnamoorthy, and G. Paul, FEMS Microbiol. Lett. 120:75-80, 1994) were found in TEM enzymes from the TP 01 and TP 02 strains, respectively. This is the first report of inhibitor-resistant TEM (IRT) in species other than Escherichia coli from the family Enterobacteriaceae. PMID:8585751

  1. Molecular and biochemical characterization of VEB-1, a novel class A extended-spectrum beta-lactamase encoded by an Escherichia coli integron gene.

    PubMed

    Poirel, L; Naas, T; Guibert, M; Chaibi, E B; Labia, R; Nordmann, P

    1999-03-01

    A clinical isolate, Escherichia coli MG-1, isolated from a 4-month-old Vietnamese orphan child, produced a beta-lactamase conferring resistance to extended-spectrum cephalosporins and aztreonam. In a disk diffusion test, a typical synergistic effect between ceftazidime or aztreonam and clavulanic acid was observed along with an unusual synergy between cefoxitin and cefuroxime. The gene for VEB-1 (Vietnamese extended-spectrum beta-lactamase) was cloned and expressed in E. coli JM109. The recombinant plasmid pRLT1 produced a beta-lactamase with a pI of 5.35 and conferred high-level resistance to extended-spectrum (or oxyimino) cephalosporins and to aztreonam. Vmax values for extended-spectrum cephalosporins were uncommonly high, while the affinity of the enzyme for ceftazidime and aztreonam was relatively low. blaVEB-1 showed significant homology at the DNA level with only blaPER-1 and blaPER-2. Analysis of the deduced protein sequence showed that VEB-1 is a class A penicillinase having very low levels of homology with any other known beta-lactamases. The highest percentage of amino acid identity was 38% with PER-1 or PER-2, two uncommon class A extended-spectrum enzymes. Exploration of the genetic environment of blaVEB-1 revealed the presence of gene cassette features, i.e., (i) a 59-base element associated with blaVEB-1; (ii) a second 59-base element just upstream of blaVEB-1, likely belonging to the aacA1-orfG gene cassette; (iii) two core sites (GTTRRRY) on both sides of blaVEB-1; and (iv) a second antibiotic resistance gene 3' of blaVEB-1, aadB. blaVEB-1 may therefore be the first class A extended-spectrum beta-lactamase that is part of a gene cassette, which itself is likely to be located on a class 1 integron, as sulfamide resistance may indicate. Furthermore, blaVEB-1 is encoded on a large (> 100-kb) transferable plasmid found in a Klebsiella pneumoniae MG-2 isolated at the same time from the same patient, indicating a horizontal gene transfer.

  2. Genetic diversity of genes encoding OKP and LEN beta-lactamases produced by clinical Klebsiella pneumoniae strains in Portugal.

    PubMed

    Mendonça, Nuno; Ferreira, Eugénia; Caniça, Manuela

    2009-03-01

    Of the 308 clinical Klebsiella pneumoniae strains collected in 21 Portuguese health institutions, 11 encoded for LEN and 9 for OKP enzymes; of these, 15 were new enzymes. Ninety-one percent of LEN and all OKP producer strains were resistant to amoxicillin. We demonstrate that these beta-lactamase were highly diverse.

  3. Occurrence of Multidrug Resistant Extended Spectrum Beta-Lactamase-Producing Bacteria on Iceberg Lettuce Retailed for Human Consumption.

    PubMed

    Bhutani, Natasha; Muraleedharan, Chithra; Talreja, Deepa; Rana, Sonia Walia; Walia, Sandeep; Kumar, Ashok; Walia, Satish K

    2015-01-01

    Antibiotic resistance in bacteria is a global problem exacerbated by the dissemination of resistant bacteria via uncooked food, such as green leafy vegetables. New strains of bacteria are emerging on a daily basis with novel expanded antibiotic resistance profiles. In this pilot study, we examined the occurrence of antibiotic resistant bacteria against five classes of antibiotics on iceberg lettuce retailed in local convenience stores in Rochester, Michigan. In this study, 138 morphologically distinct bacterial colonies from 9 iceberg lettuce samples were randomly picked and tested for antibiotic resistance. Among these isolates, the vast majority (86%) demonstrated resistance to cefotaxime, and among the resistant bacteria, the majority showed multiple drug resistance, particularly against cefotaxime, chloramphenicol, and tetracycline. Three bacterial isolates (2.17%) out of 138 were extended spectrum beta-lactamase (ESBL) producers. Two ESBL producers (T1 and T5) were identified as Klebsiella pneumoniae, an opportunistic pathogen with transferable sulfhydryl variable- (SHV-) and TEM-type ESBLs, respectively. The DNA sequence analysis of the bla SHV detected in K. pneumoniae isolate T1 revealed 99% relatedness to bla SHV genes found in clinical isolates. This implies that iceberg lettuce is a potential reservoir of newly emerging and evolving antibiotic resistant bacteria and its consumption poses serious threat to human health. PMID:26064922

  4. Occurrence of Multidrug Resistant Extended Spectrum Beta-Lactamase-Producing Bacteria on Iceberg Lettuce Retailed for Human Consumption

    PubMed Central

    Talreja, Deepa; Rana, Sonia Walia; Walia, Sandeep; Walia, Satish K.

    2015-01-01

    Antibiotic resistance in bacteria is a global problem exacerbated by the dissemination of resistant bacteria via uncooked food, such as green leafy vegetables. New strains of bacteria are emerging on a daily basis with novel expanded antibiotic resistance profiles. In this pilot study, we examined the occurrence of antibiotic resistant bacteria against five classes of antibiotics on iceberg lettuce retailed in local convenience stores in Rochester, Michigan. In this study, 138 morphologically distinct bacterial colonies from 9 iceberg lettuce samples were randomly picked and tested for antibiotic resistance. Among these isolates, the vast majority (86%) demonstrated resistance to cefotaxime, and among the resistant bacteria, the majority showed multiple drug resistance, particularly against cefotaxime, chloramphenicol, and tetracycline. Three bacterial isolates (2.17%) out of 138 were extended spectrum beta-lactamase (ESBL) producers. Two ESBL producers (T1 and T5) were identified as Klebsiella pneumoniae, an opportunistic pathogen with transferable sulfhydryl variable- (SHV-) and TEM-type ESBLs, respectively. The DNA sequence analysis of the blaSHV detected in K. pneumoniae isolate T1 revealed 99% relatedness to blaSHV genes found in clinical isolates. This implies that iceberg lettuce is a potential reservoir of newly emerging and evolving antibiotic resistant bacteria and its consumption poses serious threat to human health. PMID:26064922

  5. Characterization of Multidrug Resistant Extended-Spectrum Beta-Lactamase-Producing Escherichia coli among Uropathogens of Pediatrics in North of Iran

    PubMed Central

    Rezai, Mohammad Sadegh; Salehifar, Ebrahim; Rafiei, Alireza; Rafati, Mohammadreza; Shafahi, Kheironesa

    2015-01-01

    Escherichia coli remains as one of the most important bacteria causing infections in pediatrics and producing extended-spectrum beta-lactamases (ESBLs) making them resistant to beta-lactam antibiotics. In this study we aimed to genotype ESBL-producing E. coli isolates from pediatric patients for ESBL genes and determine their association with antimicrobial resistance. One hundred of the E. coli isolates were initially considered ESBL producing based on their MIC results. These isolates were then tested by polymerase chain reaction (PCR) for the presence or absence of CTX, TEM, SHV, GES, and VEB beta-lactamase genes. About 30.5% of isolated E. coli was ESBL-producing strain. The TEM gene was the most prevalent (49%) followed by SHV (44%), CTX (28%), VEB (8%), and GES (0%) genes. The ESBL-producing E. coli isolates were susceptible to carbapenems (66%) and amikacin (58%) and showed high resistance to cefixime (99%), colistin (82%), and ciprofloxacin (76%). In conclusion, carbapenems were the most effective antibiotics against ESBl-producing E. coli in urinary tract infection in North of Iran. The most prevalent gene is the TEM-type, but the other resistant genes and their antimicrobial resistance are on the rise. PMID:26064896

  6. Comparative characterization of the cephamycinase blaCMY-1 gene and its relationship with other beta-lactamase genes.

    PubMed Central

    Bauernfeind, A; Stemplinger, I; Jungwirth, R; Wilhelm, R; Chong, Y

    1996-01-01

    A plasmidic beta-lactamase which hydrolyzed cephamycins was first detected and reported in 1989. At that time its description was restricted to phenotypic characteristics. We analyzed nucleotide sequence of its gene and explored it genetic relationship with other bla genes. The deduced amino acid sequence of the blaCMY-1 product was compared with those of other known plasmidic cephamycinases and of chromosomal AmpC beta-lactamases. The results indicate that the relationship of CMY-1 is closest to MOX-1 among the plasmidic cephamycinases and to AmpC of Pseudomonas aeruginosa among the chromosomal cephalosporinases. We conclude that the plasmidic cephamycinases described up to now may be classified into three families, as follows: CMY-1, MOX-1, and FOX-1 with AmpC of P. aeruginosa; CMY-2, BIL-1 and LAT-1 with AmpC of Citrobacter freundii; and MIR-1 with AmpC of Enterobacter cloacae. Plasmidic cephamycinases are now recognized as clinically relevant class C beta-lactamases. PMID:8843306

  7. Early onset Morganella morganii sepsis in a newborn infant with emergence of cephalosporin resistance caused by depression of AMPC beta-lactamase production..

    PubMed

    Sinha, Ajay K; Kempley, Stephen T; Price, Elizabeth; Sharma, Bal K; Livermore, David M

    2006-04-01

    A preterm infant with early onset Morganella morganii sepsis was treated with cefotaxime and gentamicin after confirmation of antimicrobial susceptibility. The infant developed persistent ventriculitis caused by the emergence of a cefotaxime-resistant Morganella variant with derepression of its AmpC beta-lactamase. When choosing antibiotic therapy, the risk of development of resistance to cephalosporins should be considered in infections caused by M. morganii and other Gram-negative organisms with inducible AmpC beta-lactamases.

  8. Delivery of TEM beta-lactamase by gene-transformed Lactococcus lactis subsp. lactis through cervical cell monolayer.

    PubMed

    Kaushal, Gagan; Trombetta, Louis; Ochs, Raymond S; Shao, Jun

    2006-04-26

    Lactococcus lactis subsp. lactis transformed with Plasmid ss80 (encoding the production and secretion of TEM beta-lactamase) was used for the delivery of beta-lactamase through the C-33A (cervix cell) monolayer. The viability of the cell monolayers co-cultured with L. lactis was examined by the trypan blue exclusion method. The integrity of the monolayers was monitored by measuring the transport of mannitol and propranolol as well as the transepithelial electrical resistance. The transport rate of beta-lactamase through C-33A monolayer was increased by four- and nine-folds (p < 0.05) at the first hour by the transformed L. lactis compared to the free solution with or without presence of the untransformed L. lactis, respectively. This increase was gradually diminished after the 1st hour: it became 30 and 50% (p < 0.05) at 10 h. The presence of the untransformed L. lactis with free solution delivery also increased the transport rate by 100% at 1 h (p < 0.05) and 15% at 10h (p>0.05). The increase in transport rate by the transformed L. lactis is most probably due to the concentrate of beta-lactamase on C-33A monolayer. When co-cultured with the L. lactis, the C-33A cell viability and the monolayer TEER remained steady for 10 h. The presence of L. lactis did not change the transport of propranolol and mannitol through the monolayers. In conclusion, the transformed L. lactis significantly (p < 0.05) increased the transport of beta-lactamase through the cervical monolayers, indicating probiotic bacteria delivery may be a promising approach for protein delivery through the vagina.

  9. Decreased production of AmpC-type beta-lactamases associated with the development of resistance to quinolones in Citrobacter freundii strains.

    PubMed

    Tavío Pérez, M M; Amicosante, G; Franceschini, N; Vila, J; Ruiz, J; Oratore, A; Martín-Sánchez, A M; Jiménez de Anta, M T

    1999-01-01

    The effect of fluoroquinolones in Citrobacter freundii strains that results in a decreased expression of cephalosporin-hydrolysing beta-lactamases was studied. Resistance to broad-spectrum cephalosporins and penicillins in two C. freundii clinical isolates was associated with moderate production of chromosomal AmpC-type-beta-lactamase in addition to changes in the outer membrane proteins profile with respect to wild-type C. freundii strains. Ten quinolone-resistant mutants were derived from the two clinical isolates using increasing fluoroquinolone concentrations. The level of susceptibility to cephalosporins and meropenem of these 10 mutants was increased and was associated with a 3.6-32% diminution in the hydrolyzing activity of their periplasmic extracts containing beta-lactamases on cephaloridine as compared with those from their parent strains. Susceptibility to cephalosporins and meropenem, as well as the expression of chromosomal AmpC-type-beta-lactamase in C. freundii strains, was influenced by the exposure to quinolones.

  10. Characterization of an extended-spectrum class C beta-lactamase of Citrobacter freundii.

    PubMed

    Haruta, S; Nukaga, M; Sawai, T

    2001-01-01

    Citrobacter freundii GC3 is a clinical isolate which showed moderate resistance to oxyimino beta-lactams such as ceftazidime and aztreonam. This drug resistance was due to an extended-spectrum class C beta-lactamase encoded by chromosomal gene(s). The GC3 beta-lactamase showed high amino acid sequence homology to a known C. freundii beta-lactamase, i.e., 346 of 361 amino acids were identical with those of C. freundii GN346 beta-lactamase (Tsukamoto, K. et al, Eur. J. Biochem. 188, 15-22, 1990). Asp198 was the only dissimilar amino acid found in the omega loop region, known as the hot spot for extended-spectrum resistance in class C beta-lactamases (Haruta, S. et al, Microbiol. Immunol. 42, 165-169, 1998). However, Asp198 was eliminated as a cause of the extended-spectrum resistance by the substitution of Asn for Asp198. Subsequent investigation suggested that the moderate resistance to oxyimino beta-lactams is attributable to the replacement of amino acids on the enzyme's surface area, far from the active-site. Some or all of the replacements are assumed to delicately modify the active-site configuration. The GC3 beta-lactamase is the first example of an extended-spectrum class C beta-lactamase in which mutations are independent of the omega loop.

  11. Plasmid-mediated AmpC-type beta-lactamase isolated from Klebsiella pneumoniae confers resistance to broad-spectrum beta-lactams, including moxalactam.

    PubMed Central

    Horii, T; Arakawa, Y; Ohta, M; Ichiyama, S; Wacharotayankun, R; Kato, N

    1993-01-01

    Klebsiella pneumoniae NU2936 was isolated from a patient and was found to produce a plasmid-encoded beta-lactamase (MOX-1) which conferred resistance to broad spectrum beta-lactams, including moxalactam, flomoxef, ceftizoxime, cefotaxime, and ceftazidime. Resistance could be transferred from K. pneumoniae NU2936 to Escherichia coli CSH2 by conjugation with a transfer frequency of 5 x 10(-7). The structural gene of MOX-1 (blaMOX-1) was cloned and expressed in E. coli HB101. The MIC of moxalactam for E. coli HB101 producing MOX-1 was > 512 micrograms/ml. The apparent molecular mass and pI of this enzyme were calculated to be 38 kDa and 8.9, respectively. Hg2+ and Cu2+ failed to block enzyme activity, and the presence of EDTA in the reaction buffer did not reduce the enzyme activity. However, clavulanate and cloxacillin, serine beta-lactamase inhibitors, inhibited the enzyme activity competitively (Kis = 5.60 and 0.35 microM, respectively). The kinetic study of MOX-1 suggested that it effectively hydrolyzed broad-spectrum beta-lactams. A hybridization study confirmed that blaMOX-1 is encoded on a large resident plasmid (pRMOX1; 180 kb) of strain NU2936. By deletion analysis, the functional region was localized within a 1.2-kb region of the plasmid. By amino acid sequencing, 18 of 33 amino acid residues at the N terminus of MOX-1 were found to be identical to those of Pseudomonas aeruginosa AmpC. These findings suggest that MOX-1 is a plasmid-mediated AmpC-type beta-lactamase that provides enteric bacteria resistance to broad-spectrum beta-lactams, including moxalactam. Images PMID:8517725

  12. Emergence of Multidrug Resistance and Metallo-beta-lactamase Producing Acinetobacter baumannii Isolated from Patients in Shiraz, Iran

    PubMed Central

    Moghadam, MN; Motamedifar, M; Sarvari, J; Sedigh, Ebrahim-Saraie H; Mousavi, Same M; Moghadam, FN

    2016-01-01

    Background: Metallo-beta-lactamase (MβL) enzymes production is one of the most important resistance mechanisms against carbapenems in some bacteria including Acinetobacter baumannii. Aims: This study was aimed to determine the antimicrobial susceptibility and the prevalence of MβL among carbapenem-resistant isolates of A. baumannii. Materials and Methods: In this cross-sectional study from October 2012 to April 2013, 98 isolates were identified as A. baumannii using Microgen™ kits and confirmed by molecular method. These isolates were tested for antimicrobial susceptibilities by disk diffusion method according to the Clinical and Laboratory Standards Institute guidelines. Carbapenem-resistant isolates were further detected phenotypically by MβL minimal inhibitory concentration (MIC)-test strips, and subsequently positive MβL isolates were confirmed by polymerase chain reaction (PCR). Results: Overall, 98% (96/98) of A. baumannii isolates were detected as carbapenem-resistant by MIC test. Highest sensitivity to the tested antibiotic with 42.9% (42/98) was observed to colistin. Of 96 carbapenem-resistant isolates, 43 were phenotypically positive for MβL; out of 43 isolates, 37 were confirmed for the presence of MβL genes by PCR. Conclusion: The frequency of drug resistance among the clinical samples of A. baumannii isolated in our study against most of the antibiotics was very high. Moreover, all MβL producing isolates were multidrug resistance. Therefore, systematic surveillance to detect MβL producing bacteria and rational prescription and use of carbapenems could be helpful to prevent the spread of carbapenem resistance. PMID:27398247

  13. Ampicillin-resistant non-beta-lactamase-producing Haemophilus influenzae in Spain: recent emergence of clonal isolates with increased resistance to cefotaxime and cefixime.

    PubMed

    García-Cobos, Silvia; Campos, José; Lázaro, Edurne; Román, Federico; Cercenado, Emilia; García-Rey, César; Pérez-Vázquez, María; Oteo, Jesús; de Abajo, Francisco

    2007-07-01

    The sequence of the ftsI gene encoding the transpeptidase domain of penicillin-binding protein 3 (PBP 3) was determined for 354 nonconsecutive Haemophilus influenzae isolates from Spain; 17.8% of them were ampicillin susceptible, 56% were beta-lactamase nonproducing ampicillin resistant (BLNAR), 15.8% were beta-lactamase producers and ampicillin resistant, and 10.4% displayed both resistance mechanisms. The ftsI gene sequences had 28 different mutation patterns and amino acid substitutions at 23 positions. Some 93.2% of the BLNAR strains had amino acid substitutions at the Lys-Thr-Gly (KTG) motif, the two most common being Asn526 to Lys (83.9%) and Arg517 to His (9.3%). Amino acid substitutions at positions 377, 385, and 389, which conferred cefotaxime and cefixime MICs 10 to 60 times higher than those of susceptible strains, were found for the first time in Europe. In 72 isolates for which the repressor acrR gene of the AcrAB efflux pump was sequenced, numerous amino acid substitutions were found. Eight isolates with ampicillin MICs of 0.25 to 2 microg/ml showed changes that predicted the early termination of the acrR reading frame. Pulsed-field gel electrophoresis analysis demonstrated that most BLNAR strains were genetically diverse, although clonal dissemination was detected in a group of isolates presenting with increased resistance to cefotaxime and cefixime. Background antibiotic use at the community level revealed a marked trend toward increased amoxicillin-clavulanic acid consumption. BLNAR H. influenzae strains have arisen by vertical and horizontal spread and have evolved to adapt rapidly to the increased selective pressures posed by the use of oral penicillins and cephalosporins.

  14. Thiol-beta-lactamase: replacement of the active-site serine of RTEM beta-lactamase by a cysteine residue.

    PubMed

    Sigal, I S; Harwood, B G; Arentzen, R

    1982-12-01

    We describe a procedure by which the codon (AGC) for the active-site serine-70 of pBR322 beta-lactamase (penicillinase, penicillin amido-beta-lactamhydrolase, EC 3.5.2.6) is altered to that for cysteine (TGC). The pertinent nucleotide bases, A-G-C-A, positions 410-413, of pBR322 are excised by treating a limited HgiAI digest of pBR322 with the 3' leads to 5' exonuclease of T4 DNA polymerase. The new sequence, T-G-C-A, is inserted in two steps. First, the Kpn I molecular linker d(T-G-G-T-A-C-C-A) is ligated into the gap described above. The internal sequence G-T-A-C is then excised enzymatically with Kpn I and T4 DNA polymerase and the molecule is recircularized. This mutant gene, which codes for a thiol-beta-lactamase, confers on Escherichia coli K-12 hosts an ampicillin resistance that is reduced compared with that given by pBR322 yet is greater than that of E. coli lacking any intact beta-lactamase gene. Cell-free extracts of E. coli strains hosting the thiol-beta-lactamase gene possess a p-chloromercuribenzoate-sensitive beta-lactamase activity.

  15. Acquired resistance of Nocardia brasiliensis to clavulanic acid related to a change in beta-lactamase following therapy with amoxicillin-clavulanic acid.

    PubMed Central

    Steingrube, V A; Wallace, R J; Brown, B A; Pang, Y; Zeluff, B; Steele, L C; Zhang, Y

    1991-01-01

    Previous studies have demonstrated that Nocardia brasiliensis is susceptible to amoxicillin-clavulanic acid and that its beta-lactamases are inhibited in vitro by clavulanic acid. A cardiac transplant patient with disseminated infection caused by N. brasiliensis was treated with this drug combination with good response, but relapsed while still on therapy. The relapse isolate was found to be identical to the initial isolate by using genomic DNA restriction fragment patterns obtained by pulsed field gel electrophoresis, but it was resistant to amoxicillin-clavulanic acid. On isoelectric focusing, the beta-lactamase from the relapse isolate exhibited a shift in the isoelectric point (pI) of its major band from 5.10 to 5.04 compared with the enzyme from the pretreatment isolate. As determined by using values of the amount of beta-lactamase inhibitor necessary to give 50 +/- 5% inhibition of beta-lactamase-mediated hydrolysis of 50 microM nitrocefin, the beta-lactamase of the relapse isolate was also 200-fold more resistant than the enzyme from the pretreatment isolate to clavulanic acid and was more resistant to sulbactam, tazobactam, cloxacillin, and imipenem. The beta-lactamase of the relapse isolate exhibited a 10-fold decrease in hydrolytic activity for cephaloridine and other hydrolyzable cephalosporins compared with that for nitrocefin. Acquired resistance to amoxicillin-clavulanic acid in this isolate of N. brasiliensis appears to have resulted from a mutational change affecting the inhibitor and active site(s) in the beta-lactamase. Images PMID:2039203

  16. Translocation of antibiotic resistance determinants including an extended-spectrum beta-lactamase between conjugative plasmids of Klebsiella pneumoniae and Escherichia coli.

    PubMed Central

    Sirot, D; De Champs, C; Chanal, C; Labia, R; Darfeuille-Michaud, A; Perroux, R; Sirot, J

    1991-01-01

    The extended-spectrum beta-lactamase CAZ-7, derived from TEMs, was produced by two different strains of the family Enterobacteriaceae, Klebsiella pneumoniae and Escherichia coli, isolated from the same patient. Both isolates were resistant to amikacin. In addition, the K. pneumoniae strain was TEM-1 producing and resistant to gentamicin. An E. coli HB101 transconjugant obtained from K. pneumoniae, selected on ceftazidime, showed that CAZ-7 and amikacin resistance were encoded by an 85-kb Inc7 or M plasmid, while an E. coli HB101 transconjugant obtained from E. coli under the same conditions showed that CAZ-7 and amikacin resistance were encoded by a greater than 150-kb Inc6 or C plasmid. Two other E. coli HB101 transconjugants obtained from K. pneumoniae, selected on gentamicin or chloramphenicol, showed that TEM-1 and gentamicin resistance could be encoded either by a greater than 150-kb Inc6 or C plasmid or by an 85-kb Inc7 or M plasmid. It was hypothesized that the genes for beta-lactam and aminoglycoside resistances were located on translocatable sequences. EcoRI digestion and hybridizations obtained with blatem, aacA4, and IS15 probes demonstrated that the CAZ-7 gene, amikacin resistance gene, and IS15 element were clustered on an approximately 20-kb fragment common to 85- and greater than 150-kb plasmids. E. coli HB101 transconjugants from K. pneumoniae and E. coli isolates were used to obtain translocations of CAZ-7 and amikacin resistance and of TEM-1 and gentamicin resistance between the 85- and greater than 150-kb plasmids. This study shows a typical example of in vivo gene dissemination involving transposable elements which translocate multiresistance genes, including an extended-spectrum beta-lactamase. Images PMID:1929328

  17. Translocation of antibiotic resistance determinants including an extended-spectrum beta-lactamase between conjugative plasmids of Klebsiella pneumoniae and Escherichia coli.

    PubMed

    Sirot, D; De Champs, C; Chanal, C; Labia, R; Darfeuille-Michaud, A; Perroux, R; Sirot, J

    1991-08-01

    The extended-spectrum beta-lactamase CAZ-7, derived from TEMs, was produced by two different strains of the family Enterobacteriaceae, Klebsiella pneumoniae and Escherichia coli, isolated from the same patient. Both isolates were resistant to amikacin. In addition, the K. pneumoniae strain was TEM-1 producing and resistant to gentamicin. An E. coli HB101 transconjugant obtained from K. pneumoniae, selected on ceftazidime, showed that CAZ-7 and amikacin resistance were encoded by an 85-kb Inc7 or M plasmid, while an E. coli HB101 transconjugant obtained from E. coli under the same conditions showed that CAZ-7 and amikacin resistance were encoded by a greater than 150-kb Inc6 or C plasmid. Two other E. coli HB101 transconjugants obtained from K. pneumoniae, selected on gentamicin or chloramphenicol, showed that TEM-1 and gentamicin resistance could be encoded either by a greater than 150-kb Inc6 or C plasmid or by an 85-kb Inc7 or M plasmid. It was hypothesized that the genes for beta-lactam and aminoglycoside resistances were located on translocatable sequences. EcoRI digestion and hybridizations obtained with blatem, aacA4, and IS15 probes demonstrated that the CAZ-7 gene, amikacin resistance gene, and IS15 element were clustered on an approximately 20-kb fragment common to 85- and greater than 150-kb plasmids. E. coli HB101 transconjugants from K. pneumoniae and E. coli isolates were used to obtain translocations of CAZ-7 and amikacin resistance and of TEM-1 and gentamicin resistance between the 85- and greater than 150-kb plasmids. This study shows a typical example of in vivo gene dissemination involving transposable elements which translocate multiresistance genes, including an extended-spectrum beta-lactamase.

  18. Growing Menace of Antibacterial Resistance in Clinical Isolates of Pseudomonas aeruginosa in Nepal: An Insight of Beta-Lactamase Production

    PubMed Central

    Dhital, Rabindra; Puri, Ram; Chaudhary, Niraj; Khatiwada, Suresh

    2016-01-01

    Introduction. Pseudomonas aeruginosa is the most frequently isolated organism as it acts as the opportunistic pathogen and can cause infections in immunosuppressed patients. The production of different types of beta-lactamases renders this organism resistant to many commonly used antimicrobials. Therefore, the aim of this study was to document the antibiotic resistance rate in Pseudomonas aeruginosa isolated from different clinical specimens. Methods. Pseudomonas aeruginosa recovered was identified by standard microbiological methods. Antibiotic susceptibility testing was performed by modified Kirby-Bauer disc diffusion method following Clinical and Laboratory Standard Institute (CLSI) guidelines and all the suspected isolates were tested for the production of ESBLs, MBLs, and AmpC. Results. Out of total (178) isolates, 83.1% were recovered from the inpatient department (IPD). Majority of the isolates mediated resistance towards the beta-lactam antibiotics, while nearly half of the isolates were resistant to ciprofloxacin. Most of the aminoglycosides used showed resistance rate up to 75% but amikacin proved to be better option. No resistance to polymyxin was observed. ESBLs, MBLs, and AmpC mediated resistance was seen in 33.1%, 30.9%, and 15.7% isolates, respectively. Conclusions. Antibiotic resistance rate and beta-lactamase mediated resistance were high. Thus, regular surveillance of drug resistance is of utmost importance.

  19. Growing Menace of Antibacterial Resistance in Clinical Isolates of Pseudomonas aeruginosa in Nepal: An Insight of Beta-Lactamase Production.

    PubMed

    Ansari, Shamshul; Dhital, Rabindra; Shrestha, Sony; Thapa, Sangita; Puri, Ram; Chaudhary, Niraj; Khatiwada, Suresh; Gautam, Rajendra

    2016-01-01

    Introduction. Pseudomonas aeruginosa is the most frequently isolated organism as it acts as the opportunistic pathogen and can cause infections in immunosuppressed patients. The production of different types of beta-lactamases renders this organism resistant to many commonly used antimicrobials. Therefore, the aim of this study was to document the antibiotic resistance rate in Pseudomonas aeruginosa isolated from different clinical specimens. Methods. Pseudomonas aeruginosa recovered was identified by standard microbiological methods. Antibiotic susceptibility testing was performed by modified Kirby-Bauer disc diffusion method following Clinical and Laboratory Standard Institute (CLSI) guidelines and all the suspected isolates were tested for the production of ESBLs, MBLs, and AmpC. Results. Out of total (178) isolates, 83.1% were recovered from the inpatient department (IPD). Majority of the isolates mediated resistance towards the beta-lactam antibiotics, while nearly half of the isolates were resistant to ciprofloxacin. Most of the aminoglycosides used showed resistance rate up to 75% but amikacin proved to be better option. No resistance to polymyxin was observed. ESBLs, MBLs, and AmpC mediated resistance was seen in 33.1%, 30.9%, and 15.7% isolates, respectively. Conclusions. Antibiotic resistance rate and beta-lactamase mediated resistance were high. Thus, regular surveillance of drug resistance is of utmost importance. PMID:27642599

  20. Growing Menace of Antibacterial Resistance in Clinical Isolates of Pseudomonas aeruginosa in Nepal: An Insight of Beta-Lactamase Production

    PubMed Central

    Dhital, Rabindra; Puri, Ram; Chaudhary, Niraj; Khatiwada, Suresh

    2016-01-01

    Introduction. Pseudomonas aeruginosa is the most frequently isolated organism as it acts as the opportunistic pathogen and can cause infections in immunosuppressed patients. The production of different types of beta-lactamases renders this organism resistant to many commonly used antimicrobials. Therefore, the aim of this study was to document the antibiotic resistance rate in Pseudomonas aeruginosa isolated from different clinical specimens. Methods. Pseudomonas aeruginosa recovered was identified by standard microbiological methods. Antibiotic susceptibility testing was performed by modified Kirby-Bauer disc diffusion method following Clinical and Laboratory Standard Institute (CLSI) guidelines and all the suspected isolates were tested for the production of ESBLs, MBLs, and AmpC. Results. Out of total (178) isolates, 83.1% were recovered from the inpatient department (IPD). Majority of the isolates mediated resistance towards the beta-lactam antibiotics, while nearly half of the isolates were resistant to ciprofloxacin. Most of the aminoglycosides used showed resistance rate up to 75% but amikacin proved to be better option. No resistance to polymyxin was observed. ESBLs, MBLs, and AmpC mediated resistance was seen in 33.1%, 30.9%, and 15.7% isolates, respectively. Conclusions. Antibiotic resistance rate and beta-lactamase mediated resistance were high. Thus, regular surveillance of drug resistance is of utmost importance. PMID:27642599

  1. Novel plasmid-mediated beta-lactamase (MIR-1) conferring resistance to oxyimino- and alpha-methoxy beta-lactams in clinical isolates of Klebsiella pneumoniae.

    PubMed

    Papanicolaou, G A; Medeiros, A A; Jacoby, G A

    1990-11-01

    Klebsiella pneumoniae isolates from 11 patients at the Miriam Hospital were identified as resistant to cefoxitin and ceftibuten as well as to aztreonam, cefotaxime, and ceftazidime. Resistance could be transferred by conjugation or transformation with plasmid DNA into Escherichia coli and was due to the production of a beta-lactamase with an isoelectric point of 8.4 named MIR-1. In E. coli, MIR-1 conferred resistance to aztreonam, cefotaxime, ceftazidime, ceftibuten, ceftriaxone, and such alpha-methoxy beta-lactams as cefmetazole, cefotetan, cefoxitin, and moxalactam. In vitro, MIR-1 hydrolyzed cephalothin and cephaloridine much more rapidly than it did penicillin G, ampicillin, or carbenicillin. Cefotaxime was hydrolyzed at 10% the rate of cephaloridine. Cefoxitin inactivation could only be detected by a microbiological test. The inhibition profile of MIR-1 was similar to that of chromosomally mediated class I beta-lactamases. Potassium clavulanate had little effect on cefoxitin or cefibuten resistance and was a poor inhibitor of MIR-1 activity. Cefoxitin or imipenem did not induce MIR-1. The gene determining MIR-1 was cloned on a 1.4-kb AccI-PstI fragment. Under stringent conditions, probes for TEM-1 and SHV-1 genes and the E. coli ampC gene failed to hybridize with the MIR-1 gene. However, a provisional sequence of 150 bp of the MIR-1 gene proved to be 90% identical to the sequence of ampC from Enterobacter cloacae but only 71% identical to that of E. coli, thus explaining the lack of hybridization to the E. coli ampC probe. Plasmid profiles of the 11 K. pneumoniae clinical isolates were not identical, but each contained a plasmid from 40 to 60 kb that hybridized with the cloned MIR-1 gene. Both transfer-proficient and transfer-deficient MIR-1 plasmids belonged to the N incompatibility group. Thus, the resistance of these K. pneumoniae strains was the result of plasmid acquisition of a class I beta-lactamase, a new resistance determinant that expands the kinds

  2. Novel plasmid-mediated beta-lactamase (MIR-1) conferring resistance to oxyimino- and alpha-methoxy beta-lactams in clinical isolates of Klebsiella pneumoniae.

    PubMed Central

    Papanicolaou, G A; Medeiros, A A; Jacoby, G A

    1990-01-01

    Klebsiella pneumoniae isolates from 11 patients at the Miriam Hospital were identified as resistant to cefoxitin and ceftibuten as well as to aztreonam, cefotaxime, and ceftazidime. Resistance could be transferred by conjugation or transformation with plasmid DNA into Escherichia coli and was due to the production of a beta-lactamase with an isoelectric point of 8.4 named MIR-1. In E. coli, MIR-1 conferred resistance to aztreonam, cefotaxime, ceftazidime, ceftibuten, ceftriaxone, and such alpha-methoxy beta-lactams as cefmetazole, cefotetan, cefoxitin, and moxalactam. In vitro, MIR-1 hydrolyzed cephalothin and cephaloridine much more rapidly than it did penicillin G, ampicillin, or carbenicillin. Cefotaxime was hydrolyzed at 10% the rate of cephaloridine. Cefoxitin inactivation could only be detected by a microbiological test. The inhibition profile of MIR-1 was similar to that of chromosomally mediated class I beta-lactamases. Potassium clavulanate had little effect on cefoxitin or cefibuten resistance and was a poor inhibitor of MIR-1 activity. Cefoxitin or imipenem did not induce MIR-1. The gene determining MIR-1 was cloned on a 1.4-kb AccI-PstI fragment. Under stringent conditions, probes for TEM-1 and SHV-1 genes and the E. coli ampC gene failed to hybridize with the MIR-1 gene. However, a provisional sequence of 150 bp of the MIR-1 gene proved to be 90% identical to the sequence of ampC from Enterobacter cloacae but only 71% identical to that of E. coli, thus explaining the lack of hybridization to the E. coli ampC probe. Plasmid profiles of the 11 K. pneumoniae clinical isolates were not identical, but each contained a plasmid from 40 to 60 kb that hybridized with the cloned MIR-1 gene. Both transfer-proficient and transfer-deficient MIR-1 plasmids belonged to the N incompatibility group. Thus, the resistance of these K. pneumoniae strains was the result of plasmid acquisition of a class I beta-lactamase, a new resistance determinant that expands the kinds

  3. Molecular characterization of In50, a class 1 integron encoding the gene for the extended-spectrum beta-lactamase VEB-1 in Pseudomonas aeruginosa.

    PubMed

    Naas, T; Poirel, L; Karim, A; Nordmann, P

    1999-07-15

    A clinical isolate of Pseudomonas aeruginosa, JES, was resistant to extended-spectrum cephalosporins with a marked synergistic effect with clavulanic acid on a routine antibiogram. Preliminary PCR analysis revealed the presence of blaVEB-1, an integron-located gene encoding an extended-spectrum beta-lactamase previously identified in Escherichia coli MG-1. Using class 1 integron primers and blaVEB-1 intragenic primers, the insert region of the blaVEB-1 containing integron along with some flanking sequence from P. aeruginosa JES was amplified and subsequently sequenced. In50 contains within its variable region, in addition to qacE delta 1 and sull genes commonly found in class 1 integrons, two gene cassettes, veb1 and aadB. In50 is peculiar since its attI1 site is interrupted by two novel insertion sequences, IS1999 and IS2000. P. aeruginosa JES and Escherichia coli MG-1 strains were isolated from patients previously hospitalized in south east Asian countries. The finding of blaVEB-1 in these strains and on different integrons underlines the interspecies spread of this integron-located extended-spectrum beta-lactamase gene.

  4. Molecular and phylogenetic characterization of multidrug resistant extended spectrum beta-lactamase producing Escherichia coli isolated from poultry and cattle in Odisha, India.

    PubMed

    Kar, Debasish; Bandyopadhyay, Samiran; Bhattacharyya, Debaraj; Samanta, Indranil; Mahanti, Achintya; Nanda, Pramod K; Mondal, Bimalendu; Dandapat, Premanshu; Das, Arun K; Dutta, Tapan K; Bandyopadhyay, Subhasish; Singh, Raj Kumar

    2015-01-01

    The present study was undertaken to determine the occurrence and characterization of extended spectrum beta-lactamase (ESBL) producing Escherichia coli isolated from cattle and poultry in Odisha, India. Of 316 E. coli isolated from 305 samples (170 fecal samples from poultry and 135 milk samples from cattle), a total of 18 E. coli isolates were confirmed as ESBL producers by combination disc method and ESBL E-test. The isolates were resistant to oxyimino cephalosporins and monobactam as revealed by disc diffusion assay and determination of minimum inhibitory concentration. Resistance against other antibiotics was frequently noted as well. Further, beta-lactamase genes viz., blaSHV, blaCTXM, blaTEM and blaampC were detected in 17, 13, 9 and 2 isolates, respectively in PCR. Of the 18 ESBL strains, 16 were positive for class I integron (int1), nine of them carried sulphonamide resistance gene (sul1) and one harbored quinolone resistance gene (qnrB). Virulence markers for extraintestinal pathogenic E. coli like astA, tsh and iucD were also present in 4, 3 and 3 isolates, respectively. All the PCR amplified products were cloned and subjected to sequencing for homology analysis and data were submitted to gene bank. Sequence analysis of the amplified variable regions of class 1 integron of four representative isolates revealed the presence of aadA2 and dfrA12 gene cassettes conferring resistance to aminoglycosides and trimethoprim, respectively. Most of the ESBL producing strains emerged as single lineage through phylogenetic analysis by RAPD and ERIC PCR. This is the first ever systemic study on multidrug resistant ESBL producing E. coli in food producing animals from India.

  5. [blaVIM-2 gene detection in metallo-beta-lactamase-producing Pseudomonas aeruginosa strains isolated in an intensive care unit in Ciudad Bolívar, Venezuela].

    PubMed

    Guevara, Armando; de Waard, Jacobus; Araque, María

    2009-08-01

    Ten Pseudomonas aeruginosa strains with resistance to broad-spectrum cephalosporin and carbapenems were studied to determine the presence of genes that mediate the production of metallo-beta-lactamases. These strains were isolated from patients with nosocomial infection at the Intensive Care Unit of the Complejo Hospitalario "Ruiz y Paéz" of Ciudad Bolívar, Bolívar State, Venezuela, from 2003 to 2006. In all isolates a metallo-enzyme activity was detected by using the double disk synergism test. PCR amplification of genes encoding the families IMP, VIM and SPM metallo-beta-lactamases showed the presence of a blaVIM gene in all strains studied. DNA sequencing revealed that all isolates showed the presence of blaVIM-2. These results suggest that it is necessary to keep these strains under epidemiologic surveillance, establish laboratory strategies for opportune detection and the implementation of new policies to ensure the appropriate use of antibiotics in this institution.

  6. A new mutagenicity assay method for frameshift mutagens based on deleting or inserting a guanosine nucleotide in the beta-lactamase gene.

    PubMed

    Hour, T C; Lee, C C; Lin, J K

    1995-09-01

    The conventional method of site-directed mutagenesis was used to develop two Salmonella strains, JK-1 and JK-2, for detecting frameshift mutagens. The JK-1 strain was derived from Salmonella typhimurium TA1537 strain transformed by a mutant construct. A guanosine nucleotide was inserted between nucleotide residues 312 and 313 of the beta-lactamase gene. The JK-2 strain was obtained by the same procedure, but a guanosine nucleotide in position 315 of the beta-lactamase gene was deleted. The strains were tested with ten frameshift mutagens and the revertants were selected by ampicillin resistance. Representative mutagens including 2-nitrofluorene (2-NF), 2-acetylaminofluorene (AAF), 9-aminoacridine (9-AA), 2,7-diaminofluorene (2,7-DAF) and 2-methoxy-6-chloro-9-(3-(ethyl-2-chloro-ethyl)-aminopropylamino)acridine (ICR-170) were more potent in the JK-1 strain than the JK-2 strain, and the number of revertant colonies were dose related. Under the same conditions, the ampicillin test was more sensitive than the Ames test. Other types of compounds such as 2-methoxy-6-chloro-9-(2-chloroethylaminopropylamino)acridine (ICR-191), benzo[a]pyrene (BP), 4-nitroquinoline N-oxide (4-NQNO), hycanthone and aflatoxin B1 (AFB1) were not as mutagenic to these new strains. The method is quite promising for studying certain specific frameshift mutagens, but more chemical mutagens should be tested to validate its applicability and reproducibility in general use. PMID:8544757

  7. Contribution of enzymatic properties, cell permeability, and enzyme expression to microbiological activities of beta-lactams in three Bacteroides fragilis isolates that harbor a metallo-beta-lactamase gene.

    PubMed

    Rasmussen, B A; Yang, Y; Jacobus, N; Bush, K

    1994-09-01

    The metallo-beta-lactamase gene, ccrA, has been cloned from three clinical isolates of Bacteroides fragilis, TAL3636, QMCN3, and QMCN4. Although all three isolates harbored a gene encoding a potent beta-lactamase, the MICs of benzylpenicillin, piperacillin, cefotaxime, ceftazidime, imipenem, and biapenem for the three isolates varied from 4- to > 128-fold. QMCN4 was the most susceptible of the three isolates, followed by QMCN3. TAL3636 was resistant to all of the beta-lactams. Previous DNA sequence analysis of the three ccrA genes revealed that the enzymes differed at 5 amino acid residues (B. A. Rasmussen, Y. Gluzman, and F. P. Tally, Mol. Microbiol. 5:1211-1219, 1991). Biochemical characterization of the three enzymes revealed only small differences in kcat and Km values for the majority of beta-lactams tested. Thus, the 5 amino acid substitutions affected the hydrolyzing activity of the enzymes only modestly. Crypticity differences between the three isolates showed that QMCN4 was the least permeable of the isolates to cephaloridine, followed by TAL3636, and that QMCN3 was highly permeable to cephaloridine. Therefore, neither catalytic activity nor permeability was a major contributor to the dramatic differences in the MICs. Instead, microbiological susceptibility was closely related to the level of metallo-beta-lactamase present in each isolate. Both biochemical and physical studies indicated that TAL3636 produced 5- to 10-fold and 50- to 100-fold more metallo-beta-lactamase than QMCN3 and QMCN4, respectively. Therefore, the level of CcrA enzyme production is the dominant contributing factor to high-level resistance among strains harboring a ccrA gene.

  8. Clonal spread of both oxyimino-cephalosporin- and cefoxitin-resistant Klebsiella pneumoniae isolates co-producing SHV-2a and DHA-1 beta-lactamase at a burns intensive care unit.

    PubMed

    Song, Wonkeun; Lee, Kyu Man; Kim, Han-Sung; Kim, Jae-Seok; Kim, Jonghyun; Jeong, Seok Hoon; Roh, Kyoung Ho

    2006-12-01

    Over a 1-month period, a total of 16 ceftriaxone- and cefoxitin-resistant Klebsiella pneumoniae isolates were isolated from 15 patients hospitalised at a burns intensive care unit (ICU). These isolates showed negative results for extended-spectrum beta-lactamase (ESBL) by the Vitek system and were highly resistant to ceftazidime, aztreonam and cefoxitin (minimum inhibitory concentrations > or =128 microg/mL). The bla(SHV-2a) and bla(DHA-1) genes were detected by polymerase chain reaction and sequence analysis. Pulsed-field gel electrophoresis profiles of the isolates were identical. AmpC disk tests for AmpC enzymes as well as double-disk tests and Clinical and Laboratory Standards Institute (CLSI) confirmatory disk tests for ESBLs yielded positive results for all the isolates. However, only three isolates (18.8%) were shown to produce ESBL by CLSI confirmatory tests using broth microdilution. We report the first outbreak of colonisations and infections due to K. pneumoniae isolates co-producing an SHV-2a ESBL and a DHA-1 AmpC beta-lactamase in a Korean hospital, which were suggested to represent a single clonal spread at a burns ICU. In addition, this report presents problems associated with ESBL detection using broth microdilution in isolates that co-produce an ESBL and an AmpC beta-lactamase. PMID:17095195

  9. Effect of certain bioactive plant extracts on clinical isolates of beta-lactamase producing methicillin resistant Staphylococcus aureus.

    PubMed

    Aqil, Farrukh; Khan, M Sajjad A; Owais, Mohd; Ahmad, Iqbal

    2005-01-01

    Ethanolic extracts and some fractions from 10 Indian medicinal plants, known for antibacterial activity, were investigated for their ability to inhibit clinical isolates of beta-lactamase producing methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-sensitive S. aureus (MSSA). Synergistic interaction of plant extracts with certain antibiotics was also evaluated. The MRSA test strains were found to be multi-drug resistant and also exhibited high level of resistance to common beta-lactam antibiotics. These strains produced beta-lactamases, which hydrolyze one or other beta-lactam antibiotics, tested. The extract of the plants from Camellia sinensis (leaves), Delonix regia (flowers), Holarrhena antidysenterica (bark), Lawsonia inermis (leaves), Punica granatum (rind), Terminalia chebula (fruits) and Terminalia belerica (fruits) showed a broad-spectrum of antibacterial activity with an inhibition zone size of 11 mm to 27 mm, against all the test bacteria. The extracts from the leaves of Ocimum sanctum showed better activity against the three MRSA strains. On the other hand, extracts from Allium sativum (bulb) and Citrus sinensis (rind) exhibited little or no activity, against MRSA strains. The antibacterial potency of crude extracts was determined in terms of minimum inhibitory concentration (MIC) by the tube dilution method. MIC values, of the plant extracts, ranged from 1.3 to 8.2 mg/ml, against the test bacteria. Further, the extracts from Punica granatum and Delonix regia were fractionated in benzene, acetone and methanol. Antibacterial activity was observed in acetone as well as in the methanol fractions. In vitro synergistic interaction of crude extracts from Camellia sinensis, Lawsonia inermis, Punica granatum, Terminalia chebula and Terminalia belerica was detected with tetracycline. Moreover, the extract from Camellia sinensis also showed synergism with ampicillin.TLC of the above extracts revealed the presence of major phytocompounds, like

  10. Multidrug resistance in Gram-negative bacteria that produce extended-spectrum beta-lactamases (ESBLs).

    PubMed

    Giamarellou, H

    2005-07-01

    In 1983, just two years after the introduction of the oxymino-beta-lactams to the market , the first extended-spectrum beta-lactamases were isolated in Germany from Klebsiella pneumoniae strains. Since then several outbreaks have been reported in many European countries and the USA, and nowadays in several places worldwide the problem seems to reach endemic dimensions, with rates exceeding 50% in some countries, such as Portugal and Turkey. On the other hand not only K. pneumoniae but also Escherichia coli strains, with Enterobacter aerogenes predominating among the other enterobacteriaceal species, are increasingly reported as ESBL producers. In this review types, molecular characteristics, detection methods, epidemiology as well as interventions for therapy and antibiotic strategies to prevent and control infections caused by ESBL-producing microorganisms, are presented and discussed.

  11. Approaches to characterize extended spectrum beta-lactamase/beta-lactamase producing Escherichia coli in healthy organized vis-a-vis backyard farmed pigs in India.

    PubMed

    Samanta, Indranil; Joardar, Siddhartha N; Mahanti, Achintya; Bandyopadhyay, Samiran; Sar, Tapas K; Dutta, Tapan K

    2015-12-01

    The study was undertaken to investigate the occurrence and to characterize the ESBL/beta-lactamase producing-Escherichia coli in healthy pigs of organized and backyard farms in West Bengal, India. Total 200 rectal swabs were collected randomly from healthy pigs maintained in four organized farms and 10 backyard farms (n=100 each) and 76 isolates were identified as E. coli from organized (48/100, 48%) and backyard pigs (28/100, 28%). Twelve E. coli isolates (6%) in the present study were detected to possess any of the ESBL/beta-lactamase genes studied. ESBL/beta-lactamase producers were isolated with significantly more frequency from backyard pigs than the organized farm pigs (p=0.026). Six of ESBL/beta-lactamase producing isolates were phenotypically confirmed as CTX-M producers and ten of them were confirmed as TEM/SHV producers. PCR and sequencing of the amplified product from representative isolates revealed the presence of blaCTX-M-9, blaSHV-12 and blaTEM-1. No unique combination of the studied beta lactamase genes for organized and backyard farm pig isolates was noted. The ESBL isolates belonged to O13, O55, O133, O153, O157, O158, O166, rough and OUT serogroups. The association of heat labile toxin (elt) (p<0.0005) with organized farm isolates and heat stable toxin (estA) (p=0.0143) with backyard piggery sector was significantly higher. The ESBL/beta-lactamase producers from organized farm (Ak/Ex) and indigenous pigs (Ak/Ex/Te; Ak/CoT/G) showed a characteristic phenotypical antibiotic resistance pattern. Two pairs of isolates from organized and backyard farm pigs showed clonal relationship indicating a possible transmission between the farms which were situated adjacently. Thus the present study revealed backyard farm pigs as major source of ESBL/beta-lactamase producing-E. coli associated with STa and characteristic antibiotic resistance pattern in India.

  12. Prevalence of 16S rRNA methylase, modifying enzyme, and extended-spectrum beta-lactamase genes among Acinetobacter baumannii isolates.

    PubMed

    Liu, Zhenru; Ling, Baodong; Zhou, Liming

    2015-08-01

    Multidrug-resistant Acinetobacter baumannii has become a worldwide problem, and methylation of 16S rRNA has recently emerged as a new mechanism of resistance to aminoglycosides, which is mediated by a newly recognized group of 16S rRNA methylases. 16S rRNA methylase confers a high-level resistance to all 4,6-substituted deoxystreptamine aminoglycosides that are currently used in clinical practice. Some of the A. baumannii isolates have been found to coproduce extended-spectrum beta-lactamases (ESBLs), contributing to their multidrug resistance. The aim of this study was to detect the determinants of the 16S rRNA methylase genes armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA, the modifying enzyme genes aac(6')-Ib, ant(3″)-Ia, aph(3')-I, and the extended-spectrum beta-lactamase genes bla(TEM), bla(SHV), and bla(CTX-M-3) among A. baumannii isolates in northeastern Sichuan, China. Minimum inhibitory concentrations (MICs) of 21 different antimicrobial agents against the A. baumannii isolates were determined. The clinical isolates showed a high level of resistance (MIC≧256 μg/ml) to aminoglycosides, which ranged from 50·1 to 83·8%. The resistances to meropenem and imipenem, two of the beta-lactam antibiotics and the most active antibiotics against A. baumannii, were 9·1 and 8·2%, respectively. Among 60 amikacin-resistant isolates, only the 16S rRNA methylase gene armA was found to be prevalent (66·7%), but the other 16S rRNA methylase genes rmtA, rmtB, rmtC, rmtD, rmtE, and npmA were not detected. The prevalences of the modifying enzyme genes aac (6')-Ib, ant (3″)-Ia, and aph (3')-I were 51·7, 81·7, and 58·3%, respectively, which are different from a previous study in which the occurrences of these genes were 3, 64, and 72%, respectively. Among the 40 isolates that were armA-positive, the prevalences of bla(TEM), bla(SHV), and bla(CTX-M-3) genes were detected for the first time in China, and their occurrences were 45, 65, and 52·5%, respectively. In all, A

  13. Phenotypic Detection of Metallo-Beta-Lactamases in Carbapenem Resistant Acinetobacter baumannii Isolated from Pediatric Patients in Pakistan

    PubMed Central

    Anwar, Muneeza; Ejaz, Hassan; Zafar, Aizza; Hamid, Hamdan

    2016-01-01

    Multidrug resistant A. baumannii has emerged as an important and problematic human pathogen as it is the causative agent of several types of infections especially in neonates and immunocompromised patients because they have least capacity to fight against infections. Carbapenems are used as last resort antibiotics for treating these infections but currently resistance against carbapenems due to MBL production is on the rise. The objective of this study was to determine the frequency of antibiotic resistance in A. baumannii and also to compare the efficacy of combined disk test and double disk synergy test for detection of metallo-beta-lactamases. A total of 112 A. baumannii were identified from various clinical samples and antibiotic susceptibility profile was determined by Kirby-Bauer Disk Diffusion method. Out of 112, 66 (58.9%) isolates were resistant to both imipenem and meropenem (OXOID). These resistant isolates were tested for carbapenemase production, and 55 (83.3%) were carbapenemase producers by Modified Hodge Test. These isolates were further tested for MBL production by combined disk test and double disk synergy test. Out of 66, 49 isolates were positive by both methods, CDT and DDST, and only one isolate was detected as negative (with kappa value = 0.038). All MBL producing strains showed remarkable resistance to cephalosporins, fluoroquinolones, aminoglycosides, and piperacillin/tazobactam (OXOID). The antibiotic resistance was very high in A. baumannii which were isolated from children in Pakistan specially attending a nephrology unit. PMID:27123345

  14. Accumulation of plasmid-mediated fluoroquinolone resistance genes, qepA and qnrS1, in Enterobacter aerogenes co-producing RmtB and class A beta-lactamase LAP-1.

    PubMed

    Park, Yeon-Joon; Yu, Jin Kyung; Kim, Sang-Il; Lee, Kyungwon; Arakawa, Yoshichika

    2009-01-01

    A new plasmid-mediated fluoroquinolone efflux pump gene, qepA, is known to be associated with the rmtB gene, which confers high-level resistance to aminoglycosides. We investigated the qepA gene in 573 AmpC-producing Enterobacteriaceae including one Citrobacter freundii known to harbor rmtB. Of them, two clonally unrelated E. aerogenes harbored qepA. Both isolates co-harbored rmtB, qnrS1, qepA, and bla(LAP-1) on an IncFI type plasmid. The qepA was flanked by two copies of IS26 containing ISCR3C, tnpA, tnpR, bla(TEM), and rmtB. The qnrS1 and bla(LAP-1) were located upstream of qepA. All the resistance determinants (qepA, qnrS1, rmtB, and bla(LAP-1)) were co-transferred to E. coli J53 by filter mating from both isolates. Although the prevalence of qepA is currently low, considering the presence of ISCR3C and the possibility of co-selection and co-transferability of plasmids, more active surveillance for these multi-drug resistant bacteria and prudent use of antimicrobials are needed.

  15. Widespread detection of VEB-1-type extended-spectrum beta-lactamases among nosocomial ceftazidime-resistant Pseudomonas aeruginosa isolates in Sofia, Bulgaria.

    PubMed

    Strateva, T; Ouzounova-Raykova, V; Markova, B; Todorova, A; Marteva-Proevska, Y; Mitov, I

    2007-04-01

    A total of 132 ceftazidime-resistant clinical isolates of Pseudomonas aeruginosa were collected during 2001-2005 from 5 university hospitals in Sofia, Bulgaria to assess the current levels of antimicrobial susceptibility and to evaluate resistance mechanisms to beta-lactams. Antimicrobial susceptibilities were detected by a disk diffusion method and E-test. Polymerase chain reaction amplification and sequencing of bla(VEB-1 )and bla(PER-1 )were performed. The antibiotic resistance rates were: to piperacillin 90.2%, piperacillin/tazobactam 52.3%, ceftazidime 94.7%, cefepime 88.6%, cefpirome 98.5%, aztreonam 85.6%, imipenem 66.6%, meropenem 63.6%, amikacin 81.1%, gentamicin 84.8%, tobramycin 89.4%, netilmicin 57.6%, ciprofloxacin 83.4%. Structural genes for VEB-1 extended-spectrum beta -lactamases (ESBLs) were found in 75 (56.8%) of the isolates. PER-1 ESBLs were not detected. The VEB-1-producing strains were more resistant than VEB-1 non-producers to amikacin, gentamicin, tobramycin and ciprofloxacin ( P<0.001). VEB-1 appears to have a significant presence among ceftazidime-resistant P. aeruginosa isolates from Sofia.

  16. Prevalence and antibacterial resistance patterns of extended-spectrum beta-lactamase producing Gram-negative bacteria isolated from ocular infections

    PubMed Central

    Rameshkumar, G; Ramakrishnan, R; Shivkumar, C; Meenakshi, R; Anitha, V; Venugopal Reddy, Y C; Maneksha, V

    2016-01-01

    Purpose: Extended-spectrum beta-lactamases (ESBLs) mediated resistance is more prevalent worldwide, especially among Gram-negative bacterial isolates, conferring resistance to the expanded spectrum cephalosporins. As limited data were available on the prevalence of ESBLs in this area, the current study was undertaken to determine the prevalence, antibacterial resistance patterns, and molecular detection and characterization of ESBL encoding resistance genes among ocular Gram-negative bacterial isolates from ocular infections. Materials and Methods: A prospective study was done on 252 ocular Gram-negative bacterial isolates recovered from ocular infections during a study period from February 2011 to January 2014. All isolates were subjected to detection of ESBLs by cephalosporin/clavulanate combination disc test and their antibacterial resistance pattern was studied. Molecular detection and characterization of ESBL encoding blaTEM-, blaSHV, blaOXA-, and blaCTX-M (phylogenetic groups 1, 2, 9, and 8/25) resistance genes by multiplex polymerase chain reaction and DNA sequence analysis. Results: Of all Gram-negative bacteria, Pseudomonas aeruginosa (44%) was the most common strain, followed by Enterobacter agglomerans and Klebsiella pneumoniae each (10%). Among the 252, 42 (17%) were ESBL producers. The major source of ESBL producers were corneal scraping specimens, highest ESBL production was observed in P. aeruginosa 16 (38%) and Escherichia coli 7 (16.6%). Among ESBL-producing genes, the prevalence of blaTEM-gene was the highest (83%) followed by blaOXA-gene (35%), blaSHV-gene (18.5%), and blaCTX-M-1-gene (18.5%) alone or together. Conclusion: The higher rate of prevalence of ESBLs-encoding genes among ocular Gram-negative bacteria is of great concern, as it causes limitation to therapeutic options. This regional knowledge will help in guiding appropriate antibiotic use which is highly warranted. PMID:27221683

  17. Association of plasmid-mediated quinolone resistance with extended-spectrum beta-lactamase VEB-1.

    PubMed

    Poirel, Laurent; Van De Loo, Marc; Mammeri, Hedi; Nordmann, Patrice

    2005-07-01

    Association of the plasmid-mediated quinolone resistance determinant QnrA and the bla(VEB-1) gene was identified in a single Enterobacter cloacae isolate from K.-Bicêtre, France, and in 11 out of 23 bla(VEB-1)-positive enterobacterial isolates from Bangkok, Thailand. This result may explain in part the association between quinolone and extended-spectrum beta-lactam resistance.

  18. Carbapenem-resistant Enterobacteriaceae containing New Delhi metallo-beta-lactamase in two patients - Rhode Island, March 2012.

    PubMed

    2012-06-22

    U.S. and international efforts to control carabapenem-resistant Enterobacteriaceae (CRE) are critical to protect public health. Clinicians caring for patients infected with such organisms have few, if any, therapeutic options available. CRE containing New Delhi metallo-beta-lactamase (NDM), first reported in a patient who had been hospitalized in New Delhi, India, in 2007, are of particular concern because these enzymes usually are encoded on plasmids that harbor multiple resistance determinants and are transmitted easily to other Enterobacteriaceae and other genera of bacteria. A urine specimen collected on March 4, 2012, from a patient who recently had been hospitalized in Viet Nam, but who was receiving care at a hospital in Rhode Island, was found to have a Klebsiella pneumoniae isolate containing NDM. The isolate was susceptible only to tigecycline, colistin, and polymyxin B. Point-prevalence surveys of epidemiologically linked patients revealed transmission to a second patient on the hematology/oncology unit. These two cases bring to 13 the number of cases of NDM reported in the United States. After contact precautions were reinforced and environmental cleaning was implemented, no further cases were identified. Similarly aggressive infection control efforts can limit the spread of NDM in acute-care medical facilities.

  19. The Structural Bases of Antibiotic Resistance in the Clinically Derived Mutant beta-Lactamases TEM-30, TEM-32, and TEM-34

    SciTech Connect

    Wang, Xiaojun; Minasov, George; Shoichet, Brian K.

    2010-03-08

    Widespread use of {beta}-lactam antibiotics has promoted the evolution of {beta}-lactamase mutant enzymes that can hydrolyze ever newer classes of these drugs. Among the most pernicious mutants are the inhibitor-resistant TEM {beta}-lactamases (IRTs), which elude mechanism-based inhibitors, such as clavulanate. Despite much research on these IRTs, little is known about the structural bases of their action. This has made it difficult to understand how many of the resistance substitutions act as they often occur far from Ser-130. Here, three IRT structures, TEM-30 (R244S), TEM-32 (M69I/M182T), and TEM-34 (M69V), are determined by x-ray crystallography at 2.00, 1.61, and 1.52 {angstrom}, respectively. In TEM-30, the Arg-244 {yields} Ser substitution (7.8 {angstrom} from Ser-130) displaces a conserved water molecule that usually interacts with the {beta}-lactam C3 carboxylate. In TEM-32, the substitution Met-69 {yields} Ile (10 {angstrom} from Ser-130) appears to distort Ser-70, which in turn causes Ser-130 to adopt a new conformation, moving its O{gamma} further away, 2.3 {angstrom} from where the inhibitor would bind. This substitution also destabilizes the enzyme by 1.3 kcal/mol. The Met-182 {yields} Thr substitution (20 {angstrom} from Ser-130) has no effect on enzyme activity but rather restabilizes the enzyme by 2.9 kcal/mol. In TEM-34, the Met-69 {yields} Val substitution similarly leads to a conformational change in Ser-130, this time causing it to hydrogen bond with Lys-73 and Lys-234. This masks the lone pair electrons of Ser-130 O{gamma}, reducing its nucleophilicity for cross-linking. In these three structures, distant substitutions result in accommodations that converge on the same point of action, the local environment of Ser-130. TEM-1 {beta}-lactamase is the predominant source of resistance to {beta}-lactams, such as the penicillins. TEM-1 and related class A {beta}-lactamases confer resistance by hydrolyzing the {beta}-lactam ring of these antibiotics

  20. Automatic phylogenetic classification of bacterial beta-lactamase sequences including structural and antibiotic substrate preference information.

    PubMed

    Ma, Jianmin; Eisenhaber, Frank; Maurer-Stroh, Sebastian

    2013-12-01

    Beta lactams comprise the largest and still most effective group of antibiotics, but bacteria can gain resistance through different beta lactamases that can degrade these antibiotics. We developed a user friendly tree building web server that allows users to assign beta lactamase sequences to their respective molecular classes and subclasses. Further clinically relevant information includes if the gene is typically chromosomal or transferable through plasmids as well as listing the antibiotics which the most closely related reference sequences are known to target and cause resistance against. This web server can automatically build three phylogenetic trees: the first tree with closely related sequences from a Tachyon search against the NCBI nr database, the second tree with curated reference beta lactamase sequences, and the third tree built specifically from substrate binding pocket residues of the curated reference beta lactamase sequences. We show that the latter is better suited to recover antibiotic substrate assignments through nearest neighbor annotation transfer. The users can also choose to build a structural model for the query sequence and view the binding pocket residues of their query relative to other beta lactamases in the sequence alignment as well as in the 3D structure relative to bound antibiotics. This web server is freely available at http://blac.bii.a-star.edu.sg/.

  1. Resistance to cefepime and cefpirome due to a 4-amino-acid deletion in the chromosome-encoded AmpC beta-lactamase of a Serratia marcescens clinical isolate.

    PubMed

    Mammeri, Hedi; Poirel, Laurent; Bemer, Pascal; Drugeon, Henri; Nordmann, Patrice

    2004-03-01

    A multiresistant Serratia marcescens strain, HD, isolated from a patient with a urinary tract infection, was resistant to amino-, carboxy-, and ureidopenicillins, ceftazidime, and cefepime and was susceptible to cefotaxime and ceftriaxone, according to the guidelines of the NCCLS. No synergy was found between expanded-spectrum cephalosporins and clavulanic acid, according to the double-disk synergy test. The bla(AmpC) gene of the strain was amplified by PCR and cloned into Escherichia coli DH10B, giving rise to high-level resistance to ceftazidime, cefepime, and cefpirome. Sequencing analysis revealed that the bla(AmpC) gene from S. marcescens HD had a 12-nucleotide deletion compared to the bla(AmpC) gene from reference strain S. marcescens S3, leading to a 4-amino-acid deletion located in the H-10 helix of the beta-lactamase. Kinetic analysis showed that this enzyme significantly hydrolyzed ceftazidime, cefepime, and cefpirome. This work underlined that resistance to the latest expanded-spectrum cephalosporins may be mediated by structurally modified AmpC-type beta-lactamases.

  2. Resistance to cefepime and cefpirome due to a 4-amino-acid deletion in the chromosome-encoded AmpC beta-lactamase of a Serratia marcescens clinical isolate.

    PubMed

    Mammeri, Hedi; Poirel, Laurent; Bemer, Pascal; Drugeon, Henri; Nordmann, Patrice

    2004-03-01

    A multiresistant Serratia marcescens strain, HD, isolated from a patient with a urinary tract infection, was resistant to amino-, carboxy-, and ureidopenicillins, ceftazidime, and cefepime and was susceptible to cefotaxime and ceftriaxone, according to the guidelines of the NCCLS. No synergy was found between expanded-spectrum cephalosporins and clavulanic acid, according to the double-disk synergy test. The bla(AmpC) gene of the strain was amplified by PCR and cloned into Escherichia coli DH10B, giving rise to high-level resistance to ceftazidime, cefepime, and cefpirome. Sequencing analysis revealed that the bla(AmpC) gene from S. marcescens HD had a 12-nucleotide deletion compared to the bla(AmpC) gene from reference strain S. marcescens S3, leading to a 4-amino-acid deletion located in the H-10 helix of the beta-lactamase. Kinetic analysis showed that this enzyme significantly hydrolyzed ceftazidime, cefepime, and cefpirome. This work underlined that resistance to the latest expanded-spectrum cephalosporins may be mediated by structurally modified AmpC-type beta-lactamases. PMID:14982755

  3. Carbapenem-resistant Pseudomonas aeruginosa strains from a Spanish hospital: characterization of metallo-beta-lactamases, porin OprD and integrons.

    PubMed

    Rojo-Bezares, Beatriz; Estepa, Vanesa; Cebollada, Rocío; de Toro, María; Somalo, Sergio; Seral, Cristina; Castillo, Francisco Javier; Torres, Carmen; Sáenz, Yolanda

    2014-05-01

    Molecular typing and mechanisms of carbapenem resistance such as alterations in porin OprD and presence of metallo-beta-lactamases (MBLs), as well as integrons have been studied in a collection of carbapenem-resistant Pseudomonas aeruginosa (CRPA) isolates from a Spanish hospital. One hundred and twenty-three CRPA isolates were recovered from different samples of 80 patients. Clonal relationship among CRPA was analyzed by SpeI-PFGE. Susceptibility testing to 11 antibiotics and MBL phenotype was determined by microdilution, IP/IPI E-test and double disc method. The oprD gene was studied by PCR and sequencing, and mutations were determined comparing with P. aeruginosa PAO1 sequence. Characterization of MBLs, and class 1 and 2 integrons were studied by PCR and sequencing. SDS-PAGE analysis of outer membrane proteins of selected strains was performed. Seventy-four-per-cent of patients with CRPA were hospitalised in the ICU setting and 50% had long hospitalization stays. Sixty-four different PFGE patterns were detected, and 87 CRPA strains were further analyzed. MBL phenotype was detected in 43 of 87 strains (49.4%), which contained blaVIM-2 gene inside class 1 integrons. VIM-2-producing strains belonged to lineages ST175, ST235, and ST973. A great diversity of nucleotide insertions, deletions, and mutations in oprD gene, and the presence of a new insertion sequence (ISPa45) truncating oprD were identified among CRPA strains. Class 1 integrons were detected in 75% of CRPA strains, blaVIM-2 and the new arrangement aac(3)-Ia+ISPa34+aadA1 (named as In661) being the most frequent gene-cassette arrays detected. Other gene cassettes detected in integrons were: aadB, aadA6, aadA7, aac(6')-Ib', and blaOXA-46.

  4. Determinants of the activity of beta-lactamase inhibitor combinations.

    PubMed

    Livermore, D M

    1993-01-01

    Inhibitor combinations provide one strategy to overcome beta-lactamase-mediated resistance. Their success depends, obviously, on the inhibitor being able to bind and inactivate the beta-lactamase molecules. Clavulanate, sulbactam and tazobactam are irreversible inactivators of many beta-lactamases, forming covalent complexes which resist hydrolysis. 'Suicide' kinetics are seen with some, but not all, enzymes. All three compounds inactivate staphylococcal penicillinase, the chromosomal beta-lactamases of Proteus vulgaris and Bacteroides spp., and the Class IV beta-lactamases present in some klebsiellae. Tazobactam, but not the other compounds, has moderate activity against some Class I (AmpC) chromosomal beta-lactamases, notably that of Morganella morganii, but not that of Enterobacter cloacae. Both clavulanate and tazobactam are strong inhibitors of the widely distributed TEM and SHV plasmid-mediated beta-lactamases; sulbactam is a weaker inhibitor. Other factors, aside from the affinity of the inhibitor for the enzyme, co-determine the success or failure of inhibition. Potentiation is most readily achieved if little enzyme is produced, and if the organism is very permeable to the inhibitor. Thus, resistance to inhibitor combinations is rare in strains of Haemophilus influenzae and Neisseria gonorrhoeae that produce TEM-beta-lactamase, but is commoner in enterobacteria that produce this enzyme, since these are less permeable and sometimes manufacture very large amounts of enzyme. The partner beta-lactam agent is also important. Irrespective of the inhibitor used, piperacillin is easier to protect against TEM beta-lactamases and the M. morganii Class I enzyme than are ampicillin, amoxycillin or ticarcillin. This may relate to the lower affinity of piperacillin for these enzymes, or to its greater affinity for the bacterial penicillin-binding proteins. Finally, pH can affect the degree of inhibition achieved with sulphones for some beta-lactamases, notably TEM-1

  5. Transferable resistance to third-generation cephalosporins in clinical isolates of Klebsiella pneumoniae: identification of CTX-1, a novel beta-lactamase.

    PubMed

    Sirot, D; Sirot, J; Labia, R; Morand, A; Courvalin, P; Darfeuille-Michaud, A; Perroux, R; Cluzel, R

    1987-09-01

    Approximately 10% (89 isolates) of Klebsiella pneumoniae isolated in 1985 from patients in intensive care units in Clermont-Ferrand exhibited a complex resistance phenotype towards antibiotics. They were resistant to amino-, carboxy- and ureidopenicillins, aminoglycosides (except gentamicin), chloramphenicol, sulphonamides, tetracyclines and, most importantly, to cephalosporins (except cefoxitin and latamoxef) and to aztreonam. The metabolic profile of fifty isolates was identical and seven were selected for further study. All the resistance characters in these isolates were transferable to Escherichia coli by conjugation and were lost en bloc after treatment with ethidium bromide. Agarose gel electrophoresis of crude lysates of the wild types and their transconjugants indicated that the multiple resistances were mediated by a 95kb plasmid, pCF04. The seven isolates selected for study and their corresponding transconjugants, constitutively produced a plasmid-mediated beta-lactamase with a pI of 6.3 that was much more active against third-generation cephalosporins than against cephalothin. The substrate profile and the isoelectric-focusing behaviour of this enzyme differed from those of other known plasmid-mediated beta-lactamases, and the enzyme was designated CTX-1. A chromosomally-encoded SHV-1 (PIT-2) penicillinase (pI 7.7) was also present in the seven K. pneumoniae isolates but did not transfer. Resistance to aminoglycosides in the K. pneumoniae isolates was due to synthesis of a 6'-aminoglycoside acetyltransferase type IV. Our data indicate an epidemic of antibiotic multiply-resistant strains of K. pneumoniae producing a new beta-lactamase.

  6. Haemophilus influenzae with Non-Beta-Lactamase-Mediated Beta-Lactam Resistance: Easy To Find but Hard To Categorize

    PubMed Central

    Lia, Astrid; Hannisdal, Anja; Tveten, Yngvar; Matuschek, Erika; Kahlmeter, Gunnar; Kristiansen, Bjørn-Erik

    2015-01-01

    Haemophilus influenzae is a major pathogen, and beta-lactams are first-line drugs. Resistance due to altered penicillin-binding protein 3 (rPBP3) is frequent, and susceptibility testing of such strains is challenging. A collection of 154 beta-lactamase-negative isolates with a large proportion of rPBP3 (67.5%) was used to evaluate and compare Etest (Haemophilus test medium [HTM]) and disk diffusion (EUCAST method) for categorization of susceptibility to aminopenicillins and cefuroxime, using MICs generated with broth (HTM) microdilution and clinical breakpoints from CLSI and EUCAST as the gold standards. In addition, the proficiency of nine disks in screening for the rPBP3 genotype (N526K positive) was evaluated. By Etest, both essential and categorical agreement were generally poor (<70%), with high very major errors (VME) (CLSI, 13.0%; EUCAST, 34.3%) and falsely susceptible rates (FSR) (CLSI, 87.0%; EUCAST, 88.3%) for ampicillin. Ampicillin (2 μg) with adjusted (+2 mm) zone breakpoints was superior to Etest for categorization of susceptibility to ampicillin (agreement, 74.0%; VME, 11.0%; FSR, 28.3%). Conversely, Etest was superior to 30 μg cefuroxime for categorization of susceptibility to cefuroxime (agreement, 57.1% versus 60.4%; VME, 2.6% versus 9.7%; FSR, 7.1% versus 26.8%). Benzylpenicillin (1 unit) (EUCAST screening disk) and cefuroxime (5 μg) identified rPBP3 isolates with highest accuracies (95.5% and 92.2%, respectively). In conclusion, disk screening reliably detects rPBP3 H. influenzae, but false ampicillin susceptibility is frequent with routine methods. We suggest adding a comment recommending high-dose aminopenicillin therapy or the use of other agents for severe infections with screening-positive isolates that are susceptible to aminopenicillins by gradient or disk diffusion. PMID:26354813

  7. Haemophilus influenzae with Non-Beta-Lactamase-Mediated Beta-Lactam Resistance: Easy To Find but Hard To Categorize.

    PubMed

    Skaare, Dagfinn; Lia, Astrid; Hannisdal, Anja; Tveten, Yngvar; Matuschek, Erika; Kahlmeter, Gunnar; Kristiansen, Bjørn-Erik

    2015-11-01

    Haemophilus influenzae is a major pathogen, and beta-lactams are first-line drugs. Resistance due to altered penicillin-binding protein 3 (rPBP3) is frequent, and susceptibility testing of such strains is challenging. A collection of 154 beta-lactamase-negative isolates with a large proportion of rPBP3 (67.5%) was used to evaluate and compare Etest (Haemophilus test medium [HTM]) and disk diffusion (EUCAST method) for categorization of susceptibility to aminopenicillins and cefuroxime, using MICs generated with broth (HTM) microdilution and clinical breakpoints from CLSI and EUCAST as the gold standards. In addition, the proficiency of nine disks in screening for the rPBP3 genotype (N526K positive) was evaluated. By Etest, both essential and categorical agreement were generally poor (<70%), with high very major errors (VME) (CLSI, 13.0%; EUCAST, 34.3%) and falsely susceptible rates (FSR) (CLSI, 87.0%; EUCAST, 88.3%) for ampicillin. Ampicillin (2 μg) with adjusted (+2 mm) zone breakpoints was superior to Etest for categorization of susceptibility to ampicillin (agreement, 74.0%; VME, 11.0%; FSR, 28.3%). Conversely, Etest was superior to 30 μg cefuroxime for categorization of susceptibility to cefuroxime (agreement, 57.1% versus 60.4%; VME, 2.6% versus 9.7%; FSR, 7.1% versus 26.8%). Benzylpenicillin (1 unit) (EUCAST screening disk) and cefuroxime (5 μg) identified rPBP3 isolates with highest accuracies (95.5% and 92.2%, respectively). In conclusion, disk screening reliably detects rPBP3 H. influenzae, but false ampicillin susceptibility is frequent with routine methods. We suggest adding a comment recommending high-dose aminopenicillin therapy or the use of other agents for severe infections with screening-positive isolates that are susceptible to aminopenicillins by gradient or disk diffusion. PMID:26354813

  8. Sequence analysis and enzyme kinetics of the L2 serine beta-lactamase from Stenotrophomonas maltophilia.

    PubMed Central

    Walsh, T R; MacGowan, A P; Bennett, P M

    1997-01-01

    The L2 serine active-site beta-lactamase from Stenotrophomonas maltophilia has been classified as a clavulanic acid-sensitive cephalosporinase. The gene encoding this enzyme from S. maltophilia 1275 IID has been cloned on a 3.3-kb fragment into pK18 under the control of a Ptac promoter to generate recombinant plasmid pUB5840; when expressed in Escherichia coli, this gene confers resistance to cephalosporins and penicillins. Sequence analysis has revealed an open reading frame (ORF) of 909 bp with a GC content of 71.6%, comparable to that of the L1 metallo-beta-lactamase gene (68.4%) from the same bacterium. The ORF encodes an unmodified protein of 303 amino acids with a predicted molecular mass of 31.5 kDa, accommodating a putative leader peptide of 27 amino acids. Comparison of the amino acid sequence with those of other beta-lactamases showed it to be most closely related (54% identity) to the BLA-A beta-lactamase from Yersinia enterocolitica. Sequence identity is most obvious near the STXK active-site motif and the SDN loop motif common to all serine active-site penicillinases. Sequences outside the conserved regions display low homology with comparable regions of other class A penicillinases. Kinetics of the enzyme from the cloned gene demonstrated an increase in activity with cefotaxime but markedly less activity with imipenem than previously reported. Hence, the S. maltophilia L2 beta-lactamase is an inducible Ambler class A beta-lactamase which would account for the sensitivity to clavulanic acid. PMID:9210666

  9. Genetic and biochemical characterization of the chromosomal class A beta-lactamases of Raoultella (formerly Klebsiella) planticola and Raoultella ornithinolytica.

    PubMed

    Walckenaer, Estelle; Poirel, Laurent; Leflon-Guibout, Véronique; Nordmann, Patrice; Nicolas-Chanoine, Marie-Hélène

    2004-01-01

    Enterobacterial strains of Raoultella spp. display a penicillinase-related beta-lactam resistance pattern suggesting the presence of a chromosomal bla gene. From whole-cell DNA of Raoultella planticola strain ATCC 33531(T) and Raoultella ornithinolytica strain ATCC 31898(T), bla genes were cloned and expressed into Escherichia coli. Each gene encoded an Ambler class A beta-lactamase, named PLA-1 and ORN-1 for R. planticola and R. ornithinolytica, respectively. These beta-lactamases (291 amino acids), with the same pI value of 7.8, had a shared amino acid identity of 94%, 37 to 47% identity with the majority of the chromosome-encoded class A beta-lactamases previously described for Enterobacteriaceae, and 66 to 69% identity with the two beta-lactamases LEN-1 and SHV-1 from Klebsiella pneumoniae. However, the highest identity percentage (69 to 71%) was found with the plasmid-mediated beta-lactamase TEM-1. PLA-1, which displayed very strong hydrolytic activity against penicillins, also displayed significant hydrolytic activity against cefepime and, to a lesser extent, against cefotaxime and aztreonam, but there was no hydrolytic activity against ceftazidime. Such a substrate profile suggests that the Raoultella beta-lactamases PLA-1 and ORN-1 should be classified into the group 2be of the beta-lactamase classification of K. Bush, G. A. Jacoby, and A. A. Medeiros (Antimicrob. Agents Chemother. 39:1211-1233, 1995). The highly homologous regions upstream of the bla(PLA-1A) and bla(ORN-1A) genes comprised a nucleotide sequence identical to the -35 region and another one very close to the -10 region of the bla(LEN-1) gene. From now on, as the bla gene sequences of the most frequent Raoultella and Klebsiella species are available, the bla gene amplification method can be used to differentiate these species from each other, which the biochemical tests currently carried out in the clinical laboratory are unable to do.

  10. Molecular characterization of nine different types of mutants among 107 inhibitor-resistant TEM beta-lactamases from clinical isolates of Escherichia coli.

    PubMed Central

    Henquell, C; Chanal, C; Sirot, D; Labia, R; Sirot, J

    1995-01-01

    DNA-DNA hybridization and sequencing were performed to determine the molecular basis of resistance to clavulanic acid in 107 inhibitor-resistant TEM (IRT) enzymes produced by Escherichia coli clinical isolates. These beta-lactamases derived from TEM-1 enzyme focused at pI 5.2 (n = 68) or 5.4 (n = 39) and were very poorly inhibited by clavulanic acid compared with TEM-1 enzyme. Results showed that the amino acid sequences of 84 of the 107 enzymes differ from TEM-1 by one or two substitutions previously described: Arg-244-->Ser (IRT-2) in 22 strains, Met-69-->Leu (TEM-33) in 17 strains, Met-69-->Val (TEM-34) in 14 strains, Met-69-->Ile (IRT-3) in 6 strains, Met-69-->Leu associated with Asn-276-->Asp (IRT-4) in 13 strains, and Met-69-->Val associated with Asn-276-->Asp (TEM-36) in 12 strains. A new combination, Met-69-->Ile with Asn-276-->Asp, was found in 20 strains and was called IRT-8. Two IRT enzymes not previously described were characterized. The substitution Met-69-->Val associated with a novel substitution Arg-275-->Leu occurred in one strain. The combination Met-69-->Leu and Asn-276-->Asp was associated with the novel substitution Trp-165-->Arg in two strains. These two novel enzymes were called IRT-9 and IRT-10, respectively. The implication of these novel mutated positions, 165 and 275, in resistance to inactivation by clavulanate was supported by crystallographic data on the TEM-1 enzyme and results of site-directed mutagenesis. Molecular characterization of these mutants showed great diversity among the genes coding for inhibitor-resistant TEM enzymes produced by clinical E. coli isolates. PMID:7726509

  11. Extended Spectrum Beta Lactamase producing Cephalosporin resistant Salmonella Typhi, reported from Rawalpindi, Pakistan.

    PubMed

    Munir, Tehmina; Lodhi, Munir; Ansari, Jawad Khaliq; Andleeb, Saadia; Ahmed, Mushtaq

    2016-08-01

    Typhoid is endemic in many parts of southeast Asia. Due to the resistance of the organism to first line of antibiotics (ampicillin, chloramphenicol, cotrimoxazole) as well as to fluoroquinolones, third generation cephalosporins have been in use for the empiric treatment of typhoid for years. However an increasing incidence of Salmonella Typhi is being reported sporadically from various regions. We report a case of typhoid due to Salmonella Typhi which was non-responsive to treatment with a cephalosporin, was found to be multidrug resistant and resistant to ciprofloxacin and third generation cephalosporin as well. The patient was finally treated successfully with intravenous administration of a carbapenem. PMID:27524545

  12. Transferable class C beta-lactamases in Escherichia coli strains isolated in Greek hospitals and characterization of two enzyme variants (LAT-3 and LAT-4) closely related to Citrobacter freundii AmpC beta-lactamase.

    PubMed

    Gazouli, M; Tzouvelekis, L S; Vatopoulos, A C; Tzelepi, E

    1998-10-01

    Among 2133 isolates of Escherichia coli obtained during 1996 from 10 Greek hospitals, 63 (3%) were resistant to cefoxitin. Typing by ERIC2-PCR indicated that the cefoxitin-resistant (FOXr) isolates were distinct. beta-Lactamase studies and hybridization experiments showed that most strains produced beta-lactamases related to the AmpC chromosomal cephalosporinase of Citrobacter freundii. The enzymes were encoded by similar non-self-transmissible plasmids. The bla genes encoding two beta-lactamases (LAT-3 and LAT-4) with isoelectric points 8.9 and 9.4, respectively, were cloned and sequenced. The deduced amino acid sequences displayed a high degree of homology (>95%) with the AmpC beta-lactamase of C. freundii. The patterns of resistance to beta-lactams of the FOXr E. coli depended on the quantity of class C enzymes and the simultaneous expression of other beta-lactamases. In a few isolates a 36 kDa outer-membrane protein, presumably a porin, was not expressed at detectable quantities. These isolates were resistant to cefoxitin, and their susceptibility to the other beta-lactams tested was not significantly decreased.

  13. Antibiotic resistance and extended spectrum beta-lactamases: Types, epidemiology and treatment

    PubMed Central

    Shaikh, Sibhghatulla; Fatima, Jamale; Shakil, Shazi; Rizvi, Syed Mohd. Danish; Kamal, Mohammad Amjad

    2014-01-01

    Antibiotic resistance is a problem of deep scientific concern both in hospital and community settings. Rapid detection in clinical laboratories is essential for the judicious recognition of antimicrobial resistant organisms. Production of extended-spectrum β-lactamases (ESBLs) is a significant resistance-mechanism that impedes the antimicrobial treatment of infections caused by Enterobacteriaceae and is a serious threat to the currently available antibiotic armory. ESBLs are classified into several groups according to their amino acid sequence homology. Proper infection control practices and barriers are essential to prevent spread and outbreaks of ESBL producing bacteria. As bacteria have developed different strategies to counter the effects of antibiotics, the identification of the resistance mechanism may help in the discovery and design of new antimicrobial agents. The carbapenems are widely regarded as the drugs of choice for the treatment of severe infections caused by ESBL-producing Enterobacteriaceae, although comparative clinical trials are scarce. Hence, more expeditious diagnostic testing of ESBL-producing bacteria and the feasible modification of guidelines for community-onset bacteremia associated with different infections are prescribed. PMID:25561890

  14. Beta-Lactamase Encoded Genes blaTEM and blaCTX Among Acinetobacter baumannii Species Isolated From Medical Devices of Intensive Care Units in Tehran Hospitals

    PubMed Central

    Khalilzadegan, Sara; Sade, Mojtaba; Godarzi, Hussein; Eslami, Gita; Hallajzade, Masoumeh; Fallah, Fatemeh; Yadegarnia, Davood

    2016-01-01

    Background Excessive consumption of antimicrobial materials in hospitals is considered as the main encoder leading to the emergence, development and acquisition of new bacterial resistance to beta-lactamase. Objectives Owing to the lack of proper information regarding the mechanism of the bacterial resistance to antibiotics and responsible genes in the country, the current study aimed to consider the resistance or sensitivity of the Acinetobacter baumannii multi drug resistant (MDR) isolates facing 2% glutaraldehyde. The study was conducted in the selected intensive care units in Tehran hospitals, Iran, in 2013. Materials and Methods In this study conducted over a period of 10 months, A. baumannii species were isolated by bacterial culture following biochemical tests from intensive care units (ICUs) of some hospitals in Tehran, Iran (Fayazbaksh, Taleghani, Imam Khomeini, Valiasr, Labafinejad). The resistance and sensitivity of the isolates to antibiotics were considered according to the clinical and laboratory standard institute CLSI (2012) guidelines. By multiplex PCR method, blaCTX and blaTEM genes were detected and finally, MDR strains were treated with 2% glutaraldehyde. PCR was used for each strain of MDR using specific primers. Results In the current study, 131 A. baumannii isolates (22.3%) out of 588 were studied. The level of resistance to various antibiotics was in the range of 69.4% to 100%. The frequencies of blaTEM and blaCTX genes were 3.2% and 19.4%, respectively. MIC50% and MIC90% of imipenem and meropenem antibiotics were 32 ± 1 µg/mL and 64 ± 1 µg/mL, respectively (P < 0.9). However no resistance to glutaraldehyde was observed. Different bands of MDR strains were observed in the PCR product by electrophoresis. Conclusions It seems that besides the variety and prevalence of blaTEM and blaCTX, enormous mechanisms such as porin and leaking systems (efflux pumps) are responsible for the information of the A. baumannii resistance to disinfectants

  15. Expression, purification, crystallization, and preliminary X-ray crystallographic analysis of OXA-17, an extended-spectrum {beta}-lactamase conferring severe antibiotic resistance

    SciTech Connect

    Lee, J. H. Sohn, S. G. Jung, H. I. An, Y. J. Lee, S. H.

    2013-07-15

    OXA-17, an extended-spectrum {beta}-lactamase (ESBL) conferring severe antibiotic resistance, hydrolytically inactivates {beta}-lactam antibiotics, inducing a lack of eradication of pathogenic bacteria by oxyimino {beta}-lactams and not helping hospital infection control. Thus, the enzyme is a potential target for developing antimicrobial agents against pathogens producing ESBLs. OXA-17 was purified and crystallized at 298 K. X-ray diffraction data from OXA-17 crystal have been collected to 1.85 A resolution using synchrotron radiation. The crystal of OXA-17 belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 48.37, b = 101.12, and c = 126.07 A. Analysis of the packing density shows that the asymmetric unit probably contains two molecules with a solvent content of 54.6%.

  16. TEM-4, a new plasmid-mediated beta-lactamase that hydrolyzes broad-spectrum cephalosporins in a clinical isolate of Escherichia coli.

    PubMed Central

    Paul, G C; Gerbaud, G; Bure, A; Philippon, A M; Pangon, B; Courvalin, P

    1989-01-01

    A clinical isolate of Escherichia coli, strain CB-134, recovered in 1986 from an abdominal abscess, exhibited resistance to penams, oxyimino-beta-lactams including broad-spectrum cephalosporins (cefotaxime, ceftriaxone, ceftazidime), and aztreonam but remained susceptible to cephamycins (cefoxitin, cefotetan) and to moxalactam and imipenem. Clavulanate (2 micrograms/ml) restored the susceptibility of the strain to broad-spectrum cephalosporins and aztreonam. A beta-lactamase with an isoelectric point (pI) of 5.9 was detected in strain CB-134, and the corresponding gene was transferred by conjugation to E. coli together with the associated aminoglycoside resistance determinant [AAC(3)-II] and tetracycline, trimethoprim, and sulfonamide resistance. The beta-lactamase efficiently hydrolyzed cefotaxime and ceftriaxone but only moderately hydrolyzed ceftazidime and was inhibited by clavulanate and sulbactam (1 microM) and by anti-TEM-1 and anti-TEM-2 sera. This extended-spectrum beta-lactamase, conferring resistance to cefotaxime, ceftriaxone, ceftazidime, and aztreonam, was comparable to CTX-1 (TEM-3) but differed from it by pI. Agarose gel electrophoresis of the plasmid DNA indicated that this new enzyme was coded by pUD16, a plasmid of 220 kilobases which belongs to the Inc6 incompatibility group. Hybridization with an intragenic probe for TEM-1 revealed that this beta-lactamase derives from TEM-type beta-lactamases and hence it was named TEM-4. Images PMID:2692515

  17. Genetic and biochemical characterization of TRU-1, the endogenous class C beta-lactamase from Aeromonas enteropelogenes.

    PubMed

    De Luca, Filomena; Giraud-Morin, Chantal; Rossolini, Gian Maria; Docquier, Jean-Denis; Fosse, Thierry

    2010-04-01

    Aeromonas enteropelogenes (formerly A. tructi) was described to be an ampicillin-susceptible and cephalothin-resistant Aeromonas species, which suggests the production of a cephalosporinase. Strain ATCC 49803 was susceptible to amoxicillin, cefotaxime, and imipenem but resistant to cefazolin (MICs of 2, 0.032, 0.125, and >256 microg/ml, respectively) and produced an inducible beta-lactamase. Cefotaxime-resistant mutants (MIC, 32 microg/ml) that showed constitutive beta-lactamase production could be selected in vitro. The gene coding for the cephalosporinase of A. enteropelogenes ATCC 49803 was cloned, and its biochemical properties were investigated. Escherichia coli transformants showing resistance to various beta-lactams carried a 3.5-kb plasmid insert whose sequence revealed a 1,146-bp open reading frame (ORF) encoding a class C beta-lactamase, named TRU-1, showing the highest identity scores with A. punctata CAV-1 (75%), A. salmonicida AmpC (75%), and A. hydrophila CepH (71%). The bla(TRU-1) locus includes open reading frames (ORFs) showing significant homology with genes found in the genomes of other Aeromonas species, although it exhibits a different organization, as reflected by the presence of additional ORFs located downstream of the beta-lactamase gene in the A. hydrophila and A. salmonicida genomes. Specific PCR assays were negative for cphA-like and bla(OXA-12)-like genes in three A. enteropelogenes ATCC strains. Purified TRU-1 showed a broad substrate profile, efficiently hydrolyzing benzylpenicillin, cephalothin, cefoxitin, and, although with significantly lower turnover rates, oxyiminocephalosporins. Cephaloridine and cefepime were poorly recognized by the enzyme, as reflected by the high K(m) values observed with these substrates. Thus far, A. enteropelogenes represents the only known example of an Aeromonas species that produces only one beta-lactamase belonging to molecular class C. PMID:20124004

  18. Diversity of CTX-M beta-lactamases and their promoter regions from Enterobacteriaceae isolated in three Parisian hospitals.

    PubMed

    Saladin, Michèle; Cao, Van Thi Bao; Lambert, Thierry; Donay, Jean-Luc; Herrmann, Jean-Louis; Ould-Hocine, Zahia; Verdet, Charlotte; Delisle, Françoise; Philippon, Alain; Arlet, Guillaume

    2002-04-01

    Nine clinical isolates of Enterobacteriaceae (six Escherichia coli and three Proteus mirabilis) isolated in three Parisian hospitals between 1989 and 2000 showed a particular extended-spectrum cephalosporin-resistance profile characterized by resistance to cefotaxime and aztreonam but not to ceftazidime. CTX-M-1, CTX-M-2, CTX-M-9, CTX-M-14 and two novel plasmid-mediated CTX-M beta-lactamases (CTX-M-20, and CTX-M-21) were identified by polymerase chain reaction and isoelectric focusing (pI>8) and were associated in eight cases with TEM-1 (pI=5.4) or TEM-2 (pI=5.6) beta-lactamases. We used internal ISEcp1 and IS26 forward primers and the CTX-M consensus reverse primer to characterize the CTX-M beta-lactamase promoter regions and showed their high degree of structure diversity. We found upstream of some bla(CTX-M) genes, a 266-bp sequence 100% identical to the sequence upstream of the Kluyvera ascorbata beta-lactamase gene, suggesting that this chromosomal enzyme is the progenitor of the CTX-M-2/5 cluster.

  19. Characterization of a beta-lactamase found in Eikenella corrodens.

    PubMed Central

    Lacroix, J M; Walker, C

    1991-01-01

    Eleven strains of Eikenella corrodens with beta-lactamase activity were isolated from a patient with refractory periodontitis who had previously been treated with penicillin antibiotics. These strains were relatively resistant to benzylpenicillin, amoxicillin, and ampicillin (MICs, greater than or equal to 64 micrograms/ml); susceptible to amoxicillin-clavulanate (2:1) (MICs, less than or equal to 4 micrograms/ml); and moderately susceptible to cephalothin and cephaloridine (MICs, 0.12 to 16 micrograms/ml). The addition of 1 microgram of potassium clavulanate, a beta-lactamase inhibitor, per ml resulted in a significant increase in the susceptibilities of these strains to penicillins but not to cephalosporins. Potassium clavulanate had no effect on non-beta-lactamase-producing strains. Enzyme production was constitutive since activity was not increased when cells were cultivated in the presence of benzylpenicillin. Enzyme activity was strongly inhibited by potassium clavulanate, sulbactam, and iodine; weakly inhibited by cloxacillin, imipenem, and moxalactam; but not inhibited by aztreonam, EDTA, or p-chloromercuribenzoate. By gel infiltration, the enzyme had an estimated molecular mass of 29 kDa. Isoelectric focusing of the partially purified enzyme gave a major beta-lactamase band at pH 5.50 and a minor band at pH 5.60. Plasmids were not detected in any of the 11 beta-lactamase-positive strains. This enzyme is considered to belong to class 2a of the Bush classification scheme. PMID:1854171

  20. Antimicrobial susceptibilities and beta-lactamase characterization of Capnocytophaga species.

    PubMed Central

    Roscoe, D L; Zemcov, S J; Thornber, D; Wise, R; Clarke, A M

    1992-01-01

    Capnocytophaga species have been associated with a wide variety of infections in both immunocompetent and immunocompromised patients. On the basis of data from antimicrobial susceptibility studies, beta-lactam antibiotics have been considered efficacious therapy. Six of 19 isolates from primarily clinical sources across Canada demonstrated beta-lactamase production, and agar dilution susceptibility testing showed broad resistance to beta-lactam antibiotics. For the beta-lactamase producing isolates, clavulanate reduced the MIC of amoxicillin for 90% of the strains tested by 64-fold. Isolates were highly susceptible to clindamycin, imipenem, and ciprofloxacin. Characterization of the beta-lactamases produced by two of these isolates (Van1 and Van2) was performed. Isoelectric focusing revealed an identical isoelectric point of 5.6 for both enzymes, but they had markedly different relative hydrolysis efficiencies, and different conditions were required to extract the enzymes. This study demonstrates the production of different types of beta-lactamases by Capnocytophaga spp. and suggests the need to screen all clinical isolates of Capnocytophaga spp. for the presence of beta-lactamases. PMID:1444299

  1. Mechanisms of ceftazidime and ciprofloxacin transport through porins in multidrug-resistance developed by extended-spectrum beta-lactamase E.coli strains.

    PubMed

    Radu, Beatrice Mihaela; Bacalum, Mihaela; Marin, Adela; Chifiriuc, Carmen-Mariana; Lazar, Veronica; Radu, Mihai

    2011-07-01

    Resistance towards antibiotics stands out today as a major issue in the clinical act of treatment of bacterial-generated infections. This process was characterized in proteoliposomes reconstituted from an E.coli strain isolated from invasive infections (blood culture) occurred in patients with a cardio-vascular device admitted for surgery. Fluorescence spectroscopy and patch-clamp technique have been used. Two types of antibiotics have been targeted: ceftazidime and ciprofloxacin. Antibiotics addition in proteoliposomes suspension undergoes a quenching in tryptophan residues from outer membrane porins structure, probably due to the formation of a transient non-fluorescent porin-antibiotic complex. Patch-clamp recordings revealed strong ion current blockages for both antibiotics, reflecting antibiotic-channel interactions but with varying strength of interaction. The present study puts forward the mechanism of multidrug-resistance in extended-spectrum beta-lactamase E.coli strains, as being caused by alterations of the antibiotics transport across the porins of the outer bacterial membrane.

  2. Suspected nosocomial infections with multi-drug resistant E. coli, including extended-spectrum beta-lactamase (ESBL)-producing strains, in an equine clinic.

    PubMed

    Walther, Birgit; Lübke-Becker, Antina; Stamm, Ivonne; Gehlen, Heidrun; Barton, Ann Kristin; Janssen, Traute; Wieler, Lothar H; Guenther, Sebastian

    2014-01-01

    Enterobacteriaceae such as Escherichia coli are common commensals as well as opportunistic and obligate pathogens. They cause a broad spectrum of infectious diseases in various hosts, including hospital-associated infections. In recent years, the rise of extended spectrum beta-lactamase (ESBL)-producing E. coli in companion animals (dogs, cats and horses) has been striking. However, reports on nosocomial infections are mostly anecdotic. Here we report on the suspected nosocomial spread of both ESBL-producing and non-ESBL-producing multi-drug resistant E. coli isolates in three equine patients within an equine clinic. Unlike easy-to-clean hospitalization opportunities available for small animal settings like boxes and cages made of ceramic floor tiles or stainless steel, clinical settings for horses are challenging environments for infection control programs due to unavoidable extraneous material including at least hay and materials used for horse bedding. The development of practice-orientated recommendations is needed to improve the possibilities for infection control to prevent nosocomial infections with multi-drug resistant and other transmissible pathogens in equine clinical settings.

  3. Detection of CMY-2, CTX-M-14, and SHV-12 beta-lactamases in Escherichia coli fecal-sample isolates from healthy chickens.

    PubMed

    Briñas, Laura; Moreno, Miguel Angel; Zarazaga, Myriam; Porrero, Concepción; Sáenz, Yolanda; García, María; Dominguez, Lucas; Torres, Carmen

    2003-06-01

    Genes encoding the CMY-2, CTX-M-14, and SHV-12 beta-lactamases were detected in three of five Escherichia coli isolates from fecal samples from healthy chickens which showed resistance or diminished susceptibility to extended-spectrum cephalosporins. A -42 mutation at the promoter region of the ampC gene was detected in the other two isolates.

  4. Transcriptional induction of Streptomyces cacaoi beta-lactamase by a beta-lactam compound.

    PubMed

    Forsman, M; Lindgren, L; Häggström, B; Jaurin, B

    1989-10-01

    The soil bacterium Streptomyces cacaoi produces an extracellular beta-lactamase. The beta-lactamase expression could be induced by the beta-lactam compound 6-amino penicillinoic acid (6-APA). In liquid cultures, a 50-fold increase in beta-lactamase expression was observed within the first three hours after addition of 6-APA. Using the cloned beta-lactamase gene as a probe, it was shown that this increase was mediated at the level of transcriptional initiation. The start point of the induced beta-lactamase transcript was determined, and the nucleotide sequence of the promoter region was analysed. No noticeable homology was found to control regions of inducible beta-lactamase genes of other bacteria. A striking feature was the presence of six direct repeats (ten base pairs each) upstream of the promoter region. Thus, an example of an inducible regulatory gene system in this Gram-positive microorganism is presented. Also, the primary structure of the beta-lactamase was deduced, showing a high degree of homology with class A beta-lactamases. PMID:2559297

  5. OXA-18, a class D clavulanic acid-inhibited extended-spectrum beta-lactamase from Pseudomonas aeruginosa.

    PubMed Central

    Philippon, L N; Naas, T; Bouthors, A T; Barakett, V; Nordmann, P

    1997-01-01

    Clinical isolate Pseudomonas aeruginosa Mus showed resistance both to extended-spectrum cephalosporins and to aztreonam. We detected a typical double-disk synergy image when ceftazidime or aztreonam was placed next to a clavulanic acid disk on an agar plate. This resistance phenotype suggested the presence of an extended-spectrum beta-lactamase. Isoelectric focusing revealed that this strain produced three beta-lactamases, of pI 5.5, 7.4, and 8.2. A 2.6-kb Sau3A fragment encoding the extended-spectrum beta-lactamase of pI 5.5 was cloned from P. aeruginosa Mus genomic DNA. This enzyme, named OXA-18, had a relative molecular mass of 30.6 kDa. OXA-18 has a broad substrate profile, hydrolyzing amoxicillin, ticarcillin, cephalothin, ceftazidime, cefotaxime, and aztreonam, but not imipenem or cephamycins. Its activity was totally inhibited by clavulanic acid at 2 microg/ml. Hydrolysis constants of OXA-18 (Vmax, Km) confirmed the MIC results. Cloxacillin and oxacillin hydrolysis was noticeable with the partially purified OXA-18. The blaOXA-18 gene encodes a 275-amino-acid protein which has weak identity with all class D beta-lactamases except OXA-9 and OXA-12 (45 and 42% amino acid identity, respectively). OXA-18 is likely to be chromosomally encoded since no plasmid was found in the strain and because attempts to transfer the resistance marker failed. OXA-18 is peculiar since it is a class D beta-lactamase which confers high resistance to extended-spectrum cephalosporins and seems to have unique hydrolytic properties among non-class A enzymes. PMID:9333046

  6. Validation of the VITEK2 and the Advance Expert System with a collection of Enterobacteriaceae harboring extended spectrum or inhibitor resistant beta-lactamases.

    PubMed

    Cantón, R; Pérez-Vázquez, M; Oliver, A; Coque, T M; Loza, E; Ponz, F; Baquero, F

    2001-01-01

    The susceptibility testing accuracy of the VITEK2 system and the ability of the Advance Expert System (AES) to provide interpretive readings were evaluated against 86 extended spectrum (ESBL) and 6 inhibitor-resistant-TEM (IRT) beta-lactamases producing Enterobacteriaceae clinical isolates. VITEK2 MICs of 12 beta-lactams were compared with those obtained by the standard NCCLS microdilution technique. The overall essential agreement ( +/- 1 log dilution) was 87.8%. Discrepancies were mainly observed with cefepime (30.3% of total number of discrepancies), ceftazidime (21.2%), and cefotaxime (15.1%). MIC discrepancies were slightly higher in CTX-M- (14.4%) than in TEM- (12.5%) or SHV- (11.9%) type ESBL producers and were rare in IRT producers (1.4%). Overall interpretive agreement was 92.5% and minor, major, and very major errors were 5.4%, 1.7%, and 2.1%, respectively. The AES was able to identify an ESBL phenotype in 85 out of 86 isolates (98.8%) and an IRT phenotype in all 6 isolates harboring these enzymes, thus reducing very major errors to 0.9%. The VITEK2 system, in conjunction with the AES software, is a reliable tool for detection of ESBL or IRT producing Enterobacteriaceae isolates. PMID:11687316

  7. Strategic Design of an Effective beta-Lactamase Inhibitor

    SciTech Connect

    Pattanaik, P.; Bethel, C; Hujer, A; Hujer, K; Distler, A; Taracila, M; Anderson, V; Fritsche, T; Jones, R; et. al.

    2009-01-01

    In an effort to devise strategies for overcoming bacterial beta-lactamases, we studied LN-1-255, a 6-alkylidene-2'-substituted penicillin sulfone inhibitor. By possessing a catecholic functionality that resembles a natural bacterial siderophore, LN-1-255 is unique among beta-lactamase inhibitors. LN-1-255 combined with piperacillin was more potent against Escherichia coli DH10B strains bearing bla(SHV) extended-spectrum and inhibitor-resistant beta-lactamases than an equivalent amount of tazobactam and piperacillin. In addition, LN-1-255 significantly enhanced the activity of ceftazidime and cefpirome against extended-spectrum cephalosporin and Sme-1 containing carbapenem-resistant clinical strains. LN-1-255 inhibited SHV-1 and SHV-2 beta-lactamases with nm affinity (K(I) = 110 +/- 10 and 100 +/- 10 nm, respectively). When LN-1-255 inactivated SHV beta-lactamases, a single intermediate was detected by mass spectrometry. The crystal structure of LN-1-255 in complex with SHV-1 was determined at 1.55A resolution. Interestingly, this novel inhibitor forms a bicyclic aromatic intermediate with its carbonyl oxygen pointing out of the oxyanion hole and forming hydrogen bonds with Lys-234 and Ser-130 in the active site. Electron density for the 'tail' of LN-1-255 is less ordered and modeled in two conformations. Both conformations have the LN-1-255 carboxyl group interacting with Arg-244, yet the remaining tails of the two conformations diverge. The observed presence of the bicyclic aromatic intermediate with its carbonyl oxygen positioned outside of the oxyanion hole provides a rationale for the stability of this inhibitory intermediate. The 2'-substituted penicillin sulfone, LN-1-255, is proving to be an important lead compound for novel beta-lactamase inhibitor design.

  8. The role of horizontal gene transfer in the dissemination of extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates in an endemic setting

    PubMed Central

    Doi, Yohei; Adams-Haduch, Jennifer M.; Peleg, Anton Y.; D’Agata, Erika MC

    2012-01-01

    The contribution of horizontal gene transmission (HGT) in the emergence and spread of extended-spectrum beta-lactamase (ESBL)-producing gram-negative bacteria during periods of endemicity is unclear. Over a 12-month period, rectal colonization with SHV-5 and SHV-12 producing-Escherichia coli and Klebsiella pneumoniae was quantified among a cohort of residents in a long-term care facility. Demographic and clinical data were collected on colonized residents. Transferability of SHV-encoding plasmids and pulsed-field gel electrophoresis was performed to quantify the contribution of HGT and cross-transmission, respectively. A total of 25 (12%) of 214 enrolled patients were colonized with 11 SHV-5- and 17 SVH-12-producing E. coli and K. pneumoniae. Clonally-related isolates were detected among multiple residents residing on the same and different wards. Among 12 clonally-distinct isolates, HGT of SHV-5- and SHV-12-encoding plasmids was identified among 6 (50%) isolates. HGT among clonally-distinct strains contributes to the transmission dynamics of these ESBL-producing gram-negative bacteria and should be considered when evaluating the spread of these pathogens. PMID:22722012

  9. Characterization of extended-spectrum beta-lactamases and antimicrobial resistance of Klebsiella pneumoniae in intra-abdominal infection isolates in Latin America, 2008-2012. Results of the Study for Monitoring Antimicrobial Resistance Trends.

    PubMed

    Kazmierczak, Krystyna M; Lob, Sibylle H; Hoban, Daryl J; Hackel, Meredith A; Badal, Robert E; Bouchillon, Samuel K

    2015-07-01

    The Study for Monitoring Antimicrobial Resistance Trends has monitored the in vitro activity of several recommended antimicrobials used in the management of intra-abdominal infections (IAIs) globally since 2002. In this report, we document the changing susceptibility patterns to recommended antimicrobials in Klebsiella pneumoniae isolates from patients with IAIs in 11 Latin American countries between 2008 and 2012 and describe the beta-lactamases encoded by phenotypically extended-spectrum beta-lactamase (ESBL)-positive and ertapenem-nonsusceptible isolates. Overall, the incidence of phenotypically ESBL-positive K. pneumoniae did not change significantly from 2008 (40.4%) to 2012 (41.2%) (P > 0.05). However, trend analysis documented an increase in isolates encoding K. pneumoniae carbapenemase (KPC) or both KPC and an ESBL. Decreasing susceptibility (P < 0.05) was noted for cefepime, ceftazidime, ceftriaxone, ertapenem, and imipenem among all K. pneumoniae, as well as for cefepime, cefotaxime, cefoxitin, ceftriaxone, ertapenem, and imipenem among ESBL-positive isolates, while susceptibility of ESBL-negative isolates to ampicillin-sulbactam actually increased (P < 0.05).

  10. Cloning and sequence analysis of a class A beta-lactamase from Mycobacterium tuberculosis H37Ra.

    PubMed Central

    Hackbarth, C J; Unsal, I; Chambers, H F

    1997-01-01

    A cosmid library from Mycobacterium tuberculosis H37Ra was introduced into Mycobacterium smegmatis, and eight recombinant clones with increased resistance to cefoxitin were identified. Isoelectric focusing detected an M. tuberculosis-derived beta-lactamase in one of these recombinant clones. A sequence analysis identified it as a class A beta-lactamase whose expression correlated with the increased resistance phenotype. PMID:9145897

  11. Molecular and biochemical characterization of the chromosome-encoded class A beta-lactamase BCL-1 from Bacillus clausii.

    PubMed

    Girlich, Delphine; Leclercq, Roland; Naas, Thierry; Nordmann, Patrice

    2007-11-01

    A chromosomal beta-lactamase gene from Bacillus clausii NR, which is used as a probiotic, was cloned and expressed in Escherichia coli. It encodes a clavulanic acid-susceptible Ambler class A beta-lactamase, BCL-1, with a pI of 5.5 and a molecular mass of ca. 32 kDa. It shares 91% and 62% amino acid identity with the chromosomally encoded PenP penicillinases from B. clausii KSM-K16 and Bacillus licheniformis, respectively. The hydrolytic profile of this beta-lactamase includes penicillins, narrow-spectrum cephalosporins, and cefpirome. This chromosome-encoded enzyme was inducible in B. clausii, and its gene is likely related to upstream-located regulatory genes that share significant identity with those reported to be upstream of the penicillinase gene of B. licheniformis. The bla(BCL-1) gene was located next to the known chromosomal aadD2 gene and the erm34 gene, which encode resistance to aminoglycosides and macrolides, respectively. Similar genes were found in a collection of B. clausii reference strains. PMID:17846134

  12. Effects of temperature on Escherichia coli overproducing beta-lactamase or human epidermal growth factor.

    PubMed Central

    Chalmers, J J; Kim, E; Telford, J N; Wong, E Y; Tacon, W C; Shuler, M L; Wilson, D B

    1990-01-01

    The effects of temperature on strains of Escherichia coli which overproduce and excrete either beta-lactamase or human epidermal growth factor were investigated. E. coli RB791 cells containing plasmid pKN which has the tac promoter upstream of the gene for beta-lactamase were grown and induced with isopropyl-beta-D-thiogalactopyranoside in batch culture at 37, 30, 25, and 20 degrees C. The lower temperature greatly reduced the formation of periplasmic beta-lactamase inclusion bodies, increased significantly the total amount of beta-lactamase activity, and increased the purity of extracellular beta-lactamase from approximately 45 to 90%. Chemostat operation at 37 and 30 degrees C was difficult due to poor cell reproduction and beta-lactamase production. However, at 20 degrees C, continuous production and excretion of beta-lactamase were obtained for greater than 450 h (29 generations). When the same strain carried plasmid pCU encoding human epidermal growth factor, significant cell lysis was observed after induction at 31 and 37 degrees C, whereas little cell lysis was observed at 21 and 25 degrees C. Both total soluble and total human epidermal growth factor increased with decreasing temperature. These results indicate that some of the problems of instability of strains producing high levels of plasmid-encoded proteins can be mitigated by growth at lower temperatures. Further, lower temperatures can increase for at least some secreted proteins both total plasmid-encoded protein formed and the fraction that is soluble. Images PMID:2155574

  13. Metallo-beta-lactamases (classification, activity, genetic organization, structure, zinc coordination) and their superfamily.

    PubMed

    Bebrone, Carine

    2007-12-15

    One strategy employed by bacterial strains to resist beta-lactam antibiotics is the expression of metallo-beta-lactamases requiring Zn(2+) for activity. In the last few years, many new zinc beta-lactamases have been described and several pathogens are now known to synthesize members of this class. Metallo-beta-lactamases are especially worrisome due to: (1) their broad activity profiles that encompass most beta-lactam antibiotics, including the carbapenems; (2) potential for horizontal transference; and (3) the absence of clinically useful inhibitors. On the basis of the known sequences, three different lineages, identified as subclasses B1, B2, and B3 have been characterized. The three-dimensional structure of at least one metallo-beta-lactamase of each subclass has been solved. These very similar 3D structures are characterized by the presence of an alphabetabetaalpha-fold. In addition to metallo-beta-lactamases which cleave the amide bond of the beta-lactam ring, the metallo-beta-lactamase superfamily includes enzymes which hydrolyze thiol-ester, phosphodiester and sulfuric ester bonds as well as oxydoreductases. Most of the 6000 members of this superfamily share five conserved motifs, the most characteristic being the His116-X-His118-X-Asp120-His121 signature. They all exhibit an alphabetabetaalpha-fold, similar to that found in the structure of zinc beta-lactamases. Many members of this superfamily are involved in mRNA maturation and DNA reparation. This fact suggests the hypothesis that metallo-beta-lactamases may be the result of divergent evolution starting from an ancestral protein which did not have a beta-lactamase activity.

  14. Crystallographic Studies of Two Bacterial AntibioticResistance Enzymes: Aminoglycoside Phosphotransferase (2')-Ic and GES-1\\beta-lactamase

    SciTech Connect

    Brynes, Laura; /Rensselaer Poly.

    2007-10-31

    Guiana Extended-Spectrum-1 (GES-1) and Aminoglycoside phosphotransferase (2')-Ic (APH(2')-Ic) are two bacteria-produced enzymes that essentially perform the same task: they provide resistance to an array of antibiotics. Both enzymes are part of a growing resistance problem in the medical world. In order to overcome the ever-growing arsenal of antibiotic-resistance enzymes, it is necessary to understand the molecular basis of their action. Accurate structures of these proteins have become an invaluable tool to do this. Using protein crystallography techniques and X-ray diffraction, the protein structure of GES-1 bound to imipenem (an inhibitor) has been solved. Also, APH(2')-Ic has been successfully crystallized, but its structure was unable to be solved using molecular replacement using APH(2')-Ib as a search model. The structure of GES-1, with bound imipenem was solved to a resolution of 1.89A, and though the inhibitor is bound with only moderate occupancy, the structure shows crucial interactions inside the active site that render the enzyme unable to complete the hydrolysis of the {beta}-lactam ring. The APH(2')-Ic dataset could not be matched to the model, APH(2')-Ib, with which it shares 25% sequence identity. The structural information gained from GES-1, and future studies using isomorphous replacement to solve the APH(2')-Ic structure can aid directly to the creation of novel drugs to combat both of these classes of resistance enzymes.

  15. Multidrug-Resistant and Extended Spectrum Beta-Lactamase-Producing Escherichia coli in Dutch Surface Water and Wastewater

    PubMed Central

    Blaak, Hetty; Lynch, Gretta; Italiaander, Ronald; Hamidjaja, Raditijo A.; Schets, Franciska M.; de Roda Husman, Ana Maria

    2015-01-01

    Objective The goal of the current study was to gain insight into the prevalence and concentrations of antimicrobial resistant (AMR) Escherichia coli in Dutch surface water, and to explore the role of wastewater as AMR contamination source. Methods The prevalence of AMR E. coli was determined in 113 surface water samples obtained from 30 different water bodies, and in 33 wastewater samples obtained at five health care institutions (HCIs), seven municipal wastewater treatment plants (mWWTPs), and an airport WWTP. Overall, 846 surface water and 313 wastewater E. coli isolates were analysed with respect to susceptibility to eight antimicrobials (representing seven different classes): ampicillin, cefotaxime, tetracycline, ciprofloxacin, streptomycin, sulfamethoxazole, trimethoprim, and chloramphenicol. Results Among surface water isolates, 26% were resistant to at least one class of antimicrobials, and 11% were multidrug-resistant (MDR). In wastewater, the proportions of AMR/MDR E. coli were 76%/62% at HCIs, 69%/19% at the airport WWTP, and 37%/27% and 31%/20% in mWWTP influents and effluents, respectively. Median concentrations of MDR E. coli were 2.2×102, 4.0×104, 1.8×107, and 4.1×107 cfu/l in surface water, WWTP effluents, WWTP influents and HCI wastewater, respectively. The different resistance types occurred with similar frequencies among E. coli from surface water and E. coli from municipal wastewater. By contrast, among E. coli from HCI wastewater, resistance to cefotaxime and resistance to ciprofloxacin were significantly overrepresented compared to E. coli from municipal wastewater and surface water. Most cefotaxime-resistant E. coliisolates produced ESBL. In two of the mWWTP, ESBL-producing variants were detected that were identical with respect to phylogenetic group, sequence type, AMR-profile, and ESBL-genotype to variants from HCI wastewater discharged onto the same sewer and sampled on the same day (A1/ST23/CTX-M-1, B23/ST131/CTX-M-15, D2/ST405/CTX

  16. Antimicrobial resistance status and prevalence rates of extended spectrum beta-lactamase producers isolated from a mixed human population

    PubMed Central

    Afunwa, Ruth A.; Odimegwu, Damian C.; Iroha, Romanus I.; Esimone, Charles O.

    2011-01-01

    Owing to the increasing epidemiological and therapeutic challenges associated with infections due to ESBL producers, ESBL prevalence rate among some bacteria isolates from healthy and non-healthy human population in a metropolitan Nigerian setting was evaluated. A total of one hundred and forty-five (145) bacteria strains were isolated from a total of four hundred and sixty (460) samples collected from urine, wound, throat and anal swabs of 220 healthy volunteers in the community and from 240 patients in 2 secondary and 2 tertiary hospitals (altogether, 4) in Enugu metropolis. The presumptive confirmatory test used for ESBL detection was the Double Disc Synergy Test (DDST) method. Conjugation and plasmid curing studies were also done for resistance factor determination. Of the 145 isolates, 20 were ESBL producers with 35% of these ESBL producers being of community origin and 65% from hospitals. This translates to 4.8% and 9% incidences (comparably higher than established prevalence of 4.4% and 7.5 respectively) for community and hospital infections respectively. The ESBL isolates showed high resistance to tetracycline, gentamicin, pefloxacin, ceftriaxone, cefuroxime, ciprofloxacin and Augmentin® (Amoxicilin and clavulanic acid combination). Conjugation studies for Resistance plasmid transfer showed non-transference of resistance determinants between the ESBL transconjugants and recipient strains. Correspondingly, the plasmid curing studies revealed that the acridine orange could not effect a cure on the isolates as they still retained high resistance to the antibiotics after the treatment. This study confirms the growing incidences/pool of ESBL strains in Nigeria and call for widespread and continuous monitoring towards an effective management of the potential therapeutic hurdle posed by this trend. PMID:21619555

  17. Antimicrobial resistance status and prevalence rates of extended spectrum beta-lactamase (ESBL) producers isolated from a mixed human population.

    PubMed

    Afunwa, Ruth A; Odimegwu, Damian C; Iroha, Romanus I; Esimone, Charles O

    2011-05-01

    Owing to the increasing epidemiological and therapeutic challenges associated with infections due to ESBL producers, ESBL prevalence rate among some bacteria isolates from healthy and non-healthy human population in a metropolitan Nigerian setting was evaluated. A total of one hundred and forty-five (145) bacteria strains were isolated from a total of four hundred and sixty (460) samples collected from urine, wound, throat and anal swabs of 220 healthy volunteers in the community and from 240 patients in 2 secondary and 2 tertiary hospitals (altogether, 4) in Enugu metropolis. The presumptive confirmatory test used for ESBL detection was the Double Disc Synergy Test (DDST) method. Conjugation and plasmid curing studies were also done for resistance factor determination. Of the 145 isolates, 20 were ESBL producers with 35% of these ESBL producers being of community origin and 65% from hospitals. This translates to 4.8% and 9% incidences (comparably higher than established prevalence of 4.4% and 7.5 respectively) for community and hospital infections respectively. The ESBL isolates showed high resistance to tetracycline, gentamicin, pefloxacin, ceftriaxone, cefuroxime, ciprofloxacin and Augmentin(®) (Amoxicilin and clavulanic acid combination). Conjugation studies for Resistance plasmid transfer showed non-transference of resistance determinants between the ESBL transconjugants and recipient strains. Correspondingly, the plasmid curing studies revealed that the acridine orange could not effect a cure on the isolates as they still retained high resistance to the antibiotics after the treatment. This study confirms the growing incidences/pool of ESBL strains in Nigeria and call for widespread and continuous monitoring towards an effective management of the potential therapeutic hurdle posed by this trend.

  18. Binding of the Citrobacter freundii AmpR regulator to a single DNA site provides both autoregulation and activation of the inducible ampC beta-lactamase gene.

    PubMed Central

    Lindquist, S; Lindberg, F; Normark, S

    1989-01-01

    Citrobacter freundii encodes an inducible chromosomal beta-lactamase. Induction requires the product of the ampR gene, which is transcribed in the opposite orientation from the ampC beta-lactamase gene. We show here that the AmpR protein acts as a transcriptional activator by binding to a DNA region immediately upstream of the ampC promoter. The DNase I footprint pattern was not affected by growth in the presence of beta-lactam inducer or by the use of extracts prepared from cells carrying the ampD2 allele leading to semiconstitutive production of beta-lactamase. It is suggested that activation of AmpR facilitates binding or open complex formation for RNA polymerase at the ampC promoter. The AmpR-binding site overlaps the ampR promoter, and beta-galactosidase activity was decreased from an ampR-lacZ transcriptional fusion when AmpR was expressed from a coresident plasmid, suggesting that ampR is autogenously controlled. The AmpR protein belongs to a family of highly homologous transcriptional activators that includes LysR, which regulates the E. coli lysine synthetase gene, and the NodD protein, which regulates expression of a number of genes involved in nodulation in Rhizobium. The lack of sequence homology to any known beta-lactam-binding protein suggests that AmpR does not bind directly to the beta-lactam inducer but interacts with a second messenger of unknown nature. Images PMID:2786868

  19. Beta-Lactamase Producing Escherichia coli Isolates in Imported and Locally Produced Chicken Meat from Ghana.

    PubMed

    Rasmussen, Mette Marie; Opintan, Japheth A; Frimodt-Møller, Niels; Styrishave, Bjarne

    2015-01-01

    The use of antibiotics in food animals is of public health concern, because resistant zoonotic pathogens can be transmitted to humans. Furthermore, global trade with food may rapidly spread multi-resistant pathogens between countries and even continents. The purpose of the study was to investigate whether imported chicken meat and meat from locally reared chicken are potential sources for human exposure to multi resistant Escherichia coli isolates. 188 samples from imported and locally produced chicken meat were sampled and analyzed. 153 bacteria isolates were successfully cultured and identified as E. coli using MALDI-ToF. Of these 109 isolates were from meat whereas the remaining 44 were isolated from the cloaca of locally reared live chickens. Antimicrobial susceptibility test was done on the identified E. coli isolates. Additionally, beta-lactamases production (ESBL and/or AmpC) were phenotypically confirmed on all isolates showing resistance to cefpodoxime. Beta-lactamase producing (BLP) E. coli meat isolates were further genotyped. Antimicrobial resistance to four antibiotic markers with highest resistance was detected more frequently in isolates from local chickens compared to imported chickens (tetracycline 88.9% vs. 57.5%, sulphonamide 75.0% vs. 46.6%, ampicillin 69.4% vs. 61.6% and trimethoprim 66.7% vs. 38.4%). Beta-lactamase production was found in 29 E. coli meat isolates, with 56.9% of them being multiple drug resistant (≥ 3). The predominant phylogroup identified was B1 followed by A and D, with similar distribution among the isolates from meat of locally reared chickens and imported chickens. Beta-lactamase producing genotype blaCTX-M-15 (50%; 10/20) was the most frequently drug resistant gene detected. More BLP E. coli isolates were found in imported chicken meat compared to locally reared chickens, demonstrating that these isolates may be spreading through food trade. In conclusion, both imported and locally produced chicken meats are potential

  20. Beta-Lactamase Producing Escherichia coli Isolates in Imported and Locally Produced Chicken Meat from Ghana

    PubMed Central

    Rasmussen, Mette Marie; Opintan, Japheth A.; Frimodt-Møller, Niels; Styrishave, Bjarne

    2015-01-01

    The use of antibiotics in food animals is of public health concern, because resistant zoonotic pathogens can be transmitted to humans. Furthermore, global trade with food may rapidly spread multi-resistant pathogens between countries and even continents. The purpose of the study was to investigate whether imported chicken meat and meat from locally reared chicken are potential sources for human exposure to multi resistant Escherichia coli isolates. 188 samples from imported and locally produced chicken meat were sampled and analyzed. 153 bacteria isolates were successfully cultured and identified as E. coli using MALDI-ToF. Of these 109 isolates were from meat whereas the remaining 44 were isolated from the cloaca of locally reared live chickens. Antimicrobial susceptibility test was done on the identified E. coli isolates. Additionally, beta-lactamases production (ESBL and/or AmpC) were phenotypically confirmed on all isolates showing resistance to cefpodoxime. Beta-lactamase producing (BLP) E. coli meat isolates were further genotyped. Antimicrobial resistance to four antibiotic markers with highest resistance was detected more frequently in isolates from local chickens compared to imported chickens (tetracycline 88.9% vs. 57.5%, sulphonamide 75.0% vs. 46.6%, ampicillin 69.4% vs. 61.6% and trimethoprim 66.7% vs. 38.4%). Beta-lactamase production was found in 29 E. coli meat isolates, with 56.9% of them being multiple drug resistant (≥ 3). The predominant phylogroup identified was B1 followed by A and D, with similar distribution among the isolates from meat of locally reared chickens and imported chickens. Beta-lactamase producing genotype blaCTX-M-15 (50%; 10/20) was the most frequently drug resistant gene detected. More BLP E. coli isolates were found in imported chicken meat compared to locally reared chickens, demonstrating that these isolates may be spreading through food trade. In conclusion, both imported and locally produced chicken meats are potential

  1. Non-inducible, mainly cell-associated beta-lactamase from Nocardia asteroides strain 108.

    PubMed

    Scopetti, F; Fattorini, L; Franceschini, N; Amicosante, G; Orefici, G

    1997-07-01

    The beta-lactamase of the soil-borne strain 108 (parental strain) of Nocardia asteroides is a non-inducible enzyme mainly associated with the cells; it can be efficiently extracted by ultrasonication and SDS treatment. Crude enzyme preparations showed penicillinase and cephalosporinase activity. The kinetics of beta-lactamase production and in-vitro susceptibility to combinations of beta-lactam antibiotics plus beta-lactamase inhibitors have been studied in two stable overproducer mutants (A14 and B1) obtained by mutagenization of the parental strain with nitrosoguanidine. The cell-associated enzyme increased with bacterial growth in parental and mutant strains and was particularly abundant in stationary phase cells. The beta-lactamase inhibitors sulbactam and clavulanic acid decreased MIC values of penicillins more efficiently in the parental strain than in mutants, thus indicating some involvement of the enzyme in the resistance of N. asteroides strain 108 to beta-lactam antibiotics. PMID:9249198

  2. Phenotypic and molecular characterization of a novel beta-lactamase carried by Klebsiella pneumoniae, CTX-M-72, derived from CTX-M-3.

    PubMed

    Cheng, Jun; Wang, Qian; Chen, Yan; Ye, Ying; Li, Hui; Li, Xu; Li, Jia-Bin

    2009-06-01

    This study reports phenotypic and molecular characterization of a novel CTX-M beta-lactamase carried by two Klebsiella pneumoniae isolates collected from two hospitals in China. Conjugation experiment, Southern hybridization, susceptibility testing, isoelectric focusing, PCR, and sequencing techniques as well as clone, expression, purification and kinetics were carried out to describe the characterization of the novel CTX-M-type enzyme. The analyses of plasmid profiling and pulsed-field gel electrophoresis of the novel enzyme were performed to investigate epidemiology. The PCR products had 967 nucleotides and a novel CTX-M enzyme with a pI of 8.5 was implicated in this resistance: CTX-M-72. Two strains exhibited a clavulanic acid-inhibited substrate profile that included extended-spectrum cephalosporins. The amino acid sequence of the CTX-M-72 beta-lactamase differed from that of the CTX-M-3 beta-lactamase by the Arg-->Gly change at position 164. The novel enzyme was susceptible to ceftazidime, the same response being observed for other CTX-M enzymes. The substrates of the beta-lactamase were also characterized. Furthermore, two resistant genes of clinical strains were closely related. The emergence of a novel CTX-M-type extended-spectrum beta-lactamase was rarely described in other areas. This study illustrated the importance of molecular surveillance in tracking CTX-M-producing strains in large teaching hospitals, suggested the horizontal transfer of plasmid-borne bla(CTX-M) genes contributed to the dissemination of CTX-M enzymes in hospital environments, and emphasized the need for epidemiological monitoring.

  3. Detection of Resistance to Beta-Lactamase Inhibitors in Strains with CTX-M Beta-Lactamases: a Multicenter External Proficiency Study Using a Well-Defined Collection of Escherichia coli Strains

    PubMed Central

    Ripoll, Aida; Rodríguez, Cristina; Tormo, Nuria; Gimeno, Concepción; Baquero, Fernando; Martínez-Martínez, Luis; Cantón, Rafael

    2014-01-01

    Under the auspices of the Spanish Society for Infectious Diseases and Clinical Microbiology Quality Control program, 14 Escherichia coli strains masked as blood culture isolates were sent to 68 clinical microbiology laboratories for antimicrobial susceptibility testing to β-lactam antibiotics. This collection included three control strains (E. coli ATCC 25922, an IRT-2 producer, and a CMY-2 producer), six isogenic strains with or without the OmpF porin and expressing CTX-M β-lactamases (CTX-M-1, CTX-M-15, and CTX-M-14), one strain carrying a double mechanism for β-lactam resistance (i.e., carrying CTX-M-15 and OXA-1 enzymes), and four strains carrying CTX-M variants with different levels of resistance to β-lactams and β-lactam–β-lactamase inhibitor (BLBLI) combinations. The main objective of the study was to ascertain how these variants with reduced susceptibilities to BLBLIs are identified in clinical microbiology laboratories. CTX-M variants with high resistance to BLBLIs were mainly identified as inhibitor-resistant TEM (IRT) enzymes (68.0%); however, isogenic CTX-M mutant strains with reduced susceptibilities to BLBLIs and cephalosporins were mainly associated with extended-spectrum β-lactamase production alone (51 to 80%) or in combination with other mechanisms (14 to 31%). Concerning all β-lactams tested, the overall interpretative discrepancy rate was 11.5%, of which 38.1% were the consequence of postreading changes in the clinical categories when a resistance mechanism was inferred. Therefore, failure to recognize these complex phenotypes might contribute to an explanation of their apparent absence in the clinical setting and might lead to inadequate drug treatment selection. A proposal for improving recognition is to adhere strictly to the current CLSI or EUCAST guidelines for detecting reduced susceptibility to BLBLI combinations, without any interpretative modification. PMID:24153133

  4. Beta-lactamase targeted enzyme activatable photosensitizers for antimicrobial PDT

    NASA Astrophysics Data System (ADS)

    Zheng, Xiang; Verma, Sarika; Sallum, Ulysses W.; Hasan, Tayyaba

    2009-06-01

    Photodynamic therapy (PDT) as a treatment modality for infectious disease has shown promise. However, most of the antimicrobial photosensitizers (PS) non-preferentially accumulate in both bacteria and host tissues, causing host tissue phototoxicity during treatment. We have developed a new antimicrobial PDT strategy which exploits beta-lactam resistance mechanism, one of the major drug-resistance bacteria evolved, to achieve enhanced target specificity with limited host damage. Our strategy comprises a prodrug construct with a PS and a quencher linked by beta-lactam ring, resulting in a diminished phototoxicity. This construct, beta-lactamase enzyme-activated-photosensitizer (beta-LEAP), can only be activated in the presence of both light and bacteria, and remains inactive elsewhere such as mammalian tissue. Beta-LEAP construct had shown specific cleavage by purified beta-lactamase and by beta-lactamase over-expressing methicillin resistant Staphylococcus aureus (MRSA). Specific photodynamic toxicity was observed towards MRSA, while dark and light toxicity were equivalent to reference strains. The prodrug design, synthesis and photophysical properties will be discussed.

  5. Sensitive and Rapid Detection of the New Delhi Metallo-Beta-Lactamase Gene by Loop-Mediated Isothermal Amplification

    PubMed Central

    Liu, Wei; Zou, Dayang; Li, Yan; Wang, Xuesong; He, Xiang; Wei, Xiao; Shao, Changlin; Li, Xuelian; Shang, Wei; Yu, Kaitao; Liu, Dawei; Li, Yunmei; Guo, Jing; Yin, Zhitao

    2012-01-01

    New Delhi metallo-β-lactamase 1 (NDM-1), which is associated with resistance to carbapenem, was first reported in 2008. A sensitive and rapid molecular assay to detect the plasmid blaNDM-1 in clinical isolates is needed to control its spread. We describe a loop-mediated isothermal amplification (LAMP) assay for the rapid detection of blaNDM-1 from pure culture and sputum, urine, and fecal samples. Eight sets of primers were designed to recognize six or eight distinct sequences on target blaNDM-1, and one set was selected as the most appropriate set of primers for its rapid detection. The specificity and sensitivity of the primers in the LAMP reactions for blaNDM-1 detection were determined. The sensitivity of the LAMP assay for blaNDM-1 detection in sputum, urine, and fecal samples was also tested. Two methods, namely, monitoring of turbidity and addition of calcein to the reaction tube, were used to determine negative and positive results. The results showed that target DNA was amplified and visualized by the two detection methods within 70 min at an isothermal temperature of 65°C. The sensitivity of LAMP, with a detection limit of 10.70 pg/μl DNA, was 100-fold greater than that of PCR. Thirteen infection bacterial strains without blaNDM-1 were selected for testing of specificity, and the results of the amplification were negative, which showed that the primers had good levels of specificity. The LAMP method reported here is demonstrated to be a potentially valuable means for the detection of blaNDM-1 and rapid clinical diagnosis, being fast, simple, and low in cost. PMID:22357496

  6. Oral delivery of beta-lactamase by Lactococcus lactis subsp. lactis transformed with Plasmid ss80.

    PubMed

    Kaushal, Gagan; Shao, Jun

    2006-04-01

    The objective was to use normal flora to deliver protein/peptide drugs orally. A probiotic bacterium, Lactococcus lactis subsp. lactis (L. lactis) transformed with Plasmid ss80, which made it able to synthesize and secrete beta-lactamase, a 29 kDa protein, was used as the delivery system for beta-lactamase. Oral absorption of beta-lactamase in rats when delivered by this L. lactis system was investigated. The oral bioavailability of beta-lactamase delivered by 3x10(7) of the L. lactis was equivalent to 209 mU of i.v. dose, and the estimated relative bioavailability was 16.7%. When delivered by beta-lactamase free solution form, the relative oral bioavailability was 4.7%, which increased to 6.0% when co-administered with 3x10(7) of the untransformed L. lactis. The results demonstrated that the L. lactis significantly increased the beta-lactamase oral bioavailability by 2-3-folds (p<0.01), the mean residence time (MRT) by 3-4 times (p<0.01), and the mean absorption time (MAT) by 6-14 times (p<0.01), as compared to the free solution form with/without the untransformed L. lactis. In conclusion, the L. lactis is more efficient in delivering beta-lactamase orally compared with the free solution form. It also provides a sustained delivery mechanism for beta-lactamase. Gene-transformed normal flora may be used as an efficient and sustained delivery system for protein drugs through oral route.

  7. Reduced susceptibility to chlorhexidine disinfectant among New Delhi metallo-beta-lactamase-1 positive Enterobacteriaceae and other multidrug-resistant organisms: Report from a tertiary care hospital in Karachi, Pakistan.

    PubMed

    Mal, P B; Farooqi, J; Irfan, S; Hughes, M A; Khan, E

    2016-01-01

    We analysed susceptibility of multidrug-resistant organisms (MDROs) including New Delhi metallo-beta-lactamase-1 positive Enterobacteriaceae to chlorhexidine and compared results to their susceptible counterparts. Susceptibilities of chlorhexidine digluconate in a standard (CHX-S) preparation and two commercial disinfectants containing different CHX concentrations (2% w/v and 4% w/w) were performed. MDROs had narrower range of higher CHX-S minimum inhibitory concentrations (MICs) as compared to pan-sensitive organisms. The MIC values for commercial disinfectants products for MDROs were many folds higher (20-600 times), than CHX-S for in vitro use. Increasing antibiotic resistance among bacterial isolates can be an indirect marker of reduced susceptibility to chlorhexidine in hospital setting. PMID:27514958

  8. Nosocomial spread of the integron-located veb-1-like cassette encoding an extended-pectrum beta-lactamase in Pseudomonas aeruginosa in Thailand.

    PubMed

    Girlich, Delphine; Naas, Thierry; Leelaporn, Amornrut; Poirel, Laurent; Fennewald, Michael; Nordmann, Patrice

    2002-03-01

    The beta-lactamase gene content and epidemiology of ceftazidime-resistant Pseudomonas aeruginosa isolates (24% of the total number of P. aeruginosa isolates) were investigated at a University Hospital in Thailand during a 4-month period in 1999. Of 33 nonrepetitive clinical isolates, 31 produced a VEB-1-like clavulanic acid-inhibited extended-spectrum beta-lactamase (ESBL). These isolates belonged to different pulsed-field gel electrophoresis types and subtypes. In 1 case, the bla(VEB-1)-like gene was plasmid located. The bla(VEB-1)-like genes were present as a gene cassette on class 1 integrons that varied in size and structure. In most cases, the veb-1 cassette was associated with an arr-2 cassette (rifampin resistance), aminoglycoside resistance gene cassettes, and an oxa-10-like cassette encoding a narrow-spectrum oxacillinase-type beta-lactamase. The present study indicates that ESBLs may be endemic in P. aeruginosa and illustrates that integrons are efficient means for their spread.

  9. Peptidase activity of beta-lactamases.

    PubMed Central

    Rhazi, N; Galleni, M; Page, M I; Frère, J M

    1999-01-01

    Although beta-lactamases have generally been considered as being devoid of peptidase activity, a low but significant hydrolysis of various N-acylated dipeptides was observed with representatives of each class of beta-lactamases. The kcat/Km values were below 0.1 M(-1). s(-1), but the enzyme rate enhancement factors were in the range 5000-20000 for the best substrates. Not unexpectedly, the best 'peptidase' was the class C beta-lactamase of Enterobacter cloacae P99, but, more surprisingly, the activity was always higher with the phenylacetyl- and benzoyl-d-Ala-d-Ala dipeptides than with the diacetyl- and alpha-acetyl-l-Lys-d-Ala-d-Ala tripeptides, which are the preferred substrates of the low-molecular-mass, soluble dd-peptidases. A comparison between the beta-lactamases and dd-peptidases showed that it might be as difficult for a dd-peptidase to open the beta-lactam ring as it is for the beta-lactamases to hydrolyse the peptides, an observation which can be explained by geometric and stereoelectronic considerations. PMID:10393100

  10. Beta-lactamase stability of faropenem.

    PubMed

    Dalhoff, A; Nasu, T; Okamoto, K

    2003-09-01

    Faropenem (FAR) is an orally available member of the penem class unique among carbapenems and other available beta-lactams. This study compared FAR to cephalosporins and imipenem with respect to beta-lactamase (BLA) stability and emergence of resistance to Staphylococcus aureus and Escherichia coli. BLA stability was studied using enzyme preparations from sonicated/centrifuged 24-hour cultures of E. coli, Enterobacter cloacae, Proteus vulgaris, Providencia rettgeri, Klebsiella pneumoniae, S. aureus, and Bacteroides fragilis grown in the presence of 20 mg/l ampicillin or cephaloridine to induce penicillinase or cephalosporinase, respectively. Substrate hydrolysis was quantitated spectrophotometrically. Multistep acquisition of resistance was promoted by growing bacteria in broth containing 2-fold dilutions of antibiotic over 10 cycles. Aliquots from test tubes with visible growth provided the inoculum for the next series of dilutions. FAR as well as other cephalosporins tested were highly stable to penicillinase derived from S. aureus and E. coli. However, E. coli- and P. vulgaris-derived cephalosporinase hydrolyzed cephaloridine, cefaclor and cefotiam considerably, whereas FAR was highly stable. FAR was highly stable against hydrolysis by various BLAs prepared from four B. fragilis strains and the rate of FAR hydrolysis by metallo-BLA was 5 times lower than that for imipenem. Additionally, the acquisition of resistant S. aureus strains was less pronounced for FAR compared to other agents tested. MICs rose 8-fold after the 10th sub-MIC exposure, while MICs rose 16-, 31- and 512-fold for cefixime, cefazolin and cefaclor, respectively. E. coli shifts in MICs were moderate for all the agents tested. In conclusion, FAR is characterized by pronounced BLA stability compared to other cephalosporins and imipenem. Furthermore, a lower propensity for resistance development with FAR as compared to cephalosporins was observed. PMID:14504433

  11. Side chain SAR of bicyclic [beta]-lactamase inhibitors (BLIs). 1. Discovery of a class C BLI for combination with imipinem

    SciTech Connect

    Blizzard, Timothy A.; Chen, Helen; Kim, Seongkon; Wu, Jane; Young, Katherine; Park, Young-Whan; Ogawa, Amy; Raghoobar, Susan; Painter, Ronald E.; Hairston, Nichelle; Lee, Sang Ho; Misura, Andrew; Felcetto, Tom; Fitzgerald, Paula; Sharma, Nandini; Lu, Jun; Ha, Sookhee; Hickey, Emily; Hermes, Jeff; Hammond, Milton L.

    2010-09-17

    Bridged monobactam {beta}-lactamase inhibitors were prepared and evaluated as potential partners for combination with imipenem to overcome class C {beta}-lactamase mediated resistance. The (S)-azepine analog 2 was found to be effective in both in vitro and in vivo assays and was selected for preclinical development.

  12. Antimicrobial susceptibility and beta-lactamase production of selected gram-negative bacilli from two Croatian hospitals: MYSTIC study results.

    PubMed

    Bedenic, B; Goic-Barisic, I; Budimir, A; Tonkic, M; Mihajkevic, L J; Novak, A; Sviben, M; Plecko, V; Punda-Polic, V; Kalenic, S

    2010-06-01

    The meropenem yearly Susceptibility Test Information Collection (MYSTIC) programme is a global, longitudinal resistance surveillance network that monitors the activity of meropenem and compares its activity with other broadspectrum antimicrobial agents. We now report the antimicrobial efficacy of meropenem compared to other broad-spectrum agents within the selective Gram-negative pathogen groups from two Croatian Hospitals investigated between 2002-2007. A total of 1510 Gram-negative pathogens were tested and the minimum-inhibitory concentrations (MICs) were determined by broth microdilution method according to CLSI.There was no resistance to either imipenem or meropenem observed for Escherichia coli, Klebsiella pneumoniae and Proteus mirabilis in both medical centers. High resistance rates of K. pneumoniae to ceftazidime (18%), cefepime (17%) and gentamicin (39%) are raising concern. Acinetobacter baumannii turned out to be the most resistant Gram-negative bacteria with 81% resistant to ceftazidime, 73% to cefepime, 69% to gentamicin and 71% to ciprofloxacin. Almost 20% of Pseudomonas aeruginosa strains were resistant to imipenem, 13% to meropenem, 69% to gentamicin and 38% to ciprofloxacin.The prevalence of extended-spectrum beta-lactamases (ESBLs) in E. coli was 10% and in K. pneumoniae 49%. PCR and sequencing of the amplicons revealed the presence of SHV-5 in nine E. coli strains and additional tem-1 beta-lactamase five strains. Five K. pneumoniae strains were positive for bla(SHV-5 )gene. Eight ESBL positive Enterobacter spp. strains were found to produce tem and CtX-m beta-lactamases. Plasmid-mediated AmpC beta-lactamases were not found among K. pneumoniae, E. coli and Enterobacter spp. Three A. baumannii strains from Zagreb University Center were identified by multiplex PCR as OXA-58 like producers. Six A. baumannii strains from Split University Center were found to possess an ISAba1 insertion sequence upstream of bla(OXA-51 )gene. According to our results

  13. Escherichia coli with extended-spectrum beta-lactamases or transferable AmpC beta-lactamases and Salmonella on meat imported into Sweden.

    PubMed

    Egervärn, Maria; Börjesson, Stefan; Byfors, Sara; Finn, Maria; Kaipe, Caroline; Englund, Stina; Lindblad, Mats

    2014-02-01

    The presence of Enterobacteriaceae producing extended spectrum beta-lactamases (ESBL) or transferable AmpC beta-lactamases (pAmpC) is increasingly being reported in humans and animals world-wide. Their occurrence in food-producing animals suggests that meat is a possible link between the two populations. This study investigated the occurrence and characteristics of Salmonella and ESBL- or pAmpC-producing E. coli in 430 samples of beef, pork and broiler meat imported into Sweden, in order to provide data required for assessing the potential public health risk of these bacteria in food. Depending on region of origin, ESBL/pAmpC-producing E. coli were found in 0-8% of beef samples, 2-13% of pork samples and 15-95% of broiler meat samples. The highest prevalence was in South American broiler meat (95%), followed by broiler meat from Europe (excluding Denmark) (61%) and from Denmark (15%). Isolates from meat outside Scandinavia were generally defined as multiresistant. A majority of the ESBL/pAmpC genes were transferable by conjugation. Bla(CTX-M-2) and bla(CTX-M-8) were the dominant genes in E. coli from South American broiler meat, whereas bla(CMY-2) and bla(CTX-M-1) dominated in European meat. The majority of bla(CMY-2) and bla(CTX-M-1) were situated on plasmids of replicon type incK and incI1, respectively. The same combinations of ESBL/pAmpC genes and plasmids have been described previously in clinical human isolates. Salmonella was found in five samples tested, from European pork and broiler meat. No Salmonella isolate was resistant to third-generation cephalosporins. In conclusion, meat imported into Sweden, broiler meat in particular, is a potential source of human exposure to ESBL- and pAmpC-producing E. coli.

  14. Nanomolar Inhibitors of AmpC [beta]-Lactamase

    SciTech Connect

    Morandi, Federica; Caselli, Emilia; Morandi, Stefania; Focia, Pamela J.; Blazquez, Jesus; Shoichet, Brian K.; Prati, Fabio

    2010-03-08

    {beta}-lactamases are the most widespread resistance mechanism to {beta}-lactam antibiotics, such as the penicillins and the cephalosporins. In an effort to combat these enzymes, a combination of stereoselective organic synthesis, enzymology, microbiology, and X-ray crystallography was used to design and evaluate new carboxyphenyl-glycylboronic acid transition-state analogue inhibitors of the class C {beta}-lactamase AmpC. The new compounds improve inhibition by over 2 orders of magnitude compared to analogous glycylboronic acids, with K{sub i} values as low as 1 nM. On the basis of the differential binding of different analogues, the introduced carboxylate alone contributes about 2.1 kcal/mol in affinity. This carboxylate corresponds to the ubiquitous C3(4)' carboxylate of {beta}-lactams, and this energy represents the first thermodynamic measurement of the importance of this group in molecular recognition by class C {beta}-lactamases. The structures of AmpC in complex with two of these inhibitors were determined by X-ray crystallography at 1.72 and 1.83 {angstrom} resolution. These structures suggest a structural basis for the high affinity of the new compounds and provide templates for further design. The highest affinity inhibitor was 5 orders of magnitude more selective for AmpC than for characteristic serine proteases, such as chymotrypsin. This inhibitor reversed the resistance of clinical pathogens to the third generation cephalosporin ceftazidime; it may serve as a lead compound for drug discovery to combat bacterial resistance to {beta}-lactam antibiotics.

  15. Clavulanic acid: a beta-lactamase-inhiting beta-lactam from Streptomyces clavuligerus.

    PubMed

    Reading, C; Cole, M

    1977-05-01

    A novel beta-lactamase inhibitor has been isolated from Streptomyces clavuligerus ATCC 27064 and given the name clavulanic acid. Conditions for the cultivation of the organism and detection and isolation of clavulanic acid are described. This compound resembles the nucleus of a penicillin but differs in having no acylamino side chain, having oxygen instead of sulfur, and containing a beta-hydroxyethylidine substituent in the oxazolidine ring. Clavulanic acid is a potent inhibitor of many beta-lactamases, including those found in Escherichia coli (plasmid mediated), Klebsiella aerogenes, Proteus mirabilis, and Staphylococcus aureus, the inhibition being of a progressive type. The cephalosporinase type of beta-lactamase found in Pseudomonas aeruginosa and Enterobacter cloacae P99 and the chromosomally mediated beta-lactamase of E. coli are less well inhibited. The minimum inhibitory concentrations of ampicillin and cephaloridine against beta-lactamase-producing, penicillin-resistant strains of S. aureus, K. aerogenes, P. mirabilis, and E. coli have been shown to be considerably reduced by the addition of low concentrations of clavulanic acid.

  16. Structural Aspects for Evolution of [beta]-Lactamases from Penicillin-Binding Proteins

    SciTech Connect

    Meroueh, Samy O.; Minasov, George; Lee, Wenlin; Shoichet, Brian K.; Mobashery, Shahriar

    2010-03-08

    Penicillin-binding proteins (PBPs), biosynthetic enzymes of bacterial cell wall assembly, and {beta}-lactamases, resistance enzymes to {beta}-lactam antibiotics, are related to each other from an evolutionary point of view. Massova and Mobashery (Antimicrob. Agents Chemother. 1998, 42, 1-17) have proposed that for {beta}-lactamases to have become effective at their function as antibiotic resistance enzymes, they would have had to undergo structure alterations such that they would not interact with the peptidoglycan, which is the substrate for PBPs. A cephalosporin analogue, 7{beta}-[N-Acetyl-L-alanyl-{gamma}-D-glutamyl-L-lysine]-3-acetoxymethyl-3-cephem-carboxylic acid (compound 6), was conceived and synthesized to test this notion. The X-ray structure of the complex of this cephalosporin bound to the active site of the deacylation-deficient Q120L/Y150E variant of the class C AmpC {beta}-lactamase from Escherichia coli was solved at 1.71 {angstrom} resolution. This complex revealed that the surface for interaction with the strand of peptidoglycan that acylates the active site, which is present in PBPs, is absent in the {beta}-lactamase active site. Furthermore, insertion of a peptide in the {beta}-lactamase active site at a location where the second strand of peptidoglycan in some PBPs binds has effectively abolished the possibility for such interaction with the {beta}-lactamase. A 2.6 ns dynamics simulation was carried out for the complex, which revealed that the peptidoglycan surrogate (i.e., the active-site-bound ligand) undergoes substantial motion and is not stabilized for binding within the active site. These factors taken together disclose the set of structure modifications in the antibiotic resistance enzyme that prevent it from interacting with the peptidoglycan, en route to achieving catalytic proficiency for their intended function.

  17. Using steric hindrance to design new inhibitors of class C beta-lactamases

    SciTech Connect

    Trehan, Indi; Morandi, F.; Blaszczak, L.C.; Shoichet, Brian K.

    2010-03-08

    {beta}-lactamases confer resistance to {beta}-lactam antibiotics such as penicillins and cephalosporins. However, {beta}-lactams that form an acyl-intermediate with the enzyme but subsequently are hindered from forming a catalytically competent conformation seem to be inhibitors of {beta}-lactamases. This inhibition may be imparted by specific groups on the ubiquitous R1 side chain of {beta}-lactams, such as the 2-amino-4-thiazolyl methoxyimino (ATMO) group common among third-generation cephalosporins. Using steric hindrance of deacylation as a design guide, penicillin and carbacephem substrates were converted into effective {beta}-lactamase inhibitors and antiresistance antibiotics. To investigate the structural bases of inhibition, the crystal structures of the acyl-adducts of the penicillin substrate amoxicillin and the new analogous inhibitor ATMO-penicillin were determined. ATMO-penicillin binds in a catalytically incompetent conformation resembling that adopted by third-generation cephalosporins, demonstrating the transferability of such sterically hindered groups in inhibitor design.

  18. Interactions of biapenem with active-site serine and metallo-beta-lactamases.

    PubMed Central

    Felici, A; Perilli, M; Segatore, B; Franceschini, N; Setacci, D; Oratore, A; Stefani, S; Galleni, M; Amicosante, G

    1995-01-01

    Biapenem, formerly LJC 10,627 or L-627, a carbapenem antibiotic, was studied in its interactions with 12 beta-lactamases belonging to the four molecular classes proposed by R. P. Ambler (Philos. Trans. R. Soc. Lond. Biol. Sci. 289:321-331, 1980). Kinetic parameters were determined. Biapenem was readily inactivated by metallo-beta-lactamases but behaved as a transient inhibitor of the active-site serine enzymes tested, although with different acylation efficiency values. Class A and class D beta-lactamases were unable to confer in vitro resistance toward this carbapenem antibiotic. Surprisingly, the same situation was found in the case of class B enzymes from Aeromonas hydrophila AE036 and Bacillus cereus 5/B/6 when expressed in Escherichia coli strains. PMID:7574520

  19. Antimicrobial resistance in faecal Escherichia coli isolates from farmed red deer and wild small mammals. Detection of a multiresistant E. coli producing extended-spectrum beta-lactamase.

    PubMed

    Alonso, C A; González-Barrio, D; Tenorio, Carmen; Ruiz-Fons, F; Torres, C

    2016-04-01

    Eighty-nine Escherichia coli isolates recovered from faeces of red deer and small mammals, cohabiting the same area, were analyzed to determine the prevalence and mechanisms of antimicrobial resistance and molecular typing. Antimicrobial resistance was detected in 6.7% of isolates, with resistances to tetracycline and quinolones being the most common. An E. coli strain carrying blaCTX-M-1 as well as other antibiotic resistant genes included in an unusual class 1 integron (Intl1-dfrA16-blaPSE-1-aadA2-cmlA1-aadA1-qacH-IS440-sul3-orf1-mef(B)Δ-IS26) was isolated from a deer. The blaCTX-M-1 gene was transferred by conjugation and transconjugants also acquired an IncN plasmid. This strain was typed as ST224, which seems to be well adapted to both clinical and environmental settings. The phylogenetic distribution of the 89 strains varied depending on the animal host. This work reveals low antimicrobial resistance levels among faecal E. coli from wild mammals, which reflects a lower selective pressure affecting these bacteria, compared to livestock. However, it is remarkable the detection of a multi-resistant ESBL-E. coli with an integron carrying clinically relevant antibiotic-resistance genes, which can contribute to the dissemination of resistance determinants among different ecosystems. PMID:27012919

  20. Energetic, Structural, and Antimicrobial Analyses of [beta]-Lactam Side Chain Recognition by [beta]-Lactamases

    SciTech Connect

    Caselli, E.; Powers, R.A.; Blaszczak, L.C.; Wu, C.Y.E.; Prati, F.; Shoichet, B.K.

    2010-03-05

    Penicillins and cephalosporins are among the most widely used and successful antibiotics. The emergence of resistance to these {beta}-lactams, most often through bacterial expression of {beta}-lactamases, threatens public health. To understand how {beta}-lactamases recognize their substrates, it would be helpful to know their binding energies. Unfortunately, these have been difficult to measure because {beta}-lactams form covalent adducts with {beta}-lactamases. This has complicated functional analyses and inhibitor design. To investigate the contribution to interaction energy of the key amide (R1) side chain of {beta}-lactam antibiotics, eight acylglycineboronic acids that bear the side chains of characteristic penicillins and cephalosporins, as well as four other analogs, were synthesized. These transition-state analogs form reversible adducts with serine {beta}-lactamases. Therefore, binding energies can be calculated directly from K{sub i} values. The K{sub i} values measured span four orders of magnitude against the Group I {beta}-lactamase AmpC and three orders of magnitude against the Group II {beta}-lactamase TEM-1. The acylglycineboronic acids have K{sub i} values as low as 20 nM against AmpC and as low as 390 nM against TEM-1. The inhibitors showed little activity against serine proteases, such as chymotrypsin. R1 side chains characteristic of {beta}-lactam inhibitors did not have better affinity for AmpC than did side chains characteristic of {beta}-lactam substrates. Two of the inhibitors reversed the resistance of pathogenic bacteria to {beta}-lactams in cell culture. Structures of two inhibitors in their complexes with AmpC were determined by X-ray crystallography to 1.90 {angstrom} and 1.75 {angstrom} resolution; these structures suggest interactions that are important to the affinity of the inhibitors. Acylglycineboronic acids allow us to begin to dissect interaction energies between {beta}-lactam side chains and {beta}-lactamases. Surprisingly

  1. Occurrence and characteristics of extended spectrum beta-lactamases-producing Enterobacteriaceae from foods of animal origin.

    PubMed

    Tekiner, İsmail Hakkı; Özpınar, Haydar

    2016-01-01

    Presence of extended spectrum beta-lactamases (ESBL) in bacteria is a growing health concern of global significance. The local, regional, national, and international epidemiological studies for extended spectrum beta-lactamases-producing Enterobacteriaceae and their encoding genes in foods are still incomplete. The objective of this study was to determine the occurrence of extended spectrum beta-lactamases-producing Enterobacteriaceae and the characteristics of their encoding genes from a total of 250 samples of various foods of animal-origin (100 raw chicken meat, 100 raw cow milk, and 50 raw cow milk cheese) sold in Turkey. Overall, 55 isolates were positive as extended spectrum beta-lactamases-producing Enterobacteriaceae. The most prevalent extended spectrum beta-lactamases-producing strain were identified as Escherichia coli (80%), followed by Enterobacter cloacae (9.1%), Citrobacter braakii (5.5%), Klebsiella pneumoniae (3.6%), and Citrobacter werkmanii (1.8%) by Vitek(®) MS. The simultaneous production of extended spectrum beta-lactamases and AmpC was detected in five isolates (9.1%) in E. coli (80%) and E. cloacae (20%). The frequency rates of blaTEM, blaCTX-M, and blaSHV were 96.4%, 53.7%, and 34.5%, respectively. The co-existence of bla-genes was observed in 82% of extended spectrum beta-lactamases producers with a distribution of blaTEM &blaCTX-M (52.7%), blaTEM &blaSHV (20%), blaTEM &blaCTX-M &blaSHV (12.7%), and blaSHV &blaCTX-M (1.8%). The most prevalent variant of blaCTX-M clusters was defined as blaCTX-M-1 (97.2%), followed by blaCTX-M-8 (2.8%). In summary, the analysed foods were found to be posing a health risk for Turkish consumers due to contamination by Enterobacteriaceae with a diversity of extended spectrum beta-lactamases encoding genes. PMID:26991276

  2. Occurrence and characteristics of extended spectrum beta-lactamases-producing Enterobacteriaceae from foods of animal origin.

    PubMed

    Tekiner, İsmail Hakkı; Özpınar, Haydar

    2016-01-01

    Presence of extended spectrum beta-lactamases (ESBL) in bacteria is a growing health concern of global significance. The local, regional, national, and international epidemiological studies for extended spectrum beta-lactamases-producing Enterobacteriaceae and their encoding genes in foods are still incomplete. The objective of this study was to determine the occurrence of extended spectrum beta-lactamases-producing Enterobacteriaceae and the characteristics of their encoding genes from a total of 250 samples of various foods of animal-origin (100 raw chicken meat, 100 raw cow milk, and 50 raw cow milk cheese) sold in Turkey. Overall, 55 isolates were positive as extended spectrum beta-lactamases-producing Enterobacteriaceae. The most prevalent extended spectrum beta-lactamases-producing strain were identified as Escherichia coli (80%), followed by Enterobacter cloacae (9.1%), Citrobacter braakii (5.5%), Klebsiella pneumoniae (3.6%), and Citrobacter werkmanii (1.8%) by Vitek(®) MS. The simultaneous production of extended spectrum beta-lactamases and AmpC was detected in five isolates (9.1%) in E. coli (80%) and E. cloacae (20%). The frequency rates of blaTEM, blaCTX-M, and blaSHV were 96.4%, 53.7%, and 34.5%, respectively. The co-existence of bla-genes was observed in 82% of extended spectrum beta-lactamases producers with a distribution of blaTEM &blaCTX-M (52.7%), blaTEM &blaSHV (20%), blaTEM &blaCTX-M &blaSHV (12.7%), and blaSHV &blaCTX-M (1.8%). The most prevalent variant of blaCTX-M clusters was defined as blaCTX-M-1 (97.2%), followed by blaCTX-M-8 (2.8%). In summary, the analysed foods were found to be posing a health risk for Turkish consumers due to contamination by Enterobacteriaceae with a diversity of extended spectrum beta-lactamases encoding genes.

  3. Widespread detection of PER-1-type extended-spectrum beta-lactamases among nosocomial Acinetobacter and Pseudomonas aeruginosa isolates in Turkey: a nationwide multicenter study.

    PubMed Central

    Vahaboglu, H; Oztürk, R; Aygün, G; Coşkunkan, F; Yaman, A; Kaygusuz, A; Leblebicioglu, H; Balik, I; Aydin, K; Otkun, M

    1997-01-01

    We studied the prevalence and molecular epidemiology of PER-1-type beta-lactamases among Acinetobacter, Klebsiella, and Pseudomonas aeruginosa strains isolated over a 3-month period in eight university hospitals from distinct regions of Turkey. A total of 72, 92, and 367 Acinetobacter, Klebsiella, and P. aeruginosa isolates were studied, respectively. The presence of blaPER was determined by the colony hybridization method and later confirmed by isoelectric focusing. We detected PER-1-type beta-lactamases in 46% (33/72) of Acinetobacter strains and in 11% (40/367) of P. aeruginosa strains but not in Klebsiella strains. PER-1-type enzyme producers were highly resistant to ceftazidime and gentamicin, intermediately resistant to amikacin, and susceptible or moderately susceptible to imipenem and meropenem. Among PER-1-type-beta-lactamase-positive isolates, five Acinetobacter isolates and six P. aeruginosa isolates from different hospitals were selected for ribosomal DNA fingerprinting with EcoRI and SalI. The EcoRI-digested DNAs were later hybridized with a digoxigenin-labelled PER-1 probe. The ribotypes and the lengths of blaPER-carrying fragments were identical in four Acinetobacter strains. A single isolate (Ac3) harbored a PER gene on a different fragment (approximately 4.2 kbp) than the others (approximately 3.4 kbp) and showed a clearly distinguishable ribotype. Ribotypes of P. aeruginosa strains obtained with EcoRI showed three patterns. Similarly, in Pseudomonas strains two different EcoRI fragments harbored blaPER (approximately 4.2 kbp in five isolates and 3.4 kbp in one isolate). PER-1-type beta-lactamases appear to be restricted to Turkey. However, their clonal diversity and high prevalence indicate a high spreading potential. PMID:9333059

  4. Replacement of serine 237 in class A beta-lactamase of Proteus vulgaris modifies its unique substrate specificity.

    PubMed

    Tamaki, M; Nukaga, M; Sawai, T

    1994-08-23

    The chromosomal beta-lactamase gene of Proteus vulgaris K1 was cloned and sequenced. The gene comprises 813 nucleotides and codes for the mature enzyme of 29,655 Da, comprising 271 amino acids. The K1 beta-lactamase showed 30-70% similarity, in the overall amino acid sequence, to class A beta-lactamases of Gram-negative bacteria. However, the K1 beta-lactamase differs from most class A enzymes in having a unique substrate specificity as a cephalosporinase, its spectrum extending to even oxyiminocephalosporins. To clarify the relationship between its unique substrate specificity and specific amino acid residues, alignment of the amino acid sequence of the K1 beta-lactamase with those of class A beta-lactamases was performed, and Ala104 and Ser237 were found to be candidates. Ala104 and Ser237 were replaced with glutamic acid and alanine, respectively, which are commonly found in other class A beta-lactamases. The substitution at position 104 had no effect on the enzyme activity or the substrate specificity. The amino acid replacement at position 237, however, reduced the kcat/Km value for an oxyiminocephalosporin (cefuroxime) to 17% of that in the case of the wild-type enzyme, whereas the mutant enzyme showed a higher kcat/Km value for benzylpenicillin, 3 times, than that of the wild-type enzyme. These results indicated that Ser237 is one of the residues responsible for the unique substrate specificity of the P. vulgaris beta-lactamase.

  5. Novel Computational Protocols for Functionally Classifying and Characterising Serine Beta-Lactamases

    PubMed Central

    Das, Sayoni; Dawson, Natalie L.; Dobrijevic, Dragana; Orengo, Christine

    2016-01-01

    Beta-lactamases represent the main bacterial mechanism of resistance to beta-lactam antibiotics and are a significant challenge to modern medicine. We have developed an automated classification and analysis protocol that exploits structure- and sequence-based approaches and which allows us to propose a grouping of serine beta-lactamases that more consistently captures and rationalizes the existing three classification schemes: Classes, (A, C and D, which vary in their implementation of the mechanism of action); Types (that largely reflect evolutionary distance measured by sequence similarity); and Variant groups (which largely correspond with the Bush-Jacoby clinical groups). Our analysis platform exploits a suite of in-house and public tools to identify Functional Determinants (FDs), i.e. residue sites, responsible for conferring different phenotypes between different classes, different types and different variants. We focused on Class A beta-lactamases, the most highly populated and clinically relevant class, to identify FDs implicated in the distinct phenotypes associated with different Class A Types and Variants. We show that our FunFHMMer method can separate the known beta-lactamase classes and identify those positions likely to be responsible for the different implementations of the mechanism of action in these enzymes. Two novel algorithms, ASSP and SSPA, allow detection of FD sites likely to contribute to the broadening of the substrate profiles. Using our approaches, we recognise 151 Class A types in UniProt. Finally, we used our beta-lactamase FunFams and ASSP profiles to detect 4 novel Class A types in microbiome samples. Our platforms have been validated by literature studies, in silico analysis and some targeted experimental verification. Although developed for the serine beta-lactamases they could be used to classify and analyse any diverse protein superfamily where sub-families have diverged over both long and short evolutionary timescales. PMID

  6. Inhibition of AmpC beta-lactamase through a destabilizing interaction in the active site

    SciTech Connect

    Trehan, I.; Beadle, B.M.; Shoichet, B.K.

    2010-03-08

    {beta}-Lactamases hydrolyze {beta}-lactam antibiotics, including penicillins and cephalosporins; these enzymes are the most widespread resistance mechanism to these drugs and pose a growing threat to public health. {beta}-Lactams that contain a bulky 6(7){alpha} substituent, such as imipenem and moxalactam, actually inhibit serine {beta}-lactamases and are widely used for this reason. Although mutant serine {beta}-lactamases have arisen that hydrolyze {beta}-lactamase resistant {beta}-lactams (e.g., ceftazidime) or avoid mechanism-based inhibitors (e.g., clavulanate), mutant serine {beta}-lactamases have not yet arisen in the clinic with imipenemase or moxalactamase activity. Structural and thermodynamic studies suggest that the 6(7){alpha} substituents of these inhibitors form destabilizing contacts within the covalent adduct with the conserved Asn152 in class C {beta}-lactamases (Asn132 in class A {beta}-lactamases). This unfavorable interaction may be crucial to inhibition. To test this destabilization hypothesis, we replaced Asn152 with Ala in the class C {beta}-lactamase AmpC from Escherichia coli and examined the mutant enzyme's thermodynamic stability in complex with imipenem and moxalactam. Consistent with the hypothesis, the Asn152 {yields} Ala substitution relieved 0.44 and 1.10 kcal/mol of strain introduced by imipenem and moxalactam, respectively, relative to the wild-type complexes. However, the kinetic efficiency of AmpC N152A was reduced by 6300-fold relative to that of the wild-type enzyme. To further investigate the inhibitor's interaction with the mutant enzyme, the X-ray crystal structure of moxalactam in complex with N152A was determined to a resolution of 1.83 {angstrom}. Moxalactam in the mutant complex is significantly displaced from its orientation in the wild-type complex; however, moxalactam does not adopt an orientation that would restore competence for hydrolysis. Although Asn152 forces {beta}-lactams with 6(7){alpha} substituents out of

  7. Relationships between beta-lactamase production and beta-lactam susceptibility of environmental strains of Yersinia kristensenii.

    PubMed

    Ahmedy, A M; Vidon, D J; Labia, R; Delmas, C L

    1989-01-01

    Strains of Yersinia kristensenii display high susceptibility to carbenicillin (MIC90 less than 8 micrograms/ml) in comparison with the majority of environmental strains of Yersinia closely related to Y. enterocolitica which are resistant to this antibiotic (MIC90 greater than 256 micrograms/ml). beta-lactamases of 39 strains of Y. kristensenii isolated from foods were analysed by isoelectric focusing and gel electrophoresis of ultrasonically disrupted uninduced cultures. beta-lactamase patterns showed the presence of only one out of three classes of enzymes of pI 6.7, 7.6 and 8.2, respectively, by strain. One beta-lactamase showed electrophoretic mobility different (EM + 2.0 cm/h) from that of all the other enzymes (EM + 1.6 cm/h) belonging to the class of pI 7.6. Induction by cefoxitin revealed the existence of inducible beta-lactamases in two out of eight selected strains. The substrate profile of these enzymes, which are probably chromosomally mediated, showed a predominant cephalosporinase activity. None of the type A and B beta-lactamases described by Cornelis and Abraham in Y. enterocolitica were found in any of the strains examined. The lack of beta-lactamase A (a penicillinase) accounts for the carbenicillin susceptibility of Y. kristensenii strains.

  8. Terminal truncations in amp C beta-lactamase from a clinical isolate of Pseudomonas aeruginosa.

    PubMed

    Walther-Rasmussen, J; Johnsen, A H; Høiby, N

    1999-07-01

    AmpC beta-lactamases from strains of Pseudomonas aeruginosa have previously been shown to be heterogeneous with respect to their isoelectric point (pI). In order to elucidate the origin of this heterogeneity enzymes were isolated from a clinical isolate of a multiresistant P. aeruginosa strain and biochemically characterized. The purification was accomplished in four chromatographic steps comprising dye-affinity, size-exclusion, hydrophobic interaction chromatography, and chromatofocusing; this resulted in five forms with pI values of 9.1, 8.7, 8.3, 8.2, and 7.6. When analysed by SDS/PAGE and agarose IEF each separated beta-lactamase appeared to be both size- and charge-homogeneous. The specific activities of the variants were very similar. MS of each isolated beta-lactamase form showed minor differences in molecular mass (range 40.0-40.8 kDa). MS of the beta-lactamase with a pI of 8.2 demonstrated the presence of two subforms. The N-terminal sequences of three of the beta-lactamases were identical to the published sequence [Lodge, J.M. , Minchin, S.D., Piddock, L.J.V. & Busby, J.W. (1990) Biochem. J. 272, 627-631], while two variants were truncated by two amino-acid residues, one of which was acidic. The previously published sequence contains an alanine as the ultimate residue, but two of the beta-lactamases showed a substitution of Ala371 for arginine, whereas in the remaining forms C-terminal truncations by one and three residues were found. Our results indicate that the P. aeruginosa strain does not harbour multiple copies of the ampC gene, but rather that the five beta-lactamase isoforms are products of a single structural gene. The combinations of the identified N- and/or C-terminal truncations explained the multiple pI values of the beta-lactamase isoforms. PMID:10406957

  9. Chromosomal integration of a cephalosporinase gene from Acinetobacter baumannii into Oligella urethralis as a source of acquired resistance to beta-lactams.

    PubMed

    Mammeri, Hedi; Poirel, Laurent; Mangeney, Nicole; Nordmann, Patrice

    2003-05-01

    Clinical Oligella urethralis isolate COH-1, which was uncommonly resistant to penicillins and narrow-spectrum cephalosporins, was recovered from a 55-year-old patient with a urinary tract infection. Shotgun cloning into Escherichia coli and expression experiments gave recombinant clones expressing either an AmpC beta-lactamase-type phenotype of resistance or a carbenicillin-hydrolyzing beta-lactamase-type phenotype of resistance. The AmpC beta-lactamase identified (ABA-1), which had a pI value of 8.2, had 98% amino acid identity with a chromosomally encoded cephalosporinase of Acinetobacter baumannii. A 820-bp insertion sequence element, ISOur1, belonging to the IS6 family of insertion sequence elements, was identified immediately upstream of bla(ABA-1), providing a -35 promoter sequence and likely giving rise to a hybrid promoter region. The carbenicillin-hydrolyzing beta-lactamase identified (CARB-8), which had a pI value of 6.4, differed from CARB-5 by two amino acid substitutions. Hybridization of CeuI fragment I-restricted DNA fragments of O. urethralis COH-1 with bla(ABA-1)-, bla(CARB-8)-, and 16S rRNA-specific probes indicated the chromosomal integration of the beta-lactamase genes. PCR and hybridization experiments failed to detect bla(CARB-8)- and bla(ABA-1)-like genes in three O. urethralis reference strains, indicating that the beta-lactamase genes identified were the source of acquired resistance in O. urethralis COH-1. This is one of the few examples of the interspecies transfer and the chromosomal integration of a gene encoding a naturally occurring beta-lactamase.

  10. Beta-lactamases of Mycobacterium tuberculosis and Mycobacterium kansasii.

    PubMed

    Segura, C; Salvadó, M

    1997-09-01

    Re-emergence of infectious diseases caused by mycobacteria as well as the emergence of multiresistant strains of Mycobacterium has promoted the research on the use of beta-lactames in the treatment of such diseases. Mycobacteria produce beta-lactamases: M. tuberculosis produces a wide-spectrum beta-lactamase whose behaviour mimicks those of Gram-negative bacteria. M. kansasii produces also beta-lactamase which can be inhibited by clavulanic acid. An overview on beta-lactamases from both species is reported.

  11. Exploring the potential reservoirs of non specific TEM beta lactamase (blaTEM) gene in the Indo-Gangetic region: A risk assessment approach to predict health hazards.

    PubMed

    Singh, Gulshan; Vajpayee, Poornima; Rani, Neetika; Amoah, Isaac Dennis; Stenström, Thor Axel; Shanker, Rishi

    2016-08-15

    The emergence of antimicrobial resistant bacteria is an important public health and environmental contamination issue. Antimicrobials of β-lactam group accounts for approximately two thirds, by weight, of all antimicrobials administered to humans due to high clinical efficacy and low toxicity. This study explores β-lactam resistance determinant gene (blaTEM) as emerging contaminant in Indo-Gangetic region using qPCR in molecular beacon format. Quantitative Microbial Risk Assessment (QMRA) approach was adopted to predict risk to human health associated with consumption/exposure of surface water, potable water and street foods contaminated with bacteria having blaTEM gene. It was observed that surface water and sediments of the river Ganga and Gomti showed high numbers of blaTEM gene copies and varied significantly (p<0.05) among the sampling locations. The potable water collected from drinking water facility and clinical settings exhibit significant number of blaTEM gene copies (13±0.44-10200±316 gene copies/100mL). It was observed that E.crassipes among aquatic flora encountered in both the rivers had high load of blaTEM gene copies. The information on prevalence of environmental reservoirs of blaTEM gene containing bacteria in Indo-Gangetic region and risk associated will be useful for formulating strategies to protect public from menace of clinical risks linked with antimicrobial resistant bacteria. PMID:27111425

  12. Exploring the potential reservoirs of non specific TEM beta lactamase (blaTEM) gene in the Indo-Gangetic region: A risk assessment approach to predict health hazards.

    PubMed

    Singh, Gulshan; Vajpayee, Poornima; Rani, Neetika; Amoah, Isaac Dennis; Stenström, Thor Axel; Shanker, Rishi

    2016-08-15

    The emergence of antimicrobial resistant bacteria is an important public health and environmental contamination issue. Antimicrobials of β-lactam group accounts for approximately two thirds, by weight, of all antimicrobials administered to humans due to high clinical efficacy and low toxicity. This study explores β-lactam resistance determinant gene (blaTEM) as emerging contaminant in Indo-Gangetic region using qPCR in molecular beacon format. Quantitative Microbial Risk Assessment (QMRA) approach was adopted to predict risk to human health associated with consumption/exposure of surface water, potable water and street foods contaminated with bacteria having blaTEM gene. It was observed that surface water and sediments of the river Ganga and Gomti showed high numbers of blaTEM gene copies and varied significantly (p<0.05) among the sampling locations. The potable water collected from drinking water facility and clinical settings exhibit significant number of blaTEM gene copies (13±0.44-10200±316 gene copies/100mL). It was observed that E.crassipes among aquatic flora encountered in both the rivers had high load of blaTEM gene copies. The information on prevalence of environmental reservoirs of blaTEM gene containing bacteria in Indo-Gangetic region and risk associated will be useful for formulating strategies to protect public from menace of clinical risks linked with antimicrobial resistant bacteria.

  13. Regulatory components in Citrobacter freundii ampC beta-lactamase induction.

    PubMed

    Lindberg, F; Westman, L; Normark, S

    1985-07-01

    Citrobacter freundii encodes an inducible chromosomal beta-lactamase similar to the constitutively expressed ampC beta-lactamase of Escherichia coli. In the latter species the ampC gene is located next to the fumarate reductase (frd) operon, whereas in C. freundii the ampC gene is known to be separated from frd by 1100 base pairs. This intervening DNA segment carries a gene, ampR, coding for a 31-kilodalton polypeptide. The cloned C. freundii OS60 ampC gene is inducible by beta-lactam antibiotics in E. coli, but only in the presence of an intact ampR gene. In the absence of inducer the AmpR protein represses C. freundii ampC synthesis 2.5-fold. Addition of beta-lactams induced expression from the cloned ampC beta-lactamase gene 11-fold. Thus, the AmpR protein has a positive effect on ampC expression in the presence of inducing beta-lactams. Two spontaneous mutants of C. freundii were isolated that constitutively overproduce the ampC beta-lactamase. The mutations in both these strains occurred outside the frd-amp region, suggesting that there is at least one additional component in the regulatory system. With the cloned C. freundii ampC gene in E. coli, mutants with the same phenotype could be obtained. These mutations were located on the E. coli chromosome. The constitutive beta-lactamase overproduction in these mutants requires the presence of an intact ampR gene.

  14. Detection of cfxA2, cfxA3, and cfxA6 genes in beta-lactamase producing oral anaerobes.

    PubMed

    Binta, Buhle; Patel, Mrudula

    2016-04-01

    Purpose The aim of this study was to identify β-lactamase-producing oral anaerobic bacteria and screen them for the presence of cfxA and BlaTEM genes that are responsible for β-lactamase production and resistance to β-lactam antibiotics. Material and Methods Periodontal pocket debris samples were collected from 48 patients with chronic periodontitis and anaerobically cultured on blood agar plates with and without β-lactam antibiotics. Presumptive β-lactamase-producing isolates were evaluated for definite β-lactamase production using the nitrocefin slide method and identified using the API Rapid 32A system. Antimicrobial susceptibility was performed using disc diffusion and microbroth dilution tests as described by CLSI Methods. Isolates were screened for the presence of the β-lactamase-TEM (BlaTEM) and β-lactamase-cfxA genes using Polymerase Chain Reaction (PCR). Amplified PCR products were sequenced and the cfxA gene was characterized using Genbank databases. Results Seventy five percent of patients carried two species of β-lactamase-producing anaerobic bacteria that comprised 9.4% of the total number of cultivable bacteria. Fifty one percent of β-lactamase-producing strains mainly Prevotella, Porphyromonas, and Bacteroides carried the cfxA gene, whereas none of them carried blaTEM. Further characterization of the cfxA gene showed that 76.7% of these strains carried the cfxA2 gene, 14% carried cfxA3, and 9.3% carried cfxA6. The cfxA6 gene was present in three Prevotella spp. and in one Porphyromonas spp. Strains containing cfxA genes (56%) were resistant to the β-lactam antibiotics. Conclusion This study indicates that there is a high prevalence of the cfxA gene in β-lactamase-producing anaerobic oral bacteria, which may lead to drug resistance and treatment failure.

  15. Eradication of methicillin-resistant Staphylococcus aureus and of Enterobacteriaceae expressing extended-spectrum beta-lactamases on a model pig farm.

    PubMed

    Schmithausen, Ricarda Maria; Kellner, Sophia Ricarda; Schulze-Geisthoevel, Sophia Veronika; Hack, Sylvia; Engelhart, Steffen; Bodenstein, Isabel; Al-Sabti, Nahed; Reif, Marion; Fimmers, Rolf; Körber-Irrgang, Barbara; Harlizius, Jürgen; Hoerauf, Achim; Exner, Martin; Bierbaum, Gabriele; Petersen, Brigitte; Bekeredjian-Ding, Isabelle

    2015-11-01

    Colonization of livestock with bacteria resistant to antibiotics is considered a risk for the entry of drug-resistant pathogens into the food chain. For this reason, there is a need for novel concepts to address the eradication of drug-resistant commensals on farms. In the present report, we evaluated the decontamination measures taken on a farm contaminated with methicillin-resistant Staphylococcus aureus (MRSA) and Enterobacteriaceae expressing extended-spectrum β-lactamases (ESBL-E). The decontamination process preceded the conversion from piglet breeding to gilt production. Microbiological surveillance showed that the decontamination measures eliminated the MRSA and ESBL-E strains that were detected on the farm before the complete removal of pigs, cleaning and disinfection of the stable, and construction of an additional stable meeting high-quality standards. After pig production was restarted, ESBL-E remained undetectable over 12 months, but MRSA was recovered from pigs and the environment within the first 2 days. However, spa (Staphylococcus aureus protein A gene) typing revealed acquisition of an MRSA strain (type t034) that had not been detected before decontamination. Interestingly, we observed that a farmworker who had been colonized with the prior MRSA strain (t2011) acquired the new strain (t034) after 2 months. In summary, this report demonstrates that decontamination protocols similar to those used here can lead to successful elimination of contaminating MRSA and ESBL-E in pigs and the stable environment. Nevertheless, decontamination protocols do not prevent the acquisition of new MRSA strains.

  16. Eradication of methicillin-resistant Staphylococcus aureus and of Enterobacteriaceae expressing extended-spectrum beta-lactamases on a model pig farm.

    PubMed

    Schmithausen, Ricarda Maria; Kellner, Sophia Ricarda; Schulze-Geisthoevel, Sophia Veronika; Hack, Sylvia; Engelhart, Steffen; Bodenstein, Isabel; Al-Sabti, Nahed; Reif, Marion; Fimmers, Rolf; Körber-Irrgang, Barbara; Harlizius, Jürgen; Hoerauf, Achim; Exner, Martin; Bierbaum, Gabriele; Petersen, Brigitte; Bekeredjian-Ding, Isabelle

    2015-11-01

    Colonization of livestock with bacteria resistant to antibiotics is considered a risk for the entry of drug-resistant pathogens into the food chain. For this reason, there is a need for novel concepts to address the eradication of drug-resistant commensals on farms. In the present report, we evaluated the decontamination measures taken on a farm contaminated with methicillin-resistant Staphylococcus aureus (MRSA) and Enterobacteriaceae expressing extended-spectrum β-lactamases (ESBL-E). The decontamination process preceded the conversion from piglet breeding to gilt production. Microbiological surveillance showed that the decontamination measures eliminated the MRSA and ESBL-E strains that were detected on the farm before the complete removal of pigs, cleaning and disinfection of the stable, and construction of an additional stable meeting high-quality standards. After pig production was restarted, ESBL-E remained undetectable over 12 months, but MRSA was recovered from pigs and the environment within the first 2 days. However, spa (Staphylococcus aureus protein A gene) typing revealed acquisition of an MRSA strain (type t034) that had not been detected before decontamination. Interestingly, we observed that a farmworker who had been colonized with the prior MRSA strain (t2011) acquired the new strain (t034) after 2 months. In summary, this report demonstrates that decontamination protocols similar to those used here can lead to successful elimination of contaminating MRSA and ESBL-E in pigs and the stable environment. Nevertheless, decontamination protocols do not prevent the acquisition of new MRSA strains. PMID:26341200

  17. Eradication of Methicillin-Resistant Staphylococcus aureus and of Enterobacteriaceae Expressing Extended-Spectrum Beta-Lactamases on a Model Pig Farm

    PubMed Central

    Kellner, Sophia Ricarda; Schulze-Geisthoevel, Sophia Veronika; Hack, Sylvia; Engelhart, Steffen; Bodenstein, Isabel; Al-Sabti, Nahed; Reif, Marion; Fimmers, Rolf; Körber-Irrgang, Barbara; Harlizius, Jürgen; Hoerauf, Achim; Exner, Martin; Bierbaum, Gabriele; Petersen, Brigitte

    2015-01-01

    Colonization of livestock with bacteria resistant to antibiotics is considered a risk for the entry of drug-resistant pathogens into the food chain. For this reason, there is a need for novel concepts to address the eradication of drug-resistant commensals on farms. In the present report, we evaluated the decontamination measures taken on a farm contaminated with methicillin-resistant Staphylococcus aureus (MRSA) and Enterobacteriaceae expressing extended-spectrum β-lactamases (ESBL-E). The decontamination process preceded the conversion from piglet breeding to gilt production. Microbiological surveillance showed that the decontamination measures eliminated the MRSA and ESBL-E strains that were detected on the farm before the complete removal of pigs, cleaning and disinfection of the stable, and construction of an additional stable meeting high-quality standards. After pig production was restarted, ESBL-E remained undetectable over 12 months, but MRSA was recovered from pigs and the environment within the first 2 days. However, spa (Staphylococcus aureus protein A gene) typing revealed acquisition of an MRSA strain (type t034) that had not been detected before decontamination. Interestingly, we observed that a farmworker who had been colonized with the prior MRSA strain (t2011) acquired the new strain (t034) after 2 months. In summary, this report demonstrates that decontamination protocols similar to those used here can lead to successful elimination of contaminating MRSA and ESBL-E in pigs and the stable environment. Nevertheless, decontamination protocols do not prevent the acquisition of new MRSA strains. PMID:26341200

  18. Outbreak of Serratia marcescens Coproducing ArmA and CTX-M-15 Mediated High Levels of Resistance to Aminoglycoside and Extended-Spectrum Beta-Lactamases, Algeria.

    PubMed

    Batah, Rima; Loucif, Lotfi; Olaitan, Abiola Olumuyiwa; Boutefnouchet, Nafissa; Allag, Hamoudi; Rolain, Jean-Marc

    2015-08-01

    Serratia marcescens is one of the most important pathogens responsible for nosocomial infections worldwide. Here, we have investigated the molecular support of antibiotic resistance and genetic relationships in a series of 54 S. marcescens clinical isolates collected from Eastern Algeria between December 2011 and July 2013. The 54 isolates were identified by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (MS). Antibiotic susceptibility testing was performed by disc diffusion and E-test methods. Antibiotic resistance genes were detected by polymerase chain reaction (PCR). The genetic transfer of antibiotic resistance was performed by conjugation using azide-resistant Escherichia coli J53 as the recipient strain, and plasmid analysis was done by PCR-based replicon typing. The relatedness of our isolates was determined by phylogenetic analysis based on partial sequences of four protein-encoding genes (gyrB, rpoB, infB, and atpD) and then compared to MALDI-TOF MS clustering. Thirty-five out of 54 isolates yielded an extended-spectrum β-lactamase (ESBL) phenotype and carried bla(CTX-M-15) (n=32), bla(TEM-1) (n=26), bla(TEM-71) (n=1), bla(SHV-1a) (n=1), and bla(PER-2) (n=12). Among these isolates, we identified a cluster of 15 isolates from a urology unit that coharbored ESBL and the 16S rRNA methyltransferase armA. Conjugation was successful for five selected strains, demonstrating the transferability of a conjugative plasmid of incompatibility group incL/M type. Phylogenetic analysis along with MALDI-TOF clustering likely suggested an outbreak of such isolates in the urology unit. In this study, we report for the first time the co-occurrence of armA methyltransferase with ESBL in S. marcescens clinical isolates in Eastern Algeria.

  19. Outbreak of infection caused by Enterobacter cloacae producing the novel VEB-3 beta-lactamase in China.

    PubMed

    Jiang, Xiaofei; Ni, Yuxing; Jiang, Yanqun; Yuan, Feiyi; Han, Lizhong; Li, Ming; Liu, Hong; Yang, Li; Lu, Yuan

    2005-02-01

    Over a 4-month period from November 2002 to February 2003, 27 ceftazidime-resistant or cefotaxime-resistant nonrepetitive Enterobacter cloacae isolates were collected from 27 patients hospitalized at HuaShan Hospital, Shanghai, People's Republic of China. The Etest did not detect extended-spectrum beta-lactamases (ESBLs) in those 27 isolates; however, screening by the NCCLS ESBL disk test and confirmatory tests detected ESBLs in 4 of 27 isolates and PCR detected ESBLs in 23 of 27 isolates. The majority of ESBL producers exhibited the same repetitive extragenic palindromic PCR pattern but harbored different ESBL genes. CTX-M-3 was the most prevalent ESBL in our study. Interestingly, 12 clonally related E. cloacae isolates possessed a novel bla(VEB)-type beta-lactamase, bla(VEB-3). Bla(VEB-3) was encoded by the chromosome and was located in an integron. Nine of the 12 isolates harbored both the bla(VEB-3) and the bla(CTX-M-3)-like ESBLs. This is the first report of a VEB-1-like ESBL in China and the first report of the simultaneous presence of VEB-1 and CTX-M-3-like ESBLs in an isolate.

  20. A Multicenter Study of Beta-Lactamase Resistant Escherichia coli and Klebsiella pneumoniae Reveals High Level Chromosome Mediated Extended Spectrum β Lactamase Resistance in Ogun State, Nigeria

    PubMed Central

    Adeyankinnu, Folasoge A.; Motayo, Babatunde O.; Akinduti, Akinniyi; Akinbo, John; Ogiogwa, Joseph I.; Aboderin, Bukola W.; Agunlejika, R. A.

    2014-01-01

    As a result of the ever increasing problem of multiresistant bacteria, we instituted a surveillance program with the aim of identifying the basic molecular properties of ESBL in our environment. About 197 isolates of Escherichia coli and Klebsiella pneumoniae were selected and tested for ESBL production and antimicrobial susceptibility. Plasmid profiles were determined and curing ability was tested. ESBL prevalence was 26.4% for all isolates tested, with E. coli having a greater proportion. There was absolute resistance to ampicilin, tetracycline, and co-trimaxole among tested isolates. There was above average susceptibility to the 2nd and 3rd generation cephalosporins. Plasmid profiles of tested isolates ranged from 9 kbp to 26 kbp with average of 14.99 ± 2.3 kbp for E. coli and 20.98 ± 1.8 kbp K. pneumoniae, 9.6% of ESBL positive E. coli plasmids were cured, while 3.9% of K. pneumoniae plasmids were cured after treatment. The present study shows an upsurge in ESBL acquisition by gram negative bacteria and evidence of cocirculation of varying subtypes of ESBL with both plasmid transmissible and chromosome encoded subtypes. This calls for universal surveillance and more effort towards molecular epidemiology of this public health treatment. PMID:24790598

  1. Ureidopenicillins and beta-lactam/beta-lactamase inhibitor combinations.

    PubMed

    Bush, L M; Johnson, C C

    2000-06-01

    Although research and development of new penicillins have declined, penicillins continue to be essential antibiotics for the treatment and prophylaxis of infectious diseases. The most recent additions are the ureidopenicillins and beta-lactam/beta-lactamase inhibitor combinations. This article reviews the spectrum of activity, toxicity, pharmacokinetics, and clinical uses of the ureidopenicillins, and the beta-lactam/beta-lactamase inhibitor combination agents.

  2. [beta]-Lactamases in the Biochemistry and Molecular Biology Laboratory

    ERIC Educational Resources Information Center

    Amador, Paula; Prudencio, Cristina; Vieira, Monica; Ferraz, Ricardo; Fonte, Rosalia; Silva, Nuno; Coelho, Pedro; Fernandes, Ruben

    2009-01-01

    [beta]-lactamases are hydrolytic enzymes that inactivate the [beta]-lactam ring of antibiotics such as penicillins and cephalosporins. The major diversity of studies carried out until now have mainly focused on the characterization of [beta]-lactamases recovered among clinical isolates of Gram-positive staphylococci and Gram-negative…

  3. Properties of novel beta-lactamase produced by Bacteroides fragilis.

    PubMed Central

    Yotsuji, A; Minami, S; Inoue, M; Mitsuhashi, S

    1983-01-01

    Bacteroides fragilis strains were isolated from clinical specimens. B. fragilis G-237 was highly resistant to beta-lactam antibiotics due to beta-lactamase production. The purified enzyme from this strain gave a single protein band on polyacrylamide gel electrophoresis. The isoelectric point was 4.8, and the molecular weight was estimated to be 26,000 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The enzyme activity was inhibited by p-chloromercuribenzoate and iodine but not by clavulanic acid or sulbactam. The purified enzyme showed a unique substrate profile by hydrolyzing at a high rate most of the cephalosporins, including cephamycin derivatives, penicillins, and imipenem (formerly imipemide, N-formimidoyl thienamycin, or MK 0787). PMID:6607033

  4. In vitro and in vivo evaluation of pectin beads for the colon delivery of beta-lactamases.

    PubMed

    Bourgeois, Sandrine; Laham, Antoun; Besnard, Madeleine; Andremont, Antoine; Fattal, Elias

    2005-06-01

    The aim of the present study was to provide a "proof of concept" of colon delivery of beta-lactamases by pectin beads aiming to degrade residual beta-lactam antibiotics, in order to prevent the emergence of resistant bacterial strains. Pectin beads were prepared according to ionotropic gelation method using CaCl2 as a gelling agent. Particles were then washed and soaked in polyethylenimine (PEI). Coating beads with PEI considerably improved their stability in simulated intestinal medium. In vitro studies showed that beta-lactamases were released from pectin beads in colonic medium due to the action of pectinolytic enzymes. When ampicillin was added to this medium, the release of beta-lactamases induced, as expected, the antibiotic inactivation. Finally, after oral administration of loaded-beads to CD1 mice, beta-lactamases were retrieved in high concentrations in faeces. Observation by SEM of beads extracted from mice intestinal tracts concluded the core degradation of beads without any modification of the PEI coating layer. This study demonstrates that a multiparticulate system with suitable characteristics for site-specific colonic delivery can be prepared. This system could be used to target beta-lactamases to the colon in order to hydrolyse antibiotic residues during treatment and prevent their impact on colonic microflora.

  5. Successive emergence of extended-spectrum beta-lactamase-producing and carbapenemase-producing Enterobacter aerogenes isolates in a university hospital.

    PubMed

    Biendo, M; Canarelli, B; Thomas, D; Rousseau, F; Hamdad, F; Adjide, C; Laurans, G; Eb, F

    2008-03-01

    Sixty-two clinical isolates of Enterobacter aerogenes resistant to expanded-spectrum cephalosporins were collected between July 2003 and May 2005. Among these isolates, 23 (37.1%) were imipenem (IPM) susceptible, and 39 (62.9%) were IPM insusceptible, of which 89.7% (35/39) were resistant and 10.3% (4/39) were intermediate. Isolate genotypes were compared by pulsed-field gel electrophoresis. Of 62 isolates, 48 belonged to epidemic pulsotype A (77.4%). This pulsotype included 37.5% and 58.4% of beta-lactam phenotypes b and a, respectively. Nine isolates (14.5%) belonged to pulsotype E, which included 22.3% and 77.7% of phenotypes b and a, respectively. The beta-lactamases with pIs of 5.4, 6.5, 8.2, and 8.2 corresponded to extended-spectrum beta-lactamases (ESBLs) TEM-20, TEM-24, SHV-5, and SHV-12, respectively. Of 39 IPM-insusceptible E. aerogenes isolates, 26 (66.6%) were determined to be metallo-beta-lactamase producers, by using a phenotypic method. Of these isolates, 24 harbored a bla(IMP-1) gene encoding a protein with a pI of >9.5, and two carried the bla(VIM-2) gene encoding a protein with a pI of 5.3, corresponding to beta-lactamases IMP-1 and VIM-2, respectively. The remaining 13 (33.4%) isolates were negative for the bla(IMP-1) and bla(VIM-2) genes but showed an alteration of their outer membrane proteins (OMPs). Ten of these isolates produced the two possible OMPs (32 and 42 kDa), with IPM MICs between 8 and 32 microg/ml, and three others produced only a 32-kDa OMP with IPM MICs >32 microg/ml. This work demonstrates that, in addition to resistance to expanded-spectrum cephalosporins, IPM resistance can occur in ESBL-producing E. aerogenes isolates by carbapenemase production or by the loss of porin in the outer membrane.

  6. First Description of the Extended Spectrum-Beta-Lactamase Gene blaCTX-M-109 in Salmonella Grumpensis Strains Isolated from Neonatal Nosocomial Infections in Dakar, Senegal

    PubMed Central

    Seck, Abdoulaye; Dia, Mouhamadou Lamine; Timbiné, Lassina Gadi; Niang, Aïssatou Ameth; Ndiaye, El Hadji Momar; Sonko, Mouhamadou Abdoulaye; Wane, Abdoul Aziz; Bercion, Raymond; Ndiaye, Ousmane; Cissé, Moussa Fafa; Gassama-Sow, Amy

    2016-01-01

    Nosocomial infections are very common in African hospitals, particularly in neonatal units. These infections are most often caused by bacteria such as Escherichia coli, Klebsiella spp and Staphylococcus spp. Salmonella strains are rarely involved in nosocomial infections. Here, we report the first description of S. Grumpensis in neonatal infections in Senegal. Seventeen Salmonella strains were isolated from hospitalized infants’ stool samples. The following resistance phenotype was described in strains: AMXRTICRCFR FOXRCFXRCTXRCAZRIMPSATMRNARNORRCIPRTMRGMRTERSXTR. All isolates were susceptible to imipenem, 15 out of 17 produced an extended spectrum ß-lactamase (ESBL). blaOXA-1, blaSHV-1, blaTEM-1, blaCTX-M1 genes were detected in strains 8, 13, 5 and 8, respectively. blaCTX-M1 sequencing revealed the presence of blaCTX-M-109. Thirteen of the 17 Salmonella Grumpensis strains were analyzed by PFGE. These 13 isolates belonged to a single pulsotype and were genotypically identical. This is the first report of neonatal S. Grumpensis infections in Senegal, and the first report of blaCTX-M-109 in the genus Salmonella. PMID:27355480

  7. First Description of the Extended Spectrum-Beta-Lactamase Gene blaCTX-M-109 in Salmonella Grumpensis Strains Isolated from Neonatal Nosocomial Infections in Dakar, Senegal.

    PubMed

    Diop, Amadou; Sambe-Ba, Bissoume; Seck, Abdoulaye; Dia, Mouhamadou Lamine; Timbiné, Lassina Gadi; Niang, Aïssatou Ameth; Ndiaye, El Hadji Momar; Sonko, Mouhamadou Abdoulaye; Wane, Abdoul Aziz; Bercion, Raymond; Ndiaye, Ousmane; Cissé, Moussa Fafa; Gassama-Sow, Amy

    2016-01-01

    Nosocomial infections are very common in African hospitals, particularly in neonatal units. These infections are most often caused by bacteria such as Escherichia coli, Klebsiella spp and Staphylococcus spp. Salmonella strains are rarely involved in nosocomial infections. Here, we report the first description of S. Grumpensis in neonatal infections in Senegal. Seventeen Salmonella strains were isolated from hospitalized infants' stool samples. The following resistance phenotype was described in strains: AMXRTICRCFR FOXRCFXRCTXRCAZRIMPSATMRNARNORRCIPRTMRGMRTERSXTR. All isolates were susceptible to imipenem, 15 out of 17 produced an extended spectrum ß-lactamase (ESBL). blaOXA-1, blaSHV-1, blaTEM-1, blaCTX-M1 genes were detected in strains 8, 13, 5 and 8, respectively. blaCTX-M1 sequencing revealed the presence of blaCTX-M-109. Thirteen of the 17 Salmonella Grumpensis strains were analyzed by PFGE. These 13 isolates belonged to a single pulsotype and were genotypically identical. This is the first report of neonatal S. Grumpensis infections in Senegal, and the first report of blaCTX-M-109 in the genus Salmonella. PMID:27355480

  8. Detection of KPC-2 in a Clinical Isolate of Proteus mirabilis and First Reported Description of Carbapenemase Resistance Caused by a KPC Beta-Lactamase in P. mirabilis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An isolate of Proteus mirabilis recovered from bacterial cultures was shown to be resistant to imipenem, meropenem, and ertapenem by disk diffusion susceptibility testing. Amplification of whole cell and/or plasmid DNA recovered from the isolate using primers specific for the blaKPC carbapenemase g...

  9. Outbreak of extended-spectrum beta-lactamase VEB-1-producing isolates of Acinetobacter baumannii in a French hospital.

    PubMed

    Poirel, Laurent; Menuteau, Olivier; Agoli, Nathalie; Cattoen, Christian; Nordmann, Patrice

    2003-08-01

    Twelve clonally related and multidrug-resistant Acinetobacter baumannii isolates were recovered during a 4-month period from 12 patients hospitalized at the Valenciennes Hospital in France. Antibiograms determined by the double-disk diffusion technique on cloxacillin-containing plates detected a clavulanic acid-inhibited extended-spectrum beta-lactamase (ESBL). PCR and sequencing identified the gene encoding the Ambler class A ESBL VEB-1. This gene was located on the chromosome and was part of a class 1 integron identical to that previously identified in Pseudomonas aeruginosa isolates from Thailand. Additionally, seven clonally related bla(VEB-1)-positive A. baumannii strains were identified in the immediate environment of the hospitalized patients. This is the first report of the ESBL VEB-1 in Acinetobacter spp. and the first description of VEB-1-producing strains as a source of an outbreak occurring outside Southeast Asia. This report underlines the difficulty of the identification of ESBLs in A. baumannii.

  10. Prevalence and Clonal Dissemination of Metallo-Beta-Lactamase-Producing Pseudomonas aeruginosa in Kermanshah

    PubMed Central

    Akya, Alisha; Salimi, Afsaneh; Nomanpour, Bizhan; Ahmadi, Kamal

    2015-01-01

    Background: Pseudomonas aeruginosa is an opportunistic pathogen associated with nosocomial infections. The emergence and dissemination of metallo-beta-lactamases (MBLs) has contributed to the high rate of resistance among P. aeruginosa isolates. Objectives: The purpose of this study was to describe the prevalence and the clonal dissemination of MBL- producing P. aeruginosa isolates collected from major hospitals in Kermanshah. Materials and Methods: Antibiotic susceptibility testing was performed using the minimal inhibitory concentrations. The MBLs were investigated using the Double-Disk Synergy Test (DDST) and Polymerase Chain Reaction. Molecular typing was performed by Pulsed-Field Gel Electrophoresis (PFGE). Results: Of the 60 P. aeruginosa isolates included in this study, 30 (50%) were resistant to Gentamicin, 38 (63.3%) to Piperacillin, 42 (70%) to Ceftazidime, and 45 (75%) to Cefepime. Twenty-nine (48.3%) isolates were MBL producers in the DDST test. Five (8.3%) isolates were positive for the VIM gene. PFGE analysis among the MBL producers revealed 12 distinct clonal patterns. Conclusions: The inter- and intra-hospital dissemination of resistant clones is a matter of concern and is an indicator of the level of the improvement and surveillance of standard hygiene, particularly disinfection and hand washing before and after contact with patients. Given the emergence of MBL-producing strains, surveillance has become an important procedure to control the transmission of resistant strains. PMID:26421137

  11. Molecular epidemiology and antimicrobial susceptibility of extended- and broad-spectrum beta-lactamase-producing Klebsiella pneumoniae isolated in Portugal.

    PubMed

    Mendonça, Nuno; Ferreira, Eugénia; Louro, Deolinda; Caniça, Manuela

    2009-07-01

    All 187 Klebsiella pneumoniae isolated over six consecutive months of 1999 in 17 Portuguese health institutions were studied: 89% were resistant to ampicillin, 31% to trimethoprim/sulfamethoxazole, 17% to aminoglycosides and 3% to fluoroquinolones; 16% were multidrug-resistant and 14% expressed an extended-spectrum beta-lactamase (ESBL) phenotype confirmed by genotyping. Molecular methods identified: 11 isolates possessing bla(ESBL-SHV) genes (bla(SHV-2A), bla(SHV-5), bla(SHV-12) and bla(SHV-55)), 9 isolates with bla(ESBL-TEM) (bla(TEM-3), bla(TEM-10) and bla(TEM-24)) and 7 isolates with bla(GES-1), encoding ESBL enzymes; and 160 isolates with bla(SHV-1) and bla(SHV-type) encoding non-ESBL enzymes. Overall, 15 new beta-lactamases were detected: SHV-60 to SHV-62, SHV-71 and SHV-73 to SHV-83. The genetic relatedness of 108 isolates was studied by pulsed-field gel electrophoresis (PFGE) analysis. The isolates were diverse and 18 clusters were defined, the largest including 12 isolates of different specimens, 6 of which expressed GES-1 enzymes. Twenty additional strains isolated during a second period (March-November 2006) in three of the participating hospitals contained ESBL-encoding genes, whereas none of the isolates in the same hospitals in 1999 carried such genes: bla(SHV-5), bla(SHV-12), bla(TEM-10), bla(TEM-52), bla(CTX-M-15), bla(CTX-M-32) and bla(CTX-M-61) (first described in the country). In this period, three new enzymes were detected: SHV-106 to SHV-108. We provide evidence that the genotypes of K. pneumoniae isolates is changing towards the emergence of ESBL enzymes. PMID:19272757

  12. Properties of a class C beta-lactamase from Serratia marcescens.

    PubMed Central

    Joris, B; De Meester, F; Galleni, M; Masson, S; Dusart, J; Frère, J M; Van Beeumen, J; Bush, K; Sykes, R

    1986-01-01

    A beta-lactamase produced by a penicillin-resistant strain of Serratia marcescens was isolated and purified. The kcat. value for benzylpenicillin was about 5% of that observed for the best cephalosporin substrates. However, the low Km of the penam resulted in a high catalytic efficiency (kcat./Km) and the classification of the enzyme as a cephalosporinase might not be completely justified. It also exhibited a low but measurable activity against cefotaxime, cefuroxime, cefoxitin and moxalactam. Substrate-induced inactivation was observed both with a very good (cephalothin) or a very bad (moxalactam) substrate. The active site was labelled by beta-iodopenicillanate. Trypsin digestion produced a 19-residue active-site peptide whose sequence clearly allowed the classification of the enzyme as a class C beta-lactamase. PMID:3548700

  13. Comparative possession of Shiga toxin, intimin, enterohaemolysin and major extended spectrum beta lactamase (ESBL) genes in Escherichia coli isolated from backyard and farmed poultry.

    PubMed

    Samanta, I; Joardar, S N; Das, P K; Sar, T K

    2015-01-01

    The present work was conducted to compare the occurrence of Escherichia coli possessing virulence and ESBL genes in backyard and farmed poultry. Three hundred and sixty samples from the poultry kept in backyard system and 120 samples from the farmed birds were collected from West Bengal, India. Among the E. coli isolates of backyard poultry (O2, O10, O25, O55, O60, O106, UT), none of them possessed any of the Shiga toxin genes and eight E. coli isolates (8/272; 2.9%) harboured eaeA gene alone. Whereas among the E. coli isolated from the farmed poultry (O17, O20, O22, O102, O114, O119, rough, UT), four isolates (4/78, 5.1%) harboured stx 1/stx 2 gene and 11 isolates (11/78, 14.1%) possessed eaeA gene. None of the E. coli isolates from the backyard poultry harboured any studied ESBL gene. Whereas 29.4% of E. coli isolates from the farmed poultry were found to possess the ESBL genes.

  14. Comparative possession of Shiga toxin, intimin, enterohaemolysin and major extended spectrum beta lactamase (ESBL) genes in Escherichia coli isolated from backyard and farmed poultry

    PubMed Central

    Samanta, I.; Joardar, S. N.; Das, P. K.; Sar, T. K.

    2015-01-01

    The present work was conducted to compare the occurrence of Escherichia coli possessing virulence and ESBL genes in backyard and farmed poultry. Three hundred and sixty samples from the poultry kept in backyard system and 120 samples from the farmed birds were collected from West Bengal, India. Among the E. coli isolates of backyard poultry (O2, O10, O25, O55, O60, O106, UT), none of them possessed any of the Shiga toxin genes and eight E. coli isolates (8/272; 2.9%) harboured eaeA gene alone. Whereas among the E. coli isolated from the farmed poultry (O17, O20, O22, O102, O114, O119, rough, UT), four isolates (4/78, 5.1%) harboured stx1/stx2 gene and 11 isolates (11/78, 14.1%) possessed eaeA gene. None of the E. coli isolates from the backyard poultry harboured any studied ESBL gene. Whereas 29.4% of E. coli isolates from the farmed poultry were found to possess the ESBL genes. PMID:27175158

  15. Potent combinations of beta-lactam antibiotics using the beta-lactamase inhibition principle.

    PubMed

    Greenwood, D; O'Grady, F

    1975-01-01

    Several penicillins known to be stable to enterobacterial beta-lactamases were tested in combination with beta-lactamase-sensitive penicillins and cephalosporins in a turbidimetric system. Nafcillin was found to be the best beta-lactamase inhibitor amongst agents presently available commercially, but the related, new semi-synthetic penicillin BRL 1437 (2-isopropoxy-1-naphthylpenicillin) was consistently found to be superior. Using 103 ampicillin-resistant coliform bacilli and antibiotic levels achievable in urine, cephalothin or cephaloridine alone achieved long-term suppression of growth (greater than 20 h) of 16 and 13% of strains, respectively, while the additional presence of BRL 1437 suppressed growth for longer than 20 h of 81% of the remaining strains. Even where 'success' was not achieved according to these stringent criteria, regrowth was significantly delayed by the presence of BRL 1437. Suppression of growth for longer than 20 h by BRL 1437 plus cephalothin was achieved with all of the 46 Escherichia coli strains tested. Antibiotic combinations were also studied in an in vitro model which stimulates the hydrokinetic features of the urinary bladder. Suppression of the growth of two highly resistant E. coli strains was achieved in this system, for therapeutically acceptable periods of time, with combinations of cephalothin or cephaloridine with BRL 1437, but not nafcillin.

  16. Potent combinations of beta-lactam antibiotics using the beta-lactamase inhibition principle.

    PubMed

    Greenwood, D; O'Grady, F

    1975-01-01

    Several penicillins known to be stable to enterobacterial beta-lactamases were tested in combination with beta-lactamase-sensitive penicillins and cephalosporins in a turbidimetric system. Nafcillin was found to be the best beta-lactamase inhibitor amongst agents presently available commercially, but the related, new semi-synthetic penicillin BRL 1437 (2-isopropoxy-1-naphthylpenicillin) was consistently found to be superior. Using 103 ampicillin-resistant coliform bacilli and antibiotic levels achievable in urine, cephalothin or cephaloridine alone achieved long-term suppression of growth (greater than 20 h) of 16 and 13% of strains, respectively, while the additional presence of BRL 1437 suppressed growth for longer than 20 h of 81% of the remaining strains. Even where 'success' was not achieved according to these stringent criteria, regrowth was significantly delayed by the presence of BRL 1437. Suppression of growth for longer than 20 h by BRL 1437 plus cephalothin was achieved with all of the 46 Escherichia coli strains tested. Antibiotic combinations were also studied in an in vitro model which stimulates the hydrokinetic features of the urinary bladder. Suppression of the growth of two highly resistant E. coli strains was achieved in this system, for therapeutically acceptable periods of time, with combinations of cephalothin or cephaloridine with BRL 1437, but not nafcillin. PMID:1102266

  17. Studies on structure-based sequence alignment and phylogenies of beta-lactamases.

    PubMed

    Salahuddin, Parveen; Khan, Asad U

    2014-01-01

    The β-lactamases enzymes cleave the amide bond in β-lactam ring, rendering β-lactam antibiotics harmless to bacteria. In this communication we have studied structure-function relationship and phylogenies of class A, B and D beta-lactamases using structure-based sequence alignment and phylip programs respectively. The data of structure-based sequence alignment suggests that in different isolates of TEM-1, mutations did not occur at or near sequence motifs. Since deletions are reported to be lethal to structure and function of enzyme. Therefore, in these variants antibiotic hydrolysis profile and specificity will be affected. The alignment data of class A enzyme SHV-1, CTX-M-15, class D enzyme, OXA-10, and class B enzyme VIM-2 and SIM-1 show sequence motifs along with other part of polypeptide are essentially conserved. These results imply that conformations of betalactamases are close to native state and possess normal hydrolytic activities towards beta-lactam antibiotics. However, class B enzyme such as IMP-1 and NDM-1 are less conserved than other class A and D studied here because mutation and deletions occurred at critically important region such as active site. Therefore, the structure of these beta-lactamases will be altered and antibiotic hydrolysis profile will be affected. Phylogenetic studies suggest that class A and D beta-lactamases including TOHO-1 and OXA-10 respectively evolved by horizontal gene transfer (HGT) whereas other member of class A such as TEM-1 evolved by gene duplication mechanism. Taken together, these studies justify structure-function relationship of beta-lactamases and phylogenetic studies suggest these enzymes evolved by different mechanisms. PMID:24966539

  18. Prevalence of Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Isolates in Nosocomial and Community-Acquired Urinary Tract Infections

    PubMed Central

    Latifpour, Mohammad; Gholipour, Abolfazl; Damavandi, Mohammad Sadegh

    2016-01-01

    Background Klebsiella pneumoniae is a family member of Enterobacteriaceae. Isolates of K. pneumoniae produce enzymes that cause decomposition of third generation cephalosporins. These enzymes are known as extended-spectrum beta-lactamase (ESBL). Resistance of K. pneumoniae to beta-lactamase antibiotics is commonly mediated by beta-lactamase genes. Objectives The aim of this study was to identify the ESBL produced by K. pneumoniae isolates that cause community-acquired and nosocomial urinary tract infections within a one-year period (2013 to 2014) in Kashani and Hajar university hospitals of Shahrekord, Iran. Patients and Methods From 2013 to 2014, 150 strains of K. pneumoniae isolate from two different populations with nosocomial and community-acquired infections were collected. The strains were then investigated by double disk synergism and multiplex polymerase chain reaction (PCR). Results The study population of 150 patients with nosocomial and community-acquired infections were divided to two groups of 75 each. We found that 48 of the K. pneumoniae isolates in the patients with nosocomial infection and 39 isolates in those with community-acquired infections produced ESBL. The prevalence of TEM1, SHV1 and VEB1 in ESBL-producing isolates in nosocomial patients was 24%, 29.3% and 10.6%, and in community-acquired patients, 17.3%, 22.7% and 8%, respectively. Conclusions The prevalence of ESBL-producing K. pneumoniae isolate is of great concern; therefore, continuous investigation seems essential to monitor ESBL-producing bacteria in patients with nosocomial and community-acquired infections. PMID:27226874

  19. A putative low-molecular-mass penicillin-binding protein (PBP) of Mycobacterium smegmatis exhibits prominent physiological characteristics of DD-carboxypeptidase and beta-lactamase.

    PubMed

    Bansal, Ankita; Kar, Debasish; Murugan, Rajagopal A; Mallick, Sathi; Dutta, Mouparna; Pandey, Satya Deo; Chowdhury, Chiranjit; Ghosh, Anindya S

    2015-05-01

    DD-carboxypeptidases (DD-CPases) are low-molecular-mass (LMM) penicillin-binding proteins (PBPs) that are mainly involved in peptidoglycan remodelling, but little is known about the dd-CPases of mycobacteria. In this study, a putative DD-CPase of Mycobacterium smegmatis, MSMEG_2433 is characterized. The gene for the membrane-bound form of MSMEG_2433 was cloned and expressed in Escherichia coli in its active form, as revealed by its ability to bind to the Bocillin-FL (fluorescent penicillin). Interestingly, in vivo expression of MSMEG_2433 could restore the cell shape oddities of the septuple PBP mutant of E. coli, which was a prominent physiological characteristic of DD-CPases. Moreover, expression of MSMEG_2433 in trans elevated beta-lactam resistance in PBP deletion mutants (ΔdacAdacC) of E. coli, strengthening its physiology as a dd-CPase. To confirm the biochemical reason behind such physiological behaviours, a soluble form of MSMEG_2433 (sMSMEG_2433) was created, expressed and purified. In agreement with the observed physiological phenomena, sMSMEG_2433 exhibited DD-CPase activity against artificial and peptidoglycan-mimetic DD-CPase substrates. To our surprise, enzymic analyses of MSMEG_2433 revealed efficient deacylation for beta-lactam substrates at physiological pH, which is a unique characteristic of beta-lactamases. In addition to the MSMEG_2433 active site that favours dd-CPase activity, in silico analyses also predicted the presence of an omega-loop-like region in MSMEG_2433, which is an important determinant of its beta-lactamase activity. Based on the in vitro, in vivo and in silico studies, we conclude that MSMEG_2433 is a dual enzyme, possessing both DD-CPase and beta-lactamase activities.

  20. The prevalence of Escherichia coli strains with extended spectrum beta-lactamases isolated in China

    PubMed Central

    Liu, Haihong; Wang, Yueling; Wang, Gang; Xing, Quantai; Shao, Lihua; Dong, Xiaomeng; Sai, Lintao; Liu, Yongjuan; Ma, Lixian

    2015-01-01

    The extended-spectrum-lactamases-producing Escherichia coli has rapidly spread worldwide. Escherichia coli has been becoming much more resistant to β-lactam antibiotics and other commonly available antimicrobials. We investigated the prevalence, resistance, and probable gene type of extended spectrum beta-lactamases (ESBLs) using minimum inhibitory concentrations (MICs) testing and polymerase chain reaction (PCR). We have collected 289 single-patient E. coli Isolates based on samples of China from July 2013 to August 2014. This article explored that the prevalence of ESBL-producing Isolates showed multi-resistant to antimicrobials such as fluoroquinolones, trimethoprim, tetracycline and aminoglycosides, and so on. The frequencies of resistance in Isolates were as follows: Ciprofloxacin, 74%, gentamicin, 69.5%, levofloxacin, 63%, tobramycin, 39%, and minocycline, 7.9%. According to our results, 197(68.2%) of the total 289 Isolates were ESBL-producing strains; further, 172 (87.3%) producers contained genes encoding CTX-M enzymes and 142(72.1%) producers contained genes encoding TEM enzymes. Most ESBL-producing Escherichia coli has produced more than one type of β-lactamase. Nucleotide sequence analysis has revealed the diversity of ESBLs types: CTX-M -15 is in the majority and TEM-135, CTX-M-3, CTX-M-98, CTX-M-14, CTX-M-142, CTX-M-65, CTX-M-55, CTX-M-27, and CTX-M-123 have been recovered. The results confirm that ESBL producers which are common in hospital strains of Escherichia coli are resistant to cephalosporins and other antibiotics in China. It is important to monitor such strains closely and provide scientific evidence of rational application of antibiotics to prevent their spread. PMID:25954262

  1. Characterization of the staphylococcal beta-lactamase transposon Tn552.

    PubMed Central

    Rowland, S J; Dyke, K G

    1989-01-01

    The staphylococcal beta-lactamase transposon Tn552 is a member of a novel group of transposable elements. The organization of genes in Tn552 resembles that of members of the Tn21 sub-group of Tn3 family transposons, which transpose replicatively by cointegrate formation and resolution. Thus, a possible resolution site ('resL') and a resolvase gene (tnpR or 'binL') have been identified. However, consistent with the fact that Tn552 generates 6 bp (rather than 5 bp) flanking direct repeats of target DNA, neither the putative transposase protein, nor the terminal inverted repeats of Tn552 are homologous to those of Tn3 elements. Tn552, like phage Mu and retroelements, is defined by the terminal dinucleotides 5' TG .. CA 3'. A naturally occurring staphylococcal plasmid, pI9789, contains a Tn552-derived resolution system ('resR-binR') that acts as a 'hotspot' for Tn552 transposition; insertion creates a segment of DNA flanked by inversely repeated resolution sites, one (resR) on pI9789 and the other (resL) on Tn552. The putative Tn552 resolvase, the most closely related of known resolvases to the homologous DNA invertases, initially was identified as a DNA invertase ('Bin') as a result of its ability to mediate efficient inversion of this segment in vivo. PMID:2555186

  2. In vitro antibacterial activity and beta-lactamase stability of a new carbapenem, BO-2727.

    PubMed Central

    Inoue, K; Hamana, Y; Mitsuhashi, S

    1995-01-01

    The in vitro activity of BO-2727, a new carbapenem, was compared with those of meropenem, biapenem, imipenem, and ceftazidime. BO-2727 was four- or eightfold more active than the other carbapenems against methicillin-resistant staphylococci and Pseudomonas aeruginosa strains, including imipenem- and ceftazidime-resistant bacteria. BO-2727 was quite stable to penicillinases, cephalosporinases, and oxyiminocephalosporinases, but not to metallo-beta-lactamase. Time-kill studies against Staphylococcus aureus Smith, Escherichia coli ML4707, and P. aeruginosa GN11189 showed that BO-2727 has potent bactericidal activity at concentrations greater than the MIC. PMID:8619591

  3. Ligand-Dependent Disorder of Loop Observed in Extended-Spectrum SHV-Type beta-Lactamase

    SciTech Connect

    J Sampson; W Ke; C Bethel; S Pagadala; M Nottingham; R Bonomo; J Buynak; F van den Akker

    2011-12-31

    Among Gram-negative bacteria, resistance to {beta}-lactams is mediated primarily by {beta}-lactamases (EC 3.2.6.5), periplasmic enzymes that inactivate {beta}-lactam antibiotics. Substitutions at critical amino acid positions in the class A {beta}-lactamase families result in enzymes that can hydrolyze extended-spectrum cephalosporins, thus demonstrating an 'extended-spectrum' {beta}-lactamase (ESBL) phenotype. Using SHV ESBLs with substitutions in the {Omega} loop (R164H and R164S) as target enzymes to understand this enhanced biochemical capability and to serve as a basis for novel {beta}-lactamase inhibitor development, we determined the spectra of activity and crystal structures of these variants. We also studied the inactivation of the R164H and R164S mutants with tazobactam and SA2-13, a unique {beta}-lactamase inhibitor that undergoes a distinctive reaction chemistry in the active site. We noted that the reduced K{sub i} values for the R164H and R164S mutants with SA2-13 are comparable to those with tazobactam (submicromolar). The apo enzyme crystal structures of the R164H and R164S SHV variants revealed an ordered {Omega} loop architecture that became disordered when SA2-13 was bound. Important structural alterations that result from the binding of SA2-13 explain the enhanced susceptibility of these ESBL enzymes to this inhibitor and highlight ligand-dependent {Omega} loop flexibility as a mechanism for accommodating and hydrolyzing {beta}-lactam substrates.

  4. Molecular epidemiology of Klebsiella pneumoniae producing SHV-5 beta- lactamase: parallel outbreaks due to multiple plasmid transfer.

    PubMed Central

    Prodinger, W M; Fille, M; Bauernfeind, A; Stemplinger, I; Amann, S; Pfausler, B; Lass-Florl, C; Dierich, M P

    1996-01-01

    Over a period of 22 months, 32 patients treated in three independent intensive care units of the Innsbruck University Hospital were infected with extended-spectrum beta-lactamase-producing members of the family Enterobacteriaceae (30 Klebsiella pneumoniae isolates, 1 Klebsiella oxytoca isolate, and 1 Escherichia coli isolate). As confirmed by sequencing of a bla gene PCR fragment, all isolates expressed the SHV-5-type beta-lactamase. Genomic fingerprinting of epidemic strains with XbaI and pulsed-field gel electrophoresis grouped 20 of 21 isolates from ward A into two consecutive clusters which included 1 of 3 ward B isolates. All six K. pneumoniae isolates from ward C formed a third cluster. Stool isolates of asymptomatic patients and environmental isolates belonged to these clusters as well. Additionally, 2,600 routine K. pneumoniae isolates from the surrounding provinces (population, 900,000) were screened for SHV-5 production. Only one of six nonepidemic isolates producing SHV-5 beta-lactamase was matched with the outbreak strains by genomic fingerprinting. Plasmid fingerprinting, however, revealed the epidemic spread of a predominant R-plasmid, with a size of approximately 80 kb, associated with 29 of the 30 K. pneumoniae isolates. This plasmid was also present in the single K. oxytoca and E. coli isolates from ward C and in three nonepidemic isolates producing SHV-5. Our results underline that strain typing exclusively on the genomic level can be misleading in the epidemiological investigation of plasmid-encoded extended-spectrum beta-lactamases. Our evidence for multiple events of R-plasmid transfer between species of the family Enterobacteriaceae in this nosocomial outbreak stresses the need for plasmid typing, especially because SHV-5 beta-lactamase seems to be regionally spread predominantly via plasmid transfer. PMID:8904415

  5. Prevalence and characterization of extended-spectrum beta-lactamase (ESBL)- and CMY-2-producing Escherichia coli isolates from healthy food-producing animals in Tunisia.

    PubMed

    Ben Sallem, Rym; Ben Slama, Karim; Sáenz, Yolanda; Rojo-Bezares, Beatriz; Estepa, Vanesa; Jouini, Ahlem; Gharsa, Haythem; Klibi, Naouel; Boudabous, Abdellatif; Torres, Carmen

    2012-12-01

    The prevalence of extended-spectrum beta-lactamase (ESBL)- and plasmidic AmpC-beta-lactamase (pAmpC-BL)-producing Escherichia coli isolates has been studied in food-producing animals at the farm level in Tunisia, and recovered isolates were characterized for the presence of other resistance genes and integrons. Eighty fecal samples of food-producing animals (23 sheep, 22 chickens, 22 cattle, six horses, five rabbits, and two dromedaries) were obtained from 35 different farms in Tunisia in 2011. Samples were inoculated onto MacConkey agar plates supplemented with cefotaxime (2 mg/L) for cefotaxime-resistant (CTX(R)) E. coli recovery. CTX(R) E. coli isolates were detected in 11 out of 80 samples (13.8%), and one isolate per sample was further characterized (10 from chickens and one from a dromedary). The 11 CTX(R) isolates were distributed into phylogroups: B1 (five isolates), A (two isolates), D (three isolates), and B2 (one isolate). The following beta-lactamase genes were detected: bla(CTX-M-1) (seven isolates), bla(CTX-M-1)+bla(TEM-135) (one isolate), bla(CTX-M-1)+bla(TEM-1b) (one isolate), and bla(CMY-2) (two isolates). All ESBL- and pAmpC-BL-producing E. coli strains showed unrelated pulsed-field gel electrophoresis patterns. Seven isolates contained class 1 integrons with four gene cassette arrangements: dfrA17-aadA5 (three isolates), dfrA1-aadA1 (two isolates), dfrA15-aadA1 (one isolate), and aadA1 (one isolate). All isolates showed tetracycline resistance and contained the tet(A) +/- tet(B) genes. Virulence genes detected were as follows (number of isolates in parentheses): fimA (10); aer (eight); papC (two); and papGIII, hly, cnf, and bfp (none). Chicken farms constitute a reservoir of ESBL- and pAmpC-BL-producing E. coli isolates of the CTX-M-1 and CMY-2 types that potentially could be transmitted to humans via the food chain or by direct contact.

  6. In vitro activity and beta-lactamase stability of LJC 10,627.

    PubMed Central

    Neu, H C; Gu, J W; Fang, W; Chin, N X

    1992-01-01

    The in vitro activity of LJC 10,627, a new carbapenem, was compared with those of imipenem, cefotaxime, ceftazidime, and gentamicin. LJC 10,627 inhibited 90% of Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter aerogenes, Enterobacter agglomerans, Enterobacter cloacae, Hafnia alvei, Citrobacter freundii, Citrobacter diversus, Proteus mirabilis, Morganella morganii, Proteus rettgeri, Serratia marcescens, Pseudomonas cepacia, salmonellae, shigellae, aeromonas, and yersiniae at less than or equal to 2 micrograms/ml. Haemophilus influenzae was inhibited by 0.5 microgram/ml, and moraxellae were inhibited by 0.12 microgram/ml. LJC 10,627 was twofold more active than imipenem against aerobic gram-negative organisms and inhibited ceftazidime-, cefotaxime-, and gentamicin-resistant members of the genera Klebsiella, Enterobacter, Citrobacter, and Serratia at less than or equal to 2 micrograms/ml. Xanthomonas maltophilia strains were resistant to the drug. Imipenem was two- to fourfold more active than LJC 10,627 against Staphylococcus aureus and Staphylococcus epidermidis. LJC 10,627 did not inhibit most methicillin-resistant Staphylococcus aureus or methicillin-resistant Staphylococcus epidermidis strains. LJC 10,627 inhibited Streptococcus pyogenes and Streptococcus pneumoniae at 0.06 and 0.12 microgram/ml, respectively. Bacteroides fragilis and other Bacteroides spp. were inhibited by 0.5 microgram of LJC 10,627 per ml. Serum (50%) did not affect the MICs. LJC 10,627 was not hydrolyzed by plasmid-mediated beta-lactamases of Bush types 2b, 2b', TEM-1, TEM-2, TEM-3, TEM-5, TEM-7, TEM-9, and SHV-1; the chromosomal beta-lactamases of Bush type 1; P-99; a Morganella enzyme; or a Citrobacter freundii enzyme. The Bush type 2c and 2d enzymes OXA-1, OXA-2, PSE-1, PSE-2, and PSE-4 did not hydrolyze LJC 10,627, nor did the beta-lactamases of Staphylococcus aureus, Moraxella spp., Bacteroides fragilis, and Proteus vulgaris. The beta-lactamase of Xanthomonas

  7. Impact of the New Delhi metallo-beta-lactamase on beta-lactam antibiotics

    PubMed Central

    Zmarlicka, Monika T; Nailor, Michael D; Nicolau, David P

    2015-01-01

    Since the first New Delhi metallo-beta-lactamase (NDM) report in 2009, NDM has spread globally causing various types of infections. NDM-positive organisms produce in vitro resistance phenotypes to carbapenems and many other antimicrobials. It is thus surprising that the literature examining clinical experiences with NDM does not report corresponding poor clinical outcomes. There are many instances where good clinical outcomes are described, despite a mismatch between administered antimicrobials and resistant in vitro susceptibilities. Available in vitro data for either monotherapy or combination therapy does not provide an explanation for these observations. However, animal studies do begin to shed more light on this phenomenon. They imply that the in vivo expression of NDM may not confer clinical resistance to all cephalosporin and carbapenem antibiotics as predicted by in vitro testing but other resistance mechanisms need to be present to generate a resistant phenotype. As such, previously abandoned therapies, particularly carbapenems and beta-lactamase inhibitor combinations, may retain utility against infections caused by NDM producers. PMID:26345624

  8. IS1999 increases expression of the extended-spectrum beta-lactamase VEB-1 in Pseudomonas aeruginosa.

    PubMed

    Aubert, Daniel; Naas, Thierry; Nordmann, Patrice

    2003-09-01

    The integron-borne bla(VEB-1) gene encodes an extended-spectrum beta-lactamase. This gene was associated mostly with IS1999 and rarely with an additional IS2000 element in Pseudomonas aeruginosa isolates from Thailand, whereas IS1999 was only very rarely associated with bla(VEB-1) in Enterobacteriaceae. Expression experiments and promoter study identified promoter sequences in IS1999 that increased the expression of VEB-1 in P. aeruginosa.

  9. SHV-12, SHV-5, SHV-2a and VEB-1 extended-spectrum beta-lactamases in Gram-negative bacteria isolated in a university hospital in Thailand.

    PubMed

    Chanawong, A; M'Zali, F H; Heritage, J; Lulitanond, A; Hawkey, P M

    2001-12-01

    Sixty-one extended-spectrum beta-lactamase (ESBL)-producing isolates were collected from Srinagarind Hospital, Thailand. These included 43 Enterobacteriaceae and 18 Pseudomonadaceae. The 43 Enterobacteriaceae were found to produce the following ESBLs: 26 (60.5%) SHV-12, 13 (30.2%) SHV-5, two (4.7%) SHV-2a, one (2.3%) VEB-1 and one (2.3%) unidentified. Twenty-four isolates (55.8%) also carried bla(TEM-1B), as well as bla(SHV) or bla(VEB-1). Plasmid DNA from transconjugants carrying the bla(SHV-12) gene showed various restriction patterns, indicating the distribution of the bla(SHV-12) gene among different antibiotic resistance plasmids. In contrast, bla(SHV-5) in 13 isolates was found on a single plasmid of c. 130 kb. Pulsed-field gel electrophoresis (PFGE) analysis of genomic DNA from these isolates revealed that nine of 11 Klebsiella pneumoniae gave the same pattern, indicating clonal spread of the strain within the hospital, together with the occasional spread of the plasmid to other strains. Among the pseudomonad isolates, 16 Pseudomonas aeruginosa and one Pseudomonas putida had bla(VEB-like) and one P. aeruginosa had bla(SHV-12). Nine of the 16 isolates carrying bla(VEB-like) (56.3%) had identical PFGE patterns, suggesting the dissemination of this gene, also by clonal spread. At least six different bla(VEB-like-)containing integrons were found among the 18 isolates. This is the first report of bacteria producing SHV-12 and SHV-2a in Thailand and the first report of SHV-12 in P. aeruginosa, of VEB-1 in Citrobacter freundii and a VEB-1-like beta-lactamase in P. putida. These findings indicate that ESBL genes in the Far East are part of a gene pool capable of broad horizontal gene transfer, in that these genes can transfer between different families of Gram-negative bacilli. PMID:11733468

  10. SHV-12, SHV-5, SHV-2a and VEB-1 extended-spectrum beta-lactamases in Gram-negative bacteria isolated in a university hospital in Thailand.

    PubMed

    Chanawong, A; M'Zali, F H; Heritage, J; Lulitanond, A; Hawkey, P M

    2001-12-01

    Sixty-one extended-spectrum beta-lactamase (ESBL)-producing isolates were collected from Srinagarind Hospital, Thailand. These included 43 Enterobacteriaceae and 18 Pseudomonadaceae. The 43 Enterobacteriaceae were found to produce the following ESBLs: 26 (60.5%) SHV-12, 13 (30.2%) SHV-5, two (4.7%) SHV-2a, one (2.3%) VEB-1 and one (2.3%) unidentified. Twenty-four isolates (55.8%) also carried bla(TEM-1B), as well as bla(SHV) or bla(VEB-1). Plasmid DNA from transconjugants carrying the bla(SHV-12) gene showed various restriction patterns, indicating the distribution of the bla(SHV-12) gene among different antibiotic resistance plasmids. In contrast, bla(SHV-5) in 13 isolates was found on a single plasmid of c. 130 kb. Pulsed-field gel electrophoresis (PFGE) analysis of genomic DNA from these isolates revealed that nine of 11 Klebsiella pneumoniae gave the same pattern, indicating clonal spread of the strain within the hospital, together with the occasional spread of the plasmid to other strains. Among the pseudomonad isolates, 16 Pseudomonas aeruginosa and one Pseudomonas putida had bla(VEB-like) and one P. aeruginosa had bla(SHV-12). Nine of the 16 isolates carrying bla(VEB-like) (56.3%) had identical PFGE patterns, suggesting the dissemination of this gene, also by clonal spread. At least six different bla(VEB-like-)containing integrons were found among the 18 isolates. This is the first report of bacteria producing SHV-12 and SHV-2a in Thailand and the first report of SHV-12 in P. aeruginosa, of VEB-1 in Citrobacter freundii and a VEB-1-like beta-lactamase in P. putida. These findings indicate that ESBL genes in the Far East are part of a gene pool capable of broad horizontal gene transfer, in that these genes can transfer between different families of Gram-negative bacilli.

  11. Failure of ceftazidime-amikacin therapy for bacteremia and meningitis due to Klebsiella pneumoniae producing an extended-spectrum beta-lactamase.

    PubMed Central

    Smith, C E; Tillman, B S; Howell, A W; Longfield, R N; Jorgensen, J H

    1990-01-01

    A multiple trauma patient failed treatment with ceftazidime and amikacin for bacteremia and meningitis due to a Klebsiella pneumoniae strain that produced a novel, plasmid-mediated beta-lactamase. Both pre- and posttreatment isolates were resistant to ceftazidime (MIC, greater than or equal to 64 micrograms/ml) and various penicillins but not to other expanded-spectrum cephalosporins. The beta-lactamase had a pI of 5.25 and was encoded on a conjugal plasmid of approximately 150 kilobases. DNA hybridization studies indicated that the enzyme was a TEM derivative. Images PMID:2203306

  12. RESULTS OF MONITORING METALLO-BETA-LACTAMASE-PRODUCING STRAINS OF PSEUDOMONAS AERUGINOSA IN A MULTI-PROFILE HOSPITAL.

    PubMed

    Shamaeva, S K; Portnyagina, U S; Edelstein, M V; Kuzmina, A A; Maloguloval, S; Varfolomeeva, N A

    2015-01-01

    The authors present the results of long-term monitoring of metallo-beta-lactamase (MBL) producing strains of Pseudomonas aeruginosa in the Republican Hospital No 2 of Yakutsk, Russian Federation. Hospitals across Russia, as well as the rest of the world, face a rapid appearance and a virtually unchecked spread of multiresistant and panresistant nosocomial pathogens. Especially prevalent are multidrug-resistant isolates of P. aeruginosa, most often found among the patients of intensive care and intensive therapy units, as well as surgery departments. The aim of this study is to investigate the prevalence of metallo-beta-lactamase-producing strains of P. aeruginosa in a multi-profile hospital. 2,135 isolates of P. aeruginosa were studied, collected during a time span of seven years (2008-2014) from clinical specimens of hospitalised patients in acute surgery, purulent surgery, neurosurgery, otolaryngology, coloproctology departments, intensive care and intensive therapy, burn units, as well as intensive care unit for patients with acute cerebrovascular accidents and coronary care unit. Strains were identified and re-identified using established methods, NEFERMtest 24 (MICROLATEST) biochemical microtest and API (bioMerieux) test systems were used. For all carbapenem-resistant strains a phenotype screening for MBL was performed using the double-disks method with EDTA. In order to identify VIM-type and IMP-type MBL genes a real-time multiplex polymerase chain reaction was used. Among the investigated strains the largest number of P. aeruginosa - 35.6% (761 isolates) was found in patients at intensive care and intensive therapy units. Clonal expansion of extensively drug-resistant strain P. aeruginosa ST235 (VIM-2) was determined, the resistance mechanism of which is connected to MBL. Sensitivity determination of MBL-producing isolates of P. aeruginosa has shown that isolated strains have a high level of resistance (100%) to all tested antibacterial agents: piperacillin

  13. High prevalence of extended-spectrum and plasmidic AmpC beta-lactamase-producing Escherichia coli from poultry in Tunisia.

    PubMed

    Maamar, Elaa; Hammami, Samia; Alonso, Carla Andrea; Dakhli, Nouha; Abbassi, Mohamed Salah; Ferjani, Sana; Hamzaoui, Zaineb; Saidani, Mabrouka; Torres, Carmen; Boutiba-Ben Boubaker, Ilhem

    2016-08-16

    This study was conducted to detect extended spectrum beta-lactamases (ESBLs) and plasmidic AmpC beta-lactamase (pAmpC-BL)-producing Escherichia coli isolates in industrial poultry samples were collected from healthy chickens of the three farms. Samples were inoculated onto desoxycholate-lactose-agar plates supplemented with cefotaxime (2mg/L). E. coli was identified by biochemical and molecular methods and antibiotic susceptibility testing by the disk diffusion method. Genes encoding ESBLs and pAmpC-BL were detected by PCR and sequencing. Phylogenetic groups were determined by triplex PCR. The molecular typing of strains was done by pulsed field gel electrophoresis (PFGE) and Multilocus Sequence Typing (MLST) in those isolates showing different PFGE patterns. Cefotaxime-resistant E. coli isolates were recovered in 48 of 137 fecal samples (35%), and one isolate/sample was further studied. The following beta-lactamase genes were detected: blaCTX-M-1 (29 isolates, isolated in all three farms), blaCTX-M-15 (5 isolates, confined in farm II), blaCTX-M-14 and blaCMY-2 (one isolate and 13 isolates, respectively, in farm III). The 48 cefotaxime-resistant isolates were distributed into phylogroups: B1 (n=21), A (n=15) and D (n=12). PFGE analysis revealed 19 unrelated patterns: 15 different profiles among ESBL-positive strains and 4 among the CMY-2-positive isolates. The following sequence types-associated phylogroups were detected: a) CTX-M-1-positive strains: lineages ST542-B1, ST212-B1, ST58-B1, ST155-B1 and ST349-D; b) CTX-M-15-positive strain: lineage ST405-D; c) CTX-M-14-positive strain: lineage ST1056-B1; d) CMY-2-positive strains: lineages ST117-D, ST2197-A, and ST155-B1. Healthy chickens constitute an important reservoir of ESBL- and pAmpC-BL-producing E. coli isolates that potentially could be transmitted to humans via the food chain or by direct contact. PMID:27220012

  14. Biosynthesis of ketomycin. (II) biomimetic model for beta-lactamase catalysis: host-guest interactions in cyclodextrin-penicillin inclusion complex

    SciTech Connect

    Mak, H.W.

    1986-01-01

    The antibiotic ketomycin is formed from shikimic acid via chorismic acid and prephenic acid. Phenylalanine and 2',5'-dihydrophenylalanine derived from shikimic acid are not intermediates in the biosynthesis. Degradation of ketomycin derived from (1,6-/sup 14/C)shikimic acid showed that prephenic acid is converted into ketomycin with stereospecific discrimination between the two enantiotopic edges of the ring, the pro-S-R edge giving rise to the C-2', C-3' side of the cyclohexane ring of ketomycin. The resistance of pathogenic bacteria to the action of ..beta..-lactam antibiotics is mainly ascribed to their ability to produce ..beta..-lactamase to cleave the ..beta..-lactam ring. It is essential to understand the molecular nature of ..beta..-lactamase-penicillin recognition for designing and formulating more effective ..beta..-lactam antibiotics. A biomimetic study of ..beta..-lactamase is therefore initiated. To meet the requirements of hydrophobic and serine protease characteristics of ..beta..-lactamase, ..cap alpha..-cyclodextrin is chosen as a biomimetic model for ..beta..-lactamase. The structural specificity and the chemical dynamics of ..cap alpha..-cyclodextrin-phenoxymethyl penicillin inclusion complex in solid state and in solution have been determined by IR and NMR spectroscopy. The spectral results strongly indicate that the phenyl portion of the phenoxymethyl penicillin forms a stable inclusion complex with the hydrophobic cavity of ..cap alpha..-cyclodextrin in solution as well as in the solid state. Kinetic studies followed by /sup 1/HNMR and HPLC analyses under alkaline condition have shown that the ..cap alpha..-cyclodextrin mimics the catalytic function of serine of ..beta..-lactamase in the stereospecific hydrolysis of the ..beta..-lactam ring of phenoxymethyl penicillin.

  15. Characterization of the extended-spectrum beta-lactamase reference strain, Klebsiella pneumoniae K6 (ATCC 700603), which produces the novel enzyme SHV-18.

    PubMed

    Rasheed, J K; Anderson, G J; Yigit, H; Queenan, A M; Doménech-Sánchez, A; Swenson, J M; Biddle, J W; Ferraro, M J; Jacoby, G A; Tenover, F C

    2000-09-01

    Klebsiella pneumoniae K6 (ATCC 700603), a clinical isolate, is resistant to ceftazidime and other oxyimino-beta-lactams. A consistent reduction in the MICs of oxyimino-beta-lactams by at least 3 twofold dilutions in the presence of clavulanic acid confirmed the utility of K. pneumoniae K6 as a quality control strain for extended-spectrum beta-lactamase (ESBL) detection. Isoelectric-focusing analysis of crude lysates of K6 demonstrated a single beta-lactamase with a pI of 7.8 and a substrate profile showing preferential hydrolysis of cefotaxime compared to ceftazidime. PCR analysis of total bacterial DNA from K6 identified the presence of a bla(SHV) gene. K6 contained two large plasmids with molecular sizes of approximately 160 and 80 kb. Hybridization of plasmid DNA with a bla(SHV)-specific probe indicated that a bla(SHV) gene was encoded on the 80-kb plasmid, which was shown to transfer resistance to ceftazidime in conjugal mating experiments with Escherichia coli HB101. DNA sequencing of this bla(SHV)-related gene revealed that it differs from bla(SHV-1) at nine nucleotides, five of which resulted in amino acid substitutions: Ile to Phe at position 8, Arg to Ser at position 43, Gly to Ala at position 238, and Glu to Lys at position 240. In addition to the production of this novel ESBL, designated SHV-18, analysis of the outer membrane proteins of K6 revealed the loss of the OmpK35 and OmpK37 porins. PMID:10952583

  16. Effect of tannin extract against Pseudomonas aeruginosa producing metallo beta-lactamase.

    PubMed

    Ghafourian, S; Mohebi, R; Sekawi, Z; Raftari, M; Neela, V; Ghafourian, E; Aboualigalehdari, E; Rahbar, M; Sadeghifard, N

    2012-01-01

    Carbapenems are the most potent beta-lactam agents with a broad-spectrum activity against Gram-negative and Gram-positive bacteria. They are stable in the presence of penicillinases and cephalosporinases. This study was focused on frequency of metallo beta- lactamase (MBL) among Pesudomonas aeruginosa strains isolated in patients with urinary tract infection, effect of tannin against PA positive strains which produced blaVIM or blaIMP and both of these genes (Species). Detection of MBL was performed by phonotypic and genotypic methods. Tannin extract was tested against P. aeruginosa producing MBL. During the study period, 240 P. aeruginosa isolates were identified. Among them 64 (26.6 percent) isolates were imipenem non-susceptible and confirmed by imipenem/EDTA. Our results revealed that the growth of blaVIM positive P. aeruginosa inhibited at 15 microg/ml concentration. The experiment repeated for blaIMP-positive P. aeruginosa and P. aeruginosa which harbored blaIMP and blaVIM, the results showed 35 microg/ml was the best concentration for inhibition of P. aeruginosa-positive blaIMP and also P. aeruginosa blaIMP and blaVIM. In conclusion, tannin was effective against P. aeruginosa producing blaVIM and blaIMP and both of them so it can be substituted with common antibiotics. The result showed significantly P. aeruginosa-harbored blaIMP was more responsible for imipenem resistance than P. aeruginosa-positive blaVIM. Interestingly, tannin was more effective against MBL-P. aeruginosa in comparison with current antibiotics. PMID:22824750

  17. Evolution of CTX-M-type beta-lactamases in isolates of Escherichia coli infecting hospital and community patients.

    PubMed

    Brigante, Gioconda; Luzzaro, Francesco; Perilli, Mariagrazia; Lombardi, Gianluigi; Colì, Alessandra; Rossolini, Gian Maria; Amicosante, Gianfranco; Toniolo, Antonio

    2005-02-01

    Escherichia coli isolates collected at our Institution from 1999 to 2003 (n=20,258) were studied to evaluate the production of CTX-M-type extended-spectrum beta-lactamases (ESBL). Isolates suspected of producing CTX-M enzymes were analyzed by the double-disk synergy test, hybridization with specific probes, PCR and direct DNA sequencing. Overall, 53 ESBL-positive isolates were found to carry CTX-M-type genes (blaCTX-M-1, n=51; blaCTX-M-15, n=2). The isolation of CTX-M-positive strains increased from 1 per year (1999) to 26 per year (2003). The first isolate carrying the blaCTX-M-15 gene appeared in 2003 and was obtained from a patient previously treated with ceftazidime. CTX-M-positive isolates were characterized by multi-drug resistance and were obtained both from inpatients (n=29) and outpatients (n=24). Most patients were over 60-year-old (n=45), had underlying chronic diseases (n=32), and had been hospitalized more than once (n=33). Strains were frequently isolated from the urinary tract, often after recurrent infections. Our study demonstrates that CTX-M-producing isolates are increasing among E. coli strains. Adequate laboratory detection may help in choosing appropriate treatment and in limiting the spread of this resistance trait.

  18. Discrimination of extended-spectrum beta-lactamases by a novel nitrocefin competition assay.

    PubMed Central

    Papanicolaou, G A; Medeiros, A A

    1990-01-01

    We describe a nitrocefin competition assay for determining inhibition profiles as a useful adjunct to existing biochemical methods for the discrimination of beta-lactamases. The hydrolysis rate of nitrocefin was measured with a plate photometer as the change in A480 over 45 min in the presence of 17 inhibitors. Fourteen well-established beta-lactamases and 13 extended-spectrum beta-lactamases were tested. Correlations with data from isoelectric focusing and amino acid sequencing suggested that the inhibition profile reflects alterations in the active-site configuration of beta-lactamases. The method was especially useful in measuring the relative affinities of beta-lactamases against poorly hydrolyzed substrates and in screening large numbers of isolates for the detection of new beta-lactamase types. PMID:2073109

  19. Exposure assessment of extended-spectrum beta-lactamases/AmpC beta-lactamases-producing Escherichia coli in meat in Denmark

    PubMed Central

    Carmo, Luís P.; Nielsen, Liza R.; da Costa, Paulo M.; Alban, Lis

    2014-01-01

    Introduction Extended-spectrum beta-lactamases (ESBL) and AmpC beta-lactamases (AmpC) are of concern for veterinary and public health because of their ability to cause treatment failure due to antimicrobial resistance in Enterobacteriaceae. The main objective was to assess the relative contribution (RC) of different types of meat to the exposure of consumers to ESBL/AmpC and their potential importance for human infections in Denmark. Material and methods The prevalence of each genotype of ESBL/AmpC-producing E. coli in imported and nationally produced broiler meat, pork and beef was weighted by the meat consumption patterns. Data originated from the Danish surveillance program for antibiotic use and antibiotic resistance (DANMAP) from 2009 to 2011. DANMAP also provided data about human ESBL/AmpC cases in 2011, which were used to assess a possible genotype overlap. Uncertainty about the occurrence of ESBL/AmpC-producing E. coli in meat was assessed by inspecting beta distributions given the available data of the genotypes in each type of meat. Results and discussion Broiler meat represented the largest part (83.8%) of the estimated ESBL/AmpC-contaminated pool of meat compared to pork (12.5%) and beef (3.7%). CMY-2 was the genotype with the highest RC to human exposure (58.3%). However, this genotype is rarely found in human infections in Denmark. Conclusion The overlap between ESBL/AmpC genotypes in meat and human E. coli infections was limited. This suggests that meat might constitute a less important source of ESBL/AmpC exposure to humans in Denmark than previously thought – maybe because the use of cephalosporins is restricted in cattle and banned in poultry and pigs. Nonetheless, more detailed surveillance data are required to determine the contribution of meat compared to other sources, such as travelling, pets, water resources, community and hospitals in the pursuit of a full source attribution model. PMID:24511370

  20. The 1.4 Å Crystal Structure of the Class D [beta]-Lactamase OXA-1 Complexed with Doripenem

    SciTech Connect

    Schneider, Kyle D.; Karpen, Mary E.; Bonomo, Robert A.; Leonard, David A.; Powers, Rachel A.

    2010-01-12

    The clinical efficacy of carbapenem antibiotics depends on their resistance to the hydrolytic action of {beta}-lactamase enzymes. The structure of the class D {beta}-lactamase OXA-1 as an acyl complex with the carbapenem doripenem was determined to 1.4 {angstrom} resolution. Unlike most class A and class C carbapenem complexes, the acyl carbonyl oxygen in the OXA-1-doripenem complex is bound in the oxyanion hole. Interestingly, no water molecules were observed in the vicinity of the acyl linkage, providing an explanation for why carbapenems inhibit OXA-1. The side chain amine of K70 remains fully carboxylated in the acyl structure, and the resulting carbamate group forms a hydrogen bond to the alcohol of the 6{alpha}-hydroxyethyl moiety of doripenem. The carboxylate attached to the {beta}-lactam ring of doripenem is stabilized by a salt bridge to K212 and a hydrogen bond with T213, in lieu of the interaction with an arginine side chain found in most other {beta}-lactamase-{beta}-lactam complexes (e.g., R244 in the class A member TEM-1). This novel set of interactions with the carboxylate results in a major shift of the carbapenem's pyrroline ring compared to the structure of the same ring in meropenem bound to OXA-13. Additionally, bond angles of the pyrroline ring suggest that after acylation, doripenem adopts the {Delta}{sup 1} tautomer. These findings provide important insights into the role that carbapenems may have in the inactivation process of class D {beta}-lactamases.

  1. Screening of some medicinal plants from cameroon for beta-lactamase inhibitory activity.

    PubMed

    Gangoué-Piéboji, Joseph; Baurin, Stéphane; Frère, Jean-Marie; Ngassam, Pierre; Ngameni, Bathelemy; Azebaze, Anatole; Pegnyemb, Dieudonné Emmanuel; Watchueng, Jean; Goffin, Colette; Galleni, Moreno

    2007-03-01

    In efforts to find new bioactive beta-lactamase inhibitors, this study investigated 16 Cameroonian plants belonging to 10 families which were evaluated for anti-beta-lactamase activity. The investigation showed that extracts 2, 6, 3 and 5 of the 16 plants investigated presented interesting in vitro beta-lactamase inhibition (over 90%), respectively, of the beta-lactamases TEM-1, OXA-10, IMP-1 and P99. These extracts were from Mammea africana (all beta-lactamases), Garcinia lucida, G. kola (OXA-10, IMP-1 and P99), Bridelia micrantha (OXA-10, P99), Ochna afzelii (OXA-10, P99), Prunus africana (IMP-1) and Adenia lobata (TEM-1). After elimination of tannins (according to the European Pharmacopoeia) the extracts from B. micrantha, G. lucida and M. africana were tested further for their anti-beta-lactamase activity. The extracts from B. micrantha and G. lucida exhibited potent inhibitory activity, respectively, of beta-lactamase OXA-10 (IC(50) = 0.02 mg/mL) and P99 (IC(50) = 0.01 mg/mL). The anti-beta-lactamase activity of M. africana extract was weak. The isolation and the structural elucidation of the active constituents of G. lucida and B. micrantha will provide useful leads in the development of beta-lactamase inhibitors.

  2. Formation of beta-lactamase in Bacteroides fragilis: cell-bound and extracellular activity.

    PubMed

    Olsson, B; Nord, C E; Wadström, T

    1976-05-01

    Nine strains of Bacteroides fragilis were cultivated in stirred fermentors and tested for their ability to produce beta-lactamase. There was a correlation between formation of beta-lactamase and high values of the minimal inhibitory concentration against beta-lactam antibiotics. B. fragilis strain B70 was used for optimizing the production of beta-lactamase. The highest bacterial yield was obtained in a proteose peptone-yeast extract medium. Optimal conditions for growth and beta-lactamase production were obtained at 37 C and pH 7.0. The beta-lactamase was released into the surrounding medium during the growth period to about 50%. Osmotic shock released about 20% of the total activity, and remaining activity was found in the cytoplasmic fraction. Substrate profile studies on four beta-lactamase-producing strains showed that the enzymes were mainly cephalosporinases. They are inhibited by cloxacillin, p-chloromercuribenzoate, and iodine. Analytical isoelectric focusing in polyacrylamide gel gave an isoelectric point of 4.9 +/- 0.2 for three of the strains and 5.6 +/- 0.2 for one. Comparison with beta-lactamases from aerobic gram-negative species with regard to isoelectric points showed no similarities. Also the molecular weight of the beta-lactamase from strain B70 of 43,000 indicates that this is a new class of beta-lactamase.

  3. Dissemination and diversity of metallo-beta-lactamases in Latin America: report from the SENTRY Antimicrobial Surveillance Program.

    PubMed

    Sader, Helio S; Castanheira, Mariana; Mendes, Rodrigo E; Toleman, Mark; Walsh, Timothy R; Jones, Ronald N

    2005-01-01

    Carbapenem resistance among Pseudomonas aeruginosa and Acinetobacter spp. is becoming a critical therapeutic problem worldwide. The SENTRY Antimicrobial Surveillance Program monitors pathogen frequency and antimicrobial resistance patterns of nosocomial and community-acquired infections through sentinel hospitals on five continents. Pseudomonas spp. and Acinetobacter spp. strains resistant to imipenem (MIC, >/=16 mg/l), meropenem (MIC, >/=16 mg/l), and ceftazidime (MIC, >/=32 mg/l) collected from January 2001 to December 2003 were routinely screened for antimicrobial resistance genes. Resistant isolates were initially tested for metallo-beta-lactamase (MbetaL) production by phenotypic tests (disk approximation or MbetaL Etest strip) and then characterization of the MbetaL (hydrolysis assays, PCR for bla(IMP), bla(VIM), bla(SPM), gene sequencing). Eighty-nine isolates (33 Acinetobacter spp., 54 Pseudomonas aeruginosa, and 2 P. fluorescens) had positive phenotypic screening tests. Among those, 34 isolates producing MbetaL were identified, including 7 Acinetobacter spp., 25 P. aeruginosa and 2 P. fluorescens. The MbetaLs identified were IMP-1, VIM-2 and two newly described enzymes: SPM-1 and IMP-16. The greatest concentration of MbetaL strains was in Brazil, where imipenem-resistant P. aeruginosa increased significantly in the time period evaluated by the SENTRY Program. MbetaL-producing P. aeruginosa was detected in São Paulo (SPM-1) and Brasilia (SPM-1 and IMP-16), Brazil and Caracas, Venezuela (VIM-2); while MbetaL-producing Acinetobacter spp. isolates were detected in São Paulo, Brazil (IMP-1). P. fluorescens isolates producing IMP-1 and VIM-2 were detected in São Paulo, Brazil and Santiago, Chile, respectively. The emergence and dissemination of mobile MbetaL-producing isolates represent an alarming factor for increasing resistance to carbapenems in several medical centres evaluated by the SENTRY Program in Latin America.

  4. Comparative activities of clavulanic acid, sulbactam, and tazobactam against clinically important beta-lactamases.

    PubMed Central

    Payne, D J; Cramp, R; Winstanley, D J; Knowles, D J

    1994-01-01

    Clavulanic acid, sulbactam, and tazobactam are inhibitors of a variety of plasmid-mediated beta-lactamases. However, inhibition data for these three inhibitors with a wide range of different plasmid-mediated beta-lactamases have not yet been compared under the same experimental conditions. A number of groups have inferred that clavulanic acid inhibits extended-spectrum TEM and SHV beta-lactamases, but inhibition data have rarely been published. In this study, the 50% inhibitory concentrations of these three beta-lactamase inhibitors for 35 plasmid-mediated beta-lactamases have been determined. Of these 35 beta-lactamases, 20 were extended-spectrum TEM- or SHV-derived beta-lactamases. The other 15 enzymes were conventional-spectrum beta-lactamases such as TEM-1 and SHV-1. Clavulanic acid was a more potent inhibitor than sulbactam for 32 of the 35 plasmid-mediated beta-lactamases tested. In particular, clavulanic acid was 60 and 580 times more potent than sulbactam against TEM-1 and SHV-1, respectively, currently the two most clinically prevalent gram-negative plasmid-mediated beta-lactamases. Statistical analysis of the data of the 50% inhibitory concentrations showed that clavulanic acid was 20 times more active overall than sulbactam against the conventional-spectrum enzymes. In addition, clavulanic acid was 14 times more potent than sulbactam at inhibiting the extended-spectrum enzymes. Tazobactam also showed significantly greater activity than sulbactam against the two groups of beta-lactamases. There were no significant differences between the overall activities of tazobactam and clavulanic acid against the extended-spectrum TEM and SHV enzymes and conventional-spectrum enzymes, although differences in their inhibition profiles were observed. PMID:8031044

  5. Extended-Spectrum Beta-Lactamases Producing Escherichia coli and Klebsiella pneumoniae: A Multi-Centric Study Across Karnataka

    PubMed Central

    Rao, Sridhar PN; Rama, Prasad Subba; Gurushanthappa, Vishwanath; Manipura, Radhakrishna; Srinivasan, Krishna

    2014-01-01

    Background: There are sporadic reports on detection of extended-spectrum beta-lactamases (ESBL) producers from Karnataka; hence, this is a first multicentric study across Karnataka state to determine the prevalence of ESBL production among clinical isolates of Escherichia coli and Klebsiella pneumoniae. Aims and objectives: To determine the prevalence of ESBL producing clinical isolates of E. coli and K. pneumoniae from five geographically distributed centers across Karnataka, to study the susceptibility of ESBL producing isolates to other beta-lactam and beta-lactam-beta-lactamase inhibitors and to demonstrate transferability of plasmids coding for ESBL phenotype. Materials and Methods: Two hundred isolates of E. coli and K. pneumoniae each were collected from each of the five centers (Bellary, Dharwad, Davangere, Kolar and Mangalore). They were screened for resistance to screening agents (ceftazidime, cefotaxime, ceftriaxone, aztreonam) and positive isolates were confirmed for ESBL production by test described by Clinical and Laboratory Standards Institute. Co-production of ESBL and AmpC beta-lactamase was identified by using amino-phenylboronic acid disk method. Susceptibility of ESBL producers to beta-lactam antibiotics and beta-lactamase inhibitors was performed. Transferability of plasmids was performed by conjugation experiment. Results: Overall prevalence of ESBL production among E. coli and K. pneumoniae across five centers of the state was 57.5%. ESBL production was found to be 61.4% among E. coli and 46.2% among K. pneumoniae. ESBL production was significantly more among E. coli than K. pneumoniae. Significant variations in distribution of ESBL across the state was observed among E. coli isolates, but not among K. pneumoniae isolates. All ESBL producers demonstrated minimum inhibitory concentration levels ≥2 μg/ml towards cefotaxime, ceftazidime and ceftriaxone. Conclusion: Overall prevalence of ESBL production among clinical isolates of E. coli and K

  6. SMB-1, a novel subclass B3 metallo-beta-lactamase, associated with ISCR1 and a class 1 integron, from a carbapenem-resistant Serratia marcescens clinical isolate.

    PubMed

    Wachino, Jun-ichi; Yoshida, Hiroyuki; Yamane, Kunikazu; Suzuki, Satowa; Matsui, Mari; Yamagishi, Takuya; Tsutsui, Atsuko; Konda, Toshifumi; Shibayama, Keigo; Arakawa, Yoshichika

    2011-11-01

    A carbapenem-resistant Serratia marcescens strain, 10mdr148, was identified in a Japanese hospital in 2010. The carbapenem resistance of this strain was attributed to the production of a novel metallo-β-lactamase (MBL), named SMB-1 (Serratia metallo-β-lactamase). SMB-1 possessed a zinc binding motif, H(Q)XHXDH (residues 116 to 121), H196, and H263 and was categorized as a member of subclass B3 MBL. SMB-1 has 75% amino acid identity with the most closely related MBL, AMO1, of uncultured bacterium, recently identified through the metagenomic analysis of apple orchard soil. The introduction of bla(SMB-1) into Escherichia coli conferred resistance to a variety of β-lactam antibiotics, penicillins, cephalosporins, and carbapenems, but not aztreonam, a resistance pattern consistent with those of other MBLs. SMB-1 demonstrated high k(cat) values of >500 s(-1) for carbapenems, resulting in the highest hydrolyzing efficiency (k(cat)/K(m)) among the agents tested. The hydrolyzing activity of SMB-1 was well inhibited by chelating agents. The bla(SMB-1) gene was located on the chromosome of S. marcescens strain 10mdr148 and at the 3' end of the ISCR1 element in complex with a typical class 1 integron carrying aac(6')-Ib and catB3 gene cassettes. Downstream of bla(SMB-1), the second copy of the 3'conserved segment and ISCR1 were found. To our knowledge, this is the first subclass B3 MBL gene associated with an ISCR1 element identified in an Enterobacteriaceae clinical isolate. A variety of antibiotic resistance genes embedded with ISCR1 have been widely spread among Enterobacteriaceae clinical isolates, thus the further dissemination of bla(SMB-1) mediated by ISCR1 transposition activity may become a future concern. PMID:21876060

  7. Lysine carboxylation in proteins: OXA-10 beta-lactamase.

    PubMed

    Li, Jie; Cross, Jason B; Vreven, Thom; Meroueh, Samy O; Mobashery, Shahriar; Schlegel, H Bernhard

    2005-11-01

    An increasing number of proteins are being shown to have an N(zeta)-carboxylated lysine in their structures, a posttranslational modification of proteins that proceeds without the intervention of a specific enzyme. The role of the carboxylated lysine in these proteins is typically structural (hydrogen bonding or metal coordination). However, carboxylated lysines in the active sites of OXA-10 and OXA-1 beta-lactamases and the sensor domain of BlaR signal-transducer protein serve in proton transfer events required for the functions of these proteins. These examples demonstrate the utility of this unusual amino acid in acid-base chemistry, in expansion of function beyond those of the 20 standard amino acids. In this study, the ONIOM quantum-mechanical/molecular-mechanical (QM/MM) method is used to study the carboxylation of lysine in the OXA-10 beta-lactamase. Lys-70 and the active site of the OXA-10 beta-lactamase were treated with B3LYP/6-31G(d,p) density functional calculations and the remainder of the enzyme with the AMBER molecular mechanics force field. The barriers for unassisted carboxylation of neutral lysine by carbon dioxide or bicarbonate are high. However, when the reaction with CO2 is catalyzed by a molecule of water in the active site, it is exothermic by about 13 kcal/mol, with a barrier of approximately 14 kcal/mol. The calculations show that the carboxylation and decarboxylation of Lys-70 are likely to be accompanied by deprotonation and protonation of the carbamate, respectively. The analysis may also be relevant for other proteins with carboxylated lysines, a feature that may be more common in nature than previously appreciated.

  8. Role of the 7 alpha-methoxy and side-chain carboxyl of moxalactam in beta-lactamase stability and antibacterial activity.

    PubMed Central

    Murakami, K; Yoshida, T

    1981-01-01

    The effects of the alpha-carboxyl of the phenylmalonyl side chain and the 7 alpha-methoxy group in moxalactam (6059-S) (7 beta-[2-carboxy-2-(4-hydroxyphenyl) acetamido]-7 alpha-methoxy-3[[(1-methyl-1H-tetrazol-5-y])thio] methyl]-1-oxa-1-dethia-3-cephem-4-carboxylic acid) and in the 1-sulfur congener on the stability to beta-lactamase were investigated by spectrophotometric and microbiological assays. The 7 alpha-methoxy substituent stabilized the compounds against penicillinase hydrolysis, and the alpha-carboxyl group stabilized them against cephalosporinase. An exception is the beta-lactamase produced by Proteus vulgaris, an inducible cephalosporinase, which hydrolyzed compounds having the alpha-carboxyl group but not those having the 7 alpha-methoxy group. Both substituents exerted their stabilizing effects independently, and compounds with both substituents, e.g., moxalactam (6059-S) and its 1-sulfur congener, were resistant to both penicillinases and cephalosporinases. The stabilization of the compounds to beta-lactamase hydrolysis improved their antibacterial activity against beta-lactamase-producing strains. PMID:6454378

  9. Comparative in vitro and in vivo activities of piperacillin combined with the beta-lactamase inhibitors tazobactam, clavulanic acid, and sulbactam.

    PubMed Central

    Kuck, N A; Jacobus, N V; Petersen, P J; Weiss, W J; Testa, R T

    1989-01-01

    Tazobactam (YTR-830H), a novel beta-lactamase inhibitor, was compared with clavulanic acid and sulbactam for enhancement of the activity of piperacillin against beta-lactamase-producing, piperacillin-resistant clinical isolates. Piperacillin MICs were determined in media containing a fixed concentration of 2 or 4 micrograms of the inhibitors per ml. The higher concentration was generally more effective. Tazobactam was superior to sulbactam in enhancing the spectrum and potency of piperacillin. Although the calvulanic acid combination was more potent, tazobactam was effective for a similar spectrum of resistant gram-negative clinical isolates containing beta-lactamase. MICs were reduced to the susceptible range for Escherichia coli, Klebsiella pneumoniae, Proteus spp., Salmonella spp., and Shigella spp. Combinations with tazobactam and sulbactam, but not clavulanic acid, were effective against Morganella spp. Some antagonism of the activity of piperacillin was observed with clavulanic acid but not with tazobactam or sulbactam. The inhibitors were similarly effective with piperacillin against beta-lactamase-positive Staphylococcus spp. and the Bacteroides fragilis group. Piperacillin-tazobactam was more effective against a broader spectrum of gram-negative enteric bacteria than ticarcillin plus clavulanic acid was. Combinations with tazobactam or clavulanic acid had a broader spectrum of activity than combinations with sulbactam against bacteria that produce characterized plasmid-mediated enzymes of clinical significance. In particular, piperacillin with tazobactam or clavulanic acid, but not with sulbactam, inhibited TEM-1, TEM-2, and SHV-1 enzymes. In vitro activity was reflected in vivo. Tazobactam and clavulanic acid were superior to sulbactam in enhancing the therapeutic efficacy of piperacillin in mice infected with beta-lactamase-positive E. coli, K. pneumoniae, Proteus mirabilis, and Staphylococcus aureus. Only combinations with tazobactam and sulbactam were

  10. [In vitro activity of faropenem against beta-lactamase producing clinical isolates].

    PubMed

    Nishiyama, T; Matsuzaki, K; Koyama, H; Saika, T; Hasegawa, M; Kobayashi, I

    2000-03-01

    Each 20 strains of beta-lactamase producing methicillin susceptible Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Haemophilus influenzae, Moraxella (Branhamella) catarrhalis, and Bacteroides fragilis group were used as the test strains. Drug susceptibility of these strains to faropenem (FRPM), cefdinir, cefditoren, cefcapene, cefteram, cefaclor, and ampicillin was determined by an agar dilution method according to the NCCLS guideline M100-S9. beta-Lactamase activity of the test strains was determined by a spectrophotometric method. In the present study, FRPM was highly active against beta-lactamase-producing strains, and no close correlation was found between the MICs of FRPM for the test strains and their beta-lactamase activities. These results suggest that FRPM has potential in successful application for the treatment of infectious diseases with various types of bacterial pathogens including beta-lactamase producing strains. PMID:10834149

  11. [Rapid detection of extended-spectrum beta-lactamases by flow cytometry method].

    PubMed

    Duyan, Serhat; Kılıç, Abdullah; Yılmaz, Soner; Ardıç, Nurittin

    2015-10-01

    Extended-spectrum beta-lactamases (ESBL), produced by Enterobacteriaceae members are enzymes that especially cause a resistance to cephalosporin group antibiotics commonly used in clinics. Early and rapid detection of ESBL production is crucial for antimicrobial treatment and infection control; however the methods used for this purpose are time consuming (24 to 48 hours). The aim of this study was to determine a flow cytometry based-test which provides to detect ESBL producing bacteria in a short time. A total of 38 ESBL-producing (29 Escherichia coli, 9 Klebsiella pneumoniae) and 10 non-producing (5 E.coli, 5 K.pneumoniae) Enterobacteriaceae strains isolated between 2012 and 2013 were included in this study. The identification and antibiotic susceptibility tests of the isolates were performed by using Phoenix(TM) 100 automated system (Becton Dickinson, USA). The presence of bla(TEM), bla(SHV), bla(CTX-M1), bla(CTX-M2) and bla(CTX-M9) genes were investigated in ESBL positive isolates via polymerase chain reaction method. At least one of the ESBL genes were detected in 36 out of 38 isolates and no genes were detected in two E.coli isolates. In flow cytometric method, the percentages of death cells exposed to cephalosporin [(ceftazidime (CAZ) or cefotaxime (CTX)] and clavulanic acid (CLA) combination, were compared with death cells exposed only to cephalosporin (CAZ or CTX). CLA index values (CAZ-CLA and CTX-CLA indices) were obtained for CTX and CAZ. Index values which was higher than 1.5 just for one cephalosporin were accepted as GSBL positive. The mean index values for CTX-CLA in ESBL positive strains according to their genotypic characteristics were between 1.14 and 7.22, while those values for CAZ-CLA were between 0.85 and 5.6. When the two groups of 38 ESBL positive and 10 ESBL negative strains were evaluated, statistically significant difference was detected for both CAZ-CLA and CTX-CLA indices (p< 0.005). CTX-CLA indices (p= 0.001) shown a better

  12. Characterization of extended-spectrum beta-lactamase, carbapenemase, and plasmid quinolone determinants in Klebsiella pneumoniae isolates carrying distinct types of 16S rRNA methylase genes, and their association with mobile genetic elements.

    PubMed

    Wei, Dan-Dan; Wan, La-Gen; Yu, Yang; Xu, Qun-Fei; Deng, Qiong; Cao, Xian-Wei; Liu, Yang

    2015-04-01

    Eighty-four multidrug-resistant Klebsiella pneumoniae (MDR-KP) isolates from a Chinese hospital from January to October 2012 were evaluated to characterize the coexistence of 16S rRNA methylase, extended-spectrum β-lactamase, carbapenemase, and plasmid-mediated quinolone resistance determinants and their association with mobile genetic elements. Among the 84 MDR-KP isolates studied, 19 isolates exhibited high-level resistance to amikacin mediated by the production of the 16S rRNA methylase. They carried 19 armA genes (22.9%) and three rmtB genes (3.6%). CTX-M genes were found in all of the isolates. Among these armA- or rmtB/CTX-M-producing K. pneumoniae isolates, 31.6% carried the carbapenemase genes (blaKPC-2 [26.3%], blaIMP-4 [10.5%], and blaNDM-1 [5.3%]), which made them resistant to imipenem (minimum inhibitory concentration [MIC] ≥16 mg/L). All positive strains possessed qnr-like genes (16 qnrA1, 10 qnrS1, and 7 qnrB4 genes) and 18 harbored an aac(6')-Ib-cr gene. Mobile elements ISEcp1, IS26, ISCR1, ISAba125, and sul-1 integrons were detected in 19/19 (100%), 16/19 (84.2%), 18/19 (94.7%), 9/19 (47.4%), and 18/19 (94.7%) isolates, respectively. The mobilizing elements occurred in different combinations in the study isolates. Majority of armA and qnr genes were in MDR-KP strains carrying integrons containing the ISCR1. Close to 80% of blaTEM-1 and blaSHV-12 were linked to IS26 while ≥90% of blaCTX-Ms and blaCMYs were linked to ISEcp1. ISAba125 was located upstream of blaNDM-1 and some blaCMY-2 genes. In addition, seven transconjugants were available for further analysis, and armA, qnrS1, acc(6')-Ib-cr, blaCTX-M-15, blaTEM-1, and blaNDM-1 were cotransferred. This study points to the dissemination of 16S rRNA methylase genes and the prevalence of selected elements implicated in evolution of resistance determinants in collection of clinical K. pneumoniae in China.

  13. Molecular epidemiology of the integron-located VEB-1 extended-spectrum beta-lactamase in nosocomial enterobacterial isolates in Bangkok, Thailand.

    PubMed

    Girlich, D; Poirel, L; Leelaporn, A; Karim, A; Tribuddharat, C; Fennewald, M; Nordmann, P

    2001-01-01

    Over a 21/2-month period in 1999, 37 ceftazidime-resistant nonrepetitive enterobacterial isolates were collected from 37 patients in a Bangkok hospital, Thailand. Eighty-one percent of these strains expressed a clavulanic acid-inhibited extended-cephalosporin resistance profile. An identical extended-spectrum beta-lactamase (ESBL), VEB-1, was found in 16 unrelated enterobacterial isolates (Escherichia coli, n = 10; Enterobacter cloacae, n = 2; Enterobacter sakazakii, n = 1; and Klebsiella pneumoniae, n = 3) and in two clonally related E. cloacae isolates. The bla(VEB-1) gene was located on mostly self-conjugative plasmids (ca. 24 to 200 kb) that conferred additional non-beta-lactam antibiotic resistance patterns. Additionally, the bla(VEB-1) gene cassette was part of class 1 integrons varying in size and structure. The bla(VEB-1)-containing integrons were mostly associated with bla(OXA-10)-like and arr-2-like gene cassettes, the latter conferring resistance to rifampin. These data indicated the spread of bla(VEB-1) in Bangkok due to frequent transfer of different plasmids and class 1 integrons and rarely to clonally related strains. Plasmid- and integron-mediated resistance to rifampin was also found in enterobacterial isolates.

  14. Structure of the Covalent Adduct Formed Between Mycobacterium tuberculosis beta-Lactamase and Clavulanate

    SciTech Connect

    Tremblay,L.; Hugonnet, J.; Blanchard, J.

    2008-01-01

    The intrinsic resistance of Mycobacterium tuberculosis to the {beta}-lactam class of antibiotics arises from a chromosomally encoded, extended spectrum, class A {beta}-lactamase, BlaC. Herein, we report the X-ray crystallographic structure of BlaC inhibited with clavulanate at a resolution of 1.7 Angstroms with an R-factor value of 0.180 and R-free value of 0.212 for the m/z +154 clavulanate-derived fragment observed in the active site. Structural evidence reveals the presence of hydrogen bonds to the C1 carbonyl along with a coplanar arrangement of C1, C2, C3, and N4, which favors enolization to generate a trans-a, {beta}-eneamine, stabilizing the +154 adduct from hydrolysis. The irreversible inhibition of BlaC suggests that treatment of M. tuberculosis with a combination of a {beta}-lactam antibiotic and clavulanate may lead to rapid bactericidal activity.

  15. VEB-1 Extended-spectrum beta-lactamase-producing Acinetobacter baumannii, France.

    PubMed

    Naas, Thierry; Coignard, Bruno; Carbonne, Anne; Blanckaert, Karine; Bajolet, Odile; Bernet, Claude; Verdeil, Xavier; Astagneau, Pascal; Desenclos, Jean-Claude; Nordmann, Patrice

    2006-08-01

    VEB-1 extended-spectrum beta-lactamase-producing Acinetobacter baumannii was responsible for an outbreak in hospitals in France. A national alert was triggered in September 2003 when 4 hospitals reported clusters of A. baumannii infection with similar susceptibility profiles. Case definitions and laboratory guidelines were disseminated, and prospective surveillance was implemented; strains were sent to a single laboratory for characterization and typing. From April 2003 through June 2004, 53 hospitals reported 290 cases of A. baumannii infection or colonization; 275 isolates were bla(VEB-1)-positive and clonally related. Cases were first reported in 5 districts of northern France, then in 10 other districts in 4 regions. Within a region, interhospital spread was associated with patient transfer. In northern France, investigation and control measures led to a reduction of reported cases after January 2004. The national alert enabled early control of new clusters, demonstrating the usefulness of early warning about antimicrobial drug resist.

  16. Novel Insights Into The Mode of Inhibition of Class A SHV-1 Beta-Lactamases Revealed by Boronic Acid Transition State Inhibitors

    SciTech Connect

    W Ke; J Sampson; C Ori; F Prati; S Drawz; C Bethel; R Bonomo; F van den Akker

    2011-12-31

    Boronic acid transition state inhibitors (BATSIs) are potent class A and C {beta}-lactamase inactivators and are of particular interest due to their reversible nature mimicking the transition state. Here, we present structural and kinetic data describing the inhibition of the SHV-1 {beta}-lactamase, a clinically important enzyme found in Klebsiella pneumoniae, by BATSI compounds possessing the R1 side chains of ceftazidime and cefoperazone and designed variants of the latter, compounds 1 and 2. The ceftazidime and cefoperazone BATSI compounds inhibit the SHV-1 {beta}-lactamase with micromolar affinity that is considerably weaker than their inhibition of other {beta}-lactamases. The solved crystal structures of these two BATSIs in complex with SHV-1 reveal a possible reason for SHV-1's relative resistance to inhibition, as the BATSIs adopt a deacylation transition state conformation compared to the usual acylation transition state conformation when complexed to other {beta}-lactamases. Active-site comparison suggests that these conformational differences might be attributed to a subtle shift of residue A237 in SHV-1. The ceftazidime BATSI structure revealed that the carboxyl-dimethyl moiety is positioned in SHV-1's carboxyl binding pocket. In contrast, the cefoperazone BATSI has its R1 group pointing away from the active site such that its phenol moiety moves residue Y105 from the active site via end-on stacking interactions. To work toward improving the affinity of the cefoperazone BATSI, we synthesized two variants in which either one or two extra carbons were added to the phenol linker. Both variants yielded improved affinity against SHV-1, possibly as a consequence of releasing the strain of its interaction with the unusual Y105 conformation.

  17. Effect of clavulanic acid on activity of beta-lactam antibiotics in Serratia marcescens isolates producing both a TEM beta-lactamase and a chromosomal cephalosporinase.

    PubMed Central

    Bush, K; Flamm, R K; Ohringer, S; Singer, S B; Summerill, R; Bonner, D P

    1991-01-01

    An isolate of Serratia marcescens that produced both an inducible chromosomal and a plasmid-mediated TEM-1 beta-lactamase was resistant to ampicillin and amoxicillin and also demonstrated decreased susceptibility to extended-spectrum beta-lactam antibiotics (ESBAs). Clavulanic acid did not lower the MICs of the ESBAs, but it decreased the MICs of the penicillins. The TEM-1-producing plasmid was transferred to a more susceptible S. marcescens strain that produced a well-characterized inducible chromosomal beta-lactamase. The MICs of the ESBAs remained at a low level for the transconjugant. Ampicillin and amoxicillin which were good substrates for the plasmid-mediated enzyme, were not well hydrolyzed by the chromosomal enzymes; the ESBAs were hydrolyzed slowly by all the enzymes. When each of the S. marcescens strains was grown with these beta-lactam antibiotics, at least modest increases in chromosomal beta-lactamase activity were observed. When organisms were grown in the presence of clavulanic acid and an ESBA, no enhanced induction was observed. The increases in the MICs of the ESBAs observed for the initial clinical isolate may have been due to a combination of low inducibility, slow hydrolysis, and differences in permeability between the S. marcescens isolates. When clavulanic acid and a penicillin were added to strains that produced both a plasmid-mediated TEM and a chromosomal beta-lactamase, much higher levels of chromosomal beta-lactamase activity were present than were observed in cultures induced by the penicillin alone. This was due to the higher levels of penicillin that were available for induction as a result of inhibition of the TEM enzyme by clavulanate. Images PMID:1803992

  18. An alkaline D-stereospecific endopeptidase with beta-lactamase activity from Bacillus cereus.

    PubMed

    Asano, Y; Ito, H; Dairi, T; Kato, Y

    1996-11-22

    We purified a novel extracellular D-stereospecific endopeptidase, alkaline D-peptidase (D-stereospecific peptide hydrolase, EC 3.4.11.-), to homogeneity from the culture broth of the soil bacterium Bacillus cereus strain DF4-B. The Mr of the enzyme was 37,952, and it was composed of a single polypeptide chain. The optimal pH for activity was approximately 10.3. The enzyme was strictly D-stereospecific toward oligopeptides composed of Dphenylalanine such as (D-Phe)3 and (D-Phe)4. The enzyme also acted to a lesser extent on (D-Phe)6, Boc-(D-Phe)4 (where Boc is tert-butoxycarbonyl), Boc-(D-Phe)4 methyl ester, Boc-(D-Phe)3 methyl ester, Boc-(D-Phe)2, (D-Phe)2, and others, but not upon their corresponding peptides composed of L-Phe, (D-Ala)n (n = 2-5), (D-Val)3, and (D-Leu)2. The mode of action of the enzyme was clarified with synthetic substrates ((D-Phe)2-D-Tyr and D-Tyr-(D-Phe)2) and eight stereoisomers of (Phe)3. The enzyme had beta-lactamase activity toward ampicillin and penicillin G, although carboxypeptidase DD and D-aminopeptidase activities were undetectable. The gene coding for alkaline D-peptidase (adp) was cloned into plasmid pUC118, and a 1164-base pair open reading frame consisting of 388 codons was identified as the adp gene. The predicted polypeptide was similar to carboxypeptidase DD from Streptomyces R61, penicillin-binding proteins from Streptomyces lactamdurans and Bacillus subtilis, and class C beta-lactamases. Thus, the enzyme was categorized as a new "penicillin-recognizing enzyme." PMID:8939979

  19. Detection of VEB-1, OXA-10 and PER-1 genotypes in extended-spectrum beta-lactamase-producing Pseudomonas aeruginosa strains isolated from burn patients.

    PubMed

    Mirsalehian, Akbar; Feizabadi, Mehdi; Nakhjavani, Farrokh A; Jabalameli, Fereshteh; Goli, Hamidreza; Kalantari, Narges

    2010-02-01

    Resistance of Pseudomonas aeruginosa strains to the broad-spectrum cephalosporins may be mediated by the extended-spectrum beta-lactamases (ESBLs). These enzymes are encoded by different genes located on either chromosomes or plasmids. This study aimed to investigate the prevalence of ESBLs and antimicrobial susceptibilities of P. aeruginosa isolated from burn patients in Tehran, Iran. Antimicrobial susceptibility of 170 isolates to cefpodoxime, aztreonam, ciprofloxacin, ofloxacin, ceftazidime, cefepime, imipenem, meropenem, cefotaxime, levofloxacin, piperacillin-tazobactam and ceftriaxone was determined by disc agar diffusion test. Polymerase chain reaction (PCR) amplification of the genes encoding OXA-10, PER-1 and VEB-1 was also performed. All isolates (100%) were resistant to ceftazidime, cefotaxime, cefepime and aztreonam. Imipenem and meropenem were the most effective anti-pseudomonal agents. The results revealed that 148 (87.05%) of the isolates were multidrug resistant and 67 (39.41%) of the isolates were ESBL positive. Fifty (74.62%), 33 (49.25%) and 21 (31.34%) strains among 67 ESBL-producing strains amplified blaOXA-10, blaPER-1 and blaVEB-1 respectively. In conclusion, the high prevalence of multidrug resistance (87.05%) and production of OXA-10, PER-1 and VEB-1 genes in P. aeruginosa isolates in burn patients confirm that protocols considering these issues should be considered in burn hospitals.

  20. Biochemical and Structural Characterization of Mycobacterium tuberculosis beta-Lactamase with the Carbapenems Ertapenem and Doripenem

    SciTech Connect

    L Tremblay; F Fan; J Blanchard

    2011-12-31

    Despite the enormous success of {beta}-lactams as broad-spectrum antibacterials, they have never been widely used for the treatment of tuberculosis (TB) due to intrinsic resistance that is caused by the presence of a chromosomally encoded gene (blaC) in Mycobacterium tuberculosis. Our previous studies of TB BlaC revealed that this enzyme is an extremely broad-spectrum {beta}-lactamase hydrolyzing all {beta}-lactam classes. Carbapenems are slow substrates that acylate the enzyme but are only slowly deacylated and can therefore act also as potent inhibitors of BlaC. We conducted the in vitro characterization of doripenem and ertapenem with BlaC. A steady-state kinetic burst was observed with both compounds with magnitudes proportional to the concentration of BlaC used. The results provide apparent K{sub m} and k{sub cat} values of 0.18 {micro}M and 0.016 min{sup -1} for doripenem and 0.18 {micro}M and 0.017 min{sup -1} for ertapenem, respectively. FTICR mass spectrometry demonstrated that the doripenem and ertapenem acyl-enzyme complexes remain stable over a time period of 90 min. The BlaC-doripenem covalent complex obtained after a 90 min soak was determined to 2.2 {angstrom}, while the BlaC-ertapenem complex obtained after a 90 min soak was determined to 2.0 {angstrom}. The 1.3 {angstrom} diffraction data from a 10 min ertapenem-soaked crystal revealed an isomerization occurring in the BlaC-ertapenem adduct in which the original {Delta}2-pyrroline ring was tautomerized to generate the {Delta}1-pyrroline ring. The isomerization leads to the flipping of the carbapenem hydroxyethyl group to hydrogen bond to carboxyl O2 of Glu166. The hydroxyethyl flip results in both the decreased basicity of Glu166 and a significant increase in the distance between carboxyl O2 of Glu166 and the catalytic water molecule, slowing hydrolysis.

  1. Reconstitution of Bacillus cereus 5/B/6 metallo-[beta]-lactamase activity with copper

    SciTech Connect

    Hilliard, N.P.; Shaw, R.W. )

    1992-01-01

    Pathogenic bacteria become resistant to [beta]-lactam antibiotics such as penicillins and cephalosporins through the production of enzymes called [beta]-lactamases. The authors have successfully reconstituted the enzymatic activity of the metallo-[beta]-lactamase of Bacillus cereus 5/B/6 purified from an E. coli expression vector system by the addition of Cu(II) to the apoenzyme. This is the first report that copper supports catalytic activity in this enzyme. Maximal activity of the copper-reconstituted enzyme was achieved by a careful addition of a stoichiometric amount of CuSO[sub 4] to 200 [mu]M apoenzyme. Using either benzylpenicillin or cephalosporin C as the substrate, reconstitution of the activity by addition of copper to the apoenzyme resulted in the recovery of approximately 35% of the control activity of the native Zn(II) enzyme. In agreement with previous reports, in the presence of excess Cu(II), the preparation did not possess measurable catalytic activity. Electronic spectra of the copper-reconstituted enzyme displayed adsorption maxima at 394, 698 and 1,022 nm with extinction coefficients of 2,656, 55 and < 3 M[sup [minus]1]cm[sup [minus]1] respectively. Circular dichorism spectra in the ultraviolent region (UVCD) of the copper-reconstituted enzyme were identical with those of the native Zn(II) enzyme. Addition of excess cephalosporin C to the copper-reconstituted enzyme caused a decrease of about 50% of the absorbance of the 394 nm band and the formation of a new feature at 350 nm.

  2. Implication of Ile-69 and Thr-182 residues in kinetic characteristics of IRT-3 (TEM-32) beta-lactamase.

    PubMed Central

    Farzaneh, S; Chaibi, E B; Peduzzi, J; Barthelemy, M; Labia, R; Blazquez, J; Baquero, F

    1996-01-01

    The substitution of a methionine for an isoleucine at position 69 (Met69Ile), which causes inhibitor resistance to TEM-type beta-lactamases (IRT-3 and IRT-I69), altered the positions of the Asn-170 and Glu-166 side chains as well as the position of the catalytic water molecule. A novel hydrogen bond between the hydroxyl of Thr-182 and the carbonyl of Glu-64 was expected to be responsible for the increase in the catalytic activity of the IST-T182 and IRT-3 enzymes compared with those of TEM-1 and IRT-169, respectively. PMID:8891161

  3. Zero prevalence of extended spectrum beta-lactamase-producing bacteria in 300 breeding Collared Flycatchers in Sweden.

    PubMed

    Järhult, Josef D; Stedt, Johan; Gustafsson, Lars

    2013-01-01

    Wild birds are important indicators and potential spreaders of antibiotic resistance. The order Passerines is scarcely studied apart from Corvus sp. but extended spectrum beta-lactamases (ESBLs) has been found in Blackbirds. We tested 300 fecal samples from a well-studied population of Collared Flycatchers (Ficedula albicollis) at the Island of Gotland in Sweden and found no ESBL-producing bacteria. These results support the idea of 'ecological guild' as Blackbirds are ground-foraging invertebrate feeders, whereas Collared Flycatchers are aerial insectivores not regularly coming into contact with fecal contaminations and therefore less prone to acquire pathogens spread by the fecal-oral route. PMID:23898397

  4. Sequence of pNL194, a 79.3-kilobase IncN plasmid carrying the blaVIM-1 metallo-beta-lactamase gene in Klebsiella pneumoniae.

    PubMed

    Miriagou, V; Papagiannitsis, C C; Kotsakis, S D; Loli, A; Tzelepi, E; Legakis, N J; Tzouvelekis, L S

    2010-10-01

    The nucleotide sequence of pNL194, a VIM-1-encoding plasmid, is described in this study. pNL194 (79,307 bp) comprised an IncN-characteristic segment (38,940 bp) and a mosaic structure (40,367 bp) including bla(VIM-1), aacA7, aadA1, aadA2, dfrA1, dfrA12, aphA1, strA, strB, and sul1. Tn1000 or Tn5501 insertion within fipA probably facilitated recruitment of additional mobile elements carrying resistance genes. PMID:20660690

  5. Sequence of pNL194, a 79.3-kilobase IncN plasmid carrying the blaVIM-1 metallo-beta-lactamase gene in Klebsiella pneumoniae.

    PubMed

    Miriagou, V; Papagiannitsis, C C; Kotsakis, S D; Loli, A; Tzelepi, E; Legakis, N J; Tzouvelekis, L S

    2010-10-01

    The nucleotide sequence of pNL194, a VIM-1-encoding plasmid, is described in this study. pNL194 (79,307 bp) comprised an IncN-characteristic segment (38,940 bp) and a mosaic structure (40,367 bp) including bla(VIM-1), aacA7, aadA1, aadA2, dfrA1, dfrA12, aphA1, strA, strB, and sul1. Tn1000 or Tn5501 insertion within fipA probably facilitated recruitment of additional mobile elements carrying resistance genes.

  6. Escherichia coli-producing extended-spectrum beta-lactamase CTX-M-15 in a captive South American tapir (Tapirus terrestris).

    PubMed

    Klimes, Jiri; Machalkova, Marketa; Dolejska, Monika; Cizek, Alois; Janoszowska, Dagmar; Alexa, Pavel; Albrechtova, Katerina; Vojtech, Jiri; Literak, Ivan

    2013-03-01

    Only a few reports exist on the occurrence of resistant bacteria in zoo animals. Therefore, an isolation of multiresistant Escherichia coli from the lungs of a captive South American tapir (Tapirus terrestris) lead to its characterization and further investigation of samples from animals inhabiting the same paddock and from the shared environment. The tapir suffered from an intermandibular abscess and pneumonia and was euthanatized after unsuccessful therapy, including administration of antibiotics. The authors performed selective isolation of extended-spectrum beta-lactamase (ESBL)-positive E. coli strains and identification of resistance genes using polymerase chain reaction. Seven multiresistant, ESBL-producing E. coli isolates were obtained, all belonging to the B2 phylogenetic group and showing identical profile on pulsed-field gel electrophoresis. These isolates carried several resistance genes, including the gene bla(CTX-M-15). This case demonstrates the transmission of related epidemiologically important E. coli isolates whose potential transmission to other animals and zoo staff can be assumed. PMID:23505722

  7. Escherichia coli-producing extended-spectrum beta-lactamase CTX-M-15 in a captive South American tapir (Tapirus terrestris).

    PubMed

    Klimes, Jiri; Machalkova, Marketa; Dolejska, Monika; Cizek, Alois; Janoszowska, Dagmar; Alexa, Pavel; Albrechtova, Katerina; Vojtech, Jiri; Literak, Ivan

    2013-03-01

    Only a few reports exist on the occurrence of resistant bacteria in zoo animals. Therefore, an isolation of multiresistant Escherichia coli from the lungs of a captive South American tapir (Tapirus terrestris) lead to its characterization and further investigation of samples from animals inhabiting the same paddock and from the shared environment. The tapir suffered from an intermandibular abscess and pneumonia and was euthanatized after unsuccessful therapy, including administration of antibiotics. The authors performed selective isolation of extended-spectrum beta-lactamase (ESBL)-positive E. coli strains and identification of resistance genes using polymerase chain reaction. Seven multiresistant, ESBL-producing E. coli isolates were obtained, all belonging to the B2 phylogenetic group and showing identical profile on pulsed-field gel electrophoresis. These isolates carried several resistance genes, including the gene bla(CTX-M-15). This case demonstrates the transmission of related epidemiologically important E. coli isolates whose potential transmission to other animals and zoo staff can be assumed.

  8. Monitoring and characterization of extended-spectrum beta-lactamases in Escherichia coli strains from healthy and sick animals in Spain in 2003.

    PubMed

    Briñas, Laura; Moreno, Miguel Angel; Teshager, Tirushet; Sáenz, Yolanda; Porrero, María Concepción; Domínguez, Lucas; Torres, Carmen

    2005-03-01

    Genes encoding CTX-M-14, CTX-M-9, CTX-M-1, CTX-M-32, SHV-12, TEM-52, or CMY-2 beta-lactamases were detected in 21 Escherichia coli strains recovered during 2003 from sick animals (11 of 459 [2.4%] strains) and healthy animals (10 of 158 [6.3%] strains) in Spain. Twelve of these strains harbored bla(CTX-M) genes and showed unrelated pulsed-field gel electrophoresis patterns.

  9. CTX-M-2 and a New CTX-M-39 Enzyme Are the Major Extended-Spectrum Beta-Lactamases in Multiple Escherichia coli Clones Isolated in Tel Aviv, Israel

    PubMed Central

    Chmelnitsky, Inna; Carmeli, Yehuda; Leavitt, Azita; Schwaber, Mitchell J.; Navon-Venezia, Shiri

    2005-01-01

    The rate of occurrence of the extended-spectrum beta-lactamase (ESBL)-producing phenotype among Escherichia coli isolates in Tel Aviv is 12% (22). The aim of this study was to understand the molecular epidemiology of E. coli ESBL producers and to identify the ESBL genes carried by them. We studied 20 single-patient ESBL-producing E. coli clinical isolates. They comprised 11 distinct nonrelated pulsed-field gel electrophoresis (PFGE) genotypes: six isolates belonged to the same PFGE clone, four other clones included two isolates each, and six unrelated clones included only one isolate. All isolates produced various beta-lactamases with pIs ranging from 5.2 to 8.2, varying within similar PFGE clones. The most prevalent ESBL gene was blaCTX-M; 16 isolates carried blaCTX-M-2 and three carried a new ESBL gene designated blaCTX-M-39. Three strains carried blaSHV (two blaSHV-12 and one blaSHV-5), and two strains carried inhibitor-resistant ESBL genes, blaTEM-33 and blaTEM-30; 18 strains carried blaTEM-1 and eight strains carried blaOXA-2. Plasmid mapping and Southern blot analysis with a CTX-M-2 probe demonstrated that blaCTX-M-2 is plasmid borne. The wide dissemination of ESBLs among E. coli isolates in our institution is partly related to clonal spread, but more notably to various plasmid-associated ESBL genes, occurring in multiple clones, wherein the CTX-M gene family appears almost uniformly. We report here a new CTX-M gene, designated blaCTX-M-39, which revealed 99% homology with blaCTX-M-26, with a substitution of arginine for glutamine at position 225. PMID:16251320

  10. Surveillance of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli in Dairy Cattle Farms in the Nile Delta, Egypt

    PubMed Central

    Braun, Sascha D.; Ahmed, Marwa F. E.; El-Adawy, Hosny; Hotzel, Helmut; Engelmann, Ines; Weiß, Daniel; Monecke, Stefan; Ehricht, Ralf

    2016-01-01

    Introduction: Industrial livestock farming is a possible source of multi-resistant Gram-negative bacteria, including producers of extended spectrum beta-lactamases (ESBLs) conferring resistance to 3rd generation cephalosporins. Limited information is currently available on the situation of ESBL producers in livestock farming outside of Western Europe. A surveillance study was conducted from January to May in 2014 in four dairy cattle farms in different areas of the Nile delta, Egypt. Materials and Methods: In total, 266 samples were collected from 4 dairy farms including rectal swabs from clinically healthy cattle (n = 210), and environmental samples from the stalls (n = 56). After 24 h pre-enrichment in buffered peptone water, all samples were screened for 3rd generation cephalosporin-resistant Escherichia coli using Brilliance™ ESBL agar. Suspected colonies of putatively ESBL-producing E. coli were sub-cultured and subsequently genotypically and phenotypically characterized. Susceptibility testing using the VITEK-2 system was performed. All suspect isolates were genotypically analyzed using two DNA-microarray based assays: CarbDetect AS-1 and E. coli PanType AS-2 kit (ALERE). These tests allow detection of a multitude of genes and their alleles associated with resistance toward carbapenems, cephalosporins, and other frequently used antibiotics. Serotypes were determined using the E. coli SeroGenotyping AS-1 kit (ALERE). Results: Out of 266 samples tested, 114 (42.8%) ESBL-producing E. coli were geno- and phenotypically identified. 113 of 114 phenotypically 3rd generation cephalosporin-resistant isolates harbored at least one of the ESBL resistance genes covered by the applied assays [blaCTX-M15 (n = 105), blaCTX-M9 (n = 1), blaTEM (n = 90), blaSHV (n = 1)]. Alarmingly, the carbapenemase genes blaOXA-48 (n = 5) and blaOXA-181 (n = 1) were found in isolates that also were phenotypically resistant to imipenem and meropenem. Using the array-based serogenotyping

  11. [A Polish multicenter survey of antimicrobial susceptibility and prevalence of beta-lactamase production among bacterial pathogens isolated from hospitalized and ambulatory patients].

    PubMed

    Zwolska, Z; Jezierska-Anczuków, A; Filczak, K; Basta, M; Dworzyński, A; Rogala-Zawada, D; Samet, A

    1998-05-01

    The aim of the study was to establish the frequency of occurrence of bacterial pathogens with beta-lactamase activity, and pattern of resistance among aerobic and anaerobic strains isolated from: respiratory tract, urinary tract, skin and soft tissues (hospitalized patients) and throat swabs (ambulatory patients). The study was conducted in 1994 year in 6 bacteriological laboratories in four Polish towns (Warszawa, Kraków, Katowice, Gdańsk) according to the protocol. Sensitivity of bacteria was tested by the disc method on the Müeller-Hinton agar or chocolate agar according to NCCLS, activity of beta-lactamase was tested with nitrocephin. A total 2038 clinical strains--1869 aerobic and 169 anaerobic was well-defined and tested for susceptibility to ten antibiotics--amoxicilin, augmentin, ofloxacin, gentamycin, cefradin, erythromycin, cefuroxim, kotrimoxazol, cefalexin and cefaclor. Among the isolated aerobes Staphylococcus aureus (25.1%), E. coli (23.2%) and Haemophilus influenzae (14.0%) were most frequent, and in the group of anaerobes the most frequent were Bacteroides spp (40.8%) We have found 45.8% of all tested aerobic strains with beta-lactamase production, the highest proportion in pathogens isolated from respiratory tract--51.4%, 46.6% from urinary tract, and 48.4% from skin and soft tissues. Among the isolated anaerobic--68.8% of Bacteroides and 28.6% others produced beta-lactamase. Forty percentage of all strains were sensitive to amoxicilin, 70-90% of aerobic bacteria were sensitive to augmentin. Augmentin had a high activity against anaerobic bacteria too. Only a small proportion of the tested aerobic bacteria (12.2%) were resistant to ofloxacin, gentamycin showed a sufficient activity against tested strains (24.4% were resistant). The most frequent pathogen--Staphylococcus aureus was resistant to amoxicilin in 83.1% hospitalized patients, and in 73.9% in ambulatory patients.

  12. Family disintegration: one fusarium verticillioides beta-lactamase at a time

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fusarium verticillioides is a mycotoxigenic fungus found commonly on maize, where it primarily exhibits asymptomatic endophytic growth. The F. verticillioides genome possesses approximately 30 regions that potentially encode beta-lactamase enzymatic domains. These enzymes are classically involved ...

  13. Therapeutic challenges of ESBLS and AmpC beta-lactamase producers in a tertiary care center

    PubMed Central

    Grover, Naveen; Sahni, A.K.; Bhattacharya, S.

    2012-01-01

    Background Resistance to broad-spectrum beta lactams mediated by extended spectrum beta lactamases (ESBLs) and AmpC beta lactamases (AmpC βLs) enzymes is an increasing problem worldwide. Determination of their prevalence is essential to formulate an effective antibiotic policy and hospital infection control measures. Present study was undertaken to determine the prevalence of ESBL and AmpC βL producers in ICU of a tertiary care center. Methods A total of 262 clinical isolates comprising of Escherichia coli, Klebsiella pneumoniae and Proteus mirabilis that were recovered from various clinical specimens over a one year period, were studied. Antibiogram profile was determined to conventionally used antibiotics, along with recommended tests for detection of ESBL and AmpC βL production. Results 40.07% (105/262) were found to be ESBL producers, 14.8% (39/262) were AmpC bL producers. The coexistence of ESBL and AmpC βL producers was detected in 9.9% (26/262) of the isolates. Conclusion Screening of multidrug resistant bacteria especially belonging to the Enterobacteriaceae poses considerable therapeutic challenges in critical care patients because of the production of ESBL and AmpC βL. Strategies to keep a check on the emergence of such drug resistant microbes by hospital environmental surveillance and laboratory monitoring should form an important aspect of Hospital Infection control policy guidelines. PMID:24532926

  14. Incompatibility group P-1 bla+ plasmids do not increase penicillin resistance of Pseudomonas acidovorans.

    PubMed Central

    Bruce, D L; Warren, R A

    1979-01-01

    Incompatibility group P-1 plasmids with the bla+ genotype were transferred from various Escherichia coli strains to Pseudomonas acidovorans strain 29. When resistance to ampicillin was used as the criterion, none of these plasmids appeared able to express their Bla+ phenotype in this host. When the plasmids were subsequently transferred back from these ampicillin-sensitive P. acdiovorans transcipients to E. coli strains, it was found that the Bla+ phenotype was again expressed. Although beta-lactamase was not detected in cultures of P. acidovorans transcipients, macroiodometric determinations of beta-lactamase activity made on broken cell suspensions revealed that beta-lactamase was indeed synthesized. It was concluded that P. acidovorans strain 29 allows expression of the bla gene within the cell but that this organism is unable to excrete the enzyme. PMID:383693

  15. Improved detection of extended spectrum beta-lactamase (ESBL)-producing Escherichia coli in input and output samples of German biogas plants by a selective pre-enrichment procedure.

    PubMed

    Schauss, Thorsten; Glaeser, Stefanie P; Gütschow, Alexandra; Dott, Wolfgang; Kämpfer, Peter

    2015-01-01

    The presence of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli was investigated in input (manure from livestock husbandry) and output samples of six German biogas plants in 2012 (one sampling per biogas plant) and two German biogas plants investigated in an annual cycle four times in 2013/2014. ESBL-producing Escherichia coli were cultured by direct plating on CHROMagar ESBL from input samples in the range of 100 to 104 colony forming units (CFU) per g dry weight but not from output sample. This initially indicated a complete elimination of ESBL-producing E. coli by the biogas plant process. Detected non target bacteria were assigned to the genera Acinetobacter, Pseudomonas, Bordetella, Achromobacter, Castellaniella, and Ochrobactrum. A selective pre-enrichment procedure increased the detection efficiency of ESBL-producing E. coli in input samples and enabled the detection in five of eight analyzed output samples. In total 119 ESBL-producing E. coli were isolated from input and 46 from output samples. Most of the E. coli isolates carried CTX-M-type and/or TEM-type beta lactamases (94%), few SHV-type beta lactamase (6%). Sixty-four blaCTX-M genes were characterized more detailed and assigned mainly to CTX-M-groups 1 (85%) and 9 (13%), and one to group 2. Phylogenetic grouping of 80 E. coli isolates showed that most were assigned to group A (71%) and B1 (27%), only one to group D (2%). Genomic fingerprinting and multilocus sequence typing (MLST) showed a high clonal diversity with 41 BOX-types and 19 ST-types. The two most common ST-types were ST410 and ST1210. Antimicrobial susceptibility testing of 46 selected ESBL-producing E. coli revealed that several isolates were additionally resistant to other veterinary relevant antibiotics and some grew on CHROMagar STEC but shiga-like toxine (SLT) genes were not detected. Resistance to carbapenems was not detected. In summary the study showed for the first time the presence of ESBL-producing E. coli in

  16. Improved detection of extended spectrum beta-lactamase (ESBL)-producing Escherichia coli in input and output samples of German biogas plants by a selective pre-enrichment procedure.

    PubMed

    Schauss, Thorsten; Glaeser, Stefanie P; Gütschow, Alexandra; Dott, Wolfgang; Kämpfer, Peter

    2015-01-01

    The presence of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli was investigated in input (manure from livestock husbandry) and output samples of six German biogas plants in 2012 (one sampling per biogas plant) and two German biogas plants investigated in an annual cycle four times in 2013/2014. ESBL-producing Escherichia coli were cultured by direct plating on CHROMagar ESBL from input samples in the range of 100 to 104 colony forming units (CFU) per g dry weight but not from output sample. This initially indicated a complete elimination of ESBL-producing E. coli by the biogas plant process. Detected non target bacteria were assigned to the genera Acinetobacter, Pseudomonas, Bordetella, Achromobacter, Castellaniella, and Ochrobactrum. A selective pre-enrichment procedure increased the detection efficiency of ESBL-producing E. coli in input samples and enabled the detection in five of eight analyzed output samples. In total 119 ESBL-producing E. coli were isolated from input and 46 from output samples. Most of the E. coli isolates carried CTX-M-type and/or TEM-type beta lactamases (94%), few SHV-type beta lactamase (6%). Sixty-four blaCTX-M genes were characterized more detailed and assigned mainly to CTX-M-groups 1 (85%) and 9 (13%), and one to group 2. Phylogenetic grouping of 80 E. coli isolates showed that most were assigned to group A (71%) and B1 (27%), only one to group D (2%). Genomic fingerprinting and multilocus sequence typing (MLST) showed a high clonal diversity with 41 BOX-types and 19 ST-types. The two most common ST-types were ST410 and ST1210. Antimicrobial susceptibility testing of 46 selected ESBL-producing E. coli revealed that several isolates were additionally resistant to other veterinary relevant antibiotics and some grew on CHROMagar STEC but shiga-like toxine (SLT) genes were not detected. Resistance to carbapenems was not detected. In summary the study showed for the first time the presence of ESBL-producing E. coli in

  17. Improved Detection of Extended Spectrum Beta-Lactamase (ESBL)-Producing Escherichia coli in Input and Output Samples of German Biogas Plants by a Selective Pre-Enrichment Procedure

    PubMed Central

    Schauss, Thorsten; Glaeser, Stefanie P.; Gütschow, Alexandra; Dott, Wolfgang; Kämpfer, Peter

    2015-01-01

    The presence of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli was investigated in input (manure from livestock husbandry) and output samples of six German biogas plants in 2012 (one sampling per biogas plant) and two German biogas plants investigated in an annual cycle four times in 2013/2014. ESBL-producing Escherichia coli were cultured by direct plating on CHROMagar ESBL from input samples in the range of 100 to 104 colony forming units (CFU) per g dry weight but not from output sample. This initially indicated a complete elimination of ESBL-producing E. coli by the biogas plant process. Detected non target bacteria were assigned to the genera Acinetobacter, Pseudomonas, Bordetella, Achromobacter, Castellaniella, and Ochrobactrum. A selective pre-enrichment procedure increased the detection efficiency of ESBL-producing E. coli in input samples and enabled the detection in five of eight analyzed output samples. In total 119 ESBL-producing E. coli were isolated from input and 46 from output samples. Most of the E. coli isolates carried CTX-M-type and/or TEM-type beta lactamases (94%), few SHV-type beta lactamase (6%). Sixty-four blaCTX-M genes were characterized more detailed and assigned mainly to CTX-M-groups 1 (85%) and 9 (13%), and one to group 2. Phylogenetic grouping of 80 E. coli isolates showed that most were assigned to group A (71%) and B1 (27%), only one to group D (2%). Genomic fingerprinting and multilocus sequence typing (MLST) showed a high clonal diversity with 41 BOX-types and 19 ST-types. The two most common ST-types were ST410 and ST1210. Antimicrobial susceptibility testing of 46 selected ESBL-producing E. coli revealed that several isolates were additionally resistant to other veterinary relevant antibiotics and some grew on CHROMagar STEC but shiga-like toxine (SLT) genes were not detected. Resistance to carbapenems was not detected. In summary the study showed for the first time the presence of ESBL-producing E. coli in

  18. Structural Milestones in the Reaction Pathway of an Amide Hydrolase: Substrate, Acyl, and Product Complexes of Cephalothin with AmpC [beta]-Lactamase

    SciTech Connect

    Beadle, Beth M.; Trehan, Indi; Focia, Pamela J.; Shoichet, Brian K.

    2010-03-05

    {beta}-lactamases hydrolyze {beta}-lactam antibiotics and are the leading cause of bacterial resistance to these drugs. Although {beta}-lactamases have been extensively studied, structures of the substrate-enzyme and product-enzyme complexes have proven elusive. Here, the structure of a mutant AmpC in complex with the {beta}-lactam cephalothin in its substrate and product forms was determined by X-ray crystallography to 1.53 {angstrom} resolution. The acyl-enzyme intermediate between AmpC and cephalothin was determined to 2.06 {angstrom} resolution. The ligand undergoes a dramatic conformational change as the reaction progresses, with the characteristic six-membered dihydrothiazine ring of cephalothin rotating by 109{sup o}. These structures correspond to all three intermediates along the reaction path and provide insight into substrate recognition, catalysis, and product expulsion.

  19. Salicylate decreases production of AmpC type beta-lactamases and increases susceptibility to beta-lactams in a Morganella morganii clinical isolate.

    PubMed

    Tavío, María M; Perilli, Mariagrazia; Vila, Jordi; Becerro, Pino; Casañas, Lucía; Amicosante, Gianfranco; Jiménez de Anta, María Teresa

    2004-09-01

    The effect of salicylate, a marRAB inducer, on the resistance to beta-lactams was characterized in an AmpC beta-lactamase hyperproducer Morganella morganii clinical isolate (the M1 strain). Results were compared with those of the effect of salicylate in a wild-type M. morganii strain. Salicylate induced a decreased susceptibility to nalidixic acid, norfloxacin and tetracycline and simultaneously increased the susceptibility to beta-lactams apparently due to the repression of AmpC beta-lactamase synthesis in the M1 strain. Likewise, salicylate only repressed 46 kDa outer membrane protein expression in the wild-type strain, since the clinical isolate M1 did not express it.

  20. Structures of the Michaelis Complex (1.2A) and the Covalent Acyl Intermediate (2.0A ) of Cefamandole Bound in the Active Sites of the Mycobacterium tuberculosis beta-Lactamase K72A and E166A Mutants

    SciTech Connect

    L Tremblay; h Xu; J Blanchard

    2011-12-31

    The genome of Mycobacterium tuberculosis (TB) contains a gene that encodes a highly active {beta}-lactamase, BlaC, that imparts TB with resistance to {beta}-lactam chemotherapy. The structure of covalent BlaC-{beta}-lactam complexes suggests that active site residues K73 and E166 are essential for acylation and deacylation, respectively. We have prepared the K73A and E166A mutant forms of BlaC and have determined the structures of the Michaelis complex of cefamandole and the covalently bound acyl intermediate of cefamandole at resolutions of 1.2 and 2.0 {angstrom}, respectively. These structures provide insight into the details of the catalytic mechanism.

  1. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    PubMed

    Agga, Getahun E; Arthur, Terrance M; Durso, Lisa M; Harhay, Dayna M; Schmidt, John W

    2015-01-01

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie). Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR) Gram-negative (Escherichia coli and Salmonella enterica) and Gram-positive (enterococci) bacteria were determined from individual samples (n = 174). The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44) by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine), low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05) in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar prevalences

  2. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    PubMed

    Agga, Getahun E; Arthur, Terrance M; Durso, Lisa M; Harhay, Dayna M; Schmidt, John W

    2015-01-01

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie). Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR) Gram-negative (Escherichia coli and Salmonella enterica) and Gram-positive (enterococci) bacteria were determined from individual samples (n = 174). The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44) by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine), low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05) in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar prevalences

  3. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste

    PubMed Central

    Durso, Lisa M.; Harhay, Dayna M.; Schmidt, John W.

    2015-01-01

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two “low impact” environments (an urban lake and a relict prairie). Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR) Gram-negative (Escherichia coli and Salmonella enterica) and Gram-positive (enterococci) bacteria were determined from individual samples (n = 174). The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44) by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine), low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05) in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar

  4. Sensitivity of Aeromonas hydrophila carbapenemase to delta3-cephems: comparative study with other metallo-beta-lactamases.

    PubMed Central

    Felici, A; Perilli, M; Franceschini, N; Rossolini, G M; Galleni, M; Frere, J M; Oratore, A; Amicosante, G

    1997-01-01

    Ceftriaxone and ceftriaxone S-oxide behaved as inactivators against the metallo-beta-lactamase of Aeromonas hydrophila AE036 and as substrates for the zinc beta-lactamase produced by Bacillus cereus (569/H/9) and Stenotrophomonas maltophilia ULA 511. Moreover, RO 09-1428, a catechol-cephalosporin, was not recognized by the A. hydrophila enzyme. Panipenem, cephalosporin C, cephalosporin C-gamma-lactone, and loracarbef were substrates for the three studied beta-lactamases. PMID:9087509

  5. Evolutionary perspectives on multiresistance beta-lactamase transposons.

    PubMed Central

    Lafond, M; Couture, F; Vézina, G; Levesque, R C

    1989-01-01

    A series of intragenic DNA probes, encoding the major part of the transposase resolvase and inverted repeats of transposons Tn3, Tn21, and Tn2501, were used in hybridization assays for homologous DNA sequences in 18 transposons studied. The tnpA and tnpR probes detected extensive homology with Tn3-like and Tn21-like elements for 11 transposons. This high degree of homology was confirmed with the 38- and 48-base-pair inverted-repeat oligonucleotide probes of Tn3, Tn21, and Tn2501. The Southern-type gel hybridization experiments localized the tnpA-homologous sequences on the physical DNA maps constructed. The genetic and physical maps of the transposons were compared, as were their nucleic acid sequence homologies. These comparisons suggested a subfamily of mobile elements distinct from but related to the Tn21 group. Based on these results, an evolutionary model is proposed and a pedigree is presented for the genesis of multiresistance beta-lactamase transposons. Images PMID:2556363

  6. Noncovalent Interaction Energies in Covalent Complexes: TEM-1 beta-Lactamase and beta-Lactams

    SciTech Connect

    Wang, Xiaojun; Minasov, George; Shoichet, Brian K.

    2010-03-08

    The class A {beta}-lactamase TEM-1 is a key bacterial resistance enzyme against {beta}-lactam antibiotics, but little is known about the energetic bases for complementarity between TEM-1 and its inhibitors. Most inhibitors form a covalent adduct with the catalytic Ser70, making the measurement of equilibriumconstants, and hence interaction energies, technically difficult. This study evaluates noncovalent interactions withincovalent complexes by examining the differential stability of TEM-1 and its inhibitor adducts. The thermal denaturation of TEM-1 follows a two-state, reversible model with a melting temperature (T{sub m}) of 51.6 C and a van't Hoff enthalpy of unfolding ({Delta}H{sub VH}) of 146.2 kcal/mol at pH 7.0. The stability of the enzyme changes on forming an inhibitor adduct. As expected, some inhibitors stabilize TEM-1; transition-state analogues increase the T{sub m} by up to 3.7 C(1.7 kcal/mol). Surprisingly, all {beta}-lactam covalent acyl-enzyme complexes tested destabilize TEM-1 significantly relative to the apoenzyme. For instance, the clinically used inhibitor clavulanic acid and the {beta}-lactamase-resistant {beta}-lactams moxalactam and imipenem destabilize TEM-1 by over 2.6 C (1.2 kcal/mol) in their covalent adducts. Based on the structure of the TEM-1/imipenem complex (Maveyraud et al., J Am Chem Soc 1998;120:9748-52), destabilization by moxalactam and imipenem is thought to be caused by a steric clash between the side-chain of Asn132 and the 6(7)-{alpha} group of these {beta}-lactams. To test this hypothesis, the mutant enzyme N132A was made. In contrast with wild-type, the covalent complexes between N132A and both imipenem and moxalactam stabilize the enzyme, consistent with the hypothesis. To investigate the structural bases of this dramatic change instability, the structure of N132A/imipenem was determined by X-ray crystallography. In the complex with N132A, imipenemadopts a very different conformation from that observed in the wild

  7. Clonal outbreaks of extended-spectrum beta-lactamase-producing strains of Klebsiella pneumoniae demonstrated by antibiotic susceptibility testing, beta-lactamase typing, and multilocus enzyme electrophoresis.

    PubMed Central

    Nouvellon, M; Pons, J L; Sirot, D; Combe, M L; Lemeland, J F

    1994-01-01

    Nineteen extended-spectrum beta-lactamase (ESBla)-producing Klebsiella pneumoniae isolates from Rouen Hospital were investigated for their implication in nosocomial outbreaks: in addition to antibiotic susceptibility testing, the ESBlas were characterized by isoelectric focusing, and the genetic relationships between the strains were analyzed by multilocus enzyme electrophoresis using a combined polyacrylamide electrophoresis-electrophoretic transfer technique. Four isoelectric focusing beta-lactamase patterns and 11 enzyme electrophoretic types (ETs) among the strains tested were described. Three strains isolated in the same neurological unit over a 7-day period exhibited an SHV 3 beta-lactamase (pI 7.0) and were assigned to a common ET. Three of five strains isolated from patients in a rehabilitation center over a 6-week period harbored an SHV 4 beta-lactamase (pI 7.8) and exhibited the same ET. These results differentiate nosocomial transmission from sporadic cases and provide evidence that multilocus enzyme electrophoresis is a potential tool for studying genetic relationships between strains harboring a common ESBla. PMID:7814515

  8. The Ocean as a Global Reservoir of Antibiotic Resistance Genes

    PubMed Central

    Hatosy, Stephen M.

    2015-01-01

    Recent studies of natural environments have revealed vast genetic reservoirs of antibiotic resistance (AR) genes. Soil bacteria and human pathogens share AR genes, and AR genes have been discovered in a variety of habitats. However, there is little knowledge about the presence and diversity of AR genes in marine environments and which organisms host AR genes. To address this, we identified the diversity of genes conferring resistance to ampicillin, tetracycline, nitrofurantoin, and sulfadimethoxine in diverse marine environments using functional metagenomics (the cloning and screening of random DNA fragments). Marine environments were host to a diversity of AR-conferring genes. Antibiotic-resistant clones were found at all sites, with 28% of the genes identified as known AR genes (encoding beta-lactamases, bicyclomycin resistance pumps, etc.). However, the majority of AR genes were not previously classified as such but had products similar to proteins such as transport pumps, oxidoreductases, and hydrolases. Furthermore, 44% of the genes conferring antibiotic resistance were found in abundant marine taxa (e.g., Pelagibacter, Prochlorococcus, and Vibrio). Therefore, we uncovered a previously unknown diversity of genes that conferred an AR phenotype among marine environments, which makes the ocean a global reservoir of both clinically relevant and potentially novel AR genes. PMID:26296734

  9. Use of microbial beta-lactamase to destroy penicillin added to milk.

    PubMed

    Korycka-Dahl, M; Richardson, T; Bradley, R L

    1985-08-01

    A simple method is described for destruction of penicillin residues in bulk milk to an undetectable amount (less than .003 U/ml) with commercially available crude beta-lactamase enzyme. Milk containing .1 or .5 U/ml penicillin G was treated with .01 to 1.0 mU/ml of beta-lactamase (Bacillus cereus) for up to 96 h. The Bacillus stearothermophilus var. calidolactis assay was used to quantify penicillin in milk between .003 to 1.0 U/ml. The .5 U/ml of penicillin G was reduced to an undetectable amount within 18 h at 4 degrees C by 1.0 mU/ml of beta-lactamase. The development of titratable acidity over 5 to 6 h in contaminated milks treated with beta-lactamase and inoculated with Streptococcus thermophilus GH, Streptococcus cremoris, Streptococcus lactis, or a commercial starter culture was the same as for control milk samples containing no additives or only enzyme. Pilot-scale manufacture of Swiss and Cheddar cheeses from contaminated milks treated with beta-lactamase yielded cheeses of comparable quality, to control cheeses produced from penicillin-free milk. There were no delays in acid production as judged from pH measurements during production and ripening of the cheeses. About 50% of beta-lactamase activity added to milk remained after pasteurization at 63 degrees C for 30 min. The safety for human consumption of cheese containing small quantities of penicillin degradation products from milk treated with beta-lactamase remains to be established.

  10. An efficient heat-inducible Bacillus subtilis bacteriophage 105 expression and secretion system for the production of the Streptomyces clavuligerus beta-lactamase inhibitory protein (BLIP).

    PubMed

    Liu, Hong-Bing; Chui, Ka-Shun; Chan, Chi-Leong; Tsang, Chun-Wai; Leung, Yun-Chung

    2004-03-18

    The Streptomyces clavuligerus beta-lactamase inhibitory protein (BLIP) has been shown to be a potent inhibitor of class A beta-lactamases including the Escherichia coli TEM-1 beta-lactamase (Ki = 0.6 nM). A heat-inducible BLIP expression system was constructed based on a derivative of Bacillus subtilis phage phi105. The recombinant BLIP produced by this system was secreted to the culture medium, purified to homogeneity, and fully active. We have shown that the signal peptide of BLIP functions well in B. subtilis to secrete BLIP out of the cells, which facilitates purification. The absence of a His-tag also avoids the activity and structure of BLIP being altered. An unprecedented high yield of recoverable protein in culture supernatant (3.6mg of >95% pure BLIP/l culture) was achieved by a simple purification protocol. We have developed an efficient production process in which the culture time before heat-induction was 3-4h and the culture supernatant could be collected 5h after induction. This total time of 8-9h is considered to be very short compared to that of the native S. clavuligerus culturing (60-70h). We achieved a very efficient BLIP production rate of 0.8-0.9mg/l/h. Heterologous gene expression was tightly controlled and no production of BLIP was observed before heat-induction, suggesting that cell density can be further increased to improve enzyme yield.

  11. Coevolutionary Landscape Inference and the Context-Dependence of Mutations in Beta-Lactamase TEM-1

    PubMed Central

    Figliuzzi, Matteo; Jacquier, Hervé; Schug, Alexander; Tenaillon, Oliver; Weigt, Martin

    2016-01-01

    The quantitative characterization of mutational landscapes is a task of outstanding importance in evolutionary and medical biology: It is, for example, of central importance for our understanding of the phenotypic effect of mutations related to disease and antibiotic drug resistance. Here we develop a novel inference scheme for mutational landscapes, which is based on the statistical analysis of large alignments of homologs of the protein of interest. Our method is able to capture epistatic couplings between residues, and therefore to assess the dependence of mutational effects on the sequence context where they appear. Compared with recent large-scale mutagenesis data of the beta-lactamase TEM-1, a protein providing resistance against beta-lactam antibiotics, our method leads to an increase of about 40% in explicative power as compared with approaches neglecting epistasis. We find that the informative sequence context extends to residues at native distances of about 20 Å from the mutated site, reaching thus far beyond residues in direct physical contact. PMID:26446903

  12. [THE APPLICATION OF SELECTIVE CHROMOGENIC AGAR FOR DETECTING ENTEROBACTERIA WITH PRODUCTION OF BETA-LACTAMASES].

    PubMed

    Korobova, A G; Frolova, L N; Kliasova, G A

    2015-11-01

    The detection of enterobacteria with production of beta-lactamases of extended spectrum in selective chromogenic agar was analyzed The results ofdetection of beta-lactamases of extended spectrum was compared with "double disc" technique. The smears from mucous membrane of guttur and rectum from patients were analyzed in parallel on solid growth agar (Endo or Mac Conkey) and on selective agar CHROMagartm ESBL (CHROMagar France). The production of beta-lactamases of extended spectrum was confirmed using "double discs" technique. To exclude hyper-production of ampC beta-lactamases E-test was applied containing cefotetan and cefotetan with cloxacillin. The sampling consisted of 1552 samples from patients. The study permitted to isolate 1243 strains of enterobacteria on agar Endo or Mac Conkey and 409 strains of enterobacteria on selective agar CHROMagartm ESBL (Escherichia coli n = 226, Klebsiella pneumoniae n = 105, enterobacter spp. n = 35, Citrobacter spp. n = 21, others n = 22). The application of "double discs" technique confirmed production of beta-lactamases of extended spectrum in 386 (94%) out of 409 strains isolated on agar CHROMagartm ESBL. In 23 (6%) of strains no confirmation was established and hyper-production of ampC of beta-lactamases was established 15 out of total. Additionally, 8 were sensitive to cephalosporin of third generation. All enterobacteria isolated on agar Endo or Mac Conkey also were tested by "double discs" technique. Overall, 394 strains of enterobacteria with production of beta-lactamases of extended spectrum were obtained. On all agars (agar Endo or Mac Conkey and CHROMagartm ESBL)--263 (67%) strains; only on CHROMagartm ESBL--123 (31%) and only on agar Endo or Mac Conkey--8 (2%) (p < 0.0001). The sensitivity of selective agar CHROMagartm ESBL made up to 98% and specificity--97%. The resolution about detection of enterobacteria producing beta-lactamases of extended spectrum were submitted to clinic in 18-24 hours after arrival

  13. [THE APPLICATION OF SELECTIVE CHROMOGENIC AGAR FOR DETECTING ENTEROBACTERIA WITH PRODUCTION OF BETA-LACTAMASES].

    PubMed

    Korobova, A G; Frolova, L N; Kliasova, G A

    2015-11-01

    The detection of enterobacteria with production of beta-lactamases of extended spectrum in selective chromogenic agar was analyzed The results ofdetection of beta-lactamases of extended spectrum was compared with "double disc" technique. The smears from mucous membrane of guttur and rectum from patients were analyzed in parallel on solid growth agar (Endo or Mac Conkey) and on selective agar CHROMagartm ESBL (CHROMagar France). The production of beta-lactamases of extended spectrum was confirmed using "double discs" technique. To exclude hyper-production of ampC beta-lactamases E-test was applied containing cefotetan and cefotetan with cloxacillin. The sampling consisted of 1552 samples from patients. The study permitted to isolate 1243 strains of enterobacteria on agar Endo or Mac Conkey and 409 strains of enterobacteria on selective agar CHROMagartm ESBL (Escherichia coli n = 226, Klebsiella pneumoniae n = 105, enterobacter spp. n = 35, Citrobacter spp. n = 21, others n = 22). The application of "double discs" technique confirmed production of beta-lactamases of extended spectrum in 386 (94%) out of 409 strains isolated on agar CHROMagartm ESBL. In 23 (6%) of strains no confirmation was established and hyper-production of ampC of beta-lactamases was established 15 out of total. Additionally, 8 were sensitive to cephalosporin of third generation. All enterobacteria isolated on agar Endo or Mac Conkey also were tested by "double discs" technique. Overall, 394 strains of enterobacteria with production of beta-lactamases of extended spectrum were obtained. On all agars (agar Endo or Mac Conkey and CHROMagartm ESBL)--263 (67%) strains; only on CHROMagartm ESBL--123 (31%) and only on agar Endo or Mac Conkey--8 (2%) (p < 0.0001). The sensitivity of selective agar CHROMagartm ESBL made up to 98% and specificity--97%. The resolution about detection of enterobacteria producing beta-lactamases of extended spectrum were submitted to clinic in 18-24 hours after arrival

  14. Evaluation of Zataria MultiFlora Boiss and Carum copticum antibacterial activity on IMP-type metallo-beta-lactamase-producing Pseudomonas aeruginosa.

    PubMed

    Fallah, F; Taherpour, A; Borhan, R S; Hashemi, A; Habibi, M; Sajadi Nia, R

    2013-12-31

    Carbapenem resistance due to acquired metallo-beta-lactamases (MBLs) is considered to be more serious than other resistance mechanisms. The aim of this study was to evaluate the antibacterial activity of Zataria multiflora Boiss and Carum copticum plants on IMP-producing P.aeruginosa strains. This experimental study was carried out on hospitalized burn patients during 2011 and 2012. Antibiotics and extracts susceptibility tests were performed by disc diffusion and broth microdilution methods. MBL detection was performed by Combination Disk Diffusion Test (CDDT). The bla(VIM) and bla(IMP) genes were detected by PCR and sequencing methods. Using Combination Disk Diffusion test method, it was found that among 83 imipenem resistant P.aeruginosa strains, 48 (57.9%) were MBL producers. PCR and sequencing methods proved that these isolates were positive for blaIMP-1 genes, whereas none were positive for bla(VIM) genes. The mortality rate of hospitalized patients with MBL-producing Pseudomonas infection was 4/48 (8.3%). It was shown that Zataria multiflora and Carum copticum extracts had a high antibacterial effect on regular and IMP-producing P. aeruginosa strains in 6.25 mg/ml concentration. The incidence of MBL-producing P. aeruginosa in burn patients is very high. In our study, all MBL-producing isolates carry the blaIMP-1 gene. Therefore, detection of MBL-producing isolates is of great importance in identifying drug resistance patterns in P. aeruginosa, and in prevention and control of infections. In this study, it was shown that extracts of Z. multiflora and C. copticum have high antibacterial effects on ß-lactamase producing P. aeruginosa strains.

  15. Evaluation of Zataria MultiFlora Boiss and Carum copticum antibacterial activity on IMP-type metallo-beta-lactamase-producing Pseudomonas aeruginosa.

    PubMed

    Fallah, F; Taherpour, A; Borhan, R S; Hashemi, A; Habibi, M; Sajadi Nia, R

    2013-12-31

    Carbapenem resistance due to acquired metallo-beta-lactamases (MBLs) is considered to be more serious than other resistance mechanisms. The aim of this study was to evaluate the antibacterial activity of Zataria multiflora Boiss and Carum copticum plants on IMP-producing P.aeruginosa strains. This experimental study was carried out on hospitalized burn patients during 2011 and 2012. Antibiotics and extracts susceptibility tests were performed by disc diffusion and broth microdilution methods. MBL detection was performed by Combination Disk Diffusion Test (CDDT). The bla(VIM) and bla(IMP) genes were detected by PCR and sequencing methods. Using Combination Disk Diffusion test method, it was found that among 83 imipenem resistant P.aeruginosa strains, 48 (57.9%) were MBL producers. PCR and sequencing methods proved that these isolates were positive for blaIMP-1 genes, whereas none were positive for bla(VIM) genes. The mortality rate of hospitalized patients with MBL-producing Pseudomonas infection was 4/48 (8.3%). It was shown that Zataria multiflora and Carum copticum extracts had a high antibacterial effect on regular and IMP-producing P. aeruginosa strains in 6.25 mg/ml concentration. The incidence of MBL-producing P. aeruginosa in burn patients is very high. In our study, all MBL-producing isolates carry the blaIMP-1 gene. Therefore, detection of MBL-producing isolates is of great importance in identifying drug resistance patterns in P. aeruginosa, and in prevention and control of infections. In this study, it was shown that extracts of Z. multiflora and C. copticum have high antibacterial effects on ß-lactamase producing P. aeruginosa strains. PMID:24799849

  16. blaCTX-M-I group extended spectrum beta lactamase-producing Salmonella typhi from hospitalized patients in Lagos, Nigeria

    PubMed Central

    Akinyemi, Kabiru O; Iwalokun, Bamidele A; Alafe, Olajide O; Mudashiru, Sulaiman A; Fakorede, Christopher

    2015-01-01

    Purpose The global spread of blaCTX-M-I extended-spectrum beta-lactamase (ESBL)-producing Salmonella spp. remains a major threat to treatment and control. Evidence of emergence and spread of this marker are lacking in Nigeria. This study investigated blaCTX-M-I ESBL production among Salmonella isolates from hospitalized patients. Methods Patients (158 total) made up of two groups were evaluated. Group A was composed of 135 patients with persistent pyrexia and group B was composed of 23 gastroenteritis patients and their stool samples. Samples were cultured, and isolates were identified and were subjected to antibiotic susceptibility testing by standard methods. Isolates were further screened for ESBL production, blaCTX-M-I genes and transferability by double disk synergy test, plasmid extraction, polymerase chain reaction, and conjugation experiment. Results Thirty-five (25.9%) Salmonella isolates were identified from group A, of which 74.3% were S. typhi, 22.9% were S. paratyphi and two (5.7%) were invasive non-typhoidal S. enteritidis. Nine Plasmodium falciparum infections were recorded, four of which were identified as co-infections with typhoidal Salmonella. Only two (8.7%) S. enteritidis samples were obtained from group B (P>0.05). A total of 24 isolates were ESBL-positive, eliciting resistance to five to seven antibiotics, and were multiple-drug resistant. ESBL production due to the blaCTX-M-I gene cluster was detected in eleven (45.8%) Salmonella isolates. Nine (81.8%) of the eleven blaCTX-M-I ESBL producers were S. typhi and two (18.2%) isolates were S. enteritidis. Four of nine S. typhi blaCTX-M-I ESBL-producing strains harbored 23 kb self-transmissible plasmid that was co-transferred with cefotaxime and augmentin resistance to Escherichia coli j53-2 transconjugants. Conclusion This study revealed the emergence of blaCTX-M-I S. typhi as an agent of persistent pyrexia with potential to spread to other Enterobacteriaceae in Lagos, Nigeria. Cautionary

  17. Effect of porin loss on the activity of tigecycline against Klebsiella pneumoniae producing extended-spectrum beta-lactamases or plasmid-mediated AmpC-type beta-lactamases.

    PubMed

    Conejo, M Carmen; Hernández, J Ramón; Pascual, Alvaro

    2008-07-01

    Tigecycline showed excellent in vitro activity against 50 clinical isolates of Klebsiella pneumoniae producing extended-spectrum beta-lactamases, plasmid-mediated AmpC-type beta-lactamases, or both. This activity was not affected by porin loss. Porin loss, however, did affect the activity of imipenem against strains that expressed both types of enzymes. PMID:18339509

  18. Beta Lactamase Producing Clostridium perfringens Bacteremia in an Elderly Man with Acute Pancreatitis

    PubMed Central

    Mishra, Rashmi; Duncalf, Richard

    2016-01-01

    Clostridium perfringens bacteremia is associated with adverse outcomes. Known risk factors include chronic kidney disease, malignancy, diabetes mellitus, and gastrointestinal disease. We present a 74-year-old man admitted with confusion, vomiting, and abdominal pain. Exam revealed tachycardia, hypotension, lethargy, distended abdomen, and cold extremities. He required intubation and aggressive resuscitation for septic shock. Laboratory data showed leukocytosis, metabolic acidosis, acute kidney injury, and elevated lipase. CT scan of abdomen revealed acute pancreatitis and small bowel ileus. He was started on vancomycin and piperacillin-tazobactam. Initial blood cultures were positive for C. perfringens on day five. Metronidazole and clindamycin were added to the regimen. Repeat CT (day 7) revealed pancreatic necrosis. The patient developed profound circulatory shock requiring multiple vasopressors, renal failure requiring dialysis, and bacteremia with vancomycin-resistant enterococci. Hemodynamic instability precluded surgical intervention and he succumbed to multiorgan failure. Interestingly, our isolate was beta lactamase producing. We review the epidemiology, risk factors, presentation, and management of C. perfringens bacteremia. This case indicates a need for high clinical suspicion for clostridial sepsis and that extended spectrum beta lactam antibiotic coverage may be inadequate and should be supplemented with use of clindamycin or metronidazole if culture is positive, until sensitivities are known. PMID:26904307

  19. Mechanism of suppression of piperacillin resistance in enterobacteria by tazobactam.

    PubMed Central

    Kadima, T A; Weiner, J H

    1997-01-01

    Resistance to piperacillin in several isolates of Citrobacter freundii and Enterobacter cloacae was investigated and confirmed to occur at a frequency of 10(-7) to 10(-6). Development of resistance to piperacillin was significantly suppressed by tazobactam but not by clavulanic acid. To elucidate the mechanism by which resistance suppression occurs, the effect of piperacillin plus tazobactam on the induction of AmpC beta-lactamase was analyzed by monitoring the beta-galactosidase activity of an inducible ampC-lacZ gene fusion in Escherichia coli. The combination exerted no inhibitory effect on AmpC beta-lactamase induction. Tazobactam also had no effect on the accumulation of a key intermediate in the AmpC beta-lactamase induction pathway, 1,6-anhydromurotripeptide, in an ampD mutant strain of E. coli. However, the addition of tazobactam to liquid cultures of E. cloacae 40001 in the presence of piperacillin at four times the MIC caused a delay in the recovery of the culture to piperacillin-induced stress. At 16 times the MIC, a complete suppression of regrowth occurred. Analysis of culture viability on piperacillin plates showed that the culture recovery was due to growth by moderately resistant mutants preexisting in the cell population, which at 16 times the MIC became susceptible to the combination. Evidence from the kinetics of inhibition of the E. cloacae 40001 AmpC beta-lactamase by clavulanic acid, sulbactam, and tazobactam and from the effects of these drugs on the frequency of resistance to piperacillin suggests that the suppressive effect of tazobactam on the appearance of resistance is primarily mediated by the beta-lactamase inhibitory activity. PMID:9333044

  20. Prevalence of extended-spectrum beta-lactamase-producing Enterobacteriaceae isolated from blood cultures in Africa.

    PubMed

    Sangare, S A; Maiga, A I; Guindo, I; Maiga, A; Camara, N; Savadogo, S; Diallo, S; Bougoudogo, F; Armand-Lefevre, L; Andremont, A; Maiga, I I

    2015-09-01

    Extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae have been isolated from many regions of the world. Epidemiological studies are being conducted in Europe, North America, and Asia. No study has however been conducted in Africa to determine the prevalence and distribution of ESBLs on the continent. This literature review aimed at describing the prevalence of ESBL-producing Enterobacteriaceae isolated from blood cultures, as well as the ESBL genes involved at the international level. Our focus was mainly on Africa. We conducted a literature review on PubMed. Articles related to our study field and published between 1996 and 2014 were reviewed and entirely read for most of them, while we only focused on the abstracts of some other articles. Relevant articles to our study were then carefully reviewed and included in the review. The prevalence of ESBL-producing Enterobacteriaceae differs from one country to another. The results of our literature review however indicate that class A ESBLs prevail over the other types. We took into consideration articles focusing on various types of samples to assess the prevalence of ESBL-producing Enterobacteriaceae, but information on isolates from blood cultures is limited. The worldwide prevalence of ESBL-producing Enterobacteriaceae has increased over time. Evidence of ESBL-producing Enterobacteriaceae can be found in all regions of the world. Studies conducted in Africa mainly focused on the Northern and Eastern parts of the continent, while only rare studies were carried out in the rest of the continent. PMID:26433872

  1. A self-assembled quantum dot probe for detecting {beta}-lactamase activity

    SciTech Connect

    Xu Chenjie; Xing Bengang; Rao Jianghong . E-mail: jrao@stanford.edu

    2006-06-09

    This communication describes a quantum dot probe that can be activated by a reporter enzyme, {beta}-lactamase. Our design is based on the principle of fluorescence resonance energy transfer (FRET). A biotinylated {beta}-lactamase substrate was labeled with a carbocyanine dye, Cy5, and immobilized on the surface of quantum dots through the binding of biotin to streptavidin pre-coated on the quantum dots. In assembling this nanoprobe, we have found that both the distance between substrates and the quantum dot surface, and the density of substrates are important for its function. The fluorescence emission from quantum dots can be efficiently quenched (up to 95%) by Cy5 due to FRET. Our final quantum dot probe, assembled with QD605 and 1:1 mixture of biotin and a Cy5-labeled lactam, can be activated by 32 {mu}g/mL of {beta}-lactamase with 4-fold increase in the fluorescence emission.

  2. Antibacterial characteristics of YTR 830, a sulfone beta-lactamase inhibitor, compared with those of clavulanic acid and sulbactam.

    PubMed Central

    Moosdeen, F; Williams, J D; Yamabe, S

    1988-01-01

    The antibacterial activity, binding to penicillin-binding proteins, and morphological changes effected by YTR 830, a sulfone beta-lactamase inhibitor, were studied in comparison with those of other beta-lactamase inhibitors. YTR 830 had very poor antibacterial activity, bound to PBP 2 of gram-negative organisms, and at the MIC caused rapid lysis of spheroplasts formed. Images PMID:2843088

  3. Kinetic analysis of extension of substrate specificity with Xanthomonas maltophilia, Aeromonas hydrophila, and Bacillus cereus metallo-beta-lactamases.

    PubMed Central

    Felici, A; Amicosante, G

    1995-01-01

    Twenty beta-lactam molecules, including penicillins, cephalosporins, penems, carbapenems, and monobactams, were investigated as potential substrates for Xanthomonas maltophilia ULA-511, Aeromonas hydrophila AE036, and Bacillus cereus 5/B/6 metallo-beta-lactamases. A detailed analysis of the kinetic parameters examined confirmed these enzymes to be broad-spectrum beta-lactamases with different ranges of catalytic efficiency. Cefoxitin and moxalactam, substrates for the beta-lactamases from X. maltophilia ULA-511 and B. cereus 5/B/6, behaved as inactivators of the A. hydrophila AE036 metallo-beta-lactamase, which appeared to be unique among the enzymes tested in this study. In addition, we report a new, faster, and reliable purification procedure for the B. cereus 5/B/6 metallo-beta-lactamase, cloned in Escherichia coli HB101. PMID:7695305

  4. Extended-spectrum beta-lactamases in Shigella flexneri from Argentina: first report of TOHO-1 outside Japan.

    PubMed

    Andres, Patricia; Petroni, Alejandro; Faccone, Diego; Pasterán, Fernando; Melano, Roberto; Rapoport, Melina; Martínez, Mariela; Culasso, Catalina; Di Bella, Adriana; Irigoyen, Bettina; Mulki, Jorgelina; Procopio, Adriana; von Specht, Martha; Galas, Marcelo

    2005-06-01

    A 9-year nation-wide survey of the presence of extended-spectrum beta-lactamases (ESBLs) in Shigella flexneri is described. Ten of 9033 (0.1%) isolates produced ESBLs, which were characterized by isoelectric focusing, PCR and DNA sequencing. These were CTX-M-2 (five isolates), TOHO-1 (one isolate), SHV-2 (two isolates) and PER-2 (two isolates, the first report in S. flexneri world wide). The emergence of each ESBL type in S. flexneri was not restricted to a particular region of Argentina. TOHO-1 showed a more basic isoelectric point (8.4) than that previously found (7.8) and its encoding gene (bla(TOHO-1a)) harboured a silent change, G825A, relative to the reported bla(TOHO-1). All the ESBL-encoding genes were transferred to Escherichia coli by conjugation. PFGE analysis indicated that the 10 ESBL-producing S. flexneri isolates were subtypes of a unique clone.

  5. In vitro evaluation of CENTA, a new beta-lactamase-susceptible chromogenic cephalosporin reagent.

    PubMed Central

    Jones, R N; Wilson, H W; Novick, W J; Barry, A L; Thornsberry, C

    1982-01-01

    CENTA is a newly synthesized, beta-lactamase-labile, chromogenic cephalosporin reagent which changes color from light yellow (lambda maximum ca. 340 nm) to chrome yellow (lambda maximum ca. 405 nm) concomitant with hydrolysis of the beta-lactam ring. This compound offers promise as a diagnostic reagent comparable to other chromogens (PADAC and nitrocefin) for the early detection of beta-lactamase-producing clinical isolates, while retaining some antimicrobial effect against Escherichia coli, Klebsiella spp., Proteus mirabilis, Staphylococcus aureus, and non-enterococcal Streptococcus spp. CENTA is relatively unaffected by commonly used microbiological media and human serum. PMID:7047560

  6. Genetic Environment of Plasmid Mediated CTX-M-15 Extended Spectrum Beta-Lactamases from Clinical and Food Borne Bacteria in North-Eastern India

    PubMed Central

    Upadhyay, Supriya; Hussain, Abbas; Mishra, Shweta; Maurya, Anand Prakash; Bhattacharjee, Amitabha; Joshi, Santa Ram

    2015-01-01

    Background The study investigated the presence of CTX-M-15 type extended spectrum beta-lactamases (ESBL), compared their genetic arrangements and plasmid types in gram negative isolates of hospital and food origin in north-east India. From September 2013 to April 2014, a total of 252 consecutive, non-duplicate clinical isolates and 88 gram negative food isolates were selected. Phenotypic and molecular characterization of ESBL genes was performed. Presence of integrons and gene cassettes were analyzed by integrase and 59 base-element PCR respectively. The molecular environments surrounding blaCTX-M and plasmid types were investigated by PCR and PCR-based replicon typing respectively. Transformation was carried out to assess plasmid transfer. Southern blotting was conducted to localize the blaCTX-M-15 genes. DNA fingerprinting was performed by ERIC-PCR. Results Prevalence of ESBL was found to be 40.8% (103/252) in clinical and 31.8% (28/88) in food-borne isolates. Molecular characterization revealed the presence of 56.3% (58/103) and 53.5% (15/28) blaCTX-M-15 in clinical and food isolates respectively. Strains of clinical and food origin were non-clonal. Replicon typing revealed that IncI1 and IncFII plasmid were carrying blaCTX-M-15 in clinical and food isolates and were horizontally transferable. The ISEcp1 element was associated with blaCTX-M-15 in both clinical and food isolates. Conclusions The simultaneous presence of resistance determinants in non-clonal isolates of two different groups thus suggests that the microbiota of common food products consumed may serve as a reservoir for some of the drug resistance genes prevalent in human pathogens. PMID:26361395

  7. Molecular epidemiology of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae strains in a university hospital in Tunis, Tunisia, 1999-2005.

    PubMed

    Elhani, D; Bakir, L; Aouni, M; Passet, V; Arlet, G; Brisse, S; Weill, F-X

    2010-02-01

    During a period of 6 years and 5 months (January 1999 to May 2005), 103 extended-spectrum beta-lactamase (ESBL)-producing Klebsiella pneumoniae isolates, each from an individual patient or site, were collected at Mongi Slim University Hospital Centre, Tunis, Tunisia. The objectives of our work were the characterization of the bla genes encoding ESBLs, the investigation of clonal diversity of strains, and identification of the transmission modes of the resistance genes. We carried out detection by PCR and sequencing of the bla(SHV), bla(CTX-M) and bla(TEM) genes, transferability studies, plasmid replicon typing, and analysis by multilocus sequence typing (MLST) on selected isolates. Forty-seven isolates were found to be producers of CTX-M-type ESBLs, of which 43 were CTX-M-15, two CTX-M-14 and two CTX-M-27. Fifty-eight isolates were producers of SHV-12, and three were producers of SHV-2a. More than one ESBL was detected in seven isolates, as five produced both CTX-M-15 and SHV-12, and two produced both CTX-M-27 and SHV-12. By a PCR-based replicon typing method, the plasmids carrying the bla(SHV-2a) or bla(CTX-M-15) genes were assigned to IncFII or, more rarely, to IncL/M types. Of 12 plasmids carrying the bla(SHV-12) gene, only one could be typed: it was positive for the HI2 replicon. The MLST results showed large genetic background diversity in the SHV-12-producing isolates and dissemination of specific clones of the CTX-M-15-producing isolates within the same ward and among wards, and suggested endemicity with horizontal dissemination of the bla(CTX-M-15) and the bla(SHV-12) genes.

  8. Activity of imipenem against VIM-1 metallo-beta-lactamase-producing Klebsiella pneumoniae in the murine thigh infection model.

    PubMed

    Daikos, G L; Panagiotakopoulou, A; Tzelepi, E; Loli, A; Tzouvelekis, L S; Miriagou, V

    2007-02-01

    The in-vivo activity of imipenem against VIM-1-producing Klebsiella pneumoniae (VPKP) was assessed in a thigh infection model in neutropenic mice. Animals were infected with three VPKP isolates (imipenem MICs 2, 4 and 32 mg/L, respectively) and a susceptible clinical isolate (MIC 0.125 mg/L) that did not produce any beta-lactamase with broad-spectrum activity. Bacterial density at the site of infection was determined after imipenem treatment (30 and 60 mg/kg every 2 h for 24 h). The log(10) reduction in CFU/thigh was greatest for the wild-type isolate, intermediate for the two imipenem-susceptible VPKP isolates, and lowest for the imipenem-resistant VPKP isolate. Whilst in-vivo imipenem activity appeared reduced against in-vitro susceptible VIM-1 producers compared with a VIM-1-negative control, an increased drug dosage could moderate this reduction. PMID:17328735

  9. Activity of imipenem against VIM-1 metallo-beta-lactamase-producing Klebsiella pneumoniae in the murine thigh infection model.

    PubMed

    Daikos, G L; Panagiotakopoulou, A; Tzelepi, E; Loli, A; Tzouvelekis, L S; Miriagou, V

    2007-02-01

    The in-vivo activity of imipenem against VIM-1-producing Klebsiella pneumoniae (VPKP) was assessed in a thigh infection model in neutropenic mice. Animals were infected with three VPKP isolates (imipenem MICs 2, 4 and 32 mg/L, respectively) and a susceptible clinical isolate (MIC 0.125 mg/L) that did not produce any beta-lactamase with broad-spectrum activity. Bacterial density at the site of infection was determined after imipenem treatment (30 and 60 mg/kg every 2 h for 24 h). The log(10) reduction in CFU/thigh was greatest for the wild-type isolate, intermediate for the two imipenem-susceptible VPKP isolates, and lowest for the imipenem-resistant VPKP isolate. Whilst in-vivo imipenem activity appeared reduced against in-vitro susceptible VIM-1 producers compared with a VIM-1-negative control, an increased drug dosage could moderate this reduction.

  10. An overview of extended-spectrum beta-lactamases in veterinary medicine and their public health consequences.

    PubMed

    Nóbrega, Diego Borin; Brocchi, Marcelo

    2014-08-01

    Serious human and animal infections caused by bacteria are usually treated with beta-lactams. Extended-spectrum beta-lactamases (ESBLs) constitute the most clinically and economically important enzymes that are able to hydrolyze and inactivate beta-lactam antibiotics in veterinary medicine. The spread of ESBLs represents a serious threat to healthcare systems, drastically undermining therapeutic options. The relationship between drug usage and the emergence of resistance has been extensively reported. Nevertheless, the use of antimicrobials in veterinary medicine and the emergence of ESBLs in animals remains a matter of debate. Moreover, there is still controversy about whether antibiotic usage in farm animals poses a potential public health risk. This review will (i) deal with aspects related to the presence of ESBLs in veterinary medicine, (ii) its link with human medicine, and (iii) discuss strategies to be implemented to preserve antimicrobial effectiveness. New insights relative to old questions concerning antimicrobial use in domestic animals are also presented.

  11. Occurrence of efflux mechanism and cephalosporinase variant in a population of Enterobacter aerogenes and Klebsiella pneumoniae isolates producing extended-spectrum beta-lactamases.

    PubMed

    Tran, Que-Tien; Dupont, Myrielle; Lavigne, Jean-Philippe; Chevalier, Jacqueline; Pagès, Jean-Marie; Sotto, Albert; Davin-Regli, Anne

    2009-04-01

    We investigated the occurrence of multidrug resistance in 44 Enterobacter aerogenes and Klebsiella pneumoniae clinical isolates. Efflux was involved in resistance in E. aerogenes isolates more frequently than in K. pneumoniae isolates (100 versus 38% of isolates) and was associated with the expression of phenylalanine arginine beta-naphthylamide-susceptible active efflux. AcrA-TolC overproduction in E. aerogenes isolates was noted. An analysis of four E. aerogenes isolates for which cefepime MICs were high revealed no modification in porin expression but a new specific mutation in the AmpC beta-lactamase.

  12. Biochemical and molecular characterization of three new variants of AmpC beta-lactamases from Morganella morganii.

    PubMed

    Power, Pablo; Galleni, Moreno; Ayala, Juan A; Gutkind, Gabriel

    2006-03-01

    Morganella morganii produces an inducible, chromosomally encoded AmpC beta-lactamase. We describe in this study three new variants of AmpC within this species with apparent pIs of 6.6 (M19 from M. morganii strain PP19), 7.4 (M29 from M. morganii strain PP29), and 7.8 (M37 from M. morganii strain PP37). After gene sequencing, deduced amino acid sequences displayed one to six substitutions when compared to the available Morganella AmpC sequences. An AmpR-encoding gene was also found upstream of ampC, including the LysR regulators' helix-turn-helix DNA-binding domain and the putative T-N11-A-protected region in the ampR-ampC intercistronic sequence. All three AmpC variants were purified from in vitro-generated derepressed mutants and showed overall similar kinetic parameters. None of the observed amino acid changes, occurring at the surface of the protein, appear to have a major influence in their catalytic properties. Morganella AmpCs exhibit the highest catalytic efficiencies (k(cat)/K(m)) on classical penicillins, cefoxitin, narrow-spectrum cephalosporins, and cefotaxime. Cefotaxime was more effectively hydrolyzed than other oxyimino-cephalosporins, whereas cefepime was 3 log-fold less efficiently hydrolyzed than other cephalosporins such as cephalothin. Several differences with other AmpC beta-lactamases were found. Ampicillin was more efficiently hydrolyzed than benzylpenicillin. High k(cat)/K(m) values were observed for oxacillin and piperacillin, which are usually poor substrates for AmpC. A fairly efficient hydrolysis of imipenem was detected as well. Aztreonam, carbenicillin, and tazobactam were effective transient inactivators of these variants.

  13. beta-Lactamase hydrolysis of cephalosporin 3'-quinolone esters, carbamates, and tertiary amines.

    PubMed Central

    Georgopapadakou, N H; McCaffrey, C

    1994-01-01

    The beta-lactam hydrolysis of five cephalosporin 3'-quinolones (dual-action cephalosporins) by three gram-negative beta-lactamases was examined. The dual-action cephalosporins tested were the ester Ro 23-9424; the carbamates Ro 25-2016, Ro 25-4095, and Ro 25-4835; and the tertiary amine Ro 25-0534. Also tested were cephalosporins with similar side chains (cefotaxime, desacetylcefotaxime, cephalothin, cephacetrile, and Ro 09-1227 [SR 0124]) and standard beta-lactams (penicillin G, cephaloridine). The beta-lactamases used were the plasmid-mediated TEM-1 and TEM-3 enzymes and the chromosomal AmpC. The cephacetrile-related compounds Ro 25-4095 and Ro 25-4835 were hydrolyzed by all three beta-lactamases with catalytic efficiencies (relative to penicillin G) ranging from approximately 5 (TEM-1, AmpC) to approximately 25 (TEM-3). The cephalothin-related Ro 25-2016 was also hydrolyzed by all three beta-lactamases, particularly the AmpC enzyme (relative catalytic efficiency, 110). The cefotaxime-related compounds Ro 25-0534 and Ro 23-9424 were hydrolyzed to any significant extent only by the TEM-3 enzyme (relative catalytic efficiencies, 1.2 and 4.7, respectively. PMID:8067776

  14. Colonization with extended-spectrum beta-lactamase-producing and carbapenemase-producing Enterobacteriaceae in international travelers returning to Germany.

    PubMed

    Lübbert, Christoph; Straube, Laurentia; Stein, Claudia; Makarewicz, Oliwia; Schubert, Stefan; Mössner, Joachim; Pletz, Mathias W; Rodloff, Arne C

    2015-01-01

    Two hundred and twenty-five healthy German volunteers traveling to 53 different countries (mostly in Asia, Africa and South America) were enrolled in a prospective cohort study. Stool samples and data on potential travel-associated risk factors (such as type of travel, nutritional habits, occurrence of gastroenteritis) were collected before and after traveling. Screening for extended-spectrum beta-lactamase-producing Enterobacteriaceae (ESBL-PE) and carbapenemase-producing Enterobacteriaceae (CPE) was performed using selective media (CHROMagar™ ESBL/CPE plates). Isolates with confirmed ESBL-phenotype were examined for the presence of blaCTX-M, blaTEM, blaSHV, and blaVIM, blaIMP, blaNDM, blaKPC, blaOXA-48 genes by PCR amplification and sequencing. Antimicrobial susceptibility testing was performed using conventional microbroth dilution. Pre-travel analysis of 205 fully evaluable participants revealed an ESBL-PE prevalence rate of 6.8% (14/205). Among 191 participants that were ESBL-negative before travel, 58 (30.4%) were colonized by ESBL-producing Escherichia coli, and 5 (8.6%) additionally carried ESBL-producing Klebsiella pneumoniae upon return. However, no carbapenem-resistant Enterobacteriaceae were detected. ESBL-genotyping revealed that 52/54 (96.6%) E. coli and 4/4 (100%) K. pneumoniae strains available for sequencing produced CTX-M enzymes, mostly CTX-M-15 (33/56, 58.9%), and 2/54 (3.7%) E. coli strains produced SHV-12 enzymes. Travel to India was associated with the highest ESBL-PE acquisition rate (11/15, 73.3%; p=0.015), followed by South East Asia (22/46, 47.8%; p=0.038). Evaluation of travel-associated risk factors demonstrated significance for the occurrence of gastroenteritis (p=0.011). Strictly practiced hand hygiene and exclusive consumption of packaged beverages showed no protective effect. The ESBL-PE persistence rate after 6 months was 8.6% (3/35). We conclude that global efforts are needed to address the further spread of ESBL-PE in the

  15. Neutron Diffraction Studies of a Class A beta-Lactamase Toho-1 E166A/R274N/R276N Triple Mutant

    SciTech Connect

    Blakeley, Matthew P.; Chen, Yu; Afonine, Pavel

    2010-01-01

    beta-Lactam antibiotics have been used effectively over several decades against many types of bacterial infectious diseases. However, the most common cause of resistance to the beta-lactam antibiotics is the production of beta-lactamase enzymes that inactivate beta-lactams by rapidly hydrolyzing the amide group of the beta-lactam ring. Specifically, the class A extended-spectrum beta-lactamases (ESBLs) and inhibitor-resistant enzymes arose that were capable of hydrolyzing penicillins and the expanded-spectrum cephalosporins and monobactams in resistant bacteria, which lead to treatment problems in many clinical settings. A more complete understanding of the mechanism of catalysis of these ESBL enzymes will impact current antibiotic drug discovery efforts. Here, we describe the neutron structure of the class A, CTX-M-type ESBL Toho-1 E166A/R274N/R276N triple mutant in its apo form, which is the first reported neutron structure of a beta-lactamase enzyme. This neutron structure clearly reveals the active-site protonation states and hydrogen-bonding network of the apo Toho-1 ESBL prior to substrate binding and subsequent acylation. The protonation states of the active-site residues Ser70, Lys73, Ser130, and Lys234 in this neutron structure are consistent with the prediction of a proton transfer pathway from Lys73 to Ser130 that is likely dependent on the conformation of Lys73, which has been hypothesized to be coupled to the protonation state of Glu166 during the acylation reaction. Thus, this neutron structure is in agreement with a proposed mechanism for acylation that identifies Glu166 as the general base for catalysis.

  16. In vitro activity and beta-lactamase stability of FK-037, a parenteral cephalosporin.

    PubMed Central

    Neu, H C; Chin, N X; Huang, H B

    1993-01-01

    The in vitro activity of FK-037, 5-amino-2-[[(6R, 7R)-7-[[(Z)-2-(2-amino-4-thiazolyl)-2- methoxyimino) acetyl] amino]-2-carboxy-8-oxo-5-thia-1- azabicyclo[4.2.0]oct-2-en-3-yl]methyl]-1-(2-hydroxyethyl)-1H-pyrazoli um hydroxide, inner salt, sulfate (1:1), a new parenteral cephem, was compared with those of cefepime, ceftazidime, imipenem, and ciprofloxacin. FK-037 inhibited methicillin-susceptible staphylocci at < or = 4 micrograms/ml. Of 98 isolates of homogenous methicillin-resistant Staphylococcus aureus, 55 (56.1%) were inhibited by 8 micrograms of FK-037 per ml, compared to 3.1% for cefepime. Imipenem was the most active beta-lactam tested against staphylococci. The MIC of FK-037 for 90% of the strains tested (MIC90) was 0.06 micrograms/ml for hemolytic streptococci, Streptococcus pneumoniae, viridans group streptococci, and Streptococcus bovis. The MIC90 for many of the members of the family Enterobacteriaceae was 1 microgram/ml, similar to that of cefepime and lower than those of ceftazidime and imipenem. The MIC90 for Klebsiella pneumoniae and Enterobacter cloacae was 8 micrograms/ml, similar to that for cefepime, but all isolates were inhibited by 2 micrograms of imipenem per ml. K. pneumoniae isolates with cefotaxime and ceftazidime MICs of > 32 micrograms/ml with Bush type 2b' beta-lactamases were inhibited by 4 micrograms of FK-037 per ml. E. cloacae, Citrobacter freundii, and S. aureus stably resistant to FK-037 could be selected by repeated transfer in the presence of FK-037. The FK-037 MIC90 for Pseudomonas aeruginosa was 4 microgram/ml, compared to 32 microgram/ml for cefepime and ceftazidime and 8 microgram/ml for imipenem. Xanthomonas maltophilia, Pseudomonas cepacia, Acinetobacter anitratus, and Bacteroides species were resistant to FK-037 (MIC, more than or equal 32 microgram/ml). MBCs were identical to or within twofold of the MICs except for a 32-fold greater MBC for P. aeruginosa. Inoculum size and acid environment did not lower the activity

  17. Detection of extended-spectrum beta-lactamases in clinical isolates of Enterobacter cloacae and Enterobacter aerogenes.

    PubMed

    Tzelepi, E; Giakkoupi, P; Sofianou, D; Loukova, V; Kemeroglou, A; Tsakris, A

    2000-02-01

    The aim of the present study was to investigate the frequency of extended-spectrum beta-lactamases (ESBLs) in a consecutive collection of clinical isolates of Enterobacter spp. The abilities of various screening methods to detect ESBLs in enterobacters were simultaneously tested. Among the 68 consecutive isolates (56 Enterobacter cloacae and 12 Enterobacter aerogenes isolates) that were analyzed for beta-lactamase content, 21 (25 and 58%, respectively) possessed transferable ESBLs with pIs of 8.2 and phenotypic characteristics of SHV-type enzymes, 8 (14.3%) of the E. cloacae isolates produced a previously nondescribed, clavulanate-susceptible ESBL that exhibited a pI of 6.9 and that conferred a ceftazidime resistance phenotype on Escherichia coli transconjugants, and 2 E. cloacae isolates produced both of these enzymes. Among the total of 31 isolates that were considered ESBL producers, the Vitek ESBL detection test was positive for 2 (6.5%) strains, and the conventional double-disk synergy test (DDST) with amoxicillin-clavulanate and with expanded-spectrum cephalosporins and aztreonam was positive for 5 (16%) strains. Modifications of the DDST consisting of closer application of the disks (at 20 instead of 30 mm), the use of cefepime, and the use of both modifications increased the sensitivity of this test to 71, 61, and 90%, respectively. Of the 37 isolates for which isoelectric focusing failed to determine ESBLs, the Vitek test was false positive for 1 isolate and the various forms of DDSTs were false-positive for 3 isolates.

  18. Production and property of beta-lactamases in Streptomyces: comparison of the strains isolated newly and thirty years ago.

    PubMed

    Ogawara, H; Horikawa, S; Shimada-Miyoshi, S; Yasuzawa, K

    1978-05-01

    Productivity and property of beta-lactamases of Streptomyces strains isolated from soil some 30 years ago were studied in comparison with those of the newly isolated strains. At least three-quarters of the Streptomyces strains produced beta-lactamase constitutively and extracellularly, mainly as penicillinases, as in the cases of those from the newly isolated strains. Strains such as S. albus, S. diastatochromogenes, S. fradiae, and S. lavendulae were the highest producing strains, and the amounts of beta-lactamase activity they produced were comparable to those produced by Bacillus cereus 569/H and B. licheniformis 749/C. In isoelectric focusing, most strains contained one main beta-lactamase band with a number of satellite bands, but some strains contained one band only. Although beta-lactamases from most strains showed isoelectric points of pH 5 to 6, some strains produced beta-lactamases with strongly basic isoelectric points of pH 8 to 9. Molecular weights were between 20,000 and 30,000. From these results, it is suggested that the proportion of the producing strains of Streptomyces and the properties of the beta-lactamases have not been affected significantly by the introduction of penicillin into the natural environment, in contrast to the cases of other microorganisms. PMID:666306

  19. Enzyme immunoassays in which biotinillated beta-lactamase is used for the detection of microbial antigens.

    PubMed

    Yolken, R H; Wee, S B

    1984-03-01

    The performance characteristics of enzyme immunoassays are determined to a great extent by the enzyme-substrate system utilized for the immunoassay. Beta-lactamases (penicillin amido-beta-lactamhydrolase EC 3.5.2.6) offer a number of advantages which might make them useful in immunoassay systems. We linked beta-lactamase from Bacillus cereus with biotin and used the biotinillated enzyme to devise immunoassay systems for the detection of a number of microbial antigens. An assay system in which antibodies to the polyribitol phosphate antigen of Haemophilus influenzae type b were used was capable of detecting between 0.4 and 1.6 ng of that antigen. Similarly, an assay in which antibodies to the common antigens of adenoviruses and biotin-linked beta-lactamase were used was capable of detecting between 1 and 10 50% tissue culture infective doses of a strain of enteric-type adenovirus. When applied to the detection of rotavirus, a similar system in which biotinillated beta-lactamase was used was capable of detecting small amounts of antigen in a standard rotavirus preparation. This assay could also detect virus in 36 of 37 stool specimens from children with rotavirus gastroenteritis. The positive specimens could easily be distinguished from negative ones by the naked eye, and a permanent record of the qualitative results could be obtained by the use of a standard office photocopying machine. Beta-lactamases have promise for use in practical enzyme immunoassay systems, especially in situations in which expensive colorimetric instrumentation is not available. PMID:6325489

  20. Inhibition of metallo-beta-lactamases by a series of mercaptoacetic acid thiol ester derivatives.

    PubMed Central

    Payne, D J; Bateson, J H; Gasson, B C; Proctor, D; Khushi, T; Farmer, T H; Tolson, D A; Bell, D; Skett, P W; Marshall, A C; Reid, R; Ghosez, L; Combret, Y; Marchand-Brynaert, J

    1997-01-01

    A series of mercaptoacetic acid thiol esters have been identified as metallo-beta-lactamase inhibitors. Electrospray mass spectrometry (ESMS) has shown that irreversible inhibition of the Bacillus cereus II metallo-beta-lactamase by SB214751, SB214752, and SB213079 was concomitant with a 90-Da increase in mass of the enzyme. Tryptic digestion of the B. cereus II inhibited with SB214751 illustrated that the peptide fragment, containing the only cysteine of the enzyme, had undergone a mass increment of 90 Da. It was further demonstrated that B. cereus II hydrolyzed this type of compound across the thiol ester bond to yield mercaptoacetic acid. Mercaptoacetic acid is the only molecular fragment common to SB214751, SB214752, and SB213079, and free mercaptoacetic acid does not bind covalently to B. cereus II. Therefore, it is concluded that these compounds inhibit B. cereus II by the mechanism-based delivery of mercaptoacetic acid, forming a disulfide linkage with the active sites cysteine (predicted mass shift = +90 Da) under the aerobic conditions of the assay. The different thiol esters examined had a broad range of potencies against the metallo-beta-lactamases tested. For example SB214751, SB214752, and SB213079 all had 50% inhibitory concentrations of < 10 and > 1,000 microM for the Stenotrophomonas maltophilia L-1 and Bacteroides fragilis CfiA enzymes, respectively. SB216968 was particularly active against the Aeromonas hydrophila CphA metallo-beta-lactamase and was found to be an uncompetitive inhibitor of this enzyme (Ki = 3.9 microM), whereas it exhibited irreversible inhibition of the L-1 enzyme. These observations with this series of compounds have revealed subtle differences between the active sites of different metallo-beta-lactamases. Finally, a novel application for isothermal titration calorimetry for assessing the zinc chelating activity of candidate inhibitors is also presented. PMID:8980769

  1. Detection of integrons and antibiotic-resistance genes in Salmonella enterica serovar Typhimurium isolates with resistance to ampicillin and variable susceptibility to amoxicillin-clavulanate.

    PubMed

    Güerri, María Luisa; Aladueña, Ana; Echeíta, Aurora; Rotger, Rafael

    2004-10-01

    We characterized 29 antimicrobial-resistant Salmonella enterica serovar Typhimurium strains, including four belonging to the monophasic variant 4,5,12:i:-, mostly isolated from infants. They were selected from 3230 strains isolated in the years 1990-2001 on the basis of resistance to ampicillin and variable susceptibility to the amoxicillin-clavulanate combination. Twenty-three strains were resistant to more than four antibiotics. All the strains carried the bla(TEM) gene and most were able to transfer this gene by conjugation. Sequencing of the gene from one of the amoxicillin-clavulanate-resistant strains allowed identification of the encoded beta-lactamase as TEM-1; all of these strains carried a second gene encoding beta-lactamase production, either pse-1 or oxa1. However, the association of bla(TEM) plus pse-1 genes did not always confer resistance to amoxicillin-clavulanate. The pse-1 gene, found in 17 strains, was located in the Salmonella Genomic Island-1 (SGI1), which carries two integrons and encodes multiple drug-resistance. None of the oxa1-bearing strains had the SGI1, yet this gene was found as part of an integron that also carried the aadA1 gene and was not plasmid-associated. Thirteen of the strains harbouring SGI1 belonged to the definitive phage type (DT) 104, and most of those remaining to DT104b and U302; particularly, strains carrying the oxa1-aadA1 integron belonged to the last two phage types. Pulsed field electrophoresis confirmed the clonal organization of DT104 strains, whereas U302 strains fell into different groups, depending on their resistance determinants.

  2. Extended-Spectrum Beta-Lactamase Bacteria From Urine Isolates in Children

    PubMed Central

    Degnan, Lisa A.; Milstone, Aaron M.; Diener-West, Marie

    2015-01-01

    OBJECTIVES: Multidrug-resistant Gram-negative bacteria, including extended-spectrum beta-lactamase (ESBL)–producing organisms, are a growing problem. The primary objective of this study was to describe the proportion of children with ESBL-producing urinary isolates at a tertiary medical center as well as these organisms' susceptibility patterns. The secondary objective was to identify the risk factors for acquiring ESBL urinary pathogens. METHODS: This retrospective study evaluated a cohort of children with ESBL urinary isolates, admitted to a tertiary children's hospital during a 6-year period. The proportion of patients with an ESBL-producing urinary isolate among all patients who grew a Gram-negative isolate is described together with the organism's susceptibility pattern. Patients with non-ESBL Gram-negative urinary organisms were used as a control group for identifying patient risk factors for ESBL. RESULTS: A total of 7.8% (29 of 370) of patients in our cohort grew Gram-negative urinary isolates with an ESBL strain. Most of the ESBL organisms isolated were sensitive to carbapenems (100% of ESBL organisms susceptible to ertapenem and 93.8% susceptible to meropenem) and amikacin (92.3% of ESBL organisms susceptible). Patients with longer hospitalization, recent antibiotic use, and recent intensive care unit admission were found to be at increased risk for ESBL organisms in the urine. CONCLUSIONS: When selecting empiric antibiotic therapy for suspected urinary tract infection in children, it may be prudent to consider the risk factors identified for acquiring an ESBL urinary pathogen. PMID:26472951

  3. A complex mutant of TEM-1 beta-lactamase with mutations encountered in both IRT-4 and extended-spectrum TEM-15, produced by an Escherichia coli clinical isolate.

    PubMed Central

    Sirot, D; Recule, C; Chaibi, E B; Bret, L; Croize, J; Chanal-Claris, C; Labia, R; Sirot, J

    1997-01-01

    Escherichia coli GR102 was isolated from feces of a leukemic patient. It expressed different levels of resistance to amoxicillin or ticarcillin plus clavulanate and to the various cephalosporins tested. The double-disk synergy test was weakly positive. Production of a beta-lactamase with a pI of 5.6 was transferred to E. coli HB101 by conjugation. The nucleotide sequence was determined by direct sequencing of the amplification products obtained by PCR performed with TEM gene primers. This enzyme differed from TEM-1 (blaT-1B gene) by four amino acid substitutions: Met-->Leu-69, Glu-->Lys-104, Gly-->Ser-238 and Asn-->Asp-276. The amino acid susbstitutions Leu-69 and Asp-276 are known to be responsible for inhibitor resistance of the IRT-4 mutant, as are Lys-104 and Ser-238 substitutions for hydrolytic activity of the extended-spectrum beta-lactamases TEM-15, TEM-4, and TEM-3. These combined mutations led to a mutant enzyme which conferred a level of resistance to coamoxiclav (MIC, 64 microg/ml) much lower than that conferred by IRT-4 (MIC, 2,048 microg/ml) but higher than that conferred by TEM-15 or TEM-1 (MIC, 16 microg/ml). In addition, the MIC of ceftazidime for E. coli transconjugant GR202 (1 microg/ml) was lower than that for E. coli TEM-15 (16 microg/ml) and higher than that for E. coli IRT-4 or TEM-1 (0.06 microg/ml). The MICs observed for this TEM-type enzyme were related to the kinetic constants Km and k(cat) and the 50% inhibitory concentration, which were intermediate between those observed for IRT-4 and TEM-15. In conclusion, this new type of complex mutant derived from TEM-1 (CMT-1) is able to confer resistance at a very low level to inhibitors and at a low level to extended-spectrum cephalosporins. CMT-1 received the designation TEM-50. PMID:9174192

  4. Comparison of rates of fecal colonization with extended-spectrum beta-lactamase-producing enterobacteria among patients in different wards, outpatients and medical students.

    PubMed

    Ebrahimi, Fatemeh; Mózes, Julianna; Monostori, Júlia; Gorácz, Orsolya; Fésűs, Adina; Majoros, László; Szarka, Krisztina; Kardos, Gábor

    2016-05-01

    Because asymptomatic carriage of extended-spectrum beta-lactamase (ESBL) producers is a risk factor for infection, data on colonization dynamics are important when planning infection control. This study investigated fecal colonization with ESBL producers among inpatients, outpatients and medical students and compares the characteristics of ESBL producers among these groups. Carriage rates were investigated in 5581 fecal samples; 4343 from inpatients (330, 1397, 619 and 1864 from adult ICUs [intensive care units], adult non-ICUs, pediatric ICUs and pediatric non-ICUs, respectively), 814 from outpatients and 424 from screening of medical students. ESBL producers were characterized by co-resistance, integrons carried, and aminoglycoside resistance and ESBL genes. Dynamic regression models were built to identify relationships between combinations of time series of monthly antibiotic consumption, prevalence of carriers and infected subjects. Inpatients, ICU patients and adults showed higher prevalence than outpatients, non-ICU patients or children (7.4%, 9.3% and 12.0% vs. 3.1%, 6.1% and 4.1%, respectively). Klebsiella pneumoniae was more frequent in ICU patients; dominance of CTX-M-15 producers was more marked in adult than in pediatric inpatients. ESBL carriage was shown to be a consequence of infection in adults in the time-series analysis; antibiotic consumption had little effect. The epidemiology of colonization with ESBL producers differed between pediatric ICU, adult ICU and adult non-ICU patients. In adults, carriage of ESBL producers seems to be the consequence of infection, especially in ICU patients; the main source of colonization is nosocomial acquisition. In contrast, children are less likely to acquire colonizer strains in hospitals; importation of ESBL producers by colonized children seems to be significant. PMID:26959958

  5. Crystal structure of the AmpR effector binding domain provides insight into the molecular regulation of inducible ampc beta-lactamase.

    PubMed

    Balcewich, Misty D; Reeve, Thomas M; Orlikow, Evan A; Donald, Lynda J; Vocadlo, David J; Mark, Brian L

    2010-07-30

    Hyperproduction of AmpC beta-lactamase (AmpC) is a formidable mechanism of resistance to penicillins and cephalosporins in Gram-negative bacteria such as Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is regulated by the LysR-type transcriptional regulator AmpR. ampR and ampC genes form a divergent operon with overlapping promoters to which AmpR binds and regulates the transcription of both genes. AmpR induces ampC by binding to one member of the family of 1,6-anhydro-N-acetylmuramyl peptides, which are cytosolic catabolites of peptidoglycan that accumulate during beta-lactam challenge. To gain structural insights into AmpR regulation, we determined the crystal structure of the effector binding domain (EBD) of AmpR from Citrobacter freundii up to 1.83 A resolution. The AmpR EBD is dimeric and each monomer comprises two subdomains that adopt alpha/beta Rossmann-like folds. Located between the monomer subdomains is a pocket that was found to bind the crystallization buffer molecule 2-(N-morpholino)ethanesulfonic acid. The pocket, together with a groove along the surface of subdomain I, forms a putative effector binding site into which a molecule of 1,6-anhydro-N-acetylmuramyl pentapeptide could be modeled. Amino acid substitutions at the base of the interdomain pocket either were found to render AmpR incapable of inducing ampC (Thr103Val, Ser221Ala and Tyr264Phe) or resulted in constitutive ampC expression (Gly102Glu). While the substitutions that prevented ampC induction did not alter the overall AmpR EBD structure, circular dichroism spectroscopy revealed that the nonconservative Gly102Glu mutation affected EBD secondary structure, confirming previous work suggesting that Gly102Glu induces a conformational change to result in constitutive AmpC production. PMID:20594961

  6. Infections due to beta-lactamase-producing Neisseria gonorrhoeae at the University Hospital Medical Center, Kuala Lumpur, Malaysia.

    PubMed

    Ismail, R

    1987-01-01

    The incidence of infections due to beta-lactamase-producing Neisseria gonorrhoeae is increasing in many parts of the world. An epidemiologic survey of infections caused by beta-lactamase-producing strains of N. gonorrhoeae at the University Hospital, Kuala Lumpur, from February 1977 to December 1985 (106 months) showed that the incidence rose from 4.8% (two cases) in 1977 to 49.4% (39 cases) by the end of 1985. The highest incidence of gonococcal infections was found to be in the group aged 20-39 years; the male-to-female ratio was 1.55:1. The mean inhibitory concentrations of benzylpenicillin were 0.12 microgram/ml for non-beta-lactamase-producing strains and 16 micrograms/ml for isolates of N. gonorrhoeae that produce beta-lactamase.

  7. Use of the beta-lactamase inhibitor clavulanic acid in the isolation of auxotrophic mutants of Bacillus licheniformis.

    PubMed Central

    Fields, P I; Schreier, H J; Saha, A L; Bernlohr, R W

    1984-01-01

    The isolation of auxotrophic mutants of Bacillus licheniformis, a microbe containing constitutive beta-lactamase activity, was found to be facilitated by the addition of clavulanic acid and cefotaxime during enrichment. PMID:6086590

  8. Ceftazidime/avibactam: a novel cephalosporin/nonbeta-lactam beta-lactamase inhibitor for the treatment of complicated urinary tract infections and complicated intra-abdominal infections

    PubMed Central

    Hidalgo, Jose A; Vinluan, Celeste M; Antony, Nishaal

    2016-01-01

    There has been greater interest in developing additional antimicrobial agents due to the increasing health care costs and resistance resulting from bacterial pathogens to currently available treatment options. Gram-negative organisms including Enterobacteriaceae and Pseudomonas aeruginosa are some of the most concerning threats due to their resistance mechanisms: extended-spectrum beta-lactamase production and Klebsiella pneumoniae carbapenemase enzymes. Ceftazidime is a third-generation broad-spectrum cephalosporin with activity against P. aeruginosa and avibactam is a novel nonbeta-lactam beta-lactamase inhibitor. Avycaz®, the trade name for this new combination antibiotic, restores the activity of ceftazidime against some of the previously resistant pathogens. Avycaz was approved in 2015 for the treatment of complicated urinary tract infections, including pyelonephritis, and complicated intra-abdominal infections with the addition of metronidazole in patients with little to no other treatment options. This review article assesses the clinical trials and data that led to the approval of this antibiotic, in addition to its spectrum of activity and limitations. PMID:27528799

  9. Ceftazidime/avibactam: a novel cephalosporin/nonbeta-lactam beta-lactamase inhibitor for the treatment of complicated urinary tract infections and complicated intra-abdominal infections.

    PubMed

    Hidalgo, Jose A; Vinluan, Celeste M; Antony, Nishaal

    2016-01-01

    There has been greater interest in developing additional antimicrobial agents due to the increasing health care costs and resistance resulting from bacterial pathogens to currently available treatment options. Gram-negative organisms including Enterobacteriaceae and Pseudomonas aeruginosa are some of the most concerning threats due to their resistance mechanisms: extended-spectrum beta-lactamase production and Klebsiella pneumoniae carbapenemase enzymes. Ceftazidime is a third-generation broad-spectrum cephalosporin with activity against P. aeruginosa and avibactam is a novel nonbeta-lactam beta-lactamase inhibitor. Avycaz(®), the trade name for this new combination antibiotic, restores the activity of ceftazidime against some of the previously resistant pathogens. Avycaz was approved in 2015 for the treatment of complicated urinary tract infections, including pyelonephritis, and complicated intra-abdominal infections with the addition of metronidazole in patients with little to no other treatment options. This review article assesses the clinical trials and data that led to the approval of this antibiotic, in addition to its spectrum of activity and limitations. PMID:27528799

  10. Antibacterial Activity of Some Plant Extracts Against Extended- Spectrum Beta-Lactamase Producing Escherichia coli Isolates

    PubMed Central

    Saeidi, Saeide; Amini Boroujeni, Negar; Ahmadi, Hassan; Hassanshahian, Mehdi

    2015-01-01

    Background: The extended-spectrum beta-lactamase (ESBL) -producing Escherichia coli isolates make many serious infections, especially urinary tract infections. Objectives: The purpose of this study was to determine the antibacterial activities of some natural plant extracts against ESBL-producing E. coli isolates, which harbor the TEM gene in urine samples of the patients who have urinary tract infections. Materials and Methods: Evaluation has to be exactly determined for both methods of disk diffusion test and polymerase chain reaction (PCR), separately. We evaluated 120 strains of E. coli isolates from the urine culture of the patients in Boo-Ali Hospital (Zahedan, south-eastern Iran) who were suffering from urinary tract infections. The ESBL-producing E. coli isolates were evaluated by disk diffusion test and PCR through TEM gene detection. The minimal inhibitory concentration (MIC) of commonly used antibiotics including ceftazidime, ceftriaxon, amikacin, gentamicin and ciprofloxacin along with the MIC of the alcoholic extract of different natural plants including Myrtus communis L (Myrtaceae), Amaranthus retraflexus (Amaranthaceae), Cyminum cuminum L (Apiaceae), Marrubium vulgare (Laminaceae) and Peganum. harmala (Zygrophyllaceae) against the ESBL-producing E. coli isolates, which harbor the TEM genes, were determined using the microdulition method. Results: Results of this study showed that in disk diffusion method, 80 samples of E. coli produced ESBLs. In PCR method, the TEM gene distribution in the isolated ESBL-producing organisms was 50 (41.6%). Amikacin was the most effective anti-bacterial agent and ciprofloxacin was the least effective against E. coli isolates. All the natural plant extracts mentioned above, especially P. harmala, were effective against the selected isolates of ESBL-producing E. coli. The most frequent ESBL rate producing E. coli isolates (32 out of 50) had MIC of 2.5 mg/mL in ethanol extract of P. harmala. Conclusions: The alcoholic

  11. Molecular epidemiology of TEM-3 (CTX-1) beta-lactamase.

    PubMed Central

    Petit, A; Gerbaud, G; Sirot, D; Courvalin, P; Sirot, J

    1990-01-01

    A total of 33 clinical isolates encoding TEM-3 (CTX-1) from four French hospitals were studied. The strains belonged to seven species, Klebsiella pneumoniae (n = 24), Escherichia coli (n = 3), Serratia marcescens (n = 2), Citrobacter freundii (n = 1), Enterobacter aerogenes (n = 1), Enterobacter cloacae (n = 1), and Klebsiella oxytoca (n = 1). All the strains harbored an Inc7 or M self-transferable plasmid with a size of approximately 85 kilobases. The plasmids had closely related EcoRI, HincII, HindIII, and PvuII restriction endonuclease-generated patterns and conferred resistance to all beta-lactams, except cephamycins and imipenem; to tetracycline, because of the presence of the genes blatem-3 and tetC, respectively, as determined by hybridization with specific probes; and to sulfonamide. Depending on the presence or absence and level of expression of the genes aacA4, aadA, and dfrI and of insertion element IS15, four types of plasmids could be distinguished. Plasmid pCFF04, the prototype plasmid encoding TEM-3, was widespread and appeared, by Southern hybridization, as the progenitor of the other types of replicons. The plasmid epidemic responsible for dissemination of TEM-3 in clinical isolates of members of the family Enterobacteriaceae may have originated in S. marcescens since pCFF04 was first detected in this species. Images PMID:2327769

  12. Active site peptide of beta-lactamase from Shigella flexneri UCSF-129.

    PubMed

    Campos, M; González, H; Bocaz, G; Vásquez, O

    1997-01-01

    The peptide containing the catalytic serine of beta-lactamase from Shigella flexneri was determined as V-D-E-R-F-P-M-M-S*-T-F-K. It is a local pathogenic strain which produces intestinal problems, especially in children. The highly purified enzyme was prepared by affinity chromatography in phenylboronic acid-agarose gels. The peptide was obtained by tryptic hydrolysis, with further purification by Bio-Gel P-4, Sephadex QAE-25 and Sephadex SP-25. The relevance of the serine, lysine and arginine residues was mainly shown by the loss of enzymatic activity after specific chemical modifications. Finally, this enzyme was classified as A, according to the similarity of this peptide with that of class A beta-lactamases such as R-TEM 1 and 2. PMID:9301069

  13. Motion of the Zinc Ions in Catalysis by a di-Zinc Metallo-beta-Lactamase

    SciTech Connect

    R Breece; Z Hu; M Crowder; D Tierney

    2011-12-31

    We report rapid-freeze-quench X-ray absorption spectroscopy of a dizinc metallo-beta-lactamase (MbetaL) reaction intermediate. The Zn(II) ions in the dinuclear active site of the S. maltophilia Class B3 MbetaL move away from each other, by approximately 0.3 A after 10 ms of reaction with nitrocefin, from 3.4 to 3.7 A. Together with our previous characterization of the resting enzyme and its nitrocefin product complex, where the Zn(II) ion separation relaxes to 3.6 A, these data indicate a scissoring motion of the active site that accompanies the ring-opening step. The average Zn(II) coordination number of 4.5 in the resting enzyme appears to be maintained throughout the reaction with nitrocefin. This is the first direct structural information available on early stage dizinc metallo-beta-lactamase catalysis.

  14. Effects of phenotype and genotype on methods for detection of extended-spectrum-beta-lactamase-producing clinical isolates of Escherichia coli and Klebsiella pneumoniae in Norway.

    PubMed

    Tofteland, Ståle; Haldorsen, Bjørg; Dahl, Kristin H; Simonsen, Gunnar S; Steinbakk, Martin; Walsh, Timothy R; Sundsfjord, Arnfinn

    2007-01-01

    Consecutive clinical isolates of Escherichia coli (n = 87) and Klebsiella pneumoniae (n = 25) with reduced susceptibilities to oxyimino-cephalosporins (MICs > 1 mg/liter) from 18 Norwegian laboratories during March through October 2003 were examined for bla(TEM/SHV/CTX-M) extended-spectrum-beta-lactamase (ESBL) genes, oxyimino-cephalosporin MIC profiles, ESBL phenotypes (determined by the ESBL Etest and the combined disk and double-disk synergy [DDS] methods), and susceptibility to non-beta-lactam antibiotics. Multidrug-resistant CTX-M-15-like (n = 23) and CTX-M-9-like (n = 15) ESBLs dominated among the 50 ESBL-positive E. coli isolates. SHV-5-like (n = 9) and SHV-2-like (n = 4) ESBLs were the most prevalent in 19 ESBL-positive K. pneumoniae isolates. Discrepant ESBL phenotype test results were observed for one major (CTX-M-9) and several minor (TEM-128 and SHV-2/-28) ESBL groups and in SHV-1/-11-hyperproducing isolates. Negative or borderline ESBL results were observed when low-MIC oxyimino-cephalosporin substrates were used to detect clavulanic acid (CLA) synergy. CLA synergy was detected by the ESBL Etest and the DDS method but not by the combined disk method in SHV-1/-11-hyperproducing strains. The DDS method revealed unexplained CLA synergy in combination with aztreonam and cefpirome in three E. coli strains. The relatively high proportion of ESBL-producing E. coli organisms with a low ceftazidime MIC in Norway emphasizes that cefpodoxime alone or both cefotaxime and ceftazidime should be used as substrates for ESBL detection. PMID:17079502

  15. Analysis of Yersinia enterocolitica Effector Translocation into Host Cells Using Beta-lactamase Effector Fusions.

    PubMed

    Wolters, Manuel; Zobiak, Bernd; Nauth, Theresa; Aepfelbacher, Martin

    2015-01-01

    Many gram-negative bacteria including pathogenic Yersinia spp. employ type III secretion systems to translocate effector proteins into eukaryotic target cells. Inside the host cell the effector proteins manipulate cellular functions to the benefit of the bacteria. To better understand the control of type III secretion during host cell interaction, sensitive and accurate assays to measure translocation are required. We here describe the application of an assay based on the fusion of a Yersinia enterocolitica effector protein fragment (Yersinia outer protein; YopE) with TEM-1 beta-lactamase for quantitative analysis of translocation. The assay relies on cleavage of a cell permeant FRET dye (CCF4/AM) by translocated beta-lactamase fusion. After cleavage of the cephalosporin core of CCF4 by the beta-lactamase, FRET from coumarin to fluorescein is disrupted and excitation of the coumarin moiety leads to blue fluorescence emission. Different applications of this method have been described in the literature highlighting its versatility. The method allows for analysis of translocation in vitro and also in in vivo, e.g., in a mouse model. Detection of the fluorescence signals can be performed using plate readers, FACS analysis or fluorescence microscopy. In the setup described here, in vitro translocation of effector fusions into HeLa cells by different Yersinia mutants is monitored by laser scanning microscopy. Recording intracellular conversion of the FRET reporter by the beta-lactamase effector fusion in real-time provides robust quantitative results. We here show exemplary data, demonstrating increased translocation by a Y. enterocolitica YopE mutant compared to the wild type strain. PMID:26484613

  16. High-level carbapenem resistance in a Citrobacter freundii clinical isolate is due to a combination of KPC-2 production and decreased porin expression.

    PubMed

    Zhang, Rong; Yang, Lijiang; Cai, Jia Chang; Zhou, Hong Wei; Chen, Gong-Xiang

    2008-03-01

    An imipenem-resistant isolate of Citrobacter freundii ZJ163 (MIC 256 microg ml(-1)) isolated from a Chinese hospital was investigated. The C. freundii ZJ163 isolate exhibited high-level resistance to carbapenems, penicillins, cephalosporins, cefoxitin, aztreonam, quinolones and aminoglycosides. Isoelectric focusing (IEF) demonstrated three beta-lactamases with pIs of 5.4 (TEM-1), 6.7 (KPC-2) and 7.9 (CTX-M-14). Two different transconjugants (types A and B) were obtained by conjugation studies. The type A transconjugant exhibited reduced susceptibility or resistance to penicillins, cephalosporins and aztreonam, but was susceptible to carbapenems, quinolones and aminoglycosides. The antimicrobial susceptibility patterns of the type B transconjugant were similar to that of type A, except for its significantly reduced carbapenem susceptibility (imipenem MIC 2 microg ml(-1)). IEF, specific PCRs and DNA sequence analysis indicated that the type A transconjugant produced CTX-M-14 beta-lactamase with a pI of 7.9, that the type B transconjugant produced KPC-2 beta-lactamase with a pI of 6.7 and that the beta-lactamase with a pI of 5.4 was TEM-1. PCR analysis and sequencing confirmed the presence of the ampC gene in the chromosomal DNA from C. freundii ZJ163, although no activity of AmpC beta-lactamase was detected by IEF. Urea/SDS-PAGE analysis of outer-membrane proteins revealed that the levels of the 41 and 38 kDa porins were decreased in C. freundii ZJ163. It was concluded that production of KPC-2 combined with decreased expression of porins contributes to high-level resistance to carbapenems in C. freundii ZJ163.

  17. Ongoing increasing temporal and geographical trends of the incidence of extended-spectrum beta-lactamase-producing Enterobacteriaceae infections in France, 2009 to 2013.

    PubMed

    Arnaud, Isabelle; Maugat, Sylvie; Jarlier, Vincent; Astagneau, Pascal

    2015-01-01

    Extended-spectrum beta-lactamase-producing Enterobacteriaceae (ESBL-E) are a major focus of multidrug-resistant organisms (MRO) surveillance programmes in France. To describe the temporal and geographical trends of these pathogens, we conducted an epidemiological study based on data extracted from the nationwide MRO surveillance network from 2009 to 2013. During this time, the incidence of ESBL-E infections in French hospitals increased by 73%, from 0.35 to 0.60 per 1,000 patient days (PD) (p<0.001) and ESBL-E bacteraemia by 77%, from 0.03 to 0.05 per 1,000 PD (p<0.001). The incidence of ESBL-E infections was higher in intensive-care units (1.62 to 2.44 per 1,000 PD (p<0.001)) than in recovery and long-term care facilities (0.20 to 0.31 per 1,000 PD (p<0.001)). Escherichia coli was the most frequent extended-spectrum beta-lactamase-producing (ESBL) pathogen, representing 59% (26,238/44,425) of all ESBL isolates, followed by Klebsiella pneumoniae (20%; 8,856/44,425) in 2013. The most frequent infection was urinary tract infection, for all species. The incidence of ESBL-E varied by region but showed an upward trend overall. Reinforcement of control measures for halting the spread of such MRO is crucial.

  18. An Ultrahigh Resolution Structure of TEM-1 beta-Lactamase Suggests a Role for Glu166 as the General Base in Acylation

    SciTech Connect

    Minasov, George; Wang, Xiaojun; Shoichet, Brian K.

    2010-03-08

    Although TEM-1 {beta}-lactamase is among the best studied enzymes, its acylation mechanism remains controversial. To investigate this problem, the structure of TEM-1 in complex with an acylation transition-state analogue was determined at ultrahigh resolution (0.85 {angstrom}) by X-ray crystallography. The quality of the data was such as to allow for refinement to an R-factor of 9.1% and an R{sub free} of 11.2%. In the resulting structure, the electron density features were clear enough to differentiate between single and double bonds in carboxylate groups, to identify multiple conformations that are occupied by residues and loops, and to assign 70% of the protons in the protein. Unexpectedly, even at pH 8.0 where the protein was crystallized, the active site residue Glu166 is clearly protonated. This supports the hypothesis that Glu166 is the general base in the acylation half of the reaction cycle. This structure suggests that Glu166 acts through the catalytic water to activate Ser70 for nucleophilic attack on the {beta}-lactam ring of the substrate. The hydrolytic mechanism of class A {beta}-lactamases, such as TEM-1, appears to be symmetrical, as are the serine proteases. Apart from its mechanistic implications, this atomic resolution structure affords an unusually detailed view of the structure, dynamics, and hydrogen-bonding networks of TEM-1, which may be useful for the design of inhibitors against this key antibiotic resistance target.

  19. [Examination of metallo-beta-lactamase-producing different types of Serratia marcescens detected in the same patient].

    PubMed

    Takamitsu, Ito; Fukui, Yasuo; Ono, Noriaki; Ikeda, Fumiaki; Kanayama, Akiko; Kobayashi, Intetsu

    2013-03-01

    Metallo-beta-lactamase (MBL) producing Serratia marcescens isolate was recovered from a study patient in September, 2007 in whom MBL non-producing S. marcescens had been isolated 2 months previously. Two S. marcescens isolates recovered from the study patient showed the same pulsed-field gel electrophoresis (PFGE) pattern. Seven S. marcescens isolates were recovered from other patients in our hospital during August, 2007 and November, 2007. Five of the seven isolates produced MBL. All of the MBL-producing isolates showed the same PFGE pattern and harbored plasmids of the same size and bla(IMP) genes. The bla(IMP) genes were easily transferred to Escherichia coli DH5alpha by transformation of a plasmid purified from the MBL-producing isolate. Those transformation experiments suggested that bla(IMP) genes were encoded by the plasmid. From these observations, it was speculated that the MBL non-producing S. marcescens isolate recovered from the study patient had acquired the plasmid which encoded bla(IMP) genes and a monoclone of MBL-producing S. marcescens spread horizontally in our hospital.

  20. Dissemination of Proteus mirabilis isolates harboring CTX-M-14 and CTX-M-3 beta-lactamases at 2 hospitals in Taiwan.

    PubMed

    Wu, Lii-Tzu; Wu, Hwa-Jen; Chung, Jing-Gung; Chuang, Yin-Ching; Cheng, Kuo-Chen; Yu, Wen-Liang

    2006-02-01

    From February to June 2003, 111 clinical isolates of Proteus mirabilis were mainly isolated from patients with respiratory or urinary tract infections hospitalized at 3 district hospitals (A, B, C) in central Taiwan. Among them, 34 (30.6%) strains, isolated within 2 hospitals (A and B), exhibited nonsusceptibility to cefotaxime with significant reduction of MIC (> or = 3 log2 dilution) by the effect of clavulanic acid, which confirmed the phenotype of extended-spectrum beta-lactamases (ESBLs). These ESBL producers were coresistant to gentamicin, isepamicin, and amikacin, but remained susceptible to ceftazidime (MIC, < or = 0.5 microg/mL) and meropenem (MIC, <0.5 microg/mL). By isoelectric focusing analysis, polymerase chain reaction, and nucleotide sequencing, we detected the presence of CTX-M-14 in 33 strains and CTX-M-3 in 6 strains (5 strains harboring both CTX-M-14 and CTX-M-3 enzymes). These beta-lactamase genes can be successfully transferred by the conjugative plasmid. Molecular epidemiology of the 34 ESBL-producing P. mirabilis strains by pulsed-field gel electrophoresis using SfiI restriction enzyme revealed 9 different genotypes, suggesting epidemic clones with intra- and interhospital spread. In conclusion, the broadly extended clonal spreading of CTX-M-type P. mirabilis was first discovered at the district hospitals in Taiwan.

  1. Microbiological Screening Is Necessary to Distinguish Carriers of Plasmid-Mediated AmpC Beta-Lactamase-Producing Enterobacteriaceae and Extended-Spectrum Beta-Lactamase (ESBL)-Producing Enterobacteriaceae because of Clinical Similarity

    PubMed Central

    Conen, Anna; Frei, Reno; Adler, Hildegard; Dangel, Marc; Fux, Christoph A.; Widmer, Andreas F.

    2015-01-01

    Objectives Plasmid-mediated AmpC beta-lactamase-producing (pAmpC) Enterobacteriaceae are increasing worldwide, difficult to identify and often confounded with extended-spectrum beta-lactamase (ESBL) producers. The low prevalence precludes routine universal admission screening. Therefore, we evaluated potential risk factors for carriage of pAmpC-producing Enterobacteriaceae that would allow targeted screening to improve yield and reduce cost. Patients and methods We performed a case control study at a tertiary care center from 1/2006 to 12/2010. Cases were adult patients in whom pAmpC-producing Enterobacteriaceae were isolated; controls were chosen among carriers of ESBL-producing Enterobacteriaceae. Both infected and colonized patients were included. Results Over five years, we identified 40 pAmpC producers in 39 patients among 16,247 screened consecutive isolates of Enterobacteriaceae. The pAmpC prevalence was low (0.25%), but more than 30% of pAmpC carriers received incorrect empirical antibiotic treatment. When compared with 39 ESBL controls, pAmpC carriage was associated with clinically confirmed infections in 74% (versus 51%) (p=0.035), mainly of the urinary tract, previous antibiotic exposure in 63% (versus 36%) (p=0.035) and carriage of a nasogastric tube in 23% (versus 0%) (p=0.002). In the multivariate regression analysis only clinically confirmed infections remained significantly associated with pAmpC carriage (OR 1.44 (95%CI 1.15-2.57)). No other clinical and blood test-associated risk factor allowed discrimination of pAmpC-carrying patients from ESBL controls. The type of acquisition – nosocomial versus community-acquired – was also non-informative for resistance type, as 46% of pAmpC- and 44% of ESBL-producing Enterobacteriaceae were community-acquired. Conclusions This study could not identify a clinical profile that would allow targeted screening for pAmpC-producing Enterobacteriaceae when compared to ESBL carriers. Because empiric antimicrobial

  2. Influence of beta-lactamase inhibitors on the potency of their companion drug with organisms possessing class I enzymes.

    PubMed

    Cavalieri, S J; Sanders, C C; New, C

    1991-07-01

    The ability of beta-lactamase inhibitors to induce class I beta-lactamases in certain organisms in vitro suggests a potential for antagonism in vivo. Therefore, a study was designed to assess the ability of sulbactam and clavulanate to induce beta-lactamases in two strains each of Enterobacter cloacae, Citrobacter freundii, Serratia marcescens, and Pseudomonas aeruginosa both in vitro and in vivo. Induction in vitro was observed only with S. marcescens and P. aeruginosa and generally only when inhibitor concentrations greater than 2 micrograms/ml were examined. A mouse model of lethal infection, designed to detect in vivo antagonism arising from beta-lactamase induction, was used to determine what effect sulbactam and clavulanate would have on the 50% protective doses (PD50s) of cefoperazone and ticarcillin. Antagonism (a significant increase in the PD50) was observed in only 4 of 32 tests. Three of these involved antagonism of cefoperazone by clavulanate, and one involved antagonism of cefoperazone by sulbactam. In 6 of 32 tests, enhancement of efficacy (a significant decrease in PD50) was observed. In four of these, sulbactam enhanced cefoperazone; in one, sulbactam enhanced ticarcillin; and in one, clavulanate enhanced ticarcillin. Four of the six cases of enhancement occurred when the beta-lactamase inhibitor was given at the time of challenge. None of these positive or negative in vivo effects were predicted by in vitro tests. These data suggest that beta-lactamase inhibitors can influence the in vivo potency of their companion drug in both a beneficial and detrimental fashion against organisms with class I beta-lactamases and that these effects cannot be predicted from in vitro assays.

  3. Expression of the AsbA1, OXA-12, and AsbM1 beta-lactamases in Aeromonas jandaei AER 14 is coordinated by a two-component regulon.

    PubMed Central

    Alksne, L E; Rasmussen, B A

    1997-01-01

    Aeromonas jandaei AER 14 (formerly Aeromonas sobria AER 14) expresses three inducible beta-lactamases, AsbA1, OXA-12 (AsbB1), and AsbM1. Mutant strains that constitutively overexpress all three enzyme simultaneously, suggesting that they share a common regulatory pathway, have been isolated. Detectable expression of the cloned genes of AsbA1 and OXA-12 in some Escherichia coli K-12 laboratory strains is achieved only in the presence of a blp mutation. These mutations map to the cre operon at 0 min, which encodes a classical two-component regulatory system of unknown function. Two regulatory elements from A. jandaei which permit high-level constitutive expression of OXA-12 in E. coli were cloned. Both loci encode proteins with characteristics of response regulator proteins of two-component regulatory systems. One of these loci, designated blrA, bestowed constitutive expression of all three beta-lactamases in A. jandaei AER 14 when present on a multicopy plasmid, confirming its role in the regulatory pathway of beta-lactamase production in this organism. PMID:9068648

  4. [Clinical study of the urinary tract infections due to Escherichia coli harboring extended-spectrum beta lactamase].

    PubMed

    Hori, Junichi; Yamaguchi, Satoshi; Osanai, Hiroaki; Kinebuchi, Takahiro; Usami, Kazuo; Takahashi, Naoshi; Ishii, Yoshikazu

    2007-11-01

    Multiple drug resistance is one of the problems associated with the treatment of urinary tract infection. Urine bacterial culture confirmed extended-spectrum beta lactamase (ESBL)-producing Escherichia coli in 56 patients in the Department of Urology, Hokkaido Social Welfare Association Furano Hospital. The mean age of the patients was 83 years, and the male-to-female ratio was 1:2. The source of infection was cystitis in 51 patients and pyelonephritis in 5 patients. The most common underlying disease was neurogenic bladder in 42 patients, and a urinary tract catheter had been placed in 33 patients. Before the detection of ESBL-producing E. coli, common bacteria included E. coli, Enterococcus, and Pseudomonas. ESBL-producing E. coli were sensitive to the following antibiotics: carbapenem; cephamycin; aminoglycoside; and synthesized penicillin. ESBL-producing E. coli are resistant to multiple drugs. The use of urinary tract catheterization and antibiotics for asymptomatic urinary tract infection should be kept to a minimum. PMID:18051801

  5. Characteristics of extended-spectrum β-lactamase (ESBL)- and pAmpC beta-lactamase-producing Enterobacteriaceae of water samples in Tunisia.

    PubMed

    Ben Said, Leila; Jouini, Ahlem; Alonso, Carla Andrea; Klibi, Naouel; Dziri, Raoudha; Boudabous, Abdellatif; Ben Slama, Karim; Torres, Carmen

    2016-04-15

    The presence of extended-spectrum beta-lactamase and plasmid-mediated AmpC beta-lactamase producing Enterobacteriaceae (ESBL-Eb and pAmpC-Eb, respectively) was analyzed in 57 wastewater and 57 surface-water samples in Tunisia. Twenty-four of the 57 wastewater samples (42.1%) and one of the 57 surface-water samples (1.7%, a river that received effluents of a wastewater-treatment-plant) contained ESBL-Eb or pAmpC-Eb; one ESBL/pAmpC-Eb per positive sample was further characterized. Beta-lactamase genes detected were as follows: blaCTX-M-1 (10 Escherichia coli),blaCTX-M-15 (eight E. coli, one Klebsiella pneumoniae, one Citrobacter freundii), blaCTX-M-14 (one E. coli) and blaCMY-2 (four E. coli). The blaTEM-1, blaOXA-1 or blaSHV-1 genes were also found in 72% of these isolates. The ISEcp1, orf477 or IS903 sequences were found upstream or downstream of blaCTX-M genes. Class 1 integrons were present in 16 of the 25 ESBL-Eb/pAmpC-Eb strains (64%), and contained five different gene-cassette arrays. Most of the strains (76%) showed a multiresistant phenotype and qnr genes were identified in four strains. Molecular typing of ESBL/CMY-2-producing E. coli isolates showed 23 different PFGE-patterns and 15 different sequence-types (ST10, ST46, ST48, ST58, ST69, ST101, ST117, ST131, ST141, ST288, ST359, ST399, ST405, ST617, and the new ST4530); these strains were ascribed to phylogroups A (11 isolates), B1 (3 isolates), D (6 isolates) and B2 (3 isolates). From one to five plasmids were detected in each strain (size from 30kb to >240kb) and ESBL or pAmpC genes were transferred by conjugation in 69.5% of the E. coli strains. In conclusion, ESBL-Eb and pAmpC-Eb strains are frequently detected in wastewater samples and they might be a source for dissemination in other environments with repercussion in public health.

  6. Inducible expression of the chromosomal cdiA from Citrobacter diversus NF85, encoding an ambler class A beta-lactamase, is under similar genetic control to the chromosomal ampC, encoding an ambler class C enzyme, from Citrobacter freundii OS60.

    PubMed

    Jones, M E; Bennett, P M

    1995-01-01

    This study aimed to characterize the molecular basis of beta-lactamase induction in Citrobacter diversus. The chromosomal beta-lactamase encoding region from C. diversus, strain NF85, was cloned and expressed in Escherichia coli. The cloned region was sequenced and open-reading frames encoding a class A beta-lactamase, designated cdiA, and a putative LysR-type transcriptional regulator protein, divergently transcribed from the beta-lactamase gene and designated cdiR, were identified. The nucleotide sequence of the NF85 cdiA was identical to that of the published C. diversus ULA27 ampC sequence. A putative helix-turn-helix DNA-binding motif was located at the N-terminus of CdiR, and homology with enterobacterial AmpR proteins was noted. CdiR was demonstrated to bind to the C. diversus cdiAR intergenic region but not to the C. freundii ampCR intergenic region. A putative CdiR binding motif was identified in the cdiAR intergenic region. The cloned cdiAR region was inducible in E. coli strains SNO3 and HfrH. The inducible phenotype was dependent on the E. coli ampD and ampG gene products. We conclude that the molecular basis of inducible cdiA expression in C. diversus is similar to that of C. freundii ampC.

  7. Refined models of New Delhi metallo-beta-lactamase-1 with inhibitors: an QM/MM modeling study.

    PubMed

    Wang, Yeng-Tseng; Cheng, Tian-Lu

    2016-10-01

    New Delhi metallo-beta-lactamase 1 (NDM-1) has been identified as a potential target for the treatment of multi-drug resistance bacterial infections. We used molecular docking, normal MD, SIE, QM/MM MD simulations, QM/MM GBSA binding free energy, and QM/MM GBSA alanine-scanning mutagenesis techniques to investigate interactions of the NDM-1 with 11 inhibitors (Tigecycline, BAL30072, D-captopril, Penicillin G, Ampicillin, Carbenicillin, Cephalexin, Cefaclor, Nitrocefin, Meropenem, and Imipenem). From our normal MD and QM/MM simulations, the correlation coefficients between the predicted binding free energies and experimental values are .88 and .93, respectively. Then simulations, which combined QM/MM/GBSA and alanine-scanning mutagenesis techniques, were performed and our results show that two residues (Lys211 and His250) have the strongest impact on the binding affinities of the 11 NDM-1/inhibitors. Therefore, our approach theoretically suggests that the two residues (Lys211 and His250) are responsible for the selectivity of NDM-1 associated inhibitors. PMID:26488313

  8. Beta-lactamase-free penicillin amidase from Alcaligenes sp.: isolation strategy, strain characteristics, and enzyme immobilization.

    PubMed

    Pal, A; Samanta, T B

    1999-11-01

    Isolation and characterization of a beta-lactamase (EC 3.5.2.6)-free, penicillin amidase (penicillin amidohydrolase, EC 3.5.1. 11)-producing organism is reported. The test strain was isolated by an enrichment technique with a substrate other than penicillins. The isolated strain belongs to the genus Alcaligenes. Phenylacetic acid was found to be the inducer of penicillin amidase. The amidase has a broad substrate spectrum. It is very active against penicillin G and semisynthetic cephalosporins, whereas penicillin V and semisynthetic penicillins acted moderately as a substrate. Immobilized cells of Alcaligenes sp. were shown to act as a reversible enzyme. PMID:10489431

  9. Vibrio cholerae MARTX toxin heterologous translocation of beta-lactamase and roles of individual effector domains on cytoskeleton dynamics.

    PubMed

    Dolores, Jazel S; Agarwal, Shivani; Egerer, Martina; Satchell, Karla J F

    2015-02-01

    The Vibrio cholerae MARTXVc toxin delivers three effector domains to eukaryotic cells. To study toxin delivery and function of individual domains, the rtxA gene was modified to encode toxin with an in-frame beta-lactamase (Bla) fusion. The hybrid RtxA::Bla toxin was Type I secreted from bacteria; and then Bla was translocated into eukaryotic cells and delivered by autoprocessing, demonstrating that the MARTXVc toxin is capable of heterologous protein transfer. Strains that produce hybrid RtxA::Bla toxins that carry one effector domain in addition to Bla were found to more efficiently translocate Bla. In cell biological assays, the actin cross-linking domain (ACD) and Rho-inactivation domain (RID) are found to cross-link actin and inactivate RhoA, respectively, when other effector domains are absent, with toxin autoprocessing required for high efficiency. The previously unstudied alpha-beta hydrolase domain (ABH) is shown here to activate CDC42, although the effect is ameliorated when RID is also present. Despite all effector domains acting on cytoskeleton assembly, the ACD was sufficient to rapidly inhibit macrophage phagocytosis. Both the ACD and RID independently disrupted polarized epithelial tight junction integrity. The sufficiency of ACD but strong selection for retention of RID and ABH suggests these two domains may primarily function by modulating cell signaling.

  10. Design, synthesis, and evaluation of 2 beta-alkenyl penam sulfone acids as inhibitors of beta-lactamases.

    PubMed

    Richter, H G; Angehrn, P; Hubschwerlen, C; Kania, M; Page, M G; Specklin, J L; Winkler, F K

    1996-09-13

    A general method for synthesis of 2 beta-alkenyl penam sulfones has been developed. The new compounds inhibited most of the common types of beta-lactamase. The level of activity depended very strongly on the nature of the substituent in the 2 beta-alkenyl group. The inhibited species formed with the beta-lactamase from Citrobacter freundii 1205 was sufficiently stable for X-ray crystallographic studies. These, together with UV absorption spectroscopy and studies of chemical degradation, suggested a novel reaction mechanism for the new inhibitors that might account for their broad spectrum of action. The (Z)-2 beta-acrylonitrile penam sulfone Ro 48-1220 was the most active inhibitor from this class of compound. The inhibitor enhanced the action of, for example, ceftriaxone against a broad selection of organisms producing beta-lactamases. The organisms included strains of Enterobacteriaceae that produce cephalosporinases, which is an exceptional activity for penam sulfones.

  11. Individual use of antibiotics and prevalence of beta-lactamase production among bacterial pathogens from middle ear fluid.

    PubMed

    Thrane, N; Olesen, C; Sørensen, H T; Schønheyder, H C

    2001-02-01

    Prescription data and clinical laboratory data were analysed to assess the influence of previous antibiotic therapy on the prevalence of beta-lactamase in isolates of Haemophilus influenzae and Moraxella catarrhalis from primary specimens of middle ear fluid from 2129 children aged 0-5 years. The prevalence of beta-lactamase-positive H. influenzae was 6.6% [95% confidence interval (CI): 3.5-9.8%] in children who received antibiotics 5-90 days before isolation of the organism compared with 7.0% (95% CI: 3.9-10.2%) in those who did not. The prevalence of beta-lactamase-positive M. catarrhalis was 90.9% (95% CI: 84.0-97.8%) in children who received antibiotics compared with 86.7% (95% CI: 79.0-94.4%) in those who did not.

  12. Prospective survey of colonization and infection caused by expanded-spectrum-beta-lactamase-producing members of the family Enterobacteriaceae in an intensive care unit.

    PubMed Central

    De Champs, C; Sauvant, M P; Chanal, C; Sirot, D; Gazuy, N; Malhuret, R; Baguet, J C; Sirot, J

    1989-01-01

    The occurrence of expanded-spectrum-beta-lactamase-producing strains was prospectively studied in 56 patients in an intensive care unit. Ten patients were infected or colonized; some of these patients had asymptomatic intestinal colonization. Four different expanded-spectrum beta-lactamases were identified and used as epidemiological markers to survey nosocomial infections. PMID:2592552

  13. High Prevalence of Escherichia coli-Producing CTX-M-15 Extended-Spectrum Beta-Lactamases in Poultry and Human Clinical Isolates in Romania.

    PubMed

    Maciuca, Iuliana E; Williams, Nicola J; Tuchilus, Cristina; Dorneanu, Olivia; Guguianu, Eleonora; Carp-Carare, Catalin; Rimbu, Cristina; Timofte, Dorina

    2015-12-01

    Use of antibiotics in food animals may contribute to development and spread of resistant organisms, particularly so in some countries. The aim of this study was two-fold; first, to establish the prevalence of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli in chicken production in a region within Romania. Second, to study the relatedness of ESBL-producing E. coli isolates recovered from broilers, abattoir workers where the chickens were slaughtered and from the human clinical specimens from two regional hospitals. The results indicated a very high (69%) rate of carriage of ESBL and AmpC-producing E. coli in chickens with 36% CTX-M producers. Sequencing showed that chickens in Romania have the highest worldwide prevalence (53%) of blaCTX-M-15 reported in poultry E. coli isolates. The majority (53%) of the extended-spectrum cephalosporin-resistant E. coli carried plasmid-mediated blaampC genes, mostly blaCMY-2 type, one of the highest prevalences reported in Europe. The predominant CTX-M type found in the human clinical E. coli isolates was blaCTX-M-15 and most isolates coharbored blaOXA-1, blaTEM, and aac(6')-ib-cr. The majority (60%) of the human clinical isolates belonged to the pandemic virulent clone B2-ST131. The clonal relationship between broiler and the human CTX-M-producing E. coli isolates was assessed by macrorestriction pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST), which indicated strain diversity with no common STs found between human and poultry isolates. Moreover, IncI1 was the most prevalent replicon found in broiler ESBL-producing E. coli isolates and also in transconjugants, indicating that plasmids and not clonal spread may play a role in the transfer of blaCTX-M genes. This study identifies a high prevalence of ESBL-producing E. coli from broiler chickens in Romania with a high occurrence incidence of blaCTX-M-15, which reflects the main ESBL type found in human E. coli infections in this

  14. Cefotaxime-resistant Citrobacter freundii in isolates from blood in a tertiary teaching hospital in Northern Taiwan.

    PubMed

    Liu, Chang-Pan; Weng, Li-Chuan; Tseng, Hsiang-Kuang; Wang, Nai-Yu; Lee, Chun-Ming

    2007-10-01

    From January 2002 to December 2003, 12 patients in a tertiary teaching hospital in northern Taiwan had bloodstream infections caused by Citrobacter freundii. Seven of the 12 isolates were resistant to cefotaxime. Using polymerase chain reaction and DNA sequencing, 3 of the 7 cefotaxime-resistant C. freundii isolates were found to carry extended-spectrum beta-lactamase (ESBL). AmpC beta-lactamase genes were also detected in all strains of C. freundii. All strains of C. freundii with MICs >or=4 mg/L for cefepime were positive for ESBL. Rather than performing PCR on all cefotaxime-resistant C. freundii isolates, assessment of the MIC for cefepime might be a practical way to choose between treatment with cefepime or with carbapenems.

  15. High prevalence and risk factors of fecal carriage of CTX-M type extended-spectrum beta-lactamase-producing Enterobacteriaceae from healthy rural residents of Taian, China

    PubMed Central

    Zhang, Hongna; Zhou, Yufa; Guo, Shuyuan; Chang, Weishan

    2015-01-01

    The study was carried out to understand the prevalence of CTX-M type extended-spectrum beta-lactamase (ESBL)-harboring Enterobacteriaceae and to analyze risk factors related with fecal carriage in healthy rural residents in Taian, China. A total of 620 stool samples were collected from rural residents. The ESBL-positive Enterobacteriaceae was screened using ChromID ESBL agar, and then further confirmed by double-disk diffusion. The CTX-M genes were determined using polymerase chain reaction. The risk factors associated with fecal carriage of CTX-M-positive isolates were analyzed using the standard statistic methods. 458 isolates carrying CTX-M gene (458/620, 73.9%) were obtained from different individuals, and the most dominant genotype was CTX-M-9 group (303/458, 66.2%). The dominant species were Escherichia coli (E. coli; 403/458, 88.0%) and Klebsiella pneumoniae (K. pneumoniae; 26/458, 5.7%) among the isolates carrying CTX-M genes. All the CTX-M producers were resistant to ampicillin, cefazolin, cefuroxime, and ceftriaxone, but were all susceptible to biapenem, imipenem, and meropenem. The results of multivariate logistic regression model identified the enrollment in formal education (OR 2.321; 95% CI 1.302–3.768; P= 0.039), the hospitalization history within the last 6 months (OR 1.753; 95% CI 1.127–2.584; P= 0.031) and the antibiotics use within the last 6 months (OR 1.892; 95% CI 1.242–2.903; P= 0.034). The three variables were significantly associated with carriage of CTX-M ESBL producers (x2 = 21.21; df = 3; P< 0.001). The prevalence of fecal carriage of CTX-M ESBL-producing Enterobacteriaceae among healthy rural humans in Taian was high, and the recent antibiotic use and hospitalization history may be the important contributors. PMID:25870591

  16. Dissemination and spread of CTX-M extended-spectrum beta-lactamases among clinical isolates of Klebsiella pneumoniae in central China.

    PubMed

    Li, Cong-Rong; Li, Yan; Zhang, Pin-An

    2003-11-01

    Of 50 extended-spectrum beta-lactamase-producing (ESBL) isolates of Klebsiella pneumoniae collected from six hospitals in Hubei Province, 20 were found to produce CTX-M ESBLs (40%). Sequence analysis of the six isolates carrying bla(CTX-M) genes revealed that they all harboured bla(CTX-M-3). In the majority of isolates, bla(CTX-M) genes were within large conjugative plasmids. A high degree of diversity of the RAPD types revealed that all the isolates carrying CTX-M were genetically unrelated and horizontal transfer of plasmids was probably the main mechanism of bla(CTX-M) spread. This is the first report of the occurrence of CTX-M-3 ESBLs in central China; previously this enzyme was identified only in Europe. A more comprehensive survey of ESBL types from China is urgently needed.

  17. Cephalosporin resistance in Klebsiella pneumoniae from Nova Scotia, Canada.

    PubMed

    Melano, Roberto G; Davidson, Ross J; Musgrave, Heather L; Forward, Kevin R

    2006-10-01

    From 2116 Klebsiella pneumoniae strains isolated between January 2001 and December 2002 in Nova Scotia, Canada, 25 (1.18%) showed a reduced susceptibility to cefoxitin or extended-spectrum cephalosporins. Narrow-spectrum beta-lactamase genes (bla(SHV-11), bla(SHV-1), bla(SHV-26), bla(SHV-32), bla(SHV-36), and bla(SHV-40)) were the most prevalent. Four new variants were identified (bla(LEN-17), bla(OKP-B-13), bla(OKP-B-14), and bla(OKP-A-11)), representing the 1st description of bla(OKP) in the Americas. Among the extended-spectrum beta-lactamase (ESBL) genes, bla(SHV-2), bla(SHV2a), bla(SHV-12), and bla(CTX-M-15) were detected (ESBL prevalence of 0.14%). Nineteen strains were resistant to cefoxitin (MIC, 32 to >256 microg/mL). Nevertheless, an AmpC-like activity was detected in only 1 strain, which expressed CMY-2. The combined effects of narrow-spectrum beta-lactamase production and decreased or nonexpression of OmpK35/36 porins did not account for the cefoxitin resistance observed in some of these strains. PMID:16769193

  18. Multiplicity of TEM-derived beta-lactamases from Klebsiella pneumoniae strains isolated at the same hospital and relationships between the responsible plasmids.

    PubMed Central

    Chanal, C M; Sirot, D L; Petit, A; Labia, R; Morand, A; Sirot, J L; Cluzel, R A

    1989-01-01

    Five plasmid-mediated beta-lactamases conferring high-level resistance to ceftazidime were isolated from Klebsiella pneumoniae strains in the same hospital. These enzymes had isoelectric points ranging from 5.3 to 6.5 (CAZ-1, 5.55; CAZ-2, 6.0; CAZ-3, 5.3; CAZ-6, 6.5; and CAZ-7, 6.3). All isolates and their Escherichia coli transconjugants were highly resistant to amoxicillin (MICs, greater than 4,096 micrograms/ml), piperacillin (64 to 256 micrograms/ml), cephalothin (32 to 256 micrograms/ml), and ceftazidime (32 to 512 micrograms/ml) but remained moderately susceptible to cefotaxime (0.5 to 8 micrograms/ml). Only CAZ-6- and CAZ-7-producing strains were highly resistant to aztreonam (64 to 128 micrograms/ml). All the isolates remained susceptible to moxalactam and imipenem. The reduced activity of piperacillin, cefotaxime, ceftazidime, or aztreonam was restored by 2 micrograms of clavulanate, sulbactam, tazobactam, or brobactam per ml for E. coli producing CAZ-2, CAZ-3, and CAZ-7. Sulbactam had a lower protective effect than other inhibitors for E. coli harboring CAZ-1 and especially CAZ-6. Except for CAZ-1, which was mediated by a 150-kilobase (kb) plasmid (pCFF14), the other ceftazidimases were mediated by plasmids of 85 kb with EcoRI digestion patterns similar to that of pCFF04 encoding CTX-1 beta-lactamase. A TEM probe hybridized with a 19-kb EcoRI fragment of all these closely related plasmids. Images PMID:2558614

  19. Activity of cefazolin and two beta-lactamase inhibitors, clavulanic acid and sulbactam, against Bacteroides fragilis.

    PubMed Central

    Fekete, T; McGowen, J; Cundy, K R

    1987-01-01

    One hundred clinical isolates of the Bacteroides fragilis group of bacteria were tested by agar dilution for susceptibility to cefazolin alone or in combination with clavulanic acid or sulbactam. For cefazolin, the MIC for 50% of the isolates (MIC50) was 32 micrograms/ml, the breakpoint for susceptibility. With the addition of 0.5 micrograms of clavulanic acid per ml, the MIC for 90% of the isolates (MIC90) was 8 micrograms/ml, well within the achievable range of concentrations in serum or tissue. Similarly, with the addition of 0.5 micrograms of sulbactam per ml, the MIC90 was 16 micrograms/ml. The addition of a higher concentration (4.0 micrograms/ml) of clavulanic acid or sulbactam resulted in MIC90S which were fourfold lower than those with 0.5 micrograms/ml. A fixed ratio of cefazolin-beta-lactamase inhibitor of 4:1 resulted in an MIC50 and MIC90 which were intermediate between the 0.5- and 4.0-micrograms/ml fixed concentration of beta-lactamase inhibitor. PMID:3032097

  20. Activity of tigecycline against clinical isolates of Staphylococcus aureus and extended-spectrum beta-lactamase-producing Escherichia coli in Granada, Spain.

    PubMed

    Sorlózano, A; Gutiérrez, J; Salmerón, A; Luna, J D; Martínez-Checa, F; Román, J; Piédrola, G

    2006-12-01

    We evaluated the in vitro activity of tigecycline using the Etest and disk diffusion method according to Clinical and Laboratory Standards Institute guidelines against clinical isolates of methicillin-susceptible Staphylococcus aureus (MSSA) and methicillin-resistant S. aureus (MRSA) as well as for CTX-M-9 extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli and SHV ESBL-producing E. coli. All isolates were susceptible to tigecycline according to US Food and Drug Administration cut-off points. There were no differences in the activity of tigecycline between MSSA and MRSA isolates or between the presence of either type of ESBL. For each type of microorganism studied, we established the equation relating the minimum inhibitory concentration to the diameter of the zone of inhibition.

  1. Prevalence and Characteristics of the Epidemic Multiresistant Escherichia coli ST131 Clonal Group among Extended-Spectrum Beta-Lactamase-Producing E. coli Isolates in Copenhagen, Denmark

    PubMed Central

    Hansen, Dennis S.; Nilsson, Frida; Frimodt-Møller, Jakob; Leihof, Rikke Fleron; Struve, Carsten; Scheutz, Flemming; Johnston, Brian; Krogfelt, Karen A.; Johnson, James R.

    2013-01-01

    We report the characteristics of 115 extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli clinical isolates, from 115 unique Danish patients, over a 1-year study interval (1 October 2008 to 30 September 2009). Forty-four (38%) of the ESBL isolates represented sequence type 131 (ST13)1, from phylogenetic group B2. The remaining 71 isolates were from phylogenetic groups D (27%), A (22%), B1 (10%), and B2 (3%). Serogroup O25 ST131 isolates (n = 42; 95% of ST131) comprised 7 different K antigens, whereas two ST131 isolates were O16:K100:H5. Compared to non-ST131 isolates, ST131 isolates were associated positively with CTX-M-15 and negatively with CTX-M-1 and CTX-M-14. They also were associated positively with 11 virulence genes, including afa and dra (Dr family adhesins), the F10 papA allele (P fimbria variant), fimH (type 1 fimbriae), fyuA (yersiniabactin receptor), iha (adhesin siderophore), iutA (aerobactin receptor), kpsM II (group 2 capsules), malX (pathogenicity island marker), ompT (outer membrane protease), sat (secreted autotransporter toxin), and usp (uropathogenicity-specific protein) and negatively with hra (heat-resistant agglutinin) and iroN (salmochelin receptor). The consensus virulence gene profile (>90% prevalence) of the ST131 isolates included fimH, fyuA, malX, and usp (100% each), ompT and the F10 papA allele (95% each), and kpsM II and iutA (93% each). ST131 isolates were also positively associated with community acquisition, extraintestinal pathogenic E. coli (ExPEC) status, and the O25, K100, and H4 antigens. Thus, among ESBL E. coli isolates in Copenhagen, ST131 was the most prevalent clonal group, was community associated, and exhibited distinctive and comparatively extensive virulence profiles, plus a greater variety of capsular antigens than reported previously. PMID:23554186

  2. Prevalence and characteristics of the epidemic multiresistant Escherichia coli ST131 clonal group among extended-spectrum beta-lactamase-producing E. coli isolates in Copenhagen, Denmark.

    PubMed

    Olesen, Bente; Hansen, Dennis S; Nilsson, Frida; Frimodt-Møller, Jakob; Leihof, Rikke Fleron; Struve, Carsten; Scheutz, Flemming; Johnston, Brian; Krogfelt, Karen A; Johnson, James R

    2013-06-01

    We report the characteristics of 115 extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli clinical isolates, from 115 unique Danish patients, over a 1-year study interval (1 October 2008 to 30 September 2009). Forty-four (38%) of the ESBL isolates represented sequence type 131 (ST13)1, from phylogenetic group B2. The remaining 71 isolates were from phylogenetic groups D (27%), A (22%), B1 (10%), and B2 (3%). Serogroup O25 ST131 isolates (n = 42; 95% of ST131) comprised 7 different K antigens, whereas two ST131 isolates were O16:K100:H5. Compared to non-ST131 isolates, ST131 isolates were associated positively with CTX-M-15 and negatively with CTX-M-1 and CTX-M-14. They also were associated positively with 11 virulence genes, including afa and dra (Dr family adhesins), the F10 papA allele (P fimbria variant), fimH (type 1 fimbriae), fyuA (yersiniabactin receptor), iha (adhesin siderophore), iutA (aerobactin receptor), kpsM II (group 2 capsules), malX (pathogenicity island marker), ompT (outer membrane protease), sat (secreted autotransporter toxin), and usp (uropathogenicity-specific protein) and negatively with hra (heat-resistant agglutinin) and iroN (salmochelin receptor). The consensus virulence gene profile (>90% prevalence) of the ST131 isolates included fimH, fyuA, malX, and usp (100% each), ompT and the F10 papA allele (95% each), and kpsM II and iutA (93% each). ST131 isolates were also positively associated with community acquisition, extraintestinal pathogenic E. coli (ExPEC) status, and the O25, K100, and H4 antigens. Thus, among ESBL E. coli isolates in Copenhagen, ST131 was the most prevalent clonal group, was community associated, and exhibited distinctive and comparatively extensive virulence profiles, plus a greater variety of capsular antigens than reported previously.

  3. The Human Gut Microbiome as a Transporter of Antibiotic Resistance Genes between Continents

    PubMed Central

    Bengtsson-Palme, Johan; Angelin, Martin; Huss, Mikael; Kjellqvist, Sanela; Kristiansson, Erik; Palmgren, Helena; Larsson, D. G. Joakim

    2015-01-01

    Previous studies of antibiotic resistance dissemination by travel have, by targeting only a select number of cultivable bacterial species, omitted most of the human microbiome. Here, we used explorative shotgun metagenomic sequencing to address the abundance of >300 antibiotic resistance genes in fecal specimens from 35 Swedish students taken before and after exchange programs on the Indian peninsula or in Central Africa. All specimens were additionally cultured for extended-spectrum beta-lactamase (ESBL)-producing enterobacteria, and the isolates obtained were genome sequenced. The overall taxonomic diversity and composition of the gut microbiome remained stable before and after travel, but there was an increasing abundance of Proteobacteria in 25/35 students. The relative abundance of antibiotic resistance genes increased, most prominently for genes encoding resistance to sulfonamide (2.6-fold increase), trimethoprim (7.7-fold), and beta-lactams (2.6-fold). Importantly, the increase observed occurred without any antibiotic intake. Of 18 students visiting the Indian peninsula, 12 acquired ESBL-producing Escherichia coli, while none returning from Africa were positive. Despite deep sequencing efforts, the sensitivity of metagenomics was not sufficient to detect acquisition of the low-abundant genes responsible for the observed ESBL phenotype. In conclusion, metagenomic sequencing of the intestinal microbiome of Swedish students returning from exchange programs in Central Africa or the Indian peninsula showed increased abundance of genes encoding resistance to widely used antibiotics. PMID:26259788

  4. The Human Gut Microbiome as a Transporter of Antibiotic Resistance Genes between Continents.

    PubMed

    Bengtsson-Palme, Johan; Angelin, Martin; Huss, Mikael; Kjellqvist, Sanela; Kristiansson, Erik; Palmgren, Helena; Larsson, D G Joakim; Johansson, Anders

    2015-10-01

    Previous studies of antibiotic resistance dissemination by travel have, by targeting only a select number of cultivable bacterial species, omitted most of the human microbiome. Here, we used explorative shotgun metagenomic sequencing to address the abundance of >300 antibiotic resistance genes in fecal specimens from 35 Swedish students taken before and after exchange programs on the Indian peninsula or in Central Africa. All specimens were additionally cultured for extended-spectrum beta-lactamase (ESBL)-producing enterobacteria, and the isolates obtained were genome sequenced. The overall taxonomic diversity and composition of the gut microbiome remained stable before and after travel, but there was an increasing abundance of Proteobacteria in 25/35 students. The relative abundance of antibiotic resistance genes increased, most prominently for genes encoding resistance to sulfonamide (2.6-fold increase), trimethoprim (7.7-fold), and beta-lactams (2.6-fold). Importantly, the increase observed occurred without any antibiotic intake. Of 18 students visiting the Indian peninsula, 12 acquired ESBL-producing Escherichia coli, while none returning from Africa were positive. Despite deep sequencing efforts, the sensitivity of metagenomics was not sufficient to detect acquisition of the low-abundant genes responsible for the observed ESBL phenotype. In conclusion, metagenomic sequencing of the intestinal microbiome of Swedish students returning from exchange programs in Central Africa or the Indian peninsula showed increased abundance of genes encoding resistance to widely used antibiotics.

  5. CARB-9, a carbenicillinase encoded in the VCR region of Vibrio cholerae non-O1, non-O139 belongs to a family of cassette-encoded beta-lactamases.

    PubMed

    Petroni, Alejandro; Melano, Roberto G; Saka, Héctor A; Garutti, Alicia; Mange, Laura; Pasterán, Fernando; Rapoport, Melina; Miranda, Mariana; Faccone, Diego; Rossi, Alicia; Hoffman, Paul S; Galas, Marcelo F

    2004-10-01

    The gene bla(CARB-9) was located in the Vibrio cholerae super-integron, but in a different location relative to bla(CARB-7). CARB-9 (pI 5.2) conferred beta-lactam MICs four to eight times lower than those conferred by CARB-7, differing at Ambler's positions V97I, L124F, and T228K. Comparison of the genetic environments of all reported bla(CARB) genes indicated that the CARB enzymes constitute a family of cassette-encoded beta-lactamases.

  6. Pediatric fecal microbiota harbor diverse and novel antibiotic resistance genes.

    PubMed

    Moore, Aimée M; Patel, Sanket; Forsberg, Kevin J; Wang, Bin; Bentley, Gayle; Razia, Yasmin; Qin, Xuan; Tarr, Phillip I; Dantas, Gautam

    2013-01-01

    Emerging antibiotic resistance threatens human health. Gut microbes are an epidemiologically important reservoir of resistance genes (resistome), yet prior studies indicate that the true diversity of gut-associated resistomes has been underestimated. To deeply characterize the pediatric gut-associated resistome, we created metagenomic recombinant libraries in an Escherichia coli host using fecal DNA from 22 healthy infants and children (most without recent antibiotic exposure), and performed functional selections for resistance to 18 antibiotics from eight drug classes. Resistance-conferring DNA fragments were sequenced (Illumina HiSeq 2000), and reads assembled and annotated with the PARFuMS computational pipeline. Resistance to 14 of the 18 antibiotics was found in stools of infants and children. Recovered genes included chloramphenicol acetyltransferases, drug-resistant dihydrofolate reductases, rRNA methyltransferases, transcriptional regulators, multidrug efflux pumps, and every major class of beta-lactamase, aminoglycoside-modifying enzyme, and tetracycline resistance protein. Many resistance-conferring sequences were mobilizable; some had low identity to any known organism, emphasizing cryptic organisms as potentially important resistance reservoirs. We functionally confirmed three novel resistance genes, including a 16S rRNA methylase conferring aminoglycoside resistance, and two tetracycline-resistance proteins nearly identical to a bifidobacterial MFS transporter (B. longum s. longum JDM301). We provide the first report to our knowledge of resistance to folate-synthesis inhibitors conferred by a predicted Nudix hydrolase (part of the folate synthesis pathway). This functional metagenomic survey of gut-associated resistomes, the largest of its kind to date, demonstrates that fecal resistomes of healthy children are far more diverse than previously suspected, that clinically relevant resistance genes are present even without recent selective antibiotic

  7. Rectal Carriage of Extended-Spectrum-Beta-Lactamase-Producing Enterobacteriaceae in Hospitalized Patients: Selective Preenrichment Increases Yield of Screening

    PubMed Central

    Verhulst, C.; Willemsen, L. E.; Verkade, E.; Bonten, M. J. M.; Kluytmans, J. A. J. W.

    2015-01-01

    This study evaluated the added value of selective preenrichment for the detection of rectal carriage of extended-spectrum-beta-lactamase-producing Enterobacteriaceae (ESBL-E). ESBL-E rectal carriage was identified in 4.8% of hospitalized patients, and 25.9% of ESBL-E rectal carriers were identified with selective preenrichment only. PMID:25994164

  8. Fulminant mediastinitis due to extended-spectrum beta-lactamase-producing Klebsiella pneumoniae: atypical presentation and spreading following cardiac surgery†

    PubMed Central

    Valenzuela, Horacio; Carrascal, Yolanda; Maroto, Laura; Arce, Nuria

    2013-01-01

    Mediastinitis due to Klebsiella pneumoniae, related to thoracic wall contamination after cardiac surgery, has rarely been described. We aim to report a case of fulminant mediastinitis due to extended-spectrum beta-lactamase-producing K. pneumoniae, secondary to a disseminated concomitant pulmonary infection. The patient remained pauci-symptomatic until clinical manifestations of sepsis acutely appeared. PMID:23416348

  9. In vitro activities of 15 oral beta-lactams against Klebsiella pneumoniae harboring new extended-spectrum beta-lactamases.

    PubMed Central

    Kitzis, M D; Liassine, N; Ferré, B; Gutmann, L; Acar, J F; Goldstein, F

    1990-01-01

    The activities of 15 oral beta-lactams against Klebsiella pneumoniae harboring new extended-spectrum beta-lactamases were studied. All compounds were affected by these enzymes, especially by the SHV derivatives. Except for ceftibuten, the compounds with the greatest intrinsic activity were more affected by the presence of these enzymes than were older compounds with moderate intrinsic activity. PMID:2285291

  10. Development of "oligotyping" for characterization and molecular epidemiology of TEM beta-lactamases in members of the family Enterobacteriaceae.

    PubMed Central

    Mabilat, C; Courvalin, P

    1990-01-01

    Based on the DNA sequences of blaTEM-1 and blaTEM-2, which encode parental penicillinases TEM-1 and TEM-2, respectively, and blaTEM-3, blaTEM-4, blaTEM-5, blaTEM-6, and blaTEM-7, which encode extended-spectrum beta-lactamases, we designed heptadecanucleotides to discriminate point mutations in five loci. Determination of the hybridization profiles by colony hybridization with this selection of probes, termed "oligotyping," allowed characterization of the TEM variants present in 265 clinical isolates of the family Enterobacteriaceae that exhibit synergism between a penicillinase inhibitor and broad-spectrum cephaslosporins. Among the 222 strains harboring TEM enzymes, Klebsiella pneumoniae (48%) and Escherichia coli (21%) were predominant, and TEM-3 was the most common enzyme (60%). Penicillinases TEM-1 and TEM-2 were detected alone (15 and 1%, respectively), combined (1%), or associated with another TEM beta-lactamase (17 and 6%, respectively). Fourteen variants, including seven new enzymes, were detected. One, TEM-13, was a new penicillinase with the same isoelectric point and substrate range as TEM-2 but differed by a single amino acid substitution, whereas the others, TEM-14 to TEM-19, were extended-spectrum beta-lactamases that consisted of novel combinations of known amino acid substitutions. Different TEM variants were found to coexist within the same cells. A patient could harbor two or three different strains that encoded the same enzyme or two indistinguishable isolates that produced distinct TEM beta-lactamases. PMID:2073111

  11. Evaluation of Brilliance ESBL agar, a novel chromogenic medium for detection of extended-spectrum-beta- lactamase-producing Enterobacteriaceae.

    PubMed

    Huang, Te-Din; Bogaerts, Pierre; Berhin, Catherine; Guisset, Amelie; Glupczynski, Youri

    2010-06-01

    The aim of this study was to evaluate the performance of Brilliance ESBL agar (OX; Oxoid, Basingstoke, United Kingdom), a novel chromogenic agar for the selective isolation and the presumptive identification of extended-spectrum-beta-lactamase (ESBL)-producing Enterobacteriaceae. A panel of 200 clinical Gram-negative Enterobacteriaceae and nonfermenting isolates with defined resistance mechanisms was inoculated onto OX and onto ChromID ESBL agar (BM; bioMérieux, Marcy l'Etoile, France) chromogenic medium in the first part of the study to evaluate the growth selectivity and chromogenic features of these two media. Of the 156 Enterobacteriaceae challenge isolates, 8 fully susceptible isolates were inhibited, all 98 ESBL producers were detected, and 50 isolates harboring other resistance mechanisms were recovered on both chromogenic agars. In the second phase, 528 clinical samples (including 344 fecal specimens) were plated onto OX, BM, and MacConkey agar with a ceftazidime disk (MCC) for the screening of ESBL-producing Enterobacteriaceae. Growth on at least one medium was observed with 144 (27%) of the clinical samples screened. A total of 182 isolates, including 109 (60%) of Enterobacteriaceae, were recovered and 70 of these (from 59 specimens) were confirmed as ESBL-producing isolates. The sensitivities of MCC, BM, and OX were 74.6%, 94.9%, and 94.9%, respectively. The specificities of MCC, BM, and OX by specimens reached 94.9%, 95.5%, and 95.7%, respectively, when only colored colonies were considered on the two selective chromogenic media. The high negative predictive value (99.3%) found for OX suggests that this medium may constitute an excellent screening tool for the rapid exclusion of patients not carrying ESBL producers.

  12. Inhibitory effects of various essential oils and individual components against extended-spectrum beta-lactamase (ESBL) produced by Klebsiella pneumoniae and their chemical compositions.

    PubMed

    Orhan, Ilkay Erdogan; Ozcelik, Berrin; Kan, Yüksel; Kartal, Murat

    2011-10-01

    In the current study, in vitro inhibitory activity of several essential oils obtained from the cultivated plants, Foeniculum vulgare, Mentha piperita and M. spicata, Ocimum basilicum, Origanum majorana, O. onites, O. vulgare, Satureja cuneifolia, and a number of individual essential oil components of terpene and aromatic types were screened against 10 isolated strains of Klebsiella pneumoniae producing extended-spectrum beta-lactamase (ESBL) enzyme, which makes this microorganism quite resistant against the antibiotics: trimetoprime-sulfametoksazol, sulbactam-ampicilin, clavulonate-amoxicilin, ceftriaxon, cefepime, imipenem, ceftazidime, tobramicine, gentamisine, ofloxacin, and ciprofloksasin. All of the essential oils and the components exerted a remarkable inhibition ranging between 32 and 64 μg/mL against all of these strains as strong as the references (ampicilin and oflaxocin) inhibiting at 32 μg/mL. Besides, chemical compositions of the essential oils were elucidated by gas chromatography-mass spectrometry (GC-MS). The essential oils and the pure components widely found in essential oils screened herein have shown remarkable inhibition against ESBL-producing K. pneumoniae strains, which leads to the suggestion that they may be used as food preservatives for this purpose. Practical Application:  The essential oils obtained from Foeniculum vulgare, Mentha piperita and M. spicata, O.cimum basilicum, Origanum majorana, O. onites, O. vulgare, and Satureja cuneifolia as well as common essential oil components have shown notable inhibitory effects against 10 isolated strains of Klebsiella pneumoniae producing extended-spectrum beta-lactamase (ESBL) enzyme and they might be used as food preservative or ingredient. PMID:22417594

  13. Inhibitory effects of various essential oils and individual components against extended-spectrum beta-lactamase (ESBL) produced by Klebsiella pneumoniae and their chemical compositions.

    PubMed

    Orhan, Ilkay Erdogan; Ozcelik, Berrin; Kan, Yüksel; Kartal, Murat

    2011-10-01

    In the current study, in vitro inhibitory activity of several essential oils obtained from the cultivated plants, Foeniculum vulgare, Mentha piperita and M. spicata, Ocimum basilicum, Origanum majorana, O. onites, O. vulgare, Satureja cuneifolia, and a number of individual essential oil components of terpene and aromatic types were screened against 10 isolated strains of Klebsiella pneumoniae producing extended-spectrum beta-lactamase (ESBL) enzyme, which makes this microorganism quite resistant against the antibiotics: trimetoprime-sulfametoksazol, sulbactam-ampicilin, clavulonate-amoxicilin, ceftriaxon, cefepime, imipenem, ceftazidime, tobramicine, gentamisine, ofloxacin, and ciprofloksasin. All of the essential oils and the components exerted a remarkable inhibition ranging between 32 and 64 μg/mL against all of these strains as strong as the references (ampicilin and oflaxocin) inhibiting at 32 μg/mL. Besides, chemical compositions of the essential oils were elucidated by gas chromatography-mass spectrometry (GC-MS). The essential oils and the pure components widely found in essential oils screened herein have shown remarkable inhibition against ESBL-producing K. pneumoniae strains, which leads to the suggestion that they may be used as food preservatives for this purpose. Practical Application:  The essential oils obtained from Foeniculum vulgare, Mentha piperita and M. spicata, O.cimum basilicum, Origanum majorana, O. onites, O. vulgare, and Satureja cuneifolia as well as common essential oil components have shown notable inhibitory effects against 10 isolated strains of Klebsiella pneumoniae producing extended-spectrum beta-lactamase (ESBL) enzyme and they might be used as food preservative or ingredient.

  14. Epidemiological study by pulsed-field gel electrophoresis of an outbreak of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae in a geriatric hospital.

    PubMed Central

    Gouby, A; Neuwirth, C; Bourg, G; Bouziges, N; Carles-Nurit, M J; Despaux, E; Ramuz, M

    1994-01-01

    Twelve cases of infections caused by extended-spectrum beta-lactamase (ESBla)-producing Klebsiella pneumoniae were reported between August 1991 and March 1993 in the Geriatric Department of the Nimes University Hospital, where these bacterial had not been previously isolated. Restriction profiles of total genomic DNAs cleaved by XbaI and SpeI were compared by pulsed-field gel electrophoresis. The strains that were tested included the 12 isolates from K. pneumoniae-infected patients, strains recovered from rectal swabs of asymptomatic patients in the same ward, and strains isolated in other hospitals in Nîmes at the same time. The restriction profiles of the 12 isolates and those recovered from asymptomatic patients in the same ward were very similar. Over a period of more than 1 year, extended-spectrum beta-lactamases were not detected in K. pneumoniae isolates with restriction patterns different from that of the epidemic strain. It seems, therefore, that there was no transfer of a plasmid or a gene coding for ESBla to strains of K. pneumoniae that were different from the epidemic strain. At the same time, ESBla-producing K. pneumoniae isolates exhibiting restriction endonuclease profiles very different from that of the epidemic strain were isolated from other hospitals in Nîmes. None of these strains caused an outbreak. Pulsed-field gel electrophoresis, which allows precise characterization of strains beyond the species level, is a useful tool for studying the ESBla-producing K. pneumoniae strains involved in nosocomial outbreaks. Images PMID:8150938

  15. Extended-Spectrum Beta-Lactamases Producing E. coli in Wildlife, yet Another Form of Environmental Pollution?

    PubMed Central

    Guenther, Sebastian; Ewers, Christa; Wieler, Lothar H.

    2011-01-01

    Wildlife is normally not exposed to clinically used antimicrobial agents but can acquire antimicrobial resistant bacteria through contact with humans, domesticated animals and the environment, where water polluted with feces seems to be the most important vector. Escherichia coli, an ubiquitous commensal bacterial species colonizing the intestinal tract of mammals and birds, is also found in the environment. Extended-spectrum beta-lactamases producing E. coli (ESBL-E. coli) represent a major problem in human and veterinary medicine, particular in nosocomial infections. Additionally an onset of community-acquired ESBL-E. coli infections and an emergence in livestock farming has been observed in recent years, suggesting a successful transmission as well as persistence of ESBL-E. coli strains outside clinical settings. Another parallel worldwide phenomenon is the spread of ESBL-E. coli into the environment beyond human and domesticated animal populations, and this seems to be directly influenced by antibiotic practice. This might be a collateral consequence of the community-onset of ESBL-E. coli infections but can result (a) in a subsequent colonization of wild animal populations which can turn into an infectious source or even a reservoir of ESBL-E. coli, (b) in a contribution of wildlife to the spread and transmission of ESBL-E. coli into fragile environmental niches, (c) in new putative infection cycles between wildlife, domesticated animals and humans, and (d) in problems in the medical treatment of wildlife. This review aims to summarize the current knowledge on ESBL-E. coli in wildlife, in turn underlining the need for more large scale investigations, in particular sentinel studies to monitor the impact of multiresistant bacteria on wildlife. PMID:22203818

  16. Neonatal Brain Abscess due to Extended-Spectrum Beta-Lactamase Producing Klebsiella pneumoniae

    PubMed Central

    Mondal, Monojit; Thapa, Rajoo; Mallick, Debkrishna; Datta, Asok Kumar

    2014-01-01

    Klebsiella pneumoniae (K. pneumoniae) causing brain abscess in newborn infants is rare. Presented herein, is a 27-day-old male neonate who developed two frontal lobe abscesses in association with K. pneumoniae sepsis and meningitis. Antibiotic susceptibility testing utilizing the double-disk synergy method (Cefotaxime and Amoxycillin-Clavulanate) confirmed the extended spectrum beta-lactamase (ESBL) production by the isolate. He was treated simultaneously with antibiotics (Meropenem and Amikacin) and abscess aspiration through the anterior fontanelle, with less than satisfactory outcome. ESBL producing K. pneumoniae brain abscess in neonates is extremely rare in the English literature. Emperical carbapenems and aminoglycoside coverage in neonates with K. pneumoniae sepsis and brain abscess, especially in areas with high rate of ESBL producing bacteria may be warranted. PMID:25584278

  17. Molecular Detection of New Delhi Metallo-Beta-Lactamase-1 (NDM-1) Positive Bacteria from Environmental and Drinking Water Samples by Loop Mediated Isothermal Amplification of bla NDM-1.

    PubMed

    Rathinasabapathi, P; Hiremath, Deepak S; Arunraj, Rex; Parani, M

    2015-12-01

    New Delhi metallo-β-lactamase-1 gene (bla NDM-1 ) codes for New Delhi metallo-beta-lactamase-1 (NDM-1) enzyme that cleaves the amide bond of β-lactam ring, and provides resistance against major classes of β-lactam antibiotics. Dissemination of the plasmid borne bla NDM-1 through horizontal gene transfer is a potential threat to the society. In this study, a rapid non-culture method for detecting NDM-1 positive bacteria was developed by Loop Mediated Isothermal Amplification (LAMP) of bla NDM-1 . Sensitivity of this method was found to be one femtogram of plasmid DNA, which translates into 2.6-25.8 copies depending on the size of the plasmid DNA. This method was applied to detect NDM-1 positive bacteria in 81 water samples that were collected from environmental and drinking water sources. NDM-1 positive bacteria were detected in three drinking water samples by LAMP but not by PCR. These three samples were collected from the water sources that were treated with chlorine for decontamination before public distribution. NDM-1 positive bacteria were not detected in lake water samples or in the samples that were collected from the water sources that were purified by reverse osmosis before public distribution. Detection of NDM-1 positive bacteria using LAMP was found to be safe, sensitive and rapid for screening large number of samples from diverse sources. This method could be developed as on-field detection kit by using fluorescent dyes to visualize the amplified bla NDM-1 gene.

  18. Complete genome sequence analysis and identification of putative metallo-beta-lactamase and SpoIIIE homologs in Bacillus cereus group phage BCP8-2, a new member of the proposed Bastille-like group.

    PubMed

    Asare, Paul Tetteh; Bandara, Nadeeka; Jeong, Tae-Yong; Ryu, Sangryeol; Klumpp, Jochen; Kim, Kwang-Pyo

    2015-10-01

    Bacillus cereus group-specific bacteriophage BCP8-2 exhibits a broad lysis spectrum among food and human isolates (330/364) of B. cereus while not infecting B. subtilis (50) or B. licheniformis (12) strains. Its genome is 159,071 bp long with 220 open reading frames, including genes for putative methyltransferases, metallo-beta-lactamase, and a sporulation-related SpoIIIE homolog, as wells as 18 tRNAs. Comparative genome analysis showed that BCP8-2 is related to the recently proposed Bastille-like phages, but not with either SPO1-like or Twort-like phages of the subfamily Spounavirinae.

  19. Complete Nucleotide Sequence of a 92-Kilobase Plasmid Harboring the CTX-M-15 Extended-Spectrum Beta-Lactamase Involved in an Outbreak in Long-Term-Care Facilities in Toronto, Canada

    PubMed Central

    Boyd, David A.; Tyler, Shaun; Christianson, Sara; McGeer, Allison; Muller, Matthew P.; Willey, Barbara M.; Bryce, Elizabeth; Gardam, Michael; Nordmann, Patrice; Mulvey, Michael R.

    2004-01-01

    A major outbreak involving an Escherichia coli strain that was resistant to expanded-spectrum cephalosporins occurred in Toronto and surrounding regions in 2000 to 2002. We report the complete sequence of a plasmid, pC15-1a, that was found associated with the outbreak strain. Plasmid pC15-1a is a circular molecule of 92,353 bp consisting of two distinct regions. The first is a 64-kb region that is essentially homologous to the non-R-determinant region of plasmid R100 except for several point mutations, a few small insertions and deletions, and the absence of Tn10. The second is a 28.4-kb multidrug resistance region (MDR) that has replaced the R-determinant region of the R100 progenitor and consists mostly of transposons or partial transposons and five copies of the insertion element IS26. All drug resistance genes found in pC15-1a, including the beta-lactamase genes blaCTX-M-15, blaOXA-1, and blaTEM-1, the tetracycline resistance gene tetA, and aminoglycoside resistance genes aac(6′)-Ib and aac(3)-II, are located in the MDR. The blaCTX-M-15 gene was found downstream of ISEcp1as part of a transposition unit, as determined from the surrounding sequence. Examination of the plasmids from CTX-M-15-harboring strains isolated from hospitals across Canada showed that pC15-1a was found in several strains isolated from a site in western Canada. Comparison of pC15-1a and pCTX15, found in an E. coli strain isolated in India in 1999, revealed that the plasmids had several features in common, including an R100 backbone and several of the resistance genes, including blaCTX-M-15, blaTEM-1, blaOXA-1, tetA, and aac(6′)-Ib. PMID:15388431

  20. Resistance patterns, ESBL genes, and genetic relatedness of Escherichia coli from dogs and owners

    PubMed Central

    Carvalho, A.C.; Barbosa, A.V.; Arais, L.R.; Ribeiro, P.F.; Carneiro, V.C.; Cerqueira, A.M.F.

    2016-01-01

    Antimicrobial resistance in Escherichia coli isolated from pet dogs can be considered a potential threat of infection for the human population. Our objective was to characterize the resistance pattern, extended spectrum beta-lactamase production and genetic relatedness of multiresistant E. coli strains isolated from dogs (n = 134), their owners (n = 134), and humans who claim to have no contact with dogs (n = 44, control), searching for sharing of strains. The strains were assessed for their genetic relatedness by phylogenetic grouping and pulsed-field gel electrophoresis. Multiresistant E. coli strains were isolated from 42 (31.3%) fecal samples from pairs of dogs and owners, totaling 84 isolates, and from 19 (43.1%) control group subjects. The strains showed high levels of resistance to ampicillin, streptomycin, tetracycline, trimethoprim and sulfamethoxazole regardless of host species or group of origin. The blaTEM, blaCTX-M, and blaSHV genes were detected in similar proportions in all groups. All isolates positive for bla genes were ESBL producers. The phylogenetic group A was the most prevalent, irrespective of the host species. None of the strains belonging to the B2 group contained bla genes. Similar resistance patterns were found for strains from dogs, owners and controls; furthermore, identical PFGE profiles were detected in four (9.5%) isolate pairs from dogs and owners, denoting the sharing of strains. Pet dogs were shown to be a potential household source of multiresistant E. coli strains. PMID:26887238

  1. Resistance patterns, ESBL genes, and genetic relatedness of Escherichia coli from dogs and owners.

    PubMed

    Carvalho, A C; Barbosa, A V; Arais, L R; Ribeiro, P F; Carneiro, V C; Cerqueira, A M F

    2016-01-01

    Antimicrobial resistance in Escherichia coli isolated from pet dogs can be considered a potential threat of infection for the human population. Our objective was to characterize the resistance pattern, extended spectrum beta-lactamase production and genetic relatedness of multiresistant E. coli strains isolated from dogs (n=134), their owners (n=134), and humans who claim to have no contact with dogs (n=44, control), searching for sharing of strains. The strains were assessed for their genetic relatedness by phylogenetic grouping and pulsed-field gel electrophoresis. Multiresistant E. coli strains were isolated from 42 (31.3%) fecal samples from pairs of dogs and owners, totaling 84 isolates, and from 19 (43.1%) control group subjects. The strains showed high levels of resistance to ampicillin, streptomycin, tetracycline, trimethoprim and sulfamethoxazole regardless of host species or group of origin. The blaTEM, blaCTX-M, and blaSHV genes were detected in similar proportions in all groups. All isolates positive for bla genes were ESBL producers. The phylogenetic group A was the most prevalent, irrespective of the host species. None of the strains belonging to the B2 group contained bla genes. Similar resistance patterns were found for strains from dogs, owners and controls; furthermore, identical PFGE profiles were detected in four (9.5%) isolate pairs from dogs and owners, denoting the sharing of strains. Pet dogs were shown to be a potential household source of multiresistant E. coli strains.

  2. Molecular characterization of extended-spectrum beta-lactamases and its correlation with clinical laboratory standards institute interpretive criteria for disk diffusion susceptibility testing in enterobacteriaceae isolates in Thaialnd.

    PubMed

    Tangkoskul, Teerawit; Tiengrim, Surapee; Onsomang, Supiluck; Pati, Naratchaphan; Aswapokee, Nalinee; Thamlikitkul, Visanu; Chayakulkeeree, Methee

    2012-11-01

    We performed extended-spectrum beta-lactamase (ESBL) phenotypic testing and molecular characterization of three ESBL genes (TEM, SHV and CTX-M) and susceptibility testing by Clinical Laboratory Standards Institute (CLSI) disk diffusion method against three cephalosporins (ceftriaxone, ceftazidime, cefepime) and a cephamycin (cefoxitin) among 128 Thai Escherichia coli and 84 Thai Klebsiella pneumoniae clinical isolates. ESBL production was discovered in 62% of E. coli and 43% of K. pneumoniae isolates. All isolates susceptible to ceftriaxone were ESBL-negative. Nearly all isolates non-susceptible to ceftriaxone, ceftazidime and cefepime produced ESBL; the presence of CTX-M genes in the isolates correlated with a ceftriaxone non-susceptible phenotype. Thirty-nine of 83 isolates (47%) of ceftazidime-susceptible E. coli and 50 of 99 isolates (50.5%) of cefepime-susceptible E. coli were ESBL-producing. SHV-type beta-lactamase genes were more prevalent among K. pneumoniae than E. coli isolates. CTX-M was the major ESBL gene harbored by ESBL-producers in both E. coli and K. pneumoniae isolates. Non-CTX-M ESBL-producers were found only among K. pneumoniae isolates. This study reveals an increase in ESBL-producing Enterobacteriaceae among Thai isolates and demonstrates gaps in the current CLSI disk diffusion susceptibility guidelines; it indicates the results of ceftazidime and cefepime disk diffusion susceptibility testing using CLSI criteria should be interpreted with caution.

  3. Development of test panel of beta-lactamases expressed in a common Escherichia coli host background for evaluation of new beta-lactam antibiotics.

    PubMed Central

    Bradford, P A; Sanders, C C

    1995-01-01

    A test panel of 35 different beta-lactamases expressed in a common Escherichia coli host was created to compare the effect that each beta-lactamase had on susceptibility to various beta-lactam antibiotics. A comparison of the MICs obtained with this panel generally reflected differences in the substrate profiles of the various beta-lactamases examined. In addition, several strains of the panel were subjected to selection with porin-specific bacteriophages to obtain mutants lacking either the OmpC or OmpF porin protein. A mutation in either OmpC or OmpF did change the susceptibilities of certain strains expressing beta-lactamase to certain beta-lactam antibiotics. However, the loss of a single porin did not predictably alter susceptibility to any given beta-lactam drug. This panel of strains producing various beta-lactamases was found to be a useful tool for comparing the effects of different beta-lactamases and outer membrane permeability upon susceptibility to beta-lactam drugs. PMID:7726487

  4. SCO-1, a novel plasmid-mediated class A beta-lactamase with carbenicillinase characteristics from Escherichia coli.

    PubMed

    Papagiannitsis, C C; Loli, A; Tzouvelekis, L S; Tzelepi, E; Arlet, G; Miriagou, V

    2007-06-01

    A novel class A beta-lactamase (SCO-1) encoded by an 80-kb self-transferable plasmid from Escherichia coli is described. The interaction of SCO-1 with beta-lactams was similar to that of the CARB-type enzymes. Also, SCO-1 exhibited a 51% amino acid sequence identity with the RTG subgroup of chromosomal carbenicillinases (RTG-1, CARB-5, and CARB-8). PMID:17353248

  5. Nationwide study of the prevalence, characteristics, and molecular epidemiology of extended-spectrum-beta-lactamase-producing Enterobacteriaceae in France.

    PubMed

    Galas, Muriel; Decousser, Jean-Winoc; Breton, Nelly; Godard, Thierry; Allouch, Pierre Yves; Pina, Patrick

    2008-02-01

    Among 10,872 isolates of Enterobacteriaceae from a nationwide study of 88 French hospitals in 2005, 169 (1.7%) expressed an extended-spectrum beta-lactamase. The most prevalent species were Escherichia coli (48.5%), Enterobacter aerogenes (23.7%), and Klebsiella pneumoniae (14.8%). Molecular analysis underlined the polyclonal spread of CTX-M-expressing E. coli, primarily isolates of the CTX-M-1 subgroup.

  6. SCO-1, a novel plasmid-mediated class A beta-lactamase with carbenicillinase characteristics from Escherichia coli.

    PubMed

    Papagiannitsis, C C; Loli, A; Tzouvelekis, L S; Tzelepi, E; Arlet, G; Miriagou, V

    2007-06-01

    A novel class A beta-lactamase (SCO-1) encoded by an 80-kb self-transferable plasmid from Escherichia coli is described. The interaction of SCO-1 with beta-lactams was similar to that of the CARB-type enzymes. Also, SCO-1 exhibited a 51% amino acid sequence identity with the RTG subgroup of chromosomal carbenicillinases (RTG-1, CARB-5, and CARB-8).

  7. Structural features related to hydrolytic activity against ceftazidime of plasmid-mediated SHV-type CAZ-5 beta-lactamase.

    PubMed Central

    Péduzzi, J; Barthélémy, M; Tiwari, K; Mattioni, D; Labia, R

    1989-01-01

    Tryptic peptides of the novel ceftazidimase CAZ-5 were sequenced by manual Edman degradation and aligned according to strong homology (more than 98%) with SHV-1 and SHV-2 beta-lactamase sequences. CAZ-5 differed from SHV-1 by five amino acid substitutions. Unusually high activity of CAZ-5 towards ceftazidime was imputed to substitution of a Lys for a Glu at position 214 of the mature protein. PMID:2694955

  8. Emergence of New Delhi Metallo-Beta-Lactamase (NDM-1) and Klebsiella pneumoniae Carbapenemase (KPC-2) in South Africa

    PubMed Central

    Coetzee, Jennifer; Clay, Cornelis G.; Sithole, Sindi; Richards, Guy A.; Poirel, Laurent; Nordmann, Patrice

    2012-01-01

    This report documents emergence of New Delhi metallo-beta-lactamase (NDM-1) and Klebsiella pneumoniae carbapenemase (KPC-2) in K. pneumoniae and Enterobacter cloacae in South Africa. NDM-1 producers have not been described in South Africa, and this is the first instance that KPC producers have been identified in Africa. The two patients infected with these carbapenemase-producing bacteria demised. PMID:22116157

  9. Specificity and cooperativity at [beta]-lactamase position 104 in TEM-1/BLIP and SHV-1/BLIP interactions

    SciTech Connect

    Hanes, Melinda S.; Reynolds, Kimberly A.; McNamara, Case; Ghosh, Partho; Bonomo, Robert A.; Kirsch, Jack F.; Handel, Tracy M.

    2011-11-02

    Establishing a quantitative understanding of the determinants of affinity in protein-protein interactions remains challenging. For example, TEM-1/{beta}-lactamase inhibitor protein (BLIP) and SHV-1/BLIP are homologous {beta}-lactamase/{beta}-lactamase inhibitor protein complexes with disparate K{sub d} values (3 nM and 2 {mu}M, respectively), and a single substitution, D104E in SHV-1, results in a 1000-fold enhancement in binding affinity. In TEM-1, E104 participates in a salt bridge with BLIP K74, whereas the corresponding SHV-1 D104 does not in the wild type SHV-1/BLIP co-structure. Here, we present a 1.6 {angstrom} crystal structure of the SHV-1 D104E/BLIP complex that demonstrates that this point mutation restores this salt bridge. Additionally, mutation of a neighboring residue, BLIP E73M, results in salt bridge formation between SHV-1 D104 and BLIP K74 and a 400-fold increase in binding affinity. To understand how this salt bridge contributes to complex affinity, the cooperativity between the E/K or D/K salt bridge pair and a neighboring hot spot residue (BLIP F142) was investigated using double mutant cycle analyses in the background of the E73M mutation. We find that BLIP F142 cooperatively stabilizes both interactions, illustrating how a single mutation at a hot spot position can drive large perturbations in interface stability and specificity through a cooperative interaction network.

  10. Multidrug-resistant Klebsiella pneumoniae isolated from farm environments and retail products in Oklahoma.

    PubMed

    Kim, Shin-Hee; Wei, Cheng-I; Tzou, Ywh-Min; An, Haejung

    2005-10-01

    Multidrug-resistant enteric bacteria were isolated from turkey, cattle, and chicken farms and retail meat products in Oklahoma. Among the isolated species, multidrug-resistant Klebsiella pneumoniae was prevalently isolated from most of the collected samples. Therefore, a total of 132 isolates of K. pneumoniae were characterized to understand their potential roles in the dissemination of antibiotic-resistance genes in the food chains. Multidrug-resistant K. pneumoniae was most frequently recovered from a turkey farm and ground turkey products among the tested samples. All isolates were resistant to ampicillin, tetracycline, streptomycin, gentamycin, and kanamycin. Class 1 integrons located in plasmids were identified as a common carrier of the aadA1 gene, encoding resistance to streptomycin and spectinomycin. Production of beta-lactamase in the K. pneumoniae isolates played a major role in the resistance to beta-lactam agents. Most isolates (96%) possessed bla(SHV1). Five strains were able to express both SHV-11 (pI 6.2) and TEM-1 (pI 5.2) beta-lactamase. Transfer of these antibiotic-resistance genes to Escherichia coli was demonstrated by transconjugation. The bacterial genomic DNA restriction patterns by pulsed-field gel electrophoresis showed that the same clones of multidrug-resistant K. pneumoniae remained in feathers, feed, feces, and drinking water in turkey environments, indicating the possible dissemination of antibiotic-resistance genes in the ecosystem and cross-contamination of antibiotic-resistant bacteria during processing and distribution of products.

  11. Molecular epidemiology of Escherichia coli producing extended-spectrum beta-lactamases isolated in Rome, Italy.

    PubMed

    Carattoli, Alessandra; García-Fernández, Aurora; Varesi, Paola; Fortini, Daniela; Gerardi, Serena; Penni, Adriano; Mancini, Carlo; Giordano, Alessandra

    2008-01-01

    Escherichia coli strains producing extended-spectrum beta-lactamases (ESBLs) are a major problem in many different hospitals worldwide, causing outbreaks as well as sporadic infections. The prevalence of Escherichia coli ESBL producers was analyzed in a surveillance study performed on the population attending the Policlinico Umberto I, the largest university hospital in Rome, Italy. We also investigated genotypes, pathogenicity islands, and plasmids in the ESBL-positive E. coli isolates as further markers that are useful in describing the epidemiology of the infections. In this survey, 163 nonreplicate isolates of Escherichia coli were isolated from patients from 86 different wards, and 28 were confirmed as ESBL producers. A high prevalence (26/28) of CTX-M-15 producers was observed within the bacterial population circulating in this hospital, and the dissemination of this genetic trait was associated with the spread of related strains; however, these do not have the characteristics of a single epidemic clone spreading. The dissemination was also linked to horizontal transfer among the prevalent E. coli genotypes of multireplicon plasmids showing FIA, FIB, and FII replicons in various combinations, which are well adapted to the E. coli species. The analysis of related bacteria suggests a probable interpatient transmission occurring in several wards, causing small outbreaks. PMID:17959756

  12. Engineering allosteric regulation into the hinge region of a circularly permuted TEM-1 beta-lactamase.

    PubMed

    Mathieu, Valéry; Fastrez, Jacques; Soumillion, Patrice

    2010-09-01

    In nature, the activity of many enzymes involved in important biochemical pathways is controlled by binding a ligand in a site remote from the active site. The allosteric sites are frequently located in hinge regulatory subunits, in which a conformational change can occur and propagate to the active site. The enzymatic activity is then enhanced or decreased depending on the type of effectors. Many artificial binding sites have been created to engineer an allosteric regulation. Generally, these sites were engineered near the active site in loops or at the surface of contiguous helices or strands but rarely in hinge regions. This work aims at exploring the possibility of regulating a monomeric enzyme whose active site is located at the interface between two domains. We anticipated that binding of a ligand in the hinge region linking the domains would modify their positioning and, consequently, modulate the activity. Here, we describe the design of two mutants in a circularly permuted TEM-1 (cpTEM-1) beta-lactamase. The first one, cpTEM-1-His(3) was created by a rational design. It shows little regulation upon metal ion binding except for a weak activation with Zn(2+). The second one, cpTEM-1-3M-His(2), was selected by a directed evolution strategy. It is allosterically down-regulated by Zn(2+), Ni(2+) and Co(2+) with binding affinities around 300 microM.

  13. E240V substitution increases catalytic efficiency toward ceftazidime in a new natural TEM-type extended-spectrum beta-lactamase, TEM-149, from Enterobacter aerogenes and Serratia marcescens clinical isolates.

    PubMed

    Perilli, Mariagrazia; Celenza, Giuseppe; De Santis, Francesca; Pellegrini, Cristina; Forcella, Chiara; Rossolini, Gian Maria; Stefani, Stefania; Amicosante, Gianfranco

    2008-03-01

    The aim of this study was to characterize a novel extended-spectrum beta-lactamase that belongs to the TEM family, the TEM-149 enzyme, and that was isolated from the urine of two hospitalized patients from different hospitals in southern Italy. The peculiarity of this enzyme was the finding of a valine residue at position 240. The array of amino acid substitutions found in TEM-149 was as follows: E104K, R164S, M182T, and E240V. A reversion of a threonine residue at position 182 was also performed to create a new mutant, TEM-149 T182M, in order to assess the contribution of this substitution on the kinetic profile and the stability of TEM-149. The bla TEM-149 and bla TEM-149/T182M genes were cloned into pBC-SK, and the corresponding enzymes were purified from recombinant Escherichia coli HB101 by the same procedure. Both enzymes hydrolyzed all beta-lactams tested, with a preference for ceftazidime, which was found to be the best substrate. By comparison of the kinetic parameters of the TEM-149 and the TEM-149 T182M enzymes, a reduction of the catalytic efficiency for the TEM-149 T182M mutant was observed against all substrates tested except benzylpenicillin, cefotaxime, and aztreonam. Tazobactam, clavulanic acid, and sulbactam were good inhibitors of the TEM-149 beta-lactamase.

  14. Extended-spectrum beta-lactamase-producing bacteria in a tertiary care hospital in Madrid: epidemiology, risk factors and antimicrobial susceptibility patterns

    PubMed Central

    Rubio-Perez, Ines; Martin-Perez, Elena; Garcia, Diego Domingo; Calvo, Manuel Lopez-Brea; Barrera, Eduardo Larrañaga

    2012-01-01

    Introduction Extended-spectrum beta-lactamase (ESBL) producing bacteria have been increasingly reported as causal agents of nosocomial infection worldwide. Resistance patterns vary internationally, and even locally, from one institution to the other. We investigated the clinical isolates positive for ESBL-producing bacteria in our institution, a tertiary care hospital in Madrid (Spain), during a 2-year period (2007–2008). Methods Clinical and microbiological data were retrospectively reviewed. Two hundred and nineteen patients were included in the study. Results Advanced age, diabetes, use of catheters, previous hospitalization and previous antibiotic treatment were some of the risk factors found among patients. Escherichia coli was the most frequent isolate, and urinary tract the most common site of isolation. Internal Medicine, Intensive Care Unit (ICU) and General Surgery presented the highest number of isolates. There were no outbreaks during the study period. Antibiotic patterns showed high resistance rates to quinolones in all isolates. There was 100% sensitivity to carbapenems. Conclusion Carbapenems continue to be the treatment of choice for ESBL-producing bacteria. Infection control measures are of great importance to avoid the spread of these nosocomial infections. PMID:22822411

  15. Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa isolates from Chinese hospitals.

    PubMed

    Wang, Jie; Zhou, Jian-ying; Qu, Ting-ting; Shen, Ping; Wei, Ze-qing; Yu, Yun-song; Li, Lan-juan

    2010-05-01

    We investigated the molecular epidemiology and carbapenem resistance mechanisms of 258 non-duplicate carbapenem-resistant clinical isolates of Pseudomonas aeruginosa collected from 2006 to 2007 at 28 hospitals in China. Up to 88% of the carbapenem-resistant isolates were multidrug-resistant. Pulsed-field gel electrophoresis (PFGE) revealed that levels of intrahospital and interhospital dissemination of clones were low. To assess the mechanisms leading to resistance, all 258 carbapenem-resistant isolates were analysed for expression of the chromosomal beta-lactamase (AmpC), the porin important for entry of carbapenems (OprD) and an efflux system (MexAB-OprM) known to extrude some beta-lactams. Carbapenem resistance was driven mainly by mutational inactivation of OprD, accompanied or not by hyperexpression of AmpC or MexAB-OprM. Metallo-beta-lactamase genes were detected in 22 carbapenem-resistant isolates in China, belonging to eight pulsotypes. The bla(OXA-50) gene was detected among all of the carbapenem-resistant isolates, whereas the bla(GES-5) gene was detected in only one carbapenem-resistant isolate.

  16. Carriage of extended-spectrum beta-lactamase-producing enterobacteriacae among internal medicine patients in Switzerland

    PubMed Central

    2013-01-01

    Background The incidence of extended-spectrum beta-lactamase producing-enterobacteriacae (ESBL-E) infection is rising worldwide. We aimed to determine the prevalence and nosocomial acquisition rate of ESBL-E as well as the risk factors for ESBL-E carriage and acquisition amongst patients consecutively admitted to 13 internal medicine units at our hospital who were not previously known to be ESBL-E carriers. Findings We screened all patients admitted or transferred to internal medicine units for ESBL-E on admission and discharge using rectal swabs. Of 1072 patients screened, 51 (4.8%) were carriers of an ESBL-E at admission. Of 473 patients who underwent admission and discharge screening, 21 (4.4%) acquired an ESBL-E. On multivariate analysis, diabetes mellitus without end-organ complications (OR 2.87 [1.09-7.08]), connective tissue disease (OR 7.22 [1.17-44.59]), and liver failure (OR 8.39 [1.55-45.45]) were independent risk factors for carriage of an ESBL-E upon admission to hospital (area under the ROC curve, 0.68). Receipt of a first- or second-generation cephalosporin (OR 9.25 [2.22-37.82]), intra-hospital transfer (OR 6.68 [1.71-26.06]), and a hospital stay >21 days (OR 25.17 [4.18-151.68]) were associated with acquisition of an ESBL-E during hospitalisation; whilst admission from home was protective (OR 0.16 [0.06-0.39]) on univariate regression. No risk profile with sufficient accuracy to predict previously unknown carriage on admission or acquisition of ESBL-E could be developed using readily available patient information. Conclusions ESBL-E carriage is endemic amongst internal medicine patients at our institution. We were unable to develop a clinical risk profile to accurately predict ESBL-E carriage amongst these patients. PMID:23759067

  17. Prevalence and characteristics of extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae isolated from rural well water in Taian, China, 2014.

    PubMed

    Zhang, Hongna; Zhou, Yufa; Guo, Shuyuan; Chang, Weishan

    2015-08-01

    The production of extended-spectrum beta-lactamase (ESBL) is one of the major antimicrobial resistance mechanisms in Enterobacteriaceae, and the increasing number of ESBL-producing Enterobacteriaceae isolated from water environments has posed a serious threat to the public health. The study aimed to analyze prevalence and characterization of ESBL-producing Enterobacteriaceae from rural well waters in Taian, China. A total of 10 isolates expressing an ESBL phenotype, including 9 Escherichia coli (E. coli) and 1 Klebsiella pneumoniae (K. pneumoniae) was obtained from 4 (4%) out of the 100 sampled wells. ESBL genotype revealed that 9 expressed CTX-M-15 and 1 produced CTX-M-27. Five out of 8 ESBL-producing E. coli expressing CTX-M-15 belonged to ST10, which are mostly detected from human feces in China. Importantly, the only strain of CTX-M-27-producing E. coli belonged to multi-locus sequence type B2:131 (ST131), which may be related with severe infection in humans and animals. PMID:25821088

  18. beta-Lactam resistance phenotype determination in Escherichia coli isolates from University Malaya Medical Centre.

    PubMed

    Wong, Jeanne Sze Lyn; Mohd Azri, Zainal Abidin; Subramaniam, Geetha; Ho, Siaw Eng; Palasubramaniam, Selvi; Navaratnam, Parasakthi

    2003-12-01

    beta-Lactamases have been identified as the major cause of antimicrobial resistance to beta-lactam antibiotics in Escherichia coli. The activities of ampicillin-sulbactam and amoxicillin-clavulanate as well as a range of beta-lactam antibiotics were studied with 87 clinical E. coli isolates from patients of the University Malaya Medical Center using the disc diffusion technique. Susceptible, intermediate and resistant categories were established based on the diameter of zones of inhibition set by the National Committee for Clinical Laboratory Standards (NCCLS). The isolates were then classified into 6 phenotypes according to the criteria stated in the methodology: S (susceptible to all beta-lactams); TL (resistant to aminopenicillins; amoxicillin-clavulanate susceptible and susceptible or intermediate to ampicillin-sulbactam); TI (resistant to aminopenicillins and ampicillin-sulbactam; susceptible to amoxicilin-clavulanate); TH-IRT (resistant to aminopenicillins; intermediate or resistant to amoxicillin-clavulanate; resistant to ampicillin-sulbactam); ESBL (resistant to aminopenicillins and oxyimino cephalosporins; positive results with the double-disc diffusion test); and CP (resistant to aminopenicillins, beta-lactam-beta-lactamase inhibitor combinations, oxyimino cephalosporins and cephamycins). Results showed that the TL phenotype was the commonest (40.2% of the isolates) followed by S (31%), TH-IRT (16.1%), ESBL and CP (3.4% each) and TI (2.3%). One isolate showed both ESBL and CP phenotypes while two isolates were classified as inconclusive. Representatives from each phenotype were further analysed for the presence of beta-lactamases which revealed a predominance of TEM and SHV enzyme producers. PCR-SSCP analysis of the SHV gene from all the ESBL and CP isolates revealed the predominance of SHV 5-type enzyme which was concurrent with our previous studies.

  19. Epidemiology and molecular characterization of extended-spectrum beta-lactamase-producing Enterobacter spp., Pantoea agglomerans, and Serratia marcescens isolates from a Bulgarian hospital.

    PubMed

    Markovska, Rumyana Donkova; Stoeva, Temenuga Jekova; Bojkova, Kalina Dineva; Mitov, Ivan Gergov

    2014-04-01

    Forty-two extended-spectrum beta-lactamase (ESBL)-producing isolates of Enterobacter aerogenes, Enterobacter cloacae, Pantoea agglomerans, and Serratia marcescens, collected consecutively during the period January-November 2011 from the University Hospital in Varna, Bulgaria, were studied to characterize their ESBLs by isoelectric focusing, group-specific PCR, and sequencing. The epidemiological relationship was evaluated by random amplified polymorphic DNA analysis (RAPD). Transferability of ESBL genes was determined by conjugation experiments. Plasmid analysis was done by replicon typing and PstI fingerprinting. The overall rate of ESBL production was 20%. The most widespread enzyme was CTX-M-3, found in 64%. It was dominant in E. aerogenes (100%) and S. marcescens (83%). SHV-12, CTX-M-3, and CTX-M-15 were found among E. cloacae isolates in 50%, 35%, and 45%, respectively. Three main CTX-M-3-producing epidemic clones of E. aerogenes and S. marcescens have been detected. Among E. cloacae isolates, six different RAPD profiles were discerned. The plasmids harboring blaCTX-M-3 belonged to IncL/M type and demonstrated similar PstI fingerprinting profiles. IncFII plasmids were detected in two CTX-M-15-producing E. cloacae isolates. Our results demonstrate wide intrahospital dissemination of clonal E. aerogenes and S. marcescens isolates, carrying IncL/M conjugative plasmids.

  20. Molecular Characterisation of nfsA Gene in Nitrofurantoin Resistant Uropathogens

    PubMed Central

    Shanmugam, Dhivyalakshmi; Narayanaswamy, Anbumani

    2016-01-01

    Introduction Majority of Urinary Tract Infections (UTI’s) are lower UTI’s which constitute the real burden in the primary care setting and are usually treated empirically. Nitrofurantoin is an underused antimicrobial for empiric therapy for community-acquired and nosocomial lower UTIs. Nitrofurantoin has a wide spectrum of action against Escherichia coli, Klebsiella pneumonia and Enterococci, which are the frequent causes of nosocomial lower UTIs and also against multidrug-resistant gram-negative organisms including extended spectrum beta lactamase (ESBL) producers, Amp-C producers and Carbapenamase producers. Aim The study was conducted to describe the resistance pattern of nitrofurantoin and to identify the genes responsible for nitrofurantoin resistance (i.e.) nfsA and the type of mutations involved. Settings and Design This study was conducted in a tertiary care hospital for a period of six months which caters to a total of 1200 beds. Materials and Methods A total of 115 clinical strains of Escherichia coli and Klebsiella pneumoniae including ESBL and Carbapenemase producing isolates were analysed for susceptibility to commonly used antimicrobials. Results ESBL producers 65% and 51% of carbapenems resistant strains were susceptible to nitrofurantoin by minimal inhibitory concentration. MIC to nitrofurantoin was determined by E-strip method. Nitroreductase nfsA gene was detected by PCR in 64 of 70 E.coli isolates with reduced susceptibility to nitrofurantoin. Gene sequencing was done using BLAST algorithm and substitution (N=12) and insertion mutation (N=1) were observed in the resistant strains. Conclusion Nitrofurantoin being an oral antibiotic, its usage in ESBL producers and carbapenamase producers is still warranted. Surprisingly, resistance to nitrofurantoin remains minimal even after extensive use and may be related to the fact that it has multiple mechanisms of action hence may require organisms to develop more than a single mutation to concur

  1. Varying High Levels of Faecal Carriage of Extended-Spectrum Beta-Lactamase Producing Enterobacteriaceae in Rural Villages in Shandong, China: Implications for Global Health

    PubMed Central

    Sun, Qiang; Tärnberg, Maria; Zhao, Lingbo; Stålsby Lundborg, Cecilia; Song, Yanyan; Grape, Malin; Nilsson, Maud; Tomson, Göran; Nilsson, Lennart E.

    2014-01-01

    Antibiotic resistance is considered a major threat to global health and is affected by many factors, of which antibiotic use is probably one of the more important. Other factors include hygiene, crowding and travel. The rapid resistance spread in Gram-negative bacteria, in particular extended-spectrum beta-lactamase (ESBL) producing Enterobacteriaceae (ESBL-E), is a global challenge, leading to increased mortality, morbidity and health systems costs worldwide. Knowledge about resistance in commensal flora is limited, including in China. Our aim was to establish the faecal carriage rates of ESBL-E and find its association with known and suspected risk factors in rural residents of all ages in three socio-economically different counties in the Shandong Province, China. Faecal samples and risk-factor information (questionnaire) were collected in 2012. ESBL-E carriage was screened using ChromID ESBL agar. Risk factors were analysed using standard statistical methods. Data from 1000 individuals from three counties and in total 18 villages showed a high and varying level of ESBL-E carriage. Overall, 42% were ESBL-E carriers. At county level the carriage rates were 49%, 45% and 31%, respectively, and when comparing individual villages (n = 18) the rate varied from 22% to 64%. The high level of ESBL-E carriage among rural residents in China is an indication of an exploding global challenge in the years to come as resistance spreads among bacteria and travels around the world with the movement of people and freight. A high carriage rate of ESBL-E increases the risk of infection with multi-resistant bacteria, and thus the need for usage of last resort antibiotics, such as carbapenems and colistin, in the treatment of common infections. PMID:25405340

  2. Enhancement of fluorescence development of end products by use of a fluorescence developer solution in a rapid and sensitive fluorescent spot test for specific detection of microbial beta-lactamases.

    PubMed

    Chen, K C; Holmes, K K

    1986-03-01

    A fluorescent spot test method for specific detection of microbial beta-lactamases as previously published (K. C. S. Chen, J. S. Knapp, and K. K. Holmes, J. Clin. Microbiol. 19:818-825, 1984) was improved by the use of a fluorescence developer solution. The fluorescence developer solution used in this study consisted of 0.78 M sodium tartrate buffer containing 12% formaldehyde at a final pH of 4.5. An addition of 1 volume of fluorescence developer solution to 5 volumes of ampicillin or cephalex substrate solution incubated with beta-lactamase-producing organisms, followed by heating the mixture at 45 degrees C for 10 min resulted in enhancement of fluorescence of the end products of beta-lactamase activity. This provides a more sensitive assay for microbial beta-lactamases and offers the potential for direct detection of beta-lactamases in clinical specimens.

  3. Evolution of extended-spectrum beta-lactam resistance (SHV-8) in a strain of Escherichia coli during multiple episodes of bacteremia.

    PubMed Central

    Rasheed, J K; Jay, C; Metchock, B; Berkowitz, F; Weigel, L; Crellin, J; Steward, C; Hill, B; Medeiros, A A; Tenover, F C

    1997-01-01

    Nine isolates of Escherichia coli were recovered from seven blood cultures over a period of 3 months from a 19-month-old female with aplastic anemia. Initial isolates were susceptible to extended-spectrum cephalosporins, including ceftazidime (MIC, < or = 0.25 microgram/ml), but gradually became resistant to this drug (MICs, > or = 128 micrograms/ml) and other cephalosporins and the monobactam aztreonam. Molecular typing methods, including plasmid profile analysis, pulsed-field gel electrophoresis, and arbitrarily primed PCR, indicated that the nine isolates were derived from a common ancestor. Dot blot hybridization and PCR analysis of total bacterial DNA using blaSHV- and blaTEM-specific DNA probes and primers identified the presence of a blaTEM beta-lactamase gene in all of the isolates and a blaSHV gene in the isolates with elevated ceftazidime MICs. Isoelectric focusing analysis of crude lysates showed that all nine isolates contained an enzyme with a pI of 5.4 corresponding to the TEM-1 beta-lactamase, and those isolates containing an SHV-type beta-lactamase demonstrated an additional band with a pI of 7.6. The first of the ceftazidime-resistant isolates appeared to hyperproduce the SHV enzyme compared to the other resistant isolates. DNA sequencing revealed a blaSHV-1 gene in the first ceftazidime-resistant isolate and a novel blaSHV gene, blaSHV-8, with an Asp-to-Asn substitution at amino acid position 179 in the remaining four isolates. Three of the ceftazidime-resistant isolates also showed a change in porin profile. The patient had received multiple courses of antimicrobial agents during her illness, including multiple courses of ceftazidime. This collection of blood isolates from the same patient appears to represent the in vivo evolution of resistance under selective pressure of treatment with various cephalosporins. PMID:9056008

  4. Prevalence and Risk Factors associated with Extended Spectrum Beta Lactamase Producing Escherichia coli and Klebsiella pneumoniae Isolates in Hospitalized Patients in Kashan (Iran)

    PubMed Central

    Sharif, Mohammad Reza; Soltani, Babak; Moravveji, Alireza; Erami, Mahzad; Soltani, Nika

    2016-01-01

    Introduction Production of extended spectrum beta lactamase (ESBL) is an important mechanism of antimicrobial resistance in Escherichia coli (E. coli) and Klebsiella pneumoniae (K. pneumoniae) isolates. This study was performed to determine the prevalence and risk factors associated with ESBL producing strains of E. coli and K. pneumoniae. Methods In this cross-sectional study, 250 strains (134 E. coli and 116 K. pneumoniae) were obtained, and ESBL producing isolates were detected by the combination disk test in Shahid Beheshti Hospital in Kashan, Iran, from February 2012 to June 2013. Antimicrobial resistance was screened by the disk diffusion method and was confirmed by E-test. Furthermore, risk factors of ESBL producing E. coli and K. pneumoniae microorganisms were determined. Data were analyzed by SPSS version 16, using descriptive statistics, chi-squared, independent-samples t-test, and logistic regression analysis. Results One hundred and two (40.8%) of all strains were ESBL producers, of which 54 (52.9%) were E. coli and 48 (47.1%) were K. pneumoniae (p = 0.86). Furthermore, 40.3% of E. coli and 41.4% of K. pneumoniae isolates were ESBL producers (p = 0.86). The most antimicrobial resistance was to ampicillin, and no imipenem resistance was detected. Risk factors for ESBL producing E. coli included admission duration exceeding 7 days (p = 0.011) and antibiotic use in the last month (p < 0.001), and the associated risk factor for ESBL producing K. pneumoniae was antibiotic use during the recent month (p = 0.002). Conclusion This study identified a relatively high prevalence of ESBL production among E. coli and K. pneumoniae strains. Furthermore, anti-bimicrobial use and admission duration were risk factors for ESBL producing isolates. Therefore, more comprehensive investigations are needed for the development of new strategies to control the dissemination of these microbes. PMID:27123215

  5. Toxigenic genes, spoilage potential, and antimicrobial resistance of Bacillus cereus group strains from ice cream.

    PubMed

    Arslan, Seza; Eyi, Ayla; Küçüksarı, Rümeysa

    2014-02-01

    Bacillus spp. can be recovered from almost every environment. It is also found readily in foods, where it may cause food spoilage and/or food poisoning due to its toxigenic and pathogenic nature, and extracellular enzymes. In this study, 29 Bacillus cereus group strains from ice cream were examined for the presence of following virulence genes hblC, nheA, cytK and ces genes, and tested for a range of the extracellular enzymes, and antimicrobial susceptibility. The strains were found to produce extracellular enzymes: proteolytic and lipolytic activity, gelatin hydrolysis and lecithinase production (100%), DNase production (93.1%) and amylase activity (93.1%). Of 29 strains examined, 24 (82.8%) showed hemolytic activity on blood agar. Beta-lactamase enzyme was only produced by 20.7% of B. cereus group. Among 29 B. cereus group from ice cream, nheA was the most common virulence gene detected in 44.8% of the strains, followed by hblC gene with 17.2%. Four (13.8%) of the 29 strains were positive for both hblC gene and nheA gene. Contrarily, cytK and ces genes were not detected in any of the strains. Antimicrobial susceptibility of ice cream isolates was tested to 14 different antimicrobial agents using the disc diffusion method. We detected resistance to penicillin and ampicillin with the same rate of 89.7%. Thirty-one percent of the strains were multiresistant to three or more antibiotics. This study emphasizes that the presence of natural isolates of Bacillus spp. harboring one or more enterotoxin genes, producing extracellular enzymes which may cause spoilage and acquiring antibiotic resistance might hold crucial importance in the food safety and quality.

  6. Prevalence of beta lactamase producing species of pseudomonas and acinetobacter in pediatric burn patients.

    PubMed

    Sobouti, B; Khosravi, N; Daneshvar, A; Fallah, S; Moradi, M; Ghavami, Y

    2015-09-30

    Burn wound infection is a major cause of morbidity and mortality in burn victims. Pseudomonas and Acinetobacter species are among the most common organisms complicating burn wounds. Presence of extended spectrum ß-lactamase (ESBL) and metallo-ß-lactamase (MBL) genes plays an important role in spreading ß-lactam resistant strains of these organisms and is a serious condition in the treatment of the affected patients. As a result, we aimed to determine the prevalence of SHV, TEM, PER and VIM ß-lactamases in Pseudomonas and Acinetobacter species isolates from burn wound swabs of children with burn injury. In this descriptive observational study, 107 Pseudomonas and Acinetobacter isolates collected from burn patients were subjected to PCR assay. Using PCR method and DNA sequencing, the existence of SHV-, TEM-, PER- and VIM-type ß-lactamase encoding genes were determined. Out of the 107 Pseudomonas and Acinetobacter isolates, 66 (77.6%) were ESBL positive, 26.2% were positive for SHV gene, 37.4% were positive for TEM gene, 14% were positive for PER gene and 15.9% of them harbored VIM gene. More than half of the Pseudomonas and Acinetobacter strains in our pediatric burn unit harbor ß-lactamase encoding genes that make them resistant to a wide range of ß-lactam antibiotics. Consequently, it is suggested to choose an appropriate antibiotic regimen based on the antibiogram pattern of the strains. PMID:27279802

  7. Investigation of a nosocomial outbreak of extended-spectrum beta-lactamase VEB-1-producing isolates of Acinetobacter baumannii in a hospital setting.

    PubMed

    Carbonne, A; Naas, T; Blanckaert, K; Couzigou, C; Cattoen, C; Chagnon, J-L; Nordmann, P; Astagneau, P

    2005-05-01

    A nosocomial outbreak of epidemiologically related VEB-1 extended-spectrum beta-lactamase-producing isolates of Acinetobacter baumannii occurred in 33 patients in an intensive care unit. A case-control study identified previous treatment with third-generation cephalosporins as the only risk factor for A. baumannii acquisition. Rationale for antibiotic use should be strengthened.

  8. Clinical and bacteriological efficacy of amikacin in the treatment of lower urinary tract infection caused by extended-spectrum beta-lactamase-producing Escherichia coli or Klebsiella pneumoniae.

    PubMed

    Ipekci, Tumay; Seyman, Derya; Berk, Hande; Celik, Orcun

    2014-12-01

    Urinary tract infections (UTIs) caused by extended-spectrum beta-lactamase (ESBL)-producing bacteria have become a growing problem limiting therapeutic options. The aim of this study was to investigate the clinical and microbiological efficacy of amikacin treatment in adult patients with lower UTIs due to ESBL-producing Escherichia coli (Ec) or Klebsiella pneumonia (Kp). We conducted a retrospective study of 36 outpatients aged >18 years with dysuria or problems with frequency or urgency in passing urine; pyuria and a positive urine culture (10(5) cfu/ml) for ESBL producing Ec or Kp which is also resistant to nitrofurantoin, fosfomycin, quinolones and trimethoprim/sulfamethoxazole, between January 2013 and February 2014. Patients received intramuscular amikacin 15 mg/kg/day for 10 days. Clinical success was defined as disappearance of symptoms. Bacteriological success was defined as sterile control urine cultures. 58.3% of patients were female. Age range was 18-89 years. All of the patients had at least one complicating factor. 77.8% of the isolates were E. coli. Clinical success rate was 97.2%. Overall bacteriological success rates were 91.7% on the 3 day of treatment, 97.1% at the end of the treatment and 94.1% on the 7-10 days after treatment. After 28-32 days following the treatment, reinfection was found in 12% whereas relapse was not determined. Nephrotoxicity was developed in one patient. The clinicians should keep in mind that amikacin treatment is an efficient and safe alternative treatment option before the carbapenem treatment especially in patients with lower UTIs caused by ESBL-producing Ec or Kp that are resistant to all oral antibiotics.

  9. Bacterial cheating limits antibiotic resistance

    NASA Astrophysics Data System (ADS)

    Xiao Chao, Hui; Yurtsev, Eugene; Datta, Manoshi; Artemova, Tanya; Gore, Jeff

    2012-02-01

    The widespread use of antibiotics has led to the evolution of resistance in bacteria. Bacteria can gain resistance to the antibiotic ampicillin by acquiring a plasmid carrying the gene beta-lactamase, which inactivates the antibiotic. This inactivation may represent a cooperative behavior, as the entire bacterial population benefits from removing the antibiotic. The cooperative nature of this growth suggests that a cheater strain---which does not contribute to breaking down the antibiotic---may be able to take advantage of cells cooperatively inactivating the antibiotic. Here we find experimentally that a ``sensitive'' bacterial strain lacking the plasmid conferring resistance can invade a population of resistant bacteria, even in antibiotic concentrations that should kill the sensitive strain. We observe stable coexistence between the two strains and find that a simple model successfully explains the behavior as a function of antibiotic concentration and cell density. We anticipate that our results will provide insight into the evolutionary origin of phenotypic diversity and cooperative behaviors.

  10. Origin and evolution of the AmpC beta-lactamases of Citrobacter freundii.

    PubMed

    Barlow, Miriam; Hall, Barry G

    2002-05-01

    To determine whether the widespread clinical use of beta-lactams has been selective for Citrobacter freundii-derived alleles of plasmid ampC genes, we generated a Bayesian consensus phylogeny of the published ampC sequences and compared the MICs of 16 beta-lactam antibiotics for Escherichia coli strains containing cloned copies of the C. freundii ampC alleles. We found that for the majority of compounds investigated, there has been essentially no increase in beta-lactam resistance conferred by those alleles. We also found that ampC alleles from the chromosomes of two beta-lactam-sensitive C. freundii strains isolated in the 1920s, before the clinical use of antibiotics, were as effective at providing beta-lactam resistance in E. coli as were the plasmid-borne alleles from beta-lactam-resistant clinical isolates. These results suggest that selection for increased resistance to beta-lactam antibiotics has not been a significant force directing the evolution of the C. freundii ampC alleles found in beta-lactam-resistant clinical isolates.

  11. Detection of Multi-drug Resistant Acinetobacter Lwoffii Isolated from Soil of Mink Farm.

    PubMed

    Sun, Na; Wen, Yong Jun; Zhang, Shu Qin; Zhu, Hong Wei; Guo, Li; Wang, Feng Xue; Chen, Qiang; Ma, Hong Xia; Cheng, Shi Peng

    2016-07-01

    There were 4 Acinetobacter lwoffii obtained from soil samples. The antimicrobial susceptibility of the strains to 16 antimicrobial agents was investigated using K-B method. Three isolates showed the multi-drug resistance. The presence of resistance genes and integrons was determined using PCR. The aadA1, aac(3')-IIc, aph(3')-VII, aac(6')-Ib, sul2, cat2, floR, and tet(K) genes were detected, respectively. Three class 1 integrons were obtained. The arr-3-aacA4 and blaPSE-1 gene cassette, which cause resistance to aminoglycoside and beta-lactamase antibiotics. Our results reported the detection of multi-drug resistant and carried resistant genes Acinetobacter lwoffii from soil. The findings suggested that we should pay close attention to the prevalence of multi-drug resistant bacterial species of environment. PMID:27554122

  12. Ambler Class A Extended-Spectrum Beta-Lactamase-Producing Escherichia coli and Klebsiella spp. in Canadian Hospitals

    PubMed Central

    Mulvey, Michael R.; Bryce, Elizabeth; Boyd, David; Ofner-Agostini, Marianna; Christianson, Sara; Simor, Andrew E.; Paton, Shirley

    2004-01-01

    This report describes a study carried out to gain baseline information on the molecular characteristics of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli and Klebsiella spp. in Canada. A total of 29,323 E. coli and 5,156 Klebsiella sp. isolates were screened at 12 participating sites. Of these, 505 clinically significant, nonrepeat isolates displaying reduced susceptibility to the NCCLS-recommended beta-lactams were submitted to a central laboratory over a 1-year period ending on 30 September 2000. A total of 116 isolates were confirmed to be ESBL producers. PCR and sequence analysis revealed the presence of TEM-11 (n = 1), TEM-12 (n = 1), TEM-29 (n = 1), TEM-52 (n = 4), CTX-M-13 (n = 1), CTX-M-14 (n = 15), CTX-M-15 (n = 11), SHV-2 (n = 2), SHV-2a (n = 12), SHV-5 (n = 6), SHV-12 (n = 45), and SHV-30 (n = 2). Five novel beta-lactamases were identified and designated TEM-115 (n = 2), TEM-120 (n = 1), SHV-40 (n = 2), SHV-41 (n = 4), and SHV-42 (n = 1). In addition, no molecular mechanism was identified for five isolates displaying an ESBL phenotype. Macrorestriction analysis of all ESBL isolates was conducted, as was restriction fragment length polymorphism analysis of plasmids harboring ESBLs. Although a “clonal” distribution of isolates was observed at some individual sites, there was very little evidence suggesting intrahospital spread. In addition, examples of identical or closely related plasmids that were identified at geographically distinct sites across Canada are given. However, there was considerable diversity with respect to plasmid types observed. PMID:15047521

  13. Mutational analysis of the two zinc-binding sites of the Bacillus cereus 569/H/9 metallo-beta-lactamase.

    PubMed Central

    de Seny, Dominique; Prosperi-Meys, Christelle; Bebrone, Carine; Rossolini, Gian Maria; Page, Michael I; Noel, Philippe; Frère, Jean-Marie; Galleni, Moreno

    2002-01-01

    The metallo-beta-lactamase BcII from Bacillus cereus 569/H/9 possesses a binuclear zinc centre. The mono-zinc form of the enzyme displays an appreciably high activity, although full efficiency is observed for the di-zinc enzyme. In an attempt to assign the involvement of the different zinc ligands in the catalytic properties of BcII, individual substitutions of selected amino acids were generated. With the exception of His(116)-->Ser (H116S), C221A and C221S, the mono- and di-zinc forms of all the other mutants were poorly active. The activity of H116S decreases by a factor of 10 when compared with the wild type. The catalytic efficiency of C221A and C221S was zinc-dependent. The mono-zinc forms of these mutants exhibited a low activity, whereas the catalytic efficiency of their respective di-zinc forms was comparable with that of the wild type. Surprisingly, the zinc contents of the mutants and the wild-type BcII were similar. These data suggest that the affinity of the beta-lactamase for the metal was not affected by the substitution of the ligand. The pH-dependence of the H196S catalytic efficiency indicates that the zinc ions participate in the hydrolysis of the beta-lactam ring by acting as a Lewis acid. The zinc ions activate the catalytic water molecule, but also polarize the carbonyl bond of the beta-lactam ring and stabilize the development of a negative charge on the carbonyl oxygen of the tetrahedral reaction intermediate. Our studies also demonstrate that Asn(233) is not directly involved in the interaction with the substrates. PMID:11964169

  14. Outbreak of Extended-Spectrum Beta-Lactamase Producing Enterobacter cloacae with High MICs of Quaternary Ammonium Compounds in a Hematology Ward Associated with Contaminated Sinks

    PubMed Central

    Chapuis, Angélique; Amoureux, Lucie; Bador, Julien; Gavalas, Arthur; Siebor, Eliane; Chrétien, Marie-Lorraine; Caillot, Denis; Janin, Marion; de Curraize, Claire; Neuwirth, Catherine

    2016-01-01

    Objective: To investigate an outbreak of extended-spectrum beta-lactamase (ESBL) producing Enterobacter cloacae that occurred in the Hematology ward (24-bed unit) of the François Mitterrand University Hospital (Dijon, France) between January 2011 and December 2013. The outbreak involved 43 patients (10 infected and 33 colonized). Design: We performed environmental analysis to detect multiresistant E. cloacae for comparison with clinical isolates (genotyping by pulsed-field gel electrophoresis and MLST as well as ESBL-typing) and determined the MICs of the quaternary ammonium compounds (QACs) alkyldimethylbenzylammonium chloride (ADBAC) and didecyldimethylammonium chloride (DDAC). A bleach-based cleaning-disinfection program was implemented in December 2012 after mechanical removal of the biofilm in all sinks. Results: We have detected 17 ESBL-producing E. cloacae in patients sink drains, shower drains and medical sink drains. Sequencing of the bla genes performed on 60 strains recovered from patients and environment (n = 43 clinical and n = 17 environmental) revealed that bla CTX−M15 was predominant (37 isolates) followed by bla CTX−M9 plus bla SHV−12 (20 isolates). We observed a great diversity among the isolates: 14 pulsotypes (11 STs) in clinical isolates and 9 pulsotypes (7 STs) in environmental isolates. Six pulsotypes were identical between clinical and environmental isolates. MICs of the quaternary ammonium compounds widely used for disinfection were very high in clinical and environmental isolates. Immediately after the implementation of the disinfection program we noticed a substantial fall in cases number. Our findings demonstrate the role of drains as important reservoir of ESBL-producing E. cloacae and highlight the necessity to settle drains accessible to achieve correct cleaning as well as to use disinfectant with proved activity against nosocomial pathogens. PMID:27462306

  15. Genetic analysis of faropenem-resistant Enterococcus faecalis in urinary isolates.

    PubMed

    Hiraga, Noriyuki; Muratani, Tetsuro; Naito, Seiji; Matsumoto, Tetsuro

    2008-04-01

    We isolated faropenem-resistant Enterococcus faecalis in urine specimens and studied the mechanisms of resistance to faropenem in these isolates. Three mechanisms of penicillin resistance have been reported in E. faecalis; (1) beta-lactamase production, (2) overproduction of penicillin-binding protein (PBP) 4 or PBP5, and (3) decreasing affinities of penicillins for PBP4 by the occurrence of point mutations of the penicillin-binding domain. None of the E. faecalis isolates examined produced beta-lactamase or overproduced any PBPs, but the affinities of faropenem for PBP4 were decreased in faropenem-insensitive and -resistant strains. We found single amino acid substitutions at positions 475, 520 or 605 in PBP4 in the insensitive strains and two amino acid substitutions at positions 520 and 605 in PBP4 in the resistant strains by sequencing the entire pbp4 gene from each isolate. We conclude that development of resistance to faropenem in E. faecalis is due to decreasing affinities for PBP4 that are the result of the occurrence of one or two point mutations. PMID:18503200

  16. Prevalence of Quinolone Resistance Genes Among Extended-Spectrum B-Lactamase-Producing Escherichia coli in Mashhad, Iran

    PubMed Central

    Harifi Mood, Elnaz; Meshkat, Zahra; Izadi, Nafiseh; Rezaei, Maryam; Amel Jamehdar, Saeid; Naderi Nasab, Mahboubeh

    2015-01-01

    Background: Escherichia coli is an important bacterial species based on incidence and associated infection severity. Some E. coli strains produce extended-spectrum beta lactamase (ESBL) and are called ESBL-producing E. coli. These strains are resistant to most classes of cephalosporin and a number of other classes of antibiotics. Plasmids carrying qnr genes have been found to transmit quinolone resistance. Objectives: The aim of this study was to determine the frequency of qnr genes in ESBL-producing and non-ESBL-producing E. coli isolated from outpatient and hospitalized patient clinical specimens from Imam Reza hospital in Mashhad, Iran. Materials and Methods: Two hundred E. coli strains, isolated from different clinical specimens were used. ESBL-producing E. coli were detected by determining susceptibility to ceftazidime, cefotaxime, and cefpodoxime with the phenotypic confirmatory test (PCT). PCR analysis was employed to detect the qnrA, qnrB, qnrS, blaTEM, and blaSHV genes. Results: Eighty-six (43%) isolates were ciprofloxacin-resistant. The PCT identified 85 (42.5%) of 200 E. coli isolates as ESBL-producing. The blaTEM, blaSHV, qnrA, qnrB, and qnrS gene were found in 65 (76.47%), 23 (27%), 63 (31%), 34 (17%), and 14 (7%) isolates, respectively. Conclusions: The high prevalence of quinolone resistance genes, which indicates antibiotic resistance, in the Imam Reza Hospital of Mashhad is a major concern. Hence, the antibiotics prescription policy should be revised, and infection control measures should be improved. PMID:26870307

  17. Resident microbiota of the gypsy moth midgut harbors antibiotic resistance determinants.

    PubMed

    Allen, Heather K; Cloud-Hansen, Karen A; Wolinski, Joseph M; Guan, Changhui; Greene, Serena; Lu, Shyue; Boeyink, Mallory; Broderick, Nichole A; Raffa, Kenneth F; Handelsman, Jo

    2009-03-01

    Little is known about the significance of insects as environmental reservoirs of antibiotic-resistant bacteria. We characterized the antibiotic resistome of the microbial community in gypsy moth larval midguts by applying functional metagenomics to cultured isolates. The minimum inhibitory concentrations of 12 antibiotics were determined for 44 cultured isolates, and antibiotic resistance genes were selected from metagenomic libraries derived from DNA extracted from a pool of the isolates. Six unique clones were identified. Two were highly resistant to penicillin-type beta-lactams, two were moderately resistant to erythromycin, and two were moderately resistant to a range of antibiotics, including erythromycin, carbenicillin, and chloramphenicol. Sequence analysis predicted that the active genes encoded efflux pumps, a transcriptional activator of efflux pump protein expression, and an extended-spectrum class A beta-lactamase. Insect guts are a reservoir of antibiotic resistance genes with the potential for dissemination.

  18. Isolation and molecular characterization of multidrug-resistant Gram-negative bacteria from imported flamingos in Japan.

    PubMed

    Sato, Maiko; Ahmed, Ashraf M; Noda, Ayako; Watanabe, Hitoshi; Fukumoto, Yukio; Shimamoto, Tadashi

    2009-01-01

    Imported animals, especially those from developing countries, may constitute a potential hazard to native animals and to public health. In this study, a new flock of lesser flamingos imported from Tanzania to Hiroshima Zoological Park were screened for multidrug-resistant Gram-negative bacteria, integrons and antimicrobial resistance genes. Thirty-seven Gram-negative bacterial isolates were obtained from the flamingos. Seven isolates (18.9%) showed multidrug resistance phenotypes, the most common being against: ampicillin, streptomycin, tetracycline, trimethoprim/sulfamethoxazole and nalidixic acid. Molecular analyses identified class 1 and class 2 integrons, beta-lactamase-encoding genes, blaTEM-1 and blaCTX-M-2 and the plasmid-mediated quinolone resistance genes, qnrS and qnrB. This study highlights the role of animal importation in the dissemination of multidrug-resistant bacteria, integrons and antimicrobial resistance genes from one country to another.

  19. Resistance to methicillin of coagulase-negative staphylococci (CNS) isolated from bovine mastitis.

    PubMed

    Bochniarz, M; Wawron, W; Szczubial, M

    2013-01-01

    The aim of this study was to determine the mechanisms of staphylococcal resistance to methicillin. CNS (n = 100 isolates) were prepared from the mammary inflammatory secretions of 86 cows from farms located in the Lublin region. Methicillin-resistant isolates constituted 20.0% of all CNS. Staphylococcus sciuri (n=8) and Staphylococcus xylosus (n=6) were most abundant, followed by Staphylococcus chromogenes (n=3), Staphylococcus haemolyticus (n=2) and Staphylococcus warned (n=1). The mecA gene was found in 50.0% of MRCNS (10.0% of all CNS isolates) belonging to two species: S. sciuri and S. xylosus. All mecA-positive isolates contained the protein of low affinity to penicillin (penicillin-binding protein 2a - PBP2a). The enzyme hydrolysing the beta-lactam ring in antibiotics was detected in 40.0% of MRCNS; 10.0% of MRCNS isolates were characterised by the presence of the mecA gene and ability to produce beta-lactamase. The remaining 20.0% of MRCNS isolates showing phenotypic resistance to methicillin were mecA gene-negative and were not able to produce beta-lactamase. PMID:24597303

  20. Recognition and clinical significance of mechanisms of bacterial resistance to beta-lactams.

    PubMed

    Mouton, R P

    1984-01-01

    Resistance to beta-lactams may be difficult to recognize. This is due to the difficulty in detecting these resistances, when the routine tests performed in diagnostic laboratories are interpreted in the usual manner. Since failure to recognize this type of resistance may have serious consequences for the patient, it is essential that it be detected when present. For the detection of methicillin resistance of Staphylococcus aureus a standardized method using either a medium containing 5% NaCl or a low incubation temperature is advocated. Methicillin resistance of S. epidermidis can only be recognized reliably by means of a quantitative test and incubation for 42-48 h. Resistance of Haemophilus influenzae to ampicillin may be intrinsic or it may be caused by a TEM beta-lactamase; a beta-lactamase test should be used to detect the latter type of resistance. Inducible cephalosporinase may be responsible for the rapid development of resistance of some bacterial species to cefamandole, even during therapy. If a stable beta-lactamase production is attained by mutation, resistance to other beta-lactams will usually be present as well. Routine induction tests should be performed for all isolates of species of Enterobacter, Serratia, Citrobacter and Proteus, indole-positive. The same type of 'hidden' resistance may be present in Pseudomonas aeruginosa, with regard to cefotaxime and other third-generation cephalosporins. Beta-lactamase-positive Neisseria gonorrhoeae can easily be recognized by a beta-lactamase test. In addition, the results of diffusion tests allow one to distinguish between beta-lactamase-positive and beta-lactamase-negative strains. Recognition of those strains of N. gonorrhoeae having a decreased susceptibility to penicillin is only possible when well-standardized quantitative tests are used.

  1. Recognition and clinical significance of mechanisms of bacterial resistance to beta-lactams.

    PubMed

    Mouton, R P

    1984-01-01

    Resistance to beta-lactams may be difficult to recognize. This is due to the difficulty in detecting these resistances, when the routine tests performed in diagnostic laboratories are interpreted in the usual manner. Since failure to recognize this type of resistance may have serious consequences for the patient, it is essential that it be detected when present. For the detection of methicillin resistance of Staphylococcus aureus a standardized method using either a medium containing 5% NaCl or a low incubation temperature is advocated. Methicillin resistance of S. epidermidis can only be recognized reliably by means of a quantitative test and incubation for 42-48 h. Resistance of Haemophilus influenzae to ampicillin may be intrinsic or it may be caused by a TEM beta-lactamase; a beta-lactamase test should be used to detect the latter type of resistance. Inducible cephalosporinase may be responsible for the rapid development of resistance of some bacterial species to cefamandole, even during therapy. If a stable beta-lactamase production is attained by mutation, resistance to other beta-lactams will usually be present as well. Routine induction tests should be performed for all isolates of species of Enterobacter, Serratia, Citrobacter and Proteus, indole-positive. The same type of 'hidden' resistance may be present in Pseudomonas aeruginosa, with regard to cefotaxime and other third-generation cephalosporins. Beta-lactamase-positive Neisseria gonorrhoeae can easily be recognized by a beta-lactamase test. In addition, the results of diffusion tests allow one to distinguish between beta-lactamase-positive and beta-lactamase-negative strains. Recognition of those strains of N. gonorrhoeae having a decreased susceptibility to penicillin is only possible when well-standardized quantitative tests are used. PMID:6442123

  2. Bacterial Cheating Limits the Evolution of Antibiotic Resistance

    NASA Astrophysics Data System (ADS)

    Yurtsev, Eugene; Xiao Chao, Hui; Datta, Manoshi; Artemova, Tatiana; Gore, Jeff

    2012-02-01

    The emergence of antibiotic resistance in bacteria is a significant health concern. Bacteria can gain resistance to the antibiotic ampicillin by acquiring a plasmid carrying the gene beta-lactamase, which inactivates the antibiotic. This inactivation may represent a cooperative behavior, as the entire bacterial population benefits from removal of the antibiotic. The presence of a cooperative mechanism of resistance suggests that a cheater strain - which does not contribute to breaking down the antibiotic - may be able to take advantage of resistant cells. We find experimentally that a ``sensitive'' bacterial strain lacking the plasmid conferring resistance can invade a population of resistant bacteria, even in antibiotic concentrations that should kill the sensitive strain. We use a simple model in conjunction with difference equations to explain the observed population dynamics as a function of cell density and antibiotic concentration. Our experimental difference equations resemble the logistic map, raising the possibility of oscillations or even chaotic dynamics.

  3. Clinical isolates of Enterobacteriaceae producing extended-spectrum beta-lactamases: prevalence of CTX-M-3 at a hospital in China.

    PubMed

    Wang, Hui; Kelkar, Swathi; Wu, Weiyuan; Chen, Minjun; Quinn, John P

    2003-02-01

    The prevalence of extended-spectrum beta-lactamase-producing strains was demonstrated in 5 of 44 (11.4%) Escherichia coli, 17 of 43 (39.5%) Klebsiella pneumoniae, 3 of 50 (6.0%) Enterobacter cloacae, and 2 of 25 (8.0%) Citrobacter freundii strains at a teaching hospital in China. Nineteen of these 27 strains expressed CTX-M-3 beta-lactamase (pI 8.6). A subset of the clinical isolates expressing the CTX-M-3 enzyme, tested by pulsed-field gel electrophoresis, revealed multiple clones. Five isolates expressed a novel enzyme, SHV-43 (pI 8.0), which had two substitutions (Leu113Phe and Thr149Ser) compared with SHV-1.

  4. Fecal Colonization with Extended-Spectrum Beta-Lactamase and AmpC-Producing Escherichia coli

    PubMed Central

    El Mahdy, Taghrid S.; Shibl, Atef M.

    2016-01-01

    Background. Extended-spectrum β-lactamases (ESβLs) and AmpC β-lactamases cause β-lactam resistance in Escherichia coli. Fecal colonization by ESβL- and/or AmpC-positive E. coli is a source of nosocomial infections. Methods. In order to investigate inpatient fecal colonization by ESβLs and AmpC, antibiotic sensitivity tests were conducted and minimum inhibitory concentrations (MICs) were determined using the disk diffusion method and E-test, respectively. Characterization of ESβL and AmpC was performed using E-test strips, and a set of PCRs and DNA sequence analyses were used to characterize the ESβL and AmpC genes. Results. The whole collection of E. coli isolates (n = 50) was sensitive to imipenem, tigecycline, colistin, and fosfomycin, while 26% of the isolates showed reduced susceptibility to ceftazidime (MIC ≥ 4 μg/mL). ESβL was phenotypically identified in 26% (13/50) of cases, while AmpC activity was detected in two ESβL-producing E. coli isolates. All ESβL-producing E. coli were positive for the CTX-M gene, eleven isolates carried blaCTX-M-15, and two isolates carried blaCTX-M-14 gene. Two CTX-M-positive E. coli isolates carried blaCMY-2. Conclusions. The alimentary tract is a significant reservoir for ESβL- and/or AmpC-producing E. coli, which may lead to nosocomial infection. PMID:27340657

  5. Sensitive and specific modified Hodge test for KPC and metallo-beta- lactamase detection in Pseudomonas aeruginosa by use of a novel indicator strain, Klebsiella pneumoniae ATCC 700603.

    PubMed

    Pasteran, Fernando; Veliz, Omar; Rapoport, Melina; Guerriero, Leonor; Corso, Alejandra

    2011-12-01

    We evaluated the ability of the modified Hodge test to discriminate between KPC- and metallo-beta-lactamase (MBL)-producing Pseudomonas aeruginosa isolates and carbapenemase nonproducers. With Escherichia coli ATCC 25922 as the indicator strain, the MHT resulted in low sensitivity, specificity, and repeatability. Replacing the indicator strain with Klebsiella pneumoniae ATCC 700603 led to an improved performance (100%, 97%, 0%, and 100% sensitivity, specificity, indeterminate results and repeatability, respectively).

  6. 68Zn isotope exchange experiments reveal an unusual kinetic lability of the metal ions in the di-zinc form of IMP-1 metallo-beta-lactamase.

    PubMed

    Siemann, Stefan; Badiei, Hamid R; Karanassios, Vassili; Viswanatha, Thammaiah; Dmitrienko, Gary I

    2006-02-01

    The apparently paradoxical behaviour of facile exchange (kinetic lability) of tightly bound (thermodynamic stability) zinc ions in the enzyme IMP-1 metallo-beta-lactamase with Zn-68 and cadmium ions, as indicated by in-torch vaporization inductively-coupled plasma mass spectrometry (ITV-ICP-MS) and electrospray-ionization mass spectrometry (ESI-MS), is consistent with the involvement of a third metal ion in promoting Lewis acid/base type exchange processes.

  7. Involvement of a Novel Class C Beta-Lactamase in the Transglutaminase Mediated Cross-Linking Cascade of Streptomyces mobaraensis DSM 40847.

    PubMed

    Zindel, Stephan; Ehret, Vera; Ehret, Marina; Hentschel, Madeleine; Witt, Samantha; Krämer, Andreas; Fiebig, David; Jüttner, Norbert; Fröls, Sabrina; Pfeifer, Felicitas; Fuchsbauer, Hans-Lothar

    2016-01-01

    Streptomyces mobaraensis DSM 40847 secretes transglutaminase that cross-links proteins via γ-glutamyl-ε-lysine isopeptide bonds. Characterized substrates are inhibitory proteins acting against various serine, cysteine and metalloproteases. In the present study, the bacterial secretome was examined to uncover additional transglutaminase substrates. Fractional ethanol precipitation of the exported proteins at various times of culture growth, electrophoresis of the precipitated proteins, and sequencing of a 39 kDa protein by mass spectrometry revealed the novel beta-lactamase Sml-1. As indicated by biotinylated probes, Sml-1, produced in E. coli, exhibits glutamine and lysine residues accessible for transglutaminase. The chromogenic cephalosporin analogue, nitrocefin, was hydrolyzed by Sml-1 with low velocity. The obtained Km and kcat values of the recombinant enzyme were 94.3±1.8 μM and 0.39±0.03 s(-1), respectively. Penicillin G and ampicillin proved to be weak inhibitors of nitrocefin hydrolysis (Ki of 0.1 mM and 0.18 mM). Negligible influence of metals on β-lactamase activity ruled out that Sml-1 is a Zn2+-dependent class B beta-lactamase. Rather, sequence motifs such as SITK, YSN, and HDG forming the active core in a hypothetical structure may be typical for class C beta-lactamases. Based on the results, we assume that the novel transglutaminase substrate ensures undisturbed growth of aerial hyphae in Streptomyces mobaraensis by trapping and inactivating hostile beta-lactam antibiotics. PMID:26886195

  8. Molecular epidemiology of plasmid spread among extended broad-spectrum beta-lactamase-producing Klebsiella pneumoniae isolates in a pediatric hospital.

    PubMed Central

    Bingen, E H; Desjardins, P; Arlet, G; Bourgeois, F; Mariani-Kurkdjian, P; Lambert-Zechovsky, N Y; Denamur, E; Philippon, A; Elion, J

    1993-01-01

    Over a 12-month period, 43 children in eight different wards of our hospital (Hôpital Robert Debré) were infected or colonized with Klebsiella pneumoniae strains producing extended broad-spectrum beta-lactamases. The epidemiology of the outbreak was studied by a molecular approach including the determination of the beta-lactamase physicochemical parameters and plasmid profiles, as well as analysis of the restriction fragment length polymorphisms of the rDNA regions (ribotyping). The last approach produced 12 and 5 different patterns with EcoRI and HindIII, respectively, thus identifying 15 different ribotypes among the 43 clinical K. pneumoniae strains. However, 60% of the strains in six wards belonged to only two ribotypes, whereas nine ribotypes were observed only once. Twelve isolates from different wards that were representative of the eight most common ribotypes showed four different beta-lactamase isoelectric focusing patterns and seven different plasmid profiles by direct analysis or after EcoRI digestion. Thus, at least two genetically unrelated strains in the same ward were found to have the same plasmid content. Our results show the complexity of the outbreak, which was associated with patient-to-patient cross-contamination with several epidemic strains with different plasmid contents, interspersed sporadic cases with nonepidemic strains, and the possible spread of a plasmid. The combination of plasmid profile analysis and ribotyping therefore seems to be powerful at deciphering the details of such outbreaks. Images PMID:8432800

  9. Molecular dynamics simulations of class C beta-lactamase from Citrobacter freundii: insights into the base catalyst for acylation.

    PubMed

    Díaz, Natalia; Suárez, Dimas; Sordo, Tomás L

    2006-01-17

    Herein, we present results from molecular dynamics (MD) simulations of the class C beta-lactamase from Citrobacter freundii and its Michaelis complex with aztreonam. Four different configurations of the active site were modeled in aqueous solution, and their relative stability was estimated by means of quantum mechanical energy calculations. For the free enzyme, the energetically most stable configurations present a neutral Lys67 residue or an anionic Tyr150 side chain. Our calculations predict that these two configurations are quite close in terms of free energy, the anionic Tyr150 state being favored by approximately 1 kcal/mol. In contrast, for the noncovalent complex formed between the C. freundii enzyme and aztreonam, the energetic analyses predict that the configuration with the neutral Lys67 residue is much more stable than the anionic Tyr150 one (approximately 20 kcal/mol). Moreover, the MD simulations reveal that the neutral Lys67 state results in a proper enzyme-aztreonam orientation for nucleophilic attack and in a very stable contact between the nucleophilic hydroxyl group of Ser64 and the neutral amino side chain of Lys67. Thus, both the computed free energies and the structural analyses support the assignation of Lys67 as the base catalyst for the acylation step in the native form of the C. freundii enzyme.

  10. Bacterial beta-lactamase fragmentation complementation strategy can be used as a method for identifying interacting protein pairs.

    PubMed

    Park, Jong-Hwa; Back, Jung Ho; Hahm, Soo Hyun; Shim, Hye-Young; Park, Min Ju; Ko, Sung Il; Han, Ye Sun

    2007-10-01

    We investigated the applicability of the TEM-1 beta- lactamase fragment complementation (BFC) system to develop a strategy for the screening of protein-protein interactions in bacteria. A BFC system containing a human Fas-associated death domain (hFADD) and human Fas death domain (hFasDD) was generated. The hFADD-hFasDD interaction was verified by cell survivability in ampicillin-containing medium and the colorimetric change of nitrocefin. It was also confirmed by His pull-down assay using cell lysates obtained in selection steps. A coiled-coil helix coiled-coil domain-containing protein 5 (CHCH5) was identified as an interacting protein of human uracil DNA glycosylase (hUNG) from the bacterial BFC cDNA library strategy. The interaction between hUNG and CHCH5 was further confirmed with immunoprecipitation using a mammalian expression system. CHCH5 enhanced the DNA glycosylase activity of hUNG to remove uracil from DNA duplexes containing a U/G mismatch pair. These results suggest that the bacterial BFC cDNA library strategy can be effectively used to identify interacting protein pairs.

  11. Decreased transmission of Enterobacteriaceae with extended-spectrum beta-lactamases in an intensive care unit by nursing reorganization.

    PubMed

    Soulier, A; Barbut, F; Ollivier, J M; Petit, J C; Lienhart, A

    1995-10-01

    In our gastrointestinal surgical intensive care unit (SICU), the large number of patients with multiple enterostomies enhances the risk of nosocomial transmission of gut extended-spectrum beta-lactamase-producing Enterobacteriaceae (ESBLE) by health care workers. A control study performed in our SICU from June-August 1992 showed an ESBLE gut colonization rate of 70%. To reduce this rate, nursing procedures were intensified or modified, particularly handwashing, single-use equipment and waste control. To test the efficiency of these procedures, 64 patients hospitalized for more than two days from September 1992-March 1993 were screened for gut acquisition of ESBLE. Rectal samples were taken within 48 h after admission and then weekly. After nursing reorganization, the ESBLE colonization rate dropped significantly to 40% (P < 0.001). Twenty patients (31.7%) acquired a gut ESBLE, after a mean of 24.3 +/- 13.7 days. Each patient was colonized with one, two or three ESBLE (Klebsiella pneumoniae, Escherichia coli and Enterobacter aerogenes). Baseline characteristics of the 20 colonized and 39 non-colonized patients showed no significant difference (Student's t-test, P > 0.05). The nursing workload, estimated as a omega index, was greater in the colonized group (P < 0.001). These findings show that strict observance of nursing procedures can significantly reduce ESBLE acquisition in a high-risk surgical unit.

  12. Sequential necrotizing fasciitis caused by the monomicrobial pathogens Streptococcus equisimilis and extended-spectrum beta-lactamase-producing Escherichia coli.

    PubMed

    Endo, Akiko; Matsuoka, Ryosuke; Mizuno, Yasushi; Doi, Asako; Nishioka, Hiroaki

    2016-08-01

    Necrotizing fasciitis is a rapidly progressing bacterial infection of the superficial fascia and subcutaneous tissue that is associated with a high mortality rate and is caused by a single species of bacteria or polymicrobial organisms. Escherichia coli is rarely isolated from patients with monomicrobial disease. Further, there are few reports of extended-spectrum beta-lactamase (ESBL)-producing E. coli associated with necrotizing fasciitis. We report here our treatment of an 85-year-old man who was admitted because of necrotizing fasciitis of his right thigh. Streptococcus equisimilis was detected as a monomicrobial pathogen, and the infection was cured by amputation of the patient's right leg and the administration of antibiotics. However, 5 days after discontinuing antibiotic therapy, he developed necrotizing fasciitis on his right upper limb and died. ESBL-producing E. coli was the only bacterial species isolated from blood and skin cultures. This case demonstrates that ESBL-producing E. coli can cause monomicrobial necrotizing fasciitis, particularly during hospitalization and that a different bacterial species can cause disease shortly after a previous episode.

  13. [Dissemination of an extended spectrum beta-lactamase producing Klebsiella pneumoniae strains in a Tunisian university hospital center].

    PubMed

    Elhani, D; Bakir, L; Aouni, M

    2006-01-01

    On a period of four years (january 1999-december 2002), 49 strains (non redundant) of extended spectrum beta-lactamase-producing Klebsiella pneumoniae from 43 hospitalised patients and three strains from the environment hospital were collected at Mongi Slim University Hospital Center. The objectives of our work were to investigate for clonality of strains, to clarify transmission fashions and reservoirs of the infection by reviewing clinical records and typing strains. Antibiotic susceptibility testing, plasmid analysis and Random Amplified Polymorphic DNA (RAPD) have been done. 84% of the patients were hospitalized in the intensive care and pediatric units. Urinary infections and septicaemias were the more frequent infections (74.2%). The 49 isolats have been classified in 13 antibiotypes. The plasmid analysis showed 16 patterns. The RAPD revealed 28 patterns and variation within patterns in five cases. Our results showed a diversity of the strains suggesting endemicity, possible transmission of plasmids and persistence of some clones which circulated between services. The used markers permitted the evaluation of a long-term strategy of prevention requiring a strict observance of hygiene rules and rational use of antibiotics.

  14. Dissemination of Salmonella enterica serotype agona and multidrug-resistant Salmonella enterica serotype typhimurium in Cuba.

    PubMed

    Cabrera, Roberto; Ruiz, Joaquim; Ramírez, Margarita; Bravo, Laura; Fernández, Anabel; Aladueña, Ana; Echeíta, Aurora; Gascón, Joaquim; Alonso, Pedro L; Vila, Jordi

    2006-06-01

    The molecular epidemiology, antimicrobial susceptibility, and mechanisms of resistance of 34 Salmonella spp. strains causing acute gastroenteritis, isolated from different provinces in Cuba, were determined. Sixty-four percent of the strains showed multiresistance. Salmonella typhimurium was the most frequent with 15 strains (44%), 13 of which belonged to phagotype 104 and presented similar genetic profiles of pulsed field gel electrophoresis. High levels of resistance to tetracycline (53%), spectinomycin (50%), ampicillin (44%), and chloramphenicol (41%) were found. Resistance to tetracycline was associated with the tet G and tet A genes. Resistance to ampicillin was caused by the presence of beta-lactamases, mainly the CARB type. The floR gene was the main mechanism of resistance to chloramphenicol. Our results showed an antimicrobial susceptible clone of Salmonella enterica serotype Agona in two separate regions. This is the first report of the widespread dissemination of a multiresistant clone of S. enterica serotype Typhimurium definitive phage type 104 in Cuba.

  15. Multidrug-resistant Enterobacteriaceae from indoor air of an urban wastewater treatment plant.

    PubMed

    Teixeira, Juliana V; Cecílio, Pedro; Gonçalves, Daniela; Vilar, Vítor J P; Pinto, Eugénia; Ferreira, Helena N

    2016-07-01

    Wastewater treatment plants (WWTPs) have been recognized as sources of bioaerosols that may act as vehicles for dissemination of pathogens and multidrug-resistant (MDR) bacteria. The occurrence of MDR Enterobacteriaceae in indoor air of an urban WWTP was investigated. A possible airborne contamination with extended-spectrum beta-lactamase (ESBL) and carbapenemase-producing Enterobacteriaceae was also explored. Fourteen of 39 Enterobacteriaceae isolates were MDR. These isolates were found at all sampling sites, mainly at the secondary sedimentation settings. The highest levels of resistance were detected in three different species: Enterobacter cloacae, Escherichia coli, and Citrobacter freundii. Furthermore, one of the airborne E. coli isolates was phenotypically characterized as an ESBL producer. Additionally, five isolates showed non-susceptibility to at least one carbapenem tested. The presence of genes encoding relevant beta-lactamase types in these ESBL-producing and carbapenem-resistant Enterobacteriaceae isolates was investigated by PCR. Results showed amplification for bla CTX-M and bla OXA. These findings are relevant both in terms of occupational/public health and of environmental dissemination of MDR bacteria.

  16. Risk Factors Associated with the Community-Acquired Colonization of Extended-Spectrum Beta-Lactamase (ESBL) Positive Escherichia Coli. An Exploratory Case-Control Study

    PubMed Central

    Leistner, Rasmus; Meyer, Elisabeth; Gastmeier, Petra; Pfeifer, Yvonne; Eller, Christoph; Dem, Petra; Schwab, Frank

    2013-01-01

    Background The number of extended-spectrum beta-lactamase (ESBL) positive (+) Escherichia coli is increasing worldwide. In contrast with many other multidrug-resistant bacteria, it is suspected that they predominantly spread within the community. The objective of this study was to assess factors associated with community-acquired colonization of ESBL (+) E. coli. Methods We performed a matched case-control study at the Charité University Hospital Berlin between May 2011 and January 2012. Cases were defined as patients colonized with community-acquired ESBL (+) E. coli identified <72 h after hospital admission. Controls were patients that carried no ESBL-positive bacteria but an ESBL-negative E.coli identified <72 h after hospital admission. Two controls per case were chosen from potential controls according to admission date. Case and control patients completed a questionnaire assessing nutritional habits, travel habits, household situation and language most commonly spoken at home (mother tongue). An additional rectal swab was obtained together with the questionnaire to verify colonization status. Genotypes of ESBL (+) E. coli strains were determined by PCR and sequencing. Risk factors associated with ESBL (+) E. coli colonization were analyzed by a multivariable conditional logistic regression analysis. Results We analyzed 85 cases and 170 controls, respectively. In the multivariable analysis, speaking an Asian language most commonly at home (OR = 13.4, CI 95% 3.3–53.8; p<0.001) and frequently eating pork (≥3 meals per week) showed to be independently associated with ESBL colonization (OR = 3.5, CI 95% 1.8–6.6; p<0.001). The most common ESBL genotypes were CTX-M-1 with 44% (n = 37), CTX-M-15 with 28% (n = 24) and CTX-M-14 with 13% (n = 11). Conclusion An Asian mother tongue and frequently consuming certain types of meat like pork can be independently associated with the colonization of ESBL-positive bacteria. We found neither frequent

  17. Detection of ctx-M gene in ESBL-producing E. coli strains isolated from urinary tract infection in Semnan, Iran

    PubMed Central

    Tabar, Mahbobeh Mohammad; Mirkalantari, Shiva; Amoli, Rabeeh Izadi

    2016-01-01

    Introduction The incidence of urinary tract infections caused by Extended-Spectrum Beta Lactamase (ESBL) producing Escherichia coli (E. coli) strains due to long term and overuse of broad-spectrum cephalosporine is on the rise. CTX beta-lactamase type, a broad-spectrum beta-lactamase, has been expanding in many countries. The ctx gene is harbored on a plasmid that is spread between Enterobacteriaceae family, especially in E. coli. The aim of this study was to determine the pattern of antimicrobial resistance and investigate the prevalent ESBL phenotype and the ctx-M gene in E. coli isolated from patients with urinary tract infections (UTI) in Semnan. Methods A cross sectional study was performed on 109 strains of E. coli isolated from the urine culture of patient suffering from a UTI referred to Shafa hospital (Semnan, Iran) during March–July 2015. Antimicrobial susceptibility testing was applied and the prevalence of the ESBL phenotype was confirmed using combination disk. PCR methods were completed for amplification of the bla ctx gene. Data were analyzed using SPSS version 18 software. Results One hundred ninety samples (4.16%) were identified as E. coli. Twenty one (26.6%) of E. coli were ESBL positive and 73.4% were ESBL negative. There was 100% susceptibility to imipeneme. Twenty (68.97%) out of 29 isolates were positive for the ctx-M gene, as detected by PCR. Conclusion In urinary tract infections, antibiotic treatment was experimental and detailed information regarding the sensitivity of bacteria in the area can be useful to achieve the best treatment.

  18. Detection of ctx-M gene in ESBL-producing E. coli strains isolated from urinary tract infection in Semnan, Iran

    PubMed Central

    Tabar, Mahbobeh Mohammad; Mirkalantari, Shiva; Amoli, Rabeeh Izadi

    2016-01-01

    Introduction The incidence of urinary tract infections caused by Extended-Spectrum Beta Lactamase (ESBL) producing Escherichia coli (E. coli) strains due to long term and overuse of broad-spectrum cephalosporine is on the rise. CTX beta-lactamase type, a broad-spectrum beta-lactamase, has been expanding in many countries. The ctx gene is harbored on a plasmid that is spread between Enterobacteriaceae family, especially in E. coli. The aim of this study was to determine the pattern of antimicrobial resistance and investigate the prevalent ESBL phenotype and the ctx-M gene in E. coli isolated from patients with urinary tract infections (UTI) in Semnan. Methods A cross sectional study was performed on 109 strains of E. coli isolated from the urine culture of patient suffering from a UTI referred to Shafa hospital (Semnan, Iran) during March–July 2015. Antimicrobial susceptibility testing was applied and the prevalence of the ESBL phenotype was confirmed using combination disk. PCR methods were completed for amplification of the bla ctx gene. Data were analyzed using SPSS version 18 software. Results One hundred ninety samples (4.16%) were identified as E. coli. Twenty one (26.6%) of E. coli were ESBL positive and 73.4% were ESBL negative. There was 100% susceptibility to imipeneme. Twenty (68.97%) out of 29 isolates were positive for the ctx-M gene, as detected by PCR. Conclusion In urinary tract infections, antibiotic treatment was experimental and detailed information regarding the sensitivity of bacteria in the area can be useful to achieve the best treatment. PMID:27648198

  19. Cooperative Bacterial Growth Dynamics Predict the Evolution of Antibiotic Resistance

    NASA Astrophysics Data System (ADS)

    Artemova, Tatiana; Gerardin, Ylaine; Hsin-Jung Li, Sophia; Gore, Jeff

    2011-03-01

    Since the discovery of penicillin, antibiotics have been our primary weapon against bacterial infections. Unfortunately, bacteria can gain resistance to penicillin by acquiring the gene that encodes beta-lactamase, which inactivates the antibiotic. However, mutations in this gene are necessary to degrade the modern antibiotic cefotaxime. Understanding the conditions that favor the spread of these mutations is a challenge. Here we show that bacterial growth in beta-lactam antibiotics is cooperative and that the nature of this growth determines the conditions in which resistance evolves. Quantitative analysis of the growth dynamics predicts a peak in selection at very low antibiotic concentrations; competition between strains confirms this prediction. We also find significant selection at higher antibiotic concentrations, close to the minimum inhibitory concentrations of the strains. Our results argue that an understanding of the evolutionary forces that lead to antibiotic resistance requires a quantitative understanding of the evolution of cooperation in bacteria.

  20. Molecular detection of metallo-β-lactamase gene blaVIM-1 in imipenem-resistant Pseudomonas aeruginosa strains isolated from hospitalized patients in the hospitals of Isfahan

    PubMed Central

    Sedighi, Mansour; Vaez, Hamid; Moghoofeie, Mohsen; Hadifar, Shima; Oryan, Golfam; Faghri, Jamshid

    2015-01-01

    Background: Pseudomonas aeruginosa is an opportunistic human pathogen that causes serious problems, especially in people, who have immunodeficiency. In recent times, metallo-β-lactamase (MBLs) resistance in this bacterium has led to some difficulties in treating bacterial infections. The metallo-beta-lactamase family of genes, including blaVIM-1, is being reported with increasing frequency worldwide. The aim of this study is the detection of the metallo-β-lactamase gene blaVIM-1 in imipenem-resistant P. aeruginosa (IRPA) strains isolated from hospitalized patients. Materials and Methods: In this study, 106 P. aeruginosa samples were isolated from various nosocomial infections. The isolates were identified, tested for susceptibility to various antimicrobial agents by the Kirby-Bauer disk diffusion method, and all the imipenem-resistant isolates were screened for the presence of MBLs by using the combined disk (IMP-EDTA). The minimal inhibitory concentration (MIC) of imipenem was determined by E-test on the Mueller-Hinton agar. To detect the blaVIM-1 gene, the isolates were subjected to a polymerase chain reaction (PCR). Results: Of all the P. aeruginosa isolates, 62 (58.5%) were found to be imipenem-resistant P. aeruginosa (MIC ≥32 μg/ml). Twenty-six (42%) of the imipenem-resistant isolates were MBL positive. None of these isolates carried the blaVIM-1 gene using the PCR assay. Conclusion: The results demonstrated the serious therapeutic threat of the MBL-producing P. aeruginosa populations. The rate of imipenem resistance due to MBL was increased dramatically. Early detection and infection-control practices are the best antimicrobial strategies for this organism. None of MBL-producing isolates in this study carry the blaVIM-1 gene; therefore, another gene in the MBL family should be investigated. PMID:25802826

  1. A fungal metallo-beta-lactamase necessary for biotransformation of maize phytoprotectant compounds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Xenobiotic compounds such as phytochemicals, microbial metabolites, and agrochemicals can impact the diversity and frequency of fungal species occurring in agricultural environments. Resistance to xenobiotics may allow plant pathogenic fungi to dominate the overall fungal community, with potential ...

  2. Genetic Characterization of Carbapenem-Resistant Enterobacteriaceae and the Spread of Carbapenem-Resistant Klebsiella pneumonia ST340 at a University Hospital in Thailand.

    PubMed

    Netikul, Thidarat; Kiratisin, Pattarachai

    2015-01-01

    Carbapenem-resistant Enterobacteriaceae (CRE) has increasingly spread worldwide in the past decade. The prevalence and characteristics of CRE in Thailand are unknown. In this study, we conducted a 2-year surveillance of CRE among 12,741 clinical isolates of Enterobacteriaceae at the largest university hospital in Thailand with molecular characterization of beta-lactamase (bla) genes, including carbapenemase genes. The CRE prevalence was 1.4%. blaKPC-13 and blaIMP-14a were the only carbapenemase genes detected among these CRE isolates. blaKPC-13 gene was found in a single isolate of Escherichia coli, Enterobacter cloacae and Citrobacter freundii, and blaIMP-14a was found in four isolates of Klebsiella pneumoniae. Carbapenem-resistant K. pneumoniae (CRKP) isolates were resistant to multiple carbapenems at a higher ratio than other CRE species, and thus were further characterized for resistance phenotypes, bla genotypes and molecular epidemiology. Most CRKP isolates harboured multiple bla genes, especially those related to extended-spectrum beta-lactamases. Seven CRKP isolates were resistant to all tested carbapenems, and showed decreased ompK35 and/or ompK36 porin gene expression. Molecular typing of CRKP based on pulsed-field gel electrophoresis (PFGE) demonstrated several unrelated clones. Multilocus sequence typing (MLST) was partially concordant with PFGE results and revealed that ST340, a member of drug-resistant K. pneumoniae clonal complex 258, was the most predominant clone, followed by ST48, ST11 and ST273. The novel ST1645 was identified from this study. ST340 has neither been shown to be predominated among CRKP from other studies, nor been reported in Thailand. Therefore, it emphases a critical concern to monitor and control the spread of CRKP. PMID:26407326

  3. Genetic Characterization of Carbapenem-Resistant Enterobacteriaceae and the Spread of Carbapenem-Resistant Klebsiella pneumonia ST340 at a University Hospital in Thailand

    PubMed Central

    Netikul, Thidarat; Kiratisin, Pattarachai

    2015-01-01

    Carbapenem-resistant Enterobacteriaceae (CRE) has increasingly spread worldwide in the past decade. The prevalence and characteristics of CRE in Thailand are unknown. In this study, we conducted a 2-year surveillance of CRE among 12,741 clinical isolates of Enterobacteriaceae at the largest university hospital in Thailand with molecular characterization of beta-lactamase (bla) genes, including carbapenemase genes. The CRE prevalence was 1.4%. blaKPC-13 and blaIMP-14a were the only carbapenemase genes detected among these CRE isolates. blaKPC-13 gene was found in a single isolate of Escherichia coli, Enterobacter cloacae and Citrobacter freundii, and blaIMP-14a was found in four isolates of Klebsiella pneumoniae. Carbapenem-resistant K. pneumoniae (CRKP) isolates were resistant to multiple carbapenems at a higher ratio than other CRE species, and thus were further characterized for resistance phenotypes, bla genotypes and molecular epidemiology. Most CRKP isolates harboured multiple bla genes, especially those related to extended-spectrum beta-lactamases. Seven CRKP isolates were resistant to all tested carbapenems, and showed decreased ompK35 and/or ompK36 porin gene expression. Molecular typing of CRKP based on pulsed-field gel electrophoresis (PFGE) demonstrated several unrelated clones. Multilocus sequence typing (MLST) was partially concordant with PFGE results and revealed that ST340, a member of drug-resistant K. pneumoniae clonal complex 258, was the most predominant clone, followed by ST48, ST11 and ST273. The novel ST1645 was identified from this study. ST340 has neither been shown to be predominated among CRKP from other studies, nor been reported in Thailand. Therefore, it emphases a critical concern to monitor and control the spread of CRKP. PMID:26407326

  4. Evaluation of a new selective chromogenic agar medium for detection of extended-spectrum beta-lactamase-producing Enterobacteriaceae.

    PubMed

    Glupczynski, Youri; Berhin, Catherine; Bauraing, Caroline; Bogaerts, Pierre

    2007-02-01

    A novel chromogenic agar medium (ESBL-Bx; bioMérieux, Marcy l'Etoile, France) was compared to MacConkey agar supplemented with 2 mg ceftazidime/liter (MCKC) for the selective isolation and presumptive identification of extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae directly from clinical samples. Of a total of 644 clinical specimens (including 551 fecal samples), 496 yielded no growth and 148 yielded growth on one or both media. Overall, 44 ESBL-producing Enterobacteriaceae strains (Escherichia coli [n=17], Enterobacter aerogenes [n=17], Klebsiella spp. [n=5], and Citrobacter freundii [n=5]) were isolated from 37 specimens by a combination of both methods after 18 to 24 h of incubation. The sensitivities were 97.7 and 84.1% for ESBL-Bx and MCKC, respectively, with 43 ESBL-positive strains isolated as colored colonies from 36 specimens on ESBL-Bx versus 37 ESBL-positive organisms isolated from 32 specimens on MCKC. The specificities by specimens were 89 and 91% for ESBL-Bx and MCKC, respectively. On either one of the two media, natural AmpC-hyperproducing Enterobacter spp. (n=25) and Citrobacter spp. (n=14) were the most common false positives as well as non-ESBL-producing Klebsiella oxytoca (n=18) on ESBL-Bx and Morganella morganii (n=10) on MCKC. We conclude that ESBL-Bx is a sensitive and specific medium for the isolation of ESBL-producing Enterobacteriaceae from clinical samples. The main advantages of ESBL-Bx over MCKC reside in its chromogenic character and its sensitivity and selectivity, which enabled the recovery and presumptive identification of most ESBL-producing Enterobacteriaceae within 24 h and reduced by 27% the need for unnecessary identification and confirmation of ESBL testing when disregarding all colorless colonies growing on this medium.

  5. Extended-Spectrum-Beta-Lactamase Producing Bacteria Related Urinary Tract Infection in Renal Transplant Recipients and Effect on Allograft Function

    PubMed Central

    Ramadas, Poornima; Rajendran, Prejith P.; Krishnan, Prathik; Alex, Asha; Siskind, Eric; Kadiyala, Aditya; Jayaschandran, Vivek; Basu, Amit; Bhaskaran, Madhu; Molmenti, Ernesto P.

    2014-01-01

    Background Urinary tract infection (UTI) is a well-recognized early complication in renal transplant recipients (RTR) and can have significant bearing on their outcome. The recent rise in incidence of extended spectrum beta lactamase (ESBL) producing bacteria causing UTI among RTR poses new and significant challenges in terms of management and outcome. Our aim is to analyze the effect of ESBL producing bacteria causing UTI in these patients and its impact on allograft function. Methods We reviewed the medical records of 147 RTR who were followed at a tertiary care hospital affiliated transplant center between January 2007 and May 2013 and noted five RTR who developed episodes of ESBL producing bacteria related UTI during follow up. Multiple patient characteristics including demographics, immunosuppression, recurrences, allograft function and outcome were analyzed. Results Five patients (3.4%) out of 147 had ESBL producing bacteria related UTI. We found all patients to be above 60 years of age, with three out of five being females, and all five patients had diabetes mellitus. We identified a total of 37 episodes of UTI among these five patients during this period. Two of these patients had elevated creatinine values during the episodes of UTI and three of them developed bacteremia. Of the five patients, four of them had a favorable outcome except for one patient who developed persistent allograft dysfunction. Conclusion RTR are at a higher risk for developing ESBL producing bacteria associated UTI. Early diagnosis along with appropriate and judicious use of antibiotics will ensure long term success in allograft and patient outcome. PMID:24637786

  6. Diversity of Escherichia coli strains producing extended-spectrum beta-lactamases in Spain: second nationwide study.

    PubMed

    Díaz, Miguel A; Hernández-Bello, José R; Rodríguez-Baño, Jesús; Martínez-Martínez, Luis; Calvo, Jorge; Blanco, Jorge; Pascual, Alvaro

    2010-08-01

    The prevalence of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli (ESBLEC) in Spain increased 8-fold from 2000 to 2006. ESBL type, clonal relationship, antimicrobial susceptibility, and clinical data about infections caused by ESBLEC are evaluated in a second nationwide study developed in 2006. From 1008 clinical isolates obtained over 2 months from 44 hospitals, 254 were used for further analysis. ESBL production was evaluated by synergy testing, PCR, and sequencing. Antimicrobial activity was evaluated by microdilution. The clonal relationship was evaluated by repetitive extragenic palindromic-PCR (REP-PCR). The O25b subtype and the new afa operon FM955459 were determined by triplex PCR in isolates producing CTX-M-15. Multilocus sequence typing was performed on these isolates. A total of 72% of all ESBLs were of the CTX-M type, 26.8% were of the SHV type, and 1.2% were of the TEM type. The most prevalent ESBLs were CTX-M-14 (119 isolates), SHV-12 (68 isolates), CTX-M-15 (37 isolates), and CTX-M-9 (21 isolates). By REP-PCR, 214 clones were detected. All but five CTX-M-15 ESBLEC isolates corresponded to the international O25b/ST131 clone. This clone had not been detected in the first study (published in 2000). Epidemiological and clinical features were studied in 304 representative patients. A total of 60% of the patients were older than 60 and had nonfatal underlying diseases, and 55% had recently received antibiotics. Urinary tract infections accounted for 71% of cases, and 9% were bacteremic. There has been a significant increase in the prevalence of ESBLEC in Spain, with most of these strains being CTX-M-producing isolates, including the pandemic O25b-ST131. SHV-12-producing E. coli remains an important cause of community-acquired infection.

  7. Diversity of Escherichia coli strains producing extended-spectrum beta-lactamases in Spain: second nationwide study.

    PubMed

    Díaz, Miguel A; Hernández-Bello, José R; Rodríguez-Baño, Jesús; Martínez-Martínez, Luis; Calvo, Jorge; Blanco, Jorge; Pascual, Alvaro

    2010-08-01

    The prevalence of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli (ESBLEC) in Spain increased 8-fold from 2000 to 2006. ESBL type, clonal relationship, antimicrobial susceptibility, and clinical data about infections caused by ESBLEC are evaluated in a second nationwide study developed in 2006. From 1008 clinical isolates obtained over 2 months from 44 hospitals, 254 were used for further analysis. ESBL production was evaluated by synergy testing, PCR, and sequencing. Antimicrobial activity was evaluated by microdilution. The clonal relationship was evaluated by repetitive extragenic palindromic-PCR (REP-PCR). The O25b subtype and the new afa operon FM955459 were determined by triplex PCR in isolates producing CTX-M-15. Multilocus sequence typing was performed on these isolates. A total of 72% of all ESBLs were of the CTX-M type, 26.8% were of the SHV type, and 1.2% were of the TEM type. The most prevalent ESBLs were CTX-M-14 (119 isolates), SHV-12 (68 isolates), CTX-M-15 (37 isolates), and CTX-M-9 (21 isolates). By REP-PCR, 214 clones were detected. All but five CTX-M-15 ESBLEC isolates corresponded to the international O25b/ST131 clone. This clone had not been detected in the first study (published in 2000). Epidemiological and clinical features were studied in 304 representative patients. A total of 60% of the patients were older than 60 and had nonfatal underlying diseases, and 55% had recently received antibiotics. Urinary tract infections accounted for 71% of cases, and 9% were bacteremic. There has been a significant increase in the prevalence of ESBLEC in Spain, with most of these strains being CTX-M-producing isolates, including the pandemic O25b-ST131. SHV-12-producing E. coli remains an important cause of community-acquired infection. PMID:20519460

  8. Detection of Extended-Spectrum Beta-Lactamase (ESBL)-Producing Escherichia coli on Flies at Poultry Farms

    PubMed Central

    Hamidjaja, Raditijo A.; van Hoek, Angela H. A. M.; de Heer, Lianne; de Roda Husman, Ana Maria; Schets, Franciska M.

    2014-01-01

    In the Netherlands, extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli bacteria are highly prevalent in poultry, and chicken meat has been implicated as a source of ESBL-producing E. coli present in the human population. The current study describes the isolation of ESBL-producing E. coli from house flies and blow flies caught at two poultry farms, offering a potential alternative route of transmission of ESBL-producing E. coli from poultry to humans. Overall, 87 flies were analyzed in 19 pools. ESBL-producing E. coli bacteria were detected in two fly pools (10.5%): a pool of three blow flies from a broiler farm and a pool of eight house flies from a laying-hen farm. From each positive fly pool, six isolates were characterized and compared with isolates obtained from manure (n = 53) sampled at both farms and rinse water (n = 10) from the broiler farm. Among six fly isolates from the broiler farm, four different types were detected with respect to phylogenetic group, sequence type (ST), and ESBL genotype: A0/ST3519/SHV-12, A1/ST10/SHV-12, A1/ST58/SHV-12, and B1/ST448/CTX-M-1. These types, as well as six additional types, were also present in manure and/or rinse water at the same farm. At the laying-hen farm, all fly and manure isolates were identical, carrying blaTEM-52 in an A1/ST48 genetic background. The data imply that flies acquire ESBL-producing E. coli at poultry farms, warranting further evaluation of the contribution of flies to dissemination of ESBL-producing E. coli in the community. PMID:24162567

  9. VEB-1-like extended-spectrum beta-lactamases in Pseudomonas aeruginosa, Kuwait.

    PubMed

    Poirel, L; Rotimi, V O; Mokaddas, E M; Karim, A; Nordmann, P

    2001-01-01

    Two clinical Pseudomonas aeruginosa isolates from patients in intensive care units in Kuwait were resistant to expanded-spectrum cephalosporins and showed a synergistic effect between ceftazidime and clavulanic acid. This is the first report of extended-spectrum enzymes from nosocomial isolates from the Middle East.

  10. [Investigation of integrons, sul1-2 and dfr genes in trimethoprim-sulfametoxazole-resistant Stenotrophomonas maltophilia strains isolated from clinical samples].

    PubMed

    Ozkaya, Esra; Aydin, Faruk; Bayramoglu, Gülçin; Buruk, Celal Kurtuluş; Sandalli, Cemal

    2014-04-01

    (oxa2) type of beta-lactamase, an aminoglycoside 6'-N-acetyltransferase [aac(6')-IIc], leading to resistance of aminoglycosides, and a quaternary ammonium compounds resistance gene (qacF), respectively. In conclusion, to best of our knowledge the sequences of class I integron gene cassette including oxa2, aac(6')-IIc, qacF genes were identified in S.maltophilia for the first time. It should be kept in mind that the co-presence of a class I integron gene cassette and the sul1 gene in S.maltophilia may lead to the development of multi-drug resistance and may act as a potential source for the dissemination of resistance. PMID:24819258

  11. Structural and Biochemical Evidence That a TEM-1 [beta]-Lactamase N170G Active Site Mutant Acts via Substrate-assisted Catalysis

    SciTech Connect

    Brown, Nicholas G.; Shanker, Sreejesh; Prasad, B.V. Venkataram; Palzkill, Timothy

    2010-03-12

    TEM-1 {beta}-lactamase is the most common plasmid-encoded {beta}-lactamase in Gram-negative bacteria and is a model class A enzyme. The active site of class A {beta}-lactamases share several conserved residues including Ser{sup 70}, Glu{sup 166}, and Asn{sub 170} that coordinate a hydrolytic water involved in deacylation. Unlike Ser{sup 70} and Glu{sup 166}, the functional significance of residue Asn{sup 170} is not well understood even though it forms hydrogen bonds with both Glu{sup 166} and the hydrolytic water. The goal of this study was to examine the importance of Asn{sup 170} for catalysis and substrate specificity of {beta}-lactam antibiotic hydrolysis. The codon for position 170 was randomized to create a library containing all 20 possible amino acids. The random library was introduced into Escherichia coli, and functional clones were selected on agar plates containing ampicillin. DNA sequencing of the functional clones revealed that only asparagine (wild type) and glycine at this position are consistent with wild-type function. The determination of kinetic parameters for several substrates revealed that the N170G mutant is very efficient at hydrolyzing substrates that contain a primary amine in the antibiotic R-group that would be close to the Asn{sup 170} side chain in the acyl-intermediate. In addition, the x-ray structure of the N170G enzyme indicated that the position of an active site water important for deacylation is altered compared with the wild-type enzyme. Taken together, the results suggest the N170G TEM-1 enzyme hydrolyzes ampicillin efficiently because of substrate-assisted catalysis where the primary amine of the ampicillin R-group positions the hydrolytic water and allows for efficient deacylation.

  12. Structural and biochemical evidence that a TEM-1 beta-lactamase N170G active site mutant acts via substrate-assisted catalysis.

    PubMed

    Brown, Nicholas G; Shanker, Sreejesh; Prasad, B V Venkataram; Palzkill, Timothy

    2009-11-27

    TEM-1 beta-lactamase is the most common plasmid-encoded beta-lactamase in Gram-negative bacteria and is a model class A enzyme. The active site of class A beta-lactamases share several conserved residues including Ser(70), Glu(166), and Asn(170) that coordinate a hydrolytic water involved in deacylation. Unlike Ser(70) and Glu(166), the functional significance of residue Asn(170) is not well understood even though it forms hydrogen bonds with both Glu(166) and the hydrolytic water. The goal of this study was to examine the importance of Asn(170) for catalysis and substrate specificity of beta-lactam antibiotic hydrolysis. The codon for position 170 was randomized to create a library containing all 20 possible amino acids. The random library was introduced into Escherichia coli, and functional clones were selected on agar plates containing ampicillin. DNA sequencing of the functional clones revealed that only asparagine (wild type) and glycine at this position are consistent with wild-type function. The determination of kinetic parameters for several substrates revealed that the N170G mutant is very efficient at hydrolyzing substrates that contain a primary amine in the antibiotic R-group that would be close to the Asn(170) side chain in the acyl-intermediate. In addition, the x-ray structure of the N170G enzyme indicated that the position of an active site water important for deacylation is altered compared with the wild-type enzyme. Taken together, the results suggest the N170G TEM-1 enzyme hydrolyzes ampicillin efficiently because of substrate-assisted catalysis where the primary amine of the ampicillin R-group positions the hydrolytic water and allows for efficient deacylation.

  13. Structure of GES-1 at Atomic Resolution: Insights Into the Evolution of Carbapenamase Activity in the Class a Extended-Spectrum Beta-Lactamases

    SciTech Connect

    Smith, C.A.; Caccamo, M.; Kantardjieff, K.A.; Vakulenko, S.; /Notre Dame U.

    2007-10-08

    The structure of the class A extended-spectrum {beta}-lactamase GES-1 from Klebsiella pneumoniae has been determined to 1.1 Angstrom resolution. GES-1 has the characteristic active-site disulfide bond of the carbapenemase family of {beta}-lactamases and has a structure that is very similar to those of other known carbapenemases, including NMC-A, SME-1 and KPC-2. Most residues implicated in the catalytic mechanism of this class of enzyme are present in the GES-1 active site, including Ser70, which forms a covalent bond with the carbonyl C atom of the {beta}-lactam ring of the substrate during the formation of an acyl-enzyme intermediate, Glu166, which is implicated as both the acylation and deacylation base, and Lys73, which is also implicated as the acylation base. A water molecule crucial to catalysis is observed in an identical location as in other class A {beta}-lactamases, interacting with the side chains of Ser70 and Glu166. One important residue, Asn170, also normally a ligand for the hydrolytic water, is missing from the GES-1 active site. This residue is a glycine in GES-1 and the enzyme is unable to hydrolyze imipenem. This points to this residue as being critically important in the hydrolysis of this class of {beta}-lactam substrate. This is further supported by flexible-docking studies of imipenem with in silico-generated Gly170Asn and Gly170Ser mutant GES-1 enzymes designed to mimic the active sites of imipenem-hydrolyzing point mutants GES-2 and GES-5.

  14. Different ratios of the piperacillin-tazobactam combination for treatment of experimental meningitis due to Klebsiella pneumoniae producing the TEM-3 extended-spectrum beta-lactamase.

    PubMed Central

    Leleu, G; Kitzis, M D; Vallois, J M; Gutmann, L; Decazes, J M

    1994-01-01

    We evaluated the pharmacokinetics and therapeutic efficacies of piperacillin and tazobactam, a beta-lactamase inhibitor, given either alone or in different combinations (80:10, 200:10, and 80:25 mg/kg/h), in experimental meningitis due to a strain of Klebsiella pneumoniae producing the TEM-3 extended-spectrum beta-lactamase. Treatment was administered intravenously as a 7-h constant infusion preceded by a bolus of 20% of the total dose. The mean (+/- standard deviation) rates of penetration into the cerebrospinal fluid (CSF) of infected animals were 6.7 +/- 3.9% for piperacillin given alone and 36.3 +/- 21.9% for tazobactam given alone. Combination treatment significantly magnified the concentration of either drug in CSF. Concentrations of bacteria in CSF increased throughout therapy in animals given either drug alone, even at high dosages. In animals given the combination at dosages of 80:10 and 200/10 mg/kg/h, only a suboptimal reduction of CSF bacterial titers was obtained in vivo, i.e. -0.49 +/- 0.34 and -0.73 +/- 0.49 log CFU/ml/h, respectively. An increase in the tazobactam dosage within the combination (80:25 mg/kg/h) was required in order to obtain a significantly faster elimination of viable organisms from the CSF (-0.97 +/- 0.35 log CFU/ml/h). The study shows that tazobactam is able to provide effective protection against piperacillin hydrolysis by the TEM-3 enzyme within the CSF. Appropriate dosage regimens of various beta-lactam-tazobactam combinations may deserve comparative studies in experimental meningitis caused by organisms producing extended-spectrum beta-lactamases. PMID:8192442

  15. Recurrent pyelonephritis due to NDM-1 metallo-beta-lactamase producing Pseudomonas aeruginosa in a patient returning from Serbia, France, 2012.

    PubMed

    Flateau, C; Janvier, F; Delacour, H; Males, S; Ficko, C; Andriamanantena, D; Jeannot, K; Merens, A; Rapp, C

    2012-01-01

    We describe the first isolation in France of a New-Delhi metallo-beta-lactamase-1 (NDM-1) producing Pseudomonas aeruginosa. In March 2012, a patient with history of prior hospitalisation in Serbia was diagnosed in France with acute pyelonephritis due to NDM-1 producing P. aeruginosa. Clinical and microbiological cure was obtained under appropriate antibiotic treatment. Two months later, she presented with a recurrence due to the same bacteria, with a favourable evolution. During both hospitalisations, contact isolation precautions were implemented and no cross-transmission was observed.

  16. Resistance to Broad-Spectrum Antibiotics in Aquatic Systems: Anthropogenic Activities Modulate the Dissemination of blaCTX-M-Like Genes

    PubMed Central

    Tacão, Marta; Henriques, Isabel

    2012-01-01

    We compared the resistomes within polluted and unpolluted rivers, focusing on extended-spectrum beta-lactamase (ESBL) genes, in particular blaCTX-M. Twelve rivers from a Portuguese hydrographic basin were sampled. Physicochemical and microbiological parameters of water quality were determined, and the results showed that 9 rivers were classified as unpolluted (UP) and that 3 were classified as polluted (P). Of the 225 cefotaxime-resistant strains isolated, 39 were identified as ESBL-producing strains, with 18 carrying a blaCTX-M gene (15 from P and 3 from UP rivers). Analysis of CTX-M nucleotide sequences showed that 17 isolates produced CTX-M from group 1 (CTX-M-1, -3, -15, and -32) and 1 CTX-M that belonged to group 9 (CTX-M-14). A genetic environment study revealed the presence of different genetic elements previously described for clinical strains. ISEcp1 was found in the upstream regions of all isolates examined. Culture-independent blaCTX-M-like libraries were comprised of 16 CTX-M gene variants, with 14 types in the P library and 4 types in UP library, varying from 68% to 99% similarity between them. Besides the much lower level of diversity among CTX-M-like genes from UP sites, the majority were similar to chromosomal ESBLs such as blaRAHN-1. The results demonstrate that the occurrence and diversity of blaCTX-M genes are clearly different between polluted and unpolluted lotic ecosystems; these findings favor the hypothesis that natural environments are reservoirs of resistant bacteria and resistance genes, where anthropogenic-driven selective pressures may be contributing to the persistence and dissemination of genes usually relevant in clinical environments. PMID:22492443

  17. Plasmid-Mediated Resistance to Cephalosporins and Fluoroquinolones in Various Escherichia coli Sequence Types Isolated from Rooks Wintering in Europe

    PubMed Central

    Dolejska, Monika; Vojtech, Jiri; Guenther, Sebastian; Uricariu, Raluca; Drozdowska, Joanna; Papousek, Ivo; Pasekova, Katerina; Meissner, Wlodzimierz; Hordowski, Jozef; Cizek, Alois; Literak, Ivan

    2014-01-01

    Extended-spectrum-beta-lactamase (ESBL)-producing, AmpC beta-lactamase-producing, and plasmid-mediated quinolone resistance (PMQR) gene-positive strains of Escherichia coli were investigated in wintering rooks (Corvus frugilegus) from eight European countries. Fecal samples (n = 1,073) from rooks wintering in the Czech Republic, France, Germany, Italy, Poland, Serbia, Spain, and Switzerland were examined. Resistant isolates obtained from selective cultivation were screened for ESBL, AmpC, and PMQR genes by PCR and sequencing. Pulsed-field gel electrophoresis and multilocus sequence typing were performed to reveal their clonal relatedness. In total, from the 1,073 samples, 152 (14%) cefotaxime-resistant E. coli isolates and 355 (33%) E. coli isolates with reduced susceptibility to ciprofloxacin were found. Eighty-two (54%) of these cefotaxime-resistant E. coli isolates carried the following ESBL genes: blaCTX-M-1 (n = 39 isolates), blaCTX-M-15 (n = 25), blaCTX-M-24 (n = 4), blaTEM-52 (n = 4), blaCTX-M-14 (n = 2), blaCTX-M-55 (n = 2), blaSHV-12 (n = 2), blaCTX-M-8 (n = 1), blaCTX-M-25 (n = 1), blaCTX-M-28 (n = 1), and an unspecified gene (n = 1). Forty-seven (31%) cefotaxime-resistant E. coli isolates carried the blaCMY-2 AmpC beta-lactamase gene. Sixty-two (17%) of the E. coli isolates with reduced susceptibility to ciprofloxacin were positive for the PMQR genes qnrS1 (n = 54), qnrB19 (n = 4), qnrS1 and qnrB19 (n = 2), qnrS2 (n = 1), and aac(6′)-Ib-cr (n = 1). Eleven isolates from the Czech Republic (n = 8) and Serbia (n = 3) were identified to be CTX-M-15-producing E. coli clone B2-O25b-ST131 isolates. Ninety-one different sequence types (STs) among 191 ESBL-producing, AmpC-producing, and PMQR gene-positive E. coli isolates were determined, with ST58 (n = 15), ST10 (n = 14), and ST131 (n = 12) predominating. The widespread occurrence of highly diverse ESBL- and AmpC-producing and PMQR gene-positive E. coli isolates, including the clinically important

  18. Plasmid-mediated resistance to cephalosporins and fluoroquinolones in various Escherichia coli sequence types isolated from rooks wintering in Europe.

    PubMed

    Jamborova, Ivana; Dolejska, Monika; Vojtech, Jiri; Guenther, Sebastian; Uricariu, Raluca; Drozdowska, Joanna; Papousek, Ivo; Pasekova, Katerina; Meissner, Wlodzimierz; Hordowski, Jozef; Cizek, Alois; Literak, Ivan

    2015-01-01

    Extended-spectrum-beta-lactamase (ESBL)-producing, AmpC beta-lactamase-producing, and plasmid-mediated quinolone resistance (PMQR) gene-positive strains of Escherichia coli were investigated in wintering rooks (Corvus frugilegus) from eight European countries. Fecal samples (n = 1,073) from rooks wintering in the Czech Republic, France, Germany, Italy, Poland, Serbia, Spain, and Switzerland were examined. Resistant isolates obtained from selective cultivation were screened for ESBL, AmpC, and PMQR genes by PCR and sequencing. Pulsed-field gel electrophoresis and multilocus sequence typing were performed to reveal their clonal relatedness. In total, from the 1,073 samples, 152 (14%) cefotaxime-resistant E. coli isolates and 355 (33%) E. coli isolates with reduced susceptibility to ciprofloxacin were found. Eighty-two (54%) of these cefotaxime-resistant E. coli isolates carried the following ESBL genes: blaCTX-M-1 (n = 39 isolates), blaCTX-M-15 (n = 25), blaCTX-M-24 (n = 4), blaTEM-52 (n = 4), blaCTX-M-14 (n = 2), blaCTX-M-55 (n = 2), blaSHV-12 (n = 2), blaCTX-M-8 (n = 1), blaCTX-M-25 (n = 1), blaCTX-M-28 (n = 1), and an unspecified gene (n = 1). Forty-seven (31%) cefotaxime-resistant E. coli isolates carried the blaCMY-2 AmpC beta-lactamase gene. Sixty-two (17%) of the E. coli isolates with reduced susceptibility to ciprofloxacin were positive for the PMQR genes qnrS1 (n = 54), qnrB19 (n = 4), qnrS1 and qnrB19 (n = 2), qnrS2 (n = 1), and aac(6')-Ib-cr (n = 1). Eleven isolates from the Czech Republic (n = 8) and Serbia (n = 3) were identified to be CTX-M-15-producing E. coli clone B2-O25b-ST131 isolates. Ninety-one different sequence types (STs) among 191 ESBL-producing, AmpC-producing, and PMQR gene-positive E. coli isolates were determined, with ST58 (n = 15), ST10 (n = 14), and ST131 (n = 12) predominating. The widespread occurrence of highly diverse ESBL- and AmpC-producing and PMQR gene-positive E. coli isolates, including the clinically important multiresistant

  19. Molecular Specificities of R Factor-Determined Beta-Lactamases: Correlation with Plasmid Compatibility

    PubMed Central

    Hedges, R. W.; Datta, Naomi; Kontomichalou, Polyxeni; Smith, J. T.

    1974-01-01

    Beta (β)-lactamases determined by 29 ampicillin resistance plasmids could be divided into two types. One, TEM-type, was very uniform with respect to substrate specificity but heterogeneous in absolute levels of β-lactamase activity. The TEM-type β-lactamase was determined by R factors of compatibility groups FII, Iα, Iε, N, C, A, T, W, P, L, and X, and by prophage φ Amp. The other type, characterized by the ability to hydrolyze oxacillin, was less common, showed lower absolute levels of activity, and was heterogeneous as regards substrate specificities. Oxacillin-hydrolyzing β-lactamases were determined by R factors of compatibility groups FI, Iα, N, C, and O. PMID:4587613

  20. Classification of Beta-Lactamases and Penicillin Binding Proteins Using Ligand-Centric Network Models

    PubMed Central

    Öztürk, Hakime; Ozkirimli, Elif; Özgür, Arzucan

    2015-01-01

    β-lactamase mediated antibiotic resistance is an important health issue and the discovery of new β-lactam type antibiotics or β-lactamase inhibitors is an area of intense research. Today, there are about a thousand β-lactamases due to the evolutionary pressure exerted by these ligands. While β-lactamases hydrolyse the β-lactam ring of antibiotics, rendering them ineffective, Penicillin-Binding Proteins (PBPs), which share high structural similarity with β-lactamases, also confer antibiotic resistance to their host organism by acquiring mutations that allow them to continue their participation in cell wall biosynthesis. In this paper, we propose a novel approach to include ligand sharing information for classifying and clustering β-lactamases and PBPs in an effort to elucidate the ligand induced evolution of these β-lactam binding proteins. We first present a detailed summary of the β-lactamase and PBP families in the Protein Data Bank, as well as the compounds they bind to. Then, we build two different types of networks in which the proteins are represented as nodes, and two proteins are connected by an edge with a weight that depends on the number of shared identical or similar ligands. These models are analyzed under three different edge weight settings, namely unweighted, weighted, and normalized weighted. A detailed comparison of these six networks showed that the use of ligand sharing information to cluster proteins resulted in modules comprising proteins with not only sequence similarity but also functional similarity. Consideration of ligand similarity highlighted some interactions that were not detected in the identical ligand network. Analysing the β-lactamases and PBPs using ligand-centric network models enabled the identification of novel relationships, suggesting that these models can be used to examine other protein families to obtain information on their ligand induced evolutionary paths. PMID:25689853

  1. [Extended-spectrum beta-lactamase production by Enterobacteriaceae isolates from urine cultures of outpatients: results of a 7-year follow-up].

    PubMed

    Çelikbilek, Nevreste; Gözalan, Ayşegül; Özdem, Birsen; Kırca, Fisun; Açıkgöz, Ziya Cibali

    2015-04-01

    The aim of the study was to evaluate the change of the frequency of extended-spectrum beta-lactamase (ESBL) producing Enterobacteriaceae isolates from urine samples of outpatients in years and to analyse the antibiotic resistance profiles for a rational drug use. The urine samples cultured in our laboratory from the patients who were admitted to outpatient clinics of our hospital between years 2007-2013 were included in this study. Enterobacteriaceae strains were isolated and identified by conventional methods and API 20E system (BioMérieux, France). The standard antimicrobial susceptibility tests were performed by Kirby Bauer disk diffusion method. ESBL production were screened by double-disk synergy method according to CLSI guidelines. E-test method (BioMérieux, France) were used for the verification of suspicious ESBL production. The identification and antimicrobial susceptibility testing were performed for a total of 12.535 isolates. Of the isolates 8716 were identified as Escherichia coli (69.3%), 1514 were Klebsiella pneumoniae/oxytoca (12.1%), 257 were Proteus mirabilis (2.1%), 345 were other Enterobacteriae members (8%), 411 were various non-fermentative gram-negative bacteria (3.3%) and 1292 were various gram-positive bacteria (10.3%). The total positivity rate of ESBL was found as 21.8% (2.283/10.487), and the ESBL positive rates for E.coli, K.pneumoniae/oxytoca and P.mirabilis were 21.2%, 28.2% and 4.7%, respectively. Other Enterobacteriaceae isolates were not evaluated because of the absence of standardized methods and breakpoint values. There was no statistically significant difference among ESBL producing isolates within seven years (p= 0.364). The antibiotic resistance rates of the ESBL-positive isolates were statistically higher than ESBL-negative isolates [amoxicillin-clavulanate (73.1%/11.3%), trimethoprim-sulfamethoxazole (63.1%/31.0%), nitrofurantoin (17.3%/8.6%), gentamicin (42.2%/10.1%), amikacin (3.5%/0.9%), tobramisin (56

  2. New Delhi Metallo-beta-lactamase around the world: an eReview using Google Maps.

    PubMed

    Berrazeg, M; Diene, Sm; Medjahed, L; Parola, P; Drissi, M; Raoult, D; Rolain, Jm

    2014-01-01

    Gram-negative carbapenem-resistant bacteria, in particular those producing New Delhi Metallo-betalactamase-1 (NDM-1), are a major global health problem. To inform the scientific and medical community in real time about worldwide dissemination of isolates of NDM-1-producing bacteria, we used the PubMed database to review all available publications from the first description in 2009 up to 31 December 2012, and created a regularly updated worldwide dissemination map using a web-based mapping application. We retrieved 33 reviews, and 136 case reports describing 950 isolates of NDM-1-producing bacteria. Klebsiella pneumoniae (n= 359) and Escherichia coli (n=268) were the most commonly reported bacteria producing NDM-1 enzyme. Several case reports of infections due to imported NDM-1 producing bacteria have been reported in a number of countries, including the United Kingdom, Italy, and Oman. In most cases (132/153, 86.3%), patients had connections with the Indian subcontinent or Balkan countries. Those infected were originally from these areas, had either spent time and/or been hospitalised there, or were potentially linked to other patients who had been hospitalised in these regions. By using Google Maps, we were able to trace spread of NDM-1-producing bacteria. We strongly encourage epidemiologists to use these types of interactive tools for surveillance purposes and use the information to prevent the spread and outbreaks of such bacteria.

  3. Clavulanic Acid: a Beta-Lactamase-Inhibiting Beta-Lactam from Streptomyces clavuligerus

    PubMed Central

    Reading, C.; Cole, M.

    1977-01-01

    A novel β-lactamase inhibitor has been isolated from Streptomyces clavuligerus ATCC 27064 and given the name clavulanic acid. Conditions for the cultivation of the organism and detection and isolation of clavulanic acid are described. This compound resembles the nucleus of a penicillin but differs in having no acylamino side chain, having oxygen instead of sulfur, and containing a β-hydroxyethylidine substituent in the oxazolidine ring. Clavulanic acid is a potent inhibitor of many β-lactamases, including those found in Escherichia coli (plasmid mediated), Klebsiella aerogenes, Proteus mirabilis, and Staphylococcus aureus, the inhibition being of a progressive type. The cephalosporinase type of β-lactamase found in Pseudomonas aeruginosa and Enterobacter cloacae P99 and the chromosomally mediated β-lactamase of E. coli are less well inhibited. The minimum inhibitory concentrations of ampicillin and cephaloridine against β-lactamase-producing, penicillin-resistant strains of S. aureus, K. aerogenes, P. mirabilis, and E. coli have been shown to be considerably reduced by the addition of low concentrations of clavulanic acid. Images PMID:879738

  4. Bovine intestinal bacteria inactivate and degrade ceftiofur and ceftriaxone with multiple beta-lactamases.

    PubMed

    Wagner, R Doug; Johnson, Shemedia J; Cerniglia, Carl E; Erickson, Bruce D

    2011-11-01

    The veterinary cephalosporin drug ceftiofur is rapidly degraded in the bovine intestinal tract. A cylinder-plate assay was used to detect microbiologically active ceftiofur, and high-performance liquid chromatography-mass spectrometry analysis was used to quantify the amount of ceftiofur remaining after incubation with bovine intestinal anaerobic bacteria, which were isolated from colon contents or feces from 8 cattle. Ninety-six percent of the isolates were able to inactivate ceftiofur to some degree, and 54% actually degraded the drug. None of 9 fungal isolates inactivated or degraded ceftiofur. Facultative and obligate anaerobic bacterial species that inactivated or degraded ceftiofur were identified with Vitek and Biolog systems, respectively. A subset of ceftiofur degraders also degraded the chemically similar drug ceftriaxone. Most of the species of bacteria that degraded ceftiofur belonged to the genera Bacillus and Bacteroides. PCR analysis of bacterial DNA detected specific β-lactamase genes. Bacillus cereus and B. mycoides isolates produced extended-spectrum β-lactamases and metallo-β-lactamases. Seven isolates of Bacteroides spp. produced multiple β-lactamases, including possibly CepA, and metallo-β-lactamases. Isolates of Eubacterium biforme, Bifidobacterium breve, and several Clostridium spp. also produced ceftiofur-degrading β-lactamases. An agar gel overlay technique on isoelectric focusing separations of bacterial lysates showed that β-lactamase enzymes were sufficient to degrade ceftiofur. These results suggest that ceftiofur is inactivated nonenzymatically and degraded enzymatically by multiple β-lactamases from bacteria in the large intestines of cattle.

  5. Beta-lactamase-catalyzed aminolysis of depsipeptides: Proof of the nonexistence of a specific D-phenylalanine/enzyme complex by double-label isotope trapping

    SciTech Connect

    Pazhanisamy, S.; Pratt, R.F. )

    1989-08-22

    The steady-state kinetics of the Enterobacter cloacae P99 beta-lactamase-catalyzed aminolysis of the depsipeptide m-(((phenylacetyl)glycyl)oxy)benzoic acid by D-phenylalanine were consistent with an ordered sequential mechanism with D-phenylalanine binding first. In terms of this mechanism, the kinetics data required that in 20 mM MOPS buffer, pH 7.5, the dissociation constant of the initially formed enzyme/D-phenylalanine complex be around 1.3 mM; at pH 9.0 in 0.1 M carbonate buffer, the complex should be somewhat more stable. Attempts to detect this complex in a binary mixture by spectroscopic methods (fluorescence, circular dichroic, and nuclear magnetic resonance spectra) failed. Kinetic methods were also unsuccessful--the presence of 20 mM D-phenylalanine did not appear to affect beta-lactamase activity nor inhibition of the enzyme by phenylmethanesulfonyl fluoride, phenylboronic acid, or (3-dansylamidophenyl)boronic acid. Equilibrium dialysis experiments appeared to indicate that the dissociation constant of any binary enzyme/D-phenylalanine complex must be somewhat higher than the kinetics allowed (greater than 2 mM). Since the kinetics also required that, at high depsipeptide concentrations, and again with the assumption of the ordered sequential mechanism, the reaction of the enzyme/D-phenylalanine complex to aminolysis products be faster than its reversion to enzyme and D-phenylalanine, a double-label isotope-trapping experiment was performed.

  6. PCR amplfication on a microarray of gel-immobilized oligonucleotides : detection of bacterial toxin- and drug-resistent genes and their mutations.

    SciTech Connect

    Strizhkov, B. N.; Drobyshev, A. L.; Mikhailovich, V. M.; Mirzabekov, A. D.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology

    2000-10-01

    PCR amplification on a microarray of gel-immobilized primers (microchip) has been developed. One of a pair of PCR primers was immobilized inside a separate microchip polyacrylamide porous gel pad of 0.1 x 0.1 x 0.02 (or 0.04) micron in size and 0.2 (or 0.4) nL in volume. The amplification was carried out simultaneously both in solution covering the microchip array and inside gel pads. Each gel pad contained the immobilized forward primers, while the fluorescently labeled reverse primers, as well as all components of the amplification reaction, diffused into the gel pads from the solution. To increase the amplification efficiency, the forward primers were also added into the solution. The kinetics of amplification was measured in real time in parallel for all gel pads with a fluorescent microscope equipped with a charge-coupled device (CCD) camera. The accuracy of the amplification was assessed by using the melting curves obtained for the duplexes formed by the labeled amplification product and the gel-immobilized primers during the amplification process; alternatively, the duplexes were produced by hybridization of the extended immobilized primers with labeled oligonucleotide probes. The on-chip amplification was applied to detect the anthrax toxin genes and the plasmid-borne beta-lactamase gene responsible for bacterial ampicillin resistance. The allele-specific type of PCR amplification was used to identify the Shiga toxin gene and discriminate it from the Shiga-like one. The genomic mutations responsible for rifampicin resistance of the Mycobacterium tuberculosis strains were detected by the same type of PCR amplification of the rpoB gene fragment isolated from sputum of tuberculosis patients. The on-chip PCR amplification has been shown to be a rapid, inexpensive and powerful tool to test genes responsible for bacterial toxin production and drug resistance, as well as to reveal point nucleotide mutations.

  7. [Phenotypic and genotypic characterization of imipenem-resistant Pseudomonas aeruginosa isolated in a Buenos Aires hospital].

    PubMed

    Cejas, D; Almuzara, M; Santella, G; Tuduri, A; Palombarani, S; Figueroa, S; Gutkind, G; Radice, M

    2008-01-01

    From 129 P. aeruginosa isolated at a health care centre located in Buenos Aires (Hospital "Eva Perón"), 14% produced IMP-13. Although 18 isolates were metallo-beta-lactamases (MBL) producers, only those isolates that displayed altered outer membrane protein profiles correlated with the resistant category according to CLSI or even Subcomisión de Antimicrobianos, SADEBAC, AAM. Phenotypic screening of metallo-beta-lactamases proved to be appropriate for detecting MBL producing isolates. IMP-13 producing isolates corresponded to at least five different clonal types, which not only suggests the dissemination of the resistant strain but also of the resistant marker.

  8. [Investigation of plasmid-mediated quinolone resistance genes in quinolone-resistant Escherichia coli and Klebsiella spp. isolates from bloodstream infections].

    PubMed

    Buruk, Celal Kurtuluş; Öztel Ocak, Hikmet; Bayramoğlu, Gülçin; Aydın, Faruk

    2016-04-01

    One of the treatment options of Escherichia coli and Klebsiella spp. infections which are the most common opportunistic pathogens of gram-negative sepsis is quinolones. Resistance to quinolones which act by disrupting DNA synthesis has been increasing. Horizontal transfer of plasmid-mediated quinolone resistance (PMQR) genes play an important role in the spread of resistance. The data about the prevalence of PMQR genes in our country is quite limited. The aim of this study was to investigate the presence of known PMQR genes namely qnrA, qnrB, qnrC, qnrS, qnrD, aac(6')-Ib-cr, qepA and oqxAB amongst quinolone-resistant E. coli and Klebsiella spp. strains isolated from blood cultures. One hundred twenty seven E.coli and 66 Klebsiella isolates detected as nalidixic acid- and/or ciprofloxacin-resistant by phenotypical methods, from 193 blood samples of 187 patients admitted to Karadeniz Technical University, Faculty of Medicine, Department of Medical Microbiology, Bacteriology Unit of Patient Service Laboratory between January 2012 to August 2013 were included in the study. The presence of PMQR genes were investigated by polymerase chain reaction (PCR) and for the detection of aac(6')-Ib-cr variants PCR-restriction fragment length polymorphism (PCR-RFLP) method was used. The positive bands were sequenced using the same primers, and aligned with formerly defined resistance gene sequences, and confirmed. In the study, 56.7% (72/127) of E.coli and 19.7% (13/66) of Klebsiella spp. isolates, with a total of 44% (85/193) of all the isolates were found to be phenotypically resistant to quinolones. Of the 13 resistant Klebsiella isolates, 11 were K.pneumoniae, and two were K.oxytoca. Extended-spectrum beta-lactamase (ESBL)-producing isolates showed higher resistance (50/80, 62.5%) to quinolones than the negative ones (35/113, 30.9%). The prevalence of quinolone resistance genes among resistant E. coli and Klebsiella spp. isolates was determined as qnrA, 1.4% and 15.4%; qnrB, 4

  9. The role of outer membrane in Serratia marcescens intrinsic resistance to antibiotics.

    PubMed

    Sánchez, L; Ruiz, N; Leranoz, S; Viñas, M; Puig, M

    1997-09-01

    Three different porins from Serratia marcescens were described. They were named Omp1, Omp2 and Omp3 and their molecular weights were 42, 40 and 39 kDa respectively. Omp2 and Omp3 showed osmoregulation and thermoregulation in a similar way to OmpC and OmpF of Escherichia coli. Permeability coefficients of the outer membrane of this species were calculated following the Zimmermann and Rosselet method. P values were similar to those obtained in Escherichia coli, which suggests that the chromosomal beta-lactamase would play a major role in the resistance of Serratia marcescens to beta-lactam antibiotics. Both MIC values and permeabilities were modified by salycilates and acetylsalycilate. Synergism between the outer membrane and the beta-lactamase was also evaluated. When bacteria grew in the presence of a beta-lactam in the medium, the beta-lactamase accounted for most of the resistance.

  10. Evaluation of the current National Committee for Clinical Laboratory Standards guidelines for screening and confirming extended-spectrum beta-lactamase production in isolates of Escherichia coli and Klebsiella species from bacteremic patients.

    PubMed

    Katz, O T; Peled, N; Yagupsky, P

    2004-11-01

    The National Committee for Clinical Laboratory Standards (NCCLS) recommendations for screening and confirming the production of extended-spectrum beta-lactamases (ESBLs) were evaluated in 115 isolates of Escherichia coli and 157 isolates of Klebsiella spp. from Israeli patients with bacteremia. All isolates were screened using cefotaxime, ceftazidime, and cefpodoxime discs. Confirmatory tests using pairs of discs containing ceftazidime, cefotaxime, or cefpodoxime in which clavulanic acid was added to one of the discs in each pair [inhibitor-potentiated disc diffusion test (IPDDT)] and two double-sided E test strips containing ceftazidime or cefotaxime with and without clavulanic acid were performed on all isolates regardless of the results of screening tests. Isolates that tested positive by one or more confirmatory tests were considered ESBL producers. Overall, 69 (25.4%) strains were found to be ESBL producers. The sensitivity of the NCCLS screening criteria ranged between 98.6% for cefotaxime and 92.8% for ceftazidime, and the specificity ranged between 100% for cefotaxime and cefpodoxime and 99.0% for ceftazidime. The sensitivity of the confirmatory tests ranged between 97.1% for the cefotaxime E test and only 75.4% for the ceftazidime IPDDT discs. All 64 isolates that fell in the intermediate and resistant categories for cefotaxime, as well as all 41 in the same categories for ceftazidime and 68 of 69 in these categories for cefpodoxime, were confirmed as ESBL producers. The use of multiple antimicrobial discs for screening isolates and combinations of IPPDT discs is needed to improve the sensitivity of confirmatory testing. It is recommended that isolates falling in the intermediate and resistant categories in disc diffusion testing be reported as ESBL producers. The use of confirmatory tests should be limited to organisms with inhibition zone diameters ranging between the NCCLS recommendations for ESBL screening and the intermediate category breakpoints.

  11. Gene amplification and insecticide resistance.

    PubMed

    Bass, Chris; Field, Linda M

    2011-08-01

    Pesticide resistance in arthropods has been shown to evolve by two main mechanisms, the enhanced production of metabolic enzymes, which bind to and/or detoxify the pesticide, and mutation of the target protein, which makes it less sensitive to the pesticide. One route that leads to enhanced metabolism is the duplication or amplification of the structural gene(s) encoding the detoxifying enzyme, and this has now been described for the three main families (esterases, glutathione S-transferases and cytochrome P450 monooxygenases) implicated in resistance. More recently, a direct or indirect role for gene duplication or amplification has been described for target-site resistance in several arthropod species. This mini-review summarises the involvement of gene duplication/amplification in the insecticide/acaricide resistance of insect and mite pests and highlights recent developments in this area in relation to P450-mediated and target-site resistance.

  12. Genome evolution and plasticity of Serratia marcescens, an important multidrug-resistant nosocomial pathogen.

    PubMed

    Iguchi, Atsushi; Nagaya, Yutaka; Pradel, Elizabeth; Ooka, Tadasuke; Ogura, Yoshitoshi; Katsura, Keisuke; Kurokawa, Ken; Oshima, Kenshiro; Hattori, Masahira; Parkhill, Julian; Sebaihia, Mohamed; Coulthurst, Sarah J; Gotoh, Naomasa; Thomson, Nicholas R; Ewbank, Jonathan J; Hayashi, Tetsuya

    2014-08-01

    Serratia marcescens is an important nosocomial pathogen that can cause an array of infections, most notably of the urinary tract and bloodstream. Naturally, it is found in many environmental niches, and is capable of infecting plants and animals. The emergence and spread of multidrug-resistant strains producing extended-spectrum or metallo beta-lactamases now pose a threat to public health worldwide. Here we report the complete genome sequences of two carefully selected S. marcescens strains, a multidrug-resistant clinical isolate (strain SM39) and an insect isolate (strain Db11). Our comparative analyses reveal the core genome of S. marcescens and define the potential metabolic capacity, virulence, and multidrug resistance of this species. We show a remarkable intraspecies genetic diversity, both at the sequence level and with regards genome flexibility, which may reflect the diversity of niches inhabited by members of this species. A broader analysis with other Serratia species identifies a set of approximately 3,000 genes that characterize the genus. Within this apparent genetic diversity, we identified many genes implicated in the high virulence potential and antibiotic resistance of SM39, including the metallo beta-lactamase and multiple other drug resistance determinants carried on plasmid pSMC1. We further show that pSMC1 is most closely related to plasmids circulating in Pseudomonas species. Our data will provide a valuable basis for future studies on S. marcescens and new insights into the genetic mechanisms that underlie the emergence of pathogens highly resistant to multiple antimicrobial agents.

  13. Genome Evolution and Plasticity of Serratia marcescens, an Important Multidrug-Resistant Nosocomial Pathogen

    PubMed Central

    Iguchi, Atsushi; Nagaya, Yutaka; Pradel, Elizabeth; Ooka, Tadasuke; Ogura, Yoshitoshi; Katsura, Keisuke; Kurokawa, Ken; Oshima, Kenshiro; Hattori, Masahira; Parkhill, Julian; Sebaihia, Mohamed; Coulthurst, Sarah J.; Gotoh, Naomasa; Thomson, Nicholas R.; Ewbank, Jonathan J.; Hayashi, Tetsuya

    2014-01-01

    Serratia marcescens is an important nosocomial pathogen that can cause an array of infections, most notably of the urinary tract and bloodstream. Naturally, it is found in many environmental niches, and is capable of infecting plants and animals. The emergence and spread of multidrug-resistant strains producing extended-spectrum or metallo beta-lactamases now pose a threat to public health worldwide. Here we report the complete genome sequences of two carefully selected S. marcescens strains, a multidrug-resistant clinical isolate (strain SM39) and an insect isolate (strain Db11). Our comparative analyses reveal the core genome of S. marcescens and define the potential metabolic capacity, virulence, and multidrug resistance of this species. We show a remarkable intraspecies genetic diversity, both at the sequence level and with regards genome flexibility, which may reflect the diversity of niches inhabited by members of this species. A broader analysis with other Serratia species identifies a set of approximately 3,000 genes that characterize the genus. Within this apparent genetic diversity, we identified many genes implicated in the high virulence potential and antibiotic resistance of SM39, including the metallo beta-lactamase and multiple other drug resistance determinants carried on plasmid pSMC1. We further show that pSMC1 is most closely related to plasmids circulating in Pseudomonas species. Our data will provide a valuable basis for future studies on S. marcescens and new insights into the genetic mechanisms that underlie the emergence of pathogens highly resistant to multiple antimicrobial agents. PMID:25070509

  14. Crystal Structures of KPC-2[beta]-Lactamase in Complex with 3-Nitrophenyl Boronic Acid and the Penam Sulfone PSR-3-226

    SciTech Connect

    Ke, Wei; Bethel, Christopher R.; Papp-Wallace, Krisztina M.; Pagadala, Sundar Ram Reddy; Nottingham, Micheal; Fernandez, Daniel; Buynak, John D.; Bonomo, Robert A.; van den Akker, Focco

    2012-08-01

    Class A carbapenemases are a major threat to the potency of carbapenem antibiotics. A widespread carbapenemase, KPC-2, is not easily inhibited by {beta}-lactamase inhibitors (i.e., clavulanic acid, sulbactam, and tazobactam). To explore different mechanisms of inhibition of KPC-2, we determined the crystal structures of KPC-2 with two {beta}-lactamase inhibitors that follow different inactivation pathways and kinetics. The first complex is that of a small boronic acid compound, 3-nitrophenyl boronic acid (3-NPBA), bound to KPC-2 with 1.62-{angstrom} resolution. 3-NPBA demonstrated a Km value of 1.0 {+-} 0.1 {micro}M (mean {+-} standard error) for KPC-2 and blocks the active site by making a reversible covalent interaction with the catalytic S70 residue. The two boron hydroxyl atoms of 3-NPBA are positioned in the oxyanion hole and the deac