Sample records for beta-thalassemia major patients

  1. A comparison of heart function and arrhythmia in clinically asymptomatic patients with beta thalassemia intermedia and beta thalassemia major.

    PubMed

    Amoozgar, Hamid; Zeighami, Samaneh; Haghpanah, Sezaneh; Karimi, Mehran

    2017-01-01

    The goal of this study was to compare heart function and arrhythmia in clinically asymptomatic patients with beta thalassemia intermedia and beta thalassemia major. In this cross-sectional study, 60 patients with beta thalassemia major and 60 patients with beta thalassemia intermedia who had clinically no symptoms of arrhythmia and clinically normal heart function were evaluated using 24-hour ambulatory electrocardiogram monitoring and echocardiography. For data analysis SPSS ver.20 software was used. A P-value of less than 0.05 was considered statistically significant. The mean age of the beta thalassemia intermedia patients was 24.18 ± 7.9 years and the mean age in beta thalassemia major was 24.38 ± 7.7 years (P>0.05). Premature atrial contractions (PACs) were observed in 14 (23.3%) patients with beta thalassemia intermedia and in 22 (36.6%) beta thalassemia major patients. Premature ventricular contractions (PVCs) were detected in 8 (13.3%) patients in the beta thalassemia intermediate group and 16 (26.6) patients in the beta thalassemia major group, respectively. The left ventricular diastolic dimension, end-diastolic volume, and stroke volume were significantly higher in beta thalassemia intermedia group (P<0.05). Pulmonary acceleration time as an indicator of pulmonary pressure was lower in beta thalassemia intermedia group. Both atrial and ventricular arrhythmias were more common in the beta thalassemia major group. Higher end-diastolic volume and stroke volume were detected in the beta thalassemia intermedia group. Pulmonary acceleration time was lower in the beta thalassemia intermedia group, which can be an indicator of higher pulmonary pressure.

  2. Human parvovirus B19 in patients with beta thalassemia major from Tehran, Iran.

    PubMed

    Arabzadeh, Seyed Ali Mohammad; Alizadeh, Farideh; Tavakoli, Ahmad; Mollaei, Hamidreza; Bokharaei-Salim, Farah; Karimi, Gharib; Farahmand, Mohammad; Mortazavi, Helya Sadat; Monavari, Seyed Hamidreza

    2017-03-01

    Due to the tropism of human parvovirus B19 to erythroid progenitor cells, infection in patients with an underlying hemolytic disorder such as beta-thalassemia major leads to suppression of erythrocyte formation, referred to as transient aplasia crisis (TAC), which may be life-threatening. We investigated the prevalence of parvovirus B19 among patients with beta thalassemia major attending the Zafar Adult Thalassemia Clinic in Tehran, Iran. This cross-sectional study was performed to determine the presence of parvovirus B19 DNA in blood samples and parvovirus B19 genotypes in plasma samples of patients with thalassemia major. The population consisted of 150 patients with beta-thalassemia major who attended the Zafar clinic in Tehran. Specimens were studied using a real-time polymerase chain reaction assay. The prevalence of parvovirus B19 in our study population was 4%. Of 150 patients with thalassemia, six (4%) were positive for B19 DNA. There was no significant correlation between blood transfusion frequency and B19 DNA positivity. Finally, phylogenetic analysis of human parvovirus B19 revealed genotype I in these six patients. In this study, acute B19 infections were detected in patients with beta thalassemia major. Screening of such high-risk groups can considerably reduce the incidence and prevalence of B19 infection; thus, screening is required for epidemiologic surveillance and disease-prevention measures.

  3. Human parvovirus B19 in patients with beta thalassemia major from Tehran, Iran

    PubMed Central

    Arabzadeh, Seyed Ali Mohammad; Alizadeh, Farideh; Tavakoli, Ahmad; Mollaei, Hamidreza; Bokharaei-Salim, Farah; Karimi, Gharib; Farahmand, Mohammad; Mortazavi, Helya Sadat

    2017-01-01

    Background Due to the tropism of human parvovirus B19 to erythroid progenitor cells, infection in patients with an underlying hemolytic disorder such as beta-thalassemia major leads to suppression of erythrocyte formation, referred to as transient aplasia crisis (TAC), which may be life-threatening. We investigated the prevalence of parvovirus B19 among patients with beta thalassemia major attending the Zafar Adult Thalassemia Clinic in Tehran, Iran. Methods This cross-sectional study was performed to determine the presence of parvovirus B19 DNA in blood samples and parvovirus B19 genotypes in plasma samples of patients with thalassemia major. The population consisted of 150 patients with beta-thalassemia major who attended the Zafar clinic in Tehran. Specimens were studied using a real-time polymerase chain reaction assay. Results The prevalence of parvovirus B19 in our study population was 4%. Of 150 patients with thalassemia, six (4%) were positive for B19 DNA. There was no significant correlation between blood transfusion frequency and B19 DNA positivity. Finally, phylogenetic analysis of human parvovirus B19 revealed genotype I in these six patients. Conclusion In this study, acute B19 infections were detected in patients with beta thalassemia major. Screening of such high-risk groups can considerably reduce the incidence and prevalence of B19 infection; thus, screening is required for epidemiologic surveillance and disease-prevention measures. PMID:28401102

  4. Tricuspid regurgitation in patients with beta-thalassemia major.

    PubMed

    Wu, K H; Chang, J S; Su, B H; Peng, C T

    2004-12-01

    Although cardiac complications remain the main causes of death in thalassemic patients, right heart dysfunction has been little studied and the mechanism is still unclear. Echocardiography was performed in 39 patients with beta-thalassemia major and 35 aged-matched controls. The gender, age, heart rate, blood pressure, left ventricular ejection fraction (LVEF), acceleration time (AcT) of right ventricular outflow and right ventricular ejection time (RVET), AcT/RVET, and the presence of tricuspid regurgitation (TR) were compared between the two groups. We also compared the gender, age, age at first blood transfusion, serum ferritin level, alanine aminotransferase (ALT), the presence of antibodies to hepatitis C virus, liver fibrosis, splenectomy, platelet counts, diabetes mellitus, arrhythmia, cardiomegaly, LVEF, AcT, RVET, AcT/RVET, and signal intensity ratio (SIR) of myocardial magnetic resonance imaging (MRI) between thalassemic patients with and without TR. The incidence of TR in thalassemic patients was significantly higher than that in the control group (30.8 vs 11.4%, p=0.03). The incidences of splenectomy (p=0.03), platelet counts (p=0.01), and SIR of myocardial MRI (p=0.03) in thalassemic patients with TR were significantly higher than in those without TR. The AcT was shorter and the AcT/RVET ratio was smaller, suggesting higher pulmonary pressure in the thalassemic patients with TR. Occurrence of TR in patients with beta-thalassemia major may be a consequence of cardiac iron deposit, thrombocytosis, splenectomy, or pulmonary hypertension.

  5. Magnetic measurements on human erythrocytes: Normal, beta thalassemia major, and sickle

    NASA Astrophysics Data System (ADS)

    Sakhnini, Lama

    2003-05-01

    In this article magnetic measurements were made on human erythrocytes at different hemoglobin states (normal and reduced hemoglobin). Different blood samples: normal, beta thalassemia major, and sickle were studied. Beta thalassemia major and sickle samples were taken from patients receiving lifelong blood transfusion treatment. All samples examined exhibited diamagnetic behavior. Beta thalassemia major and sickle samples showed higher diamagnetic susceptibilities than that for the normal, which was attributed to the increase of membrane to hemoglobin volume ratio of the abnormal cells. Magnetic measurements showed that the erythrocytes in the reduced state showed less diamagnetic response in comparison with erythrocytes in the normal state. Analysis of the paramagnetic component of magnetization curves gave an effective magnetic moment of μeff=7.6 μB per reduced hemoglobin molecule. The same procedure was applied to sickle and beta thalassemia major samples and values for μeff were found to be comparable to that of the normal erythrocytes.

  6. Comparison of right and left side heart functions in patients with thalassemia major, patients with thalassemia intermedia, and control group.

    PubMed

    Noori, Noormohammad; Mohamadi, Mehdi; Keshavarz, Kambiz; Alavi, Seyed Mostafa; Mahjoubifard, Maziar; Mirmesdagh, Yalda

    2013-01-01

    Heart disease is the main cause of mortality and morbidity in patients with beta thalassemia, rendering its early diagnosis vital. We studied and compared echocardiographic findings in patients with beta thalassemia major, patients with beta thalassemia intermedia, and a control group. Eighty asymptomatic patients with thalassemia major and 22 asymptomatic cases with thalassemia intermedia (8-25 years old) were selected from those referred to Ali Asghar Hospital (Zahedan-Iran) between June 2008 and June 2009. Additionally, 80 healthy individuals within the same age and sex groups were used as controls. All the individuals underwent echocardiography, the data of which were analyzed with the Student t-test. The mean value of the pre-ejection period/ejection time ratio of the left ventricle during systole, the diameter of the posterior wall of the left ventricle during diastole, the left and right isovolumic relaxation times, and the right myocardial performance index in the patients with beta thalassemia major and intermedia increased significantly compared to those of the controls, but the other parameters were similar between the two patient groups. The mean values of the left and right pre-ejection periods, left ventricular end systolic dimension, and left isovolumic contraction time in the patients with thalassemia intermedia increased significantly compared to those of the controls. In the left side, myocardial performance index, left ventricular mass index, isovolumic contraction time, and deceleration time exhibited significant changes between the patients with thalassemia major and those with thalassemia intermedia, whereas all the echocardiographic parameters of the right side were similar between these two groups. The results showed that the systolic and diastolic functions of the right and left sides of the heart would be impaired in patients with thalassemia major and thalassemia intermedia. Consequently, serial echocardiography is suggested in

  7. Polyneuropathy and myopathy in beta-thalassemia major patients.

    PubMed

    Nemtsas, P; Arnaoutoglou, M; Perifanis, V; Koutsouraki, E; Spanos, G; Arnaoutoglou, N; Chalkia, P; Pantelidou, D; Orologas, A

    2018-05-01

    The thalassemias are the most common single gene disorder in the world. Nowadays, the average life expectancy of patients in developed countries has increased significantly, while, there was an increase of complications. We aimed to investigate peripheral neuropathy and myopathy in this patient group using a neurophysiological study. We performed nerve conduction studies and electromyography of upper and lower extremities on 36 beta-thalassemia major (β-thal) patients. The electrophysiological findings were correlated with demographic data and laboratory parameters of the disease. Patients with β-thal present polyneuropathy or myopathy at (50%). Polyneuropathy was detected in (38.9%) and myopathy in (27.8%), while polyneuropathy and myopathy were present at (16.7%) with an overlap of the diseases in 1/3 of the patients. There was not a statistically significant correlation of polyneuropathy and myopathy with age, sex, splenectomy, nor with respect to laboratory parameters, hemoglobin, and ferritin. However, there was a statistically significant correlation of polyneuropathy and myopathy with iron overload, as recorded by the magnetic resonance imaging (MRI) of the heart and the liver. Our findings suggest that iron overload plays a key role in the pathogenesis of polyneuropathy and myopathy in β-thal patients, and performing heart and liver MRI for the prediction of such lesions in an annual basis is warranted.

  8. Craniofacial Characteristics of Thalassemia Major Patients

    PubMed Central

    Karakas, Sacide; Tellioglu, Ayfer Metin; Bilgin, Mehmet; Omurlu, Imran Kurt; Caliskan, Sercin; Coskun, Salih

    2016-01-01

    Objective: Thalassemias major are the most common autosomal recessive disorders; they are characterized by anomalies in the synthesis of the beta chains of hemoglobin and are often associated with varying degrees of craniofacial anomalies. The purpose of this study was to evaluate the craniofacial dimensions of β-thalassemia patients and to identify differences by comparing them to those of a control group. Materials and Methods: The study comprised 43 thalassemia major patients and 26 age- and sex- matched healthy control subjects. Anthropometric measurements were performed in six different craniofacial regions (head, face, nose, mouth, eyes, and ears); a total of 23 craniofacial variables were measured. Results: Craniofacial measurements in the regions of the face, nose, lips and mouth, and ears in the thalassemia major patient group yielded statistically significant differences compared to those in the control group (p<0.05). However, no statistically significant differences were observed in the measurements of the head and eye regions. Conclusion: The study increased our understanding of the craniofacial anatomy of thalassemia major patients and enabled us to obtain quantitative results. PMID:28149147

  9. The psychological burden of patients with beta thalassemia major in Syria.

    PubMed

    Gharaibeh, Huda; Amarneh, Basil H; Zamzam, Suzan Z

    2009-10-01

    The objective of this study was to identify the psychosocial burden of thalassemia on children with beta-thalassemia major in Damascus, Syria. The sample consisted of thalassemic patients aged 6-18 years old, admitted to the thalassemia center in Damascus, accompanied by their parents. The parents answered a structured questionnaire (developed by Ratip & Modell) on behalf of their children. The psychosocial burden affected many aspects of life such as education, time off school, sporting capabilities, difference from friends/siblings, social interactions, family adjustment, anxiety, isolation, and stigmatization. Results indicated a significant association between socio-demographic characteristics such as age, gender, school grade, current schooling, work, family income, and the occurrence of complications with the psychosocial burden variables including education, time off school, sporting capabilities, difference from friends, social interactions and stigmatization. The findings suggest the need for psychological support as well as medical help for thalassemic families. Health professionals need to assess the psychological status of children with thalassemia and that of their families in order to minimize these burdens; thus, nurses must provide psychosocial support for children with thalassemia and encourage other family members to assist in providing support for the affected children. The current study triggered the need for new policies and new roles for the community health nurse and social workers as well as the need for counseling and educational programs for children with thalassemia.

  10. Electrocardiographic Presentation, Cardiac Arrhythmias, and Their Management in β-Thalassemia Major Patients.

    PubMed

    Russo, Vincenzo; Rago, Anna; Papa, Andrea Antonio; Nigro, Gerardo

    2016-07-01

    Beta-thalassemia major (β-TM) is a genetic hemoglobin disorder characterized by an absent synthesis of globin chains that are essential for hemoglobin formation, causing chronic hemolytic anemia. Clinical management of thalassemia major consists in regular long-life red blood cell transfusions and iron chelation therapy to remove iron introduced in excess with transfusions. Iron deposition in combination with inflammatory and immunogenic factors is involved in the pathophysiology of cardiac dysfunction in these patients. Heart failure and arrhythmias, caused by myocardial siderosis, are the most important life-limiting complications of iron overload in beta-thalassemia patients. Cardiac complications are responsible for 71% of global death in the beta-thalassemia major patients. The aim of this review was to describe the most frequent electrocardiographic abnormalities and arrhythmias observed in β-TM patients, analyzing their prognostic impact and current treatment strategies. © 2016 Wiley Periodicals, Inc.

  11. Thalassemia major and consanguinity in Shiraz city, Iran.

    PubMed

    Asadi-Pooya, Ali Akbar; Doroudchi, Mehrnoosh

    2004-09-05

    Beta-thalassemia is among the most common genetic disorders in the world and in Iran, with widespread occurrence. A cross-sectional study on 648 beta-thalassemia patients in Shiraz, Iran was carried out to determine the demography of beta-thalassemia major in Shiraz city, Fars province, Iran and also the rate of consanguinity and the significance of pre-marriage counseling in decreasing familial marriages and consequently preventing this autosomal recessive genetic disease. All interviewed patients had thalassemia major and their age, sex, and the consanguinity between parents were recorded. 40.6% of beta-thalassemia patients were outcomes of first-cousin marriages. Comparison of the percentages of familial marriages (consanguinity) between parents of beta-thalassemia patients and a sample of normal population, revealed a statistically significant difference (p< 0.00001). A nonstatistically significant difference was observed between male (53.5%) and female (46.5%) thalassemia patients. Comparison of data with the situation in 22 years ago revealed a 16.4% decrease in familial marriages among thalassemic families, however, more education and awareness of young women and men about the increased risk of beta-thalassemia after familial marriage through pre-marriage counseling is still necessary.

  12. Combined therapy with desferrioxamine and deferiprone in beta thalassemia major patients with transfusional iron overload.

    PubMed

    Daar, S; Pathare, A V

    2006-05-01

    Iron overload is the main cause of morbidity and mortality especially from heart failure in patients with beta thalassemia major (TM). Successful iron chelation is therefore essential for the optimal management of TM. Although desferrioxamine (DFX) has been the major iron-chelating treatment of transfusional iron overload, compliance is a major hindrance in achieving optimal therapeutic results. The availability of oral iron chelation with deferiprone (L(1)) since 1987 is useful but showed poor efficacy when used alone as compared to DFX. We therefore decided to compare DFX alone with a prospective combined therapy with DFX and L(1) in beta thalassemia major patients with iron overload. We studied 91 patients with beta thalassemia major (mean age+/-SD, 15.02+/-5.8; range 2-30 years) attending the day care unit for regular transfusional support. They received packed red cells every 3-4 weeks to maintain pretransfusion hemoglobin concentration above 9 g/dl. They had been receiving DFX at a daily dose of 40 mg kg(-1) day(-1) by subcutaneous infusion for 8-10 h on 4-5 nights each week for the past several years. However, due to various reasons, they had developed considerable transfusional iron overload. These patients were allocated to prospectively receive additional therapy with oral iron chelator L(1) at 75 mg kg(-1) day(-1) body weight in three divided doses with food after informed consent and continued to receive treatment with DFX as per the above dosage. Of the 91 patients, six developed severe gastrointestinal (GI) upset, two agranulocytosis, two arthropathy, one persistently raised liver enzymes, two died owing to sepsis, and two received allogeneic bone marrow transplantation. Amongst the remaining 76 patients, 21 were found noncompliant (not taking DFX regularly, but taking L(1) regularly). Thus, in the 55 evaluable patients {6-48 months on combination therapy; mean [(+/-SD)22+/-12 months]}, the mean serum ferritin (+/-SD) fell dramatically from 3

  13. Genotype–phenotype correlation among beta-thalassemia and beta-thalassemia/HbE disease in Thai children: predictable clinical spectrum using genotypic analysis

    PubMed Central

    Traivaree, Chanchai; Monsereenusorn, Chalinee; Rujkijyanont, Piya; Prasertsin, Warakorn; Boonyawat, Boonchai

    2018-01-01

    Introduction Beta-thalassemia is a group of inherited hemolytic anemias and one of the most common genetic disorders in Thailand. The clinical spectrum of beta-thalassemia disease ranges from mild to severe clinical symptoms including mild beta-thalassemia intermedia (TI) and severe beta-thalassemia major (TM). Objective This study aimed to determine the correlation between beta-globin gene (HBB) mutations and their phenotypic manifestations by evaluating patients’ clinical characteristics, transfusion requirements, growth and hematologic parameters, and hemoglobin typing among pediatric patients treated at Phramongkutklao Hospital. Materials and methods Seventy beta-thalassemia patients, including 63 with beta-thalassemia/hemoglobin E (HbE) and 7 with either homozygous or compound heterozygous beta-thalassemia, were enrolled in this study. Their clinical presentation, growth parameters and laboratory findings were reviewed and analyzed. The mean follow-up time was 10.52±5.62 years. Mutation analysis in each individual was performed using multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene and gap PCR for 3.4 kb deletion detection. Results All 7 homozygous and compound heterozygous beta-thalassemia patients were classified in TM. Among 63 patients with beta-thalassemia/HbE, 58 were classified in TM and 4 were classified in TI. Mean age at diagnosis was 0.8±0.49 years for homozygous or compound heterozygous beta-thalassemia and 3.43±3.5 years for beta-thalassemia/HbE. The most common HBB mutation was HBB:c.126_129delCTTT [codon 41/42 (-TCTT)] found in 34 alleles (48.6%). The height for age was also lower in homozygous beta-thalassemia patients (<3rd percentile) compared to compound heterozygous beta-thalassemia patients (25–50th percentile). Conclusion This study revealed a genotype–phenotype correlation of the most prevalent beta-thalassemia in Thai children using diagnostic capacity in genotypic analysis

  14. High incidence of silent cerebral infarcts in adult patients with beta thalassemia major.

    PubMed

    Pazgal, Idit; Inbar, Edna; Cohen, Maya; Shpilberg, Ofer; Stark, Pinhas

    2016-08-01

    Survival of beta thalassemia major (TM) patients has improved significantly over the past few decades. Consequently, less commonly reported complications are now being recognized. An incidence as high as 60% of silent cerebral infarcts (SCI) has been demonstrated by brain Magnetic Resonance Imaging (MRI) studies in beta thalassemia intermedia (TI). The aim of this study was to determine whether regularly transfused TM adult patients experience less SCI, as compared to the incidence described in TI. In this observational study, 28 transfusion dependent TM patients, >18years of age underwent brain MRI studies. Focal bright foci in the cerebral white matter were demonstrated in 17 (60.7%) patients; most of them had multiple lesions. Elevated serum ferritin (SF), primarily 5years Area Under the Curve, was found to have a significant association with the presence of SCI (p<0.031). Similar results were found when 4 patients with intact spleen and 2 patients with splenules were excluded (p=0.027). There was no significant association between number of SCI and clinical or other laboratory parameter evaluated. The present study demonstrates a high rate of SCI in regularly transfused TM adult patients. Effective continuous iron chelation, preventive low dose aspirin and routine periodical brain MRI are recommended. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. [Beta thalassemia major and pregnancy during adolescence: report of two cases].

    PubMed

    Trigo, Lucas Augusto Monteiro Castro; Surita, Fernanda Garanhani; Parpinelli, Mary Angela; Pereira, Belmiro Gonçalves; Fertrin, Kleber Yotsumoto; Costa, Maria Laura

    2015-06-01

    Beta thalassemia major is a rare hereditary blood disease in which impaired synthesis of beta globin chains causes severe anemia. Medical treatment consists of chronic blood transfusions and iron chelation. We describe two cases of adolescents with beta thalassemia major with unplanned pregnancies and late onset of prenatal care. One had worsening of anemia with increased transfusional requirement, fetal growth restriction, and placental senescence. The other was also diagnosed with hypothyroidism and low maternal weight, and was admitted twice during pregnancy due to dengue shock syndrome and influenza H1N1-associated respiratory infection. She also developed fetal growth restriction and underwent vaginal delivery at term complicated by uterine hypotonia. Both patients required blood transfusions after birth and chose medroxyprogesterone as a contraceptive method afterwards. This report highlights the importance of medical advice on contraceptive methods for these women and the role of a specialized prenatal follow-up in association with a hematologist.

  16. EFFECTS OF HOME-CARE TRAINING ON THE SELF-EFFICACY OF PATIENTS WITH BETA THALASSEMIA MAJOR

    PubMed Central

    Moghadam, Mahdieh Poodineh; Nourisancho, Hajar; Shahdadi, Hossein; Shahraki, Sohila; Azarkish, Batoul; Balouchi, Abbas

    2016-01-01

    Background: The self-efficacy of thalassemia patients is an important factor in creating behavioral changes in such patients. Home-care training reduces hospitalization duration as well as relevant costs and improves disease outcomes. This study was designed to assess the effect of home-care training on the self-efficacy of patients with beta thalassemia major. Methodology: This was a quasi-experimental, case-control, before and after intervention study conducted on 136 thalassemia cases from January 2014 to October 2015. Data was collected through Shere general self-efficacy questionnaire (SGSES). Home-care trainings were provided in the form of training courses with respect to the training needs of thalassemia major cases. Two (2) months after the end of training courses, SGSES questionnaire was filled again and the obtained data was analyzed by SPSS 21 as well as descriptive-inferential statistics (significance level=P≤0.05). Results: The results of this study revealed that the mean self-efficacy score of control group was 48.69±6.82 before intervention which increased to 46.69±6.81 after intervention. The mean self-efficacy score of case group was 44.58±5.23 before intervention which increased to 49.5±6.66 after intervention. The rise of self-efficacy score, after intervention, was significantly higher in the case group compared with the control group (P≤.001). Conclusion: According to results, home-care training can develop self-efficacy in thalassemia patients. In home-care training procedure patients play an active role. By providing home-care trainings, therefore, an effective step should be taken to promote the self-efficacy of the patients and to decrease associated problems. PMID:27999484

  17. Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study

    PubMed Central

    Boonyawat, Boonchai; Monsereenusorn, Chalinee; Traivaree, Chanchai

    2014-01-01

    Background Beta-thalassemia is one of the most common genetic disorders in Thailand. Clinical phenotype ranges from silent carrier to clinically manifested conditions including severe beta-thalassemia major and mild beta-thalassemia intermedia. Objective This study aimed to characterize the spectrum of beta-globin gene mutations in pediatric patients who were followed-up in Phramongkutklao Hospital. Patients and methods Eighty unrelated beta-thalassemia patients were enrolled in this study including 57 with beta-thalassemia/hemoglobin E, eight with homozygous beta-thalassemia, and 15 with heterozygous beta-thalassemia. Mutation analysis was performed by multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene, and gap polymerase chain reaction for 3.4 kb deletion detection, respectively. Results A total of 13 different beta-thalassemia mutations were identified among 88 alleles. The most common mutation was codon 41/42 (-TCTT) (37.5%), followed by codon 17 (A>T) (26.1%), IVS-I-5 (G>C) (8%), IVS-II-654 (C>T) (6.8%), IVS-I-1 (G>T) (4.5%), and codon 71/72 (+A) (2.3%), and all these six common mutations (85.2%) were detected by M-ARMS. Six uncommon mutations (10.2%) were identified by DNA sequencing including 4.5% for codon 35 (C>A) and 1.1% initiation codon mutation (ATG>AGG), codon 15 (G>A), codon 19 (A>G), codon 27/28 (+C), and codon 123/124/125 (-ACCCCACC), respectively. The 3.4 kb deletion was detected at 4.5%. The most common genotype of beta-thalassemia major patients was codon 41/42 (-TCTT)/codon 26 (G>A) or betaE accounting for 40%. Conclusion All of the beta-thalassemia alleles have been characterized by a combination of techniques including M-ARMS, DNA sequencing, and gap polymerase chain reaction for 3.4 kb deletion detection. Thirteen mutations account for 100% of the beta-thalassemia genes among the pediatric patients in our study. PMID:25525381

  18. Retinal abnormalities in β-thalassemia major.

    PubMed

    Bhoiwala, Devang L; Dunaief, Joshua L

    2016-01-01

    Patients with beta (β)-thalassemia (β-TM: β-thalassemia major, β-TI: β-thalassemia intermedia) have a variety of complications that may affect all organs, including the eye. Ocular abnormalities include retinal pigment epithelial degeneration, angioid streaks, venous tortuosity, night blindness, visual field defects, decreased visual acuity, color vision abnormalities, and acute visual loss. Patients with β-thalassemia major are transfusion dependent and require iron chelation therapy to survive. Retinal degeneration may result from either retinal iron accumulation from transfusion-induced iron overload or retinal toxicity induced by iron chelation therapy. Some who were never treated with iron chelation therapy exhibited retinopathy, and others receiving iron chelation therapy had chelator-induced retinopathy. We will focus on retinal abnormalities present in individuals with β-thalassemia major viewed in light of new findings on the mechanisms and manifestations of retinal iron toxicity. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. [Pretreatment doses of antithymocyte globubin-fresenius for allogeneic hematopoietic stem cell transplantation for beta-thalassemia major].

    PubMed

    Li, Chunfu; Wang, Yanhua; Wu, Xuedong; Pei, Fuyu; He, Yuelin; Feng, Xiaoqin; Liu, Huaying

    2012-05-01

    To investigate the effects of different doses of antithymocyte globubin-fresenius (ATG-F) for allogeneic hematopoietic stem cell transplantation (allo-HSCT) in patients with beta-thalassemia Major. Sixty-four children with beta-thalassemia major undergoing allo-HSCT were divided into two equal groups to receive ATG-F pretreatments at high (30 mg/kg) or low (15 mg/kg) doses as part of the conditioning regimen including mainly cyclophosphamide, busulfan, fludarabine, and thiotepa. The outcomes of the patients were compared between the two groups. No obvious difference were noted in the time to leukocyte and platelet engraftment between the two groups. The incidence of grade II-IV acute graft-versus-host disease (aGVHD) appeared to be higher in the low-dose group than in the high-dose group (12.5% vs 9.4%). The incidence of grade III-IV aGVHD was also higher in the low dose group (12.5% vs 6.3%), but the difference was not statistically significant. Application of high-dose ATG-F was associated with a higher rate of probable and possible fungal infection (P<0.05). The two doses of ATG-F is feasible as a part of the conditioning regimen for allo-HSCT in children with beta-thalassemia major.

  20. Endocrinopathies in thalassemia major patient

    NASA Astrophysics Data System (ADS)

    Lubis, D. A.; Yunir, E. M.

    2018-03-01

    Advanced in chelation therapy and regular blood transfusion have marked improvements in the life expectancy of patients with thalassemia major, however these patients still have to deal with several complications. We report a 19-year-old male, presented with multiple endocrine complication-related thalassemia; hypogonadism, short stature, osteoporosis with history of fracture, and subclinical hypothyroid.

  1. Adipocytokine concentrations in children with different types of beta-thalassemia.

    PubMed

    Enli, Yaşar; Balci, Yasemin I; Gönen, Cafer; Uzun, Ebru; Polat, Aziz

    2014-06-01

    Beta-thalassemia is an inherited blood disorder. It results from the impaired production of β-globin chains, leading to a relative excess of alpha-globin chains. Clinical severity separates this disease into three main subtypes: β- thalassemia major, β-thalassemia intermedia and β-thalassemia minor, the former two being clinically more significant. Inflammatory processes may play an important role in some of the complications of thalassemia. Adipose tissue is one of the most important endocrine and secretory organs that release adipocytokines like adiponectin, resistin and visfatin. The aim of our study was to analyze adipocytokine concentrations (adiponectin, resistin and visfatin) in different types of β-thalassemia patients and determine any possible correlations with disease severity. We recruited 29 patients who were transfusion-dependent β-thalassemia-major patients, 17 patients with β-thalassemia intermedia, 30 β-thalassemia minor patients. The control group consisted of 30 healthy children. Anthropometric measurements, complete blood count, biochemical parameters, serum concentrations of adiponectin, resistin, visfatin were performed for all subjects. Resistin and visfatin concentrations were significantly higher in β-thalassemia minor patients than in controls. Adiponetin, resistin and visfatin concentrations were significantly higher in both β-thalassemia intermedia and major patients than in controls. The concentrations of adiponectin, resistin and visfatin were significantly higher in both β-thalassemia intermedia and major patients than in β-thalassemia minor patients. There was no significant difference between β-thalassemia intermedia and β-thalassemia major patients for adipocytokines concentrations. We speculate that these adipocytokines may play a role in the development of complications in β-thalassaemia.

  2. Genotype-phenotype diversity of beta-thalassemia in Malaysia: treatment options and emerging therapies.

    PubMed

    George, Elizabeth; Ann, T J A Mary

    2010-12-01

    The haemoglobinopathies and thalassemias represent the most common inherited monogenic disorders in the world. Beta-thalassaemia major is an ongoing public health problem in Malaysia. Prior to 2004, the country had no national policy for screening and registry for thalassemia. In the absence of a national audit, the true figure of the extent of thalassemia in the Malaysian population was largely presumptive from micro-mapping studies from various research workers in the country. The estimated carrier rate for beta-thalassemia in Malaysia is 3.5-4%. There were 4768 transfusion dependent thalassemia major patients as of May 2010 (Data from National Thalassemia Registry).

  3. Evaluation of serum levels of C3 and C4 complement factors in patients with beta thalassemia major in Khuzestan Province, Southwest Iran.

    PubMed

    Ghafourian, Mehri; Esmaeili, Mehrnosh; Dashti-Gerdabi, Nader; Sadeghi, Alireza; Malekei Naseri, Ali; Kazemi, Akhtar

    2017-01-01

    Thalassemia syndrome is the most common genetic disorder in the world and infection is the second cause of death in these patients. Measurement of serum C3 and C4 complement factors in serum was done in 60 patients with beta thalassemia major in comparison with 30 healthy subjects as control group. The serum level of C3 and C4 complement factors in 60 patients with beta thalassemia major who were randomly selected from among the patients referred to Shafa Hospital of Ahvaz was evaluated and compared with 30 samples from healthy individuals with no history of recent infectious or autoimmune diseases. It should be noted that single-radial-immunodiffusion assay was used in this study. This study has shown a significant reduction in serum levels of C3 and C4 in patients compared to controls (P value < 0.05). Decreased synthesis or increased consumption of complement factors in patients receiving multiple blood transfusions might lead to continuous contact between the immune system and various antigens, causing nonstop use of complement factors, recurrent infections, changes in parameters of the immune system due to iron overload as well as exposure to infectious factors such as HBV, HCV, HIV, and HTLV through blood transfusion.

  4. Quality of life among children with beta-thalassemia major treated in Western Saudi Arabia.

    PubMed

    Ayoub, Mohammed D; Radi, Suhaib A; Azab, Abdulrahman M; Abulaban, Abdulrahman A; Balkhoyor, Abdulrahman H; Bedair, Seifeleslam W; Aljaouni, Soad K; Kari, Jameela A

    2013-12-01

    To assess the quality of life among children and adolescents with thalassemia major. This cross-sectional study used the Pediatric Quality of Life Inventory (PedsQL). Children and adolescents with beta-thalassemia major who attended the Day Care Unit at King Abdulaziz University Hospital, Jeddah, Saudi Arabia from October 2012 to February 2013 were surveyed. The questions highlighted 4 health status scales, namely physical functioning (PF), emotional functioning (EF), school performance (SC), and social functioning (SF). Scores were calculated for each patient and data were analyzed using the Statistical Package for Social Sciences. We recruited 46 children (60.9% males). The median age of the sample was 12 years (range, 2-18 years). Most patients (84.8%) had 3 weekly blood transfusions. The mean+/-SD physical functioning (PF) score was 57.2+/-25.9; the EF score was 74.1+/-20.3, SF score was 78.5+/-24, and SC score was 54.3+/-24.2. The PF score was significantly lower in patients with a family history of thalassemia (p=0.003), and in those whose families had low incomes (p=0.049). Conversely, the SF score was significantly higher in school-educated patients (p=0.01). The quality of life of thalassemic children is affected by multiple factors, such as family income and a family history of thalassemia. Education appeared to increase patient functionality. Supportive measures could improve the quality of life in thalassemic patients.

  5. Premature atherosclerosis in children with beta-thalassemia major: New diagnostic marker.

    PubMed

    Sherief, Laila M; Dawood, Osama; Ali, Adel; Sherbiny, Hanan S; Kamal, Naglaa M; Elshanshory, Mohamed; Alazez, Osama Abd; Alhady, Mohamed Abd; Nour, Mohamed; Mokhtar, Wesam A

    2017-03-09

    Early vascular alteration, atherosclerosis and coronary artery disease have emerged as important cardiovascular complications among beta-thalassemia major (B-TM) patients. The aims of the current study were to assess the prevalence of premature atherosclerosis among our B-TM patients, and to investigate the diagnostic value of serum Osteoprotegerin assay as an early biomarker for atherosclerosis. This cross-sectional study was conducted at Hematology unit - Pediatric Department, Zagazig University Children Hospital- Egypt in the period from March 2014 to March 2015. A total of 115 children were enrolled in the current study; as sixty-five (65) children with beta thalassemia major aged 5-18 years, on regular blood transfusion regimen represented the patient group. While fifty (50) healthy children, with comparable age and gender, were assigned as control group. All participants were subjected to history taking, thorough clinical examination and laboratory investigations including; complete blood count, liver and kidney function tests, C- reactive protein, lipid profile, serum ferritin and serum Osteoprotegerin (OPG) assay. Also, carotid artery intima media thickness (CAIMT) was performed by duplex ultrasound for patients and controls. Our B-TM patients were transfusion-dependent for as long as 8.5 ± 3.8 years with significantly higher serum ferritin levels (2490 ± 1579 ng/dl vs 83 ± 32 ng/dl, p = 0.001), C-reactive protein (5.7 ± 5.7 vs 0.9 ± 0.9), liver enzymes and bilirubin when compared to controls. Significantly higher serum triglyceride (128 ± 20 vs 101 ± 7 mg/dL, p = 0.009) and atherogenic index of plasma (0.45 ± 0.12 vs 0.22 ± 0.04, p = 0.001) were recorded in patients than comparisons. On the contrary, total serum cholesterol (116 ± 16 vs 143 ± 5, p < 0.001), low density lipoprotein-cholesterol (LDL-C) (44 ± 9 vs 73 ± 6, p < 0.001) and high density lipoprotein

  6. Genetics Home Reference: beta thalassemia

    MedlinePlus

    ... Facebook Twitter Home Health Conditions Beta thalassemia Beta thalassemia Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Beta thalassemia is a blood disorder that reduces the production ...

  7. Is beta-thalassemia trait a protective factor against ischemic cerebrovascular accidents?

    PubMed

    Karimi, Mehran; Borhani Haghighi, Afshin; Yazdani, Maryam; Raisi, Hamideh; Giti, Rahil; Namazee, Mohammad Reza

    2008-01-01

    In this research, we sought to determine the association between beta-thalassemia trait and ischemic cerebrovascular accident (CVA). In acase-control study, 148 patients with thromboembolic cerebrovascular events were evaluated for the presence of hypertension, diabetes mellitus, hyperlipidemia, and beta-thalassemia trait. A total of 156 age- and sex-matched patients with no cardiac or cerebrovascular diseases, serving as the control group, were also investigated for the above-mentioned risk factors. We found that 6.1% of patients with ischemic CVA and 12.2% of the control group had beta-thalassemia trait (P = .066). In male patients, the negative association between ischemic CVA and presence of beta-thalassemia trait was significant (P = .008). In patients, the prevalence of hypertension was also significantly different between those with and without beta-thalassemia trait (P = .01); those with beta-thalassemia trait had a lower mean blood pressure than those without the trait. beta-Thalassemia trait may have a protective effect against ischemic CVA that might be caused by the lower arterial blood pressure observed in those with this trait.

  8. Molecular basis of beta-thalassemia in the Maldives.

    PubMed

    Furuumi, H; Firdous, N; Inoue, T; Ohta, H; Winichagoon, P; Fucharoen, S; Fukumaki, Y

    1998-03-01

    We have systematically analyzed beta-thalassemia genes using polymerase chain reaction-related techniques, dot-blot hybridization with oligonucleotide probes, allele specific-polymerase chain reaction, and sequencing of amplified DNA fragments from 41 unrelated patients, including 37 beta-thalassemia homozygotes, three with beta-thalassemia/Hb E, and one with beta-thalassemia/Hb S. Four different beta-thalassemia mutations were detected in 78 alleles. These are the IVS-I-5 (G-->C), codon 30 (AGG-->ACG) [also indicated as IVS-I (-1)], IVS-I-1 (G-->A), and codons 41/42 (-TTCT) mutations. The distribution of the beta-thalassemia mutations in the Maldives is 58 alleles (74.3%) with the IVS-I-5 (G-->C) mutation, 12 (15.4%) with the codon 30 (AGG-->ACG) mutation, seven (9%) with the IVS-I-1 (G-->A) mutation, and one with the codons 41/42 (-TTCT) mutation. The first three mutations account for 98.7% of the total number of beta-thalassemia chromosomes studied. These mutations are clustered in the region spanning 6 bp around the junction of exon 1 and the first intervening sequence of the beta-globin gene. These observations have significant implications for setting up a thalassemia prevention and control program in the Maldives. Analysis of haplotypes and frameworks of chromosomes bearing each beta-thalassemia mutation suggested that the origin and spread of these mutations were reflected by the historical record.

  9. Retinal abnormalities in β-thalassemia major

    PubMed Central

    Bhoiwala, Devang L.; Dunaief, Joshua L.

    2015-01-01

    Patients with beta (β)-thalassemia (β-TM: thalassemia major, β-TI: thalassemia intermedia) have a variety of complications that may affect all organs, including the eye. Ocular abnormalities include retinal pigment epithelium degeneration, angioid streaks, venous tortuosity, night blindness, visual field defects, decreased visual acuity, color vision abnormalities, and acute visual loss. Patients with β-TM are transfusion dependent and require iron chelation therapy (ICT) in order to survive. Retinal degeneration may result from either retinal iron accumulation from transfusion-induced iron overload or retinal toxicity induced by ICT. Some who were never treated with ICT exhibited retinopathy, and others receiving ICT had chelator-induced retinopathy. We will focus on retinal abnormalities present in individuals with β-TM viewed in light of new findings on the mechanisms and manifestations of retinal iron toxicity. PMID:26325202

  10. [Long-term effects of combined therapy in patients with beta-thalassemia major].

    PubMed

    Bagnulo, S; Giannini, A M; Moscatelli, F; Stragapede, L; Acquafredda, A; Dammacco, A

    1998-01-01

    We evaluated therapy complications in 19 beta-thalassemia major patients (mean age from 3 years/5 months and 1 years/6 months) who were followed at II Pediatric Department-University of Bari. 3 out of 19 patients underwent allogenic BMT from matched related donor; 2 out of 19 underwent splenectomy. All of them were receiving hypertransfusion therapy and continuous chelation with DFO. In all patients we performed physical examination, laboratory assays, cardiac and endocrinologic function tests, serum HBV-HCV-HIV antibodies, otoscopy and audiometric test, fundus oculi, skeletal x-ray. 1 out of 19 patients, who was under 15, had a slight dilatation of left ventricle and arythmia. All patients were HBsAb positive. 4/19 patients were HCV Ab positive (ELISA test) with an increase in ALT-AST serum levels since at least 6 months. In 3 of them we assessed RIBA test, always positive. 3 of them underwent liver biopsy (1 iron overload 2 chronic active hepatitis). All patients were HIV Ab negative. 4/15 patients revealed low GH levels after Arginina test. 13 pre-pubescent patients had normal results with GNRH test but lower results after FSH test. 1 pubescent patient had gonadotropic hypophyseal deficit. 4 patients had subclinic hypothiroidism. We couldn't find any sequelas in bone-eyes-ears. Hypertransfusion therapy, chelation, profilaxis of infections improved length and quality of life in thalassemic patients. Hypogonadotropic hypogonadism remains a serious sequela and we think it needs to be treated.

  11. Comparison of deferiprone and deferrioxamine for the treatment of transfusional iron overload in children with beta thalassemia major.

    PubMed

    Waheed, Nadia; Ali, Shafqut; Butt, Muhammad Asghar

    2014-01-01

    Thalassemia major is the most common genetic disorder in Pakistan. The study was done to compare the efficacy and safety of the deferiprone with deferrioxamine for the treatment of iron overload in children with thalassemia major. This randomized controlled trail was conducted at thalassemia blood transfusion unit of Allied Hospital, Faisalabad (AHF)/District Headquarter Hospital (DHQ), Faisalabad. Thalassemia-Unit Hilal-e-Ahmar, Alizeb Foundation and Blood Bank Services Faisalabad from November 2010 to December 2011.Children with beta thalassemia major of age more than 2 years and less than 16 years with transfusion iron over load were randomly allocated to one of the two groups each comprising of 67 patients. One group received deferiprone given at a daily dose of 75mg/kg in three divided doses orally while the other group received deferrioxamine at dose 50 mg/kg/24hrs for 5 days/week as parental infusion. Changes in the serum ferritin level were assessed. Cardiac function and toxicity were also examined. Serum ferritin was significantly reduced after 1 year in both treatment arms (p=0.01). Neutropenia observed in 13 (19.40%) non-splenectomized patients taking deferiprone. Transient elevations in ALT were observed in 3 (4.47%) children taking deferiprone. Left ventricular ejection fraction (LVEF) remained in normal range in both treatment arm but has decreased significantly in Deferrioxamine group compliance. Compliance was better in deferiprone as compared to deferrioxamine. Discontinuing percentage 2 (3%) vs 9 (13.43%). Deferiprone is a highly efficacious and safe chelation therapy for patients with thalassemia major who are non-compliant to Deferrioxamine. Deferiprone have an efficacy profile comparable to standard Deferrioxamine.

  12. Regional consensus opinion for the management of Beta thalassemia major in the Arabian Gulf area

    PubMed Central

    2013-01-01

    Thalassemia syndrome has diverse clinical presentations and a global spread that has far exceeded the classical Mediterranean basin where the mutations arose. The mutations that give rise to either alpha or beta thalassemia are numerous, resulting in a wide spectrum of clinical severity ranging from carrier state to life-threatening, inherited hemolytic anemia that requires regular blood transfusion. Beta thalassemia major constitutes a remarkable challenge to health care providers. The complications arising due to the anemia, transfusional iron overload, as well as other therapy-related complications add to the complexity of this condition. To produce this consensus opinion manuscript, a PubMed search was performed to gather evidence-based original articles, review articles, as well as published work reflecting the experience of physicians and scientists in the Arabian Gulf region in an effort to standardize the management protocol. PMID:24044606

  13. Ophthalmic Evaluation in Beta-Thalassemia.

    PubMed

    Merchant, Rashid H; Punde, Hrishikesh; Thacker, Neepa; Bhatt, Deepak

    2017-07-01

    To determine the association of ocular manifestations in beta-thalassemia with the patient's age, blood transfusion requirements, average serum ferritin and dose and duration of iron chelation therapy. Sixty multi-transfused beta thalassemia patients of 12 to 18 y of age on chelation therapy were included in this cross-sectional analysis. Structural and functional evaluation of the retina was done using Optical coherence tomography (OCT) and Electroretinography (ERG), including flash ERG and Pattern ERG (PERG). Routine ophthalmic examination and B scan of the eye was also done. Flash ERG a-waves and b-waves were recorded, however only a-wave amplitude was evaluated. Pattern ERG n35, n95 and p50 waves were recorded and p50 wave amplitude was evaluated. The a-wave on flash and p50 on pattern waves represent retinal photoreceptor epithelium (RPE) photoreceptor response, which is mainly affected in beta-thalassemia. Ocular changes were detected in 38.3% and a significant correlation was noted with increase in age (p = 0.045) but not with serum ferritin, transfusion requirements or chelation therapy. Refractive errors were found in 14 cases (23%), such as myopia with astigmatism in 13 (21.7%) and only myopia in 6 subjects (10%). OCT abnormality was noted in 1 patient (1.7%) who had thinning of central retina; right eye 132 μm and left eye 146 μm (n > 200 μm). Abnormalities were noted in a-wave amplitude on flash ERG in 20% of cases, while reduced p50 amplitude on PERG was noted in 15%. A significant correlation was noted between ocular findings and increase in age, but not with serum ferritin, transfusion requirements or chelation therapy. ERG appears to be a promising tool for screening patients with beta-thalassemia and can serve as a follow-up test for evaluating retinal function.

  14. Assessment of cognitive function in children with beta-thalassemia major: a cross-sectional study.

    PubMed

    Raafat, Nelly; El Safy, Usama; Khater, Nahed; Hassan, Tamer; Hassan, Basheir; Siam, Ahmed; Youssef, Amira; El Shabrawy, Amany

    2015-03-01

    Multiple risk factors contribute to cognitive impairment in children with β-thalassemia major. For a more refined understanding of this issue, we attempted to evaluate cognitive function in β-thalassemia major patients and identify the relationship between possible cognitive dysfunction and the following: demography, transfusion and chelation characteristics, iron overload, and disease complications. We studied 100 β-thalassemia major children and 100 healthy controls who matched well in terms of age, sex, and socioeconomic status. All participants underwent psychometric assessment using Wechsler Intelligence Scale for Children-Third Edition, Arabic version. The mean Full-Scale IQ and Performance IQ of patients were significantly lower than those of controls, whereas no significant difference was found for Verbal IQ. No significant relationship existed between IQ and any of the assessed parameters. We concluded that Performance IQ, not Verbal IQ, was significantly affected in β-thalassemia major patients, but there was no clear association between IQ and any of the parameters. © The Author(s) 2014.

  15. Molecular analysis of the beta-thalassemia phenotype associated with inheritance of hemoglobin E (alpha 2 beta2(26)Glu leads to Lys).

    PubMed Central

    Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G

    1981-01-01

    Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with Hb E-beta-thalassemia and Hb E trait. The initial rate of beta-globin synthesis (betaE/alpha=0.20-0.34) was less than expected on the basis of gene dosage, or comparable studies of other compound heterozygous states for beta-thalassemia and structurally abnormal beta-chains. betaE-globin synthesis was not only reduced during short-term incubations (1-5 min), but also remained relatively unchanged during long-term pulse or chase incubations up to 5h. Analysis of globin mRNA by cell-free translation and molecular hybridization confirmed that the unexpectedly low levels of betaE-globin synthesis were associated with comparable reduction in the levels of beta-globin mRNA. In Hb E-beta-thalassemia the betaA + betaE (alpha globin nRNA ratio observed were substantially lower than those obtained from reticulocytes of patients with heterozygous beta-thalassemia, or Hb S-betaO-thalassemia, while in Hb E trait, the betaA + betaE/alpha mRNA ratio was in the ranged observed for beta-thalassemia trait. The betaE-globin gene specifies reduced accumulation of betaE-globin mRNA, a property characteristic of other forms of beta-thalassemia. The beta-thalassemia phenotype associated with inheritance of Hb E is thus determined at the level of beta-globin mRNA metabolism. PMID:6166632

  16. Orthodontic Consideration in Patients with Beta-Thalassemia Major: Case Report and Literature Review.

    PubMed

    Einy, Shmuel; Hazan-Molina, Hagai; Ben-Barak, Ayelet; Aizenbud, Dror

    Beta Thalassemia (βT) patients present a unique facial appearance and specific craniofacial, jaw and dental patterns. Although this anomaly often requires orthodontic management, βT patients have received scant attention in the orthodontic and dental literature over the past 50 years. The aim of this article is to review the characteristic craniofacial and dental manifestation pattern of βT patients and to emphasize their preferred orthodontic management protocol by presenting a βT orthodontic treated patient. A 10 year old patient presented with a complaint of severe esthetic and functional disorders due to her diagnosis of βT. We initiated orthodontic treatment including a combined orthopedic and functional treatment modality to improve facial appearance. Maxillary restraint and increased mandibular size during treatment along with an increase in the vertical dimension were achieved. The patient presented with Angle class I molar relationship, with reduction of the excessive overjet and deep overbite. Orthodontic treatment comprised of maxillary orthopedic treatment directed especially toward premaxilla with light forces, and mandibular modification by functional appliance along with fixed orthodontic treatment is recommended in βT patients.

  17. Frequency of Hereditary Hemochromatosis (HFE) Gene Mutations in Egyptian Beta Thalassemia Patients and its Relation to Iron Overload.

    PubMed

    Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal

    2016-06-15

    This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.

  18. Beta-thalassemia intermedia associated with moyamoya syndrome.

    PubMed

    Göksel, Basak Karakurum; Ozdogu, Hakan; Yildirim, Tulin; Oğuzkurt, Levent; Asma, Suheyl

    2010-07-01

    Moyamoya syndrome (MMS) is a progressive disorder. We report a 19-year-old boy with beta-thalassemia who presented with a left hemiparesis. Brain MRI showed old middle cerebral artery and left frontal subcortical white matter infarcts. Brain magnetic resonance angiography and digital subtraction angiography revealed occlusion of the bilateral internal carotid arteries with a rich network of basal collateral vessels. To our knowledge this is the third report of beta-thalassemia intermedia and MMS, and the first report of a patient in Turkey. It emphasizes the potential for cerebral infarct due to anemia, protein S and thrombocytosis.

  19. [Clinical analysis of three cases with beta-thalassemia].

    PubMed

    Li, X Y; Liu, M J; Xu, L H; Xu, H G; Chen, H L; Fang, J P

    2018-04-02

    Objective: To study the diagnostic strategy of β-thalassemia through retrospective analysis of 3 cases of β-thalassemia. Methods: Three patients were admitted to the Department of Pediatrics, Sun Yat-sen Memorial Hospital of Sun Yat-sen University from January 2014 to June 2015. The clinical manifestations, hemoglobin electrophoresis and gene detection of these patients and their parents were analyzed, diagnostic ideas and key points were discussed when beta thalassemia gene detection did not explain clinical manifestations or hemoglobin electrophoresis. Results: Case 1, boy, 5 years old, was diagnosed as compound heterozygotes of β41-42 and IVS-Ⅱ-654 with hereditary persistence of fetal hemoglobin(HPFH) according to the clinical manifestations of mild anemia, normal size of liver and spleen, 92.8% fetal hemoglobin (HbF) and gene analysis. Case 2, girl, 3 years old, was confirmed the diagnosis of thalassemia intermedia with β41-42 heterozygote compound and ααα anti3.7 heterozygote in accordance with the manifestations of severe anemia, hepatosplenomegaly, 8.6% HbF, 4.1% hemoglobin A 2 (HbA 2 ) and gene analysis. Case 3, girl, 3 years old, with severe anemia, hepatosplenomegaly, 51.2% HbF and 3.7% HbA 2 , was diagnosed as thalassemia major with compound heterozygotes of PolyA (T→C) and β17 by DNA sequencing. Conclusion: The diagnosis of β-thalassemia should be confirmed by clinical manifestations of hemolytic anemia, hemoglobin electrophoresis, gene diagnosis and family survey.

  20. Sustained and full fetal hemoglobin production after failure of bone marrow transplant in a patient homozygous for beta 0-thalassemia: a clinical remission despite genetic disease and transplant rejection.

    PubMed

    Paciaroni, Katia; Gallucci, Cristiano; De Angelis, Gioia; Alfieri, Cecilia; Roveda, Andrea; Lucarelli, Guido

    2009-06-01

    An adult patient affected by beta(0)-thalassemia major underwent allogeneic bone marrow transplant (BMT) from a matched related donor. Forty days after transplant, allogeneic engraftment failure and autologous beta(0)-thalassemic bone marrow recovery were documented. Red blood cell transfusions were required until 118 days post-transplant. Thereafter, the haemoglobin (Hb) levels stabilized over 11.8 gr/dl throughout the ongoing 34-month follow-up, abolishing the need for transfusion support. The Hb electrophoresis showed 100% Hb Fetal (HbF). This unexplained case suggests full HbF production may occur in an adult patient with beta(0)-thalassemia major.

  1. Double heterozygosity for Hb New York [beta 113 GTG-->GAG; VAL-->GLU] and beta degrees-thalassemia mutations manifests as a thalassemia trait.

    PubMed

    Lee, Anselm C W; Ma, Edmond S K; Chan, Amy Y Y; Szeto, S C; Chan, L C

    2008-01-01

    An extended family with three individuals affected by two different forms of double heterozygosity for beta-thalassemia and Hb New York is reported. Double heterozygosity of Hb New York [beta 113 GTG-->GAG; VAL-->GLU] and beta degrees codon 17 was detected in a fetus following prenatal screening for thalassemia. The father and a paternal aunt were also found to be heterozygous for Hb New York and beta degrees IVSII-654. Both adults had clinical and hematological features consistent with beta-thalassemia trait. The affected child was followed up after birth and manifested the typical course of a thalassemia trait, with no signs of organomegaly or overt hemolysis. Observations strongly suggest that double heterozygosity of Hb New York and beta degrees thalassemia has mild, if any, clinical symptoms, and is not an indication of therapeutic abortion when detected antenatally.

  2. Associations between a health-promoting lifestyle and quality of life among adults with beta-thalassemia major.

    PubMed

    Maheri, Aghbabak; Sadeghi, Roya; Shojaeizadeh, Davoud; Tol, Azar; Yaseri, Mehdi; Ebrahimi, Mojtaba

    2016-01-01

    A health-promoting lifestyle (HPL) is a factor that affects the quality of life (QoL) in patients with beta-thalassemia (β-thalassemia). Due to the lack of studies of this issue, this study aimed to determine the association between HPL and QoL among adults with β-thalassemia. This cross-sectional (descriptive-analytic) study was conducted among 389 adult patients with β-thalassemia in Tehran, Iran. The research instrument included a questionnaire consisting of three parts: demographic items, the Short-Form Health Survey and the Health-Promoting Lifestyle Profile. The data were analyzed using SPSS version 23.0. The results were considered significant at the conventional p<0.05 level. The mean age of the participants was 30.2±8.3 years. The mean score of the HPL dimensions was 127.28±21.53, and the mean score of the QoL domains was 61.44±23.38. The highest and the lowest mean scores of the HPL dimensions were found for spiritual growth (23.96±5.74) and physical activity (11.32±3.95), respectively. The QoL scores in all three domains (total, physical component summary score, and mental component summary score) were moderate. Health responsibility, physical activity, spiritual growth, and interpersonal relations were significant predictive factors of QoL in adults with β-thalassemia; these four dimensions explained 37.9% of the variance in QoL. QoL and HPL were not at acceptable levels among patients with thalassemia. Therefore, educational interventions emphasizing spiritual growth, physical activity, and interpersonal relations are necessary for patients with thalassemia.

  3. Refractive errors and ocular biometry components in thalassemia major patients.

    PubMed

    Heydarian, Samira; Jafari, Reza; Karami, Hosein

    2016-04-01

    The aim of this study is to determine and compare biometric and refractive characteristics of thalassemia major patients and normal individuals. In this cross-sectional study, 54 thalassemia major patients were selected randomly as case group, and 54 age- and sex-matched healthy subjects were regarded as control group. Refractive errors, corneal curvature and ocular components were measured by autokeratorefractometery and A-scan ultrasonography, respectively. Mean spherical equivalent was -0.0093 ± 0.86 D in thalassemia patients and -0.22 ± 1.33 D in the normal group. The prevalence of myopia, Hyperopia, and emmetropia among thalassemia patients was 16.7, 19.4, and 63.9 %, respectively. While in the control group, 26.9 % were myopic, 25 % were hyperopic, and 48.1 % were emmetropic. The prevalence of astigmatism in case group was 22.2 %, which was not significantly different from that in control group, (27.8 %, p = 0.346). Mean axial length in thalassemia patients was 22.89 ± 0.70 which was significantly lower than that in normal group (23.37 ± 0.91, p = 0.000). The flattest meridian of the cornea (R1) was significantly steeper in thalassemia patients (7.77 ± 0.24) in comparison to normal individuals (7.85 ± 0.28). Although thalassemic patients had significantly smaller axial length and vitreous chamber depth in comparison to normal group, which could be due to their abnormal physical growth, there was no significant difference between the mean of spherical equivalent among two groups. This can be due to their steeper corneal curvature that overcomes the refractive disadvantage of their shorter axial length.

  4. Economic Burden of Thalassemia Major in Iran, 2015.

    PubMed

    Esmaeilzadeh, Firooz; Azarkeivan, Azita; Emamgholipour, Sara; Akbari Sari, Ali; Yaseri, Mehdi; Ahmadi, Batoul; Ghaffari, Mohtasham

    2016-01-01

    Major Thalassemia is an autosomal recessive disease with complications, mortality and serious pathology. Today, the life expectancy of patients with major thalassemia has increased along with therapeutic advances. Therefore, they need lifelong care, and caring for them would incur many costs. Being aware of the patients' costs can be effective for controlling and managing the costs and providing efficient treatments for the care of patients. Hence, this study was conducted to estimate the economic burden of the patients with major thalassemia. Totally, 198 patients with major thalassemia were randomly selected from among the patients with major thalassemia in Tehran, Iran in 2015. The economic burden of the patients was estimated from a social perspective and through a bottom-up, prevalence-based approach. The average annual cost per patient was estimated $ 8321.8 regardless of the cost of lost welfare. Of this amount, $ 7286.8 was related to direct medical costs, $ 461.4 to direct non-medical costs, and $ 573.5 to indirect costs. In addition, the annual cost per patient was estimated $ 1360.5 due to the distress caused by the disease CONCLUSIONS: Considering the high costs of the treatment of patients with major thalassemia, adopting new policies to reduce the costs that patients have to pay seems necessary. In addition, making new decisions regarding thalassemia screening, even with higher costs than the usual screening costs, can be useful since the costs of treatment are high.

  5. Genetic heterogeneity of Beta thalassemia in Lebanon reflects historic and recent population migration.

    PubMed

    Makhoul, N J; Wells, R S; Kaspar, H; Shbaklo, H; Taher, A; Chakar, N; Zalloua, P A

    2005-01-01

    Beta thalassemia is an autosomal recessive disorder characterized by reduced (beta(+)) or absent (beta(0)) beta-globin chain synthesis. In Lebanon it is the most predominant genetic defect. In this study we investigated the religious and geographic distribution of the beta-thalassemia mutations identified in Lebanon, and traced their precise origins. A total of 520 beta-globin chromosomes from patients of different religious and regional backgrounds was studied. Beta thalassemia mutations were identified using Amplification Refractory Mutation System (ARMS) PCR or direct gene sequencing. Six (IVS-I-110, IVS-I-1, IVS-I-6, IVS-II-1, cd 5 and the C > T substitution at cd 29) out of 20 beta-globin defects identified accounted for more than 86% of the total beta-thalassemia chromosomes. Sunni Muslims had the highest beta-thalassemia carrier rate and presented the greatest heterogeneity, with 16 different mutations. Shiite Muslims followed closely with 13 mutations, whereas Maronites represented 11.9% of all beta-thalassemic subjects and carried 7 different mutations. RFLP haplotype analysis showed that the observed genetic diversity originated from both new mutational events and gene flow from population migration. This study provides information about the types and distribution of beta-thalassemia mutations within each religious group and geographic region, which is essential for the implementation of screening and prevention programs.

  6. Alloimmunization and autoimmunization in transfusion dependent thalassemia major patients: Study on 319 patients

    PubMed Central

    Dhawan, Hari Krishan; Kumawat, Vijay; Marwaha, Neelam; Sharma, Ratti Ram; Sachdev, Suchet; Bansal, Deepak; Marwaha, Ram Kumar; Arora, Satyam

    2014-01-01

    Background: The development of anti-red blood cell antibodies (both allo-and autoantibodies) remains a major problem in thalassemia major patients. We studied the frequency of red blood cell (RBC) alloimmunization and autoimmunization among thalassemia patients who received regular transfusions at our center and analyzed the factors, which may be responsible for development of these antibodies. Materials and Methods: The study was carried out on 319 multiply transfused patients with β-thalassemia major registered with thalassemia clinic at our institute. Clinical and transfusion records of all the patients were examined for age of patients, age at initiation of transfusion therapy, total number of blood units transfused, transfusion interval, status of splenectomy or other interventions. Alloantibody screening and identification was done using three cell and 11 cell panel (Diapanel, Bio-rad, Switzerland) respectively. To detect autoantibodies, autocontrol was carried out using polyspecific coombs (IgG + C3d) gel cards. Results: Eighteen patients out of total 319 patients (5.64%) developed alloantibodies and 90 (28.2%) developed autoantibodies. Nine out of 18 patients with alloantibodies also had autoantibodies. Age at first transfusion was significantly higher in alloimmunized than non-immunized patients (P = 0.042). Out of 23 alloantibodies, 52.17% belonged to Rh blood group system (Anti-E = 17%, Anti D = 13%, Anti-C = 13%, Anti-Cw = 9%), 35% belonged to Kell blood group system, 9% of Kidd and 4% of Xg blood group system. Conclusion: Alloimmunization was detected in 5.64% of multitransfused thalassemia patients. Rh and Kell blood group system antibodies accounted for more than 80% of alloantibodies. This study re-emphasizes the need for RBC antigen typing before first transfusion and issue of antigen matched blood (at least for Rh and Kell antigen). Early institution of transfusion therapy after diagnosis is another means of decreasing alloimmunization. PMID

  7. Alloimmunization and autoimmunization in transfusion dependent thalassemia major patients: Study on 319 patients.

    PubMed

    Dhawan, Hari Krishan; Kumawat, Vijay; Marwaha, Neelam; Sharma, Ratti Ram; Sachdev, Suchet; Bansal, Deepak; Marwaha, Ram Kumar; Arora, Satyam

    2014-07-01

    The development of anti-red blood cell antibodies (both allo-and autoantibodies) remains a major problem in thalassemia major patients. We studied the frequency of red blood cell (RBC) alloimmunization and autoimmunization among thalassemia patients who received regular transfusions at our center and analyzed the factors, which may be responsible for development of these antibodies. The study was carried out on 319 multiply transfused patients with β-thalassemia major registered with thalassemia clinic at our institute. Clinical and transfusion records of all the patients were examined for age of patients, age at initiation of transfusion therapy, total number of blood units transfused, transfusion interval, status of splenectomy or other interventions. Alloantibody screening and identification was done using three cell and 11 cell panel (Diapanel, Bio-rad, Switzerland) respectively. To detect autoantibodies, autocontrol was carried out using polyspecific coombs (IgG + C3d) gel cards. Eighteen patients out of total 319 patients (5.64%) developed alloantibodies and 90 (28.2%) developed autoantibodies. Nine out of 18 patients with alloantibodies also had autoantibodies. Age at first transfusion was significantly higher in alloimmunized than non-immunized patients (P = 0.042). Out of 23 alloantibodies, 52.17% belonged to Rh blood group system (Anti-E = 17%, Anti D = 13%, Anti-C = 13%, Anti-C(w) = 9%), 35% belonged to Kell blood group system, 9% of Kidd and 4% of Xg blood group system. Alloimmunization was detected in 5.64% of multitransfused thalassemia patients. Rh and Kell blood group system antibodies accounted for more than 80% of alloantibodies. This study re-emphasizes the need for RBC antigen typing before first transfusion and issue of antigen matched blood (at least for Rh and Kell antigen). Early institution of transfusion therapy after diagnosis is another means of decreasing alloimmunization.

  8. Clinical and hematological response to hydroxyurea in a patient with Hb Lepore/beta-thalassemia.

    PubMed

    Rigano, P; Manfré, L; La Galla, R; Renda, D; Renda, M C; Calabrese, A; Calzolari, R; Maggio, A

    1997-05-01

    The possibility of increasing Hb F in vivo using drugs like 5-azacytidine, hydroxyurea, and butyrate has been established. However, in many cases this does not entail an increase in total hemoglobin. We report on a patient with Hb Lepore/beta-thalassemia being treated with hydroxyurea (30 mg/Kg/day) because of the presence of erythroid extramedullary masses with severe neurological abnormalities. During therapy the patient showed a remarkable improvement in neurological signs due to the reduction in extra-medullary masses, a significant increase in both total hemoglobin (from 5.8 to 9.7 g/dl) and Hb F (from 4.9 g/dl to 9.1 g/dl). The marked improvement in hemoglobin level in our patient with Hb Lepore/beta-thalassemia suggests gamma-globin gene activation due to the DNA structure determined by the crossover event.

  9. Cardiac complications in beta-thalassemia: From mice to men.

    PubMed

    Kumfu, Sirinart; Fucharoen, Suthat; Chattipakorn, Siriporn C; Chattipakorn, Nipon

    2017-06-01

    Beta-thalassemia is an inherited hemoglobin disorder caused by reduced or absent synthesis of the beta globin chains of hemoglobin. This results in variable outcomes ranging from clinically asymptomatic to severe anemia, which then typically requires regular blood transfusion. These regular blood transfusions can result in an iron overload condition. The iron overload condition can lead to iron accumulation in various organs, especially in the heart, leading to iron overload cardiomyopathy, which is the major cause of mortality in patients with thalassemia. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects that iron overload has on the hearts of β-thalassemic mice under conditions of iron overload as well as the efficacy of pharmacological interventions to combat these adverse effects on the heart are reviewed and discussed. The in-depth understanding of biomolecular alterations in the heart of these iron overload thalassemic mice will help give guidance for more effective therapeutic approaches in the near future. Impact statement Iron overload cardiomyopathy is a major cause of morbidity and mortality in patients with thalassemia. Since investigation of iron overload cardiomyopathy in thalassemia patients has many limitations, a search for an animal model for this condition has been ongoing for decades. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects of

  10. Cardiac complications in beta-thalassemia: From mice to men

    PubMed Central

    Kumfu, Sirinart; Fucharoen, Suthat; Chattipakorn, Siriporn C.

    2017-01-01

    Beta-thalassemia is an inherited hemoglobin disorder caused by reduced or absent synthesis of the beta globin chains of hemoglobin. This results in variable outcomes ranging from clinically asymptomatic to severe anemia, which then typically requires regular blood transfusion. These regular blood transfusions can result in an iron overload condition. The iron overload condition can lead to iron accumulation in various organs, especially in the heart, leading to iron overload cardiomyopathy, which is the major cause of mortality in patients with thalassemia. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects that iron overload has on the hearts of β-thalassemic mice under conditions of iron overload as well as the efficacy of pharmacological interventions to combat these adverse effects on the heart are reviewed and discussed. The in-depth understanding of biomolecular alterations in the heart of these iron overload thalassemic mice will help give guidance for more effective therapeutic approaches in the near future. Impact statement Iron overload cardiomyopathy is a major cause of morbidity and mortality in patients with thalassemia. Since investigation of iron overload cardiomyopathy in thalassemia patients has many limitations, a search for an animal model for this condition has been ongoing for decades. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects of

  11. Diagnostic difficulty of beta-thalassemia syndrome in a multi-transfused patient: contribution of myelogram and studying parents.

    PubMed

    Trawinski, Élisabeth; Fenneteau, Odile; Le Mouel, Lou; Ithier, Ghislaine; Couque, Nathalie

    2017-10-01

    We report the case of a 5 year old, initially followed for congenital sideroblastic anemia, whose explorations reveal a complex family hemoglobinopathy. Myelogram performed in children, reveals dystrophic mature erythroblasts with hemoglobinization defect and basophil punctuations. These abnormalities point towards an abnormal synthesis of heme or globin chains. Iterative transfusions in child do not allow interpreting a search for abnormal hemoglobin. However, the analysis carried out in his parents, with increased HBA2 rate and microcytosis concluded in beta-thalassemia trait for father and mother. Knowing that beta-thalassemia syndrome is a genetic condition, usually recessive, the presence of beta-thalassemia trait in parents is in favor of a beta-thalassemia syndrome in child. This diagnostic hypothesis is confirmed by molecular study of globin genes that will reveal a complex hemoglobinopathie for all family's members. The parents are carriers for heterozygous mutation of β + thalassemia that the sick child presents in homozygous state supporting the diagnosis of beta-thalassemia syndrome. Moreover, a triple α globin gene is present respectively at heterozygous state for mother and at homozygous state for father and child. The triple α globin gene is a known factor of aggravation of beta-thalassemia and this clinical case with continuum observed, perfectly illustrates the intricacies between α and β globin genes.

  12. Immune Status 'in Children with Beta Thalassemia' in Correlation 'with Iron Overload': Single Center Egyptian Study.

    PubMed

    Hagag, Adel A; Elgamsy, Mohamed A; El-Asy, Hassan M; Gamal, Rasha M; Elshahaby, Walid N; Abd Elbar, Enaam S

    2016-01-01

    'Beta thalassemia is inherited hemoglobin disorder resulting in chronic hemolytic anemia that requires lifelong transfusion therapy'. 'Repeated blood transfusions and RBCs hemolysis are the main causes of iron overload', which in addition to immune abnormalities, are common predisposing factors to infections in patients with thalassemia. The Aim of this Work: The aim of this work was to study immune status including T lymphocyte subsets and serum immunoglobulin levels 'in children with beta- thalassemia in correlation with iron overload'. The present 'study was conducted on 40 children with beta thalassemia major under follow up at Hematology Unit, Pediatric Department, Tanta University' 'including 24 males and 16 females with mean' age value of 9. 22 ± 3.9 years and 20 'healthy children of matched age and sex as a control group'. All children included in the study were subjected to; 'complete blood count, Hb electrophoresis, serum iron status', T cell subsets including CD3, CD4 and CD8 and serum immunoglobulin levels including IgM, IgA and IgG. 'Pallor and jaundice were the most common presenting' clinical manifestations. Infective episodes 'were significantly higher in patients' compared with controls. There were significantly lower Hb, MCV and MCH levels and significantly higher WBCs and platelets counts, reticulocytes and lymphocytes percentage in patients than controls and no significant differences in MCHC between patients and controls. Serum ferritin and iron were 'significantly higher but TIBC was significantly lower in' patients than controls. CD3, CD4 and IgM were significantly lower but CD8, IgG, and IgA 'were significantly higher in patients than controls' with negative correlation between CD3, CD4, IgM and ferritin and positive correlation between CD8, IgG, IgA and ferritin. Iron overload can affect humeral and cell mediated immunity in patients with beta thalassemia with reduction of IgM, CD3 and CD4 and elevation of CD8, IgG, and IgA. Regular follow

  13. Changes in lncRNAs and related genes in β-thalassemia minor and β-thalassemia major.

    PubMed

    Ma, Jing; Liu, Fei; Du, Xin; Ma, Duan; Xiong, Likuan

    2017-03-01

    β-thalassemia is caused by β-globin gene mutations. However, heterogeneous phenotypes were found in individuals with same genotype, and still undescribed mechanism underlies such variation. We collected blood samples from 30 β-thalassemia major, 30 β-thalassemia minor patients, and 30 matched normal controls. Human lncRNA Array v2.0 (8 × 60 K, Arraystar) was used to detect changes in long non-coding RNAs (lncRNAs) and mRNAs in three samples each from β-thalassemia major, β-thalassemia minor, and control groups. Compared with normal controls, 1424 and 2045 lncRNAs were up- and downregulated, respectively, in β-thalassemia major patients, whereas 623 and 349 lncRNAs were up- and downregulated, respectively, in β-thalassemia minor patients. Compared with β-thalassemia minor group, 1367 and 2356 lncRNAs were up- and downregulated, respectively, in β-thalassemia major group. We selected five lncRNAs that displayed altered expressions (DQ583499, X-inactive specific transcript (Xist), lincRNA-TPM1, MRFS16P, and lincRNA-RUNX2-2) and confirmed their expression levels in all samples using real-time polymerase chain reaction. Based on coding-noncoding gene co-expression network and gene ontology biological process analyses, several signaling pathways were associated with three common organ systems exhibiting β-thalassemia phenotypes: hematologic, skeletal, and hepatic systems. This study implicates that abnormal expression levels of lncRNAs and mRNA in β-thalassemia cases may be correlated with its various clinical phenotypes.

  14. Iron chelation monotherapy in transfusion-dependent beta-thalassemia major patients: a comparative study of deferasirox and deferoxamine

    PubMed Central

    Hassan, Mohamed Abdel Malik; Tolba, Omar Atef

    2016-01-01

    Introduction Iron overload is the primary cause of mortality and morbidity in thalassemia major (TM) despite advances in chelation therapy. The aim of this study was to compare the effectiveness and safety of deferasirox (DFX) and deferoxamine (DFO) as iron-chelating agents in patients with transfusion-dependent β-thalassemia major. Methods This prospective randomized study included 60 patients with transfusion-dependent β-TM during the period from September 2014 to September 2015. Their ages were ≥ 6 years, and they had serum ferritin above 1500 μg/L and were on irregular DFO therapy. Patients had regular packed red cell transfusion in a dose of 10 mL/kg/session. They were randomized to receive DFX (single oral daily dose of 20–40 mg/kg/day) or DFO (20–50 mg/kg/day via subcutaneous infusion over 8–10 hours, 5 days a week). Iron overload was determined by serum ferritin level. The primary endpoint was decrease of serum ferritin level below 1500 μg/L. The secondary endpoint was drug safety. Results Both drugs significantly reduced serum ferritin (p < 0.001). At the end of follow-up, there were no significant differences between the two groups in serum ferritin levels (p = 0.673) and in percent reduction of ferritin (p = 0.315). There were no significant differences between the two groups in the total amount of blood transfusion (p = 0.166) and average iron intake (p = 0.227). There were no mortalities or any serious adverse effects, neutropenia, arthropathy, or pulmonary toxicity. Gastrointestinal upset and skin rash occurred more frequently with DFX than with DFO (p = 0.254 and 0.095, respectively). Conclusion With appropriate dosing and compliance with drugs, both DFX and DFO are generally well tolerated, safe, and effective in reducing serum ferritin levels in iron-overloaded, regularly-transfused thalassemia major patients. Therefore, oral DFX is recommended for more convenience and adherence to the treatment regimen. PMID:27382454

  15. Iron chelation monotherapy in transfusion-dependent beta-thalassemia major patients: a comparative study of deferasirox and deferoxamine.

    PubMed

    Hassan, Mohamed Abdel Malik; Tolba, Omar Atef

    2016-05-01

    Iron overload is the primary cause of mortality and morbidity in thalassemia major (TM) despite advances in chelation therapy. The aim of this study was to compare the effectiveness and safety of deferasirox (DFX) and deferoxamine (DFO) as iron-chelating agents in patients with transfusion-dependent β-thalassemia major. This prospective randomized study included 60 patients with transfusion-dependent β-TM during the period from September 2014 to September 2015. Their ages were ≥ 6 years, and they had serum ferritin above 1500 μg/L and were on irregular DFO therapy. Patients had regular packed red cell transfusion in a dose of 10 mL/kg/session. They were randomized to receive DFX (single oral daily dose of 20-40 mg/kg/day) or DFO (20-50 mg/kg/day via subcutaneous infusion over 8-10 hours, 5 days a week). Iron overload was determined by serum ferritin level. The primary endpoint was decrease of serum ferritin level below 1500 μg/L. The secondary endpoint was drug safety. Both drugs significantly reduced serum ferritin (p < 0.001). At the end of follow-up, there were no significant differences between the two groups in serum ferritin levels (p = 0.673) and in percent reduction of ferritin (p = 0.315). There were no significant differences between the two groups in the total amount of blood transfusion (p = 0.166) and average iron intake (p = 0.227). There were no mortalities or any serious adverse effects, neutropenia, arthropathy, or pulmonary toxicity. Gastrointestinal upset and skin rash occurred more frequently with DFX than with DFO (p = 0.254 and 0.095, respectively). With appropriate dosing and compliance with drugs, both DFX and DFO are generally well tolerated, safe, and effective in reducing serum ferritin levels in iron-overloaded, regularly-transfused thalassemia major patients. Therefore, oral DFX is recommended for more convenience and adherence to the treatment regimen.

  16. β-Thalassemia Intermedia: A Bird's-Eye View.

    PubMed

    Haddad, Anthony; Tyan, Paul; Radwan, Amr; Mallat, Naji; Taher, Ali

    2014-03-01

    Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum's extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe β-thalassemia

  17. Interaction of Hb South Florida (codon 1; GTG-->ATG) and HbE, with beta-thalassemia (IVS1-1; G-->A): expression of different clinical phenotypes.

    PubMed

    Tan, Jin-Ai Mary Anne; Tan, Kim-Lian; Omar, Khairul Zaman; Chan, Lee-Lee; Wee, Yong-Chui; George, Elizabeth

    2009-09-01

    Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A). HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia. Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA. The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.

  18. Beta-thalassemia major and female fertility: the role of iron and iron-induced oxidative stress.

    PubMed

    Roussou, Paraskevi; Tsagarakis, Nikolaos J; Kountouras, Dimitrios; Livadas, Sarantis; Diamanti-Kandarakis, Evanthia

    2013-01-01

    Endocrine complications due to haemosiderosis are present in a significant number of patients with beta-thalassemia major (BTM) worldwide and often become barriers in their desire for parenthood. Thus, although spontaneous fertility can occur, the majority of females with BTM is infertile due to hypogonadotropic hypogonadism (HH) and need assisted reproductive techniques. Infertility in these women seems to be attributed to iron deposition and iron-induced oxidative stress (OS) in various endocrine organs, such as hypothalamus, pituitary, and female reproductive system, but also through the iron effect on other organs, such as liver and pancreas, contributing to the impaired metabolism of hormones and serum antioxidants. Nevertheless, the gonadal function of these patients is usually intact and fertility is usually retrievable. Meanwhile, a significant prooxidants/antioxidants imbalance with subsequent increased (OS) exists in patients with BTM, which is mainly caused by tissue injury due to overproduction of free radicals by secondary iron overload, but also due to alteration in serum trace elements and antioxidant enzymes. Not only using the appropriate antioxidants, essential trace elements, and minerals, but also regulating the advanced glycation end products, could probably reduce the extent of oxidative damage and related complications and retrieve BTM women's infertility.

  19. Long-term survival of beta thalassemia major patients treated with hematopoietic stem cell transplantation compared with survival with conventional treatment.

    PubMed

    Caocci, Giovanni; Orofino, Maria Grazia; Vacca, Adriana; Piroddi, Antonio; Piras, Eugenia; Addari, Maria Carmen; Caria, Rossella; Pilia, Maria Paola; Origa, Raffaella; Moi, Paolo; La Nasa, Giorgio

    2017-12-01

    Allogeneic hematopoietic stem cell transplantation (HSCT) in thalassemia remains a challenge. We reported a single-centre case-control study of a large cohort of 516 children and adult patients treated with HSCT or blood transfusion support and iron chelation therapy; 258 patients (median age 12, range 1-45) underwent sibling (67%) or unrelated (33%) HSCT; 97 patients were adults (age ≥ 16 years). The median follow-up after HSCT was 11 years (range 1-30). The conditioning regimen was busulfan (80.6%) or treosulfan-based (19.4%). A cohort of 258 age-sex matched conventionally treated (CT) patients was randomly selected. In transplanted patients the 30-year overall survival (OS) and thalassemia-free survival (TFS) were 82.6 ± 2.7% and 77.8 ± 2.9%, compared to the OS of 85.3 ± 2.7% in CT patients (P = NS); The incidence of grade II-IV acute and chronic graft versus host disease (GvHD) was 23.6% and 12.9% respectively. The probability of rejection was 6.9%. Transplant-related mortality (TRM) (13.8%) was similar to the probability of dying of cardiovascular events in CT patients (12.2%). High-risk Pesaro score (class 3) was associated with lower OS (OR = 1.99, 95% C.I.=1.31-3.03) and TFS (OR = 1.54, 95% C.I.=1.12-2.12). In adult patients, the 23-years OS and TFS after HSCT were 70 ± 5% and 67.3 ± 5%, compared to 71.2 ± 5% of OS in CT (P = NS). Finally, treosulfan was associated with lower risk of acute GvHD (P = .004; OR = 0.28, 95% C.I.=0.12-0.67). In conclusion, the 30-year survival rate of ex-thalassemia patients after HSCT was similar to that expected in CT thalassemia patients, with the vast majority of HSCT survivors cured from thalassemia. © 2017 Wiley Periodicals, Inc.

  20. Management of beta-thalassemia-associated osteoporosis.

    PubMed

    Giusti, Andrea; Pinto, Valeria; Forni, Gian Luca; Pilotto, Alberto

    2016-03-01

    Beta-Thalassemia-associated osteoporosis is a multifactorial and complex condition. Different acquired and genetic factors are involved in its pathogenesis. These factors produce an imbalance in bone remodeling by inhibiting osteoblast activity and increasing osteoclast function, leading to bone loss and increased fracture risk. The management of patients presenting with thalassemia-associated osteoporosis should consist of the implementation of general measures and the prescription of a specific pharmacological agent, with the aim of reducing fracture risk and preventing disability and deterioration of quality of life. General measures include control of anemia, adequate chelation therapy, healthy nutrition and lifestyle, regular exercise, adequate management of comorbid conditions, hormone replacement therapy in patients with hypogonadism, and vitamin D supplementation/therapy. Among the pharmacological agents currently available for the management of osteoporosis in postmenopausal women and men, bisphosphonates have been shown to improve bone mineral density, to reduce bone turnover, and to decrease bone/back pain in patients with thalassemia-associated osteoporosis, with a good profile of safety and tolerability. On the other hand, there are limited experiences with other pharmacological agents (e.g., denosumab or teriparatide). The complexity of this condition presents diagnostic and therapeutic challenges and underscores the importance of a comprehensive and multidisciplinary approach. © 2016 New York Academy of Sciences.

  1. Blood transfusion versus hydroxyurea in beta-thalassemia in Iran: a cost-effectiveness study.

    PubMed

    Ravangard, Ramin; Mirzaei, Zahra; Keshavarz, Khosro; Haghpanah, Sezaneh; Karimi, Mehran

    2017-11-21

    Thalassemia intermedia is a type of anemia which has several treatments modalities. We aimed to study the cost effectiveness of two treatments, including blood transfusion and hydroxyurea, in patients with beta-thalassemia intermedia in south of Iran referred to a referral center affiliated to Iran, Shiraz University of Medical Sciences in 2015. This was a cost-effectiveness study which was conducted on 122 patients with beta-thalassemia intermedia. The indicator of effectiveness in this study was the reduction of growth disorder (normal BMI). Data analysis was done using SPSS 21, Excel 2010 and Treeage 2011. Finally, the one-way sensitivity analysis was performed to determine the robustness of the results. The average annual costs of blood transfusion and the use of hydroxyurea in 2015 were 20733.27 purchasing power parity (PPP)$ and 7040.29 PPP$, respectively. The effectiveness of blood transfusion was57.4% while in hydroxyurea group was 60.7%. The results showed that the cost effectiveness of using hydroxyurea was more than that of blood transfusion. Therefore, it is recommended that the use of hydroxyurea in the treatment of patients with beta-thalassemia intermedia would become the first priority, and more basic and supplementary insurance coverage for treating such patients using hydroxyurea should be considered.

  2. β-Thalassemia Intermedia: A Bird’s-Eye View

    PubMed Central

    Haddad, Anthony; Tyan, Paul; Radwan, Amr; Mallat, Naji; Taher, Ali

    2014-01-01

    Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum’s extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe

  3. Pregnancy outcomes among women with beta-thalassemia trait.

    PubMed

    Charoenboon, Chitrakan; Jatavan, Phudit; Traisrisilp, Kuntharee; Tongsong, Theera

    2016-04-01

    To compare the obstetric outcomes between pregnant women affected by beta-thalassemia trait and normal controls. A retrospective cohort study was conducted on singleton pregnant women complicated by beta-thalassemia trait and normal controls, randomly selected with the controls-to-case ratio of 2:1. All were low-risk pregnancies without underlying medical diseases and fetal anomalies. The pregnancies undergoing invasive prenatal diagnosis were excluded. A total of 597 pregnant women with beta-thalassemia trait and 1194 controls were recruited. Baseline characteristics and maternal outcomes in the two groups were similar, except that hemoglobin levels were slightly lower in the study group. The prevalence of small for gestational age and preterm birth tended to be higher in the study group but not reached the significant levels but the rate of low birth weight was significantly higher in the study group (relative risk 1.25; 95 % CI 1.00-1.57). Additionally, abortion rate was also significantly higher in the study group (relative risk 3.25; 95 % CI 1.35-7.80). Beta-thalassemia trait could minimally, but significantly, increase risk of low birth weight but did not increase rates of maternal adverse outcomes.

  4. Multiorgan failure during a sickle cell crisis in sickle/beta-thalassemia.

    PubMed

    Tedla, Fasika M; Friedman, Eli A

    2003-08-01

    In contrast to the chronic nephropathy associated with sickle cell syndromes, acute renal failure and multiorgan dysfunction caused by acute sickling crisis are encountered infrequently. The authors present the first case of extensive multiorgan failure during a sickling episode in a patient with sickle/beta+thalassemia. The authors also review the interaction of the thalassemias with sickle cell disease and outline the distinctive course of their patient in comparison with previous reports.

  5. Circulating microparticles and the risk of thromboembolic events in Egyptian beta thalassemia patients.

    PubMed

    Youssry, Ilham; Soliman, Nohair; Ghamrawy, Mona; Samy, Rania Mohamed; Nasr, Amal; Abdel Mohsen, Mohamed; ElShahaat, Mohamed; Bou Fakhredin, Rayan; Taher, Ali

    2017-04-01

    The presence of elevated numbers of circulating microparticles (MPs) has been hypothesized to be responsible for the occurrence of thromboembolic events (TEEs) in thalassemic patients. Our aim is to evaluate the presence and the thrombotic risk of circulating MPs in thalassemia patients and to determine the difference in MPs between β-thalassemia major (β-TM) and thalassemia intermedia (TI). The percentage of the annexin-labeled MPs, platelet-derived MPs (PMPs), erythrocyte-derived MPs (RMPs), and endothelial-derived MPs (EMPs) was measured by flow cytometry, in 87 thalassemia patients (39 β-TM and 48 TI). By multiple regression analysis, we then assessed the various independent risk factors for the occurrence of TEE. The thalassemic patients who experienced TEE had a significantly higher platelet count, higher percentage of annexin-labeled MPs, and higher percentage of PMPs (p value = 0.014, 0.003, and 0.014, respectively). There was no significant difference between β-TM and TI patients at the level of any of the studied MPs. The predictive risk factors for TEE in thalassemic patients were splenectomy, total and direct bilirubin, the RMPs, and the EMPs (OR = 10.07 (CI = 3.7-27.1), 4.3 (CI = 2.1-8.7), 1.4 (CI = 1.5-6.2), 1.6 (CI = 1.1-2.2), 3.0 (CI = 1.9-4.9), respectively). In conclusion, the elevated numbers of circulating MPs is a risk factor for the TEE in thalassemia patients.

  6. Genetic therapy for beta-thalassemia: from the bench to the bedside.

    PubMed

    Arumugam, Paritha; Malik, Punam

    2010-01-01

    Beta-thalassemia is a genetic disorder with mutations in the β-globin gene that reduce or abolish β-globin protein production. Patients with β-thalassemia major (Cooley's anemia) become severely anemic by 6 to 18 months of age, and are transfusion dependent for life, while those with thalassemia intermedia, a less-severe form of thalassemia, are intermittently or rarely transfused. An allogeneically matched bone marrow transplant is curative, although it is restricted to those with matched donors. Gene therapy holds the promise of "fixing" one's own bone marrow cells by transferring the normal β-globin or γ-globin gene into hematopoietic stem cells (HSCs) to permanently produce normal red blood cells. Requirements for effective gene transfer for the treatment of β-thalassemia are regulated, erythroid-specific, consistent, and high-level β-globin or γ-globin expression. Gamma retroviral vectors have had great success with immune-deficiency disorders, but due to vector-associated limitations, they have limited utility in hemoglobinopathies. Lentivirus vectors, on the other hand, have now been shown in several studies to correct mouse and animal models of thalassemia. The immediate challenges of the field as it moves toward clinical trials are to optimize gene transfer and engraftment of a high proportion of genetically modified HSCs and to minimize the adverse consequences that can result from random integration of vectors into the genome by improving current vector design or developing novel vectors. This article discusses the current state of the art in gene therapy for β-thalassemia and some of the challenges it faces in human trials.

  7. High-resolution melting analysis for prenatal diagnosis of beta-thalassemia in northern Thailand.

    PubMed

    Charoenkwan, Pimlak; Sirichotiyakul, Supatra; Phusua, Arunee; Suanta, Sudjai; Fanhchaksai, Kanda; Sae-Tung, Rattika; Sanguansermsri, Torpong

    2017-12-01

    High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.

  8. Diminished ovarian reserve in women with transfusion-dependent beta-thalassemia major: Is iron gonadotoxic?

    PubMed

    Uysal, Aysel; Alkan, Gül; Kurtoğlu, Ayşegül; Erol, Onur; Kurtoğlu, Erdal

    2017-09-01

    Iron accumulation in the endocrine glands has been implicated in the aetiopathogenesis of decreased reproductive capacity in patients with beta-thalassemia major (β-TM). The aim of the current study was to investigate the serum concentration of anti-Müllerian hormone (AMH), a marker of ovarian reserve, in women with transfusion-dependent β-TM. In this case-control study, we recruited 43 women with transfusion-dependent TM and 44 age-matched healthy controls. Hormonal and haematological parameters, serum level of AMH, antral follicle count, and ovarian volume were assessed. Twenty-two of the 43 women were hypogonadotropic, 8 with primary amenorrhea and 14 with secondary amenorrhea. FSH, LH, estradiol, prolactin, and AMH levels; antral follicle count; and ovarian volume were significantly lower in women with TM compared with the control group (p<0.05 for all). AMH level and other ovarian reserve markers are significantly diminished in women with transfusion-dependent TM compared to age-matched controls. Our findings support a deleterious effect of iron overload on ovarian tissue. Published by Elsevier B.V.

  9. Effect of transfusional iron intake on response to chelation therapy in beta-thalassemia major.

    PubMed

    Cohen, Alan R; Glimm, Ekkehard; Porter, John B

    2008-01-15

    The success of chelation therapy in controlling iron overload in patients with thalassemia major is highly variable and may partly depend on the rate of transfusional iron loading. Using data from the 1-year phase III study of deferasirox, including volumes of transfused red blood cells and changes in liver iron concentration (LIC) in 541 patients, the effect of iron loading on achieving neutral or negative iron balance was assessed in patients receiving different doses of deferasirox and the comparator deferoxamine. After dose adjustment, reductions in LIC after 1 year of deferasirox or deferoxamine therapy correlated with transfusional iron intake. At a deferasirox dose of 20 mg/kg per day, neutral or negative iron balance was achieved in 46% and 75% of patients with the highest and lowest transfusional iron intake, respectively; 30 mg/kg per day produced successful control of iron stores in 96% of patients with a low rate of transfusional iron intake. Splenectomized patients had lower transfusional iron intake and greater reductions in iron stores than patients with intact spleens. Transfusional iron intake should be monitored on an ongoing basis in thalassemia major patients, and the rate of transfusional iron loading should be considered when choosing the appropriate dose of an iron-chelating agent. This study is registered at http://clinicaltrials.gov as NCT00061750.

  10. Apolipoprotein E Polymorphism and Left Ventricular Failure in Beta-Thalassemia: A Multivariate Meta-Analysis.

    PubMed

    Dimou, Niki L; Pantavou, Katerina G; Bagos, Pantelis G

    2017-09-01

    Apolipoprotein E (ApoE) is potentially a genetic risk factor for the development of left ventricular failure (LVF), the main cause of death in beta-thalassemia homozygotes. In the present study, we synthesize the results of independent studies examining the effect of ApoE on LVF development in thalassemic patients through a meta-analytic approach. However, all studies report more than one outcome, as patients are classified into three groups according to the severity of the symptoms and the genetic polymorphism. Thus, a multivariate meta-analytic method that addresses simultaneously multiple exposures and multiple comparison groups was developed. Four individual studies were included in the meta-analysis involving 613 beta-thalassemic patients and 664 controls. The proposed method that takes into account the correlation of log odds ratios (log(ORs)), revealed a statistically significant overall association (P-value  =  0.009), mainly attributed to the contrast of E4 versus E3 allele for patients with evidence (OR: 2.32, 95% CI: 1.19, 4.53) or patients with clinical and echocardiographic findings (OR: 3.34, 95% CI: 1.78, 6.26) of LVF. This study suggests that E4 is a genetic risk factor for LVF in beta-thalassemia major. The presented multivariate approach can be applied in several fields of research. © 2017 John Wiley & Sons Ltd/University College London.

  11. Coexistence of Southeast Asian ovalocytosis and beta-thalassemia: a molecular and hematological analysis.

    PubMed

    Fucharoen, Goonnapa; Fucharoen, Supan; Singsanan, Sanita; Sanchaisuriya, Kanokwan

    2007-05-01

    We describe hematological and molecular characterization of a Thai female who had Southeast Asian ovalocytosis (SAO) associated with beta+-thalassemia trait. The proband had mild microcytosis with Hb 12.9 g/dl, Hct 35.8%, MCV 74.4 fl, MCH 26.8 pg, MCHC 36.0 g/dl, and elevated Hb A2 (5.6%), characteristics of beta-thalassemia trait. Peripheral blood film examination revealed prominent ovalocytosis. However, a one-tube osmotic fragility (OF) test commonly used for thalassemia screening was negative and a normal OF curve was observed. Further polymerase chain reaction (PCR) analyses identified the beta(-28A-G) mutation in the beta-globin gene and a 27 bp deletion in erythrocyte band 3 protein gene, indicating a genetically compound heterozygote. Hematological data of the proband was comparatively presented with those of eight female and 15 male carriers of pure beta-thalassemia with the same mutation. The finding demonstrates that although the association of the SAO and beta-thalassemia does not produce a more severe clinical picture, this could lead to a mis-screening of beta-thalassemia using an OF test as a primary screening test. Additional blood film examination followed by PCR could help in the detection of this unusual genetic interaction in the region. (c) 2006 Wiley-Liss, Inc.

  12. Growth and Endocrine Function in Tunisian Thalassemia Major Patients.

    PubMed

    Dhouib, Naouel Guirat; Ben Khaled, Monia; Ouederni, Monia; Besbes, Habib; Kouki, Ridha; Mellouli, Fethi; Bejaoui, Mohamed

    2018-01-01

    β-thalassemia major (β-TM) is among the most common hereditary disorders imposing high expenses on health-care system worldwide. The patient's survival is dependent on lifetime blood transfusion which leads to iron overload and its toxicity in various organs including endocrine glands. This article provides an overview of endocrine disorders in beta-TM patients. This single center investigation enrolled 28 β-TM patients (16 males, 12 females) regularly transfused with packed red cell since early years of life. For each patient were determined: age, sex, number of transfusions received, history of splenectomy and anthropometric parameters. All patients underwent an evaluation of hormonal status including growth, gonadal, thyroid, adrenal cortex, and parathyroid glands. Dual-energy X-ray absorptiometry was used to diagnose low bone mass. Assessment of iron overload status was performed by measuring the serum ferritin concentration and the results of magnetic resonance imaging T 2 *. Growth retardation was found in 16 of the 28 studied patients (57 %). Thirteen among them had delayed puberty. Spontaneous puberty was achieved in 16 cases. Growth hormone (GH) deficiency was found in 10 cases (35 %). Seventeen among the studied patients (60 %) developed disorders of glucose homeostasis. Subclinical hypothyroidism was found in six patients (21 %). Intensive chelation therapy had allowed the reversibility of this complication in five cases. Adrenal Insufficiency was observed in 9 cases (32%). Hypoparathyroidism has occurred in one case. Ten of the 28 studied patients had low bone mass (35%). Twenty-three of the 28 studied patients (82%) had at least one endocrine complication.

  13. The role of the atrial electromechanical delay in predicting atrial fibrillation in beta-thalassemia major patients.

    PubMed

    Rago, Anna; Russo, Vincenzo; Papa, Andrea Antonio; Ciardiello, Carmine; Pannone, Bruno; Mayer, Maria Carolina; Cimmino, Giovanni; Nigro, Gerardo

    2017-03-01

    Paroxysmal atrial tachyarrhythmias frequently occur in beta-thalassemia major (β-TM) patients. The aim of the current study was to evaluate the atrial electromechanical delay (AEMD) in a large β-TM population with normal cardiac function and its relationship to atrial fibrillation (AF) onset. Eighty β-TM patients (44 men, 36 women), with a mean age of 36.2 ± 11.1 years, and 80 healthy subjects used as controls, matched for age and gender, were studied for the occurrence of AF during a 5-year follow-up, through 30-day external loop recorder (ELR) monitoring performed every 6 months. Intra-AEMD and inter-AEMD of both atria were measured through tissue Doppler echocardiography. P-wave dispersion (PD) was carefully measured using 12-lead electrocardiogram (ECG). Compared to the healthy control group, the β-TM patients showed a statistically significant increase in inter-AEMD, intra-left AEMD, maximum P-wave duration, and PD. Dividing the β-TM group into two subgroups (patients with or without AF), the inter-AEMD, intra-left AEMD, maximum P-wave duration, and PD were significantly higher in the subgroup with AF compared to the subgroup without AF. There were significant good correlations of intra-left AEMD and inter-AEMD with PD. A cut-off value of 40.1 ms for intra-left AEMD had a sensitivity of 76.2% and a specificity of 97.5% in identifying β-TM patients with AF risk. A cut-off value of 44.8 ms for inter-AEMD had a sensitivity of 81.2% and a specificity of 98.7% in identifying this category of patients. Our results showed that the echocardiographic atrial electromechanical delay indices (intra-left and inter-AEMD) and the PD were significantly increased in β-TM subjects with normal cardiac function. PD and AEMD represent non-invasive, inexpensive, useful, and simple parameters to assess the AF risk in β-TM patients.

  14. The molecular basis of beta-thalassemia in Argentina. Influence of the pattern of immigration from the Mediterranean Basin.

    PubMed

    Rossetti, Liliana C; Targovnik, Héctor M; Varela, Viviana

    2004-06-01

    In order to determine the molecular heterogeneity of the beta-thalassemia gene and to analyze the influence of immigration from the Mediterranean Basin, a total of 254 families (475 subjects) from Argentinean beta-thalassemia patients were investigated using molecular biology techniques. This allowed us to provide a simplified diagnosis and genetic counselling of this disorder in Argentina.

  15. Genotyping of beta thalassemia trait by high-resolution DNA melting analysis.

    PubMed

    Saetung, Rattika; Ongchai, Siriwan; Charoenkwan, Pimlak; Sanguansermsri, Torpong

    2013-11-01

    Beta thalassemia is a common hereditary hemalogogical disease in Thailand, with a prevalence of 5-8%. In this study, we evaluated the high resolution DNA melting (HRM) assay to identify beta thalassemia mutation in samples from 143 carriers of the beta thalassemia traits in at risk couples. The DNA was isolated from venous blood samples and tested for mutation under a series of 5 PCR-HRM (A, B, C, D and E primers) protocols. The A primers were for detection of beta thalassemia mutations in the HBB promoter region, the B primers for mutations in exon I, the C primers for exon II, the D primers for exon III and the E primers for the 3.4 kb deletion mutation. The mutations were diagnosed by comparing the complete melting curve profiles of a wild type control with those for each mutant sample. With the PCR-HRM technique, fourteen types of beta thalassemia mutations were detected. Each mutation had a unique and specific melting profile. The mutations included 36.4% (52 cases) codon 41/42-CTTT, 26.6% (38 cases) codon 17 A-T, 11.2% (16 cases) IVS1-1 G-T, 8.4% (12 cases) codon 71/72 +A, 8.4% (12 cases) of the 3.4 kb deletion and 3.5% (5 cases) -28 A-G. The remainder included one instance each of -87 C-A, -31 A-C, codon 27/28 +C, codon 30 G-A, IVS1-5 G-C, codon 35 C-A, codon 41-C and IVSII -654 C-T. Of the total cases, 85.8% of the mutations could be detected by primers B and C. The PCR-HRM method provides a rapid, simple and highly feasible strategy for mutation screening of beta thalassemia traits.

  16. Abnormal troponin I levels in a thalassemia major patient with high ferritin concentration, permanent atrial fibrillation and without acute coronary syndrome.

    PubMed

    Patanè, Salvatore; Marte, Filippo

    2010-01-21

    Thalassemia is a congenital hemoglobinopathy leading to anemia because of impaired erythropoiesis and peripheral hemolysis. Thalassemia major patients are transfusion dependent and it results in iron accumulation. The heart is one of the major organs affected with iron overload and iron induced cardiac dysfunction (pump and conduction abnormalities) remains the number one cause of death among thalassemia major patients. It has been reported that a high ferritin concentration is related to high troponin levels in hemodialysis patients receiving more intravenous iron sucrose. Abnormal troponin I levels have also been reported without acute coronary syndrome. We present a case of abnormal troponin I levels in Thalassemia major patient with high ferritin concentration, permanent atrial fibrillation and without acute coronary syndrome. To our knowledge, this is the first report of abnormal troponin I levels in a Thalassemia major patient with high ferritin concentration and without acute coronary syndrome and also this case focuses attention on the importance of the correct evaluation of abnormal troponin I levels. Copyright (c) 2008 Elsevier Ireland Ltd. All rights reserved.

  17. Non-transfusion-dependent thalassemias

    PubMed Central

    Musallam, Khaled M.; Rivella, Stefano; Vichinsky, Elliott; Rachmilewitz, Eliezer A.

    2013-01-01

    Non-transfusion-dependent thalassemias include a variety of phenotypes that, unlike patients with beta (β)-thalassemia major, do not require regular transfusion therapy for survival. The most commonly investigated forms are β-thalassemia intermedia, hemoglobin E/β-thalassemia, and α-thalassemia intermedia (hemoglobin H disease). However, transfusion-independence in such patients is not without side effects. Ineffective erythropoiesis and peripheral hemolysis, the hallmarks of disease process, lead to a variety of subsequent pathophysiologies including iron overload and hypercoagulability that ultimately lead to a number of serious clinical morbidities. Thus, prompt and accurate diagnosis of non-transfusion-dependent thalassemia is essential to ensure early intervention. Although several management options are currently available, the need to develop more novel therapeutics is justified by recent advances in our understanding of the mechanisms of disease. Such efforts require wide international collaboration, especially since non-transfusion-dependent thalassemias are no longer bound to low- and middle-income countries but have spread to large multiethnic cities in Europe and the Americas due to continued migration. PMID:23729725

  18. Electrocardiographic abnormalities and arrhythmic risk markers in adult patients with beta thalassemia major.

    PubMed

    Kolios, Marios; Korantzopoulos, Panagiotis; Vlahos, Antonios P; Kapsali, Eleni; Briasoulis, Evangelos; Goudevenos, John A

    2016-10-15

    There seems to be a significant arrhythmia burden in β-thalassemia major (TM) patients without overt cardiomyopathy. Apart from conventional electrocardiographic (ECG) and arrhythmic risk markers we studied novel markers of ventricular repolarization and autonomic imbalance both at rest and after exercise testing. We studied 47 adult TM patients without systolic heart failure and 47 age and sex-matched healthy control subjects. The median age of the studied population was 36 [32-43] years, 57% men. Baseline demographic and clinical characteristics were recorded while 12-lead electrocardiograms, 24-hour ECG Holter recordings, and treadmill exercise stress tests were analyzed. TM patients exhibited increased QTc intervals in both 12-lead ECG recordings and in 24-hour Holter recordings. In addition, they had increased indexes of ventricular repolarization heterogeneity such as QT dispersion, and T peak-to-end/QT ratios. Furthermore, TM patients had decreased indexes of heart rate variability while the heart rate recovery after exercise was significantly attenuated compared to controls. Also, they had increased P wave and QRS duration while the QRS fragmentation was very prevalent. Finally, premature atrial extrasystoles and paroxysmal atrial fibrillation episodes were more frequent in TM patients. TM patients with preserved left ventricular systolic function have several ECG abnormalities including alterations in ventricular depolarization and repolarization. Also, cardiac autonomic dysfunction is evident in 24-hour ECG monitoring as well as in the recovery phase after exercise testing. The prognostic value of specific arrhythmic risk indexes in this setting remains to be elucidated. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  19. Improved treatment satisfaction and convenience with deferasirox in iron-overloaded patients with beta-Thalassemia: Results from the ESCALATOR Trial.

    PubMed

    Taher, Ali; Al Jefri, Abdullah; Elalfy, Mohsen Saleh; Al Zir, Kusai; Daar, Shahina; Rofail, Diana; Baladi, Jean François; Habr, Dany; Kriemler-Krahn, Ulrike; El-Beshlawy, Amal

    2010-01-01

    Patient-reported outcomes of once-daily oral deferasirox (Exjade) in iron-overloaded patients with beta-thalassemia not achieving successful chelation with prior deferoxamine and/or deferiprone were investigated in a prospective, open-label, 1-year, multicenter study in the Middle East (ESCALATOR). The initial dose of deferasirox was 20 mg/kg/day, with subsequent dose adjustments. At baseline and the end of study (EOS), patients (n = 237) completed a 5-point rating scale for treatment satisfaction and convenience, and recorded time lost to treatment. At EOS, 90.7% of patients were 'satisfied'/'very satisfied' with their iron chelation therapy (ICT) versus 23.2% at baseline. 92.8% (EOS) versus 21.5% (baseline) of patients considered their therapy to be 'convenient'/'very convenient'. Time lost to therapy for daily activities was substantially reduced (3.2 +/- 8.6 [mean +/- SD; EOS] vs. 30.1 +/- 44.2 [baseline] h/month). Patients reported greater satisfaction and convenience, and lower impact on daily activities, with deferasirox than with previous ICT. This may help improve adherence to lifelong ICT in iron-overloaded beta-thalassemia patients. 2010 S. Karger AG, Basel.

  20. Intracellular iron overload leading to DNA damage of lymphocytes and immune dysfunction in thalassemia major patients.

    PubMed

    Shaw, Jyoti; Chakraborty, Ayan; Nag, Arijit; Chattopadyay, Arnab; Dasgupta, Anjan K; Bhattacharyya, Maitreyee

    2017-11-01

    To investigate the cause and effects of intracellular iron overload in lymphocytes of thalassemia major patients. Sixty-six thalassemia major patients having iron overload and 10 age-matched controls were chosen for the study. Blood sample was collected, and serum ferritin, oxidative stress; lymphocyte DNA damage were examined, and infective episodes were also counted. Case-control analysis revealed significant oxidative stress, iron overload, DNA damage, and rate of infections in thalassemia cases as compared to controls. For cases, oxidative stress (ROS) and iron overload (serum ferritin) showed good correlation with R 2  = 0.934 and correlation between DNA damage and ROS gave R 2  = 0.961. We also demonstrated that intracellular iron overload in thalassemia caused oxidative damage of lymphocyte DNA as exhibited by DNA damage assay. The inference is further confirmed by partial inhibition of such damage by chelation of iron and the concurrent lowering of the ROS level in the presence of chelator deferasirox. Therefore, intracellular iron overload caused DNA fragmentation, which may ultimately hamper lymphocyte function, and this may contribute to immune dysfunction and increased susceptibility to infections in thalassemia patients as indicated by the good correlation (R 2  = 0.91) between lymphocyte DNA damage and rate of infection found in this study. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. beta-Thalassemia present in cis to a new beta-chain structural variant, Hb Vicksburg [beta 75 (E19)Leu leads to 0].

    PubMed

    Adams, J G; Steinberg, M H; Newman, M V; Morrison, W T; Benz, E J; Iyer, R

    1981-01-01

    Hemoglobin Vicksburg was discovered in a 6-year-old Black boy who had been anemic since infancy. Examination of his hemolysate revealed 87.5% Hb F, 2.4% Hb A2, and 7.6% Hb Vicksburg, which had the electrophoretic and chromatographic properties of Hb A. Structural analysis of Hb Vicksburg demonstrated a deletion of leucine at beta 75(E19), a new variant. Hb Vicksburg was neither unstable nor subject to posttranslational degradation. The alpha/non-alpha biosynthetic ratio was 2.6. Because the proband appeared to be a mixed heterozygote for Hb Vicksburg and beta 0-thalassemia, Hb Vicksburg should have comprised the major portion of the hemolysate. Thus, Hb Vicksburg was synthesized at a rate considerably lower than would be expected on the basis of gene dosage. There was no reason to suspect abnormal translation of beta Vicksburg mRNA; in individuals with Hb St. Antoine (beta 74 and beta 75 deleted), the abnormal hemoglobin comprised 25% of the hemolysate in the simple heterozygote yet was unstable. Deletion of beta 75, therefore, would not in itself appear to lead to diminished synthesis. There was a profound deficit of beta Vicksburg mRNA when measured by liquid hybridization analysis with beta cDNA. The most plausible explanation for the low output of Hb Vicksburg is that a mutation for beta +-thalassemia is present in cis to the structural mutation.

  2. Prospective evaluation of patient-reported outcomes during treatment with deferasirox or deferoxamine for iron overload in patients with beta-thalassemia.

    PubMed

    Cappellini, Maria Domenica; Bejaoui, Mohamed; Agaoglu, Leyla; Porter, John; Coates, Thomas; Jeng, Michael; Lai, Maria Eliana; Mangiagli, Antonio; Strauss, Gabriele; Girot, Robert; Watman, Nora; Ferster, Alina; Loggetto, Sandra; Abish, Sharon; Cario, Holger; Zoumbos, Nicolaos; Vichinsky, Elliott; Opitz, Herbert; Ressayre-Djaffer, Catherine; Abetz, Linda; Rofail, Diana; Baladi, Jean-Francois

    2007-05-01

    Iron chelation therapy (ICT) with deferoxamine (DFO), the current standard for the treatment of iron overload in patients with transfusion-dependent disorders such as beta-thalassemia, requires regular subcutaneous or intravenous infusions. This can lead to reduced quality of life and poor adherence, resulting in increased morbidity and mortality in iron-overloaded patients with beta-thalassemia. Deferasirox is an orally administered iron chelator that has been approved for use in the United States, Switzerland, and other countries. This analysis was conducted to compare patient-reported outcomes (PROs) during receipt of DFO infusions or once-daily oral therapy with deferasirox (ICL670). PROs were prospectively evaluated as part of a randomized, Phase III study comparing the efficacy and safety profile of DFO 20 to 60 mg/kg per day with those of deferasirox 5 to 30 mg/kg per day in patients (age > or =2 years) with beta-thalassemia who were receiving regular transfusions and had a liver iron concentration of > or =2 mg/g dry weight. PRO questionnaires were completed by patients or a parent or legal guardian at baseline, week 4, week 24, and end of study (EOS). Patients assessed their level of satisfaction with study treatment (very satisfied, satisfied, neutral, dissatisfied, or very dissatisfied) and rated its convenience (very convenient, convenient, neutral, inconvenient, or very inconvenient). Time lost from normal activities due to ICT in the previous 4 weeks was recorded using a single global assessment. At week 4, patients who had previous experience with DFO were asked to indicate their preference for treatment (ICT received before the study, ICT received during the study, no preference, or no response) and the reason for that preference. At EOS, all patients were asked if they would be willing to continue using the ICT they had received during the study. All study analyses were performed in all patients who received at least 1 dose of study medication

  3. Chorionic villus sampling for beta-thalassemia: the first report of experience in Iran.

    PubMed

    Akhlaghpoor, Shahram

    2006-12-01

    Beta-thalassemia is one of the most common hereditary disorders in Iran. The prenatal diagnosis of beta-thalassemia is part of a control program in our country and it began 13 years ago. During the past 8 years the number of procedures has increased significantly as also the legal abortions. This is the first report made on the CVS program in Iran. One thousand six hundred and sixty-one cases of transabdominal Chorionic Villus Sampling (CVS) have been retrospectively evaluated. Among them 1381 cases had inclusion criteria. CVS results, complications and fetal loss rate were evaluated. The distributions of the population at risk were divided between eight regions that have been proposed for beta-thalassemia mapping previously. The mean age of the patients was 26.2 +/- 5.2 years with mean gestational age of 11.4 +/- 1.4 weeks. CVS was successful in all the patients (100%) although 1% required a second procedure. Post CVS fetal loss was 1.45%. Other minor complications were bleeding or spotting (1.81%), amniotic fluid leak (0.5%), small sub-chorionic hematoma (0.58%), severe abdominal pain (0.6%) and severe vasovagal reaction (0.14%). Late complications were seen in 0.21% (oligohydraminos). Approximately 2/3 of the patients were referred from three regions of the country, North (26.8%), South West (22.4%), Central (19.5%) and the remainder (31.3%) were from the other five regions. CVS is a safe and effective method for prenatal diagnosis of beta-thalassemia in countries with a high prevalence as in Iran. The overall complication rate is quite low and acceptable. Fortunately the recent acceptance of legal abortion with respect to Muslim rules has increased the effectiveness of the procedure and made great advances in its application in Iran. Correspondingly, social knowledge has also improved but still there is a gap between the population at risk and the required prenatal diagnosis laboratories and sampling centers. 2006 John Wiley & Sons, Ltd.

  4. Hematopoietic stem cell transplantation from non-sibling matched family donors for patients with thalassemia major in Jordan.

    PubMed

    Hussein, Ayad Ahmed; Al-Zaben, Abdulhadi; Khattab, Eman; Haroun, Anas; Frangoul, Haydar

    2016-02-01

    There are limited data on the outcome of patients with thalassemia receiving HSCT from non-sibling matched family donors. Of the 341 patients with thalassemia major that underwent donor search at our center from January 2003 to December 2011, 236 (69.2%) had fully matched family donor of which 28 patients (8.2%) had non-sibling matched family donors identified. We report on seven patients with a median age of eight yr (4-21) who underwent myeloablative (n = 4) or RIC (n = 3) HSCT. The median age of the donors was 33 yr (4-47), three were parents, two first cousins, one paternal uncle, and one paternal aunt. All patients achieved primary neutrophil and platelet engraftment at a median of 18 (13-20) and 16 days (11-20), respectively. One patient developed grade II acute GVHD, and two patients developed limited chronic GVHD. One patient experienced secondary GF requiring a second transplant. At a median follow-up of 69 months (7-110), all patients are alive and thalassemia free. Our data emphasize the need for extended family HLA typing for patients with thalassemia major in regions where there is high rate of consanguinity. Transplant from non-sibling matched family donor can result in excellent outcome. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Quality of life, clinical effectiveness, and satisfaction in patients with beta thalassemia major and sickle cell anemia receiving deferasirox chelation therapy.

    PubMed

    Senol, Sefika Pinar; Tiftik, Eyup Naci; Unal, Selma; Akdeniz, Aydan; Tasdelen, Bahar; Tunctan, Bahar

    2016-03-01

    There is a need to remove excess iron with iron chelation therapy (ICT) to avoid the serious clinical sequelae associated with iron overload in patients with beta thalassemia major (BTM) and sickle cell anemia (SCA). Due to the effects of the diseases and their treatments, ICT is still a major reason for unsatisfactory compliance. The aim of this single-center observational study was to evaluate the quality of life, clinical effectiveness, and satisfaction in pediatric and adult patients with BTM and SCA receiving deferasirox (DFX) chelation therapy. In this study, 37 pediatric and 35 adult patients with BTM or SCA receiving DFX for at least 6 months participated. Upon receipt of Informed Consent Form, Case Report Form, Demographic Data Collection Form, Child Health Questionnaire-Parent Form, Life Quality Survey Short Form-36, and ICT Satisfaction Survey were used to obtain data for the effectiveness of ICT and parameters that may affect compliance to treatment and life quality of the participants. As a main index for the effectiveness of DFX chelation therapy, serum ferritin levels were higher than the normal values in the patients receiving DFX. The increased ferritin levels were also associated with hematological and biochemical abnormalities. Our findings regarding quality of life and satisfaction with DFX chelation therapy indicated that the patients with BTM or SCA had lower scores. Overall, problems with treatment regimen and side effects appeared to be common causes of poor compliance to DFX chelation therapy. Our findings suggest that health care providers should be aware of the importance of monitoring iron load with timely initiation of DFX chelation therapy and ongoing adjustments to chelation regimens and/or transfusion methods to decrease hospitalizations and improve compliance to ICT of the patients with BTM and SCA.

  6. Blood transfusion transmitted infections in multiple blood transfused patients of Beta thalassaemia.

    PubMed

    Vidja, Prakash J; Vachhani, J H; Sheikh, S S; Santwani, P M

    2011-06-01

    Transfusion Transmitted Infection (TTI) continue to be a problem in many parts of world and multi-transfused patients of beta thalassaemia major are at a particularly increased risk of TTI. This study is aimed to estimate the prevalence of blood TTI in multiple blood transfused patients of beta thalassaemia major. Cross-sectional study of 200 multi-transfused patients of beta thalassaemia major, who were interviewed using a structured questionnaire and history was taken regarding sero-status of HIV (Human Immunodeficiency Virus), HBV (Hepatitis B Virus), HCV (Hepatitis C Virus) infection from their case papers. This study was conducted at the department of Pathology, M.P. Shah medical college, Jamnagar and Thalassemia ward, G.G. Hospital, Jamnagar (Gujarat, India) from March to May 2010. Out of 200 multiple blood transfused patients 7% patients were infected with TTI. Total 9 male patients and 5 female patients were infected with TTI. The seroreactivity for HIV was 3% (06/200); 1% (02/200) were males and 2% (04/200) were females. The seroreactivity for HBV was 2% (04/200) all were males. The seroreactivity for HCV was 2% (04/200); 1.5% (03/200) were males and 0.5% (01/200) was female. HIV, HBV, HCV infections are most prevalent TTI among multiple blood transfused patients of beta thalassemia major, and remains a major health problem for these patients.

  7. beta-Thalassemia present in cis to a new beta-chain structural variant, Hb Vicksburg [beta 75 (E19)Leu leads to 0].

    PubMed Central

    Adams, J G; Steinberg, M H; Newman, M V; Morrison, W T; Benz, E J; Iyer, R

    1981-01-01

    Hemoglobin Vicksburg was discovered in a 6-year-old Black boy who had been anemic since infancy. Examination of his hemolysate revealed 87.5% Hb F, 2.4% Hb A2, and 7.6% Hb Vicksburg, which had the electrophoretic and chromatographic properties of Hb A. Structural analysis of Hb Vicksburg demonstrated a deletion of leucine at beta 75(E19), a new variant. Hb Vicksburg was neither unstable nor subject to posttranslational degradation. The alpha/non-alpha biosynthetic ratio was 2.6. Because the proband appeared to be a mixed heterozygote for Hb Vicksburg and beta 0-thalassemia, Hb Vicksburg should have comprised the major portion of the hemolysate. Thus, Hb Vicksburg was synthesized at a rate considerably lower than would be expected on the basis of gene dosage. There was no reason to suspect abnormal translation of beta Vicksburg mRNA; in individuals with Hb St. Antoine (beta 74 and beta 75 deleted), the abnormal hemoglobin comprised 25% of the hemolysate in the simple heterozygote yet was unstable. Deletion of beta 75, therefore, would not in itself appear to lead to diminished synthesis. There was a profound deficit of beta Vicksburg mRNA when measured by liquid hybridization analysis with beta cDNA. The most plausible explanation for the low output of Hb Vicksburg is that a mutation for beta +-thalassemia is present in cis to the structural mutation. PMID:6165992

  8. Iron-related disturbances of cell-mediated immunity in multitransfused children with thalassemia major.

    PubMed Central

    Pardalos, G; Kanakoudi-Tsakalidis, F; Malaka-Zafiriu, M; Tsantali, H; Athanasiou-Metaxa, M; Kallinikos, G; Papaevangelou, G

    1987-01-01

    Immunological abnormalities have been observed in many haemophiliacs receiving clotting factor concentrates. To determine whether similar changes also occur after repeated blood transfusions we estimated T cell subsets and cutaneous delayed hypersensitivity (CDH) in 50 multitransfused children with beta-thalassemia major (beta-TM). All patients were also tested for anti-HTLV-III/LAV antibodies. A diminished percentage of T lymphocytes (E-rosettes, T3+), and T4+ cells and a low T4/T8 ratio was found in patients as compared to age and sex matched controls (P less than 0.001). Negative CDH tests to specific antigens (Multi-test) were also found in a significantly larger proportion of beta-TM children (P less than 0.01). Antibodies against HTLV-III/LAV were negative in all patients. Decreased T4/T8 ratio in beta-TM children was primarily due to a reduction of T4+ cells and was inversely correlated to the patients' age, number of units of transfused blood (P less than 0.05) and especially to ferritin serum levels and annual iron balance (P less than 0.001). These findings indicate that immunological abnormalities in beta-TM patients appear to be acquired, transfusion-associated and related to iron load which depends on the appropriate chelation therapy. PMID:3498564

  9. One-step genetic correction of hemoglobin E/beta-thalassemia patient-derived iPSCs by the CRISPR/Cas9 system.

    PubMed

    Wattanapanitch, Methichit; Damkham, Nattaya; Potirat, Ponthip; Trakarnsanga, Kongtana; Janan, Montira; U-Pratya, Yaowalak; Kheolamai, Pakpoom; Klincumhom, Nuttha; Issaragrisil, Surapol

    2018-02-26

    Thalassemia is the most common genetic disease worldwide; those with severe disease require lifelong blood transfusion and iron chelation therapy. The definitive cure for thalassemia is allogeneic hematopoietic stem cell transplantation, which is limited due to lack of HLA-matched donors and the risk of post-transplant complications. Induced pluripotent stem cell (iPSC) technology offers prospects for autologous cell-based therapy which could avoid the immunological problems. We now report genetic correction of the beta hemoglobin (HBB) gene in iPSCs derived from a patient with a double heterozygote for hemoglobin E and β-thalassemia (HbE/β-thalassemia), the most common thalassemia syndrome in Thailand and Southeast Asia. We used the CRISPR/Cas9 system to target the hemoglobin E mutation from one allele of the HBB gene by homology-directed repair with a single-stranded DNA oligonucleotide template. DNA sequences of the corrected iPSCs were validated by Sanger sequencing. The corrected clones were differentiated into hematopoietic progenitor and erythroid cells to confirm their multilineage differentiation potential and hemoglobin expression. The hemoglobin E mutation of HbE/β-thalassemia iPSCs was seamlessly corrected by the CRISPR/Cas9 system. The corrected clones were differentiated into hematopoietic progenitor cells under feeder-free and OP9 coculture systems. These progenitor cells were further expanded in erythroid liquid culture system and developed into erythroid cells that expressed mature HBB gene and HBB protein. Our study provides a strategy to correct hemoglobin E mutation in one step and these corrected iPSCs can be differentiated into hematopoietic stem cells to be used for autologous transplantation in patients with HbE/β-thalassemia in the future.

  10. Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

    PubMed

    Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

    2006-01-01

    The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

  11. Evaluation of cardiac and hepatic iron overload in thalassemia major patients with T2* magnetic resonance imaging.

    PubMed

    Wahidiyat, Pustika Amalia; Liauw, Felix; Sekarsari, Damayanti; Putriasih, Siti Ayu; Berdoukas, Vasili; Pennell, Dudley J

    2017-09-01

    Recent advancements have promoted the use of T2* magnetic resonance imaging (MRI) in the non-invasive detection of iron overload in various organs for thalassemia major patients. This study aims to determine the iron load in the heart and liver of patients with thalassemia major using T2* MRI and to evaluate its correlation with serum ferritin level and iron chelation therapy. This cross-sectional study included 162 subjects diagnosed with thalassemia major, who were classified into acceptable, mild, moderate, or severe cardiac and hepatic iron overload following their T2* MRI results, respectively, and these were correlated to their serum ferritin levels and iron chelation therapy. The study found that 85.2% of the subjects had normal cardiac iron stores. In contrast, 70.4% of the subjects had severe liver iron overload. A significant but weak correlation (r = -0.28) was found between cardiac T2* MRI and serum ferritin, and a slightly more significant correlation (r = 0.37) was found between liver iron concentration (LIC) and serum ferritin. The findings of this study are consistent with several other studies, which show that patients generally manifest with liver iron overload prior to cardiac iron overload. Moreover, iron accumulation demonstrated by T2* MRI results also show a significant correlation to serum ferritin levels. This is the first study of its kind conducted in Indonesia, which supports the fact that T2* MRI is undoubtedly valuable in the early detection of cardiac and hepatic iron overload in thalassemia major patients.

  12. Genetic counseling for beta-thalassemia trait following health screening in a health maintenance organization: comparison of programmed and conventional counseling.

    PubMed Central

    Fisher, L; Rowley, P T; Lipkin, M

    1981-01-01

    Providing adequate counseling of patients identified in genetic screening programs is a major responsibility and expense. Adults in a health maintenance organization, unselected for interest, were screened for beta-thalassemia trait as part of preventive health care. Counseling was provided by either a trained physician (conventional counseling) or by a videotape containing the same information followed by an opportunity to question a trained physician (programmed counseling). Immediately before and after counseling, knowledge of thalassemia, knowledge of genetics, and mood change were assessed by questionnaire. Comparable mood changes and similar learning about thalassemia and genetics occurred with both counseling methods. Thus, as judged by immediate effects on knowledge and mood, videotaped instruction can greatly reduce professional time required for genetic counseling and facilitate the incorporation of genetic screening into primary health care. PMID:7325162

  13. [Current management of thalassemia intermedia].

    PubMed

    Thuret, I

    2014-11-01

    Thalassemia intermedia is a clinical entity where anemia is mild or moderate, requiring no or occasional transfusion. Non-transfusion-dependent thalassemia encompasses 3 main clinical forms: beta-thalassemia intermedia, hemoglobin E/beta-thalassemia and alpha-thalassemia intermedia (HbH disease). Clinical severity of thalassemia intermedia increases with age, with more severe anemia and more frequent complications such as extramedullary hematopoiesis and iron overload mainly related to increased intestinal absorption. Numerous adverse events including pulmonary hypertension and hypercoagulability have been associated with splenectomy, often performed in thalassemia intermedia patients. The potential preventive benefit of transfusion and chelation therapies on the occurrence of numerous complications supports the strategy of an earlier therapeutic intervention. Increasing knowledge about pathophysiological mechanisms involved in thalassemia erythropoiesis and related iron overload is currently translating in novel therapeutic approaches. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  14. Detection of Early Right Ventricular Dysfunction in Young Patients With Thalassemia Major Using Tissue Doppler Imaging

    PubMed Central

    Bornaun, Helen; Dedeoglu, Reyhan; Oztarhan, Kazim; Dedeoglu, Savas; Erfidan, Erkan; Gundogdu, Muge; Aydogan, Gonul; Cengiz, Dicle

    2016-01-01

    Background Myocardial iron overload is the most common cause of mortality in patients with thalassemia major (TM), also known as beta-thalassemia. T2* cardiovascular magnetic resonance imaging (MRI) is the best way of monitoring cardiac iron, and new echocardiographic techniques can be used to assess cardiac function. Objectives The aim of this study was to assess the systolic and diastolic right ventricular (RV) function of patients with TM using tissue Doppler imaging (TDI) and to determine whether this echocardiographic technique is an adequate diagnostic tool for the screening and detection of subclinical cardiac dysfunction. Patients and Methods Eighty-four patients with TM were evaluated by conventional echocardiography and pulse-wave TDI. The data of the TM group (Group 1) were compared with that of 85 age- and sex-matched healthy controls (Group 2). Cardiovascular T2* MRI examinations were performed in 49 of the 85 patients. Results The patients with TM had significantly lower values for weight, height, body mass index, systolic arterial pressure, deceleration time, E’/A’, and ejection time (ET) than the controls. Group 1 also had significantly higher values for peak early diastolic velocity (E) over peak late diastolic velocity (A), peak early diastolic velocity of TDI (E’), peak late diastolic velocity of TDI (A’), E/E’, isovolumetric relaxation time, isovolumetric contraction time, and RV magnetic perfusion imaging (MPI) than Group 2. Conclusions RV diastolic dysfunction occurs before systolic deterioration in patients with TM and cannot be screened with conventional echocardiographic techniques. In routine practice, TDI measurements, MPI (for global function) and the E/E’ parameter (for diastolic function) can be used to screen and detect early RV dysfunction. PMID:27617076

  15. Increased levels of advanced glycation end products positively correlate with iron overload and oxidative stress markers in patients with β-thalassemia major.

    PubMed

    Mirlohi, Maryam Sadat; Yaghooti, Hamid; Shirali, Saeed; Aminasnafi, Ali; Olapour, Samaneh

    2018-04-01

    The impaired biosynthesis of the β-globin chain in β-thalassemia leads to the accumulation of unpaired alpha globin chains, failure in hemoglobin formation, and iron overload due to frequent blood transfusion. Iron excess causes oxidative stress and massive tissue injuries. Advanced glycation end products (AGEs) are harmful agents, and their production accelerates in oxidative conditions. This study was conducted on 45 patients with major β-thalassemia who received frequent blood transfusions and chelation therapy and were compared to 40 healthy subjects. Metabolic parameters including glycemic and iron indices, hepatic and renal functions tests, oxidative stress markers, and AGEs (carboxymethyl-lysine and pentosidine) levels were measured. All parameters were significantly increased in β-thalassemia compared to the control except for glutathione levels. Blood glucose, iron, serum ferritin, non-transferrin-bound iron (NTBI), MDA, soluble form of low-density lipoprotein receptor, glutathione peroxidase, total reactive oxygen species (ROS), and AGE levels were significantly higher in the β-thalassemia patients. Iron and ferritin showed a significant positive correlation with pentosidine (P < 0.01) but not with carboxymethyl-lysine. The NTBI was markedly increased in the β-thalassemia patients, and its levels correlated significantly with both carboxymethyl-lysine and pentosidine (P < 0.05). Our findings confirm the oxidative status generated by the iron overload in β-thalassemia major patients and highlight the enhanced formation of AGEs, which may play an important role in the pathogenesis of β-thalassemia major.

  16. The ICET-A Recommendations for the Diagnosis and Management of Disturbances of Glucose Homeostasis in Thalassemia Major Patients

    PubMed Central

    De Sanctis, Vincenzo; Soliman, Ashraf T.; Elsedfy, Heba; Yaarubi, Saif AL; Skordis, Nicos; Khater, Doaa; El Kholy, Mohamed; Stoeva, Iva; Fiscina, Bernadette; Angastiniotis, Michael; Daar, Shahina; Kattamis, Christos

    2016-01-01

    Iron overload in patients with thalassemia major (TM) affects glucose regulation and is mediated by several mechanisms. The pathogenesis of glycaemic abnormalities in TM is complex and multifactorial. It has been predominantly attributed to a combination of reduced insulin secretory capacity and insulin resistance. The exact mechanisms responsible for progression from norm glycaemia to overt diabetes in these patients are still poorly understood but are attributed mainly to insulin deficiency resulting from the toxic effects of iron deposited in the pancreas and insulin resistance. A group of endocrinologists, haematologists and paediatricians, members of the International Network of Clinicians for Endocrinopathies in Thalassemia and Adolescence Medicine (ICET-A) convened to formulate recommendations for the diagnosis and management of abnormalities of glucose homeostasis in thalassemia major patients on the basis of available evidence from clinical and laboratory data and consensus practice. The results of their work and discussions are described in this article. PMID:27872738

  17. Prevalence of diabetes, impaired fasting glucose and impaired glucose tolerance in patients with thalassemia major in Iran: A meta-analysis study

    PubMed Central

    Azami, Milad; Sharifi, Ali; Norozi, Siros; Mansouri, Akram; Sayehmiri, Kourosh

    2017-01-01

    Background: This study aimed to investigate the prevalence of diabetes, impaired fasting glucose (IFG) and impaired glucose tolerance (IGT) in Iranian patients with thalassemia major. Methods: The current study has been conducted based on PRISMA guideline. To obtain the documents, Persian and English scientific databases such as Magiran, Iranmedex, SID, Medlib, IranDoc, Scopus, PubMed, ScienceDirect, Cochrane, Web of Science, Springer, Wiley Online Library as well as Google Scholar were searched until December 2015. All steps of the study were conducted by two authors independently. To the high heterogeneity of the studies, the random effect model was used to combine studies. Data were analyzed using STATA Version 11.1 software. Results: Thirty-two studies involving 3959 major thalassemia patients with mean age of 16.83 years were included in the meta-analysis. The prevalence of diabetes in Iranian patients with thalassemia major was estimated as 9% (95% CI: 6.8-10.5) and estimated rate was 12.6% (95% CI: 6.1-19.1) for males and 10.8% (95% CI: 8.2-14.5) for females. The prevalence of IFG and IGT were 12.9% (95% CI: 7-18.8) and 9.6% (95% CI: 6.6-12.5) respectively. No relationship between serum ferritin and development of diabetes was noted. Conclusion: The prevalence of diabetes, IFG, and IGT in patients with thalassemia major in Iran is high and accordingly requires new management strategies and policies to minimize endocrine disorders in Iranian patients with thalassemia major. Screening of patients for the early diagnosis of endocrine disorders particularly diabetes, IFG, and IGT is recommended. PMID:28503277

  18. A molecular study of a family with Greek hereditary persistence of fetal hemoglobin and beta-thalassemia.

    PubMed Central

    Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U

    1984-01-01

    A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198

  19. Klotho, a new marker for osteoporosis and muscle strength in β-thalassemia major.

    PubMed

    Baldan, Alessandro; Giusti, Andrea; Bosi, Cristina; Malaventura, Cristina; Musso, Marco; Forni, Gian Luca; Volpato, Stefano; Zuliani, Giovanni; Borgna-Pignatti, Caterina

    2015-12-01

    Aim of this study was to compare plasma levels of the secreted protein Klotho in β-thalassemia major patients and in healthy controls. Also, we examined the existence of correlations between the protein level and osteoporosis, poor muscle strength and fractures. A total of 106 patients with β-thalassemia major and 95 healthy blood donors were enrolled. Klotho level in plasma was measured by mean of an ELISA test and the hand-grip strength using a dynamometer. Intact parathyroid hormone (PTH), 25-hydroxy vitamin D (Vitamin D), serum calcium (Ca), phosphate (P), total alkaline phosphatase (ALP), ferritin, creatinine were measured by standard clinical techniques. DXA was used to measure bone mineral density (BMD) at the lumbar spine (L2-L4), femoral neck and total hip. We found that the Klotho protein concentration was lower in the blood of patients with β-thalassemia major than in healthy controls, and it was directly correlated to the hand-grip strength. In β-thalassemia major patients, the secreted Klotho was lower than in healthy controls. The preliminary investigation into the correlation between markers of osteo- and sarcopenia and Klotho demonstrated a decreased Klotho concentration in β-TM patients and a higher probability of having had fragility fractures. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. A randomized, controlled study evaluating effects of amlodipine addition to chelators to reduce iron loading in patients with thalassemia major.

    PubMed

    Eghbali, Aziz; Kazemi, Hamideh; Taherahmadi, Hassan; Ghandi, Yazdan; Rafiei, Mohammad; Bagheri, Bahador

    2017-12-01

    Cardiomyopathy due to iron overload can be fatal in patients with thalassemia major. Calcium channel blockers seem to be effective to reduce iron loading. Our goal was to study effects of amlodipine addition to chelators on iron loading in patients with thalassemia major. This randomized, controlled, and single-center trial was performed on 56 patients with thalassemia major. Patients were randomized 1:1 to combined group (iron chelator plus amlodipine) or control group (iron chelator) for 1 year. Iron content was measured by magnetic resonance imaging; heart T2*, and liver T2*. Serum ferritin was also measured. After 12 months of treatment, myocardial T2* values had significant improvement in combined group (21.9 ± 8.0 ms to 24.5 ± 7.6 ms; P < .05); Difference between two groups was significant (P = .02). Combined treatment had no effect on hepatic T2* value (9.6 ± 2.8 ms to 9.5 ± 3.6 ms); difference between two groups was not significant (P = .2). In addition, a significant reduction was seen in serum ferritin levels in two groups. Mild gastrointestinal upset was the most common untoward effect. Addition of amlodipine to iron chelators has beneficial effects for reduction of iron loading in patients with thalassemia major. This combination therapy seems safe. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Beta-thalassemia problems in the Turkish population in the F.R.G.

    PubMed

    Holzgreve, W; Sevinchan, E; Kohne, E; Sevinchan, S; Miny, P; Horst, J

    1990-01-01

    A sample of 165 normal Turkish probands (79 males, 86 females) living in the F.R.G. was screened for the presence of heterozygous beta-thalassemia as well as their knowledge and perception of thalassemias in general. Hematologic studies revealed two persons to be heterozygous for beta-thalassemia who had not known this before. This incidence of 1.2% in our sample of Turkish probands living in the F.R.G. is in accordance with the average range of 0.2-6% given by the World Health Organization for Turkey. The probands' places of origin in Turkey correlate well with the pattern of migration within the country, with most people coming from central Anatolia which is an area with a relatively low incidence of beta-thalassemia. Interviews conducted by a Turkish doctor revealed that the knowledge about thalassemias and the function of blood in general was extremely limited in our study population. On the other hand, 50% of the respondents would refrain from marriage or choose a different partner if both partners knew that they were heterozygous for thalassemia. 19% would still marry in this situation but refrain from having children. When asked about their most likely decision in the case of an early diagnosis of homozygous thalassemia, 78% said they would have a termination and only 15% would definitely go on with the pregnancy. About 65% felt that consanguineous marriage is a predisposing factor for diseases in the offspring. From our study it can be concluded that a large-scale screening program in the high-risk population which exists in most Mediterranean countries would be difficult regarding the more than one million people from Turkey living in the F.R.G. and would have to take into account the cultural and educational conditions of the Turkish minority. In general, if no Turkish-speaking specialist is available to explain the diagnostic possibilities, probably pre-pregnancy or early pregnancy testing would be the most appropriate way of reaching the couples at risk

  2. Heterozygous Hb Hope [beta136(H14)Gly --> Asp] in association with heterozygous beta0-thalassemia with apparent homozygous expression, in a Spanish patient.

    PubMed

    Beneitez, David; Carrera, Alícia; Duran-Suárez, Joan Ramón; Paz, Victoria; León, Antonio; García Talavera, Juan

    2006-01-01

    Hb Hope [beta136(H14)Gly --> Asp (GGT --> GAT)] has been found alone or in combination with other globin gene mutations in several African-American families, as well as in Japanese, Thai, Laotian, Cuban and Mauritanian families. We report the hematological and molecular characteristics of a heterozygous association of Hb Hope with beta0-thalassemia (thal) in a Spanish patient, in whom the level of expression of abnormal hemoglobin (Hb) by cation exchange high performance liquid chromatography (HPLC) and electrophoresis suggested initially a homozygous expression of the abnormal Hb, although sequencing of the polymerase chain reaction (PCR)-amplified beta-globin gene demonstrated a heterozygous genotype for Hb Hope. To the best of our knowledge, this is the first description of a case of Hb Hope in a Spanish family.

  3. Up-regulation of NKG2A inhibitory receptor on circulating NK cells contributes to transfusion-induced immunodepression in patients with β-thalassemia major.

    PubMed

    Zou, Yong; Song, Zhi-Xing; Lu, Ying; Liang, Xiao-Li; Yuan, Qing; Liao, Si-Hong; Bao, Jun-Jie

    2016-08-01

    Accumulating evidence has shown that allogeneic blood transfusions can induce significant immunosuppression in recipients, and thereby increase the risk of postoperative infection and/or tumor relapse. Although it is well known that natural killer (NK) cells are responsible for the immunodepression effects of transfusion, the underlying mechanisms remain obscure. In this study, we investigated the role of NK cells in transfusion-induced immunodepression in β-thalassemia major. The proportion of circulating NK cells and the expression of NK receptors (NKG2A, CD158a, NKP30, NKP46 and NKG2D) as well as CD107a were detected by multicolor flow cytometry. IFN-γ production by circulating NK cells was detected by intracellular cytokine staining. Our results showed that the proportion and cytotoxicity (CD107a expression) of circulating NK cells in transfusion-dependent β-thalassemia major patients were remarkably lower than those of β-thalassemia minor patients or healthy volunteers. Expression of NKG2A inhibitory receptor on circulating NK cells in patients with β-thalassemia major was remarkably up-regulated, but there were no significant differences in the expression levels of NKP30, NKP46, NKG2D, CD158a and IFN-γ. These results indicate NKG2A inhibitory receptor may play a key role in transfusion-induced immunodepression of NK cells in patients with β-thalassemia major.

  4. Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

    PubMed

    Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

    2017-12-30

    Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

  5. Pathogenesis of chronic rhinosinusitis in patients affected by β-thalassemia major and sickle cell anaemia post allogenic bone marrow transplant.

    PubMed

    Martino, F; Di Mauro, R; Paciaroni, K; Gaziev, J; Alfieri, C; Greco, L; Floris, R; Di Girolamo, S; Di Girolamo, M

    2018-03-01

    Sickle cell anemia (SCA) and β -thalassemia major are well-recognized beta-globin gene disorders of red blood cells associated to mortality and morbidity included bone morbidities due to ineffective erythropoiesis and bone marrow expansion, which affect every part of the skeleton. While there are an abundance of described disease manifestations of the head and neck, the manner of paranasal sinuses involvement and its relations to β-thalassemia and SCA process was not studied yet. Therefore, the aim of this study was to investigate a possible increased risk of rhinosinusitis and the real pathogenetic mechanism of it, comparing these two hematological diseases using msCT, gold standard for paranasal sinuses evaluation. A retrospective analysis of 90 patients affected by β-thalassemia major or SCA (respectively 59 and 31) underwent allogeneic bone marrow transplantation (BMT), and 44 control subjects was performed. Both patient categories and control group have been subjected to hematological and radiological evaluation using 64-multidetector-row CT scanner without contrast injection. Statistical analysis reveals that patients of the two study groups exhibit a significantly increased risk of sinusitis in comparison with the normal controls (RR: 3.55 for β-thalassemic pediatric subjects; RR: 3.35 for SCA pediatric subjects). A significant difference (p < 0,5) was found between the β -thalassemic patients on the one side, and SCA and control group on the other side, with regard to the evaluation of the typical anatomic alteration of maxillary sinus: β-thalassemic children had significant increase in the bone thickness of anterior and lateral sinus walls and significant reduction in volume and density compared to SCA patients and control group, with normal conditions of these parameters. In these hematological patients, there is an increased incidence of sinonasal infections due their therapy-induced immunosuppression post transplantation. In

  6. Associations of Thalassemia Major and satisfaction with quality of life: The mediating effect of social support

    PubMed Central

    Platania, Silvia; Gruttadauria, Stefania; Citelli, Giulia; Giambrone, Loris; Di Nuovo, Santo

    2017-01-01

    The present research analyzed the elements of thalassemia which affect the patient’s perceived quality of life. Three hundred patients with Thalassemia Major (males = 165, 55%; females = 135, 45%; Mage = 36.13, standard deviation = 8.54) were the sample. Analysis of multiple mediations revealed a direct effect of self-efficacy on the Satisfaction with Life Scale that is mediated only by social support.The findings suggest a need to accentuate help and support to patients with Thalassemia Major. PMID:29379628

  7. Laboratory investigation of hemoglobinopathies and thalassemias: review and update.

    PubMed

    Clarke, G M; Higgins, T N

    2000-08-01

    Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

  8. Evaluation of Glutathione-S-Transferase P1 Polymorphism and its Relation to Bone Mineral Density in Egyptian Children and Adolescents with Beta-Thalassemia Major

    PubMed Central

    Ragab, Seham M.; Badr, Eman A.; Ibrahim, Ahmed S.

    2016-01-01

    Background Osteoporosis is a major complication of beta thalassemia major (TM). Increased oxidative stress and its controlling genes were linked to osteoporosis. Ile105 Val variant is a functional polymorphism of Glutathione S-transferase P1 (GSTP1), with reduced anti-oxidative property. No data are available about this variant or its association with osteoporosis among thalassemia patients yet. Objectives To investigate Ile105Val polymorphism and its possible association with bone mineral density (BMD) values in a group of TM children. Methods Thirty five TM children and 30 age and sex matched healthy controls were included. Liver and renal functions, serum ferritin, calcium, phosphorous, alkaline phosphatase and osteocalcin were assayed. BMD was determined by DXA with calculation of Z-scores at lumbar spine (LS) and femoral neck (FN). Height for age Z- score (HAZ) adjusted BMD Z-scores were calculated. GSTP1 Ile105Val polymorphism was studied by polymerase chain reaction-restriction fragment length polymorphism. Results The relative frequency of 105 Val allele was significantly higher in TM patients than the controls (p<0.0001). Significant association between genotype subgroups and BMD parameters was detected. Compared to wild homozygotes, polymorphic homozygotes had lower LS-BMD (p =0.029), LS-BMD Z –score (p=0.008 ), LS- BMD haz - Z-score (p=0.011), FN- BMD (p= 0.001), FN- BMD Z –score (p=0.02) and FN-BMD haz - Z-score (p=0.001). They exhibited higher osteocalcin levels compared to heterozygotes and wild homozygotes (p=0.012, p=0.013, respectively). Conclusion Ile105Val polymorphism was frequent among TM patients and could increase their susceptibility to reduced BMD. Large sample studies are required to confirm these findings. PMID:26740865

  9. Comparison of deferasirox and deferoxamine effects on iron overload and immunological changes in patients with blood transfusion-dependent β-thalassemia

    PubMed Central

    Al-Kuraishy, Hayder M.; Al-Gareeb, Ali I.

    2017-01-01

    INTRODUCTION: Beta-thalassemias are a cluster of inherited (autosomal recessive) hematological disorders prevalent in the Mediterranean area due to defects in synthesis of β chains of hemoglobin. The aim of present study was to compare the effects of deferasirox and deferoxamine on iron overload and immunological changes in patients with blood transfusion-dependent β-thalassemia major and intermedia. PATIENTS AND METHODS: This study involved 64 patients with known cases of β-thalassemia major or intermedia that has been treated with blood transfusion and iron chelators. Serum ferritin, serum iron, serum total iron binding, unsaturated iron-binding capacity (UIBC), and immunological parameters were assessed in deferoxamine and deferasirox-treated patients. RESULTS: In deferoxamine-treated patients, serum ferritin levels were high (8160.33 ± 233.75 ng/dL) compared to deferasirox-treated patients (3000.62 ± 188.23 ng/dL; P < 0.0001), also there were significant differences in serum iron, total iron-binding capacity and UIBC (P < 0.0001) in deferasirox-treated patients compared to deferoxamine-treated patients. Immunological changes between two treated groups showed insignificant differences in levels of complements (C3 and C4) and immunoglobulin levels (IgM, IgG, and IgA) P > 0.05. CONCLUSION: This study indicated that deferasirox is more effective than deferoxamine regarding the iron overload but not in the immunological profile in patients with blood transfusion-dependent β-thalassemia. PMID:28316434

  10. Iron overload causes osteoporosis in thalassemia major patients through interaction with transient receptor potential vanilloid type 1 (TRPV1) channels

    PubMed Central

    Rossi, Francesca; Perrotta, Silverio; Bellini, Giulia; Luongo, Livio; Tortora, Chiara; Siniscalco, Dario; Francese, Matteo; Torella, Marco; Nobili, Bruno; Di Marzo, Vincenzo; Maione, Sabatino

    2014-01-01

    The pathogenesis of bone resorption in β-thalassemia major is multifactorial and our understanding of the underlying molecular and cellular mechanisms remains incomplete. Considering the emerging importance of the endocannabinoid/endovanilloid system in bone metabolism, it may be instructive to examine a potential role for this system in the development of osteoporosis in patients with β-thalassemia major and its relationship with iron overload and iron chelation therapy. This study demonstrates that, in thalassemic-derived osteoclasts, tartrate-resistant acid phosphatase expression inversely correlates with femoral and lumbar bone mineral density, and directly correlates with ferritin levels and liver iron concentration. The vanilloid agonist resiniferatoxin dramatically reduces cathepsin K levels and osteoclast numbers in vitro, without affecting tartrate-resistant acid phosphatase expression. The iron chelators deferoxamine, deferiprone and deferasirox decrease both tartrate-resistant acid phosphatase and cathepsin K expression, as well as osteoclast activity. Taken together, these data show that transient receptor potential vanilloid type 1 activation/desensitization influences tartrate-resistant acid phosphatase expression and activity, and this effect is dependent on iron, suggesting a pivotal role for iron overload in the dysregulation of bone metabolism in patients with thalassemia major. Our applied pharmacology provides evidence for the potential of iron chelators to abrogate these effects by reducing osteoclast activity. Whether iron chelation therapy is capable of restoring bone health in humans requires further study, but the potential to provide dual benefits for patients with β-thalassemia major –preventing iron-overload and alleviating associated osteoporotic changes – is exciting. PMID:25216685

  11. Comparison of deferasirox and deferoxamine effects on iron overload and immunological changes in patients with blood transfusion-dependent β-thalassemia.

    PubMed

    Al-Kuraishy, Hayder M; Al-Gareeb, Ali I

    2017-01-01

    Beta-thalassemias are a cluster of inherited (autosomal recessive) hematological disorders prevalent in the Mediterranean area due to defects in synthesis of β chains of hemoglobin. The aim of present study was to compare the effects of deferasirox and deferoxamine on iron overload and immunological changes in patients with blood transfusion-dependent β-thalassemia major and intermedia. This study involved 64 patients with known cases of β-thalassemia major or intermedia that has been treated with blood transfusion and iron chelators. Serum ferritin, serum iron, serum total iron binding, unsaturated iron-binding capacity (UIBC), and immunological parameters were assessed in deferoxamine and deferasirox-treated patients. In deferoxamine-treated patients, serum ferritin levels were high (8160.33 ± 233.75 ng/dL) compared to deferasirox-treated patients (3000.62 ± 188.23 ng/dL; P < 0.0001), also there were significant differences in serum iron, total iron-binding capacity and UIBC ( P < 0.0001) in deferasirox-treated patients compared to deferoxamine-treated patients. Immunological changes between two treated groups showed insignificant differences in levels of complements (C3 and C4) and immunoglobulin levels (IgM, IgG, and IgA) P > 0.05. This study indicated that deferasirox is more effective than deferoxamine regarding the iron overload but not in the immunological profile in patients with blood transfusion-dependent β-thalassemia.

  12. Study of Insulin Resistance in Patients With β Thalassemia Major and Validity of Triglyceride Glucose (TYG) Index.

    PubMed

    Ansari, Arif M; Bhat, Kamalakshi G; Dsa, Smitha S; Mahalingam, Soundarya; Joseph, Nitin

    2018-03-01

    Complications like impaired glucose tolerance and diabetes mellitus due to iron overload need early identification in thalassemia. We studied the proportion of insulin resistance in thalassemia major patients on chronic transfusion, identified insulin resistance using homeostasis model assessment of insulin resistance (HOMA-IR) and triglyceride glucose (TYG) index, compared them and validated TYG index. In total, 73 thalassemia patients on regular transfusion for 3 years with serum ferritin >1500 ng/mL were studied. Serum ferritin, fasting blood glucose, triglycerides, and insulin levels were measured, HOMA-IR, and TYG index calculated and analyzed. Mean fasting glucose, triglyceride, and serum insulin values were 104 mg/dL, 164.18 mg/dL, and 19.6 m IU/mL, respectively. Mean serum ferritin was 5156 ng/mL. Insulin resistance was prevalent in one third of thalassemia patients and showed increase with age and serum ferritin. Insulin resistance by HOMA-IR was 32% as against 16% by TYG index with a cut-off value of 4.3. Using receiver operating charecteristic curve analysis, it was found that, by lowering the value of TYG index to 4.0215, sensitivity improved to 78.3% (from 39.13%) with specificity of 70%. Hence, we recommend a newer lower cut-off value of 4.0215 for TYG index for better sensitivity and specificity in identifying insulin resistance.

  13. Electrophysiological assessment for early detection of retinal dysfunction in β-thalassemia major patients.

    PubMed

    Dettoraki, Maria; Kattamis, Antonis; Ladas, Ioannis; Maragkos, Konstantinos; Koutsandrea, Chryssanthi; Chatzistefanou, Klio; Laios, Konstantinos; Brouzas, Dimitrios; Moschos, Marilita M

    2017-07-01

    The purpose of this study was to assess the role of various diagnostic tests in early detection of retinal changes in β-thalassemia major patients. Thirty-eight visually asymptomatic β-thalassemia major patients receiving regular blood transfusions and iron-chelation therapy with deferoxamine (group A, n = 13), deferasirox (group B, n = 11) or deferoxamine with deferiprone (group C, n = 14) and fourteen age- and sex- matched healthy individuals were included in the study. All participants underwent ophthalmoscopy, full-field electroretinography (ERG), visual evoked potentials (VEP), multifocal electroretinography (mfERG), fundus autofluorescence (FAF) imaging and optical coherence tomography (OCT) scans. Retinal pigment epithelium changes were present in two cases. Scotopic ERG demonstrated decreased a-wave amplitude in groups A, B and C (p = 0.03, p = 0.002 and p = 0.002, respectively) and decreased b-wave amplitude in groups B and C (p = 0.002 and p = 0.01, respectively) compared to controls. Photopic ERG showed delayed b-wave latency in groups A and C (p = 0.03 and p = 0.03, respectively) ERG maximal combined response and VEP response did not differ between groups. MfERG showed reduced retinal response density in ring 1 in groups A, B, C (p < 0.001, p < 0.001, p = 0.001, respectively) and ring 2 in group B (p = 0.02) and delayed latency in ring 5 in groups A and B (p = 0.04 and p = 0.04, respectively). Abnormal FAF images appeared in three cases and OCT abnormalities in one case, whereas no changes were observed in controls (p = 0.55 and p = 1.00, respectively). Full-field ERG and mfERG are more sensitive tools for detecting early retinal changes in β-thalassemia patients compared with ophthalmoscopy, VEP, FAF imaging and OCT scans.

  14. Neurocognitive dysfunction in children with β thalassemia major: psychometric, neurophysiologic and radiologic evaluation.

    PubMed

    Elalfy, M S; Aly, R H; Azzam, H; Aboelftouh, K; Shatla, R H; Tarif, M; Abdatty, M; Elsayed, R M

    2017-12-01

    To evaluate the impact of iron chelating drugs and serum ferritin on the neurocognitive functions of patients with β thalassemia major (β-TM), using psychometric, neurophysiologic and radiologic tests. Eighty children with β-TM were enrolled into the study and were compared to 40 healthy controls. All participants were evaluated by measuring serum ferritin, neurocognitive assessment by Benton Visual Retention Test, Wechsler Intelligence Scale for Children, Wisconsin Card Sort Test, P300 and magnetic resonance spectroscopy (MRS). WISC in our study showed that 40% of cases were borderline mental function as regards total IQ. Neurophysiologic tests were significantly impaired in patients compared to control group, with significant impairment in those receiving desferrioxamine (DFO). P300 amplitude was significantly lower in cases compared to controls (2.24 and 4.66 uv, respectively), recording the shortest amplitude in patients receiving DFO. Altered metabolic markers in the brain were detected by MRS in the form of reduced N-acetylaspartate to creatine ratio in 78.3% of our cases. There were significant correlations between psychometric tests and both neurophysiologic (P300) and radiologic (MRS) tests. β-TM is associated with neurocognitive impairment that can be assessed by psychometric, neurophysiologic and radiologic tests. The role of hemosiderosis and iron chelation therapy on cognitive functioning still need more research. β-TM: beta thalassemia major; DFO: Dysferal; DFP: Deferiprone; DFX: Deferasirox; WISC: Wechsler Intelligence Scale for Children; VIQ: verbal IQ; PIQ: performance IQ; TIQ: total IQ; BVRT: Benton Visual Retention Test; WCST: Wisconsin Card Sort Test; MRS: Magnetic resonant spectroscopy; NAA/Cr ratio: N-acetylaspartate to creatine ratio.

  15. Multiparametric Cardiac Magnetic Resonance Survey in Children With Thalassemia Major: A Multicenter Study.

    PubMed

    Casale, Maddalena; Meloni, Antonella; Filosa, Aldo; Cuccia, Liana; Caruso, Vincenzo; Palazzi, Giovanni; Gamberini, Maria Rita; Pitrolo, Lorella; Putti, Maria Caterina; D'Ascola, Domenico Giuseppe; Casini, Tommaso; Quarta, Antonella; Maggio, Aurelio; Neri, Maria Giovanna; Positano, Vincenzo; Salvatori, Cristina; Toia, Patrizia; Valeri, Gianluca; Midiri, Massimo; Pepe, Alessia

    2015-08-01

    Cardiovascular magnetic resonance (CMR) plays a key role in the management of thalassemia major patients, but few data are available in pediatric population. This study aims at a retrospective multiparametric CMR assessment of myocardial iron overload, function, and fibrosis in a cohort of pediatric thalassemia major patients. We studied 107 pediatric thalassemia major patients (61 boys, median age 14.4 years). Myocardial and liver iron overload were measured by T2* multiecho technique. Atrial dimensions and biventricular function were quantified by cine images. Late gadolinium enhancement images were acquired to detect myocardial fibrosis. All scans were performed without sedation. The 21.4% of the patients showed a significant myocardial iron overload correlated with lower compliance to chelation therapy (P<0.013). Serum ferritin ≥2000 ng/mL and liver iron concentration ≥14 mg/g/dw were detected as the best threshold for predicting cardiac iron overload (P=0.001 and P<0.0001, respectively). A homogeneous pattern of myocardial iron overload was associated with a negative cardiac remodeling and significant higher liver iron concentration (P<0.0001). Myocardial fibrosis by late gadolinium enhancement was detected in 15.8% of the patients (youngest children 13 years old). It was correlated with significant lower heart T2* values (P=0.022) and negative cardiac remodeling indexes. A pathological magnetic resonance imaging liver iron concentration was found in the 77.6% of the patients. Cardiac damage detectable by a multiparametric CMR approach can occur early in thalassemia major patients. So, the first T2* CMR assessment should be performed as early as feasible without sedation to tailor the chelation treatment. Conversely, late gadolinium enhancement CMR should be postponed in the teenager age. © 2015 American Heart Association, Inc.

  16. Analyzing 5'HS3 and 5'HS4 LCR core regions and NF-E2 in Iranian thalassemia intermedia patients with normal or carrier status for beta-globin mutations.

    PubMed

    Neishabury, Maryam; Azarkeivan, Azita; Oberkanins, Christian; Abedini, Seyedeh Sedigheh; Zamani, Shahbaz; Najmabadi, Hossein

    2011-03-15

    Our data on 114 Iranian individuals with thalassemia intermedia phenotype revealed homozygous or compound heterozygous beta-globin mutations to be the predominant disease factor in 86.2% of cases. However, 8.2% of these individuals were found to be heterozygous or wild type for beta-globin mutations. In search for determinants outside of the beta-globin gene, which could be responsible for the unexpected thalassemia intermedia phenotype in these subjects, we screened the alpha-globin genes, the 5'HS3 and 5'HS4 regions of the beta-globin LCR, and the NF-E2 transcription factor for sequence variations in selected individuals. The -3.7 deletion was the only alpha-globin mutation detected, and no alterations were found in 5'HS3 and NF-E2. Sequence analysis of the 5'HS4 LCR core region identified three known SNPs in a single patient, who required irregular blood transfusions. The A/G polymorphism in the 5'HS4 palindromic region was also observed to be variable. Family studies were carried out on a female G/G homozygous patient, who received irregular blood transfusions. Her father, who had the same heterozygous IVSII-1 beta-globin mutation but the A/G genotype at the 5'HS4 palindromic site, presented with mild anemia and no requirement for blood transfusions. This suggests an impact of SNPs in the 5'HS4 LCR core region on the thalassemia phenotype and offers an interesting subject for further investigations in the Iranian population. Copyright © 2010 Elsevier Inc. All rights reserved.

  17. Q Sepharose micro-column chromatography: A simple screening method for identifying beta thalassemia traits and hemoglobin E carriers.

    PubMed

    Wong, Peerapon; Sritippayawan, Suchila; Suwannakhon, Narutchala; Tapprom, Akamon; Deoisares, Rawisut; Sanguansermsri, Torpong

    2016-11-01

    For beta thalassemia control program in pregnancy, mass screening of the carrier state by determination of the hemoglobin (Hb) A 2 and Hb E proportions and mutation analysis is a preferred method for making prenatal diagnoses. Q Sepharose micro-column chromatography, developed for the determination of Hb A 2 and Hb E for screening purposes, was compared with high performance liquid chromatography (HPLC) to ascertain its relative accuracy and reliability. Results using Q Sepharose micro-column chromatography in 350 blood specimens, including 50 samples genetically proven to be beta thalassemia heterozygotes, were compared to HPLC for validation. An additional study was conducted to test a clinical application on a large-scale survey for beta thalassemia in 1581 pregnant women and their spouses. The mean (±SD) Hb A 2 proportions in the normal and genetically proven beta thalassemia heterozygotes were 2.70±0.40% and 6.30±1.23%, respectively, as determined by Q-Sepharose micro-column chromatography, and 2.65±0.31% and 5.37±0.96%, respectively, as determined by HPLC. The mean Hb E proportions in the Hb E heterozygotes were 23.25±4.13% and 24.72±3.5% as determined by Q Sepharose micro-column chromatography and HPLC, respectively. In the large-scale survey for beta thalassemia, 23 at risk couples were detected. Seven affected fetuses were identified by prenatal diagnosis. Q Sepharose micro-column chromatography was found to be reliable, reproducible and well-suited for large-scale surveys. Additionally, by being reusable and convenient, this simple and economical chromatography method may be an alternative means to screen for beta thalassemia and Hb E carriers in the mass population. Copyright © 2016 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  18. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

    PubMed

    Harano, K; Harano, T; Kushida, Y; Ueda, S

    1991-08-01

    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  19. Hydroxyurea for hemoglobin E/β-thalassemia: a systematic review and meta-analysis.

    PubMed

    Algiraigri, Ali H; Kassam, Aliya

    2017-12-01

    Hemoglobin E-beta thalassemia (Hb E/β-thalassemia) is a distinct, yet common, type of β-thalassemia, in which the patient co-inherits a β-thalassemia allele from one parent, and a structural variant, Hb E, from the other parent. This co-inheritance leads to remarkable clinical heterogeneity, varying degrees of chronic anemia, and a wide spectrum of complications due to ineffective erythropoiesis and iron overload. Hydroxyurea (HU), an oral chemotherapeutic drug, is expected to decrease disease severity. To assess the clinical efficacy and safety of HU in Hb E/β-thalassemia patients. We searched MEDLINE, EMBASE, Cochrane databases, and major preceding conferences for studies that assessed HU in Hb E/β-thalassemias patients. The effect size was estimated as a proportion (responder/sample size). Qualities of eligible studies were assessed using NIH tools. A total of five [one randomized clinical trial (RCT) and four observational] studies involving 106 patients were included. HU was associated with a significant RR of 46% with no statistical heterogeneity. No serious adverse effects were reported. Patients with Hb E/β-thalassemia may benefit from a trial of HU, though large RCTs assessing efficacy should be conducted to confirm the findings of this meta-analysis and to assess long-term toxicity and response sustainability.

  20. Echocardiographic evaluation of thalassemia intermedia patients in Duhok, Iraq.

    PubMed

    Mohammad, Ameen Mosa

    2014-12-11

    Cardiac complications are among the most serious problems of thalassemia intermedia patients. The current study was initiated to address the latter issue through the study of the echocardiographic findings and correlate it with clinical characteristics of thalassemia intermedia patients in Duhok, Kurdistan region, Iraq. An echocardiographic assessment of 61 beta-thalassemia intermedia cases was performed. It included 30 males and 31 females, with a mean age 19.6 ± 7.5 years. The standard echostudy of two-dimension and M-mode measurements of cardiac chambers were done. The continuous doppler regurgitant jet of tricuspid and pulmonary valves were recorded. Left ventricle diastolic function was assessed by pulsed doppler of mitral valve inflow. To correlate the clinical with echocardiographic findings, patients were divided, according to tricuspid regurgitant velocity, into three groups (<2.5 m/sec, 2.5-2.9 m/sec and ≥3 m/sec). Tricuspid regurgitant velocity <2.5 m/sec, 2.5-2.9 m/sec and ≥3 m/sec occurred in 42(69%), 11(18%) and 8(13%) respectively. Comparing to other groups patients with tricuspid regurgitant velocity ≥3 m/sec were older and included more males. They had lower hemoglobin levels, but higher ferritin levels. Their age at diagnosis and the age of the initiation of blood transfusion were later. Most of them had significant exertional dyspnea. They also had relatively lower left ventricle ejection fraction values. Right ventricular diameter and right atrial size were larger in the same group. Tricuspid regurgitant velocity as a continuous predictor was associated positively with age, cardiac volumes and pulmonary regurgitation though negatively associated with ejection fraction. Echo-derived right and left side cardiac complications are not uncommon in thalassemia intermedia patients. Therapeutic trails targeting these complications are indicated, and echocardiographic assessment is necessary to be offered early for thalassemia intermedia.

  1. Serum levels of TGFβ, IL-10, IL-17, and IL-23 cytokines in β-thalassemia major patients: the impact of silymarin therapy.

    PubMed

    Balouchi, Sima; Gharagozloo, Marjan; Esmaeil, Nafiseh; Mirmoghtadaei, Milad; Moayedi, Behjat

    2014-08-01

    Abstract Several immunological abnormalities have been characterized in β-thalassemia, many of which are linked to or identified with cytokines. In this study, we investigated the serum levels of TGF-β, IL-10, IL-17 and IL-23 in β-thalassemia major patients in comparison with healthy controls. The immunomodulatory effect of silymarin (a flavonoid complex obtained from Silybum marinum) on the serum levels of cytokines was further evaluated in thalassemia patients receiving silymarin (420 mg/day) and compared with patients treated with placebo for 6-month. Serum cytokines levels were measured by enzyme linked immunosorbent assay (ELISA). The results showed a significant higher concentration of TGF-β and IL-23 in the patient group than control group. Among studied cytokines, a significant reduction in serum IL-10 levels was found in patients treated with silymarin when compared with IL-10 values at baseline. However, no significant difference was observed between baseline values of cytokine compared with end values in placebo group. Our data suggest the presence of imbalanced immune condition involving inflammation and immunosuppression in thalassemia patients, which could be modulated to a more effective immune response by silymarin.

  2. Lived experiences of Iranian parents of beta-thalassemia children

    PubMed Central

    Shahraki-vahed, Aziz; Firouzkouhi, Mohammadreza; Abdollahimohammad, Abdolghani; Ghalgaie, Jamile

    2017-01-01

    Introduction Thalassemia is a chronic blood disease, which imposes adverse effects on patients and their families. Parents of such patients, given that they had the thalassemia trait, hold themselves responsible for their children’s disease in addition to other difficulties, bear the burden of guilt and hopelessness and worry about the health and future of their children. This study aimed to explore the lived experiences of parents of children with thalassemia. Methods The present research was conducted using a descriptive phenomenological approach. A purposive sampling was carried out until data saturation. Participants included 15 parents of children with thalassemia who were referred to the Thalassemia Center of Zabol to perform therapeutic procedures for their child in 2016. Results Extracted interviews were analyzed employing Colaizzi’s method, and four main themes were obtained, including “Gray marriage consanguinity”, “Burdened with increased number of thalassemia children”, “Socio-familial worries” and “Inexpressible wishes for having an ideal society”. Conclusion The results revealed that parents of children with thalassemia experience a wide range of problems in different aspects, such as physical, emotional, mental, social, economic and familial dimensions. Their experiences are valuable and can help in achieving a better understanding of their problems, which in turn can enable the members of the treatment team to play a more active role and the society to have a better understanding of this disease. PMID:28721064

  3. Deferasirox, deferiprone and desferrioxamine treatment in thalassemia major patients: cardiac iron and function comparison determined by quantitative magnetic resonance imaging

    PubMed Central

    Pepe, Alessia; Meloni, Antonella; Capra, Marcello; Cianciulli, Paolo; Prossomariti, Luciano; Malaventura, Cristina; Putti, Maria Caterina; Lippi, Alma; Romeo, Maria Antonietta; Bisconte, Maria Grazia; Filosa, Aldo; Caruso, Vincenzo; Quarta, Antonella; Pitrolo, Lorella; Missere, Massimiliano; Midiri, Massimo; Rossi, Giuseppe; Positano, Vincenzo; Lombardi, Massimo; Maggio, Aurelio

    2011-01-01

    Background Oral deferiprone was suggested to be more effective than subcutaneous desferrioxamine for removing heart iron. Oral once-daily chelator deferasirox has recently been made commercially available but its long-term efficacy on cardiac iron and function has not yet been established. Our study aimed to compare the effectiveness of deferasirox, deferiprone and desferrioxamine on myocardial and liver iron concentrations and bi-ventricular function in thalassemia major patients by means of quantitative magnetic resonance imaging. Design and Methods From the first 550 thalassemia subjects enrolled in the Myocardial Iron Overload in Thalassemia network, we retrospectively selected thalassemia major patients who had been receiving one chelator alone for longer than one year. We identified three groups of patients: 24 treated with deferasirox, 42 treated with deferiprone and 89 treated with desferrioxamine. Myocardial iron concentrations were measured by T2* multislice multiecho technique. Biventricular function parameters were quantitatively evaluated by cine images. Liver iron concentrations were measured by T2* multiecho technique. Results The global heart T2* value was significantly higher in the deferiprone (34±11ms) than in the deferasirox (21±12 ms) and the desferrioxamine groups (27±11 ms) (P=0.0001). We found higher left ventricular ejection fractions in the deferiprone and the desferrioxamine versus the deferasirox group (P=0.010). Liver iron concentration, measured as T2* signal, was significantly lower in the desferrioxamine versus the deferiprone and the deferasirox group (P=0.004). Conclusions The cohort of patients treated with oral deferiprone showed less myocardial iron burden and better global systolic ventricular function compared to the patients treated with oral deferasirox or subcutaneous desferrioxamine. PMID:20884710

  4. Iron-chelating effect of silymarin in patients with β-thalassemia major: A crossover randomised control trial.

    PubMed

    Darvishi-Khezri, Hadi; Salehifar, Ebrahim; Kosaryan, Mehrnoush; Karami, Hossein; Mahdavi, Mohammadreza; Alipour, Abbas; Aliasgharian, Aily

    2018-03-01

    This study aimed to determine the potential iron-chelating effects of silymarin in patients with β-thalassemia major receiving standard iron-chelation therapy. We evaluated whether addition of silymarin to standard iron-chelation therapy could improve iron burden markers and liver and cardiac function in these patients, via a placebo-controlled, crossover clinical study. Silymarin (140 mg) or placebo were administered thrice daily to all patients (n = 82) for 12 weeks, and after a 2-week washout period, patients were crossed over to the other groups. Silymarin efficacy was assessed by measuring serum iron level, ferritin level, total iron-binding capacity and liver and cardiac function on magnetic resonance imaging. Silymarin treatment resulted in a negative change in the serum iron and ferritin levels and a positive change in the total iron-binding capacity levels (treatment effect, p < .001, p = .06, and p = .05, respectively). Silymarin treatment led to positive changes in cardiac and liver function in both treatment sequences of study; however, this was not statistically significant. There was a negative change in liver iron concentration in both treatment sequences (treatment effect, p = .02). In conclusion, combined iron-chelation and silymarin therapy was effective for improving the iron-burden status in patients with β-thalassemia major. Copyright © 2017 John Wiley & Sons, Ltd.

  5. Beta thalassemia in 31,734 cases with HBB gene mutations: Pathogenic and structural analysis of the common mutations; Iran as the crossroads of the Middle East.

    PubMed

    Mahdieh, Nejat; Rabbani, Bahareh

    2016-11-01

    Thalassemia is one of the most common single gene disorders worldwide. Nearly 80 to 90 million with minor beta thalassemia and 60-70 thousand affected infants are born annually worldwide. A comprehensive search on several databases including PubMed, InterScience, British Library Direct, and Science Direct was performed extracting papers about mutation detection and frequency of beta thalassemia. All papers reporting on the mutation frequency of beta thalassemia patients were selected to analyze the frequency of mutations in different regions and various ethnicities. Mutations of 31,734 individuals were identified. Twenty common mutations were selected for further analysis. Genotype-phenotype correlation, interactome, and in silico analyses of the mutations were performed using available bioinformatics tools. Secondary structure prediction was achieved for two common mutations with online tools. The mutations were also common among the countries neighboring Iran, which are responsible for 71% to 98% of mutations. Computational analyses could be used in addition to segregation and expression analysis to assess the extent of pathogenicity of the variant. The genetics of beta thalassemia in Iran is more extensively heterogeneous than in neighboring countries. Some common mutations have arisen historically from Iran and moved to other populations due to population migrations. Also, due to genetic drift, the frequencies of some mutations have increased in small populations. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Evaluation of the children with beta-thalassemia in terms of their self-concept, behavioral, and parental attitudes.

    PubMed

    Yalçn, Siddika Songül; Durmuşoğlu-Sendoğdu, Mine; Gümrük, Fatma; Unal, Selma; Karg, Eda; Tuğrul, Belma

    2007-08-01

    This study was planned to explore the self-concept, behavioral, and parental attitudes of the children with beta-thalassemia major, and the factors that affect them. The study was undertaken between January and June 2004 at the Hacettepe University Ihsan Doğramaci Children's Hospital, Pediatric Hematology Unit, Ankara and 43 voluntary children with beta-thalassemia major on regular blood transfusion and iron chelation treatment between the ages of 5.0 and 18.0 years were included into the study. Age, sex, birth order, school performance, hemoglobin value, serum ferritin levels, associated illness, splenectomy status, presence of thalassemic sibling or relatives, death of thalassemic relatives, place of residence, maternal and paternal education were recorded. Parental Attitude Research Instrument, Piers-Harris Self-Concept Scale, and Child Behavior Checklist were applied. Higher educated mothers have lower overprotection (P=0.009), parental discordance (P=0.044), and discipline scores (P=0.002) than lower educated mothers. In cases with death of thalassemic relatives, democratic/equality attitude scores were decreased (P=0.034). With stepwise multiple linear regression analysis, splenectomy, good school achievement, absence of death of thalassemic relatives, and serum ferritin levels were found to increase Piers-Harris Self-Concept Scale; however, total behavior problem score was found to decrease with increasing age, splenectomy and decreasing overprotection subscale of Parental Attitude Research Instrument scores. The self-esteem and behavior problems of children with thalassemia depended not only on the variables related exclusively to the child (age, school achievement) and the illness-associated conditions (splenectomy, serum ferritin levels) but also on the parental attitude (overprotection).

  7. A comprehensive review of the prevalence of beta globin gene variations and the co-inheritance of related gene variants in Saudi Arabians with beta-thalassemia

    PubMed Central

    Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis

    2018-01-01

    Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482

  8. β-Thalassemia.

    PubMed

    Origa, Raffaella

    2017-06-01

    β-Thalassemia is caused by reduced (β + ) or absent (β 0 ) synthesis of the β-globin chains of hemoglobin. Three clinical and hematological conditions of increasing severity are recognized: the β-thalassemia carrier state, thalassemia intermedia, and thalassemia major, a severe transfusion-dependent anemia. The severity of disease expression is related mainly to the degree of α-globin chain excess, which precipitates in the red blood cell precursors, causing both mechanic and oxidative damage (ineffective erythropoiesis). Any mechanism that reduces the number of unbound α-globin chains in the red cells may ameliorate the detrimental effects of excess α-globin chains. Factors include the inheritance of mild/silent β-thalassemia mutations, the coinheritance of α-thalassemia alleles, and increased γ-globin chain production. The clinical severity of β-thalassemia syndromes is also influenced by genetic factors unlinked to globin genes as well as environmental conditions and management. Transfusions and oral iron chelation therapy have dramatically improved the quality of life for patients with thalassemia major. Previously a rapidly fatal disease in early childhood, β-thalassemia is now a chronic disease with a greater life expectancy. At present, the only definitive cure is bone marrow transplantation. Therapies undergoing investigation are modulators of erythropoiesis and stem cell gene therapy.Genet Med advance online publication 03 November 2016.

  9. Changing patterns of thalassemia worldwide.

    PubMed

    Vichinsky, Elliott P

    2005-01-01

    Thalassemia is a growing global public health problem with an estimated 900,000 births of clinically significant thalassemia disorders expected to occur in the next 20 years. This growth will occur in disorders previously uncommon in many parts of the world. In particular, hemoglobin (Hb) E-beta-thalassemia and Hb H disease account for much of the projected increases in thalassemia. Worldwide, Hb E-beta-thalassemia is one of the most frequent hemoglobinopathies. The incidence of Hb E approaches 60% of the populations in many regions of Southeast Asia. In coastal regions of North America, its prevalence is rapidly growing. The severity of Hb E-beta-thalassemia ranges from a complete lack of symptoms to transfusion dependence. alpha-Thalassemia diseases, often considered benign, are now recognized to be more severe than originally reported. Hb H, Hb H-Constant Spring (CS), and homozygous alpha-thalassemia affect at least a million people worldwide. California considers Hb H disease a public health problem and has initiated a neonatal screening program for Hb H and particularly Hb H-CS. Homozygous alpha-thalassemia, usually fatal, is also being more commonly detected. Several regions have initiated universal prenatal screening programs to address homozygous alpha-thalassemia. In summary, the prognosis for thalassemia disorders is improving, but prenatal diagnosis and neonatal screenings are needed. Comprehensive services that address language and social barriers as well as access to Hb F-enhancing agents and transfusions are needed.

  10. Knowledge, Attitude and Practice of Carrier Thalassemia Marriage Volunteer in Prevention of Major Thalassemia.

    PubMed

    Karimzaei, Tahmineh; Masoudi, Qolamreza; Shahrakipour, Mahnaz; Navidiyan, Ali; Jamalzae, Abd Al-Qaffar; Zoraqi Bamri, Ahmad

    2015-06-09

    Thalassemia is the most common genetic disorder and rising in the world as a health problem. Due to the criticality of this disease, in our country thalassemia prevention programs are more importance. The aim of this study was investigation of knowledge, attitude and behavior of marrying partners who were thalassemia genetic carriers in prevention of the birth of the children with major thalassemia. This study was a descriptive-analytic study. Data collection tool was a self-administered questionnaire that included 43 items. The content validity of questionnaire was investigated under the supervision of physicians, experts of health education and promotion. Its reliability was confirmed by Cronbach's Alpha test. The subjects in the study consisted of 100 marrying partners who were genetic carriers of thalassemia who referred to Premarital Counseling Center in Iranshahr City. Iranshahr is a a large city of Sistan and Balouchestan Province that located in southeast of Iran. The subjects were selected by convenience non-probability sampling method. Data analyzed using descriptive and analytic statistical tests in SPSS 16.00 and level of significance considered on α<0.05. The average age of men and women that participated in this study was 21.92 and 24 years respectively. 88% of the partners had familial relationships. The educational level of most of the men (34%) was diploma and of women (44%) was pre-diploma. The research findings showed that 7% and 62% of the subjects had poor and mediocre levels of knowledge respectively. Also results showed that only 13% of them had a satisfactory behavior and educational status had a positive correlation with knowledge, behavior, perceived susceptibility and perceived severity (P<0.05). As well there was a significant statistical relationship between gender and familial relationship, and the perceived barriers of participants. (p=0.01). The survey viewpoint of participants showed that they believed knowledge increasing (40

  11. Bias-corrected diagnostic performance of the naked-eye single-tube red-cell osmotic fragility test (NESTROFT): an effective screening tool for beta-thalassemia.

    PubMed

    Mamtani, Manju; Jawahirani, Anil; Das, Kishor; Rughwani, Vinky; Kulkarni, Hemant

    2006-08-01

    It is being increasingly recognized that a majority of the countries in the thalassemia-belt need a cost-effective screening program as the first step towards control of thalassemia. Although the naked eye single tube red cell osmotic fragility test (NESTROFT) has been considered to be a very effective screening tool for beta-thalassemia trait, assessment of its diagnostic performance has been affected with the reference test- and verification-bias. Here, we set out to provide estimates of sensitivity and specificity of NESTROFT corrected for these potential biases. We conducted a cross-sectional diagnostic test evaluation study using data from 1563 subjects from Central India with a high prevalence of beta-thalassemia. We used latent class modelling after ensuring its validity to account for the reference test bias and global sensitivity analysis to control the verification bias. We also compared the results of latent class modelling with those of five discriminant indexes. We observed that across a range of cut-offs for the mean corpuscular volume (MCV) and the hemoglobin A2 (HbA2) concentration the average sensitivity and specificity of NESTROFT obtained from latent class modelling was 99.8 and 83.7%, respectively. These estimates were comparable to those characterizing the diagnostic performance of HbA2, which is considered by many as the reference test to detect beta-thalassemia. After correction for the verification bias these estimates were 93.4 and 97.2%, respectively. Combined with the inexpensive and quick disposition of NESTROFT, these results strongly support its candidature as a screening tool-especially in the resource-poor and high-prevalence settings.

  12. 2,3,7,8-tetrachlorodibenzo-p-dioxin decrease expression of aryl hydrocarbon receptor in peripheral lymphocyte of β-thalassemia major patients.

    PubMed

    Ghatrehsamani, Mahdi; Soleimani, Masoud; Esfahani, Behjat Al-Sadat Moayedi; Hakemi, Mazdak Ganjalikhani; Shirzad, Hedayatollah; Eskandari, Nahid; Adib, Minoo

    2015-01-01

    β-thalassemia major is a hereditary disease with inefficient erythropoiesis. Level of inflammatory cytokine is elevated in these patients. In this study, we investigate the effect of aryl hydrocarbon receptor (AhR) ligand, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), on the expression of inflammatory mediators in β-thalassemia major patient's lymphocytes. Peripheral blood mononuclear cells of patients and healthy participants was isolated and cultured in favor of lymphocytes increment. Based on the treatment, we divided the cell into four groups. The orders of group's treatments were no treatment, tumor necrosis factor-α (TNF-α) treatment, TNF-α and TCDD treatment, TCDD treatment in Group 1-4, respectively. After cell culture, we extracted the cells RNA and converted them to cDNA. Real-time polymerase chain reaction was performed to assessment relative expression of caspase-1, NLRP3, and AhR. We compared all patient groups with equal healthy (control) groups. Results showed that expression of caspase-1 in patients (Groups 1 and 2) was significantly lower than healthy individuals (P < 0.05). Although, no significant difference was found (Groups 1, 2, and control) in AhR gene expression (P > 0.05). Expression of AhR in other groups of patients (3 and 4) was significantly lower than control groups (P < 0.05). Expression of caspase-1 in Group 4 was significantly larger than the control group (P < 0.001). We show here that chronic inflammation decrease caspase-1 expression and exposure of human lymphocytes to TCDD promote caspase-1 expression. Furthermore, activation of AhR with TCDD decreases AhR expression in lymphocytes of β-thalassemia major disease.

  13. Hypertriglyceridemia thalassemia syndrome.

    PubMed

    Jain, Mili; Ali, Wahid; Singh, Brijendra Bahadur; Verma, Nishant; Kumar, Ashutosh

    2018-06-14

    Hypertriglyceridemia thalassemia syndrome is a rare entity with an unknown pathogenetic link. We report a case of an 8-month-old female with thalassemia major and increased triglyceride (TG) levels. The clinical features were as in classical thalassemia except for a white discoloration of the plasma. After exclusion of familial triglyceridemia and secondary causes (hypothyroidism, nephrotic syndrome, drugs etc.), a diagnosis of hypertriglyceridemia thalassemia syndrome was made. The high levels of TG in these patients are associated with oxidative stress and higher risk of acute pancreatitis and coronary diseases. An early recognition is thus essential. In our patient, the levels reduced after a transfusion therapy similar to previous reports.

  14. HLA-matched sibling bone marrow transplantation for β-thalassemia major

    PubMed Central

    Sabloff, Mitchell; Chandy, Mammen; Wang, Zhiwei; Logan, Brent R.; Ghavamzadeh, Ardeshir; Li, Chi-Kong; Irfan, Syed Mohammad; Bredeson, Christopher N.; Cowan, Morton J.; Gale, Robert Peter; Hale, Gregory A.; Horan, John; Hongeng, Suradej; Eapen, Mary

    2011-01-01

    We describe outcomes after human leukocyte antigen-matched sibling bone marrow transplantation (BMT) for 179 patients with β-thalassemia major. The median age at transplantation was 7 years and the median follow-up was 6 years. The distribution of Pesaro risk class I, II, and III categories was 2%, 42%, and 36%, respectively. The day 30 cumulative incidence of neutrophil recovery and day 100 platelet recovery were 90% and 86%, respectively. Seventeen patients had graft failure, which was fatal in 11. Six of 9 patients with graft failure are alive after a second transplantation. The day 100 probability of acute graft-versus-host disease and 5-year probability of chronic graft-versus-host disease was 38% and 13%, respectively. The 5-year probabilities of overall- and disease-free survival were 91% and 88%, respectively, for patients with Pesaro risk class II, and 64% and 62%, respectively, for Pesaro risk class III. In multivariate analysis, mortality risks were higher in patients 7 years of age and older and those with hepatomegaly before BMT. The leading causes of death were interstitial pneumonitis (n = 7), hemorrhage (n = 8), and veno-occlusive disease (n = 6). Proceeding to BMT in children younger than 7 years before development of end-organ damage, particularly in the liver, should improve results after BMT for β-thalassemia major. PMID:21119108

  15. Myocardial and liver iron overload, assessed using T2* magnetic resonance imaging with an excel spreadsheet for post processing in Tunisian thalassemia major patients.

    PubMed

    Ouederni, Monia; Ben Khaled, Monia; Mellouli, Fethi; Ben Fraj, Elhem; Dhouib, Nawel; Yakoub, Ismehen Ben; Abbes, Selem; Mnif, Nejla; Bejaoui, Mohamed

    2017-01-01

    Thalassemia is a common genetic disorder in Tunisia. Early iron concentration assessment is a crucial and challenging issue. Most of annual deaths due to iron overload occurred in underdeveloped regions of the world. Limited access to liver and heart MRI monitoring might partially explain these poor prognostic results. Standard software programs are not available in Tunisia. This study is the first to evaluate iron overload in heart and liver using the MRI T2* with excel spreadsheet for post processing. Association of this MRI tool results to serum ferritin level, and echocardiography was also investigated. One hundred Tunisian-transfused thalassemia patients older than 10 years (16.1 ± 5.2) were enrolled in the study. The mean myocardial iron concentration (MIC) was 1.26 ± 1.65 mg/g dw (0.06-8.32). Cardiac T2* (CT2*) was under 20 ms in 30 % of patients and under 10 ms in 21 % of patients. Left ventricular ejection function was significantly lower in patients with CT2* <10 ms. Abnormal liver iron concentration (LIC >3 mg/g dw) was found in 95 % of patients. LIC was over 15 mg/g dw in 25 % of patients. MIC was more correlated than CT2* to LIC and serum ferritin. Among patients with SF <1000 μg/l, 13 % had CT2* <20 ms. Our data showed that 30 % of the Tunisian thalassemia major patients enrolled in this cohort had myocardial iron overload despite being treated by iron chelators. SF could not reliably predict iron overload in all thalassemia patients. MRI T2* using excel spreadsheet for routine follow-up of iron overload might improve the prognosis of thalassemia major patients in developing countries, such as Tunisia, where standard MRI tools are not available or expensive.

  16. Prevalence of Pulmonary Hypertension in Patients with Thalassemia Intermedia in 2009: a single center's experience.

    PubMed

    Moghaddam, Hassan Mottaghi; Badiei, Zahra; Eftekhari, Kambiz; Shakeri, Reza; Farhangi, Hamid

    2015-07-01

    There are various clinical symptoms of thalassemia intermedia, and they lie roughly between those of major and minor forms of the disease. Patients with thalassemia intermedia occasionally require blood transfusions. This renders them susceptible to pulmonary arterial hypertension (PAH) syndrome, which is one of the most significant complications in patients with thalassemia intermedia. PAH is more common in in thalassemia intermedia than in thalassemia major, and it may cause cardiac complications in patients who are older than 30. The objective of this study was to estimate the prevalence of PAH in thalassemia intermedia patients so that they can be referred expeditiously for treatment, thereby preventing the complications that occur later. This cross sectional study was conducted under the supervision of hematology department of Mashhad Medical University. Forty-one patients with thalassemia intermedia were examined at the Sarvar Thalassemia and Hemophilia Clinic of Mashhad. Electrocardiography, chest radiography, and echocardiography tests were performed for all of the patients by the same pediatric cardiologist. The data were processed by SPSS software, version 11.5, and the results were analyzed using chi-squared, Student's t, and Mann-Whitney tests. The mean age of the patients was 21.93±8.34. They had been under pediatric heart specialists' constant examination and treatment since their childhood when they were diagnosed with TI, and continue to receive regular follow-up care. The prevalence of pulmonary hypertension was 24% in our study population. In patients with thalassemia intermedia, the left ventricular (LV) mass indices were about 3-5 times higher than would be expected in a normal population. Patients with higher LV mass indices have a greater risk of developing pulmonary hypertension, and those with serum ferritin levels below 1000 ng/ml are less susceptible to diastolic dysfunction. Pulmonary hypertension is common in patients with thalassemia

  17. Anti-Toxoplasma gondii antibodies in patients with beta-hemoglobinopathies: the first report in the Americas.

    PubMed

    Ferreira, Marina Neves; Bonini-Domingos, Claudia Regina; Fonseca Estevão, Isabeth; de Castro Lobo, Clarice Lopes; Souza Carrocini, Gisele Cristina; Silveira-Carvalho, Aparecida Perpétuo; Ricci, Octávio; de Mattos, Luiz Carlos; Brandão de Mattos, Cinara Cássia

    2017-06-14

    In Brazil, there have been no previous studies of Toxoplasma gondii infection in sickle cell anemia patients and carriers of severe forms of beta-thalassemia. This study evaluated T. gondii infection in patients with beta-hemoglobinopathies. A total of 158 samples, 77 (48.7%) men and 81 (51.3%) women, were evaluated. Three groups were formed: G1 (85 patients with sickle cell disease); G2 (11 patients with homozygous beta-thalassemia; G3 (62 patients with heterozygous beta-thalassemia). ELISA was employed to identify anti-T. gondii IgM and IgG antibodies, and molecular analysis was performed to determine beta-hemoglobin mutations. Fisher's exact test was used to compare frequencies of anti-T. gondii IgM and IgG antibodies in respect to gender and age. Anti-T. gondii IgG antibodies were found in 43.5% of individuals in G1, 18.1% in G2 and 50% in G3. All samples from G1 and G2 were seronegative for anti-T. gondii IgM antibodies, but 3.2% from G3 were seropositive. Considering anti-T. gondii IgG antibodies, no statistical significant differences were found between these groups nor in seroprevalence between genders within each group. Despite this, comparisons of the mean ages between G1, G2 and G3 were statistically significant (G2 vs. G1: p value = 0.0001; G3 vs. G1: p-value <0.0001; G3 vs. G2: p-value = 0.0001). A comparison by age of patients with sickle cell anemia showed a trend of lower risk of infection among younger individuals. Therefore, this study demonstrates that T. gondii infection occurs in patients with beta-thalassemia and sickle cell anemia in Brazil as seen by the presence of anti-T. gondii IgM and IgG antibodies.

  18. Investigation of FoxO3 dynamics during erythroblast development in β-thalassemia major

    PubMed Central

    Thanuthanakhun, Naruchit; Nuntakarn, Lalana; Sampattavanich, Somponnat; Anurathapan, Usanarat; Phuphanitcharoenkun, Suphanun; Pornpaiboonstid, Savichaya; Hongeng, Suradej

    2017-01-01

    The FoxO3 transcription factor is a key regulator of oxidative stress and erythroid maturation during erythropoiesis. In this study, we explored the involvement of FoxO3 in severe β-thalassemia. Using primary CD34+ hematopoietic progenitor cells from patients with β-thalassemia major, we successfully developed an in vitro model of ineffective erythropoiesis. Based on this model, FoxO3 activity was quantified in single cells using high throughput imaging flow cytometry. This study revealed a significant reduction of FoxO3 activity during the late stage of erythroblast differentiation in β-thalassemia, in contrast to erythropoiesis in normal cells that maintain persistent activation of FoxO3. In agreement with the decreased FoxO3 activity in β-thalassemia, the expression of FoxO3 target genes was also found to decrease, concurrent with elevated phosphorylation of AKT, most clearly at the late stage of erythroid differentiation. Our findings provide further evidence for the involvement of FoxO3 during terminal erythropoiesis and confirm the modulation of the PI3K/AKT pathway as a potential therapeutic strategy for β-thalassemia. PMID:29099866

  19. Investigation of FoxO3 dynamics during erythroblast development in β-thalassemia major.

    PubMed

    Thanuthanakhun, Naruchit; Nuntakarn, Lalana; Sampattavanich, Somponnat; Anurathapan, Usanarat; Phuphanitcharoenkun, Suphanun; Pornpaiboonstid, Savichaya; Borwornpinyo, Suparerk; Hongeng, Suradej

    2017-01-01

    The FoxO3 transcription factor is a key regulator of oxidative stress and erythroid maturation during erythropoiesis. In this study, we explored the involvement of FoxO3 in severe β-thalassemia. Using primary CD34+ hematopoietic progenitor cells from patients with β-thalassemia major, we successfully developed an in vitro model of ineffective erythropoiesis. Based on this model, FoxO3 activity was quantified in single cells using high throughput imaging flow cytometry. This study revealed a significant reduction of FoxO3 activity during the late stage of erythroblast differentiation in β-thalassemia, in contrast to erythropoiesis in normal cells that maintain persistent activation of FoxO3. In agreement with the decreased FoxO3 activity in β-thalassemia, the expression of FoxO3 target genes was also found to decrease, concurrent with elevated phosphorylation of AKT, most clearly at the late stage of erythroid differentiation. Our findings provide further evidence for the involvement of FoxO3 during terminal erythropoiesis and confirm the modulation of the PI3K/AKT pathway as a potential therapeutic strategy for β-thalassemia.

  20. CLINICAL APPLICATION OF RECOMBINANT ERYTHROPOIETIN IN BETA-THALASSAEMIA INTERMEDIA.

    PubMed

    Asadov, Ch; Alimirzoyeva, Z; Hasanova, M; Mammadova, T; Shirinova, A

    2016-06-01

    Research objective is to study the efficacy of recombinant erythropoietin (epoetin alfa) as alternative method of treatment beta-thalassemia intermedia. Study involved 58 patients with beta-thalassemia intermedia (23 women and 35 men). In all observed patients was defined levels of hemoglobin (Hb), red blood cells (RBC), erythrocyte indexes (MCV, MCH, MCHC), hemoglobin fractions (HbA, HbA2, HbF), serum ferritin, serum erythropoietin before and after administrated rEPO. All patients received rEPO during 6 month at the dose - 10000 IU subcutaneously. The majority of patients - 39 (67%) had a good response to rEPO (increase in hemoglobin level more than 20 g/l); 16 patients (28%) had a mean response (increase in Hb 10 - 20 g/l); in 3 (5%) patients occurred poor response to rEPO therapy (increase in Hb <10 g/l). After rEPO treatment of beta-thalassemia intermedia patients there was a statistically significant change in the number of RBC, levels of HbF and sEPO. The evaluation of interdependence between the indices of the baseline sEPO and increased Hb values in patients after rEPO treatment revealed the presence of the reverse direct relationship (r=-0.67). Based on the results, it can be concluded that the use of rEPO in complex therapy of beta-thalassemia intermedia leads to increased levels of Hb and consequently reducing the need for blood transfusions, and accordingly expected to prevent severe complications of blood transfusion (alloimmunization, hypersplenism, iron overload, contamination transmissible infections) facilitating normal growth and development, and a better quality of life.

  1. Evaluation of tissue doppler echocardiography and T2* magnetic resonance imaging in iron load of patients with thalassemia major.

    PubMed

    Saravi, Mehrdad; Tamadoni, Ahmad; Jalalian, Rozita; Mahmoodi-Nesheli, Hassan; Hojati, Mosatafa; Ramezani, Saeed

    2013-01-01

    Iron-mediated cardiomyopathy is the main complication of thalassemia major (TM) patients. Therefore, there is an important clinical need in the early diagnosis and risk stratification of patients. The aim of this study was to evaluate the efficacy of tissue doppler imaging (TDI) to study cardiac iron overload in patients with TM using T2* magnetic resonance (MR) as the gold-standard non-invasive diagnostic test. A total of 100 TM patients with the mean age of 19±7 years and 100 healthy controls 18.8±7 years were evaluated. Conventional echocardiography, TDI, and cardiac MRI T2* were performed in all subjects. TDI measures included myocardial systolic (Sm), early (Em) and late (Am) diastolic velocities at basal and middle segments of septal and lateral LV wall. The TM patients were also subgrouped according to those with iron load (T2* ≤ 20 ms) and those without (T2* > 20 ms), and also severe (T2* ≤ 10 ms) versus the non-severe (T2* ≤ 10 ms). Using T2* cardiovascular MR, abnormal myocardial iron load (T2* ≤ 20 ms) was detected in 84% of the patients and among these, 50% (42/84) had severe (T2* ≤ 10 ms) iron load. The mean T2* was 11.6±8.6 ms (5-36.7). A negative linear correlation existed between transfusion period of patients and T2* levels (r = -0.53, p=0.02). The following TDI measures were lower in patients than in controls: basal septal Am (p<0.05), mid-septal Em and Am (p<0.05), basal lateral Am (p<0.05), mid-lateral LV wall Sm (p<0.05) and Am (p<0.05). Tissue doppler imaging is helpful in predicting the presence of myocardial iron load in Thalassemia patients. Therefore, it can be used for screening of thalassemia major patients.

  2. Sickle cell/β-thalassemia: Comparison of Sβ0 and Sβ+ Brazilian patients followed at a single institution.

    PubMed

    Benites, Bruno Deltreggia; Bastos, Stephany Oliveira; Baldanzi, Gabriel; Dos Santos, Allan de Oliveira; Ramos, Celso Dario; Costa, Fernando Ferreira; Gilli, Simone Cristina Olenscki; Saad, Sara Teresinha Olalla

    2016-12-01

    In sickle cell/β-thalassemia, mutations in the corresponding β-globin genes are responsible for complex pathological events resulting in diverse clinical complications. The objective of this study was to provide an overview of the clinical and laboratory characteristics of patients with the syndrome, and of the degree of severity of clinical manifestations resulting from the β-thalassemia mutation. A retrospective chart review was performed on 46 patients with sickle cell/β-thalassemia (31 Sβ° and 15 Sβ + ), evaluating hematological parameters and end organ damage. Statistical analyzes were carried out in order to highlight differences between the two groups according to the nature of the thalassemia mutation. As expected, patients with the Sβ 0 phenotype had a higher degree of hematological involvement in comparison to Sβ + patients; with lower hemoglobin levels, and signs of more intense chronic hemolysis. However, Sβ + patients were more prone to the occurrence of acute chest syndrome. The impact of the thalassemia mutation upon total body and bone composition was also evident, as Sβ 0 patients presented lower body mass index (BMI) and bone mineral density. The degree of bone damage correlated to lower BMI and hemoglobin levels, as well as plaquetosis, monocytosis and elevated lactate dehydrogenase, possibly reflecting the effects of hemolysis and inflammation upon bone metabolism and body constitution. This study identified significant differences among sickle cell/β-thalassemia patients according to the beta mutation involvement, pointing to an important predictor of disease severity.

  3. MRI guided iron assessment and oral chelator use improve iron status in thalassemia major patients

    PubMed Central

    Nichols-Vinueza, Diana X.; White, Matthew T.; Powell, Andrew J.; Banka, Puja; Neufeld, Ellis J.

    2017-01-01

    Oral iron chelators and magnetic resonance imaging (MRI) assessment of heart and liver iron burden have become widely available since the mid 2000s, allowing for improved patient compliance with chelation and noninvasive monitoring of iron levels for titration of therapy. We evaluated the impact of these changes in our center for patients with thalassemia major and transfusional iron overload. This single center, retrospective observational study covered the period from 2005 through 2012. Liver iron content (LIC) was estimated both by a T2* method and by R2 (Ferriscan®) technique. Cardiac iron was assessed as cT2*. Forty-two patients (55% male) with transfused thalassemia and at least two MRIs were included (median age at first MRI, 17.5 y). Over a mean follow-up period of 5.2 ± 1.9 y, 190 MRIs were performed (median 4.5 per patient). Comparing baseline to last MRI, 63% of patients remained within target ranges for cT2* and LIC, and 13% improved from high values to the target range. Both the median LIC and cT2* (cR2* = 1000/cT2*) status improved over time: LIC 7.3 to 4.5 mg/g dry weight, P = 0.0004; cR2* 33.4 to 28.3 Hz, P = 0.01. Individual responses varied widely. Two patients died of heart failure during the study period. Annual MRI iron assessments and availability of oral chelators both facilitate changes in chelation dose and strategies to optimize care. PMID:24652616

  4. Evaluation of Proteinuria in β-Thalassemia Major Patients With and Without Diabetes Mellitus Taking Deferasirox.

    PubMed

    Karimi, Mehran; Avazpour, Abbas; Haghpanah, Sezaneh; Toosi, Foroogh; Badie, Arash

    2017-01-01

    β-thalassemia is the most common heredity disease in Iran. Regular blood transfusion is critical to sustain life and normal growth. Deferasirox is an oral chelator. One of the side effects of the deferasirox is proteinuria. This study aimed to investigate the safety of deferasirox on kidney function in diabetic and nondiabetic β-thalassemia major patients. In this cross-sectional study, 34 diabetic and 36 nondiabetic patients who take deferasirox (Exjade) 20 to 40 mg/kg/d were studied. Exclusion criteria included patient with renal failure, proteinuria, hepatitis B, hepatitis C, and the patients who refused to continue the study to the end. Subjects were divided into diabetic and nondiabetic groups. Spot urine protein/creatinine ratio, urinary analysis, alanine transaminase, aspartate transaminase, creatinine, fasting blood sugar, blood urea nitrogen, and serum ferritin were checked every 3 months. Patients were followed for a period of 1 year. In the ninth month after therapy there was a significant relationship in mean change of spot urine protein/creatinine ratio between diabetic and nondiabetic (P=0.011). Spot urine protein/creatinine ratio in diabetic and nondiabetic group was 0.19±0.18 and 0.1±0.05, respectively, which showed no significant relationship between the 2 groups at the end of study (P=0.162). The results of our study showed that consumption of deferasirox is safe, as there was no significant relationship between spot urine protein/creatinine ratio in diabetic and nondiabetic group. Deferasirox consumption is not associated with increased proteinuria in diabetic patients compared with nondiabetic group having only a transient proteinuria.

  5. Electrocardiographic consequences of cardiac iron overload in thalassemia major

    PubMed Central

    Detterich, Jon; Noetzli, Leila; Dorey, Fred; Bar-Cohen, Yaniv; Harmatz, Paul; Coates, Thomas; Wood, John

    2011-01-01

    Background Iron cardiomyopathy is a leading cause of death in transfusion dependent thalassemia major (TM) patients and MRI (T2*) can recognize preclinical cardiac iron overload, but, is unavailable to many centers. Design and Methods We evaluated the ability of 12-lead electrocardiography to predict cardiac iron loading in TM. 12-lead electrocardiogram and cardiac T2* measurements were performed prospectively, with a detectable cardiac iron cutoff of T2*less than 20 ms. Patients with and without cardiac iron were compared using two-sample statistics and against population norms using age and gender-matched Z-scores. Results 45/78 patients had detectable cardiac iron. Patients having cardiac iron were older and more likely female but had comparable liver iron burdens and serum ferritin. Increased heart rate (HR) and prolonged corrected QT interval (QTc) were present, regardless of cardiac iron status. Repolarization abnormalities were the strongest predictors of cardiac iron, including QT/QTc prolongation, left shift of T-wave axis, and interpretation of ST/T-wave morphology. Recursive partitioning of the data for females using T-axis and HR and for males using QT, HR and T-axis produced algorithms with AUROC’s of 88.3 and 87.1 respectively. Conclusions Bradycardia and repolarization abnormalities on 12-lead electrocardiography were the most specific markers for cardiac iron in thalassemia major. Changes in these variables may be helpful to stratify cardiac risk when cardiac MRI is unavailable. However, diagnostic algorithms need to be vetted on larger and more diverse patient populations and longitudinal studies are necessary to determine reversibility of the observed abnormalities. PMID:22052662

  6. Phylogenetic analysis of HTLV-1 in Iranian blood donors, HIV-1 positive patients and patients with beta thalassemia.

    PubMed

    Pirayeshfard, Leila; Sharifi, Zohreh; Amini-Kafiabad, Sedigheh; Haghnazari Sadaghiani, Nasrin

    2018-04-16

    Human T-cell lymphoma virus (HTLV) has been associated with various disease types. Since the discovery of the virus in 1980, seven subtypes of the virus have been identified. HTLV is widespread and endemic in some regions, such as Japan, Africa, South America, and northeast Iran. This study aimed to identify HTLV-1 genotype and also to analyze the nucleotide sequence of the LTR region in three groups, including blood donors, HIV-1+ patients, and β-thalassemia patients. In this cross-sectional study, 2200 samples were collected from blood donors in Tehran (2000 samples), HIV-1+ patients (100 samples) and β-thalassemia patients (100 samples). All samples were screened for anti-HTLV-I&II antibodies by ELISA. Then, genomic DNA was extracted from repeatedly positive samples, and nested PCR was performed for both the TAX and LTR regions. Purified PCR products were sequenced and analyzed, and finally, a phylogenetic tree was constructed using Mega7 software. The prevalence of the anti-HTLV-I&II antibody among blood donors and HIV-1+ patients was 1.7% (34/2000) and 12% (12/100), respectively. The PCR results confirmed that 0.05% (1/2000) of blood donors, 5% (5/100) of HIV-1+ patients, and 8% (8/100) of β-thalassemia patients were HTLV-I positive. All sequences were matched to HTLV-1 subtype a, subgroup A. Our phylogenetic analysis revealed that all sequenced samples belong to the endemic clusters of Iran. HTLV-1 genotypes in all samples were similar in three groups and were derived from the strains, which had been previously reported from Iran (AF00300/Mashhad and KT190712.1/Sabzevar). © 2018 Wiley Periodicals, Inc.

  7. A Pilot Study of Noninvasive Prenatal Diagnosis of Alpha- and Beta-Thalassemia with Target Capture Sequencing of Cell-Free Fetal DNA in Maternal Blood.

    PubMed

    Wang, Wenjuan; Yuan, Yuan; Zheng, Haiqing; Wang, Yaoshen; Zeng, Dan; Yang, Yihua; Yi, Xin; Xia, Yang; Zhu, Chunjiang

    2017-07-01

    Thalassemia is a dangerous hematolytic genetic disease. In south China, ∼24% Chinese carry alpha-thalassemia or beta-thalassemia gene mutations. Given the fact that the invasive sampling procedures can only be performed by professionals in experienced centers, it may increase the risk of miscarriage or infection. Thus, most people are worried about the invasive operation. As such, a noninvasive and accurate prenatal diagnosis is needed for appropriate genetic counseling for families with high risks. Here we sought to develop capture probes and their companion analysis methods for the noninvasive prenatal detection of deletional and nondeletional thalassemia. Two families diagnosed as carriers of either beta-thalassemia gene or Southeast Asian deletional alpha-thalassemia gene mutation were recruited. The maternal plasma and amniotic fluid were collected for prenatal diagnosis. Probes targeting exons of the genes of interest and the highly heterozygous SNPs within the 1Mb flanking region were designed. The target capture sequencing was performed with plasma DNA from the pregnant woman and genomic DNA from the couples and their children. Then the parental haplotype was constructed by the trios-based strategy. The fetal haplotype was deduced from the parental haplotype with a hidden Markov model-based algorithm. The fetal genotypes were successfully deduced in both families noninvasively. The noninvasively constructed haplotypes of both fetuses were identical to the invasive prenatal diagnosis results with an accuracy rate of 100% in the target region. Our study demonstrates that the effective noninvasive prenatal diagnosis of alpha-thalassemia and beta-thalassemia can be achieved with the targeted capture sequencing and the haplotype-assisted analysis method.

  8. Cardiac tamponade as a manifestation of extrapulmonary tuberculosis in β thalassemia major patient

    NASA Astrophysics Data System (ADS)

    Harahap, S.; Pramudita, A.; Lusiani

    2018-03-01

    Cardiac tamponade is a medical emergency condition. Rapid diagnosis and determination of the etiology with epidemiologic consideration may lead to earlier treatment and improved survival. Occasionally, the etiology may be clearly related to a recognized underlying disease, but the possibility of unrelated etiologies should be considered. Pericarditis tuberculosis, a rare manifestation of extrapulmonary tuberculosis in a non-HIV patient, has to be deliberate as one of the etiology, especially in the endemic area. Here, we report a case of 28 years old male with β thalassemia major presented with excessive exertion breathlessness progressing to orthopnea. Sign of cardiac tamponade was identified from echocardiography which showed large pericardial effusion with swinging heart and right atrial systolic collapse. Pericardiocentesis was performed immediately, drained 870 ml of hemorrhagic fluid from inserted pigtail. The patient was treated with the anti-tuberculosis regimen and oral corticosteroid after real-time polymerase chain reaction of Mycobacterium tuberculosis positivity in pericardial fluid. MRI T2 confirmed no haemosiderosis in patient’s heart. After treatment, the patient responded well and showed clinical improvement.

  9. Thalassemia

    MedlinePlus

    ... disorder that affects the way the body makes hemoglobin. Hemoglobin is the part of red blood cells that ... alpha globin and beta globin; these proteins make hemoglobin. In thalassemia, a gene that makes these proteins ...

  10. A confidential inquiry estimating the number of patients affected with sickle cell disease and thalassemia major confirms the need for a prevention strategy in the Netherlands.

    PubMed

    Giordano, Piero C; Bouva, Marelle J; Harteveld, Cornelis L

    2004-01-01

    We have conducted a broad confidential inquiry among 401 hospital departments trying to estimate the number of patients affected with severe forms of hemoglobinopathies living in The Netherlands. With less than 30% response we have registered 559 patients in all age categories of whom 77.0% are affected with sickle cell disease and 17.5% with beta-thalassemia (thal) major. We estimate that the real figure could be around 800 patients, a figure more than six times higher than the number published in 1995 on which the reluctance to offer prevention was based. The actual figures and the incidence estimation of approximately 60 patients a year underline the urgent need for the official implementation of a prevention strategy in The Netherlands. During the last 5 years we have been working towards the implementation of a multi-intervention strategy for primary prevention using the existing structures of public health. The obstacles we have encountered to endorse such a strategy are discussed as a possible guide for other immigration countries.

  11. Quantitative T2* magnetic resonance imaging for evaluation of iron deposition in the brain of β-thalassemia patients.

    PubMed

    Akhlaghpoor, S; Ghahari, A; Morteza, A; Khalilzadeh, O; Shakourirad, A; Alinaghizadeh, M R

    2012-09-01

    Iron overload is a common clinical problem in patients with β-thalassemia major. The purpose of this study was to assess the presence of excess iron in certain areas of the brain (thalamus, midbrain, adenohypophysis and basal ganglia) in patients with β-thalassemia major and evaluate the association with serum ferritin and liver iron content. A cross-sectional study on 53 patients with β-thalassemia major and 40 healthy controls was carried out. All patients and healthy controls underwent magnetic resonance imaging (MRI) examinations of the brain and liver. Multiecho fast gradient echo sequence was used and T2* values were calculated based on the Brompton protocol. Correlations between T2* values in the brain with T2* values in the liver as well as serum ferritin levels were investigated. There were no significant differences between patients and healthy controls with respect to age and sex. Patients had significantly lower T2* values in basal ganglia (striatum), thalamus and adenohypophysis compared to controls while there were no differences in the midbrain (red nucleus). There were no significant correlations between liver T2* values or serum ferritin with T2* values of basal ganglia (striatum), thalamus and adenohypophysis in patients or healthy controls. There were no significant correlations between T2* values of adenohypophysis and thalamus or basal ganglia (striatum) while these variables were significantly correlated in healthy controls. Serum ferritin and liver iron content may not be good indicators of brain iron deposition in patients with β thalassemia major. Nevertheless, the quantitative T2* MRI technique is useful for evaluation of brain iron overload in β thalassemia major patients.

  12. Beta Thalassemia (For Parents)

    MedlinePlus

    ... July 2015 More on this topic for: Parents Kids Teens Blood Transfusions Iron Iron-Deficiency Anemia Blood Test: Hemoglobin Electrophoresis Sickle Cell Disease Alpha Thalassemia Anemia Word! Anemia About Anemia Stem Cell Transplants Blood Transfusions Anemia Sickle Cell Disease ...

  13. Pulmonary hypertension associated with thalassemia syndromes

    PubMed Central

    Fraidenburg, Dustin R.; Machado, Roberto F.

    2016-01-01

    Chronic hemolytic anemia has increasingly been identified as an important risk factor for the development of pulmonary hypertension. Within the thalassemia syndromes, there are multiple mechanisms, both distinct and overlapping, by which pulmonary hypertension develops and that differ among β-thalassemia major or intermedia patients. Pulmonary hypertension in β-thalassemia major correlates with the severity of hemolysis, yet in patients whose disease is well treated with chronic transfusion therapy, the development of pulmonary hypertension can be related to cardiac dysfunction and the subsequent toxic effects of iron overload rather than hemolysis. β-thalassemia intermedia, on the other hand, has a higher incidence of pulmonary hypertension owing to the low level of hemolysis that exists over years without the requirement for frequent transfusions, while splenectomy is shown to play an important role in both types. Standard therapies such as chronic transfusion have been shown to mitigate pulmonary hypertension, and appropriate chelation therapy can avoid the toxic effects of iron overload, yet is not indicated in many patients. Limited evidence exists for the use of pulmonary vasodilators or other therapies, such as l-carnitine, to treat pulmonary hypertension associated with thalassemia. Here we review the most recent findings regarding the pathogenic mechanisms, epidemiology, presentation, diagnosis, and treatment of pulmonary hypertension in thalassemia syndromes. PMID:27008311

  14. The frequency of hypothyroidism and its relationship with HCV positivity in patients with thalassemia major in southern Iran.

    PubMed

    Haghpanah, Sezaneh; Jelodari, Shohreh; Karamifar, Hammdollah; Saki, Forough; Rahimi, Rahil; De Sanctis, Vincenzo; Dehbozorgian, Javad; Karimi, Mehran

    2018-03-27

    Hypothyroidism is one the most complication due to iron overload in patients with β-thalassemia major (TM). On the other hand these patients are prone to Hepatitis C virus (HCV) infection that can cause  thyroid dysfunction by itself or as the side effect of treatment with interferon (INF) or IFN plus ribavirin. The aim of this study is to evaluate the association of hypothyroidism with HCV positivity and serum ferritin levels in patients with TM. In this cross-sectional study, 201 randomly selected patients with TM who were registered at the Thalassemia Clinic of a tertiary hospital in Shiraz, southern Iran were investigated. Thyroid function tests and serologic screening assays for HCV seropositivity (HCV Ab and HCV-RNA) were conducted for all patients. Frequency of hypothyroidism was 22.9% including 19.9% subclinical hypothyroidism, 2% primary overt hypothyroidism and 1% central hypothyroidism. Eighty six patients (42.8%) were HCV Ab positive and 60 patients (29.9%) were HCV RNA positive. No significant relationship was found between hypothyroidism and HCV positivity or receiving IFN-α (P>0.05). Hypothyroidism showed a borderline significant association with high serum ferritin levels in TM patients (P=0.055). Our results showed no significant association between hypothyroidism and HCV infection in TM patients. It seems that the main mechanism of hypothyroidism in our patients is iron overload; however, for better evaluation a larger multicenter study is recommended.  Also due to the importance of consequences of HCV infection, more careful pre-transfusional screening of blood should be considered in TM patients.

  15. Study of Serum Haptoglobin Level and its Relation to Erythropoietic Activity in Beta Thalassemia Children

    PubMed Central

    Ragab, Seham M.; Safan, Manal A.; Badr, Eman A.

    2015-01-01

    Background Serum haptoglobin (Hp) is a reliable marker for hemolysis regardless the inflammatory state. Objective We investigated the possible relation between Hp depletion and hemolysis severity, hepatitis C virus (HCV) infection and iron load in β-thalassemia children. Methods Twenty two β-thalassemia major (TM),20 β-thalassemia intermedia (TI) children with 20 age and sex matched healthy controls were involved. Pre-transfusion hemoglobin level was considered. Serum ferritin, Hp and transferrin receptor levels (sTfR) (by ELISA ), alanine aminotransferase (ALT) and aspartate aminotransferase (AST) (by colorimetric method) were assayed. Markers of hepatitis C virus (HCV) were done by PCR. Results The mean Hp levels among the studied groups were as follows; 8.02 ± 0.93 (mg/dl), 8.6 ±0.72 (mg/dl) and 122 ± 18.5(mg/dl) for TM, TI and the controls respectively. Both patient groups had significantly lower Hp level compared to the controls (P<0.0001) with significant lower level in TM compared to TI children ( P= 0.034). Significant inverse correlations were found between serum Hp and sTfR levels ( reflecting the erythropoietic activity) in thalassemia children combined and in each group (TM and TI) as well as among HCV infected children. STfR was the only significant independent predictor for serum Hp level (t= −5.585, P<0.0001). Among HCV infected patients, no significant correlation was found between serum Hp and serum transaminases. Conclusion Serum Hp depletion in thalassemia had significant relation to disease severity and correlated well with their erythropoietic activity, as assessed by the measurement of sTfR without significant relation to HCV infection. Extensive multicenter studies are recommended. PMID:25745546

  16. Impact of beta thalassemia on maxillary sinuses and sino-nasal passages: A case control study.

    PubMed

    Ragab, Ahmed; Ragab, Seham Mohammed; Shawki, Mohammed

    2015-12-01

    Skeletal changes among beta (β) thalassemia children are well documented, but without available data regarding sino-nasal passages alterations. The authors investigated the maxillary sinuses and sino-nasal passages changes in β-thalassemia children and correlated such changes with the amount of transfused red cells and the erythroid marrow activity. Clinical analyses including otorhinolaryngical examination (ORL) were obtained in twenty β-thalassemia children and 20 matched healthy controls. Hemoglobin (Hb), serum ferritin, soluble transferrin receptor (sTfR) levels and bone mineral density of the lumbar spine (BMD ls) were assayed. The two groups were analyzed for the CT image parameters: bone thickness, anterior and posterior choanae diameters, extramedullary hematopoiesis and chronic rhinosinusitis (CRS) RESULTS: Nasal congestion/obstruction was identified in 14 (70%) children. Eight patients (40%) had criteria of chronic rhinosinusitis. In comparison with the normal controls, the increase in the roof, floor, medial, anterior, lateral and posterior maxillary bony walls thickness was significantly higher (1.26, 2.46, 2.6, 2.9, 3.23 and 5.34-folds, respectively). The mean posterior choanae horizontal, vertical diameters and their surface area were significantly reduced in the patients compared to the controls. The mean anterior maxillary wall bone thickness directly correlated with sTfR (P=0.047) while that of the posterior wall correlated inversely with Hb level (P=0.013). The mean vertical posterior choanae diameter had positive correlation with the amount of transfused red cells (P=0.001) and negative correlation with sTfR (P=0.001). The Hounsfield unit of maxillary sinus wall had direct relation with BMDls (P=0.003) CONCLUSIONS: Thalassemia children are at risk of different folds increase of maxillary sinuses walls thicknesses utmost at posterior and lateral walls. Other sino-nasal morbidities include diminished posterior choanal diameter, nasal obstruction

  17. Could Heterozygous Beta Thalassemia Provide Protection Against Multiple Sclerosis?

    PubMed Central

    Cikrikcioglu, Mehmet Ali; Ozcan, Muhammed Emin; Halac, Gulistan; Gultepe, Ilhami; Celik, Kenan; Sekin, Yahya; Eser, Elif Ece; Burhan, Sebnem; Cetin, Guven; Uysal, Omer

    2016-01-01

    Background Heterozygous beta thalassemia (HBT) has been proposed to increase the risk of developing autoimmune disease. Our aim in this study was to examine the prevalence of HBT among multiple sclerosis (MS) patients. Material/Methods HBT frequency was investigated in our MS group (243 patients with MS). Hemoglobin electrophoresis (HE) was carried out if MS patients had a mean corpuscular volume of (MCV) <80 fL and a mean corpuscular hemoglobin level of (MCH) <27 pg/L according to a complete blood count (CBC). If MCV was lower than 80 fL, MCH was lower than 27 pg/L, and Hemoglobin A2 equal to or higher than 3.5%, a diagnosis of HBT was established. The frequency of patients with HBT in our MS patient group was statistically compared with the prevalence of HBT in the city of Istanbul, where our MS patients lived. Results The HBT prevalence was 0.823% (2 patients) in the MS patient group. The prevalence of HBT in Istanbul has been reported to be 4.5%. According to the z-test, the HBT prevalence in our MS patient group was significantly lower than that in Istanbul (Z=6.3611, two-sided p value <0.0001, 95% confidence interval of prevalence of HBT in our MS patient group: 0.000998–0.029413). Conclusions Contrary to our hypothesis at the outset of study, the reduced HBT prevalence in the MS group compared to HBT frequency in the city of Istanbul might indicate that HBT is protective against MS. PMID:27941710

  18. Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

    PubMed

    de-la-Cruz-Salcedo, E I; Ibarra, B; Rizo-de-la-Torre, L C; Sánchez-López, J Y; González-Mercado, A; Harteveld, C L; Perea-Díaz, F J

    2016-10-01

    Alpha-thalassemia (α-thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α-thal and beta-thalassemia (β-thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α- and β-thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2 . Common deletional alleles (-α(3.7) , -α(4.2) , - -(SEA) , - -(MED) , - -(FIL) , - -(THAI) , -α(20.5) ) and α-triplication were studied by gap-PCR and nondeletional alleles (α(IVSI) ((-5nt)) , α2 (NcoI) , α1 (NcoI) ) by ARMS. β-thal alleles Cd39 (C>T), IVS1:1 (G>A), IVS1:110 (G>A), and Spanish δβ-thal were also investigated. DNA sequencing was performed on HBA2, HBA1, and HBB genes. Negative samples were subjected to MLPA. In 35 subjects, we identified the mutations, -α(3.7) , - -(SEA) , - -(FIL) , α(IVSI) ((-5nt)) , and ααα(anti3.7) and two novel deletion alleles - -(Mex1) (6.8-8.9 kb) and - -(Mex2) (77.6-135.7 kb). Four individuals also had a β-thal allele (Cd39/IVS1:110). No α-thal alleles were observed in 16 subjects, but three had a β-thal mutation Cd39, IVS1:110, and Spanish δβ-thal. α-thal is relatively common in Mexican patients, the combination with β-thal is sometimes unexpected, and this underlines the importance of performing molecular analysis for both α- and β-genes defects in patients showing microcytic hypochromic anemia. © 2016 John Wiley & Sons Ltd.

  19. The impact of silymarin on antioxidant and oxidative status in patients with β-thalassemia major: A crossover, randomized controlled trial.

    PubMed

    Darvishi-Khezri, Hadi; Salehifar, Ebrahim; Kosaryan, Mehrnoush; Karami, Hossein; Alipour, Abbas; Shaki, Fatemeh; Aliasgharian, Aily

    2017-12-01

    Blood transfusion therapy is lifesaving for individuals with β-thalassemia major (β-TM). Iron burden following blood transfusion is the main cause of oxidative stress (OS) and organ dysfunction in these patients. The aim of this study was to evaluate the effects of silymarin on serum antioxidant and oxidative status in patients with β-TM. A crossover, randomized controlled trial was performed on 82 thalassemia patients. In two periods of 12 weeks, patients received 420mg silymarin (divided into three equal 140-mg daily doses) and placebo. The washout period between the two phases was two weeks. Serum malondialdehyde (MDA), protein carbonyl (CO), total antioxidant capacity (TAC), and reduced glutathione (GSH) were measured before and after both periods. Sixty-nine patients completed the study. Mean serum MDA and protein CO significantly decreased in all patients with β-TM after three months of treatment with silymarin. At the end of the study, serum MDA decreased from 20.36±20.11 to 4.79±4.71μmol/l (compared to 17.81±16.05μmol/l after administration of placebo), and protein CO dropped from 0.31±0.28 to 0.11±0.09mM/l (compared to 0.24±0.17mM/l with placebo). Additional laboratory parameters (such as serum TAC and plasma GSH) were also significantly elevated after therapy with silymarin. At the end of the study, serum TAC increased in all patients from 620.7±202.64 to 971.83±328.16μmol FeSO 4 /l (compared to 672.22±206.88μmol FeSO 4 /l with placebo), and GSH increased from 46.16±41.68 to 195.35±210.98nM/l (compared to 58.52±48.95nM/l with placebo). The treatment effect of silymarin was measured using a mixed-effects model of variance analysis for changes in MDA, protein CO, TAC, and GSH, with significant effects being demonstrated for each laboratory parameter (P<0.001, P=0.002, P<0.001, and P<0.001, respectively). Silymarin was effective in decreasing serum OS and enhancing serum antioxidant capability in patients with β-thalassemia major

  20. Inadequate Dietary Intake in Patients with Thalassemia

    PubMed Central

    Fung, Ellen B.; Xu, Yan; Trachtenberg, Felicia; Odame, Isaac; Kwiatkowski, Janet L.; Neufeld, Ellis J.; Thompson, Alexis A.; Boudreaux, Jeanne; Quinn, Charles T.; Vichinsky, Elliott P.

    2012-01-01

    Background Patients with thalassemia have low circulating levels of many nutrients, but the contribution of dietary intake has not been assessed. Objective Assess dietary intake in a large contemporary sample of patients with thalassemia. Design Prospective, longitudinal cohort study using a validated food frequency questionnaire Participants 221 patients (19.7±11.3 yrs, 106 female) categorized into three age groups: young children (3–7.9 y), older children/adolescents (8–18.9 yr), and adult (≥ 19 yr). 78.8% β-thalassemia; 90% chronically transfused. Setting 10 hematology outpatient clinics in the United States and Canada. Main outcome measures Comparison of intake with U.S. Dietary Reference Intakes, and correlation with serum 25-OH vitamin D and total body iron stores. Statistical Analyses Performed Intake was defined as inadequate if less than the estimated average requirement (EAR). Chi-square, Fisher’s exact and Student’s t-test were utilized to compare intake between age categories and logistic regression analysis to test the relationship between intake and outcomes, controlling for age, gender and race. Results Over 30% of patients consumed inadequate levels of vitamin A, D, E, K, folate, calcium, and magnesium. The only nutrients for which >90% of patients consumed adequate amounts were riboflavin, vitamin B12 and selenium. Dietary inadequacy increased with increasing age group (p<0.01) for vitamins A, C, E, B6, folate, thiamin, calcium, magnesium and zinc. Over half the sample took additional supplements of calcium and vitamin D, although circulating levels of 25-OH vitamin D remained insufficient in 61% of patients. Dietary iron intake was not related to total body iron stores. Conclusion Patients with thalassemia have reduced intake of many key nutrients. These preliminary findings of dietary inadequacy is concerning and supports the need for nutritional monitoring to determine which patients are at greatest risk for nutritional deficiency

  1. β-Thalassemia Intermedia: A Clinical Perspective

    PubMed Central

    Musallam, Khaled M.; Taher, Ali T.; Rachmilewitz, Eliezer A.

    2012-01-01

    Our understanding of the molecular and pathophysiological mechanisms underlying the disease process in patients with β-thalassemia intermedia has substantially increased over the past decade. Earlier studies observed that patients with β-thalassemia intermedia experience a clinical-complications profile that is different from that in patients with β-thalassemia major. In this article, a variety of clinical morbidities are explored, and their associations with the underlying disease pathophysiology and risk factors are examined. These involve several organs and organ systems including the vasculature, heart, liver, endocrine glands, bone, and the extramedullary hematopoietic system. The effects of some therapeutic interventions on the development of clinical complications are also discussed. PMID:22762026

  2. [Prevalence survey and molecular characterization of alpha and beta thalassemia in Liuzhou city of Guangxi].

    PubMed

    Cai, Ren; Li, Liyan; Liang, Xin; Liu, Zhongying; Su, Liu; Li, Wenjun; Zhu, Qiangui; Mo, Qiuhua; Pan, Lizhen; Ouyang, Hong; Huang, Lihua; Xu, Xiangmin

    2002-08-01

    To investigate the gene frequencies and mutation patterns of alpha thalassemia (alpha-thal) and beta thalassemia (beta-thal) in Liuzhou city of Guangxi Zhuang Autonomous Region. Cluster sampling was used. A total of 1 028 of umbilical blood samples were collected for a prevalence study of alpha-thal and a total of 1 312 healthy young people when receiving pre-marriage consultation were recruited for a beta-thal prevalence survey. Individuals live in city or town area of Liuzhou. A complete blood count as well as hemoglobin electrophoresis analysis were done in all of samples for phenotyping of alpha and beta-thals. Those with Hb Bart's for alpha-thal indicator and those with both microcytosis (MCV < 85 fl) and elevated levels of Hb A(2) (>/=4.0%) for beta-thal were further studied by DNA analysis. PCR-based methodologies were used to characterize the mutation contributions of alpha and beta-thals. All the subjects were tested for the state of carrying beta-thala alleles for evaluating the situation of the compound heterozygotes of alpha-thal with beta-thal. Of 1 028 random samples of umbilical blood screened, 112 of subjects were defined to be the gene carriers of alpha-thal. The alpha-thal carrier rate was as high as 11.19% including 3 compound heterozygotes. Five well-known types of alpha-thal alleles were detected with gene contributions of 37.4% (--(SEA) deletion), 31.3% (-alpha(3.7) deletion), 17.4% (-alpha(4.2) deletion), 12.1% (alpha(CS)alpha mutation), and 0.9% (alpha(QS)alpha mutation), successively. Of the 1 312 adult specimens studied, 89 with beta-thal including 14 of the compound higher Hb F subjects were detected. All of the 89 phenotypic beta-thal carriers had the mutations in the beta-globin gene, making the overall prevalence 6.78%. The commonly seen three mutations, beta CD41 - 42 (-CTTT) frameshift, beta CD17 (T-A) nonsense mutation and beta-28 (A-G) promoter variation were accounted for 90% of the beta-thal alleles in Liuzhou. Of these beta

  3. Hydroxycarbamide-Induced Changes in E/beta Thalassemia Red Blood Cells

    PubMed Central

    Sylvia, Singer T.; Elliott, Vichinsky; Sandra, Larkin; Nancy, Olivieri; Nancy, Sweeters; Frans, Kuypers A.

    2010-01-01

    In thalassemia, fetal hemoglobin (HbF) augmentation with hydroxycarbamide (also known as hydroxyurea) is not always successful. The expected parallel effects on RBC membrane deformability, cell hydration and membrane phospholipid organization, all important for extending RBC life span and increasing Hb, have been infrequently examined. We analyzed these characteristics in 15 non-transfused E/β 0 thalassemia patients treated with HU (mean 10.2 months). Membrane deformability and cell hydration mildly improved in association with increased HbF levels approaching statistical significance (r = 0.51, p=0.06). All measures improved considerably splenectomized patients. These findings underscore the disappointing results of hydroxyurea treatment in clinical trials; and the importance of examining the effect on red cell characteristics for the development and understanding of HbF-enhancing agents. PMID:18821710

  4. The prevalence of zinc deficiency in patients with thalassemia in South East of iran, sistan and baluchistan province.

    PubMed

    Mashhadi, Mohammad Ali; Sepehri, Zahra; Heidari, Zahra; Shirzaee, Eghbal; Kiani, Zohre

    2014-08-01

    There are different and controversial reports about zinc deficiency in patients with major thalassemia. The aim of this study was to evaluate zinc status in patients with major thalassemia in Sistan and Baluchistan province, southeastern Iran. The study was performed in Ali Asghar Hospital, a specialized governmental hospital located in Zahedan, Iran. In this cross-sectional study, 369 patients with a history of major thalassemia for more than 5 years entered the study using convenience sampling method. Thirty-six subjects were excluded from the study based on our exclusion criteria. Zinc level was measured in all patients after 12 hours fasting using atomic absorption spectrometry method in 2012. Of 369 cases, 333 patients were eligible and evaluated. The mean age was 15.63 ± 7.4 years. One hundred ninety two cases were male and others were female (141 cases). About 27% (90) of the cases were 5-10 years-old, 24% (80) were 10-15 years-old and 49% were older than 15 years old. Iron chelator in 65.46% was Desferrioxamine, in 28.2% was Deferasirox and in 19.5% was combination of Desferrioxamine and Deferiprone. All cases had zinc deficiency, and 98.5% had severe zinc deficiency. Others (1.5%) had mild deficiency. Our study on 333 patients with major thalassemia documented severe zinc deficiency in all cases. We had no cases with normal or increased zinc levels. It was different with other reports in the world.

  5. Diagnosis and treatment of cardiac iron overload in transfusion-dependent thalassemia patients.

    PubMed

    Siri-Angkul, Natthaphat; Chattipakorn, Siriporn C; Chattipakorn, Nipon

    2018-05-18

    Thalassemia is among the most common genetic diseases. Patients with severe forms of the disease are transfusion-dependent, leading to iron overload. A condition which can eventually develop in the iron-loaded heart is iron overload cardiomyopathy, a debilitating disease that accounts for the majority of deaths in thalassemia patients. Areas covered: This review article provides a comprehensive summary of the diagnosis and treatment of cardiac iron overload in transfusion-dependent thalassemia patients, with discussion covering current weak points and potential improvements of the relevant diagnostic and therapeutic strategies. Expert commentary: Current limitations of various diagnostic techniques for iron overload cardiomyopathy include suboptimal accuracy, untimely detection, or inadequate accessibility, and novel modalities are required to overcome these shortcomings. Treatment should address key pathophysiologic mechanisms of iron overload cardiomyopathy, which include cardiac iron mishandling and iron-induced oxidative injury. Apart from the promotion of iron removal by chelators, prevention of cardiac iron deposition and attenuation of oxidative damage should also be rigorously investigated on a cell-to-bedside basis.

  6. A National Registry of Thalassemia in Turkey: Demographic and Disease Characteristics of Patients, Achievements, and Challenges in Prevention

    PubMed Central

    Aydınok, Yeşim; Oymak, Yeşim; Atabay, Berna; Aydoğan, Gönül; Yeşilipek, Akif; Ünal, Selma; Kılınç, Yurdanur; Oflaz, Banu; Akın, Mehmet; Vergin, Canan; Sezgin Evim, Melike; Çalışkan, Ümran; Ünal, Şule; Bay, Ali; Kazancı, Elif; İleri, Talia; Atay, Didem; Patıroğlu, Türkan; Kahraman, Selda; Söker, Murat; Akcan, Mediha; Akdeniz, Aydan; Büyükavcı, Mustafa; Alanoğlu, Güçhan; Bör, Özcan; Soyer, Nur; Özdemir Karadaş, Nihal; Uysalol, Ezgi; Türker, Meral; Akçay, Arzu; Ocak, Süheyla; Güneş, Adalet Meral; Tokgöz, Hüseyin; Ünal, Elif; Tiftik, Naci; Karakaş, Zeynep

    2018-01-01

    Objective: The Turkish Society of Pediatric Hematology set up a National Hemoglobinopathy Registry to demonstrate the demographic and disease characteristics of patients and assess the efficacy of a hemoglobinopathy control program (HCP) over 10 years in Turkey. Materials and Methods: A total of 2046 patients from 27 thalassemia centers were registered, of which 1988 were eligible for analysis. This cohort mainly comprised patients with β-thalassemia major (n=1658, 83.4%) and intermedia (n=215, 10.8%). Results: The majority of patients were from the coastal areas of Turkey. The high number of patients in Southeastern Anatolia was due to that area having the highest rates of consanguineous marriage and fertility. The most common 11 mutations represented 90% of all β-thalassemia alleles and 47% of those were IVS1-110(G->A) mutations. The probability of undergoing splenectomy within the first 10 years of life was 20%, a rate unchanged since the 1980s. Iron chelators were administered as monotherapy regimens in 95% of patients and deferasirox was prescribed in 81.3% of those cases. Deferasirox administration was the highest (93.6%) in patients aged <10 years. Of the thalassemia major patients, 5.8% had match-related hemopoietic stem cell transplantation with a success rate of 77%. Cardiac disease was detected as a major cause of death and did not show a decreasing trend in 5-year cohorts since 1999. Conclusion: While the HCP has been implemented since 2003, the affected births have shown a consistent decrease only after 2009, being at lowest 34 cases per year. This program failure resulted from a lack of premarital screening in the majority of cases. Additional problems were unawareness of the risk and misinformation of the at-risk couples. In addition, prenatal diagnosis was either not offered to or was not accepted by the at-risk families. This study indicated that a continuous effort is needed for optimizing the management of thalassemia and the development of

  7. A National Registry of Thalassemia in Turkey: Demographic and Disease Characteristics of Patients, Achievements, and Challenges in Prevention.

    PubMed

    Aydınok, Yeşim; Oymak, Yeşim; Atabay, Berna; Aydoğan, Gönül; Yeşilipek, Akif; Ünal, Selma; Kılınç, Yurdanur; Oflaz, Banu; Akın, Mehmet; Vergin, Canan; Sezgin Evim, Melike; Çalışkan, Ümran; Ünal, Şule; Bay, Ali; Kazancı, Elif; İleri, Talia; Atay, Didem; Patıroğlu, Türkan; Kahraman, Selda; Söker, Murat; Akcan, Mediha; Akdeniz, Aydan; Büyükavcı, Mustafa; Alanoğlu, Güçhan; Bör, Özcan; Soyer, Nur; Özdemir Karadaş, Nihal; Uysalol, Ezgi; Türker, Meral; Akçay, Arzu; Ocak, Süheyla; Güneş, Adalet Meral; Tokgöz, Hüseyin; Ünal, Elif; Tiftik, Naci; Karakaş, Zeynep

    2018-03-01

    The Turkish Society of Pediatric Hematology set up a National Hemoglobinopathy Registry to demonstrate the demographic and disease characteristics of patients and assess the efficacy of a hemoglobinopathy control program (HCP) over 10 years in Turkey. A total of 2046 patients from 27 thalassemia centers were registered, of which 1988 were eligible for analysis. This cohort mainly comprised patients with β-thalassemia major (n=1658, 83.4%) and intermedia (n=215, 10.8%). The majority of patients were from the coastal areas of Turkey. The high number of patients in Southeastern Anatolia was due to that area having the highest rates of consanguineous marriage and fertility. The most common 11 mutations represented 90% of all β-thalassemia alleles and 47% of those were IVS1-110(G->A) mutations. The probability of undergoing splenectomy within the first 10 years of life was 20%, a rate unchanged since the 1980s. Iron chelators were administered as monotherapy regimens in 95% of patients and deferasirox was prescribed in 81.3% of those cases. Deferasirox administration was the highest (93.6%) in patients aged <10 years. Of the thalassemia major patients, 5.8% had match-related hemopoietic stem cell transplantation with a success rate of 77%. Cardiac disease was detected as a major cause of death and did not show a decreasing trend in 5-year cohorts since 1999. While the HCP has been implemented since 2003, the affected births have shown a consistent decrease only after 2009, being at lowest 34 cases per year. This program failure resulted from a lack of premarital screening in the majority of cases. Additional problems were unawareness of the risk and misinformation of the at-risk couples. In addition, prenatal diagnosis was either not offered to or was not accepted by the at-risk families. This study indicated that a continuous effort is needed for optimizing the management of thalassemia and the development of strategies is essential for further achievements in the

  8. Quality of Life in Children with Thalassemia and their Caregivers in India.

    PubMed

    Sharma, Sapna; Seth, Bageshree; Jawade, Prashant; Ingale, Madhavi; Setia, Maninder Singh

    2017-03-01

    To assess and compare the Quality of Life (QOL) of children with beta-thalassemia major on regular transfusion therapy with normal children, and of the caregivers of children with beta-thalassemia major to that of caregivers of normal children. A cross-sectional comparison of QOL in 75 thalassemic and 80 non-thalassemic children was conducted using the PedsQL™ 4.0 generic core scale. Also self-rated health was assessed in their caregivers using Short Form-36 Health Survey. The total QOL score according to child-self report [83.7 (10.8) vs. 97.6 (3.3); p < 0.001] and parent-proxy report [84.2 (11.9) vs. 96.7 (3.5); p < 0.001] was significantly lower in cases as compared with controls. It was found that a significantly higher proportion of caregivers of cases reported poor health compared with caregivers of controls (29.2% vs. 2.5%, p < 0.001). Even after adjusting for age, sex, socio-economic status, and total QOL score by the parent, it was found that caregivers of thalassemic children were significantly more likely to report poor health compared with those of controls (odds ratio: 15.8, 95% confidence intervals: 2.8-89.9). Health Related QOL is significantly affected in children with beta-thalassemia major on regular transfusion across all age groups, gender and socio-economic classes and also in their caregivers.

  9. The Prevalence of Zinc Deficiency in Patients With Thalassemia in South East of Iran, Sistan and Baluchistan Province

    PubMed Central

    Mashhadi, Mohammad Ali; Sepehri, Zahra; Heidari, Zahra; Shirzaee, Eghbal; Kiani, Zohre

    2014-01-01

    Background: There are different and controversial reports about zinc deficiency in patients with major thalassemia. Objectives: The aim of this study was to evaluate zinc status in patients with major thalassemia in Sistan and Baluchistan province, southeastern Iran. Patients and Methods: The study was performed in Ali Asghar Hospital, a specialized governmental hospital located in Zahedan, Iran. In this cross-sectional study, 369 patients with a history of major thalassemia for more than 5 years entered the study using convenience sampling method. Thirty-six subjects were excluded from the study based on our exclusion criteria. Zinc level was measured in all patients after 12 hours fasting using atomic absorption spectrometry method in 2012. Results: Of 369 cases, 333 patients were eligible and evaluated. The mean age was 15.63 ± 7.4 years. One hundred ninety two cases were male and others were female (141 cases). About 27% (90) of the cases were 5-10 years-old, 24% (80) were 10-15 years-old and 49% were older than 15 years old. Iron chelator in 65.46% was Desferrioxamine, in 28.2% was Deferasirox and in 19.5% was combination of Desferrioxamine and Deferiprone. All cases had zinc deficiency, and 98.5% had severe zinc deficiency. Others (1.5%) had mild deficiency. Conclusions: Our study on 333 patients with major thalassemia documented severe zinc deficiency in all cases. We had no cases with normal or increased zinc levels. It was different with other reports in the world. PMID:25389495

  10. Coexistence of Malaria and Thalassemia in Malaria Endemic Areas of Thailand

    PubMed Central

    Kuesap, Jiraporn; Chaijaroenkul, W.; Rungsihirunrat, K.; Pongjantharasatien, K.; Na-Bangchang, Kesara

    2015-01-01

    Hemoglobinopathy and malaria are commonly found worldwide particularly in malaria endemic areas. Thalassemia, the alteration of globin chain synthesis, has been reported to confer resistance against malaria. The prevalence of thalassemia was investigated in 101 malaria patients with Plasmodium falciparum and Plasmodium vivax along the Thai-Myanmar border to examine protective effect of thalassemia against severe malaria. Hemoglobin typing was performed using low pressure liquid chromatography (LPLC) and α-thalassemia was confirmed by multiplex PCR. Five types of thalassemia were observed in malaria patients. The 2 major types of thalassemia were Hb E (18.8%) and α-thalassemia-2 (11.9%). There was no association between thalassemia hemoglobinopathy and malaria parasitemia, an indicator of malaria disease severity. Thalassemia had no significant association with P. vivax infection, but the parasitemia in patients with coexistence of P. vivax and thalassemia was about 2-3 times lower than those with coexistence of P. falciparum and thalassemia and malaria without thalassemia. Furthermore, the parasitemia of P. vivax in patients with coexistence of Hb E showed lower value than coexistence with other types of thalassemia and malaria without coexistence. Parasitemia, hemoglobin, and hematocrit values in patients with coexistence of thalassemia other than Hb E were significantly lower than those without coexistence of thalassemia. Furthermore, parasitemia with coexistence of Hb E were 2 times lower than those with coexistence of thalassemia other than Hb E. In conclusion, the results may, at least in part, support the protective effect of thalassemia on the development of hyperparasitemia and severe anemia in malaria patients. PMID:26174819

  11. Alternative options for DNA-based experimental therapy of β-thalassemia.

    PubMed

    Gambari, Roberto

    2012-04-01

    Beta-thalassemias are caused by more than 200 mutations of the β-globin gene, leading to low or absent production of adult hemoglobin. Achievements have been made with innovative therapeutic strategies for β-thalassemias, based on research conducted at the levels of gene structure, transcription, mRNA processing and protein synthesis. The objective of this review is to describe the development of therapeutic strategies employing viral and non-viral DNA-based approaches for treatment of β-thalassemia. Modification of β-globin gene expression in β-thalassemia cells has been achieved by gene therapy, correction of the mutated β-globin gene and RNA repair. In addition, cellular therapy has been proposed for β-thalassemia, including reprogramming of somatic cells to generate induced pluripotent stem cells to be genetically corrected. Based on the concept that increased production of fetal hemoglobin (HbF) is beneficial in β-thalassemia, DNA-based approaches to increase HbF production have been optimized, including treatment of target cells with lentiviral vectors carrying γ-globin genes. Finally, DNA-based targeting of α-globin gene expression has been applied to reduce the excess of α-globin production by β-thalassemia cells, one of the major causes of the clinical phenotype.

  12. Risk of Erectile Dysfunction in Transfusion-naive Thalassemia Men

    PubMed Central

    Chen, Yu-Guang; Lin, Te-Yu; Lin, Cheng-Li; Dai, Ming-Shen; Ho, Ching-Liang; Kao, Chia-Hung

    2015-01-01

    Abstract Based on the mechanism of pathophysiology, thalassemia major or transfusion-dependent thalassemia patients may have an increased risk of developing organic erectile dysfunction resulting from hypogonadism. However, there have been few studies investigating the association between erectile dysfunction and transfusion-naive thalassemia populations. We constructed a population-based cohort study to elucidate the association between transfusion-naive thalassemia populations and organic erectile dysfunction This nationwide population-based cohort study involved analyzing data from 1998 to 2010 obtained from the Taiwanese National Health Insurance Research Database, with a follow-up period extending to the end of 2011. We identified men with transfusion-naive thalassemia and selected a comparison cohort that was frequency-matched with these according to age, and year of diagnosis thalassemia at a ratio of 1 thalassemia man to 4 control men. We analyzed the risks for transfusion-naive thalassemia men and organic erectile dysfunction by using Cox proportional hazards regression models. In this study, 588 transfusion-naive thalassemia men and 2337 controls were included. Total 12 patients were identified within the thalassaemia group and 10 within the control group. The overall risks for developing organic erectile dysfunction were 4.56-fold in patients with transfusion-naive thalassemia men compared with the comparison cohort after we adjusted for age and comorbidities. Our long-term cohort study results showed that in transfusion-naive thalassemia men, there was a higher risk for the development of organic erectile dysfunction, particularly in those patients with comorbidities. PMID:25837766

  13. Value of speckle tracking echocardiography for detection of clinically silent left ventricular dysfunction in patients with β-thalassemia.

    PubMed

    Parsaee, Mozhgan; Saedi, Sedigheh; Joghataei, Pegah; Azarkeivan, Azita; Alizadeh Sani, Zahra

    2017-10-01

    β-Thalassemia is an inherited hemoglobin disorder resulting in chronic hemolytic anemia requiring chronic transfusion therapy. Cardiac involvement is the main cause of death in patients with thalassemia major. The narrow border is between overt myocardial dysfunction and clinically silent left ventricular (LV) dysfunction in patients with thalassemia. Therefore, we need novel parameters in different imaging techniques to discover cardiac involvement in an early and subtle stage. We explore to find a novel, straightforward and informative parameter in echocardiography as a noninvasive, economical and really routine in clinical practice. In this prospective study, 55 patients, who are known cases of β-thalassemia major, receiving long-term blood transfusions and undergoing iron chelation therapy were enrolled. Ferritin level, cardiac magnetic resonance (CMR) T2 * value, full conventional echocardiography and speckle tracking, LV regional circumferential and longitudinal strain values (%) and time-to-peak strain (ms) of 17 segments cardiac model in eyeball tomogram were measured. There was a significant reduction in global longitudinal strain (GLS) (-20.9% ± 1.9 vs. -22.2 ± 1.03) and also basal segments longitudinal strain compared to normal subjects group (-17.4% ± 2.7 vs. -19.6% ± 1.2). There was no significant difference in circumferential strain value between thalassemia patients and normal control group. Interestingly, there was no significant correlation between GLS and CMR T2 * values showing no association between cardiac iron load and longitudinal strain. Speckle tracking echocardiography could be used as a feasible method for evaluating subclinical myocardial dysfunction in patients with thalassemia major. Echocardiography, using GLS, could predict clinically silent myocardial dysfunction independent of CMR (T2 * value) and extension of iron deposition. Our study also puts forward other causes such as chronic tissue hypoxia resulting

  14. Thalidomide has a significant effect in patients with thalassemia intermedia.

    PubMed

    Li, YunShuan; Ren, Quan; Zhou, Yali; Li, Pingping; Lin, Wanhua; Yin, Xiaolin

    2018-01-01

    To investigate the effect of thalidomide in patients with thalassemia intermedia. We observed the effect of thalidomide in seven patients with thalassemia intermedia requiring blood transfusion. Four of the patients were transfusion-independent, and three patients were transfusion-dependent. For the four transfusion-independent patients, hemoglobin concentration increased significantly (≥2 g/dl) in three and moderately (1-2 g/dl) in one. After 3 months of treatment, hemoglobin concentration increased 3.2 ± 1.2 g/dl compared to pretreatment. Among the three transfusion-dependent patients, transfusion was terminated after one month of treatment in one patient and decreased >50% in the other two patients, accompanied by an increase in the average hemoglobin concentration. Thalidomide had a significant effect in patients with thalassemia intermedia. Further studies of a larger scale and more rigorous design are warranted.

  15. Prevalence of major depressive disorder in patients receiving beta-blocker therapy versus other medications.

    PubMed

    Carney, R M; Rich, M W; teVelde, A; Saini, J; Clark, K; Freedland, K E

    1987-08-01

    Depression is believed to be a common side effect in patients receiving beta-blocker therapy. However, diagnoses of depression defined by current diagnostic criteria may not be more common in patients receiving beta-blockers than in patients with the same medical disorder receiving other medications. Seventy-seven patients undergoing elective cardiac catheterization for evaluation of chest pain received a semi-structured diagnostic psychiatric interview. Twenty-one percent of the patients receiving beta-blockers and 33 percent of the patients receiving medications other than beta-blockers met the current American Psychiatric Association criteria for major depressive disorder (DSM-III) (p = NS). The mean heart rate and state anxiety scores for patients taking beta-blockers were significantly lower than those measured in patients taking medications other than beta-blockers. No other medical or demographic differences were observed between the two groups. Despite the methodologic limitations of the study, there does not appear to be a difference in the point prevalence of depression between patients receiving beta-blockers and those receiving other medications.

  16. In vivo reduction of erythrocyte oxidant stress in a murine model of beta-thalassemia.

    PubMed

    de Franceschi, Lucia; Turrini, Franco; Honczarenko, Marek; Ayi, Kojio; Rivera, Alicia; Fleming, Mark D; Law, Terry; Mannu, Franca; Kuypers, Frans A; Bast, Aalt; van der Vijgh, Wim J F; Brugnara, Carlo

    2004-11-01

    Oxidant damage is an important contributor to the premature destruction of erythrocytes and anemia in thalassemias. To assess the extent of oxidant damage of circulating erythrocytes and the effects of antioxidant therapy on erythrocyte characteristics and anemia, we used a mouse model of human beta-thalassemia intermedia (b1/b2 deletion). Several parameters indicative of oxidant damage were measured at baseline and following administration of the semi-synthetic flavonoid antioxidant, 7-monohydroxyethylrutoside (monoHER), to beta-thalassemic mice at a dose of either 500 mg/kg i.p. once a day (n=6) or 250 mg/kg i.p. twice a day (n=6) for 21 days. Significant erythrocyte oxidant damage at baseline was indicated by: (i) dehydration, reduced cell K content, and up-regulated K-Cl co-transport; (ii) marked membrane externalization of phosphatidylserine; (iii) reduced plasma and membrane content of vitamin E; and (iv) increased membrane bound IgG. MonoHER treatment increased erythrocyte K content, and markedly improved all cellular indicators of oxidant stress and of lipid membrane peroxidation. While anemia did not improve, monoHER therapy reduced reticulocyte counts, improved survival of a fraction of red cells, and reduced ineffective erythropoiesis with decreased total bilirubin, lactate dehydrogenase and plasma iron. Antioxidant therapy reverses several indicators of oxidant damage in vivo. These promising antioxidant effects of monoHER should be investigated further.

  17. High Frequency of Diarrheagenic Escherichia coli in HIV-Infected Patients and Patients with Thalassemia in Kerman, Iran.

    PubMed

    Alizade, Hesam; Sharifi, Hamid; Naderi, Zahedeh; Ghanbarpour, Reza; Bamorovat, Mehdi; Aflatoonian, Mohammad Reza

    This study was conducted on patients with thalassemia and HIV-infected patients to determine the frequency of diarrheagenic Escherichia coli in Kerman, Iran. We analyzed 68 and 49 E coli isolates isolated from healthy fecal samples of patients with thalassemia and HIV-infected patients, respectively. The E coli isolates were studied using a multiplex polymerase chain reaction to identify the enterotoxigenic E coli (ETEC), enterohemorrhagic E coli (EHEC), and enteropathogenic E coli (EPEC) groups. Statistical analysis was carried out to determine the correlation of diarrheagenic E coli between HIV-infected patients and patients with thalassemia using Stata 11.2 software. The frequency of having at least 1 diarrheagenic E coli was more common in patients with thalassemia (67.64%) than in HIV-infected patients (57.14%; P = .25), including ETEC (67.64% versus 57.14%), EHEC (33.82% versus 26.53%), and EPEC (19.11% versus 16.32%). The results of this study indicate that ETEC, EHEC, and EPEC pathotypes are widespread among diarrheagenic E coli isolates in patients with thalassemia and HIV-infected patients.

  18. Failure to replicate the internal structure of Greek-specific thalassemia quality of life instrument in adult thalassemia patients in Sabah.

    PubMed

    Keowmani, Thamron; Lee, Lily Wong Lee

    2016-01-01

    To study the validity and reliability of the Malay version of the Specific Thalassemia Quality of Life Instrument (STQOLI) in Sabah's adult thalassemia patients. This cross-sectional study was done at Thalassemia Treatment Centre, Queen Elizabeth Hospital in Sabah, Malaysia. Eighty-two adult thalassemia patients who fulfilled the inclusion and exclusion criteria were conveniently selected for participation in the study. The English version of STQOLI was translated into Malay by using forward and back translations. The content of the questionnaire was validated by the chief hematologist of the hospital. The construct validity of the 40-item questionnaire was assessed by principal component analysis with varimax rotation and the scale reliability was assessed by Cronbach's alpha. The study failed to replicate the internal structure of the Greek STQOLI. Instead, 12 factors have been identified from the exploratory factor analysis, which accounted for 72.2% of the variance. However, only eight factors were interpretable. The factors were iron chelation pump impact, transfusion impact, time spent on treatment and its impact on work and social life, sex life, side effects of treatment, cardiovascular problems, psychology, and iron chelation pill impact. The overall scale reliability was 0.913. This study was unable to replicate the internal structure of the Greek STQOLI in Sabah's adult thalassemia patients. Instead, a new structure has emerged that can be used as a guide to develop a questionnaire specific for adult thalassemia patients in Sabah. Future research should focus on the eight factors identified from this study.

  19. Factors associated with continuing emergence of β-thalassemia major despite prenatal testing: a cross-sectional survey.

    PubMed

    Al Sabbah, Haleama; Khan, Sarah; Hamadna, Abdallah; Abu Ghazaleh, Lamia; Dudin, Anwar; Karmi, Bashar Adnan

    2017-01-01

    Health care initiatives focusing on prenatal testing and premarital genetic screening aiming to reduce the incidence of β-thalassemia have emerged during the last decade. In Palestine, 4% of the population are known thalassemia carriers with new cases continuing to appear despite the availability of prenatal testing. This study aims to identify factors that influence the decision to retain or abort fetuses affected by β-thalassemia in Palestine. Convenience sampling was used to select 32 women (72 fetuses) who were at risk of having a baby with β-thalassemia. A questionnaire on prenatal testing, test results, pregnancy outcomes, and factors influencing the decision to terminate the pregnancy were used for this cross-sectional study. The data were analyzed using SPSS version 17. Among the fetuses screened, 36 (50%) were thalassemia carriers and 20 (28%) had β-thalassemia; 17 (85%) affected fetuses were aborted. Religious beliefs were the most cited reason for opposing abortion while prior experience with β-thalassemia patients and awareness programs promoted abortions. Mothers who opted to retain an affected fetus had modest educational attainment. Higher educational level was significantly associated with the decision to abort an affected fetus ( p <0.05). A religious consensus is needed on the abortion of fetuses affected by β-thalassemia. Improving female education and increasing awareness on thalassemia could help reduce the incidence of β-thalassemia in Palestine and around the world.

  20. Study of alpha hemoglobin stabilizing protein expression in patients with β thalassemia and sickle cell anemia and its impact on clinical severity.

    PubMed

    Mahmoud, Hanan Mohamed; Shoeib, Ahmed Al-Saiid Hamed; Abd El Ghany, Shereen Mohamed; Reda, Marwa Mohamed; Ragab, Iman Ahmed

    2015-12-01

    The α hemoglobin stabilizing protein (AHSP) binds α-Hb and prevents its precipitation limiting free α-Hb toxicities. Our aim was to study AHSP expression in β thalassemia syndromes in relation to their clinical severity and to compare it with its level in sickle cell anemia. We compared patients with β-thalassemia (n=37) (β-thalassemia major (BTM) (n=19) and β-thalassemia intermedia (BTI) (n=18)) with 12 patients with sickle cell anemia as regards clinical severity, age at presentation, transfusion dependency, mean pre-transfusion hemoglobin level, use of hydroxyurea and AHSP expression by real time quantitative PCR. Median (and IQR) AHSP expression was significantly higher in patients with sickle cell anemia 2275 (3898) compared to thalassemia 283 (718), P=0.001, with no significant difference between BTM and BTI (P=0.346). It was also significantly higher in non-transfusion dependent patients with β thalassemia (NTDT) compared to transfusion dependent ones (P=0.019), and in patients on hydroxyurea therapy (P<0.001). However, there was no significant difference in its level according to clinical severity score (P=0.946) or splenectomy status (P=0.145). AHSP expression was higher in patients with sickle cell anemia versus thalassemia, with no significant difference between BTM and BTI. Expression was higher in patients with NTDT and on hydroxyurea therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. β-Thalassemia intermedia: a comprehensive overview and novel approaches.

    PubMed

    Asadov, Chingiz; Alimirzoeva, Zohra; Mammadova, Tahira; Aliyeva, Gunay; Gafarova, Shahla; Mammadov, Jeyhun

    2018-01-29

    β-Thalassemia intermedia is a clinical condition of intermediate gravity between β-thalassemia minor, the asymptomatic carrier, and β-thalassemia major, the transfusion-dependent severe anemia. It is characterized by a significant clinical polymorphism, which is attributable to its genetic heterogeneity. Ineffective erythropoiesis, chronic anemia, and iron overload contribute to the clinical complications of thalassemia intermedia through stepwise pathophysiological mechanisms. These complications, including splenomegaly, extramedullary erythropoiesis, iron accumulation, leg ulcers, thrombophilia, and bone abnormalities can be managed via fetal hemoglobin induction, occasional transfusions, chelation, and in some cases, stem cell transplantation. Given its clinical diversity, thalassemia intermedia patients require tailored approaches to therapy. Here we present an overview and novel approaches to the genetic basis, pathophysiological mechanisms, clinical complications, and optimal management of thalassemia intermedia.

  2. [Unusual aspect of pernicious anemia during association of beta-thalassemia: a new case report and literature review].

    PubMed

    Diop, Madoky Magatte; Toure, P S; Leye, M Y; Leye, A; El Fadjri, S; Diop, M; Ka, M M; Diop, Oulimata D; Fall, S; Ndiaye, F S

    2012-01-01

    Pernicious anemia appears classically by macrocytosis. We report a case of a late discovered Biermer disease, on a 42-year-old young black woman. The reason was an unusual aspect of this disease in a context of betathalassemia. The patient presented chronic anemia which evolved during about ten year. Biology showed a normocytosis and signs of hemolysis according to beta-thalassemia. This was confirmed by an electrophoresis showing 9.1 % of fraction F some haemoglobin. Since this date, the patient was treated by folic acid alone with periodic transfusions of red blood cell. She presented eight years after the beginning of her disease, neurological deterioration. Diagnosis of pernicious anemia was finally established up on histological gastritis, low level of the blood rate of vitamin B12, macrocytosis, and presence of intrinsic anti-factor and parietal anti-cells antibodies.

  3. Factors associated with continuing emergence of β-thalassemia major despite prenatal testing: a cross-sectional survey

    PubMed Central

    Al Sabbah, Haleama; Khan, Sarah; Hamadna, Abdallah; Abu Ghazaleh, Lamia; Dudin, Anwar; Karmi, Bashar Adnan

    2017-01-01

    Purpose Health care initiatives focusing on prenatal testing and premarital genetic screening aiming to reduce the incidence of β-thalassemia have emerged during the last decade. In Palestine, 4% of the population are known thalassemia carriers with new cases continuing to appear despite the availability of prenatal testing. This study aims to identify factors that influence the decision to retain or abort fetuses affected by β-thalassemia in Palestine. Methods Convenience sampling was used to select 32 women (72 fetuses) who were at risk of having a baby with β-thalassemia. A questionnaire on prenatal testing, test results, pregnancy outcomes, and factors influencing the decision to terminate the pregnancy were used for this cross-sectional study. The data were analyzed using SPSS version 17. Results Among the fetuses screened, 36 (50%) were thalassemia carriers and 20 (28%) had β-thalassemia; 17 (85%) affected fetuses were aborted. Religious beliefs were the most cited reason for opposing abortion while prior experience with β-thalassemia patients and awareness programs promoted abortions. Mothers who opted to retain an affected fetus had modest educational attainment. Higher educational level was significantly associated with the decision to abort an affected fetus (p<0.05). Conclusion A religious consensus is needed on the abortion of fetuses affected by β-thalassemia. Improving female education and increasing awareness on thalassemia could help reduce the incidence of β-thalassemia in Palestine and around the world. PMID:29026336

  4. Rare complications after second hematopoietic stem cell transplantation for thalassemia major.

    PubMed

    Yanir, Asaf; Yatsiv, Ido; Braun, Jacques; Zilkha, Amir; Brooks, Rebecca; Bouhanna, Dalia; Weintraub, Michael; Stepensky, Polina

    2012-07-01

    We describe an 11-year-old girl with thalassemia major who underwent a second hematopoietic stem cell transplantation from a matched related donor and who subsequently developed posttransplant lymphoproliferative disorder complicated by severe ascending paralysis resembling Guillian-Barré syndrome. Six months later she developed a massive pericardial effusion. She received a multimodal treatment for these complications and currently, 18 months after transplantation, she is in a good clinical condition, is transfusion independent, with no evidence of graft-versus-host disease and off all treatment. This case highlights the dilemma surrounding second hematopoietic stem cell transplantations in hemoglobinopathies and the need for a careful, well informed, and collaborative decision-making process by patients, families, and medical professionals.

  5. Health related quality of life in Middle Eastern children with beta-thalassemia.

    PubMed

    Caocci, Giovanni; Efficace, Fabio; Ciotti, Francesca; Roncarolo, Maria Grazia; Vacca, Adriana; Piras, Eugenia; Littera, Roberto; Markous, Raji Suleiman Dawood; Collins, Gary Stephen; Ciceri, Fabio; Mandelli, Franco; Marktel, Sarah; La Nasa, Giorgio

    2012-06-22

    Thalassemia is a common disorder worldwide with a predominant incidence in Mediterranean countries, North Africa, the Middle East, India, Central Asia, and Southeast Asia. Whilst substantial progress has been made towards the improvement of Health related quality of life (HRQoL) in western countries, scarce evidence-based data exists on HRQol of thalassemia children and adolescents living in developing countries. We studied 60 thalassemia children from Middle Eastern countries with a median age of 10 years (range 5 to 17 years). HRQoL was assessed with the Pediatric Quality of Life Inventory (PedsQL) 4.0. The Questionnaire was completed at baseline by all patients and their parents. The agreement between child-self and parent-proxy HRQoL reports and the relationship between HRQoL profiles and socio-demographic and clinical factors were investigated. The scores of parents were generally lower than those of their children for Emotional Functioning (mean 75 vs 85; p = 0.002), Psychosocial Health Summary (mean 70.3 vs 79.1; p = 0.015) and the Total Summary Score (mean 74.3 vs 77.7 p = 0.047). HRQoL was not associated with ferritin levels, hepatomegaly or frequency of transfusions or iron chelation therapy. Multivariate analysis showed that a delayed start of iron chelation had a negative impact on total PedsQL scores of both children (p = 0.046) and their parents (p = 0.007). The PedsQL 4.0 is a useful tool for the measurement of HRQoL in pediatric thalassemia patients. This study shows that delayed start of iron chelation has a negative impact on children's HRQoL.

  6. Oxidative stress and age-related changes in T cells: is thalassemia a model of accelerated immune system aging?

    PubMed

    Ghatreh-Samani, Mahdi; Esmaeili, Nafiseh; Soleimani, Masoud; Asadi-Samani, Majid; Ghatreh-Samani, Keihan; Shirzad, Hedayatolah

    2016-01-01

    Iron overload in β-thalassemia major occurs mainly due to blood transfusion, an essential treatment for β-thalassemia major patients, which results in oxidative stress. It has been thought that oxidative stress causes elevation of immune system senescent cells. Under this condition, cells normally enhance in aging, which is referred to as premature immunosenescence. Because there is no animal model for immunosenescence, most knowledge on the immunosenescence pattern is based on induction of immunosenescence. In this review, we describe iron overload and oxidative stress in β-thalassemia major patients and how they make these patients a suitable human model for immunosenescence. We also consider oxidative stress in some kinds of chronic virus infections, which induce changes in the immune system similar to β-thalassemia major. In conclusion, a therapeutic approach used to improve the immune system in such chronic virus diseases, may change the immunosenescence state and make life conditions better for β-thalassemia major patients.

  7. Oxidative stress and age-related changes in T cells: is thalassemia a model of accelerated immune system aging?

    PubMed Central

    Ghatreh-Samani, Mahdi; Esmaeili, Nafiseh; Soleimani, Masoud; Asadi-Samani, Majid; Ghatreh-Samani, Keihan

    2016-01-01

    Iron overload in β-thalassemia major occurs mainly due to blood transfusion, an essential treatment for β-thalassemia major patients, which results in oxidative stress. It has been thought that oxidative stress causes elevation of immune system senescent cells. Under this condition, cells normally enhance in aging, which is referred to as premature immunosenescence. Because there is no animal model for immunosenescence, most knowledge on the immunosenescence pattern is based on induction of immunosenescence. In this review, we describe iron overload and oxidative stress in β-thalassemia major patients and how they make these patients a suitable human model for immunosenescence. We also consider oxidative stress in some kinds of chronic virus infections, which induce changes in the immune system similar to β-thalassemia major. In conclusion, a therapeutic approach used to improve the immune system in such chronic virus diseases, may change the immunosenescence state and make life conditions better for β-thalassemia major patients. PMID:27095931

  8. Anemia in patients with coinherited thalassemia and glucose-6-phosphate dehydrogenase deficiency.

    PubMed

    Pornprasert, Sakorn; Phanthong, Siratcha

    2013-01-01

    Thalassemia and glucose-6-phosphate dehydrogenase (G-6-PD) deficiency are genetic disorders that cause hemolytic anemia. In areas with high frequencies of both hematological disorders, coinheritance of G-6-PD deficiency with thalassemia can be found. Whether G-6-PD deficiency, coinherited with thalassemia, enhances severe anemia is still unclear. Hematological parameters between thalassemia carriers with G-6-PD deficiency and those without G-6-PD deficiency were compared. The G-6-PD deficiency was diagnosed in 410 blood samples from thalassemia patients using a fluorescent spot test. The levels of hemoglobin (Hb), packed cell volume (PCV), mean corpuscular volume (MCV) and Hb A2/Hb E [β26(B8)Glu→Lys; HBB: c.79G>A] were measured using an automated blood counter and high performance liquid chromatography (HPLC), respectively. The G-6-PD deficiency was found in 37 samples (9.02%). Mean levels of Hb, PCV, MCV and Hb A2/E were similar between the two groups. Thus, G-6-PD deficiency did not enhance red blood cell pathology or induce more anemic severity in thalassemia patients.

  9. Role of Three-Dimensional Speckle Tracking Echocardiography in the Quantification of Myocardial Iron Overload in Patients with Beta-Thalassemia Major.

    PubMed

    Li, Shu-Juan; Hwang, Yu-Yan; Ha, Shau-Yin; Chan, Godfrey C F; Mok, Amanda S P; Wong, Sophia J; Cheung, Yiu-Fai

    2016-09-01

    The new three-dimensional speckle tracking echocardiography (3DSTE) may enable comprehensive quantification of global left ventricular (LV) myocardial mechanics. Twenty-four patients aged 29.3 ± 5.2 years and 22 controls were studied. 3DSTE was performed to assess LV 3D global strain, twist and torsion, ejection fraction, and systolic dyssynchrony index (SDI). The LV SDI was calculated as % of SD of times-to-peak strain of 16 segments/RR interval. The global performance index (GPI) was calculated as (global 3D strain·torsion)/SDI. Area under the receiver operating characteristic curve (AUC) was calculated to determine the capability of 3DSTE parameters to discriminate between patients with (cardiac magnetic resonance T2* <20 ms) and those without myocardial iron overload. Compared with controls, patients had significantly lower LV global 3D strain (P < 0.001), twist (P = 0.01), torsion (P = 0.04), and ejection fraction (P < 0.001) and greater SDI (P < 0.001). The GPI was lower in patients than controls (P < 0.001). T2* value correlated positively with global 3D strain (r = 0.74, P < 0.001) and GPI (r = 0.63, P = 0.001), and negatively with SDI (r = -0.44, P = 0.03). The AUCs of GPI, global 3D strain, ejection fraction, torsion, and 1/SDI were 0.94, 0.90, 0.87, 0.82, and 0.70, respectively. The GPI cutoff of 2.7°/cm had a sensitivity of 94.9% and a specificity of 88.9% of differentiating patients with from those without myocardial iron overload. The LV composite index of strain, torsion, and dyssynchrony derived from 3DSTE enables sensitive detection of myocardial iron overload in patients with thalassemia. © 2016, Wiley Periodicals, Inc.

  10. Coinheritance of B-Thalassemia and Sickle Cell Anaemia in Southwestern Nigeria.

    PubMed

    Vincent, Osunkalu; Oluwaseyi, Bamisaye; James, Babatunde; Saidat, Lawal

    2016-11-01

    Genes for haemoglobin S are found in high frequencies in Nigeria. However, there is little information on beta thalassemia in sickle cell anaemia in this population. The clinical presentation of HbS- β thalassemia is enormously variable, ranging from an asymptomatic state to a severe disorder similar to homozygous sickle cell disease. Haemoglobin A 2 and HbF were determined in sickle cell anaemia patients attending LAUTECH Teaching Hospital, Osogbo, by elution after electrophoresis and alkaline denaturation methods respectively. Haematological parameters were estimated using Sysmex KX-21N and percentage target cells using Leishman's staining technique. Exactly 6% f the SCA patients were found to have elevated HbA 2 (>3.3%) and HbF (>1.3%). These patients also had normal erythrocyte indices, increased platelet count, a significantly higher HCT and an increased % target cell. These findings confirm that the frequency of beta thalassaemia in sickle cell patients in Nigeria is higher than previously thought. It is therefore important to consider the possibility of this variant in patients with sickle cell anaemia since their course may differ from that of patients with homozygous sickle cell anaemia.

  11. Gene Addition Strategies for β-Thalassemia and Sickle Cell Anemia.

    PubMed

    Dong, Alisa C; Rivella, Stefano

    2017-01-01

    Beta-thalassemia and sickle cell anemia are two of the most common diseases related to the hemoglobin protein. In these diseases, the beta-globin gene is mutated, causing severe anemia and ineffective erythropoiesis. Patients can additionally present with a number of life-threatening co-morbidities, such as stroke or spontaneous fractures. Current treatment involves transfusion and iron chelation; allogeneic bone marrow transplant is the only curative option, but is limited by the availability of matching donors and graft-versus-host disease. As these two diseases are monogenic diseases, they make an attractive setting for gene therapy. Gene therapy aims to correct the mutated beta-globin gene or add back a functional copy of beta- or gamma-globin. Initial gene therapy work was done with oncoretroviral vectors, but has since shifted to lentiviral vectors. Currently, there are a few clinical trials underway to test the curative potential of some of these lentiviral vectors. This review will highlight the work done thus far, and present the challenges still facing gene therapy, such as genome toxicity concerns and achieving sufficient transgene expression to cure those with the most severe forms of thalassemia.

  12. What Unrelated Hematopoietic Stem Cell Transplantation in Thalassemia Taught us about Transplant Immunogenetics

    PubMed Central

    La Nasa, Giorgio; Vacca, Adriana; Littera, Roberto; Piras, Eugenia; Orru, Sandro; Greco, Marianna; Carcassi, Carlo; Caocci, Giovanni

    2016-01-01

    Although the past few decades have shown an improvement in the survival and complication-free survival rates in patients with beta-thalassemia major and gene therapy is already at an advanced stage of experimentation, hematopoietic stem cell transplantation (HSCT) continues to be the only effective and realistic approach to the cure of this chronic non-malignant disease. Historically, human leukocyte antigen (HLA)-matched siblings have been the preferred source of donor cells owing to superior outcomes compared with HSCT from other sources. Nowadays, the availability of an international network of voluntary stem cell donor registries and cord blood banks has significantly increased the odds of finding a suitable HLA matched donor. Stringent immunogenetic criteria for donor selection have made it possible to achieve overall survival (OS) and thalassemia-free survival (TFS) rates comparable to those of sibling transplants. However, acute and chronic graft-versus-host disease (GVHD) remains the most important complication in unrelated HSCT in thalassemia, leading to significant rates of morbidity and mortality for a chronic non-malignant disease. A careful immunogenetic assessment of donors and recipients makes it possible to individualize appropriate strategies for its prevention and management. This review provides an overview of recent insights about immunogenetic factors involved in GVHD, which seem to have a potential role in the outcome of transplantation for thalassemia. PMID:27872728

  13. One-year results from a prospective randomized trial comparing phlebotomy with deferasirox for the treatment of iron overload in pediatric patients with thalassemia major following curative stem cell transplantation.

    PubMed

    Inati, Adlette; Kahale, Mario; Sbeiti, Nada; Cappellini, Maria Domenica; Taher, Ali T; Koussa, Suzanne; Nasr, Therese A; Musallam, Khaled M; Abbas, Hussein A; Porter, John B

    2017-01-01

    Iron overload is well documented in patients with β-thalassemia major, and patients who have undergone hematopoietic stem cell transplantation (HSCT) remain at risk as a result of pre- and immediate post-HSCT transfusions. This is a prospective, randomized, 1-year clinical trial that compares the efficacy and safety of the once-daily oral iron chelator deferasirox versus phlebotomy for the treatment of iron overload in children with β-thalassemia major following HSCT. Patients (aged 12.4 years) received deferasirox (n = 12, 10 mg/kg/day starting dose) or phlebotomy (n = 14, 6 ml/kg/2 weeks) for 1 year. In two and five patients, deferasirox dose was increased to 15 and 20 mg/kg/day, respectively. Magnetic resonance imaging (MRI)-assessed liver iron concentration (LIC) decreased with deferasirox (mean 12.5 ± 10.1 to 8.5 ± 9.3 mg Fe/g dry weight [dw]; P = 0.0005 vs. baseline) and phlebotomy (10.2 ± 6.8 to 8.3 ± 9.2 mg Fe/g dw; P = 0.05). LIC reductions were greater with deferasirox than with phlebotomy for patients with baseline serum ferritin 1,000 ng/ml or higher (-8.1 ± 1.5 vs. -3.5 ± 5.7 mg Fe/g dw; P = 0.048). Serum ferritin and non-transferrin-bound iron also decreased significantly. In two patients with severe cardiac siderosis, a clinically relevant improvement in myocardial T2* was seen, following phlebotomy and deferasirox therapy (n = 1 each). Adverse effects with deferasirox were skin rash, gastrointestinal upset, and increased liver function tests (all n = 1), while those for phlebotomy were difficulty with venous access (n = 4) and distress during procedure (n = 1). Parents of 13/14 children receiving phlebotomy wished to switch to deferasirox, with 1/14 being satisfied with phlebotomy. Deferasirox treatment or phlebotomy reduces iron burden in pediatric patients with β- thalassemia major post-HSCT, with a manageable safety profile. © 2016 Wiley Periodicals, Inc.

  14. The Effects of Group Play Therapy on Self-Concept Among 7 to 11 Year-Old Children Suffering From Thalassemia Major

    PubMed Central

    Tomaj, Ome Kolsoum; Estebsari, Fatemeh; Taghavi, Taraneh; Borim Nejad, Leili; Dastoorpoor, Maryam; Ghasemi, Afsaneh

    2016-01-01

    Background Children suffering from thalassemia have higher levels of depression and lower levels of self-concept. Objectives The aim of this study was to determine if group play therapy could significantly increase self-concept among children with thalassemia major ages 7 to 11 years old in teaching hospitals of Golestan province, Iran, in 2012. Patients and Methods In this randomized, controlled clinical trial, 60 children with thalassemia major were randomly assigned to intervention (30 children) and control (30 children) groups. The intervention included eight 45 to 60 minute sessions during four weeks, during which the intervention group received group play therapy. The control group received no interventions. Self-concept was measured three times using the Piers-Harris children’s self-concept scale: before, immediately after, and a month after the intervention. Results For the intervention group, results showed that the mean self-concept score was significantly higher at the second point in time compared to the baseline (P < 0.001), going from 60.539 to 69.908. Likewise, comparing the first and third time points, the mean score significantly increased and reached 70.611 (P < 0.001). Furthermore, changes in the mean score from the second to the third time point, though non-significant (P = 0.509), followed the trend, going from 69.908 to 70.611. For the control group, comparing the first, second, and third time points did not result in any significant change in the mean score (P > 0.05). Conclusions The results showed that group play therapy improves self-concept in children suffering from thalassemia major. PMID:27275402

  15. Alpha-thalassemia genetic testing: an important anemia diagnostic tool in patients of African heritage.

    PubMed

    Dasanu, Constantin A

    2010-01-01

    Inherited alpha-thalassemia genotypes have been shown to have a rather high prevalence in some patient populations of African heritage. These genotypes lead to mild anemia with microcytic indices and a normal hemoglobin electrophoresis. In our outpatient department, we analyzed 54 consecutive patients of African descent with longstanding microcytic anemia, but no evidence of iron deficiency. We detected alpha-thalassemia gene deletions in 94 percent of these patients. Alpha-thalassemia genetic testing appears cost-effective in an otherwise unexplained, longstanding microcytic anemia in patients of African origin.

  16. Microparticles from splenectomized β-thalassemia/HbE patients play roles on procoagulant activities with thrombotic potential.

    PubMed

    Klaihmon, Phatchanat; Phongpao, Kunwadee; Kheansaard, Wasinee; Noulsri, Egarit; Khuhapinant, Archrob; Fucharoen, Suthat; Morales, Noppawan Phumala; Svasti, Saovaros; Pattanapanyasat, Kovit; Chaichompoo, Pornthip

    2017-02-01

    Thromboembolic events including cerebral thrombosis, deep vein thrombosis, and pulmonary embolism are major complications in β-thalassemia. Damaged red blood cells and chronic platelet activation in splenectomized β-thalassemia/HbE patients were associated with increased microparticles (MPs) releases into blood circulation. MPs are small membrane vesicles, which play important roles on coagulation. However, the role of MP in thalassemia is poorly understood. In this study, the effects of splenectomized-MPs on platelet activation and aggregation were investigated. The results showed that isolated MPs from fresh platelet-free plasma of patients and normal subjects directly induce platelet activation, platelet aggregation, and platelet-neutrophil aggregation in a dose-dependent manner. Interestingly, MPs obtained from splenectomized patients are more efficient in induction of platelet activation (P-selectin + ) when compared to MPs from normal subjects (P < 0.05), tenfold lower than pathophysiological level, at 1:0.1 platelet MP ratio. Co-incubation of splenectomized-MPs with either normal-, non-splenectomized- or splenectomized-platelets at 1:10 platelet MP ratio increased platelet activation up to 5.1 ± 2.2, 5.6 ± 3.7, and 9.5 ± 3.0%, respectively, when normalized with individual baseline. These findings suggest that splenectomized patients were proned to be activated by MPs, and splenectomized-MPs could play an important role on chronic platelet activation and aggregation, leading to thrombus formation in β-thalassemia/HbE patients.

  17. Gene Therapy in Patients with Transfusion-Dependent β-Thalassemia.

    PubMed

    Thompson, Alexis A; Walters, Mark C; Kwiatkowski, Janet; Rasko, John E J; Ribeil, Jean-Antoine; Hongeng, Suradej; Magrin, Elisa; Schiller, Gary J; Payen, Emmanuel; Semeraro, Michaela; Moshous, Despina; Lefrere, Francois; Puy, Hervé; Bourget, Philippe; Magnani, Alessandra; Caccavelli, Laure; Diana, Jean-Sébastien; Suarez, Felipe; Monpoux, Fabrice; Brousse, Valentine; Poirot, Catherine; Brouzes, Chantal; Meritet, Jean-François; Pondarré, Corinne; Beuzard, Yves; Chrétien, Stany; Lefebvre, Thibaud; Teachey, David T; Anurathapan, Usanarat; Ho, P Joy; von Kalle, Christof; Kletzel, Morris; Vichinsky, Elliott; Soni, Sandeep; Veres, Gabor; Negre, Olivier; Ross, Robert W; Davidson, David; Petrusich, Alexandria; Sandler, Laura; Asmal, Mohammed; Hermine, Olivier; De Montalembert, Mariane; Hacein-Bey-Abina, Salima; Blanche, Stéphane; Leboulch, Philippe; Cavazzana, Marina

    2018-04-19

    Donor availability and transplantation-related risks limit the broad use of allogeneic hematopoietic-cell transplantation in patients with transfusion-dependent β-thalassemia. After previously establishing that lentiviral transfer of a marked β-globin (β A-T87Q ) gene could substitute for long-term red-cell transfusions in a patient with β-thalassemia, we wanted to evaluate the safety and efficacy of such gene therapy in patients with transfusion-dependent β-thalassemia. In two phase 1-2 studies, we obtained mobilized autologous CD34+ cells from 22 patients (12 to 35 years of age) with transfusion-dependent β-thalassemia and transduced the cells ex vivo with LentiGlobin BB305 vector, which encodes adult hemoglobin (HbA) with a T87Q amino acid substitution (HbA T87Q ). The cells were then reinfused after the patients had undergone myeloablative busulfan conditioning. We subsequently monitored adverse events, vector integration, and levels of replication-competent lentivirus. Efficacy assessments included levels of total hemoglobin and HbA T87Q , transfusion requirements, and average vector copy number. At a median of 26 months (range, 15 to 42) after infusion of the gene-modified cells, all but 1 of the 13 patients who had a non-β 0 /β 0 genotype had stopped receiving red-cell transfusions; the levels of HbA T87Q ranged from 3.4 to 10.0 g per deciliter, and the levels of total hemoglobin ranged from 8.2 to 13.7 g per deciliter. Correction of biologic markers of dyserythropoiesis was achieved in evaluated patients with hemoglobin levels near normal ranges. In 9 patients with a β 0 /β 0 genotype or two copies of the IVS1-110 mutation, the median annualized transfusion volume was decreased by 73%, and red-cell transfusions were discontinued in 3 patients. Treatment-related adverse events were typical of those associated with autologous stem-cell transplantation. No clonal dominance related to vector integration was observed. Gene therapy with autologous CD34

  18. Growth and endocrine disorders in thalassemia: The international network on endocrine complications in thalassemia (I-CET) position statement and guidelines

    PubMed Central

    De Sanctis, Vincenzo; Soliman, Ashraf T.; Elsedfy, Heba; Skordis, Nicos; Kattamis, Christos; Angastiniotis, Michael; Karimi, Mehran; Yassin, Mohd Abdel Daem Mohd; El Awwa, Ahmed; Stoeva, Iva; Raiola, Giuseppe; Galati, Maria Concetta; Bedair, Elsaid M.; Fiscina, Bernadette; El Kholy, Mohamed

    2013-01-01

    The current management of thalassemia includes regular transfusion programs and chelation therapy. It is important that physicians be aware that endocrine abnormalities frequently develop mainly in those patients with significant iron overload due to poor compliance to treatment, particularly after the age of 10 years. Since the quality of life of thalassemia patients is a fundamental aim, it is vital to monitor carefully their growth and pubertal development in order to detect abnormalities and to initiate appropriate and early treatment. Abnormalities should be identified and treatment initiated in consultation with a pediatric or an adult endocrinologist and managed accordingly. Appropriate management shall put in consideration many factors such as age, severity of iron overload, presence of chronic liver disease, thrombophilia status, and the presence of psychological problems. All these issues must be discussed by the physician in charge of the patient's care, the endocrinologist and the patient himself. Because any progress in research in the field of early diagnosis and management of growth disorders and endocrine complications in thalassemia should be passed on to and applied adequately to all those suffering from the disease, on the 8 May 2009 in Ferrara, the International Network on Endocrine Complications in Thalassemia (I-CET) was founded in order to transmit the latest information on these disorders to the treating physicians. The I-CET position statement outlined in this document applies to patients with transfusion-dependent thalassemia major to help physicians to anticipate, diagnose, and manage these complications properly. PMID:23776848

  19. Vitamin E supplement improves erythrocyte membrane fluidity of thalassemia: an ESR spin labeling study.

    PubMed

    Sutipornpalangkul, Werasak; Morales, Noppawan Phumala; Unchern, Supeenun; Sanvarinda, Yupin; Chantharaksri, Udom; Fucharoen, Suthat

    2012-01-01

    Beta-thalassemia/Hemoglobin E (beta-thal/Hb E) is prevalent in Thailand. The imbalance of globin chains in red blood cells is the primary cause of this anemic disease. The excess alpha-globin in beta-thal/Hb E causes typical damage(s) to membrane of erythroblasts and erythrocytes. By using three paramagnetic labeled compounds (5-, 12-, and 16-spin labeled stearic acids, SLS), the changes of the molecular motion in the lipid bilayer of thalassemic RBCs that have structural modification can be detected. to investigate erythrocyte membrane fluidity and the effect of vitamin E treatment in beta-thalassemia/Hemoglobin E patients by using spin labeling techniques. The erythrocyte membrane fluidity was investigated in nine splenectomized and five non-splenectomized beta-thalassemia/hemoglobin E (beta-thal/Hb E) patients using EPR spin labeling techniques. To determine the effect of vitamin E on erythrocyte membrane fluidity, only the splenectomized patients were enrolled. Patients were divided into two groups. The first group received 350 mg vitamin E daily for a period of 1 month (n = 5) and the second group received placebo for an equal period (n = 4). Three paramagnetic fatty acid, 5-, 12-, and 16-doxyl stearic acids, (5-, 12- and 16-DS) were used to label phospholipids layer near both the surface (5-DS) and the deeper hydrophobic region of membrane (12-and 16-DS). Lipid peroxidation (TBARs) was measured using a colorimetric method. Vitamin E was measured with high performance liquid chromatography (HPLC). Significantly higher values of erythrocyte membrane fluidity were revealed with 12-, 16-DS in splenectomized patients, as compared with non-splenectomized patients and normal subjects. In 3-thal/Hb E patients, fluidity values, both outer hyperfine splitting (2T(//)) and order parameter (S) of 12-DS showed inverse correlation with serum TBARs. There was no significant difference between the fluidity values measured with 5-DS. After vitamin E supplementation, the

  20. Better Renal Resistive Index Profile in Subjects with Beta Thalassemia Minor


    .

    PubMed

    Basut, Fahrettin; Keşkek, Şakir Özgür; Gülek, Bozkurt

    2018-05-03

    Beta thalassaemia minor is a common genetic disorder without any characteristic symptoms except mild anemia. It is found to be associated with some cardiovascular risk factors such as insulin resistance and diabetes mellitus. The renal resistive index (RRI) is a measure of renal arterial resistance to blood flow. The aim of this study was to evaluate the renal resistive index in subjects with beta thalassaemia minor (BTM). A total of 253 subjects were included in this cross-sectional study. The study group consisted of 148 subjects with BTM and the control group consisted of 105 healthy subjects. Beta thalassaemia minor was diagnosed by complete blood count and hemoglobin electrophoresis. Blood pressure measurement and biochemical tests were performed. Renal resistive index of all subjects was measured using renal Doppler ultrasonography. Subjects with beta thalassemia minor had lower renal resistive indices compared to healthy subjects (0.58 ± 0.04 vs. 0.60 ± 0.06, p = 0.0016). Additionally, the RRI levels of subjects with BTM were correlated with systolic blood pressure (p = 0.017, r = 0.194). In this study, lower renal resistive index was found in subjects with BTM. This may be associated with decreased vascular resistance and blood viscosity in these subjects. ©2018The Author(s). Published by S. Karger AG, Basel.

  1. Quantitative assessment of metal dysregulation in β-thalassemia patients in comparison with healthy controls by ICP-MS and chemometric analyses.

    PubMed

    Farooq, Sabiha; Mazhar, Wardah; Siddiqui, Amna Jabbar; Ansari, Saqib Hussain; Musharraf, Syed Ghulam

    2018-01-31

    β-Thalassemia is one of the most common inherited disorders and is widely distributed throughout the world. Owing to severe deficiencies in red blood cell production, blood transfusion is required to correct anemia for normal growth and development but causes additional complications owing to iron overload. The aim of this study is to quantify the biometal dysregulations in β-thalassemia patients as compared with healthy controls. A total of 17 elements were analyzed in serum samples of β-thalassemia patients and healthy controls using ICP-MS followed by chemometric analyses. Out of these analyzed elements, 14 showed a significant difference between healthy and disease groups at p < 0.05 and fold change >3. A PLS-DA model revealed an excellent separation with 89.8% sensitivity and 97.2% specificity and the overall accuracy of the model was 92.2%. This metallomic study revealed that there is major difference in metallomic profiling of β-thalassemia patients specifically in Co, Mn, Ni, V and Ba, whereas the fold changes in Co, Mn, V and Ba were found to be greater than that in Fe, providing evidence that, in addition to Fe, other metals are also altered significantly and therefore chelation therapy for other metals may also needed in β-thalassemia patients. Copyright © 2018 John Wiley & Sons, Ltd.

  2. Treating iron overload in patients with non-transfusion-dependent thalassemia

    PubMed Central

    Taher, Ali T; Viprakasit, Vip; Musallam, Khaled M; Cappellini, M Domenica

    2013-01-01

    Despite receiving no or only occasional blood transfusions, patients with non-transfusion-dependent thalassemia (NTDT) have increased intestinal iron absorption and can accumulate iron to levels comparable with transfusion-dependent patients. This iron accumulation occurs more slowly in NTDT patients compared to transfusion-dependent thalassemia patients, and complications do not arise until later in life. It remains crucial for these patients' health to monitor and appropriately treat their iron burden. Based on recent data, including a randomized clinical trial on iron chelation in NTDT, a simple iron chelation treatment algorithm is presented to assist physicians with monitoring iron burden and initiating chelation therapy in this group of patients. Am. J. Hematol. 88:409–415, 2013. © 2013 Wiley Periodicals, Inc. PMID:23475638

  3. Cost-effectiveness analysis of adding low dose ribavirin to peginterferon alfa-2a for treatment of chronic hepatitis C infected thalassemia major patients in iran.

    PubMed

    Mehrazmay, Alireza; Alavian, Seyed Moayed; Moradi-Lakeh, Maziar; Mokhtari Payam, Mahdi; Hashemi-Meshkini, Amir; Behnava, Bita; Miri, Seyyed Mohammad; Karimi Elizee, Pegah; Tabatabaee, Seyed Vahid; Keshvari, Maryam; Bagheri Lankarani, Kamran

    2013-01-01

    The prevalence of hepatitis C in Iran is 1% and 18% in general population and thalassemia patients respectively. The cost effectiveness analysis of adding Ribavirin to Peginterferon alfa-2a (PEG IFN alfa-2a) as a combination treatment strategy of chronic hepatitis C in thalassemia patients in comparison with monotherapy could help clinicians and policy makers to provide the best treatment for the patients. In this study we aimed to assess whether adding Ribavirin to PEG IFN alfa-2a is a cost effective strategy in different genotypes and different subgroups of 280 patients with chronic hepatitis C infection from the perspective of society in Iranian setting. A cost effectiveness analysis including all costs and outcomes of treatments for chronic hepatitis C infected thalassemia major patients was conducted. We constructed a decision tree of treatment course in which a hypothetical cohort of 100 patients received "PEG IFN alfa-2a" or "Peg IFN alfa-2a plus Ribavirin." The cost analysis was based on cost data for 2008 and we used 9300 Iranian Rials (IR Rial) as exchange rate declared by the Iranian Central Bank on that time to calculating costs by US Dollar (USD). To evaluate whether a strategy is cost effective, one time and three times of GDP per capita were used as threshold based on recommendation of the World Health Organization. The Incremental Cost Effectiveness Ratio (ICER) for combination therapy in genotype-1 and genotypes non-1 subgroups was 2,673 and 19,211 US dollars (USD) per one Sustain Virological Response (SVR), respectively. In low viral load and high viral load subgroups, the ICER was 5,233 and 14,976 USD per SVR, respectively. The calculated ICER for combination therapy in subgroup of patients with previously resistant to monotherapy was 13,006 USD per SVR. Combination therapy in previously resistant patients to combination therapy was a dominant strategy. Adding low dose of Ribavirin to PEG IFN alfa-2a for treatment of chronic hepatitis C patients

  4. The effect of perioperative beta-blockade on the pulmonary function of patients undergoing major arterial surgery.

    PubMed

    Kieran, S M; Cahill, R A; Browne, I; Sheehan, S J; Mehigan, D; Barry, M C

    2006-09-01

    Concern about the potential detrimental side-effects of beta-blockade on pulmonary function often dissuades against their perioperative use in patients undergoing major arterial surgery (especially in those with chronic obstructive pulmonary disease (COPD)). In this study we aimed to establish prospectively the clinical relevance of these concerns. After ethics committee approval and individual informed consent, the pulmonary function of twenty patients (mean age 68.7 years (range 43-82), 11 males) scheduled to undergo non-emergency major vascular surgery was studied by recording symptoms and spirometry before and after institution of effective beta-blockade. Fifteen patients (75%) had significant smoking histories (mean pack years/patient=50), while 12 (60%) had COPD. All patients tolerated effective beta-blockade satisfactorily without developing either subjective deterioration in symptoms or significant change on spirometry. The mean change in FEV1 following adequate beta-blockade was 0.05+/-0.24 liters (95% CI -0.06 to +1.61), p=0.35, giving a mean percentage change of 3.18%+/-11.66 (95% CI -2.26 to 8.62). Previously held concerns about worsening pulmonary function through the short-term use of beta-blockers should not dissuade their perioperative usage in patients with peripheral vascular disease. Furthermore, the accuracy of pulmonary function tests in preoperative assessment and risk stratification also appears unaffected by this therapy.

  5. Correlation between T2* cardiovascular magnetic resonance with left ventricular function and mass in adolescent and adult major thalassemia patients with iron overload.

    PubMed

    Djer, Mulyadi M; Anggriawan, Shirley L; Gatot, Djajadiman; Amalia, Pustika; Sastroasmoro, Sudigdo; Widjaja, Patricia

    2013-10-01

    to assess for a correlation between T2*CMR with LV function and mass in thalassemic patients with iron overload. a cross-sectional study on thalassemic patients was conducted between July and September 2010 at Cipto Mangunkusumo and Premier Hospitals, Jakarta, Indonesia. Clinical examinations, review of medical charts, electrocardiography, echocardiography, and T2*CMR were performed. Cardiac siderosis was measured by T2*CMR conduction time. Left ventricle diastolic and systolic functions, as well as LV mass index were measured using echocardiography. Correlations between T2*CMR and echocardiography findings, as well as serum ferritin were determined using Pearson's and Spearman's tests. thirty patients aged 13-41 years were enrolled, of whom two-thirds had -thalassemia major and one-third had HbE/-thalassemia. Diastolic dysfunction was identified in 8 patients, whereas systolic function was normal in all patients. Increased LV mass index was found in 3 patients. T2*CMR conduction times ranged from 8.98 to 55.04 ms and a value below 20 ms was demonstrated in 14 patients. There was a statistically significant moderate positive correlation of T2*CMR conduction time with E/A ratio (r = 0.471, P = 0.009), but no correlation was found with LV mass index (r=0.097, P=0.608). A moderate negative correlation was found between T2*CMR and serum ferritin (r = -0.514, P = 0.004), while a moderate negative correlation was found between serum ferritin and E/A ratio (r = -0.425, P = 0.019). T2*CMR myocardial conduction time has a moderate positive correlation with diastolic function, moderate negative correlation with serum ferritin, but not with LV mass index and systolic function.

  6. Mutation analysis of β-thalassemia in East-Western Indian population: a recent molecular approach

    PubMed Central

    Shah, Parth S; Shah, Nidhi D; Ray, Hari Shankar P; Khatri, Nikunj B; Vaghasia, Ketan K; Raval, Rutvik J; Shah, Sandip C; Rao, Mandava V

    2017-01-01

    Background β-Thalassemia is the most prevalent genetic disorder in India. Its traits and coinheritance vary from mild to severe conditions, resulting in thalassemia minor, intermediate, and major, depending upon many factors. Purpose The objective of this study was to identify the incidence of β-thalassemia traits, their coinheritance, and mutations, as well as to support the patients already diagnosed with β-thalassemia in East-Western Indian population for better management. Patients and methods Seventy-five referral cases for β-thalassemia were analyzed for various β-thalassemia traits, heterozygosity, and homozygosity conditions. Blood phenotypic parameters using cell counter and capillary electrophoresis were investigated. Analyses of eight common mutations of thalassemia in India were carried out using polymerase chain reaction-amplification refractory mutation system, end point polymerase chain reaction, and DNA sequencing methods. Results Of these (75) referral cases from East-Western Indian region, 68 were positive for β-thalassemia (90.67%). The majority of case types were of β-thalassemia minor (49, 65.33%), followed by HbE traits (6, 8.0%) and β-thalassemia major, including heterozygous and homozygous (5, 6.66%; 4, 5.33%) types and then HbE homozygous (2, 2.66%), as well as one each of the HbE/β-thalassemia and HbD/β-thalassemia (1, 1.34%) combination. Mutation analysis also revealed that the highest frequency of mutation was c.92+5G>C (41, 60.29%) followed by deletion 619bp (9, 13.23%) and c.79G>A (8, 11.76%) in our study group. Five cases (nos. 24, 27, 33, 58, and 71) exhibited coinheritance between β0/β+ (2), β0/β D (1), and c.124_127delTTCT/β+ or β0(2) affecting the Rajasthani and Gujarati populations in our study of the Western region of India. Conclusion We strongly recommend these Western populations for genetic screening before adopting reproductive technologies and interracial marital relations. PMID:28546763

  7. Critical appraisal of discriminant formulas for distinguishing thalassemia from iron deficiency in patients with microcytic anemia.

    PubMed

    Urrechaga, Eloísa; Hoffmann, Johannes J M L

    2017-08-28

    Many discriminant formulas have been reported for distinguishing thalassemia trait from iron deficiency in patients with microcytic anemia. Independent verification of several discriminant formulas is deficient or even lacking. Therefore, we have retrospectively investigated discriminant formulas in a large, well-characterized patient population. The investigational population consisted of 2664 patients with microcytic anemia: 1259 had iron deficiency, 1196 'pure' thalassemia trait (877 β- and 319 α-thalassemia), 150 had thalassemia trait with concomitant iron deficiency or anemia of chronic disease, and 36 had other diseases. We investigated 25 discriminant formulas that only use hematologic parameters available on all analyzers; formulas with more advanced parameters were disregarded. The diagnostic performance was investigated using ROC analysis. The three best performing formulas were the Jayabose (RDW index), Janel (11T), and Green and King formulas. The differences between them were not statistically significant (p>0.333), but each of them had significantly higher area under the ROC curve than any other formula. The Jayabose and Green and King formulas had the highest sensitivities: 0.917 both. The highest specificity, 0.925, was found for the Janel formula, which is a composite score of 11 other formulas. All investigated formulas performed significantly better in distinguishing β- than α-thalassemia from iron deficiency. In our patient population, the Jayabose RDW index, the Green and King formula and the Janel 11T score are superior to all other formulas examined for distinguishing between thalassemia trait and iron deficiency anemia. We confirmed that all formulas perform much better in β- than in α-thalassemia carriers and also that they incorrectly classify approximately 30% of thalassemia carriers with concomitant other anemia as not having thalassemia. The diagnostic performance of even the best formulas is not high enough for making a final

  8. Efficacy and Safety of Deferasirox in Pediatric Patients of Thalassemia at a Tertiary Care Teaching Hospital.

    PubMed

    Thakor, Dhaval R; Desai, Chetna K; Kapadia, Jigar D; Dikshit, Ram K; Mehariya, K M

    2017-01-01

    To evaluate efficacy, safety and utilization pattern of deferasirox in paediatric patients of transfusion dependant β Thalassemia Major at a tertiary care teaching hospital in Gujarat. This observational, prospective-retrospective, single centre, continuous study was conducted in a tertiary care teaching hospital among paediatric patients of transfusion dependent β Thalassemia Major. Patients treated with deferasirox for not more than 12 weeks were enrolled. Details of blood transfusions, relevant investigations performed every 3 weeks and 3 months and drugs used were recorded in a pretested case record form. Parents were provided with a diary to record the details of ADRs. Data were analyzed for demographic characteristics, number and mean volume of blood transfusions, changes in serum ferritin and iron levels, number and types of ADRs and progression, causality, severity and preventability of ADRs. Of the 60 patients enrolled, one patient was lost to follow up and four withdrew their consent. Of the remaining 55 patients, 36 were boys and 19 were girls (mean age: 6 ± 3.14 years), including patients of 1-3 years (11), 4-6 years (24), 7-10 years (12) and 11-12 years (8). Thirty six patients were born of consanguineous marriages. Adherence to blood transfusion guidelines and deferasirox prescribing and administration guidelines was observed. A serial and significant decrease in mean serum ferritin and serum iron at 3 weeks and 3 months with deferasirox treatment was observed in all age groups except that of 11-12 years. A total of 117 ADRs were observed in 52 patients from 19498 doses, most common being diarrhea (24), raised serum creatinine (15), raised hepatic enzymes (14), abdominal pain (14) and rashes (14). A reduction in dose was required in 32 cases, while a temporary stoppage was indicated in 41 cases. Deferasirox was the possible and probable cause of 65 and 51 ADRs respectively as assessed by WHO-UMC scale. Majority of ADRs were definitely preventable

  9. Seroprevalence of Toxoplasma gondii infection Among Β-Thalassemia Major Pediatric Population: Implications for Transfusion Transmissible Toxoplasmosis.

    PubMed

    El-Tantawy, Nora; Darwish, Ahmad; Eissa, Eman

    2018-05-14

    Children with β-thalassemia major who regularly receive blood transfusion are at risk of developing transfusion-transmitted infection. Toxoplasmosis is a common and a serious parasitic disease with high prevalence and could be transmitted through blood transfusion from healthy asymptomatic donors. However, screening Toxoplasma gondii before blood donation has not been considered. To determine the prevalence of T. gondii antibodies among thalassemia children undergoing blood transfusion. In a case-control study, serum samples from 211 thalassemia children and 100 control children were investigated for Toxoplasma IgM and IgG using the enzyme-linked immunosorbent assay (ELISA). Positive serum samples for IgG antibodies to T. gondii were further subjected to IgG avidity ELISA. The seroprevalence of Toxoplasma infection among thalassemia children was 23.2% and 53.6% for IgM and IgG anti-Toxoplasma antibodies, respectively. Whereas in the contro group, the prevalence was 5% and 18% for IgM and IgG anti-Toxoplasma antibodies, respectively. There is a significant statistical difference between thalassemia and control groups regarding the prevalence of toxoplasmosis. From these positive IgG samples, 65.5% have low avidity indicating recent infection while 38.73% have high avidity indicating past infection. Due to the high serologic infection rate of toxoplasmosis among thalassemia pediatric population in this study with no existing effective therapies and no available T. gondii vaccine, appropriate strategies are critical for reducing the risk of that infection. Screening of blood for T. gondii antibodies should be considered before transmission to those children especially in countries with a high prevalence of toxoplasmosis.

  10. A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

    PubMed

    Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

    2017-02-10

    Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (P<0.01), particularly when the disease was homozygous or double heterozygous with another α- or β-thalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal

  11. Torque Teno Virus and Hepatitis C Virus Co-Infection in Iranian Pediatric Thalassemia Patients

    PubMed Central

    Alavi, Samin; Valeshabad, Ali Kord; Sharifi, Zohreh; Nourbakhsh, Kazem; Arzanian, Mohammad Taghi; Navidinia, Masoumeh; Seraj, Siamak Mehdizadeh

    2012-01-01

    Objective: Torque teno virus (TTV) infects patients at risk for parenteral exposure and chronic blood transfusion, such as those with β-thalassemic. This study aimed to assess the prevalence of TTV infection and co-infection of TTV and hepatitis C virus (HCV) in pediatric thalassemia patients receiving chronic blood transfusion. Material and Methods: The study included 90 pediatric thalassemia patients receiving chronic blood transfusion that presented to the Mofid Children’s Hospital, Tehran, Iran. The control group included 90 healthy volunteer children. Serum TTV DNA detection via semi-nested PCR and HCV Ab were performed in all the participants. Demographic characteristics and clinical data were collected from each participant for statistical analysis. Results: In all, 64.4% of the patients had TTV infection, versus 24.4% of the controls (P < 0.01). The thalassemia patients had a greater probability of having TTV and HCV infections than the controls, with a common OR of 5.60 (95% CI: 2.94-10.69) and 2.15 (95% CI: 1.83-2.50), respectively. In total, 17.2% (10/58) of the patients that were TTV positive were also HCV positive, whereas 6.3% (2/32) of the TTV-negative patients were anti-HCV antibody (Ab) positive (P = 0.14). Conclusion: The prevalence of TTV and HCV infection was higher in the Iranian thalassemia patients on chronic transfusion therapy than in the controls. The high prevalence of TTV in pediatric thalassemia patients on chromic transfusion therapy may indicate the superiority of the parenteral route compared to other routs of TTV transmission. PMID:24744647

  12. Normalized levels of red blood cells expressing phosphatidylserine, their microparticles, and activated platelets in young patients with β-thalassemia following bone marrow transplantation.

    PubMed

    Klaihmon, Phatchanat; Vimonpatranon, Sinmanus; Noulsri, Egarit; Lertthammakiat, Surapong; Anurathapan, Usanarat; Sirachainan, Nongnuch; Hongeng, Suradej; Pattanapanyasat, Kovit

    2017-10-01

    Bone marrow transplantation (BMT) serves as the only curative treatment for patients with β-thalassemia major; however, hemostatic changes have been observed in these BMT patients. Aggregability of thalassemic red blood cells (RBCs) and increased red blood cell-derived microparticles (RMPs) expressing phosphatidylserine (PS) are thought to participate in thromboembolic events by initially triggering platelet activation. To our knowledge, there has been no report providing quantitation of these circulating PS-expressing RBCs and RMPs in young β-thalassemia patients after BMT. Whole blood from each subject was fluorescently labeled to detect RBC markers (CD235a) and annexin-V together with the known number TruCount™ beads. PS-expressing RBCs, RMPs, and activated platelets were identified by flow cytometry. In our randomized study, we found the decreased levels of three aforementioned factors compared to levels in patients receiving regular blood transfusion (RT). This study showed that BMT in β-thalassemia patients decreases the levels of circulating PS-expressing RBCs, their MPs, and procoagulant platelets when compared to patients who received RT. Normalized levels of these coagulation markers may provide the supportive evidence of the effectiveness of BMT for curing thalassemia.

  13. Regulatory B cells (CD19(+)CD38(hi)CD24(hi)) in alloimmunized and non-alloimmunized children with β-thalassemia major.

    PubMed

    Zahran, Asmaa M; Elsayh, Khalid I; Saad, Khaled; Embaby, Mostafa; Ali, Ahmed M

    2016-03-01

    β-Thalassemia major (BTM) is considered the most common hemoglobinopathy in Egypt and is one of the major health problems in our locality. We investigated the frequency of B-regulatory cells (CD19(+)CD38(hi)CD24(hi)); (Bregs) among polytransfused alloimmunized and non-alloimmunized children with BTM. The study included 110 polytransfused pediatric patients with β-thalassemia major. Clinical and transfusion records of all studied patients were reviewed. Indirect antiglobulin test was performed to detect the presence of alloantibodies. We used flow cytometry for detection of CD19(+)CD38(hi)CD24(hi) regulatory B cells. Alloimmunization was detected in 35.5% of thalassemic patients (39/110). The analysis of our data showed a significantly higher frequency of Bregs (CD19(+)CD38(hi)CD24(hi)) in the peripheral blood of both alloimmunized and non-alloimmunized patients as compared to healthy controls. Our data showed that the frequencies of CD19(+)CD24(hi)CD38(hi) Bregs cells were significantly increased in children with BTM. Our data suggested that Bregs cells could play a role in the clinical course of BTM. The relationship of Bregs to immune disorders in BTM children remains to be determined. Further longitudinal study with a larger sample size is warranted to explore the mechanisms of Breg cells in the disease process in BTM patients. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Oral chelators deferasirox and deferiprone for transfusional iron overload in thalassemia major: new data, new questions

    PubMed Central

    Neufeld, Ellis J.

    2006-01-01

    For nearly 30 years, patients with transfusional iron overload have depended on nightly deferoxamine infusions for iron chelation. Despite dramatic gains in life expectancy in the deferoxamine era for patients with transfusion-dependent anemias, the leading cause of death for young adults with thalassemia major and related disorders has been cardiac disease from myocardial iron deposition. Strategies to reduce cardiac disease by improving chelation regimens have been of the highest priority. These strategies have included development of novel oral iron chelators to improve compliance, improved assessment of cardiac iron status, and careful epidemiologic assessment of European outcomes with deferiprone, an oral alternative chelator available for about a decade. Each of these strategies is now bearing fruit. The novel oral chelator deferasirox was recently approved by the Food and Drug Administration (FDA); a randomized clinical trial demonstrates that deferasirox at 20 to 30 mg/kg/d can maintain or improve hepatic iron in thalassemia as well as deferoxamine. A randomized trial based on cardiac T2* magnetic resonance imaging (MRI) suggests that deferiprone can unload myocardial iron faster than deferoxamine. Retrospective epidemiologic data suggest dramatic reductions in cardiac events and mortality in Italian subjects exposed to deferiprone compared with deferoxamine. These developments herald a new era for iron chelation, but many unanswered questions remain. PMID:16627763

  15. A prospective analysis for prevalence of complications in Thai nontransfusion-dependent Hb E/β-thalassemia and α-thalassemia (Hb H disease).

    PubMed

    Ekwattanakit, Supachai; Siritanaratkul, Noppadol; Viprakasit, Vip

    2018-05-01

    Recently, complications in patients with nontransfusion-dependent thalassemia (NTDT), in particular those with β-thalassemia intermedia (β-TI), were found to be significantly different from those in patients with transfusion dependent thalassemia (TDT), mainly β-thalassemia major (β-TM). However, this information is rather limited in other forms of NTDT. In this prospective study, adult Thai NTDT patients were interviewed and clinically evaluated for thalassemia related complications. Fifty-seven NTDT patients (age 18-74 years), 59.6% Hb E/β-thalassemia and 40.4% Hb H disease, were recruited; 26.4% were splenectomized. The most common complications were gallstones (68.4%), osteoporosis (26.3%), and pulmonary hypertension (15.8%). Splenectomy was associated with higher rate of gallstones and serious infection (P = .001 and .052, respectively), consistent with a multivariate analysis (RR = 9.5, P = .044, and RR = 15.1, P = .043, respectively). In addition, a higher hemoglobin level was inversely associated with gallstones in both univariate and multivariate analyses (P = .01 and .022, respectively). Serum ferritin was associated with abnormal liver function (P = .002). In contrast to the previous study, the prevalence of thrombosis was less common in our population (1.7%), probably due to differences in transfusion therapy, ethnicity, and underlying genotypes. For the first time, this prospective study provided the current prevalence of NTDT related complications in a Southeast Asian population with a different underlying genetic basis compared with previous studies. Although individual prevalence of each complication might differ from other studies, several important clinical factors such as splenectomy, degree of anemia, and iron overload seem to be determining risks of developing these complications consistently across different ethnicities. © 2018 Wiley Periodicals, Inc.

  16. Risk of erectile dysfunction in transfusion-naive thalassemia men: a nationwide population-based retrospective cohort study.

    PubMed

    Chen, Yu-Guang; Lin, Te-Yu; Lin, Cheng-Li; Dai, Ming-Shen; Ho, Ching-Liang; Kao, Chia-Hung

    2015-04-01

    Based on the mechanism of pathophysiology, thalassemia major or transfusion-dependent thalassemia patients may have an increased risk of developing organic erectile dysfunction resulting from hypogonadism. However, there have been few studies investigating the association between erectile dysfunction and transfusion-naive thalassemia populations. We constructed a population-based cohort study to elucidate the association between transfusion-naive thalassemia populations and organic erectile dysfunction. This nationwide population-based cohort study involved analyzing data from 1998 to 2010 obtained from the Taiwanese National Health Insurance Research Database, with a follow-up period extending to the end of 2011. We identified men with transfusion-naive thalassemia and selected a comparison cohort that was frequency-matched with these according to age, and year of diagnosis thalassemia at a ratio of 1 thalassemia man to 4 control men. We analyzed the risks for transfusion-naive thalassemia men and organic erectile dysfunction by using Cox proportional hazards regression models. In this study, 588 transfusion-naive thalassemia men and 2337 controls were included. Total 12 patients were identified within the thalassaemia group and 10 within the control group. The overall risks for developing organic erectile dysfunction were 4.56-fold in patients with transfusion-naive thalassemia men compared with the comparison cohort after we adjusted for age and comorbidities. Our long-term cohort study results showed that in transfusion-naive thalassemia men, there was a higher risk for the development of organic erectile dysfunction, particularly in those patients with comorbidities.

  17. Novel Multiplex Fluorescent PCR-Based Method for HLA Typing and Preimplantational Genetic Diagnosis of β-Thalassemia.

    PubMed

    Khosravi, Sharifeh; Salehi, Mansour; Ramezanzadeh, Mahboobeh; Mirzaei, Hamed; Salehi, Rasoul

    2016-05-01

    Thalassemia is curable by bone marrow transplantation; however, finding suitable donors with defined HLA combination remains a major challenge. Cord blood stem cells with preselected HLA system through preimplantation genetic diagnosis (PGD) proved very useful for resolving scarce HLA-matched bone marrow donors. A thalassemia trait couple with an affected child was included in this study. We used informative STR markers at the HLA and beta globin loci to develop a single cell multiplex fluorescent PCR protocol. The protocol was extensively optimized on single lymphocytes isolated from the couple's peripheral blood. The optimized protocol was applied on single blastomeres biopsied from day 3 cleavage stage IVF embryos of the couple. Four IVF embryos biopsied on day 3 and a single blastomere of each were provided for genetic diagnosis of combined β-thalassemia mutations and HLA typing. Of these, one embryo was diagnosed as homozygous normal for the thalassemia mutation and HLA matched with the existing affected sibling. The optimized protocol worked well in PGD clinical cycle for selection of thalassemia-unaffected embryos with the desired HLA system. Copyright © 2016 IMSS. Published by Elsevier Inc. All rights reserved.

  18. Poor stem cell harvest may not always be related to poor mobilization: lessons gained from a mobilization study in patients with β-thalassemia major.

    PubMed

    Constantinou, Varnavas C; Bouinta, Asimina; Karponi, Garyfalia; Zervou, Fani; Papayanni, Penelope-Georgia; Stamatoyannopoulos, George; Anagnostopoulos, Achilles; Yannaki, Evangelia

    2017-04-01

    Hematopoietic stem cell mobilization and leukapheresis in adult patients with β-thalassemia have recently been optimized in the context of clinical trials for obtaining hematopoietic stem cells for thalassemia gene therapy. In some patients, however, the yield of cluster of differentiation 34-positive (CD34+) cells was poor despite successful mobilization, and a modification of apheresis settings was mandatory for harvest rescue. Data were analyzed from 20 adult patients with β-thalassemia who were enrolled in a clinical trial of optimizing mobilization strategies for stem cell gene therapy. The aim of this post-hoc analysis was to assess how certain hematological and/or clinical parameters may correlate with low collection efficiency in the presence of adequate numbers of circulating stem cells after pharmacological mobilization and standard leukapheresis procedures. Among 19 patients who achieved optimal mobilization with Plerixafor, four who underwent splenectomy demonstrated disproportionately poor CD34+ cell harvests, as determined by their circulating CD34+ cell counts after mobilization. All four patients who underwent splenectomy presented at baseline and before first apheresis with lymphocytosis resulting in lymphocyte/neutrophil ratios well above 1 and marked reticulocytosis compared with patients who achieved optimal mobilization/CD34+ cell harvest. Such unexpected expansion of specific cell populations disrupted the normal cell layer separation and necessitated modification of the apheresis settings to rescue the harvests. By close examination of certain hematological and/or clinical parameters before leukapheresis, patients who, despite adequate mobilization, are at risk for poor CD34+ cell harvests may be identified, and harvest failure can be prevented by adjusting the apheresis settings. © 2016 AABB.

  19. Red cell alloantibodies in thalassemia major. Results of an Italian cooperative study.

    PubMed

    Sirchia, G; Zanella, A; Parravicini, A; Morelati, F; Rebulla, P; Masera, G

    1985-01-01

    Clinical and serological data on 1435 Italian thalassemia major patients were collected during a cooperative study involving 19 centers in 10 regions. The main findings were as follows: 18 percent of the patients were under 6 years of age, 63 percent between 6 and 15, and 19 percent over 15. Forty-one percent had undergone splenectomy. Sixty-two percent of the patients were maintained at pretransfusion hemoglobin levels higher than 10 g per dl, 36 percent between 8 and 10 g per dl, and 2 percent below 8 g per dl. Overall, 5.2 percent of the patients had clinically significant red cell alloantibodies (136 alloantibodies in 74 patients). One-half of the immunized patients had more than one and one-fourth had more than two alloantibodies. The specificities of the 136 alloantibodies were almost exclusively confined to the common antigens of the Rh, Kell, Kidd, and Duffy systems, in that decreasing order of frequency. The antibody screening procedure, using a low-ionic-strength solution antiglobulin test against a three-red-cell panel and the patient's own red cells (autocontrol) with a serum to cell ratio of 100 to 1 was shown to be an adequate technique for red cell antibody detection.

  20. Inadequate dietary intake in patients with thalassemia.

    PubMed

    Fung, Ellen B; Xu, Yan; Trachtenberg, Felicia; Odame, Isaac; Kwiatkowski, Janet L; Neufeld, Ellis J; Thompson, Alexis A; Boudreaux, Jeanne; Quinn, Charles T; Vichinsky, Elliott P

    2012-07-01

    Patients with thalassemia have low circulating levels of many nutrients, but the contribution of dietary intake has not been assessed. Our objective was to assess dietary intake in a large contemporary sample of subjects with thalassemia. A prospective, longitudinal cohort study using a validated food frequency questionnaire was conducted. Two hundred and twenty-one subjects (19.7±11.3 years, 106 were female) were categorized into the following age groups: young children (3 to 7.9 years), older children/adolescents (8 to 18.9 years), and adults (19 years or older); 78.8% had β-thalassemia and 90% were chronically transfused. This study took place at 10 hematology outpatient clinics in the United States and Canada. We conducted a comparison of intake with US Dietary Reference Intakes and correlated dietary intake of vitamin D with serum 25-OH vitamin D and dietary iron with total body iron stores. Intake was defined as inadequate if it was less than the estimated average requirement. χ(2), Fisher's exact, and Student's t test were used to compare intake between age categories and logistic regression analysis to test the relationship between intake and outcomes, controlling for age, sex, and race. More than 30% of subjects consumed inadequate levels of vitamin A, D, E, K, folate, calcium, and magnesium. The only nutrients for which >90% of subjects consumed adequate amounts were riboflavin, vitamin B-12, and selenium. Dietary inadequacy increased with increasing age group (P<0.01) for vitamins A, C, E, B-6, folate, thiamin, calcium, magnesium, and zinc. More than half of the sample took additional supplements of calcium and vitamin D, although circulating levels of 25-OH vitamin D remained insufficient in 61% of subjects. Dietary iron intake was not related to total body iron stores. Subjects with thalassemia have reduced intake of many key nutrients. These preliminary findings of dietary inadequacy are concerning and support the need for nutritional monitoring to

  1. Glucose Homeostasis and Effect of Chelation on β Cell Function in Children With β-Thalassemia Major.

    PubMed

    Gomber, Sunil; Dabas, Aashima; Bagmar, Shilpa; Madhu, Sri Venkata

    2018-01-01

    To assess the prevalence of impaired glucose tolerance in β-thalassemia major and correlate it with chelation therapy. Sixty-seven subjects with β-thalassemia major, aged 1 to 20 years, were enrolled in our prospective cohort. Clinical details were recorded. Baseline oral glucose tolerance test, serum insulin, C peptide, and insulin resistance were measured. The biochemical profile was repeated after 6 months. The mean age of subjects was 7.43±4.48 years. Eight (11.9%) subjects had impaired fasting glucose, 7 (10.4%) had impaired glucose tolerance, and 1 (1.4%) subject had diabetes at baseline. Subjects with abnormal glucose profile had longer disease duration (95% confidence interval [CI] of difference=-6.64 to -0.68; P=0.019) and higher fasting blood glucose (95% CI of difference=-32.1 to -10.5; P=0.001) and serum ferritin (95% CI of difference=-219.8 to -3.4; P=0.001) than normoglycemic subjects. Insulin resistance and serum ferritin showed significant increase at 6 months (P<0.001 and P=0.001, respectively). Patients on deferiprone alone significantly improved glucose homeostasis on follow-up than those on desferrioxamine or combination therapy of desferrioxamine and deferiprone (P<0.05). Prolonged disease duration and higher serum ferritin adversely affects glucose homeostasis in thalassemic children. Deferiprone was the most effective chelator to improve glucose homeostasis in chronically transfused thalassemics.

  2. Oral Health and Dentofacial Anomalies among β-THALASSEMIA Major in Erbil City, Iraq

    NASA Astrophysics Data System (ADS)

    Saeed, Lamya M.; Majeed, Vian O.

    2010-04-01

    Thalassemias are a heterogeneous group of genetic disorders characterized by hypochromic microcytic anemia that caused by deficient synthesis of one or more of globin subunits of human hemoglobin. This study has been conducted in the Northern part of Iraq among 238 subjects having β-thalassemia major (BTM). To evaluate their oral health status, dentofacial anomalies of patients who attended the Thalassemic center in Erbil city, were compared to 258 subjects of a control group according to the criteria suggested by the WHO in 1997, which is used to assess permanent teeth. Only 8.51% of the total study group demonstrated crowding of anterior teeth in one or both segments compared to the control group. Spacing in the incisal segments was higher, namely 19.23% in BTM compared to13.6% in the control group with a statistically significant difference (p<0.05). A higher percentage of both study and control groups were having an overbite grade (0.3-5.0 mm) of 49.59%, and 56.81%, respectively. It was found that the distal deviation from the normal anteroposterior molar relation in BTM was higher compared to the control group. Nearly similar percentages of patients were found to have an over jet grade(0.0-3.5 mm). Values of plaque and gingival health indices were recorded to be higher among the study group (plaque index = 1.570, ∓0.321 and gingival index = 1.205, ∓0.308). Differences were statistically highly significant for all indices (p<0.01). This may indicate that there is a negative attitude and poor dental knowledge of thalassemic subjects and their parents toward proper oral hygiene and dental health.

  3. Evaluation of some essential element levels in thalassemia major patients in Mosul district, Iraq.

    PubMed

    Al-Samarrai, Abdulmunaim H; Adaay, Mohaisen H; Al-Tikriti, Khudhair A; Al-Anzy, Muayed M

    2008-01-01

    To evaluate the levels of some essential elements in thalassemic patients in Mosul, Iraq. One hundred and five thalassemic blood transfusion dependent children, 2.5-18 years of age attending Ibn-Al-Atheer teaching hospital in Mosul City, Iraq, during 2005, were used in this study. Fifty-four healthy subjects served as a control group. Patients were allocated in a non-randomized prospective cross-sectional hospital based study. Essential elements levels were estimated. The mean, standard deviation, correlation coefficient, and z-test were used. P-values <0.05 were considered statistically significant. Low serum zinc, and magnesium, and high serum copper, and potassium levels were found among the 105 thalassemic patients compared to the 54 controls. Levels of calcium, phosphate, and sodium were within normal limits. Fluctuations in the essential elements levels seem to be related to the different complications associated with the disease. Zinc deficiency may be attributed to hyperzincuria resulted from the release of Zn from hemolyzed red cells. Hypercupremia occurs in acute and chronic infections and hemochromatosis, which is a principal complication of thalassemia. Increased Na levels may be due to renal damage. Hypomagnesemia may occur due to hypoparathyroidism.

  4. Evaluation of the glucocorticoid, mineralocorticoid, and adrenal androgen secretion dynamics in a large cohort of patients aged 6-18 years with transfusion-dependent β-thalassemia major, with an emphasis on the impact of cardiac iron load.

    PubMed

    Uçar, Ahmet; Öner, Nergiz; Özek, Gülcihan; Çetinçakmak, Mehmet Güli; Abuhandan, Mahmut; Yıldırım, Ali; Kaya, Cemil; Ünverdi, Sena; Emeksiz, Hamdi Cihan; Yılmaz, Yasin; Yetim, Aylin

    2016-07-01

    The variable presence of adrenal insufficiency (AI) due to hypocortisolemia (HC) in patients with thalassemia is well established; however, the prevalence of adrenocortical hypofunction (ACH) in the zona glomerulosa and zona reticularis of the adrenal cortex is unknown. To establish the prevalence of ACH, we examined the cortisol response to 1-µg and 250-µg ACTH tests, plasma aldosterone (A)/plasma renin activity (PRA) ratio, and serum dehydroepiandrosterone sulfate (DHEAS) levels in a large cohort of patients with thalassemia, and to investigate the impact of total body iron load (TBIL) on adrenocortical function. The setting used was University hospital and government-based tertiary care center. One hundred twenty-one (52 females) patients with β-thalassemia major (β-TM) and 72 healthy peers (38 females) were enrolled. The patients underwent a 250-µg cosyntropin test if their peak cortisol was <500 nmol/L in a 1-µg cosyntropin test. Magnetic resonance imaging (MRI) was performed to assess the MRI-based liver iron content and cardiac MRI T2* iron. The associations between ACH and TBIL were investigated. The patients with thalassemia had lower ACTH, cortisol, DHEAS, and A/PRA values compared with the controls (p < 0.001). Thirty-nine patients (32.2 %) had HC [primary (n = 1), central (n = 36), combined (n = 2)], and 47 (38.8 %) patients had reduced DHEAS levels; 29 (24.0 %) patients had reduced A/PRA ratios. Forty-six (38.0 %) patients had hypofunction in one of the adrenal zones, 26 (21.5 %) had hypofunction in two adrenal zones, and 9 (7.4 %) had hypofunction in all three zones. Patient age and TBIL surrogates were significant independent parameters associated with ACH. Cardiac MRI T2* iron was the only significant parameter that predicted the severity of ACH at a cut-off of 20.6 ms, with 81 % sensitivity and 78 % specificity. Patients with thalassemia have a high prevalence of AI due to HC and zona glomerulosa and zona reticularis

  5. Consequences and costs of noncompliance with iron chelation therapy in patients with transfusion-dependent thalassemia: a literature review.

    PubMed

    Delea, Thomas E; Edelsberg, John; Sofrygin, Oleg; Thomas, Simu K; Baladi, Jean-Francois; Phatak, Pradyumna D; Coates, Thomas D

    2007-10-01

    Patients with thalassemia major require iron chelation therapy (ICT) to prevent complications from transfusional iron overload. Deferoxamine is effective, but requires administration as a slow continuous subcutaneous or intravenous infusion five to seven times per week. Deferiprone is a three-times-daily oral iron chelator, but has limited availability in the United States. Deferasirox is a once-daily oral iron chelator that was approved in the United States in 2005 for patients older than 2 years of age with transfusional iron overload. Published evidence on rates of compliance with ICT and the association between compliance, and the incidence and costs of complications of iron overload, in patients with thalassemia major was reviewed. A total of 18 studies were identified reporting data on compliance with ICT, including 7 that examined deferoxamine only, 6 that examined deferiprone only, and 5 that compared deferoxamine and deferiprone; no studies reporting compliance with deferasirox were identified. In studies of deferoxamine only, estimated mean compliance ranged from 59 to 78 percent. Studies of deferiprone generally reported better compliance, ranging from 79 to 98 percent. Results of comparative studies of deferoxamine and deferiprone suggest that compliance may be better with oral therapy. Numerous studies demonstrate that that poor compliance with ICT results in increased risk of cardiac disease and endocrinopathies, as well as lower survival. Although data on the costs of noncompliance are limited, a recent model-based study estimated the lifetime costs of inadequate compliance with deferoxamine to be $33,142. Inadequate compliance with ICT in thalassemia major is common and results in substantial morbidity and mortality, as well as increased costs.

  6. The Effects of an Orientation Program on Quality of Life of Patients with Thalassemia: a Quasi-Experimental Study.

    PubMed

    Rafii, Zahra; Ahmadi, Fazlollah; Nourbakhsh, Sayed Mohamad Kazem; Hajizadeh, Ebrahim

    2016-09-01

    Introduction: Medical advances have improved life expectancy and survival of patients with thalassemia. However, as getting older, patients with thalassemia experience different complications which impair their quality of life. The aim of this study was to examine the effects of a nurse-implemented orientation program on quality of life in patients with thalassemia. Methods: A convenience sample of 55 patients with thalassemia were recruited in this quasi-experimental study. Patients were randomly allocated to control or experimental groups. A demographic questionnaire, Thalassemia quality of life questionnaire, and 36-item short form health survey were used for data collection before and one month after the intervention. In the intervention group, 1.5-month orientation program including of the three steps of inauguration, implementation, and closure was implemented, while the control group received routine care. The Chi-square, independent t-test and paired-samples t-test were used for data analysis by using SPSS ver.13 software. Results: The intervention and control group did not differ significantly from each other regarding demographic characteristics. Moreover, no significant difference was observed between the two groups regarding the quality of life scores after the implementation of orientation program. Conclusion: Implementing a short-term orientation program was not effective in enhancing the quality of life in patients with thalassemia; hence, developing long-term multimodal strategies may result in better improvement.

  7. The Assessment of Skin Color and Iron Levels in Pediatric Patients with β-Thalassemia Major Using a Visual Skin Color Chart.

    PubMed

    Bucak, Ibrahim H; Almis, Habip; Benli, Samet; Turgut, Mehmet

    2017-03-01

    Patients with β-thalassemia major (β-TM), a disease that emerges due to disorder of hemoglobin (Hb) synthesis, require life-long erythrocyte transfusion. The purpose of this study was to evaluate skin color and iron levels of patients with β-TM using a visual skin color chart. Each patient's skin color was matched on a skin color chart under a fluorescent lamp by the same physician on each occasion. Iron, iron binding capacity, ferritin and complete blood count (CBC) were studied for each patient enrolled. Colors marked on the visual skin color chart were compared with the laboratory results. Thirty-five patients being monitored at our hospital were included, 19 (54.3%) males and 16 (45.7%) females. The colors marked on the chart darkened as patients aged (p = 0.002, r = 0.49), the frequency of annual transfusions (p = 0.022, r = 0.385), ferritin levels (p < 0.001, r = 0.72) and iron levels increased (p = 0.001, r = 0.538) and as total iron binding capacity (TIBC) decreased (p < 0.001, r = -0.709). On the basis of this study, iron deposition in patients with β-TM was correlated with the colors on the chart.

  8. Molecular Mechanism of Yisui Shengxue Granule, a Complex Chinese Medicine, on Thalassemia Patients Suffering from Hemolysis and Anemia of Erythrocytes

    PubMed Central

    Chu, Na-Li; Wu, Zhi-kui; Zhang, Xin-Hua; Fang, Su-Ping; Wang, Wen-Juan; Cheng, Yan-Ling

    2014-01-01

    The objective of this study was to investigate the therapeutic biological mechanism of Yisui Shengxue Granule (YSSXG), a complex Chinese medicine, on the hemolysis and anemia of erythrocytes from patient with thalassemia disease. Sixteen patients with thalassemia (8 cases of α-thalassemia and 8 cases of β-thalassemia) disease were collected and treated with YSSXG for 3 months. The improvements of blood parameter demonstrated that YSSXG had a positive clinical effect on patients with thalassemia disease. For patients with α-thalassemia disease, RT-PCR showed that YSSXG upregulated the relative mRNA expression level of α-globin to β-globin and downregulated DNMT1, DNMT3a, and DNMT3b mRNA compared with pretreatment. Western blotting showed that YSSXG downregulated the expression of DNMT1 and DNMT3a. For patients with β-thalassemia disease, the relative expression level of A γ-globin to α-globin had an increasing trend and the level of BCL11A mRNA expression obviously increased. For all patients, RT-PCR showed that YSSXG upregulated mRNA expression of SPTA1 and SPTB. Activities of SOD and GSH-Px significantly increased and MDA obviously reduced on erythrocyte and blood serum after YSSXG treatment. TEM showed that YSSXG decreased the content of inclusion bodies. Activities of Na+K+-ATPtase and T-ATPtase of erythrocyte increased significantly after YSSXG treatment. This study provides the basis for mechanisms of YSSXG on thalassemia suffering with hemolysis and anemia of erythrocytes from patient. PMID:25574177

  9. Right ventricular volumes and function in thalassemia major patients in the absence of myocardial iron overload

    PubMed Central

    2010-01-01

    Aim We aimed to define reference ranges for right ventricular (RV) volumes, ejection fraction (EF) in thalassemia major patients (TM) without myocardial iron overload. Methods and results RV volumes, EF and mass were measured in 80 TM patients who had no myocardial iron overload (myocardial T2* > 20 ms by cardiovascular magnetic resonance). All patients were receiving deferoxamine chelation and none had evidence of pulmonary hypertension or other cardiovascular comorbidity. Forty age and sex matched healthy non-anemic volunteers acted as controls. The mean RV EF was higher in TM patients than controls (males 66.2 ± 4.1% vs 61.6 ± 6%, p = 0.0009; females 66.3 ± 5.1% vs 62.6 ± 6.4%, p = 0.017), which yielded a raised lower threshold of normality for RV EF in TM patients (males 58.0% vs 50.0% and females 56.4% vs 50.1%). RV end-diastolic volume index was higher in male TM patients (mean 98.1 ± 17.3 mL vs 88.4 ± 11.2 mL/m2, p = 0.027), with a higher upper limit (132 vs 110 mL/m2) but this difference was of borderline significance for females (mean 86.5 ± 13.6 mL vs 80.3 ± 12.8 mL/m2, p = 0.09, with upper limit of 113 vs 105 mL/m2). The cardiac index was raised in TM patients (males 4.8 ± 1.0 L/min vs 3.4 ± 0.7 L/min, p < 0.0001; females 4.5 ± 0.8 L/min vs 3.2 ± 0.8 L/min, p < 0.0001). No differences in RV mass index were identified. Conclusion The normal ranges for functional RV parameters in TM patients with no evidence of myocardial iron overload differ from healthy non-anemic controls. The new reference RV ranges are important for determining the functional effects of myocardial iron overload in TM patients. PMID:20416084

  10. Iron chelation with deferasirox in adult and pediatric patients with thalassemia major: efficacy and safety during 5 years' follow-up.

    PubMed

    Cappellini, M Domenica; Bejaoui, Mohamed; Agaoglu, Leyla; Canatan, Duran; Capra, Marcello; Cohen, Alan; Drelichman, Guillermo; Economou, Marina; Fattoum, Slaheddine; Kattamis, Antonis; Kilinc, Yurdanur; Perrotta, Silverio; Piga, Antonio; Porter, John B; Griffel, Louis; Dong, Victor; Clark, Joan; Aydinok, Yesim

    2011-07-28

    Patients with β-thalassemia require lifelong iron chelation therapy from early childhood to prevent complications associated with transfusional iron overload. To evaluate long-term efficacy and safety of once-daily oral iron chelation with deferasirox, patients aged ≥ 2 years who completed a 1-year, phase 3, randomized trial entered a 4-year extension study, either continuing on deferasirox (deferasirox cohort) or switching from deferoxamine to deferasirox (crossover cohort). Of 555 patients who received ≥ 1 deferasirox dose, 66.8% completed the study; 43 patients (7.7%) discontinued because of adverse events. In patients with ≥ 4 years' deferasirox exposure who had liver biopsy, mean liver iron concentration significantly decreased by 7.8 ± 11.2 mg Fe/g dry weight (dw; n = 103; P < .001) and 3.1 ± 7.9 mg Fe/g dw (n = 68; P < .001) in the deferasirox and crossover cohorts, respectively. Median serum ferritin significantly decreased by 706 ng/mL (n = 196; P < .001) and 371 ng/mL (n = 147; P < .001), respectively, after ≥ 4 years' exposure. Investigator-assessed, drug-related adverse events, including increased blood creatinine (11.2%), abdominal pain (9.0%), and nausea (7.4%), were generally mild to moderate, transient, and reduced in frequency over time. No adverse effect was observed on pediatric growth or adolescent sexual development. This first prospective study of long-term deferasirox use in pediatric and adult patients with β-thalassemia suggests treatment for ≤ 5 years is generally well tolerated and effectively reduces iron burden. This trial was registered at www.clinicaltrials.gov as #NCT00171210.

  11. Reduced PU.1 expression underlies aberrant neutrophil maturation and function in β-thalassemia mice and patients.

    PubMed

    Siwaponanan, Panjaree; Siegers, Jurre Ynze; Ghazali, Razi; Ng, Thian; McColl, Bradley; Ng, Garrett Zhen-Wei; Sutton, Philip; Wang, Nancy; Ooi, Isabelle; Thiengtavor, Chayada; Fucharoen, Suthat; Chaichompoo, Pornthip; Svasti, Saovaros; Wijburg, Odilia; Vadolas, Jim

    2017-06-08

    β-Thalassemia is associated with several abnormalities of the innate immune system. Neutrophils in particular are defective, predisposing patients to life-threatening bacterial infections. The molecular and cellular mechanisms involved in impaired neutrophil function remain incompletely defined. We used the Hbb th3/+ β-thalassemia mouse and hemoglobin E (HbE)/β-thalassemia patients to investigate dysregulated neutrophil activity. Mature neutrophils from Hbb th3/+ mice displayed a significant reduction in chemotaxis, opsonophagocytosis, and production of reactive oxygen species, closely mimicking the defective immune functions observed in β-thalassemia patients. In Hbb th3/+ mice, the expression of neutrophil CXCR2, CD11b, and reduced NAD phosphate oxidase components (p22phox, p67phox, and gp91phox) were significantly reduced. Morphological analysis of Hbb th3/+ neutrophils showed that a large percentage of mature phenotype neutrophils (Ly6G hi Ly6C low ) appeared as band form cells, and a striking expansion of immature (Ly6G low Ly6C low ) hyposegmented neutrophils, consisting mainly of myelocytes and metamyelocytes, was noted. Intriguingly, expression of an essential mediator of neutrophil terminal differentiation, the ets transcription factor PU.1, was significantly decreased in Hbb th3/+ neutrophils. In addition, in vivo infection with Streptococcus pneumoniae failed to induce PU.1 expression or upregulate neutrophil effector functions in Hbb th3/+ mice. Similar changes to neutrophil morphology and PU.1 expression were observed in splenectomized and nonsplenectomized HbE/β-thalassemia patients. This study provides a mechanistic insight into defective neutrophil maturation in β-thalassemia patients, which contributes to deficiencies in neutrophil effector functions. © 2017 by The American Society of Hematology.

  12. The prevalence of hepatitis C virus infection in thalassemia patients in Iran from 2000 to 2017: a systematic review and meta-analysis.

    PubMed

    Behzadifar, Masoud; Gorji, Hassan Abolghasem; Bragazzi, Nicola Luigi

    2018-05-01

    One of the major infections transmitted through the bloodstream is hepatitis C virus (HCV) infection. Patients with thalassemia requiring frequent blood transfusions are at risk for HCV. Therefore, this study was conducted to determine the incidence of HCV in thalassemia patients in Iran. The following databases were searched: ISI/Web of Science, Embase, Pubmed/MEDLINE via Ovid, Scopus, as well as Iranian databases (Magiran, Irandoc and SID) from January 2000 to July 2017. The quality of the studies was evaluated using the 22-item STROBE checklist. The random model based on the DerSimonian/Laird approach was used. To assess the stability of the results, a sensitivity analysis was performed, stratifying on the basis of quality, sample size, year of publication, and geographical area of studies. Also, meta-regression analyses were carried out in terms of sample size and year of publication of studies. Fifty-two studies were included. The total number of patients included was 13,291. Based on the random model, the overall prevalence of HCV in thalassemia patients was 19% (95% CI 16-21). The results did not differ before and after sensitivity analysis. The prevalence of HCV in thalassemia patients in Iran was 19%. This figure was lower than in the neighboring countries of Iran. Screening and the use of diagnostic methods for screening blood donors are essential. In addition, the treatment of patients should be seriously addressed by the agenda of the Iranian health system.

  13. Hypertriglyceridemia Thalassemia Syndrome: Common Disease, Uncommon Association.

    PubMed

    Das, Lipsa; Samprathi, Madhusudan; Shukla, Umesh; Bandyopadhyay, Debapriya; Das, Rashmi Ranjan

    2016-07-01

    Hypertriglyceridemia has been rarely described with thalassemia, an entity called hypertriglyceridemia-thalassemia syndrome. The authors describe a young infant diagnosed with thalassemia major with severe hypertriglyceridemia. The presence of severe hypertriglyceridemia in this child which rapidly resolved after transfusion, probably suggests a self limited mechanism which may not require therapy. Though hypertriglyceridemia has been reported with hemolytic anemias, the mechanism is unclear. This case illustrates that thalassemia may be associated with hypertriglyceridemia; once familial and secondary causes are ruled out, clinicians may wait for spontaneous resolution before considering specific therapy.

  14. Preventing thalassemia in Lebanon: successes and challenges in a developing country.

    PubMed

    Abi Saad, Michele; Haddad, Anthony G; Alam, Elie S; Aoun, Sanaa; Maatouk, Pascale; Ajami, Najat; Khairallah, Therese; Koussa, Suzanne; Musallam, Khaled M; Taher, Ali T

    2014-01-01

    Thalassemia continues to be a major health burden. The chronicity of the disease and the high cost of life-long treatment make prevention strategies crucial in the management of this disease. In this article, we revisit different successful prevention strategies, and underline the Lebanese model. The Chronic Care Center (CCC), Beirut, is the only specialized center in Lebanon for the treatment and prevention of thalassemia. The current number of patients registered up to August 2013 was 724, representing cases from all over Lebanon. In 1994, the center launched a national prevention program following the World Health Organization (WHO) recommendations. The major activities of the program include awareness campaigns, screening for thalassemia carriers in the general population and high risk groups, registry of new cases and follow-up on the mandatory premarital law (established at the same time). Screening programs showed a carrier rate of around 2.3% in the general population, and 4.0-41.0% in high risk groups. The major pitfall in the law is that only persons with a mean corpuscular volume (MCV) of >70.0 fL are asked to perform further hemoglobin (Hb) testing. A significant decrease in the number of new cases of thalassemia patients in Lebanon reflects the efforts deployed in the prevention of the disease. However, some limitations are faced in reaching a complete eradication of the disease, mainly due to the fact that abortion is illegal and due to pitfalls and incorrect implementation of the premarital law.

  15. β-thalassemias: paradigmatic diseases for scientific discoveries and development of innovative therapies.

    PubMed

    Rivella, Stefano

    2015-04-01

    β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.

  16. Lymphocyte changes in beta-thalassaemia major.

    PubMed Central

    Musumeci, S; Schiliro, G; Romeo, M A; Sciotto, A; Rosalba, A; Pizzarelli, G

    1979-01-01

    Lymphocyte subpopulations were studied in 20 hypertransfused patients with beta-thalassaemia major, some of whom had been splenectomised. B-lymphocytes were normal but T-lymphocytes were decreased in all patients. The T-cell count was lower in the splenectomised patients than in the nonsplenectomised ones. In the former, the active rosette-forming lymphocytes were also diminished, but the difference was not significant. In all patients the percentage of null cells was greater and the activity of K-cells increased compared with controls. PMID:316991

  17. Deferasirox-Iron Complex Formation Ratio as an Indicator of Long-term Chelation Efficacy in β-Thalassemia Major.

    PubMed

    Lu, Meng-Yao; Lin, Ting-Hao; Chiang, Po-Hung; Kuo, Pei-Hsin; Wang, Ning; Wu, Wen-Hsin; Lin, Kai-Hsin; Wu, Tzu-Hua

    2017-04-01

    β-Thalassemia major patients with higher total drug levels [deferasirox (DEFR) plus its iron complex] do not yield better serum ferritin (SF) control. This study aimed to determine the concentrations of DEFR and its iron complex (Fe-[DEFR]2) in thalassemia patients to predict the chelation efficacy in terms of SF and cardiac T2* values. Patients' steady-state drug levels at trough (Ctrough) and 2 hours postdose (C2h) were determined. Because iron deposition may cause changes in the hepatic metabolism of amino acids, the concentrations of 40 amino acids in plasma were also assayed at 2 hours postdose. A total of 28 patients either dosing daily or twice daily were recruited. After a 1-month DEFR maintenance therapy, 38.8% and 30% of patients from groups of once-daily and twice-daily, respectively, had a plasma DEFR-iron complex formation ratio higher than 0.05 [High Chelation Ratio, (HCR)]. After a 6-month follow-up, those patients who had a HCR (n = 10) at C2h showed more favorable median changes in SF and cardiac T2* values (-388.0, +10.1) than those with a low DEFR-iron complex formation ratio (Low Chelation Ratio; n = 18; +10.5; +4.5) compared with the baseline. The levels of plasma L-arginine, L-alanine, L-glycine, L-norleucine, and L-serine were significantly lower in patients with the low Chelation Ratio condition than the levels in HCR patients. This therapeutic drug monitoring study revealed that a DEFR-iron complex formation ratio at C2h might be an applicable indicator of the efficacy of long-term DEFR iron chelation therapy. A better iron-control response to DEFR was observed in the patients with HCRs. The trends for the ratio might have value in dose-setting and need to be validated in a larger cohort.

  18. Hematopoietic Stem Cell Transplantation in Thalassemia and Sickle Cell Disease. Unicenter Experience in a Multi-Ethnic Population.

    PubMed Central

    Marziali, Marco; Isgrò, Antonella; Gaziev, Javid; Lucarelli, Guido

    2009-01-01

    Hematopoietic stem cell transplantation (HSCT) still remains the only definitive cure currently available for patients with thalassemia and sickle cell anemia. Results of transplant in thalassemia and in sickle cell anemia have steadily improved over the last two decades due to improvements in preventive strategies, and effective control of transplant-related complications. From 2004 through 2009, 145 consecutive patients with thalassemia and sickle cell anemia, ethnically heterogeneous from Mediterranean and Middle East countries, were given HSCT in the International Center for Transplantation in Thalassemia and Sickle Cella Anemia in Rome. This experience is characterized by two peculiarities: patients were ethnically very heterogeneous and the vast majority of these patients were not regularly transfesed/chelated and therefore were highly sensitized due to RBC transfusions without leukodepletion filters. Consequently, they could have a high risk of graft rejection as a result of sensitization to HLA antigens. The Rome experience of SCT in patients with thalassemia and sickle cell anemia confirmed the results obtained in Pesaro, and most importantly showed the reproducibility of these results in other centers. PMID:21415995

  19. Hepcidin is suppressed by erythropoiesis in hemoglobin E β-thalassemia and β-thalassemia trait

    PubMed Central

    Jones, Emma; Pasricha, Sant-Rayn; Allen, Angela; Evans, Patricia; Fisher, Chris A.; Wray, Katherine; Premawardhena, Anuja; Bandara, Dyananda; Perera, Ashok; Webster, Craig; Sturges, Pamela; Olivieri, Nancy F.; St. Pierre, Timothy; Armitage, Andrew E.; Porter, John B.; Weatherall, David J.

    2015-01-01

    Hemoglobin E (HbE) β-thalassemia is the most common severe thalassemia syndrome across Asia, and millions of people are carriers. Clinical heterogeneity in HbE β-thalassemia is incompletely explained by genotype, and the interaction of phenotypic variation with hepcidin is unknown. The effect of thalassemia carriage on hepcidin is also unknown, but it could be relevant for iron supplementation programs aimed at combating anemia. In 62 of 69 Sri Lankan patients with HbE β-thalassemia with moderate or severe phenotype, hepcidin was suppressed, and overall hepcidin inversely correlated with iron accumulation. On segregating by phenotype, there were no differences in hepcidin, erythropoiesis, or hemoglobin between severe or moderate disease, but multiple linear regression showed that erythropoiesis inversely correlated with hepcidin only in severe phenotypes. In moderate disease, no independent predictors of hepcidin were identifiable; nevertheless, the low hepcidin levels indicate a significant risk for iron overload. In a population survey of Sri Lankan schoolchildren, β-thalassemia (but not HbE) trait was associated with increased erythropoiesis and mildly suppressed hepcidin, suggesting an enhanced propensity to accumulate iron. In summary, the influence of erythropoiesis on hepcidin suppression associates with phenotypic disease variation and pathogenesis in HbE β-thalassemia and indicates that the epidemiology of β-thalassemia trait requires consideration when planning public health iron interventions. PMID:25519750

  20. Combination of a triple alpha-globin gene with beta-thalassemia in a gypsy family: importance of the genetic testing in the diagnosis and search for a donor for bone marrow transplantation for one of their children.

    PubMed

    Yus Cebrian, Flor; Recasens Flores, María del Valle; Izquierdo Álvarez, Silvia; Parra Salinas, Ingrid; Rodriguez-Vigil Iturrate, Carmen

    2016-04-14

    The simultaneous presence of a heterozygous β-thalassemia with α-gene triplication may cause anything from a thalassemia trait to thalassemia intermedia of mild to moderate severity. An 8-month-old ethnic Gypsy male infant with failure to thrive from birth, mild jaundice and splenomegaly. Clinical signs were compatible with severe microcytic anemia requiring bi-monthly blood transfusions. The β-thalassemia gene analysis found homozygous mutation IVS-I-110 (G>A) (c.93-21G>A) in intron 1 of the hemoglobin beta globin gene and a non-pathogenic sequence variant (single nucleotide polimorfism (SNP) Rs1609812). In addition, the patient had α gene triplication (ααα(anti 3.7)/αα) caused by double heterozygosity for a 3.7 kb fragment that contained only the hemoglobin alpha globin gene-2 gene. This finding led to screening and follow up in first-degree relatives, twin brothers and a sister and parents to provide them with appropriate genetic counseling. Nowadays, new horizons could open a new therapeutic management until definitive cure of these diseases through gene therapy or mutation-specific genome editing. Genetic testing can provide an early diagnosis and facilitates the search for a suitable donor for transplantation.

  1. Radiological and clinical difficulties in the management of chronic maxillary sinusitis in β Thalassemic paediatric patients.

    PubMed

    Di Mauro, R; Greco, L; Melis, M; Manenti, G; Floris, R; Giacomini, P G; Di Girolamo, M; Di Girolamo, S

    2016-05-01

    Beta thalassemia is a blood dyscrasia that caused a marked expansion of active marrow spaces and extramedullary haematopoiesis results. In these patients various alterations and abnormalities affects different body areas, including increased risk of sinusitis. The marrow expansion in the facial bones results in delay in pneumatisation of the sinuses, overgrowth of the maxillae, and forward displacement of the upper incisors with skeletal deformities. In current literature, maxillary sinuses are not deeply evaluated by CT scan studies in these kind of patients. The aim of our study was to investigate the presence of maxillary sinuses abnormalities by the use of CT in patients with beta-thalassemia major and to compare these findings with a control group free from this disease. A retrospective analysis of 22 paediatric patients with beta-thalassemia major and 22 control subjects without sinonasal diseases was performed. CT was done using a 64-multidetector-row CT scanner without contrast injection, obtained in axial plane using thin-slice technique. Evaluated parameters were: bone thickness of the lateral and anterior wall, density and volume of the maxillary sinuses. Significant difference was found between the study group and control group in the evaluation of all the parameters examined. The maxillary sinus of β thalassemic patients was smaller respect of controls, the bone was more dense and thick in the side and anterior wall. Beta-thalassemic patients have a relative risk of 2.87 to develop a maxillary sinusitis. In these patients there is an increased incidence of sinonasal infections due to the abnormal development of cranio facial skeleton. These bone alterations might confuse the physicians and lead to an increased rate of sinusitis diagnoses. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. Compound heterozygosity for Hb S [beta6(A3)GluVal, GAG-->GTG] and a new thalassemic mutation [beta132(H10)Lys-->term, AAA-->TAA] detected in a family from West Africa.

    PubMed

    Frischknecht, Hannes; Troxler, Heinz; Greiner, Jeanette; Hengartner, Heinz; Dutly, Fabrizio

    2008-01-01

    We describe a Hb S/beta-thalassemia (beta-thal) mutation involving an AT transition at codon 132 of the beta-globin gene. The mutation, in the heterozygous state, unlike several other mutations in exon 3, shows no signs of dominant thalassemia but those of a typical beta(0) carrier. Compound heterozygosity with Hb S [beta6(A3)GluVal, GAGGTG] showed a severe clinical picture.

  3. Pathophysiology of transfusional iron overload: contrasting patterns in thalassemia major and sickle cell disease.

    PubMed

    Porter, John B

    2009-01-01

    The pathophysiological consequences of transfusional iron overload largely reflect the pattern of excess iron distribution and include cardiomyopathy, endocrinopathy, cirrhosis, and hepatocellular carcinoma. Since the introduction of desferrioxamine (DFO) in the late 1970s, these complications have fallen substantially but approximately half of the chelated adult patients with thalassemia major (TM) still show evidence of increased myocardial iron loading by MRI. An understanding of the factors that determine the propensity to extrahepatic iron distribution may be a key to minimizing the pathophysiological consequences of transfusional iron overload. Transfused patients with sickle cell disease (SCD) appear less likely to develop these extrahepatic complications, possibly because plasma nontransferrin-bound iron (NTBI) levels are typically lower than in TM patients at matched levels of iron loading. Other mechanisms that may reduce the extrahepatic iron distribution in SCD include raised plasma hepcidin due to chronic inflammation, lower growth differentiation factor 15 (GDF15) levels because of less ineffective erythropoiesis (IE), and induction of heme oxygenase (HO1) by intravascular hemolysis. Further understanding of these mechanisms may help in designing strategies to decrease extrahepatic iron distribution in TM.

  4. The Effects of Group Play Therapy on Self-Concept Among 7 to 11 Year-Old Children Suffering From Thalassemia Major.

    PubMed

    Tomaj, Ome Kolsoum; Estebsari, Fatemeh; Taghavi, Taraneh; Borim Nejad, Leili; Dastoorpoor, Maryam; Ghasemi, Afsaneh

    2016-04-01

    Children suffering from thalassemia have higher levels of depression and lower levels of self-concept. The aim of this study was to determine if group play therapy could significantly increase self-concept among children with thalassemia major ages 7 to 11 years old in teaching hospitals of Golestan province, Iran, in 2012. In this randomized, controlled clinical trial, 60 children with thalassemia major were randomly assigned to intervention (30 children) and control (30 children) groups. The intervention included eight 45 to 60 minute sessions during four weeks, during which the intervention group received group play therapy. The control group received no interventions. Self-concept was measured three times using the Piers-Harris children's self-concept scale: before, immediately after, and a month after the intervention. For the intervention group, results showed that the mean self-concept score was significantly higher at the second point in time compared to the baseline (P < 0.001), going from 60.539 to 69.908. Likewise, comparing the first and third time points, the mean score significantly increased and reached 70.611 (P < 0.001). Furthermore, changes in the mean score from the second to the third time point, though non-significant (P = 0.509), followed the trend, going from 69.908 to 70.611. For the control group, comparing the first, second, and third time points did not result in any significant change in the mean score (P > 0.05). The results showed that group play therapy improves self-concept in children suffering from thalassemia major.

  5. Optimal Outcomes in Young Class 3 Patients With Thalassemia Undergoing HLA-Identical Sibling Bone Marrow Transplantation.

    PubMed

    Gaziev, Javid; Isgrò, Antonella; Sodani, Pietro; Marziali, Marco; Paciaroni, Katia; Gallucci, Cristiano; De Angelis, Gioia; Andreani, Marco; Testi, Manuela; Alfieri, Cecilia; Ribersani, Michela; Galluccio, Tiziana; Battarra, Maria Rosa; Morrone, Aldo; Lucarelli, Guido

    2016-04-01

    Bone marrow transplantation (BMT) for class 3 patients with thalassemia is challenging due to high rates of graft rejection and transplant-related mortality. Since the first studies of BMT in the late 1980s, a number of conditioning regimens have been designed to improve outcomes, but with suboptimal results. Here we report the outcome of transplantation in class 3 patients using a modified protocol. Sixty-three patients between 5 and 16.7 years of age with class 3 thalassemia received HLA-matched sibling BMT following either the original protocol (26 patients) or the modified protocol (37 patients). Both regimens comprised preconditioning cytoreduction with hydroxyurea and azathioprine starting at -45 days pretransplant, and fludarabine from days -16 to -12. Conditioning was performed with busulfan and cyclophosphamide (original protocol) or with busulfan, thiotepa, and cyclophosphamide (modified protocol). The 2 groups showed similar patient demographics. At day 0, the degree of cytoreduction (lymphopenia, neuthropenia, and thrombocytopenia) achieved by the modified protocol was greater than the original protocol. The incidence of graft failure/rejection was significantly higher in the original group (15%; 95% confidence interval [95% CI], 5-32%) compared with the modified group (0%) (P = 0.014). The respective 5-year thalassemia-free survival rates were 73% (95% CI, 51-86%) and 92% (95% CI, 77-97%) (P = 0.047). Both groups showed similar incidences of grades II to IV acute graft-versus host disease. Modified protocol did not increase nonhematological toxicity or infectious complications. The modified treatment protocol effectively and safely prevented graft failure/rejection and significantly increased thalassemia-free survival of class 3 patients with thalassemia.

  6. Prevention of β Thalassemia in Northern Israel - a Cost-Benefit Analysis

    PubMed Central

    Koren, Ariel; Profeta, Lora; Zalman, Luci; Palmor, Haya; Levin, Carina; Zamir, Ronit Bril; Shalev, Stavit; Blondheim, Orna

    2014-01-01

    Background β Thalassemia major is characterized by hemolytic anemia, ineffective erythropoiesis and hemosiderosis. About 4% of the world population carries a Thalassemia gene. Management includes blood transfusions and iron chelation. However, this treatment is costly, and population screening may be significantly more cost beneficial. Purpose The purpose of the current study is to analyze the cost of running a prevention program for β Thalassemia in Israel and to compare it to the actual expenses incurred by treating Thalassemia patients. Methods Three cost parameters were analyzed and compared: the prevention program, routine treatment of patients and treatment of complications. An estimation of the expenses needed to treat patients who present with complications was calculated based on our ongoing experience in treating deteriorating patients. Results and Conclusions The cost of preventing one affected newborn was $63,660 compared to $1,971,380 for treatment of a patient during 50 years (mean annual cost: $39,427). Thus, the prevention of 45 affected newborns over a ten year period represents a net saving of $88.5 million to the health budget. Even after deducting the cost of the prevention program ($413.795/year), the program still represents a benefit of $76 million over ten years. Each prevented case could pay the screening and prevention program for 4.6 years. PMID:24678389

  7. Efficacy and Safety of Combined Oral Chelation With Deferiprone and Deferasirox in Children With β-Thalassemia Major: An Experience From North India.

    PubMed

    Parakh, Nupur; Chandra, Jagdish; Sharma, Sunita; Dhingra, Bhavna; Jain, Rajesh; Mahto, DeoNath

    2017-04-01

    A combination of desferrioxamine with either deferiprone (DFP) or deferasirox (DFX) for patients with β-thalassemia major who do not achieve negative iron balance with monotherapy has been studied widely. However, poor compliance resulting from the need for parentral administration of desferrioxamine and its cost necessicitates combining 2 oral chelators. A prospective study was conducted in patients with transfusion-dependent β-thalassemia major in a tertiary care center over 2 years. Patients on either DFP or DFX who were not improving on monotherapy over a long period and persistently maintaining serum ferritin >2500 µg/L were enrolled. Efficacy was assessed by serum ferritin levels assessed at 12 months and 2 years. Complete blood counts and liver and kidney function tests were monitored to assess the safety of the combination of drugs. In total, 33 patients with a mean age of 12.67 years (7.5 to 17.5 y) and a mean ferritin of 4835.2394±1443.85 µg/L formed the study cohort.In total, 28 patients completed the 1-year study period; and 12 patients completed 2 years. Mean serum ferritin reduction at 1 and 2 years was 34.99%±18.13% (range, -34.36% to 56.17%) and 44.67%±13.78% (range, 22.17% to 62.74%), respectively. The combination therapy was well tolerated. Combined oral chelation with DFP and DFX has better efficacy than either drug used alone. The combination of drugs was well tolerated and no new adverse effects were observed.

  8. Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

    PubMed

    Kho, S L; Chua, K H; George, E; Tan, J A M A

    2013-07-15

    Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

  9. Cure for thalassemia major – from allogeneic hematopoietic stem cell transplantation to gene therapy

    PubMed Central

    Srivastava, Alok; Shaji, Ramachandran V.

    2017-01-01

    Allogeneic hematopoietic stem cell transplantation has been well established for several decades as gene replacement therapy for patients with thalassemia major, and now offers very high rates of cure for patients who have access to this therapy. Outcomes have improved tremendously over the last decade, even in high-risk patients. The limited data available suggests that the long-term outcome is also excellent, with a >90% survival rate, but for the best results, hematopoietic stem cell transplantation should be offered early, before any end organ damage occurs. However, access to this therapy is limited in more than half the patients by the lack of suitable donors. Inadequate hematopoietic stem cell transplantation services and the high cost of therapy are other reasons for this limited access, particularly in those parts of the world which have a high prevalence of this condition. As a result, fewer than 10% of eligible patients are actually able to avail of this therapy. Other options for curative therapies are therefore needed. Recently, gene correction of autologous hematopoietic stem cells has been successfully established using lentiviral vectors, and several clinical trials have been initiated. A gene editing approach to correct the β-globin mutation or disrupt the BCL11A gene to increase fetal hemoglobin production has also been reported, and is expected to be introduced in clinical trials soon. Curative possibilities for the major hemoglobin disorders are expanding. Providing access to these therapies around the world will remain a challenge. PMID:27909215

  10. Fatal overdose due to prescription fentanyl patches in a patient with sickle cell/beta-thalassemia and acute chest syndrome: A case report and review of the literature.

    PubMed

    Biedrzycki, Olaf J; Bevan, David; Lucas, Sebastian

    2009-06-01

    Introduced into clinical practice in the 1960s, the analgesic fentanyl is 100 times more potent than morphine. Various methods of administration exist including the transdermal Duragesic patch system, widely used in chronic pain and palliative care settings. Numerous, often imaginative methods of abuse of fentanyl patches have been reported; the majority of fatal fentanyl overdose cases resulting from deliberate abuse or suicide. We describe the accidental overdose of a young black male with sickle cell/beta-thalassemia who had been using the Duragesic system for almost 2 years.At autopsy the macroscopic findings were of nonspecific opiate overdose with congested heavy lungs. Histopathological examination revealed severe sickling of red blood cells in the lungs (acute chest syndrome). Toxicological examination revealed blood and urine fentanyl levels of 40 microg/L and 400 microg/L (10 fold and 100 fold higher than therapeutic levels). The mast cell tryptase was also significantly elevated at 76 microg/L, (Normal 2-14 microg/L). We discuss the relevance of these findings with regard to the cause of death, and stress the need to consider fentanyl when confronted with nonspecific signs of opiate overdose as it is not detected in routine toxicological drug screens.

  11. β-thalassemia: a model for elucidating the dynamic regulation of ineffective erythropoiesis and iron metabolism

    PubMed Central

    Rivella, Stefano

    2011-01-01

    β-thalassemia is a disease characterized by anemia and is associated with ineffective erythropoiesis and iron dysregulation resulting in iron overload. The peptide hormone hepcidin regulates iron metabolism, and insufficient hepcidin synthesis is responsible for iron overload in minimally transfused patients with this disease. Understanding the crosstalk between erythropoiesis and iron metabolism is an area of active investigation in which patients with and models of β-thalassemia have provided significant insight. The dependence of erythropoiesis on iron presupposes that iron demand for hemoglobin synthesis is involved in the regulation of iron metabolism. Major advances have been made in understanding iron availability for erythropoiesis and its dysregulation in β-thalassemia. In this review, we describe the clinical characteristics and current therapeutic standard in β-thalassemia, explore the definition of ineffective erythropoiesis, and discuss its role in hepcidin regulation. In preclinical experiments using interventions such as transferrin, hepcidin agonists, and JAK2 inhibitors, we provide evidence of potential new treatment alternatives that elucidate mechanisms by which expanded or ineffective erythropoiesis may regulate iron supply, distribution, and utilization in diseases such as β-thalassemia. PMID:21768301

  12. Management of the Thalassemias

    PubMed Central

    Olivieri, Nancy F.; Brittenham, Gary M.

    2013-01-01

    During the last 30 years, in addition to the considerable progress made in control and prevention of thalassemias3, there have also been major advances in their symptomatic management, at least in wealthier countries where appropriate facilities are available. Remarkable improvements in survival in the severe forms of thalassemia have followed the more judicious use of blood transfusion and, in particular, the ability to manage the iron accumulation resulting from transfusion with its severe and ultimately lethal effects on endocrine and cardiac function. PMID:23732853

  13. Combination Iron Chelation Therapy with Deferiprone and Deferasirox in Iron-Overloaded Patients with Transfusion-Dependent β-Thalassemia Major.

    PubMed

    Karami, Hossein; Kosaryan, Mehrnoush; Amree, Arash Hadian; Darvishi-Khezri, Hadi; Mousavi, Masoomeh

    2017-01-11

    There are few papers on the combination therapy of deferiprone (DFP) and deferasirox (DFX) in iron-overloaded patients with transfusion-dependent β-thalassemia major (β-TM). A total of 6 patients with β-TM (5 males and 1 female) with a mean age of 23.8±5.8 years (ranging from 17 to 31) used this treatment regimen. The mean doses of DFP and DFX were 53.9±22.2 and 29.3±6.8 mg/kg/day, respectively. The duration of treatment was 11.5±4.6 months. Their serum ferritin levels were measured to be 2800±1900 and 3400±1600 ng/mL before and after treatment, respectively (p<0.6). Their cardiac magnetic resonance imaging (MRI) T2* values were 16.69±15.35 vs 17.38±5.74 millisecond (ms) before and after treatment, respectively ( p < 0.9). Although there was no significant difference between their cardiac MRI T2* values before and after treatment statistically, the values improved after combination therapy with DFP and DFX in most of the patients. Liver MRI T2 * values were changed from 2.12±0.98 to 3.03±1.51 ms after treatment (p < 0.01); Further, their liver T2* values and liver iron concentration (LIC) were improved after treatment. Our study found that cardiac MRI T2* values, liver MRI T2* values, and LIC were improved after combination therapy with DFP and DFX in β-TM patients and that DFP and DFX combination therapy could be used to alleviate cardiac and liver iron loading.

  14. Survival and complications in thalassemia.

    PubMed

    Borgna-Pignatti, C; Cappellini, M D; De Stefano, P; Del Vecchio, G C; Forni, G L; Gamberini, M R; Ghilardi, R; Origa, R; Piga, A; Romeo, M A; Zhao, H; Cnaan, A

    2005-01-01

    The life expectancy of patients with thalassemia major has significantly increased in recent years, as reported by several groups in different countries. However, complications are still frequent and affect the patients' quality of life. In a recent study from the United Kingdom, it was found that 50% of the patients had died before age 35. At that age, 65% of the patients from an Italian long-term study were still alive. Heart disease is responsible for more than half of the deaths. The prevalence of complications in Italian patients born after 1970 includes heart failure in 7%, hypogonadism in 55%, hypothyroidism in 11%, and diabetes in 6%. Similar data were reported in patients from the United States. In the Italian study, lower ferritin levels were associated with a lower probability of experiencing heart failure and with prolonged survival. Osteoporosis and osteopenia are common and affect virtually all patients. Hepatitis C virus antibodies are present in 85% of multitransfused Italian patients, 23% of patients in the United Kingdom, 35% in the United States, 34% in France, and 21% in India. Hepatocellular carcinoma can complicate the course of hepatitis. A survey of Italian centers has identified 23 such cases in patients with a thalassemia syndrome. In conclusion, rates of survival and complication-free survival continue to improve, due to better treatment strategies. New complications are appearing in long-term survivors. Iron overload of the heart remains the main cause of morbidity and mortality.

  15. High-resolution melting analysis for noninvasive prenatal diagnosis of IVS-II-I (G-A) fetal DNA in minor beta-thalassemia mothers.

    PubMed

    Zafari, Mandana; Gill, Pooria; Kowsaryan, Mehrnoush; Alipour, Abbass; Banihashemi, Ali

    2016-10-01

    The high-resolution melting (HRM) technique is fast, effective and successful method for mutation detection. The aim of this study was to determine the sensitivity and specificity of the HRM method for detection of a paternally inherited mutation in a fetus as a noninvasive prenatal diagnosis of β-thalassemia. Genomic DNAs were prepared from 50 β-thalassemia minor couples whose pregnancy was at risk for homozygous β-thalassemia. Ten milliliters of the maternal blood from each pregnant woman were collected and after separating plasma stored at -80 °C until analysis. The extracted DNAs were analyzed by HRM real-time PCR for detection of IVS-II-I (G-A) as a paternally inherited mutation. The gold standard was the result of a chorionic villus sampling by a standard reverse dot blotting test. The sensitivity and specificity of HRM real-time PCR were 92.6% and 82.6%, respectively. Also, the positive and negative predictive values were 86.2% and 90.47%, respectively. HRM real-time PCR was a sensitive and specific method for determining the paternally inherited mutation in the fetus at risk with thalassemia major.

  16. β-Thalassemia Patients Revealed a Significant Change of Untargeted Metabolites in Comparison to Healthy Individuals

    PubMed Central

    Musharraf, Syed Ghulam; Iqbal, Ayesha; Ansari, Saqib Hussain; Parveen, Sadia; Khan, Ishtiaq Ahmad; Siddiqui, Amna Jabbar

    2017-01-01

    β-Thalassemia is one of the most prevalent forms of congenital blood disorders characterized by reduced hemoglobin levels with severe complications, affecting all dimensions of life. The mechanisms underlying the phenotypic heterogeneity of β-thalassemia are still poorly understood. We aimed to work over metabolite biomarkers to improve mechanistic understanding of phenotypic heterogeneity and hence better management of disorder at different levels. Untargeted serum metabolites were analyzed after protein precipitation and SPE (solid phase extraction) from 100 β-thalassemia patients and 61 healthy controls using GC-MS. 40 metabolites were identified having a significance difference between these two groups at probability of 0.05 and fold change >1.5. Out of these 40 metabolites, 17 were up-regulated while 23 were down-regulated. PCA and PLS-DA model was also created that revealed a fine separation with a sensitivity of 70% and specificity of 100% on external validation of samples. Metabolic pathway analysis revealed alteration in multiple pathways including glycolysis, pyruvate, propanoate, glycerophospholipid, galactose, fatty acid, starch and sucrose metabolism along with fatty acid elongation in mitochondria, glycerolipid, glyoxylate and dicarboxylate metabolism pointing towards the shift of metabolism in β-thalassemia patients in comparison to healthy individuals. PMID:28198811

  17. Liver fibrosis alleviation after co-transplantation of hematopoietic stem cells with mesenchymal stem cells in patients with thalassemia major.

    PubMed

    Ghavamzadeh, Ardeshir; Sotoudeh, Masoud; Hashemi Taheri, Amir Pejman; Alimoghaddam, Kamran; Pashaiefar, Hossein; Jalili, Mahdi; Shahi, Farhad; Jahani, Mohammad; Yaghmaie, Marjan

    2018-02-01

    The aims of this study are to determine the replacement rate of damaged hepatocytes by donor-derived cells in sex-mismatched recipient patients with thalassemia major and to determine whether co-transplantation of mesenchymal stem cells and hematopoietic stem cells (HSCs) can alleviate liver fibrosis. Ten sex-mismatched donor-recipient pairs who received co-transplantation of HSCs with mesenchymal stem cells were included in our study. Liver biopsy was performed before transplantation. Two other liver biopsies were performed between 2 and 5 years after transplantation. The specimens were studied for the presence of donor-derived epithelial cells or hepatocytes using fluorescence in situ hybridization by X- and Y-centromeric probes and immunohistochemical staining for pancytokeratin, CD45, and a hepatocyte-specific antigen. All sex-mismatched tissue samples demonstrated donor-derived hepatocyte independent of donor gender. XY-positive epithelial cells or hepatocytes accounted for 11 to 25% of the cells in histologic sections of female recipients in the first follow-up. It rose to 47-95% in the second follow-up. Although not statistically significant, four out of ten patients showed signs of improvement in liver fibrosis. Our results showed that co-transplantation of HSC with mesenchymal stem cells increases the rate of replacement of recipient hepatocytes by donor-derived cells and may improve liver fibrosis.

  18. Amelioration of murine beta-thalassemia through drug selection of hematopoietic stem cells transduced with a lentiviral vector encoding both gamma-globin and the MGMT drug-resistance gene.

    PubMed

    Zhao, Huifen; Pestina, Tamara I; Nasimuzzaman, Md; Mehta, Perdeep; Hargrove, Phillip W; Persons, Derek A

    2009-06-04

    Correction of murine models of beta-thalassemia has been achieved through high-level globin lentiviral vector gene transfer into mouse hematopoietic stem cells (HSCs). However, transduction of human HSCs is less robust and may be inadequate to achieve therapeutic levels of genetically modified erythroid cells. We therefore developed a double gene lentiviral vector encoding both human gamma-globin under the transcriptional control of erythroid regulatory elements and methylguanine methyltransferase (MGMT), driven by a constitutive cellular promoter. MGMT expression provides cellular resistance to alkylator drugs, which can be administered to kill residual untransduced, diseased HSCs, whereas transduced cells are protected. Mice transplanted with beta-thalassemic HSCs transduced with a gamma-globin/MGMT vector initially had subtherapeutic levels of red cells expressing gamma-globin. To enrich gamma-globin-expressing cells, transplanted mice were treated with the alkylator agent 1,3-bis-chloroethyl-1-nitrosourea. This resulted in significant increases in the number of gamma-globin-expressing red cells and the amount of fetal hemoglobin, leading to resolution of anemia. Selection of transduced HSCs was also obtained when cells were drug-treated before transplantation. Mice that received these cells demonstrated reconstitution with therapeutic levels of gamma-globin-expressing cells. These data suggest that MGMT-based drug selection holds promise as a modality to improve gene therapy for beta-thalassemia.

  19. Relationship between β-Thalassemia minor and Helicobacter pylori infection

    PubMed Central

    Zamani, Mohammad; Vahedi, Amin; Tamaddoni, Ahmad; Bijani, Ali; Bagherzade, Mojgan; Shokri-Shirvani, Javad

    2018-01-01

    Background: Until now, no study has been reported investigating the association between β-thalassemia minor and Helicobacter pylori (H. pylori) infection. This study was designed to compare H. pylori infection rate between β-thalassemia minor patients and healthy controls. Methods: A number of 100 β-thalassemia minor patients (50 males, 50 females) and 100 gender-matched healthy controls were prospectively recruited in this study in a period of 3 months. The study population consisted of the people who referred to a health center in Babol, North of Iran, for premarital counseling. H. pylori status was assessed by measuring the anti-H. pylori IgG antibodies using enzyme-linked immunosorbent assay. Demographic information and informed consent were collected from all participants. Results: The overall H. pylori infection rate was 43%. The infection was significantly more prevalent in thalassemia patients (53%) than in the controls (33%) in both univariate (OR=2.29, 95% CI: 1.3-4.06) and multivariable analyses (OR=2.05, 95% CI: 1.12-3.76). Age was the only significant factor which was positively correlated with the infection in β-thalassemia minor cases (OR=1.11, 95% CI: 1.02-1.2). Gender, blood groups, residency, and education level were not related to the infection. Conclusions: According to the results, it can be concluded that β-thalassemia minor patients are possibly more susceptible to H. pylori infection than healthy people. Further studies are needed to discover more about the exact mechanisms of increased susceptibility to H. pylori infection in β-thalassemia minor patients. PMID:29387320

  20. Caring for adults with thalassemia in a pediatric world.

    PubMed

    Compagno, Laurice M

    2005-01-01

    Improved technology and medical advances have increased the life span for patients with thalassemia. Therefore, serious consideration must now be given to adult issues such as fertility, employment opportunities, medical insurance, and long-term coping with chronic illness. Since thalassemia is a childhood illness, most adults are seen in pediatric hospitals-often, in centers with a specialty for thalassemia. Compared to a decade ago, many more patients in thalassemia centers are adolescents or older. Unfortunately, pediatric hospitals are not fully equipped to meet the changing and complex needs of adults. Emergency room care, hospital admissions, decentralized care, comprehensive care, and psychosocial issues are current challenges that must be addressed. In this study, six adult patients were asked to keep track of their care for one month to further examine self-care for thalassemia, a high-maintenance disease. From a qualitative perspective, the issues and challenges that adults face are examined and solutions for improved care are discussed.

  1. Non-transfusion Dependent Thalassemias: A Developing Country Perspective.

    PubMed

    Mukherjee, Somnath; Das, Rashmi R; Raghuwanshi, Babita

    2015-01-01

    Non-transfusion-dependent thalassemias (NTDT) encompass a group of hereditary chronic hemolytic anemia, which, as the name indicates, not require regular blood transfusion for survival. These include β-thalassemia intermedia, hemoglobin E/β-thalassemia, and Hemoglobin H disease (α- thalassemia intermedia). Individuals with structural variant of hemoglobin especially Hemoglobin S and Hemoglobin C associated with "α" or "β" thalassemia in heterozygous condition may also present with similar features of NTDT. NTDT patients are not immune to the development of transfusion unrelated complications in the long run. These hereditary chronic hemolytic anemias are still under-recognized in developing countries like India, where the disease burden might be high causing significant morbidity. The pathophysiologic hallmark that characterizes this group of disorders (ineffective erythropoiesis, hemolysis, chronic anemia) leads to a number of serious complications, similar to transfusion dependent thalassemia. So, timely diagnosis and institution of appropriate preventive/remedial measures as well as education of patient population can help decrease the morbidity to a significant extent. In the present review, focus will be on the pathophysiological mechanisms and available management options of NTDT from a developing country perspective like India.

  2. Serum Paraoxonase Activity and Malondialdehyde Serum Concentrations Remain Unaffected in Response to Hydroxyurea Therapy in β-Thalassemia Patients.

    PubMed

    Zohaib, Muhammad; Ansari, Saqib H; Hashim, Zehra; Shamsi, Tahir S; Zarina, Shamshad

    2016-07-01

    β-Thalassemia is the most common hereditary disorder characterized by reduced production of β-globin chains of hemoglobin A (HbA). In recent years, hydroxyurea (HU) has shown promising therapeutic benefits in patients with β-thalassemia by fetal hemoglobin augmentation. We have analyzed effects of hydroxyurea treatment on oxidative stress in β-thalassemia patients by assessing activities of paraoxonase (PON) and arylesterase along with malondialdehyde (MDA) and total reactive oxygen species (ROS) concentrations. Blood samples from 159 individuals including 56 HU-treated and 58 untreated β-thalassemia patients and 45 healthy controls were analyzed. PON activity was found to be highest in healthy individuals (177.76 ± 4.44 U/mL) as compared to treated (52.67 ± 3.65 U/mL) and untreated (55.11 ± 3.26 U/mL) patients. A similar trend was observed in the case of arylesterase activity in normal, β-thalassemia-treated, and untreated (210.0 ± 11.25 U/mL, 163.03 ± 9.04 U/mL, 139.77 ± 10.10 U/mL) subjects. Serum MDA concentrations (2.59 ± 0.09 nmol/mL, 2.45 ± 0.08 nmol/mL, and 1.15 ± 0.05 nmol/mL) and total ROS concentrations (3.73 ± 0.20 nmol/mL, 3.54 ± 0.23 nmol/mL, and 2.45 ± 0.14 nmol/mL) were significantly elevated in both groups (untreated and treated) as compared to healthy individuals (P < .01). Oxidative stress was found to be markedly elevated in β-thalassemia patients as compared to healthy controls. Insignificant differences were, however, observed in mean concentrations of PON1 paraoxonase and arylesterase activities, serum MDA concentration and total ROS concentrations between HU-treated and untreated patients. We propose that HU therapy alone seems to be ineffective in managing oxidative stress and is likely to offer a better clinical outcome when supplemented with efficient iron chelation therapy and antioxidants. © 2015, The American College of Clinical Pharmacology.

  3. Risk factors associated with hypogonadism in β-thalassemia major patients: predictors for a frequent complication of a rare disease.

    PubMed

    Albu, Alice; Barbu, Carmen Gabriela; Antonie, Lavinia; Vladareanu, Florentina; Fica, Simona

    2014-09-01

    β-Thalassemia major (BTM) is a rare disease that challenges clinicians because of the high prevalence of complications despite progress in the development of new therapeutic methods. The aim of this study was to identify clinical and hematological parameters associated with hypogonadism, the most frequent iron overload-related complication found in Romanian patients. Patients with BTM were evaluated in the Endocrinology Department of Elias Hospital between February 2004 and December 2013. Only patients who provided written informed consent were included in the study. A complete physical and hormonal evaluation was performed on all patients, and data regarding treatment of the hematological disease were collected. Of the evaluable patients, 85 were included in the study (median age, 21[10] years; range, 13-36 years). We found that 30.6% of the study participants (26 of 85) had normal gonadal status, 54.1% (46 of 85) had early forms of hypogonadism (delayed or arrested puberty), and 15.3% (n = 13) developed hypogonadism after complete sexual maturation. Patients with any form of hypogonadism were older (median age 22 vs 16.5 years, P = 0.047), had significantly lower average hemoglobin levels (P = 0.003), and had higher levels of serum ferritin (P = 0.006) versus patients without hypogonadism. Patients with delayed puberty were associated with increased average serum ferritin levels (P = 0.007), decreased hemoglobin levels (P = 0.001), and increased age at initiation of iron chelation therapy (P < 0.01). We found no significant differences between patients with early forms of hypogonadism and those with hypogonadism after complete sexual maturation, with respect to the analyzed parameters. Patients with adult hypogonadism were significantly older (median age 26 vs 16.5 years, P = 0.007) and tended to have higher serum ferritin levels (P = 0.056) compared with patients without hypogonadism. Our data show that hypogonadism is highly prevalent among Romanian patients

  4. Copy number variations of six and seven α-globin genes in a family with intermedia and major thalassemia phenotypes.

    PubMed

    Farashi, Samaneh; Vakili, Shadi; Faramarzi Garous, Negin; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

    2015-10-01

    Copy number variations in α-globin genes are results of unequal crossover between homologous segments in the α-globin gene cluster that misalign during the meiosis phase of the gametogenesis process. Reduction or augmentation of α-globin genes leads to imbalance of α/β chains in hemoglobin tetramer and consequently attenuate or worsen the β-thal clinical symptoms, respectively. Multiplications in α-globin genes have been found in some populations, justifying unexpected severe phenotype of β-thal carriers. Unexpected severe phenotype in the family members may result from coexistence of extra α-globin genes, which is an important factor in the causation of thalassemia intermedia and major in heterozygous β-thalassemia. We described different multiplications in α-globin locus in an Iranian family with one, two or three extra α-globin genes (ααα/αα, αααα/αα and αααα/ααα). The excess α-globin gene/genes cause increment in β/α chain imbalance and leads to worsening pathophysiology and clinical severity of β-thalassemia carriers.

  5. Hemoglobinopathies and thalassemia screening among Senoi Orang Asli in Peninsular Malaysia

    NASA Astrophysics Data System (ADS)

    Rong, Danny Koh Xuan; Ismail, Endom; Sabudin, Raja Zahratul Azma Raja; Hussin, Noor Hamidah; Othman, Ainoon

    2015-09-01

    Orang Asli are the minority indigenous people in Peninsular Malaysia and can be divided into 3 main groups (Negrito, Senoi and Proto Malay) with different six sub-ethnics under each group. Within the Senoi group, the six sub-ethnics are sub-ethnic Mah Meri, Semoq Beri, Che Wong, Jah Hut, Semai and Temiar. This study was aimed to investigate the current prevalence of α- and β-thalassemia and hemoglobinopathies and their mutation types among all six sub-ethnics of Senoi Orang Asli. Blood samples from 685 Senoi participants were collected and sent immediately for routine full blood count analysis and hemoglobin sub-typing. Of 378 subjects screened, 7 subjects were found to be Hemoglobin E (HbE) beta thalassemia carriers, 13 beta thalassaemic, 35 Hemoglobin Constant Spring (HbCS) carriers, 6 compound HbE and HbCS carriers, 32 with HbE disease and 163 HbE heterozygote carriers. The findings of high HbE among Temiars and Jah Huts and high HbCS exclusively in Jah Huts in this study suggest distinct differences across sub-ethnics under Senoi group. Understanding of prevalence and wide spectrum of thalassemia and hemoglobinopathies among Senoi and Orang Asli is essential for national thalassaemia awareness and prevention program, especially in Orang Asli communities.

  6. Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

    PubMed

    Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth

    2006-10-01

    In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.

  7. Three mouse models of human thalassemia.

    PubMed Central

    Martinell, J; Whitney, J B; Popp, R A; Russell, L B; Anderson, W F

    1981-01-01

    Three types of mice with globin gene mutations, called 352HB, 27HB, and Hbath-J, appear to be true animal models of human thalassemia. Expression of the alpha-globin genes in three stocks of mice, each one heterozygous for one of the alpha-globin mutations, was examined at the polypeptide, RNA, and DNA levels. alpha-Globin polypeptide chains, relative to beta-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of alpha-globin to beta-globin RNA sequences are also 75-80% of normal, exactly reflecting the alpha-globin to beta-globin chain ratios. In the case of mutant 352HB, at least one alpha-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their alpha-globin genes. Images PMID:6946454

  8. Thalassemia: Healthy Living

    MedlinePlus

    ... Thalassemia” More What can a person living with thalassemia do to stay healthy? A healthy lifestyle is ... disorder”, as well as making healthy choices. Managing Thalassemia Thalassemia is a treatable disorder that can be ...

  9. Facts about Thalassemia

    MedlinePlus

    ... CDC’s Work Related Information UDC System Basics About Thalassemia Recommend on Facebook Tweet Share Compartir Did You ... to death. What are the different types of thalassemia? When we talk about different “types” of thalassemia, ...

  10. Depleted nitric oxide and prostaglandin E2 levels are correlated with endothelial dysfunction in β-thalassemia/HbE patients.

    PubMed

    Satitthummanid, Sudarat; Uaprasert, Noppacharn; Songmuang, Smonporn Boonyaratavej; Rojnuckarin, Ponlapat; Tosukhowong, Piyaratana; Sutcharitchan, Pranee; Srimahachota, Suphot

    2017-09-01

    Mechanisms of vascular disorders in β-thalassemia/HbE patients remain poorly understood. In the present study, we aimed to determine the presence of endothelial dysfunction and its association with altered vascular mediators in this population. Forty-three β-thalassemia/HbE patients without clinically documented vascular symptoms and 43 age-sex-matched healthy controls were enrolled. Endothelial function was assessed using flow-mediated dilatation (FMD) before and after administration of nitroglycerine (NTG). β-Thalassemia/HbE patients showed a significant endothelial dysfunction using FMD. The percentage change in the brachial artery diameter before NTG was significantly lower in the thalassemia group compared to the control (5.0 ± 5.9 vs. 9.0 ± 4.0%, p < 0.01) while no significant differences after NTG (18.4 ± 8.3 vs. 17.8 ± 6.3%, p = 0.71). Plasma nitric oxide metabolites (NO x ) and prostaglandin E 2 (PGE 2 ) levels were significantly decreased in β-thalassemia/HbE (117.2 ± 27.3 vs. 135.8 ± 11.3 µmol/L, p < 0.01) and (701.9 ± 676.0 vs. 1374.7 ± 716.5 pg/mL, p < 0.01), respectively, while a significant elevation in soluble thrombomodulin levels in β-thalassemia/HbE (3587.7 ± 1310.0 vs. 3093.9 ± 583.8 pg/mL, p = 0.028). NO x and PGE 2 levels were significantly correlated with FMD (r = 0.27, p = 0.025) and (r = 0.35, p = 0.003), respectively. These findings suggest roles for endothelial mediators and a new mechanism underlying endothelial dysfunction in β-thalassemia/HbE patients.

  11. Alpha Thalassemia (For Parents)

    MedlinePlus

    ... Safe Videos for Educators Search English Español Alpha Thalassemia KidsHealth / For Parents / Alpha Thalassemia What's in this ... Symptoms Diagnosis Treatment Print en español Alfa talasemia Thalassemias Thalassemias are a group of blood disorders that ...

  12. The prevention of thalassemia.

    PubMed

    Cao, Antonio; Kan, Yuet Wai

    2013-02-01

    The thalassemias are among the most common inherited diseases worldwide, affecting individuals originating from the Mediterranean area, Middle East, Transcaucasia, Central Asia, Indian subcontinent, and Southeast Asia. As the diseases require long-term care, prevention of the homozygous state constitutes a major armament in the management. This article discusses the major prevention programs that are set up in many countries in Europe, Asia, and Australia, often drawing from the experience in Sardinia. These comprehensive programs involve carrier detections, molecular diagnostics, genetic counseling, and prenatal diagnosis. Variability of clinical severity can be attributable to interactions with α-thalassemia and mutations that increase fetal productions. Special methods that are currently quite expensive and not widely applicable are preimplantation and preconception diagnosis. The recent successful studies of fetal DNA in maternal plasma may allow future prenatal diagnosis that is noninvasive for the fetus.

  13. The Prevention of Thalassemia

    PubMed Central

    Cao, Antonio; Kan, Yuet Wai

    2013-01-01

    The thalassemias are among the most common inherited diseases worldwide, affecting individuals originating from the Mediterranean area, Middle East, Transcaucasia, Central Asia, Indian subcontinent, and Southeast Asia. As the diseases require long-term care, prevention of the homozygous state constitutes a major armament in the management. This article discusses the major prevention programs that are set up in many countries in Europe, Asia, and Australia, often drawing from the experience in Sardinia. These comprehensive programs involve carrier detections, molecular diagnostics, genetic counseling, and prenatal diagnosis. Variability of clinical severity can be attributable to interactions with α-thalassemia and mutations that increase fetal productions. Special methods taht are currently quite expensive and not widely applicable are preimplantation and preconception diagnosis. The recent successful studies of fetal DNA in maternal plasma may allow future prenatal diagnosis that is noninvasive for the fetus. PMID:23378598

  14. Mitophagy is increased during erythroid differentiation in β-thalassemia.

    PubMed

    Wu, Limei; Xu, Wei; Xu, Luhong; Kong, Qian; Fang, Jianpei

    2017-02-01

    Mitophagy is a selective degradation of mitochondria, which also plays a critical role in hematopoiesis. However, it is unclear what role, if any, this process plays in the pathogenesis of β-thalassemia. To determine the role of mitophagy in β-thalassemia, CD34 + hematopoietic progenitor cells (HPCs) were isolated from peripheral blood of β-thalassemia patients and healthy controls and differentiated into erythrocytes. We found that the ratio of mitochondrial membrane depolarization was significantly increased, and that mitochondria co-localize with lysosomes at a higher level in β-thalassemia compared with control. Furthermore, the expression of LC3-II and Nix, as well as degradation of p62, in β-thalassemia was higher than in the control. In sum, our data suggest that selective mitophagy is enhanced during erythrocyte differentiation in β-thalassemia.

  15. The Hemoglobin E Thalassemias

    PubMed Central

    Fucharoen, Suthat; Weatherall, David J.

    2012-01-01

    Hemoglobin E (HbE) is an extremely common structural hemoglobin variant that occurs at high frequencies throughout many Asian countries. It is a β-hemoglobin variant, which is produced at a slightly reduced rate and hence has the phenotype of a mild form of β thalassemia. Its interactions with different forms of α thalassemia result in a wide variety of clinical disorders, whereas its coinheritance with β thalassemia, a condition called hemoglobin E β thalassemia, is by far the most common severe form of β thalassemia in Asia and, globally, comprises approximately 50% of the clinically severe β-thalassemia disorders. PMID:22908199

  16. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    PubMed

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  17. Iron chelation therapy in transfusion-dependent thalassemia patients: current strategies and future directions

    PubMed Central

    Saliba, Antoine N; Harb, Afif R; Taher, Ali T

    2015-01-01

    Transfusional iron overload is a major target in the care of patients with transfusion-dependent thalassemia (TDT) and other refractory anemias. Iron accumulates in the liver, heart, and endocrine organs leading to a wide array of complications. In this review, we summarize the characteristics of the approved iron chelators, deferoxamine, deferiprone, and deferasirox, and the evidence behind the use of each, as monotherapy or as part of combination therapy. We also review the different guidelines on iron chelation in TDT. This review also discusses future prospects and directions in the treatment of transfusional iron overload in TDT whether through innovation in chelation or other therapies, such as novel agents that improve transfusion dependence. PMID:26124688

  18. Hematopoietic Stem Cell Transplantation in Thalassemia and Sickle Cell Anemia

    PubMed Central

    Lucarelli, Guido; Isgrò, Antonella; Sodani, Pietro; Gaziev, Javid

    2012-01-01

    The globally widespread single-gene disorders β-thalassemia and sickle cell anemia (SCA) can only be cured by allogeneic hematopoietic stem cell transplantation (HSCT). HSCT treatment of thalassemia has substantially improved over the last two decades, with advancements in preventive strategies, control of transplant-related complications, and preparative regimens. A risk class–based transplantation approach results in disease-free survival probabilities of 90%, 84%, and 78% for class 1, 2, and 3 thalassemia patients, respectively. Because of disease advancement, adult thalassemia patients have a higher risk for transplant-related toxicity and a 65% cure rate. Patients without matched donors could benefit from haploidentical mother-to-child transplantation. There is a high cure rate for children with SCA who receive HSCT following myeloablative conditioning protocols. Novel non-myeloablative transplantation protocols could make HSCT available to adult SCA patients who were previously excluded from allogeneic stem cell transplantation. PMID:22553502

  19. Knowledge, attitude, and practice of reproductive behavior in Iranian minor thalassemia couples.

    PubMed

    Kosaryan, Mehrnoosh; Vahidshahi, Koorosh; Siami, Rita; Nazari, Meisam; Karami, Hosein; Ehteshami, Sara

    2009-06-01

    To investigate the knowledge, attitude, and practice of reproductive behavior in Iranian minor thalassemia couples in Ghaemshahr City, Mazandaran, Iran. This is a cross-sectional descriptive survey conducted in 2006. Birth rates from 1997-2005 and the number of newly registered patients from at risk couples was recorded. Tools for data collection were a valid questionnaire containing epidemiologic characteristics of couples, knowledge (20 questions), attitude 20 statements, and practice by studying the family file in health centers. Questionnaires were completed by husband and wife separately. Actual versus expected numbers of patients born in that period were compared. The data were analyzed using the Statistical Package for Social Science version 13.00, and p<0.05 was interpreted as significant. Of the 240 at risk couples, 100 were studied. Of them, 82% had good knowledge of thalassemia, and 68.5% had a positive attitude toward thalassemia prevention program. Correlations of knowledge with attitude were significant (p<0.001), and 50% of the couples had unfavorable practice including unplanned pregnancy, fetal abortion without prenatal diagnosis (PND), delivery without PND, and having a child affected by thalassemia major (TM). Without PND, 4 TM patients were born. Ninety-eight episodes of unfavorable practice were reported. Meanwhile, the contraceptive method used by 12% of couples was unsafe. Suspected TM patients with no prevention program were 25; thus, the birth of 2 TM was prevented (92% reduction). We achieved great success during the last 9 years in the region, and TM prevention program improved knowledge, attitude, and practice in high-risk couples and carrier families.

  20. Molecular Diagnosis of Thalassemias and Hemoglobinopathies: An ACLPS Critical Review.

    PubMed

    Sabath, Daniel E

    2017-07-01

    To describe the use of molecular diagnostic techniques for patients with hemoglobin disorders. A clinical scenario is presented in which molecular diagnosis is important for genetic counseling. Globin disorders, techniques for their diagnosis, and the role of molecular genetic testing in managing patients with these disorders are described in detail. Hemoglobin disorders, including thalassemias and hemoglobinopathies, are among the commonest genetic diseases, and the clinical laboratory is essential for the diagnosis of patients with these abnormalities. Most disorders can be diagnosed with protein-based techniques such as electrophoresis and chromatography. Since severe syndromes can result due to inheritance of combinations of globin genetic disorders, genetic counseling is important to prevent adverse outcomes. Protein-based methods cannot always detect potentially serious thalassemia disorders; in particular, α-thalassemia may be masked in the presence of β-thalassemia. Deletional forms of β-thalassemia are also sometimes difficult to diagnose definitively with standard methods. Molecular genetic testing serves an important role in identifying individuals carrying thalassemia traits that can cause adverse outcomes in offspring. Furthermore, prenatal genetic testing can identify fetuses with severe globin phenotypes. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  1. Existence of HbF Enhancer Haplotypes at HBS1L-MYB Intergenic Region in Transfusion-Dependent Saudi β-Thalassemia Patients

    PubMed Central

    Vatte, Chittibabu; Borgio, J. Francis; Al-Rubaish, Abdullah; Nasserullah, Zaki A.; Jarrash, Sana Al; Sulaiman, Ahmed; Qutub, Hatem; Alsaleem, Hassan; Alzahrani, Alhusain J.; Steinberg, Martin H.

    2017-01-01

    Background and Objectives. β-Thalassemia and sickle cell disease are genetic disorders characterized by reduced and abnormal β-globin chain production, respectively. The elevation of fetal hemoglobin (HbF) can ameliorate the severity of these disorders. In sickle cell disease patients, the HbF level elevation is associated with three quantitative trait loci (QTLs), BCL11A, HBG2 promoter, and HBS1L-MYB intergenic region. This study elucidates the existence of the variants in these three QTLs to determine their association with HbF levels of transfusion-dependent Saudi β-thalassemia patients. Materials and Methods. A total of 174 transfusion-dependent β-thalassemia patients and 164 healthy controls from Eastern Province of Saudi Arabia were genotyped for fourteen single nucleotide polymorphisms (SNPs) from the three QTL regions using TaqMan assay on real-time PCR. Results. Genotype analysis revealed that six alleles of HBS1L-MYB QTL (rs9376090C p = 0.0009, rs9399137C p = 0.008, rs4895441G p = 0.004, rs9389269C p = 0.008, rs9402686A p = 0.008, and rs9494142C p = 0.002) were predominantly associated with β-thalassemia. In addition, haplotype analysis revealed that haplotypes of HBS1L-MYB (GCCGCAC p = 0.022) and HBG2 (GTT p = 0.009) were also predominantly associated with β-thalassemia. Furthermore, the HBS1L-MYB region also exhibited association with the high HbF cohort. Conclusion. The stimulation of HbF gene expression may provide alternative therapies for the amelioration of the disease severity of β-thalassemia. PMID:28280727

  2. Existence of HbF Enhancer Haplotypes at HBS1L-MYB Intergenic Region in Transfusion-Dependent Saudi β-Thalassemia Patients.

    PubMed

    Cyrus, Cyril; Vatte, Chittibabu; Borgio, J Francis; Al-Rubaish, Abdullah; Chathoth, Shahanas; Nasserullah, Zaki A; Jarrash, Sana Al; Sulaiman, Ahmed; Qutub, Hatem; Alsaleem, Hassan; Alzahrani, Alhusain J; Steinberg, Martin H; Ali, Amein K Al

    2017-01-01

    Background and Objectives . β -Thalassemia and sickle cell disease are genetic disorders characterized by reduced and abnormal β -globin chain production, respectively. The elevation of fetal hemoglobin (HbF) can ameliorate the severity of these disorders. In sickle cell disease patients, the HbF level elevation is associated with three quantitative trait loci (QTLs), BCL11A , HBG 2 promoter, and HBS1L-MYB intergenic region. This study elucidates the existence of the variants in these three QTLs to determine their association with HbF levels of transfusion-dependent Saudi β -thalassemia patients. Materials and Methods . A total of 174 transfusion-dependent β -thalassemia patients and 164 healthy controls from Eastern Province of Saudi Arabia were genotyped for fourteen single nucleotide polymorphisms (SNPs) from the three QTL regions using TaqMan assay on real-time PCR. Results . Genotype analysis revealed that six alleles of HBS1L-MYB QTL (rs9376090C p = 0.0009, rs9399137C p = 0.008, rs4895441G p = 0.004, rs9389269C p = 0.008, rs9402686A p = 0.008, and rs9494142C p = 0.002) were predominantly associated with β -thalassemia. In addition, haplotype analysis revealed that haplotypes of HBS1L-MYB (GCCGCAC p = 0.022) and HBG 2 (GTT p = 0.009) were also predominantly associated with β -thalassemia. Furthermore, the HBS1L-MYB region also exhibited association with the high HbF cohort. Conclusion . The stimulation of HbF gene expression may provide alternative therapies for the amelioration of the disease severity of β -thalassemia.

  3. [Gene Diagnosis and Analysis of Clinical Hematological Phenotype of Thailand Deleted α-Thalassemia 1].

    PubMed

    Lin, Na; Huang, Hai-Long; Wang, Yan; Zheng, Lin; Fang, Xiang-Qun; Cai, Mei-Ying; Wang, Lin-Shuo; Liu, He-Kun; Xu, Liang-Pu; Lin, Yuan

    2016-08-01

    To investigate the hematologic characteristics and gene diagnosis of patients with Thailand deleted α-thalassemia 1, so as to provide the information for clinical genetic counseling. The clinical data of 32 patients with Thailand delated α-thalassemia 1 were analyzed retrospectively; the hematologic characteristics and gene diagnosis of Thailand deleted type were investigated by using routine hematologic examination, genetic detection of common thalassemia and Thailand deleted α-thalassemia 1. Among 32 cases, the Thailand deleted α-thalassemia 1 heterozygote was found in 29 cases, the Thailand deleted α-thalassemia 1 and α(3.7) gene deletion double heterozygote were found in 1 case, the Thailand deleted α-thalassemia 1 with β-thalassemia (1 case with codons 41-42 mutation heterozygous, 1 case with CD17 mutation heterozygous) was found in 2 cases by detection. The MCV and MCH levels were decreased in all cases of Thailand deleted thalassemia 1, there were significant differences in RBC, MCV, MCH (P<0.05) between normal control and Thailand deletion α-thalassemia 1 group; there were also significant differences in MCHC (P<0.05) between Southeast asia thalassemia and Thailand deleted α-thalassemia 1 group. There are no significant differences in hematological parameters except MCHC between Southeast asia thalassemia and Thailand deleted α-thalassemia 1 group. moreover the Thailand deleted α-thalassemia 1 in a certain proportion exists in area with high incidence of thalassemia, therefor the clinicians should pay more attention to the screen and diagnosis of Thailand delated α-thalassemia and can exactly diagnose the Thailand delected α-thalassemia 1 on the basis of comprehensive analysis of conventional and Thailand delected α-thalassemia 1 detection results, clinical presentation, hematologic parameters and ultrasonic examination, so as to avoid the birth of child with severe and intermidiate type α-thalassemia caused by Thailand deleted α-thalassemia

  4. Thalassemia and malaria: new insights into an old problem.

    PubMed

    Clegg, J B; Weatherall, D J

    1999-01-01

    The hemoglobinopathies are probably the world's most common genetic diseases: The World Health Organization has estimated that at least 5% of the population are carriers for one or other of the most serious forms, the alpha- and beta-thalassemias and the structural variant hemoglobins S, C, and E, which are found at polymorphic frequencies in many countries. All these hemoglobinopathies are believed to provide protection against malaria, and it is thought that, in malarial regions of the world, natural selection has been responsible for elevating and maintaining their gene frequencies, an idea first proposed 50 years ago by J.B.S. Haldane. Epidemiological studies undertaken in the 1950s on hemoglobin S in Africa provided support for the "malaria hypothesis," but until recently it has proved extremely difficult to verify it for the thalassemias. The application of molecular methods has, however, provided new opportunities to address this old question. Population and molecular genetic analysis of thalassemia variants, and microepidemiological studies of the relationship between alpha-thalassemia and malaria in the southwest Pacific, have provided unequivocal evidence for protection. Surprisingly, some of this protection appears to derive from enhanced susceptibility in very young thalassemic children to both Plasmodium falciparum and, especially, P. vivax, and this early exposure appears to provide the basis for better protection in later life.

  5. Sildenafil therapy in thalassemia patients with Doppler-defined risk of pulmonary hypertension

    PubMed Central

    Morris, Claudia R.; Kim, Hae-Young; Wood, John; Porter, John B.; Klings, Elizabeth S.; Trachtenberg, Felicia L.; Sweeters, Nancy; Olivieri, Nancy F.; Kwiatkowski, Janet L.; Virzi, Lisa; Singer, Sylvia T.; Taher, Ali; Neufeld, Ellis J.; Thompson, Alexis A.; Sachdev, Vandana; Larkin, Sandra; Suh, Jung H.; Kuypers, Frans A.; Vichinsky, Elliott P.

    2013-01-01

    Pulmonary hypertension is a common but often overlooked complication associated with thalassemia syndromes. There are limited data on the safety and efficacy of selective pulmonary vasodilators in this at-risk population. We, therefore, designed a 12-week, open-label, phase 1/2, pilot-scale, proof-of-principle trial of sildenafil therapy in 10 patients with β-thalassemia and at increased risk of pulmonary hypertension based on an elevated tricuspid regurgitant jet velocity >2.5 m/s on Doppler-echocardiography. Variables compared at baseline and after 12 weeks of sildenafil treatment included Doppler-echocardiographic parameters, 6-minute walked distance, Borg Dyspnea Score, New York Heart Association functional class, pulmonary function, and laboratory parameters. Treatment with sildenafil resulted in a significant decrease in tricuspid regurgitant jet velocity by 13.3% (3.0±0.7 versus 2.6±0.5 m/s, P=0.04), improved left ventricular end systolic/diastolic volume, and a trend towards a improved New York Heart Association functional class. No significant change in 6-minute walked distance was noted. Sildenafil was well tolerated, although minor expected adverse events were commonly reported. The total dose of sildenafil (mg) was strongly correlated with percent change in nitric oxide metabolite concentration in the plasma (ρ=0.80, P=0.01). There were also significant increases in plasma and erythrocyte arginine concentrations. Our study suggests that sildenafil is safe and may improve pulmonary hemodynamics in patients at risk of pulmonary hypertension; however, it was not demonstrated to improve the distance walked in 6 minutes. Clinical trials are needed to identify the best treatment strategy for pulmonary hypertension in patients with β-thalassemia. (clinicaltrials.gov identifier: NCT00872170) PMID:23585527

  6. Hereditary Xerocytosis due to Mutations in PIEZO1 Gene Associated with Heterozygous Pyruvate Kinase Deficiency and Beta-Thalassemia Trait in Two Unrelated Families.

    PubMed

    Fermo, Elisa; Vercellati, Cristina; Marcello, Anna Paola; Zaninoni, Anna; van Wijk, Richard; Mirra, Nadia; Curcio, Cristina; Cortelezzi, Agostino; Zanella, Alberto; Barcellini, Wilma; Bianchi, Paola

    2017-01-01

    Hereditary xerocytosis (HX) is a rare disorder caused by defects of RBC permeability, associated with haemolytic anaemia of variable degree and iron overload. It is sometimes misdiagnosed as hereditary spherocytosis or other congenital haemolytic anaemia. Splenectomy is contraindicated due to increased risk of thromboembolic complications. We report the clinical, haematological, and molecular characteristics of four patients from two unrelated Italian families affected by HX, associated with beta-thalassemia trait and heterozygous pyruvate kinase deficiency, respectively. Two patients had been splenectomised and displayed thrombotic episodes. All patients had iron overload in the absence of transfusion, two of them requiring iron chelation. The diagnosis of HX was confirmed by LoRRca Osmoscan analysis showing a left-shifted curve. PIEZO1 gene sequencing revealed the presence of mutation p.E2496ELE, showing that this is one of the most frequent mutations in this disease. The concomitant defects did not aggravate the clinical phenotype; however, in one patient, the initial diagnosis of pyruvate kinase deficiency delayed the correct diagnosis of HX for many years and resulted in splenectomy followed by thrombotic complications. The study underlines the importance of a precise diagnosis in HX, particularly in view of splenectomy, and the need of a molecular confirmation of suspected RBC enzymopathy.

  7. Hereditary Xerocytosis due to Mutations in PIEZO1 Gene Associated with Heterozygous Pyruvate Kinase Deficiency and Beta-Thalassemia Trait in Two Unrelated Families

    PubMed Central

    Vercellati, Cristina; Marcello, Anna Paola; Zaninoni, Anna; van Wijk, Richard; Mirra, Nadia; Curcio, Cristina; Cortelezzi, Agostino; Zanella, Alberto; Barcellini, Wilma; Bianchi, Paola

    2017-01-01

    Hereditary xerocytosis (HX) is a rare disorder caused by defects of RBC permeability, associated with haemolytic anaemia of variable degree and iron overload. It is sometimes misdiagnosed as hereditary spherocytosis or other congenital haemolytic anaemia. Splenectomy is contraindicated due to increased risk of thromboembolic complications. We report the clinical, haematological, and molecular characteristics of four patients from two unrelated Italian families affected by HX, associated with beta-thalassemia trait and heterozygous pyruvate kinase deficiency, respectively. Two patients had been splenectomised and displayed thrombotic episodes. All patients had iron overload in the absence of transfusion, two of them requiring iron chelation. The diagnosis of HX was confirmed by LoRRca Osmoscan analysis showing a left-shifted curve. PIEZO1 gene sequencing revealed the presence of mutation p.E2496ELE, showing that this is one of the most frequent mutations in this disease. The concomitant defects did not aggravate the clinical phenotype; however, in one patient, the initial diagnosis of pyruvate kinase deficiency delayed the correct diagnosis of HX for many years and resulted in splenectomy followed by thrombotic complications. The study underlines the importance of a precise diagnosis in HX, particularly in view of splenectomy, and the need of a molecular confirmation of suspected RBC enzymopathy. PMID:28367341

  8. Vitamin D deficiency and its relationship with cardiac iron and function in patients with transfusion-dependent thalassemia at Chiang Mai University Hospital.

    PubMed

    Dejkhamron, Prapai; Wejaphikul, Karn; Mahatumarat, Tuanjit; Silvilairat, Suchaya; Charoenkwan, Pimlak; Saekho, Suwit; Unachak, Kevalee

    2018-02-01

    Vitamin D deficiency is common in patients with thalassemia. Vitamin D deficiency could be related to cardiac dysfunction. Increased parathyroid hormone (PTH) is also known to be associated with heart failure. To determine the prevalence of Vitamin D deficiency and to explore the impact of Vitamin D deficiency on cardiac iron and function in patients with transfusion-dependent thalassemia. A cross-sectional study in patients with Transfusion-dependent thalassemia was conducted. Patients with liver disease, renal disease, type 1 diabetes, malabsorption, hypercortisolism, malignancy, and contraindication for MRI were excluded. Calcium, phosphate, PTH, vitamin D-25OH were measured. CardiacT2 * and liver iron concentration (LIC) and left ventricular ejection fraction (LVEF) were determined. Results Sixty-one (33M/28F) patients with Transfusion-dependent thalassemia were enrolled. The prevalence of Vitamin D deficiency was 50.8%. Patients with cardiac siderosis had tendency for lower D-25OH than those without siderosis (15.9 (11.7-20.0) vs. 20.2 (15.85-22.3) ng/mL); p = 0.06). Serum calcium, phosphate, PTH, LIC, cardiac T2 * , and LVEF were not different between the groups with or without Vitamin D deficiency. Patients with Vitamin D deficiency had significantly lower hemoglobin levels compared to those without Vitamin D deficiency (7.5 (6.93-8.33) vs. 8.1 (7.30-8.50) g/dL; p = 0.04). The median hemoglobin in the last 12 months was significantly correlated with D-25OH. Cardiac T2 * had significant correlation with PTH. Vitamin D deficiency is prevalent in patients with Transfusion-dependent thalassemia. Vitamin D level is correlated with hemoglobin level. Vitamin D status should be routinely assessed in these patients. Low PTH is correlated with increased cardiac iron. This study did not demonstrate an association between Vitamin D deficiency and cardiac iron or function in patients with Transfusion-dependent thalassemia.

  9. Efficacy and safety of iron-chelation therapy with deferoxamine, deferiprone, and deferasirox for the treatment of iron-loaded patients with non-transfusion-dependent thalassemia syndromes

    PubMed Central

    Kontoghiorghe, Christina N; Kontoghiorghes, George J

    2016-01-01

    The prevalence rate of thalassemia, which is endemic in Southeast Asia, the Middle East, and the Mediterranean, exceeds 100,000 live births per year. There are many genetic variants in thalassemia with different pathological severity, ranging from a mild and asymptomatic anemia to life-threatening clinical effects, requiring lifelong treatment, such as regular transfusions in thalassemia major (TM). Some of the thalassemias are non-transfusion-dependent, including many thalassemia intermedia (TI) variants, where iron overload is caused by chronic increase in iron absorption due to ineffective erythropoiesis. Many TI patients receive occasional transfusions. The rate of iron overloading in TI is much slower in comparison to TM patients. Iron toxicity in TI is usually manifested by the age of 30–40 years, and in TM by the age of 10 years. Subcutaneous deferoxamine (DFO), oral deferiprone (L1), and DFO–L1 combinations have been effectively used for more than 20 years for the treatment of iron overload in TM and TI patients, causing a significant reduction in morbidity and mortality. Selected protocols using DFO, L1, and their combination can be designed for personalized chelation therapy in TI, which can effectively and safely remove all the excess toxic iron and prevent cardiac, liver, and other organ damage. Both L1 and DF could also prevent iron absorption. The new oral chelator deferasirox (DFX) increases iron excretion and decreases liver iron in TM and TI. There are drawbacks in the use of DFX in TI, such as limitations related to dose, toxicity, and cost, iron load of the patients, and ineffective removal of excess iron from the heart. Furthermore, DFX appears to increase iron and other toxic metal absorption. Future treatments of TI and related iron-loading conditions could involve the use of the iron-chelating drugs and other drug combinations not only for increasing iron excretion but also for preventing iron absorption. PMID:26893541

  10. Efficacy and safety of iron-chelation therapy with deferoxamine, deferiprone, and deferasirox for the treatment of iron-loaded patients with non-transfusion-dependent thalassemia syndromes.

    PubMed

    Kontoghiorghe, Christina N; Kontoghiorghes, George J

    2016-01-01

    The prevalence rate of thalassemia, which is endemic in Southeast Asia, the Middle East, and the Mediterranean, exceeds 100,000 live births per year. There are many genetic variants in thalassemia with different pathological severity, ranging from a mild and asymptomatic anemia to life-threatening clinical effects, requiring lifelong treatment, such as regular transfusions in thalassemia major (TM). Some of the thalassemias are non-transfusion-dependent, including many thalassemia intermedia (TI) variants, where iron overload is caused by chronic increase in iron absorption due to ineffective erythropoiesis. Many TI patients receive occasional transfusions. The rate of iron overloading in TI is much slower in comparison to TM patients. Iron toxicity in TI is usually manifested by the age of 30-40 years, and in TM by the age of 10 years. Subcutaneous deferoxamine (DFO), oral deferiprone (L1), and DFO-L1 combinations have been effectively used for more than 20 years for the treatment of iron overload in TM and TI patients, causing a significant reduction in morbidity and mortality. Selected protocols using DFO, L1, and their combination can be designed for personalized chelation therapy in TI, which can effectively and safely remove all the excess toxic iron and prevent cardiac, liver, and other organ damage. Both L1 and DF could also prevent iron absorption. The new oral chelator deferasirox (DFX) increases iron excretion and decreases liver iron in TM and TI. There are drawbacks in the use of DFX in TI, such as limitations related to dose, toxicity, and cost, iron load of the patients, and ineffective removal of excess iron from the heart. Furthermore, DFX appears to increase iron and other toxic metal absorption. Future treatments of TI and related iron-loading conditions could involve the use of the iron-chelating drugs and other drug combinations not only for increasing iron excretion but also for preventing iron absorption.

  11. Effects of α-Thalassemia on HbA1c Measurement.

    PubMed

    Xu, Anping; Ji, Ling; Chen, Weidong; Xia, Yong; Zhou, Yu

    2016-11-01

    α-Thalassemia is a benign condition that is often present in patients with diabetes mellitus. Here, we evaluated the effects of different genotypes α-thalassemia on HbA 1c measurement. A total of 189 samples from nondiabetic patients were analyzed. HbA 1c analysis was performed by ion-exchange high-performance liquid chromatography, boronate affinity HPLC, immunoassay, and capillary electrophoresis. Fasting glucose, fructosamin, and HbA 2 were also performed. All samples were confirmed by genotyping for thalassemia. In patients with two or three functional α-genes, HbA 1c values were not significantly different from those of controls (P > 0.05); however, in individuals with α-thalassemia with one functional α-gene (i.e., HbH disease), HbA 1c levels were significantly different from those of controls (P < 0.01). HbA 1c values were significantly lower in individuals with HbH disease than in control individuals and patients in the other two α-thalassemia groups. For patients with HbH disease, there were no significant differences in the four HbA 1c measurement systems (P > 0.05). In this study, HbA 1c values in samples from individuals with two or three functional α-genes basically reflected the normal mean blood glucose level, while those in samples from individuals with one functional α-gene did not. © 2016 Wiley Periodicals, Inc.

  12. Partial Splenectomy in the treatment of an adult with β thalassemia intermedia: A case report.

    PubMed

    Correia, João Guardado; Moreira, Nídia; Costa Almeida, Carlos Eduardo; Reis, Luís Simões

    2017-01-01

    Thalassemia is a common disease which treatment is often based on splenectomy. The risks associated with total splenectomy stimulated partial splenectomy as a potentially alternative therapy. A 45 year-old female patient with long term follow-up for β thalassemia intermedia started to develop signs of hypersplenism and iron overload. A partial splenectomy was performed and was observed a marked hematologic improvement while preserving the desired splenic function. Partial splenectomy proved to provide a persistent decrease in hemolytic rate while preserving the integrity of splenic phagocytic function, presenting itself as an effective alternative to total splenectomy. After being subjected to partial splenectomy, our patient experienced a sustained control of hemolysis and showed no signs of hypersplenism or iron overload. No splenic regrowth or infectious complications were observed. The major drawbacks of partial splenectomy are the increased risk of intra- and postoperative bleeding, splenic remnant torsion and splenic regrowth. Partial splenectomy is an alternative to total splenectomy for the treatment of adult β Thalassemia intermedia patients avoiding the risks associated with total splenectomy.

  13. Coronary atherosclerosis burden is not advanced in patients with β-thalassemia despite premature extracardiac atherosclerosis: a coronary artery calcium score and carotid intima-media thickness study.

    PubMed

    Hahalis, George; Zacharioglou, Evangelia; Xanthopoulou, Ioanna; Koniari, Ioanna; Kalogeropoulou, Chistina; Tsota, Irene; Rigopoulou, Aspasia; Diamantopoulos, Athanasios; Gkizas, Vasilios; Davlouros, Periklis; Akinosoglou, Karolina; Leopoulou, Marianna; Gogos, Charalampos; Alexopoulos, Dimitrios

    2016-02-01

    Thalassemic patients demonstrate an increased rate of extracardiac vascular complications and increased carotid wall intima-media thickness (cIMT), but very low prevalence of coronary artery disease (CAD). We investigated the atheroma burden by assessing the coronary artery calcium (CAC) and cIMT in these patients. We examined 37 patients with β-thalassemia and 150 healthy control volunteers with multi-detector computer tomography (CT) and ultrasonography to determine CAC score and cIMT, respectively. Propensity score matching (C-statistic: 0.88; 95% CI: 0.83-0.93) resulted in 27 pairs of patients; severe CAC was observed in 2 (7.4%) and 0 of β-thalassemia patients and healthy volunteers respectively (P = 0.5). Median calcium score was 0 (0-0) in β-thalassemia patients and 0 (0-4) in healthy volunteers (P = 0.8). Median intima-media thickness was higher in β-thalassemia patients compared to control group [0.45 (0.06-0.65) vs. 0.062 (0.054-0.086); P = 0.04]. Patients with β-thalassemia in comparison with healthy control subjects exhibit similar CAC score and increased cIMT. Our findings indicate a disparate rate of progression of atherosclerosis between coronary and extracardiac arteries in these patients lending support to the epidemiological evidence.

  14. Engineered U7 snRNA mediates sustained splicing correction in erythroid cells from β-thalassemia/HbE patients.

    PubMed

    Preedagasamzin, Sarinthip; Nualkaew, Tiwaporn; Pongrujikorn, Tanjitti; Jinawath, Natini; Kole, Ryszard; Fucharoen, Suthat; Jearawiriyapaisarn, Natee; Svasti, Saovaros

    2018-04-30

    Repair of a splicing defect of β-globin pre-mRNA harboring hemoglobin E (HbE) mutation was successfully accomplished in erythroid cells from patients with β-thalassemia/HbE disorder by a synthetic splice-switching oligonucleotide (SSO). However, its application is limited by short-term effectiveness and requirement of lifelong periodic administration of SSO, especially for chronic diseases like thalassemias. Here, we engineered lentiviral vectors that stably express U7 small nuclear RNA (U7 snRNA) carrying the splice-switching sequence of the SSO that restores correct splicing of β E -globin pre-mRNA and achieves a long-term therapeutic effect. Using a two-step tiling approach, we systematically screened U7 snRNAs carrying splice-switching SSO sequences targeted to the cryptic 5' splice site created by HbE mutation. We tested this approach and identified the most responsive element for mediating splicing correction in engineered U7 snRNAs in HeLa-β E cell model cell line. Remarkably, the U7 snRNA lentiviral vector (U7 βE4+1) targeted to this region effectively restored the correctly-spliced β E -globin mRNA for at least 5 months. Moreover, the effects of the U7 βE4+1 snRNA lentiviral vector were also evident as upregulation of the correctly-spliced β E -globin mRNA in erythroid progenitor cells from β-thalassemia/HbE patients treated with the vector, which led to improvements of pathologies in erythroid progenitor cells from thalassemia patients. These results suggest that the splicing correction of β E -globin pre-mRNA by the engineered U7 snRNA lentiviral vector provides a promising, long-term treatment for β-thalassemia/HbE. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. KLF1 mutations are relatively more common in a thalassemia endemic region and ameliorate the severity of β-thalassemia

    PubMed Central

    Liu, Dun; Zhang, Xinhua; Yu, Lihua; Cai, Ren; Ma, Xiaoxia; Zheng, Chengguang; Zhou, Yuqiu; Liu, Qiji; Wei, Xiaofeng; Lin, Li; Yan, Tizhen; Huang, Jiwei; Mohandas, Narla; An, Xiuli

    2014-01-01

    Mutations in human Krüppel-like factor 1 (KLF1) have recently been reported to be responsible for increased fetal hemoglobin (HbF) and hemoglobin A2 (HbA2). Because increased HbF and HbA2 levels are important features of β-thalassemia, we examined whether there is any relationship between KLF1 mutation and β-thalassemia in China. To do this, we first studied the incidence of KLF1 mutations in 2 Chinese populations: 3839 individuals from a thalassemia endemic region in south China and 1190 individuals from a nonthalassemia endemic region in north China. Interestingly, we found that the prevalence of KLF1 mutations is significantly higher in the thalassemia endemic region than that in nonthalassemia endemic region (1.25% vs 0.08%). Furthermore, we identified 7 functional variants including 4 previously reported (p.Gly176AlafsX179, p.Ala298Pro, p.Thr334Arg, and c.913+1G>A) and 3 novel variants (p.His299Asp, p.Cys341Tyr, and p.Glu5Lys) in southern China. The 2 most common mutations, p.Gly176AlafsX179 and p.His299Asp, accounted for 90.6% of the total. We found that zinc-finger mutations in KLF1 were selectively represented in 12 β-thalassemia intermedia patients and resulted in significantly different transfusion-free survival curves. Our findings suggest that KLF1 mutations occur selectively in the presence of β-thalassemia to increase the production of HbF, which in turn ameliorates the clinical severity of β-thalassemia. PMID:24829204

  16. Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

    PubMed Central

    Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2013-01-01

    In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

  17. Assessing posterior ocular structures in β-thalassemia minor.

    PubMed

    Arifoglu, Hasan Basri; Kucuk, Bekir; Duru, Necati; Altunel, Orhan; Gulhan, Ahmet; Ozen, Mustafa; Aygun, Bilal; Atas, Mustafa

    2018-02-01

    The aim of this study was to investigate the effect of β-thalassemia minor on choroidal, macular, and peripapillary retinal nerve fiber layer thickness. To form the sample, we recruited 40 patients with β-thalassemia minor and 44 healthy participants. We used spectral-domain optical coherence tomography to take all measurements of ocular thickness, as well as measured intraocular pressure, axial length, and central corneal thickness. We later analyzed correlations of hemoglobin levels with ocular parameters. A statistically significant difference emerged between patients with β-thalassemia minor and the healthy controls in terms of mean values of subfoveal, nasal, and temporal choroidal thickness (p = 0.001, p = 0.016, and p = 0.010, respectively). Except for central macular thickness, differences in paracentral macular thicknesses between the groups were also significant (superior: p < 0.001, inferior: p = 0.007, temporal: p = 0.001, and nasal: p = 0.005). Also, no statistically significant differences were noted for retinal nerve fiber layer thickness between two groups. Mean values of subfoveal, nasal, temporal choroidal, and macular thickness for the four quadrants were significantly lower in patients with β-thalassemia minor than in healthy controls.

  18. Interaction of malaria with a common form of severe thalassemia in an Asian population

    PubMed Central

    O'Donnell, A.; Premawardhena, A.; Arambepola, M.; Samaranayake, R.; Allen, S. J.; Peto, T. E. A.; Fisher, C. A.; Cook, J.; Corran, P. H.; Olivieri, Nancy F.; Weatherall, D. J.

    2009-01-01

    In many Asian populations, the commonest form of severe thalassemia results from the coinheritance of HbE and β thalassemia. The management of this disease is particularly difficult because of its extreme clinical diversity; although some genetic and adaptive factors have been identified as phenotypic modifiers, the reasons remain unclear. Because the role of the environment in the course of severe thalassemia has been neglected completely and because malaria due to both Plasmodium falciparum and Plasmodium vivax has been prevalent in Sri Lanka, we carried out a pilot study of patients with HbE β thalassemia that showed high frequencies of antibodies to both parasite species and that 28.6% of the children had DNA-based evidence of current infection with P. vivax. Malarial antibodies then were assessed in patients with HbE β thalassemia compared with those in age-matched controls. There was a significant increase in the frequency of antibodies in the thalassemic patients, particularly against P. vivax and in young children. There was also a higher frequency in those who had been splenectomized compared with those with intact spleens, although in the latter it was still higher than that in the controls. The thalassemic patients showed significant correlations between malaria antibody status and phenotype. Patients with HbE β thalassemia may be more prone to malaria, particularly P. vivax, which is reflected in their clinical severity. Because P. vivax malaria is widespread in Asia, further studies of its interaction with HbE β thalassemia and related diseases are required urgently as a part of ongoing thalassemia control programs. PMID:19841268

  19. Frequencies and phenotypic consequences of association of α- and β-thalassemia alleles with sickle-cell disease in Bahrain.

    PubMed

    Abuamer, S; Shome, D K; Jaradat, A; Radhi, A; Bapat, J P; Sharif, K A; Al-Touq, J; Al-Asheeri, A; Al-Ajami, A

    2017-02-01

    Bahrain has high prevalence rates of sickle cell and thalassemia in the population. This study reports the frequencies and phenotypic characteristics of α- and/or β-thalassemia associated with sickle-cell disease (SCD) in a tertiary care hospital. Adult SCD patients (n = 200) were screened for the common α- and β-thalassemia alleles prevalent in the region using molecular techniques. Results of CBC, hemoglobin analysis, and average annual frequencies of severe pain episodes and numbers of transfused red cell units were documented. Patients were grouped on the basis of molecular studies as sickle-cell anemia (SS, n = 131), SS/α-thalassemia with three normal genes (n = 27), SS/α-thalassemia with two normal genes (n = 11), sickle-β-thalassemia (Sβ, n = 23), and Sβ with co-inherited α-thalassemia (n = 8). Identified α-thalassemia determinants were -α 3.7 (n = 52), -α 4.2 (n = 4), α T-Saudi α (n = 1), and α Hph α (n = 1). All β-thalassemia alleles were β 0 defects. Sickle-thalassemia association resulted in higher hemoglobin, hematocrit, and erythrocyte counts with reduced MCV and reticulocytes. Significant clinical associations were as follows: increased severe pain frequency with α-thalassemia (three-gene group); red cell transfusion with β-thalassemia alleles and female gender. One-third of patients with SCD co-inherited α- and/or β-thalassemia alleles and these associations explained some of the observed phenotypic variability. A low prevalence of nondeletion α-thalassemia alleles was observed in these patients. The most significant disease amelioration occurred in SCD associated with two α-thalassemia alleles. © 2016 John Wiley & Sons Ltd.

  20. Hydroxyurea for nontransfusion-dependent β-thalassemia: A systematic review and meta-analysis.

    PubMed

    Algiraigri, Ali H; Wright, Nicola A M; Paolucci, Elizabeth Oddone; Kassam, Aliya

    2017-09-01

    Nontransfusion-dependent β-thalassemia (NTDβT) syndromes consist of β-thalassemia intermedia and moderate hemoglobin E/β thalassemias. They are characterized by varying degrees of chronic anemia and a wide spectrum of complications due to ineffective erythropoiesis and iron overload from chronic transfusions. Hydroxyurea (HU), an oral chemotherapeutic drug, is anticipated to decrease disease severity. We performed a meta-analysis to evaluate the clinical efficacy and safety of HU in NTDβT patients of any age. MEDLINE, EMBASE, Cochrane databases, and major conference proceedings for studies that assessed HU in NTDβT patients were searched. Qualities of eligible studies were assessed by National Institutes of Health tools. Seventeen studies, collectively involving 709 patients, fulfilled the eligibility criteria. HU was associated with a significant decrease in transfusion need in severe NTDβT with complete and overall (≥50%) response rates of 42% and 79%, respectively. For mild NTDβT, HU was effective in raising hemoglobin by 1g/L in 64% of patients. HU appears to be effective, well tolerated, and associated with mild and transient adverse events. NTDβT patients may benefit from a trial of HU, although large randomized clinical trials assessing its efficacy should be conducted to confirm the findings of this meta-analysis and to assess its long-term toxicity and response sustainability. Copyright © 2017 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.

  1. α-Globin as a molecular target in the treatment of β-thalassemia

    PubMed Central

    Mettananda, Sachith; Gibbons, Richard J.

    2015-01-01

    The thalassemias, together with sickle cell anemia and its variants, are the world’s most common form of inherited anemia, and in economically undeveloped countries, they still account for tens of thousands of premature deaths every year. In developed countries, treatment of thalassemia is also still far from ideal, requiring lifelong transfusion or allogeneic bone marrow transplantation. Clinical and molecular genetic studies over the course of the last 50 years have demonstrated how coinheritance of modifier genes, which alter the balance of α-like and β-like globin gene expression, may transform severe, transfusion-dependent thalassemia into relatively mild forms of anemia. Most attention has been paid to pathways that increase γ-globin expression, and hence the production of fetal hemoglobin. Here we review the evidence that reduction of α-globin expression may provide an equally plausible approach to ameliorating clinically severe forms of β-thalassemia, and in particular, the very common subgroup of patients with hemoglobin E β-thalassemia that makes up approximately half of all patients born each year with severe β-thalassemia. PMID:25869286

  2. Acute peri-operative beta blockade in intermediate-risk patients.

    PubMed

    Biccard, B M; Sear, J W; Foëx, P

    2006-10-01

    Peri-operative beta-blockade has been shown to reduce the incidence of postoperative cardio- vascular complications including cardiac death in high-risk non-cardiac surgical patients. However, the recent analysis by Lindenauer et al. suggests that it is inappropriate to administer beta-blockers blindly to all surgical patients. In an attempt to determine the appropriateness of peri-operative beta-blocker administration across patients with a spectrum of cardiovascular risks, we have examined studies of intermediate-risk patient groups (that is those undergoing intermediate risk surgery or those with a Lee Revised Cardiac Risk Score of < or =2). We analysed data from randomised prospective studies of the effects of acute peri-operative beta-blockade on the incidence of peri-operative myocardial ischaemia. By examining the demographics and surgical interventions in these patients, we have compared these studies with other studies of peri-operative silent myocardial ischaemia representing patients of similar risk. We thus estimated the expected long-term postoperative cardiovascular complication rate associated with myocardial ischaemia in these patients in terms of number needed to treat for ischaemia prevention and for prevention of major cardiovascular complications. Prevention of peri-operative myocardial ischaemia with acute beta-blockade in non-cardiac surgical patients with 1-2 RCRI clinical risk factors can be achieved with a number needed to treat of 10. It is not associated with a significant increase in drug associated side-effects. However, acute beta-blockade shows no real benefit in the prevention of major cardiovascular complications in intermediate risk non-vascular surgical patients with a number-needed-to-treat of 833. Vascular surgical patients undergoing intermediate-risk surgery may benefit from the protective effects of acute peri-operative beta-blockade, however, with a number-needed-to-treat of 68 it would require a randomised clinical trial of

  3. Improved hematopoietic differentiation efficiency of gene-corrected beta-thalassemia induced pluripotent stem cells by CRISPR/Cas9 system.

    PubMed

    Song, Bing; Fan, Yong; He, Wenyin; Zhu, Detu; Niu, Xiaohua; Wang, Ding; Ou, Zhanhui; Luo, Min; Sun, Xiaofang

    2015-05-01

    The generation of beta-thalassemia (β-Thal) patient-specific induced pluripotent stem cells (iPSCs), subsequent homologous recombination-based gene correction of disease-causing mutations/deletions in the β-globin gene (HBB), and their derived hematopoietic stem cell (HSC) transplantation offers an ideal therapeutic solution for treating this disease. However, the hematopoietic differentiation efficiency of gene-corrected β-Thal iPSCs has not been well evaluated in the previous studies. In this study, we used the latest gene-editing tool, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9), to correct β-Thal iPSCs; gene-corrected cells exhibit normal karyotypes and full pluripotency as human embryonic stem cells (hESCs) showed no off-targeting effects. Then, we evaluated the differentiation efficiency of the gene-corrected β-Thal iPSCs. We found that during hematopoietic differentiation, gene-corrected β-Thal iPSCs showed an increased embryoid body ratio and various hematopoietic progenitor cell percentages. More importantly, the gene-corrected β-Thal iPSC lines restored HBB expression and reduced reactive oxygen species production compared with the uncorrected group. Our study suggested that hematopoietic differentiation efficiency of β-Thal iPSCs was greatly improved once corrected by the CRISPR/Cas9 system, and the information gained from our study would greatly promote the clinical application of β-Thal iPSC-derived HSCs in transplantation.

  4. A comparative study of hematological parameters of α and β thalassemias in a high prevalence zone: Saudi Arabia

    PubMed Central

    Mehdi, Syed Riaz; Al Dahmash, Badr Abdullah

    2011-01-01

    BACKGROUND AND AIMS: Saudi Arabia falls in the high prevalent zone of αα and β thalassemias. Early screening for the type of thalassemia is essential for further investigations and management. The study was carried out to differentiate the type of thalassemia based on red cell indices and other hematological parameters. MATERIALS AND METHODS: The study was carried out on 991 clinically suspected cases of thalassemias in Riyadh, Saudi Arabia. The hematological parameters were studied on Coulter STKS. Cellulose acetate hemoglobin electrophoresis and high-performance liquid chromatography (HPLC) were performed on all the blood samples. Gene deletion studies were carried out by restriction fragment length polymorphism (RFLP) technique using the restriction endonucleases Bam HI. STATISTICAL ANALYSIS: Statistical analysis was performed on SPSS 11.5 version. RESULTS: The hemoglobin electrophoresis and gene studies revealed that there were 406 (40.96%) and 59 (5.95 %) cases of β thalassemia trait and β thalassemia major respectively including adults and children. 426 cases of various deletion forms of α thalassemias were seen. Microcytosis was a common feature in β thalassemias trait and (-α/-α) and (--/αα) types of α thalassemias. MCH was a more significant distinguishing feature among thalassemias. β thalassemia major and α thalassemia (-α/αα) had almost normal hematological parameters. CONCLUSION: MCV and RBC counts are not statistically significant features for discriminating between α and β thalassemias. There is need for development of a discrimination index to differentiate between α and β thalassemias traits on the lines of discriminatory Indices available for distinguishing β thalassemias trait from iron deficiency anemia. PMID:22345994

  5. A comparative study of hematological parameters of α and β thalassemias in a high prevalence zone: Saudi Arabia.

    PubMed

    Mehdi, Syed Riaz; Al Dahmash, Badr Abdullah

    2011-09-01

    Saudi Arabia falls in the high prevalent zone of αα and β thalassemias. Early screening for the type of thalassemia is essential for further investigations and management. The study was carried out to differentiate the type of thalassemia based on red cell indices and other hematological parameters. The study was carried out on 991 clinically suspected cases of thalassemias in Riyadh, Saudi Arabia. The hematological parameters were studied on Coulter STKS. Cellulose acetate hemoglobin electrophoresis and high-performance liquid chromatography (HPLC) were performed on all the blood samples. Gene deletion studies were carried out by restriction fragment length polymorphism (RFLP) technique using the restriction endonucleases Bam HI. Statistical analysis was performed on SPSS 11.5 version. The hemoglobin electrophoresis and gene studies revealed that there were 406 (40.96%) and 59 (5.95 %) cases of β thalassemia trait and β thalassemia major respectively including adults and children. 426 cases of various deletion forms of α thalassemias were seen. Microcytosis was a common feature in β thalassemias trait and (-α/-α) and (--/αα) types of α thalassemias. MCH was a more significant distinguishing feature among thalassemias. β thalassemia major and α thalassemia (-α/αα) had almost normal hematological parameters. MCV and RBC counts are not statistically significant features for discriminating between α and β thalassemias. There is need for development of a discrimination index to differentiate between α and β thalassemias traits on the lines of discriminatory Indices available for distinguishing β thalassemias trait from iron deficiency anemia.

  6. Two cloned β thalassemia genes are associated with amber mutations at codon 39

    PubMed Central

    Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur

    1981-01-01

    Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

  7. Rapid Screening for Deleted Form of β-thalassemia by Real-Time Quantitative PCR.

    PubMed

    Ke, Liang-Yin; Chang, Jan-Gowth; Chang, Chao-Sung; Hsieh, Li-Ling; Liu, Ta-Chih

    2017-01-01

    Thalassemia is the most common single gene disease in human beings. The prevalence rate of β-thalassemia in Taiwan is approximately 1-3%. Previously methods to reveal and diagnose severe deleted form of α- or β-thalassemia were insufficient and inappropriate for prenatal diagnosis. A real-time quantitative PCR method was set up for rapid screening of the deleted form of β-thalassemia. Our results show that ΔΔCt between deleted form of β-thalassemia and normal individuals were 1.0674 ± 0.0713. On the contrary, mutation form β-thalassemia showed no difference with normal healthy control. The HBB/CCR5 ratio for deleted form of β-thalassemia patients was 0.48, whether normal individuals and mutation form of β-thalassemia was 1.0. This RQ-PCR technique is an alternative rapid screening assay for deleted form of β-thalassemia. In addition, it could also identify undefined type. Our technique by using RQ-PCR to quantify gene copies is a reliable and time-saving method that can screen deleted form of β-thalassemia. © 2016 Wiley Periodicals, Inc.

  8. Genetics Home Reference: alpha thalassemia

    MedlinePlus

    ... Facebook Twitter Home Health Conditions Alpha thalassemia Alpha thalassemia Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Alpha thalassemia is a blood disorder that reduces the production ...

  9. Thalassemia in the United Arab Emirates: Why it can be prevented but not eradicated

    PubMed Central

    2017-01-01

    Thalassemia is a genetic blood disorder that causes abnormal hemoglobin. Hemoglobin is a protein in red blood cells that carries oxygen and is made of two proteins from four α-globin genes and two β-globin genes. A defect in one or more of these genes causes thalassemia. The treatment of thalassemia mostly depends on life-long blood transfusions and removal of excessive iron from the blood stream. Such tremendous blood consumption puts pressure on the national blood stock in many countries. In particular, in the United Arab Emirates (UAE), various forms of thalassemia prevention have been used and hence, the substantial reduction of the thalassemia major population has been achieved. However, the thalassemia carrier population still remains high, which leads to the potential increase in the thalassemia major population through carrier-carrier marriages. In this work, we investigate the long-term impact and efficacy of thalassemia prevention measures via mathematical modeling at a population level. To our best knowledge, this type of assessment has not been done before and there is no mathematical model that has investigated such a problem for thalassemia or any blood disorders at a population level. By using UAE data, we perform numerical simulations of our model and conduct sensitivity analysis of parameter values to see which parameter values affect most the dynamics of our model. We discover that the prevention measures can contribute to reduce the prevalence of the disease only in the short term but not eradicate the disease in the long term. PMID:28135306

  10. MRI for Iron Overload in Thalassemia.

    PubMed

    Fernandes, Juliano Lara

    2018-04-01

    MRI is a key tool in the current management of patients with thalassemia. Given its capability of assessing iron overload in different organs noninvasively and without contrast, it has significant advantages over other metrics, including serum ferritin. Liver iron concentration can be measured either with relaxometry methods T2*/T2 or signal intensity ratio techniques. Myocardial iron can be assessed in the same examination through T2* imaging. In this review, we focus on showing how MRI evaluates iron in both organs and the clinical applications as well as practical approaches to using this tool by clinicians taking care of patients with thalassemia. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Prevalence of βS-globin gene haplotypes, α-thalassemia (3.7 kb deletion) and redox status in patients with sickle cell anemia in the state of Paraná, Brazil

    PubMed Central

    Shimauti, Eliana LitsukoTomimatsu; Silva, Danilo Grunig Humberto; de Souza, Eniuce Menezes; de Almeida, Eduardo Alves; Leal, Francismar Prestes; Bonini-Domingos, Claudia Regina

    2015-01-01

    The aim of this study was to determine the frequency of beta S-globin gene (βS globin) haplotypes and alpha thalassemia with 3.7 kb deletion (−α3.7kb thalassemia) in the northwest region of Paraná state, and to investigate the oxidative and clinical-hematological profile of βS globin carriers in this population. Of the 77 samples analyzed, 17 were Hb SS, 30 were Hb AS and 30 were Hb AA. The βSglobin haplotypes and −α3.7kb thalassemia were identified using polymerase chain reaction.Trolox equivalent antioxidant capacity (TEAC) and lipid peroxidation (LPO) were assessed spectophotometrically. Serum melatonin levels were determined using high-performance liquid chromatography coupled to coulometric electrochemical detection. The haplotype frequencies in the SS individuals were as follows: Bantu- 21 (62%), Benin - 11 (32%) and Atypical- 2 (6%). Bantu/Benin was the most frequent genotype. Of the 47 SS and AS individuals assessed, 17% (n = 8) had the −α3.7kb mutation. Clinical manifestations, as well as serum melatonin, TEAC and LPO levels did not differ between Bantu/Bantu and Bantu/Benin individuals (p > 0.05). Both genotypes were associated with high LPO and TEAC levels and decreased melatonin concentration. These data suggest that the level of oxidative stress in patients with Bantu/Bantu and Bantu/Benin genotypes may overload the antioxidant capacity. PMID:26500435

  12. Altered erythropoiesis and iron metabolism in carriers of thalassemia

    PubMed Central

    Guimarães, Jacqueline S.; Cominal, Juçara G.; Silva-Pinto, Ana Cristina; Olbina, Gordana; Ginzburg, Yelena Z.; Nandi, Vijay; Westerman, Mark; Rivella, Stefano; de Souza, Ana Maria

    2014-01-01

    The thalassemia syndromes (α- and β-thalassemia) are the most common and frequent disorders associated with ineffective erythropoiesis. Imbalance of α- or β-globin chain production results in impaired red blood cell synthesis, anemia and more erythroid progenitors in the blood stream. While patients affected by these disorders show definitive altered parameters related to erythropoiesis, the relationship between the degree of anemia, altered erythropoiesis and dysfunctional iron metabolism have not been investigated in both α-thalassemia carriers (ATC) and β-thalassemia carriers (BTC). Here we demonstrate that ATC have a significantly reduced hepcidin and increased soluble transferrin receptor levels but relatively normal hematological findings. In contrast, BTC have several hematological parameters significantly different from controls, including increased soluble transferrin receptor and erythropoietin levels. These changings in both groups suggest an altered balance between erythropoiesis and iron metabolism. The index sTfR/log ferrin and (hepcidin/ferritin)/sTfR are respectively increased and reduced relative to controls, proportional to the severity of each thalassemia group. In conclusion, we showed in this study, for the first time in the literature, that thalassemia carriers have altered iron metabolism and erythropoiesis. PMID:25307880

  13. Measurement of HbA1c and HbA2 by Capillarys 2 Flex Piercing HbA1c programme for simultaneous management of diabetes and screening for thalassemia

    PubMed Central

    Ke, Peifeng; Liu, Jiawei; Chao, Yan; Wu, Xiaobin; Xiong, Yujuan; Lin, Li; Wan, Zemin; Wu, Xinzhong; Xu, Jianhua; Zhuang, Junhua; Huang, Xianzhang

    2017-01-01

    Introduction Thalassemia could interfere with some assays for haemoglobin A1c (HbA1c) measurement, therefore, it is useful to be able to screen for thalassemia while measuring HbA1c. We used Capillarys 2 Flex Piercing (Capillarys 2FP) HbA1c programme to simultaneously measure HbA1c and screen for thalassemia. Materials and methods Samples from 498 normal controls and 175 thalassemia patients were analysed by Capillarys 2FP HbA1c programme (Sebia, France). For method comparison, HbA1c was quantified by Premier Hb9210 (Trinity Biotech, Ireland) in 98 thalassaemia patients samples. For verification, HbA1c from eight thalassaemia patients was confirmed by IFCC reference method. Results Among 98 thalassaemia samples, Capillarys 2FP did not provide an HbA1c result in three samples with HbH due to the overlapping of HbBart’s with HbA1c fraction; for the remaining 95 thalassaemia samples, Bland-Altman plot showed 0.00 ± 0.35% absolute bias between two systems, and a significant positive bias above 7% was observed only in two HbH samples. The HbA1c values obtained by Capillarys 2FP were consistent with the IFCC targets (relative bias below ± 6%) in all of the eight samples tested by both methods. For screening samples with alpha (α-) thalassaemia silent/trait or beta (β-) thalassemia trait, the optimal HbA2 cut-off values were ≤ 2.2% and > 2.8%, respectively. Conclusions Our results demonstrated the Capillarys 2FP HbA1c system could report an accurate HbA1c value in thalassemia silent/trait, and HbA2 value (≤ 2.2% for α-thalassaemia silent/trait and > 2.8% for β-thalassemia trait) and abnormal bands (HbH and/or HbBart’s for HbH disease, HbF for β-thalassemia) may provide valuable information for screening. PMID:28900367

  14. Measurement of HbA1c and HbA2 by Capillarys 2 Flex Piercing HbA1c programme for simultaneous management of diabetes and screening for thalassemia.

    PubMed

    Ke, Peifeng; Liu, Jiawei; Chao, Yan; Wu, Xiaobin; Xiong, Yujuan; Lin, Li; Wan, Zemin; Wu, Xinzhong; Xu, Jianhua; Zhuang, Junhua; Huang, Xianzhang

    2017-10-01

    Thalassemia could interfere with some assays for haemoglobin A 1c (HbA 1c ) measurement, therefore, it is useful to be able to screen for thalassemia while measuring HbA 1c . We used Capillarys 2 Flex Piercing (Capillarys 2FP) HbA 1c programme to simultaneously measure HbA 1c and screen for thalassemia. Samples from 498 normal controls and 175 thalassemia patients were analysed by Capillarys 2FP HbA 1c programme (Sebia, France). For method comparison, HbA 1c was quantified by Premier Hb9210 (Trinity Biotech, Ireland) in 98 thalassaemia patients samples. For verification, HbA 1c from eight thalassaemia patients was confirmed by IFCC reference method. Among 98 thalassaemia samples, Capillarys 2FP did not provide an HbA 1c result in three samples with HbH due to the overlapping of HbBart's with HbA 1c fraction; for the remaining 95 thalassaemia samples, Bland-Altman plot showed 0.00 ± 0.35% absolute bias between two systems, and a significant positive bias above 7% was observed only in two HbH samples. The HbA 1c values obtained by Capillarys 2FP were consistent with the IFCC targets (relative bias below ± 6%) in all of the eight samples tested by both methods. For screening samples with alpha (α-) thalassaemia silent/trait or beta (β-) thalassemia trait, the optimal HbA 2 cut-off values were ≤ 2.2% and > 2.8%, respectively. Our results demonstrated the Capillarys 2FP HbA 1c system could report an accurate HbA 1c value in thalassemia silent/trait, and HbA 2 value (≤ 2.2% for α-thalassaemia silent/trait and > 2.8% for β-thalassemia trait) and abnormal bands (HbH and/or HbBart's for HbH disease, HbF for β-thalassemia) may provide valuable information for screening.

  15. Outcomes, utilization, and costs among thalassemia and sickle cell disease patients receiving deferoxamine therapy in the United States.

    PubMed

    Delea, Thomas E; Hagiwara, May; Thomas, Simu K; Baladi, Jean-Francois; Phatak, Pradyumna D; Coates, Thomas D

    2008-04-01

    Deferoxamine mesylate (DFO) reduces morbidity and mortality associated with transfusional iron overload. Data on the utilization and costs of care among U.S. patients receiving DFO in typical clinical practice are limited however. This was a retrospective study using a large U.S. health insurance claims database spanning 1/97-12/04 and representing 40 million members in >70 health plans. Study subjects (n = 145 total, 106 sickle cell disease [SCD], 39 thalassemia) included members with a diagnosis of thalassemia or SCD, one or more transfusions (whole blood or red blood cells), and one or more claims for DFO. Mean transfusion episodes were 12 per year. Estimated mean DFO use was 307 g/year. Central venous access devices were required by 20% of patients. Cardiac disease was observed in 16% of patients. Mean total medical costs were $59,233 per year including $10,899 for DFO and $8,722 for administration of chelation therapy. In multivariate analyses, potential complications of iron overload were associated with significantly higher medical care costs. In typical clinical practice, use of DFO in patients with thalassemia and SCD receiving transfusions is low. Administration costs represent a large proportion of the cost of chelation therapy. Potential complications of iron overload are associated with increased costs. (c) 2007 Wiley-Liss, Inc.

  16. Prevalence and genetic analysis of α- and β-thalassemia in Baise region, a multi-ethnic region in southern China.

    PubMed

    He, Sheng; Qin, Qian; Yi, Shang; Wei, Yuan; Lin, Li; Chen, Shaoke; Deng, Jianping; Xu, Xianmin; Zheng, Chenguang; Chen, Biyan

    2017-07-01

    Thalassemia is one of the most common hereditary blood disorders. Epidemiological data regarding the occurrence and distribution of thalassemia is important for designing appropriate prevention strategies. The objective of this study was to update and reveal the prevalence of thalassemia and mutation spectrum in the Baise region of southern China. We screened 47,500 individuals from Baise region by hematological and genetic analysis. Totally, 11,432 (24.07%) subjects were diagnosed as being carriers and patients of thalassemia, including 7290 (15.35%) subjects with α-thalassemia, 3152 (6.64%) subjects with β-thalassemia and 990 (2.08%) subjects with both α-thalassemia and β-thalassemia. Ten α-thalassemia mutations and 31 genotypes were identified in the α-thalassemia carriers and patients. Meanwhile, 13 β-thalassemia mutations and 26 genotypes were characterized in the β-thalassemia carriers and patients. Furthermore, the true prevalence of nondeletional mutations and Thailand type (-THAI) deletion mutation were first reported in this study. In addition, three cases of αα/ααα3.7, five cases of HKαα/αα and two rare β-globin mutations, -86 (G>C) and CD 121 (G>T) were first identified in the Chinese Zhuang ethnic populations. Our data indicated that there was great heterogeneity and extensive spectrum of thalassemias in the Baise populations. The findings will be useful for genetic counseling and prevention of severe thalassemia in this region. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. A novel mutation of the beta-globin gene promoter (-102 C>A) and pitfalls in family screening.

    PubMed

    Aguilar-Martinez, Patricia; Jourdan, Eric; Brun, Sophie; Cunat, Séverine; Giansily-Blaizot, Muriel; Pissard, Serge; Schved, Jean-François

    2007-12-01

    We describe a family with beta-thalassemia in which several pitfalls of genetic diagnoses were present. These include coherent family phenotypes with discrepancies in molecular findings because of nonpaternity, and a false beta-globin gene homozygous genotype due to a large deletion in the second locus. These findings underline the difficulties of family genetic studies and the need for tight relationship between professionals involved in laboratory studies and those in-charge of the clinical follow-up and genetic counselling. In this family, we also report a new silent beta-thalassemia mutation, -102 (C>A), in the distal CACCC box of the beta-globin gene promoter.

  18. Improvement in liver pathology of patients with β-thalassemia treated with deferasirox for at least 3 years.

    PubMed

    Deugnier, Yves; Turlin, Bruno; Ropert, Martine; Cappellini, M Domenica; Porter, John B; Giannone, Vanessa; Zhang, Yiyun; Griffel, Louis; Brissot, Pierre

    2011-10-01

    Most data on the effects of iron chelation therapy for patients with liver fibrosis come from small studies. We studied the effects of the oral iron chelator deferasirox on liver fibrosis and necroinflammation in a large population of patients with iron overload β-thalassemia. We studied data from 219 patients with β-thalassemia, collected from histologic analyses of biopsy samples taken at baseline and after at least 3 years of treatment with deferasirox. Treatment response was assessed from liver iron concentrations at baseline and the end of the study. Liver fibrosis, necroinflammation, and markers of iron overload and liver enzymes were recorded. Patients were also assessed, by serologic analysis at baseline, for hepatitis C virus infection. By the end of the study, stability of Ishak fibrosis staging scores (change of -1, 0, or +1) or improvements (change of ≤-2) were observed in 82.6% of patients; Ishak necroinflammatory scores improved by a mean value of -1.3 (P<.001). Improvements in fibrosis stage and necroinflammation were independent of hepatitis C virus exposure or reduction in liver iron concentration defined by the response criteria. Absolute changes in concentrations of liver iron by the end of the study did not correlate with improved Ishak fibrosis or necroinflammatory scores. Deferasirox treatment for 3 or more years reversed or stabilized liver fibrosis in 83% of patients with iron-overloaded β-thalassemia. This therapeutic effect was independent of reduced concentration of liver iron (defined by the response criteria) or previous exposure to hepatitis C virus. Copyright © 2011 AGA Institute. Published by Elsevier Inc. All rights reserved.

  19. Complications of Transfusion-Dependent β-Thalassemia Patients in Sistan and Baluchistan, South-East of Iran.

    PubMed

    Yaghobi, Maryam; Miri-Moghaddam, Ebrahim; Majid, Naderi; Bazi, Ali; Navidian, Ali; Kalkali, Asiyeh

    2017-10-01

    Background : Thalassemia syndromes are among prevalent hereditary disorders imposing high expenses on health-care system worldwide and in Iran. Organ failure represents a life-threatening challenge in transfusion- dependent β-thalassemia (TDT) patients. The purpose of the present study was to determine the frequency of organ dysfunctions among TDT patients in Sistan and Baluchistan province in South-East of Iran. Materials and Methods: Laboratory and clinical data were extracted from medical records as well as by interviews. Standard criteria were applied to recognize cardiac, gonadal, endocrine and renal dysfunctions. The collected data were analyzed using the SPSS statistics software (Ver.19). Results: A total of 613 TDT patients (54.3% males and 45.7% females) were included in this study. The mean age of patients was 13.3 ±7.7 years old. Cardiac events comprised the most encountered complications (76.4%), following by hypogonadism (46.8%), parathyroid dysfunction (22%), thyroid abnormalities (8.3%), diabetes (7.8%) and renal disease (1.8%). Hypogonadism comprised the most identified complication in patient <15 years old, while the cardiac complications were the most frequent sequela in patients >15 years old (P<0.01). Conclusion: As cardiac events are significantly more common among TDT patients, close monitoring of the heart function is recommended for identifying patients with cardiac problems.

  20. Hypersensitivity reaction with deferasirox

    PubMed Central

    Sharma, Atul; Arora, Ekta; Singh, Harmanjit

    2015-01-01

    Thalassemias comprise a group of hereditary blood disorders. Thalassemia major presents with anemia within the first 2 years of life requiring frequent blood transfusions for sustaining life. Regular blood transfusions lead to iron overload-related complications. Prognosis of thalassemia has improved because of the availability of iron-chelating agents. Oral iron chelators are the mainstay of chelation therapy. Deferasirox is a new-generation oral iron chelator for once daily usage. We herein describe a patient of beta thalassemia major who developed an allergic manifestation in the form of erythematous pruritic skin rashes to the oral iron chelator deferasirox. This is a rare adverse reaction reported with deferasirox that led to a therapeutic dilemma in this particular case. PMID:25969661

  1. Sudden monocular blindness associated with homozygous B-thalassemia in a young Liberian.

    PubMed

    Njoh, J; York, S

    1990-05-01

    A 16-year old Liberian female presented with sudden monocular blindness. Physical examination and laboratory investigations were normal except that the patient had homozygous B-Thalassemia (HbA 58%, HbF 5% and HbA2 7.0%). Family study revealed that both parents had B-Thalassemia trait. We feel that the association of sudden monocular blindness with homozygous B-Thalassemia which has not been reported before, is not fortuitous but causal. It is therefore suggested that homozygous B-Thalassemia be added to the list of haemoglobinopathies (HbAS, SS and SC) that have been reported to cause blindness as complication.

  2. Interaction of an α-Globin Gene Triplication with β-Globin Gene Mutations in Iranian Patients with β-Thalassemia Intermedia.

    PubMed

    Farashi, Samaneh; Bayat, Nooshin; Faramarzi Garous, Negin; Ashki, Mehri; Montajabi Niat, Mona; Vakili, Shadi; Imanian, Hashem; Zeinali, Sirous; Najmabadi, Hossein; Azarkeivan, Azita

    2015-01-01

    The 3.7 kb triplicated α-globin gene (ααα(anti 3.7)) mutation has been found in most populations. It results from an unequal crossover between misaligned homologous segments in the α-globin gene cluster during meiosis. The pathophysiology and clinical severity of β-thalassemia (β-thal) are associated with the degree of α chain imbalance. The excess of α-globin chains plays an important role in the pathophysiology of β-thal. When heterozygous/homozygous β-thal coexists with an α gene numerical alteration, the clinical and hematological phenotype of thalassemia could change to mild anemia in case of an α deletion (-α/αα) or severe anemia in the case of an α triplication (αα/ααα). The coexistence of an ααα(anti 3.7) triplication is considered an important factor in the severity of β-thal, exacerbating the phenotypic severity of β-thal by causing more globin chain imbalance. This study shows that the ααα(anti 3.7) triplication is an important factor in the causation of β-thal intermedia (β-TI) in heterozygous β-thal. This type of phenotype modification has rarely been observed and reported in the Iranian population. Here we report the coinheritance of a triplicated α-globin gene arrangement and heterozygous/homozygous β-thal in 23 cases, presenting with a β-TI or β-thal major (β-TM) phenotype. Some of these patients were considered to have a mild β-TI phenotype as they needed no blood transfusions; some occasionally received blood transfusions in their lifetime (for example on delivery) but some are dependent on regular blood transfusions (every 20 to 40 days). Our study was focused on the importance of detecting the α-globin gene triplication in genotype/phenotype prediction in Iranian thalassemia patients.

  3. [Analysis of hematological phenotype and genotype of 23 patients from Guangdong with co-inherited hemoglobin Hb Westmead and β-thalassemia].

    PubMed

    Yan, Miansheng; Gan, Xin; Liu, Min; Huang, Bin; Zhong, Liangying

    2016-10-01

    To analyze the genotype-phenotype correlation among carriers from Guangdong with co-inherited hemoglobin Hb Westmead (HbWS) and β-thalassemia. Twenty three patients (including 9 males and 14 females, aged 1-53 year old) were diagnosed by hematological analysis and genetic testing. Complete blood cell count and hemoglobin electrophoresis analysis were performed on a XE4000i automatic hemocyte analyzer. Hb, HbF and HbA2 were tested by high performance liquid chromatography (HPLC). Gap-PCR was adopted to detect three common thalassemia deletions. Reverse dot-blotting (RDB) assay was applied for detecting three common non-deletional α2 gene mutations and β-thalassemia. Among the 23 patients, 12 showed anemia, among whom 9 had mild anemia and 3 had moderate anemia. The lowest Hb was 68 g/L, and both mean corpuscular volume and mean corpuscular hemoglobin were lower than average, while HbA2 was higher than 3.5%. Genetic analysis confirmed that 5 cases had αWS-α/α-α, β CD654/β N (21.7%), 4 had α WS-α/α-α, β CD41-42/β N (17.4%), 5 had α WS-α/α-α, β CD17/β N (21.7%), 4 had α WS-α/α-α, β CD28/β N (17.4%), 1 had α WS-α/α-α, β CD71-72/β N (4.3%), 1 had αWS-α/α-α, β CD27-28/β N (4.3%), 1 had α WS-α/α-α, β CD41-42/β CD17 (4.3%), 2 had a concomitant β-thalassemia heterozygosity and -α 3.7 deletion. Patients with co-existing Hb WS and other β-thalassemia trait may show variable clinical features. Such compound heterozygotes are usually misdiagnosed during screening by hemoglobin electrophoresis, accurate diagnose should be attained by molecular diagnosis.

  4. Thrombotic thrombocytopenic purpura or immune thrombocytopenia in a sickle cell/β+-thalassemia patient: a rare and challenging condition.

    PubMed

    Vlachaki, Efthymia; Agapidou, Aleka; Neokleous, Nikolaos; Adamidou, Despoina; Vetsiou, Evaggelia; Boura, Panagiota

    2014-10-01

    The diagnosis of thrombotic thrombocytopenic purpura is one of the possible diagnosis when a patient is admitted with unexpected micro-angiopathic hemolytic anemia and thrombocytopenia. The combination of sickle cell/β(+)-thalassemia and thrombotic thrombocytopenic purpura is rare and triggering. This article describes the poor outcome of a patient with sickle cell/β(+)-thalassemia presenting with gingival bleeding, severe thrombocytopenia and anemia. The patient had normal renal function, no neurological deficit and he was initially treated as immune thrombocytopenic purpura. He eventually died due to multi-organ failure and brain hemorrhage even though he had started plasma exchange sessions. The co-existence of thrombotic thrombocytopenic purpura and sickle cell anemia is making the diagnosis of the former difficult. Early and rapid intervention is critical to the outcome. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Oxidative status and serum PON1 activity in beta-thalassemia minor.

    PubMed

    Selek, Sahbettin; Aslan, Mehmet; Horoz, Mehmet; Gur, Mustafa; Erel, Ozcan

    2007-03-01

    Paraoxonase-1 (PON1) deficiency is related to increased susceptibility to low density lipoprotein oxidation and development of atherosclerosis. The aim of this study was to investigate paraoxonase and arylesterase activities along with oxidative status parameters, and to find out if there is any increased susceptibility to atherogenesis, which might be reflected with increased oxidative stress and decreased serum PON1 activity in beta-thalassemia minor (BTM) subjects. Thirty-two subjects with BTM and 28 healthy subjects as control were enrolled in the study. Serum paraoxonase and arylesterase activities, lipid hydroperoxide (LOOH) levels, total antioxidant capacity (TAC), total oxidant status (TOS) and oxidative stress index (OSI) were determined. Serum TAC, paraoxonase and arylesterase activities were significantly lower in BTM subjects than controls (for all p<0.001), while TOS, LOOH levels and OSI were significantly higher (p<0.001, p<0.05 and p<0.001; respectively). In BTM subjects, OSI, TOS, LOOH levels and TAC were significantly correlated with serum paraoxonase (r=-0.245, p<0.05; r=-0.231, p<0.05; r=-0.264, p<0.05 and, r=0.342, p<0.05, respectively) and arylesterase activities (r=-0.332, p<0.05, r=-0.308, p<0.05; r=-0.320, p<0.05 and r=0.443, p<0.05). Additionally, hemoglobin level was also correlated with serum paraoxonase (r=0.501, p<0.001) and arylesterase activities (r=0.501, p<0.001), TAC (r=0.402, p<0.05), TOS (r=-0.274, p<0.05) and OSI (r=-0.352, p<0.05). Oxidative stress is increased, while serum PON1 activity is decreased in BTM subjects. Decrease in PON1 activity seems to be associated with both the degree of oxidative stress and anemia. BTM subjects may be more prone to development of atherogenesis due to low serum PON1 activity.

  6. Patterns of physical growth and dental development in Jordanian children and adolescents with thalassemia major.

    PubMed

    Hattab, Faiez N

    2013-03-01

    Dental development and physical growth are of particular interest in pediatric dentistry and orthodontics. This study evaluated these variables in patients with thalassemia major (TM). Physical growth was assessed in 54 patients (31 males and 23 females) aged 5.5 to 18.3 years and dental development was analyzed using panoramic radiographs from 39 of the 54 patients. The Demirjian system was used to characterize dental development of the seven left mandibular permanent teeth. Chronologic age (CA) and dental age (DA) were compared using the paired t-test, and the correlation between CA and extent of delay in dental development (DA minus CA) was assessed using Pearson's correlation coefficients. Growth retardation (< 10th percentile for height and weight) was present in 75.9% of TM patients. Height less than the third percentile was noted in 41.9% (13/31) of males and 34.8% (8/23) of females. Mean (SD) body mass index was 16.5 ± 2.2 kg/m(2). The extent of growth retardation increased with advancing age. Patient radiographs revealed a delay in dental development in 31 of 39 (79.5%) of participants (mean delay, 1.12 years in males and 0.81 years in females; range, 0.1 to 2.7 years). The mean difference between CA and DA was 0.97 years (P < 0.001). CA was significant correlated with extent of dental developmental delay (r = 0.64, P < 0.01). The results show that, among children and adolescents with TM, the proportions of those who had short stature, were underweight, and had a low growth rate increased with age. In addition, participants had significant delays in dental development.

  7. Genetics of Iranian Alpha-Thalassemia Patients: A Comprehensive Original Study.

    PubMed

    Keikhaei, Bijan; Slehi-Fard, Pejman; Shariati, Gholamreza; Khosravi, Abbas

    2018-04-07

    Alpha thalassemia is the most prevalent monogenic gene disorder in the world, especially in Mediterranean countries. In the current hematological phenotype of patients with different genotypes, the effects of missense mutations on the protein function and also stability were evaluated in a large cohort study. A total of 1,560 subjects were enrolled in the study and divided into two groups: 259 normal subjects; and 1301 alpha-thalassemia carriers. Genomic DNA was extracted and analyzed using ARMS PCR, Multiplex Gap, and direct sequencing. The effects of single nucleotide change on the protein function and stability were predicted by freely available databases of human polymorphisms. Sixty-three different genotypes were seen in the patients. The more prevalent was heterozygote form of -α3.7 (41.4%) followed by -α3.7 homozygote (11.6%) and -MED (3.8%). The significant differences were seen in mean hemoglobin level [F = 20.5, p < 0.001] between the Alpha-globin genotypes, when adjusted for gender. Moreover, 28 different mutations were found in our study. A significant relationship was seen between ethnicity and the alpha-globin mutation frequency χ 2 (df;8) = 38.36, p < 0.0001). Different genotypes could display as different phenotypes. The mutation frequency distributions in our region are different from those of other parts of Iran. Significant differences are seen in the spectrum of mutation frequency among various ethnicities. Finally, some missense mutations might not have considerable effect on the proteins, and they could be neutral mutations.

  8. The long-term efficacy and tolerability of oral deferasirox for patients with transfusion-dependent β-thalassemia in Taiwan.

    PubMed

    Chang, Hsiu-Hao; Lu, Meng-Yao; Peng, Steven Shinn-Forng; Yang, Yung-Li; Lin, Dong-Tsamn; Jou, Shiann-Tarng; Lin, Kai-Hsin

    2015-12-01

    Deferasirox is a novel once-daily, oral iron chelator. The aim of this study was to evaluate the long-term efficacy and tolerability of deferasirox in Taiwanese patients with transfusion-dependent β-thalassemia who have been treated with deferasirox for 7 years. Taiwanese patients aged ≥2 years with transfusion-dependent β-thalassemia whose serum ferritin levels were ≥1000 ng/mL and had started deferasirox treatment since December 2005 at the National Taiwan University Hospital were enrolled. Sixty patients were recruited for analysis, and 11 (18.3 %) patients discontinued deferasirox during the study. In the 42 patients included in the efficacy analysis, the mean serum ferritin levels decreased significantly by 2566 ng/mL after 7 years of treatment (P < 0.001). Forty-one of these patients received a cardiac T2* evaluation after 3 years of deferasirox treatment, and the mean cardiac T2* value increased significantly from 30.6 ± 16.6 to 45.9 ± 22.6 ms after 7 years of deferasirox treatment (P < 0.001). Deferasirox-related adverse events assessed by investigators were reported in 46 (76.7 %) patients. The most common adverse events related to deferasirox were skin rashes (n = 29, 48.3 %), followed by abdominal pain (n = 23, 38.3 %) and diarrhea (n = 16, 26.7 %). Most adverse events were manageable. This study demonstrated that long-term treatment with deferasirox was effective in improving iron overload, including cardiac iron overload, in patients with transfusion-dependent β-thalassemia. Deferasirox was well tolerated; however, the incidences of common adverse events related to deferasirox appeared higher in our Taiwanese patients than other studies.

  9. Thalassemia: Complications and Treatment

    MedlinePlus

    ... on Facebook Tweet Share Compartir If I have thalassemia, how does it affect my body? Since your ... like flu shots and other vaccines. How is thalassemia treated? The type of treatment a person receives ...

  10. Recent trends in the gene therapy of β-thalassemia

    PubMed Central

    Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto

    2015-01-01

    The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

  11. The questioning for routine monthly monitoring of proteinuria in patients with β-thalassemia on deferasirox chelation.

    PubMed

    Bayhan, Turan; Ünal, Şule; Ünlü, Ozan; Küçüker, Hakan; Tutal, Anıl Doğukan; Karabulut, Erdem; Gümrük, Fatma

    2017-05-01

    Iron chelation therapy is one of the mainstays of the management of the patients with β-thalassemia (BT) major. Deferasirox is an oral active iron chelating agent. Proteinuria is one of the potential renal adverse effects of deferasirox, and monthly follow-up for proteinuria is suggested by Food and Drug Administration and European Medicine Agency. We aimed to investigate the necessity for monthly monitoring for proteinuria among patients with BT on deferasirox. A retrospective laboratory and clinic data review was performed for patients with BT major or intermedia who were treated with deferasirox chelation therapy. All patients were monitored for proteinuria for every 3 or 4 weeks after the initiation of deferasirox with serum creatinine and spot urine protein/creatinine ratios. The median follow-up time of the 37 (36 BT major and one BT intermedia) patients was 44 months. Seven patients (18.9%) developed significant proteinuria (ratio ≥0.8). Of the 1490 measurements, 12 tests (0.8%) were proteinuric. Urine proteinuria resolved in all of the patients during the follow-up. The risk of proteinuria was higher at ages below a cut-off point of 23 years (p = 0.019). Patients, who were on deferasirox at doses above a cut-off dose of 29 mg/kg/day, were found to have higher risk of proteinuria development (p = 0.004). Proteinuria resolves without any complication or major intervention according to our results. Potentially more risky groups (age below 23 years old and receivers above a dose of 29 mg/kg/day) might be suggested to be followed monthly, besides monitoring all of the patients.

  12. Role of XmnIgG Polymorphism in Hydroxyurea Treatment and Fetal Hemoglobin Level at Isfahanian Intermediate β-Thalassemia Patients.

    PubMed

    Motovali-Bashi, Majid; Ghasemi, Tayyebeh

    2015-01-01

    β-thalassemia is the most common monogenic disorder in human. The (C-->T) polymorphism at -158 upstream region of the γG-globin gene and pharmacological factors such as hydroxyurea have been reported to influence γ-globin gene expression and the severity of clinical symptoms of β-thalassemia. In the present study, 51 β-thalassemia intermediate patients were studied. Xmn1γG polymorphism genotype was determined using Tetra-Primer ARMS-PCR technique. Hemoglobin (Hb) and fetal hemoglobin (HbF) levels were determined by gel electrophoresis. Of 51 patients, 35 (68.6%) patients were heterozygous (CT) and 16 (31.4%) patients were homozygous (CC). Of 30 patients under treatment by hydroxyurea, 20 (66.7%) patients were heterozygous (CT) and 10 (33.3%) patients were homozygous (CC). Our results demonstrated that in the heterozygous (CT) genotype, the Hb (9.58 ± 1.25 gm/dl) and HbF (89.30 ± 21.87) levels were significantly higher in comparison with homozygous (CC) genotype (7.94 ± 1.34 gm/dl and 70.32 ± 40.56, respectively). Furthermore, we observed that after drug usage, the Hb and HbF levels in patients with heterozygous (CT) genotype (0.7 ± 1.26 gm/dl and 5.95 ± 14.8, respectively) raised more in comparison with homozygous (CC) genotype (0.26 ± 1.43 gm/dl and 0.8 ± 1.31, respectively). Hb and HbF levels in the patients carrying T allele are increased significantly, and they also response to hydroxyurea treatment.

  13. Thalassemia and Hemoglobin E in Southern Thai Blood Donors

    PubMed Central

    Kruachan, Kwanta; Sengking, Warachaya; Horpet, Dararat; Sungyuan, Ubol

    2014-01-01

    Thalassemia and hemoglobin E (Hb E) are common in Thailand. Individuals with thalassemia trait usually have a normal hemoglobin concentration or mild anemia. Therefore, thalassemic individuals who have minimum acceptable Hb level may be accepted as blood donors. This study was aimed at determining the frequency of α-thalassemia 1 trait, β-thalassemia trait, and Hb E-related syndromes in Southern Thai blood donors. One hundred and sixteen voluntary blood donors, Southern Thailand origin, were recruited for thalassemia and Hb E screening by red blood cell indices/dichlorophenolindophenol precipitation test. β-Thalassemia and Hb E were then identified by high performance liquid chromatography and 4 common α-thalassemia deletions were characterized by a single tube-multiplex gap-polymerase chain reaction. Overall frequency of hemoglobinopathies was 12.9%, classified as follows: homozygous α-thalassemia 2 (1.7%), heterozygous α-thalassemia 1 (1.7%), heterozygous β-thalassemia without α-thalassemia (0.9%), heterozygous Hb E without α-thalassemia (5.2%), double heterozygotes for Hb E/α-thalassemia 1 (1.7%), homozygous Hb E without α-thalassemia (0.9%), and homozygous Hb E with heterozygous α-thalassemia 2 (0.9%). The usefulness of thalassemia screening is not only for receiving highly effective red blood cells in the recipients but also for encouraging the control and prevention program of thalassemia in blood donors. PMID:25050123

  14. New concept in natural history and management of diabetes mellitus in thalassemia major.

    PubMed

    Chatterjee, Ratna; Bajoria, Rekha

    2009-01-01

    Diabetes Mellitus is a major endocrinopathy, which occurs due transfusional haemosiderosis and is found in 20-30% of adult patients with beta-thalassaemia worldwide, accounting for significant morbidity. It is multifactorial with iron loading being the dominant cause and its management poses a clinical challenge. Diabetes in thalassaemia patients is distinct from type 2 diabetes. It is peculiar in many aspects including its pathophysiology and occurs due to insulin resistance as well as islet cell insufficiency. This article reviews the natural history of diabetes in this presentation with emphasis on prevention monitoring and management. Use of MRI techniques may be useful for future monitoring as well as biochemical monitoring to prevent complications of diabetes. Early intervention with intensified chelation may reverse pancreatic function and structural changes as evident from MRI.

  15. Thalassemia treatment and prevention in Uva Province, Sri Lanka: a public opinion survey.

    PubMed

    Mudiyanse, Rasnayaka M

    2006-01-01

    Due to its excessive cost thalassemia management is a major health care problem in Sri Lanka. The majority of doctors are using only desferrioxamine (DFO), in grossly inadequate doses mainly because of its unavailability. Deferiprone (L1), which is more affordable, is not used due to fear of toxicity, as previously reported. Arthropathy attributed to L1 has been observed in some patients, and has led to the discontinuation of the drug in all patients, without scientific rationale. The proposed thalassemia prevention project for Uva Province is based on prevention of marriages between carriers. This could be achieved by carrier screening and counseling of teenagers and adolescents well before they select their partners. In Sri Lanka, people find their marriage partners at their work place or universities, by themselves, or with the help of professional marriage brokers (they are called Kapuwa), through relatives and close friends. This process of finding a partner may also be helped by paper advertisements. However, in addition to the appearance and attitude of the prospective partner, the caste, social background and horoscope are major considerations in selecting a partner. Even when they select partners on their own at the work place or university, they keep these factors in the back of their minds to ensure social acceptance. Many relationships are given up due to objections and advice from parents when the caste or social background does not match. A horoscope is a written document that almost every child gets, written by a professional horoscope reader and depending on the time of birth. It is believed, according to the horoscope, that a person's attitudes, desires, future prospects of finding a suitable partner, could be predicted. It is rare to proceed with a marriage if the horoscope does not match. These customs are considered less seriously among educated people when they find their partner at the work place or university. The concept of thalassemia risk

  16. Iron homeostasis during transfusional iron overload in beta-thalassemia and sickle cell disease: changes in iron regulatory protein, hepcidin, and ferritin expression.

    PubMed

    Jenkins, Zandra A; Hagar, Ward; Bowlus, Christopher L; Johansson, Hans E; Harmatz, Paul; Vichinsky, Elliott P; Theil, Elizabeth C

    2007-06-01

    Hypertransfusional (>8 transfusions/year) iron in liver biopsies collected immediately after transfusions in beta-thalassemia and sickle cell disease correlated with increased expression (RNA) for iron regulatory proteins 1 and 2 (3-, 9- to 11-fold) and hepcidin RNA: (5- to 8-fold) (each p <.01), while ferritin H and L RNA remained constant. A different H:L ferritin ratio in RNA (0.03) and protein (0.2-0.6) indicated disease-specific trends and suggests novel post-transcriptional effects. Increased iron regulatory proteins could stabilize the transferrin receptor mRNA and, thereby, iron uptake. Increased hepcidin, after correction of anemia by transfusion, likely reflects excess liver iron. Finally, the absence of a detectable change in ferritin mRNA indicates insufficient oxidative stress to significantly activate MARE/ARE promoters.

  17. Complications of Transfusion-Dependent β-Thalassemia Patients in Sistan and Baluchistan, South-East of Iran

    PubMed Central

    Yaghobi, Maryam; Miri-Moghaddam, Ebrahim; Majid, Naderi; Bazi, Ali; Navidian, Ali; Kalkali, Asiyeh

    2017-01-01

    Background: Thalassemia syndromes are among prevalent hereditary disorders imposing high expenses on health-care system worldwide and in Iran. Organ failure represents a life-threatening challenge in transfusion- dependent β-thalassemia (TDT) patients. The purpose of the present study was to determine the frequency of organ dysfunctions among TDT patients in Sistan and Baluchistan province in South-East of Iran. Materials and Methods: Laboratory and clinical data were extracted from medical records as well as by interviews. Standard criteria were applied to recognize cardiac, gonadal, endocrine and renal dysfunctions. The collected data were analyzed using the SPSS statistics software (Ver.19). Results: A total of 613 TDT patients (54.3% males and 45.7% females) were included in this study. The mean age of patients was 13.3 ±7.7 years old. Cardiac events comprised the most encountered complications (76.4%), following by hypogonadism (46.8%), parathyroid dysfunction (22%), thyroid abnormalities (8.3%), diabetes (7.8%) and renal disease (1.8%). Hypogonadism comprised the most identified complication in patient <15 years old, while the cardiac complications were the most frequent sequela in patients >15 years old (P<0.01). Conclusion: As cardiac events are significantly more common among TDT patients, close monitoring of the heart function is recommended for identifying patients with cardiac problems. PMID:29340121

  18. Clinical utility of endocrine markers predicting myocardial siderosis in transfusion dependent thalassemia major.

    PubMed

    Ehsan, Lubaina; Rashid, Mariam; Alvi, Najveen; Awais, Khadija; Nadeem, Omair; Asghar, Aleezay; Sajjad, Fatimah; Fatima, Malika; Qidwai, Asim; Hussain, Shabneez; Hasan, Erum; Brown, Nick; Altaf, Sadaf; Hasan, Babar; Kirmani, Salman

    2018-06-12

    Endocrinopathy due to iron overload is the most common morbidity whereas myocardial siderosis causing toxic cardiomyopathy is the leading cause of mortality among patients with transfusion dependent thalassemia major (TDTM). If detected early, this can be treated with aggressive chelation. T2* cardiac magnetic resonance imaging (CMR) guided chelation protocols are now the gold standard but have limited availability in low and middle-income countries. We hypothesized that markers of endocrine dysfunction would correlate with T2* CMR and can be used to predict the severity of myocardial siderosis and guide chelation therapy. We undertook a multicenter retrospective study of 280 patients with TDTM to assess the prevalence of endocrinopathies and the predictive value of a number of individual and composite markers of endocrinopathy with T2* CMR. The prevalence of hypogonadism, stunting, hypoparathyroidism, and hypothyroidism was 82%, 69%, 40%, and 30%, respectively. The sensitivity of hypogonadism and stunting predicting severe myocardial siderosis was 90% and 80%, respectively. We conclude that clinical markers of endocrine dysfunction, especially hypogonadism (positive likelihood ratio [LR+] = 1.4, 95% confidence interval [CI] = 1.0-1.9; positive predictive value [PPV] = 77%, 95% CI = 70-82; negative predictive value [NPV] = 57%, 95% CI = 34-77] and stunting (LR+ = 1.3, 95% CI = 1.1-1.6; PPV = 64%, 95% CI = 60-69; NPV = 55%, 95% CI = 45-64) in TDTM can predict severe myocardial siderosis and can potentially guide chelation therapy, especially where access to T2* CMR is limited. © 2018 Wiley Periodicals, Inc.

  19. Characterization of iron metabolism and erythropoiesis in erythrocyte membrane defects and thalassemia traits.

    PubMed

    Sulovska, Lucie; Holub, Dusan; Zidova, Zuzana; Divoka, Martina; Hajduch, Marian; Mihal, Vladimir; Vrbkova, Jana; Horvathova, Monika; Pospisilova, Dagmar

    2016-06-01

    Erythropoiesis is closely related to iron metabolism in a balanced homeostasis. Analyses of diverse erythroid and iron metabolism disorders have shown that disrupted erythropoiesis negatively affects iron homeostasis and vice versa. The aim of this study was to characterize the relationship between erythropoietic activity and iron homeostasis in pediatric patients with erythrocyte membrane defects and thalassemia traits. Selected markers of erythropoietic activity (erythropoietin, soluble transferrin receptor - sTfR and growth differentiation factor 15) and iron status parameters (serum iron, ferritin and hepcidin) were evaluated in pediatric patients with erythrocyte membrane defects and thalassemia traits. The patients with erythrocyte membrane defects and thalassemia traits had altered iron homeostasis due to disturbed erythropoiesis. In comparison with healthy controls, they had a normal to low hepcidin/ferritin ratio and concomitantly elevated sTfR. The findings suggest that pediatric patients with erythrocyte membrane defects and thalassemia traits are more susceptible to iron overload than the general population and that the (hepcidin/ferritin)/sTfR ratio can be used to monitor any worsening of the disease.

  20. Impact of educational programme regarding chelation therapy on the quality of life for B-thalassemia major children.

    PubMed

    Abu Samra, Omayma; Auda, Wafaa; Kamhawy, Heba; Al-Tonbary, Youssef

    2015-06-01

    Objectives Thalassemia is the most common genetic disorder in Egypt, with an estimated carrier rate of 9-10%. It is a genetic blood disorder which can be fatal if proper chelation is not received. The introduction of chelating agents capable of removing excessive iron from the body has dramatically increased life expectancy and improved the overall quality of life. The aim of this study was to assess the impact of educational programmes regarding chelation therapy on the quality of life of thalassemic children. Methods The study was carried out at the Mansoura University Children's Hospital in the period between March 2010 and May 2011. It included 173 B-thalassemia children (84 boys and 89 girls) with age ranging between 8-18 years. The researcher used a predesigned interviewing questionnaire to collect data regarding children's knowledge about thalassemia and its management, especially regarding chelation therapy. The paediatric quality-of-life inventory tool (Peds QL 4.0 generic core) was also used to assess the studied children's quality of life. Results There was a significant statistical difference of the studied children's knowledge regarding chelation therapy and their quality of life. Conclusion There was a positive effect of the educational programme in improving children's knowledge score and their quality of life. Application of educational programmes for thalassemic children and their nurses regarding chelation therapy and its importance in preventing thalassemia complications is established.

  1. Hydroxyurea responses in clinically varied beta, HbE-beta thalassaemia and sickle cell anaemia patients of Eastern India.

    PubMed

    Chatterjee, Tridip; Chakravarty, Amit; Chakravarty, Sudipa

    2018-05-01

    The haematological and clinical response to hydroxyurea was estimated in HbE-beta, beta thalassaemia and sickle cell anaemia patients of Eastern India, with variable clinical severity and transfusion requirement to determine whether hydroxyurea can help these patients to maintain their steady haemoglobin level without blood transfusions. Three hundred patients (189 HbE-beta thalassaemia, 95 beta thalassaemia and 16 other haemoglobinopathies including sickle cell anaemia) were selected for hydroxyurea therapy and were followed up for 48-60 months. Results suggest significant response to hydroxyurea therapy in 19 beta and 99 HbE-beta patients in the transfusion-dependent group (GR-I). All of them became transfusion-independent while on hydroxyurea therapy. The majority of responding patients were IVS1-5(G-C) in one of their alleles in HbE-beta cases (83 out of 119). Though IVS1-5(G-C) was found to be the commonest mutation in our selected patients, the mutational background of the patients does not found to have any significant correlation with the response category towards hydroxyurea as per the results observed in our study. But, the drug works pretty well in most of the transfusion-dependent patients, as these patients were withdrawn from regular blood transfusion. At the same time, partial or no response to the drug hydroxyurea was also recorded in our study.

  2. Patient Involvement as Experts in the Development and Assessment of a Smartphone App as a Patient Education Tool for the Management of Thalassemia and Iron Overload Syndromes.

    PubMed

    Ward, Richard; Taha, Karim M

    2016-09-01

    Our aim was to develop and assess the feasibility of an education tool to improve health outcomes of patients with thalassemia. Thirty-five patients attending a Canadian thalassemia clinic were enrolled. Acting in an expert role, they participated in a Delphi method to reach consensus as to what tools and information should be incorporated in the development of a self management Smartphone app. One- and 6-month usability and health impact feedback surveys were built-in. Sixty percent of responders were 18-34 years old, over 50.0% had a college degree. The Delphi method successfully generated a comprehensive list of features important to patients. The app has been downloaded 147 times globally. Between March 2015 and January 2016, 19 responses for the 1-month survey were collected and the trends described. Responders reported improved medication adherence. The personal adherence pledge feature supports gamification of health apps to individualize goals of therapy. The impact of tracking iron levels was highly favorable. The Delphi method was an effective way to introduce a patient education and empowerment tool to the thalassemia population. The long-term impact requires data maturation. Use of validated methodology is essential to ensure ehealth interventions are positively contributing to patient education and disease outcomes.

  3. Assessment of left ventricular functions and myocardial iron load with tissue Doppler and speckle tracking echocardiography and T2* MRI in patients with β-thalassemia major.

    PubMed

    Ari, Mehmet Emre; Ekici, Filiz; Çetin, İbrahim İlker; Tavil, Emine Betül; Yaralı, Neşe; Işık, Pamir; Hazırolan, Tuncay; Tunç, Bahattin

    2017-03-01

    The purpose of this study is to determine early myocardial dysfunction in β-thalassemia major (BTM) patients. Where the myocardial dysfunction cannot be detected by conventional echocardiography, it could be detected by tissue Doppler imaging (TDI) or speckle tracking echocardiography (STE). In this study, we analyzed 60 individuals, 30 of whom were BTM patients and the other 30 of whom were the control group. T2* magnetic resonance imaging (MRI) was used to measure cardiac iron deposition. The myocardial functions were evaluated by conventional echocardiography, TDI and STE. When basal lateral left ventricular and basal septal wall TDI values were compared between the patient group and control group, only isovolumic contraction time values were significantly longer in the patients. The global circumferential strain was significantly lower in the patients. When evaluated as segmental, longitudinal strain values of basal inferoseptum and circumferential strain values of anteroseptum, anterior, and inferolateral segments were significantly lower in the patients. In the patients, global longitudinal and circumferential strains in the group who had pathological T2* values were significantly lower than the group who did not. In addition, circumferential strain values in anteroseptum, anterolateral, inferior, and inferoseptum segments were significantly lower in the patients with T2* values<20 ms than those with T2* values≥20 ms. Although T2* MRI is the most sensitive test detecting myocardial iron load, TDI and STE can be used for screening myocardial dysfunction. The abnormal strain values, especially circumferential, may be detected as the first finding of abnormal iron load and related to T2* values. © 2017, Wiley Periodicals, Inc.

  4. Genetic correction of β-thalassemia patient-specific iPS cells and its use in improving hemoglobin production in irradiated SCID mice.

    PubMed

    Wang, Yixuan; Zheng, Chen-Guang; Jiang, Yonghua; Zhang, Jiqin; Chen, Jiayu; Yao, Chao; Zhao, Qingguo; Liu, Sheng; Chen, Ke; Du, Juan; Yang, Ze; Gao, Shaorong

    2012-04-01

    The generation of induced pluripotent stem cells (iPSCs) from differentiated somatic cells by over-expression of several transcription factors has the potential to cure many genetic and degenerative diseases currently recalcitrant to traditional clinical approaches. One such genetic disease is β-thalassemia major (Cooley's anemia). This disease is caused by either a point mutation or the deletion of several nucleotides in the β-globin gene, and it threatens the lives of millions of people in China. In the present study, we successfully generated iPSCs from fibroblasts collected from a 2-year-old patient who was diagnosed with a homozygous 41/42 deletion in his β-globin gene. More importantly, we successfully corrected this genetic mutation in the β-thalassemia iPSCs by homologous recombination. Furthermore, transplantation of the genetically corrected iPSCs-derived hematopoietic progenitors into sub-lethally irradiated immune deficient SCID mice showed improved hemoglobin production compared with the uncorrected iPSCs. Moreover, the generation of human β-globin could be detected in the mice transplanted with corrected iPSCs-derived hematopietic progenitors. Our study provides strong evidence that iPSCs generated from a patient with a genetic disease can be corrected by homologous recombination and that the corrected iPSCs have potential clinical uses.

  5. Hematopoietic stem cell transplantation in thalassemia major and sickle cell disease: indications and management recommendations from an international expert panel

    PubMed Central

    Angelucci, Emanuele; Matthes-Martin, Susanne; Baronciani, Donatella; Bernaudin, Françoise; Bonanomi, Sonia; Cappellini, Maria Domenica; Dalle, Jean-Hugues; Di Bartolomeo, Paolo; de Heredia, Cristina Díaz; Dickerhoff, Roswitha; Giardini, Claudio; Gluckman, Eliane; Hussein, Ayad Achmed; Kamani, Naynesh; Minkov, Milen; Locatelli, Franco; Rocha, Vanderson; Sedlacek, Petr; Smiers, Frans; Thuret, Isabelle; Yaniv, Isaac; Cavazzana, Marina; Peters, Christina

    2014-01-01

    Thalassemia major and sickle cell disease are the two most widely disseminated hereditary hemoglobinopathies in the world. The outlook for affected individuals has improved in recent years due to advances in medical management in the prevention and treatment of complications. However, hematopoietic stem cell transplantation is still the only available curative option. The use of hematopoietic stem cell transplantation has been increasing, and outcomes today have substantially improved compared with the past three decades. Current experience world-wide is that more than 90% of patients now survive hematopoietic stem cell transplantation and disease-free survival is around 80%. However, only a few controlled trials have been reported, and decisions on patient selection for hematopoietic stem cell transplantation and transplant management remain principally dependent on data from retrospective analyses and on the clinical experience of the transplant centers. This consensus document from the European Blood and Marrow Transplantation Inborn Error Working Party and the Paediatric Diseases Working Party aims to report new data and provide consensus-based recommendations on indications for hematopoietic stem cell transplantation and transplant management. PMID:24790059

  6. Mithramycin encapsulated in polymeric micelles by microfluidic technology as novel therapeutic protocol for beta-thalassemia

    PubMed Central

    Capretto, Lorenzo; Mazzitelli, Stefania; Brognara, Eleonora; Lampronti, Ilaria; Carugo, Dario; Hill, Martyn; Zhang, Xunli; Gambari, Roberto; Nastruzzi, Claudio

    2012-01-01

    This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH), based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF) accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of β-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying β-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol for β-thalassemia. PMID:22287841

  7. Hb L'Aquila [beta106(G8)Leu-->Val, CTG-->GTG]: a novel thalassemic hemoglobin variant.

    PubMed

    Amato, Antonio; Cappabianca, Maria Pia; Ponzini, Donatella; Rinaldi, Silvana; Biagio, Paola Di; Foglietta, Enrica; Grisanti, Paola; Mastropietro, Fabrizio

    2007-01-01

    A new beta-globin variant at codon 106 (CTG-->GTG), and which we named Hb L'Aquila [beta106(G8)Leu-->Val], was detected by DNA analysis. The proband and her father presented with the features of a mild beta(+)-thalassemia (thal), confirmed by their alpha/beta-globin chain biosynthesis ratios.

  8. Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

    PubMed

    Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

    2015-07-01

    The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

  9. The Molecular Basis of β-Thalassemia

    PubMed Central

    Thein, Swee Lay

    2013-01-01

    The β-thalassemias are characterized by a quantitative deficiency of β-globin chains underlaid by a striking heterogeneity of molecular defects. Although most of the molecular lesions involve the structural β gene directly, some down-regulate the gene through distal cis effects, and rare trans-acting mutations have also been identified. Most β-thalassemias are inherited in a Mendelian recessive fashion but there is a subgroup of β-thalassemia alleles that behave as dominant negatives. Unraveling the molecular basis of β-thalassemia has provided a paradigm for understanding of much of human genetics. PMID:23637309

  10. Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.

    PubMed

    Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca

    2015-01-01

    β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.

  11. A new tool for the assessment of satisfaction with iron chelation therapy (ICT-Sat) for patients with β-thalassemia major.

    PubMed

    Elalfy, Mohsen S; Massoud, Walid; Elsherif, Nayera H; Labib, Jonair H; Elalfy, Omar M; Elaasar, Safaa; von Mackensen, Sylvia

    2012-06-01

    High satisfaction with iron chelation is a major determinant for adherence to ICT in beta-thalassaemia major (β-TM) patients. In this study, a new tool to assess different domains of satisfaction for available forms of ICT was developed and validated. The impact of patients' satisfaction with ICT has been tested. Items were generated via focus groups and a preliminary version with 24 items (ICT-Sat) with an additional item for treatment preference and a knowledge questionnaire (KQ) was developed. 170 β-TM patients from three Thalassaemia centers in Egypt, aged 2-32 years received three questionnaires to fill in; the new ICT-Sat, a KQ, and a previously validated tool for satisfaction with ICT (SICT) and retested 4-6 weeks later to ensure re-test reliability. Type of chelation, drug related adverse events, compliance with ICT, and serum ferritin level (SF) during the year prior to the study as well as available cardiac T2*data were recorded. One hundred and fifty two β-TM patients completed all questionnaires; median age was 12 years. The final 15 remaining ICT-Sat items, yielding to four domain scores, explained 70.6% of the total variance. The "perceived effectiveness" and "fear and worries" domains of the ICT-Sat correlated significantly with the domains "perceived effectiveness" and "acceptance" of the SICT. Patients treated with oral ICT were more satisfied with perceived effectiveness, and their side effects. A new clinically based ICT-Sat tool was developed and revealed good psychometric characteristics. Adherence to ICT was better correlated with "perceived effectiveness" and SF level. Copyright © 2012 Wiley Periodicals, Inc.

  12. Frequency of Red Cell Alloimmunization and Autoimmunization in Thalassemia Patients: A Report from Eastern India.

    PubMed

    Datta, Suvro Sankha; Mukherjee, Somnath; Talukder, Biplabendu; Bhattacharya, Prasun; Mukherjee, Krishnendu

    2015-01-01

    Introduction. Red blood cell (RBC) alloimmunization and autoimmunization remain a major problem in transfusion dependent thalassemic patients. There is a paucity of data on the incidence of RBC alloimmunization and autoimmunization in thalassemic patients from eastern part of India, as pretransfusion antibody screening is not routinely performed. Aims. To assess the incidence of RBC alloimmunization and autoimmunization in transfusion dependent thalassemic patients in eastern India. Materials and Methods. Total 500 thalassemia cases were evaluated. The antibody screening and identification were performed with commercially available panel cells (Diapanel, Bio-rad, Switzerland) by column agglutination method. To detect autoantibodies, autocontrol and direct antiglobulin tests were carried out using polyspecific coombs (IgG + C3d) gel cards in all patients. Results. A total of 28 patients developed RBC alloimmunization (5.6%) and 5 patients had autoantibodies (1%). Alloantibody against c had the highest incidence (28.57%) followed by E (21.42%). Five out of 28 (17.85%) patients had developed antibodies against both c and E. Conclusion. Data from this study demonstrate that the RBC alloantibody and autoantibody development rates are significant in our region. Thus, pretransfusion antibody screening needs to be initiated in eastern India in order to ensure safe transfusion practice.

  13. Frequency of Red Cell Alloimmunization and Autoimmunization in Thalassemia Patients: A Report from Eastern India

    PubMed Central

    Datta, Suvro Sankha; Talukder, Biplabendu; Bhattacharya, Prasun; Mukherjee, Krishnendu

    2015-01-01

    Introduction. Red blood cell (RBC) alloimmunization and autoimmunization remain a major problem in transfusion dependent thalassemic patients. There is a paucity of data on the incidence of RBC alloimmunization and autoimmunization in thalassemic patients from eastern part of India, as pretransfusion antibody screening is not routinely performed. Aims. To assess the incidence of RBC alloimmunization and autoimmunization in transfusion dependent thalassemic patients in eastern India. Materials and Methods. Total 500 thalassemia cases were evaluated. The antibody screening and identification were performed with commercially available panel cells (Diapanel, Bio-rad, Switzerland) by column agglutination method. To detect autoantibodies, autocontrol and direct antiglobulin tests were carried out using polyspecific coombs (IgG + C3d) gel cards in all patients. Results. A total of 28 patients developed RBC alloimmunization (5.6%) and 5 patients had autoantibodies (1%). Alloantibody against c had the highest incidence (28.57%) followed by E (21.42%). Five out of 28 (17.85%) patients had developed antibodies against both c and E. Conclusion. Data from this study demonstrate that the RBC alloantibody and autoantibody development rates are significant in our region. Thus, pretransfusion antibody screening needs to be initiated in eastern India in order to ensure safe transfusion practice. PMID:26425124

  14. Plasma microRNA-451 as a novel hemolytic marker for β0-thalassemia/HbE disease

    PubMed Central

    Leecharoenkiat, Kamonlak; Tanaka, Yuka; Harada, Yasuko; Chaichompoo, Porntip; Sarakul, Orawan; Abe, Yasunobu; Smith, Duncan Richard; Fucharoen, Suthat; Svasti, Saovaros; Umemura, Tsukuru

    2017-01-01

    In Southeast Asia, particularly in Thailand, β0-thalassemia/hemoglobin E (HbE) disease is a common hereditary hematological disease. It is associated with pathophysiological processes, such as the intramedullary destruction of immature erythroid cells and peripheral hemolysis of mature red blood cells. MicroRNA (miR) sequences, which are short non-coding RNA that regulate gene expression in a suppressive manner, serve a crucial role in human erythropoiesis. In the present study, the plasma levels of the erythroid-expressed miRNAs, miR-451 and miR-155, were analyzed in 23 patients with β0-thalassemia/HbE and 16 control subjects. Reverse transcription-quantitative polymerase chain reaction analysis revealed significantly higher levels of plasma miR-451 and miR-155 in β0-thalassemia/HbE patients when compared to the control subjects. Notably, among the β0-thalassemia/HbE patients, a significant increase in miR-451 levels was detected in severe cases when compared with mild cases. The levels of plasma miR-451 correlated with reticulocyte and platelet counts. The results suggest that increased plasma miR-451 levels may be associated with the degree of hemolysis and accelerated erythropoiesis in β0-thalassemia/HbE patients. In conclusion, miR-451 may represent a relevant biomarker for pathological erythropoiesis associated with β0-thalassemia/HbE. PMID:28447765

  15. The effect of some medical treatments of thalassemia on the red blood cells

    NASA Astrophysics Data System (ADS)

    Zhang, Xiufang; Shen, Linming; Bao, Hongxia; Din, Xiaolan; Wang, Rongxin; Liu, Yuanyuan; Gao, Naifei; Huang, Youwen

    1992-04-01

    The Mössbauer spectroscopy (MS) and circular dichroism (CD) measurements have been used to investigate the effect of some medical treatments on the red blood cells (RBCs) of the patients with HbH discase and β-thalassemia (Thal.) major, respectively. The results indicate that both splenectomy and treatment with myleran are effective to alleviate the symptoms of anemia for some patients, but both of them are different in the effect on the RBCs of the patients. On the basis of the results, a hypothesis on the course of denaturation in hemoglobin (Hb) of the patients is proposed.

  16. Hepcidin suppression in β-thalassemia is associated with the down-regulation of atonal homolog 8.

    PubMed

    Upanan, Supranee; McKie, Andrew T; Latunde-Dada, Gladys O; Roytrakul, Sittiruk; Uthaipibull, Chairat; Pothacharoen, Peraphan; Kongtawelert, Prachya; Fucharoen, Suthat; Srichairatanakool, Somdet

    2017-08-01

    Atonal homolog 8 (ATOH8) is defined as a positive regulator of hepcidin transcription, which links erythropoietic activity with iron-sensing molecules. In the present study, we investigated the association between hepcidin and ATOH8 expression in β-thalassemia. We found that inhibition of hepcidin expression in β-thalassemia is correlated with reduced ATOH8 expression. Hepatic hepcidin 1 (Hamp1) and Atoh8 mRNA expression were down-regulated in β-thalassemic mice. Hepcidin (HAMP) and ATOH8 mRNA expression were consistently suppressed in Huh7 cells cultured in medium supplemented with β-thalassemia patient serum. The Huh7 cells, which were transfected with ATOH8-FLAG expression plasmid and cultured in the supplemented medium, exhibited increased levels of ATOH8 mRNA, ATOH8-FLAG protein, pSMAD1,5,8, and HAMP mRNA. Interestingly, over-expression of ATOH8 reversed the effects of hepcidin suppression induced by the β-thalassemia patient sera. In conclusion, hepcidin suppression in β-thalassemia is associated with the down-regulation of ATOH8 in response to anemia. We, therefore, suggest that ATOH8 is an important transcriptional regulator of hepcidin in β-thalassemia.

  17. Health-Related Quality of Life, Treatment Satisfaction, Adherence and Persistence in β-Thalassemia and Myelodysplastic Syndrome Patients with Iron Overload Receiving Deferasirox: Results from the EPIC Clinical Trial

    PubMed Central

    Porter, John; Bowden, Donald K.; Economou, Marina; Troncy, Jacques; Ganser, Arnold; Habr, Dany; Martin, Nicolas; Gater, Adam; Rofail, Diana; Abetz-Webb, Linda; Lau, Helen; Cappellini, Maria Domenica

    2012-01-01

    Treatment of iron overload using deferoxamine (DFO) is associated with significant deficits in patients' health-related quality of life (HRQOL) and low treatment satisfaction. The current article presents patient-reported HRQOL, satisfaction, adherence, and persistence data from β-thalassemia (n = 274) and myelodysplastic syndrome (MDS) patients (n = 168) patients participating in the Evaluation of Patients' Iron Chelation with Exjade (EPIC) study (NCT00171821); a large-scale 1-year, phase IIIb study investigating the efficacy and safety of the once-daily oral iron chelator, deferasirox. HRQOL and satisfaction, adherence, and persistence to iron chelation therapy (ICT) data were collected at baseline and end of study using the Medical Outcomes Short-Form 36-item Health Survey (SF-36v2) and the Satisfaction with ICT Questionnaire (SICT). Compared to age-matched norms, β-thalassemia and MDS patients reported lower SF-36 domain scores at baseline. Low levels of treatment satisfaction, adherence, and persistence were also observed. HRQOL improved following treatment with deferasirox, particularly among β-thalassemia patients. Furthermore, patients reported high levels of satisfaction with deferasirox at end of study and greater ICT adherence, and persistence. Findings suggest deferasirox improves HRQOL, treatment satisfaction, adherence, and persistence with ICT in β-thalassemia and MDS patients. Improving such outcomes is an important long-term goal for patients with iron overload. PMID:22924125

  18. Beta-blocking agents in patients with insulin resistance: effects of vasodilating beta-blockers.

    PubMed

    Jacob, S; Balletshofer, B; Henriksen, E J; Volk, A; Mehnert, B; Löblein, K; Häring, H U; Rett, K

    1999-01-01

    Essential hypertension is--at least in many subjects--associated with a decrease in insulin sensitivity, while glycaemic control is (still) normal. It seems that in hypertensive patients, two major functions of insulin are impaired: there is insulin resistance of peripheral glucose uptake (primarily skeletal muscle) and insulin resistance of insulin-stimulated vasodilation. In view of some retrospective data and meta-analyses, which showed a less than expected reduction in coronary events (coronary paradox), the metabolic side effects of the antihypertensive treatment have received more attention. Many groups have shown that conventional antihypertensive treatment, both with beta-blockers and/or diuretics, decreases insulin sensitivity by various mechanisms. While low-dose diuretics seem to be free of these metabolic effects, there is no evidence for this in the beta-adrenergic blockers. However, recent metabolic studies evaluated the effects of vasodilating beta-blockers, such as dilevalol, carvedilol and celiprolol, on insulin sensitivity and the atherogenic risk factors. None of them decreased insulin sensitivity, as has been described for the beta-blockers with and without beta1 selectivity. This supports the idea that peripheral vascular resistance and peripheral blood flow play a central role in mediating the metabolic side effects of the beta-blocking agents, as the vasodilating action (either via beta2 stimulation or alpha1-blockade) seems to more than offset the detrimental effects of the blockade of beta (or beta1) receptors. Further studies are needed to elucidate the relevance of the radical scavenging properties of these agents and their connection to their metabolic effects. Therefore, the beneficial characteristics of these newer beta-adrenoreceptor blockers suggest that the vasodilating beta-blocking agents could be advantageous for hypertensive patients with insulin resistance or type 2 diabetes.

  19. Neurotic manifestations in adolescents with thalassemia major.

    PubMed

    Moorjani, J D; Issac, Chithira

    2006-07-01

    To study the neurotic manifestations in thalassemic adolescents as a consequence of long-term illness. From July 2003, thirty six thalassemic adolescents and forty normal adolescents were selected with age ranging from 13 to 18 and with same socio economic status and family background. Middlesex Hospital Questionnaire by Crown and Crisp [1966] was administered and Mann Whiteny 'U' test was employed to measure free-floating anxiety, phobia, somatic anxiety, obsession, depression, hysteria and total neuroticism score. An interview was conducted along with the questionnaire to detect the problems in depth. Parents of thalassemic adolescents were interviewed subsequently to realize the behavioral problems existing along with neuroticism. Thirty-six of thalassemic and all forty normal adolescents returned the questionnaires. The responses suggest a marked difference in total neuroticism score and all other variables except that of hysteria. The interview on parents of thalassemic adolescents exposed various behavioral problems in these adolescents. Thalassemic adolescents were having higher scores in neuroticism. Some behavioral problems are also found to exist along with neurotic manifestations. There remains a need to improve the management of thalassemia in terms of psychological aspects in order to improve the mental health of this group.

  20. Role of vitamin C as an adjuvant therapy to different iron chelators in young β-thalassemia major patients: efficacy and safety in relation to tissue iron overload.

    PubMed

    Elalfy, Mohsen S; Saber, Maha M; Adly, Amira Abdel Moneam; Ismail, Eman A; Tarif, Mohamed; Ibrahim, Fatma; Elalfy, Omar M

    2016-03-01

    Vitamin C, as antioxidant, increases the efficacy of deferoxamine (DFO). To investigate the effects of vitamin C as an adjuvant therapy to the three used iron chelators in moderately iron-overloaded young vitamin C-deficient patients with β-thalassemia major (β-TM) in relation to tissue iron overload. This randomized prospective trial that included 180 β-TM vitamin C-deficient patients were equally divided into three groups (n = 60) and received DFO, deferiprone (DFP), and deferasirox (DFX). Patients in each group were further randomized either to receive vitamin C supplementation (100 mg daily) or not (n = 30). All patients received vitamin C (group A) or no vitamin C (group B) were followed up for 1 yr with assessment of transfusion index, hemoglobin, iron profile, liver iron concentration (LIC) and cardiac magnetic resonance imaging (MRI) T2*. Baseline vitamin C was negatively correlated with transfusion index, serum ferritin (SF), and LIC. After vitamin C therapy, transfusion index, serum iron, SF, transferrin saturation (Tsat), and LIC were significantly decreased in group A patients, while hemoglobin and cardiac MRI T2* were elevated compared with baseline levels or those in group B without vitamin C. The same improvement was found among DFO-treated patients post-vitamin C compared with baseline data. DFO-treated patients had the highest hemoglobin with the lowest iron, SF, and Tsat compared with DFP or DFX subgroups. Vitamin C as an adjuvant therapy possibly potentiates the efficacy of DFO more than DFP and DFX in reducing iron burden in the moderately iron-overloaded vitamin C-deficient patients with β-TM, with no adverse events. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Beta-blocker use is associated with improved outcomes in adult trauma patients.

    PubMed

    Arbabi, Saman; Campion, Eric M; Hemmila, Mark R; Barker, Melissa; Dimo, Mary; Ahrns, Karla S; Niederbichler, Andreas D; Ipaktchi, Kyros; Wahl, Wendy L

    2007-01-01

    Beta-adrenoreceptor blocker (beta-blocker) therapy may improve outcomes in surgical patients by decreasing cardiac oxygen consumption and hypermetabolism. Because beta-blockers can lower the systemic blood pressure and cerebral perfusion pressure, there is concern regarding their use in patients with head injury. However, beta-blockers may protect beta-receptor rich brain cells by attenuating cerebral oxygen consumption and metabolism. We hypothesized that beta-blockers are safe in trauma patients, even if they have suffered a significant head injury. Using pharmacy and trauma registry data of a Level I trauma center, we identified a cohort of trauma patients who received beta-blockers during their hospital stay (beta-cohort). Trauma admissions who did not receive beta-blockers were in the control cohort. beta-blocker status, in combination with other variables associated with mortality, were placed in a stepwise multivariate logistic regression to identify independent predictors of fatal outcome. In all, 303 (7%) of 4,117 trauma patients received beta-blockers. In the beta-cohort, 45% of patients were on beta-blockers preinjury. The most common reason to initiate beta-blocker therapy was blood pressure (60%) and heart rate (20%) control. The overall mortality rate was 5.6% and head injury was considered to be the major cause of death. After adjusting for age, Injury Severity Scale score, blood pressure, Glasgow Coma Scale score, respiratory status, and mechanism of injury, the odds ratio for fatal outcome was 0.3 (p < 0.001) for beta-cohort as compared with control. Decreased risk of fatal outcome was more pronounced in patients with a significant head injury. beta-blocker therapy is safe and may be beneficial in selected trauma patients with or without head injury. Further studies looking at beta-blocker therapy in trauma patients and their effect on cerebral metabolism are warranted.

  2. Association of erythrocyte deformability with red blood cell distribution width in metabolic diseases and thalassemia trait.

    PubMed

    Vayá, Amparo; Alis, Rafael; Suescún, Marta; Rivera, Leonor; Murado, Julian; Romagnoli, Marco; Solá, Eva; Hernandez-Mijares, Antonio

    2015-01-01

    Increased red blood distribution width (RDW) in anemia is related to disturbances in the cellular surface/volume ratio, usually accompanied by morphological alterations, while it has been shown in inflammatory diseases that the activity of pro-inflammatory cytokines disturbing erythropoiesis increases RDW. Recently it has been reported that higher RDW is related with decreased erythrocyte deformability, and that it could be related with the association of RDW and increased risk of cardiovascular diseases. In order to analyze the influence of morphological alterations and proinflammatory status on the relationship between RDW and erythrocyte deformability, we analyzed erythrocyte deformability along with RDW and other hematological and biochemical parameters in 36 α-thalassemia, 20 β-thalassemia, 20 δβ-thalassemia trait carriers, 61 metabolic syndrome patients and 76 morbidly obese patients. RDW correlated inversely with erythrocyte deformability in minor β-thalassemia (r =-0.530, p <  0.05), and directly in both metabolic syndrome and morbidly obese patients (ρ= 0.270, p <  0.05 and ρ= 0.258, p <  0.05, respectively). Minor β-thalassemia is often accompanied by more marked cell-shaped perturbations than other thalassemia traits. This could be the reason for this negative association only in this setting. Higher anisocytosis seems to be associated with greater morphologic alterations (shape/volume), which reduce erythrocyte deformability. The proinflammatory profile in metabolic patients can be related to the positive association of RDW with erythrocyte deformability found in these patients. However, further research is needed to explain the mechanisms underlying this association.

  3. Analysis of alpha hemoglobin stabilizing protein overexpression in murine β-thalassemia

    PubMed Central

    Nasimuzzaman, Md; Khandros, Eugene; Wang, Xiaomei; Kong, Yi; Zhao, Huifen; Weiss, David; Rivella, Stefano; Weiss, Mitchell J.; Persons, Derek A.

    2013-01-01

    Excess free α-globin is cytotoxic and contributes to the pathophysiology of β-thalassemia. Alpha hemoglobin stabilizing protein (AHSP) is a molecular chaperone that binds free α-globin to promote its folding and inhibit its ability to produce damaging reactive oxygen species. Reduced AHSP levels correlate with increased severity of β-thalassemia in some human cohorts, but causal mechanistic relationships are not established for these associations. We used transgenic and lentiviral gene transfer methods to investigate whether supraphysiologic AHSP levels could mitigate the severity of β-thalassemia intermedia by providing an increased sink for the excess pool of α-globin chains. We tested wild-type AHSP and two mutant versions with amino acid substitutions that confer 3- or 13-fold higher affinity for α-globin. Erythroid overexpression of these AHSP proteins up to 11-fold beyond endogenous levels had no major effects on hematologic parameters in β-thalassemic animals. Our results demonstrate that endogenous AHSP is not limiting for α-globin detoxification in a murine model of β-thalassemia. PMID:20815047

  4. Thalassemia

    MedlinePlus

    ... carries oxygen to the body. That leads to anemia. Thalassemias occur most often among people of Italian, ... severe. Some people have no symptoms or mild anemia. The most common severe type in the United ...

  5. [Gene Mutation Spectrum of β-Thalassemia in Dai Ethinic Population of Two Border Region in Chinese Yunnan Province].

    PubMed

    Zhang, Jie; He, Jing; Zeng, Xiao-Hong; Su, Jie; Chen, Hong; Xu, Yong-Mei; Pu, Jian; Zhu, Bao-Sheng

    2016-02-01

    To investigate the gene mutation spectrum of β-thalassemia in Dai ethnic population of 2 border region in Chinese Yunnan Province. The patients with β-thalassemia in Dai ethnic population of Dehong and Xishuangbanna autonamic prefecture were screened by using blood routine detection and capillary electrophoresis. The β-globin gene mutation in patients with β-thalassemia were detected by using PCR reverse dot-blot hybridization (PCR-RDB), the constitutive rate of gene mutation in patients with β-thalassemia of Dai ethnic population in two border regions was analyzed and compared. A total of 186 patients with gene mutation of β-thalassemia were confirmed. Among them, 10 gene mutation were found, and the 5 main gene mutations were CD26 (62.56%), CD41-42 (18.97%), CD17 (14.36%), CD71-72 (2.05%) and IVS-II-654 (1.54%). Among Dai ethinic population in Dehong region, 4 gene mutations were found including CD26 (80.31%), CD17 (11.02%), CD41-42 (6.30%) and CD71-72 (2.36%). Among Dai ethinic population in Xishuangbanna region, 6 gene mutations were found, out of them the more common gene mutations were CD41-42 (42.64%), CD26 (29.41%) and CD17 (20.59%). The gene mutations of β-thalassemia in Dai ethinic population of Yunnan province has been confirmed to be more genetic heterogenicity, the spectrums of β-thalassemia mutations in Dai ethinic population of different regions were significant different.

  6. MiR-155 enhances phagocytic activity of β-thalassemia/HbE monocytes via targeting of BACH1.

    PubMed

    Srinoun, Kanitta; Nopparatana, Chamnong; Wongchanchailert, Malai; Fucharoen, Suthat

    2017-11-01

    Abnormal red blood cell (RBC) clearance in β-thalassemia is triggered by activated monocytes. Recent reports indicate that miRNA (miR-) plays a role in monocyte activation. To study phagocytic function, we co-cultured monocytes of normal, non-splenectomized and splenectomized β-thalassemia/HbE individuals with RBCs obtained from normal, non-splenectomized and splenectomized β-thalassemia/HbE individuals. The phagocytic activity of β-thalassemia/HbE monocytes co-cultured with β-thalassemia/HbE RBCs was significantly higher than that of normal monocytes co-cultured with normal RBCs. Upregulation of monocyte miR-155 was observed in β-thalassemia/HbE patients. Increased miR-155 was associated with reductions in BTB and CNC Homology1 (BACH1) target gene expression and increased phagocytic activity of β-thalassemia/HbE monocytes. Taken together, these findings suggested that increased miR-155 expression in activated monocytes leads to enhanced phagocytic activity via BACH-1 regulation in β-thalassemia/HbE. This provides novel insights into the phagocytic clearance of abnormal RBCs in β-thalassemia/HbE.

  7. Patterns of liver iron accumulation in patients with sickle cell disease and thalassemia with iron overload.

    PubMed

    Hankins, Jane S; Smeltzer, Matthew P; McCarville, M Beth; Aygun, Banu; Hillenbrand, Claudia M; Ware, Russell E; Onciu, Mihaela

    2010-07-01

    The rate and pattern of iron deposition and accumulation are important determinants of liver damage in chronically transfused patients. To investigate iron distribution patterns at various tissue iron concentrations, effects of chelation on hepatic iron compartmentalization, and differences between patients with sickle cell disease (SCD) and thalassemia major (TM), we prospectively investigated hepatic histologic and biochemical findings in 44 patients with iron overload (35 SCD and 9 TM). The median hepatic iron content (HIC) in patients with TM and SCD was similar at 12.9 and 10.3 mg Fe/g dry weight, respectively (P = 0.73), but patients with SCD had significantly less hepatic fibrosis and inflammation (P < 0.05), less hepatic injury, and significantly less blood exposure. Patients with SCD had predominantly sinusoidal iron deposition, but hepatocyte iron deposition was observed even at low HIC. Chelated patients had more hepatocyte and portal tract iron than non-chelated ones, but similar sinusoidal iron deposition. These data suggest that iron deposition in patients with SCD generally follows the traditional pattern of transfusional iron overload; however, parenchymal hepatocyte deposition also occurs early and chelation removes iron preferentially from the reticuloendothelium. Pathophysiological and genetic differences affecting iron deposition and accumulation in SCD and TM warrants further investigation.

  8. Detection of thalassemia genes using smeared blood film or leukocytes adhering to polysthylene fibers.

    PubMed

    Tatsumi, N; Yokota, M; Shindoh, K; Funahara, Y; Nathalang, O; Sukpanichnant, S; Bunyaratvej, A; Fucharoen, S

    1997-01-01

    Presently genetic analyses for thalassemia types require relatively large amounts of heparinized blood (5 to 10 ml), and transport as well as degeneration of these sample is a problem in the developing world. We have developed a new method to simplify this procedure and obtain DNAs from small specimens. As experimental materials, thinly smeared blood on a glass slide or blood filtered with and adhered on polysthylene telephtalate (PST) fibers were used. These materials could be safely stored without interfering with DNA extraction for up to 3 months. The slide materials were digested with proteinase K, and DNA was extracted with Tris-EDTA-phenol:chloroform and precipitated with absolute ethanol. The PST specimens were washed with physiologic saline and treated in the same manner as described above. Products were easily amplified by PCR and digested with restriction endonucleases for beta thalassemia typing as well as for HLA-DQA1 gene typing. Results obtained by this method correlated well with previously reported incidences for thalassemia and HLA-DQA1 types in Thailand. This method can be used in the routine laboratory because it allows for stable and biosafe genetic analyses.

  9. Decision-making in adult thalassemia patients undergoing unrelated bone marrow transplantation: quality of life, communication and ethical issues.

    PubMed

    Caocci, G; Pisu, S; Argiolu, F; Giardini, C; Locatelli, F; Vacca, A; Orofino, M G; Piras, E; De Stefano, P; Addari, M C; Ledda, A; La Nasa, G

    2006-01-01

    Bone marrow transplantation (BMT) represents a potentially curative treatment of thalassemia. For patients without an HLA-identical sibling donor, recourse to an unrelated donor is a practicable option but the candidates and their families are faced with a difficult decision. They can either choose to continue the supportive therapy, with no chance of definitive cure, or they accept the mortality risk of BMT in the hope of obtaining a definitive resolution of the disease. We investigated the communication strategies and the post transplantation quality of life (QoL) in 19 adult thalassemia patients surviving after an unrelated donor BMT. The patients were given two questionnaires: a questionnaire to evaluate pre-transplantation communication factors and the EORTC QLQ-C30 questionnaire to assess global QoL. All patients were satisfied with the communication modalities employed by the physicians. The global post transplantation QoL in our patient cohort was found to be good. The approach used in this study may offer a contribution to understanding the decision-making process leading to the choice of a treatment with a high mortality risk for a chronic, non-malignant disease. Finally, some ethical issues of this therapeutic approach are briefly addressed.

  10. Editing an α-globin enhancer in primary human hematopoietic stem cells as a treatment for β-thalassemia.

    PubMed

    Mettananda, Sachith; Fisher, Chris A; Hay, Deborah; Badat, Mohsin; Quek, Lynn; Clark, Kevin; Hublitz, Philip; Downes, Damien; Kerry, Jon; Gosden, Matthew; Telenius, Jelena; Sloane-Stanley, Jackie A; Faustino, Paula; Coelho, Andreia; Doondeea, Jessica; Usukhbayar, Batchimeg; Sopp, Paul; Sharpe, Jacqueline A; Hughes, Jim R; Vyas, Paresh; Gibbons, Richard J; Higgs, Douglas R

    2017-09-04

    β-Thalassemia is one of the most common inherited anemias, with no effective cure for most patients. The pathophysiology reflects an imbalance between α- and β-globin chains with an excess of free α-globin chains causing ineffective erythropoiesis and hemolysis. When α-thalassemia is co-inherited with β-thalassemia, excess free α-globin chains are reduced significantly ameliorating the clinical severity. Here we demonstrate the use of CRISPR/Cas9 genome editing of primary human hematopoietic stem/progenitor (CD34+) cells to emulate a natural mutation, which deletes the MCS-R2 α-globin enhancer and causes α-thalassemia. When edited CD34+ cells are differentiated into erythroid cells, we observe the expected reduction in α-globin expression and a correction of the pathologic globin chain imbalance in cells from patients with β-thalassemia. Xenograft assays show that a proportion of the edited CD34+ cells are long-term repopulating hematopoietic stem cells, demonstrating the potential of this approach for translation into a therapy for β-thalassemia.β-thalassemia is characterised by the presence of an excess of α-globin chains, which contribute to erythrocyte pathology. Here the authors use CRISP/Cas9 to reduce α-globin expression in hematopoietic precursors, and show effectiveness in xenograft assays in mice.

  11. Association of GSK3beta polymorphisms with brain structural changes in major depressive disorder.

    PubMed

    Inkster, Becky; Nichols, Thomas E; Saemann, Philipp G; Auer, Dorothee P; Holsboer, Florian; Muglia, Pierandrea; Matthews, Paul M

    2009-07-01

    Indirect evidence suggests that the glycogen synthase kinase-3beta (GSK3beta) gene might be implicated in major depressive disorder (MDD). We evaluated 15 GSK3beta single-nucleotide polymorphisms (SNPs) to test for associations with regional gray matter (GM) volume differences in patients with recurrent MDD. We then used the defined regions of interest based on significant associations to test for MDD x genotype interactions by including a matched control group without any psychiatric disorder, including MDD. General linear model with nonstationary cluster-based inference. Munich, Germany. Patients with recurrent MDD (n = 134) and age-, sex-, and ethnicity-matched healthy controls (n = 143). Associations between GSK3beta polymorphisms and regional GM volume differences. Variation in GM volume was associated with GSK3beta polymorphisms; the most significant associations were found for rs6438552, a putative functional intronic SNP that showed 3 significant GM clusters in the right and left superior temporal gyri and the right hippocampus (P < .001, P = .02, and P = .02, respectively, corrected for multiple comparisons across the whole brain). Similar results were obtained with rs12630592, an SNP in high linkage disequilibrium. A significant SNP x MDD status interaction was observed for the effect on GM volumes in the right hippocampus and superior temporal gyri (P < .001 and P = .01, corrected, respectively). The GSK3beta gene may have a role in determining regional GM volume differences of the right hippocampus and bilateral superior temporal gyri. The association between genotype and brain structure was specific to the patients with MDD, suggesting that GSK3beta genotypes might interact with MDD status. We speculate that this is a consequence of regional neocortical, glial, or neuronal growth or survival. In considering core cognitive features of MDD, the association of GSK3beta polymorphisms with structural variation in the temporal lobe and hippocampus is of

  12. The Co-Inheritance of Alpha-Thalassemia and Sickle Cell Anemia Is Associated with Better Hematological Indices and Lower Consultations Rate in Cameroonian Patients and Could Improve Their Survival

    PubMed Central

    Rumaney, Maryam Bibi; Ngo Bitoungui, Valentina Josiane; Vorster, Anna Alvera; Ramesar, Raj; Kengne, Andre Pascal; Ngogang, Jeanne; Wonkam, Ambroise

    2014-01-01

    Background Co-inheritance of α-thalassemia was reported to be associated with a delayed age of disease onset among Cameroonian Sickle Cell Anemia (SCA) patients. The present study aimed to explore the correlation between α-thalassemia, hematological indices, and clinical events in these patients. Methods and Findings We studied 161 Cameroonian SCA patients and 103 controls (59.1% HbAA) with median ages of 17.5 and 23 years. RFLP-PCR was used to confirm SCA genotype and to describe haplotypes in the HBB-like genes cluster. Multiplex Gap-PCR was performed to investigate the 3.7 kb α-globin gene deletions. SNaPshot PCR, capillary electrophoresis and cycle sequencing were used for the genotyping of 10 SNPs in BCL11A, HMIP1/2, OR51B5/6 and HBG loci, known to influence HbF levels. Generalised linear regression models adjusted for age, sex and SNPs genotypes was used to investigate effects of α-thalassemia on clinical and hematological indices. The median rate of vaso-occlusive painful crisis and hospitalisations was two and one per year, respectively. Stroke was reported in eight cases (7.4%). Benin haplotype was the most prevalent (66.3%; n = 208 chromosomes). Among patients, 37.3% (n = 60) had at least one 3.7 kb deletion, compared to 10.9% (n = 6) among HbAA controls (p<0.001). Among patients, the median RBC count increased with the number of 3.7 kb deletions [2.6, 3.0 and 3.4 million/dl, with no, one and two deletions (p = 0.01)]. The median MCV decreased with the number of 3.7 kb deletion [86, 80, and 68fl, with no, one and two deletions (p<0.0001)], as well as median WBC counts [13.2, 10.5 and 9.8×109/L (p<0.0001. The co-inheritance of α-thalassemia was associated with lower consultations rate (p = 0.038). Conclusion The co-inheritance of α-thalassemia and SCA is associated with improved hematological indices, and lower consultations rate in this group of patients. This could possibly improve their survival and explain the higher

  13. [Prenatal diagnosis of Thailand deletion of α-thalassemia 1 families].

    PubMed

    Lin, N; Lin, Y; Huang, H L; Lin, X L; He, D Q; He, S Q; Guo, D H; Li, Y; Xu, L P

    2016-06-28

    To conduct analysis and prenatal diagnosis on 11 couples carrying Thailand deletion (--(THΑI)) α-thalassemia 1, so as to provide information for clinical genetic counseling on α-thalassemia 1. Altogether 11 Thailand deletion (--(THΑI)) α-thalassemia 1 families were collected from Fujian Maternal and Children Health Hospital from May 2009 to September 2015. Gap-polymerase chain reaction (gap-PCR) and reverse dot blot (RDB) technology were used to detect the thalassemia mutations in the couples and fetuses. In one family, Thailand deletion α-thalassemia 1 was detected in both the pregnant woman and her husband. In 10 families, Thailand deletion α-thalassemia 1 was detected in either the pregnant women or the husband, while the spouses had α-thalassemia heterozygote (1 combined with β thalassemia heterozygote). Thailand deletion α-thalassemia 1 family members all had lower mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH). In prenatal diagnosis of the 12 fetuses, 4 fetuses were found with hemoglobin(Hb) Bart's hydrops fetalis syndrome, 5 were with α-thalassemia heterozygote, and 3 were normal. For couples with positive hematological phenotype but normal results in routine genetic examination of α-thalassemia, attention should be paid especially for with a history of having babies of hydrops fetalis syndrome or hemoglobin H disease. It is necessary to consider the possibility of the rare Thailand deletion (--(THΑI)) α-thalassemia 1. Prenatal diagnosis for high-risk families plays an important role.

  14. Effect of health education on severe thalassemia prevention and control in communities in Cambodia.

    PubMed

    Cheng, Kimhaung; Fucharoen, Supan; Sanchaisuriya, Kanokwan; Fucharoen, Goonnapa; Sanchaisuriya, Pattara; Jetsrisuparb, Arunee

    2018-01-01

    Severe thalassemia diseases are a major health problem in Southeast Asia. In Cambodia, there has never been a significant program for prevention or control of severe thalassemia. We, therefore, studied the effect of a health education program on severe thalassemia prevention and control in Phnom Penh, Cambodia. A quasi-experimental study in several communities around Phnom Penh was done. The respective intervention and control group comprised 124 and 117 people, between 18 and 40 years of age, male and female. Pre- and post-tests using a validated and reliable questionnaire were performed in the intervention group and one test was done in the control group. A health education program was organized to give important information to the intervention group and, at the end of the process, to the control group. The outcomes were evaluations of their knowledge and attitude vis-à-vis severe thalassemia prevention and control, and participating in thalassemia screening. Among participants in the intervention group, 105 (84.7%) considered undergoing blood screening vs. 65 (55.6%) in the control group ( p -value < 0.001). In the intervention group, the respective mean scores for knowledge and attitude to a prevention and control program for severe thalassemia before and after health education were 2.6 VS 6.5 ( p -value < 0.001) and 4.6 VS 6.5 ( p -value < 0.001). The intention to undergo screening was significantly higher in the intervention group than the control group. Knowledge and attitude towards prevention and control of severe thalassemia was significantly improved in the intervention group. Health education clearly heightens awareness and improves consideration of screening for prevention and control of severe thalassemia.

  15. Alpha thalassemia among sickle cell anaemia patients in Kampala, Uganda.

    PubMed

    Lubega, Irene; Ndugwa, Christopher M; Mworozi, Edison A; Tumwine, James K

    2015-06-01

    Sickle cell anaemia is prevalent in sub Saharan Africa. While α+-thalassaemia is known to modulate sickle cell anaemia, its magnitude and significance in Uganda have hitherto not been described. To determine the prevalence of α+thalassaemia among sickle cell anaemia patients in Mulago Hospital and to describe the clinical and laboratory findings in these patients. A cross sectional study was carried out on patients with sickle cell anaemia in Kampala. Dried blood spots were used to analyze for the deletional α+ thalassaemia using multiplex polymerase chain reaction. Of the 142 patients with sickle cell anaemia, 110 (77.5%) had the αα+thalassaemia deletion. The gene frequency of (-α) was 0.425. Ninety one percent (100/110) of those with α+thalassaemia were heterozygous (αα/α-). Amongst the patients older than 60 months, 15 (83.3%) of those without αα+thalassaemia had significant hepatomegaly of greater than 4 cm compared to 36 (45.6%) of those with α+thalassaemia (p=0.003). The gene frequency of (-α) of 0.425 noted in this study is higher than that reported from many places in Africa. Concurrent alpha thalassemia might be a protective trait against significant hepatomegaly in sickle cell anaemia patients more than 60 months of age at Mulago hospital.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rogers, Z.R.; Powars, D.R.; Williams, W.D.

    Of 18 nonblack patients with sickle cell disease, 14 had sickle cell anemia, 2 had hemoglobin SC disease, and 2 had hemoglobin S-{beta}{sup o}-thalassemia. The {beta}{sup s} gene cluster haplotypes that were determined in 7 patients were of African origin and were identified as Central African Republic, Central African Republic minor II, Benin, and Senegal. The haplotype Central African Republic minor II was present on the {beta}{sup o}-thalassemia chromosome in 2 patients. None of 10 patients whose {alpha}-gene status was determined had {alpha}-thalassemia-2. These data strongly support the concept that the {beta}{sup s} gene on chromosome 11 of these individualsmore » is of African origin and that the {alpha}-gene locus on chromosome 16 is of white or native American origin. The clinical severity of the disease in these nonblack patients is appropriate to their haplotype without {alpha}-thalassemia-2 and is comparable with that of black patients. All persons with congenital hemolytic anemia should be examined for the presence of sickle cell disease regardless of physical appearance or ethnic background.« less

  17. The epidemiologic transition of thalassemia and associated hemoglobinopathies in southern Taiwan.

    PubMed

    Wang, Hui-Ching; Hsieh, Li-Ling; Liu, Yi-Chang; Hsiao, Hui-Hua; Lin, Shu-Kai; Tsai, Wen-Chan; Liu, Ta-Chih

    2017-02-01

    Since 1993, following the National Thalassemia Major Prevention Program and an increase in immigration and interracial marriages, especially in southern Taiwan, the distribution of hemoglobinopathies may have changed. This study investigates the epidemiologic transition of hemoglobinopathies. We analyzed 1870 specimens collected between 2003 and 2012 in southern Taiwan, used gap-polymerase chain reaction and PCR-restriction fragment length polymorphism-based methods, and confirmed genotypes of hemoglobinopathies by DNA sequencing. We found a 91% reduction in the incidence of thalassemia major compared with samples from between 1986 and 1995. The most common genotypes of α-thalassemia and α Hb variants were the SEA type (69.4%) and Hb Quong Sze (1.54%). The most common genotypes of β-thalassemia and β Hb variants were IVS-II-654 (46.2%) and Hb E (2.2%), respectively. Compared with studies performed in different areas of and time intervals in Taiwan, a higher prevalence of -α 3.7 , Hb Quong Sze, and Hb E and a lower prevalence of the SEA type were found in this study. However, the SEA type remained the most common genotype observed. In addition, an increasing number of cases with an -α 3.7 type carrier, Hb Quong Sze carrier, and G γ (A γ δβ)° were identified following a peak of interracial marriages between 2003 and 2005, reflecting a regional difference and the impact of interracial marriage. In conclusion, global migration and international marriage have changed the distribution of hemoglobinopathies in Taiwan. A more comprehensive prenatal screening for new immigrants with a longer follow-up is warranted.

  18. [Symptomatic extramedullary haematopoiesis in β-thalassemia: A retrospective single centre study].

    PubMed

    Maazoun, F; Gellen Dautremer, J; Boutekadjirt, A; Pissard, S; Habibi, A; Bachir, D; Rahmouni, A; Bartolucci, P; Debbache, K; Lagrange, J-L; Michel, M; Galacteros, F

    2016-01-01

    Symptomatic extramedullary hematopoiesis (EH) is a rare but potentially severe phenomenon which occurs in β-thalassemia. There are no treatment guidelines. Retrospective single centre study including the cases of symptomatic EH encountered between 1997 and 2014 in a unit specialised in red blood cell genetic disorders. Description of clinical, biological and radiological characteristics of the patients, treatments received, and outcomes. Among 182 β-thalassemia patients followed during the study period, 7 cases of symptomatic EH were diagnosed. They were 5 men and 2 women, and their mean age was 37 years. Four patients were splenectomised, two patients were regularly transfused, and four patients had already received erythropoietin. EH was localised in intravertebral areas and responsible for dorsal spinal cord compression in 5 patients, in paravertebral dorsal area in 1 patient, and in presacral area in 1 patient. The mean hemoglobin level at diagnosis was 7.9 g/dL. Treatment administered included: red cell transfusion in 6 cases, associated with hydroxyurea in 5 cases and/or radiotherapy in 3 patients. One patient was treated with surgery and HU. After a median follow-up of 41 months, clinical recovery was complete in 2 patients and partial in 5 patients. EH must be suspected in β-thalassemia in patients presenting clinical signs of organ compression, and a typical radiological aspect. The functional prognosis depends on the rapidity of treatment, which includes red blood cell transfusion, hydroxyurea, radiotherapy, and rarely surgery. Long-term outcome is uncertain. Copyright © 2015. Published by Elsevier SAS.

  19. Decisions Regarding Pregnancy Termination Due to β-Thalassemia Major: a Mixed-Methods Study in Sistan and Baluchestan, Iran.

    PubMed

    Moudi, Zahra; Miri-Moghaddam, Ebrahim

    2017-06-01

    In the present study, an embedded design was applied in order to conduct a one-year cross-sectional audit of chorionic villus sampling (CVS) and foetal outcomes affected by β-thalassemia major (β-TM) in a prenatal diagnosis (PND) setting. In addition, we explored the decisions regarding pregnancy termination among women whose pregnancy (or child) was affected by β-TM. In the quantitative phase, the available data in the clients' medical records were analysed, while the qualitative phase was performed using a grounded theory method. Interviews were performed with nine pregnant women who had decided against pregnancy termination despite positive CVS results, 11 mothers who had admitted their child to the thalassemia ward for blood transfusion, and 19 mothers who had received positive CVS results and had decided against pregnancy termination in the preceding year. Over one year, 18.6 % of women decided against pregnancy termination despite positive CVS results. Two main themes related to decisions against pregnancy termination emerged from the qualitative data: 1) Cognitive factors (questioning the reliability of the tests or doubts about the accuracy of the results, understanding disease recurrence, curability, perceived severity of the disease, and lack of "real-life experiences"); and 2) Sociocultural responsiveness (family opposition, responsibility before God, and self-responsiveness). All of the mentioned factors could intensify fear of abortion in couples due to possible regret, and encourage a decision against pregnancy termination.

  20. My Story: Real Stories of People Living with Thalassemia

    MedlinePlus

    ... My Story Recommend on Facebook Tweet Share Compartir Real Stories from People living with Thalassemia On this ... blood diseases. Eventually, I would really like to travel the world and treat patients in places where ...

  1. Comparison of contrast sensitivity in β-thalassemia patients treated by deferoxamine or deferasirox.

    PubMed

    Ghazanfari, Azam; Jafarzadehpour, Ebrahim; Heydarian, Samira; Nowroozpoor Dailami, Kiumars; Karami, Hosein

    2018-03-10

    To compare contrast sensitivity (CS) in multi-transfused β-thalassemia patients who received deferoxamine with those who received Osveral. In this cross sectional study a total of 60 β-thalassemia patients (30 used deferoxamine and 30 used deferasirox) were regarded as case group and 30 age and sex matched healthy subjects were selected as control group. All subjects had a set of examinations including refraction, visual acuity, Biomicroscopy, ophthalmoscopy and CS. Contrast threshold was assessed with the use of Freiberg visual acuity and contrast test under the mesopic light condition for three frequencies; 1, 5, 15cpd. All data analysis was performed using SPSS, version 17. In visual acuity tests, thalassemic patients did not have any problem. Contrast threshold was higher in thalassemic patients who infuse deferoxamine (1.87±0.63, 1.46±0.81, and 2.96±1.68 in 1, 5, and 15cpd, respectively) than that of those who intake deferasirox (1.74±0.80 (P=0.743), 0.99±0.74 (P=0.047), and 2.42±1.36 (P=0.321) for 1, 5, and 15cpd, respectively), and also than healthy patients (1.33±0.58 (P=0.009), 0.95±0.68 (P=0.022), and 2.24±1.23 (P=0.135) for 1, 5, and 15cpd, respectively). Comparing those who used deferasirox with healthy subjects, contrast threshold was higher in deferasirox group at all special frequencies (P>0.05). No significant relationship was observed between CS values and duration of transfusion, serum ferritin concentration and dose of chelation therapy (P>0.05). CS tests can detect visual disturbance in thalassemic patients before the impairment of visual acuity. It is suggested that CS tests be included in their regular eye examination. Copyright © 2018 Spanish General Council of Optometry. Published by Elsevier España, S.L.U. All rights reserved.

  2. β-Thalassemia and Polycythemia vera: targeting chronic stress erythropoiesis.

    PubMed

    Crielaard, Bart J; Rivella, Stefano

    2014-06-01

    β-Thalassemia and Polycythemia vera are genetic disorders which affect the synthesis of red blood cells, also referred to as erythropoiesis. Although essentially different in clinical presentation - patients with β-thalassemia have an impairment in β-globin synthesis leading to defective erythrocytes and anemia, while patients with Polycythemia vera present with high hemoglobin levels because of excessive red blood cell synthesis - both pathologies may characterized by lasting high erythropoietic activity, i.e. chronic stress erythropoiesis. In both diseases, therapeutic strategies targeting chronic stress erythropoiesis may improve the address phenotype and prevent secondary pathology, such as iron overload. The current review will address the basic concepts of these strategies to reduce chronic stress erythropoiesis, which may have significant clinical implications in the near future. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. [Sickle cell syndrome. Association between hemoglobin S and β thalassemia].

    PubMed

    Gasparini, Nehuen P; Agriello, Evangelina E; Zanella, M J Lorena; Iommi, María P; Maradei, Juan; Sandoval, Marisa J

    Sickle cell syndrome HbS/β thalassemia is an inheritable mendelian type disease where two affected alleles are simultaneously present, one from HbS (βS) and the other from β thalassemia. That situation is mainly linked to individuals who share African and Mediterranean ancestors. The mutation responsible for HbS is a point mutation, whereas for β thalassemia, there are more than 200 mutations that cause different degrees of deficiency synthesis of β globin chain, which justifies the clinical and genetic heterogeneity of this syndrome. It is presented a clinical case of a young adult man with limited resources that consulted by longstanding bone pain. The patient presented anemia with a marked microcytosis. Hemoglobin electrophoresis was performed, an abnormal peak in position of HbS and high HbA2 fraction were detected. These last results indicated two possible molecular alterations simultaneously, for this reason the molecular study was performed looking for the most common β thalassemia mutations in our population and, the point mutation responsible for S hemoglobinopathy. Clinical data and biochemical laboratory allowed the diagnosis of sickle cell syndrome. The molecular study confirmed the syndrome carrying mutations IVS-I nt 110 G > A, responsible for β thalassemia and, codon 6 A > T (GAG → GTG: Glu → Val) responsible for S hemoglobinophaty. Since it is a disease of high health impact, it is important to provide genetic counseling to the whole family.

  4. Molecular Basis and Genetic Modifiers of Thalassemia.

    PubMed

    Mettananda, Sachith; Higgs, Douglas R

    2018-04-01

    Thalassemia is a disorder of hemoglobin characterized by reduced or absent production of one of the globin chains in human red blood cells with relative excess of the other. Impaired synthesis of β-globin results in β-thalassemia, whereas defective synthesis of α-globin leads to α-thalassemia. Despite being a monogenic disorder, thalassemia exhibits remarkable clinical heterogeneity that is directly related to the intracellular imbalance between α- and β-like globin chains. Novel insights into the genetic modifiers have contributed to the understanding of the correlation between genotype and phenotype and are being explored as therapeutic pathways to cure this life-limiting disease. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Setting up low-risk bone marrow transplantation for children with thalassemia may facilitate pediatric cancer care.

    PubMed

    Faulkner, Lawrence B

    2013-07-01

    In many South Asian countries there is shortage of centers providing care for pediatric malignancies. This report describes the experience of the Cure2Children Foundation (C2C) in supporting, both financially and professionally, the startup of two bone marrow transplant (BMT) centers, one in Pakistan and one in India, for the cure of transfusion-dependent thalassemia. Even though transplantation is generally considered as a more complex and advanced step relatively to basic pediatric cancer care, the authors argue that BMT for low-risk thalassemia patients with a matched sibling is a relatively simple procedure amenable to focused training. Since 2008 the C2C, an Italian Nongovernmental Organization (NGO), has supported a BMT network in Pakistan. The primary aim of this project was to assess feasibility, outcomes, and costs of matched-related BMT for thalassemia in young low-risk children employing a well established and quite tolerable strategy employed in Italy. This initiative relied primarily on focused training and task-shift strategies within a structured cooperation program. The initial success of that strategy led to its replication in India with 100 total BMTs performed over the past 4 years, 91 of which were for thalassemia major. Low-risk matched-related BMT in children younger than 5 years could deliver a 92% thalassemia-free survival with 100% performance score and no extensive chronic graft versus host disease (GVHD), for an average cost of 10,000 USD per BMT. Within an existing hospital facility, 50,000 USD were sufficient to renovate and fully equip a 2-3 bedded start up BMT unit capable of performing safe low-risk compatible marrow transplantation. In low resource settings matched-related low-risk BMT for thalassemia can be performed with outcomes comparable to richer countries and with a fraction of the costs. Within structured and intensive cooperation, good outcomes can be obtained from the very beginning. This observation may have important

  6. Molecular diagnosis of α-thalassemia in a multiethnic population.

    PubMed

    Gilad, Oded; Shemer, Orna Steinberg; Dgany, Orly; Krasnov, Tanya; Nevo, Michal; Noy-Lotan, Sharon; Rabinowicz, Ron; Amitai, Nofar; Ben-Dor, Shifra; Yaniv, Isaac; Yacobovich, Joanne; Tamary, Hannah

    2017-06-01

    α-Thalassemia, one of the most common genetic diseases, is caused by deletions or point mutations affecting one to four α-globin genes. Molecular diagnosis is important to prevent the most severe forms of the disease. However, the diagnosis of α-thalassemia is complex due to a high variability of the genetic defects involved, with over 250 described mutations. We summarize herein the findings of genetic analyses of DNA samples referred to our laboratory for the molecular diagnosis of α-thalassemia, along with a detailed clinical description. We utilized a diagnostic algorithm including Gap-PCR, to detect known deletions, followed by sequencing of the α-globin gene, to identify known and novel point mutations, and multiplex ligation-dependent probe amplification (MLPA) for the diagnosis of rare or novel deletions. α-Thalassemia was diagnosed in 662 of 975 samples referred to our laboratory. Most commonly found were deletions (75.3%, including two novel deletions previously described by us); point mutations comprised 25.4% of the cases, including five novel mutations. Our population included mostly Jews (of Ashkenazi and Sephardic origin) and Muslim Arabs, who presented with a higher rate of point mutations and hemoglobin H disease. Overall, we detected 53 different genotype combinations causing a spectrum of clinical phenotypes, from asymptomatic to severe anemia. Our work constitutes the largest group of patients with α-thalassemia originating in the Mediterranean whose clinical characteristics and molecular basis have been determined. We suggest a diagnostic algorithm that leads to an accurate molecular diagnosis in multiethnic populations. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Association of an α-globin gene cluster duplication and heterozygous β-thalassemia in a patient with a severe thalassemia syndrome.

    PubMed

    Jiang, Hua; Liu, Sha; Zhang, Yong-Ling; Wan, Jun-Hui; Li, Ru; Li, Dong-Zhi

    2015-01-01

    We describe a new case of a β-thalassemia (β-thal) heterozygote with the mutation IVS-II-654 (C>T) presenting with a transfusion-dependent phenotype. Multiplex ligation-dependent probe amplification (MLPA) and array comparative genomic hybridization (CGH) analyses of the α-globin gene cluster revealed a full duplication of the α-globin genes including the upstream regulatory element. The duplicated allele and the normal allele in trans resulted in a total of six active α-globin genes. The severe clinical phenotype seemed to be related to the considerable excess of the α- and β-globin deficit caused by the presence of the β-thal. α-Globin cluster duplication should be considered in patients heterozygous for β-thal who show a more severe phenotype than β-thal trait.

  8. Study on Mössbauer spectra of hemoglobin in thalassemia

    NASA Astrophysics Data System (ADS)

    Xuanhui, Guo; Nanming, Zhao; Xiufang, Zhang; Naifei, Gao; Youwen, Huang; Rongxin, Wang

    1988-02-01

    The57Fe Mössbauer spectra of erythrocytes in normal subjects and nine patients of different thalassemias were studied. Together with clinical analysis, the correlation between the components in the spectra and different types of anemias was discussed.

  9. Beta-blockade after myocardial infarction: practical implications of major clinical trials.

    PubMed

    Rehnqvist, N; Olsson, G

    1987-01-01

    A survey of the literature concerning 20 years' experience of beta-blockade after myocardial infarction indicates that several positive effects are achieved and that these are neither marginal nor transient. Mortality is reduced during the first year from about 10 to 7%. This has been shown for the individual beta-blockers metoprolol, propranolol, and timolol, and also when the data on all beta-blocker trials have been pooled. The effect is further enhanced if therapy continues. Patients at high risk of mortality can be separated fairly accurately from those at low risk. Thus, prophylactic treatment with the sole purpose of reducing mortality can be individualized. Effects on reinfarction are also already present after 1 year and are enhanced during further follow-up. It has not yet been possible, however, to identify those patients in whom this end-point will not be influenced. Furthermore, during extended follow-up, the proportion of asymptomatic patients who are free of side effects increases during treatment with beta-blockade, whereas it decreases during placebo therapy, due mostly to increased numbers of patients suffering from complications such as reinfarction, angina pectoris, cerebrovascular incidents, arrhythmias, or disturbances in the peripheral circulation. Twenty percent of patients experienced improved fitness when beta-blockade treatment was withdrawn, which balances the beneficial effects. No other drugs have been shown to have comparable beneficial effects. We conclude that the practical implications of the clinical trials indicate that beta-blockade should be continued for at least 3 years after myocardial infarction in patients without severe side effects.

  10. Underestimation of the coexistence of iron deficiencies and thalassemia minors: a single institution experience in Taiwan.

    PubMed

    Lin, Chung-King; Chen, Ling-Ping; Chang, Hsiu-Lin; Sung, Yung-Chuan

    2014-08-01

    Some physicians neglect the possible coexistence of an iron deficiency with a thalassemia minor and do not treat the iron deficiency accordingly. This motivated us to conduct this study. We retrospectively reviewed the records of 3892 patients who visited our clinics and had hemoglobin (Hb) electrophoreses performed in our hematologic laboratory from August 1, 2007 to December 31, 2012. The thalassemia minors were identified by characteristic complete blood count (CBC) parameters obtained from an autoanalyzer and Hb electrophoresis, and some cases were confirmed with molecular tests. Then, we checked iron studies [ferritin and/or serum iron with total iron-binding capacity (TIBC)] to determine the coexistence of an iron deficiency with a thalassemia minor and a response to iron, if such treatments were given. We found 792 cases with thalassemia minors, and excluded those without iron studies, with 661 cases as our sample. A total of 202/661 cases (31%) also had iron deficiencies. They had lower red blood cell (RBC) counts, Hb, and ferritin levels as compared to those thalassemia minor cases without coexistence of iron deficiencies. We concluded that the thalassemia minor patients did not have iron overload complications in our population. On the contrary, iron deficiencies commonly coexist in the clinical visits. We propose that if Hb < 11.5 g/dL in a case of thalassemia minor, one should screen for iron deficiency simultaneously. The sensitivity is 79.8% and the specificity is 82.6%. Therefore, physicians should be aware of this coexisting condition, and know how to recognize and treat it accordingly. Copyright © 2014. Published by Elsevier B.V.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gorodetsky, R.; Goldfarb, A.; Dagan, I.

    Diagnostic x-ray spectrometry, a method based on x-ray fluorescence analysis, was used for noninvasive determination of iron and zinc in two distinct skin areas, representing predominantly dermal and epidermal tissues, in 56 patients with beta-thalassemia major and intermedia. The mean iron levels in the skin of patients with beta-thalassemia major and intermedia were elevated by greater than 200% and greater than 50%, respectively, compared with control values. The zinc levels of both skin areas examined were within the normal range. The data indicate that the rate and number of blood transfusions, which correlated well with serum ferritin levels (r .more » 0.8), are not the only factors that determine the amount of iron deposition in the skin (r less than 0.6). Other sources of iron intake contribute to the total iron load in the tissues, particularly in patients who are not given multiple transfusions. The noninvasive quantitation of skin levels may reflect the extent of iron deposition in major parenchymal organs. Repeated DXS examinations of the skin could monitor the clearance of iron from the tissues of patients with iron overload in the course of therapy with chelating agents.« less

  12. β-Thalassemia: HiJAKing Ineffective Erythropoiesis and Iron Overload

    PubMed Central

    Melchiori, Luca; Gardenghi, Sara; Rivella, Stefano

    2010-01-01

    β-thalassemia encompasses a group of monogenic diseases that have in common defective synthesis of β-globin. The defects involved are extremely heterogeneous and give rise to a large phenotypic spectrum, with patients that are almost asymptomatic to cases in which regular blood transfusions are required to sustain life. As a result of the inefficient synthesis of β-globin, the patients suffer from chronic anemia due to a process called ineffective erythropoiesis (IE). The sequelae of IE lead to extramedullary hematopoiesis (EMH) with massive splenomegaly and dramatic iron overload, which in turn is responsible for many of the secondary pathologies observed in thalassemic patients. The processes are intimately linked such that an ideal therapeutic approach should address all of the complications. Although β-thalassemia is one of the first monogenic diseases to be described and represents a global health problem, only recently has the scientific community started to focus on the real molecular mechanisms that underlie this disease, opening new and exciting therapeutic perspectives for thalassemic patients worldwide. PMID:20508726

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ngo, K.Y.; Liu, D.; Lee, J.

    During the past two years we have tested 2,300 Southeast Asians for alpha- and beta-thaleassemia mutations. We found the incidence of hemoglobin E ({beta}{sup 26}) to be 47% among Laotians and 38% among Cambodians. The incidence of beta thalassemia trait is 9% for Laotians and 6% for Cambodians. Thus, the risk for hemoglobin E/{beta}{sup 26} thalassemia, a transfusion-dependent disorder, is increased in these two population groups. Denaturing gradient gel electrophoresis (DGGE) has proven to be useful in testing for beta-thalassemia carriers and identifying new mutations in the beta globin gene. DNA was extracted from venous blood obtained from patients withmore » elevated Hgb A2 (>4%). Five DNA fragments, encompassing the beta globin gene cluster, were amplified by PCR and analyzed, along with known beta gene mutations as controls, by DGGE using different denaturing gradient concentrations. Different mutations at the same nucleotide position can be distinguished by migration pattern on the DGGE (e.g., in IVS-I-1, G{r_arrow}A and T). Compound heterozygotes for {beta}-thalassemia can be detected on the same gel (e.g., HbE/mutation codon 17). New mutations are identified by their migration pattern compared with controls and determined by subsequent sequencing. We have identified three new mutations: codon 82 CAA{r_arrow}AAA in one Cambodian patient; IVS-II-667, T{r_arrow}C and IVS-II-672, A{r_arrow}C in two Laotian patients. When the parent`s genotypes are known, prenatal diagnosis can be obtained within 24 hours. Thus, PCR/DGGE combination is a rapid and reliable diagnostic approach to clinically significant {beta}-thalassemia. The most important steps are carefully designed primers and predetermined gradient concentrations for DGGE.« less

  14. Genetics Home Reference: alpha thalassemia X-linked intellectual disability syndrome

    MedlinePlus

    ... thalassemia X-linked intellectual disability syndrome Alpha thalassemia X-linked intellectual disability syndrome Printable PDF Open All ... view the expand/collapse boxes. Description Alpha thalassemia X-linked intellectual disability syndrome is an inherited disorder ...

  15. Relation of anthropometric measurements to ocular biometric changes and refractive error in children with thalassemia.

    PubMed

    Elkitkat, Rania S; El-Shazly, Amany A; Ebeid, Weam M; Deghedy, Marwa R

    2018-03-01

    To evaluate and correlate anthropometric, biometric, and refractive error changes in thalassemia major (TM). One hundred children with TM and another hundred healthy controls were recruited. Height, weight, body mass index (BMI), and occipitofrontal circumference (OFC) were the anthropometric parameters recorded. Full ophthalmologic examination was performed, including best-corrected visual acuity, cycloplegic refraction, slit-lamp examination, Goldmann applanation tonometry, indirect ophthalmoscopy, keratometry (K readings), and ocular biometry. Compared to controls, children with TM were shorter and lighter, with a smaller BMI (p<0.001); however, no significant difference existed in OFC. Regarding ocular biometric data, patients with thalassemia had steeper mean K readings (p = 0.03), shorter axial length (AXL) (p = 0.005), shorter vitreous chamber depth (p<0.001), and thicker crystalline lens (p<0.001) than controls. Patients with thalassemia had a significant myopic shift (p = 0.003). Multiple regression analyses only showed a significant correlation between corneal astigmatism and both weight and height (β = -0.05 and p = 0.03 and β = 0.06 and p = 0.04, respectively). Spherical equivalent was significantly correlated to K readings, lens thickness, and anterior chamber depth (p<0.0001 for all parameters). Compared to controls, children with TM have significant retardation in general and ocular growth (smaller BMI and shorter AXL). Ocular growth changes probably resulted in compensatory biometric changes (steeper corneas and thicker lenses) to reach emmetropization, with an exaggerated response and subsequent myopic shift. However, growth retardation is not directly related to ocular growth changes, myopic shift, or variations in biometric parameters.

  16. Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

    PubMed

    Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein

    2018-03-01

    β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

  17. Genetic Basis and Genetic Modifiers of β-Thalassemia and Sickle Cell Disease.

    PubMed

    Thein, Swee Lay

    2017-01-01

    β-thalassemia and sickle cell disease (SCD) are prototypical Mendelian single gene disorders, both caused by mutations affecting the adult β-globin gene. Despite the apparent genetic simplicity, both disorders display a remarkable spectrum of phenotypic severity and share two major genetic modifiers-α-globin genotype and innate ability to produce fetal hemoglobin (HbF, α 2 γ 2 ).This article provides an overview of the genetic basis for SCD and β-thalassemia, and genetic modifiers identified through phenotype correlation studies. Identification of the genetic variants modifying HbF production in combination with α-globin genotype provide some prediction of disease severity for β-thalassemia and SCD but generation of a personalized genetic risk score to inform prognosis and guide management requires a larger panel of genetic modifiers yet to be discovered.Nonetheless, genetic studies have been successful in characterizing some of the key variants and pathways involved in HbF regulation, providing new therapeutic targets for HbF reactivation.

  18. Increased mitochondrial DNA deletions and copy number in transfusion-dependent thalassemia

    PubMed Central

    Calloway, Cassandra

    2016-01-01

    BACKGROUND. Iron overload is the primary cause of morbidity in transfusion-dependent thalassemia. Increase in iron causes mitochondrial dysfunction under experimental conditions, but the occurrence and significance of mitochondrial damage is not understood in patients with thalassemia. METHODS. Mitochondrial DNA (mtDNA) to nuclear DNA copy number (Mt/N) and frequency of the common 4977-bp mitochondrial deletion (ΔmtDNA4977) were quantified using a quantitative PCR assay on whole blood samples from 38 subjects with thalassemia who were receiving regular transfusions. RESULTS. Compared with healthy controls, Mt/N and ΔmtDNA4977 frequency were elevated in thalassemia (P = 0.038 and P < 0.001, respectively). ΔmtDNA4977 was increased in the presence of either liver iron concentration > 15 mg/g dry-weight or splenectomy, with the highest levels observed in subjects who had both risk factors (P = 0.003). Myocardial iron (MRI T2* < 20 ms) was present in 0%, 22%, and 46% of subjects with ΔmtDNA4977 frequency < 20, 20–40, and > 40/1 × 107 mtDNA, respectively (P = 0.025). Subjects with Mt/N values below the group median had significantly lower Matsuda insulin sensitivity index (5.76 ± 0.53) compared with the high Mt/N group (9.11 ± 0.95, P = 0.008). CONCLUSION. Individuals with transfusion-dependent thalassemia demonstrate age-related increase in mtDNA damage in leukocytes. These changes are markedly amplified by splenectomy and are associated with extrahepatic iron deposition. Elevated mtDNA damage in blood cells may predict the risk of iron-associated organ damage in thalassemia. FUNDING. This project was supported by Children’s Hospital & Research Center Oakland Institutional Research Award and by the National Center for Advancing Translational Sciences, NIH, through UCSF-CTSI grant UL1 TR000004. PMID:27583305

  19. Cure of beta-thalassaemia major by umbilical cord blood transplantation--a case report of Malaysia's first cord blood transplantation.

    PubMed

    Chan, L L; Lin, H P

    1999-08-01

    A 25-month-old boy with beta-thalassaemia major was presented with an opportunity for umbilical cord blood transplantation when his unborn sibling was diagnosed in utero to be a beta-thalassaemia carrier and also human leucocyte antigen compatible. A barely adequate amount of cord blood was collected at the birth of his sibling and infused into the patient after appropriate chemo-conditioning. Engraftment occurred without major complications. The subject is now alive and well 9 months post-transplant, thus marking our first success in umbilical cord blood transplantation.

  20. Fever of unclear origin and cytopenia because of acute splenic sequestration in a young immunocompetent carrier of beta-globin mutation for Hb Valletta.

    PubMed

    Parrinello, Gaspare; Torres, Daniele; Paterna, Salvatore; Di Pasquale, Pietro; Licata, Giuseppe

    2008-12-01

    Fever of unclear origin is a clinical challenge in medical practice. Infectious diseases, neoplasms, and collagen vascular illnesses are its main causes in adults and children. Acute splenic sequestration crises, a known potentially fatal complication of sickle cell disease and sickle beta-thalassemia, are uncommon in beta-heterozygosis. We describe a case of prolonged recurrent episodes of fever with spontaneous resolution, commencing at age 10 in a 15-year-old boy with a history of hypochromic microcytic anemia attributed to a thalassemic trait. He was admitted twice to our university hospital for continuous-remittent fever with a pruritic, macular evanescent Still's skin rash, severe splenomegaly, leucopenia, thrombocytopenia, and sudden aggravation of anemia. Infectious, rheumatologic, autoimmune, and hematologic illnesses were excluded. A genetic-based study revealed heterozygosis of the beta-globin gene for a A>C (Thr>Pro) substitution at position 87 called Hemoglobin Valletta (alpha 2 beta 2 87 PRO) with a C>G transition in homozygosis in beta-globin intronic polymorphism intervening sequence 2 at nucleotide 745. After a follow-up period of 1 year without treatment, the young patient remains apyretic and in good general clinical health with persistent microcythemia and hepatosplenomegaly. Acute splenic sequestration crisis and related cytopenia may be an unusual complication of fever of unclear origin in a beta-thalassemic carrier of a Hemoglobin Valletta mutation and polymorphism in homozygosis of intervening sequence 2 at nucleotide 745. This hemoglobinopathy may predispose to a clinical phenotype of minor or intermediate thalassemia and, during a febrile illness, to hemoglobin instability and splenic sequestration.

  1. Desensitization in patients with beta-lactam drug allergy.

    PubMed

    Yusin, J S; Klaustermeyer, W; Simmons, C W; Baum, M

    2013-01-01

    Patients with a history of beta-lactam antibiotic allergy are often admitted to the hospital with severe or life-threatening infections requiring beta-lactam antibiotics. Strict avoidance of beta lactams to such patients may prevent them from getting adequate coverage and can lead to an increase in the use of alternative antibiotics, which can predispose to antibiotic resistance. Past studies revealed a lower incidence of pen allergy then patients' histories suggest. Fortunately today, there are three options for patients presenting with a history of beta-lactam allergy. Penicillin skin testing, beta-lactam challenge or beta-lactam desensitization. Recently Pre Pen has been FDA re-approved and when combined with Pen G is a valid way to determine if patients are able to tolerate beta-lactam antibiotic. When these agents are not available one must decide about desensitization or challenge. When a patient has a positive penicillin skin test, desensitization or beta-lactam avoidance are the only options. This paper reviews the safety of beta-lactam desensitization. To perform a chart review on patients desensitised with beta lactam to determine if desensitizations can be performed safely without minimal complications. A retrospective chart review was performed on allergy and immunology inpatient consultations for beta-lactam desensitization between September 2003 and August 2006 at the Cedars-Sinai Medical Centre in Los Angeles. Patient data and outcomes of desensitization were analysed. A total of 13 intravenous desensitizations were performed on 12 patients. The patients consisted of eight females and four males with an average age of 65 years. Age range was 36-92 years old. All 13 intravenous desensitizations were completed without complications. No patient required a slower rate of desensitization or discontinuance of the desensitization. Patients were able to tolerate the initial therapeutic dose of their beta-lactam antibiotic and were then able to complete full

  2. Percutaneous excretion of iron and ferritin (through Al-hijamah) as a novel treatment for iron overload in beta-thalassemia major, hemochromatosis and sideroblastic anemia.

    PubMed

    El Sayed, Salah Mohamed; Abou-Taleb, Ashraf; Mahmoud, Hany Salah; Baghdadi, Hussam; Maria, Reham A; Ahmed, Nagwa Sayed; Nabo, Manal Mohamed Helmy

    2014-08-01

    Iron overload is a big challenge when treating thalassemia (TM), hemochromatosis and sideroblastic anemia. It persists even after cure of TM with bone marrow transplantation. Iron overload results from increased iron absorption and repeated blood transfusions causing increased iron in plasma and interstitial fluids. Iron deposition in tissues e.g. heart, liver, endocrine glands and others leads to tissue damage and organ dysfunction. Iron chelation therapy and phlebotomy for iron overload have treatment difficulties, side effects and contraindications. As mean iron level in skin of TM patients increases by more than 200%, percutaneous iron excretion may be beneficial. Wet cupping therapy (WCT) is a simple, safe and economic treatment. WCT is a familiar treatment modality in some European countries and in Chinese hospitals in treating different diseases. WCT was reported to clear both blood plasma and interstitial spaces from causative pathological substances (CPS). Standard WCT method is Al-hijamah (cupping, puncturing and cupping, CPC) method of WCT that was reported to clear blood and interstitial fluids better than the traditional WCT (puncturing and cupping method, PC method of WCT). In other word, traditional WCT may be described as scarification and suction method (double S technique), while Al-hijamah may be described as suction, scarification and suction method (triple S technique). Al-hijamah is a more comprehensive treatment modality that includes all steps and therapeutic benefits of traditional dry cupping therapy and WCT altogether according to the evidence-based Taibah mechanism (Taibah theory). During the first cupping step of Al-hijamah, a fluid mixture is collected inside skin uplifting due to the effect of negative pressure inside sucking cups. This fluid mixture contains collected interstitial fluids with CPS (iron, ferritin and hemolyzed RBCs in thalassemia), filtered fluids (from blood capillaries) with iron and hemolyzed blood cells (hemolyzed

  3. X-ray scattering signatures of β-thalassemia

    NASA Astrophysics Data System (ADS)

    Desouky, Omar S.; Elshemey, Wael M.; Selim, Nabila S.

    2009-08-01

    X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm -1, respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; β-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of β-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm -1, in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.

  4. Understanding α-globin gene regulation and implications for the treatment of β-thalassemia.

    PubMed

    Mettananda, Sachith; Gibbons, Richard J; Higgs, Douglas R

    2016-03-01

    Over the past three decades, a vast amount of new information has been uncovered describing how the globin genes are regulated. This knowledge has provided significant insights into the general understanding of the regulation of human genes. It is now known that molecular defects within and around the α- and β-globin genes, as well as in the distant regulatory elements, can cause thalassemia. Unbalanced production of globin chains owing to defective synthesis of one, and the continued unopposed synthesis of another, is the central causative factor in the cellular pathology and pathophysiology of thalassemia. A large body of clinical, genetic, and experimental evidence suggests that altering globin chain imbalance by reducing the production of α-globin synthesis ameliorates the disease severity in patients with β-thalassemia. With the development of new genetic-based therapeutic tools that have a potential to decrease the expression of a selected gene in a tissue-specific manner, the possibility of decreasing expression of the α-globin gene to improve the clinical severity of β-thalassemia could become a reality. © 2015 New York Academy of Sciences.

  5. A 1-year randomized controlled trial of deferasirox vs deferoxamine for myocardial iron removal in β-thalassemia major (CORDELIA)

    PubMed Central

    Porter, John B.; Piga, Antonio; Lai, Yongrong; El-Beshlawy, Amal; Belhoul, Khawla M.; Elalfy, Mohsen; Yesilipek, Akif; Kilinç, Yurdanur; Lawniczek, Tomasz; Habr, Dany; Weisskopf, Marianne; Zhang, Yiyun; Aydinok, Yesim

    2014-01-01

    Randomized comparison data on the efficacy and safety of deferasirox for myocardial iron removal in transfusion dependent patients are lacking. CORDELIA was a prospective, randomized comparison of deferasirox (target dose 40 mg/kg per day) vs subcutaneous deferoxamine (50-60 mg/kg per day for 5-7 days/week) for myocardial iron removal in 197 β-thalassemia major patients with myocardial siderosis (T2* 6-20 milliseconds) and no signs of cardiac dysfunction (mean age, 19.8 years). Primary objective was to demonstrate noninferiority of deferasirox for myocardial iron removal, assessed by changes in myocardial T2* after 1 year using a per-protocol analysis. Geometric mean (Gmean) myocardial T2* improved with deferasirox from 11.2 milliseconds at baseline to 12.6 milliseconds at 1 year (Gmeans ratio, 1.12) and with deferoxamine (11.6 milliseconds to 12.3 milliseconds; Gmeans ratio, 1.07). The between-arm Gmeans ratio was 1.056 (95% confidence interval [CI], 0.998, 1.133). The lower 95% CI boundary was greater than the prespecified margin of 0.9, establishing noninferiority of deferasirox vs deferoxamine (P = .057 for superiority of deferasirox). Left ventricular ejection fraction remained stable in both arms. Frequency of drug-related adverse events was comparable between deferasirox (35.4%) and deferoxamine (30.8%). CORDELIA demonstrated the noninferiority of deferasirox compared with deferoxamine for myocardial iron removal. This trial is registered at www.clinicaltrials.gov as #NCT00600938. PMID:24385534

  6. Factors affecting health-related quality of life in Thai children with thalassemia

    PubMed Central

    2010-01-01

    Background Knowledge of the factors associated with health-related quality of life (HRQOL) among patients with thalassemia is essential in developing more suitable clinical, counseling, and social support programs to improve treatment outcomes of these patients. In light of the limited research in this area, this study aims to examine factors associated with HRQOL among children and adolescents with thalassemia in Thailand. Methods A cross-sectional survey was conducted in three selected hospitals in Thailand during June to November 2006. PedsQL™ 4.0 Generic Core Scale (Thai version) was used to assess HRQOL in 315 thalassemia patients between 5 and 18 years of age. Other related clinical characteristics of the patients were collected via medical record review. Results The mean (SD) of the total summary score was 76.67 (11.40), while the means (SD) for the Physical Health Summary score and Psychosocial Health Summary score were 78.24 (14.77) and 75.54 (12.76), respectively. The school functioning subscale scored the lowest, with a mean of 67.89 (SD = 15.92). The following factors significantly affected the HRQOL of the patients: age; age at onset of anemia and age at first transfusion; pre-transfusion hemoglobin (Hb) level; receiving a blood transfusion during the previous three months; and disease severity. In addition, iron chelation therapy had a significant negative effect on HRQOL in the school functioning subscale. In contrast, serum ferritin level, frequency of blood transfusions per year, and gender were not significantly related to HRQOL among these patients. The results from multivariate analysis also confirmed these findings. Conclusions To improve HRQOL of thalassemia patients, suitable programs aimed at providing psychosocial support and a link between the patient, school officials, the family and the physician are important, especially in terms of improving the school functioning score. The findings also confirmed the importance of maintaining a pre

  7. Prevalence of low bone mass among adolescents with nontransfusion-dependent hemoglobin E/β-thalassemia and its relationship with anemia severity.

    PubMed

    Nakavachara, Pairunyar; Petchkul, Jaturat; Jeerawongpanich, Krittha; Kiattisakthavee, Pornpimol; Manpayak, Teerarat; Netsakulnee, Parichat; Chaichanwattanakul, Katharee; Pooliam, Julaporn; Srichairatanakool, Somdet; Viprakasit, Vip

    2018-01-01

    Low bone mass is common among adolescents with transfusion-dependent β-thalassemia despite adequate transfusion and iron chelation. However, there are few reports regarding bone mineral density (BMD) among adolescents with nontransfusion-dependent thalassemia (NTDT). Indeed, only BMD data in patients with nontransfusion-dependent (NTD) β-thalassemia intermedia have been reported. No previous study has investigated BMD among adolescents with NTD hemoglobin (Hb) E/β-thalassemia. To determine the prevalence of low bone mass among adolescents with NTD Hb E/β-thalassemia and factors relating to low bone mass. We investigated BMD of lumbar spine (L2-L4; BMDLS) and total body (BMDTB), as measured by dual-energy X-ray absorptiometry, in 22 adolescents (aged 13.2-20 years) with NTD Hb E/β-thalassemia. Low bone mass was found to be 18.2% and 22.7% at the lumbar spine (BMDLS Z-score adjusted for bone age and height age) and 13.6% and 9.1% at the total body (BMDTB Z-score adjusted for bone age and height age). Patients with mean Hb level <8 g/dl were more likely to have low bone mass (BMDLS and BMDTB Z-scores adjusted for bone age) compared to those with Hb level ≥ 8 g/dl. Mean Hb level correlated with BMDLS and BMDTB Z-scores adjusted for bone age. We demonstrated that a low Hb level was associated with low bone mass among adolescents with NTD Hb E/β-thalassemia. A significant proportion of low bone mass among these patients highlights the importance of appropriate management, including red cell transfusion, vitamin D and calcium supplementation for improved long-term bone health. © 2017 Wiley Periodicals, Inc.

  8. Association between sickle cell anemia and alpha thalassemia reveals a high prevalence of the α3.7 triplication in congolese patients than in worldwide series.

    PubMed

    Mikobi, Tite Minga; Lukusa, Prosper Tshilobo; Aloni, Michel Ntetani; Lumaka, Aimé; Akilimali, Pierre Zalagile; Devriendt, Koenraad; Matthijs, Gert; Mbuyi Muamba, Jean-Marie; Race, Valerie

    2018-01-01

    Information about the association with alpha thalassemia in sickle cell patients is unknown in the Democratic Republic of Congo. There is very little data on the alpha thalassemia in patients suffering from sickle cell anemia in Central Africa, and their consequences on the clinical expression of the disease. A cross-sectional study was conducted in 106 sickle cell patients living in the country's capital Kinshasa. The diagnosis of sickle cell anemia was confirmed with a molecular test using PCR-RFLP (restriction fragment length polymorphism) technique. The diagnosis of thalassemia was performed by the technique of multiplex ligation dependent probe amplification. The mean age of our patients was 22.4±13.6 years. The α 3.7 heterozygous deletion, the α 3.7 homozygous deletion and the α 3.7 triplication were respectively encountered in 23.6%, 25.5% , and 11.3% of patients. Patients with normal αα/αα genotype represented 39.6% of the study population. The average of severe vaso-occlusive crises, the rates of blood transfusions per year, the rate of osteonecrosis, cholelithiasis and leg ulcers were significantly lower in the group of patients with α 3.7 homozygous deletion and α 3.7 triplication. The prevalence of α 3.7 triplication was higher in sickle cell patients in the Democratic Republic of Congo than in worldwide series. The α 3.7 triplication and α 3.7 homozygous deletion were associated with less severe forms of the Sickle cell anemia in Congolese patients. These results showed the need to investigate systematically the alpha-globin gene mutations in sickle cell population in Central Africa. © 2017 Wiley Periodicals, Inc.

  9. The role of beta-endorphin in the pathophysiology of major depression.

    PubMed

    Hegadoren, K M; O'Donnell, T; Lanius, R; Coupland, N J; Lacaze-Masmonteil, N

    2009-10-01

    A role for beta-endorphin (beta-END) in the pathophysiology of major depressive disorder (MDD) is suggested by both animal research and studies examining clinical populations. The major etiological theories of depression include brain regions and neural systems that interact with opioid systems and beta-END. Recent preclinical data have demonstrated multiple roles for beta-END in the regulation of complex homeostatic and behavioural processes that are affected during a depressive episode. Additionally, beta-END inputs to regulatory pathways involving feeding behaviours, motivation, and specific types of motor activity have important implications in defining the biological foundations for specific depressive symptoms. Early research linking beta-END to MDD did so in the context of the hypothalamic-pituitary-adrenal (HPA) axis activity, where it was suggested that HPA axis dysregulation may account for depressive symptoms in some individuals. The primary aims of this paper are to use both preclinical and clinical research (a) to critically review data that explores potential roles for beta-END in the pathophysiology of MDD and (b) to highlight gaps in the literature that limit further development of etiological theories of depression and testable hypotheses. In addition to examining methodological and theoretical challenges of past clinical studies, we summarize studies that have investigated basal beta-END levels in MDD and that have used challenge tests to examine beta-END responses to a variety of experimental paradigms. A brief description of the synthesis, location in the CNS and behavioural pharmacology of this neuropeptide is also provided to frame this discussion. Given the lack of clinical improvement observed with currently available antidepressants in a significant proportion of depressed individuals, it is imperative that novel mechanisms be investigated for antidepressant potential. We conclude that the renewed interest in elucidating the role of beta

  10. Learning about Thalassemia

    MedlinePlus

    Skip to main content Learning About Thalassemia Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...

  11. Red Cell Alloimmunization In Multitransfused Thalassaemia Major Patients.

    PubMed

    Moeen, Shazia; Farooq, Nazish; Irshad, Romana; Ashfaq, Muhammad; Farooq, Umer; Idris, Muhammad

    2018-01-01

    Lifelong transfusions are life savers for thalassaemia patients but are associated with many complications. Alloimmunization is a major problem for blood banks. Antigens of foreign red blood cells induce the formation of antibodies in patients suffering from thalassaemia. The purpose of this study was to examine the frequency of red cell alloantibodies and to express the type of these antibodies in thalassaemia patients. Patients that have received multiple transfusions were included in this study. Those with the positive Coombs test (DAT) results were excluded from the study and remaining patients were screened for antibodies. A panel of known blood group antigens was used for the patients who had a positive antibody screening test because they had alloantibodies in their serum. First, three cell panel was applied. If the screen was positive then eleven cell panels was used to identify the specific antibody. Both the cell panels were applied at room-temperature, liss (low ionic strength saline) and coombs phase. Three hundred & two patients were selected out of which 65.6% (n=198) were males and 34.4% (n=104) females. Patient's age ranged from 1.5 years to 26 years ±5.40 years. All of the patients were given regular red cell transfusion at 2-4 weeks interval. They were given non leukodepleted transfusions. It is not the practice in any thalassaemia Centre in Pakistan to give phenotypically matched blood for Kell, Kidd, Duffy or any other minor group antigens to patients on regular blood transfusion. Alloimmunization was positive in 12 (4.0%) of the 302 patients studied. Male were 66.67% (n=8) and female were 33.33% (n=4). Samples of these positive patients were further tested to determine specificity of alloantibodies. Anti Cw was most common, detected in 4 out of 12 (1.3%) patients. Anti K, k, S and Lua were detected in 2 out of 12 (0.7%) each. Thalassemia major patients on regular blood transfusions can develop red cell alloantibodies. Detailed pretransfusion

  12. Diagnosis of thalassemia and iron deficiency anemia using confocal and atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Tariq, Saira; Bilal, Muhammad; Shahzad, Shaheen; Firdous, Shamaraz; Aziz, Uzma; Ahmed, Mushtaq

    2017-11-01

    Anemia is the most prevalent blood disorder, categorized into thalassemia and iron deficiency anemia. In anemia, the morphology of erythrocytes is disturbed, thus leading to abnormal functioning of the erythrocytes. Globally, thalassemia affects 1.3% of individuals and is one of the most widespread monogenic disorders in Pakistan. All over the World, women and children are most frequently affected by a type of nutritional deficiency known as iron deficiency anemia. The morphological changes that occur in erythrocytes due to these diseases are investigated in this study at the nano-scale level. Fifty samples of blood from individuals suffering from thalassemia or iron deficiency anemia were obtained from different hospitals in Rawalpindi and Islamabad. The blood samples were scanned using atomic force microscopy (AFM) and laser scanning confocal microscopy (LSCM) to check the morphological changes in both types of anemia. According to the present study, thalassemia is most prevalent in females in the age group between 5 and 15 years old, and iron deficiency is most prevalent in females in the age groups of 16-25 and 36-45 years old. Erythrocyte morphology is the significant determinant for diagnosing and discriminating between these two types of diseases. The study reports deformed erythrocytes in anemic patients, which were different from the ones that existed in the control. Thalassemia erythrocytes showed a crenated shape, iron deficiency anemia erythrocytes showed an elliptocyte shape and healthy erythrocytes showed a biconcave disk shape when using AFM and LSCM. These techniques seem to be very promising, cheap and less time consuming in determining the structure-function relationship of erythrocytes of thalassemic and iron deficiency anemic patients. The results of LSCM and AFM are quite useful in determining the morphological changes in erythrocytes and to study the disease at the molecular level within short period of time. Hence, we encourage employing

  13. Prevalence of β-thalassemia and other haemoglobinopathies in six cities in India: a multicentre study.

    PubMed

    Mohanty, D; Colah, R B; Gorakshakar, A C; Patel, R Z; Master, D C; Mahanta, J; Sharma, S K; Chaudhari, U; Ghosh, M; Das, S; Britt, R P; Singh, S; Ross, C; Jagannathan, L; Kaul, R; Shukla, D K; Muthuswamy, V

    2013-01-01

    The population of India is extremely diverse comprising of more than 3,000 ethnic groups who still follow endogamy. Haemoglobinopathies are the commonest hereditary disorders in India and pose a major health problem. The data on the prevalence of β-thalassemias and other haemoglobinopathies in different caste/ethnic groups of India is scarce. Therefore the present multicentre study was undertaken in six cities of six states of India (Maharashtra, Gujarat, West Bengal, Assam, Karnataka and Punjab) to determine the prevalence of haemoglobinopathies in different caste/ethnic groups using uniform methodology. Fifty-six thousand seven hundred eighty individuals (college students and pregnant women) from different caste/ethnic groups were screened. RBC indices were measured on an automated haematology counter while the percentage of HbA(2), HbF and other abnormal Hb variants were estimated by HPLC on the Variant Hemoglobin Testing System. The overall prevalence of β-thalassemia trait was 2.78 % and varied from 1.48 to 3.64 % in different states, while the prevalence of β-thalassemia trait in 59 ethnic groups varied from 0 to 9.3 %. HbE trait was mainly seen in Dibrugarh in Assam (23.9 %) and Kolkata in West Bengal (3.92 %). In six ethnic groups from Assam, the prevalence of HbE trait varied from 41.1 to 66.7 %. Few subjects with δβ-thalassemia, HPFH, HbS trait, HbD trait, HbE homozygous and HbE β-thalassemia as well as HbS homozygous and HbS-β-thalassemia (<1 %) were also identified. This is the first large multicentre study covering cities from different regions of the country for screening for β-thalassemia carriers and other haemoglobinopathies where uniform protocols and methodology was followed and quality control ensured by the co-ordinating centre. This study also shows that establishment of centres for screening for β-thalassemia and other haemoglobinopathies is possible in medical colleges. Creating awareness, screening and counselling can be

  14. Beta-Expansin of Bermuda, Johnson, and Para grass pollens, is a major cross-reactive allergen for Allergic Rhinitis patients in subtropical climate.

    PubMed

    Pacharn, Punchama; Songnual, Wisuwat; Siriwatanakul, Umaporn; Thongngarm, Torpong; Reamtong, Onrapak; Jirapongsananuruk, Orathai; Bunnag, Chawewan; Piboonpocanun, Surapon

    2018-03-12

    Subtropical grass pollens of Bermuda (BGP), Johnson (JGP), and Para or buffalo grass (PGP), are common causes of pollen allergies in warm climate area. Allergic rhinitis (AR) patients had positive skin prick test (SPT) to extract of these 3 grass pollens. However, no allergenic proteins of 3 grass pollens have never been studied. To identify major allergens of BGP, JGP, and PGP in Thai grass pollen-allergic patients and to examine their sIgE cross-reactivity. Serum of nine AR patients with positive SPT to at least 2 of 3 studied pollens were collected. Based on availability, only ImmunoCAP of BGP and JGP were available to determine a level of sIgE. Profiles of sIgE bound proteins from BGP, JGP, and PGP, were obtained by immunoblot. Major IgE bound protein was identified by liquid chromatography-tandem mass spectrophotometry (LC-MS/MS). Cross-reactivity of purified major allergen of the 3 grass pollens was determined by inhibition of sIgE in both ELISA and immunoblot. AR patients who have positive SPT to extract of BGP, JGP, and PGP, were 9, 8, and 6, respectively. Positive sIgE (> 0.35 kUA/L) to BGP and JGP were found in 9 and 8 patients, respectively. Eight profiles of IgE bound proteins of the 3 grass pollens showed 29-30 kDa pollen protein as major allergen and was identified as beta-expansin (ExpB). Moreover, purified ExpB of the 3 grass pollens cross-inhibited serum sIgE. ~30 kDa ExpB of BGP, JGP, and PGP, is major cross-reactive allergen for AR Thai patients.

  15. Thalassemia: a prevalent disease yet unknown term among college students in Saudi Arabia.

    PubMed

    Olwi, Duaa Ibrahim; Merdad, Leena Adnan; Ramadan, Eman Kamal

    2017-12-14

    Thalassemia is a life-threatening blood disorder that has a high prevalence in Saudi Arabia despite the implementation of mandatory premarital testing and the availability of genetic counseling. This study aimed to assess college students' knowledge of thalassemia. A cross-sectional survey of a random sample of 920 senior students enrolled at King Abdulaziz University was conducted. A self-administered questionnaire was used to collect information about thalassemia and socio-demographic characteristics. Of the 920 students, 445 (48%) had ever heard of thalassemia. Despite the mandatory premarital testing for thalassemia, only 50% of married students stated having heard of the disease. The mean thalassemia knowledge score was 4.4 ± 2.2 out of a maximum of 12. Knowledge was significantly influenced by university faculty, gender, and education outside of Saudi Arabia. Those who had heard of thalassemia had misconceptions about the disease characteristics and pattern of inheritance such as associating thalassemia with low iron levels. A substantial proportion of the participants had a low knowledge of thalassemia. This lack of awareness requires a reassessment of the goals and success of the premarital testing program, including the genetic counseling services, and also indicates the importance of emphasizing thalassemia in school curricula and promoting and scaling up existing thalassemia campaigns in the region.

  16. The impact of thalassemia on Southeast Asian and Asian Indian families in the United States: a qualitative study.

    PubMed

    Liem, Robert I; Gilgour, Brynnan; Pelligra, Stephanie A; Mason, Maryann; Thompson, Alexis A

    2011-01-01

    To describe the challenges, including sociocultural and socioeconomic barriers, faced by an urban immigrant population in the United States affected by thalassemia major. Ethnographic, semi-structured, 1-on-1 interviews using an interview guide developed for this study. Digital recordings were transcribed and data analyzed using constant comparative method. University-based, Comprehensive Thalassemia Program at Children's Memorial Hospital, Chicago, IL, USA. Fourteen Southeast Asian and Asian Indian parents of children with transfusion dependent thalassemia. Qualitative descriptions of parental experiences, frequency of codes applied to interviews and emergent themes. Thalassemia has its greatest impact on the emotional and social well-being of affected children and their parents. Current and future concerns were related to disease-specific complications and challenges with management such as transfusions and chelation therapy. These perceptions were tied to parental hope for a cure, a frequently coded coping mechanism. Despite their availability, few parents relied on support systems beyond immediate family members due to perceived public knowledge gaps about thalassemia. Culturally based past experiences and barriers did not emerge as dominant themes in our analysis. The impact of thalassemia is tremendous for affected children and their parents and is due more to factors that were either disease-specific or common to other chronic disease models rather than those influenced by culture. The unmet needs of these families require additional investigation to facilitate the development of initiatives aimed at improving quality of life and lessening overall impact of thalassemia

  17. Detection of β-Thalassemia Carriers by Red Cell Parameters Obtained from Automatic Counters using Mathematical Formulas

    PubMed Central

    Roth, Idit Lachover; Lachover, Boaz; Koren, Guy; Levin, Carina; Zalman, Luci; Koren, Ariel

    2018-01-01

    Background β-thalassemia major is a severe disease with high morbidity. The world prevalence of carriers is around 1.5–7%. The present study aimed to find a reliable formula for detecting β-thalassemia carriers using an extensive database of more than 22,000 samples obtained from a homogeneous population of childbearing age women with 3161 (13.6%) of β-thalassemia carriers and to check previously published formulas. Methods We applied a mathematical method based on the support vector machine (SVM) algorithm in the search for a reliable formula that can differentiate between thalassemia carriers and non-carriers, including normal counts or counts suspected to belong to iron-deficient women. Results Shine’s formula and our SVM formula showed >98% sensitivity and >99.77% negative predictive value (NPV). All other published formulas gave inferior results. Conclusions We found a reliable formula that can be incorporated into any automatic blood counter to alert health providers to the possibility of a woman being a β-thalassemia carrier. A further simple hemoglobin characterization by HPLC analysis should be performed to confirm the diagnosis, and subsequent family studies should be carried out. Our SVM formula is currently limited to women of fertility age until further analysis in other groups can be performed. PMID:29326805

  18. MRI assessment of pituitary iron accumulation by using pituitary-R2 in β-thalassemia patients.

    PubMed

    Bozdağ, Mustafa; Bayraktaroğlu, Selen; Aydınok, Yeşim; Çallı, Mehmet Cem

    2018-06-01

    Background Patients with thalassemia major (TM) require repeated blood transfusions, which leads to accumulation of iron in a wide variety of tissues. Accumulation of iron in the pituitary gland can lead to irreversible hypogonadotropic hypogonadism (HH) in this group of patients. Purpose To investigate the reliability of pituitary-R2 as a marker to estimate the extent of pituitary iron load by comparing the pituitary magnetic resonance imaging (MRI) findings with hepatic iron load and serum ferritin levels. Material and Methods A total of 38 β-TM patients were classified into HH (group A, n = 18) and non-HH (group B, n = 17) groups. A third group, group C, consisted of 17 healthy participants. Each participant underwent 1.5-T MRI examinations. Pituitary gland heights (PGH), pituitary-R2 values, and liver-R2 values were measured by using multi-echo spin-echo sequences. Results Pituitary-R2 values were significantly higher in group A compared with group B ( P < 0.05). A positive correlation was detected between the pituitary-R2 values and serum ferritin levels in TM patients ( P < 0.01). A threshold value of 14.1 Hz for pituitary-R2 was found to give a high specificity and sensitivity in distinguishing the TM patients with HH from those with normal pituitary functions. PGH measurements were significantly lower in group A compared with group B ( P < 0.05). Conclusion MRI-assessed pituitary-R2 seems to be a reliable marker for differentiating the TM patients with normal pituitary function from those with secondary hypogonadism due to iron toxicity.

  19. Molecular characterization of α- and β-thalassemia in the Yulin region of Southern China.

    PubMed

    He, Sheng; Li, Jihui; Li, Dong Ming; Yi, Shang; Lu, Xiongcai; Luo, Yudi; Liang, Yi; Feng, Chunfeng; Chen, Biyan; Zheng, Chenguang; Qiu, Xiaoxia

    2018-05-20

    Thalassemia is one of the most common hereditary blood disorders. Epidemiological data regarding the prevalence and distribution of mutations is important for planning a thalassemia control program. To reveal the prevalence of thalassemia and mutation spectrum in the Yulin region of southern China, we screened 130,318 individuals from Yulin region by hematological and genetic analysis. Totally, 24,886 (19.10%) subjects were diagnosed with thalassemia, including 16,308 (12.51%) subjects with α-thalassemia alone, 6658 (5.11%) subjects with β-thalassemia alone and 1920 (1.47%) subjects with both α- and β-thalassemia. Ten α-thalassemia mutations were identified in the α-thalassemia subjects, with the common α-thalassemia mutations being -- SEA mutation (51.91%), -α 3.7 (19.90%), α CS α (10.58%), -α 4.2 (8.13%), α WS α (7.67%). Thirteen β-thalassemia mutations and 31 genotypes were characterized in the β-thalassemia subjects. The seven common mutations [CD41-42 (-CTTT) (43.31%), CD17 (A > T) (34.58%), CD26 (G > A) (6.86%), CD71-72 (+A) (4.25%), -28 (A > G) (3.90%), IVS-II-654 (C > T) (3.53%) and IVS-I-1 (G > T) (2.22%)] accounted for 98.65% of all β-thalassemia defects. Furthermore, 6 cases of α-triplication and 3 cases of mutation -α 2.4 were first identified in this region. Our data illustrated that there was great heterogeneity and extensive spectrum of thalassemias in the Yulin populations. The findings will contribute an available reference for prevention of thalassemia in this region. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. [Molecular characterization of heterozygous beta-thalassemia in Lanzarote, Spain].

    PubMed

    Calvo-Villas, José Manuel; de la Iglesia Iñigo, Silvia; Ropero Gradilla, Paloma; Zapata Ramos, María Francisca; Cuesta Tovar, Jorge; Sicilia Guillén, Francisco

    2008-04-05

    The aim of this study was to determine the molecular defects of heterozygous beta thalassaemia and to ascertain their distribution in Lanzarote. Molecular characterization was achieved by real time polymerase chain reaction (RT-PCR LightCycler, Roche), PCR-ARMS (PCR-amplification reaction mutations system) and DNA sequencing on an automated DNA sequencer. Two hundred forty-three heterozygous beta thalassaemia carriers were included between July 1991 and February 2007. RT-PCR detected the molecular defect in 81% of the beta thalassaemia chromosomes analyzed [113 codon CD 39 (C --> T); 41 IVS-1-nt-110 (G --> A), 25 IVS 1-nt-1 (G --> A) and 19 IVS 1-nt-6 (T --> C)]. The remaining 12 molecular defects included the deletion 619 bp (7.8%) and the mutations -28 (A --> G), IVS1-nt-2 (T --> G), CD 41/42 (-TTCT), CD 8/9 (+G), CD 51 (-C), CD 22 (G --> T) and CD 24 (T --> A), CD 67 (-TG) and the novel mutation CD 20/21-TGGA. The distribution of the mutations is similar to that found in the Mediterranean area. The increasing migratory flow received in the Canary Islands may explain the emergence of new mutations not reported before in our area.

  1. Correction of β-thalassemia mutant by base editor in human embryos.

    PubMed

    Liang, Puping; Ding, Chenhui; Sun, Hongwei; Xie, Xiaowei; Xu, Yanwen; Zhang, Xiya; Sun, Ying; Xiong, Yuanyan; Ma, Wenbin; Liu, Yongxiang; Wang, Yali; Fang, Jianpei; Liu, Dan; Songyang, Zhou; Zhou, Canquan; Huang, Junjiu

    2017-11-01

    β-Thalassemia is a global health issue, caused by mutations in the HBB gene. Among these mutations, HBB -28 (A>G) mutations is one of the three most common mutations in China and Southeast Asia patients with β-thalassemia. Correcting this mutation in human embryos may prevent the disease being passed onto future generations and cure anemia. Here we report the first study using base editor (BE) system to correct disease mutant in human embryos. Firstly, we produced a 293T cell line with an exogenous HBB -28 (A>G) mutant fragment for gRNAs and targeting efficiency evaluation. Then we collected primary skin fibroblast cells from a β-thalassemia patient with HBB -28 (A>G) homozygous mutation. Data showed that base editor could precisely correct HBB -28 (A>G) mutation in the patient's primary cells. To model homozygous mutation disease embryos, we constructed nuclear transfer embryos by fusing the lymphocyte or skin fibroblast cells with enucleated in vitro matured (IVM) oocytes. Notably, the gene correction efficiency was over 23.0% in these embryos by base editor. Although these embryos were still mosaic, the percentage of repaired blastomeres was over 20.0%. In addition, we found that base editor variants, with narrowed deamination window, could promote G-to-A conversion at HBB -28 site precisely in human embryos. Collectively, this study demonstrated the feasibility of curing genetic disease in human somatic cells and embryos by base editor system.

  2. Relationship Between Some Single-nucleotide Polymorphism and Response to Hydroxyurea Therapy in Iranian Patients With β-Thalassemia Intermedia.

    PubMed

    Karimi, Mehran; Zarei, Tahereh; Haghpanah, Sezaneh; Moghadam, Mohamad; Ebrahimi, Ahmad; Rezaei, Narges; Heidari, Ghazaleh; Vazin, Afsaneh; Khavari, Maryam; Miri, Hamid R

    2017-05-01

    To evaluate the possible relationship between hydroxyurea (HU) response and some single-nucleotide polymorphism (SNP) in patients affected by β-thalassemia intermedia. In this cross-sectional study, 100 β-thalassemia intermedia patients who were taking HU with a dose of 8 to 15 mg/kg body weight per day for a period of at least 6 months were randomly selected between February 2013 and October 2014 in southern Iran. HU response was defined based on decrease or cessation of the blood transfusion need and evaluation of Hb level. In univariate analysis, from all evaluated SNPs, only rs10837814 SNP of olfactory receptors (ORs) OR51B2 showed a significant association with HU response (P=0.038) and from laboratory characteristics, only nucleated red blood cells showed significant associations (116%±183%) in good responders versus (264%±286%) in poor responders (P=0.045). In multiple logistic regression, neither laboratory variables nor different SNPs, showed significant association with HU response. Three novel nucleotide variations (-665 [A→C], -1301 [T→G],-1199 delA) in OR51B2 gene were found in good responders. None of the evaluated SNPs in our study showed significant association with HU response. Further larger studies and evaluation of other genes are suggested.

  3. Low and fixed dose of hydroxyurea is effective and safe in patients with HbSβ(+) thalassemia with IVS1-5(G→C) mutation.

    PubMed

    Dehury, Snehadhini; Purohit, Prasanta; Patel, Siris; Meher, Satyabrata; Kullu, Bipin Kishore; Sahoo, Lulup Kumar; Patel, Nayan Kumar; Mohapatra, Alok Kumar; Das, Kishalaya; Patel, Dilip Kumar

    2015-06-01

    Despite compelling evidence that hydroxyurea is safe and effective in sickle cell disease, it is prescribed sparingly due to several barriers like knowledge gaps in certain genotypes, apprehension about its safety and toxicity, and limited resources. We undertook this study to find out the efficacy and safety of HU in patients with HbSβ(+) -thalassemia with IVS1-5(G→C) mutation. We registered 318 patients with HbSβ(+) -thalassemia with IVS1-5(G→C) mutation. Of these, 203 were enrolled for hydroxyurea treatment at a low and fixed dose of 10 mg/kg/day. One hundred four patients (Group-I: 37 children and Group-II: 67 adults) with ≥2 years of hydroxyurea treatment were studied. The rate of vaso-occlusive crises, requirement of blood transfusion and rate of hospitalization reduced from 3 to 0.5, 1 to 0 and 1 to 0 in Group-I and 3 to 0, 1 to 0 and 0.5 to 0 in Group-II respectively after HU therapy (P < 0.0001). %HbF level, hemoglobin, MCV and MCH increased significantly, whereas HbS, WBC, platelet count, serum-bilirubin and LDH levels decreased significantly after HU therapy. It has been observed that along with fairly subtle hematological changes following HU therapy, there was a substantial clinical improvement occurred in these patients. Transient myelotoxicity was observed in 4.8%. There was minimal gonadal toxicity without affecting reproductive function. In view of easy affordability, better acceptability, minimal toxicity, the need of infrequent monitoring and its potential effectiveness, low and fixed dose of hydroxyurea is suitable for treatment of patients with HbSβ(+) -thalassemia in resource poor setting. © 2014 Wiley Periodicals, Inc.

  4. Minerals in thalassaemia major patients: An overview.

    PubMed

    Ozturk, Zeynep; Genc, Gizem Esra; Gumuslu, Saadet

    2017-05-01

    Thalassaemia major (TM) is a hereditary blood disease characterised by reduced or absent production of beta globin chains. Erythrocyte transfusions are given to raise the haemoglobin level in patients with thalassaemia major. However, transfusions have been related to increased risk of iron overload and tissue damage related to excess iron. Both elevated oxidative stress due to iron overload and increased hemolysis lead to over utilisation of minerals required for antioxidant enzymes activities. Iron chelators have been used to prevent iron overload in thalassaemia major patients, but these chelators have the possibility of removing minerals from the body. Thalassaemia patients are more at risk for mineral deficiency because of increased oxidative stress and iron chelation therapies. Growth and maturational delay, cardiomyopathy, endocrinopathies and osteoporosis are the complications of thalassaemia. Minerals may play a particular role to prevent these complications. In the current review, we provide an overview of minerals including zinc (Zn), copper (Cu), selenium (Se), magnesium (Mg) and calcium (Ca) in thalassaemia major patients. We, also, underline that some complications of thalassaemia can be caused by an increased need for minerals or lack of the minerals. Copyright © 2017 Elsevier GmbH. All rights reserved.

  5. [Rheumatologic and radiologic symptoms of dialysis-associated beta 2-microglobulin amyloidosis: long-term retrospective study of 175 chronic hemodialysis patients].

    PubMed

    Hermann, E; Mayet, W J; Wandel, E; Scherer, G; Schadmand, S; Klose, K J; Poralla, T; Meyer zum Büschenfelde, K H; Köhler, H

    1991-01-01

    beta 2-microglobulin amyloidosis is a major complication in chronic hemodialysis patients. Destructive arthropathy, spondylarthropathy, and carpal tunnel syndrome are clinical manifestations of beta 2M amyloid depositions within the joints, intervertebral discs, and tendon sheets. We have investigated the prevalence of beta 2M amyloidosis associated radiological joint lesions in a population of 175 patients on chronic hemodialysis. In 32 of 175 patients the diagnosis of amyloidosis arthropathy and spondylarthropathy was made by radiomorphological criteria. These 32 patients were asked about rheumatic symptoms (localisation and character of pain, synovitis, carpal tunnel syndrome, influence of dialysis membrane on pain) and examined clinically. Bilateral pain of the shoulders or wrists was complained by most of the patients. 24 of the 32 patients had signs of secondary hyperparathyroidism besides beta 2M-amyloidosis. 29 patients had a carpal tunnel syndrome, 23 of whom had to be operated. beta 2M-amyloid was histochemically demonstrated in all of these 23 cases. Renal transplantation led to immediate pain relief in 3 out of 3 patients, a change of the dialysis membrane (high-flux membrane) improved chronic pain in the majority of patients.

  6. A Genetic Variant Ameliorates β-Thalassemia Severity by Epigenetic-Mediated Elevation of Human Fetal Hemoglobin Expression.

    PubMed

    Chen, Diyu; Zuo, Yangjin; Zhang, Xinhua; Ye, Yuhua; Bao, Xiuqin; Huang, Haiyan; Tepakhan, Wanicha; Wang, Lijuan; Ju, Junyi; Chen, Guangfu; Zheng, Mincui; Liu, Dun; Huang, Shuodan; Zong, Lu; Li, Changgang; Chen, Yajun; Zheng, Chenguang; Shi, Lihong; Zhao, Quan; Wu, Qiang; Fucharoen, Supan; Zhao, Cunyou; Xu, Xiangmin

    2017-07-06

    A delayed fetal-to-adult hemoglobin (Hb) switch ameliorates the severity of β-thalassemia and sickle cell disease. The molecular mechanism underlying the epigenetic dysregulation of the switch is unclear. To explore the potential cis-variants responsible for the Hb switching, we systematically analyzed an 80-kb region spanning the β-globin cluster using capture-based next-generation sequencing of 1142 Chinese β-thalassemia persons and identified 31 fetal hemoglobin (HbF)-associated haplotypes of the selected 28 tag regulatory single-nucleotide polymorphisms (rSNPs) in seven linkage disequilibrium (LD) blocks. A Ly1 antibody reactive (LYAR)-binding motif disruptive rSNP rs368698783 (G/A) from LD block 5 in the proximal promoter of hemoglobin subunit gamma 1 (HBG1) was found to be a significant predictor for β-thalassemia clinical severity by epigenetic-mediated variant-dependent HbF elevation. We found this rSNP accounted for 41.6% of β-hemoglobinopathy individuals as an ameliorating factor in a total of 2,738 individuals from southern China and Thailand. We uncovered that the minor allele of the rSNP triggers the attenuation of LYAR and two repressive epigenetic regulators DNA methyltransferase 3 alpha (DNMT3A) and protein arginine methyltransferase 5 (PRMT5) from the HBG promoters, mediating allele-biased γ-globin elevation by facilitating demethylation of HBG core promoter CpG sites in erythroid progenitor cells from β-thalassemia persons. The present study demonstrates that this common rSNP in the proximal A γ-promoter is a major genetic modifier capable of ameliorating the severity of thalassemia major through the epigenetic-mediated regulation of the delayed fetal-to-adult Hb switch and provides potential targets for the treatment of β-hemoglobinopathy. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  7. Genetics Home Reference: sickle cell disease

    MedlinePlus

    ... of beta-globin; this abnormality is called beta thalassemia . In people with sickle cell disease , at least ... globin. If mutations that produce hemoglobin S and beta thalassemia occur together, individuals have hemoglobin S- beta thalassemia (HbSBetaThal) ...

  8. Profile of deferasirox for the treatment of patients with non-transfusion-dependent thalassemia syndromes.

    PubMed

    Ricchi, Paolo; Marsella, Maria

    2015-01-01

    It has been clearly shown that iron overload adds progressively significant morbidity and mortality in patients with non-transfusion-dependent thalassemia (NTDT). The lack of physiological mechanisms to eliminate the excess of iron requires effective iron chelation therapy. The reduced compliance to deferoxamine and the risk of severe hematological adverse events during deferiprone treatment have limited the use of both these drugs to correct iron imbalance in NTDT. According to the principles of evidence-based medicine, following the demonstration of the effectiveness and the safety of deferasirox (Exjade(®)) in a prospective, randomized, controlled trial, deferasirox was approved by the US Food and Drug Administration in May 2013 for the treatment of iron overload associated with NTDT. This review, assessing the available scientific literature, will focus on the profile of DFX in the treatment of non-transfusional hemosiderosis in patients with NTDT.

  9. Education and employment status of children and adults with thalassemia in North America.

    PubMed

    Pakbaz, Zahra; Treadwell, Marsha; Kim, Hae-Young; Trachtenberg, Felicia; Parmar, Nagina; Kwiatkowski, Janet L; Cunningham, Melody J; Martin, Marie; Sweeters, Nancy; Neufeld, Ellis J; Giardina, Patricia J; Olivieri, Nancy; Yamashita, Robert C; Vichinsky, Elliott

    2010-10-01

    Advances in the management of thalassemia have resulted in increased life expectancy and new challenges. We conducted the first survey of education and employment status of people with thalassemia in North America. A total of 633 patients (349 adults and 284 school age children) enrolled in the Thalassemia Clinical Research Network (TCRN) registry in Canada and the U.S. were included in the data analysis. Predictors considered for analysis were age, gender, race/ethnicity, site of treatment (Canada vs. United States), transfusion and chelation status, serum ferritin, and clinical complications. Seventy percent of adults were employed of which 67% reported working full-time. Sixty percent had a college degree and 14% had achieved some post-college education. Eighty-two percent of school age children were at expected grade level. In a multivariate analysis for adults, Whites (OR = 2.76, 95% CI: 1.50-5.06) were more likely to be employed compared to Asians. Higher education in adults was associated with older age (OR = 1.67, 95% CI: 1.29-2.15), female gender (OR = 2.08, 95% CI: 1.32-3.23) and absence of lung disease (OR = 14.3, 95% CI: 2.04-100). Younger children (OR = 5.7 for 10-year increments, 95% CI: 2.0-16.7) and Canadian patients (OR = 5.6, 95% CI: 1.5-20) were more likely to be at the expected education level. Neither transfusion nor chelation was associated with lower employment or educational achievement. Individuals with thalassemia in North America can achieve higher education; however, full-time employment remains a problem. Transfusion and chelation do not affect employment or education status of this patient population. Copyright 2010 Wiley-Liss, Inc.

  10. Antibodies reacting with Simian Virus 40 mimotopes in serum samples from patients with thalassaemia major

    PubMed Central

    Borgna-Pignatti, Caterina; Mazzoni, Elisa; Felletti, Marcella; Turlà, Giuliana; Malaventura, Cristina; Cappellini, Maria Domenica; Cianciulli, Paolo; Forni, Gian Luca; Corallini, Alfredo; Martini, Fernanda; Tognon, Mauro

    2014-01-01

    Background Simian virus 40 (SV40) is a small DNA tumour virus. Footprints of the virus have been detected in different humam lymphoproliferative disorders and in blood specimens of blood from healthy blood donors. This study was carried out to verify whether SV40 antibodies can be detected in serum samples from multiply transfused patients with thalassaemia major. Materials and methods An indirect enzyme-linked immunosorbent assay was employed, using SV40 specific synthetic peptides mimicking the antigens of the viral capsid proteins 1-2-3, to test for the presence of antibodies to SV40 in serum samples taken from patients affected by transfusion-dependent thalassaemia major (n=190) and healthy blood donors (n=251). Results The prevalence of antibodies against SV40 was higher in patients than in controls (24% vs 17%). The prevalence increased and was significantly higher in the older age group of patients affected by thalassemia major than in controls (38% vs 20%, p<0.04). Discussion The higher prevalence of serum antibodies against simian virus 40 in older, multiply transfused patients with thalassamia major than in controls suggests that this virus, or a closely related yet unknown human polyomavirus, could have been transmitted in the past by transfusion with whole blood. At the same time, our data indicate no significant differences in prevalence of SV40 antibodies in patients and controls of younger age thus suggesting that current transfusion methods with leucodepletion and filtered red cells are safe. PMID:24887224

  11. Antibodies reacting with Simian virus 40 mimotopes in serum samples from patients with thalassaemia major.

    PubMed

    Borgna-Pignatti, Caterina; Mazzoni, Elisa; Felletti, Marcella; Turlà, Giuliana; Malaventura, Cristina; Cappellini, Maria Domenica; Cianciulli, Paolo; Forni, Gian Luca; Corallini, Alfredo; Martini, Fernanda; Tognon, Mauro

    2014-10-01

    Simian virus 40 (SV40) is a small DNA tumour virus. Footprints of the virus have been detected in different humam lymphoproliferative disorders and in blood specimens of blood from healthy blood donors. This study was carried out to verify whether SV40 antibodies can be detected in serum samples from multiply transfused patients with thalassaemia major. An indirect enzyme-linked immunosorbent assay was employed, using SV40 specific synthetic peptides mimicking the antigens of the viral capsid proteins 1-2-3, to test for the presence of antibodies to SV40 in serum samples taken from patients affected by transfusion-dependent thalassaemia major (n=190) and healthy blood donors (n=251). The prevalence of antibodies against SV40 was higher in patients than in controls (24% vs 17%). The prevalence increased and was significantly higher in the older age group of patients affected by thalassemia major than in controls (38% vs 20%, p<0.04). The higher prevalence of serum antibodies against simian virus 40 in older, multiply transfused patients with thalassamia major than in controls suggests that this virus, or a closely related yet unknown human polyomavirus, could have been transmitted in the past by transfusion with whole blood. At the same time, our data indicate no significant differences in prevalence of SV40 antibodies in patients and controls of younger age thus suggesting that current transfusion methods with leucodepletion and filtered red cells are safe.

  12. Medium-based noninvasive preimplantation genetic diagnosis for human α-thalassemias-SEA.

    PubMed

    Wu, Haitao; Ding, Chenhui; Shen, Xiaoting; Wang, Jing; Li, Rong; Cai, Bing; Xu, Yanwen; Zhong, Yiping; Zhou, Canquan

    2015-03-01

    To develop a noninvasive medium-based preimplantation genetic diagnosis (PGD) test for α-thalassemias-SEA. The embryos of α-thalassemia-SEA carriers undergoing in vitro fertilization (IVF) were cultured. Single cells were biopsied from blastomeres and subjected to fluorescent gap polymerase chain reaction (PCR) analysis; the spent culture media that contained embryo genomic DNA and corresponding blastocysts as verification were subjected to quantitative-PCR (Q-PCR) detection of α-thalassemia-SEA. The diagnosis efficiency and allele dropout (ADO) ratio were calculated, and the cell-free DNA concentration was quantitatively assessed in the culture medium. The diagnosis efficiency of medium-based α-thalassemias-SEA detection significantly increased compared with that of biopsy-based fluorescent gap PCR analysis (88.6% vs 82.1%, P < 0.05). There is no significant difference regarding ADO ratio between them. The optimal time for medium-based α-thalassemias-SEA detection is Day 5 (D5) following IVF. Medium-based α-thalassemias-SEA detection could represent a novel, quick, and noninvasive approach for carriers to undergo IVF and PGD.

  13. High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

    PubMed

    Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

    2018-01-02

    Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and

  14. Ineffective Erythropoiesis in β-Thalassemia

    PubMed Central

    Ribeil, Jean-Antoine; Arlet, Jean-Benoit; Dussiot, Michael; Cruz Moura, Ivan; Courtois, Geneviève; Hermine, Olivier

    2013-01-01

    In humans, β-thalassemia dyserythropoiesis is characterized by expansion of early erythroid precursors and erythroid progenitors and then ineffective erythropoiesis. This ineffective erythropoiesis is defined as a suboptimal production of mature erythrocytes originating from a proliferating pool of immature erythroblasts. It is characterized by (1) accelerated erythroid differentiation, (2) maturation blockade at the polychromatophilic stage, and (3) death of erythroid precursors. Despite extensive knowledge of molecular defects causing β-thalassemia, less is known about the mechanisms responsible for ineffective erythropoiesis. In this paper, we will focus on the underlying mechanisms leading to premature death of thalassemic erythroid precursors in the bone marrow. PMID:23606813

  15. Comparison between β-thalassemia minor and normal individuals using the Wechsler Adult Intelligence Scale.

    PubMed

    Zangiabadi, Nasser; Yarahmadi, Fahimeh; Darekordi, Ali; Shabani, Mohammad; Dadgar, Mehrak Memaran

    2013-01-01

    The present study aimed at investigating and comparing patients suffering from β-thalassemia (β-thal) minor with normal individuals in regard to their performances in the short version of the Wechsler Adult Intelligence Scale (WAIS) test. Patients with β-thal minor are carriers of β-thal genes. They have mild microcytic and hypochromic anemia and are usually asymptomatic. In this cross-sectional study, a total of 60 individuals were divided into two equal groups of β-thal minor and normal subjects; they were then studied by the WAIS subscales. The mean performance scores of the normal group in the subtests of arithmetic and vocabulary (p <0.01) and picture completion (p <0.05) were higher than those of the thalassemia group. The mean performance score and ability of the normal group on the verbal scale was higher in comparison to the thalassemia group (p <0.05), while on the non verbal scale, there was no significant difference between the two groups. It can be concluded that β-thal minor negatively influences verbal fluency, reasoning and conceptualization, and sequencing tasks, perceptual skill, prediction of social situations and abstract thinking.

  16. β-Thalassemia gene mutations in Antalya, Turkey: results from a single centre study.

    PubMed

    Kurtoğlu, Ayşegül; Karakuş, Volkan; Erkal, Özgür; Kurtoğlu, Erdal

    2016-11-01

    β-Thalassemia (β-thal) is a common autosomal recessive disorder resulting from over 300 different mutations of the β-globin genes. Our aim was to create a mutation map of β-thal in the province of Antalya, Turkey. In this study, mutation analysis of a total 146 of β-thal patients followed at the Thalassemia Center of the Antalya Education and Research Hospital, Antalya, Turkey, were included. Direct DNA sequence analysis was performed for mutation scanning of the β-globin gene. One hundred and forty-six patients with β-thal including all types were analyzed, and 14 different β-thal mutations were detected. The most frequently seen mutation was HBB: c.93 - 21G > A [IVS-I-110 (G > A)] (52.7%), followed by HBB: .c.92 + 6T > C [IVS-I-6 (T > C)] (14.4%), HBB: c.-80T > A [-30 (T > A)] (8.2%), HBB: c.315 + 1G > A [IVS-II-1 (G > A)] (8.2%), which made up 83.1% of the observed mutations. Our results indicate the importance of micromapping and epidemiology studies of thalassemia, which will assist in establishing the national prevention and control program in Turkey.

  17. Methemoglobinemia and ascorbate deficiency in hemoglobin E β thalassemia: metabolic and clinical implications

    PubMed Central

    Allen, Angela; Fisher, Christopher; Premawardhena, Anuja; Bandara, Dayananda; Perera, Ashok; Allen, Stephen; St Pierre, Timothy; Olivieri, Nancy

    2012-01-01

    During investigations of the phenotypic diversity of hemoglobin (Hb) E β thalassemia, a patient was encountered with persistently high levels of methemoglobin associated with a left-shift in the oxygen dissociation curve, profound ascorbate deficiency, and clinical features of scurvy; these abnormalities were corrected by treatment with vitamin C. Studies of erythropoietin production before and after treatment suggested that, as in an ascorbate-deficient murine model, the human hypoxia induction factor pathway is not totally dependent on ascorbate levels. A follow-up study of 45 patients with HbE β thalassemia showed that methemoglobin levels were significantly increased and that there was also a significant reduction in plasma ascorbate levels. Haptoglobin levels were significantly reduced, and the high frequency of the 2.2 haptoglobin genotype may place an additional pressure on ascorbate as a free-radical scavenger in this population. There was, in addition, a highly significant correlation between methemoglobin levels, splenectomy, and factors that modify the degree of globin-chain imbalance. Because methemoglobin levels are modified by several mechanisms and may play a role in both adaptation to anemia and vascular damage, there is a strong case for its further study in other forms of thalassemia and sickle-cell anemia, particularly when splenic function is defective. PMID:22885163

  18. Circulating form of beta-2-microglobulin in dialysis patients.

    PubMed

    Gagnon, R F; Somerville, P; Thomson, D M

    1988-01-01

    The circulating profile of beta-2-microglobulin (beta 2M) was determined in 8 end-stage renal disease patients on long-term dialysis (6 on hemodialysis, 2 on CAPD) by measuring beta 2M in different fraction after molecular sieve separation of their sera. Four patients had carpal tunnel syndrome with demonstrated amyloid in excised wrist tissues of which 2 were positive for beta 2M. In all patients despite very high blood levels (34.3-63.1 mg/l), beta 2M eluted exclusively as a single peak in the molecular weight region of about 12,000 daltons on a calibrated Sephacryl S-200 column. Recoveries from within the peak accounted for 96% of the applied beta 2M serum concentrations. These results were confirmed by molecular sieve separation of the enriched beta 2M-containing fractions by high-pressure liquid chromatography. We conclude that immunoreactive beta 2M in dialysis patients circulates as an intact monomer without evidence for the formation of aggregates or fragments. The pathogenesis of tissue deposition of this low-molecular-weight protein and its polymerisation to form a specific amyloid remains to be defined.

  19. Detection of α-thalassemia-1 Southeast Asian and Thai Type Deletions and β-thalassemia 3.5-kb Deletion by Single-tube Multiplex Real-time PCR with SYBR Green1 and High-resolution Melting Analysis

    PubMed Central

    Wiengkum, Thanatcha; Srithep, Sarinee; Chainoi, Isarapong; Singboottra, Panthong; Wongwiwatthananukit, Sanchai

    2011-01-01

    Background Prevention and control of thalassemia requires simple, rapid, and accurate screening tests for carrier couples who are at risk of conceiving fetuses with severe thalassemia. Methods Single-tube multiplex real-time PCR with SYBR Green1 and high-resolution melting (HRM) analysis were used for the identification of α-thalassemia-1 Southeast Asian (SEA) and Thai type deletions and β-thalassemia 3.5-kb gene deletion. The results were compared with those obtained using conventional gap-PCR. DNA samples were derived from 28 normal individuals, 11 individuals with α-thalassemia-1 SEA type deletion, 2 with α-thalassemia-1 Thai type deletion, and 2 with heterozygous β-thalassemia 3.5-kb gene deletion. Results HRM analysis indicated that the amplified fragments from α-thalassemia-1 SEA type deletion, α-thalassemia-1 Thai type deletion, β-thalassemia 3.5-kb gene deletion, and the wild-type β-globin gene had specific peak heights at mean melting temperature (Tm) values of 86.89℃, 85.66℃, 77.24℃, and 74.92℃, respectively. The results obtained using single-tube multiplex real-time PCR with SYBR Green1 and HRM analysis showed 100% consistency with those obtained using conventional gap-PCR. Conclusions Single-tube multiplex real-time PCR with SYBR Green1 and HRM analysis is a potential alternative for routine clinical screening of the common types of α- and β-thalassemia large gene deletions, since it is simple, cost-effective, and highly accurate. PMID:21779184

  20. Clinical Features of β-Thalassemia and Sickle Cell Disease.

    PubMed

    McGann, Patrick T; Nero, Alecia C; Ware, Russell E

    2017-01-01

    Sickle cell disease (SCD) and β-thalassemia are among the most common inherited diseases, affecting millions of persons globally. It is estimated that 5-7% of the world's population is a carrier of a significant hemoglobin variant. Without early diagnosis followed by initiation of preventative and therapeutic care, both SCD and β-thalassemia result in significant morbidity and early mortality. Despite great strides in the understanding of the molecular basis and pathophysiology of these conditions, the burden of disease remains high, particularly in limited resource settings. Current therapy relies heavily upon the availability and safety of erythrocyte transfusions to treat acute and chronic complications of these conditions, but frequent transfusions results in significant iron overload, as well as challenges from acquired infections and alloimmunization. Hydroxyurea is a highly effective treatment for SCD but less so for β-thalassemia, and does not represent curative therapy. As technology and use of cellular and gene therapies expand, SCD and thalassemia should be among the highest disease priorities.

  1. The Combination of CRISPR/Cas9 and iPSC Technologies in the Gene Therapy of Human β-thalassemia in Mice.

    PubMed

    Ou, Zhanhui; Niu, Xiaohua; He, Wenyin; Chen, Yuchang; Song, Bing; Xian, Yexing; Fan, Di; Tang, Daolin; Sun, Xiaofang

    2016-09-01

    β-thalassemia results from point mutations or small deletions in the β-globin (HBB) gene that ultimately cause anemia. The generation of induced pluripotent stem cells (iPSCs) from the somatic cells of patients in combination with subsequent homologous recombination-based gene correction provides new approaches to cure this disease. CRISPR/Cas9 is a genome editing tool that is creating a buzz in the scientific community for treating human diseases, especially genetic disorders. Here, we reported that correction of β-thalassemia mutations in patient-specific iPSCs using the CRISPR/Cas9 tool promotes hematopoietic differentiation in vivo. CRISPR/Cas9-corrected iPSC-derived hematopoietic stem cells (HSCs) were injected into sublethally-irradiated NOD-scid-IL2Rg-/- (NSI) mice. HBB expression was observed in these HSCs after hematopoietic differentiation in the NSI mice. Importantly, no tumor was found in the livers, lungs, kidneys, or bone marrow at 10 weeks in the NSI mice after implantation with these HSCs. Collectively, our findings demonstrated that CRISPR/Cas9 successfully corrects β-thalassemia mutations in patient-specific iPSCs. These CRISPR/Cas9-corrected iPSC-derived HSCs express normal HBB in mice without tumorigenic potential, suggesting a safe strategy for personalized treatment of β-thalassemia.

  2. Iron Overload and Chelation Therapy in Non-Transfusion Dependent Thalassemia.

    PubMed

    Bou-Fakhredin, Rayan; Bazarbachi, Abdul-Hamid; Chaya, Bachar; Sleiman, Joseph; Cappellini, Maria Domenica; Taher, Ali T

    2017-12-20

    Iron overload (IOL) due to increased intestinal iron absorption constitutes a major clinical problem in patients with non-transfusion-dependent thalassemia (NTDT), which is a cumulative process with advancing age. Current models for iron metabolism in patients with NTDT suggest that suppression of serum hepcidin leads to an increase in iron absorption and subsequent release of iron from the reticuloendothelial system, leading to depletion of macrophage iron, relatively low levels of serum ferritin, and liver iron loading. The consequences of IOL in patients with NTDT are multiple and multifactorial. Accurate and reliable methods of diagnosis and monitoring of body iron levels are essential, and the method of choice for measuring iron accumulation will depend on the patient's needs and on the available facilities. Iron chelation therapy (ICT) remains the backbone of NTDT management and is one of the most effective and practical ways of decreasing morbidity and mortality. The aim of this review is to describe the mechanism of IOL in NTDT, and the clinical complications that can develop as a result, in addition to the current and future therapeutic options available for the management of IOL in NTDT.

  3. Reassessing the approach to informed consent: the case of unrelated hematopoietic stem cell transplantation in adult thalassemia patients

    PubMed Central

    2014-01-01

    Introduction The informed consent process is the legal embodiment of the fundamental right of the individual to make decisions affecting his or her health., and the patient’s permission is a crucial form of respect of freedom and dignity, it becomes extremely important to enhance the patient’s understanding and recall of the information given by the physician. This statement acquires additional weight when the medical treatment proposed can potentially be detrimental or even fatal. This is the case of thalassemia patients pertaining to class 3 of the Pesaro classification where Allogenic hematopoietic stem cell transplantation (HSCT) remains the only potentially curative treatment. Unfortunately, this kind of intervention is burdened by an elevated transplantation-related mortality risk (TRM: all deaths considered related to transplantation), equal to 30% according to published reports. In thalassemia, the role of the patient in the informed consent process leading up to HSCT has not been fully investigated. This study investigated the hypothesis that information provided by physicians in the medical scenario of HSCT is not fully understood by patients and that misunderstanding and communication biases may affect the clinical decision-making process. Methods A questionnaire was either mailed or given personally to 25 patients. A second questionnaire was administered to the 12 physicians attending the patients enrolled in this study. Descriptive statistics were used to evaluate the communication factors. Results The results pointed out the difference between the risks communicated by physicians and the risks perceived by patients. Besides the study highlighted the mortality risk considered to be acceptable by patients and that considered to be acceptable by physicians. Conclusions Several solutions have been suggested to reduce the gap between communicated and perceived data. A multi-disciplinary approach may possibly help to attenuate some aspects of

  4. Interleukin-1beta gene polymorphisms in Taiwanese patients with gout.

    PubMed

    Chen, Man-Ling; Huang, Chung-Ming; Tsai, Chang-Hai; Tsai, Fuu-Jen

    2005-04-01

    The purpose of this study was to examine whether interleukin-1 beta (IL-1beta) promoter and exon 5 gene polymorphisms are markers of susceptibility or clinical manifestations in Taiwanese patients with gout. The study included 196 patients in addition to 103 unrelated healthy control subjects living in central Taiwan. From genomic DNA, polymorphisms of the gene for IL-1beta promoter and IL-1beta exon 5 were typed. Allelic frequencies were compared between the two groups, and the relationship between allelic frequencies and clinical manifestations of gout was evaluated. No significant differences were observed in the allelic frequencies of the IL-1beta promoter between patients with gout and healthy control subjects. Additionally, we did not detect any association of the IL-1beta promoter genotype with the clinical and laboratory profiles of gout patients. However, there was a significant difference between the two groups in terms of hypertriglyceridemia (P=0.0004, chi(2)=12.52, OR 7.14, 95%CI 0.012-0.22). There was also a significant difference in the genotype of IL-1beta exon 5 polymorphism between patients with and without hypertriglyceridemia. Results of the present study suggest that polymorphisms of the IL-1beta promoter and IL-1beta exon 5 are not related to gout patients in central Taiwan.

  5. Development of Gene Therapy for Thalassemia

    PubMed Central

    Nienhuis, Arthur W.; Persons, Derek A.

    2012-01-01

    Retroviral vector–mediated gene transfer into hematopoietic stem cells provides a potentially curative therapy for severe β-thalassemia. Lentiviral vectors based on human immunodeficiency virus have been developed for this purpose and have been shown to be effective in curing thalassemia in mouse models. One participant in an ongoing clinical trial has achieved transfusion independence after gene transfer into bone marrow stem cells owing, in part, to a genetically modified, dominant clone. Ongoing efforts are focused on improving the efficiency of lentiviral vector–mediated gene transfer into stem cells so that the curative potential of gene transfer can be consistently achieved. PMID:23125203

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Popp, R.A.; Popp, D.M.; Johnson, F.M.

    Mice homozygous for a spontaneous mutation, in which the ..beta..-major globin gene is deleted, have clinical symptoms of ..beta..-thalassemia. These mice have a hypocellular, hypochromic, microcytic anemia that becomes more severe with increasing age. The defective red cell morphology, decreased osmotic fragility of erythrocytes and shortened red cell life span found in ..beta..-thalassemic mice are similar to those observed in human ..beta..-thalassemia. Synthesis of ..beta..-globin is depressed but not as much as might be expected because the expression of the..beta..-minor globin gene is enhanced to encode two to three times more globin than in normal mice. Splenomegaly, an enlarged poolmore » of stem cells for erythropoiesis, and iron overloading occur in older mice. The fact that these mice remain moderately healthy makes them a very suitable animal model in which to develop and test alternative techniques of gene therapy that could be successfully applied to the treatment of human thalassemia. Homozygous ..beta..-thalassemic mice have large deposits of iron in their tissues, which might make these mice also useful for in vivo tests of the effectiveness and possible long-term side effects for newly developed iron chelators.« less

  7. Surveys of Thalassemia and Other Blood Defects in Spain

    DTIC Science & Technology

    on the incidence of thalassemia trait and G6PD deficiency in Spain, with particular reference to the former incidence of malaria. They find no...correlation, in the case of thalassemia trait. The G6PD deficiency gene they believe to be uniformly distributed in Spain. They have failed to find any

  8. Development of a PCR/LDR/capillary electrophoresis assay with potential for the detection of a beta-thalassemia fetal mutation in maternal plasma.

    PubMed

    Yi, Ping; Chen, Zhuqin; Yu, Lili; Zheng, Yingru; Liu, Guodong; Xie, Haichang; Zhou, Yuanguo; Zheng, Xiuhui; Han, Jian; Li, Li

    2010-08-01

    Analysis of fetal DNA in maternal plasma has recently been introduced for non-invasive prenatal diagnosis. We have now investigated the feasibility of polymerase chain reaction (PCR)/ligase detection reaction (LDR)/capillary electrophoresis for the detection of fetal point mutations, such as the beta-thalassemia mutation, IVS2 654(C --> T), in maternal plasma DNA. The sensitivity of LDR/capillary electrophoresis was examined by quantifying the mutant PCR products in the presence of a vast excess of non-mutant competitor template, a situation that mimics the detection of rare fetal mutations in the presence of excess maternal DNA. PCR/LDR/capillary electrophoresis was applied to detect the mutation, IVS2 654(C --> T), in an experimental model at different sensitivity levels and from 10 maternal plasma samples. Our results demonstrated that this approach to detect a low abundance IVS2 654(C --> T) mutation achieved a sensitivity of approximately 1:10,000. The approach was applied to maternal plasma DNA to detect the paternally inherited fetal IVS2 654(C --> T) mutation, and the results were equivalent to those obtained by PCR/reverse dot blot of amniotic fluid cell DNA. PCR/LDR/capillary electrophoresis has a very high sensitivity that can distinguish low abundance single nucleotide differences and can detect paternally inherited fetal point mutations in maternal plasma.

  9. Left ventricular torsional mechanics and myocardial iron load in beta-thalassaemia major: a potential role of titin degradation.

    PubMed

    Chen, Mei-Pian; Li, Shu-Na; Lam, Wendy W M; Ho, Yuen-Chi; Ha, Shau-Yin; Chan, Godfrey C F; Cheung, Yiu-Fai

    2014-04-12

    Iron may damage sarcomeric proteins through oxidative stress. We explored the left ventricular (LV) torsional mechanics in patients with beta-thalassaemia major and its relationship to myocardial iron load. Using HL-1 cell and B6D2F1 mouse models, we further determined the impact of iron load on proteolysis of the giant sarcomeric protein titin. In 44 thalassaemia patients aged 25 ± 7 years and 38 healthy subjects, LV torsion and twisting velocities were determined at rest using speckle tracking echocardiography. Changes in LV torsional parameters during submaximal exercise testing were further assessed in 32 patients and 17 controls. Compared with controls, patients had significantly reduced LV apical rotation, torsion, systolic twisting velocity, and diastolic untwisting velocity. T2* cardiac magnetic resonance findings correlated with resting diastolic untwisting velocity. The increments from baseline and resultant LV torsion and systolic and diastolic untwisting velocities during exercise were significantly lower in patients than controls. Significant correlations existed between LV systolic torsion and diastolic untwisting velocities in patients and controls, both at rest and during exercise. In HL-1 cells and ventricular myocardium of B6D2F1 mice overloaded with iron, the titin-stained pattern of sarcomeric structure became disrupted. Gel electrophoresis of iron-overloaded mouse myocardial tissue further showed significant decrease in the amount of titin isoforms and increase in titin degradation products. Resting and dynamic LV torsional mechanics is impaired in patients with beta-thalassaemia major. Cell and animal models suggest a potential role of titin degradation in iron overload-induced alteration of LV torsional mechanics.

  10. Iron Overload and Chelation Therapy in Non-Transfusion Dependent Thalassemia

    PubMed Central

    Bou-Fakhredin, Rayan; Bazarbachi, Abdul-Hamid; Chaya, Bachar; Sleiman, Joseph; Cappellini, Maria Domenica; Taher, Ali T.

    2017-01-01

    Iron overload (IOL) due to increased intestinal iron absorption constitutes a major clinical problem in patients with non-transfusion-dependent thalassemia (NTDT), which is a cumulative process with advancing age. Current models for iron metabolism in patients with NTDT suggest that suppression of serum hepcidin leads to an increase in iron absorption and subsequent release of iron from the reticuloendothelial system, leading to depletion of macrophage iron, relatively low levels of serum ferritin, and liver iron loading. The consequences of IOL in patients with NTDT are multiple and multifactorial. Accurate and reliable methods of diagnosis and monitoring of body iron levels are essential, and the method of choice for measuring iron accumulation will depend on the patient’s needs and on the available facilities. Iron chelation therapy (ICT) remains the backbone of NTDT management and is one of the most effective and practical ways of decreasing morbidity and mortality. The aim of this review is to describe the mechanism of IOL in NTDT, and the clinical complications that can develop as a result, in addition to the current and future therapeutic options available for the management of IOL in NTDT. PMID:29261151

  11. Proteolytic interconversion and N-terminal sequences of the Citrobacter diversus major beta-lactamases.

    PubMed Central

    Franceschini, N; Amicosante, G; Perilli, M; Maccarrone, M; Oratore, A; van Beeumen, J; Frère, J M

    1991-01-01

    The N-terminal sequences of the two major beta-lactamases produced by Citrobacter diversus differed only by the absence of the first residue in form II and the loss of five amino acid residues at the C-terminal end. Limited proteolysis of the homogeneous form I protein yielded a variety of enzymatically active products. In the major product obtained after the action of papain, the first three N-terminal residues of form I had been cleaved, whereas at the C-terminal end the treated enzyme lacked five residues. However, this cannot explain the different behaviours of form I, form II and papain digestion product upon chromatofocusing. Form I, which was sequenced up to position 56, exhibited a very high degree of similarity with a Klebsiella oxytoca beta-lactamase. The determined sequence, which contained the active serine residue, demonstrated that the chromosome-encoded beta-lactamase of Citrobacter diversus belong to class A. Images Fig. 2. PMID:2039443

  12. A survey of the utilization of anti-pseudomonal beta-lactam therapy in cystic fibrosis patients.

    PubMed

    Zobell, Jeffery T; Young, David C; Waters, C Dustin; Ampofo, Krow; Cash, Jared; Marshall, Bruce C; Olson, Jared; Chatfield, Barbara A

    2011-10-01

    The purpose of this study was to characterize the utilization of anti-pseudomonal beta-lactam antibiotics in the treatment of acute pulmonary exacerbations (APE) among Cystic Fibrosis Foundation (CFF)-accredited care centers. An anonymous national cross-sectional survey of CFF-accredited care centers was performed using an electronic survey tool (SurveyMonkey.com®). One hundred and twenty-one of 261 centers completed the survey (46%) representing 56% (14,856/26,740) of patients in the CFF Patient Registry. One hundred and nineteen of 121 (98%) respondents reported using beta-lactams for the treatment of APE. Intermittent dosing regimens constituted 155/167 (93%) reported regimens, while extended infusions were 12/167 (7%). Ceftazidime was the most commonly utilized beta-lactam comprising 74/167 (44%) of all infusions (intermittent and extended) of which 70/74 (95%) were intermittent infusions. The majority of intermittent ceftazidime regimens (56/70; 80%) were at doses lower than CFF and European guidelines recommended doses. In conclusion, a great majority of respondents use intermittent anti-pseudomonal beta-lactam antibiotics, with over half of respondents utilizing lower than guidelines recommended doses. While this is of concern, it is not known if optimization of dosing strategies according to guidelines recommendations will result in clinical benefit. Copyright © 2011 Wiley-Liss, Inc.

  13. [Organprotection in cardiac risk patients--rational of perioperative beta-adrenoceptor-antagonists and statins].

    PubMed

    Hanss, Robert; Bein, Berthold

    2010-04-01

    The number of patients with limited organ function is steadily increasing due to the aging of the population. Consequently, a growing number of patients needing surgery is accompanied by serious comorbidities. These patients are at high risk of perioperative organ dysfunction. In this context cardiac events (e.g. cardiac arrhythmias, angina or myocardial infarction) play a major role with significant impact on postoperative care, long term outcome and economic sequelae. Thus, anaesthesiologists must prevent such events in the perioperative period. Besides general measures such as adequate analgesia, protection from stressful events and sufficient volume replacement, medical intervention with beta-blockers or HMG-CoA-reductase-inhibitors (statins) are necessary to reduce the incidence of perioperative cardiac events. Both beta-blockers and HMG-CoA-reductase-inhibitors are known to exhibit pleiotropic effects (defined as additional cardioprotective effects) besides the primary blockade of the beta-adrenergic receptor or the inhibition of the synthesis of serum cholesterol, respectively. Both groups of drugs improve cardiac function, decrease inflammatory response, decrease activation of blood coagulation and stabilize endothelial plaques. Based on the current literature the following recommendations are published concerning the perioperative administration of beta-blockers: (i) Patients who are on beta-blockers on a regular basis following guidelines concerning chronic treatment of cardiovascular diseases should continue this medication throughout the perioperative period; (ii) a sufficient indicator of an adequate therapy is the baseline heart rate. It should not exceed 60-70bpm at rest; (iii) the Revised Cardiac Risk Index (RCRI) is a widely accepted score to estimate the patient's perioperative cardiac risk; (iv) patients with a RCRI > or =3 should not be scheduled for routine surgery without sufficient beta-adrenergic-receptor blockade; (v) in patients at high

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rouyer-Fessard, P.; Garel, M.C.; Domenget, C.

    The soluble pool of alpha hemoglobin chains present in blood or bone marrow cells was measured with a new affinity method using a specific probe, beta A hemoglobin chain labeled with ({sup 3}H)N-ethylmaleimide. This pool of soluble alpha chains was 0.067 {plus minus} 0.017% of hemoglobin in blood of normal adult, 0.11 {plus minus} 0.03% in heterozygous beta thalassemia and ranged from 0.26 to 1.30% in homozygous beta thalassemia intermedia. This elevated pool of soluble alpha chains observed in human beta thalassemia intermedia decreased 33-fold from a value of 10% of total hemoglobin in bone marrow cells to 0.3% inmore » the most dense red blood cells. The amount of insoluble alpha chains was measured by using the polyacrylamide gel electrophoresis in urea and Triton X-100. In beta thalassemia intermedia the amount of insoluble alpha chains was correlated with the decreased spectrin content of red cell membrane and was associated with a decrease in ankyrin and with other abnormalities of the electrophoretic pattern of membrane proteins. The loss and topology of the reactive thiol groups of membrane proteins was determined by using ({sup 3}H)N-ethylmaleimide added to membrane ghosts prior to urea and Triton X-100 electrophoresis. Spectrin and ankyrin were the major proteins with the most important decrease of thiol groups.« less

  15. Delta-Beta Thalassaemia in a Pathan Family.

    PubMed

    Ahmad, Saqib Qayyum; Zafar, Saerah Iffat; Malik, Hamid Saeed; Ahmed, Suhaib

    2017-11-01

    Delta-beta-thalassaemia (δβ-thalassaemia) is a rare type of thalassaemia which mostly results from deletion of δ and β genes with preservation of γ genes. δβ-thalassaemia is classified into (δβ)+ and (δβ)0 types. The (δβ)0-thalassemia is further divided into GγAγ(δβ)0-thalassaemia and Gγ(Aγδβ)0-thalassaemia. In heterozygous state, (δβ)0mutations give rise to phenotype resembling β-thalassaemia trait but with raised Hb-F, ranging from 5 to 20%, without a rise in Hb-A2. In homozygotes, the clinical picture is usually that of thalassaemia intermedia and the patients have 100% Hb-F. Workup of a 1-year child suffering from pallor, chronic ill health, and splenomegaly referred to our laboratory with the suspicion of β-thalassaemia, ultimately resulted in a diagnosis on polymerase chain reaction as having homozygous inversion/deletion Gγ(Aγδβ)0-thalassaemia. Her family members were also investigated.

  16. Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

    PubMed

    Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

    2006-08-15

    The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

  17. Beta-amyloid deposition in patients with major depressive disorder with differing levels of treatment resistance: a pilot study.

    PubMed

    Li, Peng; Hsiao, Ing-Tsung; Liu, Chia-Yih; Chen, Chia-Hsiang; Huang, She-Yao; Yen, Tzu-Chen; Wu, Kuan-Yi; Lin, Kun-Ju

    2017-12-01

    Lack of treatment response in patients with late-life depression is common. The role of brain beta-amyloid (Aβ) deposition in treatment outcome in subjects with late-life depression remains unclear. The present study aimed to investigate brain Aβ deposition in patients with major depressive disorder (MDD) with differing treatment outcomes in vivo using 18 F-florbetapir imaging. This study included 62 MDD patients and 18 healthy control subjects (HCs).We first employed the Maudsley staging method (MSM) to categorize MDD patients into two groups according to treatment response: mild treatment resistance (n = 29) and moderate-to-severe treatment resistance (n = 33).The standard uptake value ratio (SUVR) of each volume of interest was analysed, and voxel-wise comparisons were made between the MDD patients and HCs. Vascular risk factors, serum homocysteine level, and apolipoprotein E (ApoE) genotype were also determined. The MDD patients with moderate-to-severe treatment resistance had higher 18 F-florbetapir SUVRs than the HCs in the parietal region (P < 0.01). Voxel-wise comparisons further demonstrated elevated SUVRs in MDD patients with moderate-to-severe treatment resistance in the precuneus, parietal, temporal, and occipital regions. The MDD patients with mild treatment resistance were found to have increased 18 F-florbetapir uptake mainly in the left frontal and parietal regions as compared with the HCs. In addition, voxel-to-voxel correlation analysis showed that brain Aβ deposition was correlated positively with MSM score in the occipital region. 18 F-florbetapir SUVRs were correlated negatively with Mini Mental Status Examination (MMSE) score in the sample of all MDD patients (r = -0.355, P = 0.005). This study provided preliminary evidence that region-specific Aβ deposition was present in some (but not all) MDD patients, especially in those with moderate-to-severe treatment resistance, and their depressive symptoms may represent

  18. Prevalence of growth hormone deficiency in adult polytransfused β-thalassemia patients and correlation with transfusional and chelation parameters.

    PubMed

    Poggi, M; Pascucci, C; Monti, S; Pugliese, P; Lauri, C; Amodeo, G; Girelli, G; Toscano, V

    2010-09-01

    Dysfunction of GH-IGF-I axis has been described in many patients affected by β-thalassemia major (TM), especially in children and in adolescents. Recent studies have demonstrated the necessity to evaluate adult patients affected by TM to establish the presence of this alteration which could be relevant in the pathogenesis of cardiac and bone disease, frequently present in this hematological condition. The pathogenesis of this alteration, correlated in the past with iron overload, is not yet completely understood. The aim of this paper is to evaluate GH-IGF-I axis in a group of adult polytransfused β-thalassemic patients (TM) and to correlate the results with transfusional and chelation parameters. We performed an arginine plus GHRH stimulation test in 28 adult TM patients. Ferritin, IGF-I, liver enzymes, and liver iron concentration, assessed by a superconducting quantum interference device (SQUID) susceptometer were also determined. Moreover, in each patient we evaluated the bone status by a dual-energy X-ray absorptiometry study. We found the presence of GH deficit in 9 patients (32.1%). There were no significant differences between the two groups regarding the value of ferritin, liver enzymes, and liver iron concentration, assessed by SQUID. The group affected by GH deficit showed a worse bone profile. This study confirms the necessity to screen the status of GH/IGF-I axis in this group of patients, even in adult age. The presence of GH deficiency does not seem to be correlated with the efficacy parameters of transfusional and chelation therapy. Other mechanisms, additional to iron overload, could therefore play a role in the pathogenesis of this clinical condition. The presence of GH deficit seems to be very important on clinical aspects, like bone disease, that are crucial for quality of life in these patients.

  19. Hematological parameters and red blood cell morphological abnormality of Glucose-6-Phosphate dehydrogenase deficiency co-inherited with thalassemia.

    PubMed

    Pengon, Jutharat; Svasti, Saovaros; Kamchonwongpaisan, Sumalee; Vattanaviboon, Phantip

    2018-03-01

    Glucose-6-phosphate dehydrogenase (G-6-PD) deficiency and thalassemia are genetically independent hemolytic disorders. Co-inheritance of both disorders may affect red blood cell pathology to a greater extent than normally seen in either disorder alone. This study determines the prevalence and evaluates hematological changes of G-6-PD deficiency and thalassemia co-inheritance. G-6-PD deficiency was screened from 200 male thalassemia blood samples using a fluorescent spot test. Hematological parameters and red blood cell morphology were evaluated among G-6-PD deficiency/thalassemia co-inheritance, G-6-PD deficiency alone, thalassemia alone, and normal individuals. G-6-PD deficiency was detected together with hemoglobin (Hb) E heterozygote, Hb E homozygote, β-thalassemia trait, and β-thalassemia/Hb E, α-thalassemia-2 trait, and Hb H disease. Hb level, hematocrit, mean cell volume, and mean cell Hb of G-6-PD deficiency co-inherited with asymptomatic thalassemia carriers show significantly lower mean values compared to carriers with only the same thalassemia genotypes. Higher mean red blood cell distribution width was observed in G-6-PD deficiency co-inherited with Hb E heterozygote, as with numbers of hemighost cells in G-6-PD deficiency/thalassemia co-inheritance compared to those with either disorder. Apart from Hb level, hematological parameters of co-inheritance disorders were not different from individuals with a single thalassemia disease. G-6-PD deficiency co-inherited with thalassemia in males was present in 10% of the participants, resulting in worsening of red blood cell pathology compared with inheritance of thalassemia alone. Copyright © 2017 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.

  20. Discordant changes in plasma ACTH and beta-lipotropin/beta-endorphin levels in Cushing's disease patients with depression.

    PubMed

    Starkman, M N; Schteingart, D E; Schork, M A

    1992-11-01

    Cushing's Disease is often associated with a depressive syndrome, with mood, vegetative, and cognitive abnormalities of variable severity. In 11 patients with (pituitary ACTH-dependent) Cushing's disease (10 women, 1 man), we studied the relationship between severity of the depressive syndrome and concordance of changes in ACTH and beta-lipotropin/beta-endorphin (beta-LPH/beta-E) levels at baseline and in response to metyrapone and dexamethasone. For each condition, blood samples were drawn at 0800h, 1200h, 1600h, and 2200h. Six patients were categorized as mildly depressed (mean [+/- SD] depressed mood score = 0.17 +/- 0.4; modified Hamilton Depression scale score = 7.6 +/- 4.5) and five as severely depressed (mean depressed mood score = 2.4 +/- 0.5; modified Hamilton Depression scale score = 15 +/- 5.6) (p < 0.05). ACTH and beta-LPH/beta-E were measured by radioimmunoassay. For each experimental condition, changes in levels were scored as concordant if the two peptides moved in parallel between sampling points. There was a relationship between greater severity of depression and more frequent discordant changes in ACTH and beta-LPH/beta-E levels: The six patients with mild depression exhibited 23 concordant and 3 discordant change patterns, while the five patients with severe depression showed 8 concordant and 15 discordant patterns. The mean percentage of concordant patterns per patient differed significantly between the two groups (mildly depressed = 90.0 +/- 16.7; severely depressed = 34.6 +/- 8.7 (p < 0.001). When each study condition was examined separately, differences in the frequency of concordance between the groups reached significance during the post-metyrapone phase and with 8.0 mg dexamethasone administration.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Postnatal and non-invasive prenatal detection of β-thalassemia mutations based on Taqman genotyping assays

    PubMed Central

    Breveglieri, Giulia; Travan, Anna; D’Aversa, Elisabetta; Cosenza, Lucia Carmela; Pellegatti, Patrizia; Guerra, Giovanni; Gambari, Roberto

    2017-01-01

    The β-thalassemias are genetic disorder caused by more than 200 mutations in the β-globin gene, resulting in a total (β0) or partial (β+) deficit of the globin chain synthesis. The most frequent Mediterranean mutations for β-thalassemia are: β039, β+IVSI-110, β+IVSI-6 and β0IVSI-1. Several molecular techniques for the detection of point mutations have been developed based on the amplification of the DNA target by polymerase chain reaction (PCR), but they could be labor-intensive and technically demanding. On the contrary, TaqMan® genotyping assays are a simple, sensitive and versatile method suitable for the single nucleotide polymorphism (SNP) genotyping affecting the human β-globin gene. Four TaqMan® genotyping assays for the most common β-thalassemia mutations present in the Mediterranean area were designed and validated for the genotype characterization of genomic DNA extracted from 94 subjects comprising 25 healthy donors, 33 healthy carriers and 36 β-thalassemia patients. In addition, 15 specimens at late gestation (21–39 gestational weeks) and 11 at early gestation (5–18 gestational weeks) were collected from pregnant women, and circulating cell-free fetal DNAs were extracted and analyzed with these four genotyping assays. We developed four simple, inexpensive and versatile genotyping assays for the postnatal and prenatal identification of the thalassemia mutations β039, β+IVSI-110, β+IVSI-6, β0IVSI-1. These genotyping assays are able to detect paternally inherited point mutations in the fetus and could be efficiently employed for non-invasive prenatal diagnosis of β-globin gene mutations, starting from the 9th gestational week. PMID:28235086

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosatelli, M.C.; Faa, V.; Sardu, R.

    This study reports the molecular characterization of [beta]-thalassemia in the Sardinian population. Three thousand [beta]-thalassemia chromosomes from prospective parents presenting at the genetic service were initially analyzed by dot blot analysis with oligonucleotide probes complementary to the most common [beta]-thalassemia mutations in the Mediterranean at-risk populations. The mutation which remained uncharacterized by this approach were defined by denaturing gradient gel electrophoresis (DGGE) followed by direct sequence analysis on amplified DNA. The authors reconfirmed that the predominant mutation in the Sardinian population is the codon 39 nonsense mutation, which accounts for 95.7% of the [beta]-thalassemia chromosomes. The other two relatively commonmore » mutations are frameshifts at codon 6 (2.1%) and at codon 76 (0.7%), relatively uncommon in other Mediterranean-origin populations. In this study they have detected a novel [beta]-thalassemia mutation, i.e., a frameshift at codon 1, in three [beta]-thalassemia chromosomes. The DGGE procedure followed by direct sequencing on amplified DNA is a powerful approach for the characterization of unknown mutations in this genetic system.« less

  3. Attitudes and beliefs among high- and low-risk population groups towards β-thalassemia prevention: a cross-sectional descriptive study from India.

    PubMed

    Chawla, Swati; Singh, Rajnish Kumar; Lakkakula, Bhaskar V K S; Vadlamudi, Raghavendra Rao

    2017-07-01

    β-thalassemia is an autosomal recessive blood disorder caused by gene mutations that affect all aspects of β-globin production. In majority of Asian countries including India, the frequency of β-thalassemia is closely intertwined with social, cultural, and religious issues of the respective country. Several national level screening programs imparted education regarding β-thalassemia, but follow-up evaluation revealed that education was not effective. It has been hypothesized that the beliefs and attitudes, carrier screening, and education among "high risk communities" will have far-reaching implications towards β-thalassemia prevention in the country. The present study is aimed to investigate attitudes, intention, and behavior of β-thalassemia high- and low-risk ethnic groups towards carrier screening and education. A structured questionnaire on knowledge, attitude, and practice regarding β-thalassemia was administered on 926 individuals belong to Arora, a high-risk ethnic group for β-thalassemia (347 rural (AR) and 202 urban (AU)) and 377 cosmopolitan commoners (CC) aged above 18 years of both sexes. To understand the relationship between various questions, Pearson's correlation test and factor analysis was performed. The responses were further categorized into the theory of planned behavior (TPB) constructs with the measures of the main constructs reported as a mean. Various dimensions of knowledge, attitude, and practice reveal that the urban groups (AU and CC) are better aware of the disease "β-thalassemia" than the rural group (AR) who witness suffering at close quarters. The AR group is more positive for preventive measures than the urban groups. Significant correlations and factor analysis show "intentions" for premarital and prenatal screening highly loaded as outcome behaviors. The Ajzen's "Theory of planned behavior" support that the "intention" and "perceived behavior control" are better predictors of "outcome behavior" compared to "attitude

  4. Morphometric analysis of erythrocytes from patients with thalassemia using tomographic diffractive microscopy

    NASA Astrophysics Data System (ADS)

    Lin, Yang-Hsien; Huang, Shin-Shyang; Wu, Shang-Ju; Sung, Kung-Bin

    2017-11-01

    Complete blood count is the most common test to detect anemia, but it is unable to obtain the abnormal shape of erythrocytes, which highly correlates with the hematologic function. Tomographic diffractive microscopy (TDM) is an emerging technique capable of quantifying three-dimensional (3-D) refractive index (RI) distributions of erythrocytes without labeling. TDM was used to characterize optical and morphological properties of 172 erythrocytes from healthy volunteers and 419 erythrocytes from thalassemic patients. To efficiently extract and analyze the properties of erythrocytes, we developed an adaptive region-growing method for automatically delineating erythrocytes from 3-D RI maps. The thalassemic erythrocytes not only contained lower hemoglobin content but also showed doughnut shape and significantly lower volume, surface area, effective radius, and average thickness. A multi-indices prediction model achieved perfect accuracy of diagnosing thalassemia using four features, including the optical volume, surface-area-to-volume ratio, sphericity index, and surface area. The results demonstrate the ability of TDM to provide quantitative, hematologic measurements and to assess morphological features of erythrocytes to distinguish healthy and thalassemic erythrocytes.

  5. A phase I study of human natural interferon-beta in cancer patients.

    PubMed

    Liberati, A M; Biscottini, B; Fizzotti, M; Schippa, M; De Angelis, V; Senatore, M; Vittori, O; Teggia, L; Natali, R; Palmisano, L

    1989-06-01

    In this phase I study 15 patients with metastatic tumors were given interferon (IFN)-beta by i.v. bolus injections. Twelve individual doses of 1, 2, 3.3, 5, 7, 9, 12, 16, 21, 27, 35, and 46 x 10(6) IU were administered every other day. The single maximal tolerated dose ranged from 9 to 46 x 10(6) IU. Eight patients tolerated the dose of 46 x 10(6) IU without side effects. Disturbances of cardiac rhythm were observed, but were closely related temporally to severe chills and appeared to be the consequence of adrenergic stimulation associated with this side-effect. In addition, no significant variations in the left ventricular function as assessed by nuclear stethoscope were observed. Neurotoxicity was not a major side-effect. The toxicity of IFN-beta given as scheduled in this study was significant, but acceptable.

  6. The molecular basis of α-thalassemia.

    PubMed

    Higgs, Douglas R

    2013-01-01

    The globin gene disorders including the thalassemias are among the most common human genetic diseases with more than 300,000 severely affected individuals born throughout the world every year. Because of the easy accessibility of purified, highly specialized, mature erythroid cells from peripheral blood, the hemoglobinopathies were among the first tractable human molecular diseases. From the 1970s onward, the analysis of the large repertoire of mutations underlying these conditions has elucidated many of the principles by which mutations occur and cause human genetic diseases. This work will summarize our current knowledge of the α-thalassemias, illustrating how detailed analysis of this group of diseases has contributed to our understanding of the general molecular mechanisms underlying many orphan and common diseases.

  7. 'Rakter dosh'--corrupting blood: The challenges of preventing thalassemia in Bengal, India.

    PubMed

    Chattopadhyay, Sreeparna

    2006-11-01

    Thalassemia is an inherited blood disorder that has been receiving increasing attention in India. However, prevention of thalassemia in India continues to be difficult despite efforts of public health professionals and the government. Using West Bengal as a case study, this paper attempts to unravel some of the barriers to the prevention campaign and the consequent under utilization of the program. Lack of access, low awareness, low-risk perception and poverty are all important proximate constraints; however, one of the greatest barriers to the program is rooted in cultural notions of blood, marriage, identity, personhood and kinship in Bengali society. Blood is so deeply valued in the Bengali kinship system that this genetic mutation is perceived to be corrupting the blood (rakter dosh). Being a thalassemia carrier (i.e., having thalassemia minor) renders an individual unfit as a suitable marriage partner because of beliefs related to purity of blood, its association with the continuity of the lineage, and subsequent transmission of desirable traits to future generations. The risk of non-marriage affects women disproportionately, and parents are not inclined to test their daughters because of the possibility of not being able to marry them off to eligible suitors. The stigma associated with having thalassemia minor (TMI) is a deterrent to the disclosure of thalassemia status as well as to testing. Using anthropological theories and ethnographic methods, this paper focuses on the gendered process by which the diagnosis of a thalassemia carrier 'spoils' identities, thereby creating a disjuncture between the goals of the prevention program and people's need for social conformity, and ultimately between medical desirability and social desirability. The paper also suggests policies for enhancing the utilization of the program. Finally the conclusions from this study have potential applications for public health prevention programs that confront problems of stigma in

  8. Decreased nitrite levels in erythrocytes of children with β-thalassemia/hemoglobin E.

    PubMed

    Suvachananonda, Thitiwat; Wankham, Amara; Srihirun, Sirada; Tanratana, Pansakorn; Unchern, Supeenun; Fucharoen, Suthat; Chuansumrit, Ampaiwan; Sirachainan, Nongnuch; Sibmooh, Nathawut

    2013-09-01

    Nitrite anion is bioactive nitric oxide (NO) species circulating in blood, and represents the NO bioavailability and endothelial function. In this study, we aimed to investigate the nitrite levels and the correlation with hemolysis and severity in β-thalassemia/hemoglobin E (β-thal/HbE). 38 Children (12.0±1.9 years of age) with a diagnosis of mild, moderate and severe β-thalassemia were enrolled in the study. The blood nitrite levels and potential plasma NO consumption were measured by the chemiluminescence method. The nitrite levels in whole blood and erythrocytes of the severe thalassemia subjects were lower than those of the control subjects. At day 7 after transfusion of packed erythrocytes, the nitrite levels in erythrocytes increased. The plasma hemoglobin and NO consumption increased in the severe thalassemia subjects. The nitrite levels in erythrocytes inversely correlated with plasma hemoglobin, lactate dehydrogenase activity, potential NO consumption, and lipid peroxidation. Our studies demonstrate the decreased NO bioavailability in thalassemia, which could result from endothelial dysfunction, the increased potential NO consumption in plasma by cell-free hemoglobin and oxidative stress. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Fulminant Liver Failure in a Child With β-Thalassemia on Deferasirox: A Case Report.

    PubMed

    Ramaswami, Archie; Rosen, Danya J; Chu, Jaime; Wistinghausen, Birte; Arnon, Ronen

    2017-04-01

    Deferesirox (DFX), an oral chelating agent, is used to treat chronic iron overload in several hematological diseases such as β-thalassemia, sickle cell disease, and myelodysplastic anemia. DFX is generally well tolerated with the exception of gastrointestinal disturbances and rash, although cases of renal toxicity, as well as acute and chronic liver failure, have been reported in adults and children. Here we describe a 3-year-old girl with β-thalassemia undergoing treatment with DFX who presented with acute liver failure and Fanconi's syndrome. It is important for pediatric gastroenterologists, hepatologists, and hematologists to be aware that the commonly used drug DFX can lead to acute liver failure in children, and liver function should be monitored closely in all patients taking DFX.

  10. Beta-1-Selective Beta-Blockers and Cognitive Functions in Patients With Coronary Artery Disease: A Cross-Sectional Study.

    PubMed

    Burkauskas, Julius; Noreikaite, Aurelija; Bunevicius, Adomas; Brozaitiene, Julija; Neverauskas, Julius; Mickuviene, Narseta; Bunevicius, Robertas

    2016-01-01

    The association between current beta-1-selective beta-blocker use and cognitive function was evaluated in 722 patients with coronary artery disease without dementia. Beta-1-selective beta-blocker use was associated with worse incidental learning independently of sociodemographic characteristics, clinical coronary artery disease severity, and depression/anxiety.

  11. Cost utility analysis of reduced intensity hematopoietic stem cell transplantation in adolescence and young adult with severe thalassemia compared to hypertransfusion and iron chelation program.

    PubMed

    Sruamsiri, Rosarin; Chaiyakunapruk, Nathorn; Pakakasama, Samart; Sirireung, Somtawin; Sripaiboonkij, Nintita; Bunworasate, Udomsak; Hongeng, Suradej

    2013-02-05

    Hematopoieticic stem cell transplantation is the only therapeutic option that can cure thalassemia disease. Reduced intensity hematopoietic stem cell transplantation (RI-HSCT) has demonstrated a high cure rate with minimal complications compared to other options. Because RI-HSCT is very costly, economic justification for its value is needed. This study aimed to estimate the cost-utility of RI-HSCT compared with blood transfusions combined with iron chelating therapy (BT-ICT) for adolescent and young adult with severe thalassemia in Thailand. A Markov model was used to estimate the relevant costs and health outcomes over the patients' lifetimes using a societal perspective. All future costs and outcomes were discounted at a rate of 3% per annum. The efficacy of RI-HSCT was based a clinical trial including a total of 18 thalassemia patients. Utility values were derived directly from all patients using EQ-5D and SF-6D. Primary outcomes of interest were lifetime costs, quality adjusted life-years (QALYs) gained, and the incremental cost-effectiveness ratio (ICER) in US ($) per QALY gained. One-way and probabilistic sensitivity analyses (PSA) were conducted to investigate the effect of parameter uncertainty. In base case analysis, the RI-HSCT group had a better clinical outcomes and higher lifetime costs. The incremental cost per QALY gained was US $3,236 per QALY. The acceptability curve showed that the probability of RI-HSCT being cost-effective was 71% at the willingness to pay of 1 time of Thai Gross domestic product per capita (GDP per capita), approximately US $4,210 per QALY gained. The most sensitive parameter was utility of severe thalassemia patients without cardiac complication patients. At a societal willingness to pay of 1 GDP per capita, RI-HSCT was a cost-effective treatment for adolescent and young adult with severe thalassemia in Thailand compared to BT-ICT.

  12. Do tribal communities show an inverse relationship between sickle cell disorders and glucose-6-phosphate dehydrogenase deficiency in malaria endemic areas of Central-Eastern India?

    PubMed

    Balgir, R S

    2006-01-01

    Tribal communities in India constitute the largest tribal population in the world. There are about 635 biological isolates (tribes and subtribes), which constituted 8.08% (about 84.3 million) of the total population of India as per the 2001 census. Out of 635 scheduled tribes (aborigines), 62 live in the state of Orissa alone forming about 10.8% of the tribal population of India. Orissa state occupies an important place, being the 3rd in rank for the highest concentration of tribal population in the country. In India, tribal communities are highly vulnerable to hereditary diseases and have a high degree of malnutrition, morbidity and mortality. The sickle cell haemoglobinopathy and glucose-6-phosphate dehydrogenase (G6PD) enzyme deficiency are important genetic and public health problems in Central-Eastern part of India. In order to map out these genetic disorders among the tribal people, a cross-section of 15 major tribal communities from different parts of Orissa was randomly screened for haemoglobin variants and G6PD deficiency. The high frequency of sickle cell haemoglobinopathy (0-22.4%) and G6PD deficiency (4.3-17.4%), with beta-thalassemia trait (0-8.5%) taking almost an intermediate position, was observed. For G6PD deficiency, hemizygous males as well as female heterozygotes and female homozygotes were detected. Twelve cases showed compound heterozygosity for sickle cell haemoglobinopathy and G6PD deficiency. There seems to be a trend towards an inverse relationship between the sickle cell allele and G6PD deficiency, and sickle cell and beta-thalassemia allele in a cross-section of malaria endemic (Plasmodium falciparum) tribal communities in Orissa. When the frequency of sickle cell allele decreases in a cross-section of malaria endemic tribal population, the frequency of G6PD enzyme deficiency and beta-thalassemia allele increases and vice versa. Natural selection had played a major role in favour of sickle cell, beta-thalassemia and G6PD mutation alleles

  13. Beta-blocker withdrawal among patients presenting for surgery from home

    PubMed Central

    Schonberger, Robert B.; Lukens, Carrie L.; Turkoglu, O. Dicle; Feinleib, Jessica L.; Haspel, Kenneth L.; Burg, Matthew M.

    2012-01-01

    Structured Abstract Objective This study sought to measure the incidence of perioperative beta-blocker non-compliance by patients who were prescribed chronic beta blocker therapy and presented for surgery from home. The effect of patient non-compliance on day of surgery presenting heart rate was also examined. Design Prospective observational study with outcome data obtained from review of the medical record. Setting The preoperative clinic and operating rooms of a Veterans Administration hospital. Participants Patients on chronic beta blocker therapy who presented from home for surgery. Interventions None. Measurements and Main Results Demographic and comorbidity data as well as data on self-reported compliance to beta-blocker therapy, initial day of surgery vital signs, and recent ambulatory vital signs were collected. Ten out of fifty subjects (20%; 95% CI = 9-31%) reported not taking their day of surgery beta-blocker. These self-reported non-adherers demonstrated a higher presenting heart rate on the day of surgery vs. adherent subjects (median of 78 beats per minute vs. 65 beats per minute, p=0.02 by Wilcoxon Rank-Sum Test). The difference-in-difference between baseline primary care and day of surgery heart rate was also statistically significant between compliant and non-compliant subjects (-7 beats per minute vs. +12.5 beats per minute, p<0.00001). Conclusions Patient self-report and physiologic data documented failure to take beta-blockers and possible beta-blocker withdrawal in 20% of patients who presented for surgery from home. If these findings are confirmed in larger studies, improved patient understanding of and compliance with medication instructions during preoperative visits should be a focus of future quality improvement initiatives. PMID:22418043

  14. Tolerability to beta-blocker therapy among heart failure patients in clinical practice.

    PubMed

    Butler, Javed; Khadim, Ghazanfar; Belue, Rhonda; Chomsky, Don; Dittus, Robert S; Griffin, Marie; Wilson, John R

    2003-06-01

    Although beta-blockers were well-tolerated by heart failure (HF) patients in clinical trials, tolerability of these drugs in a general population of HF patients is not well-described. We studied a total of 308 encounters with beta-blockers therapy in 268 ambulatory HF patients. Side effects and frequency and predictors of discontinuation of therapy were studied. Independent predictors of discontinuation were assessed. Weight gain (59%), fatigue (56%), dizziness (41%), and dyspnea (29%) were the most common side effects. Fifty-one patients (19%) were discontinued on therapy with any 1 particular beta-blocker. Fatigue (30%) and hypotension (28%) were the most common reasons for discontinuation. Forty (78%) of these were given a trial with a different beta-blocker. Of these, 22 (55%) attempts with a different beta-blocker were tolerated. Thus the overall absolute discontinuation rate was only 7% for patients who were given a trial with different beta-blockers or 11% for the entire study population. Independent predictors of discontinuation of therapy included advanced symptoms, nonischemic etiology, history of pulmonary disease, and higher diuretic doses. Side effects with beta-blockers in a general population of HF patients are common; however, with changes in medical management, most patients can tolerate them eventually. In case of intolerance to one kind, a trial with a different beta-blocker is indicated.

  15. Diverse hematological phenotypes of β-thalassemia carriers.

    PubMed

    Luo, Hong-Yuan; Chui, David H K

    2016-03-01

    Most β-thalassemia carriers have mild anemia, low mean corpuscular volume and mean corpuscular hemoglobin, and elevated hemoglobin α2 (HbA2 ). However, there is considerable variability resulting from coinheritance with α- and/or δ-globin gene mutations, dominant inheritance of β-thalassemia mutations, highly unstable variant globin chains, large deletions removing part or all of the β-globin gene cluster, loss of heterozygosity of the β-globin gene cluster during development, or concomitant erythroid enzyme or membrane protein abnormalities. Recognition of the specific abnormality and correct diagnosis can allay anxiety and unnecessary investigation, help formulate treatment programs, and deliver appropriate genetic and family counseling. © 2016 New York Academy of Sciences.

  16. β-Globin chain abnormalities with coexisting α-thalassemia mutations

    PubMed Central

    Canataroglu, Abdullah; Unsal, Cagatay; Yildiz, Sule Menziletoglu; Turhan, Ferda Tekin; Bozdogan, Sevcan Tug; Dincer, Suleyman; Erkman, Hakan

    2012-01-01

    Introduction The frequency of hemoglobinopathies is still high in Adana, the biggest city of the Cukurova Region that is located in the southern part of Turkey. Our aim was to identify the concomitant mutations in α- and β-globin genes which lead to complex hemoglobinopathies and to establish an appropriate plan of action for each subject, particularly when prenatal diagnosis is necessary. Material and methods We studied the association between the β-globin gene and α-thalassemia genotypes. The reverse hybridization technique was employed to perform molecular analysis, and the results were confirmed by amplification refractory mutation system (ARMS) or restriction fragment length polymorphism (RFLP) technique. Results We evaluated 36 adult subjects (28 female and 8 male; age range: 18-52 years) with concomitant mutations in their α- and β-globin genes. The –α3.7/αα deletion was the commonest defect in the α-chain as expected, followed by α3.7/–α3.7 deletion. Twenty-five of 36 cases were sickle cell trait with coexisting α-thalassemia, while seven Hb S/S patients had concurrent mutations in their α-genes. The coexistence of αPolyA-2α/αα with Hb A/D and with Hb S/D, which is very uncommon, was also detected. There was a subject with compound heterozygosity for β-globin chain (–α3.7/αα with IVSI.110/S), and also a case who had –α3.7/αα deletion with IVSI.110/A. Conclusions Although limited, our data suggest that it would be valuable to study coexisting α-globin mutations in subjects with sickle cell disease or β-thalassemia trait during the screening programs for premarital couples, especially in populations with a high frequency of hemoglobinopathies. PMID:23056075

  17. N-Acetylcysteine supplementation reduces oxidative stress and DNA damage in children with β-thalassemia.

    PubMed

    Ozdemir, Zeynep Canan; Koc, Ahmet; Aycicek, Ali; Kocyigit, Abdurrahim

    2014-01-01

    There are several reports that increased oxidative stress and DNA damage were found in β-thalassemia major (β-TM) patients. In this study, we aimed to evaluate the effects of N-acetylcysteine (NAC) and vitamin E on total oxidative stress and DNA damage in children with β-TM. Seventy-five children with transfusion-dependent β-thalassemia (β-thal) were randomly chosen to receive 10 mg/kg/day of NAC or 10 IU/kg/day of vitamin E or no supplementation; 28 healthy controls were also included in the study. Serum total oxidant status (TOS) and total antioxidant capacity (TAC) were measured, oxidative stress index (OSI) was calculated, and mononuclear DNA damage was assessed by alkaline comet assay; they were determined before treatment and after 3 months of treatment. Total oxydent status, OSI, and DNA damage levels were significantly higher and TAC levels were significantly lower in the thalassemic children than in the healthy controls (p < 0.001). In both supplemented groups, mean TOS and OSI levels were decreased; TAC and pre transfusion hemoglobin (Hb) levels were significantly increased after 3 months (p ≤ 0.002). In the NAC group, DNA damage score decreased (p = 0.001). N-Acetylcysteine and vitamin E may be effective in reducing serum oxidative stress and increase pre transfusion Hb levels in children with β-thal. N-Acetylcysteine also can reduce DNA damage.

  18. Cost utility analysis of reduced intensity hematopoietic stem cell transplantation in adolescence and young adult with severe thalassemia compared to hypertransfusion and iron chelation program

    PubMed Central

    2013-01-01

    Background Hematopoieticic stem cell transplantation is the only therapeutic option that can cure thalassemia disease. Reduced intensity hematopoietic stem cell transplantation (RI-HSCT) has demonstrated a high cure rate with minimal complications compared to other options. Because RI-HSCT is very costly, economic justification for its value is needed. This study aimed to estimate the cost-utility of RI-HSCT compared with blood transfusions combined with iron chelating therapy (BT-ICT) for adolescent and young adult with severe thalassemia in Thailand. Methods A Markov model was used to estimate the relevant costs and health outcomes over the patients’ lifetimes using a societal perspective. All future costs and outcomes were discounted at a rate of 3% per annum. The efficacy of RI-HSCT was based a clinical trial including a total of 18 thalassemia patients. Utility values were derived directly from all patients using EQ-5D and SF-6D. Primary outcomes of interest were lifetime costs, quality adjusted life-years (QALYs) gained, and the incremental cost-effectiveness ratio (ICER) in US ($) per QALY gained. One-way and probabilistic sensitivity analyses (PSA) were conducted to investigate the effect of parameter uncertainty. Results In base case analysis, the RI-HSCT group had a better clinical outcomes and higher lifetime costs. The incremental cost per QALY gained was US $ 3,236 per QALY. The acceptability curve showed that the probability of RI-HSCT being cost-effective was 71% at the willingness to pay of 1 time of Thai Gross domestic product per capita (GDP per capita), approximately US $ 4,210 per QALY gained. The most sensitive parameter was utility of severe thalassemia patients without cardiac complication patients. Conclusion At a societal willingness to pay of 1 GDP per capita, RI-HSCT was a cost-effective treatment for adolescent and young adult with severe thalassemia in Thailand compared to BT-ICT. PMID:23379888

  19. Combination of Hb Heze [β144(HC1)Lys→Arg; HBB: c.434A>G] and β0-Thalassemia in a Chinese Patient with β-Thalassemia Intermedia.

    PubMed

    Li, Yan; Yan, Jin-Mei; Zhou, Jian-Ying; Lu, Yue-Cheng; Li, Dong-Zhi

    2017-01-01

    We first report a novel β chain variant, Hb Heze [β144(HC1)Lys→Arg; HBB: c.434A>G], in a Chinese family. Heterozygous inheritance of the mutation results in a mild β-thalassemia (β-thal) phenotype, whereas compound heterozygosity of Hb Heze with β 0 -thal appears as the cause of β-thal intermedia (β-TI) in our case.

  20. [Therapy of heart failure with beta-blockers?].

    PubMed

    Osterziel, K J; Dietz, R

    1997-01-01

    In heart failure the chronic sympathetic stimulation alters the cardiac beta-adrenergic pathway. This alteration leads to a diminished contractile response to stimulation of the cardiac beta 1 receptor. A blockade of the beta 1 receptor partly restores the physiologic response to sympathetic stimulation at rest and during exercise. Several mechanisms resulting from the competitive blockade of the beta 1 receptor may be important. The major effect of beta-blockers seems to be triggered by a reduction of the heart rate at rest resulting in an increase of the left ventricular ejection fraction on the average by 7-8%. Patients with heart failure who are treated with a beta-blocker experience initially a slight decrease of the left ventricular function. beta-blocker therapy should therefore be initiated only in patients with stable heart failure. The starting dose of the beta-blocker has to be very small, e.g, 5 mg Metoprolol, 1.25 mg Bisoprolol or 3.125 mg Carvedilol. In a stepwise fashion the dose has to be increased to a full beta blocking effect over a period of 4-8 weeks. Despite a careful dose titration only 90% of the patients tolerate this regimen. Patients with high resting heart rates and/or dilated cardiomyopathy will have the greatest benefit. The two main reasons for withdrawal of the beta-blocker are deterioration of heart failure or symptomatic hypotension. Symptomatic improvement and a significant increase of exercise capacity appear gradually and can be measured only after more than 1 month duration of therapy. Three multicenter studies (MDC. CIBIS I, Carvedilol) evaluated the influence of beta-blockers on prognosis of heart failure. The MDC trial demonstrated a slower progression of heart failure with Metoprolol. The MDC and the CIBIS I trial could not show a significant improvement of prognosis. The larger trial with carvedilol was the first study to demonstrate a decreased mortality in patients who initially tolerate the beta-blocker therapy. One

  1. Microcytic hypochromic anemia: should high performance liquid chromatography be used routinely for screening anemic and antenatal patients?

    PubMed

    Philip, Joseph; Sarkar, Ravi Shankar; Kushwaha, Neerja

    2013-01-01

    Hemoglobinopathies are the most common inherited red cell disorders worldwide. Identification of these disorders is immensely important epidemiologically and for improved management protocols. Our aim was to determine the prevalence of hemoglobinopathies in patients with microcytic hypochromic anemia and to assess the suitability of using high performance liquid chromatography (HPLC) routinely for screening antenatal cases and patients with anemia. A total of 4335 cases received from Mar 2007 to Nov 2011 were studied for various hemoglobinopathies and variants on BIO RAD 'VARIANT' analyzer. Of the 4335 cases studied, 2119 were antenatal cases, 1710 patients with other disorders and 506 family studies. Of these, 688 cases displayed abnormal hemoglobin fractions on HPLC of which 140 were antenatal women. There were 455 cases of β thalassemia trait, 24 β thalassemia major, 20 thalassemia inter-media, 54 sickle cell trait, fivesickle cell disease, 21 double heterozygous β thalassemia-sickle cell trait, nineand 4 Hb D- Punjab heterozygous and homozygous respectively, three Hb D β Thalassemia trait, 20 and 37 Hb E homozygous and heterozygous respectively, three Hb E β Thalassemia trait and four cases of Hb Q India. Twenty nine adults had isolated HbF elevation. Our study found a high prevalence (15.8%) of hemoglobinopathies amongst microcytic hypochromic anemia and antenatal cases. An accurate diagnosis helps in preventing unnecessary iron loading. Screening all antenatal cases with anemia helps in timely antenatal counseling, thus preventing the psychological trauma of bearing a transfusion dependent child for life.

  2. Pathophysiology and Clinical Manifestations of the β-Thalassemias

    PubMed Central

    Nienhuis, Arthur W.; Nathan, David G.

    2012-01-01

    The β-thalassemia syndromes reflect deficient or absent β-globin synthesis usually owing to a mutation in the β-globin locus. The relative excess of α-globin results in the formation of insoluble aggregates leading to ineffective erythropoiesis and shortened red cell survival. A relatively high capacity for fetal hemoglobin synthesis is a major genetic modifier of disease severity, with polymorphisms in other genes also having a significant role. Iron overload secondary to enhanced absorption and red cell transfusions causes an increase in liver iron and in various other tissues, leading to endocrine and cardiac dysfunction. Modern chelation regimens are effective in removing iron and preserving or restoring organ function. PMID:23209183

  3. Preclinical Evaluation of Efficacy and Safety of an Improved Lentiviral Vector for the Treatment of β-Thalassemia and Sickle Cell Disease

    PubMed Central

    Negre, Olivier; Bartholomae, Cynthia; Beuzard, Yves; Cavazzana, Marina; Christiansen, Lauryn; Courne, Céline; Deichmann, Annette; Denaro, Maria; de Dreuzy, Edouard; Finer, Mitchell; Fronza, Raffaele; Gillet-Legrand, Béatrix; Joubert, Christophe; Kutner, Robert; Leboulch, Philippe; Maouche, Leïla; Paulard, Anaïs; Pierciey, Francis J.; Rothe, Michael; Ryu, Byoung; Schmidt, Manfred; von Kalle, Christof; Payen, Emmanuel; Veres, Gabor

    2015-01-01

    A previously published clinical trial demonstrated the benefit of autologous CD34+ cells transduced with a self-inactivating lentiviral vector (HPV569) containing an engineered β-globin gene (βA-T87Q-globin) in a subject with β-thalassemia major. This vector has been modified to increase transduction efficacy without compromising safety. In vitro analyses indicated that the changes resulted in both increased vector titers (3 to 4 fold) and increased transduction efficacy (2 to 3 fold). An in vivo study in which 58 β-thalassemic mice were transplanted with vector- or mock-transduced syngenic bone marrow cells indicated sustained therapeutic efficacy. Secondary transplantations involving 108 recipients were performed to evaluate long-term safety. The six month study showed no hematological or biochemical toxicity. Integration site (IS) profile revealed an oligo/polyclonal hematopoietic reconstitution in the primary transplants and reduced clonality in secondary transplants. Tumor cells were detected in the secondary transplant mice in all treatment groups (including the control group), without statistical differences in the tumor incidence. Immunohistochemistry and quantitative PCR demonstrated that tumor cells were not derived from transduced donor cells. This comprehensive efficacy and safety data provided the basis for initiating two clinical trials with this second generation vector (BB305) in Europe and in the USA in patients with β-thalassemia major and sickle cell disease. PMID:25429463

  4. Effect of reduced agalsidase Beta dosage in fabry patients: the Australian experience.

    PubMed

    Ghali, Joanna; Nicholls, Kathy; Denaro, Charles; Sillence, David; Chapman, Ian; Goldblatt, Jack; Thomas, Mark; Fletcher, Janice

    2012-01-01

    In Australia, enzyme replacement therapy (ERT) for Fabry Disease (FD), both Agalsidase alfa (Replagal, Shire HGT) and beta (Fabrazyme, Genzyme), is funded and monitored through a specific government program. Agalsidase beta supply has been rationed by Genzyme since 2009 due to manufacturing issues. Consequently, the Australian Fabry Disease Advisory Committee has treated patients on Agalsidase beta at 50% of their usual dose from mid-2009, with a further reduction to 30% for some patients from late 2009. To determine the clinical effect of Agalsidase beta dose reduction in the Australian FD patient cohort. A questionnaire assessing FD symptoms was administered to 40 patients on long-term ERT. Clinical data from The Fabry Registry for patients receiving Agalsidase alfa or beta, for at least 2 years prior to the time of enforced Agalsidase beta dose reduction, were reviewed. Disease burden and quality of life (QOL) were graded using the Disease Severity Scoring System, Mainz Severity Score Index, Brief Pain Inventory and Short Form 36 Health Survey at 2 years before dose reduction, at the time of dose reduction and at the most recent clinical review following dose reduction. Disease severity and QOL scores did not change between the ERT groups. Males on Agalsidase beta reported lower energy levels after dose reduction, while no change was reported by females on either product or by males on a stable dose of Agalsidase alfa. This study suggests that energy levels in male patients worsen after dose reduction of Agalsidase beta.

  5. Detection of Parvovirus B19 Infection in Thalasemic Patients in Isfahan Province, Iran

    PubMed Central

    Nikoozad, Razieh; Mahzounieh, Mohammad Reza; Ghorani, Mohammad Reza

    2015-01-01

    Background: Parvovirus B19, a member of the Erythrovirus genus of Parvoviridae family, causes various clinical illnesses including infectious erythema, arthropathy, hydrops fetalis or congenital anemia, and transient aplastic crises. The B19 virus can be transmitted through respiratory secretions, blood products, and blood transfusion. Objectives: The aim of this study was to detect the B19 virus in thalassemia patients in Isfahan, Iran. Patients and Methods: The prevalence of parvovirus B19 infection was compared between thalassemia major patients and healthy subjects. Plasma samples were collected from 30 thalassemia patients from Isfahan, Iran. Thirty patients without any blood complications were considered as the control group. After DNA extraction from the plasma samples, polymerase chain reaction was performed for parvovirus B19 detection. Results: The parvovirus B19-specific nucleotide sequence was detected in 6 patients (20%). None of the samples obtained from the 30 control subjects tested positive for B19. Conclusions: In this study B19-Parvovirus infection were detected in patients with hematologic disorders in comparison with control subjects. Screening of patients with a high risk of parvovirus B19 infection can considerably reduce the incidence and prevalence of B19 infection. PMID:26855745

  6. Hypermethylation of 28S ribosomal RNA in β-thalassemia trait carriers.

    PubMed

    Sornjai, Wannapa; Lithanatudom, Pathrapol; Erales, Jenny; Joly, Philippe; Francina, Alain; Hacot, Sabine; Fucharoen, Suthat; Svasti, Saovaros; Diaz, Jean Jacques; Mertani, Hichem C; Smith, Duncan R

    2017-01-01

    Ribosome biogenesis is the process of synthesis of the cellular ribosomes which mediate protein translation. Integral with the ribosomes are four cytoplasmic ribosomal RNAs (rRNAs) which show extensive post-transcriptional modifications including 2'-O-methylation and pseudouridylation. Several hereditary hematologic diseases including Diamond-Blackfan anemia have been shown to be associated with defects in ribosome biogenesis. Thalassemia is the most important hematologic inherited genetic disease worldwide, and this study examined the post-transcriptional ribose methylation status of three specific active sites of the 28S rRNA molecule at positions 1858, 4197 and 4506 of β-thalassemia trait carriers and normal controls. Samples from whole blood and cultured erythroid cells were examined. Results showed that site 4506 was hypermethylated in β-thalassemia trait carriers in both cohorts. Expression of fibrillarin, the ribosomal RNA methyltransferase as well as snoRNAs were additionally quantified by RT-qPCR and evidence of dysregulation was seen. Hemoglobin E trait carriers also showed evidence of dysregulation. These results provide the first evidence that ribosome biogenesis is dysregulated in β-thalassemia trait carriers. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. The complexity of selection at the major primate beta-defensin locus.

    PubMed

    Semple, Colin A M; Maxwell, Alison; Gautier, Philippe; Kilanowski, Fiona M; Eastwood, Hayden; Barran, Perdita E; Dorin, Julia R

    2005-05-18

    We have examined the evolution of the genes at the major human beta-defensin locus and the orthologous loci in a range of other primates and mouse. For the first time these data allow us to examine selective episodes in the more recent evolutionary history of this locus as well as the ancient past. We have used a combination of maximum likelihood based tests and a maximum parsimony based sliding window approach to give a detailed view of the varying modes of selection operating at this locus. We provide evidence for strong positive selection soon after the duplication of these genes within an ancestral mammalian genome. Consequently variable selective pressures have acted on beta-defensin genes in different evolutionary lineages, with episodes both of negative, and more rarely positive selection, during the divergence of primates. Positive selection appears to have been more common in the rodent lineage, accompanying the birth of novel, rodent-specific beta-defensin genes. These observations allow a fuller understanding of the evolution of mammalian innate immunity. In both the rodent and primate lineages, sites in the second exon have been subject to positive selection and by implication are important in functional diversity. A small number of sites in the mature human peptides were found to have undergone repeated episodes of selection in different primate lineages. Particular sites were consistently implicated by multiple methods at positions throughout the mature peptides. These sites are clustered at positions predicted to be important for the specificity of the antimicrobial or chemoattractant properties of beta-defensins. Surprisingly, sites within the prepropeptide region were also implicated as being subject to significant positive selection, suggesting previously unappreciated functional significance for this region. Identification of these putatively functional sites has important implications for our understanding of beta-defensin function and for novel

  8. Detection of Parvovirus B19 Infection in Thalasemic Patients in Isfahan Province, Iran.

    PubMed

    Nikoozad, Razieh; Mahzounieh, Mohammad Reza; Ghorani, Mohammad Reza

    2015-11-01

    Parvovirus B19, a member of the Erythrovirus genus of Parvoviridae family, causes various clinical illnesses including infectious erythema, arthropathy, hydrops fetalis or congenital anemia, and transient aplastic crises. The B19 virus can be transmitted through respiratory secretions, blood products, and blood transfusion. The aim of this study was to detect the B19 virus in thalassemia patients in Isfahan, Iran. The prevalence of parvovirus B19 infection was compared between thalassemia major patients and healthy subjects. Plasma samples were collected from 30 thalassemia patients from Isfahan, Iran. Thirty patients without any blood complications were considered as the control group. After DNA extraction from the plasma samples, polymerase chain reaction was performed for parvovirus B19 detection. The parvovirus B19-specific nucleotide sequence was detected in 6 patients (20%). None of the samples obtained from the 30 control subjects tested positive for B19. In this study B19-Parvovirus infection were detected in patients with hematologic disorders in comparison with control subjects. Screening of patients with a high risk of parvovirus B19 infection can considerably reduce the incidence and prevalence of B19 infection.

  9. Beta blockers in patients with end-stage renal disease-Evidence-based recommendations.

    PubMed

    Weir, Matthew A; Herzog, Charles A

    2018-05-01

    For patients who require hemodialysis, beta blockers offer a simultaneous opportunity and challenge in the treatment of cardiovascular disease. Beta blockers are well supported by data from nondialysis populations and directly mitigate the sympathetic overactivity that links chronic kidney disease with cardiovascular sequelae. However, the evidence supporting their use in patients receiving hemodialysis is sparse and the heterogeneity of the beta blocker class makes it difficult to prescribe these medications with confidence. Despite these limitations, both trial and observational data exist that can help guide the use of these medications. In this review, we outline the reasons to consider beta blockers for patients receiving hemodialysis, discuss the barriers to their use, and provide specific evidence-based recommendations for beta blocker use in patients with heart failure, hypertension, ischemic heart disease and arrhythmia. © 2018 Wiley Periodicals, Inc.

  10. Fetal hemoglobin regulation in β-thalassemia: heterogeneity, modifiers and therapeutic approaches.

    PubMed

    Sripichai, Orapan; Fucharoen, Suthat

    2016-12-01

    Stress erythropoiesis induces fetal hemoglobin (HbF) expression in β-thalassemias, however the level of expression is highly variable. The last decade has seen dramatic advances in our understanding of the molecular regulators of HbF production and the genetic factors associated with HbF levels, leading to the promise of new methods of the clinical induction of HbF. Areas covered: This article will review the heterogeneity and genetic modifiers of HbF and HbF induction therapy in β-thalassemia. Expert commentary: One promising curative β-thalassemia therapy is to induce HbF synthesis in β-thalassemic erythrocytes to therapeutic levels before clinical symptom occurs. Further understanding of HbF level variation and regulation is needed in order to predict the response from HbF-inducing approaches.

  11. Beta-blockers and cardiovascular outcomes in dialysis patients: a cohort study in Ontario, Canada.

    PubMed

    Kitchlu, Abhijat; Clemens, Kristin; Gomes, Tara; Hackam, Daniel G; Juurlink, David N; Mamdani, Muhammad; Manno, Michael; Oliver, Matthew J; Quinn, Robert R; Suri, Rita S; Wald, Ron; Yan, Andrew T; Garg, Amit X

    2012-04-01

    Beta-blockers may be cardioprotective in patients receiving chronic dialysis. We examined cardiovascular outcomes among incident dialysis patients receiving beta-blocker therapy. We conducted a retrospective cohort study employing linked healthcare databases in Ontario, Canada. We studied all consecutive chronic dialysis patients aged≥66 years who initiated dialysis between 1 July 1991 and 31 July 2007. Patients were divided into three groups according to new medication use after the initiation of chronic dialysis. The three groups were patients initiated on beta-blockers, calcium channel blockers and statins only. Patients in the beta-blocker and calcium channel blocker groups could also be concurrently receiving a statin. The primary outcome was time to a composite endpoint of death, myocardial infarction, stroke or coronary revascularization. There were a total of 1836 patients (504 beta-blocker, 570 calcium channel blocker and 762 statin-only users). Compared to statin-only use, beta-blocker use was not associated with improved cardiovascular outcomes [adjusted hazard ratio (aHR) 1.07, 95% confidence interval (CI) 0.92-1.23]. As expected, calcium channel blocker use was also not associated with improved cardiovascular outcomes (aHR 0.91, 95% CI 0.79-1.06). Among all subgroup analyses by beta-blocker attributes, only high-dose beta-blocker therapy was associated with better cardiovascular outcomes as compared to low-dose beta-blockers (aHR 0.50, 95% CI 0.29-0.88). We observed no beneficial effect of beta-blocker use among patients receiving chronic dialysis relative to our comparator groups. Given current uncertainty around the cardioprotective benefits of beta-blockers in patients receiving dialysis, a large randomized clinical trial is warranted.

  12. Antibody screening in multitransfused patients: a prerequisite before each transfusion.

    PubMed

    Lamba, Divjot S; Mittal, Kshitija; Sood, Tanvi; Bedi, Ravneet Kaur; Kaur, Paramjit; Kaur, Gagandeep

    2014-10-01

    Life-long red blood cell (RBC) transfusions remain the main treatment for severe thalassemia. We hereby report a case of anti S and anti Lu(a) in a β-thalassemia major patient detected incidentally on antibody screening. The patient was a known case of β-thalassemia major and was on regular blood transfusion every 3 weeks from the institute from the age of 6 months. Subsequently, on one occasion, patient's crossmatch was compatible despite positive antibody screen using microcolumn gel technique. Autocontrol and direct antiglobulin test were negative on microcolumn gel. Anti S and anti Lu(a) antibodies were identified. Blood unit found compatible was negative for S and Lu(a) antigens. Antibody titers were 1:1 for both anti S and anti Lu(a) in AHG phase using tube technique and antibodies were of IgG type. Blood unit was transfused uneventfully to the patient. Donors were traced back (last three donations) and called for repeat blood sample testing for S and Lu(a) antigen. Two out of three donors were found to be S antigen positive and one out of these two was Lu(a) antigen positive. Anti S and anti Lu(a) antibodies were again identified on patient's subsequent visit for transfusion. The present case re-emphasize the importance of antibody screening at each visit in earlier detection of antibodies in multi transfused patients. Encouraging patients to receive transfusion from one center and dedicating donors could reduce alloimmunization rate but larger studies are required. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. A Phase II, Multicenter, Single-Arm Study to Evaluate the Safety and Efficacy of Deferasirox after Hematopoietic Stem Cell Transplantation in Children with β-Thalassemia Major.

    PubMed

    Yesilipek, Mehmet Akif; Karasu, Gulsun; Kaya, Zuhre; Kuskonmaz, Baris B; Uygun, Vedat; Dag, Ilkiz; Ozudogru, Onur; Ertem, Mehmet

    2018-03-01

    We conducted a prospective, phase II, multicenter, single-arm study to evaluate the efficacy and safety of deferasirox in patients age >2 to <18 years with β-thalassemia major (TM) who underwent hematopoietic stem cell transplantation (HSCT) and had evidence of iron overload (serum ferritin >1000 µg/L; cardiac MRI T2* <20 ms, or liver iron concentration [LIC; by MRI R2]  ≥5 mg/g). Patients received deferasirox at an initial dose of 10 mg/kg/day, with up-titration to a maximum of 20 mg/kg/day. The study continued for 52 weeks and included a total of 27 patients (mean age, 9.1 ± 3.8 years; 70.4% male). One patient (3.7%) was lost to follow-up. The majority of patients (n = 20; 74.1%) were able to achieve the intended dose of 20 mg/kg/day. No deaths occurred. A total of 134 adverse events (AEs) were reported in 25 patients (92.6%) during the study. The majority of patients had grade 1 or 2 AEs, with only 8 patients (29.6%) experiencing grade 3 AEs. Only 10 AEs occurring in 4 patients (14.8%) were suspected to be related to deferasirox (ALT/AST increase, n = 4; urinary tract infection, n = 1). The deferasirox dose had to be adjusted or interrupted for 6 AEs occurring in 4 patients (14.8%). A total of 6 serious AEs occurred in 3 patients (11.1%), none of which were suspected to be related to deferasirox. From baseline to week 52, there were decreases in median concentrations of alanine aminotransferase (ALT), from 30.0 to 17.0 IU/L, and aspartate aminotransferase (AST), from 35.5 to 26.0 IU/L. Median serum creatinine and cystatin C concentrations were similar at baseline and week 52. There was a continuous and significant decrease in median serum ferritin level from 1718.0 µg/L at baseline to 845.3 µg/L following 52 weeks of therapy (P < .001); 9 patients (33.3%) achieved a level of <500 µg/L. There was also a significant decrease in median LIC (from 8.6 to 4.1 mg/g; P < .001) and an increase in median cardiac

  14. Isothermal strand-displacement polymerase reaction for visual detection of the Southeast Asian-type deletion of α-thalassemia.

    PubMed

    Yu, Luxin; Wu, Wei; Lie, Puchang; Liu, Yunhua; Zeng, Lingwen

    2013-11-01

    A rapid and reliable screening test for thalassemia carrier couples is the most effective strategy to decrease the risk of conceiving fetuses with severe thalassemia. We present an approach based on the isothermal strand-displacement polymerase reaction and the use of a lateral flow strip for the visual detection of an α-thalassemia Southeast Asian-type deletion. This assay was used to evaluate 86 clinical samples (72 cases of Southeast Asian-type deletions and 14 cases of other types of thalassemia), and the results obtained were 100% consistent with those obtained using conventional gap-PCR. The approach thus provides a simple, sensitive, rapid, and cost-effective method for the diagnosis of thalassemia genotypes. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  15. Can hydroxyurea serve as a free radical scavenger and reduce iron overload in β-thalassemia patients?

    PubMed

    Italia, Khushnooma; Chandrakala, S; Ghosh, Kanjaksha; Colah, Roshan

    2016-09-01

    In this study, we hypothesize that hydroxyurea could provide an additional benefit as a free radical scavenger and/or iron chelator in β-thalassemia patients with iron overload. Twenty-one β-thalassemia intermedia patients who presented between 3 and 17 years but later required regular blood transfusions were enrolled for hydroxyurea therapy for a year. Fourteen patients responded to the therapy with hemoglobin levels maintained above 7.5 g/dl without transfusions. Hydroxyurea was discontinued after 6 months in seven patients who did not respond to the therapy and had to be continued on regular blood transfusions. We observed a statistically significant decrease in serum ferritin levels from 4194 ± 4850 ng/ml to 2129 ± 2380 ng/ml among the responders and from 2955 ± 2909 ng/ml to 2040 ± 2432 ng/ml among the non-responders and statistically significant decrease in labile iron pool from 18678.7 ± 10067.4 mean fluorescence intensity (MFI) to 14888.5 ± 5284.0 MFI among responders and from 17986.3 ± 9079.8 MFI to 15634.8 ± 8976.9 MFI among the non-responders after therapy. Phosphatidylserine externalization also showed a statistically significant decrease from 44.2 ± 22.2 MFI to 16.6 ± 6.7 MFI among the responders and from 46.9 ± 33.1 MFI to 39.8 ± 7.4 MFI among the non-responders along with a statistically significant decrease in the levels of reactive oxygen species from 72.8 ± 35.5 MFI to 29.0 ± 8.3 MFI among the responders and from 80.9 ± 41.4 MFI to 40.5 ± 15.8 MFI among the non-responders after therapy. A statistically significant increase in reduced glutathione levels was also observed from 430.8 ± 201.1 MFI to 715.5 ± 292.4 MFI among the responders and from 359.6 ± 165.6 MFI to 450.3 ± 279.5 MFI among the non-responders after therapy. This suggests the possible additional role of hydroxyurea as a free radical scavenger and

  16. A whole genome analyses of genetic variants in two Kelantan Malay individuals.

    PubMed

    Wan Juhari, Wan Khairunnisa; Md Tamrin, Nur Aida; Mat Daud, Mohd Hanif Ridzuan; Isa, Hatin Wan; Mohd Nasir, Nurfazreen; Maran, Sathiya; Abdul Rajab, Nur Shafawati; Ahmad Amin Noordin, Khairul Bariah; Nik Hassan, Nik Norliza; Tearle, Rick; Razali, Rozaimi; Merican, Amir Feisal; Zilfalil, Bin Alwi

    2014-12-01

    The sequencing of two members of the Royal Kelantan Malay family genomes will provide insights on the Kelantan Malay whole genome sequences. The two Kelantan Malay genomes were analyzed for the SNP markers associated with thalassemia and Helicobacter pylori infection. Helicobacter pylori infection was reported to be low prevalence in the north-east as compared to the west coast of the Peninsular Malaysia and beta-thalassemia was known to be one of the most common inherited and genetic disorder in Malaysia. By combining SNP information from literatures, GWAS study and NCBI ClinVar, 18 unique SNPs were selected for further analysis. From these 18 SNPs, 10 SNPs came from previous study of Helicobacter pylori infection among Malay patients, 6 SNPs were from NCBI ClinVar and 2 SNPs from GWAS studies. The analysis reveals that both Royal Kelantan Malay genomes shared all the 10 SNPs identified by Maran (Single Nucleotide Polymorphims (SNPs) genotypic profiling of Malay patients with and without Helicobacter pylori infection in Kelantan, 2011) and one SNP from GWAS study. In addition, the analysis also reveals that both Royal Kelantan Malay genomes shared 3 SNP markers; HBG1 (rs1061234), HBB (rs1609812) and BCL11A (rs766432) where all three markers were associated with beta-thalassemia. Our findings suggest that the Royal Kelantan Malays carry the SNPs which are associated with protection to Helicobacter pylori infection. In addition they also carry SNPs which are associated with beta-thalassemia. These findings are in line with the findings by other researchers who conducted studies on thalassemia and Helicobacter pylori infection in the non-royal Malay population.

  17. Prevalence of β thalassemia carrier state in Sindhi community of Wardha and evaluation of risk factors for β thalassemia trait.

    PubMed

    Rakholia, R; Chaturvedi, P

    2013-01-01

    To determine the prevalence of β thalassemia in Sindhi community of Wardha and evaluation of risk factors. To give genetic counseling to those diagnosed as carriers. Cross-sectional (prevalence study). Sindhi community residing in and around Wardha. 18 months. A total of 578 individuals belonging to Sindhi community residing in and around Wardha in India were selected by systemic randomization. Those who fulfilled the inclusion criteria and voluntarily gave consent were subject to Naked Eye Single Tube Rapid Osmotic Fragility Test (Nestroft). Those found positive by Nestroft were labeled carriers and advised to undergo Hemoglobin A 2 (HbA 2 ) quantification for confirmation of carrier status. Carriers thus identified were given genetic counseling. The mean age of study population was 15.06 years with a range of 3-28 years. The largest group consisted of those between 12 and 18 years. The prevalence of β thalassemia carrier state as diagnosed by Nestroft is 36.36% (200/550) and incidence of carrier state by HbA 2 quantification in the study population was 17.2% (95/550). Prevalence of β thalassemia in the Sindhi community of Wardha is higher than in other studies and equal to the highest prevalent communities in India. Thus, we recommend that urgent measures to increase awareness and control the disease be taken.

  18. Hb Adana (HBA2 or HBA1: c.179G > A) and alpha thalassemia: Genotype-phenotype correlation.

    PubMed

    Singh, Sharon A; Sarangi, Susmita; Appiah-Kubi, Abena; Hsu, Peihong; Smith, W Byron; Gallagher, Patrick G; Glader, Bertil; Chui, David H K

    2018-05-11

    Alpha thalassemia due to nondeletional mutations usually leads to more severe disease than that caused by deletional mutations. Devastating outcomes such as hydrops fetalis can occur with two nondeletional mutations, therefore warranting DNA-based workup for suspected carriers with subtle hematological abnormalities for family counseling purposes. We describe three cases with hemoglobin (Hb) Adana, a nondeletional alpha chain mutation, compounded with an alpha globin gene deletion resulting in thalassemia intermedia. We review the literature, draw genotype-phenotype correlations from published cases of Hb Adana, and propose that this correlation can be used by clinicians to help direct diagnostic studies and urge hematologists to thoroughly workup high-risk patients. © 2018 Wiley Periodicals, Inc.

  19. Beta-blockers may reduce intrusive thoughts in newly diagnosed cancer patients.

    PubMed

    Lindgren, Monica E; Fagundes, Christopher P; Alfano, Catherine M; Povoski, Stephen P; Agnese, Doreen M; Arnold, Mark W; Farrar, William B; Yee, Lisa D; Carson, William E; Schmidt, Carl R; Kiecolt-Glaser, Janice K

    2013-08-01

    A cancer diagnosis provokes significant levels of emotional distress, with intrusive thoughts being the most common manifestation among breast cancer survivors. Cancer-related intrusive thoughts can take the form of emotional memories, flashbacks, nightmares, and intrusive images. Emotional arousal after a severe life stressor prolongs adrenergic activation, which in turn may increase risk for post-traumatic symptomatology. However, antihypertensive beta-blockers block adrenergic activation and are known to reduce traumatic memories and related psychological distress. Thus, the current study examined the association between beta-blocker use and the severity of cancer-related intrusive thoughts and related symptoms following a cancer diagnosis. The 174 breast and 36 female colorectal cancer patients who had recently undergone diagnostic screening or biopsy included 39 beta-blocker users and 171 non-users. Prior to any cancer treatment including surgery, participants completed questionnaires that included the Impact of Events Scale and the Center for Epidemiological Studies Depression Scale. Analyses controlled for age, education, cancer stage, cancer type, days since diagnosis, marital status, depression, and comorbidities. Although the high rates of cancer-related distress in this sample were similar to those of other studies with recently diagnosed patients, beta-blocker users endorsed 32% fewer cancer-related intrusive thoughts than non-users. Recently diagnosed cancer patients using beta-blockers reported less cancer-related psychological distress. These results suggest that beta-blocker use may benefit cancer patients' psychological adjustment following diagnosis, and provide a promising direction for future investigations on the pharmacological benefits of beta-blockers for cancer-related distress. Copyright © 2012 John Wiley & Sons, Ltd.

  20. Facts about Sickle Cell Disease

    MedlinePlus

    ... from many parts of the world? HbS beta thalassemia People who have this form of SCD inherit ... from one parent and one gene for beta thalassemia, another type of anemia, from the other parent. ...