Science.gov

Sample records for beta2-adrenergic receptor polymorphism

  1. Influence of polymorphisms of the beta-2 adrenergic receptor on the presence of exercise-induced bronchospasm in adolescents✰

    PubMed Central

    Consentino, Cássio Leandro Mühe; Furtado-Alle, Lupe; da Silva, Larissa Rosa; Lopes, Wendell Arthur; Tureck, Luciane Viater; Milano, Gerusa Einsfeld; Lazarotto, Leilane; Cavaglieri, Cláudia Regina; Leite, Neiva

    2016-01-01

    Abstract Objective: To determine the influence of polymorphisms of the beta-2 adrenergic receptor (ADRB2) in triggering exercise-induced bronchospasm (EIB) in adolescents. Methods: The subjects were divided into two groups: present EIB (EIB+) (n=45) and absent EIB (EIB−) (n=115). The bronchial provocation test with exercise was performed with a protocol that consisted of walking/running for at least eight minutes at high intensity, i.e., >85% of maximum heart rate, considering EIB+ as a 10% decrease in forced expiratory volume in one second (FEV1). The genotyping of the ADRB2 gene was performed by the Taqman method, using the Step One Plus system. Independent t-test, Mann–Whitney and Chi-square tests, as well as Spearman's correlation coefficient were used for the statistical analysis. Results: Age, body weight, height, FEV1, FVC and FEV1/FVC ratio were lower in the EIB+ group when compared to EIB− (p<0.05). There were no significant differences in the proportion of the allele at position 27 and Arg16Gly and Gln27Glu genotypes between the EIB+ and EIB− groups (p=0.26; p=0.97 and p=0.43, respectively). However, there was a trend toward statistical significance regarding the greater proportion of the Gly16 allele for the EIB+ when compared to the EIB− group (p=0.08). Conclusions: The presence of polymorphisms associated with the Glu27 allele and Arg16Gly and Gln27Glu genotypes had no influence on EIB. However, the statistical trend toward greater frequency of the Gly16 allele in individuals with EIB+ can be considered evidence of the influence of polymorphisms of the ADBR2 gene on EIB in adolescents. PMID:26684442

  2. Environmental factors and beta2-adrenergic receptor polymorphism: influence on the energy expenditure and nutritional status of obese women.

    PubMed

    Rosado, Eliane Lopes; Bressan, Josefina; Martínez, J Alfredo

    2015-05-01

    Our aim was to evaluate the influence of the Gln27Glu polymorphism of the β2-adrenergic receptor (ADRβ2) gene, fat intake and physical activity on the energy expenditure (EE) and nutritional status of obese women. Sixty obese women (30-46 years) participated in the study and were assigned to three groups depending on the genotypes: Gln27Gln, Gln27Glu and Glu27Glu. At baseline and after nutritional intervention, the anthropometric and body composition (bioelectrical impedance), dietary, EE (indirect calorimetry) and biochemical variables were measured. All women received a high-fat test meal to determine the postprandial EE (short-term) and an energy-restricted diet for 10 weeks (long term). The frequencies of Gln27Gln, Gln27Glu and Glu27Glu were 36.67, 40.0 and 23.33 %, respectively. Anthropometric and biochemical variables and EE did not differ between groups, although women who had no polymorphism demonstrated decreased carbohydrate oxidation. On the other hand, the Glu27Glu genotype showed a positive relation with EE in physical activity and fat oxidation. The environmental factors and Gln27Glu polymorphism did not influence the nutritional status and EE of obese women, but physical activity in obese women with the polymorphism in the ADRβ2 gene can promote fat oxidation. The results suggest that encouraging the practice of physical exercise is important considering the high frequency of this polymorphism in obese subjects.

  3. The beta2 adrenergic receptor Gln27Glu polymorphism affects insulin resistance in patients with heart failure: possible modulation by choice of beta blocker.

    PubMed

    Vardeny, Orly; Detry, Michelle A; Moran, John J M; Johnson, Maryl R; Sweitzer, Nancy K

    2008-12-01

    Insulin resistance is prevalent in heart failure (HF) patients, and beta2 adrenergic receptors (beta2-AR) are involved in glucose homeostasis. We hypothesized that beta2-AR Gln27Glu and Arg16Gly polymorphisms affect insulin resistance in HF patients, and we explored if effects of beta2-AR polymorphisms on glucose handling are modified by choice of beta blocker. We studied 30 nondiabetic adults with HF and a history of systolic dysfunction; 15 were receiving metoprolol succinate, and 15 were receiving carvedilol. We measured fasting glucose, insulin, and insulin resistance, and we determined beta2-AR genotypes at codons 27 and 16. The cohort was insulin resistant with a mean HOMA-IR score of 3.4 (95% CI, 2.3 to 4.5; normal value, 1.0). Patients with the Glu27Glu genotype exhibited higher insulin and HOMA-IR compared to individuals carrying a Gln allele (P = 0.019). Patients taking carvedilol demonstrated lower insulin resistance if also carrying a wild-type allele at codon 27 (fasting insulin, 9.8 +/- 10.5 versus 20.5 +/- 2.1 for variant, P = 0.072; HOMA-IR, 2.4 +/- 2.7 versus 5.1 +/- 0.6, P = 0.074); those on metoprolol succinate had high insulin resistance irrespective of genotype. The beta2-AR Glu27Glu genotype may be associated with higher insulin concentrations and insulin resistance in patients with HF. Future studies are needed to confirm whether treatment with carvedilol may be associated with decreased insulin and insulin resistance in beta2-AR codon 27 Gln carriers.

  4. Beta 2-adrenergic receptors are colocalized and coregulated with whisker barrels in rat somatosensory cortex

    SciTech Connect

    Vos, P.; Kaufmann, D.; Hand, P.J.; Wolfe, B.B. )

    1990-07-01

    Autoradiography has been used to visualize independently the subtypes of beta-adrenergic receptors in rat somatosensory cortex. Beta 2-adrenergic receptors, but not beta 1-adrenergic receptors colocalize with whisker barrels in this tissue. Thus, each whisker sends a specific multisynaptic pathway to the somatosensory cortex that can be histochemically visualized and only one subtype of beta-adrenergic receptor is specifically associated with this cortical representation. Additionally, neonatal lesion of any or all of the whisker follicles results in loss of the corresponding barrel(s) as shown by histochemical markers. This loss is paralleled by a similar loss in the organization of beta 2-adrenergic receptors in the somatosensory cortex. Other results indicate that these beta 2-adrenergic receptors are not involved in moment-to-moment signal transmission in this pathway and, additionally, are not involved in a gross way in the development of whisker-barrel array.

  5. The Principles of Ligand Specificity on beta-2-adrenergic receptor

    PubMed Central

    Chan, H. C. Stephen; Filipek, Slawomir; Yuan, Shuguang

    2016-01-01

    G protein-coupled receptors are recognized as one of the largest families of membrane proteins. Despite sharing a characteristic seven-transmembrane topology, G protein-coupled receptors regulate a wide range of cellular signaling pathways in response to various physical and chemical stimuli, and prevail as an important target for drug discovery. Notably, the recent progress in crystallographic methods led to a breakthrough in elucidating the structures of membrane proteins. The structures of β2-adrenergic receptor bound with a variety of ligands provide atomic details of the binding modes of agonists, antagonists and inverse agonists. In this study, we selected four representative molecules from each functional class of ligands and investigated their impacts on β2-adrenergic receptor through a total of 12 × 100 ns molecular dynamics simulations. From the obtained trajectories, we generated molecular fingerprints exemplifying propensities of protein-ligand interactions. For each functional class of compounds, we characterized and compared the fluctuation of the protein backbone, the volumes in the intracellular pockets, the water densities in the receptors, the domain interaction networks as well as the movements of transmembrane helices. We discovered that each class of ligands exhibits a distinct mode of interactions with mainly TM5 and TM6, altering the shape and eventually the state of the receptor. Our findings provide insightful prospective into GPCR targeted structure-based drug discoveries. PMID:27703221

  6. Src regulates sequence-dependent beta-2 adrenergic receptor recycling via cortactin phosphorylation.

    PubMed

    Vistein, Rachel; Puthenveedu, Manojkumar A

    2014-11-01

    The recycling of internalized signaling receptors, which has direct functional consequences, is subject to multiple sequence and biochemical requirements. Why signaling receptors recycle via a specialized pathway, unlike many other proteins that recycle by bulk, is a fundamental unanswered question. Here, we show that these specialized pathways allow selective control of signaling receptor recycling by heterologous signaling. Using assays to visualize receptor recycling in living cells, we show that the recycling of the beta-2 adrenergic receptor (B2AR), a prototypic signaling receptor, is regulated by Src family kinases. The target of Src is cortactin, an essential factor for B2AR sorting into specialized recycling microdomains on the endosome. Phosphorylation of a single cortactin residue, Y466, regulates the rate of fission of B2AR recycling vesicles from these microdomains and, therefore, the rate of delivery of B2AR to the cell surface. Together, our results indicate that actin-stabilized microdomains that mediate signaling receptor recycling can serve as a functional point of convergence for crosstalk between signaling pathways.

  7. GPCR engineering yields high-resolution structural insights into beta2-adrenergic receptor function.

    PubMed

    Rosenbaum, Daniel M; Cherezov, Vadim; Hanson, Michael A; Rasmussen, Søren G F; Thian, Foon Sun; Kobilka, Tong Sun; Choi, Hee-Jung; Yao, Xiao-Jie; Weis, William I; Stevens, Raymond C; Kobilka, Brian K

    2007-11-23

    The beta2-adrenergic receptor (beta2AR) is a well-studied prototype for heterotrimeric guanine nucleotide-binding protein (G protein)-coupled receptors (GPCRs) that respond to diffusible hormones and neurotransmitters. To overcome the structural flexibility of the beta2AR and to facilitate its crystallization, we engineered a beta2AR fusion protein in which T4 lysozyme (T4L) replaces most of the third intracellular loop of the GPCR ("beta2AR-T4L") and showed that this protein retains near-native pharmacologic properties. Analysis of adrenergic receptor ligand-binding mutants within the context of the reported high-resolution structure of beta2AR-T4L provides insights into inverse-agonist binding and the structural changes required to accommodate catecholamine agonists. Amino acids known to regulate receptor function are linked through packing interactions and a network of hydrogen bonds, suggesting a conformational pathway from the ligand-binding pocket to regions that interact with G proteins.

  8. Mechanism regulating proasthmatic effects of prolonged homologous beta2-adrenergic receptor desensitization in airway smooth muscle.

    PubMed

    Nino, Gustavo; Hu, Aihua; Grunstein, Judith S; Grunstein, Michael M

    2009-10-01

    Use of long-acting beta(2)-adrenergic receptor (beta2AR) agonists to treat asthma incurs an increased risk of asthma morbidity with impaired bronchodilation and heightened bronchoconstriction, reflecting the adverse effects of prolonged homologous beta2AR desensitization on airway smooth muscle (ASM) function. Since phosphodiesterase 4 (PDE4) regulates ASM relaxation and contractility, we examined whether the changes in ASM function induced by prolonged homologous beta2AR desensitization are attributed to altered expression and action of PDE4. Cultured human ASM cells and isolated rabbit ASM tissues exposed for 24 h to the long-acting beta2AR agonist salmeterol exhibited impaired acute beta2AR-mediated cAMP accumulation and relaxation, respectively, together with ASM constrictor hyperresponsiveness. These proasthmatic-like changes in ASM function were associated with upregulated PDE4 activity due to enhanced expression of the PDE4D5 isoform and were prevented by pretreating the ASM preparations with the PDE4 inhibitor rolipram or with inhibitors of either PKA or ERK1/2 signaling. Extended studies using gene silencing and pharmacological approaches demonstrated that: 1) the mechanism underlying upregulated PDE4D5 expression following prolonged beta2AR agonist exposure involves PKA-dependent activation of G(i) protein signaling via its betagamma-subunits, which elicits downstream activation of ERK1/2 and its induction of PDE4D5 transcription; and 2) the induction of PDE4 activity and consequent changes in ASM responsiveness are prevented by pretreating the beta2AR agonist-exposed ASM preparations with inhibitors of G(i)-betagamma signaling. Collectively, these findings identify that the proasthmatic changes in ASM function resulting from prolonged homologous beta2AR desensitization are attributed to upregulated PDE4 expression induced by G(i)-betagamma-mediated cross-talk between the PKA and ERK1/2 signaling pathways.

  9. Regulation of cyclic AMP formation in cultures of human foetal astrocytes by beta 2-adrenergic and adenosine receptors.

    PubMed

    Woods, M D; Freshney, R I; Ball, S G; Vaughan, P F

    1989-09-01

    Two cell cultures, NEP2 and NEM2, isolated from human foetal brain have been maintained through several passages and found to express some properties of astrocytes. Both cell cultures contain adenylate cyclase stimulated by catecholamines with a potency order of isoprenaline greater than adrenaline greater than salbutamol much greater than noradrenaline, which is consistent with the presence of beta 2-adrenergic receptors. This study reports that the beta 2-adrenergic-selective antagonist ICI 118,551 is approximately 1,000 times more potent at inhibiting isoprenaline stimulation of cyclic AMP (cAMP) formation in both NEP2 and NEM2 than the beta 1-adrenergic-selective antagonist practolol. This observation confirms the presence of beta 2-adrenergic receptors in these cell cultures. The formation of cAMP in NEP2 is also stimulated by 5'-(N-ethylcarboxamido)adenosine (NECA) more potently than by either adenosine or N6-(L-phenylisopropyl)adenosine (L-PIA), which suggests that this foetal astrocyte expresses adenosine A2 receptors. Furthermore, L-PIA and NECA inhibit isoprenaline stimulation of cAMP formation, a result suggesting the presence of adenosine A1 receptors on NEP2. The presence of A1 receptors is confirmed by the observation that the A1-selective antagonist 8-cyclopentyl-1,3-dipropylxanthine reverses the inhibition of isoprenaline stimulation of cAMP formation by L-PIA and NECA. Additional evidence that NEP2 expresses adenosine receptors linked to the adenylate cyclase-inhibitory GTP-binding protein is provided by the finding that pretreatment of these cells with pertussis toxin reverses the adenosine inhibition of cAMP formation stimulated by either isoprenaline or forskolin.

  10. Translational control of beta2-adrenergic receptor mRNA by T-cell-restricted intracellular antigen-related protein.

    PubMed

    Kandasamy, Karthikeyan; Joseph, Kusumam; Subramaniam, Kothandharaman; Raymond, John R; Tholanikunnel, Baby G

    2005-01-21

    Cellular expression of the beta(2)-adrenergic receptor (beta(2)-AR) is suppressed at the translational level by 3'-untranslated region (UTR) sequences. To test the possible role of 3'-UTR-binding proteins in translational suppression of beta(2)-AR mRNA, we expressed the full-length 3'-UTR or the adenylate/uridylate-rich (A+U-rich element (ARE)) RNA from the 3'-UTR sequences of beta(2)-AR in cell lines that endogenously express this receptor. Reversal of beta(2)-adrenergic receptor translational repression by retroviral expression of 3'-UTR sequences suggested that ARE RNA-binding proteins are involved in translational suppression of beta(2)-adrenergic receptor expression. Using a 20-nucleotide ARE RNA from the receptor 3'-UTR as an affinity ligand, we purified the proteins that bind to these sequences. T-cell-restricted intracellular antigen-related protein (TIAR) was one of the strongly bound proteins identified by this method. UV-catalyzed cross-linking experiments using in vitro transcribed 3'-UTR RNA and glutathione S-transferase-TIAR demonstrated multiple binding sites for this protein on beta(2)-AR 3'-UTR sequences. The distal 340-nucleotide region of the 3'-UTR was identified as a target RNA motif for TIAR binding by both RNA gel shift analysis and immunoprecipitation experiments. Overexpression of TIAR resulted in suppression of receptor protein synthesis and a significant shift in endogenously expressed beta(2)-AR mRNA toward low molecular weight fractions in sucrose gradient polysome fractionation. Taken together, our results provide the first evidence for translational control of beta(2)-AR mRNA by TIAR.

  11. A molecular dynamics approach to receptor mapping: application to the 5HT3 and beta 2-adrenergic receptors.

    PubMed

    Gouldson, P R; Winn, P J; Reynolds, C A

    1995-09-29

    A molecular dynamics-based approach to receptor mapping is proposed, based on the method of Rizzi (Rizzi, J. P.; et al. J. Med. Chem. 1990, 33, 2721). In Rizzi's method, the interaction energy between a series of drug molecules and probe atoms (which mimic functional groups on the receptor, such as hydrogen bond donors) was calculated. These interactions were calculated on a three-dimensional grid within a molecular mechanics parameters, were placed at these minima. The distances between the dummy atom sites were monitored during molecular dynamics simulations and plotted as distance distribution functions. Important distances within the receptor became apparent, as drugs with a common mode of binding share similar peaks in the distance distribution functions. In the case of specific 5HT3 ligands, the important donor--acceptor distance within the receptor has a range of ca. 7.9--8.9 A. In the case of specific beta 2-adrenergic ligands, the important donor--acceptor distances within the receptor lie between ca. 7--9 A and between 8 and 10 A. These distances distribution functions were used to assess three different models of the beta 2-adrenergic G-protein-coupled receptor. The comparison of the distance distribution functions for the simulation with the actual donor--acceptor distances in the receptor models suggested that two of the three receptor models were much more consistent with the receptor-mapping studies. These receptor-mapping studies gave support for the use of rhodopsin, rather than the bacteriorhodopsin template, for modeling G-protein-coupled receptors but also sounded a warning that agreement with binding data from site-directed mutagenesis experiments does not necessarily validate a receptor model.

  12. Involvement of central beta2-adrenergic, NMDA and thromboxane A2 receptors in the pressor effect of anandamide in rats.

    PubMed

    Malinowska, B; Zakrzeska, A; Kurz, C M; Göthert, M; Kwolek, G; Wielgat, P; Braszko, J J; Schlicker, E

    2010-04-01

    Intravenous (i.v.) injection of the endocannabinoid anandamide induces triphasic cardiovascular responses, including a pressor effect mediated via unknown central and peripheral mechanism(s). The aim of the present study was to determine the central mechanism(s) responsible for the pressor response to anandamide. For this purpose, the influence of antagonists at thromboxane A(2) TP (sulotroban, daltroban, SQ 29548), NMDA (MK-801) and beta(2)-adrenergic receptors (ICI 118551) on the pressor effect induced by i.v. and intracerebroventricularly (i.c.v.) administered anandamide was examined in urethane-anaesthetized rats. Anandamide (1.5-3 micromol/kg, i.v.) or its stable analogue methanandamide (0.75 micromol/kg, i.v.) increased blood pressure by 25%. Anandamide (0.03 mumol per animal i.c.v.) caused a pure pressor effect (by 20%) but only in the presence of antagonists of CB(1) and TRPV1 receptors. The effects of cannabinoids (i.v. or i.c.v.) were diminished by i.v. daltroban, sulotroban (10 mumol/kg each), and/or SQ 29548 (1 mumol/kg). The effect of anandamide i.v. was reduced by SQ 29548 (0.02 mumol per animal i.c.v.) and by the thromboxane A(2) synthesis inhibitor furegrelate i.c.v. (1.8 micromol per animal). ICI 118551, MK-801 (1 micromol/kg i.v. each), and bilateral adrenalectomy diminished the effect of anandamide i.c.v. Sulotroban (i.v.) failed to affect the response to anandamide (i.v.) in pithed rats, and anandamide and methanandamide did not bind to TP receptors in rat platelets. The present study suggests that central beta(2)-adrenergic, NMDA and thromboxane A(2) receptors are involved in the anandamide-induced adrenal secretion of catecholamines and their pressor effect in urethane-anaesthetized rats.

  13. Functional receptor coupling to Gi is a mechanism of agonist-promoted desensitization of the beta2-adrenergic receptor.

    PubMed

    Tepe, N M; Liggett, S B

    2000-01-01

    The beta2-adrenergic receptor (beta2AR) couples to Gs activating adenylyl cyclase (AC) and increasing cAMP. Such signaling undergoes desensitization with continued agonist exposure. Beta2AR also couple to Gi after receptor phosphorylation by the cAMP dependent protein kinase A, but the efficiency of such coupling is not known. Given the PKA dependence of beta2AR-Gi coupling, we explored whether this may be a mechanism of agonist-promoted desensitization. HEK293 cells were transfected to express beta2AR or beta2AR and Gialpha2, and then treated with vehicle or the agonist isoproterenol to evoke agonist-promoted beta2AR desensitization. Membrane AC activities showed that Gialpha2 overexpression decreased basal levels, but the fold-stimulation of the AC over basal by agonist was not altered. However, with treatment of the cells with isoproterenol prior to membrane preparation, a marked decrease in agonist-stimulated AC was observed with the cells overexpressing Gialpha2. In the absence of such overexpression, beta2AR desensitization was 23+/-7%, while with 5-fold Gialpha2 overexpression desensitization was 58+/-5% (p<0.01, n=4). The effect of Gi on desensitization was receptor-specific, in that forskolin responses were not altered by G(i)alpha2 overexpression. Thus, acquired beta2AR coupling to Gi is an important mechanism of agonist-promoted desensitization, and pathologic conditions that increase Gi levels contribute to beta2AR dysfunction.

  14. Binding of amyloid beta peptide to beta2 adrenergic receptor induces PKA-dependent AMPA receptor hyperactivity.

    PubMed

    Wang, Dayong; Govindaiah, G; Liu, Ruijie; De Arcangelis, Vania; Cox, Charles L; Xiang, Yang K

    2010-09-01

    Progressive decrease in neuronal function is an established feature of Alzheimer's disease (AD). Previous studies have shown that amyloid beta (Abeta) peptide induces acute increase in spontaneous synaptic activity accompanied by neurotoxicity, and Abeta induces excitotoxic neuronal death by increasing calcium influx mediated by hyperactive alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptors. An in vivo study has revealed subpopulations of hyperactive neurons near Abeta plaques in mutant amyloid precursor protein (APP)-transgenic animal model of Alzheimer's disease (AD) that can be normalized by an AMPA receptor antagonist. In the present study, we aim to determine whether soluble Abeta acutely induces hyperactivity of AMPA receptors by a mechanism involving beta(2) adrenergic receptor (beta(2)AR). We found that the soluble Abeta binds to beta(2)AR, and the extracellular N terminus of beta(2)AR is critical for the binding. The binding is required to induce G-protein/cAMP/protein kinase A (PKA) signaling, which controls PKA-dependent phosphorylation of GluR1 and beta(2)AR, and AMPA receptor-mediated excitatory postsynaptic currents (EPSCs). beta(2)AR and GluR1 also form a complex comprising postsynaptic density protein 95 (PSD95), PKA and its anchor AKAP150, and protein phosphotase 2A (PP2A). Both the third intracellular (i3) loop and C terminus of beta(2)AR are required for the beta(2)AR/AMPA receptor complex. Abeta acutely induces PKA phosphorylation of GluR1 in the complex without affecting the association between two receptors. The present study reveals that non-neurotransmitter Abeta has a binding capacity to beta(2)AR and induces PKA-dependent hyperactivity in AMPA receptors.

  15. beta2-adrenergic receptor signaling and desensitization elucidated by quantitative modeling of real time cAMP dynamics.

    PubMed

    Violin, Jonathan D; DiPilato, Lisa M; Yildirim, Necmettin; Elston, Timothy C; Zhang, Jin; Lefkowitz, Robert J

    2008-02-01

    G protein-coupled receptor signaling is dynamically regulated by multiple feedback mechanisms, which rapidly attenuate signals elicited by ligand stimulation, causing desensitization. The individual contributions of these mechanisms, however, are poorly understood. Here, we use an improved fluorescent biosensor for cAMP to measure second messenger dynamics stimulated by endogenous beta(2)-adrenergic receptor (beta(2)AR) in living cells. beta(2)AR stimulation with isoproterenol results in a transient pulse of cAMP, reaching a maximal concentration of approximately 10 microm and persisting for less than 5 min. We investigated the contributions of cAMP-dependent kinase, G protein-coupled receptor kinases, and beta-arrestin to the regulation of beta(2)AR signal kinetics by using small molecule inhibitors, small interfering RNAs, and mouse embryonic fibroblasts. We found that the cAMP response is restricted in duration by two distinct mechanisms in HEK-293 cells: G protein-coupled receptor kinase (GRK6)-mediated receptor phosphorylation leading to beta-arrestin mediated receptor inactivation and cAMP-dependent kinase-mediated induction of cAMP metabolism by phosphodiesterases. A mathematical model of beta(2)AR signal kinetics, fit to these data, revealed that direct receptor inactivation by cAMP-dependent kinase is insignificant but that GRK6/beta-arrestin-mediated inactivation is rapid and profound, occurring with a half-time of 70 s. This quantitative system analysis represents an important advance toward quantifying mechanisms contributing to the physiological regulation of receptor signaling.

  16. Nanoscale organization of beta2-adrenergic receptor-Venus fusion protein domains on the surface of mammalian cells.

    PubMed

    Vobornik, Dusan; Rouleau, Yanouchka; Haley, Jennifer; Bani-Yaghoub, Mahmud; Taylor, Rod; Johnston, Linda J; Pezacki, John Paul

    2009-04-24

    Adrenergic receptors are a key component of nanoscale multiprotein complexes that are responsible for controlling the beat rate in a mammalian heart. We demonstrate the ability of near-field scanning optical microscopy (NSOM) to visualize beta(2)-adrenergic receptors (beta(2)AR) fused to the GFP analogue Venus at the nanoscale on HEK293 cells. The expression of the beta(2)AR-Venus fusion protein was tightly controlled using a tetracycline-induced promoter. Both the size and density of the observed nanoscale domains are dependent on the level of induction and thus the level of protein expression. At concentrations between 100 and 700 ng/ml of inducer doxycycline, the size of domains containing the beta(2)AR-Venus fusion protein appears to remain roughly constant, but the number of domains per cell increase. At 700 ng/ml doxycycline the functional receptors are organized into domains with an average diameter of 150 nm with a density similar to that observed for the native protein on primary murine cells. By contrast, larger micron-sized domains of beta(2)AR are observed in the membrane of the HEK293 cells that stably overexpress beta(2)AR-GFP and beta(2)AR-eYFP. We conclude that precise chemical control of gene expression is highly advantageous for the use beta(2)AR-Venus fusion proteins as models for beta(2)AR function. These observations are critical for designing future cell models and assays based on beta(2)AR, since the receptor biology is consistent with a relatively low density of nanoscale receptor domains.

  17. Analysis of hydrophobic interactions of antagonists with the beta2-adrenergic receptor.

    PubMed

    Novoseletsky, V N; Pyrkov, T V; Efremov, R G

    2010-01-01

    The adrenergic receptors mediate a wide variety of physiological responses, including vasodilatation and vasoconstriction, heart rate modulation, and others. Beta-adrenergic antagonists ('beta-blockers') thus constitute a widely used class of drugs in cardiovascular medicine as well as in management of anxiety, migraine, and glaucoma. The importance of the hydrophobic effect has been evidenced for a wide range of beta-blocker properties. To better understand the role of the hydrophobic effect in recognition of beta-blockers by their receptor, we carried out a molecular docking study combined with an original approach to estimate receptor-ligand hydrophobic interactions. The proposed method is based on automatic detection of molecular fragments in ligands and the analysis of their interactions with receptors separately. A series of beta-blockers, based on phenylethanolamines and phenoxypropanolamines, were docked to the beta2-adrenoceptor binding site in the crystal structure. Hydrophobic complementarity between the ligand and the receptor was calculated using the PLATINUM web-server (http://model.nmr.ru/platinum). Based on the analysis of the hydrophobic match for molecular fragments of beta-blockers, we have developed a new scoring function which efficiently predicts dissociation constant (pKd) with strong correlations (r(2) approximately 0.8) with experimental data.

  18. Caveolin-3 regulates compartmentation of cardiomyocyte beta2-adrenergic receptor-mediated cAMP signaling.

    PubMed

    Wright, Peter T; Nikolaev, Viacheslav O; O'Hara, Thomas; Diakonov, Ivan; Bhargava, Anamika; Tokar, Sergiy; Schobesberger, Sophie; Shevchuk, Andrew I; Sikkel, Markus B; Wilkinson, Ross; Trayanova, Natalia A; Lyon, Alexander R; Harding, Sian E; Gorelik, Julia

    2014-02-01

    The purpose of this study was to investigate whether caveolin-3 (Cav3) regulates localization of β2-adrenergic receptor (β2AR) and its cAMP signaling in healthy or failing cardiomyocytes. We co-expressed wildtype Cav3 or its dominant-negative mutant (Cav3DN) together with the Förster resonance energy transfer (FRET)-based cAMP sensor Epac2-camps in adult rat ventricular myocytes (ARVMs). FRET and scanning ion conductance microscopy were used to locally stimulate β2AR and to measure cytosolic cAMP. Cav3 overexpression increased the number of caveolae and decreased the magnitude of β2AR-cAMP signal. Conversely, Cav3DN expression resulted in an increased β2AR-cAMP response without altering the whole-cell L-type calcium current. Following local stimulation of Cav3DN-expressing ARVMs, β2AR response could only be generated in T-tubules. However, the normally compartmentalized β2AR-cAMP signal became diffuse, similar to the situation observed in heart failure. Finally, overexpression of Cav3 in failing myocytes led to partial β2AR redistribution back into the T-tubules. In conclusion, Cav3 plays a crucial role for the localization of β2AR and compartmentation of β2AR-cAMP signaling to the T-tubules of healthy ARVMs, and overexpression of Cav3 in failing myocytes can partially restore the disrupted localization of these receptors.

  19. Selective inhibition of beta(2)-adrenergic receptor-mediated cAMP generation by activation of the P2Y(2) receptor in mouse pineal gland tumor cells.

    PubMed

    Suh, B C; Kim, J S; Namgung, U; Han, S; Kim, K T

    2001-06-01

    Rhythmic noradrenergic signaling from the hypothalamic clock in the suprachiasmatic nucleus to the pineal gland causes an increase in intracellular cAMP which regulates the circadian fluctuation of melatonin synthesis. The activation of phospholipase C (PLC)-coupled P2Y(2) receptors upon treatment with ATP and UTP exclusively inhibited the isoproterenol-stimulated cAMP production in mouse pineal gland tumor cells. However, the activation of other PLC-coupled receptors including P2Y(1) and bombesin receptors had little or no effect on the isoproterenol-stimulated cAMP production. Also, ATP did not inhibit cAMP production caused by forskolin, prostaglandin E(2), or the adenosine analog NECA. These results suggest a selective coupling between signalings of P2Y(2) and beta(2)-adrenergic receptors. The binding of [(3)H]CGP12177 to beta(2)-adrenergic receptors was not effected by the presence of ATP or UTP. Ionomycin decreased the isoproterenol-stimulated cAMP production, whereas phorbol 12-myristate 13-acetate slightly potentiated the isoproterenol response. Chelation of intracellular Ca(2+), however, had little effect on the ATP-induced inhibition of cAMP production, while it completely reversed the ionomycin-induced inhibition. Treatment of cells with pertussis toxin almost completely blocked the inhibitory effect of nucleotides. Pertussis toxin also inhibited the nucleotide-induced increase in intracellular Ca(2+) and inositol 1,4,5-trisphosphate production by 30-40%, suggesting that the ATP-mediated inhibition of the cAMP generation and the partial activation of PLC are mediated by pertussis toxin-sensitive G(i)-protein. We conclude that one of the functions of P2Y(2) receptors on the pineal gland is the selective inhibition of beta-adrenergic receptor-mediated signaling pathways via the inhibitory G-proteins.

  20. Genetic variation in the beta2-adrenergic receptor but not catecholamine-O-methyltransferase predisposes to chronic pain: results from the 1958 British Birth Cohort Study.

    PubMed

    Hocking, Lynne J; Smith, Blair H; Jones, Gareth T; Reid, David M; Strachan, David P; Macfarlane, Gary J

    2010-04-01

    More than 1 in 10 adults in the general population experience chronic widespread body pain (CWP), which lies at one end of a continuous spectrum of pain ranging in both severity and duration. Neuroendocrine factors can modify the effect of known psychological and psychosocial risk factors for progression along the spectrum of pain and development of CWP, and genetic variants that affect neuroendocrine and neural processing potentially affect susceptibility to chronic pain development. We have examined variants across genes encoding the beta2-adrenergic receptor (ADRB2) and catecholamine-O-methyltransferase (COMT) - key neuroendocrine signalling factors - in a large population-based sample to determine whether these may be involved in pain progression and CWP development. A nested association study was conducted using individuals from the 1958 British Birth Cohort Study who had been assessed for pain status. Genotypes were available for nine single nucleotide polymorphisms (SNPs) across ADRB2 and 11 SNPs across COMT. ADRB2 SNPs rs12654778 and rs1042713 were associated either with CWP alone (p=0.02 for both) or with position along pain spectrum (pain status; p=0.04). Common functional ADRB2 haplotype combinations were also associated with pain status (p(model)=0.002) and, further, with both extent and duration of pain (p(model)=0.003 and p(model)=0.002, respectively). There were no associations of either CWP or pain status with COMT genotypes or haplotypes. These results are the first to suggest that functional ADRB2 variants are involved in regulating pain status at a population level. A role for COMT in chronic pain development was not identified, though could not be excluded.

  1. Involvement of tyrosine residues located in the carboxyl tail of the human beta 2-adrenergic receptor in agonist-induced down-regulation of the receptor.

    PubMed Central

    Valiquette, M; Bonin, H; Hnatowich, M; Caron, M G; Lefkowitz, R J; Bouvier, M

    1990-01-01

    Chronic exposure of various cell types to adrenergic agonists leads to a decrease in cell surface beta 2-adrenergic receptor (beta 2AR) number. Sequestration of the receptor away from the cell surface as well as a down-regulation of the total number of cellular receptors are believed to contribute to this agonist-mediated regulation of receptor number. However, the molecular mechanisms underlying these phenomena are not well characterized. Recently, tyrosine residues located in the cytoplasmic tails of several membrane receptors, such as the low density lipoprotein and mannose-6-phosphate receptors, have been suggested as playing an important role in the agonist-induced internalization of these receptors. Accordingly, we assessed the potential role of two tyrosine residues in the carboxyl tail of the human beta 2AR in agonist-induced sequestration and down-regulation of the receptor. Tyr-350 and Tyr-354 of the human beta 2AR were replaced with alanine residues by site-directed mutagenesis and both wild-type and mutant beta 2AR were stably expressed in transformed Chinese hamster fibroblasts. The mutation dramatically decreased the ability of the beta 2AR to undergo isoproterenol-induced down-regulation. However, the substitution of Tyr-350 and Tyr-354 did not affect agonist-induced sequestration of the receptor. These results suggest that tyrosine residues in the cytoplasmic tail of human beta 2AR are crucial determinants involved in its down-regulation. PMID:2164220

  2. The forgotten serine. A critical role for Ser-2035.42 in ligand binding to and activation of the beta 2-adrenergic receptor.

    PubMed

    Liapakis, G; Ballesteros, J A; Papachristou, S; Chan, W C; Chen, X; Javitch, J A

    2000-12-01

    Previous work in the beta(2)-adrenergic receptor demonstrated critical interactions between Ser-204 and Ser-207 in the fifth membrane-spanning segment and the meta-OH and para-OH, respectively, of catecholamine agonists (Strader, C. D., Candelore, M. R., Hill, W. S., Sigal, I. S., and Dixon, R. A. (1989) J. Biol. Chem. 264, 13572-13578). Using the substituted cysteine accessibility method in the beta(2)-adrenergic receptor, we have found that in addition to Ser-204 and Ser-207, Ser-203 is also accessible on the surface of the binding-site crevice and is occluded by bound agonist. Mutation of Ser-203 to Ala, Val, or Cys reduced the binding affinity and adenylyl cyclase-activating potency of agonists containing a meta-OH, whereas their affinities and potencies were largely preserved by mutation of Ser-203 to Thr, which maintained an OH at this position. Thus both Ser-203 and Ser-204 appear to interact with the meta-OH of catecholamines, perhaps through a bifurcated H bond. Furthermore, the removal of the OH at position 203 led to a significant loss of affinity of antagonists with nitrogen in their heterocyclic ring structure. The greatest effect was seen with pindolol, a partial agonist, suggesting that a H bond between the heterocyclic ring and Ser-203 may play a role in partial agonism. In contrast, the affinities of antagonists such as propranolol or alprenolol, which have cyclic structures without H-bonding capability, were unaltered after mutation of Ser-203.

  3. The role of beta 2-adrenergic vascular receptors in the peripheral vasodilation caused by 17 beta-estradiol in anesthetized pigs.

    PubMed

    Molinari, C; Battaglia, A; Grossini, E; Mary, D A; Surico, N; Vacca, G

    1999-01-01

    It has been previously shown in anesthetized pigs that intravenous infusion of 2 microg/h of 17beta-estradiol primarily dilated renal, iliac and coronary circulations, while higher doses of the hormone were required to cause vasodilation also in the mesenteric vascular bed. In the same experimental model, a tonic beta2-adrenoceptor mediated vasodilation, which could be argued to attenuate the vasodilator effect of 17beta-estradiol, has been described. The present study was planned to investigate the role of beta2-adrenergic receptors in the hemodynamic responses of renal and mesenteric vascular beds to 17beta-estradiol. Changes in flow caused by intravenous infusion of 2 microg/h of the hormone at constant heart rate and aortic blood pressure in the left renal and superior mesenteric arteries were assessed using electromagnetic flowmeters. In six pigs, infusion of 17beta-estradiol caused an increase in renal blood flow, which averaged 12.1% of the control values, without affecting mesenteric blood flow. In the same pigs, after hemodynamic variables had returned to the baseline values, blockade of beta2-adrenergic receptors with butoxamine caused an increase in aortic blood pressure and an increase in renal and mesenteric resistance. The subsequent infusion of 17beta-estradiol elicited increases in renal and mesenteric blood flow which respectively averaged 19.6% and 12.8%. Therefore, the present study in anesthetized pigs have shown that the vasodilator responses of the renal and mesenteric circulations to 17beta-estradiol were attenuated and even masked by a tonic beta2-adrenoceptor mediated vasodilation. This indicates that some vasodilator effects elicited by normally used replacement doses of the hormone may not be apparent.

  4. Arrestin interactions with G protein-coupled receptors. Direct binding studies of wild type and mutant arrestins with rhodopsin, beta 2-adrenergic, and m2 muscarinic cholinergic receptors.

    PubMed

    Gurevich, V V; Dion, S B; Onorato, J J; Ptasienski, J; Kim, C M; Sterne-Marr, R; Hosey, M M; Benovic, J L

    1995-01-13

    Arrestins play an important role in quenching signal transduction initiated by G protein-coupled receptors. To explore the specificity of arrestin-receptor interaction, we have characterized the ability of various wild-type arrestins to bind to rhodopsin, the beta 2-adrenergic receptor (beta 2AR), and the m2 muscarinic cholinergic receptor (m2 mAChR). Visual arrestin was found to be the most selective arrestin since it discriminated best between the three different receptors tested (highest binding to rhodopsin) as well as between the phosphorylation and activation state of the receptor (> 10-fold higher binding to the phosphorylated light-activated form of rhodopsin compared to any other form of rhodopsin). While beta-arrestin and arrestin 3 were also found to preferentially bind to the phosphorylated activated form of a given receptor, they only modestly discriminated among the three receptors tested. To explore the structural characteristics important in arrestin function, we constructed a series of truncated and chimeric arrestins. Analysis of the binding characteristics of the various mutant arrestins suggests a common molecular mechanism involved in determining receptor binding selectivity. Structural elements that contribute to arrestin binding include: 1) a C-terminal acidic region that serves a regulatory role in controlling arrestin binding selectivity toward the phosphorylated and activated form of a receptor, without directly participating in receptor interaction; 2) a basic N-terminal domain that directly participates in receptor interaction and appears to serve a regulatory role via intramolecular interaction with the C-terminal acidic region; and 3) two centrally localized domains that are directly involved in determining receptor binding specificity and selectivity. A comparative structure-function model of all arrestins and a kinetic model of beta-arrestin and arrestin 3 interaction with receptors are proposed.

  5. G-protein-coupled receptor kinase specificity for beta-arrestin recruitment to the beta2-adrenergic receptor revealed by fluorescence resonance energy transfer.

    PubMed

    Violin, Jonathan D; Ren, Xiu-Rong; Lefkowitz, Robert J

    2006-07-21

    The small family of G-protein-coupled receptor kinases (GRKs) regulate cell signaling by phosphorylating heptahelical receptors, thereby promoting receptor interaction with beta-arrestins. This switches a receptor from G-protein activation to G-protein desensitization, receptor internalization, and beta-arrestin-dependent signal activation. However, the specificity of GRKs for recruiting beta-arrestins to specific receptors has not been elucidated. Here we use the beta(2)-adrenergic receptor (beta(2)AR), the archetypal nonvisual heptahelical receptor, as a model to test functional GRK specificity. We monitor endogenous GRK activity with a fluorescence resonance energy transfer assay in live cells by measuring kinetics of the interaction between the beta(2)AR and beta-arrestins. We show that beta(2)AR phosphorylation is required for high affinity beta-arrestin binding, and we use small interfering RNA silencing to show that HEK-293 and U2-OS cells use different subsets of their expressed GRKs to promote beta-arrestin recruitment, with significant GRK redundancy evident in both cell types. Surprisingly, the GRK specificity for beta-arrestin recruitment does not correlate with that for bulk receptor phosphorylation, indicating that beta-arrestin recruitment is specific for a subset of receptor phosphorylations on specific sites. Moreover, multiple members of the GRK family are able to phosphorylate the beta(2)AR and induce beta-arrestin recruitment, with their relative contributions largely determined by their relative expression levels. Because GRK isoforms vary in their regulation, this partially redundant system ensures beta-arrestin recruitment while providing the opportunity for tissue-specific regulation of the rate of beta-arrestin recruitment.

  6. Beta 2-adrenergic receptor gene association with overweight and asthma in children and adolescents and its relationship with physical fitness

    PubMed Central

    Leite, Neiva; Lazarotto, Leilane; Milano, Gerusa Eisfeld; Titski, Ana Claudia Kapp; Consentino, Cássio Leandro Mühe; de Mattos, Fernanda; de Andrade, Fabiana Antunes; Furtado-Alle, Lupe

    2015-01-01

    Objective: To investigate the association of Arg16Gly and Gln27Glu polymorphisms of β2-adrenergic receptor gene (ADRB2) with the occurrence of asthma and overweight and the gene's influence on anthropometric, clinic, biochemical and physical fitness variables in children and adolescents. Methods: Subjects were evaluated for allelic frequencies of the β2-adrenergic receptor gene, height, weight, body mass index (BMI), BMI Z-score, waist circumference (WC), pubertal stage, resting heart rate (HRres), blood pressure (BP), total cholesterol (TC), glucose, insulin, high density lipoprotein (HDL-C), low density lipoprotein (LDL-C), triglyceride (TG), Homeostasis Metabolic Assessment (HOMA2-IR), Quantitative Insulin Sensitivity Check Index (QUICKI) and maximal oxygen uptake (VO2max). The participants were divided in four groups: overweight asthmatic (n=39), overweight non-asthmatic (n=115), normal weight asthmatic (n=12), and normal weight non-asthmatic (n=40). Results: Regarding the Gln27Glu polymorphism, higher total cholesterol was observed in usual genotype individuals than in genetic variant carriers (p=0.04). No evidence was found that the evaluated polymorphisms are influencing the physical fitness. The Arg16 allele was found more frequently among the normal weight asthmatic group when compared to the normal weight non-asthmatic group (p=0.02), and the Glu27 allele was more frequently found in the overweight asthmatics group when compared to the normal weight non-asthmatic group (p=0.03). Conclusions: The association of Arg16 allele with the occurrence of asthma and of the Glu27 allele with overweight asthmatic adolescents evidenced the contribution of the β2-adrenergic receptor gene to the development of obesity and asthma. PMID:26409918

  7. Alpha-hederin, but not hederacoside C and hederagenin from Hedera helix, affects the binding behavior, dynamics, and regulation of beta 2-adrenergic receptors.

    PubMed

    Sieben, Anne; Prenner, Lars; Sorkalla, Thomas; Wolf, Anne; Jakobs, Daniel; Runkel, Frank; Häberlein, Hanns

    2009-04-21

    Hederacoside C, alpha-hederin, and hederagenin are saponins of dry extracts obtained from the leaves of ivy (Hedera helix L.). Internalization of beta(2)-adrenergic receptor-GFP fusion proteins after stimulation with 1 microM terbutaline was inhibited by preincubation of stably transfected HEK293 cells with 1 microM alpha-hederin for 24 h, whereas neither hederacoside C nor hederagenin (1 microM each) influenced this receptor regulation. After incubation of A549 cells with 5 nM Alexa532-NA, two different diffusion time constants were found for beta(2)AR-Alexa532-NA complexes by fluorescence correlation spectroscopy. Evaluation of the autocorrelation curve revealed diffusion time constants: tau(bound1) = 1.4 +/- 1.1 ms (n = 6) found for receptor-ligand complexes with unrestricted lateral mobility, and tau(bound2) = 34.7 +/- 14.1 ms (n = 6) for receptor-ligand complexes with hindered mobility. The distribution of diffusion time constants was 24.3 +/- 2.5% for tau(bound1) and 8.7 +/- 4.3% for tau(bound2) (n = 6). A549 cells pretreated with 1 microM alpha-hederin for 24 h showed dose-dependent alterations in this distribution with 37.1 +/- 5.5% for tau(bound1) and 4.1 +/- 1.1% for tau(bound2). Simultaneously, the level of Alexa532-NA binding was significantly increased from 33.0 +/- 6.8 to 41.2 +/- 4.6%. In saturation experiments, alpha-hederin did not influence the beta(2)-adrenergic receptor density (B(max)), whereas the K(D) value for Alexa532-NA binding decreased from 36.1 +/- 9.2 to 24.3 +/- 11.1 nM. Pretreatment of HASM cells with alpha-hederin (1 microM, 24 h) revealed an increased intracellular cAMP level of 13.5 +/- 7.0% under stimulating conditions. Remarkably, structure-related saponins like hederacoside C and hederagenin did not influence either the binding behavior of beta(2)AR or the intracellular cAMP level.

  8. Analysis of full and partial agonists binding to beta2-adrenergic receptor suggests a role of transmembrane helix V in agonist-specific conformational changes.

    PubMed

    Katritch, Vsevolod; Reynolds, Kimberly A; Cherezov, Vadim; Hanson, Michael A; Roth, Christopher B; Yeager, Mark; Abagyan, Ruben

    2009-01-01

    The 2.4 A crystal structure of the beta(2)-adrenergic receptor (beta(2)AR) in complex with the high-affinity inverse agonist (-)-carazolol provides a detailed structural framework for the analysis of ligand recognition by adrenergic receptors. Insights into agonist binding and the corresponding conformational changes triggering G-protein coupled receptor (GPCR) activation mechanism are of special interest. Here we show that while the carazolol pocket captured in the beta(2)AR crystal structure accommodates (-)-isoproterenol and other agonists without steric clashes, a finite movement of the flexible extracellular part of TM-V helix (TM-Ve) obtained by receptor optimization in the presence of docked ligand can further improve the calculated binding affinities for agonist compounds. Tilting of TM-Ve towards the receptor axis provides a more complete description of polar receptor-ligand interactions for full and partial agonists, by enabling optimal engagement of agonists with two experimentally identified anchor sites, formed by Asp113/Asn312 and Ser203/Ser204/Ser207 side chains. Further, receptor models incorporating a flexible TM-V backbone allow reliable prediction of binding affinities for a set of diverse ligands, suggesting potential utility of this approach to design of effective and subtype-specific agonists for adrenergic receptors. Systematic differences in capacity of partial, full and inverse agonists to induce TM-V helix tilt in the beta(2)AR model suggest potential role of TM-V as a conformational "rheostat" involved in the whole spectrum of beta(2)AR responses to small molecule signals.

  9. Identification of high affinity bioactive Salbutamol conformer directed against mutated (Thr164Ile) beta 2 adrenergic receptor.

    PubMed

    Bandaru, Srinivas; Tiwari, Geet; Akka, Jyothy; Marri, Vijaya Kumar; Alvala, Mallika; Gutlapalli, Venkata Ravi; Nayarisseri, Anuraj; Mundluru, Hema Prasad

    2015-01-01

    Salbutamol forms an important and widely administered β2 agonist prescribed in the symptomatic treatment of bronchial asthma. Unfortunately, a subset of patients show refractoriness to it owing to ADRB2 gene variant (rs 1800888). The variant substitutes Thr to Ile at the position 164 in the β2 adrenergic receptor leading to sub-optimal binding of agonists. The present study aims to associate the Salbutamol response with the variant and select the bioactive conformer of Sabutamol with optimal binding affinity against mutated receptor by in silico approaches. To assess bronchodilator response spirometry was performed before and 15 min after Salbutamol (200 mcg) inhalation. Responders to Salbutamol were categorized if percentage reversibility was greater than or equal to 12%, while those showing FEV₁ reversibility less than 12% were classified as non-responders. Among the 344 subjects screened, 238 were responders and 106 were non-responders. The frequency of mutant allele "T" was significantly higher in case of non-responders (p < 0.05). In silico process involved generation of Salbutamol conformer ensembles supported by systematic search algorithm. 4369 conformers were generated of which only 1882 were considered bioactive conformers (threshold RMSD≤1 in reference to normalized structure of salbutamol). All the bioactive conformers were evaluated for the binding affinity against (Thr164 Ile) receptor through MolDock aided docking algorithm. One of the bioactive conformer (P.E. = -57.0038, RMSD = 0.6) demonstrated 1.54 folds greater affinity than the normal Salbutamol in the mutated receptor. The conformer identified in the present study may be put to pharmacodynamic and pharmacokinetic studies in future ahead.

  10. The interaction of signal transduction pathways in FRTL5 thyroid follicular cells: Studies with stable expression of beta 2-adrenergic receptors

    SciTech Connect

    Tsuzaki, S.; Cone, R.D.; Frazier, A.L.; Moses, A.C. )

    1991-03-01

    Multiple signal transduction pathways interact in FRTL5 cells to promote thyroid follicular cell differentiated function and cell proliferation. In these cells, TSH is a tissue-specific mitogen that promotes DNA synthesis primarily through activation of adenylate cyclase. To further test the role of adenylate cyclase in regulating cell growth and differentiated function we have introduced into FRTL5 the human beta 2-adrenergic receptor (BAR) complementary DNA and have studied the ability of isoproterenol, alone and in combination with insulin-like growth factor I (IGF-I), to stimulate cAMP accumulation, iodide transport, (3H)thymidine incorporation into DNA, and cell growth. Wild-type FRTL5 were infected with a PLJ retroviral construct containing the BAR in either a sense (FRTL BAR) or antisense (FRTL RBAR) orientation, and cell populations were selected on the basis of resistance to the antibiotic geneticin. FRTL BAR expressed approximately 1.3 x 10(5) high affinity binding sites per cell for the beta 2-specific ligand, CGP-12177, while neither FRTL5 wild-type nor RBAR cells demonstrated any specific binding. FRTL BAR had significantly higher levels of intracellular cAMP, (3H)thymidine incorporation, and iodide uptake in the absence of added isoproterenol than FRTL RBAR or wild-type cells. In FRTL BAR, but not RBAR cells, isoproterenol stimulated a dose-dependent accumulation of cAMP, iodide uptake, (3H)thymidine incorporation, and cell growth. FRTL BAR and RBAR cells were equally responsive to TSH and to IGF-I. Isoproterenol enhanced the ability of IGF-I to stimulate (3H)thymidine incorporation in BAR but not RBAR cells. Isoproterenol partially inhibited the ability of TSH to stimulate cAMP generation and DNA synthesis.

  11. Conformational entropic maps of functional coupling domains in GPCR activation: A case study with beta2 adrenergic receptor

    NASA Astrophysics Data System (ADS)

    Liu, Fan; Abrol, Ravinder; Goddard, William, III; Dougherty, Dennis

    2014-03-01

    Entropic effect in GPCR activation is poorly understood. Based on the recent solved structures, researchers in the GPCR structural biology field have proposed several ``local activating switches'' that consisted of a few number of conserved residues, but have long ignored the collective dynamical effect (conformational entropy) of a domain comprised of an ensemble of residues. A new paradigm has been proposed recently that a GPCR can be viewed as a composition of several functional coupling domains, each of which undergoes order-to-disorder or disorder-to-order transitions upon activation. Here we identified and studied these functional coupling domains by comparing the local entropy changes of each residue between the inactive and active states of the β2 adrenergic receptor from computational simulation. We found that agonist and G-protein binding increases the heterogeneity of the entropy distribution in the receptor. This new activation paradigm and computational entropy analysis scheme provides novel ways to design functionally modified mutant and identify new allosteric sites for GPCRs. The authors thank NIH and Sanofi for funding this project.

  12. Development of beta 1 and beta 2 adrenergic receptors in baboon brain: an autoradiographic study using (/sup 125/I)iodocyanopindolol

    SciTech Connect

    Slesinger, P.A.; Lowenstein, P.R.; Singer, H.S.; Walker, L.C.; Casanova, M.F.; Price, D.L.; Coyle, J.T.

    1988-07-15

    (125I)iodocyanopindolol (ICYP) autoradiography was used to investigate the temporal development and distribution of beta 1 and beta 2 receptors in brains of baboons at ages embryonic day 100 (E100), full-term gestation (El80), and 3 years. In all brain regions examined, with the exception of the hippocampus, binding to beta 1 receptors exceeded that to beta 2 receptors. The highest densities of beta 1 receptors were found in the caudate nucleus, putamen, globus pallidus, substantia nigra, and cerebral cortex; intermediate receptor densities were observed in most nuclei of thalamus, and the lowest concentrations were in the hippocampus. At E100, beta receptors were identified in the striatum, globus pallidus, and thalamus. During maturation, the number of beta 1 receptors declined in cortical areas but increased in the head of the caudate and putamen. Significant differences in the developmental distribution of beta receptors during development were also detected: at E100 and E180 beta 1 receptors appeared as patches in the caudate and putamen, but by 3 years of age they were more homogeneously distributed in both regions; changes also occurred in the distribution of binding within cortical layers. Autoradiograms of (125I)ICYP and (3H)mazindol binding show overlapping patches of labeling in the E180 striatum, suggesting a possible developmental association between beta receptors and dopamine high-affinity uptake carrier sites. This study demonstrates that noradrenergic receptors in the primate forebrain undergo significant developmental reorganization with regional variations.

  13. Novel Confocal Microscopic and Flow Cytometric Based Assays to Visualize and Detect the (Beta)2-Adrenergic Receptor in Human Lymphocyte and Mononuclear Cell Populations

    NASA Technical Reports Server (NTRS)

    Salicru, A. N.; Crucian, B. E.; Nelman, M. A.; Sams, C. F.; Actor, J. K.; Marshall, G. D.

    2006-01-01

    The data show that immunophenotyping of leukocyte populations with (beta)2AR is possible with the commercially available Ab, although the FC assay is limited to the IST as a result of the Ab binding site to the intracellular C-terminus of the 2AR. The FC assay has applications for measuring alterations in total (beta)2AR in human leukocyte populations as changes in fluorescence. In addition, CM confirms that both surface and intracellular compartments stain positively for the (beta)2AR and can be used for qualitative assays that screen for changes in receptor compartmentalization and localization.

  14. Synthesis and structure-activity relationships of long-acting beta2 adrenergic receptor agonists incorporating metabolic inactivation: an antedrug approach.

    PubMed

    Procopiou, Panayiotis A; Barrett, Victoria J; Bevan, Nicola J; Biggadike, Keith; Box, Philip C; Butchers, Peter R; Coe, Diane M; Conroy, Richard; Emmons, Amanda; Ford, Alison J; Holmes, Duncan S; Horsley, Helen; Kerr, Fern; Li-Kwai-Cheung, Anne-Marie; Looker, Brian E; Mann, Inderjit S; McLay, Iain M; Morrison, Valerie S; Mutch, Peter J; Smith, Claire E; Tomlin, Paula

    2010-06-10

    A series of saligenin beta(2) adrenoceptor agonist antedrugs having high clearance were prepared by reacting a protected saligenin oxazolidinone with protected hydroxyethoxyalkoxyalkyl bromides, followed by removal of the hydroxy-protecting group, alkylation, and final deprotection. The compounds were screened for beta(2), beta(1), and beta(3) agonist activity in CHO cells. The onset and duration of action in vitro of selected compounds were assessed on isolated superfused guinea pig trachea. Compound 13f had high potency, selectivity, fast onset, and long duration of action in vitro and was found to have long duration in vivo, low oral bioavailability in the rat, and to be rapidly metabolized. Crystalline salts of 13f (vilanterol) were identified that had suitable properties for inhaled administration. A proposed binding mode for 13f to the beta(2)-receptor is presented.

  15. Beta 2-adrenergic stimulation causes detachment of natural killer cells from cultured endothelium.

    PubMed

    Benschop, R J; Oostveen, F G; Heijnen, C J; Ballieux, R E

    1993-12-01

    Physical exercise, mental stress, or infusion of beta-adrenergic agonists result in an increase in the number of natural killer (NK) cells in the peripheral circulation. In view of the specific migration pattern of NK cells in vivo, it has been suggested that these cells may be released from the marginating pool in blood vessels. In the present report, the in vitro effect of catecholamines on the adhesion of NK cells to unstimulated human endothelial cells (EC) was characterized. Peripheral blood mononuclear cells were allowed to adhere to monolayers of EC, after which the adherent lymphocyte fraction was analyzed phenotypically by flow cytometry. NK cells were found to adhere preferentially to EC, a process that was reversed by the addition of various adrenergic agonists. Catecholamines selectively affected adhesion of NK cells and had no effect on T cell adhesion to EC, as was determined by the use of purified cell populations. Detachment of NK cells from EC could be achieved by short incubations (5 min) with epinephrine (EPI) and was concentration-dependent, with an ED50 of 2 x 10(-10)M. Using a panel of alpha- and beta-adrenergic agonists and antagonists, we show that the detachment of NK cells is mediated via beta 2-adrenergic receptors. In line with the lower affinity for beta 2-adrenergic receptors, norepinephrine was less effective than EPI in inducing detachment of NK cells from EC. Direct activation of adenylate-cyclase with forskolin gave similar results as observed with EPI, indicating that signaling through cAMP is necessary to induce detachment of NK cells from EC. The results of the present study lend support to the hypothesis that catecholamines, via beta 2-adrenergic receptors, can induce recruitment of NK cells from the marginating pool to the circulating pool, by changing the adhesive interactions between NK cells and EC.

  16. Prolactin induces regional vasoconstriction through the beta2-adrenergic and nitric oxide mechanisms.

    PubMed

    Molinari, Claudio; Grossini, Elena; Mary, David A S G; Uberti, Francesca; Ghigo, Ezio; Ribichini, Flavio; Surico, Nicola; Vacca, Giovanni

    2007-08-01

    Prolactin has been associated with many effects and has been implicated in the pathogenesis of pregnancy-related hypertensive disorders, although little is known about its vascular effects. The present study was designed to determine the primary effect of prolactin on regional vascular beds and the mechanisms involved. In 37 anesthetized pigs, the infusion of 0.17 mug/kg min of prolactin at constant heart rate and arterial pressure decreased coronary, mesenteric, renal, and iliac blood flow. This response was graded in further five pigs by increasing the infused dose of the hormone between 0.017 and 1 mug/kg min. In 22 of the 37 pigs, blockade of cholinergic receptors (five pigs) and of alpha-adrenoceptors (five pigs) did not affect the prolactin-induced vascular response, which was abolished by blockade of beta(2)-adrenoceptors (five pigs) and by blockade of vascular nitric oxide (NO) synthase (seven pigs). In 15 of the 37 pigs the increases in measured blood flows caused by iv infusion of isoproterenol (five pigs) and by intraarterial administration of acetylcholine (five pigs) and of sodium nitroprusside (five pigs) were significantly reduced by infusion of prolactin. Moreover, the treatment of porcine aortic endothelial cells by prolactin caused a reduction of NO production and of the phosphorylation of ERK, Akt, and p38, which was prevented by the concomitant treatment by the beta(2)-adrenergic agonist albuterol. The present study showed that iv infusion of prolactin primarily caused coronary, mesenteric, renal, and iliac vasoconstriction. These effects were brought about by the inhibition of a vasodilatory beta(2)-adrenergic receptor-mediated effect related to the NO intracellular pathway.

  17. Beta 2-adrenergic agonist as adjunct therapy to levodopa in Parkinson's disease.

    PubMed

    Alexander, G M; Schwartzman, R J; Nukes, T A; Grothusen, J R; Hooker, M D

    1994-08-01

    We studied the effect of the beta 2-adrenergic agonist albuterol on Parkinson's disease (PD) patients receiving chronic levodopa treatment. The albuterol-treated patients demonstrated reduced parkinsonian symptoms and an increased ability to tap their index finger between two points 20 cm apart, and were able to perform a "walk test" in 70% of their control time. Three patients currently on chronic albuterol therapy still show amelioration of their parkinsonian symptoms, and two have reduced their daily levodopa dose. This study suggests that beta 2-adrenergic agonists as adjunct therapy to levodopa may be beneficial in PD.

  18. beta2 adrenergic agonists in acute lung injury? The heart of the matter.

    PubMed

    Lee, Jae W

    2009-01-01

    Despite extensive research into its pathophysiology, acute lung injury/acute respiratory distress syndrome (ALI/ARDS) remains a devastating syndrome with mortality approaching 40%. Pharmacologic therapies that reduce the severity of lung injury in vivo and in vitro have not yet been translated to effective clinical treatment options, and innovative therapies are needed. Recently, the use of beta2 adrenergic agonists as potential therapy has gained considerable interest due to their ability to increase the resolution of pulmonary edema. However, the results of clinical trials of beta agonist therapy for ALI/ARDS have been conflicting in terms of benefit. In the previous issue of Critical Care, Briot and colleagues present evidence that may help clarify the inconsistent results. The authors demonstrate that, in oleic acid lung injury in dogs, the inotropic effect of beta agonists may recruit damaged pulmonary capillaries, leading to increased lung endothelial permeability.

  19. Beta 2-adrenergic receptor activation enhances neurogenesis in Alzheimer's disease mice

    PubMed Central

    Chai, Gao-shang; Wang, Yang-yang; Yasheng, Amina; Zhao, Peng

    2016-01-01

    Impaired hippocampal neurogenesis is one of the early pathological features of Alzheimer's disease. Enhancing adult hippocampal neurogenesis has been pursued as a potential therapeutic strategy for Alzheimer's disease. Recent studies have demonstrated that environmental novelty activates β2-adrenergic signaling and prevents the memory impairment induced by amyloid-β oligomers. Here, we hypothesized that β2-adrenoceptor activation would enhance neurogenesis and ameliorate memory deficits in Alzheimer's disease. To test this hypothesis, we investigated the effects and mechanisms of action of β2-adrenoceptor activation on neurogenesis and memory in amyloid precursor protein/presenilin 1 (APP/PS1) mice using the agonist clenbuterol (intraperitoneal injection, 2 mg/kg). We found that β2-adrenoceptor activation enhanced hippocampal neurogenesis, ameliorated memory deficits, and increased dendritic branching and the density of dendritic spines. These effects were associated with the upregulation of postsynaptic density 95, synapsin 1 and synaptophysin in APP/PS1 mice. Furthermore, β2-adrenoceptor activation decreased cerebral amyloid plaques by decreasing APP phosphorylation at Thr668. These findings suggest that β2-adrenoceptor activation enhances neurogenesis and ameliorates memory deficits in APP/PS1 mice. PMID:27904493

  20. Beta 2-adrenergic regulation of ciliary beat frequency in rat bronchiolar epithelium: potentiation by isosmotic cell shrinkage.

    PubMed

    Shiima-Kinoshita, Chisa; Min, Kyong-Yob; Hanafusa, Toshiaki; Mori, Hiroshi; Nakahari, Takashi

    2004-01-15

    Single bronchiolar ciliary cells were isolated from rat lungs. The beta(2)-adrenergic regulation of ciliary beat frequency (CBF) was studied using video-optical microscopy. Terbutaline (a beta(2)-adrenergic agonist) increased CBF in a dose-dependent manner, and it also decreased the volume of the ciliary cells. These terbutaline actions were inhibited by a PKA inhibitor (H-89) and mimicked by forskolin, IBMX and DBcAMP. Ion transport inhibitors were used to isosmotically manipulate the volume of the terbutaline-stimulated bronchiolar ciliary cells. Amiloride (1 microM) and bumetanide (20 microM) potentiated cell shrinkage and the CBF increase, and they shifted the terbutaline dose-response curve to the lower-concentration side. Quinidine (500 microM), in contrast, increased cell volume and suppressed the CBF increase. Moreover, a KCl solution containing amiloride (1 microM) and strophanthidin (100 microM) increased cell volume and suppressed the CBF increase, and then the subsequent removal of either amiloride or strophanthidin decreased cell volume and further increased CBF. NPPB (10 microM) or glybenclamide (200 microM) had no effect on the action of terbutaline. Thus, in terbutaline-stimulated ciliary cells, cell shrinkage enhances the CBF increase; in contrast, cell swelling suppresses it. However, the results of direct manupulation of cell volume by applying osmotic stresses (hyperosmotic shrinkage or hyposmotic swelling) were the opposite of the findings of the isosmotic experiments: hyposmotic cell swelling enhanced the CBF increase, while isosmotic swelling suppressed it. These results suggest that isosmotic and non-isosmotic volume changes in terbutaline-stimulated bronchiolar ciliary cells may trigger different signalling pathways. In conclusion, terbutaline increases CBF and decreases the volume of rat bronchiolar ciliary cells via cAMP accumulation under isosmotic conditions, and the isosmotic cell shrinkage enhances the CBF increase by increasing c

  1. The effect of exercise and beta2-adrenergic stimulation on glutathionylation and function of the Na,K-ATPase in human skeletal muscle

    PubMed Central

    Juel, Carsten; Hostrup, Morten; Bangsbo, Jens

    2015-01-01

    Potassium and sodium displacements across the skeletal muscle membrane during exercise may cause fatigue and are in part controlled by the Na,K-ATPase. Regulation of the Na,K-ATPase is therefore important for muscle functioning. We investigated the effect of oxidative stress (glutathionylation) on Na,K-ATPase activity. Ten male subjects performed three bouts of 4-min submaximal exercise followed by intense exercise to exhaustion with and without beta2-adrenergic stimulation with terbutaline. Muscle biopsies were obtained from m. vastus lateralis at rest (Control samples) and at exhaustion. In vitro glutathionylation reduced (P < 0.05) maximal Na,K-ATPase activity in a dose-dependent manner. Na,K-ATPase α subunits, purified by immunoprecipitation and tested by glutathione (GSH) antibodies, had a basal glutathionylation in Control samples and no further glutathionylation with exercise and beta2-adrenergic stimulation. Immunoprecipitation with an anti-GSH antibody and subsequent immunodetection with β1 antibodies showed approximately 20% glutathionylation in Control samples and further glutathionylation after exercise (to 32%) and beta2-adrenergic stimulation (to 38%, P < 0.05). Combining exercise and beta2-adrenergic stimulation raised the β1 glutathionylation to 45% (P < 0.05). In conclusion, both α and β1 subunits of the Na,K-ATPase were glutathionylated in Control samples, which indicates that the maximal Na,K-ATPase activity is overestimated if based on protein density only. β1 subunits are further glutathionylated by exercise and beta2-adrenergic stimulation. Our data suggest that glutathionylation contributes to the complex regulation of Na,K-ATPase function in human skeletal muscle. Glutathionylation of the Na,K-ATPase may explain reductions in maximal Na,K-ATPase activity after exercise, which may be involved in muscle fatigue. PMID:26296772

  2. The effect of exercise and beta2-adrenergic stimulation on glutathionylation and function of the Na,K-ATPase in human skeletal muscle.

    PubMed

    Juel, Carsten; Hostrup, Morten; Bangsbo, Jens

    2015-08-01

    Potassium and sodium displacements across the skeletal muscle membrane during exercise may cause fatigue and are in part controlled by the Na,K-ATPase. Regulation of the Na,K-ATPase is therefore important for muscle functioning. We investigated the effect of oxidative stress (glutathionylation) on Na,K-ATPase activity. Ten male subjects performed three bouts of 4-min submaximal exercise followed by intense exercise to exhaustion with and without beta2-adrenergic stimulation with terbutaline. Muscle biopsies were obtained from m. vastus lateralis at rest (Control samples) and at exhaustion. In vitro glutathionylation reduced (P < 0.05) maximal Na,K-ATPase activity in a dose-dependent manner. Na,K-ATPase α subunits, purified by immunoprecipitation and tested by glutathione (GSH) antibodies, had a basal glutathionylation in Control samples and no further glutathionylation with exercise and beta2-adrenergic stimulation. Immunoprecipitation with an anti-GSH antibody and subsequent immunodetection with β1 antibodies showed approximately 20% glutathionylation in Control samples and further glutathionylation after exercise (to 32%) and beta2-adrenergic stimulation (to 38%, P < 0.05). Combining exercise and beta2-adrenergic stimulation raised the β1 glutathionylation to 45% (P < 0.05). In conclusion, both α and β1 subunits of the Na,K-ATPase were glutathionylated in Control samples, which indicates that the maximal Na,K-ATPase activity is overestimated if based on protein density only. β1 subunits are further glutathionylated by exercise and beta2-adrenergic stimulation. Our data suggest that glutathionylation contributes to the complex regulation of Na,K-ATPase function in human skeletal muscle. Glutathionylation of the Na,K-ATPase may explain reductions in maximal Na,K-ATPase activity after exercise, which may be involved in muscle fatigue.

  3. [Genetic polymorphism of beta-adrenergic receptors and mortality in ischemic heart disease].

    PubMed

    Jaillon, Patrice; Simon, Tabassome

    2007-01-01

    The genetic polymorphism of beta-2 adrenergic receptors (B2AR) could play a major role in the prognostic of patients with a coronary heart disease. Two recent epidemiological studies could support this hypothesis. In 597 patients treated by a beta-blocker and followed for 3 years after a myocardial infarction or an acute coronary syndrome, the death rate was 5.4 times higher in homozygous Arg 16 and Gln 27 B2AR genotypes than in heterozygous or homozygous Gly 16 and Glu 27 B2AR genotypes. The beta-1 adrenergic receptor (B1AR) genetic polymorphism did not modify mortality. In a second study, in a prospective cohort of 5249 patients aged > or =65 years, the incidence of sudden cardiac death was 1.56 times higher in patients with homozygous Gln 27 B2AR than in heterozygous or homozygous Glu 27 B2AR genotype. This result was confirmed by a case-control study (155 cases of sudden cardiac death versus 144 control subjects). These data suggest that B2AR genetic polymorphism should be systematically studied in clinical trials in myocardial ischemia, with or without congestive heart failure.

  4. Beta2-adrenergic signaling affects the phenotype of human cardiac progenitor cells through EMT modulation.

    PubMed

    Pagano, Francesca; Angelini, Francesco; Siciliano, Camilla; Tasciotti, Julia; Mangino, Giorgio; De Falco, Elena; Carnevale, Roberto; Sciarretta, Sebastiano; Frati, Giacomo; Chimenti, Isotta

    2017-01-15

    Human cardiac progenitor cells (CPCs) offer great promises to cardiac cell therapy for heart failure. Many in vivo studies have shown their therapeutic benefits, paving the way for clinical translation. The 3D model of cardiospheres (CSs) represents a unique niche-like in vitro microenvironment, which includes CPCs and supporting cells. CSs have been shown to form through a process mediated by epithelial-to-mesenchymal transition (EMT). β2-Adrenergic signaling significantly affects stem/progenitor cells activation and mobilization in multiple tissues, and crosstalk between β2-adrenergic signaling and EMT processes has been reported. In the present study, we aimed at investigating the biological response of CSs to β2-adrenergic stimuli, focusing on EMT modulation in the 3D culture system of CSs. We treated human CSs and CS-derived cells (CDCs) with the β2-blocker butoxamine (BUT), using either untreated or β2 agonist (clenbuterol) treated CDCs as control. BUT-treated CS-forming cells displayed increased migration capacity and a significant increase in their CS-forming ability, consistently associated with increased expression of EMT-related genes, such as Snai1. Moreover, long-term BUT-treated CDCs contained a lower percentage of CD90+ cells, and this feature has been previously correlated with higher cardiogenic and therapeutic potential of the CDCs population. In addition, long-term BUT-treated CDCs had an increased ratio of collagen-III/collagen-I gene expression levels, and showed decreased release of inflammatory cytokines, overall supporting a less fibrosis-prone phenotype. In conclusion, β2 adrenergic receptor block positively affected the stemness vs commitment balance within CSs through the modulation of type1-EMT (so called "developmental"). These results further highlight type-1 EMT to be a key process affecting the features of resident cardiac progenitor cells, and mediating their response to the microenvironment.

  5. Nitric oxide-dependent vasodilatation of rabbit femoral artery by beta(2)-adrenergic stimulation or cyclic AMP elevation in vivo.

    PubMed

    Xu, B; Li, J; Gao, L; Ferro, A

    2000-03-01

    Some studies suggest that beta-adrenoceptor-mediated vasorelaxation is in part mediated through nitric oxide (NO) release. We wished to determine the contribution of the L-arginine / NO system to vasodilatation in response to beta-adrenoceptor stimulation with isoprenaline or cyclic adenosine-3',5'-monophosphate (cyclic AMP) elevation with forskolin and dibutyryl cyclic AMP in vivo, using a rabbit femoral artery constant perfusion model. Baseline femoral artery pressure was similar in rabbits receiving isoprenaline, forskolin or dibutyryl cyclic AMP. Isoprenaline, forskolin and dibutyryl cyclic AMP each decreased femoral artery pressure in a dose-dependent manner. The doses (mol kg(-1)) of isoprenaline, forskolin and dibutyryl cyclic AMP which decreased pressure by 10% from baseline, expressed as a negative logarithm (-log ED(10)) were: 10.0+/-0.2, 9.5+/-0.1 and 4.9+/-0.1 respectively (P<0.0001 for each). Use of beta-adrenoceptor subtype-selective antagonists showed that the vascular response to isoprenaline was purely due to stimulation of the beta(2)-adrenoceptor subtype. Injection of 1 micromol kg(-1) N(G)-nitro-L-arginine methyl ester (L-NAME) did not alter baseline pressure. However, it abolished the pressure response to isoprenaline (P<0.0001), and significantly attenuated the pressure responses to forskolin and dibutyryl cyclic AMP: -log ED(10) values for forskolin and dibutyryl cyclic AMP, in the presence of L-NAME, were 7.9+/-0.1 and 3.5+/-0.3 respectively (P<0.0001 for each, as compared with values in the absence of L-NAME). These results indicate that beta(2)-adrenergic stimulation and cylic AMP elevation activate the L-arginine/NO system in rabbit femoral artery in vivo, and that NO generation contributes importantly to the changes in vascular tone induced by agents which modulate beta-adrenoceptors or cyclic AMP.

  6. beta-adrenergic receptor gene polymorphisms and beta-blocker treatment outcomes in hypertension.

    PubMed

    Pacanowski, M A; Gong, Y; Cooper-Dehoff, R M; Schork, N J; Shriver, M D; Langaee, T Y; Pepine, C J; Johnson, J A

    2008-12-01

    Numerous studies have demonstrated that beta(1)- and beta(2)-adrenergic receptor gene (ADRB1 and ADRB2) variants influence cardiovascular risk and beta-blocker responses in hypertension and heart failure. We evaluated the relationship between ADRB1 and ADRB2 haplotypes, cardiovascular risk (death, nonfatal myocardial infarction (MI), and nonfatal stroke), and atenolol-based vs. verapamil sustained-release (SR)-based antihypertensive therapy in 5,895 coronary artery disease (CAD) patients. After an average of 2.8 years, death rates were higher in patients carrying the ADRB1 Ser49-Arg389 haplotype (hazard ratio (HR) 3.66, 95% confidence interval (95% CI) 1.68-7.99). This mortality risk was significant in patients randomly assigned to verapamil SR (HR 8.58, 95% CI 2.06-35.8) but not atenolol (HR 2.31, 95% CI 0.82-6.55), suggesting a protective role for the beta-blocker. ADRB2 haplotype associations were divergent within the treatment groups but did not remain significant after adjustment for multiple comparisons. ADRB1 haplotype variation is associated with mortality risk, and beta-blockers may be preferred in subgroups of patients defined by ADRB1 or ADRB2 polymorphisms.

  7. [Asthma therapy by the general practitioner--new approaches and progress. Why inhaled steroids and delayed action beta-2 adrenergic drugs should be combined early on].

    PubMed

    Petro, W

    1999-08-26

    Early treatment with high-dose inhaled steroids can significantly improve the prognosis of asthma. Inhaled steroids used to treat inflammation of the mucosa, and hyperreactivity may be reduced only under careful surveillance. Hig-dose initial treatment must be followed by low-dose maintenance therapy. The best therapeutic results are obtained with a combination of inhaled steroids and long-acting beta-2-adrenergic agents. Careful titration of the dose and therapeutic effects is a major task for the family doctor. Bronchial inflammation and reactivity are dependent on external factors, and are rarely stable. The most important therapeutic basis is, therefore, continuous management involving both the patient and the family doctor. The patient should be provided with relevant information on his/her disease and its treatment. A prerequisite for the effective management of asthma is the provision of individual peak-flow-adjusted and emergency plans.

  8. A Functional polymorphism under positive evolutionary selection in ADRB2 is associated with human intelligence with opposite effects in the young and the elderly.

    PubMed

    Bochdanovits, Zoltán; Gosso, Florencia M; van den Berg, Linda; Rizzu, Patrizia; Polderman, Tinca J C; Pardo, Luba M; Houlihan, Lorna M; Luciano, Michelle; Starr, John M; Harris, Sarah E; Deary, Ian J; de Geus, Eco J C; Boomsma, Dorret I; Heutink, Peter; Posthuma, Danielle

    2009-01-01

    Comparative genomics offers a novel approach to unravel the genetic basis of complex traits. We performed a two stage analysis where genes ascertained for enhanced protein evolution in primates are subsequently searched for the presence of non-synonymous coding SNPs in the current human population at amino acid sites that differ between humans and chimpanzee. Positively selected genes among primates are generally presumed to determine phenotypic differences between humans and chimpanzee, such as the enhanced cognitive ability of our species. Amino acid substitutions segregating in humans at positively selected amino acid sites are expected to affect phenotypic differences among humans. Therefore we conducted an association study in two family based cohorts and one population based cohort between cognitive ability and the most likely candidate gene among the five that harbored more than one such polymorphism. The derived, human-specific allele of the beta-2 adrenergic receptor Arg16Gly polymorphism was found to be the increaser allele for performance IQ in the young, family based cohort but the decreaser allele for two different measures of cognition in the large Scottish cohort of unrelated individuals. The polymorphism is known to affect signaling activity and modulation of beta-2 adrenergic signaling has been shown to adjust memory consolidation, a trait related to cognition. The opposite effect of the polymorphism on cognition in the two age classes observed in the different cohorts resembles the effect of ADRB2 on hypertension, which also has been reported to be age dependent. This result illustrates the relevance of comparative genomics to detect genes that are involved in human behavior.

  9. A monoclonal antibody for G protein-coupled receptor crystallography.

    PubMed

    Day, Peter W; Rasmussen, Søren G F; Parnot, Charles; Fung, Juan José; Masood, Asna; Kobilka, Tong Sun; Yao, Xiao-Jie; Choi, Hee-Jung; Weis, William I; Rohrer, Daniel K; Kobilka, Brian K

    2007-11-01

    G protein-coupled receptors (GPCRs) constitute the largest family of signaling proteins in mammals, mediating responses to hormones, neurotransmitters, and senses of sight, smell and taste. Mechanistic insight into GPCR signal transduction is limited by a paucity of high-resolution structural information. We describe the generation of a monoclonal antibody that recognizes the third intracellular loop (IL3) of the native human beta(2) adrenergic (beta(2)AR) receptor; this antibody was critical for acquiring diffraction-quality crystals.

  10. Androgen receptor gene mutation, rearrangement, polymorphism

    PubMed Central

    Eisermann, Kurtis; Wang, Dan; Jing, Yifeng; Pascal, Laura E.

    2013-01-01

    Genetic aberrations of the androgen receptor (AR) caused by mutations, rearrangements, and polymorphisms result in a mutant receptor that has varied functions compared to wild type AR. To date, over 1,000 mutations have been reported in the AR with most of these being associated with androgen insensitivity syndrome (AIS). While mutations of AR associated with prostate cancer occur less often in early stage localized disease, mutations in castration-resistant prostate cancer (CRPC) patients treated with anti-androgens occur more frequently with 10-30% of these patients having some form of mutation in the AR. Resistance to anti-androgen therapy usually results from gain-of-function mutations in the LBD such as is seen with bicalutamide and more recently with enzalutamide (MDV3100). Thus, it is crucial to investigate these new AR mutations arising from drug resistance to anti-androgens and other small molecule pharmacological agents. PMID:25045626

  11. Bitter Taste Receptor Polymorphisms and Human Aging

    PubMed Central

    Carrai, Maura; Crocco, Paolina; Montesanto, Alberto; Canzian, Federico; Rose, Giuseppina; Rizzato, Cosmeri

    2012-01-01

    Several studies have shown that genetic factors account for 25% of the variation in human life span. On the basis of published molecular, genetic and epidemiological data, we hypothesized that genetic polymorphisms of taste receptors, which modulate food preferences but are also expressed in a number of organs and regulate food absorption processing and metabolism, could modulate the aging process. Using a tagging approach, we investigated the possible associations between longevity and the common genetic variation at the three bitter taste receptor gene clusters on chromosomes 5, 7 and 12 in a population of 941 individuals ranging in age from 20 to 106 years from the South of Italy. We found that one polymorphism, rs978739, situated 212 bp upstream of the TAS2R16 gene, shows a statistically significant association (p = 0.001) with longevity. In particular, the frequency of A/A homozygotes increases gradually from 35% in subjects aged 20 to 70 up to 55% in centenarians. These data provide suggestive evidence on the possible correlation between human longevity and taste genetics. PMID:23133589

  12. A Common Polymorphism of the Human Cardiac Sodium Channel Alpha Subunit (SCN5A) Gene Is Associated with Sudden Cardiac Death in Chronic Ischemic Heart Disease

    PubMed Central

    Marcsa, Boglárka; Dénes, Réka; Vörös, Krisztina; Rácz, Gergely; Sasvári-Székely, Mária; Rónai, Zsolt; Törő, Klára; Keszler, Gergely

    2015-01-01

    Cardiac death remains one of the leading causes of mortality worldwide. Recent research has shed light on pathophysiological mechanisms underlying cardiac death, and several genetic variants in novel candidate genes have been identified as risk factors. However, the vast majority of studies performed so far investigated genetic associations with specific forms of cardiac death only (sudden, arrhythmogenic, ischemic etc.). The aim of the present investigation was to find a genetic marker that can be used as a general, powerful predictor of cardiac death risk. To this end, a case-control association study was performed on a heterogeneous cohort of cardiac death victims (n=360) and age-matched controls (n=300). Five single nucleotide polymorphisms (SNPs) from five candidate genes (beta2 adrenergic receptor, nitric oxide synthase 1 adaptor protein, ryanodine receptor 2, sodium channel type V alpha subunit and transforming growth factor-beta receptor 2) that had previously been shown to associate with certain forms of cardiac death were genotyped using sequence-specific real-time PCR probes. Logistic regression analysis revealed that the CC genotype of the rs11720524 polymorphism in the SCN5A gene encoding a subunit of the cardiac voltage-gated sodium channel occurred more frequently in the highly heterogeneous cardiac death cohort compared to the control population (p=0.019, odds ratio: 1.351). A detailed subgroup analysis uncovered that this effect was due to an association of this variant with cardiac death in chronic ischemic heart disease (p=0.012, odds ratio = 1.455). None of the other investigated polymorphisms showed association with cardiac death in this context. In conclusion, our results shed light on the role of this non-coding polymorphism in cardiac death in ischemic cardiomyopathy. Functional studies are needed to explore the pathophysiological background of this association. PMID:26146998

  13. A Common Polymorphism of the Human Cardiac Sodium Channel Alpha Subunit (SCN5A) Gene Is Associated with Sudden Cardiac Death in Chronic Ischemic Heart Disease.

    PubMed

    Marcsa, Boglárka; Dénes, Réka; Vörös, Krisztina; Rácz, Gergely; Sasvári-Székely, Mária; Rónai, Zsolt; Törő, Klára; Keszler, Gergely

    2015-01-01

    Cardiac death remains one of the leading causes of mortality worldwide. Recent research has shed light on pathophysiological mechanisms underlying cardiac death, and several genetic variants in novel candidate genes have been identified as risk factors. However, the vast majority of studies performed so far investigated genetic associations with specific forms of cardiac death only (sudden, arrhythmogenic, ischemic etc.). The aim of the present investigation was to find a genetic marker that can be used as a general, powerful predictor of cardiac death risk. To this end, a case-control association study was performed on a heterogeneous cohort of cardiac death victims (n=360) and age-matched controls (n=300). Five single nucleotide polymorphisms (SNPs) from five candidate genes (beta2 adrenergic receptor, nitric oxide synthase 1 adaptor protein, ryanodine receptor 2, sodium channel type V alpha subunit and transforming growth factor-beta receptor 2) that had previously been shown to associate with certain forms of cardiac death were genotyped using sequence-specific real-time PCR probes. Logistic regression analysis revealed that the CC genotype of the rs11720524 polymorphism in the SCN5A gene encoding a subunit of the cardiac voltage-gated sodium channel occurred more frequently in the highly heterogeneous cardiac death cohort compared to the control population (p=0.019, odds ratio: 1.351). A detailed subgroup analysis uncovered that this effect was due to an association of this variant with cardiac death in chronic ischemic heart disease (p=0.012, odds ratio = 1.455). None of the other investigated polymorphisms showed association with cardiac death in this context. In conclusion, our results shed light on the role of this non-coding polymorphism in cardiac death in ischemic cardiomyopathy. Functional studies are needed to explore the pathophysiological background of this association.

  14. Estrogen Receptor Polymorphisms and the Vascular Effects of Hormone Therapy

    PubMed Central

    Rossouw, Jacques; Bray, Paul; Liu, Jingmin; Kooperberg, Charles; Hsia, Judith; Lewis, Cora; Cushman, Mary; Bonds, Denise; Hendrix, Susan; Papanicolaou, George; Howard, Tim; Herrington, David

    2010-01-01

    Objective To test whether estrogen receptor polymorphisms modify the effects of postmenopausal hormone therapy on biomarkers and on risk of coronary heart disease events, stroke, or venous thrombo-embolism. Methods and Results The design was a nested case-control study in the Women’s Health Initiative trials of postmenopausal hormone therapy. The study included all cases in the first 4 years: coronary heart disease, 359; stroke, 248; venous thrombo-embolism, 217). Six estrogen receptor-αand one estrogen receptorpolymorphisms were genotyped; 8 biomarkers known to be affected by hormone therapy were measured at baseline and one year after randomization. The polymorphisms were not associated with risk of vascular events, and did not modify the increased risks of coronary heart disease, stroke, or venous thrombo-embolism due to hormone therapy. However, a reduced response of plasmin-antiplasmin (PAP) to hormone therapy was noted for ESR1 IVS1-354 (interaction P<0.0001, corrected for multiple comparisons P=0.014) and ESR1 IVS1-1415 (interaction P<0.0001, corrected P= 0.014). Conclusions Estrogen receptor polymorphisms reduce the effect of postmenopausal hormone therapy on PAP, a marker of coagulation and fibrinolysis. However screening for ER polymorphisms to identify women at less risk of adverse cardiovascular outcomes is not likely to be useful for making HT treatment decisions. PMID:21106950

  15. Polymorphism of CAG repeats in androgen receptor of carnivores.

    PubMed

    Wang, Qin; Zhang, Xiuyue; Wang, Xiaofang; Zeng, Bo; Jia, Xiaodong; Hou, Rong; Yue, Bisong

    2012-03-01

    Androgen effect is mediated by the androgen receptor (AR). The polymorphism of CAG triplet repeat (polyCAG), in the N-terminal transactivation domain of the AR protein, has been involved either in endocrine or neurological disorders in human. We obtained partial sequence of AR exon 1 in 10 carnivore species. In most carnivore species, polyglutamine length polymorphism presented in all three CAG repeat regions of AR, in contrast, only CAG-I site polymorphism presented in primate species, and CAG-I and CAG-III sites polymorphism presented in Canidae. Therefore, studies focusing on disease-associated polymorphism of poly(CAG) in carnivore species AR should investigate all three CAG repeats sites, and should not only consider CAG-I sites as the human disease studies. The trinucleotide repeat length in carnivore AR exon 1 had undergone from expansions to contractions during carnivores evolution, unlike a linear increase in primate species. Furthermore, the polymorphisms of the triplet-repeats in the same tissue (somatic mosaicism) were demonstrated in Moutain weasel, Eurasian lynx, Clouded leopard, Chinese tiger, Black leopard and Leopard AR. And, the abnormal stop codon was found in the exon 1 of three carnivore species AR (Moutain weasel, Eurasian lynx and Black leopard). It seemed to have a high frequency presence of tissue-specific somatic in carnivores AR genes. Thus the in vivo mechanism leading to such highly variable phenotypes of the described mutations, and their impact on these animals, are worthwhile to be further elucidated.

  16. Nicotinic Receptor Polymorphism in Lung Cancer

    DTIC Science & Technology

    2013-10-01

    bronchial cells to the tobacco nitrosamine -induced carcinogenic transformation of human bronchial cells [1-2]. 15. SUBJECT TERMS nicotinic receptor...cells to the tobacco nitrosamine -induced carcinogenic transformation of human bronchial cells [1-2]. Body According to the Statement of Works

  17. The role of glucocorticoid receptor (GR) polymorphisms in human erythropoiesis.

    PubMed

    Varricchio, Lilian; Migliaccio, Anna Rita

    2014-01-01

    Glucocorticoids are endogenous steroid hormones that regulate several biological functions including proliferation, differentiation and apoptosis in numerous cell types in response to stress. Synthetic glucocorticoids, such as dexamethasone (Dex) are used to treat a variety of diseases ranging from allergy to depression. Glucocorticoids exert their effects by passively entering into cells and binding to a specific Glucocorticoid Receptor (GR) present in the cytoplasm. Once activated by its ligand, GR may elicit cytoplasmic (mainly suppression of p53), and nuclear (regulation of transcription of GR responsive genes), responses. Human GR is highly polymorphic and may encode > 260 different isoforms. This polymorphism is emerging as the leading cause for the variability of phenotype and response to glucocorticoid therapy observed in human populations. Studies in mice and clinical observations indicate that GR controls also the response to erythroid stress. This knowledge has been exploited in-vivo by using synthetic GR agonists for treatment of the erythropoietin-refractory congenic Diamond Blackfan Anemia and in-vitro to develop culture conditions that may theoretically generate red cells in numbers sufficient for transfusion. However, the effect exerted by GR polymorphism on the variability of the phenotype of genetic and acquired erythroid disorders observed in the human population is still poorly appreciated. This review will summarize current knowledge on the biological activity of GR and of its polymorphism in non-hematopoietic diseases and discuss the implications of these observations for erythropoiesis.

  18. The role of glucocorticoid receptor (GR) polymorphisms in human erythropoiesis

    PubMed Central

    Varricchio, Lilian; Migliaccio, Anna Rita

    2014-01-01

    Glucocorticoids are endogenous steroid hormones that regulate several biological functions including proliferation, differentiation and apoptosis in numerous cell types in response to stress. Synthetic glucocorticoids, such as dexamethasone (Dex) are used to treat a variety of diseases ranging from allergy to depression. Glucocorticoids exert their effects by passively entering into cells and binding to a specific Glucocorticoid Receptor (GR) present in the cytoplasm. Once activated by its ligand, GR may elicit cytoplasmic (mainly suppression of p53), and nuclear (regulation of transcription of GR responsive genes), responses. Human GR is highly polymorphic and may encode > 260 different isoforms. This polymorphism is emerging as the leading cause for the variability of phenotype and response to glucocorticoid therapy observed in human populations. Studies in mice and clinical observations indicate that GR controls also the response to erythroid stress. This knowledge has been exploited in-vivo by using synthetic GR agonists for treatment of the erythropoietin-refractory congenic Diamond Blackfan Anemia and in-vitro to develop culture conditions that may theoretically generate red cells in numbers sufficient for transfusion. However, the effect exerted by GR polymorphism on the variability of the phenotype of genetic and acquired erythroid disorders observed in the human population is still poorly appreciated. This review will summarize current knowledge on the biological activity of GR and of its polymorphism in non-hematopoietic diseases and discuss the implications of these observations for erythropoiesis. PMID:25755906

  19. Vitamin D receptor polymorphisms in patients with cutaneous melanoma

    PubMed Central

    Orlow, Irene; Roy, Pampa; Reiner, Anne S.; Yoo, Sarah; Patel, Himali; Paine, Susan; Armstrong, Bruce K.; Kricker, Anne; Marrett, Loraine D.; Millikan, Robert C.; Thomas, Nancy E.; Gruber, Stephen B.; Anton-Culver, Hoda; Rosso, Stefano; Gallagher, Richard P.; Dwyer, Terence; Kanetsky, Peter A.; Busam, Klaus; From, Lynn; Begg, Colin B.; Berwick, Marianne

    2011-01-01

    The vitamin D receptor (VDR) gene has been associated with cancer risk, but only a few polymorphisms have been studied in relation to melanoma risk and the results have been inconsistent. We examined 38 VDR gene SNPs in a large international multi-center population-based case-control study of melanoma. Buccal DNAs were obtained from 1207 people with incident multiple primary melanoma and 2469 with incident single primary melanoma. SNPs with known or suspected impact on VDR activity, htSNPs with ≥10% MAF in Caucasians, and SNPs reported as significant in other association studies were examined. Logistic regression was used to calculate the relative risks conferred by the individual SNP. Eight of 38 SNPs in the promoter, coding, and 3’ gene regions were individually significantly associated with multiple primary melanoma after adjusting for covariates. The estimated increase in risk for individuals who were homozygous for the minor allele ranged from 25% to 33% for 6 polymorphisms: rs10875712 (OR 1.28; 95%CI, 1.01–1.62), rs4760674 (OR 1.33; 95% CI, 1.06–1.67), rs7139166 (OR 1.26; 95%CI, 1.02–1.56), rs4516035 (OR 1.25; 95%CI, 1.01–1.55), rs11168287 (OR 1.27; 95%CI, 1.03–1.57), rs1544410 (OR 1.30; 95%CI, 1.04–1.63); for 2 polymorphisms, homozygous carriers had a decreased risk: rs7305032 (OR 0.81; 95%CI 0.65–1.02), rs7965281 (OR, 0.78; 95%CI, 0.62–0.99). We recognize the potential false positive findings due to multiple comparisons; however the 8 significant SNPs in this study outnumbered the 2 significant tests expected to occur by chance. The vitamin D receptor may play a role in melanomagenesis. PMID:21365644

  20. Vitamin D receptor polymorphisms in patients with cutaneous melanoma.

    PubMed

    Orlow, Irene; Roy, Pampa; Reiner, Anne S; Yoo, Sarah; Patel, Himali; Paine, Susan; Armstrong, Bruce K; Kricker, Anne; Marrett, Loraine D; Millikan, Robert C; Thomas, Nancy E; Gruber, Stephen B; Anton-Culver, Hoda; Rosso, Stefano; Gallagher, Richard P; Dwyer, Terence; Kanetsky, Peter A; Busam, Klaus; From, Lynn; Begg, Colin B; Berwick, Marianne

    2012-01-15

    The vitamin D receptor (VDR) gene has been associated with cancer risk, but only a few polymorphisms have been studied in relation to melanoma risk and the results have been inconsistent. We examined 38 VDR gene single nucleotide polymorphisms (SNPs) in a large international multicenter population-based case-control study of melanoma. Buccal DNAs were obtained from 1,207 people with incident multiple primary melanoma and 2,469 with incident single primary melanoma. SNPs with known or suspected impact on VDR activity, haplotype tagging SNPs with ≥ 10% minor allele frequency in Caucasians, and SNPs reported as significant in other association studies were examined. Logistic regression was used to calculate the relative risks conferred by the individual SNP. Eight of 38 SNPs in the promoter, coding, and 3' gene regions were individually significantly associated with multiple primary melanoma after adjusting for covariates. The estimated increase in risk for individuals who were homozygous for the minor allele ranged from 25 to 33% for six polymorphisms: rs10875712 (odds ratios [OR] 1.28; 95% confidence interval (CI), 1.01-1.62), rs4760674 (OR 1.33; 95% CI, 1.06-1.67), rs7139166 (OR 1.26; 95%CI, 1.02-1.56), rs4516035 (OR 1.25; 95%CI, 1.01-1.55), rs11168287 (OR 1.27; 95%CI, 1.03-1.57) and rs1544410 (OR 1.30; 95%CI, 1.04-1.63); for two polymorphisms, homozygous carriers had a decreased risk: rs7305032 (OR 0.81; 95%CI 0.65-1.02) and rs7965281 (OR, 0.78; 95%CI, 0.62-0.99). We recognize the potential false positive findings because of multiple comparisons; however, the eight significant SNPs in our study outnumbered the two significant tests expected to occur by chance. The VDR may play a role in melanomagenesis.

  1. Vitamin D Receptor (VDR) Polymorphisms in Pediatric Patients Presenting With Hodgkin's Lymphoma.

    PubMed

    Tekgündüz, Sibel A; Yeşil, Şule; Ören, Ayşe C; Tanyildiz, Hikmet G; Çandir, Mehmet O; Bozkurt, Ceyhun; Şahin, Gürses

    2017-03-01

    Vitamin D receptor (VDR) polymorphisms are found more commonly in some tumor types than in healthy individuals, suggesting that some polymorphisms (Cdx2, Fok1, Bsm1, Apa1, Taq1) contribute to tumor development. There is no previous report on VDR polymorphism in Hodgkin's lymphoma (HL) patients. VDR polymorphism patterns in 95 pediatric HL cases with 100 healthy controls were compared. No statistically significant difference was found between the patient group and control group in terms of Cdx2, Fok1, Bsm1, Apa1, and Taq1 polymorphisms (P>0.5). Our findings suggest that VDR polymorphisms may not play a role in HL development.

  2. Impact of estrogen receptor α gene and oxytocin receptor gene polymorphisms on female sexuality.

    PubMed

    Armeni, Anastasia K; Assimakopoulos, Konstantinos; Marioli, Dimitra; Koika, Vassiliki; Michaelidou, Euthychia; Mourtzi, Niki; Iconomou, Gregoris; Georgopoulos, Neoklis A

    2017-01-01

    Over the past decades, research attention has increasingly been paid to the neurobiological component of sexual behavior. The aim of the present study was to investigate the correlation of estrogen receptor α (ERA) gene polymorphism (rs2234693-PvuII) (T→C substitution) and oxytocin receptor gene polymorphism (rs53576) (G→A substitution) with sexuality parameters of young, healthy women. One hundred thirty-three Greek heterosexual women, students in higher education institutions, 20-25 years of age, sexually active, with normal menstrual cycles (28-35 days), were recruited in the study. Exclusion criteria were chronic and/or major psychiatric diseases, use of oral contraceptive pills (OCs), polycystic ovary syndrome (PCOS), thyroid diseases as well as drugs that are implicated in hypothalamus-pituitary-gonadal axis. T allele (wildtype) of rs2234693 (PvuII) polymorphism of ERA gene was correlated with increased levels of arousal and lubrication, whereas A allele (polymorphic) of rs53576 (OXTR) polymorphism was correlated with increased arousal levels. The simultaneous presence of both T allele of rs2234693 (PvuII) and A allele of rs53576 (OXTR) polymorphisms (T + A group) was correlated with increased arousal, orgasm levels as well as female sexual function index full score. To our knowledge, this is the first study to investigate the interaction between ERA and OXTR with regard to sexual function in women. Female sexuality is a complex behavioral trait that encompasses both biological and psychological components. It seems that variability in female sexual response stems from genetic variability that characterizes endocrine, neurotransmitter and central nervous system influences.

  3. Impact of estrogen receptor α gene and oxytocin receptor gene polymorphisms on female sexuality

    PubMed Central

    Armeni, Anastasia K; Assimakopoulos, Konstantinos; Marioli, Dimitra; Koika, Vassiliki; Michaelidou, Euthychia; Mourtzi, Niki; Iconomou, Gregoris

    2017-01-01

    Over the past decades, research attention has increasingly been paid to the neurobiological component of sexual behavior. The aim of the present study was to investigate the correlation of estrogen receptor α (ERA) gene polymorphism (rs2234693-PvuII) (T→C substitution) and oxytocin receptor gene polymorphism (rs53576) (G→A substitution) with sexuality parameters of young, healthy women. One hundred thirty-three Greek heterosexual women, students in higher education institutions, 20–25 years of age, sexually active, with normal menstrual cycles (28–35 days), were recruited in the study. Exclusion criteria were chronic and/or major psychiatric diseases, use of oral contraceptive pills (OCs), polycystic ovary syndrome (PCOS), thyroid diseases as well as drugs that are implicated in hypothalamus–pituitary–gonadal axis. T allele (wildtype) of rs2234693 (PvuII) polymorphism of ERA gene was correlated with increased levels of arousal and lubrication, whereas A allele (polymorphic) of rs53576 (OXTR) polymorphism was correlated with increased arousal levels. The simultaneous presence of both T allele of rs2234693 (PvuII) and A allele of rs53576 (OXTR) polymorphisms (T + A group) was correlated with increased arousal, orgasm levels as well as female sexual function index full score. To our knowledge, this is the first study to investigate the interaction between ERA and OXTR with regard to sexual function in women. Female sexuality is a complex behavioral trait that encompasses both biological and psychological components. It seems that variability in female sexual response stems from genetic variability that characterizes endocrine, neurotransmitter and central nervous system influences. PMID:28069897

  4. CXC motif chemokine receptor 4 gene polymorphism and cancer risk

    PubMed Central

    Wu, Yang; Zhang, Chun; Xu, Weizhang; Zhang, Jianzhong; Zheng, Yuxiao; Lu, Zipeng; Liu, Dongfang; Jiang, Kuirong

    2016-01-01

    Abstract Background: Previous epidemiological studies have reported the relationship between CXC motif chemokine receptor 4 (CXCR4) synonymous polymorphism (rs2228014), and risk of cancer, but the results remained conflicting and controversial. Therefore, this study was devised to evaluate the genetic effects of the rs2228014 polymorphism on cancer risk in a large meta-analysis. Methods: The computer-based databases (EMBASE, Web of Science, and PubMed) were searched for all relevant studies evaluating rs2228014 and susceptibility to cancer. In the analysis, pooled odds ratios (ORs) with its corresponding 95% confidence intervals (CIs) were calculated in 5 genetic models to assess the genetic risk. Egger regression and Begg funnel plots test were conducted to appraise the publication bias. Results: Data on rs2228014 polymorphism and overall cancer risk were available for 3684 cancer patients and 5114 healthy controls participating in 11 studies. Overall, a significantly increased risk of cancer was associated with rs2228014 polymorphism in homozygote model (OR = 2.01, 95% CI: 1.22–3.33) and in recessive model (OR = 1.97, 95% CI: 1.23–3.16). When stratified by ethnicity, the results were positive only in Asian populations (heterozygote model: OR = 1.36, 95% CI: 1.13–1.65; homozygote model: OR = 2.43, 95% CI: 1.21–4.91; dominant model: OR = 1.47, 95% CI: 1.13–1.90; recessive model: OR = 2.25, 95% CI: 1.13–4.48; and allele model: OR = 1.48, 95% CI: 1.10–1.99). Besides, in the subgroup analysis by source of control, the result was significant only in population-based control (homozygote model: OR = 2.39, 95% CI: 1.06–5.40; recessive model: pooled OR = 2.24, 95% CI: 1.02–4.96). Conclusion: In general, our results first indicated that the rs2228014 polymorphism in CXCR4 gene is correlated with an increased risk of cancer, especially among Asian ethnicity. Large, well-designed epidemiological studies are required to verify the current findings. PMID

  5. Estrogen receptor alpha polymorphisms and the risk of malignancies.

    PubMed

    Anghel, Andrei; Narita, Diana; Seclaman, Edward; Popovici, Emilian; Anghel, Mariana; Tamas, Liviu

    2010-12-01

    Estrogens represent risk factors for endocrine-related cancers and play also an important role in the development and progression of other malignancies. In order to analyze the associations between estrogen receptor gene alpha polymorphisms and cancers susceptibility, we genotyped six single nucleotide polymorphisms (SNPs) in 163 Caucasian cancer patients--103 breast cancers and 60 other malignancies (colorectal, bladder, hepatocellular carcinoma and acute myeloid leukemia)--and 114 healthy controls using hybridization probes. We performed Armitage`s association trend-test to evaluate the risk. Linkage disequilibrium (LD) was assessed for each pair of markers. The genotypes CC and CT of rs3798577 were significantly associated with the cancers risk (p-trend breast = 4 × 10(-5); p-trend cancers = 1 × 10(-5)); in discrepancy with breast cancer where the C-allele represented the risk allele, for bladder, hepatocellular carcinomas and leukemia, the T allele seems to confer susceptibility. The minor G allele of rs1801132 was protective in our cases (p = 1 × 10(-4)); for rs2228480, the heterozygous frequency was higher for cancer groups (p = 0.03); the SNP pairs rs2228480&rs3798577 and rs2234693&rs9340799 were in low LD; the haplotypes T-A of rs2234693&rs9340799 and G-C of rs2228480&rs3798577 showed a trend to be higher represented in breast cancers; T allele of rs2234693 was higher expressed in breast, colon cancers and leukemia; rs2077647 was associated with colon (p = 0.008, C-risk allele) and bladder (p = 0.01, T-risk allele) cancers. We concluded that ESR1 polymorphisms may have distinct impact in carcinogenesis and further genotyping will establish whether these findings remain significant in larger cohorts.

  6. Impact of vitamin D receptor polymorphisms in centenarians.

    PubMed

    Gussago, Cristina; Arosio, Beatrice; Guerini, Franca Rosa; Ferri, Evelyn; Costa, Andrea Saul; Casati, Martina; Bollini, Elisa Mariadele; Ronchetti, Francesco; Colombo, Elena; Bernardelli, Giuseppina; Clerici, Mario; Mari, Daniela

    2016-08-01

    Vitamin D is a seco-sterol produced endogenously in the skin or obtained from certain foods. It exerts its action through binding to intracellular vitamin D receptor (VDR). Lately, the role of vitamin D has been revised regarding its potential advantage on delaying the process of aging. The aim of this study was to assess the contribution of VDR gene polymorphisms in healthy aging and longevity. We evaluated the frequency of four polymorphisms of the VDR gene (FokI, BsmI, ApaI, and TaqI) in centenarians (102 subjects, mean age: 102.3 ± 0.3 years), compared to septuagenarians (163 subjects, mean age: 73.0 ± 0.6 years) and we analyzed a variety of pathophysiologically relevant functions in centenarians. BsmI and ApaI provided a significant association with longevity: there was a highly significant difference in the frequency of BsmI genotypes (p = 0.037), ApaI genotypes (p = 0.022), and ApaI alleles (p = 0.050) in centenarians versus septuagenarians. Furthermore, we found a significant correlation of all the VDR gene polymorphisms in centenarians with some measured variables such as hand grip strength, body mass index, blood pressure, HDL cholesterol, and mini-mental state examination. We also found a correlation with the prevalence of medical history of hypertension, acute myocardial infarction, angina, venous insufficiency, dementia, chronic obstructive pulmonary disease, and arthrosis. In conclusion, this study proposes a new scenario in which the variability of the VDR gene is relevant in the aging process and emphasizes the role of VDR genetic background in determining healthy aging.

  7. Polymorphism of the complement receptor for C3bi.

    PubMed Central

    Russ, G R; Haddad, A P; Tait, B D; d'Apice, A J

    1985-01-01

    RM2.184, a mouse IgG2a monoclonal antibody, recognizes a polymorphic determinant on the complement receptor for C3bi which is present on granulocytes and monocytes. The RM2.184 epitope is distinct from the monomorphic determinant recognized by the monoclonal antibody OKM1. The RM2.184 epitope is probably on the alpha subunit and dependent on the association of the alpha and beta subunits for its configuration, as it can not be detected after the subunits have been dissociated. The phenotypic frequency of the RM2.184 antigen is approximately 14%, and its segregation in families is independent of HLA and consistent with an autosomal co-dominant mode of inheritance. Images PMID:2414326

  8. Pharmacogenomics in psychiatry: the relevance of receptor and transporter polymorphisms.

    PubMed

    Reynolds, Gavin P; McGowan, Olga O; Dalton, Caroline F

    2014-04-01

    The treatment of severe mental illness, and of psychiatric disorders in general, is limited in its efficacy and tolerability. There appear to be substantial interindividual differences in response to psychiatric drug treatments that are generally far greater than the differences between individual drugs; likewise, the occurrence of adverse effects also varies profoundly between individuals. These differences are thought to reflect, at least in part, genetic variability. The action of psychiatric drugs primarily involves effects on synaptic neurotransmission; the genes for neurotransmitter receptors and transporters have provided strong candidates in pharmacogenetic research in psychiatry. This paper reviews some aspects of the pharmacogenetics of neurotransmitter receptors and transporters in the treatment of psychiatric disorders. A focus on serotonin, catecholamines and amino acid transmitter systems reflects the direction of research efforts, while relevant results from some genome-wide association studies are also presented. There are many inconsistencies, particularly between candidate gene and genome-wide association studies. However, some consistency is seen in candidate gene studies supporting established pharmacological mechanisms of antipsychotic and antidepressant response with associations of functional genetic polymorphisms in, respectively, the dopamine D2 receptor and serotonin transporter and receptors. More recently identified effects of genes related to amino acid neurotransmission on the outcome of treatment of schizophrenia, bipolar illness or depression reflect the growing understanding of the roles of glutamate and γ-aminobutyric acid dysfunction in severe mental illness. A complete understanding of psychiatric pharmacogenomics will also need to take into account epigenetic factors, such as DNA methylation, that influence individual responses to drugs.

  9. Pharmacogenomics in psychiatry: the relevance of receptor and transporter polymorphisms

    PubMed Central

    Reynolds, Gavin P; McGowan, Olga O; Dalton, Caroline F

    2014-01-01

    The treatment of severe mental illness, and of psychiatric disorders in general, is limited in its efficacy and tolerability. There appear to be substantial interindividual differences in response to psychiatric drug treatments that are generally far greater than the differences between individual drugs; likewise, the occurrence of adverse effects also varies profoundly between individuals. These differences are thought to reflect, at least in part, genetic variability. The action of psychiatric drugs primarily involves effects on synaptic neurotransmission; the genes for neurotransmitter receptors and transporters have provided strong candidates in pharmacogenetic research in psychiatry. This paper reviews some aspects of the pharmacogenetics of neurotransmitter receptors and transporters in the treatment of psychiatric disorders. A focus on serotonin, catecholamines and amino acid transmitter systems reflects the direction of research efforts, while relevant results from some genome-wide association studies are also presented. There are many inconsistencies, particularly between candidate gene and genome-wide association studies. However, some consistency is seen in candidate gene studies supporting established pharmacological mechanisms of antipsychotic and antidepressant response with associations of functional genetic polymorphisms in, respectively, the dopamine D2 receptor and serotonin transporter and receptors. More recently identified effects of genes related to amino acid neurotransmission on the outcome of treatment of schizophrenia, bipolar illness or depression reflect the growing understanding of the roles of glutamate and γ-aminobutyric acid dysfunction in severe mental illness. A complete understanding of psychiatric pharmacogenomics will also need to take into account epigenetic factors, such as DNA methylation, that influence individual responses to drugs. PMID:24354796

  10. Endothelin receptor polymorphisms in the cardiovascular system: potential implications for therapy and screening.

    PubMed

    Holzhauser, Luise; Zolty, Ronald

    2014-11-01

    Since its discovery in 1988, the endothelin system has been employed in multiple physiological and pathological roles. Endothelin-1 (ET-1) is not only a major regulator of vascular tone and cardiac contractility but also exerts mitogenic effects and is involved in inflammatory responses. ET-1 acts via two endothelin receptors located mainly on smooth muscle and endothelial cells through complex intracellular pathways differing between receptors and cell types. Polymorphisms of the endothelin receptor A have been associated not only with the risk in pulmonary arterial hypertension (PAH), systolic heart failure and systemic hypertension but are also of prognostic significance in dilated cardiomyopathy. Polymorphisms of endothelin receptors might lead to altered endothelin signaling and influence the response to endothelin receptor antagonist therapy in PAH in light of pharmacogenetics. This review will summarize the role of ET-1 within major cardiovascular pathologies and discuss endothelin receptor polymorphisms with special emphasis on potential therapeutic and screening implications.

  11. Estrogen receptor polymorphisms: significance to human physiology, disease and therapy.

    PubMed

    Figtree, Gemma A; Noonan, Jonathon E; Bhindi, Ravinay; Collins, Peter

    2009-01-01

    Other than its well-recognized effects on reproductive physiology, estrogen has important actions in a wide variety of other body systems with important examples including bone, blood vessels and the heart. These effects are seen in both females and males. Investigators have hypothesized those genetic variants in the genes coding for estrogen signaling proteins may cause variable sensitivity to the hormone and influence an individual's estrogen-sensitive phenotypes. The most obvious candidate genes are the estrogen receptors alpha and (ERalpha and beta). However, the regulation of these genes is complex and not well understood. Furthermore, their coding exons, and regulatory sequences are dispersed across large segments of the genome. A number of common polymorphisms have been identified in both ERalpha and ERbeta, with variable degrees of evidence of their direct biological significance and their association with human disease. The identification of genetic variations associated with altered estrogen response is of potential public health importance. Insights may be gained into the pathogenesis of estrogen sensitive diseases such as osteoporosis, breast cancer and cardiovascular disease contributing to the development and application of newer therapies for these disorders. Furthermore, genetic variants that alter sensitivity to estrogen may affect both therapeutic and harmful responses to exogenous estrogen administered in the form of the oral contraceptive pill or hormone replacement therapy. This clinical significance has led to the publication of a number of patents which will be reviewed.

  12. Olfactory Receptor Gene Polymorphisms and Nonallergic Vasomotor Rhinitis

    PubMed Central

    Bernstein, Jonathan A.; Zhang, Ge; Jin, Li; Abbott, Carol; Nebert, Daniel W.

    2009-01-01

    We sought a genotype-phenotype association: between single-nucleotide polymorphisms (SNPs) in olfactory receptor (OR) genes from the two largest OR gene clusters and odor-triggered nonallergic vasomotor rhinitis (nVMR). In the initial pedigree screen, using transmission disequilibrium test (TDT) analysis, six SNPs showed “significant” p-values between 0.0449 and 0.0043. In a second case-control population, the previously identified six SNPs did not re-emerge, whereas four new SNPs showed p-values between 0.0490 and 0.0001. Combining both studies, none of the SNPs in the TDT analysis survived the Bonferroni correction. In the population study, one SNP showed an empirical p-value of 0.0066 by shuffling cases and controls with 105 replicates; however, the p-value for this SNP was 0.83 in the pedigree study. This study emphasizes that underpowered studies having p-values between <0.05 and 0.0001 should be regarded as inconclusive and require further replication before concluding the study is “informative.” However, we believe that our hypothesis that an association between OR genotypes and the nVMR phenotype remains feasible. Future studies using either a genomewide association study of all OR gene-pseudogene regions throughout the genome—at the current recommended density of 2.5 to 5 kb per tag SNP—or studies incorporating microarray analyses of the entire “OR genome” in well-characterized nVMR patients are required. PMID:18446592

  13. Toll like receptor polymorphisms in allogeneic hematopoietic cell transplantation

    PubMed Central

    Kornblit, Brian; Enevold, Christian; Wang, Tao; Spellman, Stephen; Haagenson, Mike; Lee, Stephanie J; Müller, Klaus

    2014-01-01

    To assess the impact of the genetic variation in toll-like receptors (TLR) on outcome after allogeneic myeloablative conditioning hematopoietic cell transplantation (HCT) we have investigated 29 single nucleotide polymorphisms (SNP) across 10 TLRs in 816 patients and donors. Only donor genotype of TLR8 rs3764879, which is located on the X chromosome, was significantly associated with outcome at the Bonferroni corrected level P≤0.001. Male hemizygosity and female homozygosity for the minor allele were significantly associated with disease free survival (DFS) (hazard ratio (HR) 1.47 (95% confidence interval (CI) 1.16–1.85); P=0.001). Further analysis stratified by donor sex due to confounding by sex, was suggestive for associations with overall survival (male donor: HR 1.41 (95% CI 1.09–1.83), P=0.010); female donor: (HR 2.78 (95% CI 1.43–5.41), P=0.003), DFS (male donor: HR 1.45 (95% CI 1.12–1.87), P=0.005; female donor: HR 2.34 (95% CI 1.18–4.65), P=0.015) and treatment related mortality (male donor: HR 1.49 (95% CI 1.09–2.04), P=0.012; female donor: HR 3.12 (95% CI 1.44–6.74), P=0.004). In conclusion our findings suggest that the minor allele of TLR8 rs3764879 of the donor is associated with outcome after myeloablative conditioned allogeneic HCT. PMID:25464115

  14. Toll-like receptor polymorphisms in allogeneic hematopoietic cell transplantation.

    PubMed

    Kornblit, Brian; Enevold, Christian; Wang, Tao; Spellman, Stephen; Haagenson, Mike; Lee, Stephanie J; Müller, Klaus

    2015-02-01

    To assess the impact of the genetic variation in toll-like receptors (TLRs) on outcome after allogeneic myeloablative conditioning hematopoietic cell transplantation (HCT), we investigated 29 single nucleotide polymorphisms across 10 TLRs in 816 patients and donors. Only donor genotype of TLR8 rs3764879, which is located on the X chromosome, was significantly associated with outcome at the Bonferroni-corrected level P ≤ .001. Male hemizygosity and female homozygosity for the minor allele were significantly associated with disease-free survival (hazard ratio [HR], 1.47 [95% confidence interval {CI}, 1.16 to 1.85]; P = .001). Further analysis stratified by donor sex due to confounding by sex was suggestive for associations with overall survival (male donor: HR, 1.41 [95% CI, 1.09 to 1.83], P = .010; female donor: HR, 2.78 [95% CI, 1.43 to 5.41], P = .003), disease-free survival (male donor: HR, 1.45 [95% CI, 1.12 to 1.87], P = .005; female donor: HR, 2.34 [95% CI, 1.18 to 4.65], P = .015), and treatment-related mortality (male donor: HR, 1.49 [95% CI, 1.09 to 2.04], P = .012; female donor: HR, 3.12 [95% CI, 1.44 to 6.74], P = .004). In conclusion, our findings suggest that the minor allele of TLR8 rs3764879 of the donor is associated with outcome after myeloablative conditioned allogeneic HCT.

  15. 5-HT2A receptor gene polymorphisms in Croatian subjects with autistic disorder.

    PubMed

    Hranilovic, Dubravka; Blazevic, Sofia; Babic, Marina; Smurinic, Maja; Bujas-Petkovic, Zorana; Jernej, Branimir

    2010-08-15

    Disturbances in the expression/function of the 5-HT2A receptor are implicated in autism. The association of the 5-HT2A receptor gene with autism was studied in the Croatian population. Distribution frequencies for alleles, genotypes and haplotypes of -1438 A/G and His452Tyr polymorphisms were compared in samples of 103 autistic and 214 control subjects. Significant overrepresentation of the G allele and the GG genotype of the -1438 A/G polymorphism was observed in group of autistic subjects, supporting the possible involvement of the 5-HT2A receptor in the development of autism.

  16. Comparative analysis of IL6 and IL6 receptor gene polymorphisms in mastocytosis.

    PubMed

    Rausz, Eszter; Szilágyi, Agnes; Nedoszytko, Boguslaw; Lange, Magdalena; Niedoszytko, Marek; Lautner-Csorba, Orsolya; Falus, András; Aladzsity, István; Kokai, Márta; Valent, Peter; Marschalko, Márta; Hidvégi, Bernadett; Szakonyi, József; Csomor, Judit; Várkonyi, Judit

    2013-01-01

    Mastocytosis is a rare disease with reported high interleukin-6 (IL6) levels influencing disease severity. The present study investigated polymorphisms within the genes that encode IL6 and its receptor (IL6R) in relation to mastocytosis development in a case-control design. Analysis of the IL6R Asp358Ala polymorphism showed that carriers of the AA genotype had a 2·5-fold lower risk for mastocytosis than those with the AC or CC genotypes. No association with mastocytosis was found for the IL6-174G/C polymorphism, however, it may influence the effect of IL6R polymorphism. To the best of our knowledge this is the first study analysing IL6/IL6R polymorphisms in mastocytosis.

  17. The BDNF Val66Met polymorphism impairs NMDA receptor-dependent synaptic plasticity in the hippocampus.

    PubMed

    Ninan, Ipe; Bath, Kevin G; Dagar, Karishma; Perez-Castro, Rosalia; Plummer, Mark R; Lee, Francis S; Chao, Moses V

    2010-06-30

    The Val66Met polymorphism in the brain-derived neurotrophic factor (BDNF) gene results in a defect in regulated release of BDNF and affects episodic memory and affective behaviors. However, the precise role of the BDNF Val66Met polymorphism in hippocampal synaptic transmission and plasticity has not yet been studied. Therefore, we examined synaptic properties in the hippocampal CA3-CA1 synapses of BDNF(Met/Met) mice and matched wild-type mice. Although basal glutamatergic neurotransmission was normal, both young and adult mice showed a significant reduction in NMDA receptor-dependent long-term potentiation. We also found that NMDA receptor-dependent long-term depression was decreased in BDNF(Met/Met) mice. However, mGluR-dependent long-term depression was not affected by the BDNF Val66Met polymorphism. Consistent with the NMDA receptor-dependent synaptic plasticity impairment, we observed a significant decrease in NMDA receptor neurotransmission in the CA1 pyramidal neurons of BDNF(Met/Met) mice. Thus, these results show that the BDNF Val66Met polymorphism has a direct effect on NMDA receptor transmission, which may account for changes in synaptic plasticity in the hippocampus.

  18. A common polymorphism in the LDL receptor gene has multiple effects on LDL receptor function.

    PubMed

    Gao, Feng; Ihn, Hansel E; Medina, Marisa W; Krauss, Ronald M

    2013-04-01

    A common synonymous single nucleotide polymorphism in exon 12 of the low-density lipoprotein receptor (LDLR) gene, rs688, has been associated with increased plasma total and LDL cholesterol in several populations. Using immortalized lymphoblastoid cell lines from a healthy study population, we confirmed an earlier report that the minor allele of rs688 is associated with increased exon 12 alternative splicing (P < 0.05) and showed that this triggered nonsense-mediated decay (NMD) of the alternatively spliced LDLR mRNA. However, since synonymous single nucleotide polymorphisms may influence structure and function of the encoded proteins by co-translational effects, we sought to test whether rs688 was also functional in the full-length mRNA. In HepG2 cells expressing LDLR cDNA constructs engineered to contain the major or minor allele of rs688, the latter was associated with a smaller amount of LDLR protein at the cell surface (-21.8 ± 0.6%, P = 0.012), a higher amount in the lysosome fraction (+25.7 ± 0.3%, P = 0.037) and reduced uptake of fluorescently labeled LDL (-24.3 ± 0.7%, P < 0.01). Moreover, in the presence of exogenous proprotein convertase subtilisin/kexin type 9 (PCSK9), a protein that reduces cellular LDL uptake by promoting lysosomal degradation of LDLR, the minor allele resulted in reduced capacity of a PCSK9 monoclonal antibody to increase LDL uptake. These findings are consistent with the hypothesis that rs688, which is located in the β-propeller region of LDLR, has effects on LDLR activity beyond its role in alternative splicing due to impairment of LDLR endosomal recycling and/or PCSK9 binding, processes in which the β-propeller is critically involved.

  19. The association between estrogen receptor alpha polymorphisms and the risk of prostate cancer in Slovak population.

    PubMed

    Jurečeková, Jana; Sivoňová, Monika Kmetová; Evinová, Andrea; Kliment, Ján; Dobrota, Dušan

    2013-09-01

    The aim of our study was to evaluate the effect of two polymorphisms in the estrogen receptor alpha, PvuII and XbaI, on the development of prostate cancer within Slovak population, as well as their correlation with selected clinical characteristics. The study was performed using 311 prostate cancer patients and 256 healthy male controls. Both polymorphisms were significantly associated with higher risk of prostate cancer development. At the same time, the CC genotype of PvuII polymorphism (OR = 1.98; 95% CI 0.94-4.21; p = 0.05) and the AG genotype of XbaI polymorphism (OR = 1.74; 95% CI 1.0-3.02; p = 0.04) significantly contributed to the development of low-grade carcinoma, while the AG and GG genotypes of the XbaI polymorphism contributed mainly to the development of high-grade prostate cancer (OR = 1.83; 95% CI 1.12-3.01; p = 0.01 and OR = 2.13; 95% CI 1.06-4.19; p = 0.03, respectively). Similarly, the AG and GG genotypes of XbaI polymorphism showed significant association with prostate cancer in patients with serum PSA level ≥10 ng/ml. Both polymorphisms were found at the same time to be more frequent in patients diagnosed before the age of 60. We conclude on the basis of these results that PvuII and XbaI polymorphisms of estrogen receptor alpha might be associated with prostate cancer risk within Slovak population. Although this is a pilot study and, as such, more detailed investigations are needed to confirm the role of these polymorphisms in prostate cancer development and progression within said Slovak population, our results might still provide a valuable basis for further research with larger patient groups.

  20. Association between Estrogen Receptor Gene Polymorphisms and Depression in Post-Menopausal Women: A Preliminary Study

    PubMed Central

    Pae, Chi Un; Kim, Mi Ran; Min, Jung Ah; Kim, Kyung Hee; Lee, Chang Uk; Lee, Chul; Paik, In Ho

    2010-01-01

    Post-menopausal women experience variable biological and psychological changes. The effect of reduced levels of estrogen can effect on post-menopausal depression. Estrogen triggers physiological responses by binding to the estrogen receptor (ER). Two subtypes of ER, ERa and ERb are now known. We investigated the significance of ERa and ERb polymorphisms and post-menopasal depression in this study. Forty three women with post-menopausal depression and 63 post-menopausal women without depression as normal controls were recruited. Polymerase chain reaction-restriction fragment length polymorphism method was used to investigate genotypes of ERa and ERb polymorphisms. Genotypes of PvuII and XbaI polymorphism of ERa receptor were significantly different in patients with post-menopausal depression comparing with controls. Genotypes of ERb did not show association with post-menopausal depression. Our study showed that ERa receptor polymorphism had an association with depression in post-menopausal women. It suggests that investigation of ER genes and their functions might be important for understanding pathophysilogical mechanism of post-menopausal depression. PMID:20927313

  1. Oxytocin and vasopressin receptor polymorphisms interact with circulating neuropeptides to predict human emotional reactions to stress

    PubMed Central

    Moons, Wesley G.; Way, Baldwin M.; Taylor, Shelley E.

    2014-01-01

    Oxytocin (OT) and a polymorphism (rs53576) in the oxytocin receptor gene (OXTR) have been independently associated with stress reactivity, whereas oxytocin’s sister peptide, arginine vasopressin (AVP), and polymorphisms in the vasopressin receptor gene (AVPR1A) have been independently associated with aggressive behavior. In this study, 68 men and 98 women were genotyped for the OXTR rs53576 polymorphism and the AVPR1A RS1 polymorphism. Baseline and post-stressor levels of plasma OT, plasma AVP, positive affect, and anger were assessed. Women, but not men, with high levels of post-stressor OT and the GG genotype of rs53576 felt the most positive affect after the stressor. Men, but not women, with high levels of post-stressor AVP and with the 320allele of the RS1 polymorphism reported more post-stressor anger than non-carriers. These data constitute the first evidence that oxytocin and vasopressin receptor genes interact with levels of OT and AVP to predict sex-specific emotional stress responses. PMID:24660771

  2. Mutations and polymorphisms in FSH receptor: functional implications in human reproduction.

    PubMed

    Desai, Swapna S; Roy, Binita Sur; Mahale, Smita D

    2013-12-01

    FSH brings about its physiological actions by activating a specific receptor located on target cells. Normal functioning of the FSH receptor (FSHR) is crucial for follicular development and estradiol production in females and for the regulation of Sertoli cell function and spermatogenesis in males. In the last two decades, the number of inactivating and activating mutations, single nucleotide polymorphisms, and spliced variants of FSHR gene has been identified in selected infertile cases. Information on genotype-phenotype correlation and in vitro functional characterization of the mutants has helped in understanding the possible genetic cause for female infertility in affected individuals. The information is also being used to dissect various extracellular and intracellular events involved in hormone-receptor interaction by studying the differences in the properties of the mutant receptor when compared with WT receptor. Studies on polymorphisms in the FSHR gene have shown variability in clinical outcome among women treated with FSH. These observations are being explored to develop molecular markers to predict the optimum dose of FSH required for controlled ovarian hyperstimulation. Pharmacogenetics is an emerging field in this area that aims at designing individual treatment protocols for reproductive abnormalities based on FSHR gene polymorphisms. The present review discusses the current knowledge of various genetic alterations in FSHR and their impact on receptor function in the female reproductive system.

  3. Adrenergic receptor polymorphisms and autonomic nervous system function in human obesity.

    PubMed

    Yasuda, Koichiro; Matsunaga, Tetsuro; Adachi, Tetsuya; Aoki, Norihiko; Tsujimoto, Gozoh; Tsuda, Kinsuke

    2006-09-01

    Adrenergic receptors (ARs) are cell-surface G-protein-coupled receptors for catecholamines. They are essential components of the sympathetic nervous system, organized within the autonomic nervous system (ANS), which controls various physiological functions, including energy homeostasis and metabolism of glucose and lipids. An impairment of ANS function in metabolism is considered to be one of the pathological states associated with human obesity and related metabolic diseases; thus, alterations in AR function might be implicated in the pathophysiology of these diseases. Several studies have suggested an association between obesity phenotypes and some AR polymorphisms. In vitro and human clinical studies indicate that some of these polymorphisms have functional and pathophysiological significance, including the linkage to ANS function. This review summarizes present knowledge of AR polymorphisms related to human obesity, and their association with ANS function.

  4. A new EcoRI polymorphism for the insulin receptor gene

    SciTech Connect

    Accili, D.; Elbein, S.; McKeon, C.; Taylor, S.I. )

    1989-01-25

    A 550 bp BamHI-Pst I fragment encompassing bp 1,926-2,476 of the human insulin receptor cDNA was obtained. EcoRI identifies a two allele polymorphism, with bands of 5.8 and 5.5 kb. Co-dominant segregation was demonstrated in one Venezuelan pedigree.

  5. Dopamine Receptor D2 Polymorphism Moderates the Effect of Parental Education on Adolescents' School Performance

    ERIC Educational Resources Information Center

    Keltikangas-Jarvinen, Liisa; Pullmann, Helle; Pulkki-Raback, Laura; Alatupa, Saija; Lipsanen, Jari; Airla, Nina; Lehtimaki, Terho

    2008-01-01

    High parental socioeconomic status is known to have a positive effect on students' academic achievement. We examined whether variation in the dopamine receptor gene (DRD2 polymorphism, rs 1800497) modifies the association between parental educational level and school performance in adolescence. The participants were a randomly selected subsample…

  6. Genetic polymorphism of estrogen receptor alpha gene in Egyptian women with type II diabetes mellitus

    PubMed Central

    Motawi, Tarek M.K.; El-Rehany, Mahmoud A.; Rizk, Sherine M.; Ramzy, Maggie M.; el-Roby, Doaa M.

    2015-01-01

    Estrogen might play an important role in type 2 diabetes mellitus pathogenesis. A number of polymorphisms have been reported in the estrogen receptor alpha gene including the XbaI and PvuII restriction enzyme polymorphisms. The aim of this study was to determine if ESRα gene polymorphisms are associated with type 2 diabetes mellitus and correlated with lipid profile. Ninety diabetic Egyptian patients were compared with forty healthy controls. ESRα genotyping of PvuII and XbaI was performed using restriction fragment length polymorphism analysis. Our study showed that there is more significant difference in the frequency of C and G polymorphic allele between patients and control groups in PvuII and XbaI respectively. Also carriers of minor C and G alleles of PvuII and XbaI gene polymorphisms were associated with increased fasting blood glucose and disturbance in lipid profile as there is an increase in total cholesterol, triglycerides and Low density lipoprotein. So findings of present study suggest the possibility that PvuII and XbaI polymorphisms in ERα are related to T2DM and with increased serum lipids among Egyptian population. PMID:26401488

  7. Angiotensin II type 1 receptor A1166C gene polymorphism and essential hypertension in San Luis.

    PubMed

    Lapierre, Alicia Viviana; Arce, Maria Elena; Lopez, José Raul; Ciuffo, Gladys María

    2006-12-01

    Essential hypertension is considered a multifactorial trait resulting from a combination of environmental and genetic factors. The angiotensin II type 1 receptor mediates the vasoconstrictor and growth-promoting effects of Ang II. The A1166C polymorphism of the AT1 receptor gene may be associated with cardiovascular phenotypes, such as high arterial blood pressure, aortic stiffness, and increased cardiovascular risk. We investigated the association between this A1166C polymorphism and hypertension in hypertense and normotense subjects from San Luis (Argentina) by mismatch PCR-RFLP analysis. Hypertense patients exhibited significant increases in lipid related values and body mass index. The frequency of occurrence of the C1166 allele was higher among patients with hypertension (0.19) than in the control group (0.06). No significant association was found between this polymorphism and essential hypertension in the study population, although the AC genotype prevalence was higher in patients with hypertension and positive family history of hypertension (32%) than in control subjects (12%). Patients with the A1166C polymorphism exhibited higher levels of serum total cholesterol, LDL-cholesterol and BMI than in control subjects. Taken together the genotype and biochemical parameters and considering the restrictive selection criteria used, the present results suggest a correlation between AT1 A1166C gene polymorphism and risk of cardiovascular disease.

  8. Oxytocin and Vasopressin Receptor Gene Polymorphisms: Role in Social and Psychiatric Traits

    PubMed Central

    Aspé-Sánchez, Mauricio; Moreno, Macarena; Rivera, Maria Ignacia; Rossi, Alejandra; Ewer, John

    2016-01-01

    Oxytocin (OXT) and arginine-vasopressin (AVP) are two phylogenetically conserved neuropeptides that have been implicated in a wide range of social behaviors. Although a large body of research, ranging from rodents to humans, has reported on the effects of OXT and AVP administration on affiliative and trust behaviors, and has highlighted the genetic contributions of OXT and AVP receptor polymorphisms to both social behaviors and to diseases related to social deficits, the consequences of peptide administration on psychiatric symptoms, and the impact of receptor polymorphisms on receptor function, are still unclear. Despite the exciting advances that these reports have brought to social neuroscience, they remain preliminary and suffer from the problems that are inherent to monogenetic linkage and association studies. As an alternative, some studies are using polygenic approaches, and consider the contributions of other genes and pathways, including those involving DA, 5-HT, and reelin, in addition to OXT and AVP; a handful of report are also using genome-wide association studies. This review summarizes findings on the associations between OXT and AVP receptor polymorphism, social behavior, and psychiatric diseases. In addition, we discuss reports on the interactions of OXT and AVP receptor genes and genes involved in other pathways (such as those of dopamine, serotonin, and reelin), as well as research that has shed some light on the impact of gene polymorphisms on the volume, connectivity, and activation of specific neural structures, differential receptor expression, and plasma levels of the OXT and AVP peptides. We hope that this effort will be helpful for understanding the studies performed so far, and for encouraging the inclusion of other candidate genes not explored to date. PMID:26858594

  9. Polymorphisms in the oxidized low-density lipoprotein receptor-1 gene and risk of Alzheimer's disease.

    PubMed

    D'Introno, Alessia; Solfrizzi, Vincenzo; Colacicco, Anna M; Capurso, Cristiano; Torres, Francesco; Capurso, Sabrina A; Capurso, Antonio; Panza, Francesco

    2005-03-01

    The +1073 C/T polymorphism of the oxidized low-density lipoprotein receptor-1 (OLR1) gene has been reported to be associated with late-onset Alzheimer's disease, whereas for the +1071 T/A polymorphism no association was found. We genotyped 169 sporadic Alzheimer's disease patients and 264 sex- and age-matched nondemented controls from Southern Italy for OLR1 +1073 C/T and +1071 T/A polymorphisms and for apolipoprotein E and LBP-1c/CP2/LSF. We also performed haplotype analysis. For the +1073 C/T polymorphism, the C allele and the CC genotype have been associated with a higher risk for Alzheimer's disease without apolipoprotein E or CP2 interaction. The two polymorphisms were in linkage disequilibrium, with the haplotype T-C at significant increased risk of developing Alzheimer's disease in the whole sample and in elderly persons 70 years or older. In our population, the +1073 C/T OLR1 polymorphism exhibited a significant association with Alzheimer's disease, further supporting the role of OLR1 as a candidate risk gene for sporadic Alzheimer's disease.

  10. [Polymorphism of the sulfonylurea receptor gene in type 2 diabetes mellitus].

    PubMed

    Owecki, Maciej; Horst-Sikorska, Wanda; Kaczmarek, Marta; Słomski, Ryszard; Sowiński, Jerzy

    2003-02-01

    Sulfonylureas are used in treatment of diabetes. Resistance to these derivatives is a therapeutical problem. Sulfonylureas act through sulfonylurea receptor 1 (SUR1) in the beta cell. SUR1 also enhances a physiological secretion of insulin induced by an increase of glucose concentration. It may be expected that polymorphism of SUR1 gene can lead to beta cell dysfunction and resistance to sulfonylureas. The aim of this study was to examine the frequency of polymorphism in exon 22 of SUR1 gene and its correlation with type 2 diabetes mellitus and sulfonylurea treatment failure. The group consisted of 42 patients with type 2 diabetes. The controls were 46 persons with proper glucose tolerance. Polymorphism was found in 5 patients and in 1 control person. Neither statistically significant difference of polymorphism frequency nor correlation between polymorphism and sulfonylurea failure was found due to a low number of cases. Polymorphism of exon 22 of SUR1 gene appeared more frequent in diabetic than in non-diabetic subjects but this was statistically not significant.

  11. Vitamin D and stress fracture: the contribution of vitamin D receptor gene polymorphisms.

    PubMed

    McClung, James P; Karl, J Philip

    2010-06-01

    Vitamin D is essential for optimal bone health. Stress fracture is an overuse injury often occurring in active populations. Study results indicate an association exists between vitamin D status and the risk of stress fracture, and one intervention trial demonstrated a reduction in stress fractures in women consuming supplemental vitamin D and calcium. A recent study found that two polymorphisms in the vitamin D receptor (VDR), Fok1 and Bsm1, may increase the risk of stress fracture. Although further study is required, screening for VDR polymorphisms may become a tool for identifying individuals at increased risk of stress fracture during physical training.

  12. Vitamin D receptor gene FokI polymorphisms and tuberculosis susceptibility: a meta-analysis

    PubMed Central

    Cao, Yan; Cao, Zhihong; Cheng, Xiaoxing

    2016-01-01

    Introduction The association between FokI polymorphism of vitamin D receptor (VDR) and tuberculosis (TB) susceptibility has been investigated previously; however, the results were inconsistent and conflicting. In the present study, a meta-analysis was performed to assess the relationship between VDR FokI gene polymorphism and the risk of TB. Material and methods Databases including PubMed and Embase were searched for genetic association studies of FokI polymorphism of vitamin D receptor (VDR) and TB. Data were extracted by two independent authors and the pooled odds ratio (OR) with 95% confidence interval (CI) was calculated to assess the strength of the association between VDR FokI gene polymorphism and TB risk. Meta-regression and subgroup analyses were performed to identify the source of heterogeneity. Results Thirty-four studies with a total of 5669 cases and 6525 controls were reviewed in the present meta-analysis. A statistically significant correlation was found between VDR FokI gene polymorphism and increased TB risk in two comparison models: the homozygote model (ff vs. FF: OR = 1.37, 95% CI: 1.17–1.60; Pheterogeneity = 0.001) and the recessive model (ff vs. Ff + FF: OR = 1.32, 95% CI: 1.14–1.52; Pheterogeneity = 0.006). Meta-regression found no source contributing to heterogeneity. However, sub-group analyses revealed that there was a statistically increased TB risk in the East and Southeast Asian population. Conclusions Synthesis of the available studies suggests that homozygosity for the FokI polymorphism of the VDR gene might be associated with an increased TB risk, especially in the East and Southeast Asian population. Additional well-designed, larger-scale epidemiological studies among different ethnicities are needed. PMID:27695504

  13. Human polymorphisms in nicotinic receptors: a functional analysis in iPS-derived dopaminergic neurons.

    PubMed

    Deflorio, Cristina; Blanchard, Stéphane; Carisì, Maria Carla; Bohl, Delphine; Maskos, Uwe

    2017-02-01

    Tobacco smoking is a public health problem, with ∼5 million deaths per year, representing a heavy burden for many countries. No effective therapeutic strategies are currently available for nicotine addiction, and it is therefore crucial to understand the etiological and pathophysiological factors contributing to this addiction. The neuronal α5 nicotinic acetylcholine receptor (nAChR) subunit is critically involved in nicotine dependence. In particular, the human polymorphism α5D398N corresponds to the strongest correlation with nicotine dependence risk found to date in occidental populations, according to meta-analysis of genome-wide association studies. To understand the specific contribution of this subunit in the context of nicotine addiction, an efficient screening system for native human nAChRs is needed. We have differentiated human induced pluripotent stem (iPS) cells into midbrain dopaminergic (DA) neurons and obtained a comprehensive characterization of these neurons by quantitative RT-PCR. The functional properties of nAChRs expressed in these human DA neurons, with or without the polymorphism in the α5 subunit, were studied with the patch-clamp electrophysiological technique. Our results in human DA neurons carrying the polymorphism in the α5 subunit showed an increase in EC50, indicating that, in the presence of the polymorphism, more nicotine or acetylcholine chloride is necessary to obtain the same effect. This human cell culturing system can now be used in drug discovery approaches to screen for compounds that interact specifically with human native and polymorphic nAChRs.-Deflorio, C., Blanchard, S., Carisì, M. C., Bohl, D., Maskos, U. Human polymorphisms in nicotinic receptors: a functional analysis in iPS-derived dopaminergic neurons.

  14. G-protein-coupled estrogen receptor-30 gene polymorphisms are associated with uterine leiomyoma risk

    PubMed Central

    Kasap, Burcu; Turhan, Nilgün Öztürk; Edgünlü, Tuba; Duran, Müzeyyen; Akbaba, Eren; Öner, Gökalp

    2016-01-01

    The G-protein-coupled estrogen receptor, GPER-1) is a member of the G-protein-coupled receptor 1 family and is expressed significantly in uterine leiomyomas. To understand the relationship between GPR30 single nucleotide polymorphisms and the risk of leiomyoma, we measured the follicle-stimulating hormone (FSH) and estradiol (E2) levels of 78 perimenopausal healthy women and 111 perimenopausal women with leiomyomas. The participants’ leiomyoma number and volume were recorded. DNA was extracted from whole blood with a GeneJET Genomic DNA Purification Kit. An amplification-refractory mutation system polymerase chain reaction approach was used for genotyping of the GPR30 gene (rs3808350, rs3808351, and rs11544331). The differences in genotype and allele frequencies between the leiomyoma and control groups were calculated using the chi-square (χ2) and Fischer’s exact test. The median FSH level was higher in controls (63 vs. 10 IU/L, p=0.000), whereas the median E2 level was higher in the leiomyoma group (84 vs. 9.1 pg/mL, p=0.000). The G allele of rs3808351 and the GG genotype of both the rs3808350 and rs3808351 polymorphisms and the GGC haplotype increased the risk of developing leiomyoma. There was no significant difference in genotype frequencies or leiomyoma volume. However, the GG genotype of the GPR30 rs3808351 polymorphism and G allele of the GPR30 rs3808351 polymorphism were associated with the risk of having a single leiomyoma. Our results suggest that the presence of the GG genotype of the GPR30 rs3808351 polymorphism and the G allele of the GPR30 rs3808351 polymorphism affect the characteristics and development of leiomyomas in the Turkish population. PMID:26773178

  15. Association between vitamin D receptor (VDR) gene polymorphisms and systemic lupus erythematosus in Portuguese patients.

    PubMed

    Carvalho, C; Marinho, A; Leal, B; Bettencourt, A; Boleixa, D; Almeida, I; Farinha, F; Costa, P P; Vasconcelos, C; Silva, B M

    2015-07-01

    Systemic lupus erythematosus (SLE) is a chronic autoimmune disease of unknown origin, in which both genetic and environmental factors are involved. One such environmental factor is vitamin D, a vital hormone that plays a specific function in the immune system homeostasis, acting through a nuclear receptor (VDR) expressed in all immune cells. Several polymorphisms of the gene that encodes this receptor have been described. Though inconsistently, these polymorphisms have been associated with clinical manifestations and SLE development.The aim of this study was to determine the possible association between VDR gene polymorphisms (BsmI, ApaI, TaqI e FokI) and SLE susceptibility and severity, in a cohort of lupus patients from the north of Portugal.A total of 170 patients (F = 155, M = 15; age = 45 ± 13.4 years) with SLE (diagnosed according the American College of Rheumatology criteria) with at least five years of disease evolution and followed in the Autoimmune Disease Clinical Immunology Unit of Centro Hospitalar do Porto were studied. Patients and 192 ethnicity-matched controls were genotyped for BsmI (rs1544410), ApaI (rs7975232), TaqI (rs731236) and FokI (rs2228570) polymorphisms by TaqMan allelic discrimination assay. Disease severity was assessed by SLICC damage score, number of affected organs, number of severe flares and pharmacological history.SLE patients with the CT genotype of FokI polymorphism have a higher SLICC value (p = 0.031). The same result was observed for the group of patients with the TT genotype of TaqI polymorphism (p = 0.046). No differences were observed in VDR genotype between patients and controls. Also, we observed that the other clinical features analysed were not influenced by VDR polymorphisms.Our study confirms a possible role of VDR gene polymorphisms in SLE. A positive association was found between VDR polymorphisms and SLE severity (chronic damage). The presence of CT genotype of FokI and TT genotype of Taq

  16. Vitamin D receptor BsmI polymorphism and osteoporosis risk in post-menopausal women

    PubMed Central

    Zhao, Bizeng; Zhang, Wei; Du, Shengchao

    2016-01-01

    Introduction Many studies have suggested that the vitamin D receptor polymorphism BsmI might be associated with the risk of osteoporosis development in post-menopausal women. However, the results have been inconsistent. The aim of this meta-analysis was to derive a more precise evaluation of the relationship. Material and methods Published literature from PubMed, EMBASE and the CNKI database was searched. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of any association. Results Ten case-control studies were included with a total of 1,403 osteoporosis cases and 2,144 healthy controls. In the overall analysis, no significant association was found between BsmI polymorphism and osteoporosis risk (BB vs. bb: OR = 0.76, 95% CI = 0.39–1.48; BB vs. Bb: OR = 0.90, 95% CI = 0.71–1.15; dominant model: OR = 1.20, 95% CI = 0.74–1.93; recessive model: OR = 0.83, 95% CI = 0.53–1.30). In the subgroup analysis by ethnicity, the results showed similar result that BsmI polymorphism m had no association with osteoporosis. Conclusions Results from the current meta-analysis suggest that vitamin D receptor BsmI polymorphism may not be a risk factor for osteoporosis in post-menopausal women. PMID:26925115

  17. Vitamin D receptor polymorphisms and the polycystic ovary syndrome: A systematic review.

    PubMed

    Reis, Guilherme Victor Oliveira Pimenta Dos; Gontijo, Natália Alves; Rodrigues, Kathryna Fontana; Alves, Michelle Teodoro; Ferreira, Cláudia Natália; Gomes, Karina Braga

    2017-03-01

    Polycystic ovary syndrome (PCOS) is the most frequent endocrinological disorder that affects women of reproductive age, leading to metabolic alterations, such as hyperandrogenism, obesity, menstrual irregularities, insulin resistance, and polycystic ovaries. The etiology remains unclear, but several genetic and environmental factors have been correlated with manifestations of this syndrome. Vitamin D plays important roles in metabolic pathways affected by PCOS, including calcium homeostasis, the insulin pathway, and sex hormone synthesis. Vitamin D concentration has been related with the severity of this disorder, and vitamin D receptor polymorphisms have been shown in some studies to have an association with some of the patterns presented by PCOS. The objective of this study is to provide an up-to-date review about vitamin D receptor polymorphisms and their association with PCOS.

  18. [Genetic polymorphism of steroidogenic enzymes and steroid receptor level in tumors of the reproductive system].

    PubMed

    Berstein, L M; Zimarina, T S; Tsyrlina, E V; Kovalevskiĭ, A Iu; Imianitov, E N

    2004-01-01

    The strategy of therapy and prognosis of reproductive system neoplasia generally depend on the steroid receptor status of tumor. The causes of formation of steroid receptor-free tumors are to be investigated. The genetic polymorphism of CYP19 (aromatase), CYP17 (17-hydroxylase; 17,20-lyase), CYP1B1 (4-estrogen hydroxylase) and COMT (catechol-O-methyl transferase) was studied in a total of 254 patients with breast and endometrial cancer, with particular reference to the association of certain polymorphisms and receptor status of tumor. It was found that the lack of estrogen receptor (ER) in breast tumor was due to a deficit in the A3A6 allele (p(0.01), while the absence of progesterone receptors was associated with a lower incidence of the A1A1 and A1A2 variants (p = 0.022) of tetranucleotide repeats in the CYP19 gene. In the same patients, receptor-negative tumors occurred more often (p = 0.032) than in combinations of higher level of 4-hydroxylase estradiol of S-allele in position 48 (Gly/Arg) of the CYP1B1 gene. Moreover, endometrial carcinoma patients tended to reveal (p = 0.058) an increased ratio of A6A7-CYP19 to allele A1-containing variant. No other distinctions between R(+) and R(-) tumors were identified. It is suggested that peculiar polymorphisms of steroidogenic enzymes may moderately influence the genesis of R(-) neoplasms which may be associated with either the rate of estrogen biosynthesis or, as in the case of CYP1B1, with formation of genotoxic derivatives of estrogens. The latter point is to be investigated further.

  19. Genetic effects of common polymorphisms in estrogen receptor alpha gene on osteoarthritis: a meta-analysis

    PubMed Central

    Ma, Hecheng; Wu, Weiqian; Yang, Xiaodi; Liu, Jianguo; Gong, Yubao

    2015-01-01

    Objective: The estrogen receptor alpha (ESR1) gene has been implicated in the etiology of osteoarthritis (OA). However, the results are conflicting. We assessed the association of three common ESR1 polymorphisms, rs2234693, rs9340799 and rs2228480, with OA in this meta-analysis. Methods: A comprehensive search was performed to identify related studies. Pooled odds ratio (OR) with 95% confidence interval (CI) was calculated using fixed or random effects model. Results: 15 studies (7036 cases and 9669 controls) for rs2234693 polymorphism, 14 studies (3904 cases and 6991 controls) for rs9340799 and 3 studies (331 cases and 619 controls) for rs2228480 polymorphism were identified. The final results indicated that the G allele in ESR1 rs9340799 was associated with decreased OA risk (GG+GA vs. AA: OR=0.878, 95% CI=0.792-0.972, P=0.012; G vs. A: OR=0.902, 95% CI=0.836-0.975, P=0.009). The A allele in rs2228480 might be associated with increased OA risk. But no significant association of rs2234693 polymorphism with OA susceptibility was observed. Conclusions: This meta-analysis indicates rs9340799 and rs2228480 rather than rs2234693 polymorphisms are associated with the incidence of OA. Some stable associations should be further confirmed in future. PMID:26550281

  20. Toll-like receptor 3 gene polymorphisms in South African Blacks with type 1 diabetes.

    PubMed

    Pirie, F J; Pegoraro, R; Motala, A A; Rauff, S; Rom, L; Govender, T; Esterhuizen, T M

    2005-08-01

    Type 1 diabetes is the consequence of exposure of genetically susceptible individuals to specific environmental precipitants. The innate immune system provides the initial response to exogenous antigen and links with the adaptive immune system. The aim of this study was to assess the role of polymorphisms occurring in the cytoplasmic region of toll-like receptor (TLR) 3 gene and immediate 5' sequence, in subjects of Zulu descent with type 1 diabetes in KwaZulu-Natal, South Africa. Seventy-nine subjects with type 1 diabetes and 74 healthy normal glucose tolerant gender-matched control subjects were studied. Parts of exon 4 and exon 3/intron 3 of the TLR3 gene were studied by polymerase chain reaction, direct sequencing and restriction enzyme digestion with Bts 1. Of the nine polymorphisms studied, a significant association with type 1 diabetes was found for the major allele in the 2593 C/T polymorphism and for the minor alleles in the 2642 C/A and 2690 A/G polymorphisms, which were found to be in complete linkage disequilibrium. Correction of the P-values for the number of alleles studied, however, rendered the results no longer significant. These results suggest that polymorphisms in the TLR3 gene, which is part of the innate immune system, may be associated with type 1 diabetes in this population.

  1. Functional polymorphism of the mu-opioid receptor gene (OPRM1) influences reinforcement learning in humans.

    PubMed

    Lee, Mary R; Gallen, Courtney L; Zhang, Xiaochu; Hodgkinson, Colin A; Goldman, David; Stein, Elliot A; Barr, Christina S

    2011-01-01

    Previous reports on the functional effects (i.e., gain or loss of function), and phenotypic outcomes (e.g., changes in addiction vulnerability and stress response) of a commonly occurring functional single nucleotide polymorphism (SNP) of the mu-opioid receptor (OPRM1 A118G) have been inconsistent. Here we examine the effect of this polymorphism on implicit reward learning. We used a probabilistic signal detection task to determine whether this polymorphism impacts response bias to monetary reward in 63 healthy adult subjects: 51 AA homozygotes and 12 G allele carriers. OPRM1 AA homozygotes exhibited typical responding to the rewarded response--that is, their bias to the rewarded stimulus increased over time. However, OPRM1 G allele carriers exhibited a decline in response to the rewarded stimulus compared to the AA homozygotes. These results extend previous reports on the heritability of performance on this task by implicating a specific polymorphism. Through comparison with other studies using this task, we suggest a possible mechanism by which the OPRM1 polymorphism may confer reduced response to natural reward through a dopamine-mediated decrease during positive reinforcement learning.

  2. Toll like receptor 2 and 4 polymorphisms in malaria endemic populations of India.

    PubMed

    Bali, Prerna; Pradhan, Sabyasachi; Sharma, Divya; Adak, Tridibes

    2013-02-01

    Toll like receptors (TLRs) play a pivotal role in recognizing the invading malaria parasite Plasmodium, thus genetic makeup of the exposed population can be of utmost importance for its predisposition to malaria. In this study 264 malaria patients from seven different eco epidemiological regions of India were genotyped for TLR2 and TLR4 polymorphisms using DNA sequencing methods. No variation was observed at residue positions 677 and 753 in TLR2 whereas residue positions 299 and 399 in TLR4 were highly polymorphic. The GC haplotype (Asp299Gly/Thr399Thr) was observed at the highest frequency in populations of East Singhbhum, Vizianagaram and North Goa and absent in Kolkata, Dakshin Kannada and Nicobar district. All polymorphisms were in Hardy Weinberg equilibrium. Populations of Kolkata, Nicobar district, Sundergarh and Dakshin Kannada were observed to be closely related. TLR2 polymorphism was absent in the Indian population and an overall heterogeneous pattern of TLR4 polymorphism can be attributed to genetic drift. However it can be inferred that GC haplotype is under the process of natural selection in the Indian population and one of the factors contributing to its selection could be predominance of Plasmodium falciparum in these regions.

  3. Relationship between estrogen receptor 1 gene polymorphisms and postmenopausal osteoporosis of the spine in Chinese women.

    PubMed

    Shang, D P; Lian, H Y; Fu, D P; Wu, J; Hou, S S; Lu, J M

    2016-06-03

    The purpose of this study was to evaluate single nucleotide polymorphism (SNP) variants of the estrogen receptor 1 gene (ESR1) at rs2234693 and rs9340799, as well as to investigate the relationship between ESR gene polymorphisms and postmenopausal osteoporosis (OP) of the spine in Chinese women. We recruited 198 postmenopausal women with OP and 276 healthy women between May 2012 and September 2015 in Zhongshan Hospital. Dual energy x-ray absorptiometry was used to measure the bone mineral density (BMD) of the lumbar vertebrae in all subjects. In addition, PCR-restriction fragment length polymorphism based analysis was conducted to identify the genotypes of ESR1. The distribution of ESR1 in the osteoporosis group and the control group was determined; the relationship between ESR polymorphisms and BMD was analyzed. The distributions of BMD were: TT < TC < CC, GG < AG < AA. The TT, TTGG, and TCGG genotypes were found to be lower as compared to the other genotypes. Stratified analysis suggested that the TT genotype and the combined genotypes TTGG and TCGG were significantly higher in the OP group as compared to the control group (P < 0.01). Therefore, ESR1 polymorphisms at rs2234693 and rs9340799 may be associated with OP, and could be used as markers to screen those with high risks to postmenopausal OP in Chinese women.

  4. Otitis media associated polymorphisms in the hemin receptor HemR of nontypeable Haemophilus influenzae

    PubMed Central

    LaCross, Nathan C.; Marrs, Carl F.; Gilsdorf, Janet R.

    2014-01-01

    Nontypeable Haemophilus influenzae (NTHi) colonize the human pharynx asymptomatically, and are also an important cause of otitis media (OM). Previous studies have demonstrated that some genes are more prevalent in OM-causing NTHi strains than in commensal strains, suggesting a role in virulence. These studies, however, are unable to investigate the possible associations between gene polymorphisms and disease. This study examined amino acid polymorphisms and sequence diversity in a potential virulence gene, the hemin receptor hemR, from a previously characterized NTHi strain collection containing both commensal and OM organisms to identify possible associations between the polymorphisms and otitis media. The full open reading frame of hemR was sequenced from a total of 146 NTHi isolates, yielding a total of 47 unique HemR amino acid sequences. The predicted structure of HemR showed substantial similarity to a class of monomeric TonB dependent, ligand-gated channels involved in iron acquisition in other gram negative bacteria. Fifteen amino acid polymorphisms were significantly more prevalent at the 90% confidence level among commensal compared to OM isolates. Upon controlling for the confounding effect of population structure, over half of the polymorphism-otitis media relationships lost statistical significance, emphasizing the importance of assessing the effect of population structure in association studies. The seven polymorphisms that retained significance were dispersed throughout the protein in various functional and structural domains, including the signal peptide, N-terminal plug domain, and intra- and extracellular loops. The alternate amino acid of only one of these seven polymorphisms was more common among OM isolates, demonstrating a strong trend toward the consensus sequence among disease causing NTHi. We hypothesize that variability at these positions in HemR may result in a reduced ability to acquire iron, rendering NTHi with such versions of the gene

  5. Vitamin D receptor gene polymorphisms in breast and renal cancer: Current state and future approaches

    PubMed Central

    KHAN, MOHAMMED I.; BIELECKA, ZOFIA F.; NAJM, MOHAMMAD Z.; BARTNIK, EWA; CZARNECKI, JERZY S.; CZARNECKA, ANNA M.; SZCZYLIK, CEZARY

    2014-01-01

    Cancer is a major health problem and cause of death worldwide that accounted for 7.6 million deaths in 2008, which is projected to continue rising with an estimated 13.1 million deaths in 2030 according to WHO. Breast cancer is the leading cause of cancer-based death among women around the world and its incidence is increasing annually with a similar tendency. In contrast, renal cell carcinoma accounts for only 3% of total human malignancies but it is still the most common type of urological cancer with a high prevalence in elderly men (>60 years of age). There are several factors linked with the development of renal cell cancer only, while others are connected only with breast cancer. Genetic risk factors and smoking are the factors which contribute to carcinogenesis in general. Some evidence exists indicating that vitamin D receptor (VDR) gene polymorphisms are associated with both breast and renal cancer; therefore, we put forward the hypothesis that polymorphisms in the VDR gene may influence both the occurrence risks of these cancers and their prognosis. However, the relationship between VDR polymorphisms and these two specific cancers remains a controversial hypothesis, and consequently needs further confirmation via clinical research together with genetic investigations. Here, we aimed to assess the correlation between the different alleles of VDR gene polymorphisms and renal cell cancer and breast cancer risks separately through a systematic review of the present literature. In contrast, this analysis has revealed that some VDR gene polymorphisms, such as: Bsm1, poly(A), Taq1, Apa1, are to some extent associated with breast cancer risk. Other polymorphisms were found to be significantly associated with renal cell cancer. Namely, they were Fok1, Bsm1, Taq1 and Apa1, which encode proteins participating mainly in proliferation, apoptosis and cell cycle regulation. However, data concerning renal cancer are not sufficient to firmly establish the VDR gene

  6. High-throughput chemiluminometric genotyping of single nucleotide polymorphisms of histamine, serotonin, and adrenergic receptor genes.

    PubMed

    Toubanaki, Dimitra K; Christopoulos, Theodore K; Ioannou, Penelope C; Flordellis, Christodoulos S

    2009-02-01

    Several pharmacogenetic studies are focused on the investigation of the relation between the efficacy of various antipsychotic agents (e.g., clozapine) and the genetic profile of the patient with an emphasis on genes that code for neurotransmitter receptors such as histamine, serotonin, and adrenergic receptors. We report a high-throughput method for genotyping of single nucleotide polymorphisms (SNPs) within the genes of histamine H2 receptor (HRH2), serotonin receptor (HTR2A1 and HTR2A2), and beta(3) adrenergic receptor (ADRB3). The method combines the high specificity of allele discrimination by oligonucleotide ligation reaction (OLR) and the superior sensitivity and simplicity of chemiluminometric detection in a microtiter well assay configuration. The genomic region that spans the locus of interest is first amplified by polymerase chain reaction (PCR). Subsequently, an oligonucleotide ligation reaction is performed using a biotinylated common probe and two allele-specific probes that are labeled at the 3' end with digoxigenin and fluorescein. The ligation products are immobilized in polystyrene wells via biotin-streptavidin interaction, and the hybrids are denatured. Detection is accomplished by the addition of alkaline phosphatase-conjugated anti-digoxigenin or anti-fluorescein antibodies in combination with a chemiluminogenic substrate. The ratio of the luminescence signals obtained from digoxigenin and fluorescein indicates the genotype of the sample. The method was applied successfully to the genotyping of 23 blood samples for all four SNPs. The results were in concordance with both PCR-restriction fragment length polymorphism analysis and sequencing.

  7. Dopamine D{sub 3} receptor gene: Organization transcript variants, and polymorphism associated with schizophrenia

    SciTech Connect

    Griffon, N.; Pilon, C.; Martres, M.P.

    1996-02-16

    DNA fragments from a genomic library were used to establish the partial structure of the human dopamine D{sub 3} receptor gene (DRD3). Its coding sequence contains 6 exons and stretches over 40,000 base pairs. The complete DRD3 transcript and three shorter variants, in which the second and/or third exon are deleted, were detected in similar proportions in brains from four controls and three psychiatric patients. The Msp I polymorphism was localized in the fifth intron of the gene, 40,000 base pairs downstream the Bal I polymorphism and a PCR-based method was developed for genotyping this polymorphism. The distributions of the Msp I and Bal I genotypes were not independent in 297 individuals ({chi}{sup 2} = 10.5, df = 4, P = 0.03), but only a weak association was found between allele 1 of the Bal I polymorphism and allele 2 of the Msp I polymorphism ({chi}{sup 2} = 3.99, df = 1, P = 0.04). The previously reported association between homozygosity at both alleles of the Bal I polymorphism and schizophrenia was presently maintained in an extended sample, comprising 119 DSM-III-R chronic schizophrenics and 85 controls ({chi}{sup 2}= 5.3, df = 1, P = 0.02) and found more important in males than in females. The presence of the Bal I allele 2 is associated with an early age at onset, particularly in males (df = 35, t value = 2.6, P = 0.014). In the same sample, allelic frequencies, genotype counts, and proportion of homozygotes for the Msp I polymorphism did not differ between schizophrenics and controls ({chi}{sup 2}= 0.06, df = 1, P = 0.80, {chi}{sup 2} = 0.22, df = 1, P = 0.90 and {chi}{sup 2} = 0.16, df = 1, P = 0.69, respectively). The large distance of the Msp I polymorphism from the Bal I polymorphism and its localization in the 3{prime} part of the gene may explain the discrepant results obtained with the two polymorphisms. 36 refs., 2 figs., 4 tabs.

  8. Severity of eating disorder symptoms related to oxytocin receptor polymorphisms in anorexia nervosa.

    PubMed

    Acevedo, Summer F; Valencia, Celeste; Lutter, Michael; McAdams, Carrie J

    2015-08-30

    Oxytocin is a peptide hormone important for social behavior and differences in psychological traits have been associated with variants of the oxytocin receptor gene in healthy people. We examined whether single nucleotide polymorphisms (SNPs) of the oxytocin receptor gene (OXTR) correlated with clinical symptoms in women with anorexia nervosa, bulimia nervosa, and healthy comparison (HC) women. Subjects completed clinical assessments and provided DNA for analysis. Subjects were divided into four groups: HC, subjects currently with anorexia nervosa (AN-C), subjects with a history of anorexia nervosa but in long-term weight recovery (AN-WR), and subjects with bulimia nervosa (BN). Five SNPs of the oxytocin receptor were examined. Minor allele carriers showed greater severity in most of the psychiatric symptoms. Importantly, the combination of having had anorexia and carrying either of the A alleles for two SNPS in the OXTR gene (rs53576, rs2254298) was associated with increased severity specifically for ED symptoms including cognitions and behaviors associated both with eating and appearance. A review of psychosocial data related to the OXTR polymorphisms examined is included in the discussion. OXTR polymorphisms may be a useful intermediate endophenotype to consider in the treatment of patients with anorexia nervosa.

  9. Severity of eating disorder symptoms related to oxytocin receptor polymorphisms in anorexia nervosa

    PubMed Central

    Acevedo, Summer F.; Valencia, Celeste; Lutter, Michael; McAdams, Carrie J.

    2015-01-01

    Oxytocin is a peptide hormone important for social behavior, and differences in psychological traits have been associated with variants of the oxytocin receptor gene in healthy people. We examined whether small nucleotide polymorphisms (SNPs) of the oxytocin receptor gene (OXTR) correlated with clinical symptoms in women with anorexia nervosa, bulimia nervosa, and healthy comparison (HC) women. Subjects completed clinical assessments and provided DNA for analysis. Subjects were divided into four groups: HC, subjects currently with anorexia nervosa (AN-C), subjects with a history of anorexia nervosa but in long-term weight recovery (AN-WR), and subjects with bulimia nervosa (BN). Five SNPs of the oxytocin receptor were examined. Minor allele carriers showed greater severity in most of the psychiatric symptoms. Importantly, the combination of having had anorexia and carrying either of the A alleles for two SNPS in the OXTR gene (rs53576, rs2254298) was associated with increased severity specifically for ED symptoms including cognitions and behaviors associated both with eating and appearance. A review of psychosocial data related to the OXTR polymorphisms examined is included in the discussion. OXTR polymorphisms may be a useful intermediate endophenotype to consider in the treatment of patients with anorexia nervosa. PMID:26106053

  10. Polymorphism and genetic mapping of the human oxytocin receptor gene on chromosome 3

    SciTech Connect

    Michelini, S.; Urbanek, M.; Goldman, D.

    1995-06-19

    Centrally administered oxytocin has been reported to facilitate affiliative and social behaviors, in functional harmony with its well-known peripheral effects on uterine contraction and milk ejection. The biological effects of oxytocin could be perturbed by mutations occurring in the sequence of the oxytocin receptor gene, and it would be of interest to establish the position of this gene on the human linkage map. Therefore we identified a polymorphism at the human oxytocin receptor gene. A portion of the 3{prime} untranslated region containing a 30 bp CA repeat was amplified by polymerase chain reaction (PCR), revealing a polymorphism with two alleles occurring with frequencies of 0.77 and 0.23 in a sample of Caucasian CEPH parents (n = 70). The CA repeat polymorphism we detected was used to map the human oxytocin receptor to chromosome 3p25-3p26, in a region which contains several important genes, including loci for Von Hippel-Lindau disease (VHL) and renal cell carcinoma. 53 refs., 2 figs., 1 tab.

  11. Oxytocin receptor gene polymorphisms are associated with human directed social behavior in dogs (Canis familiaris).

    PubMed

    Kis, Anna; Bence, Melinda; Lakatos, Gabriella; Pergel, Enikő; Turcsán, Borbála; Pluijmakers, Jolanda; Vas, Judit; Elek, Zsuzsanna; Brúder, Ildikó; Földi, Levente; Sasvári-Székely, Mária; Miklósi, Adám; Rónai, Zsolt; Kubinyi, Enikő

    2014-01-01

    The oxytocin system has a crucial role in human sociality; several results prove that polymorphisms of the oxytocin receptor gene are related to complex social behaviors in humans. Dogs' parallel evolution with humans and their adaptation to the human environment has made them a useful species to model human social interactions. Previous research indicates that dogs are eligible models for behavioral genetic research, as well. Based on these previous findings, our research investigated associations between human directed social behaviors and two newly described (-212AG, 19131AG) and one known (rs8679684) single nucleotide polymorphisms (SNPs) in the regulatory regions (5' and 3' UTR) of the oxytocin receptor gene in German Shepherd (N = 104) and Border Collie (N = 103) dogs. Dogs' behavior traits have been estimated in a newly developed test series consisting of five episodes: Greeting by a stranger, Separation from the owner, Problem solving, Threatening approach, Hiding of the owner. Buccal samples were collected and DNA was isolated using standard protocols. SNPs in the 3' and 5' UTR regions were analyzed by polymerase chain reaction based techniques followed by subsequent electrophoresis analysis. The gene-behavior association analysis suggests that oxytocin receptor gene polymorphisms have an impact in both breeds on (i) proximity seeking towards an unfamiliar person, as well as their owner, and on (ii) how friendly dogs behave towards strangers, although the mediating molecular regulatory mechanisms are yet unknown. Based on these results, we conclude that similarly to humans, the social behavior of dogs towards humans is influenced by the oxytocin system.

  12. High polymorphism at the human melanocortin 1 receptor locus.

    PubMed Central

    Rana, B K; Hewett-Emmett, D; Jin, L; Chang, B H; Sambuughin, N; Lin, M; Watkins, S; Bamshad, M; Jorde, L B; Ramsay, M; Jenkins, T; Li, W H

    1999-01-01

    Variation in human skin/hair pigmentation is due to varied amounts of eumelanin (brown/black melanins) and phaeomelanin (red/yellow melanins) produced by the melanocytes. The melanocortin 1 receptor (MC1R) is a regulator of eu- and phaeomelanin production in the melanocytes, and MC1R mutations causing coat color changes are known in many mammals. We have sequenced the MC1R gene in 121 individuals sampled from world populations with an emphasis on Asian populations. We found variation at five nonsynonymous sites (resulting in the variants Arg67Gln, Asp84Glu, Val92Met, Arg151Cys, and Arg163Gln), but at only one synonymous site (A942G). Interestingly, the human consensus protein sequence is observed in all 25 African individuals studied, but at lower frequencies in the other populations examined, especially in East and Southeast Asians. The Arg163Gln variant is absent in the Africans studied, almost absent in Europeans, and at a low frequency (7%) in Indians, but is at an exceptionally high frequency (70%) in East and Southeast Asians. The MC1R gene in common and pygmy chimpanzees, gorilla, orangutan, and baboon was sequenced to study the evolution of MC1R. The ancestral human MC1R sequence is identical to the human consensus protein sequence, while MC1R varies considerably among higher primates. A comparison of the rates of substitution in genes in the melanocortin receptor family indicates that MC1R has evolved the fastest. In addition, the nucleotide diversity at the MC1R locus is shown to be several times higher than the average nucleotide diversity in human populations, possibly due to diversifying selection. PMID:10101176

  13. Receptor Polymorphism and Genomic Structure Interact to Shape Bitter Taste Perception.

    PubMed

    Roudnitzky, Natacha; Behrens, Maik; Engel, Anika; Kohl, Susann; Thalmann, Sophie; Hübner, Sandra; Lossow, Kristina; Wooding, Stephen P; Meyerhof, Wolfgang

    2015-01-01

    The ability to taste bitterness evolved to safeguard most animals, including humans, against potentially toxic substances, thereby leading to food rejection. Nonetheless, bitter perception is subject to individual variations due to the presence of genetic functional polymorphisms in bitter taste receptor (TAS2R) genes, such as the long-known association between genetic polymorphisms in TAS2R38 and bitter taste perception of phenylthiocarbamide. Yet, due to overlaps in specificities across receptors, such associations with a single TAS2R locus are uncommon. Therefore, to investigate more complex associations, we examined taste responses to six structurally diverse compounds (absinthin, amarogentin, cascarillin, grosheimin, quassin, and quinine) in a sample of the Caucasian population. By sequencing all bitter receptor loci, inferring long-range haplotypes, mapping their effects on phenotype variation, and characterizing functionally causal allelic variants, we deciphered at the molecular level how a subjects' genotype for the whole-family of TAS2R genes shapes variation in bitter taste perception. Within each haplotype block implicated in phenotypic variation, we provided evidence for at least one locus harboring functional polymorphic alleles, e.g. one locus for sensitivity to amarogentin, one of the most bitter natural compounds known, and two loci for sensitivity to grosheimin, one of the bitter compounds of artichoke. Our analyses revealed also, besides simple associations, complex associations of bitterness sensitivity across TAS2R loci. Indeed, even if several putative loci harbored both high- and low-sensitivity alleles, phenotypic variation depended on linkage between these alleles. When sensitive alleles for bitter compounds were maintained in the same linkage phase, genetically driven perceptual differences were obvious, e.g. for grosheimin. On the contrary, when sensitive alleles were in opposite phase, only weak genotype-phenotype associations were seen

  14. Polymorphism of the progesterone receptor gene associated with endometriosis in patients from Goiás, Brazil.

    PubMed

    Costa, I R; Silva, R C P C; Frare, A B; Silva, C T X; Bordin, B M; Souza, S R; Ribeiro Júnior, C L; Moura, K K V O

    2011-07-06

    We investigated a possible link between endometriosis and polymorphism of the progesterone receptor gene (PROGINS). The endometriosis group consisted of 54 patients with a diagnosis of endometriosis by laparoscopy, and the control group comprised 44 women without endometriosis. Genotypes for PROGINS polymorphisms (A1/A1, A1/A2 and A2/A2) were determined by polymerase chain reaction and analyzed on a 2% agarose gel stained with ethidium bromide. The frequency of polymorphic genotypes (A1/A2 and A2/A2) was significantly higher in patients with endometriosis (33%) than in the control group (16%). We conclude that there is a significant correlation between PROGINS polymorphism and endometriosis.

  15. MHC-Linked Olfactory Receptor Loci Exhibit Polymorphism and Contribute to Extended HLA/OR-Haplotypes

    PubMed Central

    Ehlers, Anke; Beck, Stephan; Forbes, Simon A.; Trowsdale, John; Volz, Armin; Younger, Ruth; Ziegler, Andreas

    2000-01-01

    Clusters of olfactory receptor (OR) genes are found on most human chromosomes. They are one of the largest mammalian multigene families. Here, we report a systematic study of polymorphism of OR genes belonging to the largest fully sequenced OR cluster. The cluster contains 36 OR genes, of which two belong to the vomeronasal 1 (V1-OR) family. The cluster is divided into a major and a minor region at the telomeric end of the HLA complex on chromosome 6. These OR genes could be involved in MHC-related mate preferences. The polymorphism screen was carried out with 13 genes from the HLA-linked OR cluster and three genes from chromosomes 7, 17, and 19 as controls. Ten human cell lines, representing 18 different chromosome 6s, were analyzed. They were from various ethnic origins and exhibited different HLA haplotypes. All OR genes tested, including those not linked to the HLA complex, were polymorphic. These polymorphisms were dispersed along the coding region and resulted in up to seven alleles for a given OR gene. Three polymorphisms resulted either in stop codons (genes hs6M1-4P, hs6M1-17) or in a 16–bp deletion (gene hs6M1-19P), possibly leading to lack of ligand recognition by the respective receptors in the cell line donors. In total, 13 HLA-linked OR haplotypes could be defined. Therefore, allelic variation appears to be a general feature of human OR genes. [The sequence data reported in this paper have been submitted to EMBL under accession nos. AC006137, AC004178, AJ132194, AL022727, AL031983, AL035402, AL035542, Z98744, CAB55431, AL050339, AL035402, AL096770, AL133267, AL121944, Z98745, AL021808, and AL021807.] PMID:11116091

  16. Effects of fentanyl administration on locomotor response in horses with the G57C μ-opioid receptor polymorphism.

    PubMed

    Wetmore, Lois A; Pascoe, Peter J; Shilo-Benjamini, Yael; Lindsey, Jane C

    2016-08-01

    OBJECTIVE To determine the locomotor response to the administration of fentanyl in horses with and without the G57C polymorphism of the μ-opioid receptor. ANIMALS 20 horses of various breeds and ages (10 horses heterozygous for the G57C polymorphism and 10 age-, breed-, and sex-matched horses that did not have the G57C polymorphism). PROCEDURES The number of steps each horse took was counted over consecutive 2-minute periods for 20 minutes to determine a baseline value. The horse then received a bolus of fentanyl (20 μg/kg, IV), and the number of steps was again counted during consecutive 2-minute periods for 60 minutes. The mean baseline value was subtracted from each 2-minute period after fentanyl administration; step counts with negative values were assigned a value of 0. Data were analyzed by use of a repeated-measures ANOVA. RESULTS Data for 19 of 20 horses (10 horses with the G57C polymorphism and 9 control horses without the G57C polymorphism) were included in the analysis. Horses with the G57C polymorphism had a significant increase in locomotor activity, compared with results for horses without the polymorphism. There was a significant group-by-time interaction. CONCLUSIONS AND CLINICAL RELEVANCE Horses heterozygous for the G57C polymorphism of the μ-opioid receptor had an increased locomotor response to fentanyl administration, compared with the response for horses without this polymorphism. The clinical impact of this finding should be investigated.

  17. Human T-cell receptor v{beta} gene polymorphism and multiple sclerosis

    SciTech Connect

    Wei, S.; Charmley, P.; Birchfield, R.I.; Concannon, P.

    1995-04-01

    Population-based genetic associations have been reported between RFLPs detected with probes corresponding to the genes encoding the {beta} chain of the T-cell receptor for antigen (RCRB) and a variety of autoimmune disorders. In the case of multiple sclerosis (MS), these studies have localized a putative disease-associated gene to a region of {approximately}110 kb in length, located within the TCRB locus. In the current study, all 14 known TCRBV (variable region) genes within the region of localization were mapped and identified. The nucleotide sequences of these genes were determined in a panel of six MS patients and six healthy controls, who were human-leukocyte antigen and TCRB-RFLP haplotype matched. Nine of the 14 TCRBV genes studied showed evidence of polymorphism. PCR-based assays for each of these polymorphic genes were developed, and allele and genotype frequencies were determined in a panel of DNA samples from 48 MS patients and 60 control individuals. No significant differences in allele, genotype, or phenotype frequencies were observed between the MS patients and controls for any of the 14 TCRBV-gene polymorphisms studied. In light of the extensive linkage disequilibrium across the region studied, the saturating numbers of polymorphisms examined, and the direct sequence analysis of all BV genes in the region, these results suggest that it is unlikely that germ-line polymorphism in the TCRBV locus makes a major contribution to MS susceptibility. The TCRBV coding region-specific markers generated in these studies, as well as the approach of testing for associations with specific functionally relevant polymorphic sites within individual BV genes, should be useful in the evaluation of the many reported disease associations involving the human TCRB region. 22 refs., 1 fig., 3 tabs.

  18. Association of vitamin D receptor gene polymorphisms with polycystic ovary syndrome among Indian women

    PubMed Central

    Dasgupta, Shilpi; Dutta, Joyita; Annamaneni, Sandhya; Kudugunti, Neelaveni; Battini, Mohan Reddy

    2015-01-01

    Background & objectives: The Vitamin-D receptor (VDR) regulates vitamin D levels and calcium metabolism in the body and these are known to be associated with endocrine dysfunctions, insulin resistance and type-2 diabetes in polycystic ovarian syndrome (PCOS). Studies on VDR polymorphisms among PCOS women are sparse. We undertook this study to investigate the association pattern of VDR polymorphisms (Cdx2, Fok1, Apa1 and Taq1) with PCOS among Indian women. Methods: For the present study, 250 women with PCOS and 250 normal healthy control women were selected from Hyderabad city, Telangana, India. The four VDR polymorphisms were genotyped and analysed using ASM-PCR (allele specific multiple PCR) and PCR-RFLP (restriction fragment length polymorphism). Results: The genotype and allele frequency distributions of only Cdx2 showed significant difference between the PCOS cases and control women, indicating protective role of this SNP against PCOS phenotype. However, significant association was observed between VDR genotypes and some of the PCOS specific clinical/biochemical traits. For example, Fok1 showed a significant genotypic difference for the presence of infertility and Cdx2 genotpes showed association with testosterone levels. Further, the two haplotypes, ACCA and ACTA, were found to be significantly associated with PCOS indicating haplotype specific risk. Interpretation & conclusions: Although VDR polymorphisms have not shown significant association with PCOS, in view of functional significance of the SNPs considered, one cannot yet rule out the possibility of their association with PCOS. Further, specifically designed studies on large cohorts are required to conclusively establish the role of VDR polymorphisms in PCOS, particularly including data on vitamin D levels. PMID:26458343

  19. Vitamin D receptor gene polymorphism and its association with Parkinson's disease in Chinese Han population.

    PubMed

    Han, Xun; Xue, Li; Li, Yongsheng; Chen, Biao; Xie, Anmu

    2012-09-06

    Vitamin D plays an important role in neurodegenerative disorders as a crucial neuro-immunomodulator, and accumulating data have provided evidence for that vitamin D receptor (VDR) gene is a candidate gene for susceptibility to Parkinson's disease (PD). In this study, we performed a case-control study to demonstrate whether the risk for the development of onset of sporadic PD might be influenced by VDR gene polymorphisms in a Chinese cohort. Two hundred and sixty PD patients and 282 matched-healthy controls were genotyped for two representative single nucleotide polymorphisms (SNPs) in VDR gene (FokI C/T and BsmI G/A) by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) analysis in. Results from our study revealed that FokI C allele carriers were likely to associate with an increased risk of PD (P=0.004) as well as early-onset PD (EOPD) (P=0.010). Moreover, the frequency of FokI C allele was significantly increased in PD group and late-onset PD (LOPD) group relative to the control groups respectively (P=0.023 and P=0.033, respectively). For BsmI polymorphisms, no significant difference in genotype or allele distribution was found between PD patients and the controls, as well as gender- and age-related differences between PD patients and the controls subgroup. This study demonstrated a possible association between the VDR FokI T/C polymorphism and PD, indicating that VDR polymorphisms may well change genetic susceptibility to sporadic PD in a Han Chinese population.

  20. Cognitive Functions, Concentration of Endogenous Estradiol, Estrogen Receptor α (ERα) Polymorphism in Postmenopausal Women

    PubMed Central

    Bojar, Iwona; Pinkas, Jarosław; Wierzbińska-Stępniak, Anna; Raczkiewicz, Dorota; Owoc, Alfred; Gujski, Mariusz

    2016-01-01

    Background The goal of this study was to investigate the relationship between cognitive functions and the level of endogenous estradiol in postmenopausal women, according to which estrogen receptor α (ERα) polymorphism the woman carries. Material/Methods The study group consisted of 210 women. The inclusion criteria were: minimum 2 years after the last menstruation, FSH concentration 30 U/ml, and no dementia signs on Montreal Cognitive Assessment (MoCA). A computerized battery of Central Nervous System Vital Signs (CNS VS) test was used to diagnose cognitive functions. Genotyping of the ERα polymorphism was performed using a polymerase chain reaction and restriction enzymes (PCR-RFLP). Blood plasma was tested for FSH and estradiol (E2). Statistical analysis was performed using STATISTICA software. Results A relationship was confirmed between standard scores for 3 cognitive functions: general memory, verbal memory, and processing speed, and the XbaI polymorphism in the women in the study. In the group of women with genotype TT PvuII, significant positive relationships were observed between the concentration of E2 and the standard scores of 3 cognitive functions: general memory, verbal memory, and processing speed. In the group of women with genotype TC PvuII, significant negative correlations were found between the concentration of E2 and the standard scores of 4 cognitive functions: NCI, general memory, verbal memory, and processing speed. Conclusions ERα polymorphism exerted an effect on the interaction between the concentration of estradiol and the results for cognitive functions. The concentration of estradiol did not depend on Xba1 and PvuII polymorphisms. The results for cognitive functions depended on which Xba1 polymorphism the woman carried. PMID:27680398

  1. Vitamin D receptor polymorphisms and 25-hydroxyvitamin D in a group of Sicilian multiple sclerosis patients.

    PubMed

    Agnello, Luisa; Scazzone, C; Ragonese, P; Salemi, G; Lo Sasso, B; Schillaci, R; Musso, G; Bellia, C; Ciaccio, M

    2016-02-01

    Multiple sclerosis (MS) is an auto-immune disease whose etiology remains controversial. Both genetic and environmental factors are thought to be involved in the risk of developing the disease. The purpose of our study was to assess the association of Vitamin D receptor (VDR) polymorphisms with MS and to investigate the interaction of these polymorphisms with vitamin D levels. A total of 179 Sicilian subjects, including 104 MS patients and 75 healthy controls, were studied. The most common VDR polymorphisms (Fok-I, Bsm-I, Taq-I and Apa-I) were genotyped by polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) analyses in both groups and serum 25-hydroxyvitamin D [25(OH)D] levels were determined in MS patients by high-performance liquid chromatography (HPLC). The distribution of genotype and allele frequencies of the four VDR polymorphisms did not differ significantly between MS patients and healthy controls, and were unrelated to the forms and the course of MS. Low serum levels of 25(OH)D were observed in MS patients but no association was observed between VDR and 25(OH)D levels except for Fok-I. Moreover, MS patients with FF and Ff genotype had a significantly lower serum levels of 25(OH)D compared with ff carriers (P < 0.05 FF vs Ff and Ff vs ff). Our findings showed no association between VDR polymorphisms and risk of MS. Interestingly, F allele could confer a genetic predisposition to lower 25(OH)D levels.

  2. Cognitive Functions, Concentration of Endogenous Estradiol, Estrogen Receptor α (ERα) Polymorphism in Postmenopausal Women.

    PubMed

    Bojar, Iwona; Pinkas, Jarosław; Wierzbińska-Stępniak, Anna; Raczkiewicz, Dorota; Owoc, Alfred; Gujski, Mariusz

    2016-09-28

    BACKGROUND The goal of this study was to investigate the relationship between cognitive functions and the level of endogenous estradiol in postmenopausal women, according to which estrogen receptor α (ERα) polymorphism the woman carries. MATERIAL AND METHODS The study group consisted of 210 women. The inclusion criteria were: minimum 2 years after the last menstruation, FSH concentration 30 U/ml, and no dementia signs on Montreal Cognitive Assessment (MoCA). A computerized battery of Central Nervous System Vital Signs (CNS VS) test was used to diagnose cognitive functions. Genotyping of the ERa polymorphism was performed using a polymerase chain reaction and restriction enzymes (PCR-RFLP). Blood plasma was tested for FSH and estradiol (E2). Statistical analysis was performed using STATISTICA software. RESULTS A relationship was confirmed between standard scores for 3 cognitive functions: general memory, verbal memory, and processing speed, and the XbaI polymorphism in the women in the study. In the group of women with genotype TT PvuII, significant positive relationships were observed between the concentration of E2 and the standard scores of 3 cognitive functions: general memory, verbal memory, and processing speed. In the group of women with genotype TC PvuII, significant negative correlations were found between the concentration of E2 and the standard scores of 4 cognitive functions: NCI, general memory, verbal memory, and processing speed. CONCLUSIONS ERα polymorphism exerted an effect on the interaction between the concentration of estradiol and the results for cognitive functions. The concentration of estradiol did not depend on Xba1 and PvuII polymorphisms. The results for cognitive functions depended on which Xba1 polymorphism the woman carried.

  3. Impact of gene polymorphisms of gonadotropins and their receptors on human reproductive success.

    PubMed

    Casarini, Livio; Santi, Daniele; Marino, Marco

    2015-12-01

    Gonadotropins and their receptors' genes carry several single-nucleotide polymorphisms resulting in endocrine genotypes modulating reproductive parameters, diseases, and lifespan leading to important implications for reproductive success and potential relevance during human evolution. Here we illustrate common genotypes of the gonadotropins and gonadotropin receptors' genes and their clinical implications in phenotypes relevant for reproduction such as ovarian cycle length, age of menopause, testosterone levels, polycystic ovary syndrome, and cancer. We then discuss their possible role in human reproduction and adaptation to the environment. Gonadotropins and their receptors' variants are differently distributed among human populations. Some hints suggest that they may be the result of natural selection that occurred in ancient times, increasing the individual chance of successful mating, pregnancy, and effective post-natal parental cares. The gender-related differences in the regulation of the reproductive endocrine systems imply that many of these genotypes may lead to sex-dependent effects, increasing the chance of mating and reproductive success in one sex at the expenses of the other sex. Also, we suggest that sexual conflicts within the FSH and LH-choriogonadotropin receptor genes contributed to maintain genotypes linked to subfertility among humans. Because the distribution of polymorphic markers results in a defined geographical pattern due to human migrations rather than natural selection, these polymorphisms may have had only a weak impact on reproductive success. On the contrary, such genotypes could acquire relevant consequences in the modern, developed societies in which parenthood attempts often occur at a later age, during a short, suboptimal reproductive window, making clinical fertility treatments necessary.

  4. The frequency distribution of vitamin D Receptor fok I gene polymorphism among Ugandan pulmonary TB patients

    PubMed Central

    Acen, Ester L.; Worodria, William; Mulamba, Peter; Kambugu, Andrew; Erume, Joseph

    2016-01-01

    Background: Mycobacterium tuberculosis (TB) is still a major problem globally and especially in Africa. Vitamin D deficiency has been linked to TB in the past and studies have found vitamin D deficiency to be common among Ugandan TB patients. The functional activity of vitamin D is dependent on the genotype of the vitamin D receptor (VDR) polymorphic genes. Recent findings have indicated that VDR polymorphisms may cause increased resistance or susceptibility to TB. The vitamin D ligand and its receptor play a pivotal role in innate immunity by eliciting antimicrobial activity, which is important in prevention of TB. The fok I vitamin D receptor gene has extensively been examined in TB patients but findings so far have been inconclusive. Objectives: This study sought to investigate the frequency distribution of the VDR fok I gene polymorphisms in pulmonary TB patients and controls. Methods: A pilot case control study of 41 newly diagnosed TB patients and 41 healthy workers was set up. Vitamin D receptor fok I gene was genotyped. Results: The frequency distribution of fok I genotype in Ugandan TB patients was 87.8% homozygous-dominant (FF), 7.3% (Ff) heterozygous and 4.8% (ff) homozygous recessive. For normal healthy subjects the frequencies were (FF) 92.6%, (Ff) 2.4% and (ff) 4.8%. No significant difference was observed in the FF and ff genotypes among TB patients and controls. The Ff heterozygous genotype distribution appeared more in TB patients than in controls. A significant difference was observed in the fok I genotype among gender p value 0.02. No significant difference was observed in ethnicity, p value 0.30. Conclusions: The heterozygous Ff fok I genotype may be associated with TB in the Ugandan population. PMID:27785354

  5. Toll-like receptor polymorphisms, inflammatory and infectious diseases, allergies, and cancer.

    PubMed

    Medvedev, Andrei E

    2013-09-01

    Toll-like receptors (TLRs) are germ-line-encoded innate immune sensors that recognize conserved microbial structures and host alarmins and signal expression of MHC proteins, costimulatory molecules, and inflammatory mediators by macrophages, neutrophils, dendritic cells, and other cell types. These processes activate immediate and early mechanisms of innate host defense, as well as initiate and orchestrate adaptive immune responses. Several single-nucleotide polymorphisms (SNPs) within the TLR genes have been associated with altered susceptibility to infectious, inflammatory, and allergic diseases, and have been found to play a role in tumorigenesis. Critical advances in our understanding of innate immune functions and genome-wide association studies (GWAS) have uncovered complex interactions of genetic polymorphisms within TLRs and environmental factors. However, conclusions obtained in the course of such analyses are restricted by limited power of many studies that is likely to explain controversial findings. Further, linkages to certain ethnic backgrounds, gender, and the presence of multigenic effects further complicate the interpretations of how the TLR SNPs affect immune responses. For many TLRs, the molecular mechanisms by which SNPs impact receptor functions remain unknown. In this review, I have summarized current knowledge about the TLR polymorphisms, their impact on TLR signaling, and associations with various inflammatory, infectious, allergic diseases and cancers, and discussed the directions of future scientific research.

  6. Leptin receptor expression and Gln223Arg polymorphism as prognostic markers in oral and oropharyngeal cancer.

    PubMed

    Rodrigues, P R S; Maia, L L; Santos, M; Peterle, G T; Alves, L U; Takamori, J T; Souza, R P; Barbosa, W M; Mercante, A M C; Nunes, F D; Carvalho, M B; Tajara, E H; Louro, I D; Silva-Conforti, A M A

    2015-11-25

    The leptin gene product is released into the blood stream, passes through the blood-brain barrier, and finds the leptin receptor (LEPR) in the central nervous system. This hormone regulates food intake, hematopoiesis, inflammation, immunity, differentiation, and cell proliferation. The LEPR Gln223Arg polymorphism has been reported to alter receptor function and expression, both of which have been related with prognostics in several tumor types. Furthermore, several studies have shown a relationship between the Gln223Arg polymorphism and tumor development, and its role in oral and oropharyngeal squamous cell carcinoma is now well understood. In this study, 315 DNA samples were used for LEPR Gln223Arg genotyping and 87 primary oral and oropharyngeal squamous cell carcinomas were used for immunohistochemical expression analysis, such that a relationship between these and tumor development and prognosis could be established. Homozygous LEPR Arg223 was found to be associated with a 2-fold reduction in oral and oropharyngeal cancer risk. In contrast, the presence of the Arg223 allele in tumors was associated with worse disease-free and disease-specific survival. Low LEPR expression was found to be an independent risk factor, increasing the risk for lymph node metastasis 4-fold. In conclusion, the Gln223Arg polymorphism and LEPR expression might be valuable markers for oral and oropharyngeal cancer, suggesting that LEPR might serve as a potential target for future therapies.

  7. Toll-Like Receptor Polymorphisms, Inflammatory and Infectious Diseases, Allergies, and Cancer

    PubMed Central

    2013-01-01

    Toll-like receptors (TLRs) are germ-line-encoded innate immune sensors that recognize conserved microbial structures and host alarmins and signal expression of MHC proteins, costimulatory molecules, and inflammatory mediators by macrophages, neutrophils, dendritic cells, and other cell types. These processes activate immediate and early mechanisms of innate host defense, as well as initiate and orchestrate adaptive immune responses. Several single-nucleotide polymorphisms (SNPs) within the TLR genes have been associated with altered susceptibility to infectious, inflammatory, and allergic diseases, and have been found to play a role in tumorigenesis. Critical advances in our understanding of innate immune functions and genome-wide association studies (GWAS) have uncovered complex interactions of genetic polymorphisms within TLRs and environmental factors. However, conclusions obtained in the course of such analyses are restricted by limited power of many studies that is likely to explain controversial findings. Further, linkages to certain ethnic backgrounds, gender, and the presence of multigenic effects further complicate the interpretations of how the TLR SNPs affect immune responses. For many TLRs, the molecular mechanisms by which SNPs impact receptor functions remain unknown. In this review, I have summarized current knowledge about the TLR polymorphisms, their impact on TLR signaling, and associations with various inflammatory, infectious, allergic diseases and cancers, and discussed the directions of future scientific research. PMID:23675778

  8. Interleukin-1 receptor antagonist gene polymorphism and mortality in patients with severe sepsis

    PubMed Central

    ARNALICH, F; LÓPEZ-MADERUELO, D; CODOCEO, R; LOPEZ, J; SOLIS-GARRIDO, L M; CAPISCOL, C; FERNANDEZ-CAPITÁN, C; MADERO, R; MONTIEL, C

    2002-01-01

    This study aims to determine the influence of the polymorphism within the intron 2 of the interleukin-1 receptor antagonist gene (IL-1RN*) on the outcome of severe sepsis, and to assess its functional significance by correlating this polymorphism with the total production of interleukin-1 receptor antagonist (IL-1Ra) protein determined in stimulated peripheral blood mononuclear cells (PBMC). A group of 78 patients with severe sepsis (51 survivors and 27 nonsurvivors) was compared with a healthy control group of 130 blood donors, and 56 patients with uncomplicated pneumonia. We found a significant association between IL-1RN* polymorphism and survival. Thus, after adjusting for age and APACHE II score, multiple logistic regression analysis showed that patients homozygotes for the allele *2 had a 6·47-fold increased risk of death (95% CI 1·01–41·47, P = 0·04). Besides, compared with patients homozygous or heterozygous for the allele *1, IL-1RN*2 homozygotes produced significantly lower levels of IL-1Ra from their PBMC. Our results suggest that insufficient production of this cytokine might contribute, among other factors, to the higher mortality rate found in severe sepsis patients with the IL-1RN*2 homozygous genotype. PMID:11876758

  9. Brain structural and clinical changes after first episode psychosis: Focus on cannabinoid receptor 1 polymorphisms.

    PubMed

    Suárez-Pinilla, Paula; Roiz-Santiañez, Roberto; Ortiz-García de la Foz, Víctor; Guest, Paul C; Ayesa-Arriola, Rosa; Córdova-Palomera, Aldo; Tordesillas-Gutierrez, Diana; Crespo-Facorro, Benedicto

    2015-08-30

    Cannabinoid receptor 1 (CNR1) gene polymorphisms have been associated with central and peripheral effects of cannabis and schizophrenia pathophysiology. Here, we have tested whether three CNR1 variants (rs1049353, rs1535255 and rs2023239) are associated with changes in brain volumes, body mass index (BMI) or psychopathological scores in a 3-year longitudinal study of 65 first-episode psychosis patients. The rs1049353 at-risk allele was significantly associated with a greater reduction of caudate volume, and the rs2023239 T/C polymorphism showed a significant decrease in thalamic volume after the 3-year period. For those who were not cannabis users, the rs1535255 and rs2023239 polymorphisms had effects in lateral ventricle (LV), and LV and white matter, respectively. The rs2023239 variant also was associated with significant improvements in positive and negative symptoms of schizophrenia. There was no significant effect of any of the variants on changes in BMI over the 3-year study. Finally, an interaction between all three polymorphisms was found involving evolution of positive symptoms. These findings suggest that the cannabinoid pathway is associated with schizophrenia evolution over time. However, further studies using larger cohorts are needed to confirm these results. If confirmed, the present findings could lead in subsequent investigations for identification of novel drug targets for improved treatment of patients suffering from schizophrenia.

  10. Functional 5-HT1a receptor polymorphism selectively modulates error-specific subprocesses of performance monitoring.

    PubMed

    Beste, Christian; Domschke, Katharina; Kolev, Vasil; Yordanova, Juliana; Baffa, Anna; Falkenstein, Michael; Konrad, Carsten

    2010-04-01

    Our study investigates the dependence of response monitoring and error detection on genetic influences modulating the serotonergic system. This was done using the event-related potentials (ERPs) after error (Ne/ERN) and correct trials (Nc/CRN). To induce a sufficient amount of errors, a standard flanker task was used. The subjects (N = 94) were genotyped for the functional 5-HT1A C(-1019)G polymorphism. The results show that the 5-HT1A C(-1019)G polymorphism specifically modulates error detection. Neurophysiological modulations on error detection were paralleled by a similar modulation of response slowing after an error, reflecting the behavioral adaptation. The 5-HT1A -1019 CC genotype group showed a larger Ne and stronger posterror slowing than the CG and GG genotype groups. More general processes of performance monitoring, as reflected in the Nc/CRN, were not affected. The finding that error-specific processes, but not general response monitoring processes, are modulated by the 5-HT1A C(-1019)G polymorphism is underlined by a wavelet analysis. In summary, the results suggest a specific effect of the 5-HT1A C(-1019)G polymorphism on error monitoring, as reflected in the Ne, and suggest a neurobiological dissociation between processes of error monitoring and general response monitoring at the level of the serotonin 1A receptor system.

  11. Alcohol and aggressive behavior in men--moderating effects of oxytocin receptor gene (OXTR) polymorphisms.

    PubMed

    Johansson, A; Bergman, H; Corander, J; Waldman, I D; Karrani, N; Salo, B; Jern, P; Algars, M; Sandnabba, K; Santtila, P; Westberg, L

    2012-03-01

    We explored if the disposition to react with aggression while alcohol intoxicated was moderated by polymorphic variants of the oxytocin receptor gene (OXTR). Twelve OXTR polymorphisms were genotyped in 116 Finnish men [aged 18-30, M = 22.7, standard deviation (SD) = 2.4] who were randomly assigned to an alcohol condition in which they received an alcohol dose of 0.7 g pure ethanol/kg body weight or a placebo condition. Aggressive behavior was measured using a laboratory paradigm in which it was operationalized as the level of aversive noise administered to a fictive opponent. No main effects of the polymorphisms on aggressive behavior were found after controlling for multiple testing. The interactive effects between alcohol and two of the OXTR polymorphisms (rs4564970 and rs1488467) on aggressive behavior were nominally significant and remained significant for the rs4564970 when controlled for multiple tests. To the best of our knowledge, this is the first experimental study suggesting interactive effects of specific genetic variants and alcohol on aggressive behavior in humans.

  12. Association of vitamin D receptor gene polymorphism with the urine calcium level in nephrolithiasis patients.

    PubMed

    Zhou, Tian-Biao; Jiang, Zong-Pei; Huang, Miao-Fang; Zhang, Rui

    2015-04-01

    Association of vitamin D receptor (VDR) gene polymorphism with the urine calcium level in nephrolithiasis patients from the published reports are still conflicting. This study was conducted to evaluate the relationship between VDR BsmI (rs1544410), Fok1 (rs2228570), TaqI (rs731236) and ApaI (rs7975232) gene polymorphism and urine calcium level in nephrolithiasis patients using meta-analysis method. The association studies were identified from PubMed, and Cochrane Library on 1 April 2014, and eligible investigations were included and synthesized using meta-analysis method. Four reports were recruited into this meta-analysis for the association of VDR BsmI, Fok1, TaqI and ApaI gene polymorphism with urine calcium level in nephrolithiasis patients. In this meta-analysis, VDR BsmI B allele and BB genotype, Fok1 f allele and ff genotype, TaqI, and ApaI gene polymorphism were not associated with urine calcium level in nephrolithiasis patients. However, the BsmI bb genotype and Fok1 FF genotype were associated with the urine calcium level in nephrolithiasis patients. In conclusion, VDR BsmI bb genotype and Fok1 FF genotype were associated with the urine calcium level in nephrolithiasis patients. However, more studies should be conducted to confirm it.

  13. Dopamine D2 receptor gene -141C Insertion/Deletion polymorphism in Turkish schizophrenic patients.

    PubMed

    Kurt, Hulyam; Dikmen, Miris; Basaran, Ayşe; Yenilmez, Cinar; Ozdemir, Figen; Degirmenci, Irfan; Gunes, Hasan Veysi; Kucuk, Meral Urhan; Mutlu, Fezan

    2011-02-01

    Schizophrenia is a chronic and neuropsychiatric disease that affects about 0.5-1% of the world's population. An increase in dopamine and dopamine D2 receptor (DRD2) gene products has been well described in schizophrenic patients. Several groups have studied the relationship between dopaminergic hyperactivity and cellular communications have obtained discordant results. Studies searching for the relationship between the schizophrenia and DRD2 gene have gained more interest. Our objective was to determine the relationships among schizophrenic symptoms in schizophrenia subtypes and severity of symptoms in terms of DRD2 gene -141C Insertion/Deletion [Ins/Del; I/D] polymorphism by PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) assay method. Genomic DNA was prepared from peripheral blood by using salt extraction method. After amplification of genomic DNA, PCR products were digested with BstNI restriction enzyme for the detection of DRD2 gene -141C Ins/Del polymorphism in 73 schizophrenic patients and 60 healthy control subjects. The allelic frequencies of the DRD2 gene -141C Ins/Del polymorphism in case and control groups were 79.5 and 77.5% for I allele; 20.5 and 22.5% for D allele respectively. There was no significant difference in frequencies of genotypes and alleles between the two groups. In schizophrenic and control subjects, there were no significant relationship in severity of the disease and schizophrenia types among the -141C Ins/Del genotypes and alleles.

  14. Lack of Association between Oxytocin Receptor (OXTR) Gene Polymorphisms and Alexithymia: Evidence from Patients with Obsessive-Compulsive Disorder.

    PubMed

    Koh, Min Jung; Kim, Wonji; Kang, Jee In; Namkoong, Kee; Kim, Se Joo

    2015-01-01

    Oxytocin receptor gene single nucleotide polymorphisms have been associated with structural and functional alterations in brain regions, which involve social-emotional processing. Therefore, oxytocin receptor gene polymorphisms may contribute to individual differences in alexithymia, which is considered to be a dysfunction of emotional processing. The aim of this study was to evaluate the association between oxytocin receptor gene single nucleotide polymorphisms or haplotypes and alexithymia in patients with obsessive-compulsive disorder. We recruited 355 patients with obsessive-compulsive disorder (234 men, 121 women). Alexithymia was measured by using the Toronto Alexithymia Scale. We performed single-marker and haplotype association analyses with eight single nucleotide polymorphisms (rs237885, rs237887, rs2268490, rs4686301, rs2254298, rs13316193, rs53576, and rs2268498) in the oxytocin receptor gene. There were no significant associations between any of the eight single nucleotide polymorphism of the oxytocin receptor gene and alexithymia. In addition, a six-locus haplotype block (rs237885-rs237887-rs2268490-rs4686301-rs2254298-rs13316193) was not significantly associated with alexithymia. These findings suggest that genetic variations in the oxytocin receptor gene may not explain a significant part of alexithymia in patients with obsessive-compulsive disorder.

  15. No evidence of association between structural polymorphism at the dopamine D3 receptor locus and alcoholism in the Japanese

    SciTech Connect

    Higuchi, Susumu; Muramatsu, Taro; Matsushita, Sachio; Murayama, Masanobu

    1996-07-26

    Dopaminergic systems mediate reward mechanisms and are involved in reinforcing self-administration of dependence-forming substances, including alcohol. Studies have reported that polymorphisms of the dopamine D2 receptor, whose structure and function are similar to those of the dopamine D3 receptor, increase the susceptibility to alcoholism. The observations led to the examination of the possible association between a structural polymorphism of the D3 receptor gene and alcoholism. Genotyping results, employing a PCR-RFLP method, showed no difference in allele and genotype frequencies of the D3 BalI polymorphism (Ser{sup 9}/Gly{sup 9}) between Japanese alcoholics and controls. Moreover, these frequencies were not altered in alcoholics with inactive aldehyde dehydrogenase-2 (ALDH2), a well-defined negative risk factor for alcoholism. These results strongly suggest that the dopamine D3 receptor is not associated with alcoholism. 19 refs., 1 fig., 1 tab.

  16. No allelic association between Parkinson`s disease and dopamine D2, D3, and D4 receptor gene polymorphisms

    SciTech Connect

    Nanko, S.; Hattori, M.; Dai, X.Y.

    1994-12-15

    Parkinson`s disease is thought to be caused by a combination of unknown environmental, genetic, and degenerative factors. Evidence from necropsy brain samples and pharmacokinetics suggests involvement of dopamine receptors in the pathogenesis or pathophysiology of Parkinson`s disease. Genetic association studies between Parkinson`s disease and dopamine D2, D3 and D4 receptor gene polymorphisms were conducted. The polymorphism was examined in 71 patients with Parkinson`s disease and 90 controls. There were no significant differences between two groups in allele frequencies at the D2, D3, and D4 dopamine receptor loci. Our findings do not support the hypothesis that susceptibility to Parkinson`s disease is associated with the dopamine receptor polymorphisms examined. 35 refs., 2 tabs.

  17. No Association between Oxytocin Receptor (OXTR) Gene Polymorphisms and Experimentally Elicited Social Preferences

    PubMed Central

    Apicella, Coren L.; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T.; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

    2010-01-01

    Background Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. Methodology/Principal Findings We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. Conclusion We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant. PMID:20585395

  18. IGF-I and IGF-I receptor polymorphisms among elite swimmers.

    PubMed

    Ben Zaken, Sigal; Meckel, Yoav; Dror, Nitzan; Nemet, Dan; Eliakim, Alon

    2014-11-01

    In recent years several genetic polymorphisms related to the GH-IGF-I axis were suggested to promote athletic excellence in endurance and power sports. We studied the presence of the C-1245T SNP (rs35767), a nucleotide substitution in the promoter region of the IGF-I gene, and the presence of the 275124A > C SNP (rs1464430), a common nucleotide substitution in the intron region of the IGF-I receptor (IGF-IR) gene in elite long and short-distance swimmers compared with nonphysically active controls. The rare T/T IGF-I polymorphism was found only in 5.3% of the long-distance swimmers, and was not found at all in the short-distance swimmers or among the control group participants. The prevalence of the IGF-I receptor AA genotype was significantly lower in the swimming group as a whole (35%) compared with the control group (46%), in particularly due to reduced frequency of the AA genotype among short-distance swimmers (26%). In contrast to previous reports in elite endurance and power track and field athletes, single nucleotide polymorphisms of the IGF-I and the IGF-IR were not frequent among elite Israeli short- and long-distance swimmers emphasizing the importance of other factors for excellence in swimming. The results also suggest that despite seemingly similar metabolic characteristics different sports disciplines may have different genetic polymorphisms. Thus, combining different disciplines for sports genetic research purposes should be done with extreme caution.

  19. Association of Toll-like receptors 2, 3, and 4 genes polymorphisms with periapical pathosis risk

    PubMed Central

    Özan, Ülkü; Ocak, Zeynep; Özan, Fatih; Oktay, Elif-Aybala; Şahman, Halil; Yikilgan, İhsan; Oruçoğlu, Hasan; Er, Kürşat

    2016-01-01

    Background The aim of this study was to investigate the role of gene variations of Toll-like receptors (TLR) 2, 3, and 4 on genetic susceptibility to periapical pathosis. Material and Methods One hundred patients were included in the study and divided into two groups as follows; Control Group (n=50) that have root canal treatment and no periapical lesion, Patient Group (n=50) that have root canal treatment and periapical lesion. TLR2 Arg753Gln, TLR3 (c.1377C/T) and TLR4 Asp299Gly and Thr399Ile polymorphisms were genotyped by using PCR-RFLP. Genotypical analysis of control and patient groups were investigated to disclose whether there is any association between periapical lesions and gene variations. Results There are no significant statistical differences between control and patient groups according to TLR 2 and 4 gene sequence. On the contrary, CC allele detected 74% for TLR 3 in patient group, and this difference was found to be statistically significant (p < 0.005). Conclusions According to these results, it can be suggested that patients with Toll-like receptor 3 gene polymorphisms could be susceptible to periapical pathosis. Key words:Toll-like receptors, periapical pathosis, endodontics. PMID:27031066

  20. CCR5 (chemokine receptor-5) DNA-polymorphism influences the severity of rheumatoid arthritis.

    PubMed

    Zapico, I; Coto, E; Rodríguez, A; Alvarez, C; Torre, J C; Alvarez, V

    2000-01-01

    Chemokines are critical for the inflammatory process in autoimmune diseases such as rheumatoid arthritis (RA). The chemokine receptor-5 (CCR5) mediates chemotaxis by CC-chemokines and is expressed by lymphocytes with the Th1 phenotype and monocyte/macrophages. A 32 bp deletion in the CCR5 (CCR5-delta 32 allele) abolishes receptor expression in homozygotes, while CCR5-delta 32 carriers would express less receptor than wild-type homozygotes. This polymorphism is related to the resistance to HIV-1 infection and progression towards AIDS. We hypothesized that the CCR5-delta 32 allele may modulate the severity of disease in RA. A total of 160 RA-patients (71 and 89 with severe and non-severe phenotypes, respectively) and 500 healthy individuals from the same Caucasian population (Asturias, northern Spain) were genotyped. Carriers of the CCR5-delta 32 allele were at a significantly higher frequency (P = 0.012) in non-severe compared to severe patients (17% vs 4%). Our results suggest that the CCR5-delta 32 polymorphism is a genetic marker related to the severity of RA.

  1. Association study between schizophrenia and dopamine D3 receptor gene polymorphism

    SciTech Connect

    Tanaka, Toshihisa; Takahashi, Makoto; Maeda, Masaya

    1996-07-26

    Crocq et al. reported the existence of an association between schizophrenia and homozygosity of a BalI polymorphism in the first exon of the dopamine D3 receptor (DRD3) gene. In response to this report, further studies were conducted; however, these studies yielded conflicting results. In the present study, we examined 100 unrelated Japanese schizophrenics and 100 normal controls to determine any association between this polymorphism and schizophrenia. Results suggest that neither allele nor genotype frequencies of the DRD3 gene in the schizophrenics as a whole are significantly different from those of the controls. Further, we found no association between any allele or genotype and any clinical subtype based on family history of schizophrenia and age-at-onset. A significantly high frequency of homozygosity of a dopamine D3 receptor gene allele was not observed in the schizophrenics as a whole, or in clinical subtypes. Our results suggest that an association between the dopamine D3 receptor gene and schizophrenia is unlikely to exist. 26 refs., 1 tab.

  2. Association of Vitamin D Receptor Gene Polymorphisms with Colorectal Cancer in a Saudi Arabian Population

    PubMed Central

    Alkhayal, Khayal A.; Awadalia, Zainab H.; Vaali-Mohammed, Mansoor-Ali; Al Obeed, Omar A.; Al Wesaimer, Alanoud; Halwani, Rabih; Zubaidi, Ahmed M.

    2016-01-01

    Background Vitamin D, causally implicated in bone diseases and human malignancies, exerts its effects through binding to the vitamin D receptor (VDR). VDR is a transcription factor modulating the expression of several genes in different pathways. Genetic variants in the VDR gene have been associated with several cancers in different population including colorectal cancer. Objective To assess the association of VDR gene polymorphisms in relation with colorectal cancer (CRC) in a Saudi population. Methods The polymorphisms of VDR gene (BsmI, FokI, ApaI and TaqI) were analyzed by the polymerase chain reaction amplification of segments of interest followed by Sanger sequencing. One hundred diagnosed CRC patients and 100 healthy control subjects that were age and gender matched were recruited. Results We did not observe significant association of any of the four VDR polymorphisms with colorectal cancer risk in the overall analysis. Although not statistically significant, the AA genotype of BsmI conferred about two-fold protection against CRCs compared to the GG genotype. Stratification of the study subjects based on age and gender suggests statistically significant association of CRC with the ‘C’ allele of ApaI in patients >57 years of age at disease diagnosis and BsmI polymorphism in females. In addition, statistically significant differences were observed for the genotypic distributions of VDR-BsmI, ApaI and TaqI SNPs between Saudi Arabian population and several of the International HapMap project populations. Conclusion Despite the absence of correlation of the examined VDR polymorphisms with CRCs in the combined analysis, ApaI and BsmI loci are statistically significantly associated with CRC in elderly and female patients, respectively. These findings need further validation in larger cohorts prior to utilizing these SNPs as potential screening markers for colorectal cancers in Saudi population. PMID:27309378

  3. Characterization of polymorphic forms of Fc receptor III on human neutrophils.

    PubMed Central

    Ory, P A; Goldstein, I M; Kwoh, E E; Clarkson, S B

    1989-01-01

    We characterized Fc receptor III (FcR III) on human neutrophils and found it to be heavily glycosylated and polymorphic. In some individuals, FcR III that had been digested with N-glycanase appeared after SDS-PAGE under reducing conditions as two bands with apparent molecular masses of 33 and 29 kD. In other individuals, N-glycanase-treated FcR III appeared as a single band with an Mr of either 33 or 29 kD. After SDS-PAGE of N-glycanase-treated FcR III under nonreducing conditions, the apparent Mr of each structural type was decreased, suggesting the presence of intramolecular disulfide bonds. Digestion of the 33-kD band and the 29-kD band with Staphylococcus aureus V8 protease yielded similar, but not identical, peptide maps. Thus, at least two polymorphic forms of FcR III are expressed on human neutrophils. The structural polymorphism of neutrophil FcR III correlated with previously described antigenic polymorphisms detected by monoclonal antibody Gran 11 and by alloantisera which recognize epitopes of the biallelic, neutrophil antigen (NA) system. Individuals whose neutrophils expressed the two-band structural type of FcR III were NA1NA2 heterozygotes. Individuals whose neutrophils expressed the single 33-kD band structural type were NA2NA2 homozygotes, and individuals whose neutrophils expressed the single 29-kD band structural type were NA1NA1 homozygotes. These findings indicate that antigenic and structural polymorphisms of human neutrophil FcR III are related and can be accounted for by differences at the level of primary protein structure. Images PMID:2523415

  4. Progesterone receptor (PROGINS) polymorphism and the risk of endometrial cancer development.

    PubMed

    Junqueira, M G; da Silva, I D C G; Nogueira-de-Souza, N C; Carvalho, C V; Leite, D B; Gomes, M T V; Baracat, E C; Lopes, L A F; Nicolau, S M; Gonçalves, W J

    2007-01-01

    The progesterone receptor gene (PROGINS) has been identified as a risk modifier for benign and malignant gynecological diseases. The present case-control study is to evaluate the role of the PROGINS polymorphisms, as risk factor, for endometrial cancer development and to investigate the association between these genetics variants and clinical/pathologic variables of endometrial cancer. PROGINS polymorphism was examined in a total of 121 patients with endometrial cancer and 282 population-based control subjects, all located at the same area in São Paulo, SP, Brazil. The genotyping of PROGINS polymorphism was determined by polymerase chain reaction. The frequencies of PROGINS polymorphism T1/T1, T1/T2, and T2/T2 were 82.6%, 14.9%, and 2.5% in the endometrial cancer patients and 78.4%, 21.6%, and 0% in the controls, respectively. The chi(2) test showed a higher incidence of the T2/T2 genotype in the endometrial cancer group subjects, these results were statistically different (P= 0.012). However, due to the fact that there were no women in the control group showing homozygosis for the allele T2, the correct evaluation of odds ratio could not be properly calculated. Regarding the clinical and pathologic findings observed within the group of patients with endometrial cancer, there was significant correlation between T1/T2 genotype and the presence of myoma (P= 0.048). No correlations were observed among the other variables. These data suggest that the PROGINS polymorphism T2/T2 genotype might be associated with an increased risk of endometrial cancer.

  5. Prevalence of common vitamin D receptor gene polymorphisms in HIV-infected and uninfected South Africans

    PubMed Central

    McNamara, Lynne; Takuva, Simbarashe; Chirwa, Tobias; MacPhail, Patrick

    2016-01-01

    Background: Host genetic factors may a play role in susceptibility to infection. Vitamin-D is an immunomodulator that may play a role in HIV infection. Vitamin-D action is mediated by the vitamin-D receptor. We establish prevalence of ApaI, BsmI, FokI and TaqI polymorphisms (VDRPs) amongst a black southern African HIV+ve population and investigate polymorphic differences between HIV+ve and -ve people. Methods: Seventy-nine sex and age-group matched HIV+ve patients of African origin initiating antiretroviral therapy (ART) and 79 HIV-ve participants, also of African origin, were recruited from a public sector HIV testing and treatment clinic and investigated for the 4 polymorphisms. The genotype frequencies were compared, odds ratios and 95% confidence intervals of the association of HIV status and each genotype were calculated. Both dominant, co-dominant, recessive and allele models were tested. Results: We found no evidence of difference in distribution and association between HIV infection and the genotypes of the BsmI, FokI and TaqI VDR polymorphisms. The genotype distributions were consistent with Hardy-Weinberg equilibrium for these genotypes. The ApaI genotype showed differences in distribution by HIV status in the dominant and co-dominant models. However this finding is cautiously stated as the ApaI genotype violated the Hardy-Weinberg equilibrium and frequency of the minor variant was unexpectedly low in this population. Conclusion: We do not show convincing differences in distribution of the VDR genotypes among HIV+ve and HIV-ve black southern African persons. Future studies need to be replicated in larger study populations as understanding polymorphic differences and similarities may offer insights into the different susceptibility and progression of HIV in southern African populations. PMID:27186331

  6. Expression of two human beta-adrenergic receptors in Escherichia coli: functional interaction with two forms of the stimulatory G protein.

    PubMed Central

    Freissmuth, M; Selzer, E; Marullo, S; Schütz, W; Strosberg, A D

    1991-01-01

    When expressed in Escherichia coli, the human beta 1- and beta 2-adrenergic receptors retain their ligand binding specificity. Their functional integrity was investigated by analyzing receptor-guanine nucleotide-binding regulatory (G) protein coupling by using two splice variants of the alpha subunit of the stimulatory G protein Gs synthesized in E. coli (rGs alpha-S and rGs alpha-L) and the beta gamma subunits of G protein purified from bovine brain. In competition binding experiments with (-)-[125I]iodocyanopindolol and (-)-isoproterenol, rGs alpha-S.beta gamma and rGs alpha-L.beta gamma reconstituted guanine nucleotide-sensitive high-affinity agonist binding with comparable affinities, whereas rGs alpha PT, a mutant of rGs alpha-L with an altered carboxyl terminus, and a recombinant subtype of the alpha subunit of the inhibitory G protein, rGi alpha-1, were approximately 20- and approximately 200-fold less potent, respectively. A comparison of the beta 1- and beta 2-adrenergic receptor expressed in E. coli with the beta 2-receptor in S49 murine lymphoma cyc- cell membranes revealed a similar affinity of rGs alpha-S and rGs alpha-L for the recombinant and native receptors. After stable incorporation of rGs alpha-S.beta gamma into E. coli membranes, receptor-G protein coupling was also verified by determining the isoproterenol-mediated acceleration of the rate for guanine 5'-[gamma-[35S]thio]triphosphate binding. These results show that (i) receptor-G protein coupling can be reconstituted in E. coli using recombinant components and that (ii) such an approach may be more generally used to evaluate coupling preferences between defined molecular species of receptors and G-protein subunits. PMID:1656450

  7. Oxytocin Receptor Gene Polymorphisms Are Associated with Human Directed Social Behavior in Dogs (Canis familiaris)

    PubMed Central

    Lakatos, Gabriella; Pergel, Enikő; Turcsán, Borbála; Pluijmakers, Jolanda; Vas, Judit; Elek, Zsuzsanna; Brúder, Ildikó; Földi, Levente; Sasvári-Székely, Mária; Miklósi, Ádám; Rónai, Zsolt; Kubinyi, Enikő

    2014-01-01

    The oxytocin system has a crucial role in human sociality; several results prove that polymorphisms of the oxytocin receptor gene are related to complex social behaviors in humans. Dogs' parallel evolution with humans and their adaptation to the human environment has made them a useful species to model human social interactions. Previous research indicates that dogs are eligible models for behavioral genetic research, as well. Based on these previous findings, our research investigated associations between human directed social behaviors and two newly described (−212AG, 19131AG) and one known (rs8679684) single nucleotide polymorphisms (SNPs) in the regulatory regions (5′ and 3′ UTR) of the oxytocin receptor gene in German Shepherd (N = 104) and Border Collie (N = 103) dogs. Dogs' behavior traits have been estimated in a newly developed test series consisting of five episodes: Greeting by a stranger, Separation from the owner, Problem solving, Threatening approach, Hiding of the owner. Buccal samples were collected and DNA was isolated using standard protocols. SNPs in the 3′ and 5′ UTR regions were analyzed by polymerase chain reaction based techniques followed by subsequent electrophoresis analysis. The gene–behavior association analysis suggests that oxytocin receptor gene polymorphisms have an impact in both breeds on (i) proximity seeking towards an unfamiliar person, as well as their owner, and on (ii) how friendly dogs behave towards strangers, although the mediating molecular regulatory mechanisms are yet unknown. Based on these results, we conclude that similarly to humans, the social behavior of dogs towards humans is influenced by the oxytocin system. PMID:24454713

  8. Association of androgen receptor GGN repeat length polymorphism and male infertility in Khuzestan, Iran

    PubMed Central

    Moghadam, Mohamad; Khatami, Saied Reza; Galehdari, Hamid

    2015-01-01

    Background: Androgens play critical role in secondary sexual and male gonads differentiations such as spermatogenesis, via androgen receptor. The human androgen receptor (AR) encoding gene contains two regions with three nucleotide polymorphic repeats (CAG and GGN) in the first exon. Unlike the CAG repeats, the GGN has been less studied because of technical difficulties, so the functional role of these polymorphic repeats is still unclear. Objective: The goal of this study was to investigate any relationship between GGN repeat length in the first exon of AR gene and idiopathic male infertility in southwest of Iran. Materials and Methods: This is the first study on GGN repeat of AR gene in infertile male in Khuzestan, Iran. We used polymerase chain reaction (PCR) and polyacrylamide gel electrophoresis to categorize GGN repeat lengths in 72 infertile and 72 fertile men. Afterwards we sequenced the PCR products to determine the exact length of GGN repeat in each category. Our samples included 36 azoospermic and 36 oligozoospermic men as cases and 72 fertile men as control group. Results: We found that the numbers of repeats in the cases range from 18 to 25, while in the controls this range is from 20 to 28. The results showed a significant relation between the length of GGN repeat and fertility (p=0.015). The most frequent alleles were alleles with 24 and 25 repeats respectively in case and control groups. On the other hand no significant differences were found between Arab and non-Arab cases by considering GGN repeat lengths (p=0.234). Conclusion: Due to our results, there is a significant association between the presence of allele with 24 repeats and susceptibility to male infertility. Therefore this polymorphism should be considered in future studies to clarify etiology of disorders related to androgen receptor activity. PMID:26221130

  9. Platelet receptor gain-of-function single nucleotide polymorphisms in carotid and vertebral stenosis patients.

    PubMed

    Lugli, Andrea Kopp; Brown, Martin M; Steffel, Jan; Büchi, Linda; Förnzler, Dorothee; Dupont, Annabelle; Gaussem, Pascale; Forestier, Marc; Beer, Juerg H

    2011-08-01

    The role of platelet receptor gain-of-function single nucleotide polymorphisms (SNP) in cardiovascular disease is controversial. We hypothesised that certain SNPs may accelerate the development of carotid artery stenosis. The intronic PAR-1 receptor intervening sequence-14 A/T (IVSn-14 A/T) polymorphism and three additional platelet receptor polymorphisms, i.e. GPIa (807C/T), GPIbα (5T/C) and HPA-1a/HPA-1b (Pl (A1/A2)) of GPIIIa were studied. The interaction of SNPs with conventional risk factors including male gender, hypertension, high cholesterol, diabetes, advanced age and smoking were investigated. The hypothesis was tested in 114 well-characterised patients with symptomatic carotid or vertebral stenosis from the British CAVATAS population and compared the results with 97 unrelated controls. The allele frequency of the platelet gain-of-function SNP was not significantly different in the CAVATAS population as compared to controls (PAR-1A/T (P = 0.13), GPIa C/T (P = 0.25), GPIIIa HPA-1a/HPA-1b (PlA1/A2) (P = 0.66) and GPIb T/C (P = 0.20)). In the subgroup of smokers, however, the prothrombotic GPIbα C mutated allele was found in a significantly higher frequency in the patient as compared to the control group (P = 0.04). Contrary to the primary hypothesis, the PAR-1A/T SNP as well as the other SNPs tested were not over- or underrepresented in the CAVATAS population. However, a significantly increased prevalence of GPIb-α (5C/T) was found in the subgroup of smokers and may represent an important cofactor in this patient group of our hypothesis-generating study.

  10. A natural polymorphism alters odour and DEET sensitivity in an insect odorant receptor.

    PubMed

    Pellegrino, Maurizio; Steinbach, Nicole; Stensmyr, Marcus C; Hansson, Bill S; Vosshall, Leslie B

    2011-09-21

    Blood-feeding insects such as mosquitoes are efficient vectors of human infectious diseases because they are strongly attracted by body heat, carbon dioxide and odours produced by their vertebrate hosts. Insect repellents containing DEET (N,N-diethyl-meta-toluamide) are highly effective, but the mechanism by which this chemical wards off biting insects remains controversial despite decades of investigation. DEET seems to act both at close range as a contact chemorepellent, by affecting insect gustatory receptors, and at long range, by affecting the olfactory system. Two opposing mechanisms for the observed behavioural effects of DEET in the gas phase have been proposed: that DEET interferes with the olfactory system to block host odour recognition and that DEET actively repels insects by activating olfactory neurons that elicit avoidance behaviour. Here we show that DEET functions as a modulator of the odour-gated ion channel formed by the insect odorant receptor complex. The functional insect odorant receptor complex consists of a common co-receptor, ORCO (ref. 15) (formerly called OR83B; ref. 16), and one or more variable odorant receptor subunits that confer odour selectivity. DEET acts on this complex to potentiate or inhibit odour-evoked activity or to inhibit odour-evoked suppression of spontaneous activity. This modulation depends on the specific odorant receptor and the concentration and identity of the odour ligand. We identify a single amino-acid polymorphism in the second transmembrane domain of receptor OR59B in a Drosophila melanogaster strain from Brazil that renders OR59B insensitive to inhibition by the odour ligand and modulation by DEET. Our data indicate that natural variation can modify the sensitivity of an odour-specific insect odorant receptor to odour ligands and DEET. Furthermore, they support the hypothesis that DEET acts as a molecular 'confusant' that scrambles the insect odour code, and provide a compelling explanation for the broad

  11. CAG repeat polymorphism in the androgen receptor (AR) gene of SBMA patients and a control group.

    PubMed

    Sułek, Anna; Hoffman-Zacharska, Dorota; Krysa, Wioletta; Szirkowiec, Walentyna; Fidziańska, Elzbieta; Zaremba, Jacek

    2005-01-01

    Spinobulbar muscular atrophy (SBMA) is an X-linked form of motor neuron disease characterized by progressive atrophy of the muscles, dysphagia, dysarthria and mild androgen insensitivity. SBMA is caused by CAG repeat expansion in the androgen receptor gene. CAG repeat polymorphism was analysed in a Polish control group (n = 150) and patients suspected of SBMA (n = 60). Normal and abnormal ranges of CAG repeats were established in the control group and in 21 patients whose clinical diagnosis of SBMA was molecularly confirmed. The ranges are similar to those reported for other populations.

  12. Disseminated cysticercosis: clinical spectrum, Toll-like receptor-4 gene polymorphisms and role of albendazole

    PubMed Central

    Qavi, Abdul; Garg, Ravindra Kumar; Malhotra, Hardeep Singh; Jain, Amita; Kumar, Neeraj; Malhotra, Kiran Preet; Srivastava, Pradeep Kumar; Verma, Rajesh; Sharma, Praveen Kumar

    2016-01-01

    Abstract In this study, we describe clinical and imaging spectrum, and the natural course of patients with disseminated cysticercosis. How albendazole affects the course of disease has also been evaluated. We assessed the Toll-like receptor-4 gene polymorphisms, to know the reason for the apparently higher prevalence of disseminated cysticercosis in India. Sixty consecutive patients with disseminated cysticercosis were enrolled. Sixty age-and-sex-matched healthy controls were also enrolled for the purpose of genetic study. Twenty patients, who gave consent, were treated with albendazole along with corticosteroids. Forty patients did not give consent for antiparasitic therapy. Assessment for Toll-like receptor-4 gene polymorphisms (Asp299Gly and Thr399Ile genes) was done. Patients were followed for 6 months. We also performed a literature search of cases published in English language using PubMed electronic database and analyzed 56 cases thus available. There was an increased risk (6.63 fold and 4.61 fold) of disseminated cysticercosis in the presence of Asp299Gly and Thr399Ile polymorphisms in Toll-like receptor-4, respectively. The allelic frequency of Gly (11% vs. 3%, P = 0.024, odds ratio [OR] = 3.52) and Ile alleles (11% vs. 2%, P = 0.009, OR = 4.738) in disseminated cysticercosis was high. Albendazole resulted in complete disappearance of all cerebral lesions in 35% (7/20) patients and reduction in lesion load in remaining 65% (13/20) patients. No significant change in number of cysticercal lesion was noted in patients who did not receive albendazole. No major adverse reaction following antiparasitic treatment was noted. Three deaths were recorded in patients who did not receive antiparasitic treatment. Of the 56 cases reported in PubMed, 33 patients received antiparasitic treatment with follow-up data available for 31 patients. Most (24) of these patients received albendazole. A significant clinical and/or imaging improvements, on follow up, were observed in

  13. Association of toll-like receptor 4 polymorphisms with type 2 diabetes mellitus.

    PubMed

    Jiang, Zhao-Shun; Wang, Su-Xia; Jia, Hong-Xia; Wang, Jing; Liu, Yuan-Tao

    2013-02-01

    Type 2 diabetes mellitus (T2DM) is characterized by a chronic low-grade inflammatory state. Toll-like receptor 4 (TLR4) is a critical mediator of innate immunity. Polymorphisms in TLR4 gene have been shown to be associated with impaired inflammatory response. Here, we investigated the association of TLR4 polymorphisms with T2DM. Four TLR4 polymorphisms (+986A/G, +1196C/T, +3725G/C, and +11367G/C) were genotyped in a total number of 822 T2DM patients and 835 healthy controls. Results showed that the +986A/G and +1196C/T polymorphisms did not exist in the Han Chinese population. The prevalence of TLR4 +3725GC and CC genotypes were significantly decreased in T2DM cases than in controls (odds ratio (OR) = 0.62, 95 % confidence interval (CI) = 0.50-0.78, p = 3.48 × 10(-5), and OR = 0.36, 95 % CI = 0.22-0.59, p = 1.55 × 10(-5), respectively). Also, the frequency of TLR4 +3725C allele was significantly lower in T2DM patients (p = 2.46 × 10(-9)). When analyzing the TLR4 +11367G/C polymorphism, the +11367CC genotype revealed lower numbers in patients compared to healthy controls (OR = 0.46, 95 % CI = 0.27-0.78, p = 0.0032). Analysis of the clinical features on the control subjects demonstrated no correlations between these TLR4 polymorphisms and sex, age, body mass index, etc. (p > 0.05). In conclusion, these data indicate that TLR4 +3725G/C and +11367G/C polymorphisms may be novel protective factors against T2DM in the Chinese population.

  14. Human GluR6 kainate receptor (GRIK2): Molecular cloning, expression, polymorphism, and chromosomal assignment

    SciTech Connect

    Paschen, W.; Blackstone, C.D.; Huganir, R.L. ); Ross, C.A. Max-Planck-Institute for Neurological Research, Koeln )

    1994-04-01

    Glutamate receptors mediate the majority of excitatory neurotransmission in the brain, and molecular cloning studies have revealed several distinct families. Because neuropathological states and possibly human disorders may involve kainate-preferring glutamate receptors, the authors have isolated a cDNA clone for the human GluR6 kainate-preferring receptor. This clone shows a very high sequence similarity with that of the rat, except for a part of the 3[prime] untranslated region in which there is a TAA triplet repeat. When the protein was overexpressed in human embryonic kidney 293 cells, it had a molecular weight, an antibody recognition, and a glutamate ligand-binding profile similar to those of the rate GluR6 receptor. Northern analysis showed expression in both human cerebral and cerebellar cortices. By PCR analysis of rodent-human monochromosomal cell lines, the human GluR6 could be assigned to chromosome 6. The length of the TAA triplet repeat was polymorphic in the normal population, with at least four alleles and an observed heterozygosity of about 45%. These studies should provide the basis for expression or linkage studies of the GluR6 kainate receptor in human disease or neuropathologic states. 53 refs., 7 figs.

  15. Polymorphism analysis in estrogen receptors alpha and beta genes and their association with infertile population in Pakistan

    PubMed Central

    Liaqat, Sinha; Hasnain, Shahida; Muzammil, Saima; Hayat, Sumreen

    2015-01-01

    Studies on polymorphism of estrogen receptor (ESR) alpha and beta genes have been mostly implicated in infertility, but the results have been controversial due to lack of comprehensive data. The present study focused on association of ESR genes with both male and female infertility. In ESRα, PvuII (rs2234693) and XbaI (rs9340799) were studied while in ESRβ gene, risk of infertility was determined for silent G/A RsaI (rs1256049) polymorphism. Total 124 subjects (74 cases and 50 controls) were part of this study having primary infertility. Restriction fragment length polymorphism (RFLP) was performed with PvuII, XbaI and RsaI to determine polymorphism. Correlation between age and follicle stimulating hormone (FSH) of cases and controls was determined and no association was found between infertility and FSH hormone. Heterozygous AG genotype of XbaI polymorphism (P= 2.505e-06) and heterozygous TC genotype (P= 0.00003) in PvuII polymorphism were strongly associated with risk of infertility. In ESRβ gene, there was lack of polymorphism for RsaI in our population as all subjects were homozygous (GG). Haplotype frequencies showed that XbaI and PvuII polymorphisms are in strong linkage disequilibrium. This study shows that in our population XbaI and PvuII polymorphisms of ESRα are associated with risk of infertility. PMID:27065769

  16. Epidermal growth factor receptor gene polymorphisms are associated with prognostic features of breast cancer

    PubMed Central

    2014-01-01

    Background The epidermal growth factor receptor (EGFR) is differently expressed in breast cancer, and its presence may favor cancer progression. We hypothesized that two EGFR functional polymorphisms, a (CA)n repeat in intron 1, and a single nucleotide polymorphism, R497K, may affect EGFR expression and breast cancer clinical profile. Methods The study population consisted of 508 Brazilian women with unilateral breast cancer, and no distant metastases. Patients were genotyped for the (CA)n and R497K polymorphisms, and the associations between (CA)n polymorphism and EGFR transcript levels (n = 129), or between either polymorphism and histopathological features (n = 505) were evaluated. The REMARK criteria of tumor marker evaluation were followed. Results (CA)n lengths ranged from 14 to 24 repeats, comprehending 11 alleles and 37 genotypes. The most frequent allele was (CA)16 (0.43; 95% CI = 0.40–0.46), which was set as the cut-off length to define the Short allele. Variant (CA)n genotypes had no significant effect in tumoral EGFR mRNA levels, but patients with two (CA)n Long alleles showed lower chances of being negative for progesterone receptor (ORadjusted = 0.42; 95% CI = 0.19–0.91). The evaluation of R497K polymorphism indicated a frequency of 0.21 (95% CI = 0.19 – 0.24) for the variant (Lys) allele. Patients with variant R497K genotypes presented lower proportion of worse lymph node status (pN2 or pN3) when compared to the reference genotype Arg/Arg (ORadjusted = 0.32; 95% CI = 0.17–0.59), which resulted in lower tumor staging (ORadjusted = 0.34; 95% CI = 0.19-0.63), and lower estimated recurrence risk (OR = 0.50; 95% CI = 0.30-0.81). The combined presence of both EGFR polymorphisms (Lys allele of R497K and Long/Long (CA)n) resulted in lower TNM status (ORadjusted = 0.22; 95% CI = 0.07-0.75) and lower ERR (OR = 0.25; 95% CI = 0.09-0.71). When tumors were stratified according to biological

  17. Single nucleotide polymorphisms of Toll-like receptors and susceptibility to infectious diseases

    PubMed Central

    Skevaki, C; Pararas, M; Kostelidou, K; Tsakris, A; Routsias, J G

    2015-01-01

    Toll-like receptors (TLRs) are the best-studied family of pattern-recognition receptors (PRRs), whose task is to rapidly recognize evolutionarily conserved structures on the invading microorganisms. Through binding to these patterns, TLRs trigger a number of proinflammatory and anti-microbial responses, playing a key role in the first line of defence against the pathogens also promoting adaptive immunity responses. Growing amounts of data suggest that single nucleotide polymorphisms (SNPs) on the various human TLR proteins are associated with altered susceptibility to infection. This review summarizes the role of TLRs in innate immunity, their ligands and signalling and focuses on the TLR SNPs which have been linked to infectious disease susceptibility. PMID:25560985

  18. Receptor Polymorphism and Genomic Structure Interact to Shape Bitter Taste Perception

    PubMed Central

    Roudnitzky, Natacha; Behrens, Maik; Engel, Anika; Kohl, Susann; Thalmann, Sophie; Hübner, Sandra; Lossow, Kristina; Wooding, Stephen P.; Meyerhof, Wolfgang

    2015-01-01

    The ability to taste bitterness evolved to safeguard most animals, including humans, against potentially toxic substances, thereby leading to food rejection. Nonetheless, bitter perception is subject to individual variations due to the presence of genetic functional polymorphisms in bitter taste receptor (TAS2R) genes, such as the long-known association between genetic polymorphisms in TAS2R38 and bitter taste perception of phenylthiocarbamide. Yet, due to overlaps in specificities across receptors, such associations with a single TAS2R locus are uncommon. Therefore, to investigate more complex associations, we examined taste responses to six structurally diverse compounds (absinthin, amarogentin, cascarillin, grosheimin, quassin, and quinine) in a sample of the Caucasian population. By sequencing all bitter receptor loci, inferring long-range haplotypes, mapping their effects on phenotype variation, and characterizing functionally causal allelic variants, we deciphered at the molecular level how a subjects’ genotype for the whole-family of TAS2R genes shapes variation in bitter taste perception. Within each haplotype block implicated in phenotypic variation, we provided evidence for at least one locus harboring functional polymorphic alleles, e.g. one locus for sensitivity to amarogentin, one of the most bitter natural compounds known, and two loci for sensitivity to grosheimin, one of the bitter compounds of artichoke. Our analyses revealed also, besides simple associations, complex associations of bitterness sensitivity across TAS2R loci. Indeed, even if several putative loci harbored both high- and low-sensitivity alleles, phenotypic variation depended on linkage between these alleles. When sensitive alleles for bitter compounds were maintained in the same linkage phase, genetically driven perceptual differences were obvious, e.g. for grosheimin. On the contrary, when sensitive alleles were in opposite phase, only weak genotype-phenotype associations were

  19. Cdx2 Polymorphism Affects the Activities of Vitamin D Receptor in Human Breast Cancer Cell Lines and Human Breast Carcinomas

    PubMed Central

    Di Benedetto, Anna; Korita, Etleva; Goeman, Frauke; Sacconi, Andrea; Biagioni, Francesca; Blandino, Giovanni; Strano, Sabrina; Muti, Paola; Mottolese, Marcella; Falvo, Elisabetta

    2015-01-01

    Vitamin D plays a role in cancer development and acts through the vitamin D receptor (VDR). It regulates the action of hormone responsive genes and is involved in cell cycle regulation, differentiation and apoptosis. VDR is a critical component of the vitamin D pathway and different common single nucleotide polymorphisms have been identified. Cdx2 VDR polymorphism can play an important role in breast cancer, modulating the activity of VDR. The objective of this study is to assess the relationship between the Cdx2 VDR polymorphism and the activities of VDR in human breast cancer cell lines and carcinomas breast patients. Cdx2 VDR polymorphism and antiproliferative effects of vitamin D treatment were investigated in a panel of estrogen receptor-positive (MCF7 and T-47D) and estrogen receptor-negative (MDA-MB-231, SUM 159PT, SK-BR-3, BT549, MDA-MB-468, HCC1143, BT20 and HCC1954) human breast cancer cell lines. Furthermore, the potential relationship among Cdx2 VDR polymorphism and a number of biomarkers used in clinical management of breast cancer was assessed in an ad hoc set of breast cancer cases. Vitamin D treatment efficacy was found to be strongly dependent on the Cdx2 VDR status in ER-negative breast cancer cell lines tested. In our series of breast cancer cases, the results indicated that patients with variant homozygote AA were associated with bio-pathological characteristics typical of more aggressive tumours, such as ER negative, HER2 positive and G3. Our results may suggest a potential effect of Cdx2 VDR polymorphism on the efficacy of vitamin D treatment in aggressive breast cancer cells (estrogen receptor negative). These results suggest that Cdx2 polymorphism may be a potential biomarker for vitamin D treatment in breast cancer, independently of the VDR receptor expression. PMID:25849303

  20. Cdx2 polymorphism affects the activities of vitamin D receptor in human breast cancer cell lines and human breast carcinomas.

    PubMed

    Pulito, Claudio; Terrenato, Irene; Di Benedetto, Anna; Korita, Etleva; Goeman, Frauke; Sacconi, Andrea; Biagioni, Francesca; Blandino, Giovanni; Strano, Sabrina; Muti, Paola; Mottolese, Marcella; Falvo, Elisabetta

    2015-01-01

    Vitamin D plays a role in cancer development and acts through the vitamin D receptor (VDR). It regulates the action of hormone responsive genes and is involved in cell cycle regulation, differentiation and apoptosis. VDR is a critical component of the vitamin D pathway and different common single nucleotide polymorphisms have been identified. Cdx2 VDR polymorphism can play an important role in breast cancer, modulating the activity of VDR. The objective of this study is to assess the relationship between the Cdx2 VDR polymorphism and the activities of VDR in human breast cancer cell lines and carcinomas breast patients. Cdx2 VDR polymorphism and antiproliferative effects of vitamin D treatment were investigated in a panel of estrogen receptor-positive (MCF7 and T-47D) and estrogen receptor-negative (MDA-MB-231, SUM 159PT, SK-BR-3, BT549, MDA-MB-468, HCC1143, BT20 and HCC1954) human breast cancer cell lines. Furthermore, the potential relationship among Cdx2 VDR polymorphism and a number of biomarkers used in clinical management of breast cancer was assessed in an ad hoc set of breast cancer cases. Vitamin D treatment efficacy was found to be strongly dependent on the Cdx2 VDR status in ER-negative breast cancer cell lines tested. In our series of breast cancer cases, the results indicated that patients with variant homozygote AA were associated with bio-pathological characteristics typical of more aggressive tumours, such as ER negative, HER2 positive and G3. Our results may suggest a potential effect of Cdx2 VDR polymorphism on the efficacy of vitamin D treatment in aggressive breast cancer cells (estrogen receptor negative). These results suggest that Cdx2 polymorphism may be a potential biomarker for vitamin D treatment in breast cancer, independently of the VDR receptor expression.

  1. The role of vitamin D receptor gene polymorphisms in Turkish infants with urolithiasis.

    PubMed

    Goknar, Nilufer; Öktem, Faruk; Torun, Emel; Gok, Ozlem; Demir, Aysegul Dogan; Kucukkoc, Mehmet; Kilic, Ulkan

    2016-01-01

    Polymorphisms in the vitamin D receptor (VDR) gene have recently been reported to be associated with urinary calculi in pediatric and adult cases, but no studies have looked at the youngest period of life. The purpose of this study was to investigate the role of VDR gene polymorphisms in infantile urolithiasis in a Turkish population. We compared a study group of 104 infants (55 girls and 49 boys, mean age 6.94 ± 3.81 months) with a control group of 96 infants (51 girls and 45 boys, mean age 7.51 ± 3.23) to evaluate their demographics and metabolic risk factors. PCR-based restriction analysis of the polymorphisms on the VDR gene (BsmI and TaqI) showed statistically significant differences between study and control groups (p = 0.001 and 0.043, respectively). In addition, the prevalence of the BsmI genotype was significantly different between the hypercalciuric and normocalciuric stone formers (p = 0.007). Allelic frequencies were similar between the urolithiasis and control groups (p > 0.05). The B allele of BsmI and the A allele of ApaI were more prevalent in the hypercalciuric stone formers than in the normocalciuric stone formers (p = 0.018 vs.0.036, respectively). These results suggest that the BsmI and TaqI VDR genotypes could be candidate genes leading to infantile urolithiasis.

  2. Uremic Pruritus Is Not Associated with Endocannabinoid Receptor 1 Gene Polymorphisms

    PubMed Central

    Heisig, Monika; Łaczmański, Łukasz; Reich, Adam; Lwow, Felicja

    2016-01-01

    Uremic pruritus (UP) is a frequent and bothersome symptom in hemodialysis patients. Its etiology is not fully understood and that is why there is no specific treatment. The endocannabinoid system plays a role in many pathological conditions. There is reliable evidence on the association between cannabinoid system and pruritus. In our study, we aimed to evaluate whether genetic variations in the endocannabinoid receptor 1 (CNR1) gene can affect UP. The rs12720071, rs806368, rs1049353, rs806381, rs10485170, rs6454674, and rs2023239 polymorphisms of the CNR1 gene were genotyped in 159 hemodialysis patients and 150 healthy controls using two multiplex polymerase chain reactions and the minisequencing technique. No statistically significant relationship was found in any of the evaluated genotypes between patients with and without UP, even after excluding patients with diabetes and dyslipidemia. There were no differences between patients with UP and the control group. However, in the group of all HD patients, a significantly higher incidence of GA genotype and lower incidence in GG genotype in the polymorphism rs806381s were revealed versus the control group (p = 0.04). It seems that polymorphisms of the CNR1 gene are not associated with uremic pruritus. PMID:27034934

  3. Genetic polymorphism of chemokine receptors CCR2 and CCR5 in Swedish cervical cancer patients.

    PubMed

    Zheng, Biying; Wiklund, Fredrik; Gharizadeh, Baback; Sadat, Mehdi; Gambelunghe, Giovanni; Hallmans, Göran; Dillner, Joakim; Wallin, Keng-Ling; Ghaderi, Mehran

    2006-01-01

    Chemokines are chemotactic cytokines that orchestrate leukocyte trafficking in tissues, thus, playing an important role in regulation of immunological processes. The aim of this study was to investigate the association of human papillomavirus (HPV) infection and cervical cancer with two DNA polymorphisms of the chemokine receptors CCR5-delta32 and CCR2-64I. The study material consisted of 50 cervical intraepithelial neoplasia (CIN) cases and 50 of age and sampling-date matched controls, 100 invasive cervix cancer cases and 100 of their corresponding matched disease-free controls. Pyrosequencing was employed to genotype the CCR2-64I polymorphism. CCR5-delta32 was genotyped using standard PCR fragment length analysis. The frequencies of CCR2 and CCR5 genotypes from 150 patients and 150 healthy controls were representative of the general population according to the Hardy-Weinberg equilibrium analysis. Risk association was computed with conditional logistic regression analysis. HPV-positive individuals with the rare CCR5deelta32/delta32 genotype have a risk of 4.58 (CI = 0.40-52.64, p-value = 0.045) compare to HPV negative group. The delta-32 mutation on the CCR locus is imperceptibly associated with increased risk of HPV infection. In total, cervical neoplasia was not associated with genetic polymorphism of CCR2 and CCR5.

  4. Polymorphisms in the vitamin D receptor and risk of gout in Chinese Han male population.

    PubMed

    Liu, Shi-guo; Li, Yuan-yuan; Sun, Rui-xia; Wang, Jing-li; Li, Xin-de; Han, Lin; Chu, Nan; Li, Chang-gui

    2015-06-01

    Previous studies have showed that patients with gout showed lower serum 25(OH)D levels. As the specific receptor of vitamin D, VDR plays an important role in regulating immune system by combining with vitamin D. In this study, we investigated whether the functional VDR polymorphisms were associated with susceptibility to gout in Chinese Han male population. A total of 504 patients with gout and 523 gout-free controls were recruited from the Affiliated Hospital of the Medical College, Qingdao University. Genotyping of VDR rs11568820, rs2228570 and rs1544410 was performed by TaqMan allele discrimination assays. An association analysis was carried out using the χ(2) test. A genotype-phenotype analysis was also conducted. Our results showed that polymorphisms of rs11568820 and rs1544410 in VDR were associated with gout in Chinese Han male population. The A allele of both rs11568820 and rs1544410 was associated with the risk of gout [P = 0.012 OR 1.251, 95% CI (1.051-1.490); P = 0.006, OR 1.574, 95% CI (1.139-2.175)]. However, there was no statistic significance between rs2228570 and gout (P = 0.186). Our study suggested that the polymorphisms of VDR may be relevant host susceptibility factors for the development of gout in Chinese Han male population. However, further study should be done in a larger size sample and other ethic to test and verify our result.

  5. Effect of glucocorticoid receptor gene polymorphisms in Guillain-Barré syndrome.

    PubMed

    Dekker, Marieke J H J; van den Akker, Erica L T; Koper, Jan Willem; Manenschijn, Laura; Geleijns, Karin; Ruts, Liselotte; van Rijs, Wouter; Tio-Gillen, Anne P; van Doorn, Pieter A; Lamberts, Steven W J; Jacobs, Bart C

    2009-06-01

    Guillain-Barré syndrome (GBS) is a postinfectious immune-mediated polyneuroradiculopathy in which host factors influence disease susceptibility and clinical course. Single-nucleotide polymorphisms (SNPs) in the glucocorticoid receptor (GR) gene influence the sensitivity to glucocorticoids and are related to both microbial colonization and susceptibility to develop auto-immune disease. This genetic variation may therefore also influence the chance to develop GBS. In this study, we genotyped 318 GBS patients and 210 control subjects for five known SNPs in the GR gene. We could distinguish six different GR haplotypes of which two carried the BclI polymorphism: haplotype 1, which consists of the minor allele of BclI in combination with the common variant of TthIIII and haplotype 2, which carries the minor allele of BclI as well as the minor allele of TthIIII. The GR haplotypes were not related to susceptibility to develop GBS. Carriers of haplotype 2 had more frequently preceding diarrhea, serum antibodies to GM1 and GD1a, and more severe muscle weakness at entry. Haplotype 1 carriers had a significantly better prognosis. In conclusion, GR haplotypes are not a susceptibility factor for GBS. However, haplotypes carrying the minor allele of the BclI polymorphism were related to the phenotype and outcome of GBS.

  6. Vitamin D receptor gene FokI polymorphisms influence bone mass in adolescent football (soccer) players.

    PubMed

    Diogenes, Maria Eduarda L; Bezerra, Flávia Fioruci; Cabello, Giselda M K; Cabello, Pedro H; Mendonça, Laura M C; Oliveira Júnior, Astrogildo V; Donangelo, Carmen M

    2010-01-01

    The genetic influence on bone mineralization during adolescence is unclear possibly due to modifying factors such as skeletal maturation and lifestyle. We evaluated the influence of polymorphisms of the vitamin D receptor (VDR) gene on longitudinal changes in bone mass, bone- and calcium-related hormones in 46 adolescent soccer players (11.8-14.2 years). Total body bone mineral content (TBMC) and density (TBMD) were measured at baseline and after 6 months. Insulin-like growth factor-I (IGF-1), testosterone, intact parathyroid hormone, and activity of plasma bone alkaline phosphatase were measured at baseline and after 3 months. The influence of FokI or TaqI VDR genotypes on changes in the outcome variables were analyzed by univariate ANOVA with adjustment for chronological age, skeletal age and body weight at baseline. At baseline, boys with Ff genotype had higher TBMC, TBMD, TBMD Z-score compared to those with FF genotype (P < 0.05). After 3 months, Ff boys also had higher increment in plasma IGF-1 (P < 0.05). FokI polymorphism did not influence changes in bone mass measurements after 6 months, although differences detected at baseline remained significant after 6 months. There were no differences in the outcome variables according to TaqI genotypes. This study demonstrates that FokI polymorphisms affect bone mass in Brazilian adolescent soccer players and suggests that the FokI effect on bone mineralization occurs during bone maturation, possibly at the initial pubertal stages.

  7. Allergic rhinitis and genetic components: focus on Toll-like receptors (TLRs) gene polymorphism

    PubMed Central

    Gao, Zhiwei; Rennie, Donna C; Senthilselvan, Ambikaipakan

    2010-01-01

    Allergic rhinitis represents a global health issue affecting 10% to 25% of the population worldwide. Over the years, studies have found that allergic diseases, including allergic rhinitis, are associated with immunological responses to antigens driven by a Th2-mediated immune response. Because Toll-like receptors (TLRs) are involved in both innate and adaptive immune responses to a broad variety of antigens, the association between polymorphisms of TLRs and allergic diseases has been the focus in many animal and human studies. Although the etiology of allergic rhinitis is still unknown, extensive research over the years has confirmed that the underlying causes of allergic diseases are due to many genetic and environmental factors, along with the interactions among them, which include gene–environment, gene–gene, and environment–environment interactions. Currently, there is great inconsistency among studies mainly due to differences in genetic background and unique gene–environment interactions. This paper reviews studies focusing on the association between TLR polymorphisms and allergic diseases, including allergic rhinitis, which would help researchers better understand the role of TLR polymorphisms in the development of allergic rhinitis, and ultimately lead to more efficient therapeutic interventions being developed. PMID:23776356

  8. Association of Vitamin D Receptor Polymorphism with Susceptibility to Symptomatic Pertussis

    PubMed Central

    Han, Wanda G. H.; Hodemaekers, Hennie M.; Nagarajah, Bhawani; Poelen, Martien M. C.; Helm, Kina; Janssen, Riny; van Els, Cécile A. C. M.

    2016-01-01

    Pertussis, caused by infection with the gram negative B. pertussis bacterium, is a serious respiratory illness that can last for months. While B. pertussis infection rates are estimated between 1–10% in the general population, notifications of symptomatic pertussis only comprise 0.01–0.1% indicating that most individuals clear B. pertussis infections without developing (severe) clinical symptoms. In this study we investigated whether genetic risk factors are involved in the development of symptomatic pertussis upon B. pertussis infection. Single-nucleotide polymorphisms (SNPs) in candidate genes, MBL2, IL17A, TNFα, VDR, and IL10 were genotyped in a unique Dutch cohort of symptomatic clinically confirmed (ex-)pertussis patients and in a Dutch population cohort. Of the seven investigated SNPs in five genes, a polymorphism in the Vitamin D receptor (VDR) gene (rs10735810) was associated with pertussis. The VDR major allele and its homozygous genotype were more present in the symptomatic pertussis patient cohort compared to the control population cohort. Interestingly, the VDR major allele correlated also with the duration of reported pertussis symptoms. Vitamin D3 (VD3) and VDR are important regulators of immune activation. Altogether, these findings suggest that polymorphisms in the VDR gene may affect immune activation and the clinical outcome of B. pertussis infection. PMID:26894582

  9. Functional polymorphisms in Toll-like receptor genes for innate immunity in farm animals.

    PubMed

    Novák, Karel

    2014-01-15

    The exploitation of the genetic factors affecting the health status of farm animals represents an alternative approach to controlling the diseases caused by microbial pathogens. The determination of innate immunity based on the genotype of the germplasm cells is a constraint for specificity but becomes an advantage in breeding schemes. The structural deviations among Toll-like receptors (TLRs), as the most frequently studied innate immunity components, have been documented at all levels, i.e., interspecific, inter- and intravarietal, in the main farm species. The current computational methods facilitate the prediction of the functional consequences of the observed mutations. Subsequently, these predictions can be verified through immunological responsiveness and population-wide association studies. The frequency and haplotype grouping of individual polymorphisms are used to track the origin and selection coefficient as independent indicators of functional changes. The Toll-like receptor variants associated with mastitis and mycobacterial infection have been identified in cattle, consequently, the targeting of these proteins in breeding could contribute to disease control. The range of infections affected by TLR polymorphisms suggests that the improvement of innate resistance is feasible in more species. Thus, the traditional breeds and wild populations should be regarded as the resources of genetic variability accessible for these purposes.

  10. Influence of a critical single nucleotide polymorphism on nuclear receptor PXR-promoter function.

    PubMed

    Rana, Manjul; Coshic, Poonam; Goswami, Ravinder; Tyagi, Rakesh K

    2017-02-15

    The Pregnane and Xenobiotic Receptor (PXR; NR1I2) is a ligand-modulated transcription factor that belongs to the nuclear receptor superfamily. It is expressed at higher levels primarily in liver and intestine as compared to the levels in several other organs. It is activated by a broad spectrum of xenobiotics and endobiotics. The primary function of PXR is to regulate the expression of drug metabolizing enzymes and transporters and prevent the accumulation of toxic chemicals in the body, thereby maintaining body's homeostasis. In this study, we identified a C/T single nucleotide polymorphism at position -831 from the transcriptional start site of the PXR gene promoter and examined the functional significance of this variant using both the luciferase reporter gene assays and electrophoretic mobility shift assays (EMSA). Transient transfection experiments showed that the T-allele was associated with significantly greater transcriptional activity than the C-allele of SNP rs3814055. These results indicate that the -831C/T polymorphism has a direct effect on transcriptional regulation of PXR gene. This allelic variation may be a potential genetic marker that can help identify individuals at higher risk for Inflammatory Bowel Disease (IBD).

  11. Association studies on ghrelin and ghrelin receptor gene polymorphisms with obesity.

    PubMed

    Gueorguiev, Maria; Lecoeur, Cécile; Meyre, David; Benzinou, Michael; Mein, Charles A; Hinney, Anke; Vatin, Vincent; Weill, Jacques; Heude, Barbara; Hebebrand, Johannes; Grossman, Ashley B; Korbonits, Márta; Froguel, Philippe

    2009-04-01

    Ghrelin exerts a stimulatory effect on appetite and regulates energy homeostasis. Ghrelin gene variants have been shown to be associated with metabolic traits, although there is evidence suggesting linkage and association with obesity and the ghrelin receptor (GHSR). We hypothesized that these genes are good candidates for susceptibility to obesity. Direct sequencing identified 12 ghrelin single-nucleotide polymorphisms (SNPs) and 8 GHSR SNPs. The 10 common SNPs were genotyped in 1,275 obese subjects and in 1,059 subjects from a general population cohort of European origin. In the obesity case-control study, the GHSR SNP rs572169 was found to be associated with obesity (P = 0.007 in additive model, P = 0.001 in dominant model, odds ratio (OR) 1.73, 95% confidence interval (1.23-2.44)). The ghrelin variant, g.A265T (rs4684677), showed an association with obesity (P = 0.009, BMI adjusted for age and sex) in obese families. The ghrelin variant, g.A-604G (rs27647), showed an association with insulin levels at 2-h post-oral glucose tolerance test (OGTT) (P = 0.009) in obese families. We found an association between the eating behavior "overeating" and the GHSR SNP rs2232169 (P = 0.02) in obese subjects. However, none of these associations remained significant when corrected for multiple comparisons. Replication of the nominal associations with obesity could not be confirmed in a German genome-wide association (GWA) study for rs4684677 and rs572169 polymorphisms. Our data suggest that common polymorphisms in ghrelin and its receptor genes are not major contributors to the development of polygenic obesity, although common variants may alter body weight and eating behavior and contribute to insulin resistance, in particular in the context of early-onset obesity.

  12. Dopamine D1 receptor (DRD1) genetic polymorphism: pleiotropic effects on heritable renal traits

    PubMed Central

    Fung, Maple M.; Rana, Brinda K.; Tang, Chih-Min; Shiina, Tetsuo; Nievergelt, Caroline M.; Rao, Fangwen; Salem, Rany M.; Waalen, Jill; Ziegler, Michael G.; Insel, Paul A.; O'Connor, Daniel T.

    2009-01-01

    Because dopamine D1 receptors (DRD1) influence renal sodium transport and vascular hemodynamics, we examined whether genetic polymorphisms play a role in renal function. We conducted polymorphism discovery across the DRD1 open reading frame and its 5′-UTR and then performed association studies with estimated glomerular filtration rate (eGFR), plasma creatinine (pCr), and fractional excretion of uric acid (FeUA). We used a twin/family group of 428 subjects from 195 families and a replication cohort of 677 patients from the Kaiser health-care organization sampled from the lower percentiles of diastolic blood pressures. Although the coding region lacked common non-synonymous variants, we identified two polymorphisms in the DRD1 5′-UTR (G-94A, A-48G) that occurred with frequencies of 15 and 30%, respectively. In the twin/family study, renal traits were highly heritable, such that DRD1 G-94A significantly associated with eGFR, pCr, and FeUA. Homozygotes for the G-94A minor allele (A/A) exhibited lower eGFR, higher pCr, and lower FeUA. No effects were noted for DRD1 A-48G. Patients in the Kaiser group had similar effects of G-94A on eGFR and pCr. Kidney cells transfected with the -94A variant but not the wild type vectors had increased receptor density. Because the -94A allele is common and may reduce glomerular capillary hydrostatic pressure, G-94A profiling may aid in predicting survival of renal function in patients with progressive renal disease. PMID:19675531

  13. Antisocial behavior and polymorphisms in the oxytocin receptor gene: findings in two independent samples.

    PubMed

    Hovey, D; Lindstedt, M; Zettergren, A; Jonsson, L; Johansson, A; Melke, J; Kerekes, N; Anckarsäter, H; Lichtenstein, P; Lundström, S; Westberg, L

    2016-07-01

    The quantitative genetic contribution to antisocial behavior is well established, but few, if any, genetic variants are established as risk factors. Emerging evidence suggests that the neuropeptide oxytocin (OXT) may modulate interpersonal aggression. We here investigated whether single-nucleotide polymorphisms (SNPs) in the OXT receptor gene (OXTR) are associated with the expression of antisocial behavior. A discovery sample, including both sexes, was drawn from the Child and Adolescent Twin Study in Sweden (CATSS; n=2372), and a sample from the Twin Study of Child and Adolescent Development (TCHAD; n=1232) was used for replication. Eight SNPs in OXTR, selected on previous associations with social and antisocial behavior, were genotyped in the participants of CATSS. Significant polymorphisms were subsequently genotyped in TCHAD for replication. Participants completed self-assessment questionnaires-Life History of Aggression (LHA; available only in CATSS), and Self-Reported Delinquency (SRD; available in both samples)-designed to capture antisocial behavior as continuous traits. In the discovery sample, the rs7632287 AA genotype was associated with higher frequency of antisocial behavior in boys, and this was then replicated in the second sample. In particular, overt aggression (directly targeting another individual) was strongly associated with this genotype in boys (P=6.2 × 10(-7) in the discovery sample). Meta-analysis of the results for antisocial behavior from both samples yielded P=2.5 × 10(-5). Furthermore, an association between rs4564970 and LHA (P=0.00013) survived correction in the discovery sample, but there was no association with the SRD in the replication sample. We conclude that the rs7632287 and rs4564970 polymorphisms in OXTR may independently influence antisocial behavior in adolescent boys. Further replication of our results will be crucial to understanding how aberrant social behavior arises, and would support the OXT receptor as one

  14. μ-Opioid Receptor Gene A118G Polymorphism Predicts Survival in Patients with Breast Cancer

    PubMed Central

    Bortsov, Andrey V.; Millikan, Robert C.; Belfer, Inna; Boortz-Marx, Richard L.; Arora, Harendra; McLean, Samuel A.

    2012-01-01

    Background Preclinical studies suggest that opioids may promote tumor growth. Genetic polymorphisms have been shown to affect opioid receptor function and to modify the clinical effects of morphine. In this study we assessed the association between six common polymorphisms in the μ-opioid receptor gene, including the well known A118G polymorphism, and breast cancer survival. Methods A total of 2,039 women ages 23–74 yr (38% African American, 62% European American, 55% postmenopausal) diagnosed with breast cancer between 1993 – 2001 were followed through 2006. Genotyping was performed using the TaqMan platform (Applied Biosystems Inc., Foster City, CA). Kaplan-Meyer curves, log-rank tests, and Cox proportional hazard models were used to examine the association between each genotype and survival. Results After Bonferroni adjustment for multiple testing, patient genotype at A118G was associated with breast cancer-specific mortality at 10 yr. Women with one or more copies of the G allele had decreased breast cancer-specific mortality (p < .001). This association was limited to invasive cases only; effect size appeared to increase with clinical stage. Cox regression model adjusted for age and ethnicity also showed decreased mortality in A/G and G/G genotypes compared to A/A genotype (hazard ratio = 0.57 [0.38, 0.85] and 0.32 [0.22, 0.49], respectively; p = .006). Conclusions These results suggest that opioid pathways may be involved in tumor growth. Further studies examining the association between genetic variants influencing opioid system function and cancer survival are warranted. PMID:22433205

  15. Serotonin 2A Receptor Gene Polymorphism in Korean Children with Attention-Deficit/Hyperactivity Disorder

    PubMed Central

    Cho, Soo-Churl; Kim, Boong-Nyun; Kim, Jae-Won; Yoo, Hee-Jeong; Hwang, Jun-Won; Cho, Dae-Yeon; Chung, Un-Sun; Park, Tae-Won

    2012-01-01

    Objective The purpose of this study was to investigate the association between the T102C polymorphism in the serotonin 2A receptor gene and attention-deficit/hyperactivity disorder (ADHD) in Korean patients. Methods A total of 189 Korean children with ADHD as well as both parents of the ADHD children and 150 normal children participated in this study. DNA was extracted from blood samples from all of the subjects, and genotyping was conducted. Based on the allele and genotype information obtained, case-control analyses were performed to compare the ADHD and normal children, and Transmission disequilibrium tests (TDTs) were used for family-based association testing (number of trios=113). Finally, according to the significant finding which was showed in the case-control analyses, the results of behavioral characterastics and neuropsychological test were compared between ADHD children with and without the C allele. Results In the case-control analyses, statistically significant differences were detected in the frequencies of genotypes containing the C allele (χ2=4.73, p=0.030). In the family-based association study, TDTs failed to detect linkage disequilibrium of the T102C polymorphism associated with ADHD children. In the ADHD children, both the mean reaction time and the standard deviation of the reaction time in the auditory continuous performance test were longer in the group with the C allele compared to the group without the C allele. Conclusion The results of this study suggest that there is a significant genetic association between the T102C polymorphism in the serotonin 2A receptor gene and ADHD in Korean children. PMID:22993527

  16. Polymorphisms of genes encoding interleukin-4 and its receptor in Iranian patients with juvenile idiopathic arthritis.

    PubMed

    Ziaee, Vahid; Rezaei, Arezou; Harsini, Sara; Maddah, Marzieh; Zoghi, Samaneh; Sadr, Maryam; Moradinejad, Mohammad Hassan; Rezaei, Nima

    As cytokines, including interleukin-4 (IL-4), seem to have a pivotal role in the pathogenesis of juvenile idiopathic arthritis (JIA), this study is aimed at investigating of association of polymorphisms in IL-4 and IL-4 receptor α (IL-4RA) genes with susceptibility to JIA. A case-control study was conducted on 53 patients with JIA and 139 healthy unrelated controls. Single nucleotide polymorphisms of IL-4 gene at positions -1098, -590, and -33, as well as IL-4RA gene at position +1902 were genotyped using polymerase chain reaction with sequence-specific primers method and compared between patients and healthy individuals. At the allelic level, C allele at IL-4 -33 was found to be more frequent in patients compared to control (P value <0.01). At the genotypic level, CC genotype at IL-4 -590 (P value <0.01), together with CC and TT genotypes at IL-4 -33 (P value <0.01), were significantly higher in patients with JIA, while TC genotypes at IL-4 -590 and -33 positions were found to be lower in case group (P value <0.01). At the haplotypic level, IL-4 (positions -1098, -509, -33) TTC, GCC, and TTT haplotypes were significantly lower than controls (P value <0.01, P value = 0.03, and P value = 0.04, respectively). Although, TCC haplotype at the same positions was found to be higher in patients (P value <0.01). Polymorphic site of +1902 IL-4RA gene did not differ between cases and controls. Polymorphisms in promoter region of IL-4 but not IL-4RA genes confer susceptibility to JIA and may predispose individuals to adaptive immune responses.

  17. Post-bronchiolitis wheezing is associated with toll-like receptor 9 rs187084 gene polymorphism

    PubMed Central

    Nuolivirta, Kirsi; Törmänen, Sari; Teräsjärvi, Johanna; Vuononvirta, Juho; Koponen, Petri; Korppi, Matti; Helminen, Merja; Peltola, Ville; He, Qiushui

    2016-01-01

    Innate immunity receptors play a critical role in host defence, as well as in allergy and asthma. The aim of this exploratory study was to evaluate whether there are associations between TLR7 rs179008, TLR8 rs2407992, TLR9 rs187084 or TLR10 rs4129009 polymorphisms and viral findings, clinical characteristics or subsequent wheezing in infants with bronchiolitis. In all, 135 full-term infants were hospitalized for bronchiolitis at age less than 6 months: 129 of them were followed-up until the age of 1.5 years. The outcome measures were repeated wheezing, use of inhaled corticosteroids, atopic dermatitis during the first 1.5 years of life and total serum immunoglobulin E (IgE). There were no significant associations between the genotypes or allele frequencies of TLR7 rs179008, TLR8 rs2407992, TLR9 rs187084 or TLR10 rs4129009 polymorphisms and clinical characteristics or the severity of bronchiolitis during hospitalization. During follow-up, repeated wheezing was more common in children with TLR9 rs187084 variant genotype CC (30.5%) than in children with TLR9 wild-type genotype TT (12.2%) (p = 0.02, aOR 2.73, 95% CI 1.02–7.29). The TLR10 rs4129009 minor allele G was associated with elevated total serum IgE. TLR9 rs187084 gene polymorphism may be associated with post-bronchiolitis wheezing, and TLR10 rs4129009 gene polymorphism may be associated with atopy. PMID:27498757

  18. Inter- and intraspecies polymorphisms in the cholecystokinin-B/gastrin receptor alter drug efficacy.

    PubMed

    Kopin, A S; McBride, E W; Gordon, M C; Quinn, S M; Beinborn, M

    1997-09-30

    The brain cholecystokinin-B/gastrin receptor (CCK-BR) is a major target for drug development because of its postulated role in modulating anxiety, memory, and the perception of pain. Drug discovery efforts have resulted in the identification of small synthetic molecules that can selectively activate this receptor subtype. These drugs include the peptide-derived compound PD135,158 as well as the nonpeptide benzodiazepine-based ligand, L-740,093 (S enantiomer). We now report that the maximal level of receptor-mediated second messenger signaling that can be achieved by these compounds (drug efficacy) markedly differs among species homologs of the CCK-BR. Further analysis reveals that the observed differences in drug efficacy are in large part explained by single or double aliphatic amino acid substitutions between respective species homologs. This interspecies variability in ligand efficacy introduces the possibility of species differences in receptor-mediated function, an important consideration when selecting animal models for preclinical drug testing. The finding that even single amino acid substitutions can significantly affect drug efficacy prompted us to examine ligand-induced signaling by a known naturally occurring human CCK-BR variant (glutamic acid replaced by lysine in position 288; 288E --> K). When examined using the 288E --> K receptor, the efficacies of both PD135,158 and L-740, 093 (S) were markedly increased compared with values obtained with the wild-type human protein. These observations suggest that functional variability resulting from human receptor polymorphisms may contribute to interindividual differences in drug effects.

  19. Functional Impact of 14 Single Nucleotide Polymorphisms Causing Missense Mutations of Human α7 Nicotinic Receptor.

    PubMed

    Zhang, Qinhui; Du, Yingjie; Zhang, Jianliang; Xu, Xiaojun; Xue, Fenqin; Guo, Cong; Huang, Yao; Lukas, Ronald J; Chang, Yongchang

    2015-01-01

    The α7nicotinic receptor (nAChR) is a major subtype of the nAChRs in the central nervous system, and the receptor plays an important role in brain function. In the dbSNP database, there are 55 single nucleotide polymorphisms (SNPs) that cause missense mutations of the human α7nAChR in the coding region. In this study, we tested the impact of 14 SNPs that cause missense mutations in the agonist binding site or the coupling region between binding site and channel gate on the receptor function. The wild type or mutant receptors were expressed or co-expressed in Xenopus oocytes, and the agonist-induced currents were tested using two-electrode voltage clamp. Our results demonstrated that 6 mutants were nonfunctional, 4 mutants had reduced current expression, and 1 mutants altered ACh and nicotine efficacy in the opposite direction, and one additional mutant had slightly reduced agonist sensitivity. Interestingly, the function of most of these nonfunctional mutants could be rescued by α7nAChR positive allosteric modulator PNU-120596 and agonist-PAM 4BP-TQS. Finally, when coexpressed with the wild type, the nonfunctional mutants could also influence the receptor function. These changes of the receptor properties by the mutations could potentially have an impact on the physiological function of the α7nAChR-mediated cholinergic synaptic transmission and anti-inflammatory effects in the human SNP carriers. Rescuing the nonfunctional mutants could provide a novel way to treat the related disorders.

  20. Reduction in breast cancer susceptibility due to XbaI gene polymorphism of alpha estrogen receptor gene in Jordanians

    PubMed Central

    Atoum, Manar Fayiz; Alzoughool, Foad

    2017-01-01

    Breast cancer is a global health concern among women worldwide. Estrogen receptor alpha (ERα) mediates diverse polymorphic effects in breast tissues that may relate to breast cancer susceptibility. The aim of this study was to evaluate the effect of −397 PvuII (T/C) and −351 XbaI (A/G) restriction fragment length polymorphism within intron 1 of ERα, and its effect on breast cancer susceptibility. A total of 156 women who were histopathologically diagnosed with breast cancer and 142 healthy Jordanian women were enrolled in this case–control study. Genomic DNA was extracted from whole peripheral blood, and the desired fragment was amplified using polymerase chain reaction followed by restriction digestion with PvuII and XbaI restriction enzymes. The results showed no significant association between PvuII polymorphism and breast cancer risk. However, a significant association was found between XbaI polymorphism and reduction in breast cancer risk within the “x” allele of heterozygotes (odds ratio [OR] 0.199, 95% confidence interval [CI] 0.09–0.044) and heterozygotes (OR 0.208, 95% CI 0.09–0.047). The combined analysis of PvuII and XbaI polymorphisms revealed a synergistic effect of Pp/Xx and pp/xx genotypes and a significant reduction in breast cancer risk with these genotypes. The results also showed no statistical differences among PvuII or XbaI polymorphisms based on stage, ER, progesterone receptor and expression of hormone receptor such as human epidermal growth factor receptor 2. This case–control study showed that XbaI polymorphism of alpha estrogen gene modified and reduced breast cancer susceptibility among Jordanians. PMID:28182136

  1. Genetic polymorphism in CD14 gene, a co-receptor of TLR4 associated with non-alcoholic fatty liver disease

    PubMed Central

    Kapil, Shweta; Duseja, Ajay; Sharma, Bal Krishan; Singla, Bhupesh; Chakraborti, Anuradha; Das, Ashim; Ray, Pallab; Dhiman, Radha K; Chawla, Yogesh

    2016-01-01

    AIM To evaluate the pathogenic role of toll-like receptor (TLR) gene polymorphisms in patients with non-alcoholic fatty liver disease (NAFLD). METHODS Two hundred and fifty subjects (NAFLD = 200, healthy volunteers = 50) underwent polymerase chain reaction and restriction fragment length polymorphism to assess one polymorphism in the toll-like receptor 2 (TLR2) gene (A753G), two polymorphisms in the TLR4 gene (TLR4 Asp299Gly and Thr399Ile allele), and two polymorphisms in the cluster of differentiation 14 (CD14) (C-159T and C-550T) gene, a co-receptor of TLR4. Association of TLR gene polymorphisms with NAFLD and its severity was evaluated by genetic models of association. RESULTS On both multiplicative and recessive models of gene polymorphism association, there was significant association of CD14 C (-159) T polymorphism with NAFLD; patients with TT genotype had a 2.6 fold increased risk of developing NAFLD in comparison to CC genotype. There was no association of TLR2 Arg753Gln, TLR4 Asp299Gly, Thr399Ile, and CD14 C (-550) T polymorphisms with NAFLD. None of the TLR gene polymorphisms had an association with histological severity of NAFLD. CONCLUSION Patients with CD14 C (-159) T gene polymorphism, a co-receptor of TLR4, have an increased risk of NAFLD development. PMID:27895422

  2. N-terminal {beta}{sub 2}-adrenergic receptor polymorphisms do not correlate with bronchodilator response in asthma families

    SciTech Connect

    Holyroyd, K.J.; Dragwa, C.; Xu, J.

    1994-09-01

    Family and twin studies have suggested that susceptibility to asthma is inherited. One clinically relevant phenotype in asthma is the bronchodilator response to beta adrenergic therapy (reversibility) which may also be inherited and vary among asthmatics. Two polymorphisms of the {beta}{sub 2}-adrenergic receptor common to both asthmatic and normal individuals have been reported. One polymorphism, an amino acid polymorphism at position 16, correlated in one study with the need for long-term corticosteriod use in a population of asthmatics. It is conceivable that the increased use of corticosteroids needed to control symptoms in these patients may be explained by a decreased responsiveness to brochodilators mediated through this amino acid polymorphism in the {beta}{sub 2}-adrenergic receptor. However, the response to {beta}{sub 2} bronchodilators was not tested in these patients. In our Dutch asthma families, DNA sequencing of the {beta}{sub 2}-adrenergic receptor has been performed for N-terminal polymorphisms at amino acid positions 16 and 27 in over 100 individuals, and no correlation was found with the increase of FEV{sub 1} in response to bronchodilator. Linkage analysis between bronchodilator response and marker D5S412 near the {beta}{sub 2}-adrenergic receptor gene was performed in 286 sibpairs from these families. Using a bronchodilator response of >10% in FEV{sub 1} as a qualitative definition of affected individuals, there were 145 unaffected sibpairs, 121 sibpairs where one was affected, and 20 in which both were affected. Linear regression analysis of these sibpair data suggested possible linkage (p=0.007). This supports further examination of the {beta}{sub 2}-adrenergic receptor and its regulatory regions for polymorphisms that correlate with the bronchodilator response in asthma families.

  3. Age-dependent effects of the 5-hydroxytryptamine-2a-receptor polymorphism (His452Tyr) on human memory.

    PubMed

    Papassotiropoulos, Andreas; Henke, Katharina; Aerni, Amanda; Coluccia, Daniel; Garcia, Esmeralda; Wollmer, Marc A; Huynh, Kim-Dung; Monsch, Andreas U; Stähelin, Hannes B; Hock, Christoph; Nitsch, Roger M; de Quervain, Dominique J-F

    2005-05-31

    A polymorphism (His452Tyr) of the 5-hydroxytryptamine (5-HT)2a receptor is associated with episodic memory in healthy young humans. Because 5-HT2a-receptor density decreases with increasing age, we tested whether the 5-HT2a receptor genotype effect on memory is influenced by age. We investigated the association of the His452Tyr genotype with memory performance in 622 healthy study participants aged from 18 to 90 years. In young to middle-aged participants, age significantly influenced genotype effects on episodic memory: the His452Tyr genotype exerted a significant influence on memory only in young participants. In the group of elderly cognitively healthy participants, the His452Tyr genotype did not affect memory performance. We conclude that age strongly modulates the effect of the 5-HT2a receptor polymorphism at residue 452 on episodic memory.

  4. AT1 receptor A1166C and AT2 receptor -1332A/G gene polymorphisms: efficient genotyping by single-tube PCR.

    PubMed

    Zivković, Maja; Stanković, Aleksandra; Alavantić, Dragan

    2005-01-01

    Angiotensin II type 1 receptor (AT1) and angiotensin II type 2 receptor (AT2) genes have been investigated in recent years as potential etiologic candidates for cardiovascular and renal diseases. The pathogenic implications of AT1 A1166C and AT2 A-1332G gene polymorphisms have been shown. Here we describe a rapid and reliable method for detecting both AT1 and AT2 gene polymorphisms by a single-tube PCR, to reduce analysis time and simplify the genotyping procedure. In contrast to previously described methods, our method does not require hybridization, primer extension, or nested PCR for genotyping. In most previous studies concerning gene polymorphisms of RAS, both AT1 and AT2 receptor gene polymorphisms were investigated. The advantage of our method is that it makes it possible to detect both of these polymorphisms in a duplex PCR. The procedure described is convenient for routine laboratory use with manual sample processing, and offers the potential for further automation as well. Its simplicity makes it practical for large-scale screening of individuals and families at risk for cardiovascular or renal diseases.

  5. Association of temporomandibular dysfunction with the 102T-C polymorphism in the serotonin receptor gene in Brazilian patients

    PubMed Central

    de Freitas, Luciana Venâncio Secches; Lopes, Ana Cláudia Polli; Maniglia, José Victor

    2013-01-01

    Introduction Serotonin is a key neurotransmitter in the central nervous system. It has been suggested that serotoninergic dysfunction mediates the pathophysiology of temporomandibular dysfunction (TMD). Polymorphisms in the serotonin receptor gene (HTR2A) can alter its transcription, affecting the number of receptors in the serotoninergic system, altering nociceptive pain and hyperalgesia in TMD. The aim of this study is to investigate the association of the 102T-C polymorphism in the HTR2A gene in Brazilian patients with TMD. Material and methods This cross-sectional study examined 100 patients, of both genders, with TMD as index cases and 100 healthy volunteers as controls, also of both genders. DNA was extracted from peripheral blood leukocytes, and the site that encompassed the polymorphism in the HTR2A gene was amplified by polymerase chain reaction followed by restriction fragment length polymorphism (PCR-RFLP). Results Our results revealed that there were significantly more females among index cases compared with the control group (p < 0.05). The CC genotype of the 102T-C polymorphism was more frequent in patients with TMD vs. controls (OR: 2.25; 95% CI: 1.13–4.46; p < 0.05). Conclusions The present study supports the view that the 102T-C polymorphism in the HTR2A gene is associated with TMD in this studied Brazilian population. PMID:24482644

  6. Human epithelial growth factor receptor 2[Ile655Val] polymorphism and risk of breast fibroadenoma.

    PubMed

    Zubor, Pavol; Kajo, Karol; Stanclova, Andrea; Szunyogh, Norbert; Galo, Silvester; Dussan, Carlos A; Minarik, Gabriel; Visnovsky, Jozef; Danko, Jan

    2008-02-01

    Studies on the association between the Ile to Val polymorphism at codon 655 of the human epithelial growth factor receptor 2 (HER-2) gene and susceptibility to breast cancer have been reported for almost all ethnic populations, with both positive or negative conclusions. No study, however, has yet been focused on the possible association between this gene and its predisposition to benign breast lesions, especially on risk for fibroadenoma. We aimed to study the association of the single nucleotide polymorphism V655 HER-2 gene polymorphism with histologically verified breast fibroadenoma risk. We conducted a molecular epidemiological case-control study of 70 breast fibroadenoma cases without cellular atypia and 172 healthy female controls. We found that the Val variant allele and genotype frequency of this polymorphism is higher in cases with fibroadenoma; however, this difference was not significant (allele Val 655: 27.86 and 22.67% in fibroadenoma and controls, respectively; genotype Ile/Val: 35.71 and 38.37% and Val/Val: 10.0 and 3.49% in fibroadenoma and controls, respectively). Applying logistic regression analysis, we found an increased risk of fibroadenoma formation in carriers of the Val allele (odds ratio = 1.17; 95% confidence interval = 0.67-2.05), in which the highest risk was associated with homozygous genotype (odds ratio = 3.07; 95% confidence interval = 0.97-9.72), but this risk was not significant. Stratification by age (cut-off 45 years) revealed the highest risk of fibroadenoma among young women homozygous for the Val allele (odds ratio = 3.30). The risk, however, was slightly increased (odds ratio = 1.24) among older carriers of the aberrant allele in their genotype as well, but it was not significant. In spite of insignificant differences, our results indicate that HER-2 Ile655Val polymorphism, especially in a homozygous form might play some role in the etiology of breast fibroadenoma formation. The significance of this susceptibility, however

  7. Common α2A and α2C adrenergic receptor polymorphisms do not affect plasma membrane trafficking.

    PubMed

    Hurt, Carl M; Sorensen, Matt W; Angelotti, Timothy

    2014-06-01

    Various naturally occurring polymorphic forms of human G protein-coupled receptors (GPCRs) have been identified and linked to diverse pathological diseases, including receptors for vasopressin type 2 (nephrogenic diabetes insipidus) and gonadotropin releasing hormone (hypogonadotropic hypogonadism). In most cases, polymorphic amino acid mutations disrupt protein folding, altering receptor function as well as plasma membrane expression. Other pathological GPCR variants have been found that do not alter receptor function, but instead affect only plasma membrane trafficking (e.g., delta opiate and histamine type 1 receptors). Thus, altered membrane trafficking with retained receptor function may be another mechanism causing polymorphic GPCR dysfunction. Two common human α2A and α2C adrenergic receptor (AR) variants have been identified (α2A N251K and α2C Δ322-325 ARs), but pharmacological analysis of ligand binding and second messenger signaling has not consistently demonstrated altered receptor function. However, possible alterations in plasma membrane trafficking have not been investigated. We utilized a systematic approach previously developed for the study of GPCR trafficking motifs and accessory proteins to assess whether these α2 AR variants affected intracellular trafficking or plasma membrane expression. By combining immunofluorescent microscopy, glycosidic processing analysis, and quantitative fluorescent-activated cell sorting (FACS), we demonstrate that neither variant receptor had altered intracellular localization, glycosylation, nor plasma membrane expression compared to wild-type α2 ARs. Therefore, pathopharmacological properties of α2A N251K and α2C Δ322-325 ARs do not appear to be due to altered receptor pharmacology or plasma membrane trafficking, but may involve interactions with other intracellular signaling cascades or proteins.

  8. The CAG polymorphism in androgen receptor (AR) gene impacts the moral permissibility of harmful behavior in females.

    PubMed

    Gong, Pingyuan; Fang, Pengpeng; Yang, Xing; Ru, Wenzhao; Wang, Bei; Gao, Xiaocai; Liu, Jinting

    2017-03-07

    The moral permissibility of harm is strikingly varied among individuals. In light of the connection between testosterone levels and utilitarian moral judgment, this study examined to what extent a CAG polymorphism in the androgen receptor gene, a genetic polymorphism with the ability to regulate testosterone function, contributes to individual differences in moral judgment. Four hundred and thirty-nine Chinese Han participants completed permissibility ratings of harm in moral dilemmas and moral transgression scenarios. Results showed a significant association between the CAG polymorphism and moral permissibility of harm in females. Females with more copies of the S allele, which is associated with higher availability of testosterone, were more likely to judge harmful utilitarian acts and unintentionally harmful acts as permissible, while these effects were absent in males. The findings provide the first evidence for a link between the androgen receptor gene and moral judgment and highlight the role of androgens in moral foundations.

  9. Leptin receptor polymorphisms interact with polyunsaturated fatty acids to augment risk of insulin resistance and metabolic syndrome in adults

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The leptin receptor (LEPR) is associated with insulin resistance, a key feature of metabolic syndrome (MetS). Gene-fatty acid interactions may affect MetS risk. The objective was to investigate the relationship among LEPR polymorphisms, insulin resistance, andMetSrisk and whether plasma fatty acids,...

  10. Identification of an ionotropic glutamate receptor AMPA1/GRIA1 polymorphism in crossbred beef cows differing in fertility

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A proposed functional polymorphism in the ionotropic glutamate receptor AMPA1 (GRIA1) has been reported to influence antral follicle numbers and fertility in cows. Repeat Breeder cows that fail to produce a calf in multiple seasons have been reported to have reduced numbers of small (1-3 mm) antral ...

  11. Moderator Effects of Working Memory on the Stability of ADHD Symptoms by Dopamine Receptor Gene Polymorphisms during Development

    ERIC Educational Resources Information Center

    Trampush, Joey W.; Jacobs, Michelle M.; Hurd, Yasmin L.; Newcorn, Jeffrey H.; Halperin, Jeffrey M.

    2014-01-01

    We tested the hypothesis that dopamine D1 and D2 receptor gene (DRD1 and DRD2, respectively) polymorphisms and the development of working memory skills can interact to influence symptom change over 10 years in children with attention-deficit/hyperactivity disorder (ADHD). Specifically, we examined whether improvements in working memory maintenance…

  12. Polymorphic CAG Repeat and Protein Expression of Androgen Receptor Gene in Colorectal Cancer.

    PubMed

    Huang, Rui; Wang, Guiyu; Song, Yanni; Wang, Feng; Zhu, Bing; Tang, Qingchao; Liu, Zheng; Chen, Yinggang; Zhang, Qian; Muhammad, Shan; Wang, Xishan

    2015-04-01

    Although somatic alterations in CAG repeats in the androgen receptor (AR) gene have been suggested to predispose to colorectal cancer, less is known about AR in colorectal cancer carcinogenesis. Because of lack of relevant analysis on CAG repeat length and AR expression in colorectal cancer, we aimed to investigate the prognostic value of polymorphic CAG and protein expression of the AR gene in patients with colorectal cancer. A case-control study was carried out on 550 patients with colorectal cancer and 540 healthy controls to investigate whether polymorphic CAG within the AR gene is linked to increased risk for colorectal cancer. Polymorphic CAG and AR expression were analyzed to clarify their relationship with clinicopathologic and prognostic factors in patients with colorectal cancer. The study showed that the AR gene in patients with colorectal cancer had a longer CAG repeat sequence than those in the control group, as well as increased risk for colorectal cancer among females (P = 0.013), males (P = 0.002), and total colorectal cancer population (P < 0.001), respectively. AR expression exhibited a significant difference in long CAG repeat sequence among males (P < 0.001), females (P < 0.001), and total colorectal cancer study population (P < 0.001). Both long CAG repeat sequence and negative AR expression were associated with a short 5-year overall survival (OS) rate in colorectal cancer. Long CAG repeat sequences and the absence of AR expression were closely related to the development of colorectal cancer. Both long CAG and decreased AR expression were correlated with the poor 5-year OS in patients with colorectal cancer.

  13. Vitamin D receptor polymorphisms and survival in patients with cutaneous melanoma: a population-based study

    PubMed Central

    Orlow, Irene; Reiner, Anne S.; Thomas, Nancy E.; Roy, Pampa; Kanetsky, Peter A.; Luo, Li; Paine, Susan; Armstrong, Bruce K.; Kricker, Anne; Marrett, Loraine D.; Rosso, Stefano; Zanetti, Roberto; Gruber, Stephen B.; Anton-Culver, Hoda; Gallagher, Richard P.; Dwyer, Terence; Busam, Klaus; Begg, Colin B.; Berwick, Marianne

    2016-01-01

    Factors known to affect melanoma survival include age at presentation, sex and tumor characteristics. Polymorphisms also appear to modulate survival following diagnosis. Result from other studies suggest that vitamin D receptor (VDR) polymorphisms (SNPs) impact survival in patients with glioma, renal cell carcinoma, lung, breast, prostate and other cancers; however, a comprehensive study of VDR polymorphisms and melanoma-specific survival is lacking. We aimed to investigate whether VDR genetic variation influences survival in patients with cutaneous melanoma. The analysis involved 3566 incident single and multiple primary melanoma cases enrolled in the international population-based Genes, Environment, and Melanoma Study. Melanoma-specific survival outcomes were calculated for each of 38 VDR SNPs using a competing risk analysis after adjustment for covariates. There were 254 (7.1%) deaths due to melanoma during the median 7.6 years follow-up period. VDR SNPs rs7299460, rs3782905, rs2239182, rs12370156, rs2238140, rs7305032, rs1544410 (BsmI) and rs731236 (TaqI) each had a statistically significant (trend P values < 0.05) association with melanoma-specific survival in multivariate analysis. One functional SNP (rs2239182) remained significant after adjustment for multiple testing using the Monte Carlo method. None of the SNPs associated with survival were significantly associated with Breslow thickness, ulceration or mitosis. These results suggest that the VDR gene may influence survival from melanoma, although the mechanism by which VDR exerts its effect does not seem driven by tumor aggressiveness. Further investigations are needed to confirm our results and to understand the relationship between VDR and survival in the combined context of tumor and host characteristics. PMID:26521212

  14. Dopamine D4 receptor polymorphism and sex interact to predict children’s affective knowledge

    PubMed Central

    Ben-Israel, Sharon; Uzefovsky, Florina; Ebstein, Richard P.; Knafo-Noam, Ariel

    2015-01-01

    Affective knowledge, the ability to understand others’ emotional states, is considered to be a fundamental part in efficient social interaction. Affective knowledge can be seen as related to cognitive empathy, and in the framework of theory of mind (ToM) as affective ToM. Previous studies found that cognitive empathy and ToM are heritable, yet little is known regarding the specific genes involved in individual variability in affective knowledge. Investigating the genetic basis of affective knowledge is important for understanding brain mechanisms underlying socio-cognitive abilities. The 7-repeat (7R) allele within the third exon of the dopamine D4 receptor gene (DRD4-III) has been a focus of interest, due to accumulated knowledge regarding its relevance to individual differences in social behavior. A recent study suggests that an interaction between the DRD4-III polymorphism and sex is associated with cognitive empathy among adults. We aimed to examine the same association in two childhood age groups. Children (N = 280, age 3.5 years, N = 283, age 5 years) participated as part of the Longitudinal Israel Study of Twins. Affective knowledge was assessed through children’s responses to an illustrated story describing different emotional situations, told in a laboratory setting. The findings suggest a significant interaction between sex and the DRD4-III polymorphism, replicated in both age groups. Boy carriers of the 7R allele had higher affective knowledge scores than girls, whereas in the absence of the 7R there was no significant sex effect on affective knowledge. The results support the importance of DRD4-III polymorphism and sex differences to social development. Possible explanations for differences from adult findings are discussed, as are pathways for future studies. PMID:26157401

  15. GH deficiency status combined with GH receptor polymorphism affects response to GH in children.

    PubMed

    Valsesia, Armand; Chatelain, Pierre; Stevens, Adam; Peterkova, Valentina A; Belgorosky, Alicia; Maghnie, Mohamad; Antoniazzi, Franco; Koledova, Ekaterina; Wojcik, Jerome; Farmer, Pierre; Destenaves, Benoit; Clayton, Peter

    2015-12-01

    Meta-analysis has shown a modest improvement in first-year growth response to recombinant human GH (r-hGH) for carriers of the exon 3-deleted GH receptor (GHRd3) polymorphism but with significant interstudy variability. The associations between GHRd3 and growth response to r-hGH over 3 years in relation to severity of GH deficiency (GHD) were investigated in patients from 14 countries. Treatment-naïve pre-pubertal children with GHD were enrolled from the PREDICT studies (NCT00256126 and NCT00699855), categorized by peak GH level (peak GH) during provocation test: ≤4 μg/l (severe GHD; n=45) and >4 to <10 μg/l mild GHD; n=49) and genotyped for the GHRd3 polymorphism (full length (fl/fl, fl/d3, d3/d3). Gene expression (GE) profiles were characterized at baseline. Changes in growth (height (cm) and SDS) over 3 years were measured. There was a dichotomous influence of GHRd3 polymorphism on response to r-hGH, dependent on peak GH level. GH peak level (higher vs lower) and GHRd3 (fl/fl vs d3 carriers) combined status was associated with height change over 3 years (P<0.05). GHRd3 carriers with lower peak GH had lower growth than subjects with fl/fl (median difference after 3 years -3.3 cm; -0.3 SDS). Conversely, GHRd3 carriers with higher peak GH had better growth (+2.7 cm; +0.2 SDS). Similar patterns were observed for GH-dependent biomarkers. GE profiles were significantly different between the groups, indicating that the interaction between GH status and GHRd3 carriage can be identified at a transcriptomic level. This study demonstrates that responses to r-hGH depend on the interaction between GHD severity and GHRd3 carriage.

  16. Sun exposure, vitamin D receptor gene polymorphisms, and risk of advanced prostate cancer.

    PubMed

    John, Esther M; Schwartz, Gary G; Koo, Jocelyn; Van Den Berg, David; Ingles, Sue A

    2005-06-15

    Substantial experimental evidence indicates that the hormonal form of vitamin D promotes the differentiation and inhibits the proliferation, invasiveness, and metastasis of human prostatic cancer cells. Results from epidemiologic studies of vitamin D status and/or vitamin D receptor (VDR) polymorphisms and prostate cancer risk have been mixed. We conducted a population-based, case-control study of advanced prostate cancer among men ages 40 to 79 years from the San Francisco Bay area. Interview data on lifetime sun exposure and other risk factors were collected for 905 non-Hispanic White men (450 cases and 455 controls). Using a reflectometer, we measured constitutive skin pigmentation on the upper underarm (a sun-protected site) and facultative pigmentation on the forehead (a sun-exposed site) and calculated a sun exposure index from these measurements. Biospecimens were collected for 426 cases and 440 controls. Genotyping was done for VDR polymorphisms in the 5' regulatory region (Cdx-2), exon 2 (FokI), and the 3' region (TaqI and BglI). Reduced risk of advanced prostate cancer was associated with high sun exposure determined by reflectometry [odds ratio (OR), 0.51; 95% confidence interval (95% CI), 0.33-0.80] and high occupational outdoor activity (OR, 0.73; 95% CI, 0.48-1.11). Significant risk reductions with the high-activity alleles FokI FF or Ff, TaqI tt, and BglI BB genotypes and a nonsignificant reduction with Cdx-2 AG or AA genotype were observed in the presence of high sun exposure, with ORs ranging from 0.46 to 0.67. Our findings support the hypothesis that sun exposure and VDR polymorphisms together play important roles in the etiology of prostate cancer.

  17. Toll-like receptor 4 D299G polymorphism in metabolic disorders: a meta-analysis.

    PubMed

    Belforte, F S; Coluccio Leskow, F; Poskus, E; Penas Steinhardt, A

    2013-04-01

    The toll-like receptor 4 (TLR4) plays a key role in the activation of innate immune response participating in the recognition of lipopolysaccharides. Changes in the innate immune response are involved in the pathogenesis of some metabolic disorders such as metabolic syndrome and type 2 diabetes mellitus (Met-S and T2DM). It has been recently shown the role of gut microbiota in the perpetuation of both insulin resistance and low-grade chronic inflammation. Some studies have reported that TLR4 D299G polymorphism is associated with metabolic disorders, however results have been inconsistent. Two recent meta-analyses showed that D299G is associated with inflammatory bowel disease and gastrointestinal cancers risk, two pathological states in which the luminal microbial flora-host cells interaction may be implicated. We conducted a systemic review of the published data considering all eligible published studies (six studies with 1696 cases and 3388 controls for D299G) and a meta-analysis was performed to evaluate the association between TLR4 D299G polymorphism and the risk for metabolic disorders. Five studies were identified for T2DM: three corresponding to Caucasian populations and two to mixed populations. The remaining study analyzed Met-S in a Caucasian population. We observed a significant association between D299G polymorphism and metabolic disorders (T2DM and Met-S) risk (OR = 0.566, 95 % CI: 0.347-0.925, p = 0.023) particularly in Caucasians. No association was found in mixed population subgroup. Our meta-analysis identified that the AG/GG genotypes of D299G are associated with decreased metabolic disorders risk.

  18. Gene polymorphisms in pattern recognition receptors and susceptibility to idiopathic recurrent vulvovaginal candidiasis

    PubMed Central

    Rosentul, Diana C.; Delsing, Corine E.; Jaeger, Martin; Plantinga, Theo S.; Oosting, Marije; Costantini, Irene; Venselaar, Hanka; Joosten, Leo A. B.; van der Meer, Jos W. M.; Dupont, Bertrand; Kullberg, Bart-Jan; Sobel, Jack D.; Netea, Mihai G.

    2014-01-01

    Objective: Approximately 5% of women suffer from recurrent vulvovaginal candidiasis (RVVC). It has been hypothesized that genetic factors play an important role in the susceptibility to RVVC. The aim of this study was to assess the effect of genetic variants of genes encoding for pattern recognition receptors (PRRs) on susceptibility to RVVC. Study design: For the study, 119 RVVC patients and 263 healthy controls were recruited. Prevalence of polymorphisms in five PRRs involved in recognition of Candida were investigated in patients and controls. In silico and functional studies were performed to assess their functional effects. Results: Single nucleotide polymorphisms (SNPs) in TLR1, TLR4, CLEC7A, and CARD9 did not affect the susceptibility to RVVC. In contrast, a non-synonymous polymorphism in TLR2 (rs5743704, Pro631His) increased the susceptibility to RVVC almost 3-fold. Furthermore, the TLR2 rs5743704 SNP had deleterious effects on protein function as assessed by in silico analysis, and in vitro functional assays suggested that it reduces production of IL-17 and IFNγ upon stimulation of peripheral blood mononuclear cells with Candida albicans. No effects were observed on serum mannose-binding lectin concentrations. Condensation: This study demonstrates the association of susceptibility to RVVC with genetic variation in TLR2, most likely caused by decreased induction of mucosal antifungal host defense. Conclusion: Genetic variation in TLR2 may significantly enhance susceptibility to RVVC by modulating host defense mechanisms against Candida. Additional studies are warranted to assess systematically the role of host genetic variation for susceptibility to RVVC. PMID:25295030

  19. Vitamin D receptor gene polymorphisms are associated with obesity and inflammosome activity.

    PubMed

    Al-Daghri, Nasser M; Guerini, Franca R; Al-Attas, Omar S; Alokail, Majed S; Alkharfy, Khalid M; Draz, Hossam M; Agliardi, Cristina; Costa, Andrea S; Saulle, Irma; Mohammed, Abdul Khader; Biasin, Mara; Clerici, Mario

    2014-01-01

    To explore the mechanisms underlying the suggested role of the vitamin D/vitamin D receptor (VDR) complex in the pathogenesis of obesity we performed genetic and immunologic analyses in obese and non-obese Saudi individuals without other concomitant chronic diseases. Genomic DNA was genotyped for gene single nucleotide polymorphisms (SNPs) of VDR by allelic discrimination in 402 obese (body mass index -BMI≥30 kg/m2) and 489 non-obese (BMI<30 kg/m2) Saudis. Q-PCR analyses were performed using an ABI Prism 7000 Sequence Detection System. The inflammosome pathway was analysed by PCR, cytokines and plasma lipopolysaccaride (LPS) concentrations with ELISA assays. Results showed that the VDR SNPs rs731236 (G) (TaqI) and rs1544410 (T) (Bsm-I) minor allele polymorphisms are significantly more frequent in obese individuals (p = 0.009, β = 0.086 and p = 0.028, β = 0.072, respectively). VDR haplotypes identified are positively (GTA) (p = 0.008, β = 1.560); or negatively (ACC) (p = 0.044, β = 0.766) associated with obesity and higher BMI scores. The GTA "risk" haplotype was characterized by an up-regulation of inflammosome components, a higher production of proinflammatory cytokines (p<0.05) and a lower VDR expression. Plasma LPS concentration was also increased in GTA obese individuals (p<0.05), suggesting an alteration of gut permeability leading to microbial translocation. Data herein indicate that polymorphisms affecting the vitamin D/VDR axis play a role in obesity that is associated with an ongoing degree of inflammation, possibly resulting from alterations of gut permeability and microbial translocation. These results could help the definition of VDR fingerprints that predict an increased risk of developing obesity and might contribute to the identification of novel therapeutic strategies for this metabolic condition.

  20. Vitamin D receptor polymorphisms and survival in patients with cutaneous melanoma: a population-based study.

    PubMed

    Orlow, Irene; Reiner, Anne S; Thomas, Nancy E; Roy, Pampa; Kanetsky, Peter A; Luo, Li; Paine, Susan; Armstrong, Bruce K; Kricker, Anne; Marrett, Loraine D; Rosso, Stefano; Zanetti, Roberto; Gruber, Stephen B; Anton-Culver, Hoda; Gallagher, Richard P; Dwyer, Terence; Busam, Klaus; Begg, Colin B; Berwick, Marianne

    2016-01-01

    Factors known to affect melanoma survival include age at presentation, sex and tumor characteristics. Polymorphisms also appear to modulate survival following diagnosis. Result from other studies suggest that vitamin D receptor (VDR) polymorphisms (SNPs) impact survival in patients with glioma, renal cell carcinoma, lung, breast, prostate and other cancers; however, a comprehensive study of VDR polymorphisms and melanoma-specific survival is lacking. We aimed to investigate whether VDR genetic variation influences survival in patients with cutaneous melanoma. The analysis involved 3566 incident single and multiple primary melanoma cases enrolled in the international population-based Genes, Environment, and Melanoma Study. Melanoma-specific survival outcomes were calculated for each of 38 VDR SNPs using a competing risk analysis after adjustment for covariates. There were 254 (7.1%) deaths due to melanoma during the median 7.6 years follow-up period. VDR SNPs rs7299460, rs3782905, rs2239182, rs12370156, rs2238140, rs7305032, rs1544410 (BsmI) and rs731236 (TaqI) each had a statistically significant (trend P values < 0.05) association with melanoma-specific survival in multivariate analysis. One functional SNP (rs2239182) remained significant after adjustment for multiple testing using the Monte Carlo method. None of the SNPs associated with survival were significantly associated with Breslow thickness, ulceration or mitosis. These results suggest that the VDR gene may influence survival from melanoma, although the mechanism by which VDR exerts its effect does not seem driven by tumor aggressiveness. Further investigations are needed to confirm our results and to understand the relationship between VDR and survival in the combined context of tumor and host characteristics.

  1. Vitamin D receptor levels in colorectal cancer. Possible role of BsmI polymorphism.

    PubMed

    Parisi, Eva; Reñé, Josep Maria; Cardús, Anna; Valcheva, Petya; Piñol-Felis, Carme; Valdivielso, José Manuel; Fernández, Elvira

    2008-07-01

    A high expression of vitamin D receptor (VDR) in colorectal cancer (CRC) tumoral tissue has been related to a good prognosis and it has been proposed that it could be a good biological marker of CRC progression. Nevertheless, there are no previous studies that compare the VDR expression in tumoral towards normal tissue of the same CRC patient in relation to VDR BsmI genotype. We collected normal and tumoral tissue samples, as well as blood samples, from CRC patients (n=170) and controls (n=122). VDR genotyping was performed and BsmI homozygous patients were selected (CRC=50, Cont=32). VDR mRNA and protein levels were analyzed. We also measured 25-Hydroxyvitamin D serum levels. We found no differences in the polymorphism distribution in tumoral versus normal tissue (control: BB=15.7%, bb=41.3%, Bb=43%; CRC: BB=14.2%, bb=41.9%, Bb=43.9%). Furthermore, VDR levels decreased in colonic cancer tissue (mean: 3.03) versus normal mucosa (11.62) from the same patient (p<0.001), but this decrease was similar in both genotypes. There were differences in 25-Hydroxyvitamin D(3) levels between the CRC and the control group (CRC=8.65 ng/ml, Cont=18.15 ng/ml). In conclusion, we found a decrease in VDR levels in tumoral compared with normal mucosa from the same patient. This difference is independent of the BsmI polymorphism.

  2. Distress of ostracism: oxytocin receptor gene polymorphism confers sensitivity to social exclusion.

    PubMed

    McQuaid, Robyn J; McInnis, Opal A; Matheson, Kimberly; Anisman, Hymie

    2015-08-01

    A single-nucleotide polymorphism on the oxytocin receptor gene (OXTR), rs53576, involving a guanine (G) to adenine (A) substitution has been associated with altered prosocial features. Specifically, individuals with the GG genotype (i.e. the absence of the polymorphism) display beneficial traits including enhanced trust, empathy and self-esteem. However, because G carriers might also be more socially sensitive, this may render them more vulnerable to the adverse effects of a negative social stressor. The current investigation, conducted among 128 white female undergraduate students, demonstrated that relative to individuals with AA genotype, G carriers were more emotionally sensitive (lower self-esteem) in response to social ostracism promoted through an on-line ball tossing game (Cyberball). Furthermore, GG individuals also exhibited altered blood pressure and cortisol levels following rejection, effects not apparent among A carriers. The data support the view that the presence of the G allele not only promotes prosocial behaviors but also favors sensitivity to a negative social stressor.

  3. Association study of polymorphisms in interferon-γ receptor genes with the risk of pulmonary tuberculosis.

    PubMed

    Shin, Joong-Gon; Park, Byung Lae; Kim, Lyoung Hyo; Namgoong, Suhg; Kim, Ji On; Chang, Hun Soo; Park, Jong Sook; Jang, An Soo; Park, Sung Woo; Kim, Do Jin; Kim, Ki Up; Kim, Yang Gee; Uh, Soo-Taek; Seo, Ki Hyun; Kim, Young Hoon; Koh, Insong; Park, Choon Sik; Shin, Hyoung Doo

    2015-07-01

    Tuberculosis (TB) is an infectious disease caused by mycobacterium, which most commonly affects the lungs. The adaptive immune response in Mycobacterium tuberculosis is predominantly mediated by the interferon-γ (IFN-γ) signaling pathway, which is regulated by IFN-γ receptors (IFNGR). IFN-γ activates the transcription of a number of genes that are important in immune responses, thus the appropriate function of IFNGR appears to be important in host defense against mycobacteria. In the present study, 22 genetic variants in IFNGR1 and IFNGR2 were genotyped in 673 patients and 592 normal controls to investigate the association between IFNGR1 and IFNGR2 polymorphisms and the risk of TB. Statistical analyses revealed that four genetic variants in IFNGR1, rs9376269, rs9376268, rs9376267 and rs56251346 were marginally associated with the risk of TB (P = 0.02-0.04), while other single nucleotide polymorphisms in IFNGR1 and IFNGR2 did not exhibit any associations. However, the significance of the four genetic variants rs9376269, rs9376268, rs9376267 and rs56251346 was eliminated following a multiple testing correction of the data (P>0.05). The present results revealed that certain genetic variants in IFNGR genes may be associated with TB development, which may be useful preliminary data for future investigation.

  4. Distress of ostracism: oxytocin receptor gene polymorphism confers sensitivity to social exclusion

    PubMed Central

    McInnis, Opal A.; Matheson, Kimberly; Anisman, Hymie

    2015-01-01

    A single-nucleotide polymorphism on the oxytocin receptor gene (OXTR), rs53576, involving a guanine (G) to adenine (A) substitution has been associated with altered prosocial features. Specifically, individuals with the GG genotype (i.e. the absence of the polymorphism) display beneficial traits including enhanced trust, empathy and self-esteem. However, because G carriers might also be more socially sensitive, this may render them more vulnerable to the adverse effects of a negative social stressor. The current investigation, conducted among 128 white female undergraduate students, demonstrated that relative to individuals with AA genotype, G carriers were more emotionally sensitive (lower self-esteem) in response to social ostracism promoted through an on-line ball tossing game (Cyberball). Furthermore, GG individuals also exhibited altered blood pressure and cortisol levels following rejection, effects not apparent among A carriers. The data support the view that the presence of the G allele not only promotes prosocial behaviors but also favors sensitivity to a negative social stressor. PMID:25564674

  5. Vascular endothelial growth factor receptor 2 gene (KDR) polymorphisms and expression levels in depressive disorder.

    PubMed

    Gałecki, Piotr; Orzechowska, Agata; Berent, Dominika; Talarowska, Monika; Bobińska, Kinga; Gałecka, Elżbieta; Lewiński, Andrzej; Maes, Michael; Szemraj, Janusz

    2013-05-01

    Recent research findings suggest that vascular endothelial growth factor (VEGF) participates in the development of depressive disorder. VEGF is involved in neurogenesis and neuroprotection processes, mediated by vascular endothelial growth factor receptor 2 (VEGFR2). VEGFR2 also plays a role in angiogenesis, a process related to neurogenesis and other biological processes. We examined VEGFR2 (KDR) gene polymorphism, mRNA expression levels, as well as VEGFR2 protein levels in 268 patients diagnosed with a recurrent depressive disorder (rDD) using the ICD-10 criteria, and in 200 healthy controls. Genotyping and gene expression level analysis was performed using polymerase chain reaction (PCR)-based methods. An Enzyme-Linked Immunosorbent Assay (ELISA) was used for measurement of KDR protein levels. Our study found that distribution of KDR polymorphism +1416T/A differs significantly in patients with rDD when compared to healthy subjects, while A allele and AA genotype are risk factors for rDD. KDR mRNA and protein expression are higher in patients with rDD. We also observed a significant association between the -271A/G variant and gene and protein levels. Our study is the first to demonstrate that the KDR gene may serve as a novel genetic marker that could participate in the etiology of rDD. This new pathway may play a role in the inflammatory pathophysiology of depression.

  6. Androgen receptor gene CAG repeat polymorphism and ovarian cancer risk: A meta-analysis.

    PubMed

    Deng, Yang; Wang, Jue; Wang, Ling; Du, Yan

    2017-02-28

    Ovarian cancer is one of the common gynecological malignancies worldwide. It is usually diagnosed at a later stage, thus missing the best opportunity for treatment. Despite the advancement of ovarian cancer treatment, the prognosis is still poor. Androgen receptor (AR) may play a role in ovarian carcinogenesis. Previous studies regarding the association between AR CAG repeat length and ovarian cancer risk reported inconsistent results. Therefore, we conducted a meta-analysis to evaluate the association between AR CAG repeat length and ovarian cancer risk following the MOOSE guidelines. PubMed, Web of Science, EBSCO and other databases were searched up to September 15(th) 2016. Case control studies with clear definition of CAG repeat length and detailed genotype information were included. Two authors independently reviewed and extracted data. Pooled analysis and subgroup analysis stratified by ethnicity were performed for different genetic models. Begg's funnel plot and Egger's test were performed for publication bias estimation. Overall, there was no association between the AR CAG repeat polymorphism and ovarian cancer risk. However, short CAG repeat polymorphism was associated with increased ovarian cancer risk in African Americans and Chinese under the dominant model, whereas a reverse association was observed in Caucasians and Italians under the other three models. Our study results should be interpreted with caution. Further well-designed epidemiological and functional studies are needed to elucidate the role of AR in ovarian carcinogenesis.

  7. Androgen receptor gene polymorphisms are associated with aggression in Japanese Akita Inu.

    PubMed

    Konno, Akitsugu; Inoue-Murayama, Miho; Hasegawa, Toshikazu

    2011-10-23

    We tested for an association between variable number of tandem repeats in the canine androgen receptor (AR) gene and personality differences in Japanese Akita Inu dogs. The polymorphic trinucleotide (CAG) repeat region coding for glutamine in exon 1 of the AR gene was genotyped using genomic DNA obtained from 171 dogs. Three alleles (23, 24 and 26 repeats) were detected, and the allele frequency differed with the coat colour. We assessed the personality profiles of 100 fawn-coloured dogs (54 males and 46 females) based on a questionnaire answered by each dog's owner. The questionnaire consisted of five sub-scales (sociability, playfulness, neuroticism, aggressiveness, distractibility), and the psychometric properties were acceptable based upon internal consistency of the subscales. We found that male dogs with a short allele conferring increased AR function had higher aggressiveness scores than male dogs with longer alleles. By contrast, no evidence was found for a relationship between AR gene variants and personality in females. To our knowledge, our findings provide the first evidence of polymorphism in the AR gene being associated with canine aggression.

  8. Oxytocin Receptor (OXTR) Single Nucleotide Polymorphisms Indirectly Predict Prosocial Behavior Through Perspective Taking and Empathic Concern.

    PubMed

    Christ, Christa C; Carlo, Gustavo; Stoltenberg, Scott F

    2016-04-01

    Engaging in prosocial behavior can provide positive outcomes for self and others. Prosocial tendencies contribute to the propensity to engage in prosocial behavior. The oxytocin receptor gene (OXTR) has also been associated with prosocial tendencies and behaviors. There has been little research, however, investigating whether the relationship between OXTR and prosocial behaviors is mediated by prosocial tendencies. This relationship may also vary among different types of prosocial behavior. The current study examines the relationship between OXTR, gender, prosocial tendencies, and both altruistic and public prosocial behavior endorsement. Students at a midwestern university (N = 398; 89.2% Caucasian; Mage  = 20.76; 26.6% male) provided self-report measures of prosocial tendencies and behaviors and buccal cells for genotyping OXTR polymorphisms. Results indicated that OXTR single nucleotide polymorphism (SNP) rs2268498 genotype significantly predicted empathic concern, whereas gender moderated the association between several other OXTR SNPs and prosocial tendencies. Increased prosocial tendencies predicted increased altruistic prosocial behavior endorsement and decreased public prosocial behavior endorsement. Our findings suggest an association between genetic variation in OXTR and endorsement of prosocial behavior indirectly through prosocial tendencies, and that the pathway is dependent on the type of prosocial behavior and gender.

  9. Androgen receptor gene polymorphisms lean mass and performance in young men.

    PubMed

    Guadalupe-Grau, Amelia; Rodríguez-González, F Germán; Dorado, Cecilia; Olmedillas, Hugo; Fuentes, Teresa; Pérez-Gómez, Jorge; Delgado-Guerra, Safira; Vicente-Rodríguez, Germán; Ara, Ignacio; Guerra, Borja; Arteaga-Ortiz, Rafael; Calbet, José A L; Díaz-Chico, B Nicolás

    2011-02-01

    The exon-1 of the androgen receptor (AR) gene contains two repeat length polymorphisms which modify either the amount of AR protein inside the cell (GGN(n), polyglycine) or its transcriptional activity (CAG(n), polyglutamine). Shorter CAG and/or GGN repeats provide stronger androgen signalling and vice versa. To test the hypothesis that CAG and GGN repeat AR polymorphisms affect muscle mass and various variables of muscular strength phenotype traits, the length of CAG and GGN repeats was determined by PCR and fragment analysis and confirmed by DNA sequencing of selected samples in 282 men (28.6 ± 7.6 years). Individuals were grouped as CAG short (CAG(S)) if harbouring repeat lengths of ≤ 21 and CAG long (CAG(L)) if CAG >21. GGN was considered short (GGN(S)) or long (GGN(L)) if GGN ≤ 23 or >23, respectively. No significant differences in lean body mass or fitness were observed between the CAG(S) and CAG(L) groups, or between GGN(S) and GGN(L) groups, but a trend for a correlation was found for the GGN repeat and lean mass of the extremities (r=-0.11, p=0.06). In summary, the lengths of CAG and GGN repeat of the AR gene do not appear to influence lean mass or fitness in young men.

  10. T-cell receptor polymorphisms in Tlingit Indians with rheumatoid arthritis.

    PubMed

    Charmley, P; Nelson, J L; Hansen, J A; Branchaud, A; Barrington, R A; Templin, D; Boyer, G; Lanier, A P; Concannon, P

    1994-01-01

    Rheumatoid arthritis (RA) develops as a result of the interaction of both genetic and environmental factors. Among the genes in humans that have been suggested as candidate susceptibility genes in RA are those encoding the T cell receptor for antigen (TCR). A high prevalence and early age of onset of RA has previously been reported in Alaskan Tlingit Indians. In this study, the frequency of seven different restriction fragment length polymorphisms (RFLPs) in the TCR alpha and beta gene complexes were measured in a population of Alaskan Tlingit Indians. No statistically significant differences were noted when the frequencies of these RFLPs were compared between Tlingits with RA and healthy controls (p > 0.05). These results do not support the hypothesis of an RA-susceptibility allele in the vicinity of these TCR alpha or beta genes. Since TCR RFLPs have not been extensively studied in native American populations, TCR polymorphism frequencies in the Tlingits were also compared to the frequencies observed in a second control group of healthy Caucasians. Statistically significant differences were observed in these comparisons implying a different distribution of individuals in these populations with different TCR repertoires.

  11. Toll-like receptor 4 polymorphisms in dengue virus-infected children.

    PubMed

    Djamiatun, Kis; Ferwerda, Bart; Netea, Mihai G; van der Ven, André J A M; Dolmans, Wil M V; Faradz, Sultana M H

    2011-08-01

    Differential viral recognition by cells bearing Toll-like receptor 4 (TLR4) polymorphisms Asp299Gly and Thr399Ile may influence susceptibility and severity of dengue virus infection. In central Java, Indonesia, we investigated 201 children with dengue hemorrhagic fever (DHF) and 179 healthy controls. Patients and controls were mostly ethnic Javanese. A nearly complete cosegregation of the two mutations was observed. The TLR4 299/399 genotype was found in five patients and four controls. Prevalence of the TLR4 299/399 genotype did not differ significantly between controls and DHF patients or between patients with different severities of DHF. Also, vascular leakage in patients with different TLR4 genotypes did not differ. Thus, the 299/399 TLR4 haplotype has only minor influence on susceptibility and severity of complicated dengue virus infection.

  12. Dopamine receptor polymorphism modulates the relation between antenatal maternal anxiety and fetal movement.

    PubMed

    Kaitz, Marsha; Mankuta, David; Rokem, Ann Marie; Faraone, Stephen

    2016-12-01

    We determined whether the combination of fetal genotype (dopamine D4 receptor; DRD4) and mothers' anxiety during pregnancy is associated with fetal behavior. Two hundred and six pregnant women underwent an ultrasound exam. Fetal movement measures (Movement Frequency, Total Activity, Movement Duration, and Longest Quiet Time) were derived from off-line coding. A moderating role of the DRD4-III polymorphism was found: Results indicate that higher levels of antenatal maternal anxiety symptoms were associated with more frequent fetal movements among fetuses carrying a 7R allele, but not among fetuses carrying shorter alleles. Total Activity did not show full moderation by DRD4, though the measure was correlated with maternal anxiety among fetuses in the Anxious Group with a 7R allele; not among fetuses without both factors. The findings provide the first evidence of a GXE interaction in association with fetal behavior. Results also demonstrate that some individuals are inherently more susceptible to uterine environmental influences than are others.

  13. The Clinical Significance of Interleukin–1 Receptor Antagonist +2018 Polymorphism in Rheumatoid Arthritis

    PubMed Central

    Ismail, Endom; Nofal, Omimah Khaled Jaber; Sakthiswary, Rajalingham; Shaharir, Syahrul Sazliyana; Sridharan, Radhika

    2016-01-01

    Objective Interleukin-1 receptor antagonist (IL-1Ra) acts as an inhibitor of IL-1; which is one of the culprit cytokines in rheumatoid arthritis (RA). Although +2018 polymorphism of IL-1Ra has been implicated in the pathogenesis of RA, its importance remains poorly understood. Hence, the purpose of this study was to determine the clinical significance of interleukin-1 receptor antagonist (IL-1Ra) +2018 polymorphism in RA. Methods Polymerase chain reaction (PCR) and sequencing were used to determine the genotypes of the IL-1Ra +2018 for 77 RA patients and 18 healthy controls. All RA patients were assessed for the disease activity score that includes 28 joints (DAS28) and radiographic disease damage based on Modified Sharp Score (MSS). Results The frequency of the T/T and C/T genotypes did not differ significantly (p = 0.893) between the RA patients and the controls. The C/T genotype had significantly higher mean disease activity (DAS 28) and disease damage (MSS) scores with p values of 0.017 and 0.004, respectively. Additionally, the ESR (erythrocyte sedimentation rate), CRP (C-reactive protein), the number of swollen and tender joints were higher for the C/T individuals. On multivariate analysis the CRP, swollen joint count and MSS remained significant with the following p values i.e. 0.045, 0.046 and less than 0.05. Conclusions C/T genotype of IL-1Ra +2018 prognosticates more aggressive disease in RA. PMID:27105431

  14. Toll-like receptor 8 and 9 polymorphisms in Crimean-Congo hemorrhagic fever.

    PubMed

    Engin, Aynur; Arslan, Serdal; Kizildag, Sibel; Oztürk, Hasret; Elaldi, Nazif; Dökmetas, Ilyas; Bakir, Mehmet

    2010-11-01

    Crimean-Congo hemorrhagic fever (CCHF) is an acute viral hemorrhagic fever. The clinical course and outcome of the CCHF infection are different in humans. Toll-like receptors (TLRs) are a family of pathogen recognition receptors. TLR8 and TLR9 contribute to the recognition of viruses. We investigated frequency of TLR8 Met1Val, TLR8 -129C/G, TLR9 -1486T/C and TLR9 2458G/A polymorphisms in CCHF patients and healthy controls. Our study was conducted between June 1 and August 31, 2007 in Cumhuriyet University Hospital, Turkey. TLR genotypes were detected using the PCR-RFLP assay in 85 CCHF patients and 171 healthy controls. We found that heterozygous plus homozygous mutant genotypes frequency for TLR8 Met1Val and for TLR9 -1486T/C were significantly higher in CCHF patients than controls (p = 0.038 and p = 0.009, respectively). The frequency of TLR8 -129G/G genotype in the fatal CCHF patients was significantly higher than that of the non-fatal patients (p = 0.026). The frequency of TLR9 -1486C/C genotype was significantly higher in fatal CCHF patients than in healthy controls (p = 0.009) and in patients with severe disease compared to non-severe disease (p = 0.044). Our findings suggest that TLR8 Met1Val, TLR8 -129C/G, and TLR9 -1486T/C polymorphisms are important on clinical course of CCHF disease.

  15. Molecular characterization, expression profile, and polymorphism of goose dopamine D1 receptor gene.

    PubMed

    Wang, Cui; Liu, Yi; Wang, Huiying; Wu, Huali; Gong, Shaoming; He, Daqian

    2014-05-01

    Dopamine D1 receptor (DRD1) is one of the dopamine receptors with seven transmembrane domains that are coupled to the G protein. In the present study, we cloned the full coding region of DRD1 gene by the reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends from the goose hypothalamus tissues. Results showed that the goose DRD1 cDNA (GenBank: KF156790) contained a 1,356 bp open reading frame encoding a protein 452 amino acid with a molecular weight of 50.52 kDa and a isoelectric point of 6.96. Bioinformatics analysis indicated that the deduced amino acid sequence was 71-98% identical to the DRD1 protein of other species, contained seven transmembrane domains and four N-glycosylation sites. A phylogenetic tree analysis revealed that the deduced goose DRD1 protein had a close genetic relationship and evolutional distance with that of duck, chicken, and zebra finch. The semi-quantitative RT-PCR analysis displayed goose DRD1 gene was widely expressed in all detected tissues, including heart, lung, liver, spleen, kidney, breast muscle, duodenum, sebum, pituitary, hypothalamus, ovary and oviduct. Eighteen single nucleotide polymorphisms were indentified in 3,169 bp length of this gene. For G90A mutation, the genotyping analysis of PCR-TspRI-RFLP showed the allele G was in dominance in all detected goose breeds, and the allele frequencies of this polymorphism were significantly different between Chinese goose breeds and foreign breeds (P<0.01). These findings will help us understand the functions of the DRD1 gene and the molecular breeding in geese.

  16. Vasomotor symptom prevalence is associated with polymorphisms in sex steroid-metabolizing enzymes and receptors.

    PubMed

    Crandall, Carolyn J; Crawford, Sybil L; Gold, Ellen B

    2006-09-01

    The relation of single nucleotide polymorphisms (SNPs) of genes involved in estrogen function to vasomotor symptoms (VMS) has been inadequately explored. We evaluated SNPs in sex steroid-metabolizing genes and estrogen receptors (ERs) for their association with VMS (hot flashes, night sweats, and/or cold sweats) reported by women who were premenopausal or in early perimenopause at baseline. The study population was drawn from participants in the Study of Women's Health Across the Nation (SWAN). African American, Caucasian, Chinese, and Japanese women, 42 to 52 years of age at baseline, who were enrolled in the longitudinal, community-based cohort of SWAN provided questionnaire, interview, weight and height measurements, and serum samples through the sixth annual visit. SNPs associated with the sex steroid hormone pathway were genotyped and available for 1,538 participants. These SNPs were associated with reporting VMS > or =6 days compared with <6 days in the past 2 weeks using race/ethnicity-specific repeated measures logistic regression models. Participants were on average 46 years old at baseline. The prevalence of VMS reporting increased in all racial/ethnic groups from baseline to the sixth annual follow-up visit. After adjustment for covariates, several SNPs encoding genes responsible for estrogen metabolism and ERs were associated with decreased odds of reporting VMS, including the CYP1B1 rs1056836 GC genotype in African American women; 17HSD rs615942 TG, 17HSD rs592389 TG, and 17HSD rs2830 AG genotypes in Caucasian women; and the CYP1A1 rs2606345 AC genotype in Chinese women. We identified race/ethnicity-specific associations between VMS reporting and specific polymorphisms for sex steroid-metabolizing enzymes and sex steroid receptors. Clarification of the mechanisms of the associations and confirmation in other populations is warranted.

  17. Vascular Endothelial Growth Factor Gene Polymorphism (rs2010963) and Its Receptor, Kinase Insert Domain-Containing Receptor Gene Polymorphism (rs2071559), and Markers of Carotid Atherosclerosis in Patients with Type 2 Diabetes Mellitus

    PubMed Central

    Merlo, Sebastjan; Starčević, Jovana Nikolajević; Mankoč, Sara; Šantl Letonja, Marija; Cokan Vujkovac, Andreja; Zorc, Marjeta; Petrovič, Daniel

    2016-01-01

    Background. The current study was designed to reveal possible associations between the polymorphisms of the vascular endothelial growth factor (VEGF) gene (rs2010963) and its receptor, kinase insert domain-containing receptor (KDR) gene polymorphism (rs2071559), and markers of carotid atherosclerosis in patients with type 2 diabetes mellitus (T2DM). Patients and Methods. 595 T2DM subjects and 200 control subjects were enrolled. The carotid intima-media thickness (CIMT) and plaque characteristics (presence and structure) were assessed ultrasonographically. Biochemical analyses were performed using standard biochemical methods. Genotyping of VEGF/KDR polymorphisms (rs2010963, rs2071559) was performed using KASPar assays. Results. Genotype distributions and allele frequencies of the VEGF/KDR polymorphisms (rs2010963, rs2071559) were not statistically significantly different between diabetic patients and controls. In our study, we demonstrated an association between the rs2071559 of KDR and either CIMT or the sum of plaque thickness in subjects with T2DM. We did not, however, demonstrate any association between the tested polymorphism of VEGF (rs2010963) and either CIMT, the sum of plaque thickness, the number of involved segments, hsCRP, the presence of carotid plaques, or the presence of unstable carotid plaques. Conclusions. In the present study, we demonstrated minor effect of the rs2071559 of KDR on markers of carotid atherosclerosis in subjects with T2DM. PMID:26881237

  18. Vascular Endothelial Growth Factor Gene Polymorphism (rs2010963) and Its Receptor, Kinase Insert Domain-Containing Receptor Gene Polymorphism (rs2071559), and Markers of Carotid Atherosclerosis in Patients with Type 2 Diabetes Mellitus.

    PubMed

    Merlo, Sebastjan; Starčević, Jovana Nikolajević; Mankoč, Sara; Šantl Letonja, Marija; Cokan Vujkovac, Andreja; Zorc, Marjeta; Petrovič, Daniel

    2016-01-01

    Background. The current study was designed to reveal possible associations between the polymorphisms of the vascular endothelial growth factor (VEGF) gene (rs2010963) and its receptor, kinase insert domain-containing receptor (KDR) gene polymorphism (rs2071559), and markers of carotid atherosclerosis in patients with type 2 diabetes mellitus (T2DM). Patients and Methods. 595 T2DM subjects and 200 control subjects were enrolled. The carotid intima-media thickness (CIMT) and plaque characteristics (presence and structure) were assessed ultrasonographically. Biochemical analyses were performed using standard biochemical methods. Genotyping of VEGF/KDR polymorphisms (rs2010963, rs2071559) was performed using KASPar assays. Results. Genotype distributions and allele frequencies of the VEGF/KDR polymorphisms (rs2010963, rs2071559) were not statistically significantly different between diabetic patients and controls. In our study, we demonstrated an association between the rs2071559 of KDR and either CIMT or the sum of plaque thickness in subjects with T2DM. We did not, however, demonstrate any association between the tested polymorphism of VEGF (rs2010963) and either CIMT, the sum of plaque thickness, the number of involved segments, hsCRP, the presence of carotid plaques, or the presence of unstable carotid plaques. Conclusions. In the present study, we demonstrated minor effect of the rs2071559 of KDR on markers of carotid atherosclerosis in subjects with T2DM.

  19. Associations between oxytocin receptor gene (OXTR) polymorphisms and self-reported aggressive behavior and anger: Interactions with alcohol consumption.

    PubMed

    Johansson, Ada; Westberg, Lars; Sandnabba, Kenneth; Jern, Patrick; Salo, Benny; Santtila, Pekka

    2012-09-01

    Oxytocin has been implicated in the regulation of social as well as aggressive behaviors, and in a recent study we found that the effect of alcohol on aggressive behavior was moderated by the individual's genotype on an oxytocin receptor gene (OXTR) polymorphism (Johansson et al., 2012). In this study we wanted to deepen and expand the analysis by exploring associations between three (rs1488467, rs4564970, rs1042778) OXTR polymorphisms and aggressive behavior, trait anger as well as anger control in a population-based sample of Finnish men and women (N=3577) aged between 18 and 49 years (M=26.45 years, SD=5.02). A specific aim was to investigate if the polymorphisms would show interactive effects with alcohol consumption on aggressive behavior and trait anger, as well as to explore whether these polymorphisms affect differences in anger control between self-reported sober and intoxicated states. The results showed no main effects of the polymorphisms, however, three interactions between the polymorphisms and alcohol consumption were found. The effect of alcohol consumption on aggressive behavior was moderated by the genotype of the individual on the rs4564970 polymorphism, in line with previous results (Johansson et al., 2012). For trait anger, both the rs1488467 and the rs4564970 polymorphisms interacted with alcohol consumption. It appears that the region of the OXTR gene including both the rs4564970 and the rs1488467 polymorphisms may be involved in the regulation of the relationship between alcohol and aggressive behavior as well as between alcohol and the propensity to react to situations with elevated levels of anger.

  20. Fc Gamma Receptor 3A Polymorphism and Risk for HIV-Associated Cryptococcal Disease

    PubMed Central

    Rohatgi, Soma; Gohil, Shruti; Kuniholm, Mark H.; Schultz, Hannah; Dufaud, Chad; Armour, Kathryn L.; Badri, Sheila; Mailliard, Robbie B.; Pirofski, Liise-anne

    2013-01-01

    ABSTRACT Cryptococcus neoformans is one of the most common causes of fungal disease in HIV-infected persons, but not all of those who are infected develop cryptococcal disease (CD). Although CD4+ T cell deficiency is a risk factor for HIV-associated CD, polymorphisms of phagocytic Fc gamma receptors (FCGRs) have been linked to CD risk in HIV-uninfected persons. To investigate associations between FCGR2A 131 H/R and FCGR3A 158 F/V polymorphisms and CD risk in HIV-infected persons, we performed PCR-based genotyping on banked samples from 164 men enrolled in the Multicenter AIDS Cohort Study (MACS): 55 who were HIV infected and developed CD and a matched control group of 54 who were HIV infected and 55 who were HIV uninfected. Using additive and allelic statistical models for analysis, the high-affinity FCGR3A 158V allele was significantly associated with CD status after adjusting for race/ethnicity (odds ratio [OR], 2.1; P = 0.005), as was the FCGR3A 158 VV homozygous genotype after adjusting for race/ethnicity, rate of CD4+ T cell decline, and nadir CD4+ T cell count (OR, 21; P = 0.005). No associations between CD and FCGR2A 131 H/R polymorphism were identified. In binding studies, human IgG (hIgG)-C. neoformans complexes exhibited more binding to CHO-K1 cells expressing FCGR3A 158V than to those expressing FCGR3A 158F, and in cytotoxicity assays, natural killer (NK) cells expressing FCGR3A 158V induced more C. neoformans-infected monocyte cytotoxicity than those expressing FCGR3A 158F. Together, these results show an association between the FCGR3A 158V allele and risk for HIV-associated CD and suggest that this polymorphism could promote C. neoformans pathogenesis via increased binding of C. neoformans immune complexes, resulting in increased phagocyte cargo and/or immune activation. PMID:23982074

  1. Toll-like Receptor 1 Polymorphisms Affect Innate Immune Responses and Outcomes in Sepsis

    PubMed Central

    Wurfel, Mark M.; Gordon, Anthony C.; Holden, Tarah D.; Radella, Frank; Strout, Jeanna; Kajikawa, Osamu; Ruzinski, John T.; Rona, Gail; Black, R. Anthony; Stratton, Seth; Jarvik, Gail P.; Hajjar, Adeline M.; Nickerson, Deborah A.; Rieder, Mark; Sevransky, Jonathan; Maloney, James P.; Moss, Marc; Martin, Greg; Shanholtz, Carl; Garcia, Joe G. N.; Gao, Li; Brower, Roy; Barnes, Kathleen C.; Walley, Keith R.; Russell, James A.; Martin, Thomas R.

    2008-01-01

    Rationale: Polymorphisms affecting Toll-like receptor (TLR)–mediated responses could predispose to excessive inflammation during an infection and contribute to an increased risk for poor outcomes in patients with sepsis. Objectives: To identify hypermorphic polymorphisms causing elevated TLR-mediated innate immune cytokine and chemokine responses and to test whether these polymorphisms are associated with increased susceptibility to death, organ dysfunction, and infections in patients with sepsis. Methods: We screened single-nucleotide polymorphisms (SNPs) in 43 TLR-related genes to identify variants affecting TLR-mediated inflammatory responses in blood from healthy volunteers ex vivo. The SNP associated most strongly with hypermorphic responses was tested for associations with death, organ dysfunction, and type of infection in two studies: a nested case–control study in a cohort of intensive care unit patients with sepsis, and a case–control study using patients with sepsis, patients with sepsis-related acute lung injury, and healthy control subjects. Measurements and Main Results: The SNP demonstrating the most hypermorphic effect was the G allele of TLR1−7202A/G (rs5743551), which associated with elevated TLR1-mediated cytokine production (P < 2 × 10−20). TLR1−7202G marked a coding SNP that causes higher TLR1-induced NF-κB activation and higher cell surface TLR1 expression. In the cohort of patients with sepsis TLR1−7202G predicted worse organ dysfunction and death (odds ratio, 1.82; 95% confidence interval, 1.07–3.09). In the case-control study TLR1−7202G was associated with sepsis-related acute lung injury (odds ratio, 3.40; 95% confidence interval, 1.59–7.27). TLR1−7202G also associated with a higher prevalence of gram-positive cultures in both clinical studies. Conclusions: Hypermorphic genetic variation in TLR1 is associated with increased susceptibility to organ dysfunction, death, and gram-positive infection in sepsis. PMID

  2. Vitamin D receptor gene polymorphisms and susceptibility of hand osteoarthritis in Finnish women

    PubMed Central

    Solovieva, Svetlana; Hirvonen, Ari; Siivola, Päivi; Vehmas, Tapio; Luoma, Katariina; Riihimäki, Hilkka; Leino-Arjas, Päivi

    2006-01-01

    We examined whether polymorphisms of the vitamin D receptor (VDR) gene was associated with individual risk of hand osteoarthritis (OA). Radiographs of both hands of 295 dentists and of 248 teachers were examined and classified for the presence of OA using reference images. The VDR ApaI and TaqI genotypes were determined by PCR-based methods. No association was observed between the VDR polymorphisms and the odds of overall hand OA. However, the carriers of the VDR t allele or At haplotype were at almost half the odds of symmetrical hand OA (odds ratio [OR] = 0.60, 95% confidence interval [CI] = 0.38–0.94 and OR = 0.59, 95% CI = 0.38–0.93, respectively) compared with the carriers of the T allele and of the non-At haplotype, respectively. Increased odds of this disease, on the contrary, was observed for women with two copies of the VDR a allele (OR = 1.93, 95% CI = 1.99–3.70) compared with women with the AA genotype. Conversely, the VDR a allele carriage was associated with a tendency of lowered odds of osteophyte (OR = 0.51, 95% CI = 0.25–1.03). When the genotype data were used to construct haplotypes, the VDR AaTt joint genotype appeared to pose a remarkably lower odds (OR = 0.26, 95% CI = 0.08–0.91) of osteophyte compared with the AAtt joint genotype. As a novel finding we observed a joint effect of a low calcium intake and VDR polymorphisms on symmetrical OA; the OR was 2.64 (95% CI = 1.29–5.40) for carriers of the aT haplotype with low daily calcium intake compared with non-carriers of the haplotype with high daily calcium intake. Our results suggest that VDR gene polymorphisms play a role in the etiology of symmetrical hand OA. Moreover, the association between the VDR gene and OA may be modified by calcium intake. PMID:16507122

  3. Prognostic significance of fibroblast growth factor receptor 4 polymorphisms on biochemical recurrence after radical prostatectomy in a Chinese population

    PubMed Central

    Chen, Luyao; Lei, Zhengwei; Ma, Xin; Huang, Qingbo; Zhang, Xu; Zhang, Yong; Hao, Peng; Yang, Minggang; Zhao, Xuetao; Chen, Jun; Liu, Gongxue; Zheng, Tao

    2016-01-01

    Fibroblast growth factor receptor 4 (FGFR4) is a transmembrane receptor with ligand-induced tyrosine kinase activity and is involved in various biological and pathological processes. Several polymorphisms of FGFR4 are associated with the incidence and mortality of numerous cancers, including prostate cancer. In this study, we investigated whether the polymorphisms of FGFR4 influence the biochemical recurrence of prostate cancer in Chinese men after radical prostatectomy. Three common polymorphisms (rs1966265, rs2011077, and rs351855) of FGFR4 were genotyped from 346 patients with prostate cancer by using the Sequenom MassARRAY system. Kaplan–Meier curves and Cox proportional hazard models were used for survival analysis. Results showed biochemical recurrence (BCR) free survival was significantly affected by the genotypes of rs351855 but not influenced by rs1966265 and rs2011077. After adjusting for other variables in multivariable analysis, patients with rs351855 AA/AG genotypes showed significantly worse BCR-free survival than those with the GG genotype (HR = 1.873; 95% CI, 1.209–2.901; P = 0.005). Hence, FGFR4 rs351855 could be a novel independent prognostic factor of BCR after radical prostatectomy in the Chinese population. This functional polymorphism may also provide a basis for surveillance programs. Additional large-scale studies must be performed to validate the significance of this polymorphism in prostate cancer. PMID:27640814

  4. The promoter polymorphisms of receptor for advanced glycation end products were associated with the susceptibility and progression of sepsis.

    PubMed

    Shao, Y; Shao, X; He, J; Cai, Y; Zhao, J; Chen, F; Tao, H; Yin, Z; Tan, X; He, Y; Lin, Y; Li, K; Cui, L

    2017-04-01

    Receptor for advanced glycation end products (RAGE) is considered a major pattern recognition receptor, which plays an important role in the development of sepsis. Increasing evidence showed an association between RAGE polymorphisms and the susceptibility to several inflammatory-related diseases. However, little is known about the clinical relationship between RAGE polymorphisms and sepsis. In this study, we analyzed the association of sepsis with three functional RAGE gene polymorphisms (rs1800624, rs1800625 and rs2070600) in a Chinese Han population (372 sepsis cases and 400 healthy controls). Significant differences were observed in the rs1800624 and rs1800625 genotype/allele distributions between the sepsis and controls, but no significant difference was observed in the rs2070600 genotype/allele. Moreover, our results also revealed a significant difference in the genotype/allele frequencies of the rs1800624 and rs1800625 polymorphisms between the sepsis and severe sepsis subtypes, the rs1800624 TT or rs1800625 TT genotype carriers exhibited a significant increase in RAGE mRNA, sRAGE, TNF-α and IL-6 expression compared with the rs1800624 AT/AA or rs1800625 CT/CC carriers in sepsis patients. Overall, this study might provide valuable clinical evidence between the RAGE gene polymorphisms and the risk or the development of sepsis.

  5. Association of IFN-γ and P2X7 Receptor Gene Polymorphisms in Susceptibility to Tuberculosis Among Iranian Patients.

    PubMed

    Shamsi, Mahdi; Zolfaghari, Mohammad Reza; Farnia, Parissa

    2016-03-01

    Interferon-gamma (IFN-γ) and P2X7 receptor are crucial for host defence against mycobacterial infections. Recent studies have indicated that IFN-γ, IFN-γ receptor 1 (IFN-γR1) andP2X7 gene polymorphisms are associated with susceptibility to pulmonary tuberculosis (TB). However, the relationship between IFN-γ and P2X7 polymorphism and TB susceptibility remains inconclusive in Iranian population. For this reason, single nucleotide polymorphisms (SNPs) in IFN-γ (G+2109A), IFN-γR1 (G-611A) and P2X7 genes (at -762, 1513 position) in patients (n = 100) were assessed using PCR-RFLP. Data were analysed with SPSS version 18. For the 2109 loci of IFN-γ gene, the frequency of mutant alleles between patients and controls were not statistically significant. However, there was a significant difference between the TB patient and controls for -611 alleles of IFN-γR1 (P = 0.01). Additionally, the frequency of P2X7 gene polymorphisms (SNP-762 and 1513) between patients and controls was statistically significant. In conclusions, our study revealed a significant association of IFN-γR1 and P2X7 genes polymorphisms with risk of developing TB in Iranian population.

  6. Investigation of 1377C/T polymorphism of the Toll-like receptor 3 among patients with chronic hepatitis B.

    PubMed

    Goktas, Emine Firat; Bulut, Cemal; Goktas, Mustafa Tugrul; Ozer, Erdem Kamil; Karaca, Ragip Ozgur; Kinikli, Sami; Demiroz, Ali Pekcan; Bozkurt, Atilla

    2016-07-01

    The immunopathogenesis of chronic hepatitis B (CHB) has not been clarified yet. Toll-like receptors (TLR) are a receptor family that initiates immunity with exogenous-endogenous ligands and plays a role in the pathogenesis of infections. In this study, we aimed to investigate the frequency of TLR 3 1377C/T (rs3775290) polymorphism and its role in patients with CHB. We included 50 healthy individuals as control group and 73 active and 43 inactive hepatitis B patients. All DNA samples were isolated from blood samples. For the detection of TLR 3 1377C/T single-nucleotide polymorphism, restriction fragment length polymorphism was used. A statistically significant difference was determined in Hepatitis B virus (HBV) DNA levels of CHB patients with the CC, CT, and TT genotypes (p = 0.013). The highest levels of HBV DNA were detected in individuals with TT genotypes. Additionally, the frequency of CC genotype was higher in the active CHB patients compared with that of the inactive CHB patients (p = 0.044). No statistically significant difference in TLR 3 1377C/T polymorphism was detected between healthy controls and the hepatitis B patients (p = 0.342). In conclusion, HBV DNA level was higher in the individuals with TT genotype, and CC genotype was more frequent in the active CHB patients. These results suggest a possible association between CHB and TLR 3 gene (1377C/T) polymorphism.

  7. Relationship Between Genotype Variants Follicle-stimulating Hormone Receptor Gene Polymorphisms (FSHR) and Morphology of Oocytes Prior to ICSI Procedures

    PubMed Central

    Gashi, Zafer; Elezaj, Shkelzen; Zeqiraj, Afrim; Grabanica, Driton; Shabani, Isak; Gruda, Bujar; Gashi, Fitore

    2016-01-01

    Introduction: This study investigated association of Asn680Ser FSHR polymorphism with the ovarian response in 104 women of Albanian ethnic population enrolled in ICSI program. The reason of infertility in all cases has been identified as male factor. Methods: Analysis of the Asn680Ser polymorphism was performed using TaqMan® SNP Genotyping Assay. Clinical and endocrinologic parameters were analyzed based on the genotype, age, BMI, oocyte yield, number of transferred embryos and pregnancy rate. Results: The frequencies of the Asn680 Ser genotype variants were as follows: Asn/Asn 22.1%, Asn/Ser 47.1%, and Ser/Ser 30.8%, respectively. BMI was significantly higher in the Ser/Ser group as compared to those from the Asn/Ser or the Asn/Asn group (p= 0.0010). The genotype variants Ser/Ser indicates a higher rate of oocyte retrieval (25.9%) in the immature form, metaphase I (MI) as opposed to the other two groups (Asn/Asn 23.7 % vs. Asn/Ser 21.9%), which was statistically significant (p = 0.3020). Conclusions: FSH receptor polymorphism is associated with different ovarian response to controlled ovarian stimulation (COS), but is not an important factor in increasing the degree of pregnancy. Polymorphisms of the FSH receptor is associated with normal morphology and genetic maturation (metaphase II) oocytes in dependence of genotypic variation polymorphisms. PMID:27994298

  8. Association between Estrogen Receptor Alpha Gene Polymorphisms and Susceptibility to Idiopathic Scoliosis in Bulgarian Patients: A Case-Control Study

    PubMed Central

    Nikolova, Svetla; Yablanski, Vasil; Vlaev, Evgeni; Stokov, Luben; Savov, Alexey; Kremensky, Ivo

    2015-01-01

    BACKGROUND: The current consensus on idiopathic scoliosis maintains that it has a multifactorial etiology with genetic predisposing factors. AIM: Estrogen receptor alpha gene has been considered as candidate gene of idiopathic scoliosis. MATERIAL AND METHODS: We conducted a case-control study of Bulgarian population samples (eighty patients with idiopathic scoliosis and one hundred-sixty healthy unrelated gender-matched controls) trying to investigate the association between common genetic polymorphisms of estrogen receptor alpha and the susceptibility to idiopathic scoliosis. Molecular detection of the restriction polymorphisms XbaI and PvuII was performed by polymerase chain reaction following by restriction fragment length polymorphism. The statistical analysis was performed by Pearson’s chi-squared test. RESULTS: Our case-control study showed statistically significant association between the PvuII polymorphism and susceptibility to idiopathic scoliosis and curve progression. No genotype or allele of XbaI polymorphism was found to be correlated with the onset or severity of the disease. CONCLUSIONS: The identification of molecular markers with diagnostic and prognostic value could be useful for early detection of children at risk for the development of scoliosis and for prognosis of the risk for a rapid deformity progression. That would facilitate the therapy decisions and early stage treatment of the patient with the least invasive procedures. PMID:27275235

  9. Association of mu-opioid receptor gene polymorphism A118G with alcohol dependence in a Japanese population.

    PubMed

    Nishizawa, Daisuke; Han, Wenhua; Hasegawa, Junko; Ishida, Takafumi; Numata, Yukio; Sato, Tadahiro; Kawai, Atsuko; Ikeda, Kazutaka

    2006-01-01

    Ethanol is considered to activate the brain reward system by increasing the release of an endogenous opioid receptor ligand, beta-endorphin. The polymorphism A118G in the mu-opioid receptor gene (OPRM1) causes the amino acid change Asn40Asp and has been reported to affect the affinity of the ligand for the receptor. The association of this polymorphism with the vulnerability to alcohol dependence has been studied in many populations, but not yet in Japanese people. In the present study, we compared the frequencies of the polymorphism OPRM1 A118G between patients with alcohol dependence and healthy control subjects living in a Japanese provincial prefecture. We also genotyped a polymorphism, G1510A, in the acetaldehyde dehydrogenase 2 gene (ALDH2), in which the A allele causes poor metabolism of acetaldehyde, a major metabolite of alcohol. Both OPRM1 118G and ALDH2 1510G were significantly associated with alcohol dependence. These results suggest that OPRM1 118G in addition to ALDH2 1510G might be one of the risk factors for alcohol dependence in Japanese people.

  10. Estrogen receptor alpha single nucleotide polymorphism as predictor of diabetes type 2 risk in hypogonadal men.

    PubMed

    Linnér, Carl; Svartberg, Johan; Giwercman, Aleksander; Giwercman, Yvonne Lundberg

    2013-06-01

    Estradiol (E2) is, apart from its role as a reproductive hormone, also important for cardiac function and bone maturation in both genders. It has also been shown to play a role in insulin production, energy expenditure and in inducing lipolysis. The aim of the study was to investigate if low circulating testosterone or E2 levels in combination with variants in the estrogen receptor alpha (ESR1) and estrogen receptor beta (ESR2) genes were of importance for the risk of type-2 diabetes. The single nucleotide polymorphisms rs2207396 and rs1256049, in ESR1 and ESR2, respectively, were analysed by allele specific PCR in 172 elderly men from the population-based Tromsø study. The results were adjusted for age. In individuals with low total (≤11 nmol/L) or free testosterone (≤0.18 nmol/L) being carriers of the variant A-allele in ESR1 was associated with 7.3 and 15.9 times, respectively, increased odds ratio of being diagnosed with diabetes mellitus type 2 (p = 0.025 and p = 0.018, respectively). Lower concentrations of E2 did not seem to increase the risk of being diagnosed with diabetes. In conclusion, in hypogonadal men, the rs2207396 variant in ESR1 predicts the risk of type 2 diabetes.

  11. Genetic imaging of the association of oxytocin receptor gene (OXTR) polymorphisms with positive maternal parenting

    PubMed Central

    Michalska, Kalina J.; Decety, Jean; Liu, Chunyu; Chen, Qi; Martz, Meghan E.; Jacob, Suma; Hipwell, Alison E.; Lee, Steve S.; Chronis-Tuscano, Andrea; Waldman, Irwin D.; Lahey, Benjamin B.

    2013-01-01

    Background: Well-validated models of maternal behavior in small-brain mammals posit a central role of oxytocin in parenting, by reducing stress and enhancing the reward value of social interactions with offspring. In contrast, human studies are only beginning to gain insights into how oxytocin modulates maternal behavior and affiliation. Methods: To explore associations between oxytocin receptor genes and maternal parenting behavior in humans, we conducted a genetic imaging study of women selected to exhibit a wide range of observed parenting when their children were 4–6 years old. Results: In response to child stimuli during functional magnetic resonance imaging (fMRI), hemodynamic responses in brain regions that mediate affect, reward, and social behavior were significantly correlated with observed positive parenting. Furthermore, single nucleotide polymorphisms (SNPs) (rs53576 and rs1042778) in the gene encoding the oxytocin receptor were significantly associated with both positive parenting and hemodynamic responses to child stimuli in orbitofrontal cortex (OFC), anterior cingulate cortex (ACC), and hippocampus. Conclusions: These findings contribute to the emerging literature on the role of oxytocin in human social behavior and support the feasibility of tracing biological pathways from genes to neural regions to positive maternal parenting behaviors in humans using genetic imaging methods. PMID:24550797

  12. Extraversion. Interaction between D2 dopamine receptor polymorphisms and parental alcoholism.

    PubMed

    Ozkaragoz, T; Noble, E P

    2000-11-01

    Both molecular genetic factors (the D2 dopamine receptor (DRD2) and the D4 dopamine receptor (DRD4) polymorphisms) and environmental influences of living in an alcoholic or nonalcoholic home on the personality traits of Extraversion and Neuroticism were assessed in drug-naive, young adolescent boys. There were no significant main effects of genetic or environmental factors on either Neuroticism or Extraversion as measured by the Junior Eysenck Personality Inventory (JEPI). However, a significant interaction between DRD2 (but not DRD4) alleles and environmental variables was observed on Extraversion. Specifically, children with the minor alleles of the DRD2 gene showed a significantly greater Extraversion score when living in an alcoholic than in a nonalcoholic home. In contrast, children with the major alleles of the DRD2 gene showed a trend in the opposite direction. Although the results are preliminary and pending replication, they nevertheless provide the first report of a specific gene-environment interaction involving a human personality trait.

  13. Common polymorphism in the oxytocin receptor gene (OXTR) is associated with human social recognition skills

    PubMed Central

    Skuse, David H.; Lori, Adriana; Cubells, Joseph F.; Lee, Irene; Conneely, Karen N.; Puura, Kaija; Lehtimäki, Terho; Binder, Elisabeth B.; Young, Larry J.

    2014-01-01

    The neuropeptides oxytocin and vasopressin are evolutionarily conserved regulators of social perception and behavior. Evidence is building that they are critically involved in the development of social recognition skills within rodent species, primates, and humans. We investigated whether common polymorphisms in the genes encoding the oxytocin and vasopressin 1a receptors influence social memory for faces. Our sample comprised 198 families, from the United Kingdom and Finland, in whom a single child had been diagnosed with high-functioning autism. Previous research has shown that impaired social perception, characteristic of autism, extends to the first-degree relatives of autistic individuals, implying heritable risk. Assessments of face recognition memory, discrimination of facial emotions, and direction of gaze detection were standardized for age (7–60 y) and sex. A common SNP in the oxytocin receptor (rs237887) was strongly associated with recognition memory in combined probands, parents, and siblings after correction for multiple comparisons. Homozygotes for the ancestral A allele had impairments in the range −0.6 to −1.15 SD scores, irrespective of their diagnostic status. Our findings imply that a critical role for the oxytocin system in social recognition has been conserved across perceptual boundaries through evolution, from olfaction in rodents to visual memory in humans. PMID:24367110

  14. Human complement C3b/C4b receptor (CR1) mRNA polymorphism that correlates with the CR1 allelic molecular weight polymorphism

    SciTech Connect

    Holers, V.M.; Chaplin, D.D.; Leykam, J.F.; Gruner, B.A.; Kumar, V.; Atkinson, J.P.

    1987-04-01

    The human C3b/C4b receptor (CR1) is a M/sub r/ approx. = 200,000 single-chain integral membrane glycoprotein of human erythrocytes and leukocytes. It functions both as a receptor for C3b- and C4b-coated ligands and as a regulator of complement activation. Prior structural studies have defined an unusual molecular weight allelic polymorphism in which the allelic products differ in molecular weight by as much as 90,000. On peripheral blood cells there is codominant expression of CR1 gene products of M/sub r/ 190,000 (A), 220,000 (B), 160,000 (C), and 250,000 (D). Results of prior biosynthetic and tryptic peptide mapping experiments have suggested that the most likely basis for the allelic molecular weight differences if at the polypeptide level. In order to define further the molecular basis for these molecular weight differences, human CR1 was purified to homogeneity, tryptic peptide fragments were isolated by HPLC and sequenced, oligonucleotide probes were prepared, and a CR1 cDNA was identified. A subclone of this CR1 cDNA was used as a probe of RNA blots of Epstein-Barr virus-transformed cell lines expressing the allelic variants. Each allelic variant encodes two distinct transcripts. A mRNA size polymorphism was identified that correlated with the gene product molecular weight polymorphism. This finding, in addition to a prior report of several homologous repeats in CR1, is consistent with the hypothesis that the molecular weight polymorphism is determined at the genomic level and may have been generated by unequal crossing-over.

  15. Genetic Polymorphisms Affect Mouse and Human Trace Amine-Associated Receptor 1 Function

    PubMed Central

    Shi, Xiao; Walter, Nicole A. R.; Harkness, John H.; Neve, Kim A.; Williams, Robert W.; Lu, Lu; Belknap, John K.; Eshleman, Amy J.; Phillips, Tamara J.; Janowsky, Aaron

    2016-01-01

    Methamphetamine (MA) and neurotransmitter precursors and metabolites such as tyramine, octopamine, and β-phenethylamine stimulate the G protein-coupled trace amine-associated receptor 1 (TAAR1). TAAR1 has been implicated in human conditions including obesity, schizophrenia, depression, fibromyalgia, migraine, and addiction. Additionally TAAR1 is expressed on lymphocytes and astrocytes involved in inflammation and response to infection. In brain, TAAR1 stimulation reduces synaptic dopamine availability and alters glutamatergic function. TAAR1 is also expressed at low levels in heart, and may regulate cardiovascular tone. Taar1 knockout mice orally self-administer more MA than wild type and are insensitive to its aversive effects. DBA/2J (D2) mice express a non-synonymous single nucleotide polymorphism (SNP) in Taar1 that does not respond to MA, and D2 mice are predisposed to high MA intake, compared to C57BL/6 (B6) mice. Here we demonstrate that endogenous agonists stimulate the recombinant B6 mouse TAAR1, but do not activate the D2 mouse receptor. Progeny of the B6XD2 (BxD) family of recombinant inbred (RI) strains have been used to characterize the genetic etiology of diseases, but contrary to expectations, BXDs derived 30–40 years ago express only the functional B6 Taar1 allele whereas some more recently derived BXD RI strains express the D2 allele. Data indicate that the D2 mutation arose subsequent to derivation of the original RIs. Finally, we demonstrate that SNPs in human TAAR1 alter its function, resulting in expressed, but functional, sub-functional and non-functional receptors. Our findings are important for identifying a predisposition to human diseases, as well as for developing personalized treatment options. PMID:27031617

  16. Polymorphisms of the Kappa Opioid Receptor and Prodynorphin Genes: HIV risk and HIV Natural History

    PubMed Central

    Proudnikov, Dmitri; Randesi, Matthew; Levran, Orna; Yuferov, Vadim; Crystal, Howard; Ho, Ann; Ott, Jurg; Kreek, Mary Jeanne

    2013-01-01

    Objective Studies indicate cross-desensitization between opioid receptors (e.g., kappa opioid receptor, OPRK1), and chemokine receptors (e.g., CXCR4) involved in HIV infection. We tested whether gene variants of OPRK1 and its ligand, prodynorphin (PDYN), influence the outcome of HIV therapy. Methods Three study points, admission to the Women’s Interagency HIV Study (WIHS), initiation of highly active antiretroviral therapy (HAART) and the most recent visit were chosen for analysis as crucial events in the clinical history of the HIV patients. Regression analyses of 17 variants of OPRK1, and 11 variants of PDYN with change of viral load (VL) and CD4 count between admission and initiation of HAART, and initiation of HAART to the most recent visit to WIHS were performed in 598 HIV+ subjects including African Americans, Hispanics and Caucasians. Association with HIV status was done in 1009 subjects. Results Before HAART, greater VL decline (improvement) in carriers of PDYN IVS3+189C>T, and greater increase of CD4 count (improvement) in carriers of OPRK1 −72C>T, were found in African Americans. Also, greater increase of CD4 count in carriers of OPRK1 IVS2+7886A>G, and greater decline of CD4 count (deterioration) in carriers of OPRK1 −1205G>A, were found in Caucasians. After HAART, greater decline of VL in carriers of OPRK1 IVS2+2225G>A, and greater increase of VL in carriers of OPRK1 IVS2+10658G>T and IVS2+10963A>G, were found in Caucasians. Also, a lesser increase of CD4 count was found in Hispanic carriers of OPRK1 IVS2+2225G>A. Conclusion OPRK1 and PDYN polymorphisms may alter severity of HIV infection and response to treatment. PMID:23392455

  17. Desensitization of the Y1 cell adrenocorticotropin receptor: evidence for a restricted heterologous mechanism implying a role for receptor-effector complexes.

    PubMed

    Baig, A H; Swords, F M; Noon, L A; King, P J; Hunyady, L; Clark, A J

    2001-11-30

    Receptor desensitization provides a potential mechanism for the regulation of adrenocortical adrenocorticotropin (ACTH) responsiveness. Using the mouse adrenocortical Y1 cell line we demonstrate that ACTH effectively desensitizes the cAMP response of its own receptor, the melanocortin 2 receptor (MC2R), in these cells with a maximal effect between 30 and 60 min. Neither forskolin nor isoproterenol (in Y1 cells stably transfected with the beta(2)-adrenergic receptor) desensitize this ACTH response. ACTH desensitizes its receptor at concentrations at which only a fraction of receptors are occupied, implying that this mechanism acts on agonist-unoccupied receptors. Y1 cells express G protein-coupled receptor kinase (GRK) 2 and 5, but stable expression of a dominant negative GRK2 (K220W) only marginally reduces the desensitization by ACTH. The protein kinase A (PKA) inhibitor, H89, extinguishes almost the entire desensitization response over the initial 30-min period at all concentrations of ACTH. A mutant MC2R in which the single consensus PKA phosphorylation site has been mutated (S208A) when expressed in MC2R-negative Y6 cells is also unable to desensitize. These data imply a heterologous, PKA-dependent, mode of desensitization, which is restricted to agonist-occupied and -unoccupied MC2R, possibly as a consequence of receptor/effector complexes that functionally compartmentalize this receptor.

  18. Association study between growth hormone receptor (GHR ) gene polymorphisms and obesity in Korean population

    PubMed Central

    Yang, Seung-Ae

    2016-01-01

    A main target of growth hormone (GH) is adipose tissue in human body. The GH secretion in obesity patients is impaired. It is needless to say that growth hormone receptor (GHR) is necessary in GH hormone signaling. The purpose of the present study is to examine the association between single nucleotide polymorphisms (SNPs) and the development of obesity. A total of 211 overweight/obese subjects with a body mass index (BMI) ≥23 kg/m2 and 157 nonoverweight/obese controls with a BMI of 18.5–23.0 kg/m2 were involved in this study. Seven SNPs including the rs6451620 (intron), rs4130114 (intron), rs4410646 (intron), rs6898743 (intron), rs4394131 (intron), rs6182 (Cys440Phe), and rs6184 (Pro579Thr) and rs2229765 SNPs of GHR gene were genotyped. Genotyping was performed using custom DNA chip. SNPStats was used to calculate the odds ratio, 95% confidence interval, and P-value. The link-age disequilibrium block and haplotypes among seven SNPs were determined using Haploview version 4.2. Dominant, recessive, and log-additive genetic models were conducted for genetic analyzing. Among tested SNPs in GHR gene, rs4410646 and rs6898743 showed significant association with obesity (rs4410646, P=0.02 in dominant model and P=0.036 in log-additive model; rs6898743, P=0.039 in dominant model and P=0.044 in log-additive model). In summary, these results suggest that GHR gene polymorphisms might play a role in the development of obesity in the Korean population. PMID:28119888

  19. Contribution of oxytocin receptor polymorphisms to amygdala activation in schizophrenia spectrum disorders

    PubMed Central

    Bettella, Francesco; Brandt, Christine Lycke; Quintana, Daniel S.; Nerhus, Mari; Bjella, Thomas; Djurovic, Srdjan; Westlye, Lars T.; Andreassen, Ole A.; Melle, Ingrid; Tesli, Martin

    2016-01-01

    Background Oxytocin has been proposed to mediate amygdala dysfunction associated with altered emotion processing in schizophrenia, but the contribution of oxytocin pathway genes is yet to be investigated. Aims To identify potential different contributions of three oxytocin receptor polymorphisms (rs53576, rs237902 and rs2254298) between patients with schizophrenia spectrum disorders (SCZ), affective spectrum disorders (AD) and healthy controls (HC). Method In a total of 346 participants (104 with SCZ, 100 with AD, and 142 HC) underwent genotyping and functional magnetic resonance imaging (fMRI) during an emotional faces matching paradigm. Genetic association analyses were performed to test the possible effects on task-induced BOLD amygdala response to fearful/angry faces. Results In participants with SCZ, the rs237902 G allele was associated with low amygdala activation (left hemisphere: b=−4.99, Bonferroni corrected P=0.04) and interaction analyses showed that this association was disorder specific (left hemisphere: Bonferroni corrected P=0.003; right hemisphere: Bonferroni corrected P=0.03). There were no associations between oxytocin polymorphisms and amygdala activation in the total sample, among AD patients or HC. Conclusions Rs237902 was associated with amygdala activation in response to fearful/angry faces only in patients with SCZ. Our findings indicate that the endogenous oxytocin system could serve as a contributing factor in biological underpinnings of emotion processing and that this contribution is disorder specific. Declaration of interest O.A.A. received speaker’s honoraria from GSK, Otsuka, Lundbeck. Copyright and usage © The Royal College of Psychiatrists 2016. This is an open access article distributed under the terms of the Creative Commons Non-Commercial, No Derivatives (CC BY-NC-ND) licence. PMID:27847593

  20. Characterization and validation of bovine gonadotripin releasing hormone receptor (GNRHR) polymorphisms.

    PubMed

    Lirón, J P; Prando, A; Ripoli, M V; Rogberg-Muñoz, A; Posik, D M; Baldo, A; Peral-García, P; Giovambattista, G

    2011-12-01

    Gonadotropin releasing hormone and its receptor (GNRHR) play a critical role in sexual differentiation and reproduction. Available evidence shows a strong genetic component in the timing of puberty. In bovines, there are significant differences within and among beef breeds in the time when bulls reach puberty. Despite its economic importance, there are not many SNPs or genetic markers associated with this characteristic. The aims of the study were to identify DNA polymorphism in the bovine GNRHR by re-sequencing analysis, determine haplotype phases, and perform a population study in a selected tag SNP in six breeds. Eight SNPs were detected, including: one in the Upstream Regulatory Region (URR), five in the coding regions, and two in non-coding regions. This polymorphism level corresponds to one variant every 249.4bp and a global nucleotide diversity of 0.385. Two haplogroups comprising nine haplotypes and two linkage blocks were detected. Despite 5 tag SNPs were required to capture all variability, just one SNP allowed to define both haplogroups, and only two SNPs were needed to differentiate the most common haplotypes. An additional taq SNP was necessary to identify both URR variants. Allele-frequency analysis of a selected taq SNP among breeds showed a geographical cline. European Bos taurus breeds had lower frequencies of the C allele than B. indicus type cattle, while Creole cattle and Wagyu breeds had intermediate frequency. There was a significant correlation between frequency profile and timing of puberty among the studied breeds, which seems to suggest that genetic variation within bovine GNRHR gene could explain at least part of the reported variability.

  1. Effect of epidermal growth factor receptor gene polymorphisms on prognosis in glioma patients

    PubMed Central

    Li, Jingjie; Yan, Mengdan; Xie, Zhilan; Zhu, Yuanyuan; Chen, Chao; Jin, Tianbo

    2016-01-01

    Previous studies suggested that single nucleotide polymorphisms (SNPs) in epidermal growth factor receptor (EGFR) are associated with risk of glioma. However, the associations between these SNPs and glioma patient prognosis have not yet been fully investigated. Therefore, the present study was aimed to evaluate the effects of EGFR polymorphisms on the glioma patient prognosis. We retrospectively evaluated 269 glioma patients and investigated associations between EGFR SNPs and patient prognosis using Cox proportional hazard models and Kaplan-Meier curves. Univariate analysis revealed that age, gross-total resection and chemotherapy were associated with the prognosis of glioma patients (p < 0.05). In addition, four EGFR SNPs (rs11506105, rs3752651, rs1468727 and rs845552) correlated with overall survival (OS) (Log-rank p = 0.011, 0.020, 0.008, and 0.009, respectively) and progression-free survival PFS (Log-rank p = 0.026, 0.024, 0.019 and 0.009, respectively). Multivariate analysis indicated that the rs11506105 G/G genotype, the rs3752651 and rs1468727 C/C genotype and the rs845552 A/A genotype correlated inversely with OS and PFS. In addition, OS among patients with the rs730437 C/C genotype (p = 0.030) was significantly lower OS than among patients with A/A genotype. These data suggest that five EGFR SNPs (rs11506105, rs3752651, rs1468727, rs845552 and rs730437) correlated with glioma patient prognosis, and should be furthered validated in studies of ethnically diverse patients. PMID:27437777

  2. Interleukin-1β and interleukin-1receptor antagonist polymorphisms in Egyptian children with febrile seizures

    PubMed Central

    Al Morshedy, Salah; Elsaadany, Hosam F.; Ibrahim, Hany E.; Sherif, Ashraf M.; Farghaly, Mohsen A.A.; Allah, Mayy A.N.; Abouzeid, Heba; Elashkar, Shaimaa S.A.; Hamed, Mohammed E.; Fathy, Manar M.; Khalil, Atef M.; Noah, Maha A.; Hegab, Mohamed S.; Ahmed, Ahmed R.; Hashem, Mustafa I.A.; Emam, Ahmed A.; Anany, Heba G.; Ibrahim, Boshra R.; Gawish, Heba H.; Nabil, Rehab M.; Fattah, Lobna Abdel; Alsayed, Salah F.

    2017-01-01

    Abstract Febrile seizure is the most common seizure disorder of childhood. Of the pro-inflammatory cytokines, interleukin-1 is defined as the first endogenous pyrogen. We designed this study to investigate single-nucleotide polymorphisms (SNPs) situated at positions –31 (C/T), and –511 (C/T) of interleukin-1beta (IL-1β) gene promoter and interleukin-1receptor antagonist (IL-1RA) gene variable number of tandem repeats in intron 2 (VNTR); to determine whether these polymorphisms could be a marker of susceptibility to febrile seizures in Egyptian children and we also measured the serum level of IL-1β to assess its relation to such polymorphisms. This was a case-control study included 155 patients with febrile seizure, and matched with age, sex, ethnicity 155 healthy control subjects. IL-1β promoter at positions −31 (C/T), −511 (C/T), and IL-1RA gene VNTR polymorphisms were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), while the serum IL-1β levels were measured by enzyme-linked immunosorbent assay (ELISA) method. The frequency of the IL-1β-511 TT genotype and T allele at the same position were observed to be increased in patients with febrile seizures (FS) compared with the control group (odds ratio [OR]: 3.96; 95% confidence interval [CI]: 1.68–9.5; P = 0.001 for the TT genotype and OR: 1.65; 95% CI: 1.18–2.3; P = 0.003 for the T allele, respectively). The IL-1 RA II/II homozygous variant and IL-1 RA allele II were overrepresented in patients with FS than control group (OR: 4.02; 95% CI: 1.78–9.15; P = 0.001and OR: 1.73; 95% CI: 1.24–2.4; P = 0.001, respectively). We found a significant positive association between the IL-1 RA II/II genotype and susceptibility to FS in sporadic cases as did allele II at the same position (OR: 5.04; 95% CI: 2.1–12.5 for the IL-1 RA II/II genotype; P = 0.001) and (OR: 1.94; 95% CI: 1.3–2.8 for the allele II; P = 0.001, respectively

  3. Polymorphism in the tumour necrosis factor receptor II gene is associated with circulating levels of soluble tumour necrosis factor receptors in rheumatoid arthritis

    PubMed Central

    Glossop, John R; Dawes, Peter T; Nixon, Nicola B; Mattey, Derek L

    2005-01-01

    Levels of soluble tumour necrosis factor receptors (sTNFRs) are elevated in the circulation of patients with rheumatoid arthritis (RA). Although these receptors can act as natural inhibitors of tumour necrosis factor-α, levels of sTNFRs in RA appear to be insufficient to prevent tumour necrosis factor-α induced inflammation. The factors that regulate circulating levels of sTNFRs are unclear, but polymorphisms in the tumour necrosis factor receptor genes may play a role. We investigated the relationship between polymorphisms in the tumour necrosis factor receptor I (TNF-RI) and II (TNF-RII) genes and levels of sTNFRs in two groups of Caucasian RA patients: one with early (disease duration ≤2 years; n = 103) and one with established disease (disease duration ≥5 years; n = 151). PCR restriction fragment length polymorphism analysis was used to genotype patients for the A36G polymorphism in the TNF-RI gene and the T676G polymorphism in TNF-RII. Levels of sTNFRs were measured using ELISA. We also isolated T cells from peripheral blood of 58 patients with established RA with known TNF-R genotypes, and release of sTNFRs into the culture medium was measured in cells incubated with or without phytohaemagglutinin. Serum levels of the two sTNFRs (sTNF-RI and sTNF-RII) were positively correlated in both populations, and the level of each sTNFR was significantly higher in the patients with established disease (P < 0.0001). Multiple regression analyses corrected for age, sex and disease duration revealed a significant trend toward decreasing sTNF-RI and sTNF-RII levels across the TNF-RII genotypes (TT > TG > GG) of patients with established disease (P for trend = 0.01 and P for trend = 0.03, respectively). A similar nonsignificant trend was seen for early disease. No relationship with the TNF-RI A36G polymorphism was observed. sTNFRs released by isolated T cells exhibited a similar trend toward decreasing levels according to TNF-RII genotype, although only the association

  4. Adrenergic Receptor Polymorphism and Maximal Exercise Capacity after Orthotopic Heart Transplantation

    PubMed Central

    Feliciano, Helene; Martin, David; Regamey, Julien; Tozzi, Piergiorgio; Meyer, Philippe; Hullin, Roger

    2016-01-01

    Background Maximal exercise capacity after heart transplantion (HTx) is reduced to the 50–70% level of healthy controls when assessed by cardiopulmonary exercise testing (CPET) despite of normal left ventricular function of the donor heart. This study investigates the role of donor heart β1 and β2- adrenergic receptor (AR) polymorphisms for maximal exercise capacity after orthotopic HTx. Methods CPET measured peak VO2 as outcome parameter for maximal exercise in HTx recipients ≥9 months and ≤4 years post-transplant (n = 41; mean peak VO2: 57±15% of predicted value). Donor hearts were genotyped for polymorphisms of the β1-AR (Ser49Gly, Arg389Gly) and the β2-AR (Arg16Gly, Gln27Glu). Circumferential shortening of the left ventricle was measured using magnetic resonance based CSPAMM tagging. Results Peak VO2 was higher in donor hearts expressing the β1-Ser49Ser alleles when compared with β1-Gly49 carriers (60±15% vs. 47±10% of the predicted value; p = 0.015), and by trend in cardiac allografts with the β1-AR Gly389Gly vs. β1-Arg389 (61±15% vs. 54±14%, p = 0.093). Peak VO2 was highest for the haplotype Ser49Ser-Gly389, and decreased progressively for Ser49Ser-Arg389Arg > 49Gly-389Gly > 49Gly-Arg389Arg (adjusted R2 = 0.56, p = 0.003). Peak VO2 was not different for the tested β2-AR polymorphisms. Independent predictors of peak VO2 (adjusted R2 = 0.55) were β1-AR Ser49Gly SNP (p = 0.005), heart rate increase (p = 0.016), and peak systolic blood pressure (p = 0.031). Left ventricular (LV) motion kinetics as measured by cardiac MRI CSPAMM tagging at rest was not different between carriers and non-carriers of the β1-AR Gly49allele. Conclusion Similar LV cardiac motion kinetics at rest in donor hearts carrying either β1-AR Gly49 or β1-Ser49Ser variant suggests exercise-induced desensitization and down-regulation of the β1-AR Gly49 variant as relevant pathomechanism for reduced peak VO2 in β1-AR Gly49 carriers. PMID:27669015

  5. Vitamin-D receptor (VDR) gene polymorphisms (Taq-I & Apa-I) in Syrian healthy population.

    PubMed

    Haddad, Shaden

    2014-12-01

    The vitamin D endocrine system regulates bone metabolism and calcium homeostasis as well as cellular proliferation and differentiation. Vitamin D receptor (VDR) mediates Vit-D activity, thus VDR gene polymorphisms may correlate with different diseases. This study aimed to determine the distribution of VDR gene (Taq-I and Apa-I) polymorphisms using a RFLP in unrelated normal healthy individuals of Syrian population. Allelic frequencies were 65% vs 35% and 66% vs 34% for T vs t and A vs a alleles, respectively. Genotype distribution was 36%, 58% and 6% for TT, Tt and tt and 42%, 47% and 10% for AA, Aa and aa, respectively. These results demonstrate that the frequency and distribution of the VDR polymorphisms in Syrian population are different from other populations worldwide.

  6. Polymorphism of CC chemokine receptors CCR2 and CCR5 in Crohn's disease.

    PubMed

    Herfarth, H; Pollok-Kopp, B; Göke, M; Press, A; Oppermann, M

    2001-06-01

    Crohn's disease (CD) is a chronic inflammatory disease of the intestine that is characterized by mononuclear cell infiltration and a predominant Th1 lymphocyte response. We tested the hypothesis that CC chemokine receptors CCR2 and CCR5 might be important in the regulation of the intestinal immune response in this disease, and we speculated that carriers of a defective 32 base pair deletion mutant of CCR5, CCR5Delta32, which results in a non-functional receptor, might be protected from CD. Using polymerase chain reaction (PCR) and PCR restriction fragment length polymorphism (PCR-RFLP) gene frequencies of CCR5Delta32 and of CCR2-641 (replacement of valine-64 by isoleucine in the CCR2 gene) in healthy controls (n=346) and in CD patients (n=235) were determined. In CD patients, subgroup phenotypic analyses were performed according to the Vienna classification. The overall gene frequency of CCR5Delta32 (9.8%) and CCR2-641 (7.6%) in CD patients did not deviate significantly from healthy controls (9.2 and 8.2%, respectively), nor did we observe a significant deviation from the predicted Hardy-Weinberg distribution. No significant differences in the CD phenotype classification for the different CCR5 and CCR2 alleles were observed, except for a trend to disease sparing of the upper gastrointestinal tract (carrier frequency 0 versus 19.6%, Delta=1 9.6%, P=0.079) as well as a more stricturing disease behaviour (23.5 versus 16.2%, Delta=7.3%, P=0.136) in carriers of the mutant CCR5Delta32 allele. These results indicate that the different CCR5 but not CCR2 alleles may influence disease behaviour and thereby contribute to the observed heterogeneity of CD. However, the associations observed are limited and await replication in other datasets. CCR2 and CCR5 polymorphisms are unlikely to be important determinants of overall disease susceptibility.

  7. Roles of the Taql and Bsml vitamin D receptor gene polymorphisms in hospital mortality of burn patients

    PubMed Central

    Nogueira, Glaucia R.; Azevedo, Paula S.; Polegato, Bertha F.; Zornoff, Leonardo A.M.; Paiva, Sergio A.R.; Nogueira, Celia R.; Araujo, Natalia C.; Carmona, Bruno H.M.; Conde, Sandro J.; Minicucci, Marcos F.

    2016-01-01

    OBJECTIVE: The aim of this study was to evaluate the roles of the Taql and Bsml vitamin D receptor gene polymorphisms in hospital mortality of burn patients. METHODS: In total, 105 consecutive burn injury patients over 18 years in age who were admitted to the Burn Unit of Bauru State Hospital from January to December 2013 were prospectively evaluated. Upon admission, patient demographic information was recorded and a blood sample was taken for biochemical analysis to identify the presence of the Taql(rs731236) and Bsml(rs1544410) polymorphisms. All of the patients were followed over their hospital stay and mortality was recorded. RESULTS: Eighteen of the patients did not sign the informed consent form, and there were technical problems with genotype analysis for 7 of the patients. Thus, 80 patients (mean age, 42.5±16.1 years) were included in the final analysis. In total, 60% of the patients were male, and 16.3% died during the hospital stay. The genotype frequencies for the Taql polymorphism were 51.25% TT, 41.25% TC and 7.50% CC; for the Bsml polymorphism, they were 51.25% GG, 42.50% GA and 6.25% AA. In logistic regression analysis, after adjustments for age, gender and total body surface burn area, there were no associations between the Taql (OR: 1.575; CI95%: 0.148-16.745; p=0.706) or Bsml (OR: 1.309; CI95%: 0.128-13.430; p=0.821) polymorphisms and mortality for the burn patients. CONCLUSIONS: Our results suggest that the Taql and Bsml vitamin D receptor gene polymorphisms are not associated with hospital mortality of burn patients. PMID:27626478

  8. Cellular signalling of non-synonymous single-nucleotide polymorphisms of the human μ-opioid receptor (OPRM1)

    PubMed Central

    Knapman, Alisa; Connor, Mark

    2015-01-01

    There is significant variability in individual responses to opioid drugs, which is likely to have a significant genetic component. A number of non-synonymous single-nucleotide polymorphisms (SNPs) in the coding regions of the μ-opioid receptor gene (OPRM1) have been postulated to contribute to this variability. Although many studies have investigated the clinical influences of these μ-opioid receptor variants, the outcomes are reported in the context of thousands of other genes and environmental factors, and we are no closer to being able to predict individual response to opioids based on genotype. Investigation of how μ-opioid receptor SNPs affect their expression, coupling to second messengers, desensitization and regulation is necessary to understand how subtle changes in receptor structure can impact individual responses to opioids. To date, the few functional studies that have investigated the consequences of SNPs on the signalling profile of the μ-opioid receptor in vitro have shown that the common N40D variant has altered functional responses to some opioids, while other, rarer, variants display altered signalling or agonist-dependent regulation. Here, we review the data available on the effects of μ-opioid receptor polymorphisms on receptor function, expression and regulation in vitro, and discuss the limitations of the studies to date. Whether or not μ-opioid receptor SNPs contribute to individual variability in opioid responses remains an open question, in large part because we have relatively little good data about how the amino acid changes affect μ-opioid receptor function. LINKED ARTICLES This article is part of a themed section on Opioids: New Pathways to Functional Selectivity. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2015.172.issue-2 PMID:24527749

  9. Vitamin D Receptor Gene, Matrix Metalloproteinase 3 Polymorphisms and the Risk of Intervertebral Disc Degeneration Susceptibility: Meta-Analysis

    PubMed Central

    Huang, Yongjing; Zhao, Shujie; Xu, Nanwei

    2016-01-01

    Several studies have evaluated the association between vitamin D receptor, matrix metalloproteinase 3 (MMP-3) polymorphisms and the risk of intervertebral disc degeneration susceptibility. The findings were inconsistent. This meta-analysis aimed to systematically assess the association between vitamin D receptor, MMP-3 polymorphisms and the risk of intervertebral disc degeneration susceptibility. A search of various databases was done covering all papers published until December 31th, 2014. Eight, 4, 3 studies were finally included that addressed the risk of intervertebral disc degeneration susceptibility and vitamin D receptor FokI (rs2228570), ApaI (rs7975232), and MMP-3 (rs731236) polymorphisms, respectively. FokI (f vs. F: summary odds ratio [OR], 1.13; 95% confidence interval [CI], 0.76–1.69; ff vs. FF: OR, 1.02; 95% CI, 0.59–1.77; ff vs. Ff/FF: OR, 1.05; 95% CI, 0.70–1.58), ApaI (a vs. A: OR, 0.73; 95% CI, 0.45–1.19; aa vs. AA: OR, 0.53; 95% CI, 0.22–1.25 p=0.14; aa vs. AA/Aa: OR, 0.69; 95% CI, 0.53–0.89) in the vitamin D receptor gene and MMP3 polymorphisms (5A vs. 6A: OR, 1.92; 95% CI, 0.77–4.80; 5A5A vs. 6A6A: OR, 2.17; 95% CI, 0.75–6.24; 5A5A vs. 5A6A/6A6A: OR, 1.58; 95% CI, 0.72–3.44) were not obviously associated with risk of intervertebral disc degeneration susceptibility. FokI, ApaI polymorphisms in the vitamin D receptor gene and MMP-3 polymorphism are not obvious risk factors for intervertebral disc degeneration susceptibility. PMID:27790329

  10. Polymorphisms in gonadotropin and gonadotropin receptor genes as markers of ovarian reserve and response in in vitro fertilization.

    PubMed

    La Marca, Antonio; Sighinolfi, Giovanna; Argento, Cindy; Grisendi, Valentina; Casarini, Livio; Volpe, Annibale; Simoni, Manuela

    2013-03-15

    Since gonadotropins are the fundamental hormones that control ovarian activity, genetic polymorphisms may alter gonadal responsiveness to glycoproteins; hence they are important regulators of hormone activity at the target level. The establishment of the pool of primordial follicles takes place during fetal life and is mainly under genetic control. Consequently, single nucleotide polymorphisms (SNPs) in gonadotropins and their receptors do not seem to be associated with any significant modification in the endowment of nongrowing follicles in the ovary. Indeed, the age at menopause, a biological characteristic strongly related to ovarian reserve, as well as markers of functional ovarian reserve such as anti-Müllerian hormone and antral follicle count, are not different in women with different genetic variants. Conversely, some polymorphisms in FSH receptor (FSHR) seem to be associated with modifications in ovarian activity. In particular, studies suggest that the Ser680 genotype for FSHR is a factor of relative resistance to FSH stimulation resulting in slightly higher FSH serum levels, thus leading to a prolonged duration of the menstrual cycle. Moreover, some FSHR gene polymorphisms show a positive association with ovarian response to exogenous gonadotropin administration, hence exhibiting some potential for a pharmacogenetic estimation of the FSH dosage in controlled ovarian stimulation. The study of SNPs of the FSHR gene is an interesting field of research that could provide us with new information about the way each woman responds to exogenous gonadotropin administration during ovulation induction.

  11. Polymorphism in vitamin D receptor and osteoprotegerin genes in Egyptian rheumatoid arthritis patients with and without osteoporosis.

    PubMed

    Hussien, Yousry Mostafa; Shehata, Amal; Karam, Rehab A; Alzahrani, Saad S; Magdy, Hanem; El-Shafey, Abeer M

    2013-05-01

    1α,25-Dihydroxyvitamin D3 upregulates the expression of the receptor activator of nuclear factor kB ligand (RANKL), and downregulates osteoprotegerin (OPG) expression. We tested the effects of polymorphisms in the vitamin D receptor gene (VDR), and OPG gene in rheumatoid arthritis (RA) patients and healthy controls and their relationship to bone mineral density (BMD) and development of osteoporosis. Three hundred and fifty women were evaluated, 200 women having RA and 150 healthy control. The subjects were genotyped for polymorphism at BsmI in VDR and A163G in OPG genes by polymerase chain reaction followed by restriction fragment length polymorphism analysis. BMD was also measured. In A163G, the G allele increased the risk for RA and for the development of osteoporosis. We found a significant association between lower hip (BMD-h) and genotype variants of VDR (BsmI) and OPG A163G in RA patients with osteoporosis. Our results suggested that OPG A163G polymorphism was associated with RA susceptibility and with the development of osteoporosis in these patients. Also, VDR and OPG genes are important candidates for osteoporosis in RA patients.

  12. Preliminary genetic imaging study of the association between estrogen receptor-α gene polymorphisms and harsh human maternal parenting.

    PubMed

    Lahey, Benjamin B; Michalska, Kalina J; Liu, Chunyu; Chen, Qi; Hipwell, Alison E; Chronis-Tuscano, Andrea; Waldman, Irwin D; Decety, Jean

    2012-09-06

    A failure of neural changes initiated by the estrogen surge in late pregnancy to reverse the valence of infant stimuli from aversive to rewarding is associated with dysfunctional maternal behavior in nonhuman mammals. Estrogen receptor-α plays the crucial role in mediating these neural effects of estrogen priming. This preliminary study examines associations between estrogen receptor-α gene polymorphisms and human maternal behavior. Two polymorphisms were associated with human negative maternal parenting. Furthermore, hemodynamic responses in functional magnetic resonance imaging to child stimuli in neural regions associated with social cognition fully mediated the association between genetic variation and negative parenting. This suggests testable hypotheses regarding a biological pathway between genetic variants and dysfunctional human maternal parenting.

  13. Genetic polymorphisms of interleukin-1 alpha and the vitamin d receptor in mexican mestizo patients with intervertebral disc degeneration.

    PubMed

    Cervin Serrano, Salvador; González Villareal, Dalia; Aguilar-Medina, Maribel; Romero-Navarro, Jose Guillermo; Romero Quintana, Jose Geovanni; Arámbula Meraz, Eliakym; Osuna Ramírez, Ignacio; Picos-Cárdenas, Veronica; Granados, Julio; Estrada-García, Iris; Sánchez-Schmitz, Guzman; Ramos-Payán, Rosalío

    2014-01-01

    Intervertebral disc degeneration (IDD) is the most common diagnosis in patients with back pain, a leading cause of musculoskeletal disability worldwide. Several conditions, such as occupational activities, gender, age, and obesity, have been associated with IDD. However, the development of this disease has strong genetic determinants. In this study, we explore the possible association between rs1800587 (c.-949C>T) of interleukin-1 alpha (IL1A) and rs2228570 (c.2T>V) and rs731236 (c.1056T>C) of vitamin D receptor (VDR) gene polymorphisms and the development of IDD in northwestern Mexican Mestizo population. Gene polymorphisms were analyzed by polymerase chain reaction followed by restriction fragment length polymorphism, in two groups matched by age and gender: patients with symptomatic lumbar IDD (n = 100) and subjects with normal lumbar-spine MRI-scans (n = 100). Distribution of the mutated alleles in patients and controls was 27.0% versus 28.0% (P = 0.455) for T of rs1800587 (IL1A); 53.0% versus 58.0% (P = 0.183) for V of rs2228570 (VDR); and 18.0% versus 21.0% (P = 0.262) for C of rs731236 (VDR). Our results showed no association between the studied polymorphisms and IDD in this population. This is the first report on the contribution of gene polymorphisms on IDD in a Mexican population.

  14. [Toll-like receptor 2 R753Q polymorphisms are associated with an increased risk of infective endocarditis].

    PubMed

    Bustamante, Juan; Tamayo, Eduardo; Flórez, Santiago; Telleria, Juan J; Bustamante, Elena; López, Javier; San Román, J Alberto; Alvarez, F Javier

    2011-11-01

    The ability to respond to the ligands of toll-like receptors (TLR) could be affected by single nucleotide polymorphisms in TLR codifying genes. The influence of the polymorphisms TLR2 (R753Q, R677W), TLR4 (D299G, T399I) and CD14 (C-159T) was consecutively studied in 65 patients with infective endocarditis. The control group (n=66) consisted of healthy volunteers. All the polymorphisms were genotyped by means of restriction analysis after their amplification. An association between endocarditis and variants of TLR2 R753Q (P <.001) was observed, but no association with other polymorphisms was found. The TLR2 R753Q co-dominant (odds ratio=13.33), recessive (odds ratio=9.12) and dominant (odds ratio=3.65) genotypes showed a positive association with the infective endocarditis phenotype. The polymorphism TLR2 R753Q was associated with a greater susceptibility towards the development of infective endocarditis. Further studies are required to validate these results and identify other genetic risk factors.

  15. Polymorphism in the promoter region of the Toll-like receptor 9 gene and cervical human papillomavirus infection.

    PubMed

    Oliveira, Lucas Boeno; Louvanto, Karolina; Ramanakumar, Agnihotram V; Franco, Eduardo L; Villa, Luisa L

    2013-08-01

    Polymorphism in the Toll-like receptor (TLR) 9 gene has been shown to have a significant role in some diseases; however, little is known about its possible role in the natural history of human papillomavirus (HPV) infections. We investigated the association between a single-nucleotide polymorphism (SNP) (rs5743836) in the promoter region of TLR9 (T1237C) and type-specific HPV infections. Specimens were derived from a cohort of 2462 women enrolled in the Ludwig-McGill Cohort Study. We randomly selected 500 women who had a cervical HPV infection detected at least once during the study as cases. We defined two control groups: (i) a random sample of 300 women who always tested HPV negative, and (ii) a sample of 234 women who were always HPV negative but had a minimum of ten visits during the study. TLR9 genotyping was performed using bidirectional PCR amplification of specific alleles. Irrespective of group, the WT homozygous TLR9 genotype (TT) was the most common form, followed by the heterozygous (TC) and the mutant homozygous (CC) forms. There were no consistent associations between polymorphism and infection risk, either overall or by type or species. Likewise, there were no consistently significant associations between polymorphism and HPV clearance or persistence. We concluded that this polymorphism in the promoter region of TLR9 gene does not seem to have a mediating role in the natural history of the HPV infection.

  16. Androgen receptor and prostate-specific antigen gene polymorphisms and breast cancer in African-American women.

    PubMed

    Wang, Wei; John, Esther M; Ingles, Sue Ann

    2005-12-01

    Several previous studies have found the CAG repeat polymorphism in exon 1 of the androgen receptor (AR) gene to be associated with breast cancer risk among some groups of Caucasian and Asian women. In a population-based case-control study of 488 African-American women (239 cases and 249 controls), we examined this polymorphism along with a polymorphism (-158 G/A) in an androgen-regulated gene (PSA) whose expression has been correlated with breast cancer prognosis. Overall, we did not observe any significant association between the CAG repeat polymorphism and breast cancer risk. However, among women with a first-degree family history of breast cancer, longer CAG repeats were associated with a significantly increased risk. Women carrying at least one longer allele [(CAG)n > or = 22] had a 3-fold increased risk compared to those with two shorter alleles (odds ratio, 3.18; 95% confidence interval, 1.08-9.36). There was no significant association between the PSA gene polymorphism and breast cancer risk, nor was there significant gene-gene interaction. In summary, our results further support that shorter CAG repeats (stronger AR transactivation activity) may reduce the risk of breast cancer, at least among some groups of women. Our data, however, are unable to provide evidence that PSA is the pathway through which the protective effect of androgens operates.

  17. Genetic Polymorphisms of Interleukin-1 Alpha and the Vitamin D Receptor in Mexican Mestizo Patients with Intervertebral Disc Degeneration

    PubMed Central

    Cervin Serrano, Salvador; González Villareal, Dalia; Aguilar-Medina, Maribel; Romero-Navarro, Jose Guillermo; Romero Quintana, Jose Geovanni; Arámbula Meraz, Eliakym; Osuna Ramírez, Ignacio; Picos-Cárdenas, Veronica; Granados, Julio; Estrada-García, Iris; Sánchez-Schmitz, Guzman; Ramos-Payán, Rosalío

    2014-01-01

    Intervertebral disc degeneration (IDD) is the most common diagnosis in patients with back pain, a leading cause of musculoskeletal disability worldwide. Several conditions, such as occupational activities, gender, age, and obesity, have been associated with IDD. However, the development of this disease has strong genetic determinants. In this study, we explore the possible association between rs1800587 (c.-949C>T) of interleukin-1 alpha (IL1A) and rs2228570 (c.2T>V) and rs731236 (c.1056T>C) of vitamin D receptor (VDR) gene polymorphisms and the development of IDD in northwestern Mexican Mestizo population. Gene polymorphisms were analyzed by polymerase chain reaction followed by restriction fragment length polymorphism, in two groups matched by age and gender: patients with symptomatic lumbar IDD (n = 100) and subjects with normal lumbar-spine MRI-scans (n = 100). Distribution of the mutated alleles in patients and controls was 27.0% versus 28.0% (P = 0.455) for T of rs1800587 (IL1A); 53.0% versus 58.0% (P = 0.183) for V of rs2228570 (VDR); and 18.0% versus 21.0% (P = 0.262) for C of rs731236 (VDR). Our results showed no association between the studied polymorphisms and IDD in this population. This is the first report on the contribution of gene polymorphisms on IDD in a Mexican population. PMID:25506053

  18. Effect of common polymorphisms of the farnesoid X receptor and bile acid transporters on the pharmacokinetics of ursodeoxycholic acid.

    PubMed

    Hu, Miao; Fok, Benny S P; Wo, Siu-Kwan; Lee, Vincent H L; Zuo, Zhong; Tomlinson, Brian

    2016-01-01

    Ursodeoxycholic acid (UDCA), a natural, dihydroxy bile acid, promotes gallstone dissolution and has been attributed with several other beneficial effects. The farnesoid X receptor (FXR) may influence the pharmacokinetics of UDCA by modulating the expression of bile acid transporters. This exploratory study examined whether common functional polymorphisms in FXR and in bile acid transporter genes affect the pharmacokinetics of exogenous UDCA. Polymorphisms in genes for transporters involved in bile acid transport, solute carrier organic anion 1B1 (SLCO1B1) 388A>G and 521T>C, solute carrier 10A1 (SLC10A1) 800 C>T and ATP-binding cassette B11 (ABCB11) 1331T>C, and the FXR -1G>T polymorphism were genotyped in 26 male Chinese subjects who ingested single oral 500-mg doses of UDCA. Plasma concentrations of UDCA and its major conjugate metabolite glycoursodeoxycholic acid (GUDCA) were determined. The mean systemic exposure of UDCA was higher in the five subjects with one copy of the FXR -1G>T variant allele than in those homozygous for the wild-type allele (n = 21) (AUC0-24 h : 38.5 ± 28.2 vs. 20.9 ± 8.0 μg h/mL, P = 0.021), but this difference appeared mainly due to one outlier with the -1GT genotype and elevated baseline and post-treatment UDCA concentrations. After excluding the outlier, body weight was the only factor associated with plasma concentrations of UDCA and there were no significant associations with the other polymorphisms examined. None of the polymorphisms affected the pharmacokinetics of GUDCA. This study showed that the common polymorphisms in bile acid transporters had no significant effect on the pharmacokinetics of exogenous UDCA but an effect of the FXR polymorphism cannot be excluded.

  19. Risk Factors in Normal-Tension Glaucoma and High-Tension Glaucoma in relation to Polymorphisms of Endothelin-1 Gene and Endothelin-1 Receptor Type A Gene

    PubMed Central

    Wróbel-Dudzińska, Dominika; Kosior-Jarecka, Ewa; Łukasik, Urszula; Kocki, Janusz; Witczak, Agnieszka; Mosiewicz, Jerzy; Żarnowski, Tomasz

    2015-01-01

    The aim of the research is to analyse the influence of polymorphisms of endothelin-1 gene and endothelin-1 receptor type A gene on the clinical condition of patients with primary open angle glaucoma. Methods. 285 Polish patients took part in the research (160 normal-tension glaucoma and 125 high-tension glaucoma). DNA was isolated by standard methods and genotype distributions of four polymorphisms in genes encoding endothelin-1 (K198N) and endothelin-1 receptor type A polymorphisms (C1222T, C70G, and G231A) were determined. Genotype distributions were compared between NTG and HTG groups. The clinical condition of participants was examined for association with polymorphisms. Results. A similar frequency of occurrence of the polymorphic varieties of the studied genes was observed in patients with NTG and HTG. There is no relation between NTG risk factors and examined polymorphisms. NTG patients with TT genotype of K198N polymorphism presented with the lowest intraocular pressure in comparison to GG + GT genotype (p = 0.03). In NTG patients with CC genotype of C1222T polymorphism (p = 0.028) and GG of C70G polymorphism (p = 0.03) the lowest values of mean blood pressure were observed. Conclusions. The studied polymorphic varieties (K198N, C1222T) do have an influence on intraocular pressure as well as arterial blood pressure in NTG patients. PMID:26697209

  20. Failure to find linkage between a functional polymorphism in the dopamine D4 receptor gene and schizophrenia

    SciTech Connect

    Shaikh, S.; Gill, M.; Collier, D.A.

    1994-03-15

    We report the results of a linkage study in 24 families multiply affected with schizophrenia using a polymorphic DNA sequence encoding the third cytoplasmic loop of the dopamine D4 receptor. Two-point LOD score analyses with a range of single gene models ranging from near dominant to near recessive revealed no evidence for linkage. In addition, we examined the data by non-parametric sib-pair analysis and found no excess sharing of alleles between affected sib-pairs. We therefore conclude that mutations within the dopamine D4 receptor gene do not have a major aetiological role in schizophrenia in our collection of pedigrees. 20 refs., 2 tabs.

  1. Cholinergic muscarinic M4 receptor gene polymorphisms: a potential risk factor and pharmacogenomic marker for schizophrenia.

    PubMed

    Scarr, Elizabeth; Um, Jung Yoon; Cowie, Tiffany Frances; Dean, Brian

    2013-05-01

    Although schizophrenia is a widespread disorder of unknown aetiology, we have previously shown that muscarinic M4 receptor (CHRM4) expression is decreased in the hippocampus and caudate-putamen from subjects with the disorder, implicating the receptor in its pathophysiology. These findings led us to determine whether variation in the CHRM4 gene sequence was associated with an altered risk of schizophrenia by sequencing the CHRM4 gene from the brains of 76 people with the disorder and 74 people with no history of psychiatric disorders. In addition, because the CHRM4 is a potential target for antipsychotic drug development, we investigated whether variations in CHRM4 sequence were associated with final recorded doses of, and life-time exposure to, antipsychotic drugs. Gene sequencing identified two single nucleotide polymorphisms (SNPs; rs2067482 and rs72910092) in the CHRM4 gene. For rs2067482, our data suggested that both genotype (1341C/C; p = 0.05) and allele (C; p = 0.03) were associated with an increased risk of schizophrenia. In addition, there was a strong trend (p = 0.08) towards an association between CHRM4 sequence and increased lifetime exposure to antipsychotic drugs. Furthermore, there was a trend for people with the C allele to be prescribed benzodiazepines more frequently (p = 0.06) than those with the T allele. These data, albeit on small cohorts, are consistent with genetic variance at rs2067482 contributing to an altered risk of developing schizophrenia which requires more forceful pharmacotherapy to achieve a clinical response.

  2. ESR1 and PGR polymorphisms are associated with estrogen and progesterone receptor expression in breast tumors.

    PubMed

    Hertz, Daniel L; Henry, N Lynn; Kidwell, Kelley M; Thomas, Dafydd; Goddard, Audrey; Azzouz, Faouzi; Speth, Kelly; Li, Lang; Banerjee, Mousumi; Thibert, Jacklyn N; Kleer, Celina G; Stearns, Vered; Hayes, Daniel F; Skaar, Todd C; Rae, James M

    2016-09-01

    Hormone receptor-positive (HR+) breast cancers express the estrogen (ERα) and/or progesterone (PgR) receptors. Inherited single nucleotide polymorphisms (SNPs) in ESR1, the gene encoding ERα, have been reported to predict tamoxifen effectiveness. We hypothesized that these associations could be attributed to altered tumor gene/protein expression of ESR1/ERα and that SNPs in the PGR gene predict tumor PGR/PgR expression. Formalin-fixed paraffin-embedded breast cancer tumor specimens were analyzed for ESR1 and PGR gene transcript expression by the reverse transcription polymerase chain reaction based Oncotype DX assay and for ERα and PgR protein expression by immunohistochemistry (IHC) and an automated quantitative immunofluorescence assay (AQUA). Germline genotypes for SNPs in ESR1 (n = 41) and PGR (n = 8) were determined by allele-specific TaqMan assays. One SNP in ESR1 (rs9322336) was significantly associated with ESR1 gene transcript expression (P = 0.006) but not ERα protein expression (P > 0.05). A PGR SNP (rs518162) was associated with decreased PGR gene transcript expression (P = 0.003) and PgR protein expression measured by IHC (P = 0.016), but not AQUA (P = 0.054). There were modest, but statistically significant correlations between gene and protein expression for ESR1/ERα and PGR/PgR and for protein expression measured by IHC and AQUA (Pearson correlation = 0.32-0.64, all P < 0.001). Inherited ESR1 and PGR genotypes may affect tumor ESR1/ERα and PGR/PgR expression, respectively, which are moderately correlated. This work supports further research into germline predictors of tumor characteristics and treatment effectiveness, which may someday inform selection of hormonal treatments for patients with HR+ breast cancer.

  3. Multiple Polymorphisms Affect Expression and Function of the Neuropeptide S Receptor (NPSR1)

    PubMed Central

    Anedda, Francesca; Zucchelli, Marco; Schepis, Danika; Hellquist, Anna; Corrado, Lucia; D'Alfonso, Sandra; Achour, Adnane; McInerney, Gerald; Bertorello, Alejandro; Lördal, Mikael; Befrits, Ragnar; Björk, Jan; Bresso, Francesca; Törkvist, Leif; Halfvarson, Jonas

    2011-01-01

    Background neuropeptide S (NPS) and its receptor NPSR1 act along the hypothalamic-pituitary-adrenal axis to modulate anxiety, fear responses, nociception and inflammation. The importance of the NPS-NPSR1 signaling pathway is highlighted by the observation that, in humans, NPSR1 polymorphism associates with asthma, inflammatory bowel disease, rheumatoid arthritis, panic disorders, and intermediate phenotypes of functional gastrointestinal disorders. Because of the genetic complexity at the NPSR1 locus, however, true causative variations remain to be identified, together with their specific effects on receptor expression or function. To gain insight into the mechanisms leading to NPSR1 disease-predisposing effects, we performed a thorough functional characterization of all NPSR1 promoter and coding SNPs commonly occurring in Caucasians (minor allele frequency >0.02). Principal Findings we identified one promoter SNP (rs2530547 [−103]) that significantly affects luciferase expression in gene reporter assays and NPSR1 mRNA levels in human leukocytes. We also detected quantitative differences in NPS-induced genome-wide transcriptional profiles and CRE-dependent luciferase activities associated with three NPSR1 non-synonymous SNPs (rs324981 [Ile107Asn], rs34705969 [Cys197Phe], rs727162 [Arg241Ser]), with a coding variant exhibiting a loss-of-function phenotype (197Phe). Potential mechanistic explanations were sought with molecular modelling and bioinformatics, and a pilot study of 2230 IBD cases and controls provided initial support to the hypothesis that different cis-combinations of these functional SNPs variably affect disease risk. Significance these findings represent a first step to decipher NPSR1 locus complexity and its impact on several human conditions NPS antagonists have been recently described, and our results are of potential pharmacogenetic relevance. PMID:22216302

  4. Disrupted cell cycle control in cultured endometrial cells from patients with endometriosis harboring the progesterone receptor polymorphism PROGINS.

    PubMed

    D'Amora, Paulo; Maciel, Thiago Trovati; Tambellini, Rodrigo; Mori, Marcelo A; Pesquero, João Bosco; Sato, Helio; Girão, Manoel João Batista Castello; Guerreiro da Silva, Ismael Dale Cotrim; Schor, Eduardo

    2009-07-01

    Presently, little is understood about how endometriosis is established or maintained, or how genetic factors can predispose women to the disease. Because of the crucial role that the progesterone receptor polymorphism PROGINS plays in predisposing women to the development of endometriosis, we hypothesized that this variant may influence critical steps during endometrial cell metabolism that are involved in the pathogenesis of endometriosis. Eutopic endometria were collected from three sources: women with endometriosis who had a single PROGINS allele (from the progesterone receptor gene); women with endometriosis who had the wild-type progesterone receptor allele; and women without endometriosis who had the wild-type allele. Cells prepared from the eutopic endometria of these women were stimulated with both estradiol and progesterone, and then examined for cell proliferation, viability, and apoptosis. The cells from women with endometriosis that carried the PROGINS allele demonstrated increased proliferation, greater viability, and decreased apoptosis following progesterone treatment. In general, these parameters were very different as compared with those of women with endometriosis but without the PROGINS allele and women in the control group. This result indicates there is a reduced level of progesterone responsiveness in women who carry the PROGINS polymorphism. Because progesterone responsiveness is known to be an important characteristic of women with endometriosis, these data support the contention that the PROGINS polymorphism enhances the endometriosis phenotype.

  5. Siglec-5 and Siglec-14 are polymorphic paired receptors that modulate neutrophil and amnion signaling responses to group B Streptococcus

    PubMed Central

    Ali, Syed Raza; Fong, Jerry J.; Carlin, Aaron F.; Busch, Tamara D.; Linden, Rebecka; Angata, Takashi; Areschoug, Thomas; Parast, Mana; Varki, Nissi; Murray, Jeffrey

    2014-01-01

    Group B Streptococcus (GBS) causes invasive infections in human newborns. We recently showed that the GBS β-protein attenuates innate immune responses by binding to sialic acid–binding immunoglobulin-like lectin 5 (Siglec-5), an inhibitory receptor on phagocytes. Interestingly, neutrophils and monocytes also express Siglec-14, which has a ligand-binding domain almost identical to Siglec-5 but signals via an activating motif, raising the possibility that these are paired Siglec receptors that balance immune responses to pathogens. Here we show that β-protein–expressing GBS binds to both Siglec-5 and Siglec-14 on neutrophils and that the latter engagement counteracts pathogen-induced host immune suppression by activating p38 mitogen-activated protein kinase (MAPK) and AKT signaling pathways. Siglec-14 is absent from some humans because of a SIGLEC14-null polymorphism, and homozygous SIGLEC14-null neutrophils are more susceptible to GBS immune subversion. Finally, we report an unexpected human-specific expression of Siglec-5 and Siglec-14 on amniotic epithelium, the site of initial contact of invading GBS with the fetus. GBS amnion immune activation was likewise influenced by the SIGLEC14-null polymorphism. We provide initial evidence that the polymorphism could influence the risk of prematurity among human fetuses of mothers colonized with GBS. This first functionally proven example of a paired receptor system in the Siglec family has multiple implications for regulation of host immunity. PMID:24799499

  6. Estrogen receptor 1 gene polymorphisms and decreased risk of obesity in women

    PubMed Central

    Goulart, Alessandra C.; Zee, Robert Y.L.; Rexrode, Kathryn M.

    2009-01-01

    Estrogen receptor alpha gene (ESR1) polymorphisms have been associated with several diseases, but whether they are associated with obesity is uncertain. To elucidate the role of genetic variation in the ESR1 gene with body mass index (BMI), 543 Caucasian women (median age 63 years) from the Women’s Health Study were examined. Most were postmenopausal (99.3%). The relationships between rs2234693 and rs9340799 genotypes and their associated haplotypes with obesity (BMI ≥ 30kg/m2) and overweight (BMI≥25kg/m2) were evaluated. Among women with the rs2234693 TT genotype, 18.3% were obese, while only 8.2% of those with the CC genotype only were obese (p=0.04). In a logistic regression model assuming additive inheritance, rs2234693 was associated with decreased odds of obesity (BMI ≥ 30) (crude odds ratio [OR] = 0.63, 95%CI= 0.44-0.90, P=0.01). For rs9340799, only an inverse trend was observed for BMI (P=0.08). Haplotypes that included the variant C allele were associated with a reduced risk of obesity (crude OR=0.65, 95%CI=0.44-0.94, P= 0.02 for C-G). The rs2234693 C allele of ESR1 and its associated genotypes and haplotypes were inversely and consistently associated with obesity. One or more copies of the C allele were associated with decreased risk of obesity in white post-menopausal women. PMID:19375130

  7. Vitamin D receptor gene polymorphisms, smoking, and risk of sporadic Parkinson's disease in Japan.

    PubMed

    Tanaka, Keiko; Miyake, Yoshihiro; Fukushima, Wakaba; Kiyohara, Chikako; Sasaki, Satoshi; Tsuboi, Yoshio; Oeda, Tomoko; Shimada, Hiroyuki; Kawamura, Nobutoshi; Sakae, Nobutaka; Fukuyama, Hidenao; Hirota, Yoshio; Nagai, Masaki; Nakamura, Yoshikazu

    2017-03-16

    Epidemiological evidence on the relationships between the vitamin D receptor (VDR) single nucleotide polymorphisms (SNPs) rs731236 (TaqI), rs7975232 (ApaI), rs1544410 (BsmI), and rs2228570 (FokI) and Parkinson's disease (PD) is inconsistent. We investigated these relationships in 229 sporadic PD patients within six years of onset in Japan. Controls were 357 patients without neurodegenerative disease. Adjustment was made for sex, age, region of residence, and smoking. A significant inverse association was found between SNP rs2228570 and the risk of sporadic PD under the additive but not the co-dominant or dominant model (P=0.048); however, this fell below significance after adjustment for multiple comparisons (adjusted P=0.46). No significant relationships were found between SNPs rs731236, rs7975232, or rs1544410 and the risk of sporadic PD in any genetic model. VDR haplotypes inferred in the current study were not associated with sporadic PD. Compared with subjects with the GA or AA genotype of SNP rs2228570 who had ever smoked, those with the GG genotype who had never smoked had a 3.78-fold increased risk of sporadic PD; however, no significant interaction was observed. VDR SNP rs2228570 may be associated with sporadic PD in Japan. Smoking did not significantly modify the relationship between SNP rs2228570 and sporadic PD.

  8. Molecular Recognition by a Polymorphic Cell Surface Receptor Governs Cooperative Behaviors in Bacteria

    PubMed Central

    Dey, Arup; Wall, Daniel

    2013-01-01

    Cell-cell recognition is a fundamental process that allows cells to coordinate multicellular behaviors. Some microbes, such as myxobacteria, build multicellular fruiting bodies from free-living cells. However, how bacterial cells recognize each other by contact is poorly understood. Here we show that myxobacteria engage in recognition through interactions between TraA cell surface receptors, which leads to the fusion and exchange of outer membrane (OM) components. OM exchange is shown to be selective among 17 environmental isolates, as exchange partners parsed into five major recognition groups. TraA is the determinant of molecular specificity because: (i) exchange partners correlated with sequence conservation within its polymorphic PA14-like domain and (ii) traA allele replacements predictably changed partner specificity. Swapping traA alleles also reprogrammed social interactions among strains, including the regulation of motility and conferred immunity from inter-strain killing. We suggest that TraA helps guide the transition of single cells into a coherent bacterial community, by a proposed mechanism that is analogous to mitochondrial fusion and fission cycling that mixes contents to establish a homogenous population. In evolutionary terms, traA functions as a rare greenbeard gene that recognizes others that bear the same allele to confer beneficial treatment. PMID:24244178

  9. Association of Toll-Like Receptor 3 Single-Nucleotide Polymorphisms and Hepatitis C Virus Infection

    PubMed Central

    Al-Anazi, Mashael R.; Matou-Nasri, Sabine; Abdo, Ayman A.; Sanai, Faisal M.; Alkahtani, Saad; Alarifi, Saud; Alkahtane, Abdullah A.; Al-Yahya, Hamad; Ali, Daoud; Alessia, Mohammed S.; Alshahrani, Bushra; Al-Ahdal, Mohammed N.

    2017-01-01

    Toll-like receptor 3 (TLR3) plays a key role in innate immunity by recognizing pathogenic, double-stranded RNAs. Thus, activation of TLR3 is a major factor in antiviral defense and tumor eradication. Although downregulation of TLR3 gene expression has been mainly reported in patients infected with hepatitis C virus (HCV), the influence of TLR3 genotype on the risk of HCV infection, HCV-related cirrhosis, and/or hepatocellular carcinoma (HCC) remains to be determined. Single-nucleotide polymorphisms (SNPs) within the TLR3 gene and their associations with HCV-related disease risk were investigated in a Saudi Arabian population in this study. Eight TLR3 SNPs were analyzed in 563 patients with HCV, which consisted of 437 patients with chronic HCV infections, 88 with HCV-induced liver cirrhosis, and 38 with HCC. A total of 599 healthy control subjects were recruited to the study. Among the eight TLR3 SNPs studied, the rs78726532 SNP was strongly associated with HCV infection when compared to that in healthy control subjects. The rs5743314 was also strongly associated with HCV-related liver disease progression (cirrhosis and HCC). In summary, these results indicate that distinct genetic variants of TLR3 SNPs are associated with HCV infection and HCV-mediated liver disease progression in the Saudi Arabian population. PMID:28127569

  10. How Oxytocin Receptor (OXTR) Single Nucleotide Polymorphisms Act on Prosociality: The Mediation Role of Moral Evaluation

    PubMed Central

    Shang, Siyuan; Wu, Nan; Su, Yanjie

    2017-01-01

    Prosociality is related to numerous positive outcomes, and mechanisms underlying individual differences in prosociality have been widely discussed. Recently, research has found converging evidence on the influence of the oxytocin receptor (OXTR) gene on prosociality. Meanwhile, moral reasoning, a key precursor for social behavior, has also been associated with variability in OXTR gene, thus the relationship between OXTR and prosociality is assumed to be mediated by moral evaluation. The current study examines the relationship in question, and includes gender as a potential moderator. Self-reported prosociality on Prosocial Tendencies Measure and evaluation on the moral acceptability of behaviors in stories from 790 Chinese adolescents (32.4% boys) were analyzed for the influence of their OXTR single nucleotide polymorphisms (SNPs). Results showed that SNP at site rs2254298 was indirectly associated with prosocial behaviors via moral evaluation of behaviors, and this effect was moderated by gender. Our findings suggest an indirect association between genetic variations in OXTR and prosociality through moral evaluation, indicating the potential pathway from genetic variability to prosociality through level of moral development. We also provide some evidence that the role of oxytocin system may to some extent depend on gender. These findings may promote our understanding of the genetic and biological roots of prosociality and morality. PMID:28377734

  11. Sun exposure, vitamin D receptor gene polymorphisms, and breast cancer risk in a multiethnic population.

    PubMed

    John, Esther M; Schwartz, Gary G; Koo, Jocelyn; Wang, Wei; Ingles, Sue A

    2007-12-15

    Considerable evidence indicates that vitamin D may reduce the risk of several cancers, including breast cancer. This study examined associations of breast cancer with sun exposure, the principal source of vitamin D, and vitamin D receptor gene (VDR) polymorphisms (FokI, TaqI, BglI) in a population-based case-control study of Hispanic, African-American, and non-Hispanic White women aged 35-79 years from the San Francisco Bay Area of California (1995-2003). In-person interviews were obtained for 1,788 newly diagnosed cases and 2,129 controls. Skin pigmentation measurements were taken on the upper underarm (a sun-protected site that measures constitutive pigmentation) and on the forehead (a sun-exposed site) using reflectometry. Biospecimens were collected for a subset of the study population (814 cases, 910 controls). A high sun exposure index based on reflectometry was associated with reduced risk of advanced breast cancer among women with light constitutive skin pigmentation (odds ratio = 0.53, 95% confidence interval: 0.31, 0.91). The association did not vary with VDR genotype. No associations were found for women with medium or dark pigmentation. Localized breast cancer was not associated with sun exposure or VDR genotype. This study supports the hypothesis that sunlight exposure reduces risk of advanced breast cancer among women with light skin pigmentation.

  12. Social cognition, face processing, and oxytocin receptor single nucleotide polymorphisms in typically developing children.

    PubMed

    Slane, Mylissa M; Lusk, Laina G; Boomer, K B; Hare, Abby E; King, Margaret K; Evans, David W

    2014-07-01

    Recent research has provided evidence of a link between behavioral measures of social cognition (SC) and neural and genetic correlates. Differences in face processing and variations in the oxytocin receptor (OXTR) gene have been associated with SC deficits and autism spectrum disorder (ASD) traits. Much work has examined the qualitative differences between those with ASD and typically developing (TD) individuals, but very little has been done to quantify the natural variation in ASD-like traits in the typical population. The present study examines this variation in TD children using a multidimensional perspective involving behavior assessment, neural electroencephalogram (EEG) testing, and OXTR genotyping. Children completed a series of neurocognitive assessments, provided saliva samples for sequencing, and completed a face processing task while connected to an EEG. No clear pattern emerged for EEG covariates or genotypes for individual OXTR single nucleotide polymorphisms (SNPs). However, SNPs rs2254298 and rs53576 consistently interacted such that the AG/GG allele combination of these SNPs was associated with poorer performance on neurocognitive measures. These results suggest that neither SNP in isolation is risk-conferring, but rather that the combination of rs2254298(A/G) and rs53576(G/G) confers a deleterious effect on SC across several neurocognitive measures.

  13. Association of bone mineral density with polymorphism of the human calcium-sensing receptor locus.

    PubMed

    Tsukamoto, K; Orimo, H; Hosoi, T; Miyao, M; Ota, N; Nakajima, T; Yoshida, H; Watanabe, S; Suzuki, T; Emi, M

    2000-03-01

    A strong correlation between bone mass and genetic factors has been shown in twins and family studies. Some of the genes involved would regulate bone metabolism, bone formation, and resorption, all processes that determine bone mass. One candidate genes, calcium-sensing receptor (CASR) in the parathyroid gland, regulates calcium homeostasis by sensing decreases in extracellular calcium level and effecting an increase in secretion of parathyroid hormone (PTH) and calcium (Ca) reabsorption in the kidney. We have investigated a possible association between the CA-repeat polymorphism at the human CASR gene locus and the bone mineral density (BMD) of radial bone in 472 postmenopausal Japanese women. Genotypes were classified into nine groups according to the number of CA repeats present, from 20 to 12. BMD was expressed as the adjusted BMD, which was the body mass index (BMI), and age-adjusted average BMD. The 247 women who had an A3 allele (228 bp, containing 18 repeats of CA) had significantly lower adjusted BMD (mean +/- SD: 0.303 +/- 0.059 versus 0.316 +/- 0.063 g/cm(2); P = 0.0308) than the participants (n = 201) who did not carry an allele of that size. This result suggests that genetic variation at the CASR gene locus is associated with some determinants for BMD in postmenopausal women.

  14. Association of Oxytocin Receptor Gene (OXTR) rs53576 Polymorphism with Sociality: A Meta-Analysis

    PubMed Central

    Li, Jingguang; Zhao, Yajun; Li, Rena; Broster, Lucas S.; Zhou, Chenglin; Yang, Suyong

    2015-01-01

    A common variant in the oxytocin receptor gene (OXTR), rs53576, has been broadly linked to socially related personality traits and behaviors. However, the pattern of published results is inconsistent. Here, we performed a meta-analysis to comprehensively evaluate the association. The literature was searched for relevant studies and effect sizes between individuals homozygous for the G allele (GG) and individuals with A allele carriers (AA/AG). Specifically, two indices of sociality were evaluated independently: i) general sociality (24 samples, n = 4955), i.e., how an individual responds to other people in general; and ii) close relationships (15 samples, n = 5262), i.e., how an individual responds to individuals with closed connections (parent-child or romantic relationship). We found positive association between the rs53576 polymorphism and general sociality (Cohen’s d = 0.11, p = .02); G allele homozygotes had higher general sociality than the A allele carriers. However, the meta-analyses did not detect significant genetic association between rs53576 and close relationships (Cohen’s d = 0.01, p = .64). In conclusion, genetic variation in the rs53576 influences general sociality, which further implies that it is worthy to systematically examine whether the rs53576 is a valid genetic marker for socially related psychiatric disorders. PMID:26121678

  15. Platelet Derived Growth Factor-B and Human Epidermal Growth Factor Receptor-2 Polymorphisms in Gall Bladder Cancer.

    PubMed

    Mishra, Kumudesh; Behari, Anu; Kapoor, Vinay Kumar; Khan, M Salman; Prakash, Swayam; Agrawal, Suraksha

    2015-01-01

    Gall bladder cancer (GBC) is a gastro-intestinal cancer with high prevalence among north Indian women. Platelet derived growth factor-B (PDGFB) and human epidermal growth factor receptor-2 (HER2) may play roles in the etiology of GBC through the inflammation-hyperplasia-dysplasia-carcinoma pathway. To study the association of PDGFB and HER2 polymorphisms with risk of GBC, 200 cases and 300 controls were considered. PDGFB +286A>G and +1135A>C polymorphisms were investigated with an amplification refractory mutation system and the HER2 Ile655Val polymorphism by restriction fragment length polymorphism. Significant risk associations for PDGFB +286 GG (OR=5.25) and PDGFB +1135 CC (OR=3.19) genotypes were observed for GBC. Gender wise stratification revealed susceptibility for recessive models of PDGFB +1135A>C (OR=3.00) and HER2 Ile655Val (OR=2.52) polymorphisms among female GBC cases. GBC cases with gall stones were predisposed to homozygous +286 GG and +1135 CC genotypes. Significant risk associations were found for ACIle (OR=1.48), GAVal (OR=1.70), GAIle (OR=2.00) haplotypes with GBC cases and GCIle haplotype with female GBC cases (OR=10.37, P=<0.0001). Pair-wise linkage disequilibrium revealed negative associations among variant alleles. On multi-dimensional reduction analysis, a three factor model revealed significant gene-gene interaction for PDGFB +286A>G, PDGFB +1135A>C and HER2 Ile165Val SNPs with GBC. Protein-protein interaction showed significant association of PDGFB and HER2 with the epidermal growth factor receptor signaling pathway.

  16. Association between alcoholism and the genetic polymorphisms of the GABAA receptor genes on chromosome 5q33-34 in Korean population.

    PubMed

    Park, Chul-Soo; Park, So-Young; Lee, Chul-Soon; Sohn, Jin-Wook; Hahn, Gyu-Hee; Kim, Bong-Jo

    2006-06-01

    Family, twin, and adoption studies have demonstrated that genes play an important role in the development of alcoholism. We investigated the association between alcoholism and the genetic polymorphisms of the GABAA receptor genes on chromosome 5q33-34 in Korean population. The genotype of the GABAA receptor gene polymorphisms were determined by performing polymerase chain reaction genotyping for 172 normal controls and 162 male alcoholics who are hospitalized in alcoholism treatment institute. We found a significant association between the genetic polymorphisms of the GABAA alpha1 and GABAA alpha6 receptor gene and alcoholism. The GG genotype of the GABAA alpha1 receptor gene was associated with the onset age of alcoholism and alcohol withdrawal symptoms, and a high score on the Korean version of the ADS. However, there was no association between the genetic polymorphisms of the GABAA beta2 and gamma2 receptor gene and alcoholisms. Our finding suggest that genetic polymorphisms of the GABAA alpha1 and GABAA alpha6 receptor gene may be associated with the development of alcoholism and that the GG genotype of the GABAA alpha1 receptor gene play an important role in the development of the early onset and the severe type of alcoholism.

  17. Lack of association between serotonin-2A receptor gene (HTR2A) polymorphisms and tardive dyskinesia in schizophrenia.

    PubMed

    Basile, V S; Ozdemir, V; Masellis, M; Meltzer, H Y; Lieberman, J A; Potkin, S G; Macciardi, F M; Petronis, A; Kennedy, J L

    2001-03-01

    Tardive dyskinesia (TD) is a disabling neurological side effect associated with long-term treatment with typical antipsychotics. Family studies and animal models lend evidence for hereditary predisposition to TD. The newer atypical antipsychotics pose a minimal risk for TD which is in part attributed to their ability to block the serotonin-2A (5-HT(2A)) receptor. 5-HT(2A) receptors were also identified in the basal ganglia; a brain region that plays a critical role in antipsychotic-induced movement disorders. We tested the significance of variation in the 5-HT(2A) receptor gene (HTR2A) in relation to the TD phenotype. Three polymorphisms in HTR2A, one silent (C102T), one that alters the amino acid sequence (his452tyr) and one in the promoter region (A-1437G) were investigated in 136 patients refractory or intolerant to treatment with typical antipsychotics and with a DSM-IIIR diagnosis of schizophrenia. We did not find any significant difference in allele, genotype or haplotype frequencies of polymorphisms in HTR2A among patients with or without TD (P > 0.05). Further analysis using the ANCOVA statistic with a continuous measure of the TD phenotype (Abnormal Involuntary Movement Scale (AIMS) score) found that the AIMS scores were not significantly influenced by HTR2A polymorphisms, despite controlling for potential confounders such as age, gender and ethnicity (P > 0.05). Theoretically, central serotonergic function can be subject to genetic control at various other mechanistic levels including the rate of serotonin synthesis (tryptophane hydroxylase gene), release, reuptake (serotonin transporter gene) and degradation (monoamine oxidase gene). Analyses of these other serotonergic genes are indicated. In summary, polymorphisms in HTR2A do not appear to influence the risk for TD. Further studies evaluating in tandem multiple candidate genes relevant for the serotonergic system are warranted to dissect the genetic basis of the complex TD phenotype.

  18. 5' UTR polymorphism of dopamine receptor D1 (DRD1) associated with severity and temperament of alcoholism.

    PubMed

    Kim, Dai-Jin; Park, Byung Lae; Yoon, Sujung; Lee, Hae-Kook; Joe, Keun-Ho; Cheon, Young-Hoon; Gwon, Do-Hoon; Cho, Sung-Nam; Lee, Hye Won; NamGung, Suk; Shin, Hyoung Doo

    2007-06-15

    Multiple dopamine receptors in the dopaminergic system may be prime candidates for genetic influence on alcohol abuse and dependence due to their involvement in reward and reinforcing mechanisms. Genetic polymorphisms in dopamine receptor genes are believed to influence the development and/or severity of alcoholism. To examine the genetic effects of the Dopamine Receptor D1 (DRD) gene family (DRD1-DRD5) in the Korean population, 11 polymorphisms in the DRD gene family were genotyped and analyzed in 535 alcohol-dependent subjects and 273 population controls. Although none of the polymorphisms of DRD1-5 genes were found to be associated with the risk of alcoholism, one 5' UTR polymorphism in the DRD1 (DRD1-48A>G) gene was significantly associated with severity of alcohol-related problem, as measured by the Alcohol Use Disorders Identification Test (AUDIT) in a gene dose-dependent manner, i.e., 24.37 (+/-8.19) among patients with -48A/A genotype, 22.37 (+/-9.49) among those with -48A/G genotype, and 17.38 (+/-8.28) among those with -48G/G genotype (P=0.002). The genetic effects of DRD1-48A>G were further analyzed with other phenotypes among alcohol-dependent subjects. Interestingly, the DRD1-48A>A genotype was also found to be associated with novelty seeking (NC), harm avoidance (HA), and persistence (P) (P =0.01, 0.02, and 0.003, respectively). The information derived from this study could be valuable for understanding the genetic factors involved in alcoholic phenotypes and genetic distribution of the DRD gene family, and could facilitate further investigation in other ethnic groups.

  19. Multigenic control of measles vaccine immunity mediated by polymorphisms in measles receptor, innate pathway, and cytokine genes.

    PubMed

    Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; O'Byrne, Megan M; Jacobson, Robert M; Pankratz, V Shane; Poland, Gregory A

    2012-03-09

    Measles infection and vaccine response are complex biological processes that involve both viral and host genetic factors. We have previously investigated the influence of genetic polymorphisms on vaccine immune response, including measles vaccines, and have shown that polymorphisms in HLA, cytokine, cytokine receptor, and innate immune response genes are associated with variation in vaccine response but do not account for all of the inter-individual variance seen in vaccinated populations. In the current study we report the findings of a multigenic analysis of measles vaccine immunity, indicating a role for the measles virus receptor CD46, innate pattern-recognition receptors (DDX58, TLR2, 4, 5, 7 and 8) and intracellular signaling intermediates (MAP3K7, NFKBIA), and key antiviral molecules (VISA, OAS2, MX1, PKR) as well as cytokines (IFNA1, IL4, IL6, IL8, IL12B) and cytokine receptor genes (IL2RB, IL6R, IL8RA) in the genetic control of both humoral and cellular immune responses. This multivariate approach provided additional insights into the genetic control of measles vaccine responses over and above the information gained by our previous univariate SNP association analyses.

  20. Receptor Reserve Moderates Mesolimbic Responses to Opioids in a Humanized Mouse Model of the OPRM1 A118G Polymorphism

    PubMed Central

    Robinson, J Elliott; Vardy, Eyal; DiBerto, Jeffrey F; Chefer, Vladimir I; White, Kate L; Fish, Eric W; Chen, Meng; Gigante, Eduardo; Krouse, Michael C; Sun, Hui; Thorsell, Annika; Roth, Bryan L; Heilig, Markus; Malanga, C J

    2015-01-01

    The OPRM1 A118G polymorphism is the most widely studied μ-opioid receptor (MOR) variant. Although its involvement in acute alcohol effects is well characterized, less is known about the extent to which it alters responses to opioids. Prior work has shown that both electrophysiological and analgesic responses to morphine but not to fentanyl are moderated by OPRM1 A118G variation, but the mechanism behind this dissociation is not known. Here we found that humanized mice carrying the 118GG allele (h/mOPRM1-118GG) were less sensitive than h/mOPRM1-118AA littermates to the rewarding effects of morphine and hydrocodone but not those of other opioids measured with intracranial self-stimulation. Reduced morphine reward in 118GG mice was associated with decreased dopamine release in the nucleus accumbens and reduced effects on GABA release in the ventral tegmental area that were not due to changes in drug potency or efficacy in vitro or receptor-binding affinity. Fewer MOR-binding sites were observed in h/mOPRM1-118GG mice, and pharmacological reduction of MOR availability unmasked genotypic differences in fentanyl sensitivity. These findings suggest that the OPRM1 A118G polymorphism decreases sensitivity to low-potency agonists by decreasing receptor reserve without significantly altering receptor function. PMID:25881115

  1. The Polymorphisms of Ser49Gly and Gly389Arg in Beta-1-Adrenergic Receptor Gene in Major Depression

    PubMed Central

    KOKUT, Süleyman; ATAY, İnci Meltem; UZ, Efkan; AKPINAR, Abdullah; DEMİRDAŞ, Arif

    2015-01-01

    Introduction It was reported that the genetic susceptibility of major depressive disorder (MDD) is related with genetic polymorphisms. The aim of this study was to investigate the possible association of the genotype and allele frequencies of Ser49Gly and Arg389Gly polymorphisms in MDD by comparing them with healthy subjects. Methods A total of 144 patients with MDD diagnosed according to Diagnostic and Statistical Manual of Mental Disorders, 4th Edition (DSM-IV) criteria and 105 healthy controls were included in the study. Polymerase chain reaction (PCR) with restriction fragment length polymorphism (RFLP) was used for genotyping. Results Of the 144 participants in the MDD group, 77 (53.5%) had homozygous wild type (AA), 57 (39.6%) had heterozygous type (AG), and 10 (6.9%) had mutant (GG) genotype for Ser49Gly, whereas 75 (52.1%) had homozygous wild type (GG), 59 (41.0%) had heterozygous (GC) type, and 10 (6.9%) had mutant homozygous (CC) genotype for Gly386Arg. There were no significant difference in the allele and genotype frequencies of the beta-1-adrenergic receptor (ADRB1) gene for Ser49Gly and Arg389Gly polymorphisms after comparing with healthy controls (p=0.626; p=0.863 and p=0.625; p=0.914). Conclusion The results of our study did not reveal a major effect of the polymorphism of Ser49Gly and Gly389Arg in the ADRB1 gene in MDD. Further studies with larger sample size are required to elucidate the role of other beta-1 adrenergic gene polymorphisms in MDD. PMID:28360691

  2. Agonist-receptor-arrestin, an alternative ternary complex with high agonist affinity.

    PubMed

    Gurevich, V V; Pals-Rylaarsdam, R; Benovic, J L; Hosey, M M; Onorato, J J

    1997-11-14

    The rapid decrease of a response to a persistent stimulus, often termed desensitization, is a widespread biological phenomenon. Signal transduction by numerous G protein-coupled receptors appears to be terminated by a strikingly uniform two-step mechanism, most extensively characterized for the beta2-adrenergic receptor (beta2AR), m2 muscarinic cholinergic receptor (m2 mAChR), and rhodopsin. The model predicts that activated receptor is initially phosphorylated and then tightly binds an arrestin protein that effectively blocks further G protein interaction. Here we report that complexes of beta2AR-arrestin and m2 mAChR-arrestin have a higher affinity for agonists (but not antagonists) than do receptors not complexed with arrestin. The percentage of phosphorylated beta2AR in this high affinity state in the presence of full agonists varied with different arrestins and was enhanced by selective mutations in arrestins. The percentage of high affinity sites also was proportional to the intrinsic activity of an agonist, and the coefficient of proportionality varies for different arrestin proteins. Certain mutant arrestins can form these high affinity complexes with unphosphorylated receptors. Mutations that enhance formation of the agonist-receptor-arrestin complexes should provide useful tools for manipulating both the efficiency of signaling and rate and specificity of receptor internalization.

  3. The BclI polymorphism of the glucocorticoid receptor gene is associated with emotional memory performance in healthy individuals.

    PubMed

    Ackermann, Sandra; Heck, Angela; Rasch, Björn; Papassotiropoulos, Andreas; de Quervain, Dominique J-F

    2013-07-01

    Glucocorticoids, stress hormones released from the adrenal cortex, are important players in the regulation of emotional memory. Specifically, in animals and in humans, glucocorticoids enhance memory consolidation of emotionally arousing experiences, but impair memory retrieval. These glucocorticoid actions are partly mediated by glucocorticoid receptors in the hippocampus, amygdala and prefrontal cortex, key brain regions for emotional memory. In a recent study in patients who underwent cardiac surgery, the BclI polymorphism of the glucocorticoid receptor gene (NR3C1) was associated with traumatic memories and posttraumatic stress disorder symptoms after intensive care therapy. Based on this finding, we investigated if the BclI polymorphism is also associated with emotional memory in healthy young subjects (N=841). We used a picture-learning task consisting of learning and recalling neutral and emotional photographs on two consecutive days. The BclI variant was associated with short-delay recall of emotional pictures on both days, with GG carriers showing increased emotional memory performance as compared to GC and CC carriers. We did not detect a genotype-dependent difference in recall performance for neutral pictures. These findings suggest that the Bcll polymorphism contributes to inter-individual differences in emotional memory also in healthy humans.

  4. Functional polymorphisms of the glutamate receptor N-methyl D-aspartate 2A gene are associated with heroin addiction.

    PubMed

    Zhong, H J; Huo, Z H; Dang, J; Chen, J; Zhu, Y S; Liu, J H

    2014-10-27

    Heroin dependence is a debilitating psychiatric disorder with a complex inheritance mechanism. Genetic polymorphisms in functional regions of the glutamate receptor, N-methyl D-aspartate 2A (GRIN2A) gene, which encodes the 2A subunit of the N-methyl D-aspartate (NMDA) receptor, may modulate the risk of heroin addiction. We investigated the potential association between 8 single nucleotide polymorphisms (SNPs) of the GRIN2A gene (SNPs rs3219790, rs1014531, rs8044472, rs8045712, rs9933624, rs9940680, rs1420040, and rs767749) and heroin addiction using the MassARRAY system and GeneScan. A total of 405 heroin-addicted patients and 397 healthy control subjects were recruited for this study. Statistically significant differences were observed for rs3219790 in the promoter region of the GRIN2A gene. The frequency of the (GT)26 repeats in the heroin addiction group was significantly higher than that in the control group [X(2) = 5.475, P = 0.019, odds ratio (OR) = 1.367, 95% confidence interval (CI) = 1.051-1.776]. Strong linkage disequilibrium was observed in block 1 (D' > 0.9). However, significant evidence of linkage disequilibrium was not observed between the 7 SNPs in our sample population. These data suggest that GRIN2A gene polymorphisms confer susceptibility to heroin addiction and support the hypothesis that dysfunction of GRIN2A is involved in the pathophysiological process of heroin addiction.

  5. A genetic polymorphism (rs17251221) in the calcium-sensing receptor is associated with ovarian cancer susceptibility.

    PubMed

    Yan, Shi; Yuan, Cunzhong; Yang, Qifeng; Li, Xiaoyan; Yang, Ning; Liu, Xiaoyan; Dong, Ruihua; Zhang, Xi; Yuan, Zeng; Zhang, Ning; Kong, Beihua

    2015-10-01

    Calcium-sensing receptor (CaSR) is a G-protein‑ coupled receptor that senses blood calcium. In vivo, CaSR is required for normal epidermal differentiation by mediating calcium signaling. CaSR was confirmed to be a tumor suppressor in colon and breast cancer. The single-nucleotide polymorphism (SNP) rs17251221, located on the intron, is a genetic variation of the CaSR gene. We analyzed rs17251221 in ovarian cancer using an allelic discrimination assay. Cycling probes were used for genotyping 290 ovarian cancer patients and 312 age-matched cancer-free females. rs17251221 and clinicopathological characteristics of ovarian cancer were analyzed statistically. The AG and GG genotypes were confirmed to appear in fewer cancer cases than in controls and the genotype distribution between cases and controls was statistically significant. The AG+GG genotype was correlated with low ovarian cancer risk, while rs17251221 was not associated with clinicopathological variables including age at diagnosis, tumor size, histologic type, pathological subtype, lymph node metastasis, CA-125 expression, clinical stage, or degree of differentiation. The rs17251221 polymorphism genotype was not correlated with survival in ovarian cancer. These results suggest that the G allele of the CaSR rs17251221 polymorphism is protective against ovarian cancer and the homozygous GG genotype may be a protective genotype as well. The rs17251221 may play an important role in the development of ovarian cancer and could be used as a biomarker for predicting ovarian cancer.

  6. Association between Opioid Receptor mu 1 (OPRM1) Gene Polymorphisms and Tobacco and Alcohol Consumption in a Spanish Population.

    PubMed

    Francès, Francesc; Portolés, Olga; Castelló, Ana; Costa, Jose Antonio; Verdú, Fernando

    2015-04-25

    Evidence gained from animals and humans suggests that the encephalic opioid system might be involved in the development of drug addiction through its role in reward. Our aim is to assess the influence of genetic variations in the opioid receptor mu 1 on alcohol and tobacco consumption in a Spanish population. 763 unrelated individuals (465 women, 298 men) aged 18-85 years were recruited between October 2011 and April 2012. Participants were requested to answer a 35-item questionnaire on tobacco and alcohol consumption, as well as to complete the AUDIT and Fagerström tests. Individuals were genotyped for three polymorphisms in the opioid receptor mu 1 (OPRM1) gene, using a TaqMan protocol. In males, the rs10485057 polymorphism was associated with total pure ethanol intake and with the risk of being an alcohol consumer. Also, this polymorphism was significantly associated with higher Fagerström scores. Rs1799971 had a different influence on adaptive and maladaptive patterns of alcohol use. Despite the limited sample size, our study might enrich current knowledge on patterns of alcohol use, because it encompasses both extreme and adaptive phenotypes, providing thus a wider perspective on this subject.

  7. Gender-Related Survival Differences Associated With Polymorphic Variants of Estrogen Receptor Beta (ERβ) in Patients with Metastatic Colon Cancer

    PubMed Central

    Press, Oliver A.; Zhang, Wu; Gordon, Michael A.; Yang, Dongyun; Haiman, Christopher A.; Azuma, Mizutomo; Iqbal, Syma; Lenz, Heinz-Josef

    2010-01-01

    Estrogen replacement therapy in women has demonstrated a protective effect in the development of colonic carcinomas. Gender-related differences in the development of colonic carcinomas have also been reported. Estrogen receptor beta (ERβ) is expressed in colon carcinomas and has demonstrated prognostic value in colon cancer patients. This study investigated an ERβ 3’ non-coding polymorphism associated with transcriptional activity to determine clinical outcome in patients with metastatic colon cancer. Genomic DNA from 318 metastatic colon cancer patients, 177 males and 141 females, were collected from 1992 to 2003. These patients were analyzed for CA repeat polymorphism of the ERβ gene. Gender-related survival differences were associated with an ERβ (CA)n repeat polymorphism (P for interaction=0.003, the likelihood ratio test). Female patients with any short <22 (CA)n repeat alleles had shorter overall survival compared to female patients that had both long ≥22 (CA)n repeat alleles. In the male patients the opposite overall survival difference was found. This study supports the role of an ERβ (CA)n repeat polymorphism as a prognostic marker in metastatic colon cancer; however, this prognostic factor had opposite implications based on gender. PMID:20548329

  8. Influence of Androgen Receptor Gene CAG and GGC Polymorphisms on Male Sexual Function: A Cross-Sectional Study

    PubMed Central

    Corona, Giovanni; Falzetti, Sara; delli Muti, Nicola

    2016-01-01

    Background. No study has assessed the possible involvement of GGC androgen receptor (AR) polymorphism in sexual function. Our aim is to evaluate the association between CAG and GGC AR polymorphisms in this function. Methods. We retrospectively examined eighty-five outpatients. Clinical, biochemical, and genetic parameters were considered. Sexual assessment was performed using the International Index of Erectile Function (IIEF) which evaluates erectile function (EF), orgasmic function (OF), sexual desire (SD), intercourse satisfaction (IS), and overall satisfaction (OS). Results. In the whole sample, CAG repeats were inversely correlated with EF, OF, and total IIEF-15 score, whereas GGC tracts did not show any significant correlation with sexual function. CAG relationship with IIEF items retained significance only in the eugonadal but not in the hypogonadal cohort. On the other hand, GGC tracts were not found to be significantly correlated with IIEF variables in either eugonadal or hypogonadal subjects. In eugonadal subjects, logistic regression pointed out that a higher number of CAG triplets were associated with lower values of EF, OF, SD, OS, and total IIEF independently from other confounders. Conclusions. GGC polymorphism seems not to exert any influence on sexual function, whereas CAG polymorphism appears to affect sexual parameters only in eugonadal subjects. PMID:28243253

  9. Receptor for advanced glycation end products Glycine 82 Serine polymorphism and risk of cardiovascular events in rheumatoid arthritis.

    PubMed

    Carroll, Lisa; Frazer, Ian H; Turner, Malcolm; Marwick, Thomas H; Thomas, Ranjeny

    2007-01-01

    Patients with rheumatoid arthritis (RA) are at risk of excess mortality, predominantly owing to cardiovascular (CV) events. The receptor for advanced glycation end products (RAGE) has been implicated in the perpetuation of the chronic inflammatory response in vascular disease. A Gly82-->Ser polymorphism in the RAGE gene, which is associated with enhanced RAGE signaling, is present more frequently in patients with RA than the general population. To investigate whether RAGE Gly82-->Ser polymorphism is associated with CV events in RA, we examined CV events, CV risk factors, features of RA and RAGE Gly82-->Ser polymorphism in 232 patients with RA attending a tertiary referral hospital. CV events, the duration and severity of RA, and risk factors for CV disease were determined using patient questionnaires, chart review, laboratory analysis and radiographs. DNA was typed for HLA-DRB1 genes and RAGE Gly82-->Ser polymorphism. The RAGE Ser82 allele, which is in linkage disequilibrium with the RA susceptibility allele HLA-DRB1*0401, was carried by 20% of patients. More than 20% of the cohort had suffered a vascular event; a shorter duration of RA, but not the RAGE genotype, was significantly associated with CV events. However, a history of statin use was protective. Thus, the RAGE Ser82 allele, associated with enhanced RAGE signaling, does not predispose to CV events in RA. However, treatment of hyperlipidemia with statins reduces the probability of a CV event.

  10. The progesterone receptor PROGINS polymorphism is not related to oxidative stress factors in women with polycystic ovary syndrome

    PubMed Central

    Karadeniz, Muammer; Erdogan, Mehmet; Berdeli, Afig; Tamsel, Sadik; Saygili, Fusun; Yilmaz, Candeger

    2007-01-01

    Background Women with PCOS have been reported to be at increased risk of a number of gynaecological neoplasias, including endometrial, breast, and ovarian cancer. Studies of the possible association of genetic variation in progesterone receptor polymorphism with risk of ovarian and breast cancer have concentrated on a variant known as PROGINS. Methods Ninety-five young women with PCOS and 99 healthy control women were included in our study. All subjects underwent venous blood drawing for complete hormonal assays, lipid profile, glucose, insulin and PROGINS polymorphism genetic study. Results In PROGINS polymorphism results; in both control and the patient groups T1/T1 has been detected in high levels. But for genotype (p = 0.178) and allele (p = 0.555) frequencies both of the groups give similar results. Statistically significant difference has been detected on serum FSH levels for T1/T1 genotype according to T2/T2 genotype. Conclusion No relation has been detected between the inflammatory and oxidative stress factors, and PROGINS polymorphism alleles. This may be because the PCOS patients are young and their BMI means are normal and their CIMT and oxidative stress markers are like healthy women. PMID:17919323

  11. Evidence of association of vitamin D receptor Apa I gene polymorphism with bone mineral density in postmenopausal women with osteoporosis.

    PubMed

    Dundar, Umit; Solak, Mustafa; Kavuncu, Vural; Ozdemir, Mujgan; Cakir, Tuncay; Yildiz, Handan; Evcik, Deniz

    2009-10-01

    The vitamin D receptor (VDR) was the first candidate gene to be studied in relation to osteoporosis, and most attention has focused on polymorphisms situated near the 3' flank of VDR. The aim of this study was to investigate the association about VDR gene Apa I polymorphism with bone mineral density (BMD) in postmenopausal women with osteoporosis. We studied a total of 136 postmenopausal women with a mean age of 56.36 +/- 10.29 years. Among them, a total of 75 had osteoporosis, 37 had osteopenia, and 24 had normal BMD. Venous blood samples were obtained for evaluation of bone metabolism and genotyping. The VDR Apa I genotype was determined by polymerase chain reaction-restriction fragment length polymorphism. BMDs at the lumbar spine and hip were measured by dual-energy X-ray absorptiometry. Postmenopausal women with aa genotype had significantly lower BMD values (grams per centimeter square) at lumbar spines compared to persons with AA genotype. Also, postmenopausal women with AA genotype had significantly higher serum Ca level than the subjects with aa genotype. In conclusion, our result may indicate that VDR Apa I gene polymorphism may be responsible for a important part of the heritable component of lumbar spine BMD in postmenopausal women, possibly related to impaired calcium absorption from the bowel.

  12. -383 A/C tumor necrosis factor receptor 1 polymorphism and ankylosing spondylitis in Mexicans: a preliminary study.

    PubMed

    Corona-Sanchez, Esther Guadalupe; Muñoz-Valle, José Francisco; Gonzalez-Lopez, Laura; Sanchez-Hernandez, Julia Dolores; Vazquez-Del Mercado, Monica; Ontiveros-Mercado, Heriberto; Huerta, Miguel; Trujillo, Xochitl; Rocha-Muñoz, Alberto Daniel; Celis, Alfredo; Ortega-Flores, Ricardo; Gamez-Nava, Jorge Ivan

    2012-08-01

    The objective of this study was to evaluate the differences in allele and genotype frequencies of -383 tumor necrosis factor receptor 1 (TNFR1) polymorphism between ankylosing spondylitis (AS) and controls. Mexican Mestizos with AS were matched by gender, age, and ethnicity with healthy controls and compared in allele and genotype frequencies of the -383 TNFR1 polymorphism. Polymorphisms were genotyped using PCR-RFLP. The AA genotype occurred at a higher frequency in the AS group (92%) compared with controls (79%, P = 0.03). A allele was increased in AS (96% vs. 88%, P = 0.015) and was associated with genetic susceptibility for AS (odds ratio = 3.48, 95% CI = 1.23-10.61). This preliminary study is the first assessing the association of the -383 A/C TNFR1 polymorphism with AS, although it has the limitation of a small sample size. These data are of interest for the genetic epidemiology of AS in the Mexican population, requiring further investigation in other countries.

  13. Association of Polymorphisms of the Receptor for Advanced Glycation Endproducts Gene with Schizophrenia in a Han Chinese Population

    PubMed Central

    Fu, Jiawu; Zuo, Xiang; Yin, Jingwen; Luo, Xudong; Li, Zheng; Lin, Juda

    2017-01-01

    Receptor for Advanced Glycation Endproducts (RAGE) is a member of the immunoglobulin superfamily that binds diverse ligands involved in the development of inflammatory damage and diverse chronic diseases including schizophrenia. Here, three single-nucleotide polymorphisms (SNPs) (G82S, -374T/A, and -429T/C) in the RAGE gene were genotyped in 923 patients with schizophrenia and 874 healthy-matched controls in a Han Chinese population using the SNaPshot technique. Additionally, we investigated the association among aforementioned SNPs with the clinical psychotic symptoms of the patients and neurocognitive function. Our study demonstrated that the frequencies of the TC + CC genotypes and the C allele in the -429T/C polymorphism were significantly lower in the patients compared with the controls (p = 0.031 and p = 0.034, resp.). However, the significant effect disappeared when using Bonferroni correction (p = 0.093 and p = 0.102, resp.). And there were no significant differences in the genotype and allele frequencies between the patients and the controls for G82S and -374T/A polymorphisms. Additionally, the -429T/C C allele carriers had marginally higher Symbol coding scores than the subjects with the TT genotypes [p = 0.031 and p (corr) = 0.093]. Our data indicate that the RAGE -429T/C polymorphism may be associated with the susceptibility of schizophrenia. PMID:28373983

  14. Serotonin receptor gene (HTR2A) T102C polymorphism modulates individuals’ perspective taking ability and autistic-like traits

    PubMed Central

    Gong, Pingyuan; Liu, Jinting; Blue, Philip R.; Li, She; Zhou, Xiaolin

    2015-01-01

    Previous studies have indicated that empathic traits, such as perspective taking, are associated with the levels of serotonin in the brain and with autism spectrum conditions. Inspired by the finding that the serotonin receptor 2A gene (HTR2A) modulates the availability of serotonin, this study investigated to what extent HTR2A modulates individuals’ perspective taking ability and autistic-like traits. To examine the associations of the functional HTR2A polymorphism T102C (rs6313) with individuals’ perspective taking abilities and autistic-like traits, we differentiated individuals according to this polymorphism and measured empathic and autistic-like traits with Interpersonal Reactivity Index (IRI) and Autism-Spectrum Quotient (AQ) scale in 523 Chinese people. The results indicated that this polymorphism was significantly associated with the scores on Perspective Taking and Personal Distress subscales of IRI, and Communication subscale of AQ. Individuals with a greater number of the C alleles were less likely to spontaneously adopt the point of view of others, more likely to be anxious when observing the pain endured by others, and more likely to have communication problems. Moreover, the genotype effect on communication problems was mediated by individuals’ perspective taking ability. These findings provide evidence that the HTR2A T102C polymorphism is a predictor of individual differences in empathic and autistic-like traits and highlight the role of the gene in the connection between perspective taking and autistic-like traits. PMID:26557070

  15. Serotonin receptor gene (HTR2A) T102C polymorphism modulates individuals' perspective taking ability and autistic-like traits.

    PubMed

    Gong, Pingyuan; Liu, Jinting; Blue, Philip R; Li, She; Zhou, Xiaolin

    2015-01-01

    Previous studies have indicated that empathic traits, such as perspective taking, are associated with the levels of serotonin in the brain and with autism spectrum conditions. Inspired by the finding that the serotonin receptor 2A gene (HTR2A) modulates the availability of serotonin, this study investigated to what extent HTR2A modulates individuals' perspective taking ability and autistic-like traits. To examine the associations of the functional HTR2A polymorphism T102C (rs6313) with individuals' perspective taking abilities and autistic-like traits, we differentiated individuals according to this polymorphism and measured empathic and autistic-like traits with Interpersonal Reactivity Index (IRI) and Autism-Spectrum Quotient (AQ) scale in 523 Chinese people. The results indicated that this polymorphism was significantly associated with the scores on Perspective Taking and Personal Distress subscales of IRI, and Communication subscale of AQ. Individuals with a greater number of the C alleles were less likely to spontaneously adopt the point of view of others, more likely to be anxious when observing the pain endured by others, and more likely to have communication problems. Moreover, the genotype effect on communication problems was mediated by individuals' perspective taking ability. These findings provide evidence that the HTR2A T102C polymorphism is a predictor of individual differences in empathic and autistic-like traits and highlight the role of the gene in the connection between perspective taking and autistic-like traits.

  16. Environmental stress, oxytocin receptor gene (OXTR) polymorphism, and mental health following collective stress.

    PubMed

    Lucas-Thompson, Rachel G; Holman, E Alison

    2013-04-01

    We examined whether the oxytocin receptor gene (OXTR) single nucleotide polymorphism (SNP) rs53576 genotype buffers the combined impact of negative social environments (e.g., interpersonal conflict/constraint) and economic stress on post-traumatic stress (PTS) symptoms and impaired daily functioning following collective stress (September 11th terrorist attacks). Saliva was collected by mail and used to genotype 704 respondents. Participants completed Web-based assessments of pre-9/11 mental health, acute stress 9-23 days after 9/11, the quality of social environments 1 year post-9/11, economic stress 18 months post-9/11, and PTS symptoms and impaired functioning 2 and 3 years post-9/11. Interactions between negative social environments and economic stress were examined separately based on OXTR rs53576 genotype (GG vs. any A allele). For individuals with an A allele, a negative social environment significantly increased PTS symptoms without regard to the level of economic stress experienced. However, for respondents with a GG genotype, negative social environments predicted elevated PTS symptoms only for those also experiencing high economic stress. Gender moderated associations between negative social environments, economic stress, and impaired functioning. The functioning of females was most affected by negative social environments regardless of genotype and economic stress, whereas the functioning of males was differentially susceptible to economic stress depending on OXTR genotype and negative social environments. These findings suggest that it is important to consider the combined impact of gender and ongoing stress in different domains as moderators of genetic vulnerability following collective stress.

  17. The Influence of Dopamine Receptor D4 Polymorphism on Resting EEG in Healthy Young Females

    PubMed Central

    Lee, Tien-Wen; Yu, Younger W.-Y; Hong, Chen-Jee; Tsai, Shih-Jen; Wu, Hung-Chi; Chen, Tai-Jui

    2012-01-01

    The polymorphism of variable number of tandem repeat (VNTR) in dopamine receptor D4 (DRD4) gene exon III has been linked to various neuro-psychiatric conditions with disinhibition/impulsivity as one of the core features. This study examined the modulatory effects of long-allele variant of DRD4 VNTR on the regional neural activity as well as inter-regional neural interactions in a young female population. Blood sample and resting state eyes-closed EEG signals were collected in 233 healthy females, stratified into two groups by polymerase chain reaction: long-allele carriers (>4- repeat) and non-carriers (<=4-repeat/<=4-repeat). The values of mean power of 18 electrodes and mutual information of 38 channel pairs across theta, alpha, and beta frequencies were analyzed. Our connectivity analysis was based on information theory, which combined Morlet wavelet transform and mutual information calculation. Between-group differences of regional power and connectivity strength were quantified by independent t-test, while between-group differences in global trends were examined by non-parametric analyses. We noticed that DRD4 VNTR long-allele was associated with decreased global connectivity strength (from non-parametric analysis), especially over bi-frontal, biparietal and right fronto-parietal and right fronto-temporal connections (from independent t-tests). The between-group differences in regional power were not robust. Our findings fit with the networks of response inhibition, providing evidence bridging DRD4 long-allele and disinhibition/impulsivity in neuropsychiatric disorders. We suggest future DRD4 studies of imaging genetics incorporate connectivity analysis to unveil its impact on cerebral network. PMID:22448208

  18. Calcium intake, polymorphisms of the calcium-sensing receptor, and recurrent/aggressive prostate cancer

    PubMed Central

    Binder, Moritz; Shui, Irene M.; Wilson, Kathryn M.; Penney, Kathryn L.; Mucci, Lorelei A.; Kibel, Adam S.

    2015-01-01

    Purpose To assess whether calcium intake and common genetic variants of the calcium-sensing receptor (CASR) are associated with either aggressive prostate cancer (PCa) or disease recurrence after prostatectomy. Methods Calcium intake at diagnosis was assessed, and 65 common single-nucleotide polymorphisms (SNPs) in CASR were genotyped in 886 prostatectomy patients. We investigated the association between calcium intake and CASR variants with both PCa recurrence and aggressiveness (defined as Gleason score ≥4 + 3, stage ≥pT3, or nodal-positive disease). Results A total of 285 men had aggressive disease and 91 experienced recurrence. A U-shaped relationship between calcium intake and both disease recurrence and aggressiveness was observed. Compared to the middle quintile, the HR for disease recurrence was 3.07 (95 % CI 1.41–6.69) for the lowest quintile and 3.21 (95 % CI 1.47–7.00) and 2.97 (95 % CI 1.37–6.45) for the two upper quintiles, respectively. Compared to the middle quintile, the OR for aggressive disease was 1.80 (95 % CI 1.11–2.91) for the lowest quintile and 1.75 (95 % CI 1.08–2.85) for the highest quintile of calcium intake. The main effects of CASR variants were not associated with PCa recurrence or aggressiveness. In the subgroup of patients with moderate calcium intake, 31 SNPs in four distinct blocks of high linkage disequilibrium were associated with PCa recurrence. Conclusions We observed a protective effect of moderate calcium intake for PCa aggressiveness and recurrence. While CASR variants were not associated with these outcomes in the entire cohort, they may be associated with disease recurrence in men with moderate calcium intakes. PMID:26407952

  19. Transcobalamin II Receptor Polymorphisms Are Associated with Increased Risk for Neural Tube Defects

    PubMed Central

    Pangilinan, Faith; Mitchell, Adam; VanderMeer, Julie; Molloy, Anne M.; Troendle, James; Conley, Mary; Kirke, Peadar N.; Sutton, Marie; Sequeira, Jeffrey M.; Quadros, Edward V.; Scott, John M.; Mills, James L.; Brody, Lawrence C.

    2014-01-01

    Objective: Women who have low cobalamin (vitamin B12) levels are at increased risk for having children with neural tube defects (NTDs). The transcobalamin II receptor (TCblR) mediates uptake of cobalamin into cells. We evaluated inherited variants in the TCblR gene as NTD risk factors. Methods: Case-control and family-based tests of association were used to screen common variation in TCblR as genetic risk factors for NTDs in a large Irish group. A confirmatory group of NTD triads was used to test positive findings. Results: We found two tightly linked variants associated with NTDs in a recessive model: TCblR rs2336573 (G220R) (pcorr=0.0080, corrected for multiple hypothesis testing) and TCblR rs9426 (pcorr =0. 0279). These variants were also associated with NTDs in a family-based test prior to multiple test correction (log-linear analysis of a recessive model: rs2336573 (G220R) (RR=6.59, p=0.0037) and rs9426 (RR=6.71, p=0.0035)). We describe a copy number variant (CNV) distal to TCblR and two previously unreported exonic insertion-deletion polymorphisms. Conclusions: TCblR rs2336573 (G220R) and TCblR rs9426 represent a significant risk factor in NTD cases in the Irish population. The homozygous risk genotype was not detected in nearly one thousand controls, indicating this NTD risk factor may be of low frequency and high penetrance. Nine other variants are in perfect LD with the associated SNPs. Additional work is required to identify the disease-causing variant. Our data suggest that variation in TCblR plays a role in NTD risk and that these variants may modulate cobalamin metabolism. PMID:20577008

  20. Association of 3'-UTR polymorphisms of the oxidised LDL receptor 1 (OLR1) gene with Alzheimer's disease.

    PubMed

    Lambert, J-C; Luedecking-Zimmer, E; Merrot, S; Hayes, A; Thaker, U; Desai, P; Houzet, A; Hermant, X; Cottel, D; Pritchard, A; Iwatsubo, T; Pasquier, F; Frigard, B; Conneally, P M; Chartier-Harlin, M-C; DeKosky, S T; Lendon, C; Mann, D; Kamboh, M I; Amouyel, P

    2003-06-01

    Although possession of the epsilon 4 allele of the apolipoprotein E gene appears to be an important biological marker for Alzheimer's disease (AD) susceptibility, strong evidence indicates that at least one additional risk gene exists on chromosome 12. Here, we describe an association of the 3'-UTR +1073 C/T polymorphism of the OLR1 (oxidised LDL receptor 1) on chromosome 12 with AD in French sporadic (589 cases and 663 controls) and American familial (230 affected sibs and 143 unaffected sibs) populations. The age and sex adjusted odds ratio between the CC+CT genotypes versus the TT genotypes was 1.56 (p=0.001) in the French sample and 1.92 (p=0.02) in the American sample. Furthermore, we have discovered a new T/A polymorphism two bases upstream of the +1073 C/T polymorphism. This +1071 T/A polymorphism was not associated with the disease, although it may weakly modulate the impact of the +1073 C/T polymorphism. Using 3'-UTR sequence probes, we have observed specific DNA protein binding with nuclear proteins from lymphocyte, astrocytoma, and neuroblastoma cell lines, but not from the microglia cell line. This binding was modified by both the +1071 T/A and +1073 C/T polymorphisms. In addition, a trend was observed between the presence or absence of the +1073 C allele and the level of astrocytic activation in the brain of AD cases. However, Abeta(40), Abeta(42), Abeta total, and Tau loads or the level of microglial cell activation were not modulated by the 3'-UTR OLR1 polymorphisms. Finally, we assessed the impact of these polymorphisms on the level of OLR1 expression in lymphocytes from AD cases compared with controls. The OLR1 expression was significantly lower in AD cases bearing the CC and CT genotypes compared with controls with the same genotypes. In conclusion, our data suggest that genetic variation in the OLR1 gene may modify the risk of AD.

  1. Vitamin D receptor gene BsmI polymorphisms in Egyptian children and adolescents with systemic lupus erythematosus

    PubMed Central

    Azab, Seham F.; Ali, Yasser F.; Farghaly, Mohsen A.A.; Hamed, Mohammed E.; Allah, Mayy A.N.; Emam, Ahmed A.; Abdelsalam, Nasser I.; Hashem, Mustafa I.A.; Gawish, Heba H.; Nabil, Rehab M.; Kamel, Lamiaa M.; Fahmy, Dalia S.; Alsayed, Salah F.; Al Azizi, Nashwa M.; Al-Akad, Ghada M.; Noah, Maha A.; Abdelrahman, Hind M.; Ahmed, Ahmed R.; Bendary, Eman A.

    2016-01-01

    Abstract Systemic lupus erythematosus (SLE) is a multisystemic autoimmune disease. The vitamin D receptor (VDR) gene is a candidate gene for susceptibility to autoimmune disorders. To date, only a few studies concerned the association of the VDR gene polymorphisms with childhood-onset SLE. In this study, we aimed to investigate the BsmI polymorphisms in the VDR gene, for the first time in Egyptian children and adolescents with SLE, to determine whether this polymorphism could be a marker of susceptibility to or severity of SLE and we also measured the serum level of 25-hydroxyvitamin D (25[OH] D) to assess its relation to such polymorphism. This was a case–control study including 100 patients with SLE and matched with age, sex, and ethnicity and 100 healthy controls. All subjects were genotyped for the VDR gene BsmI polymorphism by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), whereas the serum 25(OH) D levels were measured by enzyme-linked immunosorbent assay method. Compared to the contros subjects, the VDR BsmI BB genotype and B allele were overrepresented among SLE patients (odda ratio [OR]: 5.5; 95% confidence interval [CI]: 1.9–15.9; P = 0.002 and OR: 1.84; 95% CI: 1.21–2.80; P = 0.003; respectively). We found a significant association between VDR BsmI BB genotype with lupus nephritis (OR: 6.8; 95% CI: 1.18–50.5; P = 0.001). However, we did not observe any significant association of studied polymorphisms with other clinical manifestations, laboratory profiles of SLE, or disease activity score. Our data revealed no association between VDR BsmI genotypes or alleles and serum 25-hydroxyvitamin D levels among studied patients with SLE (all P > 0.05). We demonstrate for the first time, to the best of our knowledge, that the VDR BsmI gene polymorphisms may contribute to susceptibility to SLE in Egyptian children and adolescents. Moreover, we found that the BB genotype constituted a risk factor for the

  2. Vitamin D receptor gene TaqI and Apal polymorphisms and steroid responsiveness in childhood idiopathic nephrotic syndrome

    PubMed Central

    Al-Eisa, Amal A; Haider, Mohammad Z

    2016-01-01

    Background Vitamin D activity is controlled by vitamin D receptors (VDRs), which are affected by different genetic polymorphisms, including TaqI and Apal restriction fragment length polymorphisms (RFLPs), which have been reported to be associated with several diseases. The aim of this study was to determine the frequency and the association of VDR gene polymorphisms with idiopathic nephrotic syndrome (INS) and steroid responsiveness in Kuwaiti children. Subjects and methods Genotypes of the VDR TaqI gene polymorphism and the Apal gene polymorphism were analyzed using polymerase chain reaction-RFLP in 78 INS patients and 56 matched controls. Results A total of 78 INS (62 steroid sensitive [SS] and 16 steroid resistant [SR]) patients with a mean age of 6.5±3.1 years were studied. Male:female ratio was 2:1. The TT genotype of VDR–TaqI polymorphism was detected in 41% of the INS patients compared to 42% of the controls (P=0.816). The heterozygous TC genotype was detected in 33% of INS patients compared to 46% of the controls (P=0.462). The CC genotype was detected in 25.6% of INS patients and 21% of the controls (P=0.719). The C-allele frequency, in its homozygous and heterozygous forms, was 71% in INS patients compared to 63% in the controls (P=0.342). Similarly, no significant difference was detected in terms of VDR–Apal polymorphism in INS patients compared to the controls for all the three genotypes (P=0.76, P=0.207, and P=0.364, respectively, for GG, GT, and TT genotypes). The T-allele frequency, in its homozygous and heterozygous forms, was 89% in INS patients compared to 93% in the controls (P=0.076). No significant difference was found in any of the allele frequencies between SS and SR subgroups when compared with each other or when compared to the controls. Conclusion Our data do not support the use of VDR–TaqI or –Apal gene polymorphisms as genetic markers of INS nor do they predict steroid responsiveness in children with the disease. PMID:27540309

  3. Association of the Alu insertion polymorphism in the progesterone receptor gene with breast cancer in a Mexican population

    PubMed Central

    Figuera, Luis E.; Flores-Ramos, Liliana Gómez; Puebla-Pérez, Ana María; Zúñiga-González, Guillermo Moisés

    2015-01-01

    Introduction The progesterone receptor (PR) gene plays an important role in reproduction-related events. Data on polymorphisms in the PR gene have revealed associations with cancer, particularly for the Alu insertion polymorphism, which has been suggested to affect progesterone receptor function and contribute to tumor promotion in the mammary gland. Material and methods We examined the role of the Alu insertion polymorphism in the PR gene by comparing the genotypes of 209 healthy Mexican women with those of 481 Mexican women with breast cancer (BC). Results The genotype frequencies observed in the controls and BC patients were 0% and 4% for T2/T2 (Alu insertion), 16% and 21% for T1/T2, and 84% and 75% for T1/T1 (Alu deletion), respectively. The obtained odds ratio (OR) was 1.7, with a 95% confidence interval (95% CI) of 1.1–2.6, p = 0.009, for the T1/T2–T2/T2 genotypes. The association was also evident when the distributions of the T1/T2–T2/T2 genotypes in patients in the following categories were compared: obesity grade II (OR = 1.81, 95% CI: 1.03–3.18, p = 0.039) and the chemotherapy response (OR = 1.91, 95% CI: 1.27–3.067, p = 0.002). Conclusions The T1/T2–T2/T2 genotypes of the Alu insertion polymorphism in the PR gene are associated with BC susceptibility in the analyzed Mexican population. PMID:26170848

  4. Single-nucleotide polymorphisms in dopamine receptor D1 are associated with heroin dependence but not impulsive behavior.

    PubMed

    Liu, J H; Zhong, H J; Dang, J; Peng, L; Zhu, Y S

    2015-04-27

    Previous studies suggested that dopamine receptors may be associated with drug dependence and impulsive behavior. In this study, we examined whether dopamine receptor D1 (DRD1) is associated with heroin dependence and the impulsive behavior in patients with heroin dependence. The participants included 367 patients with heroin dependence and 372 healthy controls from a Chinese Han population. We examined the potential association between heroin dependence and 8 single-nucleotide polymorphisms (rs686, rs4867798, rs1799914, rs4532, rs5326, rs265981, rs10078714, rs10078866) of DRD1, and the associations between single single-nucleotide polymorphism, haplotypes, and impulsive behavior. Compared with the healthy controls, heroin dependence patients showed a significantly lower frequency of GG homozygotes of rs5326 (P = 0.027), significantly lower frequency of the G allele of rs5326 (P = 0.007, odds ratio = 0.718, 95% confidence interval = 0.565-0.913), and higher frequency of the rs265981 G allele (P = 0.0002, odds ratio = 1.711, 95% confidence interval = 1.281-2.287). Furthermore, strong linkage disequilibrium was observed in 2 blocks (D' > 0.9). However, no association was observed between haplotypes and heroin dependence in the 2 blocks. This genetic behavior correlation study showed that the 2 single-nucleotide polymorphisms, rs5326 and rs265981, were not associated with the impulsive behavior in patients with heroin dependence. These findings indicate that DRD1 gene polymorphisms are related to heroin dependence in a Chinese Han population and may be informative for future genetic or biological studies on heroin dependence.

  5. Suicide, stress and serotonin receptor 1A promoter polymorphism -1019C>G in Slovenian suicide victims.

    PubMed

    Videtic, Alja; Zupanc, Tomaz; Pregelj, Peter; Balazic, Joze; Tomori, Martina; Komel, Radovan

    2009-06-01

    Implication of serotonergic system in suicide and suicide attempts has been discussed for several years. One of the most abundant serotonin receptors in the mammalian brain is the receptor 1A (5-HT1A); studies of its polymorphisms and suicide have provided very inconsistent results so far. The suggestion that the G allele depresses HTR1A autoreceptor expression, and therefore reduces serotonergic neurotransmission that might predispose to depression and suicide, made the promoter polymorphism -1019C>G a very promising candidate gene. In our study we analyzed promoter polymorphism -1019C>G on 323 suicide victims and 190 controls (all of Slovenian origin), taking into account sex, suicide method, and in case of suicide victims also stressful life events. Differences in the distributions of genotype and allele frequencies were not statistically significant between suicide victims and control group, and the same was found for distributions according to sex and suicide method. For 62 suicide victims information about stressful life events in the month prior to the suicide and in childhood was provided. For analysis we combined CG/GG genotypes and compared them to the CC genotype. More stressful life events in the month prior to the suicide were reported for the subgroup with CC genotype (mean number of events = 2.53; SD = 1.50) in comparison to subgroup with CG/GG genotypes (mean number of events = 1.58; SD = 1.32; P < 0.05). However, subgroups of suicide victims with CC or CG/GG genotypes did not differ regarding numbers of reported stressful life events in childhood (P > 0.05). Our study provides no evidence for the implication of HTR1A promoter polymorphism in suicide in general, but it suggests further studies that would take into account the interconnected network of suicide completion, genetic background and stress, beside other risk factors.

  6. R270C polymorphism leads to loss of function of the canine P2X7 receptor.

    PubMed

    Spildrejorde, Mari; Bartlett, Rachael; Stokes, Leanne; Jalilian, Iman; Peranec, Michelle; Sluyter, Vanessa; Curtis, Belinda L; Skarratt, Kristen K; Skora, Amanda; Bakhsh, Tahani; Seavers, Aine; McArthur, Jason D; Dowton, Mark; Sluyter, Ronald

    2014-07-15

    The relative function of the P2X7 receptor, an ATP-gated ion channel, varies between humans due to polymorphisms in the P2RX7 gene. This study aimed to assess the functional impact of P2X7 variation in a random sample of the canine population. Blood and genomic DNA were obtained from 69 dogs selected as representatives of a cross section of different breeds. P2X7 function was determined by flow cytometric measurements of dye uptake and patch-clamp measurements of inward currents. P2X7 expression was determined by immunoblotting and immunocytochemistry. Sequencing was used to identify P2RX7 gene polymorphisms. P2X7 was cloned from an English springer spaniel, and point mutations were introduced into this receptor by site-directed mutagenesis. The relative function of P2X7 on monocytes varied between individual dogs. The canine P2RX7 gene encoded four missense polymorphisms: F103L and P452S, found in heterozygous and homozygous dosage, and R270C and R365Q, found only in heterozygous dosage. Moreover, R270C and R365Q were associated with the cocker spaniel and Labrador retriever, respectively. F103L, R270C, and R365Q but not P452S corresponded to decreased P2X7 function in monocytes but did not explain the majority of differences in P2X7 function between dogs, indicating that other factors contribute to this variability. Heterologous expression of site-directed mutants of P2X7 in human embryonic kidney-293 cells indicated that the R270C mutant was nonfunctional, the F103L and R365Q mutants had partly reduced function, and the P452S mutant functioned normally. Taken together, these data highlight that a R270C polymorphism has major functional impact on canine P2X7.

  7. Polymorphisms in genes of the steroid receptor superfamily modify postmenopausal breast cancer risk associated with menopausal hormone therapy.

    PubMed

    2010-06-15

    Menopausal hormone therapy (HT) is associated with increased breast cancer risk among postmenopausal women. Nuclear receptors are involved in steroid hormone- and xenobiotic-mediated signal transduction playing a crucial role in regulating gene expression. Therefore, variations within these genes may influence HT-associated breast cancer risk. We investigated 3,149 postmenopausal breast cancer patients and 5,489 controls from 2 German population-based case-control studies. Thirty-three polymorphisms selected on the basis of known or putative functional relevance located in ESR1, ESR2, PGR, PXR and AR were genotyped. Conditional logistic regression was used to assess multiplicative statistical interaction between polymorphisms and duration of estrogen-progestagen therapy and of estrogen monotherapy with regard to breast cancer risk assuming log-additive and codominant modes of inheritance. We observed an increased risk for women carrying short AR_(CAG) alleles of <22 repeats associated with combined estrogen-progestagen therapy compared with those with long alleles (> or =22 repeats) (p(interaction) = 0.03). Additionally, risk associated with combination therapy use was significantly modified by 2 PXR polymorphisms with reduction of risk effects in carriers of the minor PXR_rs6785049_G and PXR_rs1054191_A alleles (p(interaction) = 0.04 and 0.05, respectively). Variants in both ESR1 and ESR2 modified risk associated with estrogen monotherapy use. Higher risk were observed in homozygotes for the major ESR1_rs910416_T allele (p(interaction) < 0.01) and in homozygotes for the minor ESR2_rs1271572_T, major ESR2_rs4986938_G and minor ESR2_rs928554_G alleles (p(interaction) = 0.02, 0.05, 0.02, respectively). Risk effect modification by ESR1_rs910416 and AR_(CAG)n polymorphisms remained significant after correction for multiple testing. We conclude that genetic variants in nuclear receptor genes may modify HT-associated postmenopausal breast cancer risk.

  8. Genetic Polymorphism of 1019C/G (rs6295) Promoter of Serotonin 1A Receptor and Catechol-O-Methyltransferase in Panic Disorder

    PubMed Central

    Ishiguro, Shin; Aoki, Akiko; Ueda, Mikito; Hayashi, Yuki; Akiyama, Kazufumi; Kato, Kazuko; Shimoda, Kazutaka

    2017-01-01

    Objective Family and twin studies have suggested genetic liability for panic disorder (PD) and therefore we sought to determine the role of noradrenergic and serotonergic candidate genes for susceptibility for PD in a Japanese population. Methods In this age- and gender-matched case-control study involving 119 PD patients and 119 healthy controls, we examined the genotype distributions and allele frequencies of the serotonin transporter gene linked polymorphic region (5-HTTLPR), −1019C/G (rs6295) promoter polymorphism of the serotonin receptor 1A (5-HT1A), and catechol-O-methyltransferase (COMT) gene polymorphism (rs4680) and their association with PD. Results No significant differences were evident in the allele frequencies or genotype distributions of the COMT (rs4680), 5-HTTLPR polymorphisms or the −1019C/G (rs6295) promoter polymorphism of 5-HT1A between PD patients and controls. Although there were no significant associations of these polymorphisms with in subgroups of PD patients differentiated by gender or in subgroup comorbid with agoraphobia (AP), significant difference was observed in genotype distributions of the −1019C/G (rs6295) promoter polymorphism of 5-HT1A between PD patients without AP and controls (p=0.047). Conclusion In this association study, the 1019C/G (rs6295) promoter polymorphism of the 5-HT1A receptor G/G genotype was associated with PD without AP in a Japanese population. PMID:28096880

  9. A Study of the Impact of Death Receptor 4 (DR4) Gene Polymorphisms in Alzheimer’s Disease

    PubMed Central

    Edgünlü, Tuba Gökdoğan; Özge, Aynur; Yalın, Osman Özgür; Kul, Seval; Erdal, Mehmet Emin

    2013-01-01

    Background: Excessive apoptosis is believed to play a role in many degenerative and non-degenerative neurological diseases including Alzheimer’s disease (AD). Much recent data suggest that apoptotic mechanisms may represent the missing link between Aβ deposition and proteolysis of tau protein. However, there is emerging evidence that apoptotic mechanisms may play a role in Alzheimer’s Disease pathogenesis in the absence of overt apoptosis. TNF-related apoptosis inducing ligand receptor 1 (Death Receptor 4, DR4) might impair the apoptotic signal transduction and lead to dysregulation of the homeostasis between cell survival and cell death. Aims: The aim of our study was to further investigate the relationship between genetic variants of DR4 and Alzheimer’s Disease. Study Design: Case control study. Methods: Sixty-eight patients with AD were included in the study. The control group comprised 72 subjects without signs of neurodegenerative diseases, as evidenced by the examination.DNA was extracted from whole blood using the salting-out procedure. Genotypes were identified by restriction fragment length polymorphism analysis of polymerase chain reaction (PCR-RFLP) products. Results: We observed significant differences in the genotypic distribution of the rs6557634 polymorphism in AD patients compared with controls (p<0.05); our data suggest that the GA genotype in rs6557634 could be protective against AD (p<0.05). However, there were no significant differences between AD patients and control groups in terms of the DR4 rs20575 polymorphism (p>0.05) and the DR4 rs20576 polymorphism (p>0.05). According to haplotype analysis of the DR4 gene for rs6557634, rs20575 and rs20576 polymorphisms, GCA and GCC haplotypes might be a risk factor for AD. Also, we have shown that ACA, GGC and GGA haplotypes might be protective factors against AD. Conclusion: The present results indicate for the first time the possible contribution of the DR4 gene rs6557634, rs20575, rs20576

  10. Low-density lipoprotein receptor genetic polymorphism in chronic hepatitis C virus Egyptian patients affects treatment response

    PubMed Central

    Naga, Mazen; Amin, Mona; Algendy, Dina; Elbadry, Ahmed; Fawzi, May; Foda, Ayman; Esmat, Serag; Sabry, Dina; Rashed, Laila; Gabal, Samia; Kamal, Manal

    2015-01-01

    AIM: To correlate a genetic polymorphism of the low-density lipoprotein (LDL) receptor with antiviral responses in Egyptian chronic hepatitis C virus (HCV) patients. METHODS: Our study included 657 HCV-infected patients with genotype 4 who received interferon-based combination therapy. Patients were divided into two groups based on their response to therapy: 356 were responders, and 301 were non-responders. Patients were compared to 160 healthy controls. All patients and controls underwent a thorough physical examination, measurement of body mass index (BMI) and the following laboratory tests: serum alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, albumin, total bilirubin, direct bilirubin, prothrombin time, prothrombin concentration, INR, complete blood count, serum creatinine, fasting blood sugar, HCV antibody, and hepatitis B surface antigen. All HCV patients were further subjected to the following laboratory tests: HCV-RNA using quantitative polymerase chain reaction (PCR), antinuclear antibodies, thyroid-stimulating hormone, an LDL receptor (LDLR) genotype study of LDLR exon8c.1171G>A and exon10c.1413G>A using real-time PCR-based assays, abdominal ultrasonography, ultrasonographic-guided liver biopsy, and histopathological examination of liver biopsies. Correlations of LDL receptor polymorphisms with HAI, METAVIR score, presence of steatosis, and BMI were performed in all cases. RESULTS: There were no statistically significant differences in response rates between the different types of interferon used or LDLR exon10c.1413G>A. However, there was a significant difference in the frequency of the LDL receptor exon8c.1171G>A genotype between cases (AA: 25.9%, GA: 22.2%, GG: 51.9%) and controls (AA: 3.8%, GA: 53.1% and GG: 43.1%) (P < 0.001). There was a statistically significant difference in the frequency of the LDLR exon 8C:1171 G>A polymorphism between responders (AA: 3.6%, GA: 15.2%, GG: 81.2%) and non-responders (AA: 52.2%, GA: 30

  11. Revisiting automated G-protein coupled receptor modeling: the benefit of additional template structures for a neurokinin-1 receptor model.

    PubMed

    Kneissl, Benny; Leonhardt, Bettina; Hildebrandt, Andreas; Tautermann, Christofer S

    2009-05-28

    The feasibility of automated procedures for the modeling of G-protein coupled receptors (GPCR) is investigated on the example of the human neurokinin-1 (NK1) receptor. We use a combined method of homology modeling and molecular docking and analyze the information content of the resulting docking complexes regarding the binding mode for further refinements. Moreover, we explore the impact of different template structures, the bovine rhodopsin structure, the human beta(2) adrenergic receptor, and in particular a combination of both templates to include backbone flexibility in the target conformational space. Our results for NK1 modeling demonstrate that model selection from a set of decoys can in general not solely rely on docking experiments but still requires additional mutagenesis data. However, an enrichment factor of 2.6 in a nearly fully automated approach indicates that reasonable models can be created automatically if both available templates are used for model construction. Thus, the recently resolved GPCR structures open new ways to improve the model building fundamentally.

  12. Functional polymorphisms in the P2X7 receptor gene are associated with stress fracture injury.

    PubMed

    Varley, Ian; Greeves, Julie P; Sale, Craig; Friedman, Eitan; Moran, Daniel S; Yanovich, Ran; Wilson, Peter J; Gartland, Alison; Hughes, David C; Stellingwerff, Trent; Ranson, Craig; Fraser, William D; Gallagher, James A

    2016-03-01

    Military recruits and elite athletes are susceptible to stress fracture injuries. Genetic predisposition has been postulated to have a role in their development. The P2X7 receptor (P2X7R) gene, a key regulator of bone remodelling, is a genetic candidate that may contribute to stress fracture predisposition. The aim of this study is to evaluate the putative contribution of P2X7R to stress fracture injury in two separate cohorts, military personnel and elite athletes. In 210 Israeli Defense Forces (IDF) military conscripts, stress fracture injury was diagnosed (n = 43) based on symptoms and a positive bone scan. In a separate cohort of 518 elite athletes, self-reported medical imaging scan-certified stress fracture injuries were recorded (n = 125). Non-stress fracture controls were identified from these cohorts who had a normal bone scan or no history or symptoms of stress fracture injury. Study participants were genotyped for functional SNPs within the P2X7R gene using proprietary fluorescence-based competitive allele-specific PCR assay. Pearson's chi-squared (χ (2)) tests, corrected for multiple comparisons, were used to assess associations in genotype frequencies. The variant allele of P2X7R SNP rs3751143 (Glu496Ala-loss of function) was associated with stress fracture injury, whilst the variant allele of rs1718119 (Ala348Thr-gain of function) was associated with a reduced occurrence of stress fracture injury in military conscripts (P < 0.05). The association of the variant allele of rs3751143 with stress fractures was replicated in elite athletes (P < 0.05), whereas the variant allele of rs1718119 was also associated with reduced multiple stress fracture cases in elite athletes (P < 0.05). The association between independent P2X7R polymorphisms with stress fracture prevalence supports the role of a genetic predisposition in the development of stress fracture injury.

  13. Vitamin D receptor gene polymorphisms among Emirati patients with type 2 diabetes mellitus.

    PubMed

    Safar, Habiba Al; Chehadeh, Sarah El Hajj; Abdel-Wareth, Laila; Haq, Afrozul; Jelinek, Herbert F; ElGhazali, Gehad; Anouti, Fatme Al

    2017-03-18

    At a prevalence rate close to 19.5%, the UAE has one of the highest rates of Type 2 Diabetes Mellitus (T2DM) in the world. Genome wide association studies (GWAS) have led to the identification of several genetic variants that are associated with T2DM. Recently, genes involved in vitamin D metabolism have gained interest because of the association between vitamin D deficiency (VDD) and increased risk for T2DM. Among these, the Vitamin D receptor (VDR) gene is a good candidate for T2DM susceptibility. The aim of this study was to investigate the association between VDR polymorphisms and T2DM among a representative sample of the Emirati population. In this cross sectional study, two hundred and sixty four patients with T2DM and ninety-one healthy controls were enrolled. The study population was genotyped for the three VDR gene mutations, TaqI (rs731236), FokI (rs2228570) and BsmI (rs1544410). VDR alleles and haplotypes were compared between patients and their healthy controls. The mean age of the T2DM cohort was 60±11.59years and 48.21±12.17years for the healthy controls. The G-allele and GG genotype of rs2228570 and T-allele and TT genotype of rs1544410 SNPs were associated with T2DM. In regards to T2DM-related metabolic complications, the AG and GG genotypes of rs731236 were significantly associated with higher total cholesterol (p=0.011) and LDL-cholesterol (p=0.009) levels in the patients with T2DM. In contrast, the CT genotype of rs1544410 was significantly associated with lower BMI (p=0.031) and the TT genotype was associated with lower LDL-cholesterol level (p=0.007). The frequency of AAT and GGC haplotypes was also different between groups (p=0.014; p=0.032, respectively), implying that these haplotypes of the VDR gene are associated with the susceptibility to T2DM in the Emirati population. To conclude, an association between SNPs in the VDR gene (except for rs731236) and T2DM per se was demonstrated. The rs731236 variant was shown to be associated with

  14. Lack of Association between Polymorphisms of the Dopamine Receptor D4 and Dopamine Transporter Genes and Personality Traits in a Korean Population

    PubMed Central

    Kim, Se Joo; Kim, Young Shin; Lee, Hong Shick

    2006-01-01

    Human personality traits have a considerable genetic component. Cloninger et al. were the first to postulate that certain personality traits, such as novelty seeking, are related to the dopamine neurotransmitter system. In this study, we investigated the associations between dopamine receptor D4 (DRD4) exon III and dopamine transporter (DAT1) polymorphisms and personality traits. The DRD4 and DAT1 gene polymorphisms were genotyped in 214 healthy Korean subjects, whose personality traits were assessed with the Temperament and Character Inventory (TCI). There were no significant differences between scores of TCI temperament dimensions (novelty seeking, harm avoidance, reward dependence, and persistence) and DRD4 gene polymorphism. The DAT1 gene polymorphisms also showed no significant association with any of the temperament subscales of the TCI. These data suggest that DRD4 and DAT1 gene polymorphism may not associated with personality traits in a Korean population. PMID:17191306

  15. Lack of Association of Estrogen Receptor Alpha Gene Polymorphisms with Cardiorespiratory and Metabolic Variables in Young Women

    PubMed Central

    Rebelo, Ana Cristina; Verlengia, Rozangela; Kunz, Vandeni; Tamburus, Nayara; Cerda, Alvaro; Hirata, Rosario; Hirata, Mario; Silva, Ester

    2012-01-01

    This study examined the association of estrogen receptor alpha gene (ESR1) polymorphisms with cardiorespiratory and metabolic parameters in young women. In total, 354 healthy women were selected for cardiopulmonary exercise testing and short-term heart rate (HR) variability (HRV) evaluation. The HRV analysis was determined by the temporal indices rMSSD (square root of the mean squared differences of successive R–R intervals (RRi) divided by the number of RRi minus one), SDNN (root mean square of differences from mean RRi, divided by the number of RRi) and power spectrum components by low frequency (LF), high frequency (HF) and LF/HF ratio. Blood samples were obtained for serum lipids, estradiol and DNA extraction. ESR1 rs2234693 and rs9340799 polymorphisms were analyzed by PCR and fragment restriction analysis. HR and oxygen uptake (VO2) values did not differ between the ESR1 polymorphisms with respect to autonomic modulation. We not find a relationship between ESR1 T–A, T–G, C–A and C–G haplotypes and cardiorespiratory and metabolic variables. Multiple linear regression analysis demonstrated that VO2, total cholesterol and triglycerides influence HRV (p < 0.05). The results suggest that ESR1 variants have no effect on cardiorespiratory and metabolic variables, while HRV indices are influenced by aerobic capacity and lipids in healthy women. PMID:23202974

  16. An evaluation of single nucleotide polymorphisms in the human aryl hydrocarbon receptor-interacting protein (AIP) gene.

    PubMed

    Rowlands, J Craig; Urban, Jonathan D; Wikoff, Daniele Staskal; Budinsky, Robert A

    2011-01-01

    The human aryl hydrocarbon receptor (AHR) is a protein for which there is little evidence of polymorphic variability of functional consequence. It has been hypothesized that potential variability in dioxin sensitivity may be due to polymorphisms in AHR-associated proteins, such as the human AHR-interacting protein (AIP). There are limited data on AIP single nucleotide polymorphisms (SNPs) with potential functional consequences. We sequenced 103 human DNA samples within the open reading frames of the AIP locus using samples from six ethnic populations to further characterize AIP SNPs. Eight exonic SNPs were identified at the AIP locus, including three novel SNPs: T48T, L212L, and V302V. Combined with prior reports, there are now a total of 14 exonic SNPs that have been identified within AIP. Of these, six are non-synonymous and are therefore of potential functional importance, though only two of these (Q228K and A276V) were detected in the current study. The functional consequences of Q228K and A276V are unknown, although functional evidence from AIP SNPs associated with congenital pituitary tumors suggests that such amino acid changes are likely to have no effect or to decrease, rather than increase, sensitivity to dioxins. To date, no non-synonymous SNPs have been detected in the AHR-binding region of AIP.

  17. Cannabinoid receptor 1 gene polymorphisms and nonalcoholic Fatty liver disease in women with polycystic ovary syndrome and in healthy controls.

    PubMed

    Kuliczkowska Plaksej, Justyna; Laczmanski, Lukasz; Milewicz, Andrzej; Lenarcik-Kabza, A; Trzmiel-Bira, Anna; Zaleska-Dorobisz, Urszula; Lwow, Felicja; Hirnle, Lidia

    2014-01-01

    Context. Polycystic ovary syndrome (PCOS) is frequently associated with nonalcoholic fatty liver disease (NAFLD). The endocannabinoid system may play a crucial role in the pathogenesis of NAFLD. Polymorphism of the cannabinoid receptor 1 gene (CNR1) may be responsible for individual susceptibility to obesity and related conditions. Objective. To determine the role of genetic variants of CNR1 in the etiopathology of NAFLD in women with PCOS. Design and Setting. Our department (a tertiary referral center) conducted a cross-sectional, case-controlled study. Subjects. 173 women with PCOS (aged 20-35) and 125 healthy, age- and weight-matched controls were studied. Methods. Hepatic steatosis was assessed by ultrasound evaluation. Single nucleotide polymorphisms of CNR1 (rs806368, rs12720071, rs1049353, rs806381, rs10485170, rs6454674) were genotyped. Results. Frequency of the G allele of rs806381 (P < 0.025) and the GG genotype of rs10485170 (P < 0.03) was significantly higher in women with PCOS and NAFLD than in PCOS women without NAFLD. Frequency of the TT genotype of rs6454674 was higher in PCOS women with NAFLD (not significantly, P = 0.059). In multivariate stepwise regression, allele G of rs806381 was associated with PCOS + NAFLD phenotype. Conclusion. Our preliminary results suggest the potential role of CNR1 polymorphisms in the etiology of NAFLD, especially in PCOS women.

  18. Cannabinoid Receptor 1 Gene Polymorphisms and Nonalcoholic Fatty Liver Disease in Women with Polycystic Ovary Syndrome and in Healthy Controls

    PubMed Central

    Kuliczkowska Plaksej, Justyna; Milewicz, Andrzej; Lenarcik-Kabza, A.; Trzmiel-Bira, Anna; Zaleska-Dorobisz, Urszula; Hirnle, Lidia

    2014-01-01

    Context. Polycystic ovary syndrome (PCOS) is frequently associated with nonalcoholic fatty liver disease (NAFLD). The endocannabinoid system may play a crucial role in the pathogenesis of NAFLD. Polymorphism of the cannabinoid receptor 1 gene (CNR1) may be responsible for individual susceptibility to obesity and related conditions. Objective. To determine the role of genetic variants of CNR1 in the etiopathology of NAFLD in women with PCOS. Design and Setting. Our department (a tertiary referral center) conducted a cross-sectional, case-controlled study. Subjects. 173 women with PCOS (aged 20–35) and 125 healthy, age- and weight-matched controls were studied. Methods. Hepatic steatosis was assessed by ultrasound evaluation. Single nucleotide polymorphisms of CNR1 (rs806368, rs12720071, rs1049353, rs806381, rs10485170, rs6454674) were genotyped. Results. Frequency of the G allele of rs806381 (P < 0.025) and the GG genotype of rs10485170 (P < 0.03) was significantly higher in women with PCOS and NAFLD than in PCOS women without NAFLD. Frequency of the TT genotype of rs6454674 was higher in PCOS women with NAFLD (not significantly, P = 0.059). In multivariate stepwise regression, allele G of rs806381 was associated with PCOS + NAFLD phenotype. Conclusion. Our preliminary results suggest the potential role of CNR1 polymorphisms in the etiology of NAFLD, especially in PCOS women. PMID:25136364

  19. Association of vitamin D receptor Fok I polymorphism with the risk of prostate cancer: a meta-analysis

    PubMed Central

    Kang, Shaosan; Zhao, Yansheng; Liu, Jian; Wang, Lei; Zhao, Geng; Chen, Xi; Yao, Anliang; Zhang, Liguo; Zhang, Xiaojun; Li, Xiaoqiang

    2016-01-01

    Several previous studies have been reported to examine the association between Vitamin D receptor (VDR) gene Fok I polymorphism and susceptibility to prostate cancer (PCa), however the results remain inconclusive. To provide a relatively comprehensive account of the association, we searched PubMed, Embase, CNKI, and Wanfang for eligible studies and carry out this meta-analysis. A total of 27 case-control studies with 10,486 cases and 10,400 controls were included. In the overall analysis, Fok I polymorphism was not significantly associated with the susceptibility to PCa. Subgroup analyses showed that significantly association was existed in Caucasian population, the subgroup of population-based controls and the stratified group with advanced tumor.These results indicate that the VDR Fok I polymorphism might be capable of causing PCa susceptibility and could be a promising target to forecast the PCa risk for clinical practice. However further well-designed epidemiologic studies are needed to confirm this conclusion. PMID:27788484

  20. Buprenorphine signalling is compromised at the N40D polymorphism of the human μ opioid receptor in vitro

    PubMed Central

    Knapman, Alisa; Santiago, Marina; Connor, Mark

    2014-01-01

    Background and Purpose There is significant variation in individual response to opioid drugs, which may result in inappropriate opioid therapy. Polymorphisms of the μ opioid receptor (MOP receptor) may contribute to individual variation in opioid response by affecting receptor function, and the effect may be ligand-specific. We sought to determine functional differences in MOP receptor signalling at several signalling pathways using a range of structurally distinct opioid ligands in cells expressing wild-type MOP receptors (MOPr-WT) and the commonly occurring MOP receptor variant, N40D. Experimental Approach MOPr-WT and MOPr-N40D were stably expressed in CHO cells and in AtT-20 cells. Assays of AC inhibition and ERK1/2 phosphorylation were performed on CHO cells, and assays of K activation were performed on AtT-20 cells. Signalling profiles for each ligand were compared between variants. Key Results Buprenorphine efficacy was reduced by over 50% at MOPr-N40D for AC inhibition and ERK1/2 phosphorylation. Buprenorphine potency was reduced threefold at MOPr-N40D for K channel activation. Pentazocine efficacy was reduced by 50% for G-protein-gated inwardly rectifying K channel activation at MOPr-N40D. No other differences were observed for any other ligands tested. Conclusions and Implications The N40D variant is present in 10–50% of the population. Buprenorphine is a commonly prescribed opioid analgesic, and many individuals do not respond to buprenorphine therapy. This study demonstrates that buprenorphine signalling to several effectors via the N40D variant of MOP receptors is impaired, and this may have important consequences in a clinical setting for individuals carrying the N40D allele. PMID:24846673

  1. Association of polymorphisms in nicotinic acetylcholine receptor alpha 4 subunit gene (CHRNA4), mu-opioid receptor gene (OPRM1), and ethanol-metabolizing enzyme genes with alcoholism in Korean patients.

    PubMed

    Kim, Soon Ae; Kim, Jong-Woo; Song, Ji-Young; Park, Sunny; Lee, Hee Jae; Chung, Joo-Ho

    2004-01-01

    Findings obtained from several studies indicate that ethanol enhances the activity of alpha4beta2 neuronal nicotinic acetylcholine receptor and support the possibility that a polymorphism of the nicotinic acetylcholine receptor alpha4 subunit gene (CHRNA4) modulates enhancement of nicotinic receptor function by ethanol. To identify the association between the CfoI polymorphism of the CHRNA4 and alcoholism, we examined distribution of genotypes and allele frequencies in Korean patients diagnosed with alcoholism (n = 127) and Korean control subjects without alcoholism (n = 185) with polymerase chain reaction-restriction fragment length polymorphism methods. We were able to detect the association between the CfoI polymorphism of the CHRNA4 and alcoholism in Korean patients (genotype P = .023; allele frequency P = .047). The genotypes and allele frequencies of known polymorphisms in other alcoholism candidate genes, such as alcohol metabolism-related genes [alcohol dehydrogenase 2 (ADH2), aldehyde dehydrogenase 2 (ALDH2), alcohol dehydrogenase 3 (ADH3), and cytochrome P450 2E1 (CYP2E1)] and mu-opioid receptor gene (OPRM1), were studied. The polymorphisms of ADH2, ALDH2, and CYP2E1 were significantly different in Korean patients with alcoholism and Korean control subjects without alcoholism, but ADH3 and OPRM1 did not differ between the two groups.

  2. Classical phenotype of Laron syndrome in a girl with a heterozygous mutation and heterozygous polymorphism of the growth hormone receptor gene.

    PubMed

    Shevah, Orit; Galli-Tsinopoulou, Assimina; Rubinstein, Menachem; Nousia-Arvanitakis, Sanda; Laron, Zvi

    2004-03-01

    We describe here a 19 month-old girl with classical Laron syndrome (LS). Molecular analysis of the GH receptor gene in the patient and her parents was performed. The patient was found to be heterozygous for a mutation in exon 4 (R43X) and heterozygous for a polymorphism in exon 6 (Gly168Gly). Her mother was also heterozygous for R43X but homozygous for the polymorphism. In the father, a heterozygous polymorphism was found. Contrary to previous assumptions that only homozygous patients express the typical phenotype, this patient shows all the classical features of LS, despite being a heterozygote for a pathological defect.

  3. Toll-Like Receptor 4 Wild Type Homozygozity of Polymorphisms +896 and +1196 Is Associated with High Gastrin Serum Levels and Peptic Ulcer Risk.

    PubMed

    Pohjanen, Vesa-Matti; Koivurova, Olli-Pekka; Huhta, Heikki; Helminen, Olli; Mäkinen, Johanna M; Karhukorpi, Jari M; Joensuu, Tapio; Koistinen, Pentti O; Valtonen, Jarno M; Niemelä, Seppo E; Karttunen, Riitta A; Karttunen, Tuomo J

    2015-01-01

    Toll-like receptor 4 is a part of the innate immune system and recognizes Helicobacter pylori lipopolysaccharide. The goal of this study was to analyze the role of Toll-like receptor 4 polymorphisms +896 (rs4986790) and +1196 (rs4986791) in the pathogenesis of Helicobacter pylori related gastroduodenal diseases in relation to gastric secretion and inflammation. Toll-like receptor 4 polymorphisms, serum gastrin-17 and pepsinogen I and II concentrations were determined, and gastroscopies with histopathological analyses were performed to 216 dyspeptic patients. As genotype controls, 179 controls and 61 gastric cancer patients were studied. In our study, the Toll-like receptor 4 +896 and +1196 polymorphisms were in total linkage disequilibrium. The homozygous wild types displayed higher gastrin-17 serum concentrations than the mutants (p = 0.001) and this effect was independent of Helicobacter pylori. The homozygous wild types also displayed an increased risk for peptic ulcers (OR: 4.390). Toll-like receptor 4 genotypes did not show any association with Helicobacter pylori positivity or the features of gastric inflammation. Toll-like receptor 4 expression was seen in gastrin and somatostatin expressing cells of antral mucosa by immunohistochemistry. Our results suggest a role for Toll-like receptor 4 in gastric acid regulation and that the Toll-like receptor 4 +896 and +1196 wild type homozygozity increases peptic ulcer risk via gastrin secretion.

  4. Relationship between melatonin receptor 1B and insulin receptor substrate 1 polymorphisms with gestational diabetes mellitus: a systematic review and meta-analysis.

    PubMed

    Zhang, Yan; Sun, Cheng-Ming; Hu, Xiang-Qin; Zhao, Yue

    2014-08-22

    Studies have investigated the relationship between genetic variants and risk of gestational diabetes mellitus (GDM). However, the results remain inconclusive. The aim of this study was to investigate the association of rs10830963 and rs1387153 variants in melatonin receptor 1B (MTNR1B) and rs1801278 variant in insulin receptor substrate 1 (IRS1) with GDM susceptibility. Electronic database of PubMed, Medline, Embase, and CNKI (China National Knowledge Infrastructure) were searched for relevant studies between 2005 and 2014. The odds ratio (OR) with its 95% confidence interval (CI) were employed to estimate the association. Total ten case-control studies, including 3428 GDM cases and 4637 healthy controls, met the inclusion criteria. Our results showed a significant association between the three genetic variants and GDM risk, rs10830963 with a P-value less than 0.0001, rs1387153 with a P-value of 0.0002, and rs1801278 with a P-value of 0.001. Furthermore, all the genetic models in these three polymorphisms were associated with increased risks of GDM as well (P< = 0.009). In conclusion, our study found that the genetic polymorphisms rs10830963 and rs1387153 in MTNR1B and rs1801278 in IRS1 were associated with an increased risk of developing GDM. However, further studies with gene-gene and gene-environmental interactions should be considered.

  5. Aging males' symptoms in relation to the genetically determined androgen receptor CAG polymorphism, sex hormone levels and sample membership.

    PubMed

    Schneider, Gudrun; Nienhaus, Kathrin; Gromoll, Jörg; Heuft, Gereon; Nieschlag, Eberhard; Zitzmann, Michael

    2010-05-01

    Late-onset hypogonadism describes the co-occurrence of a range of physical, psychological and sexual symptoms in aging men, with the implication that these symptoms are caused by androgen deficiency. Previous investigations examined mostly population samples and did not take into account the testosterone modulating effects of the genetically determined CAG repeat polymorphism (CAGn) of the androgen receptor (AR) gene. This is the first study which investigates aging male symptoms (AMS) in relation to the genetically determined androgen receptor CAG polymorphism, estradiol and testosterone levels in men > or =50 years of age in a healthy population sample (n=100), outpatients of an andrological department (n=76) who presented with sexual and "aging male" symptoms and a psychosomatic/psychiatric sample (n=120) who presented with various psychological and medically unexplained somatic complaints. Although the population sample was significantly older than the two patient groups, they reported significantly fewer AMS and had higher testosterone levels and shorter CAG repeats of the AR. Regression analysis revealed influences of CAGn on the AMS global score and the psychological and somatic subscale only in the two patient samples, while testosterone had some impact on the sexual subscale. Our results suggest that the so-called aging male symptoms show a certain association to androgenicity, but that they are rather unspecific and of multifactorial origin. Other factors contributing to AMS need further clarification.

  6. The role of natural killer (NK) cells and NK cell receptor polymorphisms in the assessment of HIV-1 neutralization.

    PubMed

    Brown, Bruce K; Wieczorek, Lindsay; Kijak, Gustavo; Lombardi, Kara; Currier, Jeffrey; Wesberry, Maggie; Kappes, John C; Ngauy, Viseth; Marovich, Mary; Michael, Nelson; Ochsenbauer, Christina; Montefiori, David C; Polonis, Victoria R

    2012-01-01

    The importance of innate immune cells in HIV-1 pathogenesis and protection has been highlighted by the role of natural killer (NK) cells in the containment of viral replication. Use of peripheral blood mononuclear cells (PBMC) in immunologic studies provides both HIV-1 target cells (ie. CD4+ T cells), as well as anti-HIV-1 effector cells, such as NK cells. In this study, NK and other immune cell populations were analyzed in HIV-negative donor PBMC for an impact on the anti-HIV activity of polyclonal and monoclonal antibodies. NK cell percentages were significantly higher in donor PBMC that supported lower levels of viral replication. While the percentage of NK cells was not directly associated with neutralization titers, NK cell-depletion significantly diminished the antiviral antibody activity by up to three logs, and polymorphisms in NK killer immunoglobulin receptor (KIR) and FcγRIIIa alleles appear to be associated with this affect. These findings demonstrate that NK cells and NK cell receptor polymorphisms may influence assessment of traditional HIV-1 neutralization in a platform where antibody is continuously present. This format appears to simultaneously assess conventional entry inhibition (neutralization) and non-neutralizing antibody-dependent HIV inhibition, which may provide the opportunity to delineate the dominant antibody function(s) in polyclonal vaccine responses.

  7. A novel polymorphism of FcgammaRIIIa (CD16) alters receptor function and predisposes to autoimmune disease.

    PubMed Central

    Wu, J; Edberg, J C; Redecha, P B; Bansal, V; Guyre, P M; Coleman, K; Salmon, J E; Kimberly, R P

    1997-01-01

    A novel polymorphism in the extracellular domain 2 (EC2) of FcgammaRIIIA affects ligand binding by natural killer (NK) cells and monocytes from genotyped homozygous normal donors independently of receptor expression. The nonconservative T to G substitution at nucleotide 559 predicts a change of phenylalanine (F) to valine (V) at amino acid position 176. Compared with F/F homozygotes, FcgammaRIIIa expressed on NK cells and monocytes in V/V homozygotes bound more IgG1 and IgG3 despite identical levels of receptor expression. In response to a standard aggregated human IgG stimulus, FcgammaRIIIa engagement on NK cells from V/V (high-binding) homozygotes led to a larger rise in [Ca2+]i, a greater level of NK cell activation, and a more rapid induction of activation-induced cell death (by apoptosis). Investigation of an independently phenotyped normal cohort revealed that all donors with a low binding phenotype are F/F homozygotes, while all phenotypic high binding donors have at least one V allele. Initial analysis of 200 patients with SLE indicates a strong association of the low binding phenotype with disease, especially in patients with nephritis who have an underrepresentation of the homozygous high binding phenotype. Thus, the FcgammaRIIIa polymorphism at residue 176 appears to impact directly on human biology, an effect which may extend beyond autoimmune disease characterized by immune complexes to host defense mechanisms. PMID:9276722

  8. Association of Single Nucleotide Polymorphisms in Toll-like Receptors with Acinetobacter baumanii Infectionin a Chinese Population

    PubMed Central

    HE, Lei; LIN, Maohu; FAN, Wensheng; LIU, Yunxi; SUO, Jijiang; XING, Yubin; JIA, Ning

    2016-01-01

    Background: During recent years, infection of Acinetobacter baumanii showed a rapid growth in hospitals and community. Toll-like receptors (TLRs) are the most important pattern recognition receptors, which play a critical role during recognizing invading pathogens by the natural immune system. Our objective was to determine the associations of TLRs polymorphisms with the susceptibility to A. baumanii infection in a Chinese population. Methods: We carried out a case-control study, genotyping 13 polymorphisms of TLR-2, TLR-4, TLR-5 and TLR-9 genes on 423 A. baumanii-infected patients and 385 exposed controls. Thirteen SNPs at the TLR-2 (rs3804099, rs7656411 and rs76112010), TLR-4 (rs1927914, rs10759932 and rs11536889), TLR-5 (rs1341987, rs1640827, rs1861172, rs2241097, rs5744174 and rs17163737) and TLR9 (rs187084) genes were analyzed. SNP genotyping was performed using an improved multiplex ligation detection reaction (iMLDR) technique. Results: The SNP of TLR-9, rs187084, was related to A. baumanii-infection significantly under recessive model (G/G, to A/A + G/A, P = 0.0064, OR = 0.59, 95% CI = 0.40–0.86) after adjustment with age. Besides, the haplotype GCG of TLR-4 was significantly associated with A. baumanii infection (P = 0.027). Conclusion: TLR-4 and TLR-9 may be related to the susceptibility to A. baumanii infection in a Chinese population. PMID:27057517

  9. The Role of Natural Killer (NK) Cells and NK Cell Receptor Polymorphisms in the Assessment of HIV-1 Neutralization

    PubMed Central

    Brown, Bruce K.; Wieczorek, Lindsay; Kijak, Gustavo; Lombardi, Kara; Currier, Jeffrey; Wesberry, Maggie; Kappes, John C.; Ngauy, Viseth; Marovich, Mary; Michael, Nelson; Ochsenbauer, Christina; Montefiori, David C.; Polonis, Victoria R.

    2012-01-01

    The importance of innate immune cells in HIV-1 pathogenesis and protection has been highlighted by the role of natural killer (NK) cells in the containment of viral replication. Use of peripheral blood mononuclear cells (PBMC) in immunologic studies provides both HIV-1 target cells (ie. CD4+ T cells), as well as anti-HIV-1 effector cells, such as NK cells. In this study, NK and other immune cell populations were analyzed in HIV-negative donor PBMC for an impact on the anti-HIV activity of polyclonal and monoclonal antibodies. NK cell percentages were significantly higher in donor PBMC that supported lower levels of viral replication. While the percentage of NK cells was not directly associated with neutralization titers, NK cell-depletion significantly diminished the antiviral antibody activity by up to three logs, and polymorphisms in NK killer immunoglobulin receptor (KIR) and FcγRIIIa alleles appear to be associated with this affect. These findings demonstrate that NK cells and NK cell receptor polymorphisms may influence assessment of traditional HIV-1 neutralization in a platform where antibody is continuously present. This format appears to simultaneously assess conventional entry inhibition (neutralization) and non-neutralizing antibody-dependent HIV inhibition, which may provide the opportunity to delineate the dominant antibody function(s) in polyclonal vaccine responses. PMID:22509241

  10. Allelic polymorphism in IL-1 beta and IL-1 receptor antagonist (IL-1Ra) genes in inflammatory bowel disease.

    PubMed Central

    Bioque, G; Crusius, J B; Koutroubakis, I; Bouma, G; Kostense, P J; Meuwissen, S G; Peña, A S

    1995-01-01

    Recent reports have shown that allele 2 of the IL-1 receptor antagonist (IL-1Ra) gene is over-represented in ulcerative colitis (UC). Healthy individuals carrying allele 2 of this gene have increased production of IL-1Ra protein. Since the final outcome of the biological effects of IL-1 beta may depend on the relative proportion of these two cytokines, we have studied if a TaqI polymorphism in the IL-1 beta gene, which is relevant to IL-1 beta protein production, may be involved in the genetic susceptibility to UC and Crohn's disease (CD), in association with the established IL-1Ra gene polymorphism. Polymorphisms in the closely linked genes for IL-1 beta and IL-1Ra were typed in 100 unrelated Dutch patients with UC, 79 with CD, and 71 healthy controls. The polymorphic regions in exon 5 of the IL-1 beta gene and in intron 2 of the IL-1Ra gene, were studied by polymerase chain reaction (PCR)-based methods. The IL-1 beta allele frequencies in UC and CD patients did not differ from those in healthy controls. In order to study if the IL-1 beta gene polymorphism might participate synergistically with the IL-1Ra gene polymorphism in susceptibility to UC and CD, individuals were distributed into carriers and non-carriers of allele 2 of the genes encoding IL-1 beta and IL-1Ra, in each of the patient groups and controls. Results indicated a significant association of this pair of genes, estimated by the odds ratio (OR) after performing Fisher's exact test, in the UC group (P = 0.023, OR = 2.81), as well as in the CD group (P = 0.01, OR = 3.79). Thus, non-carriers of IL-1 beta allele 2 were more often present in the subgroup of patients carrying the IL-1Ra allele 2. By contrast, no association of these alleles was detected in the group of healthy controls (P = 1.00, OR = 0.92). These results suggest that the IL-1 beta/IL-1Ra allelic cluster may participate in defining the biological basis of predisposition to chronic inflammatory bowel diseases. PMID:7586694

  11. Leptin and leptin receptor polymorphisms are associated with poor outcome (death) in patients with non-appendicular secondary peritonitis

    PubMed Central

    2011-01-01

    Introduction Leptin (LEP) and its receptor (LEPR) participate in the immunological response during infection. LEP serum levels rise during sepsis. In patients with peritonitis, an insufficient elevation in serum LEP is associated with an increased risk of death. As gene variants of LEP and LEPR have been associated with diverse pathologic conditions, we explored the association of genetic polymorphisms of LEP or LEPR with death in patients with secondary peritonitis. Methods A case control study was undertaken. LEP Gene -2548G > A and the LEPR Gene 223A > G polymorphism were determined in 74 patients. The odds ratio of genotype and allele distribution in survival (control) versus death (case) among patients was calculated. Serum LEP, interleukin (IL)-6, tumour necrosis factor alpha, C-reactive protein (C-RP), IL-10 and IL-13 levels were analyzed in 34 patients. Results There were significant differences in genotype and allele distribution between survivors and non-survivors for -2548G > A and 223A > G polymorphisms. The presence of the mutant allele A, in -2548, had an odds ratio of 4.64 (95% CI 1.22, 17.67) with significance (P = 0.017) in the risk of death. The presence of mutant allele G, in 223, had an odds ratio of 3.57 (95% CI 1.06, 12.01) with significance in the risk of death (P = 0.033). The presence of allele A in the -2548 polymorphism was associated with differences in serum LEP (P = 0.013), and IL-10 (P = 0.0001). The presence of allele G in 223 polymorphism was likewise correlated with differences in serum LEP (P < 0001), C-RP (P = 0.033), and IL-10 (P = 0.043). Conclusions The polymorphisms studied are associated with death in patients with peritonitis of non-appendicular origin. This association is stronger than many known risk-factors related to peritonitis severity, and is independent of body mass. The physiopathologic mechanism is possibly related to an insufficient increase in the elevation of serum LEP levels, and is unrelated to body mass

  12. The relationship between vitamin D receptor (VDR) polymorphism and the occurrence of osteoporosis in menopausal Iranian women

    PubMed Central

    Dabirnia, Raheleh; Mahmazi, Sanaz; Taromchi, Amirhossein; Nikzad, Masoum; Saburi, Ehsan

    2016-01-01

    Summary Background Osteoporosis, a multifactorial disease with reduced bone mineral density which increases the probability of bone fractures, is caused by calcium deficiency, and its incidence increases with age. It has been determined that mutations in functional regions of vitamin D receptor gene will affect the metabolism of minerals especially calcium and, therefore, bone density. The present study evaluates the relation between vitamin D receptor polymorphisms, TaqI (rs731236) and ApaI (rs7975232), and osteoporosis in menopausal Azari women in Zanjan province. Materials and methods This case-control study has been conducted on 50 menopausal women suffering from osteoporosis and 50 menopausal women who did not suffer from osteoporosis in Zanjan province. The diagnosis of osteoporosis was confirmed using DEXA instrument. Peripheral blood was collected from the subjects and controls to extract DNA and assess the ApaI and TaqI polymorphisms using PCR-RFLP method. The results were interpreted using independent T-test, chi-square, and Pearson correlation coefficient with a p-value less than 0.05. Results There was not a significant difference between the frequency of ApaI (AA/Aa/aa) and TaqI (TT/Tt/tt) genotypes in cases (mean age 68.72) and controls (mean age 64.7) (p=0.37 and p=0.64, respectively). In addition, ApaI/TaqI allele haplotype in osteoporotic population showed non-significant relation (p value=0.563) compared with the control group. Discussion and conclusion The relationship between the genotypes and osteoporosis, cancers, and mineral metabolism disorders has been studied for a long time. Although there has been a significant relation between the aforementioned genotypes and osteoporosis or reduced mineral density-related bone fractures in some studied, some other studies have opposing results. Therefore, it is only possible to reach an acceptable conclusion by studying the haplotype of the polymorphisms in subjects. PMID:28228780

  13. Polymorphism in the Plasmodium falciparum erythrocyte-binding ligand JESEBL/EBA-181 alters its receptor specificity

    PubMed Central

    Mayer, D. C. Ghislaine; Mu, Jian-Bing; Kaneko, Osamu; Duan, Junhui; Su, Xin-zhuan; Miller, Louis H.

    2004-01-01

    The malaria parasite lives within erythrocytes and depends on the binding of parasite ligands to host cell surface receptors for invasion. The most virulent human malaria parasite, Plasmodium falciparum, uses multiple ligands, including EBA-175, BAEBL, and JESEBL of the Duffy-binding-like (DBL) family of erythrocyte-binding proteins, for invasion of human erythrocytes. Region II of these parasite ligands is the erythrocyte-binding domain. Previously, we had shown that polymorphism in region II of BAEBL leads to different erythrocyte-binding specificities. We have now identified and characterized the binding specificity of six JESEBL variants. We sequenced region II of JESEBL from 20 P. falciparum clones collected from various parts of the world where malaria is endemic. We observed eight JESEBL variants that contained amino acid polymorphisms at five positions among all clones. Seven of the eight variants could be connected by a single base change that led to an amino acid change. We investigated the functional significance of these polymorphisms by transiently expressing region II from six of JESEBL variants on the surface of Chinese hamster ovary cells. We observed four erythrocyte-binding patterns to enzyme-treated erythrocytes. Thus, P. falciparum DBL ligands JESEBL and BAEBL can recognize multiple receptors on the erythrocyte surface. In contrast to Plasmodium vivax, which has disappeared from West Africa because of the Duffy-negative blood group, P. falciparum may have been successful in endemic areas because it has mutated the ligands of the DBL family to create multiple pathways of invasion, thus making selection of refractory erythrocytes unlikely. PMID:14983041

  14. Prediction of response to chemoradiation in rectal cancer by a gene polymorphism in the epidermal growth factor receptor promoter region

    SciTech Connect

    Spindler, Karen-Lise Garm . E-mail: kalgsp@vgs.vejleamt.dk; Nielsen, Jens Nederby; Lindebjerg, Jan; Brandslund, Ivan; Jakobsen, Anders

    2006-10-01

    Purpose: Epidermal growth factor receptor (EGFR) has been associated with radioresistance in solid tumors. Recently a polymorphism in the Sp1 recognition site of the EGFR promoter region was identified. The present study investigated the predictive value of this polymorphism for the outcome of chemoradiation in locally advanced rectal cancer. Methods and Materials: The study included 77 patients with locally advanced T3 rectal tumors. Treatment consisted of preoperative radiation therapy at a total tumor dose of 65 Gy and concomitant chemotherapy with Uftoral. Blood samples from 63 patients were evaluated for Sp1 -216 G/T polymorphism by polymerase chain reaction analysis. Forty-eight primary tumor biopsies were available for EGFR immunostaining. Patients underwent surgery 8 weeks after treatment. Pathologic response evaluation was performed according to the tumor regression grade (TRG) system. Results: Forty-nine percent had major response (TRG1-2) and 51% moderate response (TRG 3-4) to chemoradiation. The rates of major response were 34% (10/29) in GG homozygote patients compared with 65% (22/34) in patients with T containing variants (p = 0.023). Fifty-eight percent of biopsies were positive for EGFR expression (28/48). The major response rates with regard to EGFR immunostaining were not significantly different. EGFR-positive tumors were found in 83% of the GG homozygote patients compared with 38% of patients with TT or GT variants (p = 0.008). Conclusions: There was a significant correlation between EGFR Sp1 -216 G/T polymorphism and treatment response to chemoradiation in locally advanced rectal cancer. Further investigations of a second set of patient and other treatment schedules are warranted.

  15. Interaction between Serotonin Transporter and Serotonin Receptor 1 B genes polymorphisms may be associated with antisocial alcoholism

    PubMed Central

    2012-01-01

    Background Several studies have hypothesized that genes regulating the components of the serotonin system, including serotonin transporter (5-HTTLPR) and serotonin 1 B receptor (5-HT1B), may be associated with alcoholism, but their results are contradictory because of alcoholism’s heterogeneity. Therefore, we examined whether the 5-HTTLPR gene and 5-HT1B gene G861C polymorphism are susceptibility factors for a specific subtype of alcoholism, antisocial alcoholism in Han Chinese in Taiwan. Methods We recruited 273 Han Chinese male inmates with antisocial personality disorder (ASPD) [antisocial alcoholism (AS-ALC) group (n = 120) and antisocial non-alcoholism (AS-N-ALC) group (n = 153)] and 191 healthy male controls from the community. Genotyping was done using PCR-RFLP. Results There were no significant differences in the genotypic frequency of the 5-HT1B G861C polymorphism between the 3 groups. Although AS-ALC group members more frequently carried the 5-HTTLPR S/S, S/LG, and LG/LG genotypes than controls, the difference became non-significant after controlling for the covarying effects of age. However, the 5-HTTLPR S/S, S/LG, and LG/LG genotypes may have interacted with the 5-HT1B G861C C/C polymorphism and increased the risk of becoming antisocial alcoholism. Conclusion Our study suggests that neither the 5-HTTLPR gene nor the 5-HT1B G861C polymorphism alone is a risk factor for antisocial alcoholism in Taiwan’s Han Chinese population, but that the interaction between both genes may increase susceptibility to antisocial alcoholism. PMID:22550993

  16. Associations of the Dopamine D4 Receptor Gene VNTR Polymorphism with Drug Use in Adolescent Psychiatric Inpatients

    PubMed Central

    McGeary, John E.; Esposito-Smythers, Christianne; Spirito, Anthony; Monti, Peter M.

    2007-01-01

    Background The VNTR polymorphism in the Dopamine D4 receptor gene (DRD4) has been associated with differential urge for substances across multiple methodologies ranging from neuroimaging to assessment in the natural environment. It is unclear whether the DRD4 gene is a marker for an underlying propensity for greater urge or whether the DRD4 gene differentially moderates the neuroadaptive effects of extended substance use on urge. Examination of the DRD4 in an adolescent sample may provide evidence of a mechanism of this putative relationship. Method Data from a subset of 77 participants in a larger assessment study characterized adolescents for substance-related behaviors by DRD4 genotype. The psychiatrically admitted adolescents were genotyped for the variable number of tandem repeats polymorphism in the DRD4 gene (L ≥ 7 [n = 25], S = < 7 [n = 52]). Associations of the DRD4 with scores on the SASSI, and ADI were examined as well as selected individual items thought to be most related to the intermediate phenotype of urge. Results The DRD4 gene was not associated with any DSM-IV substance misuse diagnostic classification. Individual items related to urge were also nonsignificantly related to DRD4 status. Carriers of the long variant of the DRD4 polymorphism were more likely to have used hard drugs within the previous 6 months and scored higher on the self-medication subscale of the ADI compared to short variant homozygotes. Discussion Preliminary results provide little evidence for the DRD4 VNTR polymorphism to be related to urge-related phenomena in hospitalized adolescents on a psychiatric inpatient unit. The association of the DRD4 gene with hard drug use may support literature linking this gene to impulsivity. Subscale findings may suggest a role of negative affect in previous DRD4 urge findings. PMID:17175015

  17. Micro opioid receptor A118G polymorphism and post-operative pain: opioids' effects on heterozygous patients.

    PubMed

    De Capraris, A; Cinnella, G; Marolla, A; Salatto, P; Da Lima, S; Vetuschi, P; Consoletti, L; Gesualdo, L; Dambrosio, M

    2011-01-01

    The single-nucleotide-polymorphism (SNP) 118A>G in the micro-1 opioid receptor gene (OPRM1) is associated with a decrease in the analgesic effects of opioids. The aim of this study is to assess whether 118A >G polymorphism could influence the analgesic response to opioid-based postoperative pain (POP) therapy. The study consisted of two parts: section alpha, observational, included 199 subjects undergoing scheduled surgical procedures with pain management standardized on surgery invasiveness and on expected level of postoperative pain; section beta, randomized, included 41 women undergoing scheduled caesarean delivery with continuous intra-operative epidural anesthesia and post-operative analgesia (CEA). In both sections, POP was measured over 48 h (T6h-T24h-T48h) by the visual analogue scale (VAS). In section beta we also tested the responsiveness of hypothalamic-pituitary-adrenal axis (HPA) expressed by cortisol levels. In section alpha, with cluster analysis, subjects were analyzed according to their genotype: a group (no. 1) of 34 patients reporting VAS score >3 at every time lapse was identified and included only A118G carriers, while wild-type (A118A - absence of 118A>G polymorphism) patients were unevenly distributed between those with cluster no. 2 (VAS score <3 at every study steps) and those with cluster no. 3 (VAS score progressively reducing from T6h). In section beta, A118G carriers receiving epidural sufentanil had the lowest VAS scores at T24h; also in these patients, cortisol levels remained more stable, with a mild decrease at T6h. This study shows that the OPRM1 118A>G polymorphism affects postoperative pain response in heterozygous patients: they have a different postoperative pain response than patients with wild-type genes, which may affect the efficacy of the analgesic therapy.

  18. Single nucleotide polymorphisms in toll-like receptor genes and case-control association studies with bovine tuberculosis

    PubMed Central

    Bhaladhare, Ashish; Sharma, Deepak; Kumar, Amit; Sonwane, Arvind; Chauhan, Anuj; Singh, Ranvir; Kumar, Pushpendra; Yadav, Ramji; Baqir, Mohd; Bhushan, Bharat; Prakash, Om

    2016-01-01

    Aim: Toll-like receptor 2 (TLR2) and TLR4 genes play critical roles in host recognition of Mycobacterium bovis infection and initiation of innate and adaptive immune response. The present study was aimed at exploring the association of seven single nucleotide polymorphisms (SNPs) in TLR2 and TLR4 genes with susceptibility/resistance against bovine tuberculosis (bTB) infection in cattle. Materials and Methods: A case-control resource population of 35 positive and 45 negative animals was developed after screening with single intradermal tuberculin test for bTB. Resource population was screened for SNPs in TLR2 and TLR4 genes using polymerase chain reaction-restriction fragment length polymorphism. The PROC LOGISTIC procedure of SAS 9.3 was used to find an association of allelic and genotypic frequencies with bTB. Results: In TLR2 gene, two of SNPs under study (rs55617172 and rs68268253) revealed polymorphism while in the case of TLR4 gene all four SNPs under investigation (rs8193041, rs207836014, rs8193060, and rs8193069) were found to be polymorphic in case-control population. SNP locus rs55617172 in TLR2 gene was found significantly (p<0.01) associated with susceptibility/resistance to TB in cattle. Conclusion: These findings indicate the presence of SNPs in TLR2 and TLR4 genes in our resource population. Upon validation in independent, large resource population and following biological characterization, SNP rs55617172 can be incorporated in marker panel for selection of animals with greater resistance to bTB. PMID:27284220

  19. Epidermal growth factor receptor (EGFR) polymorphisms and survival in head and neck cancer patients.

    PubMed

    Bandrés, Eva; Barricarte, Rubén; Cantero, Cristina; Honorato, Beatriz; Malumbres, Raquel; Zárate, Ruth; Alcalde, Juan; García-Foncillas, Jesús

    2007-08-01

    EGFR overexpression has been implicated in the development of head and neck squamous cell carcinoma (HNSCC). This study evaluates the prognostic ability of four polymorphisms in EGFR gene for patients diagnosed with HNSCC and treated with chemoradiation. EGFR polymorphisms in the promoter region were not associated with clinical or pathological characteristics. In relation to R497K polymorphism, patients with the Arg/Arg genotype showed the highest risk of disease-specificity mortality and none of the patients with the Lys/Lys genotype died throughout the follow-up period of the study. Patients with (CA)(n) repeats <17 in both alleles tended toward inferior overall survival compared with those with (CA)(n) repeats > or = 17 in both alleles (p=0.07). Moreover, the distribution of patients with any (CA)(n) repeats > or = 17 and both alleles <17 was statistically different across patients who were recorded as having partial response or no response to therapy (p=0.034). Combination analysis of both polymorphisms, (CA)(n) repeats and R497K, suggests that these polymorphisms may be associated with clinical outcome in patients treated with chemoradiation.

  20. Psychological, neuroimaging, and biochemical studies on functional association between impulsive behavior and the 5-HT2A receptor gene polymorphism in humans.

    PubMed

    Nomura, Michio; Nomura, Yasuyuki

    2006-11-01

    It has been suggested that impulsive behavior is caused by dysfunctional serotonergic 5-HT neurotransmission in the central nervous system (CNS). Brain neuroimaging studies have shown that behavioral inhibition is linked to the activation of cortex sites such as the ventral frontal cortex. Positron emission tomography (PET) imaging with [(18)F]altanserin to characterize 5-HT(2A) receptor binding revealed a reduction in 5-HT(2A) binding in the ventral frontal cortex in women who had recovered from impulsive diseases. These clinical, neuroimaging, and pharmacological studies appear to support the hypothesis that functional alteration of neurotransmission due to genetic polymorphisms of the 5-HT receptors may be involved in impulsive behavior modulation. Following evaluation by a self-reporting measure, it was proposed that a polymorphism in the promoter of the 5-HT(2A) receptor gene is the underlying cause of impulsive behavior; however, this hypothesis is not convincing. We examined whether the polymorphism in the 5-HT(2A) receptor gene promoter is involved in impulsive aggression by evaluating a behavioral task (Go/No-go task) in normal volunteers. The polymorphism of the 5-HT(2A) receptor gene promoter in lymphocytes from 71 volunteers was analyzed by using PCR. Impulsivity was defined as the number of commission errors (responding when one should not) recorded during a Go/No-go task; a larger number of commission errors indicate greater difficulty in inhibiting impulsive behavior. The subjects of the A-1438A allele group for the 5-HT(2A) receptor gene made more commission errors under the punishment-reward (PR)condition in a Go/No-go task than those in the G-1438G group. In the present review, we discuss and suggest the possible involvement of the A-1438A polymorphism of the 5HT2A receptor gene promoter in impulsive behavior. This hypothesis was evaluated by using a behavioral task measure that could directly reveal impulsive behavioral traits in humans.

  1. [The influence of hormonal replacement therapy on bone density in postmenopausal women depending on polymorphism of vitamin D receptor (VDR) and estrogen receptor (ER) genes].

    PubMed

    Brodowska, Agnieszka

    2003-01-01

    Osteoporosis is still an important health problem in modern societies. The densitometric criterion for the diagnosis of this condition established by WHO in 1994 is bone mass density (BMD) lower than 2.5 standard deviation (SD) from the mean value for young healthy individuals of the same sex. Between 60 and 90% of bone density (quantity of bone tissue in the human skeleton) at the time when growth is terminated is genetically determined. For this reason, genes predisposing to osteoporosis and mechanisms of their activity remain the object of investigations. Among them are genes coding for vitamin D receptor (VDR), estrogen receptor (ER), type I collagen, TGF-beta and IL-6. Diminishing bone density past the age of thirty is a physiologic process. Bone loss averages 0.3-0.6% per year. Acceleration of this process to 1.2-6% per year in postmenopausal women has been attributed to constantly decreasing estrogen concentration. Hence, the gold standard in osteoporosis prevention and treatment includes estrogen-progestagen therapy enriched with vitamin D analogues, calcium-rich diet and regular physical exercises. Treatment of osteoporosis can be long and expensive. The condition may lead to disability. Osteoporotic fractures and their complications may be fatal. For these reasons, the chief priority in osteoporosis is prevention. Unfortunately, current diagnostic methods (for detection of osteoporosis and monitoring of treatment) remain unsatisfactory. Molecular techniques offer a promising approach to diagnosis and monitoring of therapy. Additionally, the risk of osteoporosis in 1st degree relatives can be assessed and early prevention can be started. The present study addressed the following questions: 1. Are there differences in spine BMD in untreated women with postmenopausal osteoporosis depending on polymorphism of VDR and ER genes? 2. Does efficacy of treatment (increase in spine BMD) in women with postmenopausal osteoporosis depend on polymorphism of VDR and ER

  2. Autonomic receptors in urinary tract: Sex and age differences

    SciTech Connect

    Latifpour, J.; Kondo, S.; O'Hollaren, B.; Morita, T.; Weiss, R.M. )

    1990-05-01

    As age and sex affect the function of the lower urinary tract, we studied the characteristics of adrenergic and cholinergic receptors in various parts of lower urinary tract smooth muscle of young (6 months) and old (4 1/2-5 years) male and female rabbits. Saturation experiments performed with (3H)prazosin, (3H)yohimbine, (3H)dihydroalprenolol and (3H)quinuclidinyl benzylate in rabbit bladder base, bladder dome and urethra indicate the presence of regional, sex- and age-related differences in the density of alpha-1, alpha-2, and beta adrenergic and muscarinic cholinergic receptors. Alpha-2 adrenergic receptor density is considerably higher in the female than in the male urethra of both age groups, whereas the higher density of beta adrenergic receptors in the female than in the male bladder base is observed only in the younger animals. The density of muscarinic receptors is higher in bladder dome than in bladder base or urethra in young rabbits of both sexes. In the old animals, the density of muscarinic receptors in bladder base increases to the level observed in bladder dome. Inhibition experiments with selective adrenergic agonists and antagonists indicate that the pharmacological profiles of alpha-2 adrenergic receptors in the urethra and beta adrenergic receptors in the bladder dome and bladder base are similar in both sexes and at both ages. Beta-2 adrenergic receptors are shown to be predominant in bladder base and bladder dome of rabbits. Parallel studies in rabbit urethra, adult rat cortex and neonatal rat lung show that the urethral alpha-2 adrenergic receptors are of the alpha-2A subtype.

  3. Influence of music on steroid hormones and the relationship between receptor polymorphisms and musical ability: a pilot study

    PubMed Central

    Fukui, Hajime; Toyoshima, Kumiko

    2013-01-01

    Studies have shown that music confers plasticity to the brain. In a preliminary pilot study, we examined the effect of music listening on steroid hormones and the relationship between steroid hormone receptor polymorphisms and musical ability. Twenty-one subjects (10 males and 11 females) were recruited and divided into musically talented and control groups. The subjects selected (1) music they preferred (chill-inducing music) and (2) music they did not like. Before and after the experiments, saliva was collected to measure the levels of steroid hormones such as testosterone, estradiol, and cortisol. DNA was also isolated from the saliva samples to determine the androgen receptor (AR) and arginine vasopressin receptor 1A genotypes. Advanced Measures of Music Audiation (AMMA) was used to determine the musical ability of the subjects. With both types of music, the cortisol levels decreased significantly in both sexes. The testosterone (T) levels declined in males when they listened to both types of music. In females, the T levels increased in those listening to chill-inducing music but declined when they listened to music they disliked. However, these differences were not significant. The 17-beta estradiol levels increased in males with both types of music, whereas the levels increased with chill-inducing music but declined with disliked music in females. The AMMA scores were higher for the short repeat length-type AR than for the long repeat length-type. Comparisons of AR polymorphisms and T levels before the experiments showed that the T levels were within the low range in the short repeat length-type group and there was a positive relationship with the repeat length, although it was not significant. This is the first study conducted in humans to analyze the relationships between the AR gene, T levels, and musical ability. PMID:24348454

  4. Does the oxytocin receptor (OXTR) polymorphism (rs2254298) confer 'vulnerability' for psychopathology or 'differential susceptibility'? Insights from evolution.

    PubMed

    Brüne, Martin

    2012-04-17

    The diathesis-stress model of psychiatric conditions has recently been challenged by the view that it might be more accurate to speak of 'differential susceptibility' or 'plasticity' genes, rather than one-sidedly focusing on individual vulnerability. That is, the same allelic variation that predisposes to a psychiatric disorder if associated with (developmentally early) environmental adversity may lead to a better-than-average functional outcome in the same domain under thriving (or favourable) environmental conditions. Studies of polymorphic variations of the serotonin transporter gene, the monoamino-oxidase-inhibitor A coding gene or the dopamine D4 receptor gene indicate that the early environment plays a crucial role in the development of favourable versus unfavourable outcomes. Current evidence is limited, however, to establishing a link between genetic variation and behavioural phenotypes. In contrast, little is known about how plasticity may be expressed at the neuroanatomical level as a 'hard-wired' correlate of observable behaviour. The present review article seeks to further strengthen the argument in favour of the differential susceptibility theory by incorporating findings from behavioural and neuroanatomical studies in relation to genetic variation of the oxytocin receptor gene. It is suggested that polymorphic variation at the oxytocin receptor gene (rs2254298) is associated with sociability, amygdala volume and differential risk for psychiatric conditions including autism, depression and anxiety disorder, depending on the quality of early environmental experiences. Seeing genetic variation at the core of developmental plasticity can explain, in contrast to the diathesis-stress perspective, why evolution by natural selection has maintained such 'risk' alleles in the gene pool of a population.

  5. Effect of the Leptin Receptor Q223R Polymorphism on the Host Transcriptome following Infection with Entamoeba histolytica

    PubMed Central

    Mackey-Lawrence, Nicole M.; Guo, Xiaoti; Sturdevant, Daniel E.; Virtaneva, Kimmo; Hernandez, Matthew M.; Houpt, Eric; Sher, Alan; Porcella, Stephen F.

    2013-01-01

    Resistance to amebiasis is associated with a polymorphism in the leptin receptor. Previous studies demonstrated that humans with the ancestral Q223 leptin receptor allele were nearly four times less likely to be infected with Entamoeba histolytica than those carrying the mutant R223 allele. We hypothesized that the Q223 allele protected against E. histolytica via STAT3-mediated transcription of genes required for mucosal immunity. To test this, mice containing the humanized LEPR Q or R allele at codon 223 were intracecally infected with E. histolytica. Susceptibility to amebiasis was assessed, and cecal tissues were analyzed for changes in gene expression. By 72 h postchallenge, all Q223 mice had cleared E. histolytica, whereas 39% of 223R mice were infected. Thirty-seven genes were differentially expressed in response to infection at 72 h, including proinflammatory genes (CXCL2, S100A8/9, PLA2G7, ITBG2, and MMP9) and functions pertaining to the movement and activity of immune cells. A comparison at 12 h postchallenge of infected Q223 versus R223 mice identified a subset of differentially expressed genes, many of which were closely linked to leptin signaling. Further analyses indicated that the Q223 gene expression pattern was consistent with a suppressed apoptotic response to infection, while 223R showed increased cellular proliferation and recruitment. These studies are the first to illuminate the downstream effects of leptin receptor polymorphisms on intestinal infection by E. histolytica. As such, they are important for the insight that they provide into this previously uncharacterized mechanism of mucosal immunity. PMID:23429533

  6. Association Between Cytokines and Their Receptor Antagonist Gene Polymorphisms and Clinical Risk Factors and Acute Rejection Following Renal Transplantation

    PubMed Central

    Ding, Siqing; Xie, Jianfei; Wan, Qiquan

    2016-01-01

    Background Acute rejection (AR) after renal transplantation affects both patient and graft survival. There is growing evidence of the genetic association between cytokine or its receptor antagonist and AR in solid organ transplantation. The objectives of this study were to investigate the role of recipient TNF β, IL-10, IL-1β, and IL-1 receptor antagonist (ra) gene polymorphism, as well as traditional clinical variables such as panel-reactive antibody (PRA) levels, donor type, and HLA mismatches in AR following renal transplantation. Material/Methods TNF β (+252A/G), IL-10 (−592A/C), IL-1β (−511C/T) and IL-1ra (86 bp VNTR) gene polymorphisms were determined in 195 renal allograft recipients with and without AR, using PCR. Both these genotypic variants and clinical risk factors were investigated for correlation with AR within the first year after renal transplantation. Results Patients with increased pre-transplant PRA levels (P<0.001) and donor type (P=0.012) were prone to the development of AR. After adjusting for all variables of P<0.2, a PRA level >10% (OR=4.515, 95% confidence intervals=1.738–11.727, P=0.002) and the receipt of a graft from a donation after cardiac death (DCD) donor (OR=2.437, 95% confidence intervals=1.047–5.673, P=0.039) remained significantly associated with AR in a multivariate logistic regression analysis. No correlation could be found between recipients with an episode and absence of acute rejection and the gene polymorphisms of these cytokines investigated in the present study. Conclusions This study shows that the presence of increased pre-transplant levels of PRA and the receipt of a graft from DCD donor other than cytokine gene polymorphisms are significant risk factors for AR in renal transplantation. To reduce the occurrence of AR, clinicians should take necessary measures to lower the PRA levels and pay more attention to patients who received a graft from a DCD donor. PMID:27913812

  7. The relationship between toll like receptor 4 gene rs4986790 and rs4986791 polymorphisms and sepsis susceptibility: A meta-analysis

    PubMed Central

    Liu, Rui; Mo, Yuan-Yuan; Wang, Hui-Li; Tan, Yan; Wen, Xiu-Jie; Deng, Man-Jing; Yan, Hong; Li, Lei

    2016-01-01

    Accumulating evidences have demonstrated that lipopolysaccharide (LPS) represents the important etiologic factor for sepsis. Some previous studies have reported the relationship between common polymorphisms rs4986790 and rs4986791 in the coding gene for this receptor and the susceptibility to sepsis, but there were distinct divergences between those findings. We therefore designed this meta-analysis incorporated 28 published articles containing 6,537 sepsis patients and 8,832 controls for a more comprehensive conclusion on this matter. Odds ratios (ORs) and 95% confidence interval (95% CIs) were calculated to evaluate the association of toll like receptor 4 gene polymorphisms rs4986790 and rs4986791 with sepsis risk. Heterogeneity between included studies was inspected using Q test, and sensitivity analysis was implemented via sequential deletion of each included study to investigate the stability of overall estimates. Funnel plot and Egger’s test were adopted to examine publication bias across selected studies. We found no significant association for either the polymorphism rs4986790 or rs4986791 with sepsis susceptibility in total analysis under any genetic models. Neither did we after combining these two polymorphisms. The results of this meta-analysis suggest that the rs4986790 and rs4986791 polymorphisms in toll like receptor 4 gene may have no statistically significant influence on sepsis susceptibility. PMID:27958344

  8. Human Mu Opioid Receptor (OPRM1 A118G) polymorphism is associated with brain mu-opioid receptor binding potential in smokers

    PubMed Central

    Ray, Riju; Ruparel, Kosha; Newberg, Andrew; Wileyto, E. Paul; Loughead, James W.; Divgi, Chaitanya; Blendy, Julie A.; Logan, Jean; Zubieta, Jon-Kar; Lerman, Caryn

    2011-01-01

    Evidence points to the endogenous opioid system, and the mu-opioid receptor (MOR) in particular, in mediating the rewarding effects of drugs of abuse, including nicotine. A single nucleotide polymorphism (SNP) in the human MOR gene (OPRM1 A118G) has been shown to alter receptor protein level in preclinical models and smoking behavior in humans. To clarify the underlying mechanisms for these associations, we conducted an in vivo investigation of the effects of OPRM1 A118G genotype on MOR binding potential (BPND or receptor availability). Twenty-two smokers prescreened for genotype (12 A/A, 10 */G) completed two [11C]carfentanil positron emission tomography (PET) imaging sessions following overnight abstinence and exposure to a nicotine-containing cigarette and a denicotinized cigarette. Independent of session, smokers homozygous for the wild-type OPRM1 A allele exhibited significantly higher levels of MOR BPND than smokers carrying the G allele in bilateral amygdala, left thalamus, and left anterior cingulate cortex. Among G allele carriers, the extent of subjective reward difference (denicotinized versus nicotine cigarette) was associated significantly with MOR BPND difference in right amygdala, caudate, anterior cingulate cortex, and thalamus. Future translational investigations can elucidate the role of MORs in nicotine addiction, which may lead to development of novel therapeutics. PMID:21576462

  9. Human Mu Opioid Receptor (OPRM1A118G) polymorphism is associated with brain mu- opioid receptor binding potential in smokers

    SciTech Connect

    Ray, R.; Logan, J.; Ray, R.; Ruparel, K.; Newberg, A.; Wileyto, E.P.; Loughead, J.W.; Divgi, C.; Blendy, J.A.; Logan, J.; Zubieta, J.-K.; Lerman, C.

    2011-04-15

    Evidence points to the endogenous opioid system, and the mu-opioid receptor (MOR) in particular, in mediating the rewarding effects of drugs of abuse, including nicotine. A single nucleotide polymorphism (SNP) in the human MOR gene (OPRM1 A118G) has been shown to alter receptor protein level in preclinical models and smoking behavior in humans. To clarify the underlying mechanisms for these associations, we conducted an in vivo investigation of the effects of OPRM1 A118G genotype on MOR binding potential (BP{sub ND} or receptor availability). Twenty-two smokers prescreened for genotype (12 A/A, 10 */G) completed two [{sup 11}C] carfentanil positron emission tomography (PET) imaging sessions following overnight abstinence and exposure to a nicotine-containing cigarette and a denicotinized cigarette. Independent of session, smokers homozygous for the wild-type OPRM1 A allele exhibited significantly higher levels of MOR BP{sub ND} than smokers carrying the G allele in bilateral amygdala, left thalamus, and left anterior cingulate cortex. Among G allele carriers, the extent of subjective reward difference (denicotinized versus nicotine cigarette) was associated significantly with MOR BP{sub ND} difference in right amygdala, caudate, anterior cingulate cortex, and thalamus. Future translational investigations can elucidate the role of MORs in nicotine addiction, which may lead to development of novel therapeutics.

  10. A polymorphism in a staphylococcal enterotoxin receptor gene (T cell receptor BV3 recombination signal sequence) is not associated with unexplained sudden unexpected death in infancy in an Australian cohort.

    PubMed

    Highet, Amanda R; Gibson, Catherine S; Goldwater, Paul N

    2010-01-01

    Polymorphisms in genes that influence the expression of toxin receptors could contribute to Sudden Infant Death Syndrome (SIDS) and unexplained Sudden Unexpected Death in Infancy (uSUDI) for which there is evidence of toxin involvement. We aimed to determine whether TCRBV3S1 allele 2 could be involved in a staphylococcal toxic shock hypothesis for uSUDI. Observed frequencies of the TCRBV3S1*2 allele and genotype in 48 Australian uSUDI cases and 96 live comparison infants did not differ. In future the role of other toxin receptor gene polymorphisms deserves investigation.

  11. Oral and intestinal sweet and fat tasting: impact of receptor polymorphisms and dietary modulation for metabolic disease.

    PubMed

    Cvijanovic, Nada; Feinle-Bisset, Christine; Young, Richard L; Little, Tanya J

    2015-05-01

    The human body has evolved with a disposition for nutrient storage, allowing for periods of irregular food availability and famine. In contrast, the modern diet is characterized by excessive consumption of fats and sugars, resulting in a surge in the rates of obesity and type 2 diabetes. Although these metabolic disorders arise from a complex interaction of genetic, social, and environmental factors, evidence now points to fundamental changes in nutrient metabolism at the cellular level contributing to the underlying pathology. Taste receptors detect nutrients in the oral cavity and gastrointestinal tract and can influence the hormonal response to nutrients; they may also become maladaptive in conditions of excess fat or sugar consumption. Precise links between taste receptor activity, and downstream effects on energy intake and glycemia are not well defined. This review outlines the candidate taste receptors for carbohydrates and fats in the oral cavity and within the small intestine, highlighting the contributions of underlying genetics (polymorphisms) and sensory challenges (e.g., a high-fat diet) to the development of obesity and type 2 diabetes.

  12. Estrogen receptor alpha gene ( ESR1) polymorphism can contribute to clinical findings in systemic lupus erythematosus patients.

    PubMed

    Drehmer, M N; Andrade, D; Pereira, I A; Marrero, A R; Muniz, Y C N; de Souza, I R; Löfgren, S E

    2017-03-01

    Background Estrogens have a modulatory effect on several immune responses, many of which are correlated to autoimmune diseases. Estrogens act through binding to their receptors, and an overexpression of these receptors has been identified in patients with different autoimmune diseases. Here we analyzed the association of a putative functional genetic variant in the main estrogen receptor (ERα) gene ( ESR1), and the susceptibility to clinical findings and severity of SLE. Methods A total of 426 individuals (266 healthy controls and 160 SLE patients) were genotyped for the polymorphism rs2234693 in the ESR1 gene. Allele and genotype frequencies were calculated and analyzed between cases and controls using Unphased software. Results The SNP rs2234693 was not associated with SLE per se but the minor allele rs2234693-C was correlated with the presence of nephritis and discoid skin rash. On the other hand, the rs2234693-CC genotype was correlated with the absence of arthritis as well as anti-ANA and anti-RNP autoantibodies. The comprehensive clinical analysis of these patients revealed a more severe status of the disease, characterized by a younger age of onset and higher number of organs involved when compared to European populations. Conclusions Minor allele rs2234693-C was associated with renal and cutaneous involvement, as well as the absence of arthritis, anti-ANA and anti-RNP autoantibodies.

  13. Effect of serotonin receptor 2A gene polymorphism on mirtazapine response in major depression.

    PubMed

    Kang, Rhee-Hun; Choi, Myoung-Jin; Paik, Jong-Woo; Hahn, Sang-Woo; Lee, Min-Soo

    2007-01-01

    The 5-HTR2A gene is a candidate gene for influencing the clinical response to treatment with antidepressants. The purpose of this study was to determine the relationship between the -1438A/G polymorphism of the 5-HTR2A gene and the response to mirtazapine in a Korean population with major depressive disorder. Mirtazapine was administered for eight weeks to the 101 patients who completed the study, during which we evaluated the clinical outcome using repeated-measures ANCOVA. A main effect of genotype or an effect of genotype-time interactions on the decrease in HAMD score during the eight-week follow-up was not found, which suggests that the 5-HTR2A -1438A/G polymorphism does not affect the clinical outcome to mirtazapine administration. However, significant effects of genotype and allele carriers on the decrease in the sleep score over the eight weeks were found (genotype: F = 4.093, p = 0.017; allele: F = 4.371, p = 0.037), whereas no effect of genotype-time interactions on the decrease in the HAMD score over the eight-week follow-up was found. These observations suggest that the -1438A/G polymorphism on the sleep improvement at each time period revealed significant differences in the sleep scores after two weeks of mirtazapine administration. The sleep scores were lower for carriers of the A+ allele than of the A- allele after two weeks of mirtazapine administration (p = 0.041), which means that the -1438GG genotype is associated with less improvement in sleep, and suggests that the effect of mirtazapine on improving the sleep quality differs with the 5-HTR2A -1438A/G polymorphism within two weeks of mirtazapine treatment. In conclusion, although the -1438A/G polymorphism affects the sleep improvement resulting from the administration of mirtazapine to Korean patients with major depressive disorder, our results do not support the hypothesis that this polymorphism of the 5-HTR2A gene is involved in the therapeutic response to mirtazapine.

  14. Peroxisome proliferator-activated receptor gamma (PPARG) rs1801282 C>G polymorphism is associated with cancer susceptibility in asians: an updated meta-analysis

    PubMed Central

    Wang, Yafeng; Chen, Yu; Jiang, Heping; Tang, Weifeng; Kang, Mingqiang; Liu, Tianyun; Guo, Zengqing; Ma, Zhiqiang

    2015-01-01

    Peroxisome proliferator-activated receptor gamma (PPARG) is related to inflammation and plays an important role in the development of cancer. PPARG rs1801282 C>G polymorphism might influence the risk of cancer by regulating production of PPARG gene. Hence, a comprehensive meta-analysis was conducted to explore the association of PPARG rs1801282 C>G polymorphism with cancer susceptibility. An extensive search of PubMed and Embase databases for all relevant publications was carried out. A total of 38 publications with 16,844 cancer cases and 23,736 controls for PPARG rs1801282 C>G polymorphism were recruited in our study. Our results indicated that PPARG rs1801282 C>G variants were associated with an increased cancer risk in Asian populations and gastric cancer. In summary, the findings suggest that PPARG rs1801282 C>G polymorphism may play a crucial role in malignant transformation and the development of cancer. PMID:26550180

  15. Association of Toll-Like Receptor 3 and Toll-Like Receptor 9 Single Nucleotide Polymorphisms with Hepatitis C Virus Infection and Hepatic Fibrosis in Egyptian Patients.

    PubMed

    Zayed, Rania A; Omran, Dalia; Mokhtar, Doha A; Zakaria, Zinab; Ezzat, Sameera; Soliman, Mohamed A; Mobarak, Lamiaa; El-Sweesy, Hossam; Emam, Ghada

    2017-01-16

    Toll-like receptors (TLRs) are recognized as fundamental contributors to the immune system function against infections. Hepatitis C virus (HCV) infection represents a global health problem especially in Egypt having the highest HCV prevalence worldwide where HCV infection is a continuing epidemic. The aim of the present study was to investigate the possible association between genetic variation in TLR-3 and TLR-9 and HCV infection and hepatic fibrosis in chronic HCV-positive Egyptian patients. The present study included 100 naïve chronic HCV-positive patients and 100 age- and sex-matched healthy controls. Genotyping of TLR-3 (_7 C/A [rs3775296]), TLR-3 (c.1377C/T [rs3775290]) and TLR-9 (1237T/C [rs5743836]) were done by polymerase chain reaction restriction fragment length polymorphism technique. Frequency of polymorphic genotypes in TLR-3 (_7 C/A), TLR-3 (c.1377C/T) and TLR-9 (1237T/C) were not significantly different between studied HCV-positive patients and controls with P values 0.121, 0.112, and 0.683, respectively. TLR-3 c.1377 T-allele was associated with advanced stage of hepatic fibrosis (P = 0.003).

  16. The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity

    PubMed Central

    Ovsyannikova, Inna G.; Haralambieva, Iana H.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

    2014-01-01

    Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines. PMID:21424379

  17. Polymorphism in the Serotonin Receptor 2a (HTR2A) Gene as Possible Predisposal Factor for Aggressive Traits

    PubMed Central

    Banlaki, Zsofia; Elek, Zsuzsanna; Nanasi, Tibor; Szekely, Anna; Nemoda, Zsofia; Sasvari-Szekely, Maria; Ronai, Zsolt

    2015-01-01

    Aggressive manifestations and their consequences are a major issue of mankind, highlighting the need for understanding the contributory factors. Still, aggression-related genetic analyses have so far mainly been conducted on small population subsets such as individuals suffering from a certain psychiatric disorder or a narrow-range age cohort, but no data on the general population is yet available. In the present study, our aim was to identify polymorphisms in genes affecting neurobiological processes that might explain some of the inter-individual variation between aggression levels in the non-clinical Caucasian adult population. 55 single nucleotide polymorphisms (SNP) were simultaneously determined in 887 subjects who also filled out the self-report Buss-Perry Aggression Questionnaire (BPAQ). Single marker association analyses between genotypes and aggression scores indicated a significant role of rs7322347 located in the HTR2A gene encoding serotonin receptor 2a following Bonferroni correction for multiple testing (p = 0.0007) both for males and females. Taking the four BPAQ subscales individually, scores for Hostility, Anger and Physical Aggression showed significant association with rs7322347 T allele in themselves, while no association was found with Verbal Aggression. Of the subscales, relationship with rs7322347 was strongest in the case of Hostility, where statistical significance virtually equaled that observed with the whole BPAQ. In conclusion, this is the first study to our knowledge analyzing SNPs in a wide variety of genes in terms of aggression in a large sample-size non-clinical adult population, also describing a novel candidate polymorphism as predisposal to aggressive traits. PMID:25658328

  18. Baldness and the androgen receptor: the AR polyglycine repeat polymorphism does not confer susceptibility to androgenetic alopecia.

    PubMed

    Ellis, Justine A; Scurrah, Katrina J; Cobb, Joanna E; Zaloumis, Sophie G; Duncan, Anna E; Harrap, Stephen B

    2007-05-01

    Androgenetic alopecia, or male pattern baldness, is a complex condition with a strong heritable component. In 2001, we published the first significant evidence of a genetic association between baldness and a synonymous coding SNP (rs6152) in the androgen receptor gene, AR. Recently, this finding was replicated in three independent studies, confirming an important role for AR in the baldness phenotype. In one such replication study, it was claimed that the causative variant underlying the association was likely to be the polyglycine (GGN) repeat polymorphism, one of two apparently functional triplet repeat polymorphisms located in the exon 1 transactivating domain of the gene. Here, we extend our original association finding and present comprehensive evidence from approximately 1,200 fathers and sons drawn from 703 families of the Victorian Family Heart Study, a general population Caucasian cohort, that neither exon 1 triplet repeat polymorphism is causative in this condition. Seventy-eight percent of fathers (531/683) and 30% of sons (157/520) were affected to some degree with AGA. We utilised statistical methods appropriate for the categorical nature of the phenotype and familial structure of the cohort, and determined that whilst SNP rs6152 was strongly associated with baldness (P < 0.0001), the GGN triplet repeat was not (P = 0.13). In the absence of any other known common functional coding variants, we argue that the causative variant is likely to be in the non-coding region, and yet to be identified. The identification of functional non-coding variants surrounding AR may have significance not only for baldness, but also for the many other complex conditions that have thus far been linked to AR.

  19. Vitamin D receptor gene polymorphisms in relation to the risk of colorectal cancer in the Polish population.

    PubMed

    Laczmanska, Izabela; Laczmanski, Lukasz; Bebenek, Marek; Karpinski, Pawel; Czemarmazowicz, Halina; Ramsey, David; Milewicz, Andrzej; Sasiadek, Maria M

    2014-12-01

    The protective effect of vitamin D against several cancers including colorectal cancer is modulated by the vitamin D receptor (VDR) and its ligand, the active form of vitamin D. VDR response has been found to play a role in various genes encoding proteins involved in crucial cellular pathways. Single nucleotide polymorphisms (SNPs) of the VDR gene that modulate its activity are located in the promoter region, exons 2-9, and their vicinity and also in the 3'UTR region. Some of them have been previously studied in relation to cancer susceptibility and prognosis. The aim of our study was to investigate four polymorphisms, BsmI, ApaI, TaqI, and FokI, of the VDR gene in Polish patients with sporadic colorectal cancer and to evaluate their association with susceptibility to cancer. We found a significant association between the BsmI genotype and cancer (individuals with the bb genotype are more susceptible to cancer compared to those with other genotypes, p = 0.025, Fisher's exact test for 2 × 2 table). Also, the TT genotype at TaqI and the AA genotype at ApaI are correlated with a higher risk of cancer (p = 0.00071 and p = 1.0 × 10(-5), respectively). We found relatively strong linkage disequilibrium between the TaqI and ApaI loci (T with A and t with a, respectively). Both of these loci are associated with cancer. We do not observe any such association for the FokI polymorphism. In conclusion, a small modification in VDR expression may play a role in such a multipathway process as tumorigenesis.

  20. Association Study of Vitamin D Receptor (VDR) - Related Genetic Polymorphisms and their Haplotypes with Chronic Periodontitis in Colombian Population

    PubMed Central

    Isaza-Guzmán, Diana María; Pineda-Trujillo, Nicolás

    2017-01-01

    Introduction There is strong evidence that both genetic and environmental factors may affect the periodontal clinical status. However, epidemiological evidence on the association between Vitamin D Receptor (VDR) polymorphisms and Chronic Periodontitis (CP) has been inconsistent. Aim The focus of this study was to identify if a possible association between VDR Single-Nucleotide Polymorphisms (SNPs) may be implicated in the aetiopathogenesis of CP in Colombian population. Materials and Methods One hundred and ten CP patients and 50 Healthy Controls (HC) were recruited. Periodontal status was assessed based on probing depth, clinical attachment level, extent, and severity of periodontal breakdown. The polymerase chain reaction-restriction fragment length polymorphism method was used to identify the VDR rs7975232, rs1544410, rs2228570, and rs731236 SNPs from saliva samples. Odds Ratios (ORs) along with their 95% Confidence Intervals (CIs) were computed to compare the distribution of genotypes/alleles between HC and CP patients, alongside with analysis of Linkage Disequilibrium (LD) and haplotype associations between SNPs. Also, an analysis of the interaction between genetic findings and those significant demographic factors was performed for all SNPs. Results There was no association neither between the different genotypes/allele frequencies nor haplotypes and CP. Similarly, no significant differences in extent or severity amongst genotype/allele groups were observed. Even so, interaction analysis revealed significant synergistic interactions between each SNP and age associated with the disease status. Conclusion Although these results do not support that VDR SNPs could be identified as independent risk predictor variables for CP in the Colombian population, synergistic biological interactive effects of all these SNPs related to age might play a significant role in the pathogenic pathways of CP. PMID:28384983

  1. Association between killer cell immunoglobulin-like receptor (KIR) polymorphisms and systemic lupus erythematosus (SLE) in populations

    PubMed Central

    Liang, Hui-ling; Ma, Shu-juan; Tan, Hong-zhuan

    2017-01-01

    Abstract Background: Recently, a growing number of studies show that the killer cell immunoglobulin-like receptor (KIR) gene polymorphisms may play a role in the systemic lupus erythematosus (SLE) susceptibility. Nonetheless, the results were inconsistent. Thus, a meta-analysis was carried out by integrating multiple research to clarify the association between KIR polymorphisms and SLE susceptibility. Methods: The Web of Science, Embase (Ovid), PubMed, Elsevier Science Direct, the Chinese Biomedical Database and CNKI, Wanfang databases (last search was updated on May 15, 2016) were systematically searched to select studies on addressing the association between the KIR polymorphisms and susceptibility to SLE in populations. The odds ratio (OR) with 95% confidence interval (95% CI) was calculated. Results: A total of 10 published case-control studies involving 1450 SLE patients and 1758 controls were available for this meta-analysis. Results suggested that KIR2DL1 might be a risk factor for SLE (OR 2DL1 =1.047, 95% CI=1.011–1.083) in all subjects. The KIR2DL3, KIR2DL5 were identified as protective factors for SLE in Asian populations (OR2DL3= 0.215, 95% CI = 0.077–0.598; OR2DL5 = 0.588, 95% CI = 0.393–0.881), but not in Caucasians. Conclusions: The meta-analysis results suggested that 2DL1 might be a potential risk factor and 2DL3, 2DL5 might be protective factors for SLE in Asians but not in Caucasians. PMID:28272205

  2. Insertion/deletion-related polymorphisms in the human T cell receptor beta gene complex

    PubMed Central

    1989-01-01

    Insertion/deletion related polymorphisms (IDRP) involving stretches of 15-30 kb within the human TCR-beta gene complex were revealed by pulse- field gel electrophoresis. Two independent IDRP systems were detected by analysis of Sfi I- and Sal I-digested human DNA samples using probes for TCR C and V region gene segments. The allelic nature of these systems was verified in family studies, and mapping data allowed localization of one area of insertion/deletion among the V gene segments and the other near the C region genes. All but one of 50 individuals tested could be typed for the two allelic systems, and gene frequencies for the two allelic forms were 0.37/0.61 and 0.46/0.54, indicating that these polymorphisms are widespread. PMID:2571667

  3. Role of Thr399Ile and Asp299Gly polymorphisms of toll-like receptor-4 gene in acute dental abscess

    PubMed Central

    Miri-Moghaddam, Ebrahim; Baghaee, Elnaz; Bazi, Ali; Garme, Yasaman

    2017-01-01

    Background Apical Periodontitis (AP) is an inflammatory disease that affects the tissues surrounding the root end of a tooth. The disease which is caused by endodontic infections presents in different clinical ways including development of an acute abscess. Recent studies have provided information suggesting role of a multitude of factors in pathogenesis of acute apical abscess (AAA). In this case-control study, our goal was to evaluate the frequency and potential role of two common polymorphisms of toll like receptor-4 (TLR-4) gene; Thr399Ile (1196 C>T) and Asp299Gly (+896 A>G), in 50 patients with AAA as cases and 50 patients with asymptomatic apical periodontitis (AAP) as controls. Material and Methods Saliva sample containing mucosal epithelial cells was used for DNA extraction. Polymorphisms were detected by Tetra-ARMS (Amplification Refractory Mutation System) PCR method. Statistical analyses were carried out in SPSS 21 software. Results Homozygous wild type (CC) and heterozygous (CT) genotypes of Thr399Ile polymorphism were detected in 84% and 16% of AAA patients respectively. In controls, respective ratios were 94% (CC) and 6% (CT). Observed difference was not statistically significant (P>0.05) for distribution of these genotypes. The mutant homozygous (TT) genotype of this polymorphism was identified in neither of the participants. Overall, T allele frequency was obtained 8% in AAA and 3% in AAP (OR=2.6, 95% CI; 0. 6-10.6, p>0.05). For Asp299Gly polymorphism, no individual was detected with the mutant allele in case or control groups. Conclusions Our results indicated a possible role for Thr399Ile polymorphism in acute presentations of abscess in AAA. However, the impact of this polymorphism needs to be more assessed in future studies. Key words:Genetic polymorphism, periapical abscess, periapical periodontitis, toll-like receptor 4. PMID:28210435

  4. Humanizing the Mouse Androgen Receptor to Study Polymorphisms and Mutations in Prostate Cancer

    DTIC Science & Technology

    2005-01-01

    hormone levels are subject to wide variation, so we are currently measuring seminal vesicle weight as a better indicator of testosterone action. Since we...and somatic mutations may affect progression and response to therapy [2-4]. In most cases, hormonal therapy is initially successful, but tumors...How do polymorphisms in AR lead to greater risk of disease? 2) How do somatic mutations in AR during tumor growth circumvent hormone ablation? This

  5. Humanizing the Mouse Androgen Receptor to Study Polymorphisms and Mutations in Prostate Cancer

    DTIC Science & Technology

    2006-01-01

    process. AR molecular genetics underlie two crucial problems in PCa: 1) Do polymorphisms in AR lead to differential risk of disease? 2) Do...Nkx3.1, which is critical in prostate growth and differentiation , was higher for short compared to long Q tract alleles (see Fig. 6 in ms.), likely...This link between Q tract length and prostate cancer establishment, likely due to the differential transcriptional strength of these AR alleles

  6. Vitamin D Receptor Gene Polymorphisms and Haplotypes in Hungarian Patients with Idiopathic Inflammatory Myopathy

    PubMed Central

    Griger, Zoltán; Dankó, Katalin

    2015-01-01

    Idiopathic inflammatory myopathies are autoimmune diseases characterized by symmetrical proximal muscle weakness. Our aim was to identify a correlation between VDR polymorphisms or haplotypes and myositis. We studied VDR-BsmI, VDR-ApaI, VDR-TaqI, and VDR-FokI polymorphisms and haplotypes in 89 Hungarian poly-/dermatomyositis patients (69 females) and 93 controls (52 females). We did not obtain any significant differences for VDR-FokI, BsmI, ApaI, and TaqI genotypes and allele frequencies between patients with myositis and healthy individuals. There was no association of VDR polymorphisms with clinical manifestations and laboratory profiles in myositis patients. Men with myositis had a significantly different distribution of BB, Bb, and bb genotypes than female patients, control male individuals, and the entire control group. Distribution of TT, Tt, and tt genotypes was significantly different in males than in females in patient group. According to four-marker haplotype prevalence, frequencies of sixteen possible haplotypes showed significant differences between patient and control groups. The three most frequent haplotypes in patients were the fbAt, FBaT, and fbAT. Our findings may reveal that there is a significant association: Bb and Tt genotypes can be associated with myositis in the Hungarian population we studied. We underline the importance of our result in the estimated prevalence of four-marker haplotypes. PMID:25649962

  7. A highly pleiotropic amino acid polymorphism in the Drosophila insulin receptor contributes to life-history adaptation

    PubMed Central

    Paaby, Annalise B.; Bergland, Alan O.; Behrman, Emily L.; Schmidt, Paul S.

    2016-01-01

    Finding the specific nucleotides that underlie adaptive variation is a major goal in evolutionary biology, but polygenic traits pose a challenge because the complex genotype–phenotype relationship can obscure the effects of individual alleles. However, natural selection working in large wild populations can shift allele frequencies and indicate functional regions of the genome. Previously, we showed that the two most common alleles of a complex amino acid insertion–deletion polymorphism in the Drosophila insulin receptor show independent, parallel clines in frequency across the North American and Australian continents. Here, we report that the cline is stable over at least a five-year period and that the polymorphism also demonstrates temporal shifts in allele frequency concurrent with seasonal change. We tested the alleles for effects on levels of insulin signaling, fecundity, development time, body size, stress tolerance, and life span. We find that the alleles are associated with predictable differences in these traits, consistent with patterns of Drosophila life-history variation across geography that likely reflect adaptation to the heterogeneous climatic environment. These results implicate insulin signaling as a major mediator of life-history adaptation in Drosophila, and suggest that life-history trade-offs can be explained by extensive pleiotropy at a single locus. PMID:25319083

  8. Polymorphisms in the platelet-specific collagen receptor GP6 are associated with risk of nonfatal myocardial infarction in Caucasians

    PubMed Central

    Shaffer, JR; Kammerer, CM; Dorn, J; Ferrell, RE; Iacoviello, L; Trevisan, M; Donahue, RP

    2010-01-01

    Background and Aims Glycoprotein 6 (GP6) is a platelet-specific collagen receptor implicated in the thrombotic pathway to acute myocardial infarction (AMI), but a possible genetic relationship between GP6 and AMI is poorly understood. We tested for the genetic association between AMI and single nucleotide polymorphisms (SNPs) in 24 loci, including GP6. Methods and Results We conducted a case-control study of AMI and GP6 in a community-based population (n=652 cases, 625 controls). We also examined men and women separately and stratified the latter by use of hormone replacement therapy (HRT). Among both sexes, the strongest association was for a protective missense polymorphism (rs1163662) in the GP6 gene (OR=0.70; Bonferroni-adjusted p<0.05). SNPs in GP6 were also strongly associated with AMI among women who reported ever taking HRT, but not among women who never took HRT. Haplotype analyses were consistent with the single-SNP findings. Conclusions In this sample of white non-Hispanic men and women, several SNPs in GP6 were significantly related to risk of AMI. Development of pharmacologic therapy directed towards platelet activity and thrombosis may reduce the incidence of AMI among at-risk groups. PMID:20227257

  9. Association between the Growth Hormone Receptor Exon 3 Polymorphism and Metabolic Factors in Korean Patients with Acromegaly

    PubMed Central

    Park, Hye Yoon; Hwang, In Ryang; Seo, Jung Bum; Kim, Su Won; Seo, Hyun Ae; Lee, In Kyu

    2015-01-01

    Background This study investigated the association between the frequency of growth hormone receptor (GHR) exon 3 polymorphism (exon 3 deletion; d3-GHR) and metabolic factors in patients with acromegaly in Korea. Methods DNA was extracted from the peripheral blood of 30 unrelated patients with acromegaly. GHR genotypes were evaluated by polymerase chain reaction and correlated with demographic data and laboratory parameters. Results No patient had the d3/d3 genotype, while four (13.3%) had the d3/fl genotype, and 26 (86.7%) had the fl/fl genotype. Body mass index (BMI) in patients with the d3/fl genotype was significantly higher than in those with the fl/fl genotype (P=0.001). Age, gender, blood pressure, insulin-like growth factor-1, growth hormone, fasting plasma glucose, triglycerides, high density lipoprotein cholesterol, and low density lipoprotein cholesterol levels showed no significant differences between the two genotypes. Conclusion The d3-GHR polymorphism may be associated with high BMI but not with other demographic characteristics or laboratory parameters. PMID:25559716

  10. Interleukin (IL)1beta, IL-1alpha, and IL-1 receptor antagonist gene polymorphisms in patients with temporal lobe epilepsy.

    PubMed

    Kanemoto, K; Kawasaki, J; Miyamoto, T; Obayashi, H; Nishimura, M

    2000-05-01

    Proinflammatory cytokines, including interleukin (IL)-1beta, are known to modulate effects of neurotoxic neurotransmitters discharged during excitation or inflammation in the central nervous system (CNS). They also regulate development of glial scars at sites of CNS injury. To elucidate a genetic predisposition of temporal lobe epilepsy with hippocampal sclerosis (TLE-HS+), we studied polymorphisms in the IL-1beta, IL-1alpha, and IL-1 receptor antagonist (IL-1RA) genes in 50 patients with TLE-HS+ and in 112 controls. Fifty-three patients who had TLE without HS were also examined (TLE-HS-) as disease controls. The distribution of the biallelic polymorphism in the promoter region at position -511 of the IL-1beta gene (IL-1B-511) was significantly different both between TLE-HS+ patients and controls and between TLE-HS+ and TLE-HS- patients. The differences were due to overrepresentation of the homozygotes for IL-1B-511*2, which is suggested to be a high producer of IL-1beta, in TLE-HS+ patients compared with both controls and TLE-HS- patients. In contrast, there was no difference between TLE-HS- patients and controls. Our data suggest that, in the homozygotes for IL-IB-511*2, minor events in development such as febrile convulsions could set up a cascade leading to HS.

  11. Duffy antigen receptor for chemokines (Darc) polymorphism regulates circulating concentrations of monocyte chemoattractant protein-1 and other inflammatory mediators

    PubMed Central

    Schnabel, Renate B.; Baumert, Jens; Barbalic, Maja; Dupuis, Josée; Ellinor, Patrick T.; Durda, Peter; Dehghan, Abbas; Bis, Joshua C.; Illig, Thomas; Morrison, Alanna C.; Jenny, Nancy S.; Keaney, John F.; Gieger, Christian; Tilley, Cathy; Yamamoto, Jennifer F.; Khuseyinova, Natalie; Heiss, Gerardo; Doyle, Margaret; Blankenberg, Stefan; Herder, Christian; Walston, Jeremy D.; Zhu, Yanyan; Vasan, Ramachandran S.; Klopp, Norman; Boerwinkle, Eric; Larson, Martin G.; Psaty, Bruce M.; Peters, Annette; Ballantyne, Christie M.; Witteman, Jacqueline C. M.

    2010-01-01

    To identify the genetic basis of circulating concentrations of monocyte chemoattractant protein-1 (MCP-1), we conducted genome-wide association analyses for MCP-1 in 3 independent cohorts (n = 9598). The strongest association was for serum MCP-1 with a nonsynonymous polymorphism, rs12075 (Asp42Gly) in DARC, the gene for Duffy antigen receptor for chemokines, a known vascular reservoir of proinflammatory cytokines (minor allele frequency, 45.6%; P < 1.0 * 10−323). This association was supported by family-based genetic linkage at a locus encompassing the DARC gene (genome-wide P = 8.0 * 10−13). Asp42Gly accounted for approximately 20% of the variability in serum MCP-1 concentrations and also was associated with serum concentrations of interleukin-8 and RANTES. While exploring a lack of association between this polymorphism and EDTA plasma MCP-1 concentrations (P = .82), we determined that both clotting and exogenous heparan sulfate (unfractionated heparin) released substantial amounts of MCP-1 from Darc. Quantitative immunoflow cytometry failed to identify meaningful Asp42Gly-associated differences in Darc expression, suggesting that a functional change is responsible for the differential cytokine binding. We conclude that Asp42Gly is a major regulator of erythrocyte Darc-mediated cytokine binding and thereby the circulating concentrations of several proinflammatory cytokines. We have also identified for the first time 2 mechanisms for the release of reservoir chemokines with possible clinical implications. PMID:20040767

  12. Polymorphisms of insulin receptor substrate 2 are putative biomarkers for pediatric medulloblastoma: considering the genetic susceptibility and pathological diagnoses

    PubMed Central

    Baocheng, Wang; Zhao, Yang; Meng, Wei; Han, Yipeng; Wang, Jiajia; Liu, Feili; Qin, Shengying; Ma, Jie

    2017-01-01

    ABSTRACT Molecular profiling subgrouped medulloblastoma (MB) into four subtypes featured by distinct footprints. However, germline studies on genetic susceptibility in Chinese population have not been reported. To investigate the correlation of polymorphisms involved in the AKT signaling pathway with clinicopathological parameters in pediatric MB, and their contribution to the clinical outcome, we performed a case-controlled cohort consisting of 48 patients with pediatric MB and 190 healthy controls from Han population. Significant association in rs7987237 of insulin receptor substrate 2 (IRS2) was identified as risk allele/genotype between MB patients and control group (P<0.05). The allele “C” of rs7987237 in IRS2 gene was associated with an increased risk of MB (P=0.025; OR=2.95, 95%CI 1.43–6.11) after Bonferroni correction. Among 48 patients, various genotypes of rs7987237 show significant association with pathological diagnosis and metastases risk (P<0.05). Furthermore, the survival curve of patients with genotype “CC” of rs7987237 was confirmed with better outcome (P<0.001). Combined with previous results, our study suggests that polymorphisms of IRS2 putatively participated in the development of pediatric MB development. Therefore, it may benefit the early diagnosis and indicate the prognosis of patients with MB in Han population. PMID:28303061

  13. Fluoride Exposure, Follicle Stimulating Hormone Receptor Gene Polymorphism and Hypothalamus-pituitary-ovarian Axis Hormones in Chinese Women.

    PubMed

    Zhao, Ming Xu; Zhou, Guo Yu; Zhu, Jing Yuan; Gong, Biao; Hou, Jia Xiang; Zhou, Tong; Duan, Li Ju; Ding, Zhong; Cui, Liu Xin; Ba, Yue

    2015-09-01

    The effects of fluoride exposure on the functions of reproductive and endocrine systems have attracted widespread attention in academic circle nowadays. However, it is unclear whether the gene-environment interaction may modify the secretion and activity of hypothalamus-pituitary- ovarian (HPO) axis hormones. Thus, the aim of this study was to explore the influence of fluoride exposure and follicle stimulating hormone receptor (FSHR) gene polymorphism on reproductive hormones in Chinese women. A cross sectional study was conducted in seven villages of Henan Province, China during 2010-2011. A total of 679 women aged 18-48 years were recruited through cluster sampling and divided into three groups, i.e. endemic fluorosis group (EFG), defluoridation project group (DFPG), and control group (CG) based on the local fluoride concentration in drinking water. The serum levels of gonadotropin releasing hormone (GnRH), follicle stimulating hormone (FSH), luteinizing hormone (LH), and estradiol (E2) were determined respectively and the FSHR polymorphism was detected by real time PCR assay. The results provided the preliminary evidence indicating the gene-environment interaction on HPO axis hormones in women.

  14. Polymorphism and chromosomal location of the MC4R (melanocortin-4 receptor) gene in the dog and red fox.

    PubMed

    Skorczyk, Anna; Stachowiak, Monika; Szczerbal, Izabela; Klukowska-Roetzler, Jolanta; Schelling, Claude; Dolf, Gaudenz; Switonski, Marek

    2007-05-01

    The melanocortin-4 receptor (MC4R) is expressed in the hypothalamus and regulates energy intake and body weight. In silico screening of the canine chromosome 1 sequence and a comparison with the porcine MC4R sequence by BLAST were performed. The nucleotide sequence of the whole coding region and 3'- and 5'-flanking regions of the dog (1214 bp) and red fox (1177 bp) MC4R gene was established and high conservation of the nucleotide sequences was revealed (99%). Five sets of PCR primers were designed and a search for polymorphism was performed by the SSCP technique in a group of 31 dogs representing nineteen breeds and 35 farm red foxes. Sequencing of DNA fragments, representing the identified SSCP patterns, revealed three single nucleotide polymorphisms (including a missense one) in dogs and four silent SNPs in red foxes. An average SNP frequency was approx. 1/400 bp in the dog and 1/300 bp in the red fox. We mapped the MC4R gene by FISH to the canine chromosome 1 (CFA1q1.1) and to the red fox chromosome 5 (VVU5p1.2).

  15. Association of Toll-Like Receptor 4 Gene Polymorphism and Expression with Urinary Tract Infection Types in Adults

    PubMed Central

    Yin, Xiaolin; Hou, Tianwen; Liu, Ying; Chen, Jing; Yao, Zhiyan; Ma, Cuiqing; Yang, Lijuan; Wei, Lin

    2010-01-01

    Background Innate immunity of which Toll-like receptor (TLR) 4 and CXCR1 are key elements plays a central role in the development of urinary tract infection (UTI). Although the relation between the genetics of TLR4 and CXCR1 and UTI is investigated partly, the polymorphisms and expression of TLR4 and CXCR1 in different types of UTI in adults are not extremely clear. Methodology/Principal Findings This study investigates the presence of TLR4 A (896) G and CXCR1 G (2608) C polymorphisms in 129 UTI patients using RFLP-PCR. Gene and allelic prevalence were compared with 248 healthy controls. Flow cytometry was used to detect TLR4 and CXCR1 expression in the monocytes of UTI patients and healthy controls. TLR4 (896) AG genotype and TLR4 (896) G allele had higher prevalence in UTI (especially in acute cystitis and urethritis) patients, whereas CXCR1 (2608) GC genotype and CXCR1 (2608) C allele had lower prevalence in UTI patients than controls. TLR4 expression was significantly lower in chronic UTI patients than in acute pyelonephritis or healthy controls. CXCR1 expression was similar in both controls and patients. TLR4 expression in chronic UTI patients after astragalus treatment was higher than pre-treatment. Conclusions The results indicate the relationship between the carrier status of TLR4 (896) G alleles and the development of UTI, especially acute cystitis and urethritis, in adults. TLR4 expression levels are correlated with chronic UTI. PMID:21151974

  16. Polymorphism of the Fractalkine Receptor CX3CR1 and Systemic Sclerosis-associated Pulmonary Arterial Hypertension

    PubMed Central

    Marasini, Bianca; Cossutta, Roberta; Selmi, Carlo; Pozzi, Maria Rosa; Gardinali, Marco; Massarotti, Marco; Erario, Maddalena; Battaglioli, Lodovica; Biondi, Maria Luisa

    2005-01-01

    Fractalkine (FKN) and its receptor CX3CR1 are critical mediators in the vascular and tissue damage of several chronic diseases, including systemic sclerosis (SSc) and pulmonary arterial hypertension (PAH). Interestingly, the V249I and T280M genetic polymorphisms influence CX3CR1 expression and function. We investigated whether these polymorphisms are associated with PAH secondary to SSc. CX3CR1 genotypes were analyzed by PCR and sequencing in 76 patients with limited SSc and 204 healthy controls. PAH was defined by colorDoppler echocardiography. Homozygosity for 249II as well as the combined presence of 249II and 280MM were significantly more frequent in patients with SSc compared to controls (17 vs 6%, p = 0.0034 and 5 vs 1%, p = 0.0027, respectively). The 249I and 280M alleles were associated with PAH (odd ratio [OR] 2.2, 95% confidence interval [CI] 1.01-4.75, p = 0.028 and OR 7.37, 95%CI: 2.45-24.60, p = 0.0001, respectively). In conclusion, the increased frequencies of 249I and 280M CX3CR1 alleles in a subgroup of patients with SSc-associated PAH suggest a role for the fractalkine system in the pathogenesis of this condition. Further, the 249I allele might be associated with susceptibility to SSc. PMID:16584113

  17. Polymorphism of the fractalkine receptor CX3CR1 and systemic sclerosis-associated pulmonary arterial hypertension.

    PubMed

    Marasini, Bianca; Cossutta, Roberta; Selmi, Carlo; Pozzi, Maria Rosa; Gardinali, Marco; Massarotti, Marco; Erario, Maddalena; Battaglioli, Lodovica; Biondi, Maria Luisa

    2005-12-01

    Fractalkine (FKN) and its receptor CX3CR1 are critical mediators in the vascular and tissue damage of several chronic diseases, including systemic sclerosis (SSc) and pulmonary arterial hypertension (PAH). Interestingly, the V249I and T280M genetic polymorphisms influence CX3CR1 expression and function. We investigated whether these polymorphisms are associated with PAH secondary to SSc. CX3CR1 genotypes were analyzed by PCR and sequencing in 76 patients with limited SSc and 204 healthy controls. PAH was defined by colorDoppler echocardiography. Homozygosity for 249II as well as the combined presence of 249II and 280MM were significantly more frequent in patients with SSc compared to controls (17 vs 6%, p = 0.0034 and 5 vs 1%, p = 0.0027, respectively). The 249I and 280M alleles were associated with PAH (odd ratio [OR] 2.2, 95% confidence interval [CI] 1.01-4.75, p = 0.028 and OR 7.37, 95%CI: 2.45-24.60, p = 0.0001, respectively). In conclusion, the increased frequencies of 249I and 280M CX3CR1 alleles in a subgroup of patients with SSc-associated PAH suggest a role for the fractalkine system in the pathogenesis of this condition. Further, the 249I allele might be associated with susceptibility to SSc.

  18. Haplotyping the human T-cell receptor. beta. -chain gene complex by use of restriction fragment length polymorphisms

    SciTech Connect

    Charmley, P.; Chao, A.; Gatti, R.A. ); Concannon, P. ); Hood, L. )

    1990-06-01

    The authors have studied the genetic segregation of human T-cell receptor {beta}-chain (TCR{beta}) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCR{beta} gene complex. Analysis of allele distributions between TCR{beta} genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCR{beta} gene complex. The results should provide new insight into recent reports of disease associations with the TCR{beta} gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome.

  19. Association between corticotropin-releasing hormone receptor 1 and 2 (CRHR1 and CRHR2) gene polymorphisms and personality traits.

    PubMed

    Ishitobi, Yoshinobu; Nakayama, Shinya; Kanehisa, Masayuki; Higuma, Haruka; Maruyama, Yoshihiro; Okamoto, Shizuko; Inoue, Ayako; Imanaga, Junko; Tanaka, Yoshihiro; Tsuru, Jusen; Hanada, Hiroaki; Akiyoshi, Jotaro

    2013-12-01

    Previous studies have reported that the hypothalamic-pituitary-adrenal axis is involved with personality traits. We examined the association between corticotropin-releasing hormone receptor (CRHR) genes and personality traits. We investigated the 12 single-nucleotide polymorphisms of intron CRHR (six in CRHR1 and six in CRHR2, respectively) in 218 healthy volunteers using TaqMan PCR assays. Personality traits were assessed using the Revised NEO-Personality Inventory, the Temperament and Character Inventory, and the State-Trait Anxiety Inventory. No significant associations were observed between CRHR1 and CRHR2 expression and personality traits. These results fail to provide support for an association of CRHR1 and CRHR2 with personality traits in a Japanese adult population.

  20. Cannabinoid Receptor 1 Gene Polymorphisms and Marijuana Misuse Interactions On White Matter and Cognitive Deficits in Schizophrenia

    PubMed Central

    Ho, Beng-Choon; Wassink, Thomas H.; Ziebell, Steven; Andreasen, Nancy C.

    2011-01-01

    Marijuana exposure during the critical period of adolescent brain maturation may disrupt neuro-modulatory influences of endocannabinoids and increase schizophrenia susceptibility. Cannabinoid receptor 1 (CB1/CNR1) is the principal brain receptor mediating marijuana effects. No study to-date has systematically investigated the impact of CNR1 on quantitative phenotypic features in schizophrenia and inter-relationships with marijuana misuse. We genotyped 235 schizophrenia patients using 12 tag single nucleotide polymorphisms (tSNPs) that account for most of CB1 coding region genetic variability. Patients underwent a high-resolution anatomic brain magnetic resonance scan and cognitive assessment. Almost a quarter of the sample met DSM marijuana abuse (14%) or dependence (8%) criteria. Effects of CNR1 tSNPs and marijuana abuse/dependence on brain volumes and neurocognition were assessed using ANCOVA, including co-morbid alcohol/non-marijuana illicit drug misuse as covariates. Significant main effects of CNR1 tSNPs (rs7766029, rs12720071, and rs9450898) were found in white matter (WM) volumes. Patients with marijuana abuse/dependence had smaller fronto-temporal WM volumes than patients without heavy marijuana use. More interestingly, there were significant rs12720071 genotype-by-marijuana use interaction effects on WM volumes and neurocognitive impairment; suggestive of gene-environment interactions for conferring phenotypic abnormalities in schizophrenia. In this comprehensive evaluation of genetic variants distributed across the CB1 locus, CNR1 genetic polymorphisms were associated with WM brain volume variation among schizophrenia patients. Our findings suggest that heavy cannabis use in the context of specific CNR1 genotypes may contribute to greater WM volume deficits and cognitive impairment, which could in turn increase schizophrenia risk. PMID:21420833

  1. Gene Amplification and Functional Diversification of Melanocortin 4 Receptor at an Extremely Polymorphic Locus Controlling Sexual Maturation in the Platyfish

    PubMed Central

    Volff, Jean-Nicolas; Selz, Yvonne; Hoffmann, Carsten; Froschauer, Alexander; Schultheis, Christina; Schmidt, Cornelia; Zhou, Qingchun; Bernhardt, Wolfgang; Hanel, Reinhold; Böhne, Astrid; Brunet, Frédéric; Ségurens, Béatrice; Couloux, Arnaud; Bernard-Samain, Sylvie; Barbe, Valérie; Ozouf-Costaz, Catherine; Galiana, Delphine; Lohse, Martin J.; Schartl, Manfred

    2013-01-01

    In two swordtail species of the genus Xiphophorus, the onset of puberty has been shown to be modulated at the P locus by sequence polymorphism and gene copy-number variation affecting the type 4 melanocortin hormone receptor Mc4r. The system works through the interaction of two allelic types, one encoding wild type and the other dominant-negative receptors. We have analyzed the structure and evolution of the P locus in the platyfish Xiphophorus maculatus, where as many as nine alleles of P determining the onset of sexual maturity in males and females, fecundity in females, and adult size in males are located on both the X and Y chromosomes in a region linked to the master sex-determining locus. In this species, mc4r has been amplified to up to 10 copies on both the X and Y chromosomes through recent large serial duplications. Subsequently, mc4r paralogues have diverged considerably into many different subtypes. Certain copies have acquired new untranslated regions through genomic rearrangements, and transposable element insertions and other mutations have accumulated in promoter regions, possibly explaining observed deviations from the classical mc4r transcriptional pattern. In the mc4r-coding sequence, in-frame insertions and deletions as well as nonsense and missense mutations have generated a high diversity of Mc4r-predicted proteins. Most of these variants are expressed in embryos, adults, and/or tumors. Functional receptor characterization demonstrated major divergence in pharmacological behavior for Mc4r receptors encoded by different copies of platyfish mc4r, with differences in constitutive activity as well as binding and stimulation by hormones. The high degree of allelic and copy-number variation observed between individuals can explain the high level of polymorphism for sexual maturation, fecundity, and body size in the platyfish: multiple combinations of Mc4r variants with different biochemical properties might interact to modulate the melanocortin

  2. Polymorphisms in Chemokine Receptor 5 and Toll-Like Receptor 3 Genes Are Risk Factors for Clinical Tick-Borne Encephalitis in the Lithuanian Population

    PubMed Central

    Nordgren, Johan; Carlsson, Beatrice; Hagbom, Marie; Svensson, Lennart; Lindquist, Lars

    2014-01-01

    Background Tick-borne encephalitis virus (TBEV) infections can be asymptomatic or cause moderate to severe injuries of the nervous system. We previously reported that a nonfunctional chemokine receptor 5 (CCR5) and a functional Toll-like receptor 3 (TLR3) predispose adults to clinical tick-borne encephalitis (TBE). This study expands our previous findings and further examines polymorphisms in CCR5 and TLR3 genes in different age and disease severity groups. Methods 117 children and 129 adults, stratified into mild, moderate and severe forms of TBE, and 103 adults with severe TBE were analyzed. 135 healthy individuals and 79 patients with aseptic meningoencephalitis served as controls. CCR5 delta 32 and rs3775291 TLR3 genotypes were established by pyrosequencing, and their frequencies were analyzed using recessive genetic, genotype and allelic models. Findings The prevalence of CCR5Δ32 homozygotes was higher in children (2.5%), in adults with severe TBE (1.9%), and in the combined cohort of TBE patients (2.3%) than in controls (0%) (p<0.05). The nonfunctional homozygous TLR3 genotype was less prevalent among the combined TBE cohort (11.5%) than among controls (19.9%) (p = 0.025), but did not differ between children TBE and controls. The genotype and allele prevalence of CCR5 and TLR3 did not differ in children nor adult TBE cohorts stratified by disease severity. However, in the severe adult TBE cohort, homozygous functional TLR3 genotype and wt allele were less prevalent compared to the adult cohort with the whole disease severity spectrum (44.4% vs 59.8% p = 0.022 and 65.2% vs 76.4% p = 0.009; respectively). Conclusions Independently of age, nonfunctional CCR5Δ32 mutation is a significant risk factor for development of clinical TBE, but not for disease severity. The polymorphism of TLR3 gene predisposes to clinical TBE in adults only and may be associated with disease severity. Further studies are needed to clarify the role of these polymorphisms in

  3. [Relationship between genetic polymorphism of dopamine receptor and schizophrenia and its forensic significance].

    PubMed

    Yao, Jun; Wang, Bao-Jie

    2014-06-01

    Schizophrenia is a common but complex mental disorder affected by multiple factors. Forensic psychiatric assessment of schizophrenia involves evaluations on many aspects, but there is no effective biological identification index for schizophrenia. Researches indicate that dysfunction of dopaminergic neurotransmission plays an important role in the pathogenesis of schizophrenia. Our study reviews the classification, genetic structure of dopamine receptors and the recent pertinent studies between the dopamine receptors and schizophrenia and its forensic significance.

  4. Associations between dopamine D2 receptor gene polymorphisms and schizophrenia risk: a PRISMA compliant meta-analysis

    PubMed Central

    He, Hairong; Wu, Huanhuan; Yang, Lihong; Gao, Fan; Fan, Yajuan; Feng, Junqin; Ma, Xiancang

    2016-01-01

    Objective To determine the relationships between dopamine D2 receptor gene polymorphisms and the risk of schizophrenia using meta-analysis. Method The PubMed, Embase, and China National Knowledge Infrastructure databases were searched to identify relevant literature published up to February 2016. The allele contrast model was used. Stata software was used for statistical analysis, with odds ratios (ORs) and 95% confidence intervals (CIs) calculated to evaluate the associations between dopamine D2 receptor gene polymorphisms and the risk of schizophrenia. Meta-regression and publication bias, trim-and-fill, subgroup, sensitivity, cumulative, and fail-safe number analyses were also performed. Results This meta-analysis included 81 studies. The rs1801028 and rs1799732 were associated with schizophrenia risk among Asians (P=0.04, OR =1.25, 95% CI =1.01–1.55; P<0.01, OR =0.76, 95% CI =0.63–0.92, respectively), while the rs6277 was associated with schizophrenia risk in Caucasians (P<0.01, OR=0.72, 95% CI =0.66–0.79). The rs1800497 was also associated with schizophrenia risk in population-based controls (P<0.01, OR =0.84, 95% CI =0.72–0.97). The rs6275, rs1079597, and rs1800498 were not associated with schizophrenia risk. In addition, meta-regression indicated that the controls may be sources of heterogeneity for the rs1801028 single-nucleotide polymorphism (SNP), while ethnicity may be sources of heterogeneity for the rs6277 SNP. Publication bias was significant for the rs1801028 SNP, and this result changed after the publication bias was adjusted using the trim-and-fill method. Conclusion This meta-analysis demonstrated that the rs1801028 may be a risk factor for susceptibility to schizophrenia among Asians, while the rs1799732 may be a protective factor for that population. Large-sample studies are necessary to verify the results of this meta-analysis. PMID:28003749

  5. Relationship of oestrogen receptor alpha gene polymorphisms with risk for benign prostatic hyperplasia and prostate cancer in Chinese men

    PubMed Central

    Han, Zihua; Zhang, Lingzhi; Zhu, Rujian; Luo, Lifei; Zhu, Min; Fan, Lilong; Wang, Guanfu

    2017-01-01

    Abstract The relationship of oestrogen receptor with benign prostatic hyperplasia (BPH) and prostate cancer (PC) is not clear at present. This study aimed to investigate the molecular mechanism underlying the occurrence and development of BPH and prostate. Two hundred forty-four PC cases, 260 BPH patients, and 222 healthy men were recruited from Han people in China, and the oestrogen receptor alpha (ESRα) gene polymorphism (rs2234693 [PvuII] and rs9340799 [XbaI]) on intron 1 was determined. The relationship of gene polymorphism with PC and BPH was evaluated with Logistic regression, and the linkage disequilibrium and haplotyping were assessed with SHEsis software. The risk for PC in BPH patients with PvuII C allele was higher (OR = 1.437, 95% CI: 1.110–1.859), but the differentiation degree of cancer cells was relatively better in PC patients with PvuII C allele (OR = 0.419, 95% CI: 0.285–0.616), and most of them are circumscribed (OR = 0.706, 95% CI: 0.485–1.02). There was significant linkage disequilibrium between PvuII and XbaI. The genotype TTAG not only induced BPH (OR = 6.260, 95% CI: 1.407–27.852), but increased the risk for PC (OR = 6.696, 95% CI: 1.504–29.801). However, the genotype TTAG in BPH patients had no relationship with the risk for PC (P > 0.05). Furthermore, men with haplotype TG were more likely to suffer PC (OR = 9.168, 95% CI: 2.393–35.119), but men with haplotype TA and enlarged prostate had a low risk for PC (OR = 0.708, 95% CI: 0.551–0.912). These results show the relationship between ESRα gene polymorphism and susceptibility to PC and BPH in Chinese men, and the ethnic and regional difference as well. PMID:28353585

  6. Vitamin D receptor gene polymorphisms and haplotypes (Apa I, Bsm I, Fok I, Taq I) in Turkish psoriasis patients

    PubMed Central

    Acikbas, Ibrahim; Sanlı, Berna; Tepeli, Emre; Ergin, Seniz; Aktan, Sebnem; Bagci, Huseyin

    2012-01-01

    Summary Background Psoriasis is an inflammatory disease characterized by increased squamous cell proliferation and impaired differentiation. Vitamin D, Calcitriol, and its analogues are successfully used for psoriasis therapy. However, it is unknown why some psoriasis patients are resistant to Vitamin D therapy. Vitamin D mediates its activity by a nuclear receptor. It is suggested that polymorphisms and haplotypes in the VDR gene may explain the differences in response to vitamin D therapy. Material/Methods In this study, 102 psoriasis patients and 102 healthy controls were studied for VDR gene polymorphisms. The Fok I, Bsm I, Apa I and Taq I polymorphisms were examined by PCR-RFLP, and 50 subjects received vitamin D therapy to evaluate the association between VDR gene polymorphisms and response to vitamin D therapy. Existence of cutting site is shown by capital letters, and lack was shown by lower case. The haplotypes were analysed by CHAPLIN. Results There was significant difference in allele frequency of T and genotype frequency of Tt between cases and controls (p values 0.038 and 0.04, respectively). The Aa and bb genotypes were significantly higher in early onset than late onset psoriasis (p values 0.008 and 0.04, respectively). The genotypes Ff, ff and TT are significantly different between vitamin D3 therapy responders and non-responders (p values 0.04, 0.0001, 0.009, respectively). To the best of our knowledge, this is the first report showing importance of VDR gene haplotypes in psoriasis, the significance of the Wald and LR (Likelihood Ratio) statistics (p=0,0042) suggest that FfBbAatt is a disease-susceptibility haplotype. Conclusions Haplotype analysis is a recent and commonly used method in genetic association studies. Our results reveal a previously unidentified susceptibility haplotype and indicate that certain haplotypes are important in the resistance to vitamin D3 therapy and the onset of psoriasis. The haplotypes can give valuable data where

  7. Neurovascular control during exercise in acute coronary syndrome patients with Gln27Glu polymorphism of β2-adrenergic receptor

    PubMed Central

    Ferreira-Santos, Larissa; Martinez, Daniel G.; Nicolau, José Carlos; Moreira, Humberto G.; Alves, Maria Janieire; Pereira, Alexandre C.; Trombetta, Ivani C.; Negrão, Carlos Eduardo

    2017-01-01

    Background Gln27Glu (rs1042714) polymorphism of the β2-adrenergic receptor (ADRB2) has been association with cardiovascular functionality in healthy subjects. However, it is unknown whether the presence of the ADRB2 Gln27Glu polymorphism influences neurovascular responses during exercise in patients with acute coronary syndromes (ACS). We tested the hypothesis that patients with ACS homozygous for the Gln allele would have increased muscle sympathetic nerve activity (MSNA) responses and decreased forearm vascular conductance (FVC) responses during exercise compared with patients carrying the Glu allele (Gln27Glu and Glu27Glu). In addition, exercise training would restore these responses in Gln27Gln patients. Methods and results Thirty-days after an ischemic event, 61 patients with ACS without ventricular dysfunction were divided into 2 groups: (1) Gln27Gln (n = 35, 53±1years) and (2) Gln27Glu+Glu27Glu (n = 26, 52±2years). MSNA was directly measured using the microneurography technique, blood pressure (BP) was measured with an automatic oscillometric device, and blood flow was measured using venous occlusion plethysmography. MSNA, mean BP, and FVC were evaluated at rest and during a 3-min handgrip exercise. The MSNA (P = 0.02) and mean BP (P = 0.04) responses during exercise were higher in the Gln27Gln patients compared with that in the Gln27Glu+Glu27Glu patients. No differences were found in FVC. Two months of exercise training significantly decreased the MSNA levels at baseline (P = 0.001) and in their response during exercise (P = 0.02) in Gln27Gln patients, but caused no changes in Gln27Glu+Glu27Glu patients. Exercise training increased FVC responses in Gln27Glu+Glu27Glu patients (P = 0.03), but not in Gln27Gln patients. Conclusion The exaggerated MSNA and mean BP responses during exercise suggest an increased cardiovascular risk in patients with ACS and Gln27Gln polymorphism. Exercise training emerges as an important strategy for restoring this reflex

  8. TREATMENT WITH HORMONE THERAPY AND CALCITRIOL DID NOT AFFECT DEPRESSION IN ELDERLY POSTMENOPAUSAL WOMEN: NO INTERACTION WITH ESTROGEN AND VITAMIN D RECEPTOR GENOTYPE POLYMORPHISMS

    PubMed Central

    YALAMANCHILI, VINOD; GALLAGHER, J. CHRISTOPHER

    2011-01-01

    Objective To examine the effect of hormone therapy and calcitriol on depression in elderly postmenopausal women and also to determine whether the response was associated with polymorphisms of estrogen receptor-alpha and vitamin D receptor. Methods In a double-blinded placebo controlled prospective trial involving 489 postmenopausal elderly women, a secondary analysis of depression was done. Geriatric Depression Scale was used to screen for depression. We used binary logistic regression to examine the effect of treatment on depression and one-way ANOVA to find relationship between gene polymorphisms and depression. Results There was no effect of hormone therapy (OR 1.65; 95% CI 0.66–4.12; p = 0.277), calcitriol (OR 1.15; 95% CI 0.43–3.11; p = 0.772) or hormone therapy with calcitriol (OR 1.01; 95% CI 0.36–2.80; p = 0.979) on depression. Neither polymorphisms of estrogen receptor-alpha (XbaI-beta=0.093, CI −0.337–1.350, p = 0.239 and PvuII-beta=−0.064, CI −1.171-0.491, p = 0.421) nor vitamin D receptor (BsmI-beta=0.044, CI −2.546–3.030, p = 0.865 and TaqI-beta=−0.015, CI −2.900-2.738, p = 0.955) were associated with depression. Conclusion In elderly post-menopausal women there was no effect of hormone therapy and calcitriol either individually or in combination with depression. Estrogen receptor-alpha and vitamin D receptor polymorphisms are not associated with depression or the response to intervention in elderly postmenopausal women. Additional trials are required to confirm these findings. PMID:22205149

  9. Overlap of dopaminergic, adrenergic, and serotoninergic receptors and complementarity of their subtypes in primate prefrontal cortex

    SciTech Connect

    Goldman-Rakic, P.S.; Lidow, M.S.; Gallager, D.W. )

    1990-07-01

    Quantitative in vitro autoradiography was used to determine and compare the areal and laminar distribution of the major dopaminergic, adrenergic, and serotonergic neurotransmitter receptors in 4 cytoarchitectonic regions of the prefrontal cortex in adult rhesus monkeys. The selective ligands, 3H-SCH-23390, 3H-raclopride, 3H-prazosin, and 3H-clonidine were used to label the D1 and D2 dopamine receptor subtypes and the alpha 1- and alpha 2-adrenergic receptors, respectively, while 125I-iodopindolol was used to detect beta-adrenergic receptors. The radioligands, 3H-5-hydroxytryptamine and 3H-ketanserin labeled, respectively, the 5-HT1 and 5-HT2 receptors. Densitometry was performed on all cortical layers and sublayers for each of the 7 ligands to allow quantitative as well as qualitative comparison among them in each cytoarchitectonic area. Although each monoamine receptor was distributed in a distinctive laminar-specific pattern that was remarkably similar from area to area, there was considerable overlap among the dopaminergic, adrenergic, and serotoninergic receptors, while subtypes of the same receptor class tended to have complementary laminar profiles and different concentrations. Thus, the D1 dopamine, the alpha 1- and alpha 2-adrenergic, and the 5-HT1 receptors were present in highest relative concentration in superficial layers I, II, and IIIa (the S group). In contrast, the beta 1- and beta 2-adrenergic subtypes and the 5-HT2 receptor had their highest concentrations in the intermediate layers, IIIb and IV (the I group), while the D2 receptor was distinguished by relatively high concentrations in the deep layer V compared to all other layers (the D class). Thus, clear laminar differences were observed in the D1 vs D2 dopaminergic, the alpha- vs beta-adrenergic, and the 5-HT1 vs 5-HT2 serotoninergic receptor subtypes in all 4 areas examined.

  10. Significant Association Between Fc Receptor-Like 3 Polymorphisms (-1901A>G and -658C>T) and Neuromyelitis Optica (NMO) Susceptibility in the Chinese Population.

    PubMed

    Wang, Xinling; Yu, Tao; Yan, Qichang; Wang, Wei; Meng, Nan; Li, Xuejiao; Luo, Yahong

    2016-01-01

    Neuromyelitis optica (NMO) is an autoimmune disorder. In pathogenesis, NMO-immunoglobulin G (NMO-IgG) selectively binds to aquaporin-4 (AQP4) and resulted in neuritis, myelitis, and brain lesion. Fc receptor-like 3 (FCRL3) gene encodes a member of the immunoglobulin receptor superfamily, which plays an important part in regulating immune activities. This study aimed at investigating the association between FCRL3 polymorphisms and NMO susceptibility and, hopefully, to contribute to the development of novel methods for diagnosis and treatment of NMO. We selected 150 NMO patients and 300 healthy controls from the Chinese population. Tag single nucleotide polymorphisms (SNPs) were identified with reference to CBI-dbSNP and HapMap databases. DNA were extracted and amplified. Matrix-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI-TOF-MS) was applied to determine the polymorphisms. χ (2), odds ratio (OR), and 95 % confidence interval (95 % CI) were presented to evaluate genotype distribution and association between SNPs and NMO susceptibility. Six out of 15 SNPs were selected according to the filter. No significant altered genotype distribution was observed concerning -11G>C, -166C>T, -219G>C, and -1629C>G polymorphisms. The G allele of -1901A>G variation was demonstrated to be more frequent in patients compared with controls (P < 0.001). The T allele of -658C>T polymorphism was significantly more prevalent in NMO patients than controls (P = 0.009). In summary, the study revealed that the G allele in -1901A>G polymorphism and T allele in -658C>T polymorphism are genetic risk factors for NMO in the Chinese population. Further research is needed to account for different ethnicities and clarify the mechanisms behind, which might contribute to the elucidation of novel diagnosis methods.

  11. Lack of association between FokI polymorphism in vitamin D receptor gene (VDR) & type 2 diabetes mellitus in the Tunisian population

    PubMed Central

    Mahjoubi, Imen; Kallel, Amani; Sbaï, Mohamed Hédi; Ftouhi, Bochra; ben Halima, Meriam; Jemaa, Zeineb; Feki, Moncef; Slimane, Hedia; Jemaa, Riadh; Kaabachi, Naziha

    2016-01-01

    Background & objectives: The impact of several environmental and genetic factors on diabetes is well documented. Though the association between the vitamin D receptor (VDR) gene polymorphisms and type 2 diabetes mellitus (T2DM) has been analyzed in different ethnic groups, the results have been inconsistent. The aim of this study was to evaluate the possible association between VDR FokI polymorphism and genetic susceptibility to T2DM in Tunisian population. Methods: A total of 439 unrelated patients with T2DM and 302 healthy controls were included in the study. Genomic DNA was extracted from blood and genotyped for the single nucleotide polymorphism (SNP) of FokI (T/C: (rs2228570) by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) analysis. Results: The genotype distribution and the relative allelic frequencies for the FokI polymorphism were not significantly different between T2DM and controls: in T2DM patients the frequencies of the CC, CT, and TT genotypes were 52.6, 41.0, and 6.1 per cent, respectively, and in controls the genotype frequencies were 55.6, 38.7, and 5.6 per cent, respectively. In our study, the TT genotype of the FokI polymorphism was not associated with T2DM (OR =1.19, 95% CI 0.63 - 2.25, P=0.577). Interpretation & conclusions: Our study showed no significant association of the FokI polymorphism in the vitamin D receptor gene with type 2 diabetes mellitus in Tunisian population. PMID:27834325

  12. Dopamine D4 Receptor Gene Polymorphism in a Sample of Egyptian Children With Attention-Deficit Hyperactivity Disorder (ADHD).

    PubMed

    ElBaz Mohamed, Farida; Kamal, Tarek Mostafa; Zahra, Sally Soliman; Khfagy, Mona Abdel Hakiem; Youssef, Azza Mohamed

    2017-02-01

    This study aimed to detect DRD4 receptor gene polymorphisms in attention-deficit hyperactivity disorder (ADHD) children and to correlate their phenotype-genotype. Fifty children with ADHD were diagnosed by Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition, criteria and were subjected to Conners Parent Rating Scale. All cases and controls were subjected to history taking, physical examination, IQ assessment, and dopamine receptor D4 (DRD4) exon 3 genotyping. The 7-repeat allele was present only in controls, whereas 2-repeat allele was present in the ADHD children (heterozygous 2-repeat allele in 16% and homozygous in 26% of cases). Eight percent of cases had homozygous 4-repeat allele vs 28% of controls, whereas 10% of cases had heterozygous 4-repeat allele vs 6% of controls, with its predominance in controls. The 2-repeat and 4-repeat alleles have been associated with more inattention, hyperactivity, and impulsivity phenotypes. In conclusion, children with ADHD had a significant presence of the 2-repeat allele and absence of the 7-repeat allele.

  13. Prognostic significance of interleukin-6 single nucleotide polymorphism genotypes in neuroblastoma: rs1800795 (promoter) and rs8192284 (receptor)

    PubMed Central

    Lagmay, Joanne P.; London, Wendy B.; Gross, Thomas G.; Termuhlen, Amanda; Sullivan, Nicholas; Axel, Amy; Mundy, Bethany; Ranalli, Mark; Canner, Jason; McGrady, Patrick; Hall, Brett

    2009-01-01

    Purpose Neuroblastoma is a childhood cancer of the sympathetic nervous system and many patients present with high risk disease. Risk stratification, based on pathology and tumor-derived biomarkers, has improved prediction of clinical outcomes, but overall survival rates remain unfavorable and new therapeutic targets are needed. Some studies suggest a link between interleukin-6 and more aggressive behavior in neuroblastoma tumor cells. Therefore, we examined the impact of two IL-6 single nucleotide polymorphisms (SNP) on neuroblastoma disease progression. Experimental design DNA samples from 96 high risk neuroblastoma patients were screened for two SNP that are known to regulate the serum levels of IL-6 and the soluble IL-6 receptor (IL-6R), rs1800795 and rs8192284 respectively. The genotype for each SNP was determined in a blinded fashion and independent statistical analysis was performed to determine SNP-related event free survival (EFS) and overall survival (OS) rates. Results The rs1800795 IL-6 promoter SNP is an independent prognostic factor for EFS and OS in -high risk neuroblastoma patients. In contrast, the rs8192284 IL-6 receptor SNP revealed no prognostic value. Conclusions The rs1800795 SNP (-174 IL-6 (G>C) represents a novel and independent prognostic marker for both EFS and OS in high risk neuroblastoma. Since the rs1800795 SNP (-174 IL-6 (G>C) has been shown to correlate with production of IL-6, this cytokine may represent a target for development of new therapies in neuroblastoma. PMID:19671870

  14. Vitamin D and Calcium-Sensing Receptor polymorphisms differentially associate with resting energy expenditure in peri-pubertal children

    PubMed Central

    Hanks, Lynae J.; Casazza, Krista; Ashraf, Ambika P.; Ramanadham, Sasanka; Ard, Jamy; Bray, Molly S.; Beasley, T. Mark; Fernandez, Jose R.

    2014-01-01

    Given that calcium metabolism is influenced by genes and is tightly linked to energy-utilizing pathways, this study evaluated the association of single nucleotide polymorphisms (SNPs) in the vitamin D receptor (VDR) and calcium-sensing receptor (CASR) with resting energy expenditure (REE). In 273 boys and girls, 7-12y, cross-sectional REE was measured via indirect calorimetry, body composition by DXA, and dietary measures by 24-hour recall. SNPs for VDR Cdx-2 (rs11568820) and CASR A986S (rs1801725) were genotyped using the Illumina Golden Gate assay. Multiple linear regression models were used to determine the association between SNPs and REE. African American carriers of the ‘A’ VDR Cdx2 allele had increased levels of REE in the overall sample and this association was apparent among participants with an adiposity level of <25% and 30% body fat in males and females, respectively. For CASR, an association between carriers of the ‘A’ allele and REE was observed only in those in the upper median of calcium intake. VDR and CASR variants are associated with REE in children, and are influenced by levels of calcium intake and adiposity. Our results bring awareness to mechanisms underlying the regulation of REE and biological and dietary influential factors. PMID:23546818

  15. Protective effect of a GRK5 polymorphism on heart failure and its interaction with beta-adrenergic receptor antagonists.

    PubMed

    Eijgelsheim, Mark; Visser, Loes E; Uitterlinden, André G; Stricker, Bruno H Ch

    2008-10-01

    EVALUATION OF: Liggett SB, Cresci S, Kelly RJ et al.: A GRK5 polymorphism that inhibits beta-adrenergic receptor signaling is protective in heart failure. Nat. Med. 14, 510-517 (2008). beta-Adrenoceptor blockade therapy was developed for the treatment of hypertension but is now also a cornerstone in the treatment of heart failure. Based on the mechanisms of action and current knowledge of pathway signaling, Ligget et al. hypothesized that genetic variants within G-protein coupled receptor kinases might alter disease course and response to beta-adrenoceptor blockade therapy. Following a multistep approach, a common variant in GRK5 was identified as being important in vitro and in vivo (mouse model) in beta-adrenergic desensitization, and was epidemiologically related to survival and therapy response in African-Americans. Although such a variety of research approaches is appealing, owing to the large number of used methods readers remain puzzled on some issues because it is not possible to give all details of each individual study. Therefore, interpretation of the overwhelming amount of results is difficult. In an era of shifting emphasis from classic hypothesis driven pharmacogenetics to genome-wide association studies, this study shows that hypothesis driven translational research is still of high value, especially in phenotypes as investigated here.

  16. Analysis of clozapine response and polymorphisms of the dopamine D4 receptor gene (DRD4) in schizophrenic patients

    SciTech Connect

    Shaikh, S.; Collier, D.A.; Sham, P.

    1995-12-18

    We have examined the hypothesis that a variable number of tandem repeats in the third cytoplasmic loop of the dopamine D4 receptor influences clinical response to clozapine using a sample of 189 schizophrenic patients. Alleles of the 48-bp repeat, which range from two to ten copies in the normal human population, were analysed by the polymerase chain reaction using genomic DNA as template. Association between these alleles and response to clozapine was tested using the difference in pre- and post-treatment GAS scores as a measure of response. We found no statistically significant variation between genotypic groups and response by analysis of variance. We conclude that the variation of the number of 48-bp repeats alone does not determine response to clozapine. Larger studies are underway to determine if there is a more subtle relationship with sequence variation within the repeats or at other polymorphic sites within the gene that may provide evidence for a component of clozapine`s action being at D4 receptors. 28 refs., 1 fig., 3 tabs.

  17. Polymorphisms of the serotonin transporter and receptor genes: susceptibility to substance abuse.

    PubMed

    Herman, Aryeh I; Balogh, Kornelia N

    2012-06-01

    Serotonin (5-hydroxytryptamine [5-HT]) is an important neurotransmitter implicated in regulating substance-use disorder (SUD) acquisition, maintenance, and recovery. During the past several years, an abundance of research has begun discovering and describing specific 5-HT genetic polymorphisms associated with SUDs. Genetic variations in the 5-HT system, such as SLC6A4, HTR1B, HTR2A, HTR2C, HTR3 (HTR3A, HTR3B, HTR3C, HTR3D, and HTR3E), likely play a role contributing to SUD patient heterogeneity. The 5-HT transporter-linked polymorphic region S allele, located in SLC6A4, has now been modestly associated with alcohol dependence in two large meta-analyses. Additional 5-HT genes may also play a role but have not been extensively investigated. A limited number of SUD treatment studies have included 5-HT gene variation as moderating treatment outcomes, but the results have been equivocal. Future research on 5-HT addiction genetics should adopt whole-genome sequencing technology, utilize large study samples, and collect data from multiple ethnic groups. Together, these methods will build on the work already conducted with the aim of utilizing 5-HT genetics in SUD treatment settings.

  18. Association of Interleukin-1 Gene Cluster and Interleukin-1 Receptor Polymorphisms With Febrile Seizures.

    PubMed

    Soltani, Samaneh; Zare-Shahabadi, Ameneh; Shahrokhi, Amin; Rezaei, Arezou; Zoghi, Samaneh; Zamani, Gholam Reza; Mohammadi, Mahmoud; Ashrafi, Mahmoud Reza; Rezaei, Nima

    2016-05-01

    Interleukin-1 (IL-1) plays a key role in inflammation, has an effect on a wide variety of cells, and often leads to tissue destruction. While the ratio between IL-1 and IL-1Ra could influence the development of different diseases of the central nervous system, its gene polymorphisms were investigated in a group of patients with febrile seizures. Ninety patients with febrile seizures were enrolled and compared with 140 controls. The allele and genotype frequency of single nucleotide polymorphisms within the IL-1α, β, IL-1 R and IL-1Ra gene were determined. The frequency of the IL-1Ra/C allele at position Mspa-I 11100 was decreased significantly (P= .002) and the IL-1Ra/T frequency was significantly increased in patients (P= .002). In addition, the CT genotype frequency at the same position was significantly overrepresented in controls compared to patients (P= .001). Certain alleles and genotypes in the IL-1 gene were overrepresented in patients with febrile seizures, which possibly could predispose individuals to this disease.

  19. Evidence for association between polymorphisms in the Cannabinoid Receptor 1 (CNR1) gene and cannabis dependence

    PubMed Central

    Agrawal, Arpana; Wetherill, Leah; Dick, Danielle M.; Xuei, Xiaoling; Hinrichs, Anthony; Hesselbrock, Victor; Kramer, John; Nurnberger, John I.; Schuckit, Marc; Bierut, Laura J.; Edenberg, Howard J.; Foroud, Tatiana

    2009-01-01

    Genomic studies of cannabis use disorders have been limited. The cannabinoid receptor 1 gene (CNR1) on chromosome 6q14–15 is an excellent candidate gene for cannabis dependence due to the important role of the G-protein coupled receptor encoded by this gene in the rewarding effects of Δ9-tetrahydrocannabinol. Previous studies have found equivocal evidence for an association between SNPs in CNR1 and a general vulnerability to substance use disorders. We investigate the association between 9 SNPs spanning CNR1 and cannabis dependence in 1,923 individuals. Two SNPs that were previously associated with cannabis dependence in other studies were also significant with this phenotype in our analyses [rs806368 (p = 0.05) and rs806380 (p = 0.009)]. Haplotype analyses revealed the association to be largely driven by the SNP rs806380. These results suggest a role for the cannabinoid receptor 1 gene in cannabis dependence. PMID:19016476

  20. Vitamin D receptor gene (VDR) polymorphisms and the urolithiasis risk: an updated meta-analysis based on 20 case-control studies.

    PubMed

    Liu, Wentao; Chen, Minfeng; Li, Mengjun; Ma, Hong; Tong, Shiyu; Lei, Ye; Qi, Lin

    2014-02-01

    Vitamin D receptor (VDR) plays a key role in calcium metabolism, and is closely related to urinary stone formation (urolithiasis). Previous studies have investigated the associations between VDR single nucleotide polymorphisms (SNPs) (polymorphisms at BsmI, ApaI, FokI, or TaqI cutting sites) and urolithiasis in different populations. However, the results remain inconsistent and controversial. Therefore, meta-analysis was performed to evaluate these associations. Twenty studies that investigated the associations between VDR SNPs and urolithiasis were retrieved. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated under the most appropriate genetic model. The TaqI polymorphism was associated with an increased risk of urolithiasis (tt + Tt vs. TT: OR = 1.253; 95% CI = 1.033-1.520, p = 0.022, I(2) = 0), whereas the ApaI, BsmI, and FokI polymorphisms were not. Stratifying for ethnicity, a slightly increased risk was found among Asians as compared to Whites (OR 1.263, 1.232, respectively, p < 0.01). Deviation from Hardy-Weinberg equilibrium (HWE) was the major source of heterogeneity. In summary, this updated meta-analysis suggests the TaqI polymorphism is associated with urolithiasis risk, whereas BsmI, ApaI, and FokI polymorphisms are not.

  1. A-1012G promoter polymorphism of vitamin D receptor gene is associated with psoriasis risk and lower allele-specific expression.

    PubMed

    Richetta, Antonio Giovanni; Silvestri, Valentina; Giancristoforo, Simona; Rizzolo, Piera; D'Epiro, Sara; Graziano, Veronica; Mattozzi, Carlo; Navazio, Anna Sara; Campoli, Marco; D'Amico, Cristina; Scarnò, Marco; Calvieri, Stefano; Ottini, Laura

    2014-02-01

    Psoriasis is caused by a combination of genetic, immunologic, and environmental factors. The vitamin D receptor (VDR) is involved in antiproliferative and prodifferentiation pathways in keratinocytes and exerts immunosuppressive effects. We aimed to investigate possible associations between VDR polymorphisms and psoriasis susceptibility and to evaluate functional effects of potential psoriasis-associated polymorphisms. We genotyped 108 patients with psoriasis and 268 healthy controls at 5 VDR polymorphisms (A-1012G, FokI, BsmI, ApaI, and TaqI) by TaqMan allelic-discrimination real-time polymerase chain reaction. We found a significant increased overall risk of psoriasis for the VDR A-1012G promoter polymorphism (odds ratio [OR]=2.43, 95% confidence interval [CI]: 1.15-5.13; p=0.05). A significant higher frequency (p=0.035) of the A allele was found in psoriatic cases compared with controls. In a case-case analysis, a statistically significant association between A-1012G and family history emerged (p=0.033). Furthermore, a significant association of A-1012G risk genotypes with a lower expression of VDR mRNA emerged (p=0.0028). Our data show that VDR promoter A-1012G polymorphism is associated with psoriasis risk and suggest that this polymorphism may modulate psoriasis risk by affecting VDR expression.

  2. The moderating role of an oxytocin receptor gene polymorphism in the relation between unsupportive social interactions and coping profiles: implications for depression

    PubMed Central

    McInnis, Opal A.; McQuaid, Robyn J.; Matheson, Kimberly; Anisman, Hymie

    2015-01-01

    Oxytocin is a hormone that is thought to influence prosocial behaviors and may be important in modulating responses to both positive and negative social interactions. Indeed, a single nucleotide polymorphism, rs53576, of the oxytocin receptor gene (OXTR) has been associated with decreased trust, empathy, optimism, and social support seeking, which are important components of coping with stressors. In the current study, conducted among undergraduate students (N = 225), it was shown that parental and peer social support was related to fewer depressive symptoms through elevated problem-focused coping and lower emotion-focused coping, and these effects were independent of the OXTR polymorphism. Unsupportive social interactions from parents were associated with more severe depressive symptoms through the greater use of emotion-focused coping, and this relation was moderated by the OXTR genotype. Specifically, individuals who carried the polymorphism on one or both of their alleles demonstrated increased emotion-focused coping following unsupportive responses compared to those without the polymorphism. Likewise, lower problem-focused coping mediated the relation between parental and peer unsupportive responses to depressive symptoms, but this mediated relation was only evident among carriers of the polymorphism. These findings suggest that carrying this OXTR polymorphism might favor disadvantageous coping styles in the face of negative social interactions, which in turn are linked to poor mood. Regardless of genotype, parental, and peer social support are fundamental in determining stress-related coping and well-being. PMID:26321972

  3. Toll-like receptor 4 polymorphism impairing lipopolysaccharide signaling in Sus scrofa, and its restricted distribution among Japanese wild boar populations.

    PubMed

    Shinkai, Hiroki; Okumura, Naohiko; Suzuki, Rintaro; Muneta, Yoshihiro; Uenishi, Hirohide

    2012-04-01

    Toll-like receptor 4 (TLR4) responds to lipid A, the active moiety of lipopolysaccharide from gram-negative bacteria, in cooperation with myeloid differentiation protein-2 and plays a vital role in innate immunity. Polymorphisms in TLR4 are associated with changes in susceptibility to various infectious diseases. We previously found seven amino acid polymorphisms in Sus scrofa TLR4. In this study, we showed by luciferase reporter assay that an alteration from cysteine to tryptophan at position 506 (C506W) caused loss of ability to induce nuclear factor-κB activation after lipid A stimulation. This polymorphism was found only in Japanese wild boar (JWB) populations of S. scrofa. Genotyping of TLR4 in different JWB populations revealed that C506W polymorphism was under pressure from purifying selection in a local population (Tajima's D=-0.98; p<0.05). However, in another population, this polymorphism existed at a frequency such that homozygous animals with the W506 alleles seldom appeared. These findings suggest that the C506W polymorphism is under different types of pressure by natural selection between populations, which may reflect differences in residential pathogens or demographic factors.

  4. Lack of association between the T-->C 267 serotonin 5-HT6 receptor gene (HTR6) polymorphism and prediction of response to clozapine in schizophrenia.

    PubMed

    Masellis, M; Basile, V S; Meltzer, H Y; Lieberman, J A; Sevy, S; Goldman, D A; Hamblin, M W; Macciardi, F M; Kennedy, J L

    2001-01-15

    The affinity of clozapine for 5-HT2A, 5-HT2C, 5-HT6, 5-HT7, and 5-HT1A receptors has been suggested to contribute to various aspects of its complex clinical actions. This study examined the hypothesis that genetic variation in 5-HT1A, 5-HT6, and 5-HT7 receptor genes is involved in the variability observed in response to clozapine. We employed a pharmacogenetic approach in a group (n=185) of schizophrenia patients that have been clinically well characterized for clozapine response. Polymorphisms in the 5-HT6 (HTR6), 5-HT1A (HTR1A) and 5-HT7 (HTR7) receptor genes were genotyped. No evidence for either an allelic or genotypic association of the T-->C 267 HTR6 polymorphism with response to clozapine was found in our sample (allele: chi(2)=0.06, 1 df, P=0.80; genotype: chi(2)=1.21, 2 df, P=0.55). The pro16leu HTR1A polymorphism was not observed in our sample; all individuals genotyped were pro/pro 16 homozygotes. With respect to the pro279leu HTR7 polymorphism, one Caucasian male responder to clozapine was observed to be heterozygous (pro/leu 279 genotype). This individual was clinically similar to the other clozapine responders. Overall, our findings do not support a role for the T-->C 267 polymorphism of the 5-HT6 receptor gene in response to clozapine, although replication is required to confirm this finding.

  5. Glucocorticoid receptor genetic polymorphisms is associated with improvement of health-related quality of life in Chinese population with systemic lupus erythematosus.

    PubMed

    Zou, Yan-Feng; Xu, Jian-Hua; Pan, Fa-Ming; Tao, Jin-Hui; Xu, Sheng-Qian; Xiao, Hui; Liu, Shuang; Cai, Jing; Lian, Li; Chen, Pei-Ling; Wang, De-Guang; Liu, Sheng-Xiu; Liang, Chun-Mei; Ye, Qian-Ling; Tian, Guo; Wu, Min; Gu, Yuan-Yuan; Pan, Hai-Feng; Su, Hong; Ye, Dong-Qing

    2015-09-01

    In our previous study, we found that glucocorticoid receptor (GR) gene genetic polymorphisms may play a major role in the efficacy of glucocorticoids (GCs) in Chinese systemic lupus erythematosus (SLE) patients. The aim of this study is to explore the association of GR gene genetic polymorphisms and improvement of health-related quality of life (HRQOL) in Chinese SLE patients treated with GCs. A total of 195 Chinese SLE patients were treated with GCs for 12 weeks. The HRQOL of patients was measured with the Medical Outcomes Study Short Form-36 (SF-36) at baseline and 12 weeks. Polymorphisms of GR gene were genotyped by using multiplex SNaPshot method. One hundred eighty-four patients (94.36 %) completed the 12-week follow-up. Twenty-three single-nucleotide polymorphisms of GR gene were genotyped. There was a significant association between rs10482672 polymorphism and improvement in physical function (P = 0.043), general health (P = 0.024), and social function (P = 0.013). The rs12656106 polymorphism was associated with improvement in the total score of SF-36 (P = 0.014), physical function (P = 0.013), general health (P = 0.010), vitality (P = 0.015), social function (P = 0.004), physical component summary (P = 0.016), and mental component summary (P = 0.014). The rs4912905 polymorphism was associated with improvement in bodily pain (P = 0.040) and general health (P = 0.038). The rs4912911 polymorphism was associated with improvement in general health (P = 0.026) and vitality (P = 0.027). The rs4986593 polymorphism was associated with improvement in bodily pain (P = 0.034). The rs7719514 polymorphism was associated with improvement in vitality (P = 0.002) and mental component summary (P = 0.041). We also found a significant association between rs9324924 polymorphism and improvement in physical function (P = 0.040), bodily pain (P = 0.007), and general health (P = 0.019). These results

  6. Single nucleotide polymorphism variants within tva and tvb receptor genes in Chinese chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Avian leukosis is an immunosuppressive neoplastic disease caused by avian leukosis viruses (ALV), which causes tremendous economic losses in the worldwide poultry industry. The susceptibility or resistance of chicken cells to subgroup A ALV and subgroup B, D, and E ALV are determined by the receptor...

  7. Evaluation of human epidermal growth factor receptor 2 (HER2) single nucleotide polymorphisms (SNPs) in normal and breast tumor tissues and their link with breast cancer prognostic factors.

    PubMed

    Furrer, Daniela; Lemieux, Julie; Côté, Marc-André; Provencher, Louise; Laflamme, Christian; Barabé, Frédéric; Jacob, Simon; Michaud, Annick; Diorio, Caroline

    2016-12-01

    Amplification of the human epidermal growth factor receptor 2 (HER2) gene is associated with worse prognosis and decreased overall survival in breast cancer patients. The HER2 gene contains several polymorphisms; two of the best-characterized HER2 polymorphisms are Ile655Val and Ala1170Pro. The aim of this study was to evaluate the association between these two HER2 polymorphisms in normal breast and breast cancer tissues and known breast cancer prognostic factors in a retrospective cohort study of 73 women with non-metastatic HER2-positive breast cancer. HER2 polymorphisms were assessed in breast cancer tissue and normal breast tissue using TaqMan assay. Ala1170Pro polymorphism in normal breast tissue was associated with age at diagnosis (p = 0.007), tumor size (p = 0.004) and lymphovascular invasion (p = 0.06). Similar significant associations in cancer tissues were observed. No association between the Ile655Val polymorphism and prognostic factors were observed. However, we found significant differences in the distribution of Ile655Val (p = 0.03) and Ala1170Pro (p = 0.01) genotypes between normal breast and breast tumor tissues. This study demonstrates that only the Ala1170Pro polymorphism is associated with prognostic factors in HER2-positive breast cancer patients. Moreover, our results suggest that both HER2 polymorphisms could play a significant role in carcinogenesis in non-metastatic HER2-positive breast cancer women.

  8. Ancient Genetic Signatures of Orang Asli Revealed by Killer Immunoglobulin-Like Receptor Gene Polymorphisms

    PubMed Central

    NurWaliyuddin, Hanis Z. A.; Norazmi, Mohd N.; Edinur, Hisham A.; Chambers, Geoffrey K.; Panneerchelvam, Sundararajulu; Zafarina, Zainuddin

    2015-01-01

    The aboriginal populations of Peninsular Malaysia, also known as Orang Asli (OA), comprise three major groups; Semang, Senoi and Proto-Malays. Here, we analyzed for the first time KIR gene polymorphisms for 167 OA individuals, including those from four smallest OA subgroups (Che Wong, Orang Kanaq, Lanoh and Kensiu) using polymerase chain reaction-sequence specific primer (PCR-SSP) analyses. The observed distribution of KIR profiles of OA is heterogenous; Haplotype B is the most frequent in the Semang subgroups (especially Batek) while Haplotype A is the most common type in the Senoi. The Semang subgroups were clustered together with the Africans, Indians, Papuans and Australian Aborigines in a principal component analysis (PCA) plot and shared many common genotypes (AB6, BB71, BB73 and BB159) observed in these other populations. Given that these populations also display high frequencies of Haplotype B, it is interesting to speculate that Haplotype B may be generally more frequent in ancient populations. In contrast, the two Senoi subgroups, Che Wong and Semai are displaced toward Southeast Asian and African populations in the PCA scatter plot, respectively. Orang Kanaq, the smallest and the most endangered of all OA subgroups, has lost some degree of genetic variation, as shown by their relatively high frequency of the AB2 genotype (0.73) and a total absence of KIR2DL2 and KIR2DS2 genes. Orang Kanaq tradition that strictly prohibits intermarriage with outsiders seems to have posed a serious threat to their survival. This present survey is a demonstration of the value of KIR polymorphisms in elucidating genetic relationships among human populations. PMID:26565719

  9. Kallikrein 3 and vitamin D receptor polymorphisms: potentials environmental risk factors for prostate cancer

    PubMed Central

    2014-01-01

    Objective To investigate the relationship and interaction of the single nucleotide polymorphisms (SNPs) of KLK3 and VDR and environmental factors with the predisposition to prostate cancer within Chinese population. Methods The comparison between 108 patients and 242 healthy people was carried out by using the TaqMan/MGB Probe Technology to determine the genotypes of KLK3(rs2735839 is located between KLK2 and KLK3) and VDR (rs731236 is located exon 9). Univariate and multivariate logistic regression model were used to assess the connection of genetic polymorphisms and environmental risk factors with PCa by collecting demographic information, as well as BMI, consumption of cigarettes, alcohol, and tea, exercise, and other environmental risk factors. Results The appearing frequencies of AA, AG, and GG genotypes at the SNPs rs2735839 (A/G) for KLK3 were 13.89%, 62.96% and 23.15% in PCa and 37.19%, 44.63%, 18.18% in control, respectively; these two groups are statistically different (P = 0.00). While the appearing frequencies of TT, TC, and CC genotypes at the SNPs rs731236 (T/C) for VDR were 88.89%, 9, 26%, 1.85% and 90.50%, 9.10%, 0.40% in control, respectively, with no significant statistical difference between the two group. The study confirmed decreasing risk in tea drinkers (OR = 0.58, 95% CI = 0.35-0.96). Conclusions Our studies indicate that environmental factor-tea drinking is associated with the development of PCa. The habit of drinking tea is a protective factor against PCa. The SNPs rs2735839 for KLK3 is strongly related to the development of PCa, while the SNPs rs731236 for VDR is not. Virtual slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/9759981571058803. PMID:24755043

  10. Genetic polymorphism of ACE and the angiotensin II type1 receptor genes in children with chronic kidney disease

    PubMed Central

    2011-01-01

    Aim and Methods We investigated the association between polymorphisms of the angiotensin converting enzyme-1 (ACE-1) and angiotensin II type one receptor (AT1RA1166C) genes and the causation of renal disease in 76 advanced chronic kidney disease (CKD) pediatric patients undergoing maintenance hemodialysis (MHD) or conservative treatment (CT). Serum ACE activity and creatine kinase-MB fraction (CK-MB) were measured in all groups. Left ventricular mass index (LVMI) was calculated according to echocardiographic measurements. Seventy healthy controls were also genotyped. Results The differences of D allele and DI genotype of ACE were found significant between MHD group and the controls (p = 0.0001). ACE-activity and LVMI were higher in MHD, while CK-MB was higher in CT patients than in all other groups. The combined genotype DD v/s ID+II comparison validated that DD genotype was a high risk genotype for hypertension .~89% of the DD CKD patients were found hypertensive in comparison to ~ 61% of patients of non DD genotype(p = 0.02). The MHD group showed an increased frequency of the C allele and CC genotype of the AT1RA1166C polymorphism (P = 0.0001). On multiple linear regression analysis, C-allele was independently associated with hypertension (P = 0.04). Conclusion ACE DD and AT1R A/C genotypes implicated possible roles in the hypertensive state and in renal damage among children with ESRD. This result might be useful in planning therapeutic strategies for individual patients. PMID:21859496

  11. Polymorphisms of toll-like receptors 2 and 9 and severity and prognosis of bacterial meningitis in Chinese children.

    PubMed

    Zhang, Pingping; Zhang, Nan; Liu, Linlin; Zheng, Kai; Zhu, Liang; Zhu, Junping; Cao, Lina; Jiang, Yiyuan; Liu, Gang; He, Qiushui

    2017-02-16

    Toll-like receptors (TLRs) play a crucial role in innate immunity, protecting the host from bacterial pathogens. We investigated whether bacterial meningitis (BM) in children was associated with gene polymorphisms in TLR2 (rs3804099), TLR3 (rs3775291 and rs3775290) and TLR9 (rs352139 and rs352140). Blood samples were taken from 218 child patients with confirmed BM and 330 healthy adult controls (HC) and polymorphisms of these genes were analyzed by PCR-based sequencing. For TLR2 rs3804099, frequencies of the minor allele C were markedly higher in patients with severe BM (defined as CSF glucose concentration ≤ 1.5 mmol/L and seizures) than those without (43.5% and 40.1% vs. 30.1% and 29.1%, p = 0.008 and p = 0.016, respectively). For TLR9 rs352139, patients who carried genotype AA and minor allele A developed seizures less often than those without (OR = 0.289, p = 0.003 and OR = 0.568, p = 0.004, respectively). However, for TLR9 rs352140, patients who carried genotype TT and minor allele T developed seizures more often than those without (OR = 3.385, p = 0.004 and OR = 1.767, p = 0.004, respectively). Our finding suggested that genetic variations in TLR2 and TLR9 are associated with severity and prognosis of bacterial meningitis in Chinese children. However, the results should be interpreted with caution since the number of subjects included was limited.

  12. Polymorphisms of toll-like receptors 2 and 9 and severity and prognosis of bacterial meningitis in Chinese children

    PubMed Central

    Zhang, Pingping; Zhang, Nan; Liu, Linlin; Zheng, Kai; Zhu, Liang; Zhu, Junping; Cao, Lina; Jiang, Yiyuan; Liu, Gang; He, Qiushui

    2017-01-01

    Toll-like receptors (TLRs) play a crucial role in innate immunity, protecting the host from bacterial pathogens. We investigated whether bacterial meningitis (BM) in children was associated with gene polymorphisms in TLR2 (rs3804099), TLR3 (rs3775291 and rs3775290) and TLR9 (rs352139 and rs352140). Blood samples were taken from 218 child patients with confirmed BM and 330 healthy adult controls (HC) and polymorphisms of these genes were analyzed by PCR-based sequencing. For TLR2 rs3804099, frequencies of the minor allele C were markedly higher in patients with severe BM (defined as CSF glucose concentration ≤ 1.5 mmol/L and seizures) than those without (43.5% and 40.1% vs. 30.1% and 29.1%, p = 0.008 and p = 0.016, respectively). For TLR9 rs352139, patients who carried genotype AA and minor allele A developed seizures less often than those without (OR = 0.289, p = 0.003 and OR = 0.568, p = 0.004, respectively). However, for TLR9 rs352140, patients who carried genotype TT and minor allele T developed seizures more often than those without (OR = 3.385, p = 0.004 and OR = 1.767, p = 0.004, respectively). Our finding suggested that genetic variations in TLR2 and TLR9 are associated with severity and prognosis of bacterial meningitis in Chinese children. However, the results should be interpreted with caution since the number of subjects included was limited. PMID:28202935

  13. Food Cravings, Food Addiction, and a Dopamine-Resistant (DRD2 A1) Receptor Polymorphism in Asian American College Students

    PubMed Central

    Yeh, Joanna; Trang, Amy; Henning, Susanne M; Wilhalme, Holly; Carpenter, Catherine; Heber, David; Li, Zhaoping

    2016-01-01

    Background/Objectives In an era where obesity remains an important public health concern, food addiction has emerged as a possible contributor to obesity. The DRD2 gene is the most studied polymorphism. The aim of this study was to investigate a relationship between food craving and food addiction questionnaires, body composition measurements, and a dopamine-resistant receptor polymorphism (DRD2 A1) among healthy Asian Americans. Subjects/Methods A total of 84 Asian American college students were recruited. Participants underwent body composition measurement via bioelectrical impedance, answered subjective questionnaires, and had blood drawn for genotyping. Results Among Asian American college students, there was no difference in body composition (BMI, percent body fat) between the A1 (A1A1 or A1A2) and A2 (A2A2) groups. There were statistically significant differences in food cravings of carbohydrates and fast food on the Food Craving Inventory between the A1 and A2 groups (p=0.03), but not for sugar or fat. Among female Asian college students, there was also a difference on the Power of Food questionnaire (p=0.04), which was not seen among males. 13 out of 55 females also had > 30% body fat at a BMI of 21.4 to 28.5 kg/m2. Conclusion Greater carbohydrate and fast food craving was associated with the DRD2 A1 versus A2 allele among Asian Americans. Further studies examining the ability of dopamine agonists to affect food craving and to reduce body fat in Asian American are warranted. More studies in food addiction among obese Asian Americans are needed with careful definition of obesity, specifically for Asian women. PMID:27222427

  14. Chronic pain after lower abdominal surgery: do catechol-O-methyl transferase/opioid receptor μ-1 polymorphisms contribute?

    PubMed Central

    2013-01-01

    Background Preoperative pain, type of operation and anesthesia, severity of acute postoperative pain, and psychosocial factors have been identified as risk factors for chronic postsurgical pain (CPP). Recently, it has been suggested that genetic factors also contribute to CPP. In this study, we aimed to determine whether the catechol-O-methyl transferase (COMT) and opioid receptor μ-1 (OPRM1) common functional polymorphisms rs4680 and rs1799971 were associated with the incidence, intensity, or duration of CPP in patients after lower abdominal surgery. Methods One hundred and two patients with American Society of Anesthesiologists (ASA) physical status I/II underwent either abdominal radical prostatectomy (n = 45) or hysterectomy (n = 57). The incidences of CPP in the pelvic and scar areas were evaluated in all patients three months after surgery. Results Thirty-five (34.3%) patients experienced CPP after lower abdominal surgery. Within this group, six (17.1%) patients demonstrated symptoms of neuropathic pain. For COMT rs4680, 22 (21.6%) patients had Met158Met, 55 (53.9%) patients had Val158Met, and 25 (24.5%) patients had Val158Val. No association was found between CPP phenotypes (incidence, intensity, and duration) and different rs4680 genotypes. For OPRM1 rs1799971, only CPP patients carrying at least one copy of the G allele had higher pain intensity than A118A carriers (p=0.02). No associations with other phenotypes were found. No combined effect of COMT/OPRM1 polymorphisms on CPP phenotypes was observed. Conclusions OPRM1 genotype influences CPP following lower abdominal surgery. COMT didn’t affect CPP, suggesting its potential modality-specific effects on human pain. PMID:23566343

  15. Polymorphisms in the glucocorticoid receptor co-chaperone FKBP5 predict persistent musculoskeletal pain after traumatic stress exposure

    PubMed Central

    Bortsov, Andrey V.; Smith, Jennifer E.; Diatchenko, Luda; Soward, April C.; Ulirsch, Jacob C.; Rossi, Catherine; Swor, Robert A.; Hauda, William E.; Peak, David A.; Jones, Jeffrey S.; Holbrook, Debra; Rathlev, Niels K.; Foley, Kelly A.; Lee, David C.; Collette, Renee; Domeier, Robert M.; Hendry, Phyllis L.; McLean, Samuel A.

    2013-01-01

    Individual vulnerability factors influencing the function of the hypothalamic-pituitary-adrenal (HPA) axis may contribute to the risk of the development of persistent musculoskeletal pain after traumatic stress exposure. The objective of the study was to evaluate the association between polymorphisms in the gene encoding FK506 binding protein 51, FKBP5, a glucocorticoid receptor co-chaperone, and musculoskeletal pain severity six weeks after two common trauma exposures. The study included data from two prospective emergency department-based cohorts: a discovery cohort (n=949) of European Americans experiencing motor vehicle collision and a replication cohort of adult European American women experiencing sexual assault (n=53). DNA was collected from trauma survivors at the time of initial assessment. Overall pain and neck pain six weeks after trauma exposure were assessed using a 0–10 numeric rating scale. After adjustment for multiple comparisons, six FKBP5 polymorphisms showed significant association (minimum p <0.0001) with both overall and neck pain in the discovery cohort. The association of rs3800373, rs9380526, rs9394314, rs2817032, and rs2817040 with neck pain and/or overall pain six weeks after trauma was replicated in the sexual assault cohort, showing the same direction of the effect in each case. The results of this study indicate that genetic variants in FKBP5 influence the severity of musculoskeletal pain symptoms experienced during the weeks after motor vehicle collision and sexual assault. These results suggest that glucocorticoid pathways influence the development of persistent post-traumatic pain, and that such pathways may be a target of pharmacologic interventions aimed at improving recovery after trauma. PMID:23707272

  16. Bone mass and breast milk calcium concentration are associated with vitamin D receptor gene polymorphisms in adolescent mothers.

    PubMed

    Bezerra, Flávia F; Cabello, Giselda M K; Mendonça, Laura M C; Donangelo, Carmen M

    2008-02-01

    Lactation-associated bone loss has been reported in adolescent mothers. Polymorphisms in the vitamin D receptor (VDR) gene may contribute to differences in the physiologic skeletal response to lactation in these mothers. We evaluated the influence of VDR gene polymorphisms ApaI, BsmI, and TaqI on bone mass, bone and calcium-related hormones, and breast milk calcium of lactating adolescents with habitually low calcium intake. Total body bone mineral content (TBMC), total body bone mineral density (TBMD), lumbar spine BMD (LSBMD), serum hormones [intact parathyroid hormone (iPTH), 25-hydroxyvitamin D, insulin-like growth factor-I (IGF1), prolactin, and estradiol), and breast milk calcium were measured in 40 lactating Brazilian adolescents (15-18 y), and compared by VDR genotype subgroups after adjustment for calcium intake and postmenarcheal and lactational periods. TBMD and LSBMD Z scores were -0.55 +/- 1.01 and -1.15 +/- 1.48, respectively. LSBMD was higher (21%; P < 0.05) in adolescents with the aa genotype (n = 5) compared with those with the AA genotype (n = 7). TBMC and IGF1 were higher (23 and 50%, respectively; P < 0.05) in adolescents with tt (n = 4) than those with TT (n = 29) and Tt (n = 7) genotypes. Breast milk calcium and serum iPTH were higher (24 and 80%, respectively; P < 0.05) in adolescents with bb (n = 8) compared with those with BB (n = 21) genotype. These results indicate that bone mass and breast milk calcium are significantly associated with VDR genotypes in lactating Brazilian adolescents. Those with aa and tt genotypes had a better bone status and those with bb genotype had greater breast milk calcium.

  17. Analysis of the association between polymorphisms in the vitamin D receptor (VDR) gene and dental caries in a Chinese population.

    PubMed

    Hu, X P; Li, Z Q; Zhou, J Y; Yu, Z H; Zhang, J M; Guo, M L

    2015-09-28

    Environmental influences on the development and progression of dental caries are well known; however, there is little evidence of a genetic component imparting susceptibility to dental caries. The aim of this study was to investigate the relationship between a single nucleotide polymorphism in the vitamin D receptor TaqI locus and dental caries susceptibility in a Chinese population. This case-control study was conducted with a case group (264 patients with dental caries from northwestern China) and a control group (219 individuals without dental caries or systemic disease from the same area). DNA was extracted from the peripheral venous blood of the study participants; the distribution of TaqI locus genotypes and allele frequencies was determined via polymerase chain reaction-restriction fragment length polymorphism. The data obtained were statistically analyzed using the Hardy-Weinberg equilibrium and Chi-square test. The frequency of the Tt genotype in the case group (14.0%) was significantly higher than that in the control group (4.3%), as determined using the genotype TT as the reference. The risk of dental caries was increased 3.8-fold in individuals with the heterozygous Tt genotype comp