Science.gov

Sample records for bi-affinity alpha 1-adrenoceptor

  1. Recent advances in the discovery of alpha1-adrenoceptor agonists.

    PubMed

    Bishop, Michael J

    2007-01-01

    The alpha(1) adrenoceptors are three of nine well-characterized receptors that are activated by epinephrine and norepinephrine. Agonists acting at the alpha(1) adrenoceptors produce numerous physiological effects, and are used therapeutically for several indications. Many known alpha(1) adrenoceptor agonists are alpha(1A) selective, but the discovery of highly selective alpha(1B) and alpha(1D) adrenoceptor agonists has proven to be an extremely difficult goal to achieve. This review will focus on recent advances in the discovery, development and clinical utility of subtype-specific alpha(1) agonists as well as contributions to our understanding of agonist-receptor interactions.

  2. alpha(1)-Adrenoceptors augment thermal hyperalgesia in mildly burnt skin.

    PubMed

    Drummond, Peter D

    2009-03-01

    The effect of the alpha(1)-adrenoceptor agonist phenylephrine on sensitivity to heat was investigated at three sites of mild burn injury in the cutaneous forearm of 19 healthy participants. Two of the sites were pre-treated with the alpha(1)-antagonist terazosin, to determine whether the effect of phenylephrine was mediated by alpha(1)-adrenoceptors. Terazosin was administered before the burn injury at one site, and after the burn injury at the other site. In another 15 participants, the nociceptive effect of the alpha(2)-adrenoceptor agonist clonidine was investigated with and without prior treatment with the alpha(2)-antagonist rauwolscine. Drugs were introduced into the skin by iontophoresis, and burns were induced by heating the skin to 48 degrees C for 2min. Heat pain thresholds to a temperature ramp (0.5 degrees C/s), and heat pain ratings to a thermal stimulus (45 degrees C, 7s), were determined before and after the administration of each drug. Thermal hyperalgesia provoked by phenylephrine was inhibited by terazosin administered after the burn injury, but not by terazosin administered before the burn injury. However, neither alpha(2)-adrenoceptor stimulation nor blockade affected sensitivity to heat in the mildly burnt skin. These findings suggest that stimulation of cutaneous alpha(1)-adrenoceptors increased the excitability of heat-sensitized nociceptive afferents. As terazosin was more effective when administered in burnt skin, an inflammatory response induced by the burn injury may have facilitated access of adrenergic agents to alpha(1)-adrenoceptors.

  3. [beta]1-Adrenoceptor or [alpha]1-Adrenoceptor Activation Initiates Early Odor Preference Learning in Rat Pups: Support for the Mitral Cell/cAMP Model of Odor Preference Learning

    ERIC Educational Resources Information Center

    Harley, Carolyn W.; Darby-King, Andrea; McCann, Jennifer; McLean, John H.

    2006-01-01

    We proposed that mitral cell [beta]1-adrenoceptor activation mediates rat pup odor preference learning. Here we evaluate [beta]1-, [beta]2-, [alpha]1-, and [alpha]2-adrenoceptor agonists in such learning. The [beta]1-adrenoceptor agonist, dobutamine, and the [alpha]1-adrenoceptor agonist, phenylephrine, induced learning, and both exhibited an…

  4. Comparison of the antagonistic activity of tamsulosin and doxazosin at vascular alpha 1-adrenoceptors in humans.

    PubMed

    Harada, K; Ohmori, M; Fujimura, A

    1996-11-01

    alpha 1-Adrenoceptor blockers such as prazosin and doxazosin are used to treat hypertension as well as benign prostatic hyperplasia (BPH), whereas the new alpha 1-adrenoceptor blocker tamsulosin is used only for BPH and does not reduce blood pressure at the doses used to relax prostatic smooth muscle. In contrast to prazosin, tamsulosin has a higher affinity for prostatic than vascular alpha 1-adrenoceptors in vitro. The functional correlate of this observation in humans is the subject of this study. The alpha 1-adrenoceptor blockade by oral tamsulosin (0.2 mg), doxazosin (1 mg) or placebo on finger tip vascular and dorsal hand venous alpha 1-adrenoceptors stimulated by cold treatment (immersion in ice water) and the alpha 1-adrenoceptor agonist phenylephrine, was thus studied in a 3-way crossover study in eight, healthy, male adults. Finger tip vasoconstriction after cold stimulation was assessed by laser Doppler flowmetry. A linear variable differential transformer was used to assess the drug effect on phenylephrine-induced venoconstriction. All study parameters were assessed at around 2 and 3.5 h after oral intake of doxazosin and tamsulosin respectively. The drug plasma levels were not significantly different. No significant differences were found for blood pressure or heart rate in the three treatments in supine and erect position. The reduction in finger tip blood flow after cold stimulation was significantly smaller after doxazosin treatment (P < 0.01) than after tamsulosin or placebo, whereas there was no significant difference between tamsulosin and placebo treatments. The infusion rate of phenylephrine producing a half-maximum venoconstriction was significantly larger after doxazosin than after tamsulosin (P < 0.05) or placebo (P < 0.01), whereas there was again no significant difference between tamsulosin and placebo treatments. The data suggest that, at doses producing equal plasma levels after single oral doses in human subjects, the blocking activity

  5. Role of alpha-1 adrenoceptor subtypes mediating constriction of the rabbit ear thermoregulatory microvasculature.

    PubMed

    Li, Z; Silver, W P; Koman, L A; Strandhoy, J W; Rosencrance, E; Gordon, S; Smith, T L

    2000-01-01

    An acute in vivo preparation of the microvasculature of the rabbit ear was used to evaluate the functional role of alpha1 (alpha1)-adrenoceptor subtypes in thermoregulatory microcirculation. The effect of alpha1-adrenoceptor subtype blockade on phenylephrine-induced vasoconstriction was assessed with the alpha1A, alpha1B, and alpha1D-adrenoceptor-selective antagonists 5-methyl-urapidil (10(-8) M), chloroethylclonidine (10(-5) M), and 8-[2-[4(2-methoxyphenyl)-1-piperazinyl]ethyl]-8-azaspirol[4.5]deca ne-7,9-dione dihydrochloride (BMY7378) (10(-6) M), respectively. The results demonstrated that pretreatment of the ear microvasculature with 5-methyl-urapidil or BMY7378 shifted the phenylephrine concentration-response curve rightward and significantly changed the log of the phenylephrine concentration, causing half-maximum stimulation (EC50) in arterioles (p < 0.05). BMY7378 shifted the phenylephrine concentration-response curve of the arteriovenous anastomoses about 100-fold rightward (p < 0.05). All three alpha1-adrenoceptor antagonists eliminated the vasoconstrictive effects of phenylephrine on venules. The results indicate that the ear microvasculature has a heterogenous distribution of alpha1-adrenoceptor subtypes. The alpha1A and alpha1D-adrenoceptor subtypes appear to have a greater influence on constrictive function in arterioles, whereas the alpha1D-adrenoceptor is the dominant constrictor of arteriovenous anastomoses. In general, the alpha1-adrenoceptor does not play a major vasoconstrictor role in venules. Chloroethylclonidine, an irreversible alpha1B-adrenoceptor antagonist, induced contractile responses in the ear microvasculature, probably due to its alpha2-adrenoceptor agonist effects. This study extended our understanding of the adrenergic receptor control mechanisms of a cutaneous thermoregulatory end organ characterized by two parallel perfusion circuits providing nutritional and thermoregulatory functions. PMID:10716292

  6. Evaluation of the pharmacological selectivity profile of alpha 1 adrenoceptor antagonists at prostatic alpha 1 adrenoceptors: binding, functional and in vivo studies.

    PubMed Central

    Kenny, B. A.; Miller, A. M.; Williamson, I. J.; O'Connell, J.; Chalmers, D. H.; Naylor, A. M.

    1996-01-01

    1. The profile of a range of alpha 1 adrenoceptor antagonists was determined in vitro against cloned human alpha 1A, alpha 1B and alpha 1D adrenoceptors and against noradrenaline-mediated contractions of rat aorta and human prostate. The in vivo profile of compounds was determined in an anaesthetized dog model which allowed the simultaneous assessment of antagonist potency against phenylephrine-mediated increases in blood pressure and prostatic pressure. 2. The quinazoline antagonists, prazosin, doxazosin and alfuzosin displayed high affinity but were non selective for the three cloned human alpha 1 adrenoceptors. Indoramin and SNAP 1069 showed selectivity for alpha 1A and alpha 1B adrenoceptors relative to the alpha 1D subtype. Rec 15/2739, WB 4101, SL 89,0591, (+)- and (-)- tamsulosin showed selectivity for alpha 1A and alpha 1D adrenoceptors relative to the alpha 1B subtype. RS 17053 showed high affinity and selectivity for alpha 1A adrenoceptors (pKi 8.6) relative to alpha 1B (pKi = 7.3) and alpha 1D (pKi = 7.1) subtypes. 3. (+)-Tamsulosin, (-)-tamsulosin, SL 89,0591, Rec 15/2739, SNAP 1069 and RS 17053 appeared to act as competitive antagonists of noradrenaline-mediated contractions of rat aorta yielding pA2 affinity estimates which were similar to binding affinities at cloned human alpha 1D adrenoceptors. The following rank order was obtained: prazosin = (-)-tamsulosin > doxazosin > SL 89,0591 = (+)-tamsulosin > Rec 15/2739 > RS 17053 = SNAP 1069. 4. (-)-Tamsulosin was a very potent, insurmountable antagonist of noradrenaline-mediated contractions of human prostate, yielding an approximate pA2 estimate of 9.8 at 1 nM. The corresponding (+)-enantiomer was 30 fold weaker. SL 89,0591, SNAP 1069 and Rec 15/2739 yielded pA2 estimates which compared well with their alpha 1A binding affinities. The affinity estimate for prazosin on human prostate was lower than the corresponding binding affinity determined at alpha 1A adrenoceptors and RS 17053 was a very weak

  7. [Medical expulsive therapy facilitated by alpha 1 adrenoceptor antagonist].

    PubMed

    Itoh, Yasunori; Niimi, Kazuhiro; Hirose, Yasuhiko

    2011-10-01

    In 2002, speedy elimination of ureterolithiasis in the lower part of ureter was first reported with the alpha 1 blocker. Thereafter, there are a lot of reports including meta-analysis about tamsulosin. In 2011 EAU Guidelines on Urolithiasis, it is the most important to establish effective MET (medical expulsive therapy) to facilitate spontaneous stone passage. Alpha 1 blockers are the preferred agents for MET. As a basic evidence for MET, we reported that alpha 1a and 1d AR subtype mRNA was highly expressed in the human ureter and that alpha 1A AR is the main participant in the human ureteral contraction. It is published newly in Japanese Guidelines on Urolithiasis revised edition to schedule to be published soon. PMID:21960238

  8. The effects of SB 216469, an antagonist which discriminates between the alpha 1A-adrenoceptor and the human prostatic alpha 1-adrenoceptor.

    PubMed Central

    Chess-Williams, R.; Chapple, C. R.; Verfurth, F.; Noble, A. J.; Couldwell, C. J.; Michel, M. C.

    1996-01-01

    1. The affinity of the alpha 1-adrenoceptor antagonist SB 216469 (also known as REC 15/2739) has been determined at native and cloned alpha 1-adrenoceptor subtypes by radioligand binding and at functional alpha 1-adrenoceptor subtypes in isolated tissues. 2. In radioligand binding studies with [3H]-prazosin, SB 216469 had a high affinity at the alpha 1A-adrenoceptors of the rat cerebral cortex and kidney (9.5-9.8) but a lower affinity at the alpha 1B-adrenoceptors of the rat spleen and liver (7.7-8.2). 3. At cloned rat alpha 1-adrenoceptor subtypes transiently expressed in COS-1 cells and also at cloned human alpha 1-adrenoceptor subtypes stably transfected in Rat-1 cells, SB 216469 exhibited a high affinity at the alpha 1a-adrenoceptors (9.6-10.4) with a significantly lower affinity at the alpha 1b-adrenoceptor (8.0-8.4) and an intermediate affinity at the alpha 1d-adrenoceptor (8.7-9.2). 4. At functional alpha 1-adrenoceptors, SB 216469 had a similar pharmacological profile, with a high affinity at the alpha 1A-adrenoceptors of the rat vas deferens and anococcygeus muscle (pA2 = 9.5-10.0), a low affinity at the alpha 1B-adrenoceptors of the rat spleen (6.7) and guinea-pig aorta (8.0), and an intermediate affinity at the alpha 1D-adrenoceptors of the rat aorta (8.8). 5. Several recent studies have concluded that the alpha 1-adrenoceptor present in the human prostate has the pharmacological characteristics of the alpha 1A-adrenoceptor subtype. However, the affinity of SB 216469 at human prostatic alpha 1-adrenoceptors (pA2 = 8.1) determined in isolated tissue strips, was significantly lower than the values obtained at either the cloned alpha 1a-adrenoceptors (human, rat, bovine) or the native alpha 1A-adrenoceptors in radioligand binding and functional studies in the rat. 6. Our results with SB 216469, therefore, suggest that the alpha 1-adrenoceptor mediating contractile responses of the human prostate has properties which distinguish it from the cloned alpha 1a

  9. Insular cortex alpha1-adrenoceptors modulate the parasympathetic component of the baroreflex in unanesthetized rats.

    PubMed

    Alves, Fernando H F; Crestani, Carlos C; Resstel, Leonardo B M; Correa, Fernando M A

    2009-10-27

    The insular cortex (IC) has been reported to modulate the cardiac parasympathetic activity of the baroreflex in unanesthetized rats. However, which neurotransmitters are involved in this modulation is still unclear. In the present study, we evaluated the possible involvement of local IC-noradrenergic neurotransmission in modulating reflex bradycardiac responses. Bilateral microinjection of the selective alpha(1)-adrenoceptor antagonist WB4101 (15 nmol/100 nL), into the IC of male Wistar rats, increased the gain of reflex bradycardia in response to mean arterial pressure (MAP) increases evoked by intravenous infusion of phenylephrine. However, bilateral microinjection of equimolar doses of either the selective alpha(2)-adrenoceptor antagonist RX821002 or the non-selective beta-adrenoceptor antagonist propranolol into the IC did not affect the baroreflex response. No effects were observed in basal MAP or heart rate values after bilateral microinjection of noradrenergic antagonists into the IC, thus suggesting no tonic influence of IC-noradrenergic neurotransmission on resting cardiovascular parameters. In conclusion, these data provide evidence that local IC-noradrenergic neurotransmission has an inhibitory influence on baroreflex responses to blood pressure increase evoked by phenylephrine infusion through activation of alpha(1)-adrenoceptors. PMID:19686710

  10. Apoptosis induction by doxazosin and other quinazoline alpha1-adrenoceptor antagonists: a new mechanism for cancer treatment?

    PubMed

    Kyprianou, Natasha; Vaughan, Taylor B; Michel, Martin C

    2009-12-01

    Doxazosin and related, quinazoline-based alpha(1)-adrenoceptor antagonists can induce apoptosis in prostate and various other normal, benign, smooth muscle, endothelial and malignant cells. Such apoptosis-inducing effects occur independently of alpha(1)-adrenoceptor antagonism and typically require much high concentrations than those required for receptor occupancy. Several studies have invested efforts towards the elucidation of the molecular mechanisms underlying doxazosin-induced apoptosis. These include various tumor cells, cardiomyocytes, endothelial cells and bladder smooth muscle cells. While the high concentrations of doxazosin required to induce apoptosis challenge the use of this and related drugs for clinical optimization of apoptosis induction, such quinazoline structure may represent chemical starting points to develop more potent apoptosis-inducing agents free of alpha(1)-adrenoceptor antagonistic action and suitable for cancer treatment with minimal and well-tolerated side effects.

  11. Analysis of the activity of alpha 1-adrenoceptor antagonists in rat aorta.

    PubMed Central

    Van der Graaf, P. H.; Shankley, N. P.; Black, J. W.

    1996-01-01

    1. In this study, the effect of seven alpha 1-adrenoceptor antagonists (tamsulosin, phentolamine, prazosin, WB-4101, 5-methylurapidil, spiperone and HV723) have been examined on the contractile response to noradrenaline (NA) and phenylephrine (PE) in rat isolated aorta. 2. NA and PE, when administered using a cumulative dosing schedule, both produced concentration-dependent contraction of aortic rings. It was possible to fit the individual concentration-effect (E/[A]) curve data to the Hill equation to provide estimates of the curve midpoint location (p[A]50 = 7.74 +/- 0.10 and 7.14 +/- 0.18), midpoint slope (nH = 0.82 +/- 0.03 and 0.99 +/- 0.10) and upper asymptote (alpha = 3.2 +/- 0.3 and 3.1 +/- 0.2 g) parameters for NA and PE, respectively. However, the Hill equation provided a better fit to the E/[A] curve data obtained with another contractile agent, 5-hydroxytryptamine (5-HT) (p[A50] = 6.09 +/- 0.08, nH = 1.49 +/- 0.09, alpha = 2.6 +/- 0.3 g), as judged by calculation of the mean sum of squares of the differences between the observed and predicted values. 3. All of the antagonists investigated produced concentration-dependent inhibition of the contractile responses of the aorta to NA and PE. Although no significant effects on the upper asymptotes of the E/[A] curves of any of the antagonists tested were detected, only tamsulosin and 5-methylurapidil did not have a significant effect on the slope (nH) of the NA and PE E/[A] curves. The other antagonists produced significant steepening of the curves obtained with NA and/or PE. 4. Notwithstanding the fact that one of the basic criteria for simple competitive antagonism at a single receptor class was not always satisfied, the individual log [A]50 values estimated in the absence and presence of antagonist within each experiment were fitted to the competitive model. The Schild plot slope parameters for the antagonism of NA and PE by phentolamine and HV723 were found to be significantly less than unity. The Schild

  12. Effect of alpha 1-adrenoceptor blockade on resting and hyperemic myocardial blood flow in normal humans.

    PubMed

    Lorenzoni, R; Rosen, S D; Camici, P G

    1996-10-01

    In the present study we aimed to assess the effect of alpha 1-adrenoceptor blockade on resting and hyperemic myocardial blood flow in normal humans. Myocardial blood flow, at baseline and after dipyridamole, was measured with positron emission tomography and 15O-labeled water in 11 normal volunteers at control and during alpha 1-blockade with doxazosin. Baseline myocardial blood flow during alpha 1-blockade was not different from control, whereas coronary resistance was significantly lower (73.48 +/- 18.31 vs. 89.84 +/- 27.96 mmHg.min.ml-1.g-1; P < 0.05). After dipyridamole, myocardial blood flow during alpha 1-blockade was significantly higher (3.50 +/- 0.75 vs. 2.58 +/- 0.54 ml.min-1.g-1; P < 0.01) and coronary resistance lower (25.30 +/- 7.37 vs. 33.89 +/- 7.04 mmHg.min.ml-1.g-1; P < 0.01) compared with control. In conclusion, in normal humans, dipyridamole-induced increase in myocardial blood flow is limited by alpha 1-mediated coronary vasoconstriction.

  13. Pharmacological characterization of alpha 1-adrenoceptor subtypes in rat heart: a binding study.

    PubMed Central

    Noguchi, H; Muraoka, R; Kigoshi, S; Muramatsu, I

    1995-01-01

    1. The alpha 1-adrenoceptor subtypes of rat heart were characterized in binding experiments performed with [3H]-prazosin as the radiolabel. The specific binding to the alpha 1-adrenoceptors was determined with 0.3 microM prazosin, because phentolamine (10 microM) was insufficient to inhibit completely the specific binding of high concentrations of [3H]-prazosin. 2. In saturation experiments, [3H]-prazosin bound to two distinct affinity sites (pKD = 10.39 and 8.19). The proportion of the low affinity sites was approximately 84% of total specific binding. Membranes pretreated with chloroethylclonidine (CEC, 10 microM) also showed two distinct affinity sites for [3H]-prazosin, although the maximum numbers of high and low affinity sites were reduced by 86 and 64%, respectively. 3. In competition experiments, [3H]-prazosin (100 pM) binding was inhibited by WB4101 (2-(2,6-dimethoxy-phenoxyethyl)aminomethyl-1,4-benzodioxane) and 5-methylurapidil. The inhibition curves displayed shallow slopes which could be subdivided into high and low affinity components (pKi = 10.43 and 8.36 for WB4101, 8.62 and 6.61 for 5-methylurapidil). However, unlabelled prazosin or HV723 (alpha-ethyl-3,4,5-trimethoxy-alpha-(3-((2-(2-methoxyphenoxy)-ethyl)amin o) propyl)benzeneacetonitrile fumarate) competed for [3H]-prazosin binding monophasically (pKi = 10.34 and 8.28, respectively). In CEC-pretreated membranes, prazosin, WB4101, 5-methylurapidil and HV723 antagonized the [3H]-prazosin (100 pM) binding monophasically (pKi = 9.70, 9.56, 8.60 and 8.82, for each antagonist). 4. On the other hand, 1000 pM [3H]-prazosin binding was inhibited by unlabelled prazosin biphasically (pKi = 10.49 and 8.49). HV723 did not discriminate both prazosin-high and low affinity sites (pKi = 8.18).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7780636

  14. Positive inotropic effects mediated by alpha 1 adrenoceptors in intact human subjects.

    PubMed

    Curiel, R; Pérez-González, J; Brito, N; Zerpa, R; Téllez, D; Cabrera, J; Curiel, C; Cubeddu, L

    1989-10-01

    The role of alpha 1-adrenergic receptors (adrenoceptors) on cardiac contractility was investigated in human subjects. The effect of methoxamine, a selective alpha-adrenoceptor agonist, and angiotensin II, on cardiac contractility was determined by means of noninvasive assessment of the slope of the end-systolic pressure (ESP)/end-systolic dimension (ESD) relationship. The slope (m) of this ratio was significantly higher with methoxamine (17.0; SD = 9.0 mm Hg/mm) than with angiotensin II (4.8; SD = 1.9 mm Hg/mm) (p less than 0.05). Slopes with methoxamine were higher when heart rates (HRs) were reflexly reduced, and were significantly diminished when reflex bradycardia was prevented by atropine (p less than 0.05) or atrial pacing (p less than 0.01). Previous treatment with propranolol did not modify m values with methoxamine (m = 15.5; SD = 4.4 mm Hg/mm). Phentolamine, given at peak methoxamine effect, did not consistently modify m values, resulting in an average slope not significantly different from that obtained with methoxamine alone. However, the addition of phentolamine did not cause an increase in ESDs at each level of ESP with respect to methoxamine. In the same subjects, infusion of phentolamine after angiotensin did not modify ESDs at comparable ESP levels. These findings suggest the existence of a positive inotropic effect mediated by alpha 1 adrenoceptors in the intact human heart.

  15. Possible dopaminergic stimulation of locus coeruleus alpha1-adrenoceptors involved in behavioral activation.

    PubMed

    Lin, Yan; Quartermain, David; Dunn, Adrian J; Weinshenker, David; Stone, Eric A

    2008-07-01

    alpha(1)-Adrenoceptors of the locus coeruleus (LC) have been implicated in behavioral activation in novel surroundings, but the endogenous agonist that activates these receptors has not been established. In addition to the canonical activation of alpha(1)-receptors by norepinephrine (NE), there is evidence that dopamine (DA) may also activate certain brain alpha(1)-receptors. This study examined the contribution of DA to exploratory activity in a novel cage by determining the effect of infusion of various dopaminergic and adrenergic drugs into the mouse LC. It was found that the D2/D3 agonist, quinpirole, which selectively blocks the release of CNS DA, produced a dose-dependent and virtually complete abolition of exploration and all movement in the novel cage test. The quinpirole-induced inactivity was significantly attenuated by coinfusion of DA but not by the D1 agonist, SKF38390. Furthermore, the DA attenuation of quinpirole inactivity was blocked by coinfusion of the alpha(1)-adrenergic receptor antagonist, terazosin, but not by the D1 receptor antagonist, SCH23390. LC infusions of either quinpirole or terazosin also produced profound inactivity in DA-beta-hydroxylase knockout (Dbh -/-) mice that lack NE, indicating that their behavioral effects were not due to an alteration of the release or action of LC NE. Measurement of endogenous DA, NE, and 5HT and their metabolites in the LC during exposure to the novel cage indicated an increase in the turnover of DA and NE but not 5HT. These results indicate that DA is a candidate as an endogenous agonist for behaviorally activating LC alpha(1)-receptors and may play a role in the activation of this nucleus by novel surroundings. PMID:18435418

  16. alpha1-Adrenoceptors stimulate a Galphas protein and reduce the transient outward K+ current via a cAMP/PKA-mediated pathway in the rat heart.

    PubMed

    Gallego, Mónica; Setién, Raúl; Puebla, Lilian; Boyano-Adánez, María Del Carmen; Arilla, Eduardo; Casis, Oscar

    2005-03-01

    alpha(1)-Adrenoceptor stimulation prolongs the duration of the cardiac action potentials and leads to positive inotropic effects by inhibiting the transient outward K(+) current (I(to)). In the present study, we have examined the role of several protein kinases and the G protein involved in I(to) inhibition in response to alpha(1)-adrenoceptor stimulation in isolated adult rat ventricular myocytes. Our findings exclude the classic alpha(1)-adrenergic pathway: activation of the G protein G(alphaq), phospholipase C (PLC), and protein kinase C (PKC), because neither PLC, nor PKC, nor G(alphaq) blockade prevents the alpha(1)-induced I(to) reduction. To the contrary, the alpha(1)-adrenoceptor does not inhibit I(to) in the presence of protein kinase A (PKA), adenylyl cyclase, or G(alphas) inhibitors. In addition, PKA and adenylyl cyclase activation inhibit I(to) to the same extent as phenylephrine. Finally, we have shown a functional coupling between the alpha(1)-adrenoceptor and G(alphas) in a physiological system. Moreover, this coupling seems to be compartmentalized, because the alpha(1)-adrenoceptor increases cAMP levels only in intact cells, but not in isolated membranes, and the effect on I(to) disappears when the cytoskeleton is disrupted. We conclude that alpha(1)-adrenoceptor stimulation reduces the amplitude of the I(to) by activating a G(alphas) protein and the cAMP/PKA signaling cascade, which in turn leads to I(to) channel phosphorylation.

  17. Noradrenaline acting on alpha1-adrenoceptor mediates REM sleep deprivation-induced increased membrane potential in rat brain synaptosomes.

    PubMed

    Das, Gitanjali; Mallick, Birendra Nath

    2008-01-01

    We hypothesized that one of the functions of REM sleep is to maintain brain excitability and therefore, REM sleep deprivation is likely to modulate neuronal transmembrane potential; however, so far there was no direct evidence to support the claim. In this study a cationic dye, 3,3'-diethylthiacarbocyanine iodide was used to estimate the potential in synaptosomal samples prepared from control and REM sleep deprived rat brains. The activity of Na-K-ATPase that maintains the transmembrane potential was also estimated in the same sample. Further, the roles of noradrenaline and alpha1-adrenoceptor in mediating the responses were studied both in vivo as well as in vitro. Rats were REM sleep deprived for 4 days by the classical flower-pot method; large platform and recovery controls were carried out in addition to free-moving control. The fluorescence intensity increased in samples prepared from REM sleep deprived rat brain as compared to control, which reflected synaptosomal depolarization after deprivation. The Na-K-ATPase activity also increased in the same deprived sample. Furthermore, both the effects were mediated by noradrenaline acting on alpha1-adrenoceptors in the brain. This is the first direct evidence showing that REM sleep deprivation indeed increased neuronal depolarization, which is the likely cause for increased brain excitability, thus supporting our hypothesis and the effect was mediated by noradrenaline acting through the alpha1-adrenoceptor.

  18. Contractions mediated by alpha 1-adrenoceptors and P2-purinoceptors in a cat colon circular muscle.

    PubMed Central

    Venkova, K.; Milne, A.; Krier, J.

    1994-01-01

    1. The postjunctional excitatory and inhibitory effects of adrenoceptor and purinoceptor agonists and antagonists were studied in circular smooth muscle strips of cat colon. 2. In the presence of tetrodotoxin (0.5 microM), noradrenaline caused contraction or relaxation of circular smooth muscle at resting tension or with raised tone, respectively. The noradrenaline-evoked contractions were potentiated and the noradrenaline-evoked relaxations were antagonized by propranolol (1 microM), suggesting beta-adrenoceptor involvement. 3. At resting tension, noradrenaline, adrenaline and the selective alpha 1-adrenoceptor agonist, phenylephrine, caused concentration-dependent contractile responses, with EC50 values of 1.8 +/- 0.2 microM, 1.9 +/- 0.4 microM and 4.3 +/- 1.7 microM, respectively. The EC50 values and the amplitude of maximal responses were not significantly different from one another. Clonidine (0.1-500 microM), a selective alpha 2-adrenoceptor agonist, was not effective. 4. Prazosin (0.1-9 microM), competitively antagonized the contractile effects of noradrenaline with an estimated pA2 value of 6.93 and a slope of 1.07 +/- 0.03. The Kb values, estimated from a single shift (0.1 microM prazosin) of the concentration-response curves to noradrenaline, adrenaline and phenylephrine were 92.8 +/- 9.3 nM, 108.7 +/- 6.4 nM and 18.4 +/- 3.1 nM, respectively. 5. At resting tension, adenosine 5' triphosphate (ATP, 5-1000 microM), alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP, 0.05-50 microM), beta,gamma-methylene adenosine 5'-triphosphate (beta,gamma-MeATP, 0.5-100 microM), and 2-methylthioadenosine 5'-triphosphate (2-MeSATP, 1-500 microM) caused concentration-dependent contractions with EC50 values of 60.5 +/- 15.9 microM, 0.7 +/- 0.1 microM, 7.6 +/- 0.1 microM and 25.3 +/- 12.8 microM, respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7952886

  19. Alpha1-adrenoceptors trigger the snake venom production cycle in secretory cells by activating phosphatidylinositol 4,5-bisphosphate hydrolysis and ERK signaling pathway.

    PubMed

    Kerchove, Celine M; Luna, Milene S A; Zablith, Mariana B; Lazari, Maria F M; Smaili, Soraya S; Yamanouye, Norma

    2008-08-01

    Loss of venom from the venom gland after biting or manual extraction leads to morphological changes in venom secreting cells and the start of a cycle of production of new venom. We have previously shown that stimulation of both alpha- and beta-adrenoceptors in the secretory cells of the venom gland is essential for the onset of the venom production cycle in Bothrops jararaca. We investigated the signaling pathway by which the alpha-adrenoceptor initiates the venom production cycle. Our results show that the alpha(1)-adrenoceptor subtype is present in venom gland of the snake. In quiescent cells, stimulation of alpha(1)-adrenoceptor with phenylephrine increased the total inositol phosphate concentration, and this effect was blocked by the phospholipase C inhibitor U73122. Phenylephrine mobilized Ca(2+) from thapsigargin-sensitive stores and increased protein kinase C activity. In addition, alpha(1)-adrenoceptor stimulation increased the activity of ERK 1/2, partially via protein kinase C. Using RT-PCR approach we obtained a partial sequence of a snake alpha(1)-adrenoceptor (260 bp) with higher identity with alpha(1D) and alpha(1B)-adrenoceptors from different species. These results suggest that alpha(1)-adrenoceptors in the venom secreting cells are probably coupled to a G(q) protein and trigger the venom production cycle by activating the phosphatidylinositol 4,5-bisphosphate and ERK signaling pathway.

  20. Selective increase of alpha 1-adrenoceptors and muscarinic cholinergic receptors in rat cerebral cortex after chronic haloperidol.

    PubMed

    Pazo, J H; Levi de Stein, M; Jerusalinsky, D; Novas, M L; Raskovsky, S; Tumilasci, O R; Medina, J H; De Robertis, E

    1987-06-30

    The effect of chronic administration of haloperidol on alpha 1-, alpha 2-, and beta-adrenoceptors, cholinergic muscarinic, GABAA and benzodiazepine receptors in the cerebral cortex of the rat was investigated. Doses of 0.3 and 2 mg/kg of haloperidol during 7 days increased markedly the density of alpha 1-adrenoceptors without changes in affinity. The alpha 2- and beta-adrenoceptors were not modified after neuroleptic administration. The number of muscarinic receptors were also increased after haloperidol treatment (2 mg/kg/day). However, the GABAA and benzodiazepine binding sites remained unchanged. In the brainstem an increment in the alpha 1-, but not the beta-adrenoceptors was observed. The well known increase in the dopamine receptors in the striatum was confirmed. These observations demonstrate a multireceptor effect of haloperidol in the cerebral cortex.

  1. Alpha 1-adrenoceptors mediating contraction in arteries of normotensive and spontaneously hypertensive rats are of the alpha 1D or alpha 1A subtypes.

    PubMed

    Villalobos-Molina, R; Ibarra, M

    1996-03-18

    Alpha 1-Adrenoceptor subtypes mediating contraction in carotid, aorta, mesenteric and caudal arteries from both Wistar Kyoto (WKY) normotensive and spontaneously hypertensive (SHR) rats were investigated by using the alpha 1A-adrenoceptor agonist methoxamine and antagonized with selective, competitive antagonists WB-4101, 5-methyl urapidil or BMY 7378 (8-(4-(2-methoxyphenyl)-1-piperazinyl)ethyl)-8-azaspiro(4,5)decane -7,9-dione dihydrochloride). Isometric tension changes were recorded after methoxamine addition to the arterial rings, and the effects of the antagonists determined. All the antagonists shifted to the right the concentration-response curve to methoxamine. pA2 values indicate that all arteries but caudal express the alpha 1D-adrenoceptor subtype, since BMY 7378 values were high in these arteries. Due to the high pA2 values for 5-methyl urapidil and WB-4101 and the low values for BMY 7378 we conclude that the tail artery expresses the alpha 1A and not the alpha 1B subtype. No differences were found between both strains of rats, suggesting that hypertension does not modify the alpha 1-adrenoceptors in conductance arteries. PMID:8846824

  2. Alpha 1-adrenoceptor blocking activities of bevantolol hydrochloride(NC-1400) and labetalol in rat isolated thoracic aorta--do they distinguish between subtypes?

    PubMed

    Shiraishi, K; Moriya, M; Miyake, N; Takayanagi, I

    1992-09-01

    1. alpha 1-adrenoceptor blocking activity of bevantolol(NC-1400) was tested in the rat thoracic aorta, comparing with that of labetalol. 2. In alpha 1-adrenoceptor blocking activity, bevantolol(NC-1400) was 1/20th as potent as labetalol. 3. The pA2 values of bevantolol(NC-1400) and labetalol estimated in the rat thoracic aorta were compared with those in the rabbit thoracic aorta, which were reported by Takayanagi et al. [Takayanagi I., Kizawa Y., Iwasaki S. and Nakagoshi A. (1987) Gen. Pharmac. 18, 87-89]. 4. The pA2 values of bevantolol(NC-1400) and labetalol were approximately 1 order of magnitude higher in rat aorta than in rabbit aorta, suggesting that both the drugs distinguish between subtypes of alpha 1-adrenoceptors.

  3. Examination by radioligand binding of the alpha1 adrenoceptors in the mesenteric arterial vasculature during the development of salt-sensitive hypertension.

    PubMed

    Caveney, S W; Taylor, D A; Fleming, W W

    1997-09-01

    Previous experiments have suggested that the vascular smooth muscle of Dahl salt-sensitive (DS) rats may possess a difference in the alpha1-adrenoceptor population or its transduction processes compared to Dahl salt-resistant (DR) rats. The purpose of the current research is to study the role of alpha1-adrenoceptors in the specific supersensitivity to norepinephrine (NE) seen prior to and early in the development of hypertension in the DS rat. Experiments in isolated perfused superior mesenteric arterial vasculature from DS rats chronically fed a high (7%) salt diet for 5 days or 3 weeks, in the absence or presence of an elevation in systolic blood pressure, respectively, demonstrated a specific supersensitivity to NE relative to DR rats. The enhanced responsiveness was specific to NE after 5 days of high salt since no differences in sensitivity of these preparations was observed to either KCl or 5-HT. A small but significant elevation in sensitivity to KCl following 3 weeks of treatment suggests that multiple factors may contribute to tissue responsiveness at this time. Radioligand binding experiments were performed using [125I]-HEAT to study the alpha1-adrenoceptor population and its subtypes. Saturation experiments using membranes prepared from the superior mesenteric arterial vasculature or mesenteric arterial branches showed no significant differences in overall alpha1-adrenoceptor population between DS and DR rats fed a high-salt diet for 5 days or 3 weeks. Competition experiments using membranes prepared from the superior mesenteric arterial branches in the presence of the alpha1A-subtype selective antagonist 5-methylurapidil showed two binding sites (high and low affinity) in these resistance vessels but no significant differences in nature or ratio of these sites between the DS and DR groups. These results suggest that changes in the alpha1-adrenoceptor population are not responsible for the specific supersensitivity to NE, which may be an early event in

  4. Effect of alpha 1-adrenoceptor blockade on maximal VO2 and endurance capacity in well-trained athletic hypertensive men.

    PubMed

    Tomten, S E; Kjeldsen, S E; Nilsson, S; Westheim, A S

    1994-07-01

    The effect of alpha 1-adrenoceptor blockade (doxazosin, 4 mg daily) on maximal VO2 and physical endurance capacity in 16 mildly hypertensive, athletic men was investigated in a randomized, placebo-controlled, double-blind, two-period of 4 weeks, cross-over study. The maximal workload obtained during graded bicycle ergometer exercise and the corresponding maximal VO2 were reduced by 16 +/- 3 W (mean +/- SE), (P = .00003) and 3 +/- 1 mL/(kg.min) (P = .0004), respectively, on doxazosin compared with placebo. The running time on a 5000 m track increased by 43 +/- 12 sec on doxazosin (P = .04). Heart rate was unchanged during the running session. Systolic blood pressure was reduced by 9 +/- 4.1 mm Hg (P = .04) immediately after finishing 5000 m. Six subjects reported side effects from doxazosin (headache, fatigue, and leg pain). Thus, antihypertensive treatment with alpha 1-selective adrenoceptor blockade moderately, but significantly, reduces maximal O2 consumption and high intensity physical endurance capacity in mildly hypertensive athletic men. Significantly reduced systolic blood pressure and unchanged heart rate immediately after running, combined with unchanged heart rate during the race may, however, suggest a safer exercise performance.

  5. In vivo binding in rat brain and radiopharmaceutical preparation of radioiodinated HEAT, an alpha-1 adrenoceptor ligand

    SciTech Connect

    Couch, M.W.; Greer, D.M.; Thonoor, C.M.; Williams, C.M.

    1988-03-01

    In vivo binding of (/sup 125/I)-2-(beta-(3-iodo-4-hydroxyphenyl)ethylaminomethyl tetralone) ((/sup 125/I)HEAT) to alpha-1 adrenoceptors in the rat brain was determined over 4 hr. Uptake in the thalamus and frontal cortex was approximately 0.1% injected dose per gram tissue. Thalamus/cerebellum ratios of 10:1 and frontal cortex/cerebellum ratios of 5:1 were found at 4 hr. Pretreatment with prazosin, an alpha-1 antagonist, completely inhibited the accumulation of (/sup 125/I)HEAT in thalamus and frontal cortex; yet uptake of radioactivity was not significantly affected by antagonists and agonists for other receptors classes (propranolol, beta-1; apomorphine, D-1; spiperone, D-2). Binding of (/sup 125/I)HEAT is saturable. At 4 hr, (/sup 125/I)HEAT or (/sup 123/I)HEAT was shown to be the only radioactive material in rat thalamus and frontal cortex. Iodine-123 HEAT and (/sup 125/I)HEAT were synthesized as radiopharmaceuticals within 3 hr in 99% radiochemical purity.

  6. Effects of alpha1-adrenoceptor antagonist (tamsulosin) on incident of ejaculation and semen quality in the goat.

    PubMed

    Kimsakulvech, S; Suttiyotin, P; Pinyopummin, A

    2015-04-01

    Male temporary contraception is occasionally required in some animals. Alpha1-adrenoceptor antagonist (tamsulosin) can cause ejaculation disorder. Two sets of Latin square were applied to six male goats to received either normal saline, dimethylsulphoxide or tamsulosin (179.8 nmol kg(-1) ) at 1-week interval. Semen collection and libido scoring were undertaken at 3, 6 and 24 h post-injection. For ejaculated semen, its quality was evaluated. Physiological measurements including body temperature, respiration and heart rates were measured before injection and at 30 min before semen collection. The results showed that libido score and physiological changes were not affected by treatments and time periods. Anejaculation was observed in 11 (91.7%), 5 (41.7%) and 1 (8.3%) males at 3, 6 and 24 h post-tamsulosin injection respectively. The incidence returned to normal when compared with control groups at 24 h. The percentages of motile and live spermatozoa at 6 h post-tamsulosin injection were significantly lower (P < 0.05) than that of normal saline group. At 24 h post-injection, there were no significant differences of all semen parameters among treatments. This study demonstrated that tamsulosin had temporary effects on ejaculation and semen quality without reducing sex desire and physiological functions in male goats.

  7. (+/-)-1-[[2-(3,4-Dimethoxphenyl)ethyl]amino]-3-(3-methylphenoxy)-2- propanol hydrochloride (bevantolol, NC-1400) as a beta 1-selective adrenoceptor blocker with alpha 1-adrenoceptor blocking activity.

    PubMed

    Takayanagi, I; Kizawa, Y; Iwasaki, S; Nakagoshi, A

    1987-01-01

    Blocking activities of alpha- and beta-adrenoceptors by (+/-)-1-[[2-(3,4-dimethoxyphenyl)-ethyl]amino]-3-(3-methylphenoxy)-2 -propanol hydrochloride (NC-1400) were tested on the isolated muscles, comparing with those of labetalol and atenolol. In blocking the beta 1-adrenoceptor, NC-1400 was slightly more potent than labetalol and atenolol. NC-1400 was about 1/10th as potent as labetalol and about ten times as potent as atenolol in blocking the beta 2-receptor. NC-1400 was beta 1-adrenoceptor selective. NC-1400 was about 1/30th as potent as labetalol in blocking the alpha 1-receptor. NC-1400 did not interact with the alpha 2-adrenoceptor in concentrations up to 10(-5) M. The present results indicate that NC-1400 is the selective beta 1-adrenoceptor blocker with some blocking activity of alpha 1-adrenoceptors.

  8. Effect of alpha1-adrenoceptor blockade on coronary vasodilator reserve in cardiac syndrome X.

    PubMed

    Rosen, S D; Lorenzoni, R; Kaski, J C; Foale, R A; Camici, P G

    1999-10-01

    We sought to test the response of the coronary microcirculation to alpha-adrenoceptor blockade in patients with syndrome X (angina, ischemia-like stress electrocardiogram, and a normal coronary arteriogram). The response of the microcirculation was assessed by quantification of coronary vasodilator reserve (the ratio of hyperemic to resting myocardial blood flow). We investigated 28 patients with syndrome X [18 women, age 54.4 (7.6) years]. Myocardial blood flow was measured at rest and after dipyridamole by using positron emission tomography with H(2)15O. The measurements were made before and after treatment for 10 days with doxazosin (1 mg o.d. for 3 days, followed by 2 mg o.d. for 7 days) or a matched placebo, similarly administered. Patients were randomized to alpha1-blockade or to placebo in double-blind fashion. No significant differences were demonstrable between syndrome X patients treated with doxazosin and those receiving placebo, with respect to resting myocardial blood flow, myocardial blood flow after dipyridamole, or coronary vasodilator reserve (the ratio of the latter two). In addition, no relations were demonstrable among myocardial blood flow, coronary vasodilator reserve, development of chest pain after dipyridamole, or development of ischemia-like ECG changes. Doxazosin had no effect on the perception of chest pain after dipyridamole. No differences were found between the effects of alpha1-blockade with doxazosin or those of placebo with respect to myocardial blood flow in syndrome X. The values obtained for myocardial blood flow and coronary vasodilator reserve for the patients were within the normal range. The data do not support the case for alpha1-mediated vasoconstriction having an etiologic role in the chest pain of syndrome X.

  9. BMY 20064, a potent calcium channel blocker with. cap alpha. /sub 1/-adrenoceptor antagonist properties

    SciTech Connect

    Stanton, H.C.; Rosenberger, L.B.; Hanson, R.C.; Fleming, J.S.; Poindexter, G.

    1986-03-05

    BMY 20064 ((3-(4-(2-methoxyphenyl)-1-piperazinyl)propyl)-methyl 1,4-dihydro-2-6-dimethyl-4-(3-nitrophenyl)-3-5-pyridinedicarboxylate) is a new Ca/sup +2/ channel blocking agent equivalent in activity to nifedipine in the isolated K/sup +/ depolarized rat aorta. It is also an ..cap alpha../sub 1/ selective antagonist (0.17x prazosin) in a radioligand binding assay. BMY 20064 (10-/sup 7/M) was more effective than nifedipine (10/sup -7/M) in antagonizing net increases in /sup 45/Ca/sup +2/ uptake induced in isolated rabbit aortic strips by K/sup +/ (80 mM), norepinephrine (10/sup -5/M), methoxamine (10/sup -5/M) or a combination of K/sup +/ and adrenergic agonist. In ganglion-blocked, anesthetized rats, BMY 20064 (3, 10 and 15 mg/kg, p.o.) induced shifts in the dose-effect curve of phenylephrine of 2.8 +/- 1.2, 12.8 +/- 5.1 and 30.5 +/- 7.8, respectively. BMY 20064 (0.3 - 10 mg/kg, p.o.) induced dose-related decreases in arterial blood pressure of SH rats and normotensive rats of 6-8 hours duration. BMY 20064, (i.v.), prevented the loss in ATP which occurs when the excised rat heart is incubated for 15 minutes at 37/sup 0/C under global ischemic conditions. BMY 20064 was also much more active than nifedipine, prazosin or combinations of nifedipine-prazosin in preventing ADP or collagen-induced aggregation of human platelets in vitro. The actions of BMY 20064 may not be due entirely to its Ca/sup +2/ or ..cap alpha../sub 1/ receptor blocking actions.

  10. Ranolazine enhances nicardipine-induced relaxation of alpha1-adrenoceptor-mediated contraction on isolated rabbit aorta.

    PubMed

    Malavaki, Christina; Hatziefthimiou, Apostolia; Daskalopoulou, Stella S; Stefanidis, Ioannis; Karatzaferi, Christina; Aidonidis, Isaac

    2015-04-01

    Ranolazine (RAN) and nicardipine (NIC) have been studied for their vasorelaxing effects but the combination of these agents against adrenergic vasoconstriction has not been tested. The present study aimed at investigating the vasorelaxing effect by the combination of the two agents on alpha1-adrenoceptor-mediated contraction on isolated rabbit aorta. Aortic rings were mounted for isometric tension recording in organ baths containing Krebs-Henseleit solution. Concentration-response curves of RAN (10(-9) to 10(-4) M), NIC (10(-1) to 10(-5) M), and RAN + NIC (3 x 10(-6) M) were obtained in a cumulative manner using phenylephrine (PE, 2 x 10(-6) M) as constrictor agent. The effective concentration (EC)50 values for RAN and NIC were 6.5 x 10(-6) M and 1.4 x 10(-5) M, respectively. The treatment of PE-precontracted aortic rings with either RAN or NIC up to 65 min revealed that both agents displayed a biphasic pattern of initial rising and late sustained phases of relaxation. At 35 min of incubation, RAN and NIC induced relaxation by 23 +/- 3% and 14 +/- 4%, respectively (N = 7, P=NS, RAN vs. NIC); their combination resulted in a 34 +/- 4% relaxation (N=7; P < 0.01, RAN + NIC vs. NIC). At 65 min the effect of NIC prevailed and tended to be closer to the values of the combination treatment (P < 0.01, RAN + NIC vs. RAN). The results indicate that RAN at therapeutic concentrations exerts a significant additive vasorelaxing effect when combined with NIC in rabbit aorta.

  11. Ranolazine enhances nicardipine-induced relaxation of alpha1-adrenoceptor-mediated contraction on isolated rabbit aorta.

    PubMed

    Malavaki, Christina; Hatziefthimiou, Apostolia; Daskalopoulou, Stella S; Stefanidis, Ioannis; Karatzaferi, Christina; Aidonidis, Isaac

    2015-04-01

    Ranolazine (RAN) and nicardipine (NIC) have been studied for their vasorelaxing effects but the combination of these agents against adrenergic vasoconstriction has not been tested. The present study aimed at investigating the vasorelaxing effect by the combination of the two agents on alpha1-adrenoceptor-mediated contraction on isolated rabbit aorta. Aortic rings were mounted for isometric tension recording in organ baths containing Krebs-Henseleit solution. Concentration-response curves of RAN (10(-9) to 10(-4) M), NIC (10(-1) to 10(-5) M), and RAN + NIC (3 x 10(-6) M) were obtained in a cumulative manner using phenylephrine (PE, 2 x 10(-6) M) as constrictor agent. The effective concentration (EC)50 values for RAN and NIC were 6.5 x 10(-6) M and 1.4 x 10(-5) M, respectively. The treatment of PE-precontracted aortic rings with either RAN or NIC up to 65 min revealed that both agents displayed a biphasic pattern of initial rising and late sustained phases of relaxation. At 35 min of incubation, RAN and NIC induced relaxation by 23 +/- 3% and 14 +/- 4%, respectively (N = 7, P=NS, RAN vs. NIC); their combination resulted in a 34 +/- 4% relaxation (N=7; P < 0.01, RAN + NIC vs. NIC). At 65 min the effect of NIC prevailed and tended to be closer to the values of the combination treatment (P < 0.01, RAN + NIC vs. RAN). The results indicate that RAN at therapeutic concentrations exerts a significant additive vasorelaxing effect when combined with NIC in rabbit aorta. PMID:26148375

  12. Alpha-1 adrenoceptor blockade with doxazosin in hypertension: effects on blood pressure and lipoproteins.

    PubMed

    Ames, R P; Kiyasu, J Y

    1989-02-01

    The effects of doxazosin, a long-acting alpha-1 adrenoreceptor blocking drug, were observed upon blood pressure and serum lipoproteins. Thirty patients with supine diastolic blood pressure between 90 and 114 mm Hg during single-blind placebo therapy were randomized to double-blind treatment with either doxazosin or further placebo in a parallel-design protocol. Starting at one mg, dosage was doubled every 2 weeks during a 10-week treatment period to a maximum dose of 16 mg once daily. Blood was sampled in the fasting state before and during double-blind therapy for measurement of total cholesterol and triglycerides, cholesterol in the lipoprotein fractions, and apolipoproteins A and B. At the end of 10 weeks of titration, systolic and diastolic blood pressure were each reduced by 14 mm Hg in the standing position when measured 24 hours following the previous dose. Supine pressure was lowered by 6 mm Hg systolic and by 5 mm Hg diastolic at the same time point. Measured hourly for 12 hours following the ingestion of doxazosin, blood pressure was lowered maximally at 4-5 hours when an additional decline of 14/6 mm Hg (systolic/diastolic) was observed in the standing position and 13/6 in the supine posture. Postural dizziness, the most frequent symptomatic complaint, was reported in 4 patients during doxazosin treatment. After brief interruption of treatment in one and dosage adjustment in another, titration was continued in all four and no patient was withdrawn because of side effects. Concerning lipoproteins, the ratio of total cholesterol to HDL cholesterol and of LDL to HDL cholesterol both improved during treatment with doxazosin.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. ATP-binding cassette transporter A1 gene transcription is downregulated by activator protein 2alpha. Doxazosin inhibits activator protein 2alpha and increases high-density lipoprotein biogenesis independent of alpha1-adrenoceptor blockade.

    PubMed

    Iwamoto, Noriyuki; Abe-Dohmae, Sumiko; Ayaori, Makoto; Tanaka, Nobukiyo; Kusuhara, Masatoshi; Ohsuzu, Fumitaka; Yokoyama, Shinji

    2007-07-20

    ATP-binding cassette transporter A1 (ABCA1) is a rate-limiting factor for high-density lipoprotein (HDL) biogenesis. The ABCA1 gene expression is known to be upregulated by various transcriptional factors. However, negative regulation factors would be better targets for pharmacological modulation of HDL biogenesis. Doxazosin, an alpha(1)-adrenoceptor blocker, increased ABCA1 mRNA, its protein, and apolipoprotein A-I-mediated HDL biogenesis in THP-1 macrophages and CHO-K1 cells, independent of alpha(1)-adrenoceptor blockade. Analysis of the human ABCA1 promoter indicated that the region between the positions -368 and -147 that contains an activator protein (AP)2-binding site responsible for the effects of doxazosin. Overexpression of AP2alpha inhibited ABCA1 transcription in a dose-dependent fashion. Mutation in the AP2-binding site caused increase of the basal promoter activity and cancelling both the transactivation by doxazosin and the trans-repression by AP2alpha. Doxazosin had no effect on ABCA1 mRNA level in HepG2 cells, which lack endogenous AP2alpha, and it reversed the inhibitory effect of AP2alpha expression in this type of cells. Chromatin immunoprecipitation and gel shift assays revealed that doxazosin reduced specific binding of AP2alpha to the ABCA1 promoter, as it suppressed phosphorylation of AP2alpha. Finally, doxazosin increased ABCA1 expression and plasma HDL in mice. We thus concluded that AP2alpha negatively regulates the ABCA1 gene transcription. Doxazosin inhibits AP2alpha activity independent of alpha(1)-adrenoceptor blockade and increases the ABCA1 expression and HDL biogenesis. AP2alpha is a potent pharmacological target for the increase of HDL.

  14. Involvement of dopamine D1 receptors and alpha1-adrenoceptors in the antidepressant-like effect of chlorpheniramine in the mouse tail suspension test.

    PubMed

    Hirano, Shoko; Miyata, Shigeo; Onodera, Kenji; Kamei, Junzo

    2007-05-01

    It has been reported that chlorpheniramine, a classical antihistamine, has antidepressant-like effects in animal models of depression. In this study, we examined the involvement of dopaminergic (dopamine D(1) and dopamine D(2) receptors), noradrenergic (alpha(1)- and beta-adrenoceptors) and serotonergic (5-HT(1A) and 5-HT(2) receptors) receptors in the antidepressant-like effect of chlorpheniramine in the mouse tail suspension test. We also investigated the involvement of these monoamine receptors in the antidepressant-like effect of imipramine for comparison with the mechanisms of the effect of chlorpheniramine. Both imipramine and chlorpheniramine significantly reduced the duration of immobility in the tail suspension test without affecting spontaneous locomotor activity in mice. The anti-immobility effect of imipramine (30 mg/kg, i.p.) was significantly antagonized by the selective dopamine D(1) receptor antagonist SCH23390 but not by the other receptor antagonists. In contrast, the anti-immobility effect of chlorpheniramine was significantly inhibited by SCH23390 and the selective alpha(1)-adrenoceptor antagonist prazosin, but not by the other receptor antagonists. In conclusion, these results suggest that chlorpheniramine exerts an antidepressant-like effect in the mouse tail suspension test that is mediated by at least the activation of dopamine D(1) receptors and alpha(1)-adrenoceptors. In addition, the antidepressant-like effect of chlorpheniramine may be induced by several mechanisms that are different from those involved in the antidepressant-like effect of imipramine.

  15. Inhibition of human ether-a-go-go-related gene potassium channels by alpha 1-adrenoceptor antagonists prazosin, doxazosin, and terazosin.

    PubMed

    Thomas, Dierk; Wimmer, Anna-Britt; Wu, Kezhong; Hammerling, Bettina C; Ficker, Eckhard K; Kuryshev, Yuri A; Kiehn, Johann; Katus, Hugo A; Schoels, Wolfgang; Karle, Christoph A

    2004-05-01

    Human ether-a-go-go-related gene (HERG) potassium channels are expressed in multiple tissues including the heart and adenocarcinomas. In cardiomyocytes, HERG encodes the alpha-subunit underlying the rapid component of the delayed rectifier potassium current, I(Kr), and pharmacological reduction of HERG currents may cause acquired long QT syndrome. In addition, HERG currents have been shown to be involved in the regulation of cell proliferation and apoptosis. Selective alpha 1-adrenoceptor antagonists are commonly used in the treatment of hypertension and benign prostatic hyperplasia. Recently, doxazosin has been associated with an increased risk of heart failure. Moreover, quinazoline-derived alpha 1-inhibitors induce apoptosis in cardiomyocytes and prostate tumor cells independently of alpha1-adrenoceptor blockade. To assess the action of the effects of prazosin, doxazosin, and terazosin on HERG currents, we investigated their acute electrophysiological effects on cloned HERG potassium channels heterologously expressed in Xenopus oocytes and HEK 293 cells.Prazosin, doxazosin, and terazosin blocked HERG currents in Xenopus oocytes with IC(50) values of 10.1, 18.2, and 113.2 microM respectively, whereas the IC(50) values for HERG channel inhibition in human HEK 293 cells were 1.57 microM, 585.1 nM, and 17.7 microM. Detailed biophysical studies revealed that inhibition by the prototype alpha 1-blocker prazosin occurred in closed, open, and inactivated channels. Analysis of the voltage-dependence of block displayed a reduction of inhibition at positive membrane potentials. Frequency-dependence was not observed. Prazosin caused a negative shift in the voltage-dependence of both activation (-3.8 mV) and inactivation (-9.4 mV). The S6 mutations Y652A and F656A partially attenuated (Y652A) or abolished (F656A) HERG current blockade, indicating that prazosin binds to a common drug receptor within the pore-S6 region. In conclusion, this study demonstrates that HERG

  16. In vitro studies of release of adenine nucleotides and adenosine from rat vascular endothelium in response to alpha 1-adrenoceptor stimulation.

    PubMed Central

    Shinozuka, K; Hashimoto, M; Masumura, S; Bjur, R A; Westfall, D P; Hattori, K

    1994-01-01

    1. Noradrenaline-induced release of endogenous adenine nucleotides (ATP, ADP, AMP) and adenosine from both rat caudal artery and thoracic aorta was characterized, using high-performance liquid chromatography with fluorescence detection. 2. Noradrenaline, in a concentration-dependent manner, increased the overflow of ATP and its metabolites from the caudal artery. The noradrenaline-induced release of adenine nucleotides and adenosine from the caudal artery was abolished by bunazosin, an alpha 1-adrenoceptor antagonist, but not by idazoxan, an alpha 2-adrenoceptor antagonist. Clonidine, an alpha 2-adrenoceptor agonist, contracted caudal artery smooth muscle but did not induce release of adenine nucleotides or adenosine. 3. Noradrenaline also significantly increased the overflow of ATP and its metabolites from the thoracic aorta in the rat; however, the amount of adenine nucleotides and adenosine released from the aorta was considerably less than that released from the caudal artery. 4. Noradrenaline significantly increased the overflow of ATP and its metabolites from cultured endothelial cells from the thoracic aorta and caudal artery. The amount released from the cultured endothelial cells from the thoracic aorta and caudal artery. The amount released from the cultured endothelial cells from the aorta was also much less than that from cultured endothelial cells from the caudal artery. In cultured smooth muscle cells from the caudal artery, a significant release of ATP or its metabolites was not observed. 5. These results suggest that there are vascular endothelial cells that are able to release ATP by an alpha 1-adrenoceptor-mediated mechanism, but that these cells are not homogeneously distributed in the vasculature. PMID:7889273

  17. Rapid Eye Movement Sleep Deprivation Induces Neuronal Apoptosis by Noradrenaline Acting on Alpha1 Adrenoceptor and by Triggering Mitochondrial Intrinsic Pathway

    PubMed Central

    Somarajan, Bindu I.; Khanday, Mudasir A.; Mallick, Birendra N.

    2016-01-01

    Many neurodegenerative disorders are associated with rapid eye movement sleep (REMS) loss; however, the mechanism was unknown. As REMS loss elevates noradrenaline (NA) level in the brain as well as induces neuronal apoptosis and degeneration, in this study, we have delineated the intracellular molecular pathway involved in REMS deprivation (REMSD)-associated NA-induced neuronal apoptosis. Rats were REMS deprived for 6 days by the classical flower pot method; suitable controls were conducted and the effects on apoptosis markers evaluated. Further, the role of NA was studied by one, intraperitoneal (i.p.) injection of NA-ergic alpha1 adrenoceptor antagonist prazosin (PRZ) and two, by downregulation of NA synthesis in locus coeruleus (LC) neurons by local microinjection of tyrosine hydroxylase siRNA (TH-siRNA). Immunoblot estimates showed that the expressions of proapoptotic proteins viz. Bcl2-associated death promoter protein, apoptotic protease activating factor-1 (Apaf-1), cytochrome c, caspase9, caspase3 were elevated in the REMS-deprived rat brains, while caspase8 level remained unaffected; PRZ treatment did not allow elevation of these proapoptotic factors. Further, REMSD increased cytochrome c expression, which was prevented if the NA synthesis from the LC neurons was blocked by microinjection of TH-siRNA in vivo into the LC during REMSD in freely moving normal rats. Mitochondrial damage was re-confirmed by transmission electron microscopy, which showed distinctly swollen mitochondria with disintegrated cristae, chromosomal condensation, and clumping along the nuclear membrane, and all these changes were prevented in PRZ-treated rats. Combining findings of this study along with earlier reports, we propose that upon REMSD NA level increases in the brain as the LC, NA-ergic REM-OFF neurons do not cease firing and TH is upregulated in those neurons. This elevated NA acting on alpha1 adrenoceptors damages mitochondria causing release of cytochrome c to activate

  18. Rapid Eye Movement Sleep Deprivation Induces Neuronal Apoptosis by Noradrenaline Acting on Alpha1 Adrenoceptor and by Triggering Mitochondrial Intrinsic Pathway.

    PubMed

    Somarajan, Bindu I; Khanday, Mudasir A; Mallick, Birendra N

    2016-01-01

    Many neurodegenerative disorders are associated with rapid eye movement sleep (REMS) loss; however, the mechanism was unknown. As REMS loss elevates noradrenaline (NA) level in the brain as well as induces neuronal apoptosis and degeneration, in this study, we have delineated the intracellular molecular pathway involved in REMS deprivation (REMSD)-associated NA-induced neuronal apoptosis. Rats were REMS deprived for 6 days by the classical flower pot method; suitable controls were conducted and the effects on apoptosis markers evaluated. Further, the role of NA was studied by one, intraperitoneal (i.p.) injection of NA-ergic alpha1 adrenoceptor antagonist prazosin (PRZ) and two, by downregulation of NA synthesis in locus coeruleus (LC) neurons by local microinjection of tyrosine hydroxylase siRNA (TH-siRNA). Immunoblot estimates showed that the expressions of proapoptotic proteins viz. Bcl2-associated death promoter protein, apoptotic protease activating factor-1 (Apaf-1), cytochrome c, caspase9, caspase3 were elevated in the REMS-deprived rat brains, while caspase8 level remained unaffected; PRZ treatment did not allow elevation of these proapoptotic factors. Further, REMSD increased cytochrome c expression, which was prevented if the NA synthesis from the LC neurons was blocked by microinjection of TH-siRNA in vivo into the LC during REMSD in freely moving normal rats. Mitochondrial damage was re-confirmed by transmission electron microscopy, which showed distinctly swollen mitochondria with disintegrated cristae, chromosomal condensation, and clumping along the nuclear membrane, and all these changes were prevented in PRZ-treated rats. Combining findings of this study along with earlier reports, we propose that upon REMSD NA level increases in the brain as the LC, NA-ergic REM-OFF neurons do not cease firing and TH is upregulated in those neurons. This elevated NA acting on alpha1 adrenoceptors damages mitochondria causing release of cytochrome c to activate

  19. Enhancement by neuropeptide Y (NPY) of the dihydropyridine-sensitive component of the response to alpha 1-adrenoceptor stimulation in rat isolated mesenteric arterioles.

    PubMed Central

    Andriantsitohaina, R.; Stoclet, J. C.

    1990-01-01

    1. The mechanism by which neuropeptide Y (NPY) potentiates the vasoconstriction induced by alpha 1-adrenoceptor agonists was investigated in 3rd generation mesenteric arterioles of the rat. 2. At a maximally active concentration, nitrendipine (10(-6) M) displaced to the right the concentration-response curves to noradrenaline (pD2 decreased from 6.2 +/- 0.06 to 5.7 +/- 0.03) and phenylephrine (pD2 decreased from 5.6 +/- 0.03 to 5.3 +/- 0.03). Diltiazem (10(-5) M) also shifted to the right the concentration-response curve to phenylephrine (pD2 decreased from 6.0 +/- 0.06 to 5.5 +/- 0.04). In addition, the maximal response to phenylephrine was significantly decreased in the presence of either nitrendipine or diltiazem. 3. In the absence of a calcium channel blocking agent, NPY (100 nM) produced a leftward shift of the concentration-response curves to noradrenaline (pD2 increased from 6.2 +/- 0.06 to 6.5 +/- 0.05) and phenylephrine (pD2 increased from 5.6 +/- 0.03 to 6.0 +/- 0.06 and from 6.0 +/- 0.06 to 6.3 +/- 0.11). In the presence of either nitrendipine (10(-6) M) or diltiazem (10(-5) M), NPY (100 nM) did not alter the concentration-response curves to either noradrenaline or phenylephrine. 4. NPY was added to arterioles brought to the same level of tension (40% of the maximal contraction) either by phenylephrine alone (1.5 x 10(-6) M) or by a higher concentration of phenylephrine (3 x 10(-6) M) followed by the addition of prazosin (1.3 x 10(-9) M; a concentration at which it partially blocks alpha 1-adrenoceptors).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1970270

  20. Haemodynamic effects of dicentrine, a novel alpha 1-adrenoceptor antagonist: comparison with prazosin in spontaneously hypertensive and normotensive Wistar-Kyoto rats.

    PubMed Central

    Yu, S. M.; Hsu, S. Y.; Ko, F. N.; Chen, C. C.; Huang, Y. L.; Huang, T. F.; Teng, C. M.

    1992-01-01

    1. The haemodynamic effects of dicentrine, an aporphine derivative isolated from the plant Lindera megaphylla, were investigated and compared with prazosin in rats. 2. In anaesthetized normotensive Wistar-Kyoto (WKY) rats, i.v. administration of dicentrine (0.1, 0.5, 1.0 mg kg-1) and prazosin (0.01, 0.05, 0.1 mg kg-1) induced a dose-related reduction of mean arterial pressure (MAP) which reached a maximal effect 5-10 min after injection and persisted for 2 h. 3. In anaesthetized WKY rats, a higher dose of dicentrine (1.0 mg kg-1, i.v.) did not cause any significant changes in heart rate (HR), cardiac output (CO) and stroke volume (SV) but markedly increased tail blood flow. In contrast, a higher dose of prazosin (0.1 mg kg-1, i.v.) produced a decrease in HR which paralleled the time course of the hypotensive response. 4. The hypotensive activity of dicentrine was completely abolished by alpha-adrenoceptor blockade. Both dicentrine and prazosin significantly attenuated pressor responses to noradrenaline but failed, even at maximal hypotensive doses, to impair the pressor effects of angiotensin II or vasopressin. These observations suggest that dicentrine appears to exert its hypotensive action through alpha 1-adrenoceptor blockade. 5. In conscious normotensive and spontaneously hypertensive (SH) rats, dicentrine (0.5-2.0 mg kg-1, i.v.) and prazosin (0.05-0.2 mg kg-1, i.v.) also evoked dose-related decreases in MAP which were of greater magnitude in SH rats. Oral administration of dicentrine (5 and 8 mg kg-1) to conscious SH rats caused a hypotensive effect which persisted for over 15 h.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1356567

  1. 8-NH2-boldine, an antagonist of alpha1A and alpha1B adrenoceptors without affinity for the alpha1D subtype: structural requirements for aporphines at alpha1-adrenoceptor subtypes.

    PubMed

    Ivorra, M Dolores; Valiente, Miguel; Martínez, Sonia; Madrero, Yolanda; Noguera, M Antonia; Cassels, Bruce K; Sobarzo, Eduardo M; D'Ocon, Pilar

    2005-10-01

    Structure-activity analysis of 21 aporphine derivatives was performed by examining their affinities for cloned human alpha (1A), alpha (1B) and alpha (1D) adrenoceptors (AR) using membranes prepared from rat-1 fibroblasts stably expressing each alpha (1)-AR subtype. All the compounds tested competed for [ (125)I]-HEAT binding with steep and monophasic curves. The most interesting compound was 8-NH (2)-boldine, which retains the selective affinity for alpha(1A)-AR (pKi = 6.37 +/- 0.21) vs. alpha(1B)-AR (pKi = 5.53 +/- 0.11) exhibited by 1,2,9,10-tetraoxygenated aporphines, but shows low affinity for alpha(1D)-AR (pKi < 2.5). Binding studies on native adrenoceptors present in rat cerebral cortex confirms the results obtained for human cloned alpha (1)-AR subtypes. The compounds selective for the alpha (1A) subtype discriminate two binding sites in rat cerebral cortex confirming a mixed population of alpha (1A)- and alpha (1B)-AR in this tissue. All compounds are more selective as inhibitors of [ (3)H]-prazosin binding than of [ (3)H]-diltiazem binding to rat cerebral cortical membranes. A close relationship was found between affinities obtained for cloned alpha (1A)-AR and inhibitory potencies on noradrenaline-induced contraction or inositol phosphate accumulation in tail artery, confirming that there is a homogeneous functional population of alpha(1A)-AR in this vessel. On the contrary, a poor correlation seems to exist between the affinity of 8-NH (2)-boldine for cloned alpha (1D)-AR and its potency as an inhibitor of noradrenaline-induced contraction or inositol phosphate accumulation in rat aorta, which confirms that a heterogeneous population of alpha (1)-AR mediates the adrenergic response in this vessel.

  2. Synthesis and alpha 1-adrenoceptor antagonistic activity of some 4-amino-5,7-dimethyl-2-(substituted) aminopyrido (2,3-d) pyrimidines.

    PubMed

    Chhabria, Mahesh T; Srinivas, Sreeramaiah; Rajan, Kombu S; Ravikumar, Tadiparthy; Rathnam, Shivprakash

    2002-01-01

    A series of new 4-amino-5,7-dimethyl-2- (substituted)aminopyrido(2,3-d)pyrimidines (5) have been synthesized and tested for selective alpha 1-adrenoreceptor antagonistic activity. Some of the compounds were found to antagonize alpha 1-adrenoreceptor in a competitive and reversible manner. When screened on rat anococcygeus muscle some of the compounds exhibited significant alpha 1-adrenoreceptor antagonistic activity (pA2 values in the range of 5.2-7.8). The most potent compound (5j) was evaluated by an in vivo method and was found to reduce the systolic and diastolic blood pressure of spontaneously hypertensive rats. The percentage reduction in blood pressure by test compound 5j was found to be higher than that of the standard drug prazosin (CAS 19216-56-9) at the same dose level (1 mg/kg p.o.). Chemically, prazosin is a 4-aminoquinazolin derivative. Pyridopyrimidine is a known bioisostere of quinazoline. The study revealed that isosteric replacement of the benzene ring of prazosin by a pyridine ring increases the potency.

  3. The effect of urapidil, an alpha-1 adrenoceptor antagonist and a 5-HT1A agonist, on the vascular tone of the porcine coronary and pulmonary arteries, the rat aorta and the human pulmonary artery.

    PubMed

    Bopp, Claire; Auger, Cyril; Diemunsch, Pierre; Schini-Kerth, Valérie

    2016-05-15

    Urapidil (Eupressyl(®)) an antihypertensive drug acting as an α1 antagonist and a 5-HT1A agonist, may be of special interest in the treatment of hypertension associated with preeclamptic toxaemia and hypoxia-induced pulmonary arterial vasoconstriction. However, the effect of urapidil on vascular tone has been poorly investigated. Vascular reactivity was evaluated using pulmonary and coronary arteries from 36 pigs, aortae from 22 rats and 9 human pulmonary artery samples suspended in organ chambers. Concentration-relaxation curves either to urapidil, 5-HT, or the 5-HT1A receptor agonist 8-OH-DPAT were constructed after pre-contraction of rings. Pig pulmonary and coronary artery rings were contracted with U46619, a thromboxane mimetic, rat aortic rings with either endothelin-1 or phenylephrine, and human pulmonary artery rings with U46619 or phenylephrine. Urapidil markedly inhibited phenylephrine-induced contractions in rat aortic rings with and without endothelium with a more pronounced effect observed in rings without endothelium. Both 5-HT and 8-OH-DPAT failed to induce relaxation in rat aortic rings with an intact endothelium. 5-HT, but not urapidil and 8-OH-DPAT, induced a concentration-dependent relaxation in the porcine coronary and pulmonary artery rings with an intact endothelium (P<0.05). 5-HT and phenylephrine but not urapidil caused concentration-dependent contractions in human pulmonary artery rings. The present findings, while confirming that urapidil is a potent inhibitor of α1-adrenoceptor-induced contraction, do not support the role of 5-HT1A receptor activation in the control of the vascular tone of the different types of arteries tested in response to urapidil. In addition, they indicate that urapidil seems to preferentially target arteries with endothelial dysfunction.

  4. Inflammation contributes to axon reflex vasodilatation evoked by iontophoresis of an α-1 adrenoceptor agonist.

    PubMed

    Drummond, Peter D

    2011-01-20

    Iontophoresis of α(1)-adrenoceptor agonists in the human forearm evoke axon reflex vasodilatation, possibly due to an accumulation of inflammatory agents at the site of iontophoresis. To investigate this possibility, skin sites in the forearm of healthy participants were treated with an anti-inflammatory gel containing ibuprofen 5% before the iontophoresis of the α(1)-adrenoceptor agonist phenylephrine (350μA for 3min). Red cell flux was measured with laser Doppler flowmetry at the site of iontophoresis and 8mm away in the region of axon reflex vasodilatation. In additional experiments, skin sites were treated with the vasodilator sodium nitroprusside (to counteract vasoconstriction and disperse inflammatory mediators produced during the iontophoresis of phenylephrine); local anaesthetic agent (to determine whether the axon reflex to phenylephrine was neurally-mediated); or the α(2)-adrenoceptor agonist clonidine (to investigate the specificity of the adrenergic axon reflex). Phenylephrine evoked marked vasodilatation 8mm from the site of iontophoresis whereas clonidine and saline-control did not (mean flux increase±S.E. 485±132% for phenylephrine; 44±24% for clonidine; 39±19% for saline-control; p<0.05 for phenylephrine versus control). Axon reflex vasodilatation to phenylephrine was unaffected by variations in blood flow at the site of phenylephrine iontophoresis, but was reduced by ibuprofen pretreatment and abolished by local anaesthetic pretreatment. These findings suggest that prostaglandin synthesis at the site of iontophoresis contributes to but does not account entirely for axon reflex vasodilatation to phenylephrine. Alpha-1 adrenoceptor mediation of axon reflexes could play a role in aberrant sensory-sympathetic coupling in neuro-inflammatory diseases.

  5. Regression of Intracranial Meningioma during Treatment with α1-Adrenoceptor Blocker

    PubMed Central

    Hoegestoel, Einar August; Berg-Johnsen, Jon

    2016-01-01

    Background Regression of meningioma has been reported after hemorrhage or hormonal withdrawal. Here, we report a case of an incidentally diagnosed meningioma that regressed in association with α1-adrenoceptor antagonist. Case report A 59-year old male patient with an incidentally diagnosed lateral sphenoid wing meningioma was followed with serial magnetic resonance imaging. The tumor with a maximum diameter of 43 mm showed progressive regression, and after 3 years the size was reduced to 22% of the initial volume. During follow-up the patient was treated with an α1-adrenoceptor antagonist (tamsulosin) for benign prostatic hyperplasia. Possible mechanisms are discussed, including our main hypothesis of reduced mitogenic effects through phospholipase C-signal transduction. Conclusion This is the first report of regression of an incidentally diagnosed meningioma associated with α1-adrenoceptor antagonist treatment. PMID:27175325

  6. Effect of block of α-1-adrenoceptors on overall motor activity but not on spatial cognition in the object-position recognition task.

    PubMed

    Levčík, D; Stuchlík, A; Klement, D

    2013-01-01

    Prazosin, an alpha(1)-adrenoceptor antagonist, is well known for its depressant effect on motivation and motor activity, while it has no effect on retention of spatial behavior in several tasks, e.g. in the Morris water maze and radial arm maze. The role of alpha(1)-adrenoceptors in operant tasks with stimulus-controlled behavior has not yet been tested. The present study investigated the effect of prazosin on the modulation of overall motor activity and on cognitive performance in a spatial operant task called object-position recognition task, where operant behavior (lever pressing) was controlled by spatial stimuli displayed on a computer screen. This task has been previously showed to be hippocampal-dependent. Pre-test injection of prazosin at the dose of 3 mg/kg decreased the responding rate, while it did not affect the recognition of object's position. In conclusion, we validated the new cognitive test with a drug with known pharmacological effects on behavior and confirmed the depressant effect of prazosin on motor activity and no effect on retrieval of spatial memory in the hippocampal-dependent operant task.

  7. Chemically Homogenous Compounds with Antagonistic Properties at All α1-Adrenoceptor Subtypes but not β1-Adrenoceptor Attenuate Adrenaline-Induced Arrhythmia in Rats

    PubMed Central

    Pytka, Karolina; Lustyk, Klaudia; Żmudzka, Elżbieta; Kotańska, Magdalena; Siwek, Agata; Zygmunt, Małgorzata; Dziedziczak, Agnieszka; Śniecikowska, Joanna; Olczyk, Adrian; Gałuszka, Adam; Śmieja, Jarosław; Waszkielewicz, Anna M.; Marona, Henryk; Filipek, Barbara; Sapa, Jacek; Mogilski, Szczepan

    2016-01-01

    Studies proved that among all α1-adrenoceptors, cardiac myocytes functionally express only α1A- and α1B-subtype. Scientists indicated that α1A-subtype blockade might be beneficial in restoring normal heart rhythm. Therefore, we aimed to determine the role of α1-adrenoceptors subtypes (i.e., α1A and α1B) in antiarrhythmic effect of six structurally similar derivatives of 2-methoxyphenylpiperazine. We compared the activity of studied compounds with carvedilol, which is β1- and α1-adrenoceptors blocker with antioxidant properties. To evaluate the affinity for adrenergic receptors, we used radioligand methods. We investigated selectivity at α1-adrenoceptors subtypes using functional bioassays. We tested antiarrhythmic activity in adrenaline-induced (20 μg/kg i.v.), calcium chloride-induced (140 and 25 mg/kg i.v.) and barium chloride-induced (32 and 10 mg/kg i.v.) arrhythmia models in rats. We also evaluated the influence of studied compounds on blood pressure in rats, as well as lipid peroxidation. All studied compounds showed high affinity toward α1-adrenoceptors but no affinity for β1 receptors. Biofunctional studies revealed that the tested compounds blocked α1A-stronger than α1B-adrenoceptors, but except for HBK-19 they antagonized α1A-adrenoceptor weaker than α1D-subtype. HBK-19 showed the greatest difference in pA2 values—it blocked α1A-adrenoceptors around seven-fold stronger than α1B subtype. All compounds showed prophylactic antiarrhythmic properties in adrenaline-induced arrhythmia, but only the activity of HBK-16, HBK-17, HBK-18, and HBK-19 (ED50 = 0.18–0.21) was comparable to that of carvedilol (ED50 = 0.36). All compounds reduced mortality in adrenaline-induced arrhythmia. HBK-16, HBK-17, HBK-18, and HBK-19 showed therapeutic antiarrhythmic properties in adrenaline-induced arrhythmia. None of the compounds showed activity in calcium chloride- or barium chloride-induced arrhythmias. HBK-16, HBK-17, HBK-18, and HBK-19 decreased heart

  8. Chemically Homogenous Compounds with Antagonistic Properties at All α1-Adrenoceptor Subtypes but not β1-Adrenoceptor Attenuate Adrenaline-Induced Arrhythmia in Rats.

    PubMed

    Pytka, Karolina; Lustyk, Klaudia; Żmudzka, Elżbieta; Kotańska, Magdalena; Siwek, Agata; Zygmunt, Małgorzata; Dziedziczak, Agnieszka; Śniecikowska, Joanna; Olczyk, Adrian; Gałuszka, Adam; Śmieja, Jarosław; Waszkielewicz, Anna M; Marona, Henryk; Filipek, Barbara; Sapa, Jacek; Mogilski, Szczepan

    2016-01-01

    Studies proved that among all α1-adrenoceptors, cardiac myocytes functionally express only α1A- and α1B-subtype. Scientists indicated that α1A-subtype blockade might be beneficial in restoring normal heart rhythm. Therefore, we aimed to determine the role of α1-adrenoceptors subtypes (i.e., α1A and α1B) in antiarrhythmic effect of six structurally similar derivatives of 2-methoxyphenylpiperazine. We compared the activity of studied compounds with carvedilol, which is β1- and α1-adrenoceptors blocker with antioxidant properties. To evaluate the affinity for adrenergic receptors, we used radioligand methods. We investigated selectivity at α1-adrenoceptors subtypes using functional bioassays. We tested antiarrhythmic activity in adrenaline-induced (20 μg/kg i.v.), calcium chloride-induced (140 and 25 mg/kg i.v.) and barium chloride-induced (32 and 10 mg/kg i.v.) arrhythmia models in rats. We also evaluated the influence of studied compounds on blood pressure in rats, as well as lipid peroxidation. All studied compounds showed high affinity toward α1-adrenoceptors but no affinity for β1 receptors. Biofunctional studies revealed that the tested compounds blocked α1A-stronger than α1B-adrenoceptors, but except for HBK-19 they antagonized α1A-adrenoceptor weaker than α1D-subtype. HBK-19 showed the greatest difference in pA2 values-it blocked α1A-adrenoceptors around seven-fold stronger than α1B subtype. All compounds showed prophylactic antiarrhythmic properties in adrenaline-induced arrhythmia, but only the activity of HBK-16, HBK-17, HBK-18, and HBK-19 (ED50 = 0.18-0.21) was comparable to that of carvedilol (ED50 = 0.36). All compounds reduced mortality in adrenaline-induced arrhythmia. HBK-16, HBK-17, HBK-18, and HBK-19 showed therapeutic antiarrhythmic properties in adrenaline-induced arrhythmia. None of the compounds showed activity in calcium chloride- or barium chloride-induced arrhythmias. HBK-16, HBK-17, HBK-18, and HBK-19 decreased heart

  9. The α1 adrenoceptors in ventrolateral orbital cortex contribute to the expression of morphine-induced behavioral sensitization in rats.

    PubMed

    Wei, Lai; Zhu, Yuan-Mei; Zhang, Yu-Xiang; Liang, Feng; Li, Teng; Gao, Hong-Yu; Huo, Fu-Quan; Yan, Chun-Xia

    2016-01-01

    The aim of the present study was to investigate the effect of microinjection of benoxathian, selective α1 adrenoceptor antagonist, into the ventrolateral orbital cortex (VLO) on morphine-induced behavioral sensitization and its underlying molecular mechanism in rats. A single morphine treatment protocol was used in establishing the behavioral sensitization model. The effect of bilateral intra-VLO benoxathian injection on locomotor activity was examined and the protein expression levels of α1 adrenoceptors and activation of extracellular signal-regulated kinase (ERK) in the VLO were detected after locomotor test. The results showed that a single injection of morphine could induce behavioral sensitization by a low challenge dosage of morphine after a 7-days drug free period. Benoxathian significantly suppressed the expression but not the development of morphine-induced behavioral sensitization. Morphine treatment significantly elicited ERK phosphorylation and downregulated the expression level of α1 adrenoceptors in the VLO. In addition, intra-VLO benoxathian injection enhanced the expression levels of α1 adrenoceptors and phosphorylated ERK. These results suggest that α1 adrenoceptors in the VLO are involved in regulating the expression of morphine-induced behavioral sensitization. The effect of decreased locomotor activity by blocking α1 adrenoceptors might be associated with activation of ERK in the VLO.

  10. Selectivity of bevantolol hydrochloride towards alpha- and beta-adrenoceptor subtypes in rat cerebral cortex.

    PubMed

    Takita, M; Kigoshi, S; Muramatsu, I

    1992-02-01

    Selectivity of bevantolol hydrochloride (NC-1400) towards alpha- and beta-adrenoceptor subtypes of rat cerebral cortex was examined in binding experiments and compared with propranolol. Bevantolol biphasically displaced the 3H-dihydroalprenolol binding. The affinity of bevantolol to beta 1-adrenoceptor was equal to that of propranolol. Bevantolol displaced 3H-prazosin binding monophasically but not 3H-p-aminoclonidine binding. These results suggest that bevantolol is a beta 1-adrenoceptor antagonist with a relatively high affinity to alpha 1-adrenoceptor subtypes.

  11. ATP is not involved in α1-adrenoceptor-mediated vasoconstriction in resistance arteries.

    PubMed

    Angus, James A; Wright, Christine E

    2015-12-15

    Recent publications suggest that α1-adrenoceptor stimulation by exogenous agonists such as phenylephrine in resistance arteries cause contraction through the release of ATP from within the vascular smooth muscle cells. This ATP exits the cell through pannexin-1 channels to act back "autocrine-like" on P2 receptors on the smooth muscle that cause the contraction. In this work we directly test this hypothesis by using a selective P2X1 purinoceptor antagonist NF449 (1-10µM) against phenylephrine and ATP concentration-response curves in small mesenteric arteries of the rat and thoracodorsal arteries of the mouse. We show that NF449 is a simple competitive antagonist of ATP with a pKB of 6.43 and 6.41 in rat and mouse arteries, respectively, but did not antagonise phenylephrine concentration-response curves. This work cautions against the growing overstated role of the reputed pannexin-1/ATP release axis following α1-adrenoceptor activation in small resistance arteries.

  12. α1-Adrenoceptors relate Ca(2+) modulation and protein secretions in rat lacrimal gland.

    PubMed

    Ikeda-Kurosawa, Chika; Higashio, Hironori; Nakano, Masato; Okubo, Masatoshi; Satoh, Yoh-Ichi; Kurosaka, Daijiro; Saino, Tomoyuki

    2015-01-01

    Noradrenaline (NA) is a catecholamine with multiple roles including as a hormone and a neurotransmitter. Cellular secretory activities are enhanced by adrenergic stimuli as well as by cholinergic stimuli. The present study aimed to determine which adrenoceptors play a role in controlling intracellular calcium ion ([Ca(2+)]i) level in acinar cells of rat lacrimal glands. Expression of mRNA for adrenoceptor subtypes in the acinar cells was assessed using RT-PCR. All types except α2c, β1, and β3 were detected. NA induced a [Ca(2+)]i increase with a biphasic pattern in the acinar cells. Removal of extracellular Ca(2+) and use of Ca(2+)-channel blockers did not inhibit the NA-induced [Ca(2+)]i increases. In contrast, U73122 and suramin almost blocked these increases. The α1-adrenoceptor agonist phenylephrine induced a strong increase in [Ca(2+)]i. However, clonidine and isoproterenol failed to induce a [Ca(2+)]i increase. The peroxidase activity was quantified as a measure of mucin secretion. Ca(2+)-dependent exocytotic secretion of peroxidase was detected in rat lacrimal glands. The RT-PCR results showed that MUC1, MUC4, MUC5AC, MUC5B, and MUC16 were expressed in acinar cells. These findings indicated that NA activates α1-adrenoceptors, which were found to be the main receptors in Ca(2+)-related cell homeostasis and protein (including mucin) secretion in lacrimal glands. PMID:26700590

  13. MH-3: evidence for non-competitive antagonism towards the low-affinity site of β1-adrenoceptors.

    PubMed

    Schlicker, Eberhard; Pędzińska-Betiuk, Anna; Kozłowska, Hanna; Szkaradek, Natalia; Żelaszczyk, Dorota; Baranowska-Kuczko, Marta; Kieć-Kononowicz, Katarzyna; Marona, Henryk; Malinowska, Barbara

    2014-08-01

    β-Adrenoceptor antagonists are important drugs for the treatment of cardiovascular diseases and some of those drugs also block the so-called low-affinity site of β1-adrenoceptors although at much higher concentrations. This low-affinity site, also identified in vivo and in human tissue, may come into play under certain pathophysiological situations including arrhythmias. The aim of our study was to determine the potency of 14 compounds chemically related to bupranolol or bevantolol and two xanthone derivatives at the low-affinity site of the β1-adrenoceptor. The potency of the compounds at the low- and high-affinity site of β1-adrenoceptors (β1L and β1H; both increasing heart rate) was compared in the pithed rat. One compound was also studied in the isolated rat heart and its α1-adrenolytic effect determined in the isolated rat mesenteric artery. In the pithed rat, four compounds blocked the β1L-adrenoceptor at a ≥10-fold lower potency than the β1H-adrenoceptor whereas the xanthone derivative (-)-MH-3 was equipotent. In the spontaneously beating right atrium (-)-MH-3 was a non-competitive antagonist of comparable potency at either receptor; its apparent pD'2 value for the β1L-adrenoceptor ranged from 5.6 to 6.4 under various conditions, including the Langendorff preparation. Its apparent pA2 at the α1-adrenoceptor in the mesenteric artery was 8.4. (-)-MH-3 is the first compound with virtually the same potency at the low- and high-affinity site of β1-adrenoceptors in vivo; it appears to be a non-competitive antagonist at either site in vitro.

  14. Selectivity of bevantolol hydrochloride, a beta 1-adrenoceptor antagonist, in asthmatic patients.

    PubMed

    Löfdahl, C G; Svedmyr, K; Svedmyr, N

    1984-01-01

    Bevantolol hydrochloride, a new beta-adrenoceptor antagonist, has been shown to be cardioselective in animals. To evaluate its selectivity in humans, a double-blind, crossover study was conducted in 8 asthmatics. Following a single oral dose of placebo, bevantolol 75 or 150 mg or propranolol hydrochloride 40 mg, forced expiratory volume in 1 second (FEV1), heart rate, blood pressure and skeletal muscle tremor were measured before and after 4 increasing intravenous doses of terbutaline sulfate to establish terbutaline dose-response curves. The FEV1 decreased after all active treatments. During terbutaline infusions there was an increase in FEV1 after both bevantolol doses and placebo. The terbutaline dose-response curve after bevantolol shifted to the right, however. After propranolol, there was no increase in FEV1 during terbutaline stimulation. Heart rate and skeletal muscle tremor showed a similar pattern during the experiment. In dosages that have previously been shown to produce at least the same degree of blockade of exercise-induced tachycardia, bevantolol has less influence on terbutaline-induced bronchodilation, heart rate increase and skeletal muscle tremor than did propranolol. Thus bevantolol has relative beta 1-adrenoceptor antagonist selectivity. Drawing upon the results of a previous study in the same patients, we believe bevantolol, atenolol and metoprolol have similar beta 1-selectivity.

  15. Pannexin-1 channels do not regulate α1-adrenoceptor-mediated vasoconstriction in resistance arteries.

    PubMed

    Angus, James A; Betrie, Ashenafi H; Wright, Christine E

    2015-03-01

    Recent reports have provided evidence for a new concept that in small resistance arteries α1D-adrenoceptor-mediated contraction is intimately linked to pannexin-1 (Px1) hemichannels that open to allow the release of ATP, from the smooth muscle effector cell, that acts back on P2Y purinoceptors to cause contraction. This concept mainly relied on using mefloquine 10-20μM as a putative selective Px1 channel-blocking agent to completely inhibit the contraction to phenylephrine, but not K(+) 40mM. Lower concentrations of mefloquine had no effect. The purpose of the present study was to explore the specificity of mefloquine for Px1 channels and the role of these channels in small artery contraction. In mouse and rat isolated small resistance arteries, either pressurised or set up for wire myography, the effects of mefloquine on contractions to K(+), phenylephrine and a range of vasoconstrictor agents were assessed and compared with the Px1 channel inhibitor carbenoxolone. Mefloquine had a wide range of inhibitory actions at 10-20μM, some 200-fold above the concentrations previously shown to inhibit expressed Px1 channel activity. Mefloquine 3-10μM inhibited phenylephrine, U46619, vasopressin, endothelin-1, sympathetic nerve stimulation and K(+) 40mM-mediated contractions in rat and mouse small mesenteric, and mouse thoracodorsal, arteries. Carbenoxolone 1-100μM did not inhibit the contractile responses to these agents in small resistance arteries. The present study demonstrates that in small resistance arteries there is no evidence that Px1 channels releasing ATP have any role in the constrictor actions of α1-adrenoceptor activation.

  16. Proliferation in cardiac fibroblasts induced by β1-adrenoceptor autoantibody and the underlying mechanisms.

    PubMed

    Lv, Tingting; Du, Yunhui; Cao, Ning; Zhang, Suli; Gong, Yulin; Bai, Yan; Wang, Wen; Liu, Huirong

    2016-01-01

    Chronic sustained stimulation of β-adrenoceptor is closely related to cardiac fibrosis which is bad for cardiac function. Growing evidence showed that the high prevalence of β1-adrenoceptor autoantibody (β1-AA) in the sera of patients with various types of cardiovascular diseases decreased cardiac function. In the current study, we demonstrated that β1-AA impaired the cardiac function evaluated by echocardiography and that β1-AA triggered cardiac fibrosis in terms of increased expression of α-smooth muscle actin as the marker of myofibroblast and collagen deposition in a passive β1-AA immunized mice model during 16 weeks. Further, we showed that β1-AA activated β1-AR/cAMP/PKA pathway and promoted proliferation in primary cardiac fibroblasts through specific binding to β1-AR but not to β2-AR. Moreover, β1-AA was also likely to promote proliferation in cardiac fibroblasts through activating p38MAPK and ERK1/2 as p38MAPK inhibitor SB203580 and ERK1/2 inhibitor PD98059 partially reversed the proliferative effect. The persistent activating signalling of PKA and P38MAPK in 1 h induced by β1-AA was associated with lacking agonist-induced desensitization phenomena. The conditioned medium from β1-AA-stimulated cardiac fibroblasts induced cardiomyocyte apoptosis, which indicated that β1-AA changed the secretion of cardiac fibroblasts contributing to cardiac injury. These findings will contribute to our understanding of the pathological mechanisms of β1-AA. PMID:27577254

  17. Membrane Potential Controls the Efficacy of Catecholamine-induced β1-Adrenoceptor Activity.

    PubMed

    Birk, Alexandra; Rinne, Andreas; Bünemann, Moritz

    2015-11-01

    G protein-coupled receptors (GPCRs) are membrane-located proteins and, therefore, are exposed to changes in membrane potential (V(M)) in excitable tissues. These changes have been shown to alter receptor activation of certain Gi-and Gq-coupled GPCRs. By means of a combination of whole-cell patch-clamp and Förster resonance energy transfer (FRET) in single cells, we demonstrate that the activation of the Gs-coupled β1-adrenoreceptor (β1-AR) by the catecholamines isoprenaline (Iso) and adrenaline (Adr) is regulated by V(M). This voltage-dependence is also transmitted to G protein and arrestin 3 signaling. Voltage-dependence of β2-AR activation, however, was weak compared with β1-AR voltage-dependence. Drug efficacy is a major target of β1-AR voltage-dependence as depolarization attenuated receptor activation, even under saturating concentrations of agonists, with significantly faster kinetics than the deactivation upon agonist withdrawal. Also the efficacy of the endogenous full agonist adrenaline was reduced by depolarization. This is a unique finding since reports of natural full agonists at other voltage-dependent GPCRs only show alterations in affinity during depolarization. Based on a Boltzmann function fit to the relationship of V(M) and receptor-arrestin 3 interaction we determined the voltage-dependence with highest sensitivity in the physiological range of membrane potential. Our data suggest that under physiological conditions voltage regulates the activity of agonist-occupied β1-adrenoceptors on a very fast time scale.

  18. Proliferation in cardiac fibroblasts induced by β1-adrenoceptor autoantibody and the underlying mechanisms

    PubMed Central

    Lv, Tingting; Du, Yunhui; Cao, Ning; Zhang, Suli; Gong, Yulin; Bai, Yan; Wang, Wen; Liu, Huirong

    2016-01-01

    Chronic sustained stimulation of β-adrenoceptor is closely related to cardiac fibrosis which is bad for cardiac function. Growing evidence showed that the high prevalence of β1-adrenoceptor autoantibody (β1-AA) in the sera of patients with various types of cardiovascular diseases decreased cardiac function. In the current study, we demonstrated that β1-AA impaired the cardiac function evaluated by echocardiography and that β1-AA triggered cardiac fibrosis in terms of increased expression of α-smooth muscle actin as the marker of myofibroblast and collagen deposition in a passive β1-AA immunized mice model during 16 weeks. Further, we showed that β1-AA activated β1-AR/cAMP/PKA pathway and promoted proliferation in primary cardiac fibroblasts through specific binding to β1-AR but not to β2-AR. Moreover, β1-AA was also likely to promote proliferation in cardiac fibroblasts through activating p38MAPK and ERK1/2 as p38MAPK inhibitor SB203580 and ERK1/2 inhibitor PD98059 partially reversed the proliferative effect. The persistent activating signalling of PKA and P38MAPK in 1 h induced by β1-AA was associated with lacking agonist-induced desensitization phenomena. The conditioned medium from β1-AA-stimulated cardiac fibroblasts induced cardiomyocyte apoptosis, which indicated that β1-AA changed the secretion of cardiac fibroblasts contributing to cardiac injury. These findings will contribute to our understanding of the pathological mechanisms of β1-AA. PMID:27577254

  19. Rayleigh light scattering detection of three α1-adrenoceptor antagonists coupled with high performance liquid chromatograph

    NASA Astrophysics Data System (ADS)

    Li, Ai Ping; Peng, Huanjun; Peng, Jing Dong; Zhou, Ming Qiong; Zhang, Jing

    2015-08-01

    Herein, a Rayleigh light-scattering (RLS) detection method combined with high performance liquid chromatograph (HPLC) without any post-column probe was developed for the separation and determination of three α1-adrenoceptor antagonists. The quantitative analysis is benefiting from RLS signal enhancement upon addition of methanol which induced molecular aggregation to form an hydrophobic interface between aggregates and water that produce a sort of superficial enhanced scattering effect. A good chromatographic separation among the compounds was achieved using a Gemini 5u C18 reversed phase column (250 mm × 4.6 mm; 4 μm) with a mobile phase consisting of methanol and ammonium acetate-formic acid buffer solution (25 mM; pH = 3.0) at the flow rate of 0.7 mL min-1. The RLS signal was monitored at λex = λem = 354 nm. A limit of detection (LOD) of 0.065-0.70 μg L-1 was reached and a linear range was found between peak height and concentration in the range of 0.75-15 μg L-1 for doxazosin mesylate (DOX), 0.075-3.0 μg L-1 for prazosin hydrochloride (PRH), and 0.25-5 μg L-1 for terazosin hydrochloride (TEH), with linear regression coefficients all above 0.999. Recoveries from spiked urine samples were 88.4-99.0% which is within acceptable limits. The proposed method is convenient, reliable and sensitive which has been used successfully in human urine samples.

  20. Alpha 1D- and alpha 1A-adrenoceptors mediate contraction in rat renal artery.

    PubMed

    Villalobos-Molina, R; López-Guerrero, J J; Ibarra, M

    1997-03-19

    To investigate the alpha 1-adrenoceptor subtype(s) mediating contraction in rat renal artery, we have compared the effect of the alpha 1-adrenoceptor antagonists, 5-methylurapidil, BMY 7378 (8-(2-(4-(2-methoxyphenyl)-1-piperazinyl) ethyl) 8-azaspiro (4.5) decane-7,9-dione 2HCl) and chloroethylclonidine on functional responses to noradrenaline. A clear blockade by chloroethylclonidine (10(-4) M) of noradrenaline-induced contraction was observed and, along with this effect. pKB values of 9.12 and 8.40 for BMY 7378 and 9.75 and 10.06 for 5-methylurapidil were obtained, indicating that the renal artery expresses the alpha 1D-adrenoceptor subtype as the one involved in contraction and not only the alpha 1A subtype as has been reported. PMID:9098691

  1. Effects of α1-adrenoceptor agonist phenylephrine on swelling-activated chloride currents in human atrial myocytes.

    PubMed

    Li, Yetao; Du, Xinling

    2015-02-01

    Swelling-activated chloride currents (ICl.swell) play an important role in cardiac electrophysiology and arrhythmogenesis. However, the regulation of these currents has not been clarified to date. In this research, we focused on the function of phenylephrine, an α1-adrenoceptor agonist, in the regulation of I(Cl.swell) in human atrial myocytes. We recorded I(Cl.swell) evoked by a hypotonic bath solution with the whole-cell patch-clamp technique. We found that I(Cl.swell) increased over time, and it was difficult to achieve absolute steady state. Phenylephrine potentiated I(Cl.swell) from -1.00 ± 0.51 pA/pF at -90 mV and 2.58 ± 1.17 pA/pF at +40 mV to -1.46 ± 0.70 and 3.84 ± 1.67 pA/pF, respectively (P < 0.05, n = 6), and the upward trend in ICl.swell was slowed after washout. This effect was concentration-dependent, and the α1-adrenoceptor antagonist prazosin shifted the dose-effect curve rightward. Addition of prazosin or the protein kinase C (PKC) inhibitor bisindolylmaleimide (BIM) attenuated the effect of phenylephrine. The PKC activator phorbol 12,13-dibutyrate (PDBu) activated I(Cl.swell) from -1.69 ± 1.67 pA/pF at -90 mV and 5.58 ± 6.36 pA/pF at +40 mV to -2.41 ± 1.95 pA/pF and 7.05 ± 6.99 pA/pF, respectively (P < 0.01 at -90 mV and P < 0.05 at +40 mV; n = 6). In conclusion, the α1-adrenoceptor agonist phenylephrine augmented I(Cl.swell), a result that differs from previous reports in other animal species. The effect was attenuated by BIM and mimicked by PDBu, which indicates that phenylephrine might modulate I(Cl,swell) in a PKC-dependent manner.

  2. The activation of α1-adrenoceptors is implicated in the antidepressant-like effect of creatine in the tail suspension test.

    PubMed

    Cunha, Mauricio P; Pazini, Francis L; Oliveira, Ágatha; Bettio, Luis E B; Rosa, Julia M; Machado, Daniele G; Rodrigues, Ana Lúcia S

    2013-07-01

    The antidepressant-like activity of creatine in the tail suspension test (TST) was demonstrated previously by our group. In this study we investigated the involvement of the noradrenergic system in the antidepressant-like effect of creatine in the mouse TST. In the first set of experiments, creatine administered by i.c.v. route (1 μg/site) decreased the immobility time in the TST, suggesting the central effect of this compound. The anti-immobility effect of peripheral administration of creatine (1 mg/kg, p.o.) was prevented by the pretreatment of mice with α-methyl-p-tyrosine (100 mg/kg, i.p., inhibitor of tyrosine hydroxylase), prazosin (1 mg/kg, i.p., α1-adrenoceptor antagonist), but not by yohimbine (1 mg/kg, i.p., α2-adrenoceptor antagonist). Creatine (0.01 mg/kg, subeffective dose) in combination with subeffective doses of amitriptyline (1 mg/kg, p.o., tricyclic antidepressant), imipramine (0.1 mg/kg, p.o., tricyclic antidepressant), reboxetine (2 mg/kg, p.o., selective noradrenaline reuptake inhibitor) or phenylephrine (0.4 μg/site, i.c.v., α1-adrenoceptor agonist) reduced the immobility time in the TST as compared with either drug alone. These results indicate that the antidepressant-like effect of creatine is likely mediated by an activation of α1-adrenoceptor and that creatine produces synergistic effects in the TST with antidepressants that modulate noradrenaline transporter, suggesting that an improvement in the response to the antidepressant therapy may occur when creatine is combined with these antidepressants. Furthermore, the synergistic effect of creatine (0.01 mg/kg, p.o.) and reboxetine (2 mg/kg, p.o.) combination was abolished by the α1-adrenoceptor antagonist prazosin, indicating that the antidepressant-like effect of combined therapy is likely mediated by an activation of α1-adrenoceptor.

  3. Functional evidence equating the pharmacologically-defined alpha 1A- and cloned alpha 1C-adrenoceptor: studies in the isolated perfused kidney of rat.

    PubMed Central

    Blue, D. R.; Bonhaus, D. W.; Ford, A. P.; Pfister, J. R.; Sharif, N. A.; Shieh, I. A.; Vimont, R. L.; Williams, T. J.; Clarke, D. E.

    1995-01-01

    1. The present study characterizes and classifies alpha 1-adrenoceptor-mediated vasoconstriction in the isolated perfused kidney of rat using quantitative receptor pharmacology and compares the results to radioligand binding studies (made in cloned alpha 1-adrenoceptor subtypes, native alpha 1A-adrenoceptors in submaxillary gland of rat, and alpha 1A-adrenoceptors in several other tissues of rat). 2. Concentration-effect curves to noradrenaline in the presence of 5-methyl-urapidil were biphasic, indicating alpha 1-adrenoceptor heterogeneity. The alpha 1-adrenoceptor subtype mediating the first phase (low affinity for 5-methyl-urapidil) could not be 'isolated' for detailed pharmacological characterization but was defined by a sensitivity to inhibition by chloroethylclonidine and an inability of methoxamine to activate the site. Additionally, vasoconstriction mediated by this alpha 1-adrenoceptor subtype or subtypes was abolished by nitrendipine (1 microM), thereby allowing characterization of the second, high affinity site for 5-methyl-urapidil. 3. The following antagonists interacted competitively with noradrenaline at the alpha 1-adrenoceptor for which 5-methyl-urapidil exhibits high affinity (pKB value): WB 4101 (10.3) > prazosin (9.5) approximately HV 723 (9.3) approximately 5-methyl-urapidil (9.2) > phenotolamine (8.6) > spiperone (pA2 = 8.1) approximately oxymetazoline (7.9). In contrast, insurmountable antagonism was seen with S(+)- and R(-)-niguldipine, the S(+)-isomer being approximately 30 fold more potent than the R(-)-isomer. Receptor protection experiments indicated that S(+)-niguldipine interacted directly with alpha 1-adrenoceptors. Dehydroniguldipine acted as a competitive antagonist (pKB = 9.0). Thus, the results with antagonists define the alpha 1-adrenoceptor as an alpha 1A-adrenoceptor. 4. An agonist 'fingerprint' was constructed in the presence of nitrendipine to define further the alpha 1A-adrenoceptor. The following order and relativity of

  4. Attenuation of ischaemia-induced regional myocardial acidosis by bevantolol, a beta 1-adrenoceptor antagonist, in dogs.

    PubMed

    Hino, T; Sakai, K; Ichihara, K; Abiko, Y

    1989-04-01

    In dogs anaesthetized with pentobarbital, the left anterior descending coronary artery (LAD) was occluded for 90 min. so that about 1/2 of the original flow was allowed to flow (partial occlusion). Bevantolol (a beta 1-adrenoceptor antagonist) or propranolol (a reference drug) was injected intravenously 30 min. after partial occlusion. Regional myocardial pH was measured by a micro glass pH electrode inserted in the LAD area. Partial occlusion decreased myocardial pH by 0.62 to 0.74. Bevantolol (1.0 mg/kg) or propranolol (1.0 mg/kg) significantly increased myocardial pH, that had been decreased by partial occlusion, within 60 min. after the injection. Restoration of myocardial [H+] (defined as return towards a lower [H+] to the preocclusion level) (calculated from the pH data) induced by bevantolol and that induced by propranolol were 64.0 and 66.4% (measured 60 min. after the injection), respectively. Bevantolol or propranolol decreased heart rate also. Even in the paced heart, bevantolol restored the myocardial [H+] that had been increased by partial occlusion. These results suggest that bevantolol has a favorable effect on the ischaemic myocardium as has propranolol, and that the pH effect of bevantolol is not primarily due to a decrease in heart rate.

  5. α1-Adrenoceptors in the hippocampal dentate gyrus involved in learning-dependent long-term potentiation during active-avoidance learning in rats.

    PubMed

    Lv, Jing; Zhan, Su-Yang; Li, Guang-Xie; Wang, Dan; Li, Ying-Shun; Jin, Qing-Hua

    2016-11-01

    The hippocampus is the key structure for learning and memory in mammals and long-term potentiation (LTP) is an important cellular mechanism responsible for learning and memory. The influences of norepinephrine (NE) on the modulation of learning and memory, as well as LTP, through β-adrenoceptors are well documented, whereas the role of α1-adrenoceptors in learning-dependent LTP is not yet clear. In the present study, we measured extracellular concentrations of NE in the hippocampal dentate gyrus (DG) region using an in-vivo brain microdialysis and high-performance liquid chromatography techniques during the acquisition and extinction of active-avoidance behavior in freely moving conscious rats. Next, the effects of prazosin (an antagonist of α1-adrenoceptor) and phenylephrine (an agonist of the α1-adrenoceptor) on amplitudes of field excitatory postsynaptic potential were measured in the DG region during the active-avoidance behavior. Our results showed that the extracellular concentration of NE in the DG was significantly increased during the acquisition of active-avoidance behavior and gradually returned to the baseline level following extinction training. A local microinjection of prazosin into the DG significantly accelerated the acquisition of the active-avoidance behavior, whereas a local microinjection of phenylephrine retarded the acquisition of the active-avoidance behavior. Furthermore, in all groups, the changes in field excitatory postsynaptic potential amplitude were accompanied by corresponding changes in active-avoidance behavior. Our results suggest that NE activation of α1-adrenoceptors in the hippocampal DG inhibits active-avoidance learning by modulation of synaptic efficiency in rats.

  6. α1-Adrenoceptors in the hippocampal dentate gyrus involved in learning-dependent long-term potentiation during active-avoidance learning in rats.

    PubMed

    Lv, Jing; Zhan, Su-Yang; Li, Guang-Xie; Wang, Dan; Li, Ying-Shun; Jin, Qing-Hua

    2016-11-01

    The hippocampus is the key structure for learning and memory in mammals and long-term potentiation (LTP) is an important cellular mechanism responsible for learning and memory. The influences of norepinephrine (NE) on the modulation of learning and memory, as well as LTP, through β-adrenoceptors are well documented, whereas the role of α1-adrenoceptors in learning-dependent LTP is not yet clear. In the present study, we measured extracellular concentrations of NE in the hippocampal dentate gyrus (DG) region using an in-vivo brain microdialysis and high-performance liquid chromatography techniques during the acquisition and extinction of active-avoidance behavior in freely moving conscious rats. Next, the effects of prazosin (an antagonist of α1-adrenoceptor) and phenylephrine (an agonist of the α1-adrenoceptor) on amplitudes of field excitatory postsynaptic potential were measured in the DG region during the active-avoidance behavior. Our results showed that the extracellular concentration of NE in the DG was significantly increased during the acquisition of active-avoidance behavior and gradually returned to the baseline level following extinction training. A local microinjection of prazosin into the DG significantly accelerated the acquisition of the active-avoidance behavior, whereas a local microinjection of phenylephrine retarded the acquisition of the active-avoidance behavior. Furthermore, in all groups, the changes in field excitatory postsynaptic potential amplitude were accompanied by corresponding changes in active-avoidance behavior. Our results suggest that NE activation of α1-adrenoceptors in the hippocampal DG inhibits active-avoidance learning by modulation of synaptic efficiency in rats. PMID:27603730

  7. Cardiovascular effects of bevantolol, a selective beta 1-adrenoceptor antagonist with a novel pharmacological profile.

    PubMed Central

    Dukes, I. D.; Vaughan Williams, E. M.

    1985-01-01

    Bevantolol was more potent in blocking the chronotropic than the hypotensive effects of isoprenaline in pithed rats. Bevantolol itself induced bradycardia, so that it was not possible to estimate the pA2 from nonparallel dose-response curves relating isoprenaline concentration to tachycardia. Bevantolol caused hypertension in pithed rats, an effect attenuated by phentolamine, implying that bevantolol may be an alpha-adrenoceptor agonist. Bevantolol potentiated the pressor effects of noradrenaline, the maximum potentiation equalling that produced by prior chemical sympathectomy with guanethidine, implying that bevantolol may block noradrenaline uptake. In isolated atria bevantolol-induced bradycardia was associated with a positive shift in take-off potential, a reduction in the maximum rate of depolarization (Vmax), and a lengthening of action potential duration (APD). No change in the slope of the slow diastolic depolarization occurred except at the highest concentration (18 mumol l(-1). In atrial and ventricular muscle bevantolol reduced Vmax and overshoot potential, implying reduction of fast inward sodium current (Class I antiarrhythmic action). In pithed rats bevantolol lengthened the P-R interval in the ECG, and produced atrioventricular (A-V) block, and bundle-branch block. In isolated A-V nodal preparations, intranodal conduction time was greatly increased, implying restriction of inward current through calcium channels responsible for nodal depolarization. Bevantolol had no negative inotropic effect in pithed rats, or in isolated atria, and did not alter the positive inotropic effect of raised extracellular calcium concentration, implying absence of restriction of current through calcium channels controlling contraction of the myocardium. Images Figure 1 PMID:2858236

  8. Cardiovascular effects of bevantolol, a selective beta 1-adrenoceptor antagonist with a novel pharmacological profile.

    PubMed

    Dukes, I D; Vaughan Williams, E M

    1985-02-01

    Bevantolol was more potent in blocking the chronotropic than the hypotensive effects of isoprenaline in pithed rats. Bevantolol itself induced bradycardia, so that it was not possible to estimate the pA2 from nonparallel dose-response curves relating isoprenaline concentration to tachycardia. Bevantolol caused hypertension in pithed rats, an effect attenuated by phentolamine, implying that bevantolol may be an alpha-adrenoceptor agonist. Bevantolol potentiated the pressor effects of noradrenaline, the maximum potentiation equalling that produced by prior chemical sympathectomy with guanethidine, implying that bevantolol may block noradrenaline uptake. In isolated atria bevantolol-induced bradycardia was associated with a positive shift in take-off potential, a reduction in the maximum rate of depolarization (Vmax), and a lengthening of action potential duration (APD). No change in the slope of the slow diastolic depolarization occurred except at the highest concentration (18 mumol l(-1). In atrial and ventricular muscle bevantolol reduced Vmax and overshoot potential, implying reduction of fast inward sodium current (Class I antiarrhythmic action). In pithed rats bevantolol lengthened the P-R interval in the ECG, and produced atrioventricular (A-V) block, and bundle-branch block. In isolated A-V nodal preparations, intranodal conduction time was greatly increased, implying restriction of inward current through calcium channels responsible for nodal depolarization. Bevantolol had no negative inotropic effect in pithed rats, or in isolated atria, and did not alter the positive inotropic effect of raised extracellular calcium concentration, implying absence of restriction of current through calcium channels controlling contraction of the myocardium.

  9. The three α1-adrenoceptor subtypes show different spatio-temporal mechanisms of internalization and ERK1/2 phosphorylation.

    PubMed

    Perez-Aso, M; Segura, V; Montó, F; Barettino, D; Noguera, M A; Milligan, G; D'Ocon, P

    2013-10-01

    We analyzed the kinetic and spatial patterns characterizing activation of the MAP kinases ERK 1 and 2 (ERK1/2) by the three α1-adrenoceptor (α1-AR) subtypes in HEK293 cells and the contribution of two different pathways to ERK1/2 phosphorylation: protein kinase C (PKC)-dependent ERK1/2 activation and internalization-dependent ERK1/2 activation. The different pathways of phenylephrine induced ERK phosphorylation were determined by western blot, using the PKC inhibitor Ro 31-8425, the receptor internalization inhibitor concanavalin A and the siRNA targeting β-arrestin 2. Receptor internalization properties were studied using CypHer5 technology and VSV-G epitope-tagged receptors. Activation of α1A- and α1B-ARs by phenylephrine elicited rapid ERK1/2 phosphorylation that was directed to the nucleus and inhibited by Ro 31-8425. Concomitant with phenylephrine induced receptor internalization α1A-AR, but not α1B-AR, produced a maintained and PKC-independent ERK phosphorylation, which was restricted to the cytosol and inhibited by β-arrestin 2 knockdown or concanavalin A treatment. α1D-AR displayed constitutive ERK phosphorylation, which was reduced by incubation with prazosin or the selective α1D antagonist BMY7378. Following activation by phenylephrine, α1D-AR elicited rapid, transient ERK1/2 phosphorylation that was restricted to the cytosol and not inhibited by Ro 31-8425. Internalization of the α1D-AR subtype was not observed via CypHer5 technology. The three α1-AR subtypes present different spatio-temporal patterns of receptor internalization, and only α1A-AR stimulation translates to a late, sustained ERK1/2 phosphorylation that is restricted to the cytosol and dependent on β-arrestin 2 mediated internalization.

  10. Evidence for an age-dependent functional expression of alpha 1D-adrenoceptors in the rat vasculature.

    PubMed

    Ibarra, M; Terrón, J A; López-Guerrero, J J; Villalobos-Molina, R

    1997-03-19

    The role of the alpha 1-adrenoceptor subtypes, and their possible change with maturation, in alpha 1-adrenoceptor-induced pressor responses in the rat has not been established. Thus, the effects of the alpha 1D-, alpha 1A/1D- and alpha 1B/1D-adrenoceptor antagonists, BMY 7378 (8-(2-(4-(2-methoxyphenyl)-1-piperazinyl)ethyl) 8-azaspiro (4.5) decane-7,9-dione 2HCl), 5-methyl-urapidil and chloroethylclonidine, respectively, on the pressor responses induced by phenylephrine in 1- and 5-month-old pithed rats were investigated. The pressor responses induced by phenylephrine were competitively antagonized by both BMY 7378 and chloroethylclonidine in 5-month-old, but not in young immature animals; in marked contrast, 5-methylurapidil antagonized with similar potency the phenylephrine-induced pressor responses in animals of both ages. The present pharmacological data suggest that functional expression of alpha 1D-adrenoceptors in the rat resistance vessels increases with age; alpha 1A-, but not alpha 1B- or alpha 1D-adrenoceptors, seem to predominate in immature animals. These findings represent the first evidence that age-related changes in functional alpha 1-adrenoceptor subtypes occur in the systemic vasculature in vivo. PMID:9098690

  11. Pre- and neonatal exposure of the Dahl rat to NaCl: development and regional distribution of myocardial alpha 1-adrenergic and cholinergic receptor sites.

    PubMed

    McCaughran, J A; Juno, C J; Friedman, R

    1986-06-01

    The prenatal and/or postweaning effects of a hypertensinogenic high NaCl-containing diet (8.0% NaCl, w/w) on (1) the regional distribution of alpha 1-adrenoceptors and muscarinic cholinergic receptor sites in the heart and (2) the predisposition/resistance to hypertension (HT) were assessed in the inbred Dahl HT-sensitive (S/JR) and HT-resistant (R/JR) rat. The density of alpha 1-adrenoceptors was reduced in the left ventricle but not consistently affected in the ventricular septum, right ventricle, or atria of S/JR offspring with NaCl-induced HT. Both normotensive and hypertensive S/JR rats also displayed a significantly greater density of cholinergic receptor sites in the atria but few consistent alterations in other regions of the heart, compared to R/JR rats. Maternal diet had no effect on the predisposition/resistance to salt-induced HT and little effect on the regional development of alpha 1-adrenoceptors and cholinergic receptor sites. The results of this study suggest that the reduced density of ventricular alpha 1-adrenoceptors in the S/JR strain is a consequence of HT while the elevated density of cholinergic receptors in the atria may be related to the genetic predisposition/resistance to HT.

  12. Effects of alpha1-adrenergic receptor blockade by doxazosin on renin-angiotensin system-regulating aminopeptidase and vasopressin-degrading activities in male and female rat thalamus.

    PubMed

    de la Chica-Rodríguez, S; Cortés-Denia, P; Ramírez-Expósito, M J; Martínez-Martos, J M

    2007-11-01

    The thalamus has connections with central autonomic centers involved in cardiovascular control and is enervated by noradrenergic fibers. The excitability of thalamic neurons is due to a reduction of ionic currents mediated by alpha(1)-adrenoceptors. The brain renin- angiotensin system (RAS) and the peptide hormone arginine-vasopressin (AVP) are also involved in the central control of blood pressure, and fluid and electrolyte homeostasis. It has been extensively reported that aminopeptidase A (APA), aminopeptidase B (APB), aminopeptidase N (APN), and vasopressin-degrading cystyl aminopeptidase activity (AVP-DA) play an important role in the regulation of the activity of angiotensins and AVP. We have analyzed the effect of alpha(1)-adrenoceptor blockade by doxazosin on RAS-regulating aminopeptidase activities and AVP-DA in soluble and membrane-bound fractions of male and female rat thalamus. Our results show that alpha(1)-adrenoceptors blockade by doxazosin does not modify the RAS through its degrading peptidases at thalamic level either in male or female rats. However, alpha(1)-adrenoceptors blockade shows gender differences in AVP-DA, increasing in males but not in females, supporting an increased capacity of males against females to degrade AVP and, therefore, to regulate cardiovascular homeostasis, under this pharmacological manipulation.

  13. Preferential reduction of binding of sup 125 I-iodopindolol to beta-1 adrenoceptors in the amygdala of rat after antidepressant treatments

    SciTech Connect

    Ordway, G.A.; Gambarana, C.; Tejani-Butt, S.M.; Areso, P.; Hauptmann, M.; Frazer, A. )

    1991-05-01

    This study utilized quantitative receptor autoradiography to examine the effects of repeated administration of antidepressants to rats on the binding of the beta adrenoceptor antagonist, {sup 125}I-iodopindolol ({sup 125}I-IPIN) to either beta-1 or beta-2 adrenoceptors in various regions of brain. Antidepressants were selected to represent various chemical and pharmacological classes including tricyclic compounds (desipramine and protriptyline), monoamine oxidase inhibitors (clorgyline, phenelzine and tranylcypromine), atypical antidepressants (mianserin and trazodone) and selective inhibitors of the uptake of serotonin (citalopram and sertraline). Additionally, rats were treated with various psychotropic drugs that lack antidepressant efficacy (cocaine, deprenyl, diazepam and haloperidol). Repeated treatment of rats with desipramine, protriptyline, clorgyline, phenelzine, tranylcypromine or mianserin reduced the binding of {sup 125}I-IPIN to beta-1 adrenoceptors in many brain areas. Only in the basolateral and lateral nuclei of the amygdala did all six of these antidepressants significantly reduce {sup 125}I-IPIN binding to beta-1 adrenoceptors. In these amygdaloid nuclei, the magnitude of the reduction in the binding of {sup 125}I-IPIN caused by each of these drugs was comparable to or greater than the reduction in binding produced in any other region of brain. Reductions of binding of {sup 125}I-IPIN after antidepressant treatments were not consistently observed in the cortex, the area of brain examined most often in homogenate binding studies. Only the monoamine oxidase inhibitors caused reductions in the binding of {sup 125}I-IPIN to beta-2 adrenoceptors, and this effect was generally localized to the amygdala and hypothalamus.

  14. Both α1- and β1-adrenoceptors in the bed nucleus of the stria terminalis are involved in the expression of conditioned contextual fear

    PubMed Central

    Hott, Sara C; Gomes, Felipe V; Fabri, Denise RS; Reis, Daniel G; Crestani, Carlos C; Côrrea, Fernando MA; Resstel, Leonardo BM

    2012-01-01

    BACKGROUND AND PURPOSE The bed nucleus of the stria terminalis (BNST) is a limbic structure that is involved in the expression of conditioned contextual fear. Among the numerous neural inputs to the BNST, noradrenergic synaptic terminals are prominent and some evidence suggests an activation of this noradrenergic neurotransmission in the BNST during aversive situations. Here, we have investigated the involvement of the BNST noradrenergic system in the modulation of behavioural and autonomic responses induced by conditioned contextual fear in rats. EXPERIMENTAL APPROACH Male Wistar rats with cannulae bilaterally implanted into the BNST were submitted to a 10 min conditioning session (6 footshocks, 1.5 ma/ 3 s). Twenty-four hours later freezing and autonomic responses (mean arterial pressure, heart rate and cutaneous temperature) to the conditioning box were measured for 10 min. The adrenoceptor antagonists were administered 10 min before the re-exposure to the aversive context. KEY RESULTS L-propranolol, a non-selective β-adrenoceptor antagonist, and phentolamine, a non-selective α-adrenoceptor antagonist, reduced both freezing and autonomic responses induced by aversive context. Similar results were observed with CGP20712, a selective β1-adrenoceptor antagonist, and WB4101, a selective α1-antagonist, but not with ICI118,551, a selective β2-adrenoceptor antagonist or RX821002, a selective α2-antagonist. CONCLUSIONS AND IMPLICATIONS These findings support the idea that noradrenergic neurotransmission in the BNST via α1- and β1-adrenoceptors is involved in the expression of conditioned contextual fear. PMID:22506532

  15. Distribution and function of peripheral alpha-adrenoceptors in the cardiovascular system.

    PubMed

    Ruffolo, R R

    1985-05-01

    alpha-Adrenoceptors may be subdivided based on their anatomical distribution within the synapse. Presynaptic alpha-adrenoceptors are generally of the alpha 2-subtype and modulate neurotransmitter liberation via a negative feedback mechanism. Postsynaptic alpha-adrenoceptors are usually of the alpha 1-subtype and mediate the response of the effector organ. Although this "anatomical" subclassification is generally applicable, many exceptions exist. A more useful classification of alpha-adrenoceptor subtypes is based on a pharmacological characterization in which selective agonists and antagonists are used. Peripheral alpha-adrenoceptors are critical in the regulation of the cardiovascular system. Postsynaptic alpha-adrenoceptors in arteries and veins represent a mixed population of alpha 1/alpha 2-adrenoceptors, with both subtypes mediating vasoconstriction. In the peripheral arterial circulation, postsynaptic vascular alpha 1-adrenoceptors are found in the adrenergic neuroeffector junction, whereas postsynaptic vascular alpha 2-adrenoceptors are located extrajunctionally. In the venous circulation, it appears that alpha 2-adrenoceptors may be predominantly junctional, whereas alpha 1-adrenoceptors may be predominantly extrajunctional. It has been proposed that junctional alpha-adrenoceptors will respond predominantly to norepinephrine liberated from sympathetic neurons, whereas extrajunctional alpha-adrenoceptors likely respond to circulating catecholamines. The functional role of extrajunctional alpha-adrenoceptors may be more important in disease states such as hypertension and congestive heart failure where circulating levels of catecholamines may be high and contribute to the maintenance of elevated vascular resistance. alpha 2-Adrenoceptors are also associated with the intima and may play a role in the release of an endogenous relaxing factor from the endothelium.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2989947

  16. Upregulation of α1-adrenoceptors on cutaneous nerve fibres after partial sciatic nerve ligation and in complex regional pain syndrome type II.

    PubMed

    Drummond, Peter D; Drummond, Eleanor S; Dawson, Linda F; Mitchell, Vanessa; Finch, Philip M; Vaughan, Christopher W; Phillips, Jacqueline K

    2014-03-01

    After peripheral nerve injury, nociceptive afferents acquire an abnormal excitability to adrenergic agents, possibly due to an enhanced expression of α1-adrenoceptors (α1-ARs) on these nerve fibres. To investigate this in the present study, changes in α1-AR expression on nerve fibres in the skin and sciatic nerve trunk were assessed using immunohistochemistry in an animal model of neuropathic pain involving partial ligation of the sciatic nerve. In addition, α1-AR expression on nerve fibres was examined in painful and unaffected skin of patients who developed complex regional pain syndrome (CRPS) after a peripheral nerve injury (CRPS type II). Four days after partial ligation of the sciatic nerve, α1-AR expression was greater on dermal nerve fibres that survived the injury than on dermal nerve fibres after sham surgery. This heightened α1-AR expression was observed on nonpeptidergic nociceptive afferents in the injured sciatic nerve, dermal nerve bundles, and the papillary dermis. Heightened expression of α1-AR in dermal nerve bundles after peripheral nerve injury also colocalized with neurofilament 200, a marker of myelinated nerve fibres. In each patient examined, α1-AR expression was greater on nerve fibres in skin affected by CRPS than in unaffected skin from the same patient or from pain-free controls. Together, these findings provide compelling evidence for an upregulation of α1-ARs on cutaneous nociceptive afferents after peripheral nerve injury. Activation of these receptors by circulating or locally secreted catecholamines might contribute to chronic pain in CRPS type II.

  17. Chronic Stress Impairs α1-Adrenoceptor-Induced Endocannabinoid-Dependent Synaptic Plasticity in the Dorsal Raphe Nucleus

    PubMed Central

    Shen, Roh-Yu

    2014-01-01

    Alpha 1-adrenergic receptors (α1-ARs) control the activity of dorsal raphe nucleus (DRn) serotonin (5-HT) neurons and play crucial role in the regulation of arousal and stress homoeostasis. However, the precise role of these receptors in regulating glutamate synapses of rat DRn 5-HT neurons and whether chronic stress exposure alters such regulation remain unknown. In the present study, we examined the impact of chronic restraint stress on α1-AR-mediated regulation of glutamate synapses onto DRn 5-HT neurons. We found that, in the control condition, activation of α1-ARs induced an inward current and long-term depression (LTD) of glutamate synapses of DRn 5-HT neurons. The α1-AR LTD was initiated by postsynaptic α1-ARs but mediated by a decrease in glutamate release. The presynaptic expression of the α1-AR LTD was signaled by retrograde endocannabinoids (eCBs). Importantly, we found that chronic exposure to restraint stress profoundly reduced the magnitude of α1-AR LTD but had no effect on the amplitude of α1-AR-induced inward current. Chronic restraint stress also reduced the CB1 receptor-mediated inhibition of EPSC and the eCB-mediated depolarization-induced suppression of excitation. Collectively, these results indicate that chronic restraint stress impairs the α1-AR LTD by reducing the function of presynaptic CB1 receptors and reveal a novel mechanism by which noradrenaline controls synaptic strength and plasticity in the DRn. They also provide evidence that chronic stress impairs eCB signaling in the DRn, which may contribute, at least in part, to the dysregulation of the stress homeostasis. PMID:25355210

  18. Pharmacology of alpha-adrenoceptors in male sexual function.

    PubMed

    Rampin, O

    1999-01-01

    Data issued from morphological and physiological experiments suggests that the noradrenergic system, through ascending pathways to the brain and descending pathways to the spinal cord, may regulate male sexual functions. Adrenoceptors have been shown to be present in the brain and spinal cord of animals and humans. The activity of spinal preganglionic neurons is modulated by noradrenaline. Pharmacological approaches aiming at selectively targeting alpha1- or alpha2-adrenoceptors have been conducted in patients with erectile dysfunction or in monkeys and rats in a variety of tests. Briefly, conclusions arising from these studies are: activation of alpha1-adrenoceptors facilitates copulation, where activation of alpha2-adrenoceptors inhibits copulation. alpha2-adrenoceptors antagonists like yohimbine facilitate sexual behavior, reducing ejaculation latency in male rats and increasing their sexual motivation. Furthermore, yohimbine induces copulation in rats either castrated or sexually naive. In contrast, activation of alpha1-adrenoceptors depresses sexual responses in another context, i.e. reflexive erections. Activation of alpha2-adrenoceptors activates reflexive erections in rats, and alpha2-adrenoceptors antagonists (yohimbine) inhibit them. Today's challenge is to separate the effects of any drug acting at the level of the alpha-adrenoceptors on the central vs. peripheral control of sexual functions, on the brain vs. spinal cord control of the same functions, and the search for any specialization of alpha-adrenoceptors subtypes in a given sexual function. Treatment of sexual dysfunctions in man (e.g. ejaculation) focusing on the spinal cord as a pharmacological target should also be expanded. Finally, considering the similarities between neural networks controlling male and female sexual functions, the treatment of female sexual dysfunction with comparable pharmacological approaches should be evaluated. PMID:10393482

  19. α1-Adrenoceptor activation of PKC-ε causes heterologous desensitization of thromboxane receptors in the aorta of spontaneously hypertensive rats

    PubMed Central

    Zhao, Yingzi; Vanhoutte, Paul M; Leung, Susan W S

    2015-01-01

    Background and Purpose In the aorta of adult spontaneously hypertensive (SHR), but not in that of normotensive Wistar-Kyoto (WKY), rats, previous exposure to phenylephrine inhibits subsequent contractions to PGE2. The present experiments were designed to examine the mechanism(s) underlying this inhibition. Experimental Approach Isometric tension was measured in isolated rings of SHR and WKY aortae. Gene expression and protein presence were measured by quantitative real-time PCR and Western blotting respectively. Key Results In aorta of 18 weeks SHR, but not age-matched WKY, pre-exposure to phenylephrine inhibited subsequent contractions to PGE2 that were mediated by thromboxane prostanoid (TP) receptors. This inhibition was not observed in preparations of pre-hypertensive 5-week-old SHR, and was significantly larger in those of 36- than 18-week-old SHR. Pre-exposure to the PKC activator, phorbol 12,13-dibutyrate, also inhibited subsequent contractions to PGE2 in SHR aortae. The selective inhibitor of PKC-ε, ε-V1-2, abolished the desensitization caused by pre-exposure to phenylephrine. Two molecular PKC bands were detected and their relative intensities differed in 36-week-old WKY and SHR vascular smooth muscle. The mRNA expressions of PKC-α, PKC-ε, PK-N2 and PKC-ζ and of G protein-coupled kinase (GRK)-2, GRK4 and β-arrestin2 were higher in SHR than WKY aortae. Conclusions and Implications These experiments suggest that in the SHR but not the WKY aorta, α1-adrenoceptor activation desensitizes TP receptors through activation of PKC-ε. This heterologous desensitization is a consequence of the chronic exposure to high arterial pressure. PMID:25857252

  20. Effect of repeated treatment with tianeptine and fluoxetine on the central alpha(1)-adrenergic system.

    PubMed

    Rogóz, Z; Skuza, G; Dlaboga, D; Maj, J; Dziedzicka-Wasylewska, M

    2001-09-01

    Tianeptine (TIA) is an antidepressant drug which enhances the reuptake of serotonin but, in contrast to tricyclics, shows no affinity for neurotransmitter receptors. The present study was aimed at determining whether repeated TIA treatment induced adaptive changes in the alpha(1)-adrenergic system, similar to those reported by us earlier for tricyclic antidepressants. The experiments were carried out on male mice and rats. TIA was administered at a dose of 5 or 10mg/kg once or repeatedly (twice daily for 14 days) and fluoxetine (FLU), used as a reference compound, at a dose of 10mg/kg. The obtained results showed that TIA administered repeatedly potentiated the methoxamine- and phenylephrine (PHEN)-induced exploratory hyperactivity in rats and clonidine-induced aggressiveness in mice, the effects mediated by alpha(1)-adrenoceptors. TIA given repeatedly (but not acutely) increased the binding (B(max)) of alpha(1)-adrenergic receptors in cerebral cortex for [(3)H]prazosin. However, the ability of the alpha(1)-adrenoceptor agonist PHEN to compete for these sites was not significantly changed. The above results indicate that repeated TIA administration increases the responsiveness of the alpha(1)-adrenergic system (behavioural and biochemical changes). On the other hand, FLU did not affect any behavioural and biochemical changes in this system.

  1. [Additional administration of dutasteride in patients with benign prostatic hyperplasia who did not respond sufficiently to α1-adrenoceptor antagonist : investigation of clinical factors affecting the therapeutic effect of dutasteride].

    PubMed

    Masuda, Mitsunobu; Murai, Tetsuo; Osada, Yutaka; Kawai, Masaki; Kasuga, Jun; Yokomizo, Yumiko; Kuroda, Shinnosuke; Nakamura, Mami; Noguchi, Go

    2014-02-01

    We performed additional administration of dutasteride in patients who did not respond sufficiently to α1-adrenoceptor antagonist treatment for lower urinary tract symptoms (LUTS) associated with benign prostatic hyperplasia (BPH) (LUTS/BPH). Among 76 registered patients, efficacy was analyzed in 58 patients. International Prostate Symptom Score (IPSS), subscores for voiding and storage symptoms and quality of life (QOL) on the IPSS, and Overactive Bladder Symptom Score (OABSS) were all significantly improved from the third month of administration compared to the time of initiating additional administration of dutasteride. Additional administration of dutasteride also significantly reduced prostate volume, and residual urine with the exception of the sixth month after administration. Age at initiation of administration and voiding symptom subscore on the IPSS were clinical factors affecting the therapeutic effects of dutasteride. The rate of improvement with treatment decreased with increasing age at initiation of dutasteride administration, and increased as voiding symptom subscore on the IPSS increased. Therefore, additional administration of dutasteride appears useful for cases of LUTS/BPH in which a sufficient response is not achieved with α1-adrenoceptor antagonist treatment. Because patients who have severe voiding symptoms or begin dutasteride at an early age may be expected to respond particularly well to dutasteride in terms of clinical efficacy, they were considered to be suitable targets for additional administration. PMID:24755815

  2. alpha. -Adrenergic vasoconstriction and receptor subtypes in large coronary arteries of calves

    SciTech Connect

    Young, M.A.; Vatner, D.E.; Knight, D.R.; Graham, R.M.; Homcy, C.J.; Vatner, S.F. New England Regional Primate Research Center, Southborough, MA )

    1988-12-01

    The authors investigated {alpha}-adrenoceptor subtype distribution in large coronary arteries from both functional and biochemical perspectives. The effects of intracoronary administration of the selective {alpha}{sub 1}-adrenoceptor agonist phenylephrine, of the selective {alpha}{sub 2}-adrenoceptor agonist B-HT 920 and of the mixed {alpha}{sub 1+2}-adrenoceptor agonist norepinephrine were examined on measurements of left circumflex coronary artery diameter in conscious calves. After {beta}-adrenergic blockade, equivalent reductions in large coronary artery diameter were observed with phenylephrine, B-HT, and norepinephrine. Phenylephrine-induced constrictions were abolished by prazosin, an {alpha}{sub 1}-selective antagonist, but unaffected by rauwolscine, an {alpha}{sub 2}-selective antagonist. Conversely, the B-HT-induced constriction was abolished by rauwolscine but unaffected by prazosin. Coronary constriction with norepinephrine was attenuated with either prazosin or rauwolscine and abolished by the two antagonists combined. Ligand-binding studies in which ({sup 3}H)prazosin and ({sup 3}H)rauwolscine and sarcolemmal membranes were used revealed an {alpha}{sub 1}-adrenoceptor density of 15 {plus minus} 3.1 fmol/mg protein with a dissociation constant (K{sub D}) of 0.7 {plus minus} 0.2 nM and an {alpha}{sub 2}-adrenoceptor density of 68 {plus minus} 5.1 fmol/mg protein, with a K{sub D} of 7.4 {plus minus} 1.2 nM. Thus large coronary arteries of the calf contain both {alpha}{sub 1}- and {alpha}{sub 2}-adrenoceptor subtypes, each of which elicits constriction of the large coronary artery in the conscious animal.

  3. The subtype of alpha-adrenoceptor involved in the neural control of renal tubular sodium reabsorption in the rabbit.

    PubMed Central

    Hesse, I F; Johns, E J

    1984-01-01

    A study was undertaken in pentobarbitone anaesthetized rabbits, undergoing a saline diuresis, to determine the subtype of alpha-adrenoceptor mediating renal tubular sodium reabsorption. Stimulation of the renal nerves at low rates, to cause an 11% fall in renal blood flow, did not change glomerular filtration rate but significantly reduced urine flow rate, and absolute and fractional sodium excretions by approximately 40%. These responses were reproducible in different groups of animals and with time. Renal nerve stimulation during an intra-renal arterial infusion of prazosin, to block alpha 1-adrenoceptors, had no effect on the renal haemodynamic response but completely abolished the reductions in urine flow rate, and absolute and fractional sodium excretion. During intra-renal arterial infusion of yohimbine, to block renal alpha 2-adrenoceptors, stimulation of the renal nerves to cause similar renal haemodynamic changes resulted in significantly larger reductions in urine flow rate, and absolute and fractional sodium excretion of about 52-58%. These results indicate that in the rabbit alpha 1-adrenoceptors are present on the renal tubules, which mediate the increase in sodium reabsorption caused by renal nerve stimulation. They further suggest the presence of presynaptic alpha 2-adrenoceptors on those nerves innervating the renal tubules. PMID:6086915

  4. Relation of central alpha-adrenoceptor and other receptors to the control of renin secretion.

    PubMed

    Ganong, W F

    1983-02-01

    The location and nature of the receptors in the brain on which clonidine acts to decrease renin secretion have been investigated in dogs. Clonidine was injected into the vertebral and carotid arteries, and its effects were compared with those of norepinephrine and epinephrine when injected into the third ventricle. It was also injected intravenously (IV) after transection of the brain stem and following treatment with intraventricular 6-hydroxydopamine. The results suggest that the renin-regulating receptors are located in the brain stem in a region different from the receptors mediating the depressor response, that they are alpha 2-adrenoceptors, and that they are postsynaptic in location. Central alpha 1-adrenoceptors appear to mediate increased renin secretion. Central serotonergic receptors also mediate increased renin secretion, but it is not known how the alpha 1- and alpha 2-adrenoceptors interact with the serotonergic systems.

  5. Influences of the endothelium and hypoxia on alpha 1- and alpha 2-adrenoceptor-mediated responses in the rabbit isolated pulmonary artery.

    PubMed Central

    MacLean, M. R.; McCulloch, K. M.; McGrath, J. C.

    1993-01-01

    1. The effects of the inhibitor of nitric oxide synthase, N omega-nitro-L-arginine methylester (L-NAME, 10(-4) M), mechanical disruption of the endothelium and hypoxia on contraction to noradrenaline (alpha 1- and alpha 2-adrenoceptor agonist), phenylephrine (alpha 1-adrenoceptor agonist) and UK 14304 (alpha 2-adrenoceptor agonist) were compared in the rabbit isolated pulmonary artery. The effects of the selective antagonists rauwolscine (10(-6) M, alpha 2-adrenoceptors) and prazosin (10(-7) M, alpha 1-adrenoceptors) on the contractions to noradrenaline before and after exposure to L-NAME were also assessed. 2. Noradrenaline, phenylephrine and UK 14304 all produced concentration-dependent increases in vascular tone. The responses to noradrenaline were sensitive to both rauwolscine and prazosin (effect of prazosin >> rauwolscine). L-NAME increased the potency of both noradrenaline and UK 14304, and also the maximum tension achieved. It had no effect on the responses to phenylephrine. After L-NAME, contractions to noradrenaline, although still sensitive to both rauwolscine and prazosin, were now more sensitive to inhibition by rauwolscine. 3. Endothelium removal augmented the potency and maximum contractions to noradrenaline, phenylephrine and UK 14304. 4. Hypoxia decreased both the potency of phenylephrine and its maximum contractile response, but increased the maximum response to noradrenaline without effecting responses to UK 14304. 5. In conclusion, in the rabbit pulmonary artery, augmentation of contractile responses to noradrenaline by L-NAME involves a potentiation of alpha 2-adrenoceptor-mediated contraction probably through an effect on the synthesis of endothelium-derived nitric oxide.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8094023

  6. Differential effects of short- and long-term bupivacaine treatment on α1-adrenoceptor-mediated contraction of isolated rat aorta rings and the reversal effect of lipid emulsion

    PubMed Central

    Guo, Hao; Zhang, He-fei; Xu, Wen-qi; Du, Qian; Zhao, Jing; Ren, Lei-ming

    2015-01-01

    Aim: Arterial function is significantly influenced by bupivacaine at both clinically relevant concentrations and toxic concentrations, but the underlying mechanisms are not fully understood. In the present study we investigated the role of α1-adrenoceptors in bupivacaine effects on isolated rat aortas. Methods: Isolated aortic rings were prepared from rats and suspended in an organ bath. Phenylephrine (Phe)-induced vasoconstriction and acetylcholine (ACh)-induced vasodilation were recorded through an isometric force transducer connected to a data acquisition system. Results: Administration of bupivacaine (30–300 μmol/L) produced mild vasoconstriction, and this response declined with repeated administrations. Treatment of the aortic rings with bupivacaine (3–30 μmol/L) for 20 min enhanced Phe-induced vasoconstriction, while treatment for 40 min suppressed Phe-induced vasoconstriction. Both the short- and long-term bupivacaine treatment suppressed ACh-induced vasodilation. Incubation of the aortic rings with 0.2%–0.6% lipid emulsion (LE) for 100 min significantly increased the pD2 and Emax values of Phe-induced vasoconstriction, and incubation with 0.4% LE for 100 min reversed the inhibition of bupivacaine on vasoconstriction induced by Phe (30 μmol/L). In contrast, incubation with LE suppressed ACh-induced vasodilation, even at a lower concentration and with a 5-min incubation. Conclusion: Bupivacaine exerts dual effects on α1-adrenoceptor-mediated vasoconstriction of isolated rat aortic rings: short-term treatment enhances the response, while long-term treatment inhibits it; the inhibition may be reversed via long-term incubation with LE. PMID:26073324

  7. Synergistic alpha-1 and alpha-2 adrenergic stimulation of rat proximal nephron Na+/H+ exchange

    SciTech Connect

    Gesek, F.A.; Cragoe, E.J. Jr.; Strandhoy, J.W.

    1989-06-01

    Both alpha-1 and alpha-2 adrenoceptors have been localized to the renal cortex, with the majority of binding sites on the proximal tubule. Because the major regulator of Na+ uptake into the proximal tubule is the Na+/H+ exchanger, and because alpha-1 and alpha-2 adrenoceptors stimulate it in other tissues, we tested the hypothesis that both alpha adrenoceptor subtypes can increase Na+ uptake into the proximal nephron by stimulating the Na+/H+ antiporter. Enhancement of Na+ transport by agonists was studied in isolated rat proximal tubules by determining the uptake of 22Na that was suppressible by the Na+/H+ inhibitor, 5-(N-ethyl-N-isopropyl)amiloride (EIPA). The phorbol ester, phorbol-12-myristate-13-acetate, (0.1 microM), directly stimulated the antiporter through protein kinase C and increased EIPA-suppressible 22Na uptake 250% above control. The alpha-1 adrenoceptor agonists, cirazoline and phenylephrine, in addition to the mixed agonist, norepinephrine, maximally stimulated uptake by 226 to 232% at 1 microM concentrations. alpha-2 agonists produced a range of maximal stimulations at 1 microM from 65% with guanabenz to 251% with B-HT 933. Increases in 22Na uptake by agonists were inhibited by selective adrenergic antagonists and by EIPA. The drugs did not change the EIPA-resistant component of 22Na uptake. Inasmuch as the adrenoceptor subtypes likely stimulated Na+/H+ exchange by differing intracellular pathways impinging upon common transport steps, we examined whether simultaneous stimulation of both pathways was additive. Submaximal concentrations (5 nM each) of alpha-1 and alpha-2 adrenoceptor agonists in combination synergistically enhanced 22Na uptake to a level similar to 1 microM concentrations of adrenoceptor agonists alone or in combination.

  8. The ontogeny of renal alpha 1- and alpha 2-adrenoceptors in the Dahl rat model of experimental hypertension.

    PubMed

    McCaughran, J A; Juno, C J; O'Malley, E; Rosenthal, M

    1986-09-01

    [3H]prazosin (PRAZ) and [3H]rauwolscine (RAUW) were used to examine the ontogeny of renal alpha 1- and alpha 2-adrenoceptors in the inbred Dahl hypertension-sensitive (S/JR) and -resistant (R/JR) rat. PRAZ and RAUW each bound to a single population of non-interacting sites. The binding of each ligand was saturable and reversible. The greatest proliferation of each receptor subtype occurred between 5 and 25 days of age. During this period, a 4 to 5-fold increase in the density of each was observed. Adult levels of each were reached by 50 days of age. The alpha 2-adrenoceptor was the predominant subtype present in renal tissue. However, its ratio to the alpha 1 subtype was influenced by strain and age: the ratio was greatest in the S/JR strain and decreased with age in both strains. The profile of alpha 1-adrenoceptor development was similar in S/JR and R/JR rats. In contrast, the density of alpha 2-adrenoceptors was similar in S/JR and R/JR rats at 5 and 15 days of age but significantly greater in the S/JR rat between 25 and 150 days of age. The elevated density of alpha 2-adrenoceptors could not be explained by strain-related differences in blood pressure or alterations in the affinity of the receptor. The results suggest that a relationship may exist between elevated renal alpha 2-adrenoceptor density and the genetic predisposition to hypertension in the S/JR rat. However, because this relationship is not apparent during the neonatal period of development, the possibility that the elevated density of sites may be secondary to some other event should also be considered.

  9. Rapid component I(Kr) of cardiac delayed rectifier potassium currents in guinea-pig is inhibited by alpha(1)-adrenoreceptor activation via protein kinase A and protein kinase C-dependent pathways.

    PubMed

    Wang, Sen; Xu, Dong-Jie; Cai, Jing-Bo; Huang, Yuan-Zhu; Zou, Jian-Gang; Cao, Ke-Jiang

    2009-04-17

    Ventricular tachyarrhythmias are often precipitated by physical or emotional stress, indicating a link between increased adrenergic stimulation and cardiac ion channel activity. Human ether-a-go-go related gene (hERG) potassium channels conduct the rapid component of delayed rectifier potassium current, I(kr), a crucial component for action potential repolarization. To evaluate the correlation between increased alpha(1)-adrenergic activity and the rapid component of cardiac I(kr), whole-cell patch-clamp recording was performed in isolated guinea-pig ventricular myocytes. Stimulation of alpha(1)-adrenoceptors using phenylephrine (0.1 nM-100 microM) reduced I(kr) current in a dose-dependent manner at 37 degrees C. Phenylephrine (0.1 microM) reduced I(kr) current to 66.83+/-3.16%. Chelerythrine (1 microM), a specific inhibitor of protein kinase C (PKC) completely inhibited the changes in I(kr) trigged by 0.1 microM phenylephrine. KT5720 (2.5 microM), a specific inhibitor of protein kinase A (PKA) partially inhibited the current decrease induced by 0.1 microM phenylephrine. Both chelerythrine and KT5720 drastically reduced the phenylephrine-induced effects, indicating possible involvement of PKC and PKA in the alpha(1)-adrenergic inhibition of I(kr). Our data suggest a link between I(kr) and the alpha(1)-adrenoceptor, involving activation of PKC and PKA in arrhythmogenesis.

  10. Anxiolytic-like profile of mirtazapine in rat conditioned fear stress model: Functional significance of 5-hydroxytryptamine 1A receptor and alpha1-adrenergic receptor.

    PubMed

    Kakui, Nobukazu; Yokoyama, Fumikazu; Yamauchi, Miki; Kitamura, Koichi; Imanishi, Taiichiro; Inoue, Takeshi; Koyama, Tsukasa

    2009-05-01

    Mirtazapine is an antidepressant with a unique mechanism of action and has been categorized as a Noradrenergic and Specific Serotonergic Antidepressant (NaSSA). Although numerous clinical trials suggested the usefulness of mirtazapine for not only major depressive disorders but also a variety of anxiety disorders, efficacy studies in animal anxiety models have been rarely reported. The present study investigated a potential anxiolytic-like profile of mirtazapine in rat conditioned fear stress model. A 5-hydroxytryptamine (5-HT) 1A receptor partial agonist, buspirone (1-5 mg/kg) exhibited a significant reduction in freezing time, and its maximal effect was reversed by a selective 5-HT(1A) antagonist, WAY-100635 (1 mg/kg). Mirtazapine (1-10 mg/kg) also reduced the freezing time in a dose-related fashion, a substantial proportion (approx. 50%) of which was likewise antagonized by WAY-100635 (1 mg/kg). Mianserin (1-30 mg/kg), a structural analogue for mirtazapine, was ineffective. Furthermore, co-administration of alpha1 adrenoceptor antagonist, prazosin (0.03 mg/kg) completely reversed mirtazapine (10 mg/kg)-induced reduction of freezing time. These findings represent the first demonstration that the anxiolytic-like action of mirtazapine involves activation of 5-HT(1A) receptor and alpha1 adrenoceptor to different extents, and are compatible with one aspect of mirtazapine's pharmacological profile as NaSSA. PMID:19167420

  11. Radiation dosimetry of iodine-123 HEAT, an alpha-1 receptor imaging agent

    SciTech Connect

    Thomas, K.D.; Greer, D.M.; Couch, M.W.; Williams, C.M.

    1987-11-01

    Biologic distribution data in the rat were obtained for the alpha-1 adrenoceptor imaging agent (+/-) 2-(beta-(iodo-4-hydroxyphenyl)ethylaminomethyl)tetralone (HEAT) labeled with (/sup 123/I). The major excretory routes were through the liver (67%) and the kidney (33%). Internal radiation absorbed dose estimates to nine source organs, total body, the GI tract, gonads, and red bone marrow were calculated for the human using the physical decay data for (/sup 123/I). The critical organ was found to be the lower large intestine, receiving 1.1 rad per mCi of (/sup 123/I)HEAT administered. The total-body dose was found to be 58 mrad per mCi.

  12. Evaluation of the effects of a specific alpha 2-adrenoceptor antagonist, atipamezole, on alpha 1- and alpha 2-adrenoceptor subtype binding, brain neurochemistry and behaviour in comparison with yohimbine.

    PubMed

    Haapalinna, A; Viitamaa, T; MacDonald, E; Savola, J M; Tuomisto, L; Virtanen, R; Heinonen, E

    1997-11-01

    In the present study we evaluated the alpha 1- and alpha 2-adrenoceptor subtype binding, central alpha 2-adrenoceptor antagonist potency, as well as effects on brain neurochemistry and behavioural pharmacology of two alpha 2-adrenoceptor antagonists, atipamezole and yohimbine. Atipamezole had higher selectivity for alpha 2- vs. alpha 1-adrenoceptors than yohimbine regardless of the subtypes studied. Both compounds had comparable affinity for the alpha 2A-, alpha 2C- and alpha 2B-adrenoceptors, but yohimbine had significantly lower affinity for the alpha 2D-subtype. This may account for the fact that significantly higher doses of yohimbine than atipamezole were needed for reversal of alpha 2-agonist (medetomidine)-induced effects in rats (mydriasis) and mice (sedation and hypothermia). The effect on central monoaminergic activity was estimated by measuring the concentrations of transmitters and their main metabolites in whole brain homogenate. At equally effective alpha 2-antagonising doses in the rat mydriasis model, both drugs stimulated central noradrenaline turnover (as reflected by increase in metabolite levels) to the same extent. Atipamezole increased dopaminergic activity only slightly, whereas yohimbine elevated central dopamine but decreased central 5-hydroxytryptamine turnover rates. In behavioural tests, atipamezole (0.1-10 mg/kg) did not affect motor activity but stimulated food rewarded operant (FR-10) responding (0.03-3 mg/kg) whereas yohimbine both stimulated (1 mg/kg) and decreased (> or = 3 mg/kg) behaviour in a narrow dose range in these tests. In the staircase test, both antagonists increased neophobia, but in the two compartment test only yohimbine (> or = 3 mg/kg) decreased exploratory behaviour. The dissimilar effects of the antagonists on neurochemistry and behaviour are thought to be caused by non alpha 2-adrenoceptor properties of yohimbine. In conclusion, the alpha 2-antagonist atipamezole blocked all alpha 2-adrenoceptor subtypes at low

  13. [Uroselectivity of alpha-1 antagonism in the treatment of benign prostatic hypertrophy: on the pharmacologic concept of the clinical approach].

    PubMed

    Jolliet, P; Bourin, M

    1998-01-01

    Benign prostatic hyperplasia is the most common cause of voiding dysfunction in men. It becomes symptomatic from the fifth decade of life and needs treatment in 50 per cent of patients. Hyperplastic prostatic tissue and the smooth involuntary sphincter have a high density of alpha 1-adrenoceptors, thus alpha 1-blockers can decrease sphincter tone and reduce the tension exerted by the prostatic muscular component. Attempts have been made to find alpha 1-antagonists that have a selective effect on the prostate (alfuzosin), are long acting (tamsulosin, terazosin, doxazosin) or present specificity on the alpha 1A prostatic adrenoceptors (tamsulosin), in order to maintain efficacy without affecting blood pressure. Finasteride, a 5 alpha-reductase inhibitor without hypotensive side-effect may be more effective in men with a predominantly glandular component to their benign hyperplasia or with very large prostate glands, but has a longer onset of action and produces more adverse sexual effects. Thus, alpha-1 antagonists can be considered as an appropriate treatment option in patients with troublesome symptoms of BPH and who have not developed serious complications indicating surgery.

  14. Green tea modulates alpha(1)-adrenergic stimulated glucose transport in cultured rat cardiomyocytes.

    PubMed

    Angeloni, Cristina; Maraldi, Tullia; Ghelli, Anna; Rugolo, Michela; Leoncini, Emanuela; Hakim, Gabriele; Hrelia, Silvana

    2007-09-01

    alpha1-Adrenergic stimulation triggers glucose transport in the heart through the translocation of glucose transporter (GLUT) 1 and GLUT4 to plasma membranes, mediated by protein kinase C (PKC) isoforms. Evidence is emerging that dietary polyphenolic compounds may act not only as antioxidants but also by modulating PKC-mediated signaling. This study evaluated the ability of a green tea extract (GTE) to modulate alpha1-adrenoceptor-mediated glucose transport in rat cardiomyocytes. GTE supplementation decreased phenylephrine (PhE)-stimulated glucose uptake and GLUT4 recruitment. PhE stimulation activated PKC alpha, beta, delta, and epsilon, while GTE supplementation decreased the translocation of beta and delta isoforms, but not alpha and epsilon, supporting the notion that GTE directly affects PKC activation and is a beta and delta isoform-selective PKC inhibitor. Due to reactive oxygen species (ROS) involvement in pathological heart alterations, the observation that GTE is able to both inhibit effects originated by some PKC isoforms and counteract ROS deleterious effects could be important in the prevention/counteraction of these diseases.

  15. Alpha-adrenergic stimulation of thermogenesis in a rat kangaroo (Marsupialia, Bettongia gaimardi).

    PubMed

    Ye, J M; Edwards, S J; Rose, R W; Steen, J T; Clark, M G; Colquhoun, E Q

    1996-09-01

    The Tasmanian bettong (Bettongia gaimardi) is a small rat kangaroo without detectable brown adipose tissue (BAT). In view of our previous findings of norepinephrine-mediated increase in O2 consumption (Vo2) in the perfused hindlimb of this species, the present study examined the effect of alpha-adrenoceptors on the thermogenesis of conscious bettongs at rest by infusing adrenergic agents via an indwelling catheter in the tail vein. The resting Vo2 was 22.9 +/- 1.9 mmol.kg-1.h-1. Norepinephrine (10-80 micrograms.kg-1.min-1) stimulated Vo2 in a dose-dependent manner with the maximal increment of 46.7%. Naphazoline (an alpha 1,alpha 2-adrenergic agonist) and phenylephrine (an alpha 1-adrenergic agonist) also elicited increases in Vo2 with maximal values of 29.6 and 34.8%, respectively. In contrast, the alpha 2-adrenergic agonist clonidine had no significant effects. Both alpha- and beta-adrenergic blockers were used to antagonize the submaximal increase in Vo2 elicited by norepinephrine. As a dose of 10 micrograms.kg-1.min-1, the alpha-adrenergic blocker phentolamine abolished the effects of naphazoline and phenylephrine and reduced norepinephrine-induced Vo2 by 45.5%. The beta-adrenergic blocker propranolol inhibited the norepinephrine-induced Vo2 by 58.8% at 20 micrograms.kg-1.min-1. A combination of the two antagonists blocked 82.5% of the norepinephrine-induced Vo2. Pretreatment of the animal with indomethacin (1 mg/kg), a known inhibitor of prostaglandin cyclooxygenase, had no effect on phenylephrine-elicited Vo2. Taken together, these results indicate that alpha 1-adrenoceptors are directly involved in norepinephrine-induced thermogenesis in non-BAT tissue(s).

  16. alpha-Adrenergic and muscarinic cholinergic receptors are not involved in the modulation of the parasympathetic baroreflex by the medial prefrontal cortex in rats.

    PubMed

    Resstel, L B M; Fernandes, K B P; Corrêa, F M A

    2005-08-12

    The medial prefrontal cortex (MPFC) is involved in cardiovascular control and baroreflex modulation. Recent studies indicated that stimulation of MPFC muscarinic receptors causes hypotensive responses whereas stimulation of alpha1- but not of alpha2-adrenoceptors causes pressor responses in unanesthetized rats. It has also been shown that the MPFC is involved in the modulation of the parasympathetic component of the baroreflex in rats. We report that bilateral injections of CoCl2 in the ventral portion of the MPFC (vMPFC) reduced the parasympathetic component of the baroreflex, thus confirming the involvement of local synapses. We further evaluated the effect of the pharmacologic block of vMPFC alpha1- or alpha2-adrenoceptors and muscarinic receptors on the vMPFC-related modulation of the parasympathetic component of the baroreflex in unanesthetized rats. Bilateral microinjections of 10 nmol of the selective alpha1-adrenoceptor antagonist WB4101 or 10 nmol of the selective alpha2-adrenoceptors antagonist RX821002 into the MPFC did not affect the baroreflex. Bilateral microinjections of 9 nmol of the muscarinic antagonist atropine also did not affect baroreflex activity. The present results indicate that although vMPFC alpha-adrenergic and muscarinic receptors are involved in cardiovascular regulation, they do not mediate the vMPFC-related modulation of the parasympathetic component of the baroreflex. PMID:15894338

  17. Correlation between phosphatidylinositol labeling and contraction in rabbit aorta: effect of alpha-1 adrenergic activation

    SciTech Connect

    Villalobos-Molina, R.; Uc, M.; Hong, E.; Garcia-Sainz, J.A.

    1982-07-01

    Activation of rabbit aortic strips with alpha adrenergic agonists increased the labeling (with (/sup 32/P)Pi) of phosphatidylinositol (PI) and phosphatidic acid and contracted the vascular preparations in dose-related fashion. Epinephrine, norepinephrine and methoxamine produced maximal effects, whereas clonidine behaved as partial agonist and B-HT 933 (2-amino-6-ethyl-4,5,7,8-tetrahydro-6H-oxazole-(5,4-d) azepin dihydrochloride) was almost without activity in the two experimental models used. Phenylephrine was a full agonist in producing contraction, but failed to elicit the maximal increase in PI labeling. The EC50 values to produce contraction of aortic strips were lower for all agonists than those required to increase the incorporation of radioactive phosphate into PI, but there was a good correlation between the two sets of data. The increased PI labeling and contraction of aortic strips induced by epinephrine were antagonized by prazosin and yohimbine in dose-related fashion, but the first alpha blocker was about three orders of magnitude more potent than the second in antagonizing the two effects. The present results indicate that both stimulation of PI labeling and contraction are mediated through activation of alpha-1 adrenoceptors in rabbit aorta.

  18. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  19. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  20. Postsynaptic alpha-adrenoceptors, calcium mobilization and (/sup 3/H), 4-dihydropyridine binding in vascular smooth muscle of rat tail artery

    SciTech Connect

    Su, C.M.

    1985-01-01

    Pharmacologic characterization of post-synaptic ..cap alpha..-adrenoceptors in rat tail artery was examined by using selective agonists and antagonists. In this tissue, the ..cap alpha..-adrenoceptor agonists employed all produced concentration-dependent mechanical responses with rank order of potency, clonidine > norepinephrine > norepinephrine > phenylephrine > UK > 14304 > B-HT 920. This order of agonists activities not consistent with a simple classification into ..cap alpha../sub 1/- and ..cap alpha../sub 2/-adrenoceptors in the rat tail artery. Antagonism by prazosin and yohimbine of phenylephrine, norepinephrine and clonidine responses did not reveal the anticipated discrimination between ..cap alpha../sub 1/- and ..cap alpha../sub 2/-adrenoceptors. Potassium depolarization-induced responses were very sensitive to antagonism by the Ca/sup 2 +/ antagonists nifedipine and D 600. The sensitivity sequence of ..cap alpha..-adrenoceptor agonist induced responses to nifedipine and D 600 is H-HT 920 (> clonidine) > phenylephrine > norepinephrine. This disagrees with the thesis that ..cap alpha../sub 2/-adrenoceptor mediated responses in vascular smooth muscle are more sensitive than are ..cap alpha../sub 1/-adrenoceptor mediated responses to Ca/sup 2 +/ channel antagonists. Radioligand binding studies of (/sup 3/H)nitrendipine and (/sup 3/H)Bay K 8644 to microsomal preparations of tail artery membrane a single set of high affinity binding sites and there is a good correlation between the pharmacological potencies and binding affinities of these agents. In addition, study of the displacement of (/sup 3/H)nitrendipine by Bay K 8644 revealed IC/sub 50/ and K/sub l/ values which are in approximate accord with those determined for pharmacologic experiments.

  1. Effect of phorbol ester on 6-keto PGF sup 1. alpha. production in aorta from control-salt and aldosterone-salt hypertensive rats

    SciTech Connect

    Jones, S.B.; Jones, A.W. )

    1991-03-11

    The authors have previously shown that norepinephrine (NE) stimulated 6-keto-PGF{sub 1{alpha}} and thromboxane B{sub 2}(TXB{sub 2}) production in aorta from control-salt (CSR) and aldosterone-salt hypertensive rats (AHR) through the alpha-1 adrenoceptor (A1AR). While there was no difference in NE-stimulated TXB{sub 2} production between CSR and AHR, 6-keto-PGF{sub 1{alpha}} production was attenuated in aorta from AHR compared tissues. The authors were interested in whether the source of the arachidonic acid (AA) metabolites was through direct coupling of the A1AR and PLA{sub 2} or secondary to activation of PLC. One approach to answering this question was to bypass the receptor and activate protein kinase-C (PKC) directly. PMA caused a time-dependent increase in both 6-keto-PGF{sub 1{alpha}} and TXB{sub 2}. The time course was much slower than NE-stimulated production of these metabolites, but the pattern was similar with TXB{sub 2} appearing before 6-keto-PGF{sub 1{alpha}}. The PMA concentration-response curves for 6-keto-PGF{sub 1{alpha}} production for CSR and AHR were nearly superimposable. Staurosporine inhibited PMA stimulated 6-keto-PGF{sub 1{alpha}} production in CSR and AHR with nearly equal potency. Thus, while activation of PKC results in increases in AA metabolites, alterations in this pathway do not appear to be responsible for the differences observed with NE-stimulated 6-keto-PGF{sub 1{alpha}} production. These data support the concept of direct coupling between the A1AR and PLA{sub 2} in vascular smooth muscle.

  2. Pharmacological activity of (-)-discretamine, a novel vascular alpha-adrenoceptor and 5-hydroxytryptamine receptor antagonist, isolated from Fissistigma glaucescens.

    PubMed Central

    Ko, F. N.; Yu, S. M.; Su, M. J.; Wu, Y. C.; Teng, C. M.

    1993-01-01

    1. The pharmacological activity of (-)-discretamine, isolated from Fissistigma glaucescens, was determined in rat isolated thoracic aorta, cardiac tissues and ventricular myocytes and guinea-pig isolated trachea. 2. (-)-Discretamine was found to be an alpha 1-adrenoceptor blocking agent in rat thoracic aorta as revealed by its competitive antagonism of noradrenaline (pA2 = 7.20 +/- 0.10)- or phenylephrine (pA2 = 7.60 +/- 0.09)-induced vasoconstriction. It was as potent as phentolamine (pA2 = 7.51 +/- 0.10), but was more potent than yohimbine (pA2 = 6.18 +/- 0.06). Removal of endothelium significantly increased the antagonistic potency of (-)-discretamine on noradrenaline (pA2 = 7.52 +/- 0.09)- or phenylephrine (pA2 = 7.90 +/- 0.09)-induced vasoconstriction. 3. (-)-Discretamine was also an alpha 2-adrenoceptor blocking agent (pA2 = 6.30 +/- 0.15) and a 5-hydroxytryptamine antagonist (pA2 = 6.87 +/- 0.06), both in rat aorta denuded of endothelium. 4. (-)-Discretamine protected alpha-adrenoceptors from alkylation by the irreversible blocking agent, phenoxybenzamine. 5. [3H]-inositol monophosphate formation caused by noradrenaline (3 microM) in rat thoracic aorta was suppressed by (-)-discretamine (10 and 30 microM) and prazosin (3 microM). 6. A high concentration of (-)-discretamine (30 microM) did not affect the contraction induced by the thromboxane receptor agonist U-46619, prostaglandin F2 alpha (PGF2 alpha), angiotensin II, high K+ or endothelin in rat aorta denuded of endothelium. Neither cyclic AMP nor cyclic GMP content of rat thoracic aorta was changed by (-)-discretamine.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7902181

  3. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  4. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  5. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  6. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  7. A possible structural determinant of selectivity of boldine and derivatives for the alpha 1A-adrenoceptor subtype.

    PubMed Central

    Madrero, Y.; Elorriaga, M.; Martinez, S.; Noguera, M. A.; Cassels, B. K.; D'Ocon, P.; Ivorra, M. D.

    1996-01-01

    1. The selectivity of action of boldine and the related aporphine alkaloids, predicentrine (9-O-methylboldine) and glaucine (2,9-O-dimethylboldine) and alpha 1-adrenoceptor subtypes was studied by examining [3H]-prazosin competition binding in rat cerebral cortex. WB 4101 and benoxathian were used as selective alpha 1A-adrenoceptor antagonists. 2. In the competition experiments [3H]-prazosin (0.2 nM) binding was inhibited by WB 4101 and benoxathian. The inhibition curves displayed shallow slopes which could be subdivided into high and low affinity components (pKi = 9.92 and 8.29 for WB 4101, 9.35 and 7.94 for benoxathian). The two antagonists recognized approximately 37% of the sites with high affinity from among the total [3H]-prazosin specific binding sites. 3. Boldine, predicentrine and glaucine also competed for [3H]-prazosin (0.2 nM) binding with shallow and biphasic curves recognizing 30-40% of the sites with high affinity. Drug affinities (pKi) at the high and low affinity sites were, 8.31 and 6.50, respectively, for boldine, 8.13 and 6.39 for predicentrine, and 7.12 and 5.92 for glaucine. The relative order of selectivity for alpha 1A-adrenoceptors was boldine (70 fold alpha 1A-selective) = predicentrine (60 fold, alpha 1A-selective) > glaucine (15 fold, alpha 1A-selective). 4. Pretreatment of rat cerebral cortex membranes with chloroethylclonidine (CEC, 10 microM) for 30 min at 37 degrees C followed by thorough washing out reduced specific [3H]-prazosin binding by approximately 70%. The CEC-insensitive [3H]-prazosin binding was inhibited by boldine monophasically (Hill slope = 0.93) with a single pKi value (7.76). 5. These results suggest that whereas the aporphine structure shared by these alkaloids is responsible for their selectively of action for the alpha 1A-adrenoceptor subtype in rat cerebral cortex, defined functional groups, namely the 2-hydroxy function, induces a significant increase in alpha 1A-subtype selectivity and affinity. PMID:8982502

  8. Efficacy and safety of the alpha-1 blocker doxazosin in the treatment of benign prostatic hyperplasia. Analysis of 5 studies. Doxazosin Study Groups.

    PubMed

    Janknegt, R A; Chapple, C R

    1993-01-01

    Controlled clinical studies have demonstrated that blockade of alpha 1-adrenergic receptors relaxes prostatic muscle tone and decreases the symptoms of benign prostatic hyperplasia (BPH). Doxazosin, a once-daily quinazoline derivative and postsynaptic alpha 1-adrenoceptor antagonist, proven as treatment for hypertension, was evaluated in the treatment of BPH in dosages of 1-16 mg. 456 BPH patients (287 doxazosin-treated and 169 placebo-treated) were evaluated for efficacy and safety in five double-blind, placebo-controlled clinical studies. Doxazosin treatment resulted in improvements in both urodynamic and symptomatic parameters associated with BPH. Efficacy was only assessed in 1, 2 and 4 mg. Adverse experiences were reported in 127 (44.3%) of the patients treated with doxazosin and in 49 (29%) of the patients treated with placebo. Fifteen (5.2%) doxazosin patients and 4 (2.4%) placebo patients withdrew from the studies due to adverse effects. Results from these five clinical trials demonstrate doxazosin is effective and safe and well tolerated in both normotensive and hypertensive patients with BPH.

  9. Alpha-1 Antitrypsin Test

    MedlinePlus

    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  10. Alpha-1 antitrypsin test

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003715.htm Alpha-1 antitrypsin test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure the ...

  11. Alpha-adrenoceptor blockade in patients with mild to moderate hypertension: long-term renal effects of doxazosin.

    PubMed

    Krusell, L R; Christensen, C K; Pedersen, O L

    1992-09-01

    Using constant infusion technique and a water-loading procedure, we investigated renal hemodynamic and excretional variables in 15 essential hypertensive patients [diastolic blood pressure (DBP) 102 +/- 10 mm Hg] after 3 weeks of placebo and after 16 weeks of treatment with a postjunctional alpha 1-adrenoceptor-antagonist, doxazosin (1-16 mg) once daily. A minor decrease in supine DBP (p less than 0.05) but no significant changes in systolic BP (SBP) and heart rate (HR) were observed. No significant changes were noted in glomerular filtration rate (GFR), renal plasma flow (RPF), and renal vascular resistance (RVR). The mean renal excretion rate of sodium, potassium, uric acid, and albumin for the entire group was unaffected by the treatment, but the individual changes in sodium clearance correlated significantly with changes in mean BP (r = 0.64, n = 15, p less than 0.05). Six patients showed an increase in sodium excretion after treatment, whereas nine showed a decrease. No decrease in mean body weight was noted, but the BP reduction after 5 months of treatment correlated significantly with the changes in body weight (r = 0.62, n = 15, p less than 0.01). The results indicate that long-term treatment with doxazosin had no deleterious effect on renal function, but the effects on BP were rather modest. The individual BP response is probably determined by the degree of fluid retention even if an intact pressure-natriuresis relationship could still be demonstrated during chronic therapy.

  12. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  13. Effect of angiotensin II receptor blockade on the interaction between enalaprilat and doxazosin in rat tail arteries.

    PubMed

    Marwood, J F

    1998-01-01

    1. Previous work has shown that enalaprilat, an inhibitor of angiotensin-converting enzyme (ACE), potentiated the actions of alpha 1-adrenoceptor antagonists; it was hypothesized that angiotensin II (AngII) modulated the activity of alpha 1-adrenoceptors. This hypothesis was tested in Sprague-Dawley rat isolated perfused tail arteries using the AT1 receptor antagonist losartan and the AT2 receptor antagonist PD123319. 2. Losartan had no alpha 1-adrenoceptor antagonist effects at concentrations below 1 mumol/L. Similarly, losartan (0.1 mumol/L) had no effect on the alpha 1-adrenoceptor antagonist action of doxazosin (1, 10 nmol/L) nor on the potentiation of doxazosin by enalaprilat (1 mumol/L). 3. PD123319 (0.1 mumol/L) had no alpha 1-adrenoceptor antagonist effect but altered the mode of action of the alpha 1-adrenoceptor antagonist doxazosin: PD123319 changed doxazosin from a competitive to a non-competitive antagonist, as evidenced by the reduced slope of the dose-response curve for the alpha 1-adrenoceptor agonist phenylephrine. 4. These results suggest that AngII can modulate alpha 1-adrenoceptor function in rat tail arteries via an indirect action at AT2 receptors. However, the present results do not rule out the involvement of bradykinin, endothelin or prostaglandin in the modulation of alpha 1-adrenoceptor function by angiotensin II.

  14. Alterations in cardiac alpha and beta adrenoceptors during the development of spontaneous hypertension

    SciTech Connect

    Yamada, S.; Ishima, T.; Tomita, T.; Hayashi, M.; Okada, T.; Hayashi, E.

    1984-02-01

    To study potential cardiac receptor alterations during the development of spontaneous hypertension, specific binding of (/sup 3/H)-2-N(2,6-dimethoxyphenoxyethyl)amino-methyl-1,4-benzodioxane, (-)-(/sup 3/H)dihydroalprenolol and (-)-(/sup 3/H)quinuclidinyl benzilate in ventricles of Wistar Kyoto rats (WKY), spontaneously hypertensive rats (SHR) and stroke-prone SHR (SHRSP) at different ages was determined. The Kd and maximal binding for specific binding of (/sup 3/H)-2-N(2,6-dimethoxyphenoxyethyl)amino-methyl-1,4-benzodioxane and (-)-(/sup 3/H)dihydroalprenolol in ventricular homogenates of SHR and SHRSP at prehypertensive ages were similar to those of age-matched WKY. With the development of spontaneous hypertension in SHR and SHRSP, there was a significant decrease in the maximal binding for both ligands without a change in Kd. The decrease in maximal binding in SHR and SHRSP at 10 weeks of age was 29 to 38%, compared with age-matched WKY. There was no difference in ventricular (-)-(3H)quinuclidinyl benzilate binding between WKY and SHRSP. Hofstee analysis of the inhibition of ventricular (-)-(3H)dihydroalprenolol binding by practolol demonstrated a specific 51% decrease in ventricular beta-1 receptor density in 10-week-old SHRSP. In addition, the inotropic response to isoproterenol in isolated papillary muscles from SHRSP was significantly smaller than that in WKY. Thus, it is concluded that during the development of spontaneous hypertension in SHR and SHRSP, there is a specific loss in number of cardiac alpha and beta-1 adrenoceptors with a consequently reduced responsiveness of isolated papillary muscles to isoproterenol in SHRSP. These results are compatible with the reported increase in sympathetic outflow to the cardiovascular system in spontaneous hypertension.

  15. (-)-Discretamine, a selective alpha 1D-adrenoceptor antagonist, isolated from Fissistigma glaucescens.

    PubMed Central

    Ko, F. N.; Guh, J. H.; Yu, S. M.; Hou, Y. S.; Wu, Y. C.; Teng, C. M.

    1994-01-01

    1. The selectivity of (-)-discretamine for alpha 1-adrenoceptor subtypes was investigated by use of functional and binding studies in rat vas deferens, spleen and aorta, and in cultured DDT1MF-2 and A10 cells. 2. In prostatic portions of rat vas deferens, the competitive antagonists (-)-discretamine, 5-methylurapidil (5-MU) and prazosin inhibited contractions to noradrenaline (NA) with pA2 values of 6.21, 8.71 and 9.27, respectively. The irreversible antagonist, chloroethylclonidine (CEC, 100 microM) failed to affect contractions to NA while nifedipine (1 microM) blocked them almost completely. 3. In rat spleen, the competitive antagonists (-)-discretamine, 5-MU and prazosin inhibited contractions to phenylephrine with pA2 values of 6.44, 7.19 and 9.45, respectively. CEC (100 microM) significantly reduced the maximum contraction to phenylephrine while nifedipine (1 microM) did not affect it. 4. In rat aorta, the competitive antagonists (-)-discretamine, 5-MU and prazosin inhibited contractions to NA with pA2 values of 7.60, 8.00 and 9.40, respectively. CEC also antagonized the contractions to NA in a competitive manner with a pA2 value of 6.10. 5. The specific binding of [3H]-prazosin to DDT1MF-2 and A10 cells was concentration-dependent and saturated at 3-5 nM with KD values of 0.24 +/- 0.02 and 0.20 +/- 0.02 nM, respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7952879

  16. Role of alpha1-blockade in congenital long QT syndrome: investigation by exercise stress test.

    PubMed

    Furushima, H; Chinushi, M; Washizuka, T; Aizawa, Y

    2001-07-01

    Beta-blockade is widely reported to reduce the incidence of syncope in 75-80% of patients with congenital long QT syndrome (LQTS). However, despite full-dose beta-blockade, 20-25% of patients continue to have syncopal episodes and remain at high risk for sudden cardiac death. In some patients refractory to beta-blockade, the recurrence of arrhythmias is successfully prevented by left stellate ganglionectomy, and also by labetalol, a nonselective beta-blockade with alpha1-blocking action. These observations suggest that not only beta-adrenoceptors, but also alpha1-adrenoceptors, play an important pathogenic role, especially under sympathetic stimulation, in LQTS. The clinical effects of alpha1-blockade in congenital LQTS were investigated in 8 patients with familial or sporadic LQTS. Two measurements of the QT interval were taken, from the QRS onset to the T wave offset (QT) and from the QRS onset to the peak of the T wave (QTp). Using the Bruce protocol, an exercise test was performed after administration of beta-blockade alone and again after administration of alpha1-blockade. The following were compared: (1) Bazzet-corrected QT (QTc) and QTp (QTpc) intervals in the supine and standing position before exercise and in the early recovery phase after exercise; and (2) the slopes (reflecting the dynamic change in the QT interval during exercise) of the QT interval to heart rate were obtained from the linear regression during the exercise test. In the supine position before exercise, there was no change in the QTc before or after the addition of alpha1-blockade (498+/-23 vs 486+/-23 ms [NS]). However, in the upright position before exercise and in the early recovery phase after exercise, QTc was significantly shortened from 523+/-21 to 483+/-22ms (p<0.01), and from 521+/-30 to 490+/-39ms (p<0.01), respectively, by alpha1-blockade. The QTpc was unchanged in any situation. Consequently, QTc-QTpc was significantly shortened by alpha1-blockade in the upright position

  17. Determination of Alpha

    NASA Astrophysics Data System (ADS)

    Chmeissani, Mokhtar Abdallah

    The determination of the strong coupling constant alpha_ s, using Energy-Energy Correlation Asymmetry and jet mass difference with Mark II data at SLC (91 GeV) is presented. In Energy-Energy Correlation Asymmetry (EECA), we used the same systematic procedure used to determine alpha_ s with MARK II data at PEP (29 GeV). The chi^2 fit suggests that alpha_ s = 0.119 +/- 0.007(stat.) +/- 0.007(syst.). In addition, we used the EECA method to determine the QCD scale parameter Lambda_{LLA}. The chi^2 fit suggests that Lambda _{LLA} = 420 +/- 90(stat.) MeV. In the jet mass difference method, the determination of alpha_ s is based on QCD calculations up to 2nd order. We showed that in this method we are able to reproduce the value of alpha _ s from a Monte Carlo sample to a very high accuracy. The result with this method is alpha _ s = 0.134 +/- 0.085(stat.) +/- 0.004(syst.). The two values of alpha_ s presented in this work are in agreement within the error bars and in a good agreement with recent results of alpha_ s published from other e^+e^- experiments.

  18. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  19. Event counting alpha detector

    DOEpatents

    Bolton, Richard D.; MacArthur, Duncan W.

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  20. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  1. Imaging alpha particle detector

    DOEpatents

    Anderson, David F.

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  2. Pharmacological activity of (-)-discretamine, a novel vascular alpha-adrenoceptor and 5-hydroxytryptamine receptor antagonist, isolated from Fissistigma glaucescens.

    PubMed

    Ko, F N; Yu, S M; Su, M J; Wu, Y C; Teng, C M

    1993-10-01

    1. The pharmacological activity of (-)-discretamine, isolated from Fissistigma glaucescens, was determined in rat isolated thoracic aorta, cardiac tissues and ventricular myocytes and guinea-pig isolated trachea. 2. (-)-Discretamine was found to be an alpha 1-adrenoceptor blocking agent in rat thoracic aorta as revealed by its competitive antagonism of noradrenaline (pA2 = 7.20 +/- 0.10)- or phenylephrine (pA2 = 7.60 +/- 0.09)-induced vasoconstriction. It was as potent as phentolamine (pA2 = 7.51 +/- 0.10), but was more potent than yohimbine (pA2 = 6.18 +/- 0.06). Removal of endothelium significantly increased the antagonistic potency of (-)-discretamine on noradrenaline (pA2 = 7.52 +/- 0.09)- or phenylephrine (pA2 = 7.90 +/- 0.09)-induced vasoconstriction. 3. (-)-Discretamine was also an alpha 2-adrenoceptor blocking agent (pA2 = 6.30 +/- 0.15) and a 5-hydroxytryptamine antagonist (pA2 = 6.87 +/- 0.06), both in rat aorta denuded of endothelium. 4. (-)-Discretamine protected alpha-adrenoceptors from alkylation by the irreversible blocking agent, phenoxybenzamine. 5. [3H]-inositol monophosphate formation caused by noradrenaline (3 microM) in rat thoracic aorta was suppressed by (-)-discretamine (10 and 30 microM) and prazosin (3 microM). 6. A high concentration of (-)-discretamine (30 microM) did not affect the contraction induced by the thromboxane receptor agonist U-46619, prostaglandin F2 alpha (PGF2 alpha), angiotensin II, high K+ or endothelin in rat aorta denuded of endothelium. Neither cyclic AMP nor cyclic GMP content of rat thoracic aorta was changed by (-)-discretamine. 7. Contraction of guinea-pig trachea caused by histamine, leukotriene C4 or carbachol was not affected by (-)-discretamine (30 microM). (-)-Discretamine also did not block beta l- or beta2-adrenoceptor-mediated responses induced by isoprenaline in rat right atria and guinea-pig trachea.8. A voltage clamp study in rat ventricular single myocytes revealed that sodium inward current, slow

  3. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.

    2015-12-10

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  4. Alpha One Foundation

    MedlinePlus

    ... related programs More News Our Number One Goal: Find a cure for Alpha-1. Website Sponsors Helpful Links 3300 Ponce de Leon Blvd. Coral Gables, FL 33134 Phone: (877) 228-7321 Email: info@alphaone.org Copyright ...

  5. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.

    2009-05-13

    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  6. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  7. Portable alpha spectrometer.

    PubMed

    Martín Sánchez, A; de la Torre Pérez, J

    2012-09-01

    Many portable devices have been designed to detect γ-rays or alpha and beta particles. Most of the α-particle detectors give the total count as a result, without identifying the radionuclides existing in the sample. The development of a device allowing rapid and straightforward α-particle spectrometry would be very useful for detecting the radioactive contents of unknown samples. This work describes the construction of a portable device using silicon semiconductor detectors designed to rapidly detect and possibly identify alpha-emitting radionuclides.

  8. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  9. Hand vein responses to noradrenaline in normotensive patients with insulin-dependent diabetes mellitus and microalbuminuria: effects of alpha-adrenoceptor blockade with doxazosin.

    PubMed

    Bodmer, C W; Lake, D; Savage, M W; Williams, G

    1999-01-01

    Nephropathy commonly develops in patients with insulin-dependent (type 1) diabetes. Administration of an antihypertensive agent to type 1 diabetes patients with microalbuminuria, the first clinically detectable stage of nephropathy, can help slow renal deterioration. It is postulated that the exaggerated vasoconstrictor response to noradrenaline seen in these patients may be relevant in the development of microalbuminuria. This open, non-comparative pilot study was designed to investigate the effects of the alpha-adrenoceptor antagonist doxazosin on noradrenaline-induced hand vein vasoconstriction and on albumin excretion in 14 normotensive type 1 diabetes patients with microalbuminuria. After a three-week placebo run-in period, patients received doxazosin (1, 2, and then 4 mg once-daily, at two-week intervals) for six weeks, followed by a two-week placebo washout period. Vasoconstrictor responses to noradrenaline were measured in dorsal hand veins at the end of each two-week period. Hand vein vasoconstrictor responses to noradrenaline decreased significantly, compared with placebo, at 4 mg/day doxazosin (p = 0.006). The mean albumin excretion rate was lower than baseline at all doses of doxazosin, but changes did not reach statistical significance. Doxazosin was generally well-tolerated; four patients (29%) reported mild-to-moderate treatment-related adverse events. This study indicates that alpha 1-adrenoceptor blockade can blunt the exaggerated vascular reactivity to noradrenaline in normotensive type 1 diabetes patients with microalbuminuria, and supports further research into a potential role for doxazosin in preventing the development of diabetic nephropathy.

  10. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  11. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  12. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  13. Comparison of once and twice daily oral dosing schedules of bevantolol, a new beta-adrenoceptor antagonist with alpha-adrenoceptor partial antagonist activity in patients with angina of effort.

    PubMed

    Molajo, A O; Bray, C L; Hillier, V

    1989-11-01

    In a placebo controlled double-blind cross-over study following a dose titration phase, we compared the efficacy of benantolol, a new beta 1 adrenoceptor antagonist with alpha-adrenoceptor partial antagonist activity at 12 and 24 hours after dosing in patients with angina of effort. Twenty patients aged 43-65 years were studied. Each study phase lasted four weeks. Efficacy was determined by treadmill exercise testing using the standard Bruce protocol at the end of each phase. Fifteen patients satisfactorily completed the study. Data from five protocol violators were not analysed. In the four patients who received bevantolol 200 mg daily, exercise time increased from 395 +/- 192 (mean +/- 1 SD) sec on placebo to 468 +/- 171 sec at 10-12 hours and to 442 +/- 230 sec at 22-24 hours after dosing with bevantolol. In the eleven patients who received bevantolol 400 mg daily, exercise tolerance of 290 +/- 103 sec on placebo increased to 408 +/- 112 sec at 10-12 hours (P = 0.001) and to 400 +/- 98 sec at 22-24 hours (P = 0.001) after dosing with bevantolol. Maximum exercise capacity at 10-12 and 22-24 hours after dosing with bevantolol were comparable. Maximum exercise heart rate and systolic blood pressure on placebo and on bevantolol at 10-12 and at 22-24 hours after dosing were comparable. Thus, bevantolol has salutary effects on exertional angina up to 24 hours after dosing.

  14. {alpha}-Decay half-lives, {alpha}-capture, and {alpha}-nucleus potential

    SciTech Connect

    Denisov, V. Yu. Khudenko, A.A.

    2009-11-15

    {alpha}-Decay half-lives and {alpha}-capture cross sections are evaluated in the framework of a unified model for {alpha}-decay and {alpha}-capture. In this model {alpha}-decay and {alpha}-capture are considered as penetration of the {alpha}-particle through the potential barrier formed by the nuclear, Coulomb, and centrifugal interactions between the {alpha}-particle and nucleus. The spins and parities of the parent and daughter nuclei as well as the quadrupole and hexadecapole deformations of the daughter nuclei are taken into account for evaluation of the {alpha}-decay half-lives. The {alpha}-decay half-lives for 344 nuclei and the {alpha}-capture cross sections of {sup 40}Ca, {sup 44}Ca, {sup 59}Co, {sup 208}Pb, and {sup 209}Bi agree well with the experimental data. The evaluated {alpha}-decay half-lives within the range of 10{sup -9}{<=}T{sub 1/2}{<=}10{sup 38} s for 1246 {alpha}-emitters are tabulated.

  15. (-)-Discretamine, a selective alpha 1D-adrenoceptor antagonist, isolated from Fissistigma glaucescens.

    PubMed

    Ko, F N; Guh, J H; Yu, S M; Hou, Y S; Wu, Y C; Teng, C M

    1994-08-01

    1. The selectivity of (-)-discretamine for alpha 1-adrenoceptor subtypes was investigated by use of functional and binding studies in rat vas deferens, spleen and aorta, and in cultured DDT1MF-2 and A10 cells. 2. In prostatic portions of rat vas deferens, the competitive antagonists (-)-discretamine, 5-methylurapidil (5-MU) and prazosin inhibited contractions to noradrenaline (NA) with pA2 values of 6.21, 8.71 and 9.27, respectively. The irreversible antagonist, chloroethylclonidine (CEC, 100 microM) failed to affect contractions to NA while nifedipine (1 microM) blocked them almost completely. 3. In rat spleen, the competitive antagonists (-)-discretamine, 5-MU and prazosin inhibited contractions to phenylephrine with pA2 values of 6.44, 7.19 and 9.45, respectively. CEC (100 microM) significantly reduced the maximum contraction to phenylephrine while nifedipine (1 microM) did not affect it. 4. In rat aorta, the competitive antagonists (-)-discretamine, 5-MU and prazosin inhibited contractions to NA with pA2 values of 7.60, 8.00 and 9.40, respectively. CEC also antagonized the contractions to NA in a competitive manner with a pA2 value of 6.10. 5. The specific binding of [3H]-prazosin to DDT1MF-2 and A10 cells was concentration-dependent and saturated at 3-5 nM with KD values of 0.24 +/- 0.02 and 0.20 +/- 0.02 nM, respectively. (-)-Discretamine,5-MU, CEC and prazosin inhibited specific [3H]-prazosin binding to DDTIMF-2 and AlO cells in a concentration-dependent manner with ICso values of 390.8 +/- 20.6, 43.6 +/- 3.9, 200.0 +/- 30.0 and 0.8 +/- 0.1 nM, respectively in DDTIMF-2 cells, and 25.0 +/- 3.2, 8.6 +/- 1.4, 1000.0 +/- 30.8 and 0.52 +/- 0.03 nM, respectively in AlO cells.6. Pretreatment of Al0 cells with CEC (10 MicroM) for 30 min and then washed out thoroughly, reduced specific [3H]-prazosin binding by 30%. The CEC-insensitive [3H]-prazosin binding was inhibited by(-)-discretamine with an IC50 value of 7.0 +/- 0.3 nM.7. 5-MU (100 nM), CEC (1 MicroM) and

  16. Simultaneous quantification of GABAergic 3alpha,5alpha/3alpha,5beta neuroactive steroids in human and rat serum.

    PubMed

    Porcu, Patrizia; O'Buckley, Todd K; Alward, Sarah E; Marx, Christine E; Shampine, Lawrence J; Girdler, Susan S; Morrow, A Leslie

    2009-01-01

    The 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone enhance GABAergic neurotransmission and produce inhibitory neurobehavioral and anti-inflammatory effects. Despite substantial information on the progesterone derivative (3alpha,5alpha)-3-hydroxypregnan-20-one (3alpha,5alpha-THP, allopregnanolone), the physiological significance of the other endogenous GABAergic neuroactive steroids has remained elusive. Here, we describe the validation of a method using gas chromatography-mass spectrometry to simultaneously identify serum levels of the eight 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone. The method shows specificity, sensitivity and enhanced throughput compared to other methods already available for neuroactive steroid quantification. Administration of pregnenolone to rats and progesterone to women produced selective effects on the 3alpha,5alpha- and 3alpha,5beta-reduced neuroactive steroids, indicating differential regulation of their biosynthetic pathways. Pregnenolone administration increased serum levels of 3alpha,5alpha-THP (+1488%, p<0.001), (3alpha,5alpha)-3,21-dihydroxypregnan-20-one (3alpha,5alpha-THDOC, +205%, p<0.01), (3alpha,5alpha)-3-hydroxyandrostan-17-one (3alpha,5alpha-A, +216%, p<0.001), (3alpha,5alpha,17beta)-androstane-3,17-diol (3alpha,5alpha-A-diol, +190%, p<0.01). (3alpha,5beta)-3-hydroxypregnan-20-one (3alpha,5beta-THP) and (3alpha,5beta)-3-hydroxyandrostan-17-one (3alpha,5beta-A) were not altered, while (3alpha,5beta)-3,21-dihydroxypregnan-20-one (3alpha,5beta-THDOC) and (3alpha,5beta,17beta)-androstane-3,17-diol (3alpha,5beta-A-diol) were increased from undetectable levels to 271+/-100 and 2.4+/-0.9 pg+/-SEM, respectively (5/8 rats). Progesterone administration increased serum levels of 3alpha,5alpha-THP (+1806%, p<0.0001), 3alpha,5beta-THP (+575%, p<0.001), 3alpha,5alpha

  17. Proteinaceous alpha-amylase inhibitors.

    PubMed

    Svensson, Birte; Fukuda, Kenji; Nielsen, Peter K; Bønsager, Birgit C

    2004-02-12

    Proteins that inhibit alpha-amylases have been isolated from plants and microorganisms. These inhibitors can have natural roles in the control of endogenous alpha-amylase activity or in defence against pathogens and pests; certain inhibitors are reported to be antinutritional factors. The alpha-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha-amylases in complex with inhibitors from five families. These structures indicate major diversity but also some similarity in the structural basis of alpha-amylase inhibition. Mutational analysis of the mechanism of inhibition was performed in a few cases and various protein engineering and biotechnological approaches have been outlined for exploitation of the inhibitory function. PMID:14871655

  18. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  19. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  20. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  1. Lorentz violation and {alpha} decay

    SciTech Connect

    Altschul, Brett

    2009-01-01

    Relating the effective Lorentz violation coefficients for composite particles to the coefficients for their constituent fields is a challenging problem. We calculate the Lorentz violation coefficients relevant to the dynamics of an {alpha} particle in terms of proton and neutron coefficients. The {alpha}-particle coefficients would lead to anisotropies in the {alpha} decays of nuclei, and because the decay process involves quantum tunneling, the effects of any Lorentz violations could be exponentially enhanced.

  2. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  3. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.

    1990-01-01

    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  4. ISS Update: Alpha Magnetic Spectrometer

    NASA Video Gallery

    NASA Public Affairs Officer Kelly Humphries interviews Trent Martin, Johnson Space Center project manager for the Alpha Magnetic Spectrometer (AMS) aboard the International Space Station. Questions...

  5. Blood flow in histamine- and allergen-induced weal and flare responses, effects of an H1 antagonist, alpha-adrenoceptor agonist and a topical glucocorticoid.

    PubMed

    Hammarlund, A; Olsson, P; Pipkorn, U

    1990-01-01

    Allergen has previously been shown to induce a continuous increase in local dermal blood flow after a prick test in allergic subjects, whereas histamine induced, initially, similar peak increases in blood flow of much shorter duration. Blood flow changes induced by histamine and allergen have now been evaluated (i) after pretreatment with a local corticosteroid cream, clobetasole-17-propionate; (ii) after oral administration of the H1-antihistamine loratadine; and (iii) after oral pretreatment with the alpha 1-adrenoceptor agonist pseudoephedrine. Blinded placebo-controlled designs were used in the substudies. Laser doppler flowmetry was used for non-invasive recording of changes in local blood flow intermittently for 24 h after the topical corticosteroid, 6 h for the substudies on loratadine and pseudoephedrine. The size of the immediate weal and flare reactions, as well as late phase reactions, were also determined. Pretreatment with clobetasole-17-propionate cream on the skin for 1 week prior to prick tests did not affect the blood flow response elicited by histamine or allergen, in either the initial part (up to 1 h) or the protracted 24 h determinations. The size of the weal and flare reactions decreased. Loratadine and pseudoephedrine did not reduce the initial allergen-induced increase in blood flow, while lower blood flow compared with placebo pretreatment was noted for the protracted (1-6 h) determinations. Blood flow changes after histamine were unaffected. The histamine-induced weal and flare was inhibited by loratadine more effectively than the corresponding allergen-induced reaction. The weal and flare reactions after histamine and allergen were not changed after pseudoephedrine.(ABSTRACT TRUNCATED AT 250 WORDS)

  6. Resting alpha activity predicts learning ability in alpha neurofeedback

    PubMed Central

    Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho

    2014-01-01

    Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

  7. Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Ting, Samuel

    2012-07-01

    The Alpha Magnetic Spectrometer (AMS) is a precision particle physics magnetic spectrometer designed to measure electrons, positrons, gamma rays and various nuclei and anti-nuclei from the cosmos up to TeV energy ranges. AMS weighs 7.5 tons and measures 5 meters by 4 meters by 3 meters. It contains 300,000 channels of electronics and 650 onboard microprocessors. It was delivered to the International Space Station onboard space shuttle Endeavour and installed on May 19, 2011. Since that time, more than 14 billion cosmic ray events have been collected. All the detectors function properly. At this moment, we are actively engaged in data analysis. AMS is an international collaboration involving 16 countries and 60 institutes. It took 16 years to construct and test. AMS is the only major physical science experiment on the International Space Station and will continue to collect data over the entire lifetime of the Space Station (10-20 years).

  8. Microscopic cluster model of {alpha}+n, {alpha}+p, {alpha}+ {sup 3}He, and {alpha}+{alpha} elastic scattering from a realistic effective nuclear interaction

    SciTech Connect

    Dohet-Eraly, J.; Baye, D.

    2011-07-15

    An effective nucleon-nucleon interaction adapted to cluster-model calculations of collisions is derived from the realistic Argonne potential AV18 with the unitary correlation operator method. The unitary correlation is determined from the {alpha}+{alpha} elastic phase shifts calculated in a cluster approach by the generator coordinate method coupled with the microscopic R-matrix method. With this interaction, the elastic phase shifts for the {alpha}+n, {alpha}+p, and {alpha}+{sup 3}He collisions are calculated within the same model. Without further adjustment, a good agreement with experimental data is obtained with a small model space.

  9. Alpha particle emitters in medicine

    SciTech Connect

    Fisher, D.R.

    1989-09-01

    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

  10. Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

    PubMed

    Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

    2006-01-01

    The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

  11. Genetics Home Reference: alpha-mannosidosis

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions alpha-mannosidosis alpha-mannosidosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Alpha-mannosidosis is a rare inherited disorder that causes ...

  12. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  13. Alpha--College for Exploring

    ERIC Educational Resources Information Center

    Leppert, William; Koenig, Joan

    1976-01-01

    Describes Alpha, the experimental college of individualized instruction at the College of DuPage (Illinois). At this college, students design their own curricula and work in an open classroom situation, and teachers start with students instead of subjects. (DC)

  14. Genetics Home Reference: alpha thalassemia

    MedlinePlus

    ... in each cell. Each copy is called an allele. For each gene, one allele is inherited from a person's father, and the ... person's mother. As a result, there are four alleles that produce alpha-globin. The different types of ...

  15. Detecting Alpha-1 Antitrypsin Deficiency.

    PubMed

    Stoller, James K

    2016-08-01

    Alpha-1 antitrypsin deficiency is a widely underrecognized condition, with evidence of persisting long diagnostic delays and patients' frequent need to see multiple physicians before initial diagnosis. Reasons for underrecognition include inadequate understanding of alpha-1 antitrypsin deficiency by physicians and allied health care providers; failure to implement available, guideline-based practice recommendations; and the belief that effective therapy is unavailable. Multiple studies have described both the results of screening and targeted detection of individuals with alpha-1 antitrypsin deficiency, with both varying strategies employed to identify at-risk individuals and varying results of testing. Also, various strategies to enhance detection of affected individuals have been examined, including use of the electronic medical record to prompt testing and empowerment of allied health providers, especially respiratory therapists, to promote testing for alpha-1 antitrypsin deficiency. Such efforts are likely to enhance detection with the expected result that the harmful effects of delayed diagnosis can be mitigated. PMID:27564667

  16. Alpha Magnetic Spectrometer (AMS) Overview

    NASA Video Gallery

    The Alpha Magnetic Spectrometer (AMS) is flying to the station on STS-134. The AMS experiment is a state-of-the-art particle physics detector being operated by an international team composed of 60 ...

  17. Synthesis and herbicidal activity of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives.

    PubMed

    Xu, Han; Zou, Xiao-Mao; Zhu, You-Quan; Liu, Bin; Tao, Han-Lin; Hu, Xu-Hong; Song, Hai-Bin; Hu, Fang-Zhong; Wang, Yong; Yang, Hua-Zheng

    2006-06-01

    A series of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives was synthesised. Herbicidal activities of the two intermediate compounds and 15 pyridazinone derivatives were evaluated through barnyardgrass and rape cup tests and Spirodela polyrrhiza (L.) Schleiden tests. Selected compounds were also evaluated under greenhouse conditions. Bleaching activities were observed at 10 microg ml(-1) and some compounds exhibited herbicidal activities at a rate of 300 g ha(-1). The relationship between crystal structures and herbicidal activities is discussed through a comparison of two compounds (5a and 5f). PMID:16602079

  18. Alpha decay in electron surrounding

    SciTech Connect

    Igashov, S. Yu.; Tchuvil’sky, Yu. M.

    2013-12-15

    The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

  19. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  20. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  1. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  2. Binding of actin to lens alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Actin has been coupled to a cyanogen bromide-activated Sepharose 4B column, then tested for binding to alpha, beta, and gamma crystallin preparations from the bovine lens. Alpha, but not beta or gamma, crystallins bound to the actin affinity column in a time dependent and saturable manner. Subfractionation of the alpha crystallin preparation into the alpha-A and alpha-B species, followed by incubation with the affinity column, demonstrated that both species bound approximately the same. Together, these studies demonstrate a specific and saturable binding of lens alpha-A and alpha-B with actin.

  3. [Alpha-Synuclein in blood and cerebrospinal fluid of patients with alpha-synucleinopathy].

    PubMed

    Ono, Kenjiro; Yamada, Masahito

    2014-03-01

    Alpha-Synuclein protein(alphaS) aggregates from a monomer to assemblies such as oligomers, protofibrils, and mature fibrils. The early intermediate aggregate, that is, the oligomer, has been reported to be the most toxic species. We recently reported that melatonin inhibits alphaS aggregation, including protofibril and oligomer formations. While the alphaS concentration in cerebrospinal fluid was reported to significantly decrease in patients with Parkinson's disease (PD) and dementia with Lewy bodies, there have been reports that the alphaS oligomer concentration was elevated in the cerebrospinal fluid of PD patients. Moreover, it was reported that the alphaS oligomer concentration was also elevated in the blood of PD patients. Further studies may establish alphaS in cerebrospinal fluid and blood as a biomarker of alpha-synucleinopathies, including PD.

  4. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  5. Workshop on Precision Measurements of $\\alpha_s$

    SciTech Connect

    Bethke, Siegfried; Hoang, Andre H.; Kluth, Stefan; Schieck, Jochen; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS

    2011-10-01

    These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

  6. The Role of α1-Adrenoceptor Antagonists in the Treatment of Prostate and Other Cancers

    PubMed Central

    Batty, Mallory; Pugh, Rachel; Rathinam, Ilampirai; Simmonds, Joshua; Walker, Edwin; Forbes, Amanda; Anoopkumar-Dukie, Shailendra; McDermott, Catherine M.; Spencer, Briohny; Christie, David; Chess-Williams, Russ

    2016-01-01

    This review evaluates the role of α-adrenoceptor antagonists as a potential treatment of prostate cancer (PCa). Cochrane, Google Scholar and Pubmed were accessed to retrieve sixty-two articles for analysis. In vitro studies demonstrate that doxazosin, prazosin and terazosin (quinazoline α-antagonists) induce apoptosis, decrease cell growth, and proliferation in PC-3, LNCaP and DU-145 cell lines. Similarly, the piperazine based naftopidil induced cell cycle arrest and death in LNCaP-E9 cell lines. In contrast, sulphonamide based tamsulosin did not exhibit these effects. In vivo data was consistent with in vitro findings as the quinazoline based α-antagonists prevented angiogenesis and decreased tumour mass in mice models of PCa. Mechanistically the cytotoxic and antitumor effects of the α-antagonists appear largely independent of α 1-blockade. The proposed targets include: VEGF, EGFR, HER2/Neu, caspase 8/3, topoisomerase 1 and other mitochondrial apoptotic inducing factors. These cytotoxic effects could not be evaluated in human studies as prospective trial data is lacking. However, retrospective studies show a decreased incidence of PCa in males exposed to α-antagonists. As human data evaluating the use of α-antagonists as treatments are lacking; well designed, prospective clinical trials are needed to conclusively demonstrate the anticancer properties of quinazoline based α-antagonists in PCa and other cancers. PMID:27537875

  7. The possible role of medial prefrontal cortex beta-1-adrenoceptors in morphine-induced amnesia.

    PubMed

    Torkaman-Boutorabi, Anahita; Hashemi-Hezaveh, Seyed-Milad; Sheidadoust, Hadi; Zarrindast, Mohammad-Reza

    2014-01-01

    The prelimbic region of the medial prefrontal cortex (mPFC) in the brain is crucial for memory. Norepinephrine elicits an important influence on mPFC functions. The stimulation of β-adrenoceptors (β-ARs) may play a critical role in the consolidation of long-term memory. The present study examines the possible role of β₁-ARs located in the mPFC on morphine-induced amnesia in rats. The animals were bilaterally implanted with chronic cannulas in the mPFC, trained in a step-through-type passive avoidance task and tested 24 h after training to measure step-through latency. Our present results indicated that posttraining intraperitoneal administration of morphine (2.5, 5 and 7.5 mg/kg) dose-dependently reduced the step-through latency. Different doses of xamoterol (0.01, 0.1 and 1 µg/rat) have shown no significant change in the step-through latency, but posttraining intra-mPFC microinjection of atenolol (0.2 and 0.4 µg/rat) had an amnesic effect. Moreover, atenolol-caused amnesia was reversed by an ineffective dose of xamoterol (0.1 µg/rat). On the other hand, coadministration of an ineffective dose of atenolol (0.1 µg/rat) with an ineffective dose of morphine (2.5 mg/kg) induced an amnesic effect. Meanwhile, xamoterol had no effect on morphine-induced amnesia. These results suggest that β₁-ARs of the prelimbic region in the mPFC may play an important role in morphine-induced amnesia.

  8. The Role of α1-Adrenoceptor Antagonists in the Treatment of Prostate and Other Cancers.

    PubMed

    Batty, Mallory; Pugh, Rachel; Rathinam, Ilampirai; Simmonds, Joshua; Walker, Edwin; Forbes, Amanda; Anoopkumar-Dukie, Shailendra; McDermott, Catherine M; Spencer, Briohny; Christie, David; Chess-Williams, Russ

    2016-01-01

    This review evaluates the role of α-adrenoceptor antagonists as a potential treatment of prostate cancer (PCa). Cochrane, Google Scholar and Pubmed were accessed to retrieve sixty-two articles for analysis. In vitro studies demonstrate that doxazosin, prazosin and terazosin (quinazoline α-antagonists) induce apoptosis, decrease cell growth, and proliferation in PC-3, LNCaP and DU-145 cell lines. Similarly, the piperazine based naftopidil induced cell cycle arrest and death in LNCaP-E9 cell lines. In contrast, sulphonamide based tamsulosin did not exhibit these effects. In vivo data was consistent with in vitro findings as the quinazoline based α-antagonists prevented angiogenesis and decreased tumour mass in mice models of PCa. Mechanistically the cytotoxic and antitumor effects of the α-antagonists appear largely independent of α 1-blockade. The proposed targets include: VEGF, EGFR, HER2/Neu, caspase 8/3, topoisomerase 1 and other mitochondrial apoptotic inducing factors. These cytotoxic effects could not be evaluated in human studies as prospective trial data is lacking. However, retrospective studies show a decreased incidence of PCa in males exposed to α-antagonists. As human data evaluating the use of α-antagonists as treatments are lacking; well designed, prospective clinical trials are needed to conclusively demonstrate the anticancer properties of quinazoline based α-antagonists in PCa and other cancers. PMID:27537875

  9. Synthesis and structure-activity relationships of novel arylpiperazines as potent antagonists of α1-adrenoceptor.

    PubMed

    Silva, Renata Oliveira; de Oliveira, Andressa Souza; Nunes Lemes, Laís Flávia; de Camargo Nascente, Luciana; Coelho do Nascimento Nogueira, Patrícia; Silveira, Edilberto R; Brand, Guilherme D; Vistoli, Giulio; Cilia, Antonio; Poggesi, Elena; Buccioni, Michela; Marucci, Gabriella; Bolognesi, Maria Laura; Romeiro, Luiz Antonio Soares

    2016-10-21

    Arylpiperazines 2-11 were synthesized, and their biological profiles at α1-adrenergic receptors (α1-ARs) assessed by binding assays in CHO cells expressing human cloned subtypes and by functional experiments in isolated rat vas deferens (α1A), spleen (α1B), and aorta (α1D). Modifications at the 1,3-benzodioxole and phenyl phamacophoric units resulted in the identification of a number of potent compounds (moderately selective with respect to the α1b-AR), in binding experiments. Notably, compound 7 (LDT451) showed a subnanomolar pKi of 9.41 towards α1a-AR. An encouragingly lower α1B-potency was a general trend for all the series of compounds, which showed α1A/D over α1B selectivity in functional assays. If adequately optimized, such peculiar selectivity could have relevance for a potential LUTS/BPH therapeutic application. PMID:27448917

  10. alpha-Thalassemia caused by an unstable alpha-globin mutant.

    PubMed Central

    Liebhaber, S A; Kan, Y W

    1983-01-01

    In a previous study, molecular cloning of the alpha-globin genes from a patient with nondeletion Hb-H disease (genotype--/alpha alpha) showed that a single nucleotide mutation (CTG to CCG) in one of the genes resulted in a leucine to proline substitution. This paper describes the approach we used to detect the abnormal alpha-globin chain. The chain was identified using a cell-free translation system. It turned over rapidly both in vitro and in vivo in the patient's reticulocytes. The unusual feature of this unstable alpha-globin is that the alpha-globin deficiency causes alpha-thalassemia. Simple heterozygotes for this lesion (alpha Pro alpha/alpha alpha) resemble alpha-thalassemia carriers and do not exhibit the hemolytic anemia usually associated with unstable hemoglobins. Images PMID:6826718

  11. Bremsstrahlung in {alpha} Decay Reexamined

    SciTech Connect

    Boie, H.; Scheit, H.; Jentschura, U. D.; Koeck, F.; Lauer, M.; Schwalm, D.; Milstein, A. I.; Terekhov, I. S.

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the {alpha} decay of {sup 210}Po has been performed, which allows us to follow the photon spectra up to energies of {approx}500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the {alpha} particle and the emitted photon.

  12. NACA Physicist Studying Alpha Rays

    NASA Technical Reports Server (NTRS)

    1957-01-01

    NACA Physicits studying Alpha Rays in a continuous cloud chamber. A cloud chamber is used by Lewis scientists to obtain information aimed at minimizing undesirable effects of radiation on nuclear-powered aircraft components. Here, alpha particles from a polonium source emit in a flower-like pattern at the cloud chamber's center. The particles are made visible by means of alcohol vapor diffusing from an area at room temperature to an area at minus -78 deg. Centigrade. Nuclear-powered aircraft were never developed and aircraft nuclear propulsion systems were canceled in the early 1960s.

  13. Bremsstrahlung in alpha decay reexamined.

    PubMed

    Boie, H; Scheit, H; Jentschura, U D; Köck, F; Lauer, M; Milstein, A I; Terekhov, I S; Schwalm, D

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the alpha decay of (210)Po has been performed, which allows us to follow the photon spectra up to energies of approximately 500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the alpha particle and the emitted photon.

  14. Test chamber for alpha spectrometry

    DOEpatents

    Larsen, Robert P.

    1977-01-01

    Alpha emitters for low-level radiochemical analysis by measurement of alpha spectra are positioned precisely with respect to the location of a surface-barrier detector by means of a chamber having a removable threaded planchet holder. A pedestal on the planchet holder holds a specimen in fixed engagement close to the detector. Insertion of the planchet holder establishes an O-ring seal that permits the chamber to be pumped to a desired vacuum. The detector is protected against accidental contact and resulting damage.

  15. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  16. Targeted therapy using alpha emitters.

    PubMed

    Vaidyanathan, G; Zalutsky, M R

    1996-10-01

    Radionuclides such as 211At and 212Bi which decay by the emission of alpha-particles are attractive for certain applications of targeted radiotherapy. The tissue penetration of 212Bi and 211At alpha-particles is equivalent to only a few cell diameters, offering the possibility of combining cell-specific targeting with radiation of similar range. Unlike the beta-particles emitted by radionuclides such as 131I and 90Y, alpha-particles are radiation of high linear energy transfer and thus greater biological effectiveness. Several approaches have been explored for targeted radiotherapy with 212Bi- and 211At-labelled substances including colloids, monoclonal antibodies, metabolic precursors, receptor-avid ligands and other lower molecular weight molecules. An additional agent which exemplifies the promise of alpha-emitting radiopharmaceuticals is meta-[211At]astatobenzylguanidine. The toxicity of this compound under single-cell conditions, determined both by [3H]thymidine incorporation and by limiting dilution clonogenic assays, for human neuroblastoma cells is of the order of 1000 times higher than that of meta-[131I] iodobenzylguanidine. For meta-[211At] astatobenzylguanidine, the Do value was equivalent to only 6-7 211At atoms bound per cell. These results suggest that meta-[211At] astatobenzylguanidine might be valuable for the targeted radiotherapy of micrometastatic neuroblastomas.

  17. Meet the Alpha-Pets.

    ERIC Educational Resources Information Center

    Zitlaw, Jo Ann Bruce; Frank, Cheryl Standish

    1985-01-01

    "Alpha-Pets" are the focal point of an integrated, multidisciplinary curriculum. Each pet is featured for a week in a vocabulary-rich story and introduces related activities beginning with the featured letter, such as the four food groups during Freddie Fish's week or universe during Ulysses Unicorn's week. (MT)

  18. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  19. Postnatal changes of nicotinic acetylcholine receptor alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits genes expression in rat brain.

    PubMed

    Zhang, X; Liu, C; Miao, H; Gong, Z H; Nordberg, A

    1998-10-01

    Postnatal changes of nicotinic acetylcholine receptor (nAChR) alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits mRNAs were investigated in rat brain using ribonuclease protection assay. Multiple developmental patterns were observed: (1) transient expression during the first few postnatal weeks; alpha 2 in the hippocampus and brain stem, alpha 3 in the striatum, cerebellum and cortex, alpha 4 in the hippocampus, striatum and cerebellum, alpha 7 in the cerebellum and beta 2 in the striatum. (2) Constant expression across development; alpha 2 and alpha 3 in the thalamus, alpha 4 in the cortex, thalamus and brain stem, alpha 7 in the thalamus and brain stem and beta 2 in all brain regions except striatum. (3) Non-detection across development; alpha 2 in the cortex, striatum and cerebellum. (4) Increase with age; alpha 7 in the cortex and hippocampus. (5) Bell-shaped development; alpha 7 in the striatum. Postnatal changes of nAChR isoforms in different brain regions of rat were investigated by receptor binding assays. The developmental patterns of [3H]epibatidine and (-)-[3H]nicotine binding sites were similar to each other in each brain region, but different from that of [3H] alpha-bungarotoxin binding sites. No obvious correlation was observed between the developmental patterns of [3H] alpha-bungarotoxin, [3H]epibatidine and (-)-[3H]nicotine binding sites and corresponding subunits mRNAs. These results indicate that multiple mechanisms are involved in changes of gene expression of nAChRs subunits in the brain of developing rats.

  20. Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be

    SciTech Connect

    Itagaki, N.; Ito, M.; Milin, M.; Hashimoto, T.; Ishiyama, H.; Miyatake, H.

    2008-06-15

    The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

  1. A synopsis of collective alpha effects and implications for ITER

    SciTech Connect

    Sigmar, D.J.

    1990-10-01

    This paper discusses the following: Alpha Interaction with Toroidal Alfven Eigenmodes; Alpha Interaction with Ballooning Modes; Alpha Interaction with Fishbone Oscillations; and Implications for ITER.

  2. Genetics Home Reference: 5-alpha reductase deficiency

    MedlinePlus

    ... gene provides instructions for making an enzyme called steroid 5-alpha reductase 2. This enzyme is involved ... external genitalia. Mutations in the SRD5A2 gene prevent steroid 5-alpha reductase 2 from effectively converting testosterone ...

  3. What Causes Alpha-1 Antitrypsin Deficiency?

    MedlinePlus

    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  4. How Is Alpha-1 Antitrypsin Deficiency Treated?

    MedlinePlus

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  5. Q (Alpha) Function and Squeezing Effect

    NASA Technical Reports Server (NTRS)

    Yunjie, Xia; Xianghe, Kong; Kezhu, Yan; Wanping, Chen

    1996-01-01

    The relation of squeezing and Q(alpha) function is discussed in this paper. By means of Q function, the squeezing of field with gaussian Q(alpha) function or negative P(a)function is also discussed in detail.

  6. Association of actin with alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Boyle, D.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The alpha crystallins are cytosolic proteins that co-localize and co-purify with actin-containing microfilaments. Affinity column chromatography employing both covalently-coupled actin or alpha crystallin was used to demonstrate specific and saturable binding of actin with alpha crystallin. This conclusion was confirmed by direct visualization of alpha aggregates bound to actin polymerized in vitro. The significance of this interaction in relation to the functional properties of these two polypeptides will be discussed.

  7. The ultraviolet spectra of Alpha Aquilae and Alpha Canis Minoris

    NASA Technical Reports Server (NTRS)

    Morton, D. C.; Bruzual A., G.; Kurucz, R. L.; Spinrad, H.

    1977-01-01

    Scans of Alpha Aql (A7 IV, V) and Alpha CMi (F5 IV-V) obtained with the Copernicus satellite spectrometer over the wavelength range from 2100 to 3200 A are presented along with a spectrum of the integrated solar disk over the same range procured during a calibrated rocket flight. About 1500 fairly strong absorption lines in the Alpha CMi spectrum between 2400 and 2961 A are identified by comparison with a solar atlas and by using a theoretical spectrum synthesized from a blanketed LTE model with an effective temperature of 6500 K and a surface gravity of 10,000 cm/sec per sec. The Mg II resonance doublet at 2795.528 and 2802.704 A is found to be present in all three stars together with a discontinuity at 2635 A due to Fe II, Fe I, Cr I, and Mn II. It is concluded that the Mg II resonance lines and the 2635-A continuum break would be the best spectral features for estimating the redshift of a galaxy observed at low resolution provided the redshift is not less than about 0.75.

  8. Effectiveness of Alpha Biofeedback Therapy: Negative Results.

    ERIC Educational Resources Information Center

    Watson, Charles G.; Herder, Joseph

    1980-01-01

    Assessed the utility of alpha biofeedback training in the treatment of patients (N=66). Biofeedback and placebo biofeedback groups were given alpha or mock-alpha training sessions. Improvement on 54 variables was compared to that of no-treatment controls. Only a chance number of significant changes appeared among the groups. (Author)

  9. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison

    2005-10-18

    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  10. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  11. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  12. 6 alpha-Fluoro- and 6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione: synthesis and evaluation of activity and kinetics of their C-22 epimers.

    PubMed

    Thalén, B A; Axelsson, B I; Andersson, P H; Brattsand, R L; Nylander, B; Wickström, L I

    1998-01-01

    It is generally accepted that the anti-inflammatory effect of glucocorticosteroids cannot be separated from their adverse effects at the receptor level. However, modification of the pharmacokinetics through structural alterations could provide steroids with a better therapeutic index than those currently used. Thus, new 16 alpha,17 alpha-acetals between butyraldehyde and 6 alpha-fluoro- or 6 alpha,9 alpha-difluoro-16 alpha-hydroxycortisol were synthesized and studied. Acetalization of the corresponding 16 alpha,17 alpha-diols or transacetalization of their 16 alpha,17 alpha-acetonides in dioxane produced mixtures of C-22 epimers, which were resolved by preparative chromatography. Alternatively, an efficient method was used to produce the 22R-epimer stereoselectively through performing the acetalization and transacetalization in a hydrocarbon with an inert material present. The C-22 configuration of (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione was unambiguously established by single crystal X-ray diffraction. The present compounds, especially the 22R-epimer just mentioned, bind to the rat thymus glucocorticoid receptor with high potency. The C-22 epimers of the 6 alpha,9 alpha-difluoro derivatives showed a 10-fold higher biotransformation rate than the budesonide 22R-epimer when incubated with human liver S9 subcellular fraction. The high receptor affinity in combination with the high biotransformation rate indicates that (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione may be an improved 16 alpha,17 alpha-acetal glucocorticosteroid for therapy of inflammatory diseases, in which the mucous membranes are involved, such as those in the intestinal tract as well in the respiratory tract. PMID:9437793

  13. Alpha voltaic batteries and methods thereof

    NASA Technical Reports Server (NTRS)

    Raffaelle, Ryne P. (Inventor); Jenkins, Phillip (Inventor); Wilt, David (Inventor); Scheiman, David (Inventor); Chubb, Donald (Inventor); Castro, Stephanie (Inventor)

    2011-01-01

    An alpha voltaic battery includes at least one layer of a semiconductor material comprising at least one p/n junction, at least one absorption and conversion layer on the at least one layer of semiconductor layer, and at least one alpha particle emitter. The absorption and conversion layer prevents at least a portion of alpha particles from the alpha particle emitter from damaging the p/n junction in the layer of semiconductor material. The absorption and conversion layer also converts at least a portion of energy from the alpha particles into electron-hole pairs for collection by the one p/n junction in the layer of semiconductor material.

  14. THE LYMAN ALPHA REFERENCE SAMPLE: EXTENDED LYMAN ALPHA HALOS PRODUCED AT LOW DUST CONTENT

    SciTech Connect

    Hayes, Matthew; Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas; Schaerer, Daniel; Verhamme, Anne; Orlitova, Ivana; Mas-Hesse, J. Miguel; Oti-Floranes, Hector; Adamo, Angela; Atek, Hakim; Cannon, John M.; Herenz, E. Christian; Kunth, Daniel; Laursen, Peter

    2013-03-10

    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  15. Subjective pain perception mediated by alpha rhythms.

    PubMed

    Peng, Weiwei; Babiloni, Claudio; Mao, Yanhui; Hu, Yong

    2015-07-01

    Suppression of spontaneous alpha oscillatory activities, interpreted as cortical excitability, was observed in response to both transient and tonic painful stimuli. The changes of alpha rhythms induced by pain could be modulated by painful sensory inputs, experimental tasks, and top-down cognitive regulations such as attention. The temporal and spatial characteristics, as well as neural functions of pain induced alpha responses, depend much on how these factors contribute to the observed alpha event-related desynchronization/synchronization (ERD/ERS). How sensory-, task-, and cognitive-related changes of alpha oscillatory activities interact in pain perception process is reviewed in the current study, and the following conclusions are made: (1) the functional inhibition hypothesis that has been proposed in auditory and visual modalities could be applied also in pain modality; (2) the neural functions of pain induced alpha ERD/ERS were highly dependent on the cortical regions where it is observed, e.g., somatosensory cortex alpha ERD/ERS in pain perception for painful stimulus processing; (3) the attention modulation of pain perception, i.e., influences on the sensory and affective dimensions of pain experience, could be mediated by changes of alpha rhythms. Finally, we propose a model regarding the determinants of pain related alpha oscillatory activity, i.e., sensory-discriminative, affective-motivational, and cognitive-modulative aspects of pain experience, would affect and determine pain related alpha oscillatory activities in an integrated way within the distributed alpha system. PMID:26026894

  16. Synthesis of 16 alpha-3H androgen and estrogen substrates for 16 alpha-hydroxylase.

    PubMed

    Cantineau, R; Kremers, P; De Graeve, J; Cornelis, A; Laszlo, P; Gielen, J E; Lambotte, R

    1981-02-01

    The synthesis of 16 alpha-3H androgens and estrogens is described. 1-(3H)-Acetic acid in the presence of zinc dust reacts with 16 alpha-bromo-17-ketosteroids to produce 16 alpha-3H-17-ketosteroids. This chemical reaction was used to prepare 16 alpha-3H-dehydroepiandrosterone (I) and 16 alpha-3H-estrone acetate (XI) from 16 alpha-bromo-dehydroepiandrosterone (X) and from 16 alpha-bromo-estrone acetate (XII), respectively. Using appropriate microbiological techniques, it was possible to convert these radiolabelled substrates into 16 alpha-3H-androstenedione (II) and 16 alpha-3H-estradiol-17 beta (VII). 16 alpha-3H-Estrone (VI) was obtained by the chemical hydrolysis of 16 alpha-3H-estrone acetate. The label distribution as determined by microbiological 16 alpha-hydroxylations indicated a specific labelling of 77% for androgens and 65% for estrogens in the 16 alpha position. These substrates can be used for measuring the 16 alpha hydroxylase activity, an important step in the biosynthesis of estriol (VIII) and estetrol (IX). PMID:7013160

  17. A study of presynaptic alpha2-autoreceptors in alpha2A/D-, alpha2B- and alpha2C-adrenoceptor-deficient mice.

    PubMed

    Trendelenburg, A U; Klebroff, W; Hein, L; Starke, K

    2001-08-01

    The function of presynaptic alpha2-autoreceptors was studied in the hippocampus, occipito-parietal cortex, atria and vas deferens of NMRI mice, mice in which the alpha2A/D-, the alpha2B- or alpha2c-adrenoceptor gene had been disrupted (alpha2A/DKO, alpha2BKO and alpha2CKO, respectively), and the wildtype mice from which the knockout animals had been generated. Tissue pieces were preincubated with 3H-noradrenaline and then superfused and stimulated electrically. The alpha2-adrenoceptor agonist medetomidine reduced the electrically evoked overflow of tritium in all tissues from all mouse strains (stimulation with single pulses or single high-frequency pulse trains, called POPs, i.e. pulse patterns leading to minimal autoinhibition). The effects of medetomidine did not differ in NMRI, wildtype, alpha2BKO and alpha2CKO mice but were greatly reduced in alpha2A/DKO brain preparations and to a lesser extent in alpha2A/DKO atria and vasa deferentia. Six drugs were tested as antagonists against medetomidine. Their pKd values indicated that the hippocampal and occipito-parietal alpha2-autoreceptors in NMRI and wildtype mice were alpha2D (the rodent variant of the alpha2A/D-adrenoceptor) whereas the atrial and vas deferens alpha2-autoreceptors in NMRI and wildtype mice could not be identified with a single alpha2 subtype. Deletion of the alpha2A/D gene changed the pKd values in all tissues so that they now reflected alpha2C properties, whereas deletion of the alpha2C gene changed the pKd values in atria and vasa deferentia so that they now had alpha2D properties (as they had in NMRI and wildtype brain preparations). Autoinhibition by released noradrenaline was created using trains of up to 64 pulses or up to 4 POPs, and the overflow-enhancing effect of the alpha2 antagonist rauwolscine was determined. Results did not differ, irrespective of whether preparations were obtained from NMRI, wildtype, alpha2BKO or alpha2CKO mice: the overflow of tritium elicited by p pulses or POPs

  18. High gas flow alpha detector

    DOEpatents

    Bolton, Richard D.; Bounds, John A.; Rawool-Sullivan, Mohini W.

    1996-01-01

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors.

  19. High gas flow alpha detector

    DOEpatents

    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.

    1996-05-07

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  20. Reliability of {alpha}{sub 1} and {alpha}{sub 2} from lattice codes

    SciTech Connect

    Ng, K.Y.

    1996-10-01

    Whether the higher-order terms in the momentum-compaction factor, {alpha}{sub 1} and {alpha}{sub 2}, can be obtained reliably from lattice codes is an important issue for some quasi-isochronous rings. A FODO lattice consisting of thin quadrupoles, dipoles filling all spaces, and two families of thin sextupoles is solved and {alpha}{sub 1} and {alpha}{sub 2} are derived analytically. We find accurate agreement with SYNCH is examined. Some methods of measurement of {alpha}{sub 1} and {alpha}{sub 2} are discussed.

  1. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  2. Effects of interferon-alpha (IFN-alpha) administration on leucocytes in healthy humans.

    PubMed

    Corssmit, E P; Heijligenberg, R; Hack, C E; Endert, E; Sauerwein, H P; Romijn, J A

    1997-02-01

    Plasma concentrations of IFN-alpha are increased in several inflammatory conditions. Several lines of evidence indicate that IFN-alpha has anti-inflammatory properties. To study the effects of IFN-alpha on leucocyte subsets and activation and on cytokines, we administered IFN-alpha (rhIFN-alpha2b; 5 x 10(6) U/m2) to eight healthy human subjects in a randomized controlled cross-over study and analysed changes in circulating leucocytes and parameters for neutrophil and monocyte activation. After administration of IFN-alpha, neutrophil counts increased, monocyte counts decreased transiently, whereas the number of lymphocytes, basophils and eosinophils showed a sustained decrease. IFN-alpha administration was also associated with neutrophil activation, reflected in an increase in the plasma concentrations of elastase-alpha1-antitrypsin complexes and lactoferrin. Serum neopterin, a marker for monocyte activation, was significantly increased 10 h after administration of IFN-alpha. IFN-alpha significantly increased plasma concentrations of IL-6, IL-8 and IL-10. Although IL-1 and tumour necrosis factor (TNF) remained undetectable, plasma concentrations of soluble TNF receptors p55 and p75 increased after IFN-alpha administration. We conclude that IFN-alpha induces multiple alterations in the distribution and functional properties of leucocytes. IFN-alpha exerts pro- as well as anti-inflammatory effects within the cytokine network.

  3. Beta/alpha continuous air monitor

    DOEpatents

    Becker, G.K.; Martz, D.E.

    1988-06-27

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  4. Beta/alpha continuous air monitor

    DOEpatents

    Becker, Gregory K.; Martz, Dowell E.

    1989-01-01

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  5. Hemoglobin Evanston (alpha 14 Trp----Arg). An unstable alpha-chain variant expressed as alpha-thalassemia.

    PubMed Central

    Honig, G R; Shamsuddin, M; Vida, L N; Mompoint, M; Valcourt, E; Bowie, L J; Jones, E C; Powers, P A; Spritz, R A; Guis, M

    1984-01-01

    A new hematologic syndrome with phenotypic features of mild Hb H disease was identified in three children from two unrelated black American families. Erythrocytes from each of these children contained Hb H (beta 4) and Hb Barts (gamma 4), as well as a slowly migrating hemoglobin fraction that made up 7-10% of the total hemoglobin. The parents of the affected children all showed mild thalassemia-like changes, with one of the parents in each family also expressing the variant hemoglobin; in the latter individuals the mutant alpha-chains made up less than 2% of the total, and were present mainly or exclusively in combination with delta-chains in the form of a slowly migrating Hb A2. Purified Hb Evanston showed an increased oxygen affinity, but its Bohr effect, cooperativity, and 2,3-diphosphoglycerate effect were normal. The mutant hemoglobin appeared to have normal stability to heat and to isopropanol, and the stability of its alpha-chain in an extended time course synthesis study also appeared to be similar to that of alpha A. However, the results from short-term globin synthesis studies, and from mRNA translation in vitro, suggest that the two types of alpha-chains were synthesized at relatively equal rates, with a major fraction of the newly synthesized variant alpha-chains undergoing rapid catabolism. The hematologic data taken in combination with DNA hybridization and globin synthesis findings indicate that the proposita in each of these families has the genotype--, alpha A/--, alpha Ev. These observations suggest that two separate mechanisms are contributing to the alpha-thalassemia-like expression of Hb Evanston : the newly synthesized alpha EV-chains are unstable and are subject to early proteolytic destruction; and the mutant alpha-allele is linked to an alpha-globin gene deletion. Images PMID:6725558

  6. Teaching calculus with Wolfram|Alpha

    NASA Astrophysics Data System (ADS)

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-12-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to Wolfram|Alpha in our differential and integral calculus labs, together with the positive results from our experience. We also discuss the current limitations of Wolfram|Alpha, including a discussion on why we still use a CAS for our multivariate calculus labs.

  7. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  8. Prospects for alpha particle studies on TFTR

    SciTech Connect

    Zweben, S.J.

    1987-05-01

    TFTR is expected to produce approximately 5 MW of alpha heating during the D/T Q approx. = 1 phase of operation in 1990. At that point the collective confinement properties and the heating effects of alpha particles become accessible for study for the first time. This paper outlines the potential performance of TFTR with respect to alpha particle production, the diagnostics which will be available for alpha particle measurements, and the physics issues which can be studied both before and during D/T operation.

  9. 5 alpha-reductase deficiency without hypospadias.

    PubMed Central

    Ng, W K; Taylor, N F; Hughes, I A; Taylor, J; Ransley, P G; Grant, D B

    1990-01-01

    A boy aged 4 with penoscrotal hypospadias and his brother aged 12 with micropenis had typical changes of homozygous 5 alpha-reductase deficiency. After three injections of chorionic gonadotrophin there was a trivial rise in plasma dihydrotestosterone with a normal increase in plasma testosterone. Urine steroid chromatography showed abnormally high 5 beta: 5 alpha ratios and 5 alpha-reductase activity was appreciably reduced in genital skin fibroblasts. The results indicate that 5 alpha-reductase deficiency is not invariably associated with genital ambiguity. PMID:2248513

  10. Synthesis of anticholinergic agents: N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate salts.

    PubMed

    Oroshnik, W; Soldati, G

    1978-05-01

    The synthesis of a new anticholinergic agent, N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate, obtained by reacting N-methyl-4-piperidinyl alpha-cyclopentylmandelate with benzoyl chloride in the presence of methyllithium, is reported. This material may be useful as an antiperspirant.

  11. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  12. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  13. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  14. Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume

    ERIC Educational Resources Information Center

    Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.

    2015-01-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha…

  15. High-alpha space trucks

    SciTech Connect

    Cook, L.M.; Ball, J.

    1997-01-01

    Vertically-landing Reusable Launch Vehicles (RLVs) are the best hope of building a true {open_quotes}Space Truck{close_quotes} with current technology. Because they do not require a low angle-of-attack (AOA, or alpha) horizontal landing, they can be designed to operate exclusively at very high angles-of-attack. This offers savings in vehicle dry weight and complexity, which can be traded for significantly heavier payload, more ascent velocity, or extra design margin. The price for abandoning low angle-of-attack flight is reduced crossrange. To quantify the potential weight reduction, a trade study was performed to determine the relationship between a vehicle{close_quote}s maximum crossrange (angle-of-attack) and it{close_quote}s dry weight (payload margin). At the study conclusion, three vertically-landing (VL) vehicles provided multiple points on a payload weight vs. maximum crossrange curve, showing significant payload increases as crossrange is sacrificed. This is primarily the result of being able to simplify the structure, fly a cooler entry trajectory, and be aerodynamically stable through the entire flight. This reduces subsystem requirements and complexity, enhancing reliability. Further benefits are realized in reduced landing propellant requirements and simplifying or eliminating the {open_quotes}rotation{close_quotes} maneuver. This paper also suggests unique operability solutions that adapt high-alpha vehicles to traditional high-crossrange missions such as the polar {open_quotes}once-around{close_quotes} flight, and proposes a small scale drop-test program to prove the subsonic and landing portion of the flight envelope. {copyright} {ital 1997 American Institute of Physics.}

  16. Arrangements of alpha-globin gene cluster in Taiwan.

    PubMed

    Peng, H W; Choo, K B; Ho, C H; Yen, M S; Liung, W Y; Lin, C K; Yang, Z L; Ng, H T; Ching, K N; Han, S H

    1989-01-01

    In a gene mapping study on 217 newborn babies in Taiwan with alpha- and zeta-globin probes, we have observed 4 cases (1.84%) of alpha-thalassemia-2 heterozygotes (zeta zeta-alpha/zeta zeta alpha alpha) without increased levels of hemoglobin (Hb) Bart's in the cord blood. Eleven subjects (5.07%) were found to have the South East Asian alpha-thalassemia-1 haplotype (zeta zeta--SEA/zeta zeta alpha alpha) with increased Hb Bart's levels ranging from 2.2 to 9%. One case, with Hb Bart's level of 14% in the cord blood, was found to have the genotype of zeta zeta--SEA/zeta zeta alpha alpha T (0.46%). Four heterozygotes (1.84%) were found with the triple alpha gene anti-rightward arrangement (zeta zeta alpha alpha alpha 3.7/zeta zeta alpha alpha). Twenty-one heterozygotes (9.68%) were found to have the triple zeta-globin gene arrangement (zeta zeta zeta alpha alpha/zeta zeta alpha alpha). A new triple zeta-globin gene variant with a BamHI polymorphism was also observed in this study.

  17. Alpha Biofeedback Conditioning and Retarded Subjects.

    ERIC Educational Resources Information Center

    Martin, Walter; And Others

    1981-01-01

    An experimental group of three institutionalized severely retarded adult males received binary tone feedback for alpha production while a control group (3) followed identical procedures without feedback. Analysis revealed significant difference between groups in alpha percentage increase over baseline, encouraging research on applications for…

  18. Elementary Processes Underlying Alpha Channeling in Tokamaks

    SciTech Connect

    NM.J. Fisch

    2012-06-15

    Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

  19. Alpha-1 Antitrypsin Deficiency (Inherited Emphysema)

    MedlinePlus

    ... 1 protein in the blood with normal alpha-1 antitrypsin from healthy plasma donors. It is given in a vein (IV). The dose is adjusted based on body weight. This treatment is often given once a week. There are three ... the management of Alpha-1 related emphysema includes: • Exercise and a healthy lifestyle ...

  20. Psychiatric Symptoms in Alpha-Mannosidosis

    ERIC Educational Resources Information Center

    Malm, D.; Pantel, J.; Linaker, O. M.

    2005-01-01

    Alpha-mannosidosis is characterized by mild to moderate intellectual disability (ID), moderate to severe neurosensory hearing loss, frequent infections, psychomotor disturbances and skeletal dysmorphism. For the first time, a panel of nine alpha-mannosidosis patients with psychiatric symptoms is presented. The clinical picture has several…

  1. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  2. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  3. Remote Associates Test and Alpha Brain Waves

    ERIC Educational Resources Information Center

    Haarmann, Henk J.; George, Timothy; Smaliy, Alexei; Dien, Joseph

    2012-01-01

    Previous studies found that performance on the remote associates test (RAT) improves after a period of incubation and that increased alpha brain waves over the right posterior brain predict the emergence of RAT insight solutions. We report an experiment that tested whether increased alpha brain waves during incubation improve RAT performance.…

  4. Atypical Alpha Asymmetry in Adults with ADHD

    ERIC Educational Resources Information Center

    Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.

    2009-01-01

    Introduction: A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8-12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha…

  5. Commentary on Coefficient Alpha: A Cautionary Tale

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2009-01-01

    The general use of coefficient alpha to assess reliability should be discouraged on a number of grounds. The assumptions underlying coefficient alpha are unlikely to hold in practice, and violation of these assumptions can result in nontrivial negative or positive bias. Structural equation modeling was discussed as an informative process both to…

  6. Teaching Calculus with Wolfram|Alpha

    ERIC Educational Resources Information Center

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-01-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to…

  7. Coefficient Alpha Bootstrap Confidence Interval under Nonnormality

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin; Newton, Matthew

    2012-01-01

    Three different bootstrap methods for estimating confidence intervals (CIs) for coefficient alpha were investigated. In addition, the bootstrap methods were compared with the most promising coefficient alpha CI estimation methods reported in the literature. The CI methods were assessed through a Monte Carlo simulation utilizing conditions…

  8. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  9. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  10. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  11. Inhibitory spectrum of alpha 2-plasmin inhibitor.

    PubMed

    Saito, H; Goldsmith, G H; Moroi, M; Aoki, N

    1979-04-01

    alpha 2-Plasmin inhibitor (alpha 2PI) has been recently characterized as a fast-reacting inhibitor of plasmin in human plasma and appears to play an important role in the regulation of fibrinolysis in vivo. We have studied the effect of purified alpha 2PI upon various proteases participating in human blood coagulation and kinin generation. At physiological concentration (50 microgram/ml), alpha 2PI inhibited the clot-promoting and prekallikrein-activating activity of Hageman factor fragments, the amidolytic, kininogenase, and clot-promoting activities of plasma kallikrein, and the clot-promoting properties of activated plasma thromboplastin antecedent (PTA, Factor XIa) and thrombin. alpha 2PI had minimal inhibitory effect on surface-bound activated PTA and activated Stuart factor (Factor Xa). alpha 2PI did not inhibit the activity of activated Christmas factor (Factor IXa) or urinary kallikrein. Heparin (1.5-2.0 units/ml) did not enhance the inhibitory function of alpha 2PI. These results suggest that, like other plasma protease inhibitors, alpha 2PI possesses a broad in vitro spectrum of inhibitory properties.

  12. Suppression of hepatic prostaglandin F2 alpha in rats by dietary alpha-tocopherol acetate is independent of total hepatic alpha-tocopherol.

    PubMed

    Duitsman, P K; Chen, H W; Cook, L R; Hendrich, S

    1992-09-01

    Groups of eight weanling female F344/N rats were fed semipurified diets that supplied 0, 50, 500, 5000, or 15,000 mg alpha-tocopherol acetate/kg diet, with and without 0.05% phenobarbital (PB) for 9 weeks. Both plasma and hepatic alpha-tocopherol levels, measured by HPLC, strongly correlated with alpha-tocopherol intake (r greater than 0.73, p less than 0.0001). Phenobarbital both depleted hepatic alpha-tocopherol and increased plasma alpha-tocopherol significantly. Although treatment with PB for 9 weeks significantly increased GST activity, PB did not affect hepatic prostaglandin (PG)F2 alpha status, as determined by radioimmunoassay. PGF2 alpha was significantly greater (by 52%) in rats fed no alpha-tocopherol than in rats fed 15,000 mg alpha-tocopherol acetate/kg diet. Hepatic PGF2 alpha status was correlated inversely but weakly with dietary alpha-tocopherol (r = -0.24, p less than 0.05). Hepatic PGF2 alpha status was not correlated with hepatic or plasma alpha-tocopherol status. This finding suggests either that there is a small depletion-resistant subcellular alpha-tocopherol pool which regulates PGF2 alpha production or that alpha-tocopherol alters PGF2 alpha production in vivo by an indirect mechanism.

  13. Local Structure and Vibrational Properties of alpha-Pu, alpha-U, and the alpha-U Charge Density Wave

    SciTech Connect

    Nelson, E J; Allen, P G; Blobaum, K M; Wall, M A; Booth, C H

    2004-08-10

    The local atomic environment and vibrational properties of atoms in monoclinic pure {alpha}-plutonium as well as orthorhombic pure {alpha}-uranium and its low-temperature charge-density-wave (CDW) modulation are examined by extended x-ray absorption fine structure spectroscopy (EXAFS). Pu L{sub III}-edge and U L{sub III}-edge EXAFS data measured at low temperatures verify the crystal structures of {alpha}-U and {alpha}-Pu samples previously determined by x-ray diffraction and neutron scattering. Debye-Waller factors from temperature-dependent EXAFS measurements are fit with a correlated Debye model. The observed Pu-Pu bond correlated Debye temperature of {theta}{sub cD}({alpha}-Pu) = 162 {+-} 5 K for the pure {alpha}-Pu phase agrees with our previous measurement of the correlated Debye temperature of the gallium-containing {alpha}'-Pu phase in a mixed phase 1.9 at% Ga-doped {alpha}'-Pu/{delta}-Pu alloy. The temperature dependence of the U-U nearest neighbor Debye-Waller factor exhibits a sharp discontinuity in slope near T{sub CDW} = 43 K, the transition temperature at which the charge-density wave (CDW) in {alpha}-U condenses from a soft phonon mode along the (100) direction. Our measurement of the CDW using EXAFS is the first observation of the structure of the CDW in polycrystalline {alpha}-U. The different temperature dependence of the Debye-Waller factor for T < T{sub CDW} can be modeled by the change in bond length distributions resulting from condensation of the charge density wave. For T > T{sub CDW}, the observed correlated Debye temperature of {theta}{sub cD}({alpha}-U) = 199 {+-} 3 K is in good agreement with other measurements of the Debye temperature for polycrystalline {alpha}-U. CDW structural models fit to the {alpha}-U EXAFS data support a squared CDW at the lowest temperatures, with a displacement amplitude of {var_epsilon} = 0.05 {+-} 0.02 {angstrom}.

  14. Improved peak shape fitting in alpha spectra.

    PubMed

    Pommé, S; Caro Marroyo, B

    2015-02-01

    Peak overlap is a recurrent issue in alpha-particle spectrometry, not only in routine analyses but also in the high-resolution spectra from which reference values for alpha emission probabilities are derived. In this work, improved peak shape formulae are presented for the deconvolution of alpha-particle spectra. They have been implemented as fit functions in a spreadsheet application and optimum fit parameters were searched with built-in optimisation routines. Deconvolution results are shown for a few challenging spectra with high statistical precision. The algorithm outperforms the best available routines for high-resolution spectrometry, which may facilitate a more reliable determination of alpha emission probabilities in the future. It is also applicable to alpha spectra with inferior energy resolution. PMID:25497323

  15. Homomers of alpha 8 and alpha 7 subunits of nicotinic receptors exhibit similar channel but contrasting binding site properties.

    PubMed

    Gerzanich, V; Anand, R; Lindstrom, J

    1994-02-01

    alpha 8 subunits of alpha-bungarotoxin-sensitive chick neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes from cRNA are shown to form homomeric, acetylcholine-gated, rapidly desensitizing, inwardly rectifying, Ca(2+)-permeable cation channels similar to those of alpha 7 homomers. alpha 8 forms oligomers of several sizes, of which < 14% are expressed on the oocyte surface, which is less efficient than for alpha 7 homomers. alpha 8 homomers are more sensitive to agonists but less sensitive to antagonists than are alpha 7 homomers, and some agonists for alpha 8 homomers are partial agonists or antagonists for alpha 7 homomers. The pharmacological properties of homomers of alpha 8 and alpha 7 subunits generally reflect those of native alpha 8 and alpha 7 receptors.

  16. Catalytic Mechanism of Human Alpha-galactosidase

    SciTech Connect

    Guce, A.; Clark, N; Salgado, E; Ivanen, D; Kulinskaya, A; Brumer, H; Garman, S

    2010-01-01

    The enzyme {alpha}-galactosidase ({alpha}-GAL, also known as {alpha}-GAL A; E.C. 3.2.1.22) is responsible for the breakdown of {alpha}-galactosides in the lysosome. Defects in human {alpha}-GAL lead to the development of Fabry disease, a lysosomal storage disorder characterized by the buildup of {alpha}-galactosylated substrates in the tissues. {alpha}-GAL is an active target of clinical research: there are currently two treatment options for Fabry disease, recombinant enzyme replacement therapy (approved in the United States in 2003) and pharmacological chaperone therapy (currently in clinical trials). Previously, we have reported the structure of human {alpha}-GAL, which revealed the overall structure of the enzyme and established the locations of hundreds of mutations that lead to the development of Fabry disease. Here, we describe the catalytic mechanism of the enzyme derived from x-ray crystal structures of each of the four stages of the double displacement reaction mechanism. Use of a difluoro-{alpha}-galactopyranoside allowed trapping of a covalent intermediate. The ensemble of structures reveals distortion of the ligand into a {sup 1}S{sub 3} skew (or twist) boat conformation in the middle of the reaction cycle. The high resolution structures of each step in the catalytic cycle will allow for improved drug design efforts on {alpha}-GAL and other glycoside hydrolase family 27 enzymes by developing ligands that specifically target different states of the catalytic cycle. Additionally, the structures revealed a second ligand-binding site suitable for targeting by novel pharmacological chaperones.

  17. Sumoylation and the function of CCAAT enhancer binding protein alpha (C/EBP alpha).

    PubMed

    Khanna-Gupta, Arati

    2008-01-01

    CCAAT enhancer binding protein alpha (C/EBP alpha) is the founding member of a family of basic region/leucine zipper (bZIP) transcription factors and is a master regulator of granulopoiesis. It is expressed at high levels throughout myeloid differentiation and binds to the promoters of multiple myeloid-specific genes at different stages of myeloid maturation. Profound hematopoietic abnormalities occur in mice nullizygous for C/EBP alpha including a selective early block in the differentiation of granulocytes. Mutations in C/EBP alpha are present in a subset of patients with AML presenting with a normal karyotype. These mutations can result in the expression of a 30 kDa dominant negative C/EBP alpha isoform, which contributes to loss of C/EBP alpha function. The molecular basis for this observation remains unknown. In addition to phosphorylation, C/EBP alpha is modified, post-translationally by a small ubiquitin-related modifier (SUMO) at a lysine residue (K159), which lies within the growth inhibitory region of the C/EBP alpha protein. Sumoylation at K159 in the C/EBP alpha protein prevents association of the SWI/SNF chromatin remodeling complex with C/EBP alpha, thereby hampering transactivation. In this review, the functional implications of post-translational modification, particularly sumoylation, of C/EBP alpha in normal granulopoiesis and leukemia are considered. PMID:18406180

  18. Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

    SciTech Connect

    Yao, Congjun; Evans, Chheng-Orn; Stevens, Victoria L.; Owens, Timothy R.; Oyesiku, Nelson M.

    2009-11-01

    We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNA staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.

  19. Alpha1 and Alpha2 Integrins Mediate Invasive Activity of Mouse Mammary Carcinoma Cells through Regulation of Stromelysin-1 Expression

    SciTech Connect

    Lochter, Andre; Navre, Marc; Werb, Zena; Bissell, Mina J

    1998-06-29

    Tumor cell invasion relies on cell migration and extracellular matrix proteolysis. We investigated the contribution of different integrins to the invasive activity of mouse mammary carcinoma cells. Antibodies against integrin subunits {alpha}6 and {beta}1, but not against {alpha}1 and {alpha}2, inhibited cell locomotion on a reconstituted basement membrane in two-dimensional cell migration assays, whereas antibodies against {beta}1, but not against a6 or {alpha}2, interfered with cell adhesion to basement membrane constituents. Blocking antibodies against {alpha}1 integrins impaired only cell adhesion to type IV collagen. Antibodies against {alpha}1, {alpha}2, {alpha}6, and {beta}1, but not {alpha}5, integrin subunits reduced invasion of a reconstituted basement membrane. Integrins {alpha}1 and {alpha}2, which contributed only marginally to motility and adhesion, regulated proteinase production. Antibodies against {alpha}1 and {alpha}2, but not {alpha}6 and {beta}1, integrin subunits inhibited both transcription and protein expression of the matrix metalloproteinase stromelysin-1. Inhibition of tumor cell invasion by antibodies against {alpha}1 and {alpha}2 was reversed by addition of recombinant stromelysin-1. In contrast, stromelysin-1 could not rescue invasion inhibited by anti-{alpha}6 antibodies. Our data indicate that {alpha}1 and {alpha}2 integrins confer invasive behavior by regulating stromelysin-1 expression, whereas {alpha}6 integrins regulate cell motility. These results provide new insights into the specific functions of integrins during tumor cell invasion.

  20. G alpha 12 and G alpha 13 subunits define a fourth class of G protein alpha subunits.

    PubMed Central

    Strathmann, M P; Simon, M I

    1991-01-01

    Heterotrimeric guanine nucleotide-binding regulatory proteins (G proteins) are central to the signaling processes of multicellular organisms. We have explored the diversity of the G protein subunits in mammals and found evidence for a large family of genes that encode the alpha subunits. Amino acid sequence comparisons show that the different alpha subunits fall into at least three classes. These classes have been conserved in animals separated by considerable evolutionary distances; they are present in mammals, Drosophila, and nematodes. We have now obtained cDNA clones encoding two murine alpha subunits, G alpha 12 and G alpha 13, that define a fourth class. The translation products are predicted to have molecular masses of 44 kDa and to be insensitive to ADP-ribosylation by pertussis toxin. They share 67% amino acid sequence identity with each other and less than 45% identity with other alpha subunits. Their transcripts can be detected in every tissue examined, although the relative levels of the G alpha 13 message appear somewhat variable. Images PMID:1905812

  1. Sensitivity to alpha-amylcinnamic aldehyde and alpha-amylcinnamic alcohol.

    PubMed

    Guin, J D; Haffley, P

    1983-01-01

    Sensitivity to alpha-amylcinnamic aldehyde (alpha-AcAld) is apparently uncommon, but, like allergy to alpha-amylcinnamic alcohol (alpha-AcAlc), it often accompanies allergy to the perfume in Mycolog cream. Although alpha-AcAlc is a known ingredient, alpha-AcAld is not. However, gas-liquid chromatographic analysis shows alpha-AcAld to be present. Of fourteen persons sensitive to either chemical, ten reacted to both. Of these, one man and three women were markedly sensitive, and all three women had chronic recalcitrant vulvar eczema. That condition might have been the cause as well as the result of sensitization, but reexposure to a suspected product reproduced the eruption in both persons tested. Its use with other potent sensitizers, e.g., ethylenediamine, to treat irritations and chronic eczemas in an area of high absorption may partly explain development of allergy to a relatively weak sensitizer.

  2. Effect of UVB on hydrolysis of alpha-tocopherol acetate to alpha-tocopherol in mouse skin.

    PubMed

    Kramer-Stickland, K; Liebler, D C

    1998-08-01

    We have assessed the hydrolysis of alpha-tocopherol acetate (alpha-TAc) to the active antioxidant alpha-tocopherol (alpha-TH) in mouse epidermis and in supernatant from epidermal homogenates. Topically administered alpha-TH prevents UVB photocarcinogenesis in C3H mice, whereas alpha-TAc does not. Hydrolysis in skin was monitored in mice treated topically with deuterium labeled alpha-TAc (d3-alpha-TAc). Epidermal samples were isolated from mice and analyzed for endogenous (d0-alpha-TAc) and d3-alpha-TH by gas chromatography-mass spectrometry. Within 24 h, the levels of d3-alpha-TH increased up to 10-fold over endogenous d0-alpha-TH levels; however, in mice irradiated with UVB prior to the application of d3-alpha-TAc, levels of d3-alpha-TH increased up to 30-40-fold over endogenous d0-alpha-TH. This enhancement of alpha-TAc hydrolysis increased with increasing UVB dose. Prior UVB exposure may increase hydrolysis of alpha-TAc by increasing epidermal esterase activity. Nonspecific esterase activity was measured in the 2000 x g supernatant from epidermis of unirradiated and irradiated mice. Alpha-napthyl acetate, a nonspecific esterase substrate, was converted to alpha-napthol in supernatants from unirradiated mice. Hydrolysis to alpha-napthol increased approximately 3-fold in supernatants from irradiated mice. Hydrolysis of alpha-TAc to alpha-TH also occurred in supernatant from unirradiated mice, and this hydrolysis increased approximately 3-fold in supernatant from irradiated animals. These data indicate that nonspecific esterase activity was increased by UVB in the skin, that alpha-TAc is converted to alpha-TH in the homogenate fraction containing nonspecific esterase, and that UVB exposure modulates the metabolism of alpha-TAc to alpha-TH in vivo.

  3. Mapping High-Velocity H-alpha and Lyman-alpha Emission from Supernova 1987A

    NASA Technical Reports Server (NTRS)

    France, Kevin; McCray, Richard; Fransson, Claes; Larsson, Josefin; Frank, Kari A.; Burrows, David N.; Challis, Peter; Kirshner, Robert P.; Chevalier, Roger A.; Garnavich, Peter; Heng, Kevin; Lawrence, Stephen S.; Lundqvist, Peter; Smith, Nathan; Sonneborn, George

    2015-01-01

    We present new Hubble Space Telescope images of high-velocity H-alpha and Lyman-alpha emission in the outer debris of SN 1987A. The H-alpha images are dominated by emission from hydrogen atoms crossing the reverse shock. For the first time we observe emission from the reverse shock surface well above and below the equatorial ring, suggesting a bipolar or conical structure perpendicular to the ring plane. Using the H-alpha imaging, we measure the mass flux of hydrogen atoms crossing the reverse shock front, in the velocity intervals (-7,500 < V(sub obs) < -2,800 km/s) and (1,000 < V(sub obs) < 7,500 km/s), ?M(sub H) = 1.2 × 10(exp -3) M/ y. We also present the first Lyman-alpha imaging of the whole remnant and new Chandra X-ray observations. Comparing the spatial distribution of the Lyman-alpha and X-ray emission, we observe that the majority of the high-velocity Lyman-alpha emission originates interior to the equatorial ring. The observed Lyman-alpha/H-alpha photon ratio, R(L-alpha/H-alpha) approx. = 17, is significantly higher than the theoretically predicted ratio of approx. = 5 for neutral atoms crossing the reverse shock front. We attribute this excess to Lyman-alpha emission produced by X-ray heating of the outer debris. The spatial orientation of the Lyman-alpha and X-ray emission suggests that X-ray heating of the outer debris is the dominant Lyman-alpha production mechanism in SN 1987A at this phase in its evolution.

  4. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples.

  5. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples. PMID:15678944

  6. A new alpha chain hemoglobin variant: Hb Al-Hammadi Riyadh [alpha75(EF4)Asp-->Val (alpha2)].

    PubMed

    Burnichon, Nelly; Lacan, Philippe; Becchi, Michel; Zanella-Cleon, Isabelle; Aubry, Martine; Mowafy, Mohammed; Couprie, Nicole; Francina, Alain

    2006-01-01

    A new hemoglobin (Hb) variant in the heterozygous state, Hb Al-Hammadi Riyadh [codon 75 (GAC-->GTC); alpha75(EF4)Asp-->Val (alpha2)] corresponding to an A-->T transversion on the second exon of the alpha2-globin gene, is described. The variant was characterized by DNA sequencing and mass spectrometry (MS). The variant was found during a routine Hb analysis for anemia in a 16-month-old boy who lived in Riyadh, Kingdom of Saudi Arabia.

  7. Genetics Home Reference: mucolipidosis III alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis III alpha/beta mucolipidosis III alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis III alpha/beta is a slowly progressive disorder that affects ...

  8. Genetics Home Reference: mucolipidosis II alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis II alpha/beta mucolipidosis II alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis II alpha/beta (also known as I-cell disease) is ...

  9. 24xi-Methyl 5 alpha-cholestane-3 alpha,6 beta,9 alpha,25-tetrol 24-monoacetate, a novel polyhydroxylated steroid from the soft coral Sarcophyton tortuosum.

    PubMed

    Su, J Y; Peng, T S; Long, K H; Zeng, L M

    1986-01-01

    A novel polyhydroxylated steroid, named sartortuosterol A, with rare 3 alpha- and 6-hydroxyl groups, was isolated from the South China Sea soft coral Sarcophyton tortuosum Tixier-Durivault, and its structure was established as 24xi-methyl 5 alpha-cholestane-3 alpha, 6 beta, 9 alpha,25-tetrol 25-monoacetate from spectroscopic data and chemical conversions.

  10. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed. PMID:7162915

  11. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed.

  12. Applying alpha-channeling to mirror machines

    SciTech Connect

    Zhmoginov, A. I.; Fisch, N. J.

    2012-05-15

    The {alpha}-channeling effect entails the use of radio-frequency waves to expel and cool high-energetic {alpha} particles born in a fusion reactor; the device reactivity can then be increased even further by redirecting the extracted energy to fuel ions. Originally proposed for tokamaks, this technique has also been shown to benefit open-ended fusion devices. Here, the fundamental theory and practical aspects of {alpha} channeling in mirror machines are reviewed, including the influence of magnetic field inhomogeneity and the effect of a finite wave region on the {alpha}-channeling mechanism. For practical implementation of the {alpha}-channeling effect in mirror geometry, suitable contained weakly damped modes are identified. In addition, the parameter space of candidate waves for implementing the {alpha}-channeling effect can be significantly extended through the introduction of a suitable minority ion species that has the catalytic effect of moderating the transfer of power from the {alpha}-channeling wave to the fuel ions.

  13. Lyman alpha radiation in external galaxies

    NASA Technical Reports Server (NTRS)

    Neufeld, David A.; Mckee, Christopher F.

    1990-01-01

    The Ly alpha line of atomic hydrogen is often a luminous component of the radiation emitted by distant galaxies. Except for those galaxies which have a substantial central source of non-stellar ionizing radiation, most of the Ly alpha radiation emitted by galaxies is generated within regions of the interstellar medium which are photoionized by starlight. Conversely, much of the energy radiated by photoionized regions is carried by the Ly alpha line. Only hot, massive stars are capable of ionizing hydrogen in the interstellar medium which surrounds them, and because such stars are necessarily short-lived, Ly alpha emission traces regions of active star formation. Researchers argue that the strength of the Ly alpha emission observed from external galaxies may be used to estimate quantitatively the dust content of the emitting region, while the Ly alpha line profile is sensitive to the presence of shock waves. Interstellar dust particles and shock waves are intimately associated with the process of star formation in two senses. First, both dust particles and shock waves owe their existence to stellar activity; second, they may both serve as agents which facilitate the formation of stars, shocks by triggering gravitational instabilities in the interstellar gas that they compress, and dust by shielding star-forming molecular clouds from the ionizing and dissociative effects of external UV radiation. By using Ly alpha observations as a probe of the dust content in diffuse gas at high redshift, we might hope to learn about the earliest epochs of star formation.

  14. Diagnostics for PLX-alpha

    NASA Astrophysics Data System (ADS)

    Gilmore, Mark; Hsu, Scott

    2015-11-01

    The goal of the Plasma Liner eXperiment PLX-alpha at Los Alamos National Laboratory is to establish the viability of creating a spherically imploding plasma liner for MIF and HED applications, using a spherical array of supersonic plasma jets launched by innovative contoured-gap coaxial plasma guns. PLX- α experiments will focus in particular on establishing the ram pressure and uniformity scalings of partial and fully spherical plasma liners. In order to characterize these parameters experimentally, a suite of diagnostics is planned, including multi-camera fast imaging, a 16-channel visible interferometer (upgraded from 8 channels) with reconfigurable, fiber-coupled front end, and visible and VUV high-resolution and survey spectroscopy. Tomographic reconstruction and data fusion techniques will be used in conjunction with interferometry, imaging, and synthetic diagnostics from modeling to characterize liner uniformity in 3D. Diagnostic and data analysis design, implementation, and status will be presented. Supported by the Advanced Research Projects Agency - Energy - U.S. Department of Energy.

  15. Lyman Alpha Spicule Observatory (LASO)

    NASA Technical Reports Server (NTRS)

    Chamberlin, Phillip C.

    2011-01-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe smallscale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mAngstroms (33mAngstroms pixels) across a broad 20Angstrom spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-a emission at 1216Angstroms. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  16. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail

    2011-01-01

    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  17. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, Phillip C.; Allred, J.; Airapetian, V.; Gong, Q.; Fontenla, J.; McIntosh, S.; de Pontieu, B.

    2011-05-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events” (RBEs), the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1” pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  18. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, P. C.; Allred, J. C.; Airapetian, V.; Gong, Q.; Mcintosh, S. W.; De Pontieu, B.; Fontenla, J. M.

    2011-12-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  19. Divergence of human [alpha]-chain constant region gene sequences: A novel recombinant [alpha]2 gene

    SciTech Connect

    Chintalacharuvu, K. R.; Morrison, S.L. ); Raines, M. )

    1994-06-01

    IgA is the major Ig synthesized in humans and provides the first line of defense at the mucosal surfaces. The constant region of IgA heavy chain is encoded by the [alpha] gene on chromosome 14. Previous studies have indicated the presence of two [alpha] genes, [alpha]1 and [alpha]2 existing in two allotypic forms, [alpha]2 m(1) and [alpha]2 m(2). Here the authors report the cloning and complete nucleotide sequence determination of a novel human [alpha] gene. Nucleotide sequence comparison with the published [alpha] sequences suggests that the gene arose as a consequence of recombination or gene conversion between the two [alpha]2 alleles. The authors have expressed the gene as a chimeric protein in myeloma cells indicating that it encodes a functional protein. The novel IgA resembles IgA2 m(2) in that disulfide bonds link H and L chains. This novel recombinant gene provides insights into the mechanisms of generation of different constant regions and suggests that within human populations, multiple alleles of [alpha] may be present providing IgAs of different structures.

  20. Fibrinogen {alpha} genes: Conservation of bipartite transcripts and carboxy-terminal-extended {alpha} subunits in vertebrates

    SciTech Connect

    Fu, Y.; Cao, Y.; Hertzberg, K.M.; Grieninger, G.

    1995-11-01

    All three well-studied subunits of the clotting protein fibrinogen ({alpha}, {beta}, {gamma}) share N-terminal structural homologies, but until recently only the {beta} and {gamma} chains were recognized as having similar globular C-termini. With the discovery of an extra exon in the human fibrinogen {alpha} gene (exon VI), a minor form of the {alpha} subunit ({alpha}{sub E}) with an extended {beta}- and {gamma}-like C-terminus has been identified. In the present study, the polymerase chain reaction has been used to identify sequences that encode counterparts to {alpha}{sub E} in chicken, rabbit, rat, and baboon. The basic six-exon structure of the fibrinogen {alpha} genes is shown to be conserved among mammals and birds, as are the intron positions. Bipartite transcripts - still bearing an intron prior to the last exon - are found among the products of the various vertebrate fibrinogen {alpha} genes. The last exon represents the largest conserved segment of the gene and, in each species examined, encodes exactly 236 amino acids. The C-termini of these {alpha}{sub E} chains align without a single gap and are between 76 and 99% identical. Since the exon VI-encoded domain of {alpha}{sub E} is as well conserved as the corresponding regions of the {beta} and {gamma} chains, it follows that it is equally important and that {alpha}{sub E}-fibrinogen plays a vital, if as-yet unrecognized physiological role. 21 refs., 7 figs., 1 tab.

  1. Variable displacement alpha-type Stirling engine

    NASA Astrophysics Data System (ADS)

    Homutescu, V. M.; Bălănescu, D. T.; Panaite, C. E.; Atanasiu, M. V.

    2016-08-01

    The basic design and construction of an alpha-type Stirling engine with on load variable displacement is presented. The variable displacement is obtained through a planar quadrilateral linkage with one on load movable ground link. The physico-mathematical model used for analyzing the variable displacement alpha-type Stirling engine behavior is an isothermal model that takes into account the real movement of the pistons. Performances and power adjustment capabilities of such alpha-type Stirling engine are calculated and analyzed. An exemplification through the use of the numerical simulation was performed in this regard.

  2. Alpha spectral analysis via artificial neural networks

    SciTech Connect

    Kangas, L.J.; Hashem, S.; Keller, P.E.; Kouzes, R.T.; Troyer, G.L.

    1994-10-01

    An artificial neural network system that assigns quality factors to alpha particle energy spectra is discussed. The alpha energy spectra are used to detect plutonium contamination in the work environment. The quality factors represent the levels of spectral degradation caused by miscalibration and foreign matter affecting the instruments. A set of spectra was labeled with a quality factor by an expert and used in training the artificial neural network expert system. The investigation shows that the expert knowledge of alpha spectra quality factors can be transferred to an ANN system.

  3. Determining cellular role of G alpha 12.

    PubMed

    Dermott, Jonathan M; Dhanasekaran, N

    2002-01-01

    Using the expression strategies described here, we have demonstrated a model system whereby the sequential signaling events involved in cell proliferation and subsequent transformation regulated by G alpha 12 can be investigated. The model system presented here can also be used to study the temporal interrelationships between small GTPases, kinases, and other signaling proteins involved in G alpha 12-signaling pathways. Further analyses using this model system and the strategies presented here should provide valuable clues in defining the signaling network regulated by G alpha 12 in stimulating cell proliferation and oncogenic transformation. PMID:11771390

  4. Crystallization of hepatocyte nuclear factor 4 alpha (HNF4 alpha) in complex with the HNF1 alpha promoter element.

    PubMed

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G; Chi, Young-In

    2008-04-01

    Hepatocyte nuclear factor 4alpha (HNF4alpha) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4alpha cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4alpha DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1alpha. The HNF4alpha protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 A using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 A, beta = 119.36 degrees . A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants. PMID:18391435

  5. Production of tumor necrosis factor alpha, interleukin-1 alpha, and interleukin-6 during murine coccidioidomycosis.

    PubMed Central

    Cox, R A; Magee, D M

    1995-01-01

    The proinflammatory cytokines tumor necrosis factor alpha (TNF-alpha), interleukin-1 alpha (IL-1 alpha), and interleukin-6 (IL-6) were induced in mice infected with Coccidioides immitis. Analyses of the cytokine profiles of two inbred mouse strains which differ in their susceptibility to pulmonary challenge with C. immitis revealed higher levels of IL-6 in lungs from DBA/2 mice (resistant strain) than in those from BALB/c mice (susceptible strain) beginning at day 6 and continuing through day 15 postinfection. Spleen cells from both mouse strains secreted TNF-alpha, IL-1 alpha, and IL-6 in vitro in response to stimulation with killed spherules but differed in that spleen cells from the resistant strain produced increased levels of these cytokines earlier after pulmonary challenge and at increased levels throughout the course of the disease. PMID:7558338

  6. Influence of fast alpha diffusion and thermal alpha buildup on tokamak reactor performance

    SciTech Connect

    Uckan, N.A.; Tolliver, J.S.; Houlberg, W.A.; Attenberger, S.E.

    1987-11-01

    The effect of fast alpha diffusion and thermal alpha accumulation on the confinement capability of a candidate Engineering Test Reactor (ETR) plasma (Tokamak Ignition/Burn Experimental Reactor (TIBER-II)) in achieving ignition and steady-state driven operation has been assessed using both global and 1-1/2-D transport models. Estimates are made of the threshold for radial diffusion of fast alphas and thermal alpha buildup. It is shown that a relatively low level of radial transport, when combined with large gradients in the fast alpha density, leads to a significant radial flow with a deleterious effect on plasma performance. Similarly, modest levels of thermal alpha concentration significantly influence the ignition and steady-state burn capability. 23 refs., 9 figs., 4 tabs.

  7. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized.

  8. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized. PMID:15640792

  9. Alpha Coincidence Spectroscopy studied with GEANT4

    SciTech Connect

    Dion, Michael P.; Miller, Brian W.; Tatishvili, Gocha; Warren, Glen A.

    2013-11-02

    Abstract The high-energy side of peaks in alpha spectra, e.g. 241Am, as measured with a silicon detector has structure caused mainly by alpha-conversion electron and to some extent alphagamma coincidences. We compare GEANT4 simulation results to 241Am alpha spectroscopy measurements with a passivated implanted planar silicon detector. A large discrepancy between the measurements and simulations suggest that the GEANT4 photon evaporation database for 237Np (daughter of 241Am decay) does not accurately describe the conversion electron spectrum and therefore was found to have large discrepancies with experimental measurements. We describe how to improve the agreement between GEANT4 and alpha spectroscopy for actinides of interest by including experimental measurements of conversion electron spectroscopy into the photon evaporation database.

  10. Radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    McDevitt, M R; Sgouros, G; Finn, R D; Humm, J L; Jurcic, J G; Larson, S M; Scheinberg, D A

    1998-09-01

    This review discusses the application of alpha particle-emitting radionuclides in targeted radioimmunotherapy. It will outline the production and chemistry of astatine-211, bismuth-212, lead-212, actinium-225, bismuth-213, fermium-255, radium-223 and terbium-149, which at present are the most promising alpha-emitting isotopes available for human clinical use. The selective cytotoxicity offered by alpha particle-emitting radioimmunoconstructs is due to the high linear energy transfer and short particle path length of these radionuclides. Based upon the pharmacokinetics of alpha particle-emitting radioimmunoconstructs, both stochastic and conventional dosimetric methodology is discussed, as is the preclinical and initial clinical use of these radionuclides conjugated to monoclonal antibodies for the treatment of human neoplasia. PMID:9724387

  11. Genetics Home Reference: alpha-1 antitrypsin deficiency

    MedlinePlus

    ... and genetic modifiers of emphysema risk. Thorax. 2004 Mar;59(3):259-64. Review. Citation on PubMed ... alpha}1-antitrypsin deficiency. Arch Intern Med. 2009 Mar 23;169(6):546-50. doi: 10.1001/ ...

  12. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, L.R.; Post, D.E. Jr.; Dawson, J.M.

    1983-11-23

    This invention relates generally to high energy confined plasmas and more particularly is directed to measuring the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a confined energetic plasma.

  13. Note on Two Generalizations of Coefficient Alpha.

    ERIC Educational Resources Information Center

    Raju, Nambury S.

    1979-01-01

    An important relationship is given for two generalizations of coefficient alpha: (1) Rajaratnam, Cronbach, and Gleser's generalizability formula for stratified-parallel tests, and (2) Raju's coefficient beta. (Author/CTM)

  14. [Multiplex PCR for detecting genotypes of deletional alpha-thalassemia].

    PubMed

    Wu, Jie-Ying; Liao, Can; Li, Jian; Huang, Yi-Ning

    2004-08-01

    To investigate the clinical application of multiplex PCR in detecting genotypes of deletional alpha-thalassemia in South China and observe the distribution frequency of alpha-globin gene deletion, 145 patients with silent carrier, alpha thalassemia trait or HbH were identified by M-PCR and 1.2% agarose gel electrophoresis. There are 1.3, 1.6, 1.8 and 2.0 kb bands which indicate --(SEA), -alpha(4.2), alphaalpha and -alpha(3.7), respectively. The results showed that among 145 patients, 100 patients with --(SEA)/alphaalpha (68.9%), 15 with -alpha(3.7)/alphaalpha (10.3%), 8 with -alpha(4.2)/alphaalpha (5.52%), 2 with -alpha(3.7)/-alpha(4.2) (1.38%), 1 with -alpha(3.7)/-alpha(3.7) (0.69%), 1 with -alpha(4.2)/-alpha(4.2) (0.69%), 14 with --(SEA)/-alpha(3.7) (9.65%), 2 with --(SEA)/-alpha(4.2) (1.38%) were found. Two patients prenatal diagnosed were confirmed with Bart's hydrops fetuses. In conclusion, M-PCR analysis is a simple, rapid and accurate method for detection of alpha-thalassemia gene deletion. This technique is helpful in screening, carrier identification and prenatal diagnosis of deletional alpha-thalassemia.

  15. The ALPHA Experiment: A Cold Antihydrogen Trap

    SciTech Connect

    Bertsche, W.; Chapman, S.; Deutsch, A.; Fajans, J.; Gomberoff, K.; Wurtele, J.; Boston, A.; Chartier, M.; Nolan, P.; Page, R.D.; Bowe, P.D.; Hangst, J.S.; Madsen, N.; Cesar, C.L.; Miranda, D.; Charlton, M.; Jenkins, M.; Joergensen, L.V.; Telle, H.H.; Werf, D.P. van der

    2005-10-26

    The ALPHA experiment aims to trap antihydrogen as the next crucial step towards a precise CPT test, by a spectroscopic comparison of antihydrogen with hydrogen. The experiment will retain the salient techniques developed by the ATHENA collaboration during the previous phase of antihydrogen experiments at the antiproton decelerator (AD) at CERN. The collaboration has identified the key problems in adding a neutral antiatom trap to the previously developed experimental configuration. The solutions identified by ALPHA are described in this paper.

  16. Transport of Radioactive Material by Alpha Recoil

    SciTech Connect

    Icenhour, A.S.

    2005-05-19

    The movement of high-specific-activity radioactive particles (i.e., alpha recoil) has been observed and studied since the early 1900s. These studies have been motivated by concerns about containment of radioactivity and the protection of human health. Additionally, studies have investigated the potential advantage of alpha recoil to effect separations of various isotopes. This report provides a review of the observations and results of a number of the studies.

  17. Measurement of the angle alpha at BABAR

    SciTech Connect

    Perez, A.; /Orsay, LAL

    2009-06-25

    The authors present recent measurements of the CKM angle {alpha} using data collected by the BABAR detector at the PEP-II asymmetric-energy e{sup +}e{sup -} collider at the SLAC National Accelerator Laboratory, operating at the {Upsilon}(4S) resonance. They present constraints on {alpha} from B {yields} {pi}{pi}, B {yields} {rho}{rho} and B {yields} {rho}{pi} decays.

  18. Alpha-emitters for medical therapy workshop

    SciTech Connect

    Feinendegen, L.E.; McClure, J.J.

    1996-12-31

    A workshop on ``Alpha-Emitters for Medical Therapy`` was held May 30-31, 1996 in Denver Colorado to identify research goals and potential clinical needs for applying alpha-particle emitters and to provide DOE with sufficient information for future planning. The workshop was attended by 36 participants representing radiooncology, nuclear medicine, immunotherapy, radiobiology, molecular biology, biochemistry, radiopharmaceutical chemistry, dosimetry, and physics. This report provides a summary of the key points and recommendations arrived at during the conference.

  19. Different polyphenolic components of soft fruits inhibit alpha-amylase and alpha-glucosidase.

    PubMed

    McDougall, Gordon J; Shpiro, Faina; Dobson, Patricia; Smith, Pauline; Blake, Alison; Stewart, Derek

    2005-04-01

    Polyphenol-rich extracts from soft fruits were tested for their ability to inhibit alpha-amylase and alpha-glucosidase. All extracts tested caused some inhibition of alpha-amylase, but there was a 10-fold difference between the least and most effective extracts. Strawberry and raspberry extracts were more effective alpha-amylase inhibitors than blueberry, blackcurrant, or red cabbage. Conversely, alpha-glucosidase was more readily inhibited by blueberry and blackcurrant extracts. The extent of inhibition of alpha-glucosidase was related to their anthocyanin content. For example, blueberry and blackcurrant extracts, which have the highest anthocyanin content, were the most effective inhibitors of alpha-glucosidase. The extracts most effective in inhibiting alpha-amylase (strawberry and raspberry) contain appreciable amounts of soluble tannins. Other tannin-rich extracts (red grape, red wine, and green tea) were also effective inhibitors of alpha-amylase. Indeed, removing tannins from strawberry extracts with gelatin also removed inhibition. Fractionation of raspberry extracts on Sephadex LH-20 produced an unbound fraction enriched in anthocyanins and a bound fraction enriched in tannin-like polyphenols. The unbound anthocyanin-enriched fraction was more effective against alpha-glucosidase than the original extract, whereas the alpha-amylase inhibitors were concentrated in the bound fraction. The LH-20 bound sample was separated by preparative HPLC, and fractions were assayed for inhibition of alpha-amylase. The inhibitory components were identified as ellagitannins using LC-MS-MS. This study suggests that different polyphenolic components of fruits may influence different steps in starch digestion in a synergistic manner. PMID:15796622

  20. HETDEX: Evolution of Lyman Alpha Emitters

    NASA Astrophysics Data System (ADS)

    Blanc, Guillermo A.; Gebhardt, K.; Hill, G. J.; Gronwall, C.; Ciardullo, R.; Finkelstein, S.; Gawiser, E.; HETDEX Collaboration

    2012-01-01

    The Hobby Eberly Telescope Dark Energy Experiment (HETDEX) will produce a sample of 800,000 Lyman Alpha Emitters (LAEs) over the 1.9Alpha photon escape fraction. Our results show a strong evolution in the Lyman Alpha escape fraction with redshift, most likely associated with the buildup of dust in the ISM. Dust is shown to be the main parameter setting the escape of Lyman Alpha photons. The observed relation between E(B-V) and the escape fraction indicates that radiative transfer effects in LAEs promote the escape of Lyman Alpha photons, but only up to the point of them suffering similar amounts of extinction as continuum photons. Enhancement of the Lyman Alpha EW (e.g. due to the presence of a clumpy medium) seems not to be a common process in these objects. We also discuss the potential of the full HETDEX sample to study the evolution of LAE properties.

  1. Alpha-dispersion in human tissue

    NASA Astrophysics Data System (ADS)

    Grimnes, Sverre; Martinsen, Ørjan G.

    2010-04-01

    Beta dispersion is found in living tissue in the kilohertz - megahertz range and is caused by the cellular structure of biological materials with low frequency properties caused by cell membranes. Alpha dispersion is found in the hertz range and the causes are not so well known. Alpha dispersions are the first to disappear when tissue dies. Tissue data have often been based upon excised specimen from animals and are therefore not necessarily representative for human tissue alpha dispersions. Here we present data obtained with non-invasive skin surface electrodes for different segments of the living human body. We found alpha dispersions in all cases; the ankle-wrist results had the smallest. Large alpha dispersions were found where the distance between the electrodes and muscle masses was small, e.g. on the calf. Further studies on electrode technique and reciprocity, electrode positioning, statistical variations, gender, age and bodily constitutions are necessary in order to reveal more about the alpha dispersion, its appearance and disappearance.

  2. [Alpha-1 antitrypsin deficiency: diagnosis and treatment].

    PubMed

    Camelier, Aquiles A; Winter, Daniel Hugo; Jardim, José Roberto; Barboza, Carlos Eduardo Galvão; Cukier, Alberto; Miravitlles, Marc

    2008-07-01

    Alpha-1 antitrypsin deficiency is a recently identified genetic disease that occurs almost as frequently as cystic fibrosis. It is caused by various mutations in the SERPINA1 gene, and has numerous clinical implications. Alpha-1 antitrypsin is mainly produced in the liver and acts as an antiprotease. Its principal function is to inactivate neutrophil elastase, preventing tissue damage. The mutation most commonly associated with the clinical disease is the Z allele, which causes polymerization and accumulation within hepatocytes. The accumulation of and the consequent reduction in the serum levels of alpha-1 antitrypsin cause, respectively, liver and lung disease, the latter occurring mainly as early emphysema, predominantly in the lung bases. Diagnosis involves detection of low serum levels of alpha-1 antitrypsin as well as phenotypic confirmation. In addition to the standard treatment of chronic obstructive pulmonary disease, specific therapy consisting of infusion of purified alpha-1 antitrypsin is currently available. The clinical efficacy of this therapy, which appears to be safe, has yet to be definitively established, and its cost-effectiveness is also a controversial issue that is rarely addressed. Despite its importance, in Brazil, there are no epidemiological data on the prevalence of the disease or the frequency of occurrence of deficiency alleles. Underdiagnosis has also been a significant limitation to the study of the disease as well as to appropriate treatment of patients. It is hoped that the creation of the Alpha One International Registry will resolve these and other important issues. PMID:18695797

  3. Alpha particle analysis using PEARLS spectrometry

    SciTech Connect

    McKlveen, J.W.; Klingler, G.W.; McDowell, W.J.; Case, G.N.

    1984-01-01

    Alpha particle assay by conventional plate-counting methods is difficult because chemical separation, tracer techniques, and/or self-absorption losses in the final sample may cause either non-reproducible results or create unacceptable errors. PEARLS (Photon-Electron Rejecting Alpha Liquid Scintillation) Spectrometry is an attractive alternative since radionuclides may be extracted into a scintillator in which there would be no self-absorption or geometry problems and in which up to 100% chemical recovery and counting efficiency is possible. Sample preparation may include extraction of the alpha emitter of interest by a specific organic-phase-soluble compound directly into the liquid scintillator. Detection electronics use energy and pulse-shape discrimination to provide discrete alpha spectra and virtual absence of beta and gamma backgrounds. Backgrounds on the order of 0.01 cpm are readily achievable. Accuracy and reproducibility are typically in the 100 +-1% range. Specific procedures have been developed for gross alpha, uranium, plutonium, thorium, and polonium assay. This paper will review liquid scintillation alpha counting methods and reference some of the specific applications. 8 refs., 1 fig.

  4. Enzymic conversion of alpha-oxyprotohaem IX into biliverdin IX alpha by haem oxygenase.

    PubMed Central

    Yoshinaga, T; Sudo, Y; Sano, S

    1990-01-01

    Conversion of four isomers of meso-oxyprotohaem IX into the corresponding biliverdin IX was attempted with a reconstituted haem oxygenase system in the presence of NADPH-cytochrome c reductase and NADPH. Only the alpha-isomer of meso-oxyprotohaem IX was converted effectively into biliverdin IX alpha, which was further reduced to bilirubin IX alpha by biliverdin reductase. Only trace amounts of biliverdins IX beta, IX gamma and IX delta were respectively formed from the incubation mixture of the corresponding oxyprotohaemin IX isomers with the complete haem oxygenase system under the same conditions. In a kinetic study, the Km for alpha-meso-oxyprotohaem IX was 3.6 microM, which was 2-fold higher than that for protohaem IX. The maximum velocity (Vmax.) of the conversion of alpha-meso-oxyprotohaem IX into biliverdin IX alpha was twice as fast as that of protohaem IX. These results demonstrate that alpha-meso-oxyprotohaem IX is an intermediate of haem degradation and it was converted stereospecifically into biliverdin IX alpha via verdohaem IX alpha. PMID:2122884

  5. Assembly of an alpha-gamma coincidence measuring device for checking alpha decay schemes.

    PubMed

    Martín Sánchez, A; Caro Marroyo, B

    2012-09-01

    Two new chambers for measuring alpha-particle emissions have been made: a low-geometry chamber with a powerful magnet to eliminate conversion electrons, and an alpha-gamma coincidence chamber. Both devices incorporate a high-resolution Si detector, and the second chamber, a low-energy Ge detector as well. A dual parameter multichannel analyzer was used to register coincidences in the second device. Alpha-particle and gamma-ray detectors work simultaneously in both individual and dual modes, providing single and coincidence spectra. Some preliminary alpha-gamma coincidence spectra have been obtained.

  6. Methods for the synthesis and polymerization of .alpha.,.alpha.'-dihalo-p-xylenes

    DOEpatents

    Ferraris, John P.; Neef, Charles J.

    2002-07-30

    The present invention describes an improved method for the polymerization of .alpha.,.alpha.-dihalo-p-xylene's such as the .alpha.,.alpha.'-dihalo-2-methoxy-5-(2-ethylhexyloxy)-xylene's. The procedure for synthesis is based on the specific order of addition of reagents and the use of an anionic initiator that allows control of the molecular weight of the polymer. The molecular weight control allows processability of the polymer which is important for its utility in applications including in light-emitting-diodes, field effect transistors and photovoltaic devices.

  7. Overview Of Suborbital Human Transportation Concept Alpha

    NASA Astrophysics Data System (ADS)

    Adirim, H.; Pilz, N.; Marini, M.; Hendrick, P.; Schmid, M.; Behr, R.; Barth, T.; Tarfeld, F.; Wiegand, A.; Charbonnier, D.; Haya Ramos, R.; Steeland, J.; Mack, A.

    2011-05-01

    Within the EC co-funded project FAST20XX (Future high-Altitude high-Speed Transport 20XX), the European suborbital passenger transportation system concept ALPHA (Airplane Launched PHoenix Aircraft), which shall be based to a maximum extent on existing technologies and capabilities, is currently being investigated as collaborative project by a European consortium under coordination of ESA. The ALPHA concept incorporates an air-launch from a carrier aircraft, which shall be used as first stage. The ALPHA vehicle shall be capable of transporting up to four passengers plus one pilot to an altitude of at least 100 km. The ALPHA vehicle is a down-scaled version of the suborbital space transportation concept Hopper, which was already deeply investigated within the European FESTIP System Study and the German ASTRA program including the successfully flown experimental landing demonstrator Phoenix. This approach has allowed the use of existing aerodynamic vehicle data and has led to the adaptation of the external Hopper/Phoenix configuration for ALPHA. In FESTIP and ASTRA, the Hopper configuration showed sufficient stability margins. Due to the geometric similarity of the ALPHA and Hopper vehicles, a trimable and flyable configuration could be derived by means of ALPHA flight trajectory calculations. In its current configuration, the ALPHA vehicle has a length of ca. 9 m and a gross take-off mass of ca. 3.5 Mg. The launch, staging and separation of ALPHA shall be performed either as internal air-launch from the cargo bay of the carrier aircraft, as under-wing air-launch or as towed air-launch. After separation from the carrier aircraft, the ALPHA vehicle ignites its onboard rocket propulsion system. Since conventional liquid and solid propulsion did not seem suitable for ALPHA due to Their high cost, limited safety and toxicity, a low-cost, “green” and non-hazardous hybrid propulsion system based on liquid nitrous oxide in combination with a solid polymer fuel was

  8. Pharmacologic specificity of alpha-2 adrenergic receptor subtypes

    SciTech Connect

    Petrash, A.; Bylund, D.

    1986-03-01

    The authors have defined alpha-2 adrenergic receptor subtypes in human and rat tissues using prazosin as a subtype selective drug. Prazosin has a lower affinity (250 nM) at alpha-2A receptor and a higher affinity (5 nM) at alpha-2B receptors. In order to determine if other adrenergic drugs are selective for one or the other subtypes, the authors performed (/sup 3/H)yohimbine inhibition experiments with various adrenergic drugs in tissues containing alpha-2A, alpha-2B or both subtypes. Oxymetazoline, WB4101 and yohimbine were found to be 80-, 20- and 10-fold more potent at alpha-2A receptors than at alpha-2B receptors. Phentolamine, adazoxan, (+)- and (-)-mianserin, clonidine, (+)-butaclamol, (-)- and (+)-norepinephrine, epinephrine, dopamine and thioridazine were found to have equal affinities for the two subtypes. These results further validate the subdivision of alpha-2 adrenergic receptors into alpha-2A and alpha-2B subtypes.

  9. Cancer radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    Couturier, Olivier; Supiot, Stéphane; Degraef-Mougin, Marie; Faivre-Chauvet, Alain; Carlier, Thomas; Chatal, Jean-François; Davodeau, François; Cherel, Michel

    2005-05-01

    In lymphoid malignancies and in certain solid cancers such as medullary thyroid carcinoma, somewhat mixed success has been achieved when applying radioimmunotherapy (RIT) with beta-emitters for the treatment of refractory cases. The development of novel RIT with alpha-emitters has created new opportunities and theoretical advantages due to the high linear energy transfer (LET) and the short path length in biological tissue of alpha-particles. These physical properties offer the prospect of achieving selective tumoural cell killing. Thus, RIT with alpha-emitters appears particularly suited for the elimination of circulating single cells or cell clusters or for the treatment of micrometastases at an early stage. However, to avoid non-specific irradiation of healthy tissues, it is necessary to identify accessible tumoural targets easily and rapidly. For this purpose, a small number of alpha-emitters have been investigated, among which only a few have been used for in vivo preclinical studies. Another problem is the availability and cost of these radionuclides; for instance, the low cost and the development of a reliable actinium-225/bismuth-213 generator were probably determining elements in the choice of bismuth-213 in the only human trial of RIT with an alpha-emitter. This article reviews the literature concerning monoclonal antibodies radiolabelled with alpha-emitters that have been developed for possible RIT in cancer patients. The principal radio-immunoconjugates are considered, starting with physical and chemical properties of alpha-emitters, their mode of production, the possibilities and difficulties of labelling, in vitro studies and finally, when available, in vivo preclinical and clinical studies. PMID:15841373

  10. Alpha Channeling in Rotating Plasma with Stationary Waves

    SciTech Connect

    A. Fetterman and N.J. Fisch

    2010-02-15

    An extension of the alpha channeling effect to supersonically rotating mirrors shows that the rotation itself can be driven using alpha particle energy. Alpha channeling uses radiofrequency waves to remove alpha particles collisionlessly at low energy. We show that stationary magnetic fields with high nθ can be used for this purpose, and simulations show that a large fraction of the alpha energy can be converted to rotation energy.

  11. Experimental and Theoretical Electron Density Distribution of Alpha,Alpha-Trehalose Dihydrate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha,alpha-rehalose is of interest because of its cryoprotective and antidessicant properties, and because it possesses various technical anomalies such as 13C NMR spectra that give misleading indications of intramolecular structural symmetry. It is a non-reducing disaccharide, with the glycosidic...

  12. Correcting Coefficient Alpha for Correlated Errors: Is [alpha][K]a Lower Bound to Reliability?

    ERIC Educational Resources Information Center

    Rae, Gordon

    2006-01-01

    When errors of measurement are positively correlated, coefficient alpha may overestimate the "true" reliability of a composite. To reduce this inflation bias, Komaroff (1997) has proposed an adjusted alpha coefficient, ak. This article shows that ak is only guaranteed to be a lower bound to reliability if the latter does not include correlated…

  13. Amyloid formation and disaggregation of {alpha}-synuclein and its tandem repeat ({alpha}-TR)

    SciTech Connect

    Bae, Song Yi; Kim, Seulgi; Hwang, Heejin; Kim, Hyun-Kyung; Yoon, Hyun C.; Kim, Jae Ho; Lee, SangYoon; Kim, T. Doohun

    2010-10-01

    Research highlights: {yields} Formation of the {alpha}-synuclein amyloid fibrils by [BIMbF{sub 3}Im]. {yields} Disaggregation of amyloid fibrils by epigallocatechin gallate (EGCG) and baicalein. {yields} Amyloid formation of {alpha}-synuclein tandem repeat ({alpha}-TR). -- Abstract: The aggregation of {alpha}-synuclein is clearly related to the pathogenesis of Parkinson's disease. Therefore, detailed understanding of the mechanism of fibril formation is highly valuable for the development of clinical treatment and also of the diagnostic tools. Here, we have investigated the interaction of {alpha}-synuclein with ionic liquids by using several biochemical techniques including Thioflavin T assays and transmission electron microscopy (TEM). Our data shows a rapid formation of {alpha}-synuclein amyloid fibrils was stimulated by 1-butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide [BIMbF{sub 3}Im], and these fibrils could be disaggregated by polyphenols such as epigallocatechin gallate (EGCG) and baicalein. Furthermore, the effect of [BIMbF{sub 3}Im] on the {alpha}-synuclein tandem repeat ({alpha}-TR) in the aggregation process was studied.

  14. Prestimulus EEG alpha activity reflects temporal expectancy.

    PubMed

    Min, Byoung-Kyong; Park, Jin Young; Kim, Eun Joo; Kim, Joong Il; Kim, Jae-Jin; Park, Hae-Jeong

    2008-06-27

    Since prestimulus EEG alpha activity has recently been considered to convey prestimulus top-down processing, we investigated whether prestimulus alpha activity reflects temporal expectancy of upcoming stimulation even under the non-classical contingent negative variation (CNV) paradigm. EEG was recorded from 16 subjects performing a color and a shape discrimination task manipulated with constant and variable inter-stimulus interval (ISI) conditions. The power of oscillatory activity was investigated by convolving the EEG signals with Morlet wavelets. The constant ISI condition yielded significantly shorter reaction times than the variable ISI condition, indicating more efficient preparation for upcoming stimuli during the constant ISI. We found significantly higher prestimulus alpha activity in the constant ISI condition than in the variable ISI condition, but no significant CNV even in the constant ISI condition. Such a reflection of temporal expectancy in the prestimulus alpha activity corroborates that the prestimulus top-down mental state for preparing upcoming task-performance is considerably reflected in the prestimulus ongoing alpha activity. PMID:18486342

  15. Role of Frontal Alpha Oscillations in Creativity

    PubMed Central

    Lustenberger, Caroline; Boyle, Michael R.; Foulser, A. Alban; Mellin, Juliann M.; Fröhlich, Flavio

    2015-01-01

    Creativity, the ability to produce innovative ideas, is a key higher-order cognitive function that is poorly understood. At the level of macroscopic cortical network dynamics, recent EEG data suggests that cortical oscillations in the alpha frequency band (8 – 12 Hz) are correlated with creative thinking. However, whether alpha oscillations play a fundamental role in creativity has remained unknown. Here we show that creativity is increased by enhancing alpha power using 10 Hz transcranial alternating current stimulation (10Hz-tACS) of the frontal cortex. In a study of 20 healthy participants with a randomized, balanced cross-over design, we found a significant improvement of 7.4% in the Creativity Index measured by the Torrance Test of Creative Thinking, a comprehensive and most frequently used assay of creative potential and strengths. In a second similar study with 20 subjects, 40Hz-tACS was used in instead of 10Hz-tACS to rule out a general “electrical stimulation” effect. No significant change in the Creativity Index was found for such frontal gamma stimulation. Our results suggest that alpha activity in frontal brain areas is selectively involved in creativity; this enhancement represents the first demonstration of specific neuronal dynamics that drive creativity and can be modulated by non-invasive brain stimulation. Our findings agree with the model that alpha recruitment increases with internal processing demands and is involved in inhibitory top-down control, which is an important requirement for creative ideation. PMID:25913062

  16. Alpha-particle sensitive test SRAMs

    NASA Technical Reports Server (NTRS)

    Buehler, M. G.; Blaes, B. R.

    1990-01-01

    A bench-level test is being developed to evaluate memory-cell upsets in a test SRAM designed with a cell offset voltage. This offset voltage controls the critical charge needed to upset the cell. The effect is demonstrated using a specially designed 2-micron n-well CMOS 4-kb test SRAM and a Po-208 5.1-MeV 0.61-LET alpha-particle source. This test SRAM has been made sensitive to alpha particles through the use of a cell offset voltage, and this has allowed a bench-level characterization in a laboratory setting. The experimental data are linked to a alpha-particle interaction physics and to SPICE circuit simulations through the alpha-particle collection depth. The collection depth is determined by two methods and found to be about 7 micron. In addition, alpha particles that struck outside the bloated drain were able to flip the SRAM cells. This lateral charge collection was observed to be more than 6 micron.

  17. H-alpha Observations of MKW10

    NASA Astrophysics Data System (ADS)

    Johnson, Harold; Coble, Kimberly A.; Koopmann, Rebecca A.; Durbala, Adriana; Undergraduate ALFALFA Team

    2016-01-01

    As part of the Undergraduate ALFALFA Team project looking at clusters and groups of galaxies to investigate the effects of environment on star formation, we analyzed H-alpha and R-band observations of the group MKW10 from the WIYN 0.9-m telescope with MOSAIC camera at Kitt Peak. We continuum-subtract the H-alpha images by scaling and subtracting the broadband R images. This process includes: determining the seeing of each image by calculating the FWHM values of several stars in the image; convolving all images to the worst seeing; stacking images for each filter; subtracting sky background; scaling the R image to H-alpha; and subtracting the scaled R from H-alpha. We then use the H-alpha-continuum-subtracted image to perform surface photometry of individual galaxies in MKW10. The data will be used to determine star formation rates and distributions of galaxies in this group environment and will be compared to results for galaxies in other UAT group and cluster environments. Analysis is ongoing.This work has been supported by NSF grant AST-1211005 and the Illinois Space Grant Consortium.

  18. Venus - False Color Image of Alpha Regio

    NASA Technical Reports Server (NTRS)

    1991-01-01

    This Magellan radar image shows Alpha Regio, a topographic upland approximately 1,300 kilometers (806 miles) across which is centered on 25 degrees south latitude, 4 degrees east longitude. In 1963 Alpha Regio was the first feature on Venus to be identified from Earth based radar. The radar bright area of Alpha Regio is characterized by multiple sets of intersecting trends of structural features such as ridges, troughs and flat floored fault valleys that together form a polygonal outline. Circular to oblong dark patches within the complex terrain are local topographic lows that are filled with smooth volcanic lava. Complex ridged terrains such as Alpha, formerly called 'tessera' in the Soviet Venera 15 and 16 radar missions and the Arecibo radar data, appear to be widespread and common surface expressions of Venusian tectonic processes. Directly south of the complex ridged terrain is a large ovoid shaped feature named Eve. The radar bright spot located centrally within Eve marks the location of the prime meridian of Venus. Magellan radar data reveals that relatively young lava flows emanate from Eve and extends into the southern margin of the ridged terrain at Alpha. The mosaic was produced by Eric de Jong and Myche McAuley in the JPL Multimission Image Processing Laboratory.

  19. ALPHA ATTENUATION DUE TO DUST LOADING

    SciTech Connect

    Dailey, A; Dennis Hadlock, D

    2007-08-09

    Previous studies had been done in order to show the attenuation of alpha particles in filter media. These studies provided an accurate correction for this attenuation, but there had not yet been a study with sufficient results to properly correct for attenuation due to dust loading on the filters. At the Savannah River Site, filter samples are corrected for attenuation due to dust loading at 20%. Depending on the facility the filter comes from and the duration of the sampling period, the proper correction factor may vary. The objective of this study was to determine self-absorption curves for each of three counting instruments. Prior work indicated significant decreases in alpha count rate (as much as 38%) due to dust loading, especially on filters from facilities where sampling takes place over long intervals. The alpha count rate decreased because of a decrease in the energy of the alpha. The study performed resulted in a set of alpha absorption curves for each of three detectors. This study also took into account the affects of the geometry differences in the different counting equipment used.

  20. Benchmarking the External Surrogate Ratio Method using the (alpha,alpha' f) reaction at STARS

    SciTech Connect

    Lesher, S R; Bernstein, L A; Ai, H; Beausang, C W; Bleuel, D; Burke, J T; Clark, R M; Fallon, P; Gibelin, J; Lee, I Y; Lyles, B F; Macchiavelli, A O; McMahan, M A; Moody, K J; Norman, E B; Phair, L; Rodriguez-Vieitez, E; Wiedeking, M

    2008-01-09

    We measured the ratio of the fission probabilities of {sup 234}U* relative to {sup 236}U* formed via an ({alpha},{alpha}{prime}) direct reactions using the STARS array at the 88-inch cyclotron at the Lawrence Berkeley National Laboratory. This ratio has a shape similar to the ratio of neutron capture probabilities from {sup 233}U(n; f) and {sup 235}U(n; f), indicating the alpha reactions likely formed a compound nucleus. This result indicates that the ratios of fission exit channel probabilities for two actinide nuclei populated via ({alpha}, {alpha}{prime}) can be used to determine an unknown fission cross section relative to a known one. The validity of the External Surrogate Ratio Method (ESRM) is tested and the results support the conclusions of Burke et al. [1].

  1. Alpha-decay of light protactinium isotopes

    SciTech Connect

    Faestermann, T.; Gillitzer, A.; Hartel, K.; Henning, W.; Kienle, P.

    1987-12-10

    Light protactinium isotopes have been produced with /sup 204/Pb (/sup 19/F,xn) reactions. ..cap alpha..-activities with E/sub ..cap alpha../ = 9.90(5) MeV, T/sub 1/2/ = 53(10) ns and E/sub ..cap alpha../ = 9.65(5) MeV, T/sub 1/2/ = 0.78(16) ..mu..s could be attributed to the previously unobserved nuclei /sup 219/Pa and /sup 220/Pa with the help of excitation functions. The peak cross sections for the 4n and 3n evaporation channels are on the order of 10 ..mu..b. The decay energies as well as the halflives fit well into the systematics of these nuclei close to the magic neutron number N = 126. /sup 219/Pa is the shortest lived nuclide known with directly measured halflife.

  2. Coefficient alpha and interculture test selection.

    PubMed

    Thurber, Steven; Kishi, Yasuhiro

    2014-04-01

    The internal consistency reliability of a measure can be a focal point in an evaluation of the potential adequacy of an instrument for adaptation to another cultural setting. Cronbach's alpha (α) coefficient is often used as the statistical index for such a determination. However, alpha presumes a tau-equivalent test and may constitute an inaccurate population estimate for multidimensional tests. These notions are expanded and examined with a Japanese version of a questionnaire on nursing attitudes toward suicidal patients, originally constructed in Sweden using the English language. The English measure was reported to have acceptable internal consistency (α) albeit the dimensionality of the questionnaire was not addressed. The Japanese scale was found to lack tau-equivalence. An alternative to alpha, "composite reliability," was computed and found to be below acceptable standards in magnitude and precision. Implications for research application of the Japanese instrument are discussed. PMID:22523134

  3. Radiation risks from inhaled alpha emitters

    NASA Astrophysics Data System (ADS)

    Simmons, Jack A.

    2001-06-01

    The alpha emitter that gives rise to the greatest concern over its link to the induction of lung cancer is radon. As noted by the ICRP, attempts to relate the risk of cancer induction to the dose delivered by the alpha particles result in a value for this risk which is unrealistically high. Instead, an estimate based on the epidemiology of radon in mines is preferred. The logical result, that the weighting factor for these alpha particles should be very much lesser than the recommended value of 20, appears to have been ignored. It will be shown that there are two fundamental reasons for this large discrepancy. The first is that the implied "linear non-threshold" hypothesis is not supported by recent investigations. The second is that the concept of "dose" is meaningless at the levels of exposure considered in this context. Alternative proposals in terms of fluence and the effect cross-section will be presented.

  4. Synthesis of peptide .alpha.-thioesters

    DOEpatents

    Camarero, Julio A.; Mitchell, Alexander R.; De Yoreo, James J.

    2008-08-19

    Disclosed herein is a new method for the solid phase peptide synthesis (SPPS) of C-terminal peptide .alpha. thioesters using Fmoc/t-Bu chemistry. This method is based on the use of an aryl hydrazine linker, which is totally stable to conditions required for Fmoc-SPPS. When the peptide synthesis has been completed, activation of the linker is achieved by mild oxidation. The oxidation step converts the acyl-hydrazine group into a highly reactive acyl-diazene intermediate which reacts with an .alpha.-amino acid alkylthioester (H-AA-SR) to yield the corresponding peptide .alpha.-thioester in good yield. A variety of peptide thioesters, cyclic peptides and a fully functional Src homology 3 (SH3) protein domain have been successfully prepared.

  5. ALPHA MIS: Reference manual. Revision 2

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  6. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, Larry R.; Post Jr., Douglass E.; Dawson, John M.

    1986-06-03

    Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.

  7. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, Larry R.; Post, Jr., Douglass E.; Dawson, John M.

    1986-01-01

    Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.

  8. Microdosimetry for Targeted Alpha Therapy of Cancer

    PubMed Central

    Huang, Chen-Yu; Guatelli, Susanna; Oborn, Bradley M.; Allen, Barry J.

    2012-01-01

    Targeted alpha therapy (TAT) has the advantage of delivering therapeutic doses to individual cancer cells while reducing the dose to normal tissues. TAT applications relate to hematologic malignancies and now extend to solid tumors. Results from several clinical trials have shown efficacy with limited toxicity. However, the dosimetry for the labeled alpha particle is challenging because of the heterogeneous antigen expression among cancer cells and the nature of short-range, high-LET alpha radiation. This paper demonstrates that it is inappropriate to investigate the therapeutic efficacy of TAT by macrodosimetry. The objective of this work is to review the microdosimetry of TAT as a function of the cell geometry, source-target configuration, cell sensitivity, and biological factors. A detailed knowledge of each of these parameters is required for accurate microdosimetric calculations. PMID:22988479

  9. Ultraviolet observations of alpha Aurigae from Copernicus

    NASA Technical Reports Server (NTRS)

    Dupree, A. K.

    1975-01-01

    Emission lines of L-alpha (1215.67 A) and O VI (1031.94 A) were detected in the spectroscopic binary alpha Aur (Capella) with the Princeton experiment on Copernicus. Temperatures of the emitting regions are inferred to be in excess of 300,000 K. The temperature and emission measure are consistent with a variable source of soft X-rays. If the emission is attributed to the primary star (G5 III), the atmosphere is expanding with velocities of about 20-100 km/s. Such expansion can lead to material within the binary system. The density of interstellar hydrogen inferred from absorption of stellar L-alpha appears to be approximately 0.01 hydrogen atoms per cu cm.

  10. The evolutionary conservation of DNA polymerase. alpha

    SciTech Connect

    Miller, M.A.; Korn, D.; Wang, T.S.F. )

    1988-08-25

    The evolutionary conservation of DNA polymerase {alpha} was assessed by immunological and molecular genetic approaches. Four anti-human KB cell DNA polymerase {alpha} monoclonal antibodies were tested for their ability to recognize a phylogenetically broad array of eukaryotic DNA polymerases. While the single non-neutralizing antibody used in this study recognizes higher mammalian (human, simian, canine, and bovine) polymerases only, three neutralizing antibodies exhibit greater, but variable, extents of cross-reactivity among vertebrate species. Genomic Southern hybridization studies with the cDNA of the human DNA polymerase {alpha} catalytic polypeptide identify the existence of many consensus DNA sequences within the DNA polymerase genes of vertebrate, invertebrate, plant and unicellular organisms. These findings illustrate the differential evolutionary conservation of four unique epitopes on DNA sequences, presumably reflective of critical functional domains, in the DNA polymerase genes from a broad diversity of living forms.

  11. Alternating current long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; McAtee, J.L.

    1993-02-16

    An alpha particle detector, utilizing alternating currents, which is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  12. Alternating current long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; McAtee, James L.

    1993-01-01

    An alpha particle detector, utilizing alternating currents, whcih is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  13. Lyman-alpha imagery of Comet Kohoutek

    NASA Technical Reports Server (NTRS)

    Carruthers, G. R.; Opal, C. B.; Page, T. L.; Meier, R. R.; Prinz, D. K.

    1974-01-01

    Electrographic imagery of Comet Kohoutek in the 1100-1500 A wavelength range was obtained from a sounding rocket on Jan. 8, 1974, and from the Skylab space station on 13 occasions between Nov. 26, 1973 and Feb. 2, 1974. These images are predominantly due to Lyman-alpha (1216 A) emission from the hydrogen coma of the comet. The rocket pictures have been calibrated for absolute sensitivity and a hydrogen production rate has been determined. However, the Skylab camera suffered degradation of its sensitivity during the mission, and its absolute sensitivity for each observation can only be estimated by comparison of the comet images with those taken by the rocket camera, with imagery of the geocoronal Lyman-alpha glow, of the moon in reflected Lyman-alpha, and of ultraviolet-bright stars. The rocket and geocoronal comparisons are used to derive a preliminary, qualitative history of the development of the cometary hydrogen coma and the associated hydrogen production rate.

  14. Solution structure of {alpha}-conotoxin PIA, a novel antagonist of {alpha}6 subunit containing nicotinic acetylcholine receptors

    SciTech Connect

    Chi, Seung-Wook; Lee, Si-Hyung; Kim, Do-Hyoung; Kim, Jae-Sung; Olivera, Baldomero M.; McIntosh, J. Michael; Han, Kyou-Hoon . E-mail: khhan600@kribb.re.kr

    2005-12-30

    {alpha}-Conotoxin PIA is a novel nicotinic acetylcholine receptor (nAChR) antagonist isolated from Conus purpurascens that targets nAChR subtypes containing {alpha}6 and {alpha}3 subunits. {alpha}-conotoxin PIA displays 75-fold higher affinity for rat {alpha}6/{alpha}3{beta}2{beta}3 nAChRs than for rat {alpha}3{beta}2 nAChRs. We have determined the three-dimensional structure of {alpha}-conotoxin PIA by nuclear magnetic resonance spectroscopy. The {alpha}-conotoxin PIA has an '{omega}-shaped' overall topology as other {alpha}4/7 subfamily conotoxins. Yet, unlike other neuronally targeted {alpha}4/7-conotoxins, its N-terminal tail Arg{sup 1}-Asp{sup 2}-Pro{sup 3} protrudes out of its main molecular body because Asp{sup 2}-Pro{sup 3}-Cys{sup 4}-Cys{sup 5} forms a stable type I {beta}-turn. In addition, a kink introduced by Pro{sup 15} in the second loop of this toxin provides a distinct steric and electrostatic environment from those in {alpha}-conotoxins MII and GIC. By comparing the structure of {alpha}-conotoxin PIA with other functionally related {alpha}-conotoxins we suggest structural features in {alpha}-conotoxin PIA that may be associated with its unique receptor recognition profile.

  15. Low-valent niobium-mediated double activation of C-F/C-H bonds: fluorene synthesis from o-arylated alpha,alpha,alpha-trifluorotoluene derivatives.

    PubMed

    Fuchibe, Kohei; Akiyama, Takahiko

    2006-02-01

    By the treatment of 0.3 molar amount of NbCl5 and LiAlH4, o-arylated alpha,alpha,alpha-trifluorotoluenes afforded fluorene derivatives in good yields. C-F bonds of the CF3 group and the neighboring ortho C-H bond were doubly activated to give the coupling products. PMID:16448098

  16. Opposite effects of the acute promyelocytic leukemia PML-retinoic acid receptor alpha (RAR alpha) and PLZF-RAR alpha fusion proteins on retinoic acid signalling.

    PubMed Central

    Ruthardt, M; Testa, U; Nervi, C; Ferrucci, P F; Grignani, F; Puccetti, E; Grignani, F; Peschle, C; Pelicci, P G

    1997-01-01

    Fusion proteins involving the retinoic acid receptor alpha (RAR alpha) and the PML or PLZF nuclear protein are the genetic markers of acute promyelocytic leukemias (APLs). APLs with the PML-RAR alpha or the PLZF-RAR alpha fusion protein are phenotypically indistinguishable except that they differ in their sensitivity to retinoic acid (RA)-induced differentiation: PML-RAR alpha blasts are sensitive to RA and patients enter disease remission after RA treatment, while patients with PLZF-RAR alpha do not. We here report that (i) like PML-RAR alpha expression, PLZF-RAR alpha expression blocks terminal differentiation of hematopoietic precursor cell lines (U937 and HL-60) in response to different stimuli (vitamin D3, transforming growth factor beta1, and dimethyl sulfoxide); (ii) PML-RAR alpha, but not PLZF-RAR alpha, increases RA sensitivity of hematopoietic precursor cells and restores RA sensitivity of RA-resistant hematopoietic cells; (iii) PML-RAR alpha and PLZF-RAR alpha have similar RA binding affinities; and (iv) PML-RAR alpha enhances the RA response of RA target genes (those for RAR beta, RAR gamma, and transglutaminase type II [TGase]) in vivo, while PLZF-RAR alpha expression has either no effect (RAR beta) or an inhibitory activity (RAR gamma and type II TGase). These data demonstrate that PML-RAR alpha and PLZF-RAR alpha have similar (inhibitory) effects on RA-independent differentiation and opposite (stimulatory or inhibitory) effects on RA-dependent differentiation and that they behave in vivo as RA-dependent enhancers or inhibitors of RA-responsive genes, respectively. Their different activities on the RA signalling pathway might underlie the different responses of PML-RAR alpha and PLZF-RAR alpha APLs to RA treatment. The PLZF-RAR alpha fusion protein contains an approximately 120-amino-acid N-terminal motif (called the POZ domain), which is also found in a variety of zinc finger proteins and a group of poxvirus proteins and which mediates protein

  17. Lunar surface outgassing and alpha particle measurements

    SciTech Connect

    Lawson, S. L.; Feldman, W. C.; Lawrence, David J. ,; Moore, K. R.; Elphic, R. C.; Maurice, S.; Belian, Richard D.; Binder, Alan B.

    2002-01-01

    The Lunar Prospector Alpha Particle Spectrometer (LP APS) searched for lunar surface gas release events and mapped their distribution by detecting alpha particle?; produced by the decay of gaseous radon-222 (5.5 MeV, 3.8 day half-life), solid polonium-2 18 (6.0 MeV, 3 minute half-life), and solid polonium-210 (5.3 MeV, 138 day half-life, but held up in production by the 21 year half-life of lead-210). These three nuclides are radioactive daughters from the decay of uranium-238.

  18. HETDEX: Diffuse Lyman-Alpha Emission

    NASA Astrophysics Data System (ADS)

    Tuttle, Sarah E.; Finkelstein, S.; Gebhardt, K.; HETDEX Collaboration

    2012-01-01

    The intermediate redshift universe probed by HETDEX, 1.8 < z < 3.0, holds a great deal of information about star formation and the evolution of galaxies. Although simulations reveal a regime active with gas accretion and feeding of galaxies via filaments, observational evidence for this accretion from the Intergalactic Medium (IGM) at any redshift has been very limited. Here we use data from VIRUS-P across several well-characterized fields to put limits on diffuse emission of Lyman-Alpha at the outskirts of galaxies. This work is done in preparation for a similar program with the full HETDEX sample of Lyman-Alpha Emitters (LAEs).

  19. Hydrogen Lyman-alpha coronagraph/polarimeter

    NASA Technical Reports Server (NTRS)

    Fineschi, Silvano; Hoover, Richard B.; Walker, Arthur B. C., Jr.

    1992-01-01

    The present treatment of vector magnetic field measurement in coronas by means of the Hanle effect of the Lyman-alpha line uses data from all-reflecting imaging coronagraph/polarimeters. The polarization sensitivity, bandpass, and spatial resolution of these instruments are defined through a modeling of the Hanle-effect signature in Lyman-alpha emission from coronal magnetic loops; the line-of-sight integration through an inhomogeneous coronal medium is taken into account. The use of the Hanle effect to measure solar corona vector magnetic fields is verified.

  20. Alpha particles in effective field theory

    SciTech Connect

    Caniu, C.

    2014-11-11

    Using an effective field theory for alpha (α) particles at non-relativistic energies, we calculate the strong scattering amplitude modified by Coulomb corrections for a system of two αs. For the strong interaction, we consider a momentum-dependent interaction which, in contrast to an energy dependent interaction alone [1], could be more useful in extending the theory to systems with more than two α particles. We will present preliminary results of our EFT calculations for systems with two alpha particles.

  1. Parallel Genetic Algorithm for Alpha Spectra Fitting

    NASA Astrophysics Data System (ADS)

    García-Orellana, Carlos J.; Rubio-Montero, Pilar; González-Velasco, Horacio

    2005-01-01

    We present a performance study of alpha-particle spectra fitting using parallel Genetic Algorithm (GA). The method uses a two-step approach. In the first step we run parallel GA to find an initial solution for the second step, in which we use Levenberg-Marquardt (LM) method for a precise final fit. GA is a high resources-demanding method, so we use a Beowulf cluster for parallel simulation. The relationship between simulation time (and parallel efficiency) and processors number is studied using several alpha spectra, with the aim of obtaining a method to estimate the optimal processors number that must be used in a simulation.

  2. Has iprindole an alpha adrenergic activity?

    PubMed

    Ganry, H; Bourin, M

    1993-05-01

    1. Acute administration of iprindole potentiated the toxicity of 1-norepinephrine and increased the intensity of oxotremorine-induced tremors. 2. On the forced swimming test combination iprindole with imipramine reduced the duration of immobility. 3. The action of yohimbine on the locomotor activity was antagonized by a pre-injection of iprindole. 4. Iprindole increased and prolonged exophthalmia and loss of righting reflex induced by xylazine. 5 All these results seems indicate that iprindole has an indirect alpha 1 and alpha 2 adrenergic activity.

  3. Fan-less long range alpha detector

    DOEpatents

    MacArthur, Duncan W.; Bounds, John A.

    1994-01-01

    A fan-less long range alpha detector which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces.

  4. Fan-less long range alpha detector

    DOEpatents

    MacArthur, D.W.; Bounds, J.A.

    1994-05-10

    A fan-less long range alpha detector is disclosed which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces. 2 figures.

  5. [Beta-1 adrenoceptor blockade decreases the firing rate to painful stimuli in spinal wide-dynamic range neurons in rats].

    PubMed

    Lamothe-Molina, Paul J; Lamothe-Molina, Pedro A; López-Ávila, Alberto

    2014-01-01

    Introducción: la epinefrina/norepinefrina inhibe la transmisión del dolor agudo; empero, no es claro el papel de los receptores beta-adrenérgicos. Por tanto, analizamos si los fármacos de estos receptores modulan la transmisión del dolor agudo mediante registro electrofisiológico unitario extracelular in vivo durante estimulación periférica dolorosa y no dolorosa en ratas. Métodos: estudio longitudinal en el que se cotejaron siete grupos de ratas: control (n = 11): solución salina (0,9 %); EPI (n = 8): 100 mcg epinefrina; agonista beta-1 (n = 8): 125 mcg dobutamina; antagonista beta-1 (n = 9): 100 mcg metoprolol; agonista beta-2 (n = 7): 100 mcg clembuterol; antagonista beta-2 (n = 8): butoxamina 100 mcg; antagonista beta-1 + EPI (n = 10): 100 mcg metoprolol + 100 mcg epinefrina. Se hizo análisis estadístico por medio de ANOVA. Resultados: La epinefrina redujo significativamente la tasa de disparo basal (RDB) en 34.1 % (p < 0.05) y la respuesta evocada por la estimulación dolorosa en 56 % (p < 0.05). No hubo cambios en la respuesta provocada por la falta de estimulación dolorosa. El antagonista beta-1 fue el único fármaco con acción beta-adrenérgica que redujo significativamente la respuesta evocada por la estimulación dolorosa en 41 % (p < 0.05). Conclusión: por primera vez un antagonista de los receptores beta-1-adrenérgicos (metoprolol) prueba ser eficaz en la reducción de la respuesta a la estimulación dolorosa en las neuronas ARD.

  6. The cytotoxicity of the α1-adrenoceptor antagonist prazosin is linked to an endocytotic mechanism equivalent to transport-P

    PubMed Central

    Fuchs, Robert; Stracke, Anika; Ebner, Nadine; Zeller, Christian Wolfgang; Raninger, Anna Maria; Schittmayer, Matthias; Kueznik, Tatjana; Absenger-Novak, Markus; Birner-Gruenberger, Ruth

    2015-01-01

    Since the α1-adrenergic antagonist prazosin (PRZ) was introduced into medicine as a treatment for hypertension and benign prostate hyperplasia, several studies have shown that PRZ induces apoptosis in various cell types and interferes with endocytotic trafficking. Because PRZ is also able to induce apoptosis in malignant cells, its cytotoxicity is a focus of interest in cancer research. Besides inducing apoptosis, PRZ was shown to serve as a substrate for an amine uptake mechanism originally discovered in neurones called transport-P. In line with our hypothesis that transport-P is an endocytotic mechanism also present in non-neuronal tissue and linked to the cytotoxicity of PRZ, we tested the uptake of QAPB, a fluorescent derivative of PRZ, in cancer cell lines in the presence of inhibitors of transport-P and endocytosis. Early endosomes and lysosomes were visualised by expression of RAB5-RFP and LAMP1-RFP, respectively; growth and viability of cells in the presence of PRZ and uptake inhibitors were also tested. Cancer cells showed co-localisation of QAPB with RAB5 and LAMP1 positive vesicles as well as tubulation of lysosomes. The uptake of QAPB was sensitive to transport-P inhibitors bafilomycin A1 (inhibits v-ATPase) and the antidepressant desipramine. Endocytosis inhibitors pitstop® 2 (general inhibitor of endocytosis), dynasore (dynamin inhibitor) and methyl-β-cyclodextrin (cholesterol chelator) inhibited the uptake of QAPB. Bafilomycin A1 and methyl-β-cyclodextrin but not desipramine were able to preserve growth and viability of cells in the presence of PRZ. In summary, we confirmed the hypothesis that the cellular uptake of QAPB/PRZ represents an endocytotic mechanism equivalent to transport-P. Endocytosis of QAPB/PRZ depends on a proton gradient, dynamin and cholesterol, and results in reorganisation of the LAMP1 positive endolysosomal system. Finally, the link seen between the cellular uptake of PRZ and cell death implies a still unknown pro-apoptotic membrane protein with affinity towards PRZ. PMID:26449523

  7. β1-adrenoceptor activation is required for ethanol enhancement of lateral paracapsular GABAergic synapses in the rat basolateral amygdala.

    PubMed

    Silberman, Yuval; Ariwodola, Olusegun J; Weiner, Jeff L

    2012-11-01

    Ethanol (EtOH) potentiation of GABAergic neurotransmission in the basolateral amygdala (BLA) may contribute to the acute anxiolytic effects of this drug. Previous studies have shown that BLA pyramidal neurons receive GABAergic input from two distinct sources: local interneurons and a cluster of GABAergic cells termed lateral paracapsular (LPCS) interneurons. It is noteworthy that whereas EtOH enhances local GABAergic synapses via a presynaptic increase in GABA release, EtOH potentiation of LPCS inhibition is mediated via a distinct mechanism that requires adrenoceptor (AR) activation. Here, we sought to further characterize the interaction between the AR system and EtOH enhancement of LPCS GABAergic synapses by using in vitro electrophysiology techniques in male Sprague-Dawley rats. Exogenous norepinephrine (NE) enhanced LPCS-evoked inhibitory postsynaptic currents (eIPSCs) via the activation of β-ARs, because this effect was blocked by propranolol. EtOH potentiation of LPCS eIPSCs was also blocked by propranolol and significantly reduced by NE pretreatment, suggesting that NE and EtOH may enhance LPCS inhibition via a common mechanism. EtOH enhancement of LPCS eIPSCs was significantly reduced by a selective β1-, but not β2- or β3-, AR antagonist, and both EtOH and NE potentiation of LPCS IPSCs was blocked by postsynaptic disruption of cAMP signaling. These data suggest that EtOH enhances LPCS synapses via a postsynaptic β1-AR, cAMP-dependent cascade. Because enhancement of LPCS inhibition can reduce anxiety-like behaviors, these findings shed light on a novel mechanism that may play a role in some of the anxiolytic effects of EtOH that are thought to contribute to the development and progression of alcoholism.

  8. Identification and quantification of alphaS1, alphaS2, beta, and kappa-caseins in water buffalo milk by reverse phase-high performance liquid chromatography and mass spectrometry.

    PubMed

    Feligini, Maria; Bonizzi, Ivan; Buffoni, Joanna Natalia; Cosenza, Gianfranco; Ramunno, Luigi

    2009-04-01

    A method for the simultaneous quantitation of alpha(S1), alpha(S2), beta, and kappa-caseins in water buffalo (Bubalus bubalis) milk using reverse phase high-performance liquid chromatography was developed. The molecular masses of the peaks separated by the described chromatographic protocol were determined by ESI-MS. alpha(S1)- and kappa-caseins were found to be heteromorphic in several individual milk samples. In particular, alpha(S1)-casein showed two peaks with a molecular mass of 23,490 Da and 23,516 Da, and kappa-casein showed three peaks with molecular masses of 19,165 Da, 19,177 Da, and 19,247 Da. Only one form for beta-casein (24,033 Da) and alpha(S2)-casein (22,741 Da) were detected. The mean values of casein fraction concentration observed throughout the individual samples were 8.89 gL(-1) with a relative standard deviation (RSD) of 20% for alpha(S1)-casein, 5.08 gL(-1) with a RSD of 25% for alpha(S2)-casein, 20.91 gL(-1) with a RSD of 16% for beta-casein, and 4.13 gL(-1) with a RSD of 24% for kappa-casein. Linear and second-order polynomial correlations with total nitrogen were calculated for all casein fractions.

  9. alpha(1A)- and alpha(1B)-adrenergic receptors differentially modulate antidepressant-like behavior in the mouse.

    PubMed

    Doze, Van A; Handel, Evelyn M; Jensen, Kelly A; Darsie, Belle; Luger, Elizabeth J; Haselton, James R; Talbot, Jeffery N; Rorabaugh, Boyd R

    2009-08-18

    Tricyclic antidepressant (TCA) drugs are used for the treatment of chronic depression, obsessive-compulsive disorder (OCD), and anxiety-related disorders. Chronic use of TCA drugs increases the expression of alpha(1)-adrenergic receptors (alpha(1)-ARs). Yet, it is unclear whether increased alpha(1)-AR expression contributes to the antidepressant effects of these drugs or if this effect is unrelated to their therapeutic benefit. In this study, mice expressing constitutively active mutant alpha(1A)-ARs (CAM alpha(1A)-AR) or CAM alpha(1B)-ARs were used to examine the effects of alpha(1A)- and alpha(1B)-AR signaling on rodent behavioral models of depression, OCD, and anxiety. CAM alpha(1A)-AR mice, but not CAM alpha(1B)-AR mice, exhibited antidepressant-like behavior in the tail suspension test and forced swim test. This behavior was reversed by prazosin, a selective alpha(1)-AR inverse agonist, and mimicked by chronically treating wild type mice with cirazoline, an alpha(1A)-AR agonist. Marble burying behavior, commonly used to model OCD in rodents, was significantly decreased in CAM alpha(1A)-AR mice but not in CAM alpha(1B)-AR mice. In contrast, no significant differences in anxiety-related behavior were observed between wild type, CAM alpha(1A)-AR, and CAM alpha(1B)-AR animals in the elevated plus maze and light/dark box. This is the first study to demonstrate that alpha(1A)- and alpha(1B)-ARs differentially modulate antidepressant-like behavior in the mouse. These data suggest that alpha(1A)-ARs may be a useful therapeutic target for the treatment of depression.

  10. A practical alpha particle irradiator for studying internal alpha particle exposure.

    PubMed

    Lee, Ki-Man; Lee, Ui-Seob; Kim, Eun-Hee

    2016-09-01

    An alpha particle irradiator has been built in the Radiation Bioengineering Laboratory at Seoul National University (SNU) to investigate the cellular responses to alpha emissions from radon and the progeny. This irradiator is designed to have the energy of alpha particles entering target cells similar to that of alpha emissions from the radon progeny Po-218 and Po-214 residing in the human respiratory tract. For the SNU alpha particle irradiator, an irradiation system is equipped with cell dishes of 4µm thick Mylar bottom and a special setup of cells on slide for gamma-H2AX assay. Dose calibration for the alpha particle irradiator was performed by dual approaches, detection and computer simulation, in consideration of the source-to-target distance (STD) and the size of a cell dish. The uniformity of dose among cells in a dish is achieved by keeping the STD and the size of cell dish in certain ranges. The performance of the SNU alpha particle irradiator has been proven to be reliable through the gamma-H2AX assay with the human lung epithelial cells irradiated. PMID:27475622

  11. Cardiac electrophysiological effects of selective adrenoceptor stimulation and their possible roles in arrhythmias.

    PubMed

    Vaughan Williams, E M

    1985-01-01

    The selective alpha 1- and alpha 2-adrenoceptor agonists St 587 and BHT 933, respectively, and the antagonists prazosin (alpha 1) and WY 25309 (alpha 2) have been used in combination with the selective beta 2-adrenoceptor agonist pirbuterol, and the antagonists atenolol (beta 1) and ICI 118551 (beta 2), to analyse the effects of individual types of adrenoceptor stimulation in various parts of the rabbit heart. In the sinus node, beta 1-, but not beta 2-adrenoceptor stimulation increased the fast phase of depolarisation. Both beta 1- and beta 2-adrenoceptor stimulation increased the slope of the slow diastolic depolarisation, accelerated repolarisation, and increased maximum diastolic potential. Beta 1- and beta 2-adrenoceptor stimulation also accelerated repolarisation in Purkinje cells and papillary muscle. After blockade of both beta 1- and beta 2-adrenoceptors, alpha 1-adrenoceptor stimulation caused bradycardia, owing exclusively to delayed repolarisation. Alpha 2-adrenoceptor stimulation had no effect. Beta 1-, but not beta 2-adrenoceptor stimulation augmented peak contractions three- to fivefold, and reduced the time-to-peak tension. In contrast, alpha 1-adrenoceptor stimulation only moderately (up to 47%) increased peak tension, but increased time-to-peak and duration of contractions. The results would be consistent with beta 1-adrenoceptor stimulation increasing inward calcium current, and with stimulation of alpha 1-adrenoceptors delaying the decline of [Ca]i rather than increasing its magnitude. Both beta 1- and beta 2-stimulation increased repolarising current, but alpha 1-stimulation decreased it.

  12. Quantification of functional and inactivated alpha 2-macroglobulin in sepsis.

    PubMed

    Abbink, J J; Nuijens, J H; Eerenberg, A J; Huijbregts, C C; Strack van Schijndel, R J; Thijs, L G; Hack, C E

    1991-01-23

    Alpha 2-macroglobulin (alpha 2 M) in vitro inhibits numerous proteinases that are generated during inflammatory reactions and therefore, probably plays an important role in diseases such as sepsis. To monitor the state of alpha 2 M in sepsis, we developed novel assays for functional and inactive alpha 2M. Functional alpha 2M in plasma was measured by quantitating the binding of alpha 2M to solid-phase trypsin. Inactive alpha 2M (i alpha 2M) was assessed with a monoclonal antibody, mcAb M1, that specifically reacts with a neodeterminant exposed on i alpha 2M. This mcAb in combination with chromogenic substrates was used to detect alpha 2M-proteinase complexes. Functional alpha 2M was reduced in plasma from 48 patients with clinical sepsis compared to healthy controls (p less than 0.0001). Levels of functional alpha 2M on admission and the lowest levels encountered in 23 patients with shock were lower than in 25 normotensive patients (p = 0.023 and p = 0.009, respectively). Increased levels of i alpha 2M (greater than 30 nM) at least on one occasion were found in only 4 of the 48 patients, being not different in hypotensive compared with normotensive patients, and not in patients who died compared with those who survived. Levels of functional alpha 2M correlated significantly with levels of factor XII and prekallikrein suggesting that decreases in alpha 2M at least in part were due to contact activation. Indeed, in two patients with increased i alpha 2M, complexes between alpha 2M and kallikrein were demonstrated in addition to plasmin- and thrombin-alpha 2M complexes.

  13. Substrate specificity of human liver neutral alpha-mannosidase.

    PubMed Central

    al Daher, S; De Gasperi, R; Daniel, P; Hirani, S; Warren, C; Winchester, B

    1992-01-01

    The digestion of radiolabelled natural oligosaccharide substrates by human liver neutral alpha-mannosidase has been studied by h.p.l.c. and h.p.t.l.c. The high-mannose oligosaccharides Man9GlcNAc and Man8GlcNAc are hydrolysed by the enzyme by two distinct non-random routes to a common product of composition Man6GlcNAc, which is then slowly converted into a unique Man5GlcNAc oligosaccharide, Man alpha(1----2)Man alpha(1----2)Man alpha(1----3)[Man alpha (1----6)] Man beta(1----4)GlcNAc. These pathways are different from the processing and lysosomal catabolic pathways for these structures. In particular, the alpha(1----2)-linked mannose residues attached to the core alpha(1----3)-linked mannose residue are resistant to hydrolysis. The key processing intermediate, Man alpha(1----3)[Man alpha(1----6)]Man alpha(1----6)[Man alpha(1----3)] Man beta(1----4)GlcNAc, is not produced in the digestion of high-mannose glycans by the neutral alpha-mannosidase, but it is hydrolysed by the enzyme by a non-random route to Man beta(1----4)GlcNAc via the core structure Man alpha(1----3)[Man alpha(1----6)]Man beta(1----4)GlcNAc. In contrast with its ready hydrolysis by lysosomal alpha-mannosidase, the core alpha(1----3)-mannosidic linkage is quite resistant to hydrolysis by neutral alpha-mannosidase. The precise specificity of neutral alpha-mannosidase towards high-mannose oligosaccharides suggests that it has a role in the modification of such structures in the cytosol. Images Fig. 4. PMID:1520283

  14. Sequence analysis of frog alpha B-crystallin cDNA: sequence homology and evolutionary comparison of alpha A, alpha B and heat shock proteins.

    PubMed

    Lu, S F; Pan, F M; Chiou, S H

    1995-11-22

    alpha-Crystallin is a major lens protein present in the lenses of all vertebrate species. Recent studies have revealed that bovine alpha-crystallins possess genuine chaperone activity similar to small heat-shock proteins. In order to facilitate the determination of the primary sequence of amphibian alpha B-crystallin, cDNA encoding alpha B subunit chain was amplified using a new "Rapid Amplification of cDNA Ends" (RACE) protocol of Polymerase Chain Reaction (PCR). PCR-amplified product corresponding to alpha B subunit was then subcloned into pUC18 vector and transformed into E. coli strain JM109. Plasmids purified from the positive clones were prepared for nucleotide sequencing by the automatic fluorescence-based dideoxynucleotide chain-termination method. Sequencing more than five clones containing DNA inserts coding for alpha B-crystallin subunit constructed only one complete full-length reading frame of 522 base pairs similar to that of alpha A subunit, covering a deduced protein sequence of 173 amino acids including the universal translation-initiating methionine. The frog alpha B crystallin shows 69, 66 and 56% whereas alpha A crystallin shows 83, 81 and 69% sequence similarity to the homologous chains of bovine, chicken and dogfish, respectively, revealing a more divergent structural relationship among these alpha B subunits as compared to alpha A subunits. Structural analysis and comparison of alpha A- and alpha B-crystallin subunits from eye lenses of different classes of vertebrates also shed some light on the evolutionary relatedness between alpha B/alpha A crystallins and the small heat-shock proteins.

  15. Plant alpha-amylase inhibitors and their interaction with insect alpha-amylases.

    PubMed

    Franco, Octávio L; Rigden, Daniel J; Melo, Francislete R; Grossi-De-Sá, Maria F

    2002-01-01

    Insect pests and pathogens (fungi, bacteria and viruses) are responsible for severe crop losses. Insects feed directly on the plant tissues, while the pathogens lead to damage or death of the plant. Plants have evolved a certain degree of resistance through the production of defence compounds, which may be aproteic, e.g. antibiotics, alkaloids, terpenes, cyanogenic glucosides or proteic, e.g. chitinases, beta-1,3-glucanases, lectins, arcelins, vicilins, systemins and enzyme inhibitors. The enzyme inhibitors impede digestion through their action on insect gut digestive alpha-amylases and proteinases, which play a key role in the digestion of plant starch and proteins. The natural defences of crop plants may be improved through the use of transgenic technology. Current research in the area focuses particularly on weevils as these are highly dependent on starch for their energy supply. Six different alpha-amylase inhibitor classes, lectin-like, knottin-like, cereal-type, Kunitz-like, gamma-purothionin-like and thaumatin-like could be used in pest control. These classes of inhibitors show remarkable structural variety leading to different modes of inhibition and different specificity profiles against diverse alpha-amylases. Specificity of inhibition is an important issue as the introduced inhibitor must not adversely affect the plant's own alpha-amylases, nor the nutritional value of the crop. Of particular interest are some bifunctional inhibitors with additional favourable properties, such as proteinase inhibitory activity or chitinase activity. The area has benefited from the recent determination of many structures of alpha-amylases, inhibitors and complexes. These structures highlight the remarkable variety in structural modes of alpha-amylase inhibition. The continuing discovery of new classes of alpha-amylase inhibitor ensures that exciting discoveries remain to be made. In this review, we summarize existing knowledge of insect alpha-amylases, plant alpha

  16. Interaction of per 3,6-anhydro-alpha cyclodextrins (alpha 36CD) and lead-alpha 36CD complex with biological systems.

    PubMed

    Debouzy, J C; Fauvelle, F; Gadelle, A; Baudin, C; Richard, M; Perly, B; Chouteau, F; Joets, J; Tazz, J J; Daveloose, D

    1998-05-01

    The interactions of per (3,6 anhydro) alpha cyclodextrin (alpha 36CD) and of lead-alpha 36CD complex with biological systems were tested by NMR, ESR and electronic microscopy using erythrocytes and model membranes. It was found that the haemolytic activity of alpha 36CD alone was seven fold lower than that of natural alpha cyclodextrin (evaluated by the concentration inducing 50% haemolysis, DH50 = 35 mM). Conversely, the formation of the complex resulted in an increase of haemolytic properties, with DH50 of 1 mM. The mechanism proposed was an increased membrane diffusion by endocytosis of the complex, leading to higher amounts of intracellular lead.

  17. Determining the alpha dynamo parameter in incompressible homogeneous magnetohydrodynamic turbulence

    NASA Technical Reports Server (NTRS)

    Matthaeus, W. H.; Goldstein, M. L.; Lantz, S. R.

    1983-01-01

    Alpha, an important parameter in dynamo theory, is proportional to either the kinetic, current, magnetic, or velocity helicity of the fluctuating magnetic field and fluctuating velocity field. The particular helicity to which alpha is proportional depends on the assumptions used in deriving the first order smoothed equations that describe the alpha effect. In two cases, when alpha is proportional to either the magnetic helicity or velocity helicity, alpha is determined experimentally from two point measurements of the fluctuating fields in incompressible, homogeneous turbulence having arbitrary symmetry. For the other two possibilities, alpha is determined if the turbulence is isotropic.

  18. The alpha-form of the hydroxides of bivalent metals

    NASA Technical Reports Server (NTRS)

    Feitknecht, W.

    1984-01-01

    X-ray analyses were made of the hydroxides of the bivalent metals. The freshly pptd. hydroxide is usually in the alpha-form, which on standing is converted to another form or other forms. The alpha and c grating dimensions of the alpha-form and the C6-type of Co, Zn, C, Co-Zn and Ni-Zn hydroxides are tabulated. Ni hydroxide does not exhibit an alpha-form. The alpha-Co(OH)2, the blue form, is stabilized by sugar or by the higher alcohols: these compounds do not stabilize alpha-Zn(OH)2.

  19. Aspergillus nidulans alpha-galactosidase of glycoside hydrolase family 36 catalyses the formation of alpha-galacto-oligosaccharides by transglycosylation.

    PubMed

    Nakai, Hiroyuki; Baumann, Martin J; Petersen, Bent O; Westphal, Yvonne; Hachem, Maher Abou; Dilokpimol, Adiphol; Duus, Jens Ø; Schols, Henk A; Svensson, Birte

    2010-09-01

    The alpha-galactosidase from Aspergillus nidulans (AglC) belongs to a phylogenetic cluster containing eukaryotic alpha-galactosidases and alpha-galacto-oligosaccharide synthases of glycoside hydrolase family 36 (GH36). The recombinant AglC, produced in high yield (0.65 g.L(-1) culture) as His-tag fusion in Escherichia coli, catalysed efficient transglycosylation with alpha-(1-->6) regioselectivity from 40 mm 4-nitrophenol alpha-d-galactopyranoside, melibiose or raffinose, resulting in a 37-74% yield of 4-nitrophenol alpha-D-Galp-(1-->6)-D-Galp, alpha-D-Galp-(1-->6)-alpha-D-Galp-(1-->6)-D-Glcp and alpha-D-Galp-(1-->6)-alpha-D-Galp-(1-->6)-D-Glcp-(alpha1-->beta2)-d-Fruf (stachyose), respectively. Furthermore, among 10 monosaccharide acceptor candidates (400 mm) and the donor 4-nitrophenol alpha-D-galactopyranoside (40 mm), alpha-(1-->6) linked galactodisaccharides were also obtained with galactose, glucose and mannose in high yields of 39-58%. AglC did not transglycosylate monosaccharides without the 6-hydroxymethyl group, i.e. xylose, L-arabinose, L-fucose and L-rhamnose, or with axial 3-OH, i.e. gulose, allose, altrose and L-rhamnose. Structural modelling using Thermotoga maritima GH36 alpha-galactosidase as the template and superimposition of melibiose from the complex with human GH27 alpha-galactosidase supported that recognition at subsite +1 in AglC presumably requires a hydrogen bond between 3-OH and Trp358 and a hydrophobic environment around the C-6 hydroxymethyl group. In addition, successful transglycosylation of eight of 10 disaccharides (400 mm), except xylobiose and arabinobiose, indicated broad specificity for interaction with the +2 subsite. AglC thus transferred alpha-galactosyl to 6-OH of the terminal residue in the alpha-linked melibiose, maltose, trehalose, sucrose and turanose in 6-46% yield and the beta-linked lactose, lactulose and cellobiose in 28-38% yield. The product structures were identified using NMR and ESI-MS and five of the 13

  20. Synthesis of 16 alpha-/sub 3/H androgen and estrogen substrates for 16 alpha-hydroxylase

    SciTech Connect

    Cantineau, R.; Kremers, P.; De Graeve, J.; Cornelis, A.; Laszlo, P.; Gielen, J.E.; Lambotte, R.

    1981-02-01

    The synthesis of 16 alpha-/sup 3/H androgens and estrogens is described. 1-(/sup 3/H)-Acetic acid in the presence of zinc dust reacts with 16 alpha-bromo-17-ketosteroids to produce 16 alpha-/sup 3/H-17-ketosteroids. This chemical reaction was used to prepare 16 alpha-/sup 3/H-dehydroepiandrosterone (I) and 16 alpha-/sub 4/H-estrone acetate (XI) from 16 alpha-bromo-dehydroepiandrosterone (X) and from 16 alpha-bromo-estrone acetate (XII), respectively. Using appropriate microbiological techniques, it was possible to convert these radiolabelled substrates into 16 alpha-/sup 3/H-androstenedione (II) and 16 alpha-/sup 3/H-estradiol-17 beta (VII). 16 alpha-/sup 3/H-Estrone (VI) was obtained by the chemical hydrolysis of 16 alpha-/sup 3/H-estrone acetate. The label distribution as determined by microbiological 16 alpha-hydroxylations indicated a specific labelling of 77% for androgens and 65% for estrogens in the 16 alpha position. These substrates can be used for measuring the 16 alpha hydroxylase activity, an important step in the biosynthesis of estriol (VIII) and estetrol (IX).

  1. Prediction of {alpha}-decay half-lives and Q{sub {alpha}} values of superheavy nuclei by a global potential for {alpha} + nucleus systems

    SciTech Connect

    Sahu, Basudeb

    2011-09-15

    An approach we have proposed recently for calculation of Q{sub {alpha}} energy and decay half-life T{sub 1/2}{sup {alpha}} on the {alpha} decay of radioactive heavy ions is applied to the evaluation of these two important parameters for the nuclei in the superheavy region Z = 112-118 for which experimental data are not available. It is shown that the {alpha} + nucleus potential represented by an exactly solvable potential used in the calculation could be expressed in terms of proton (Z) and neutron (N) numbers of the {alpha} emitter so that varieties of {alpha}-emitting nuclei differing in their Z and N values could be addressed for their decay properties without the help of any adjustable parameter and the results of Q{sub {alpha}} and T{sub 1/2}{sup {alpha}} for a nucleus are estimated without any prior knowledge of any one of these quantities. This procedure to obtain the values of Q{sub {alpha}} and T{sub 1/2}{sup {alpha}} works well to reproduce the known experimental results for superheavy nuclei and hence, the procedure is expected to provide proper information about these parameters in experiments on {alpha} decay of new nuclei in the superheavy region.

  2. Understanding a Widely Misunderstood Statistic: Cronbach's "Alpha"

    ERIC Educational Resources Information Center

    Ritter, Nicola L.

    2010-01-01

    It is important to explore score reliability in virtually all studies, because tests are not reliable. The present paper explains the most frequently used reliability estimate, coefficient alpha, so that the coefficient's conceptual underpinnings will be understood. Researchers need to understand score reliability because of the possible impact…

  3. Systemic Targeted Alpha Radiotherapy for Cancer

    PubMed Central

    Allen, BJ

    2013-01-01

    Background: The fundamental principles of internal targeted alpha therapy forcancer were established many decades ago.The high linear energy transfer (LET) ofalpha radiation to the targeted cancer cellscauses double strand breaks in DNA. Atthe same time, the short range radiation spares adjacent normal tissues. This targeted approach complements conventional external beam radiotherapy and chemotherapy. Such therapies fail on several fronts, such as lack of control of some primary cancers (e.g. glioblastoma multiforme) and to inhibit the development of lethal metastaticcancer after successful treatment of the primary cancer. Objective: This review charts the developing role of systemic high LET, internalradiation therapy. Method: Targeted alpha therapy is a rapidly advancing experimental therapy thatholds promise to deliver high cytotoxicity to targeted cancer cells. Initially thoughtto be indicated for leukemia and micrometastases, there is now evidence that solidtumors can also be regressed. Results: Alpha therapy may be molecular or physiological in its targeting. Alphaemitting radioisotopes such as Bi-212, Bi-213, At-211 and Ac-225 are used to labelmonoclonal antibodies or proteins that target specific cancer cells. Alternatively, Radium-233 is used for palliative therapy of breast and prostate cancers because of its bone seeking properties. Conclusion: Preclinical studies and clinical trials of alpha therapy are discussedfor leukemia, lymphoma, melanoma, glioblastoma multiforme, bone metastases, ovarian cancer, pancreatic cancer and other cancers. PMID:25505750

  4. Cosmetic use of alpha-hydroxy acids.

    PubMed

    Vidt, D G; Bergfeld, W F

    1997-06-01

    Frequent and daily use of cosmetic and skin-care products that contain alpha-hydroxy acids (AHAs) moisturizes the skin and produces smoother, less-wrinkled skin surfaces. The cosmetic products developed as astringents and exfoliants diminish skin scales and remove excess skin oil. New studies suggest that photodamaged skin improves with AHA treatment. PMID:9188214

  5. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  6. Electron Screening Effects on {alpha}-decay

    SciTech Connect

    Musumarra, A.; Bonasera, A.; Del Zoppo, A.; Di Pietro, A.; Figuera, P.; Kimura, S.; Lattuada, M.; Pellegriti, M. G.; Scuderi, V.; Torresi, D.; Farinon, F.; Geissel, H.; Knoebel, R.; Prochazka, A.; Scheidenberger, C.; Nociforo, C.; Behr, K.-H.; Bosch, F.; Boutin, D.; Bruenle, A.

    2009-08-26

    An open problem in Nuclear Astrophysics concerns the understanding of electron-screening effects on nuclear reaction rates at stellar energies. In this framework, we have proposed to investigate the influence of the electron cloud on {alpha}-decay by measuring Q-values and {alpha}-decay half-lives of fully stripped, H-like and He-like ions. These kinds of measurements have been feasible just recently for highly-charged radioactive nuclides by fragmentation of {sup 238}U at relativistic energies at the FRS-ESR facility at GSI. In this way it is possible to produce, efficiently separate and store highly-charged {alpha}-emitters. Candidates for the proposed investigation were carefully selected and will be studied by using the Schottky Mass Spectroscopy technique. In order to establish a solid reference data set, lifetimes and Q{sub {alpha}}-value measurements of the corresponding neutrals have been performed directly at the FRS, by implanting the separated ions into an active Silicon stopper.

  7. E-PERM alpha surface monitor

    SciTech Connect

    Fricke, V.

    1999-12-16

    Innovative Technology Summary Reports are designed to provide potential users with the information they need to quickly determine if a technology would apply to a particular environmental management problem. They are also designed for readers who may recommend that a technology be considered by prospective users. Each report describes a technology, system, or process that has been developed and tested with funding from DOE's Office of Science and Technology (OST). The E-PERM{reg{underscore}sign} Alpha Surface Monitor is an integrating electret ion chamber innovative technology used to measure alpha radiation on surfaces of materials. The technology is best used on surfaces with low contamination levels such as areas with potential for free release, but can also be used in areas with higher levels of contamination. Measurement accuracy and production of the E-PERM {reg{underscore}sign} Alpha Surface Monitor compared favorably with the baseline technology. The innovative technology cost is approximately 28% higher than the baseline with an average unit cost per reading costing %6.04 vs. $4.36; however, the flexibility of the E-PERM{reg{underscore}sign} Alpha Surface Monitor may offer advantages in ALARA, reduction of operator error, waste minimization, and measurement accuracy.

  8. Alpha particles diffusion due to charge changes

    SciTech Connect

    Clauser, C. F. Farengo, R.

    2015-12-15

    Alpha particles diffusion due to charge changes in a magnetized plasma is studied. Analytical calculations and numerical simulations are employed to show that this process can be very important in the pedestal-edge-SOL regions. This is the first study that presents clear evidence of the importance of atomic processes on the diffusion of alpha particles. A simple 1D model that includes inelastic collisions with plasma species, “cold” neutrals, and partially ionized species was employed. The code, which follows the exact particle orbits and includes the effect of inelastic collisions via a Monte Carlo type random process, runs on a graphic processor unit (GPU). The analytical and numerical results show excellent agreement when a uniform background (plasma and cold species) is assumed. The simulations also show that the gradients in the density of the plasma and cold species, which are large and opposite in the edge region, produce an inward flux of alpha particles. Calculations of the alpha particles flux reaching the walls or divertor plates should include these processes.

  9. Cytokine therapeutics: lessons from interferon alpha.

    PubMed Central

    Gutterman, J U

    1994-01-01

    Cytokines are soluble proteins that allow for communication between cells and the external environment. Interferon (IFN) alpha, the first cytokine to be produced by recombinant DNA technology, has emerged as an important regulator of growth and differentiation, affecting cellular communication and signal transduction pathways as well as immunological control. This review focuses on the biological and clinical activities of the cytokine. Originally discovered as an antiviral substance, the efficacy of IFN-alpha in malignant, viral, immunological, angiogenic, inflammatory, and fibrotic diseases suggests a spectrum of interrelated pathophysiologies. The principles learned from in vivo studies will be discussed, particularly hairy cell leukemia, chronic myelogenous leukemia, certain angiogenic diseases, and hepatitis. After the surprising discovery of activity in a rare B-cell neoplasm, IFN-alpha emerged as a prototypic tumor suppressor protein that represses the clinical tumorigenic phenotype in some malignancies capable of differentiation. Regulatory agencies throughout the world have approved IFN-alpha for treatment of 13 malignant and viral disorders. The principles established with this cytokine serve as a paradigm for future development of natural proteins for human disease. PMID:8108387

  10. Alpha 97: Basic Education and Institutional Environments.

    ERIC Educational Resources Information Center

    Hautecoeur, Jean-Paul, Ed.

    This document was published by Alpha, a research program specializing in alternative, experimental approaches to adult basic education. It is an attempt to widen the field and examine the relationship between the micro and macro levels, between the diversity of different practices and the major policy orientations that foster or limit this…

  11. H. cap alpha. in RS CVn binaries

    SciTech Connect

    Bopp, B.W.; Talcott, J.C.

    1980-01-01

    The 1976--78 results of a spectroscopic program to monitor H..cap alpha.. in several RS CVn-type binaries are reported. For six objects well observed over orbital phase, four (HR 4665, HR 5110, sigma Gem, Z Her) show H..cap alpha.. as an absorption feature having a constant ( +- 15%) equivalent width (EW). AR Lac exhibits an absorption profile also, but the EW varies by a factor of three due to partial filling by emission. This variation is sporadic and not phase dependent. The H..cap alpha.. feature in HK Lac shows the most extreme variation: normally seen as an absorption feature with variable EW, it has been observed as a pure emission feature on three spectrograms, showing a blueshift with respect to the photosphere of approx.50--100 km sec/sup -1/. On a single occasion HK Lac showed double H..cap alpha.. emission with a separation of the peaks of approx.300 km sec/sup -1/. These high velocity features are interpreted in terms of prominence-like structure in the atmosphere of the active star.

  12. Method of making nanocrystalline alpha alumina

    DOEpatents

    Siegel, Richard W.; Hahn, Horst; Eastman, Jeffrey A.

    1992-01-01

    Method of making selected phases of nanocrystalline ceramic materials. Various methods of controlling the production of nanocrystalline alpha alumina and titanium oxygen phases are described. Control of the gas atmosphere and use of particular oxidation treatments give rise to the ability to control the particular phases provided in the aluminum/oxygen and titanium/oxygen system.

  13. Alpha and Beta at the B Factories

    SciTech Connect

    Finocchiaro, Giuseppe; /Frascati

    2007-10-15

    We review recent experimental results on time-dependent CP asymmetries in the B system from the BABAR and Belle experiments. Measurements of the {alpha} and {beta} angles of the Unitarity Triangle of the CKM matrix are discussed. These measurements constitute stringent tests of the Standard Model, and are also used to search for new physics.

  14. Coefficient Alpha and Reliability of Scale Scores

    ERIC Educational Resources Information Center

    Almehrizi, Rashid S.

    2013-01-01

    The majority of large-scale assessments develop various score scales that are either linear or nonlinear transformations of raw scores for better interpretations and uses of assessment results. The current formula for coefficient alpha (a; the commonly used reliability coefficient) only provides internal consistency reliability estimates of raw…

  15. MCNP S(. alpha. beta. ) detector scheme

    SciTech Connect

    Hendricks, J.S.; Prael, R.E.

    1990-10-01

    An approximate method to allow S({alpha},{Beta}) thermal collision contributions to point detectors and DXTRAN by Prael has been implemented in MCNP4. The method is described and test results are presented, including some results that indicate inadequacies in the NJOY processing of the nuclear data. 9 refs., 53 figs., 6 tabs.

  16. The Ups and Downs of Alpha Centauri

    NASA Astrophysics Data System (ADS)

    Ayres, Thomas R.

    2013-07-01

    The nearby Alpha Centauri triple system has two solar-type stars in a relatively close orbit (20 au separation), and a dim red dwarf companion -- Proxima -- about 10,000 au away, on the Sun-ward side of the group. The heaviest star -- Alpha Cen A -- is a close twin of the Sun. Its slightly less massive companion -- Alpha Cen B -- is a K-type dwarf, and is the closest star thought to host an exoplanet (Earth-sized, but in a much tighter orbit). The close pair has been scrutinized for more than a decade in X-rays by XMM and Chandra, on a semiannual basis since 2003 and 2005, respectively. However, in recent years only Chandra has been able to cleanly separate the pair, which are approaching closest separation on the sky (only a few arcseconds) in their 80-year orbit. For the past 3 years, the HST STIS spectrograph has joined the crowd, also capturing FUV snapshots of the pair every six months. The Alpha Cen stars provide an important complement to long-term studies of the Sun at high energies. The K-star has displayed a clear 8-year cycle in recent years, while the G-star remains mired in a Maunder-like minimum.

  17. Alpha particles diffusion due to charge changes

    NASA Astrophysics Data System (ADS)

    Clauser, C. F.; Farengo, R.

    2015-12-01

    Alpha particles diffusion due to charge changes in a magnetized plasma is studied. Analytical calculations and numerical simulations are employed to show that this process can be very important in the pedestal-edge-SOL regions. This is the first study that presents clear evidence of the importance of atomic processes on the diffusion of alpha particles. A simple 1D model that includes inelastic collisions with plasma species, "cold" neutrals, and partially ionized species was employed. The code, which follows the exact particle orbits and includes the effect of inelastic collisions via a Monte Carlo type random process, runs on a graphic processor unit (GPU). The analytical and numerical results show excellent agreement when a uniform background (plasma and cold species) is assumed. The simulations also show that the gradients in the density of the plasma and cold species, which are large and opposite in the edge region, produce an inward flux of alpha particles. Calculations of the alpha particles flux reaching the walls or divertor plates should include these processes.

  18. Human alpha 2-adrenergic receptor subtype distribution: widespread and subtype-selective expression of alpha 2C10, alpha 2C4, and alpha 2C2 mRNA in multiple tissues.

    PubMed

    Eason, M G; Liggett, S B

    1993-07-01

    At present, molecular cloning and pharmacological studies have delineated three human alpha 2-adrenergic receptor (alpha 2AR) subtypes, alpha 2C10, alpha 2C4, and alpha 2C2. Assignment of the alpha 2AR subtypes to specific functions has been limited by an unclear definition of tissue alpha 2AR expression outside of the central nervous system. It has been suggested that alpha 2C4 expression is confined to the brain, that alpha 2C2 expression is only in the liver and kidney, and that there is nearly ubiquitous expression of alpha 2C10. However, this is based on studies of a limited number of rat tissues or on studies using non-species-specific approaches. Therefore, to define alpha 2C10, alpha 2C4, and alpha 2C2 tissue expression, we used reverse transcription of total RNA isolated from 20 human tissues, followed by amplification of alpha 2AR cDNA using the polymerase chain reaction. This technique provided two advantages: high sensitivity and, with the use of subtype-specific oligonucleotide primers and probes, differentiation between the alpha 2AR subtypes. The tissues studied were aorta, vena cava, heart (epicardium and endocardium), lung, skeletal muscle, liver, pancreas (head and tail), fat (perinephric and subcutaneous), kidney (cortex and medulla), prostate, stomach, ileum, jejunum, colon, adrenal gland, and spleen. We found that the majority of these tissues expressed alpha 2C10, with the exceptions being the head of the pancreas, subcutaneous fat, colon, and spleen. In marked distinction to other studies, however, we found a prolific expression of the alpha 2C4 and alpha 2C2 subtypes. Expression of alpha 2C4 was found in all tissues with the exception of liver, fat, stomach, and colon, and a virtually ubiquitous expression of alpha 2C2 was found, with the exception of epicardium. Of all tissues studied, only colon and subcutaneous fat expressed a single alpha 2AR subtype, which was alpha 2C2. Thus, the alpha 2AR subtypes do not have a confined expression but

  19. Human alpha 2-adrenergic receptor subtype distribution: widespread and subtype-selective expression of alpha 2C10, alpha 2C4, and alpha 2C2 mRNA in multiple tissues.

    PubMed

    Eason, M G; Liggett, S B

    1993-07-01

    At present, molecular cloning and pharmacological studies have delineated three human alpha 2-adrenergic receptor (alpha 2AR) subtypes, alpha 2C10, alpha 2C4, and alpha 2C2. Assignment of the alpha 2AR subtypes to specific functions has been limited by an unclear definition of tissue alpha 2AR expression outside of the central nervous system. It has been suggested that alpha 2C4 expression is confined to the brain, that alpha 2C2 expression is only in the liver and kidney, and that there is nearly ubiquitous expression of alpha 2C10. However, this is based on studies of a limited number of rat tissues or on studies using non-species-specific approaches. Therefore, to define alpha 2C10, alpha 2C4, and alpha 2C2 tissue expression, we used reverse transcription of total RNA isolated from 20 human tissues, followed by amplification of alpha 2AR cDNA using the polymerase chain reaction. This technique provided two advantages: high sensitivity and, with the use of subtype-specific oligonucleotide primers and probes, differentiation between the alpha 2AR subtypes. The tissues studied were aorta, vena cava, heart (epicardium and endocardium), lung, skeletal muscle, liver, pancreas (head and tail), fat (perinephric and subcutaneous), kidney (cortex and medulla), prostate, stomach, ileum, jejunum, colon, adrenal gland, and spleen. We found that the majority of these tissues expressed alpha 2C10, with the exceptions being the head of the pancreas, subcutaneous fat, colon, and spleen. In marked distinction to other studies, however, we found a prolific expression of the alpha 2C4 and alpha 2C2 subtypes. Expression of alpha 2C4 was found in all tissues with the exception of liver, fat, stomach, and colon, and a virtually ubiquitous expression of alpha 2C2 was found, with the exception of epicardium. Of all tissues studied, only colon and subcutaneous fat expressed a single alpha 2AR subtype, which was alpha 2C2. Thus, the alpha 2AR subtypes do not have a confined expression but

  20. Alpha decay of {sup 181}Pb

    SciTech Connect

    Davids, C.N.; Henderson, D.J.; Hermann, R.

    1995-08-01

    The {alpha}-decay energy of {sup 181}Pb was measured as 7211(10) keV and 7044(15). In the first study the isotope was produced in {sup 90}Zr bombardments of {sup 94}Mo and, after traversing a velocity filter, implanted in a position-sensitive Si detector; no half life for {sup 181}Pb was reported. In the second study the isotope was produced in {sup 40}Ca bombardments of {sup 144}Sm and transported to a position in front of a Si(Au) surface barrier detector with a fast He-gas-jet capillary system; an estimate of 50 ms was determined for the {sup 181}Pb half life. Recently we investigated {sup 181}Pb {alpha} decay at ATLAS as part of a survey experiment in which a l-pnA beam of 400-MeV {sup 92}Mo was used to irradiate targets of {sup 89}Y, {sup 90,92,94}Zr, and {sup 92}Mo to examine yields for one- and two-nucleon evaporation products from symmetric cold-fusion reactions. Recoiling nuclei of interest were passed through the Fragment Mass Analyzer and implanted in a double-sided silicon strip detector for {alpha}-particle assay. With the {sup 90}Zr target we observed a group at 7065(20) keV which was correlated with A = 181 recoils and had a half life of 45(20) ms. Our new results for {sup 181}Pb therefore agreed with those of the second study. There was no indication in the {sup 90}Zr + {sup 92}Mo data of the 7211(10)-keV {alpha} particles seen by Keller et al. The interested reader is referred to the 1993 atomic mass evaluation wherein the input {alpha}-decay energies and resultant masses of the light Pb isotopes (including {sup 181}Pb) are discussed.

  1. Alpha-particle emission probabilities of ²³⁶U obtained by alpha spectrometry.

    PubMed

    Marouli, M; Pommé, S; Jobbágy, V; Van Ammel, R; Paepen, J; Stroh, H; Benedik, L

    2014-05-01

    High-resolution alpha-particle spectrometry was performed with an ion-implanted silicon detector in vacuum on a homogeneously electrodeposited (236)U source. The source was measured at different solid angles subtended by the detector, varying between 0.8% and 2.4% of 4π sr, to assess the influence of coincidental detection of alpha-particles and conversion electrons on the measured alpha-particle emission probabilities. Additional measurements were performed using a bending magnet to eliminate conversion electrons, the results of which coincide with normal measurements extrapolated to an infinitely small solid angle. The measured alpha emission probabilities for the three main peaks - 74.20 (5)%, 25.68 (5)% and 0.123 (5)%, respectively - are consistent with literature data, but their precision has been improved by at least one order of magnitude in this work.

  2. Mechanism of release of active alpha subunit from dimeric alpha beta avian myeloblastosis virus DNA polymerase.

    PubMed Central

    Papas, T S; Marciani, D J; Samuel, K; Chirikjian, J G

    1976-01-01

    Storage of the dimeric (alphabeta) form of avian myeloblastosis virus (AMV) DNA polymerase in glycerol resulted in the release of the smaller alpha subunit, as detected by glycerol gradient sedimentation. Analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of enzyme stored in glycerol showed the concomitant appearance of several polypeptides and a lowering in the level of both beta and alpha components. This reduction appears to be the result of cleavages introduced by traces of hydrolytic activity present in glycerol samples. An enhancement of alpha subunit released, as detected by activity profile, was also achieved upon direct but limited exposure of purified avian myeloblastosis virus DNA polymerase to carboxymethyl-cellulose-bound trypsin matrix. Electrophoretic analysis of digested enzyme revealed a progressive fragmentation, with simultaneous increase in the alpha subunit and decrease in the beta subunit. PMID:58080

  3. Degradation of the potato glycoalkaloids--alpha-solanine and alpha-chaconine in groundwater.

    PubMed

    Jensen, Pia H; Jacobsen, Ole S; Henriksen, Trine; Strobel, Bjarne W; Hansen, Hans Christian B

    2009-06-01

    The potato glycoalkaloids alpha-chaconine and alpha-solanine are produced in high amounts in potato plants from where release to soil takes place. Degradation of the compounds in groundwater was investigated, as their fate in the terrestrial environment is unknown. Abiotic and microbial degradation were followed in groundwater sampled from below a potato field and spiked with the glycoalkaloids (115 nmol/l). Degradation was primarily microbial and the glycoalkaloids were degraded within 21-42 days. The metabolites beta(1)-solanine, gamma-solanine, and solanidine were formed from alpha-solanine, while beta-chaconine, gamma-chaconine and solanidine were detected from alpha-chaconine. Thus, indigenous groundwater microorganisms are capable of degrading the glycoalkaloids.

  4. Interaction of alphaVbeta3 and alphaVbeta6 integrins with human parechovirus 1.

    PubMed

    Seitsonen, Jani; Susi, Petri; Heikkilä, Outi; Sinkovits, Robert S; Laurinmäki, Pasi; Hyypiä, Timo; Butcher, Sarah J

    2010-09-01

    Human parechovirus (HPEV) infections are very common in early childhood and can be severe in neonates. It has been shown that integrins are important for cellular infectivity of HPEV1 through experiments using peptide blocking assays and function-blocking antibodies to alpha(V) integrins. The interaction of HPEV1 with alpha(V) integrins is presumably mediated by a C-terminal RGD motif in the capsid protein VP1. We characterized the binding of integrins alpha(V)beta(3) and alpha(V)beta(6) to HPEV1 by biochemical and structural studies. We showed that although HPEV1 bound efficiently to immobilized integrins, alpha(V)beta(6) bound more efficiently than alpha(V)beta(3) to immobilized HPEV1. Moreover, soluble alpha(V)beta(6), but not alpha(V)beta(3), blocked HPEV1 cellular infectivity, indicating that it is a high-affinity receptor for HPEV1. We also showed that HPEV1 binding to integrins in vitro could be partially blocked by RGD peptides. Using electron cryo-microscopy and image reconstruction, we showed that HPEV1 has the typical T=1 (pseudo T=3) organization of a picornavirus. Complexes of HPEV1 and integrins indicated that both integrin footprints reside between the 5-fold and 3-fold symmetry axes. This result does not match the RGD position predicted from the coxsackievirus A9 X-ray structure but is consistent with the predicted location of this motif in the shorter C terminus found in HPEV1. This first structural characterization of a parechovirus indicates that the differences in receptor binding are due to the amino acid differences in the integrins rather than to significantly different viral footprints.

  5. Kinetics of chaperoning of dithiothreitol-denatured alpha-lactalbumin by alpha-crystallin.

    PubMed

    Bettelheim, Frederick A

    2002-06-18

    Molecular chaperones prevent the aggregation of partially folded or misfolded forms of protein. alpha-Crystallin performs such a function in the ocular lens. Dynamic light scattering (DLS) measurements were performed to gain insight into the kinetics and mechanism of alpha-crystallin chaperoning. Experiments were conducted as a function of alpha-lactalbumin concentration as well as the alpha-crystallin/alpha-lactalbumin ratio over a 24 h period. In the particle distribution patterns the lactalbumin concentration was partitioned into three compartments: (a) monomeric free lactalbumin; (b) lactalbumin in the chaperoning complex; and (c) lactalbumin aggregates. DLS intensities were converted to molar concentrations by assuming a model of a spherical chaperoning complex. In the model, alpha-crystallin is the central core and alpha-lactalbumin molecules occupy a ring surrounding the core. The kinetics of chaperoning was studied by proposing a simple scheme with four rate constants. The reversible reaction of the formation of the chaperoning complex is characterized by rate constants k(1) and k(2). The rate constants k(3) and k(4) govern the irreversible aggregation of lactalbumin: the former from the free monomeric lactalbumin pool and the latter describing the aggregation of the denatured lactalbumin released from the chaperoning complex. The rate constants, k(3) and k(4) are four magnitudes larger than k(1) and k(2). The equilibrium constant of chaperoning complex formation lies in favor of the reactants. k(4) is somewhat faster than k(3) and it is three times faster than k(s) governing the self-aggregation of lactalbumin in the absence of alpha-crystallin.

  6. Peroxisome proliferator-activated receptor {alpha}-independent peroxisome proliferation

    SciTech Connect

    Zhang Xiuguo; Tanaka, Naoki . E-mail: naopi@hsp.md.shinshu-u.ac.jp; Nakajima, Takero; Kamijo, Yuji; Gonzalez, Frank J.; Aoyama, Toshifumi

    2006-08-11

    Hepatic peroxisome proliferation, increases in the numerical and volume density of peroxisomes, is believed to be closely related to peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) activation; however, it remains unknown whether peroxisome proliferation depends absolutely on this activation. To verify occurrence of PPAR{alpha}-independent peroxisome proliferation, fenofibrate treatment was used, which was expected to significantly enhance PPAR{alpha} dependence in the assay system. Surprisingly, a novel type of PPAR{alpha}-independent peroxisome proliferation and enlargement was uncovered in PPAR{alpha}-null mice. The increased expression of dynamin-like protein 1, but not peroxisome biogenesis factor 11{alpha}, might be associated with the PPAR{alpha}-independent peroxisome proliferation at least in part.

  7. Genetics Home Reference: alpha-methylacyl-CoA racemase deficiency

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions AMACR deficiency alpha-methylacyl-CoA racemase deficiency Enable Javascript to view ... boxes. Download PDF Open All Close All Description Alpha-methylacyl-CoA racemase (AMACR) deficiency is a disorder ...

  8. Antibody-mediated reduction of {alpha}-ketoamides

    DOEpatents

    Schultz, P.G.; Gallop, M.A.

    1998-06-09

    Monoclonal antibodies raised against a 4-nitrophenyl phosphonate hapten catalyze the stereospecific reduction of an {alpha}-ketoamide to the corresponding {alpha}-hydroxyamide in the presence of an appropriate reducing agent.

  9. Who Is at Risk for Alpha-1 Antitrypsin Deficiency?

    MedlinePlus

    ... on Twitter. Who Is at Risk for Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency occurs in all ethnic groups. ... it doesn't mean that you'll develop one of the diseases related to the condition. Some ...

  10. Antibody-mediated reduction of .alpha.-ketoamides

    DOEpatents

    Schultz, Peter G.; Gallop, Mark A.

    1998-01-01

    Monoclonal antibodies raised against a 4-nitrophenyl phosphonate hapten catalyze the stereospecific reduction of an .alpha.-ketoamide to the corresponding .alpha.-hydroxyamide in the presence of an appropriate reducing agent.

  11. An assay for intermolecular exchange of alpha crystallin

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    An affinity column of alpha crystallin linked to cyanogen bromide-activated Sepharose was developed to study the exchange of alpha subunits. Alpha crystallin bound to the Sepharose-alpha complex was dissociated with 8 mol/l urea, followed by quantitation using high-performance reverse-phase liquid chromatography. The time course of binding at 37 degrees C showed a hyperbolic binding pattern reaching equilibrium between 6-18 hr. Under these conditions, binding of beta and gamma crystallins to the same matrix was less than 10% of the alpha values, as was binding of alpha to glycine-coupled Sepharose. This assay was used to demonstrate changes in the subunit exchange of alpha crystallins present in high molecular weight versus lower molecular weight aggregates of the human lens. These results show that this binding procedure was a specific reproducible assay that might be used to study intermolecular interactions of the alpha crystallins.

  12. Synthesis of 15 alpha-hydroxyestrogen 15-N-acetylglucosaminides.

    PubMed

    Suzuki, E; Namba, S; Kurihara, H; Goto, J; Matsuki, Y; Nambara, T

    1995-03-01

    The synthesis of 15-N-acetylglucosaminides of 15 alpha-hydroxyesterone, 15 alpha-hydroxyestradiol, and 15 alpha-hydroxyestriol (estetrol) is described. The latter two were prepared by condensation of 2-acetamido-1 alpha-chloro-1,2-dideoxy-3,4,6-trio-O-acetyl-D-glucopyranose with appropriately protected 15 alpha-hydroxyestrogens by the Koenigs-Knorr reaction employing cadmium carbonate as a catalyst. Subsequent removal of protecting groups with methanolic potassium hydroxide provided the desired conjugates. 15 alpha-Hydroxyestrone 15-N-acetylglucosaminide was synthesized from the corresponding 15 alpha-hydroxyestradiol derivative by Jones oxidation followed by brief alkaline hydrolysis. These conjugates underwent enzymatic hydrolysis with beta-N-acetylglucosaminidase from Jack beans to produce 15 alpha-hydroxyestrogens. PMID:7792832

  13. Uptake and bioconversion of alpha-tocopheryl acetate to alpha-tocopherol in skin of hairless mice.

    PubMed

    Norkus, E P; Bryce, G F; Bhagavan, H N

    1993-04-01

    The photoprotective effect of topically applied alpha-tocopheryl acetate (vitamin E acetate), a stable derivative of alpha-tocopherol (vitamin E), and its possible bioconversion to the active antioxidant species (alpha-tocopherol) was examined in skin tissue of female hairless mice (HRS/J) exposed to UV-B irradiation. Our results indicate that topically applied alpha-tocopheryl acetate is absorbed into and retained by skin tissue. Furthermore, skin tissue from UV-B-irradiated animals that received daily topical alpha-tocopheryl acetate treatments contained significantly higher levels (P < 0.001) of alpha-tocopheryl acetate than non-UV-B-irradiated mice that received identical daily topical alpha-tocopheryl acetate treatments. Finally, free alpha-tocopherol levels in skin also were significantly increased (P < 0.001) by topical applications of alpha-tocopheryl acetate and skin levels of free alpha-tocopherol were significantly greater (P < 0.001) in UV-B-irradiated animals that received daily topical alpha-tocopheryl acetate treatments than in non-UV-B-irradiated animals. These results suggest that UV-B irradiation enhances both the absorption of alpha-tocopheryl acetate and its bioconversion to free alpha-tocopherol.

  14. Removal of alpha-Gal epitopes from porcine aortic valve and pericardium using recombinant human alpha galactosidase A.

    PubMed

    Park, Seongsik; Kim, Woong-Han; Choi, Sun-Young; Kim, Yong-Jin

    2009-12-01

    It has been reported that the immune response due to alpha-Gal epitopes is an important factor in tissue valve failure. The elimination of the interaction between the natural anti-Gal antibodies and alpha-gal epitopes on the xenografts is a prerequisite to the success of xenografts in humans. Previously, we reported that the green coffee bean alpha-galactosidase could remove all alpha-Gal epitopes from cell surface of porcine aortic valve and pericardial tissue, but it has limitations on cost effectiveness. In this study we wanted to know whether the recently produced recombinant human alpha-galactosidase A has the same effective enzymatic activity as green coffee bean alpha-galactosidase in removing alpha-Gal epitopes from the same tissues. After treating fresh porcine aortic valve and pericardial tissue with recombinant alpha-galactosidase A, each sample was stained with Griffonia simplicifolia type I isolectin B4 indirect immunoperoxidase avidin-biotin technique. We then examined whether the alpha-Gal epitopes were reduced or abolished in each consecutive concentration of recombinant alpha-galactosidase A by comparing the degree of the Griffonia simplicifolia isolectin B4 staining. As a result, the recombinant alpha-galactosidase A could remove cell surface alpha-Gals on porcine aortic valve and pericardial tissue as effectively as green coffee bean alpha-galactosidase.

  15. Structural and electrochemical studies of alpha manganese dioxide ({alpha}-MnO{sub 2})

    SciTech Connect

    Johnson, C.S.; Dees, D.W.; Mansuetto, M.F.; Thackeray, M.M.; Vissers, D.R.; Argyriou, D.; Loong, C.-K.; Christensen, L.

    1996-08-01

    The structural and electrochemical properties of alpha-MnO[sub 2], prepared by acid digestion of Mn[sub 2]O[sub 3], and its lithiated derivatives xLi[sub 2] O . MnO[sub 2] (where x is greater than or equal to zero and less than or equal to 0.25) have been investigated as insertion compounds in the search for new and viable cathode materials for rechargeable 3-V batteries. The alpha-MnO[sub 2] product fabricated by this technique contains water within the large (2x2) channels of the structure; the water can be removed from the alpha-MnO[sub 2] framework without degradation of the structure, and then at least partially replaced by Li[sub 2]O. The lithia-doped alpha-MnO[sub 2] electrodes, described generically as xLi[sub 2]O . Mno[sub 2], stabilize the structure and provide higher capacities on cycling than the parent material. The structures of these alpha- MnO[sub 2]-type electrode materials are described. and electrochemical data are presented for both liquid electrolyte and polymer electrolyte Li/alpha-MnO[sub 2] and Li/xLi[sub 2]O . MnO[sub 2] cells.

  16. Inhibition of microsomal lipid peroxidation by alpha-tocopherol and alpha-tocopherol acetate.

    PubMed

    Gonzalez Flecha, B S; Repetto, M; Evelson, P; Boveris, A

    1991-08-01

    1. The antioxidant effects of alpha-tocopherol and alpha-tocopherol acetate were assayed for the (a) oxygen uptake, (b) chemiluminescence and (c) malondialdehyde formation, of tert-butyl hydroperoxide-supplemented rat liver microsomes. 2. Oxygen uptake was inhibited 60% by both alpha-tocopherol and alpha-tocopherol acetate with the half-maximal effect at 5 nmol tocopherol/mg protein. Chemiluminescence and malondialdehyde formation were equally inhibited 35% by both tocopherols with half-maximal effects at 2 nmol tocopherol/mg protein. 3. The rate of O2 uptake by tocopherol-supplemented microsomes was dependent on O2 concentration. A 60% inhibition by 5 nmol tocopherol/mg protein at 0.2 mM O2 is decreased to 5% inhibition at 0.6 mM O2. 4. The inhibition of O2 uptake, chemiluminescence and malondialdehyde formation indicate that both alpha-tocopherol and alpha-tocopherol acetate have similar effects as free radical traps in the hydrophobic domain of biomembranes. The different inhibition observed at different O2 concentrations indicate competition between vitamin E and O2 by unoxygenated lipid radicals.

  17. Nucleotide dependent differences between the {alpha}-skeletal and {alpha}-cardiac actin isoforms

    SciTech Connect

    Orban, Jozsef; Lorinczy, Denes; Nyitrai, Miklos; Hild, Gabor

    2008-04-11

    The thermodynamic properties of the actin filaments prepared from cardiomyocytes were investigated with differential scanning calorimetry. This method could distinguish between the {alpha}-cardiac and {alpha}-skeletal components of the actin filaments polymerised from ADP-actin monomers by their different melting temperatures (T{sub m}). Similar separation was not possible with filaments polymerised from ATP-actin monomers. Further analyses revealed that the activation energy (E{sub act}) was greater for filaments of {alpha}-skeletal actin than for {alpha}-cardiac actin monomers when the filaments were polymerised from ADP-actin monomers. These results showed that the {alpha}-cardiac actin filaments were thermodynamically less stable than the filaments of {alpha}-skeletal actin and their difference was nucleotide dependent. Based on these results and considering previous observations it was concluded that the existence of two actin isoforms and their nucleotide dependent conformational differences are part of the tuning regulatory mechanism by which the cardiac muscle cells can maintain their biological function under pathological conditions.

  18. Effects of alpha-proton drift velocity on alpha particle firehose instability

    NASA Astrophysics Data System (ADS)

    Seough, Jungjoon; Nariyuki, Yasuhiro

    2016-08-01

    In situ measurements have shown that the less-abundant alpha particles are characterized by temperature anisotropy which could drive the anisotropy-driven kinetic instabilities in the solar wind. In the collisionless plasma, the differential alpha-proton flow velocity V d = V α - V p usually has a non-zero value of the order of the local Alfvén velocity. The presence of such differential flow may affect the properties of dispersion relations for anisotropy-driven instabilities. Based upon linear Vlasov dispersion theory in a homogeneous plasma, the present study investigates the effects of the alpha-proton drift velocity on the parallel and oblique firehose instabilities driven by an excessive parallel temperature anisotropy of alpha particles, where the parallel and oblique represent directions of fluctuation propagation relative to the background magnetic field. It is found that for oblique firehose mode as well as parallel mode, the dispersion properties are affected by the presence of the alpha-proton drift velocity, which in turn results in the increase of the maximum growth rates as Vd increases and consequently leads to the modification of the marginal stability conditions in the parameter space ( β ∥ α , T ⊥ α / T ∥ α ) . We discuss the relevance of our results to the measured temperature anisotropy of alpha particles in the solar wind context.

  19. Chaperone-like activities of {alpha}-synuclein: {alpha}-Synuclein assists enzyme activities of esterases

    SciTech Connect

    Ahn, Misun; Kim, SeungBum; Kang, Mira; Ryu, Yeonwoo . E-mail: ywryu@ajou.ac.kr; Doohun Kim, T. . E-mail: doohunkim@ajou.ac.kr

    2006-08-11

    {alpha}-Synuclein, a major constituent of Lewy bodies (LBs), has been implicated to play a critical role in the pathogenesis of Parkinson's disease (PD), although the physiological function of {alpha}-synuclein has not yet been known. Here we have shown that {alpha}-synuclein, which has no well-defined secondary or tertiary structure, can protect the enzyme activity of microbial esterases against stress conditions such as heat, pH, and organic solvents. In particular, the flexibility of {alpha}-synuclein and its C-terminal region seems to be important for complex formation, but the structural integrity of the C-terminal region may not be required for stabilization of enzyme activity. In addition, atomic force microscopy (AFM) and in vivo enzyme assays showed highly specific interactions of esterases with {alpha}-synuclein. Our results indicate that {alpha}-synuclein not only protects the enzyme activity of microbial esterases in vitro, but also can stabilize the active conformation of microbial esterases in vivo.

  20. Alternative nonallelic deletion is constitutive of ruminant alpha(s1)-casein.

    PubMed

    Ferranti, P; Lilla, S; Chianese, L; Addeo, F

    1999-07-01

    Multiple forms of alpha(s1)-casein were identified in the four major ruminant species by structural characterization of the protein fraction. While alpha(s1)-casein phenotypes were constituted by a mixture of at least seven molecular forms in ovine and caprine species, there were only two forms in bovine and water buffalo species. In ovine and caprine forms the main component corresponded to the 199-residue-long form, and the deleted proteins differed from the complete one by the absence of peptides 141-148, 110-117, or Gln78, or a combination of such deletions. The deleted segments corresponded to the sequence regions encoded by exons 13 and 16, and by the first triplet of exon 11 (CAG), suggesting that the occurrence of the short protein forms is due to alternative skipping, as previously demonstrated for some caprine and ovine phenotypes. The alternative deletion of Gln78 in alpha(s1)-casein, the only form common to the milk of all the species examined and located in a sequence region joining the polar phosphorylation cluster and the hydrophobic C-terminal domain of the protein, may play a functional role in the stabilization of the milk micelle structure.

  1. Possible Stimulation of Nuclear alpha Decay by Superfluid Helium

    SciTech Connect

    Barabanov, A. L.

    2009-08-28

    It is suggested that superfluid helium (condensate of {sup 4}He atoms) may stimulate nuclear alpha decay in a situation when an alpha emitter moves through superfluid helium with fine-tuned velocity, so that the backward-emitted alpha particle is at rest in the laboratory frame. It is shown that the probability of stimulated alpha decay in this case may be sizable enough to be detected.

  2. Possible stimulation of nuclear alpha decay by superfluid helium.

    PubMed

    Barabanov, A L

    2009-08-28

    It is suggested that superfluid helium (condensate of (4)He atoms) may stimulate nuclear alpha decay in a situation when an alpha emitter moves through superfluid helium with fine-tuned velocity, so that the backward-emitted alpha particle is at rest in the laboratory frame. It is shown that the probability of stimulated alpha decay in this case may be sizable enough to be detected.

  3. Complex effects of IL1A polymorphism and calpain inhibitors on interleukin 1 alpha (IL-1 alpha) mRNA levels and secretion of IL-1 alpha protein.

    PubMed

    Lee, S; Temple, S; Roberts, S; Price, P

    2008-07-01

    Alleles of IL1A-889(C>T) and IL1A+4845(G>T) are in linkage disequilibrium. Interleukin 1alpha (IL-1alpha) is produced as a precursor protein and cleaved at positions 117-118 by calpain, generating a mature protein for export. IL1A+4845 affects amino acids expressed at position 114 and hence may modulate calpain-mediated cleavage. We sought evidence for this mechanism in intact cells. Blood leukocytes from heterozygous donors released more IL-1alpha protein than cells from IL1A(1,1) donors, while release from IL1A(2,2) cells was variable. Genotype did not affect levels of IL-1alpha mRNA, so differential cleavage of the precursor is a feasible mechanism. However, genotype also had no effect on inhibition of IL-1alpha release by pretreatment with calpain inhibitors, and calpain inhibitors reduced IL-1alpha and tumor necrosis factor alpha mRNA levels. Hence, calpain inhibitors probably affect inhibition of signal transduction pathway rather than cleavage of IL-1alpha protein. As ratios of mu-calpain/calpastatin were lowest in heterozygous donors, genetically determined IL-1alpha levels may modulate transcription of calpain and calpastatin. This could reduce the impact of IL1A genotype on IL-1alpha secretion and amplify individual variation in levels generated in culture.

  4. Nicotine inhibits Fc epsilon RI-induced cysteinyl leukotrienes and cytokine production without affecting mast cell degranulation through alpha 7/alpha 9/alpha 10-nicotinic receptors.

    PubMed

    Mishra, Neerad C; Rir-sima-ah, Jules; Boyd, R Thomas; Singh, Shashi P; Gundavarapu, Sravanthi; Langley, Raymond J; Razani-Boroujerdi, Seddigheh; Sopori, Mohan L

    2010-07-01

    Smokers are less likely to develop some inflammatory and allergic diseases. In Brown-Norway rats, nicotine inhibits several parameters of allergic asthma, including the production of Th2 cytokines and the cysteinyl leukotriene LTC(4). Cysteinyl leukotrienes are primarily produced by mast cells, and these cells play a central role in allergic asthma. Mast cells express a high-affinity receptor for IgE (FcepsilonRI). Following its cross-linking, cells degranulate and release preformed inflammatory mediators (early phase) and synthesize and secrete cytokines/chemokines and leukotrienes (late phase). The mechanism by which nicotine modulates mast cell activation is unclear. Using alpha-bungarotoxin binding and quantitative PCR and PCR product sequencing, we showed that the rat mast/basophil cell line RBL-2H3 expresses nicotinic acetylcholine receptors (nAChRs) alpha7, alpha9, and alpha10; exposure to exceedingly low concentrations of nicotine (nanomolar), but not the biologically inactive metabolite cotinine, for > or = 8 h suppressed the late phase (leukotriene/cytokine production) but not degranulation (histamine and hexosaminidase release). These effects were unrelated to those of nicotine on intracellular free calcium concentration but were causally associated with the inhibition of cytosolic phospholipase A(2) activity and the PI3K/ERK/NF-kappaB pathway, including phosphorylation of Akt and ERK and nuclear translocation of NF-kappaB. The suppressive effect of nicotine on the late-phase response was blocked by the alpha7/alpha9-nAChR antagonists methyllycaconitine and alpha-bungarotoxin, as well as by small interfering RNA knockdown of alpha7-, alpha9-, or alpha10-nAChRs, suggesting a functional interaction between alpha7-, alpha9-, and alpha10-nAChRs that might explain the response of RBL cells to nanomolar concentrations of nicotine. This "hybrid" receptor might serve as a target for novel antiallergic/antiasthmatic therapies.

  5. Bioavailability of alpha-tocopherol fed with retinol and relative bioavailability of D-alpha-tocopherol or DL-alpha-tocopherol acetate.

    PubMed

    Eicher, S D; Morrill, J L; Velazco, J

    1997-02-01

    Two experiments were conducted to examine the effects of the form of alpha-tocopherol or interactions of alpha-tocopherol with vitamin A on its bioavailability. In Experiment 1, Holstein steers were fed a diet that was low in vitamins A and E for 1 mo; then, steers were blocked by body weight (X = 97.5 kg) and assigned randomly to one of four oral treatments: 1) no added vitamins, 2) 442 mg of retinyl acetate, 3) 1342 mg of D-alpha-tocopherol, or 4) 442 mg of retinyl acetate and 1342 mg of D-alpha-tocopherol. Each treatment was given as a pulse dose. Blood was sampled over a 36-h period. Concentrations of plasma retinyl palmitate peaked at 2 to 6 h postsupplementation for all calves and then peaked again at 22 to 28 h for calves receiving vitamin supplements. Concentrations of plasma alpha-tocopherol peaked earliest with D-alpha-tocopherol supplementation alone at 12 to 20 h after supplementation, but simultaneous supplementation with retinyl acetate resulted in lower plasma alpha-tocopherol concentrations. Plasma retinyl palmitate decreased during peak alpha-tocopherol concentrations. In Experiment 2, blood and tissue were analyzed after a single gastric tube administration of a powder (DL-alpha-tocopheryl acetate) or a liquid (D-alpha-tocopherol) form of vitamin E to Holstein calves. Plasma and kidney concentrations of alpha-tocopherol were higher when calves were fed D-alpha-tocopherol than when calves were fed the DL-alpha-tocopherol acetate form. Concentrations in the liver, spleen, adipose tissue, heart, muscle, cellular blood fraction, and gut did not differ between the two forms.

  6. Nicotine enhances expression of the alpha 3, alpha 4, alpha 5, and alpha 7 nicotinic receptors modulating calcium metabolism and regulating adhesion and motility of respiratory epithelial cells.

    PubMed

    Zia, S; Ndoye, A; Nguyen, V T; Grando, S A

    1997-09-01

    The purpose of this study was to investigate the possibility of direct toxic effects of nicotine (Nic) on human bronchial epithelial cells (BEC) suggested by our previous findings of functional nicotinic acetylcholine receptors (nAChRs) in the epithelial cells lining mucocutaneous membranes. We now demonstrate for the first time that human and murine BEC both in vivo and in vitro express functional nAChRs, and that classic alpha 3, alpha 4, alpha 5 and alpha 7 subunits can contribute to formation of these acetylcholine-gated ion channels. In human bronchial and mouse lung tissues, and in cultures of human BEC, the nAChRs were visualized by subunit-specific antibodies on the cell membranes, particularly at the sites of cell-to-cell contacts. The epithelial cells of submucosal glands abundantly expressed alpha 7 nAChRs. Smoking significantly (p < 0.05) increased the relative numbers of nAChRs, and this effects could be reproduced in cultures of BEC exposed to 10 microM Nic. At a higher dose, Nic decreased the relative numbers of alpha 5-containing nAChRs, suggesting a role for receptor desensitization. The function of the nAChR channels expressed by BEC was demonstrated by biphasic increase in the concentrations of intracellular calcium ([Ca++]i) in response to activation of the channel by Nic and fluctuations of [Ca++]i due to channel blockade by mecamylamine (Mec). Long-term exposure to milimolar concentrations of Nic resulted in a steady increase of [Ca++]i, which may lead to cell damage. The biological roles of epithelial nAChRs apparently involve regulation of cell-to-cell communications, adhesion and motility, because Mec caused rapid and profound changes in these cell functions which were reversible by Nic. An over exposure of BEC to Nic, however, produced an antagonist-like effect, suggesting that the pathobiological effects of Nic toxicity might result from both activation of nAChR channels and nAChR desensitization. We conclude that medical consequences of

  7. Hematotoxic effects of 3,5-dinitro-4-chloro-alpha,alpha,alpha-trifluorotoluene, a water contaminant

    SciTech Connect

    Guastadisegni, C.; Hall, D.; Macri, A.

    1986-10-01

    Three short-term studies of 7, 14, and 21 days, respectively, were made to investigate the nature of the anemia induced in rats by 3,5-dinitro-4-chloro-alpha,alpha,alpha-trifluorotoluene (DNCTT). This compound is an intermediate in the synthesis of dinitroaniline herbicides and was detected as a contaminant of a water-bearing stratum in northern Italy. DNCTT was mixed in a powdered rodent diet at a level of 2000 ppm and administered to Wistar-derived rats. DNCTT was shown to produce a hemolytic anemia of rapid onset; packed cell volume and hemoglobin concentration were decreased at all three treatment periods. Methemoglobin and reticulocyte count were increased in all the treated groups. The relative organ weights of the spleen and the liver were increased compared to those of the control groups. Spleen enlargement was also evident at the macroscopic examination, whereas the liver appearance was normal. Pearl's Prussian blue staining performed on the spleen and liver was highly positive in the spleen of treated rats, but no iron deposition was detected in the liver of treated rats.

  8. Some numerical reslts on best uniform polynomial approximation of. chi. sup. alpha. on (0,1)

    SciTech Connect

    Carpenter, A.J.; Varga, R.S.

    1992-01-01

    Let {alpha} be a positive number, and let E{sub n}(chi{sup {alpha}}; (0,1)) denote the error of best uniform approximation to {chi}{sup {alpha}}, by polynomials of degree at most n, on the interval (0,1). The Russian mathematician S.N. Bernstein established the existence of a nonnegative constant {Beta}({alpha}) such that {Beta}({alpha}):= {sub n{yields}{infinity}lim(2n){sup 2{alpha}}E{sub n}({chi}{sup {alpha}};(0.1)). In addition, Bernstein showed that {Beta}{alpha} < {Gamma}(2{alpha}){vert bar}sin(pi}{alpha}){vert bar}/{pi} ({alpha} > 0) and that {Gamma}(2{alpha}){vert bar}sin({pi}{alpha}){vert bar}/{pi} (1{minus}1/2{alpha}{minus}1) < {Beta}({alpha}) ({alpha} > {1/2}), so that the asymptotic behavior of {Beta}({alpha}) is known when {alpha}{yields}{infinity}. Still, the problem of trying to determine {Beta}({alpha}) more precisely, for all {alpha} > 0, is intriguing. To this end, we have rigorously determined the numbers for thirteen values of {alpha}, where these numbers were calculated with a precision of at least 200 significant digits. For each of these thirteen values of {alpha}, Richardson's extrapolation was applied to the products to obtain estimates of {Beta}({alpha}) to approximately 40 decimal places. Included are graphs of the points ({alpha},{Beta}({alpha})) for the thirteen values of {alpha} that we considered.

  9. 40 CFR 721.10491 - Benzenepropanal,.alpha.-methyl-.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Benzenepropanal,.alpha.-methyl-. 721... Substances § 721.10491 Benzenepropanal,.alpha.-methyl-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzenepropanal,.alpha.-methyl- (PMN...

  10. 40 CFR 721.10491 - Benzenepropanal,.alpha.-methyl-.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Benzenepropanal,.alpha.-methyl-. 721... Substances § 721.10491 Benzenepropanal,.alpha.-methyl-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzenepropanal,.alpha.-methyl- (PMN...

  11. Purplebook Alpha: For Pre-Professional Trainees in Higher Education.

    ERIC Educational Resources Information Center

    Reitan, Henry M.; Coole, Walter A.

    The "Purplebook" is an essential part of the "Greenbook System"--an integrated sequence of five programs (Alpha, Beta, Gamma, Delta, and Epsilon) for professional development of college educators. The Alpha program is designed for college seniors or graduate students preparing for careers in higher education. Purplebook Alpha provides guidelines…

  12. Direct Measurement of {sup 21}Na+{alpha} Stellar Reaction

    SciTech Connect

    Binh, D. N.; Kubono, S.; Yamaguchi, H.; Hayakawa, S.; Hashimoto, T.; Kahl, D.; Teranishi, T.; Iwasa, N.; Kume, N.; Kato, S.; Khiem, L. H.; Tho, N. T.; Wakabayashi, Y.

    2010-08-12

    The measurement of the resonant alpha scattering and the {sup 21}Na({alpha}, p) reaction were performed for the first time in inverse kinematics with the thick target method using a {sup 21}Na radioisotope (RI) beam. This paper reports the current result of alpha scattering measurement and its astrophysics implication.

  13. Alpha and the Gay Issue: A Lesson in Homophobia?

    ERIC Educational Resources Information Center

    Hunt, Stephen John

    2005-01-01

    The Alpha course is possibly the most widespread and best-known evangelizing initiative of recent times. Billing itself as an introduction into "basic Christianity", Alpha is a programme that has been adopted worldwide by tens of thousands of churches. This paper overviews Alpha's attitude towards one of the most controversial debates in the…

  14. Factors Affecting Coefficient Alpha: A Mini Monte Carlo Study.

    ERIC Educational Resources Information Center

    Reinhardt, Brian M.

    Factors affecting a lower-bound estimate of internal consistency reliability, Cronbach's coefficient alpha, are explored. Theoretically, coefficient alpha is an estimate of the correlation between two tests drawn at random from a pool of items like the items in the test under consideration. As a practical matter, coefficient alpha can be an index…

  15. Protonation of acyllithium reagents by dichloromethane and dichloroarylmethane. A new method for the synthesis of {alpha},{alpha}-dichloro alcohols

    SciTech Connect

    Kabalka, G.W.; Li, N.S.; Yu, S.

    1995-04-01

    The first example of the protonation of acylithium reagents by dichloromethane and dichloroarylmethane is described. The reaction affords the corresponding {alpha},{alpha}-dichloro alcohols in excellent yields. 23 refs., 1 tab.

  16. Immunohistochemical demonstration of alpha 1-antichymotrypsin and alpha 1-antitrypsin in salivary gland pleomorphic adenomas of children.

    PubMed

    Takahashi, H; Fujita, S; Tsuda, N; Tezuka, F; Okabe, H

    1990-09-01

    Twenty-five benign pleomorphic adenomas of salivary glands in children were studied with immunohistochemical techniques in order to characterize the cell types comprising the epithelial and so-called "mesenchymal" regions of the tumors. The antisera against alpha 1-antichymotrypsin (alpha 1-ACT) and alpha 1-antitrypsin (alpha 1-AT) were used to stain in normal salivary gland tissue as well as in pleomorphic adenoma. In normal salivary glands, alpha 1-ACT was localized to the intercalated duct and serous acinar cells. On the other hand, there was positive staining for alpha 1-AT in the intercalated and striated duct cells. Twenty-five cases (100%) of pleomorphic adenomas in children displayed positivity to alpha 1-ACT staining and 22 cases (88%) showed a positive staining for alpha 1-AT. alpha 1-ACT staining was particularly intense in chondrocyte-like cells of 20 cases (80%), in inner tubular cells of 16 (64%) and cyst-lining cells of 12 (52%). The limited number of tumor cells which were called plasmatoid or hyaline cells and squamous epithelial cells, were positive for alpha 1-ACT. None of the outer tubular cells and hyalinous material was positively stained for alpha 1-ACT. A strong positive reaction for alpha 1-AT was observed in chondrocyte-like cells of 15 cases (60%). Inner tubular cells were positive for alpha 1-AT in 12 cases (48%), plasmatoid or hyaline cells in 10 (40%) and cyst-lining cells in 8 (35%). Squamous epithelial cells, clear cells, secretory product and hyalinous material were positive for alpha 1-AT in some cases. Chondroid matrix and myxoid stroma had no reaction with both antibodies. The biological role of alpha 1-ACT and alpha 1-AT with a wide immunohistochemical distribution in pleomorphic adenomas of children may be associated with a self regulating mechanism which inhibits degradation by tissue proteinases.

  17. The Ups and Downs of Alpha Centauri

    NASA Astrophysics Data System (ADS)

    Ayres, Thomas

    2014-11-01

    Nearby Alpha Centauri is destined for a pivotal chapter in human history, as first stop of future starfarers from Earth: 3x closer than the next nearest star; three very different objects to visit -- Alpha Cen A (G2V), B (K1V), and C (M6V); and B hosts an Earth-mass companion, albeit in a hot, lifeless orbit. For its part, Chandra has been keeping intent watch on the high-energy starspot cycles of AB, with semi-annual pointings over the past decade. Only HRC-I can separate AB as they plunge toward a close approach of 4" in 2016; and LETGS has countered that an abrupt 50x drop in XMM count rate of sun-like A in early 2005, ominously reported as the "darkening of the solar twin," simply is a soft sensitivity issue, not an unprecedented, inexplicable case of corona interrupta.

  18. Low Alpha Experiments at the ALS

    SciTech Connect

    Robin, D.; Alvis, R.; Jackson, A.; Holtzapple, R.; Podobedov, B.

    1996-04-01

    We present a modified, low alpha lattice for the Advanced Light Source where the quadrupole field strengths have been detuned to allow the momentum compaction factor to be varied smoothly from positive to negative values. With this low alpha lattice we decrease the momentum compaction factor by a factor of 5, to 0.0003 over normal operation, resulting in a measured bunch length reduction by a factor of 2. We also measure the size of the second-order momentum compaction factor as well as store beam in a negative momentum compaction lattice. Streak camera measurements at positive and negative momentum compaction operation show longitudinal beam profile distributions that are in agreement with simulations by Fang {ital et} {ital al}. (8). {copyright} {ital 1996 American Institute of Physics.}

  19. Low alpha experiments at the ALS

    SciTech Connect

    Robin, D.; Alvis, R.; Jackson, A.; Holtzapple, R.; Podobedov, B.

    1995-08-01

    The authors present a modified, low alpha lattice for the Advanced Light Source where the quadrupole field strengths have been detuned to allow the momentum compaction factor to be varied smoothly from positive to negative values. With this low alpha lattice the authors decrease the momentum compaction factor by a factor of 5 to 0.0003 over normal operation resulting in a measured bunch length reduction of 2. They also measure the size the second order momentum compaction factor as well as store beam in a negative momentum compaction lattice. Streak camera measurements at positive and negative momentum compaction operation show longitudinal beam profile distributions that are in agreement with simulations by Fang et al.

  20. Project Longshot: A mission to Alpha Centauri

    NASA Technical Reports Server (NTRS)

    West, Curtis; Chamberlain, Sally; Pagan, Neftali; Stevens, Robert

    1989-01-01

    Project Longshot, an exercise in the Advanced Design Program for Space, had as its destination Alpha Centauri, the closest star system to our own solar system. Alpha Centauri, a trinary star system, is 4.34 light years from earth. Although Project Longshot is impossible based on existing technologies, areas that require further investigation in order to make this feat possible are identified. Three areas where advances in technology are needed are propulsion, data processing for autonomous command and control functions, and reliability. Propulsion, possibly by antimatter annihilation; navigation and navigation aids; reliable hardware and instruments; artificial intelligence to eliminate the need for command telemetry; laser communication; and a reliable, compact, and lightweight power system that converts energy efficiently and reliably present major challenges. Project Longshot promises exciting advances in science and technology and new information concerning the universe.

  1. Alpha-induced reactions in iridium

    SciTech Connect

    Bhardwaj, M.K.; Rizvi, I.A.; Chaubey, A.K. )

    1992-05-01

    The excitation function of ({alpha},{ital xn}) reactions on {sup 191}Ir (abundance 37.3%) and on {sup 193}Ir (abundance 62.7%) has been measured for the 17--55 MeV alpha-particle bombarding energy range. The stacked foil activation technique and {gamma}-ray spectroscopy were used to determine the cross sections. The experimental data were compared with calculated values obtained by means of a geometry-dependent hybrid model. The initial exciton number {ital n}{sub 0}=4 with {ital n}=2, {ital p}=2, and {ital h}=0 gives the best agreements with the presently measured results. To calculate the excitation function theoretically a computer code was used. This set of excitation functions provides a data basis for probing the validity of combined equilibrium and preequilibrium reaction models in a considerable energy range.

  2. Automatically processed alpha-track radon monitor

    DOEpatents

    Langner, Jr., G. Harold

    1993-01-01

    An automatically processed alpha-track radon monitor is provided which includes a housing having an aperture allowing radon entry, and a filter that excludes the entry of radon daughters into the housing. A flexible track registration material is located within the housing that records alpha-particle emissions from the decay of radon and radon daughters inside the housing. The flexible track registration material is capable of being spliced such that the registration material from a plurality of monitors can be spliced into a single strip to facilitate automatic processing of the registration material from the plurality of monitors. A process for the automatic counting of radon registered by a radon monitor is also provided.

  3. Automatically processed alpha-track radon monitor

    DOEpatents

    Langner, G.H. Jr.

    1993-01-12

    An automatically processed alpha-track radon monitor is provided which includes a housing having an aperture allowing radon entry, and a filter that excludes the entry of radon daughters into the housing. A flexible track registration material is located within the housing that records alpha-particle emissions from the decay of radon and radon daughters inside the housing. The flexible track registration material is capable of being spliced such that the registration material from a plurality of monitors can be spliced into a single strip to facilitate automatic processing of the registration material from the plurality of monitors. A process for the automatic counting of radon registered by a radon monitor is also provided.

  4. Alternate Alpha Induced Reactions for NIF Radiochemistry

    SciTech Connect

    Shaughnessy, D A; Moody, K J; Bernstein, L A

    2010-02-26

    Radiochemical analysis of NIF capsule residues has been identified as a potential diagnostic of NIF capsule performance. In particular, alpha-induced nuclear reactions that occur on tracer elements added to the NIF capsule have been shown through simulation to be a very sensitive diagnostic for mix. The short range of the alpha particles makes them representative of the hot spot where they are created through the fusion of deuterium and tritium. Reactions on elements doped into the innermost part of the capsule ablator would therefore be sensitive to material that had mixed into the hot spot. Radiochemical determinations of activated detector elements may perhaps be the only true measure of mix that occurs in a NIF capsule, particularly in cases when the capsule fails.

  5. Optical conductivity of alpha-Mn

    NASA Technical Reports Server (NTRS)

    Scoles, K. J.; Christy, R. W.

    1982-01-01

    The optical constants were measured at room temperature in the photon-energy range 0.6-6.5 eV on evaporated thin films. Evaporation conditions were chosen that gave the alpha-Mn crystal structure with relatively large grains. The optical conductivity was separated into intraband and interband contributions by fitting to the Drude formula at low energies. The results are anomalous in comparison to other 3d transition metals: the free-electron lifetime is exceptionally short (in agreement with the large dc resistivity of Mn), and the interband transitions seem unusually weak at the lower energies. Possible explanations related to the complicated crystal structure of alpha-Mn with its loss of point symmetry at the atom sites are discussed.

  6. Optical conductivity of alpha-Mn

    NASA Technical Reports Server (NTRS)

    Scoles, K. J.; Christy, R. W.

    1982-01-01

    The optical constants were measured at room temperature in the photon-energy range 0.6 to 6.5 eV on evaporated thin films. Evaporation conditions were chosen that gave the alpha-Mn crystal structure with reasonably large grains. The optical conductivity was separated into intraband and interband contributions by fitting to the Drude formula at low energies. The results are anomalous in comparison to other 3d transition metals. The free-electron lifetime is exceptionally sort (in agreement with the large dc resistivity of Mn), and the interband transitions seem unusually weak at the lower energies. Possible explanations related to the complicated crystal structure of alpha-Mn are discussed.

  7. Tumour necrosis factor-alpha (TNF-alpha) in patients who have asbestosis and develop cancer.

    PubMed Central

    Partanen, R; Koskinen, H; Hemminki, K

    1995-01-01

    OBJECTIVES--Concentrations of tumour necrosis factor-alpha (TNF-alpha) were assayed by radioimmunoassay in serum samples collected between 1981 and 1987 from 111 patients with asbestosis who were at a high risk of cancer. Follow up of these patients until 1993 showed that 38 had developed cancer (27 lung, three mesotheliomas, and eight diverse malignancies). RESULTS--The mean serum concentrations of TNF-alpha given in fmol/100 microliters serum in all the cases with cancer (14.1) and the cases with lung cancer (13.6) were significantly higher (P < 0.05) than the mean concentrations in the exposed controls (10.5). A positive increase was considered to be any value that was > 2 SDs above the mean of the exposed controls. 22% (six of 27) of the cases with lung cancer were positive compared with 4% (three of 73) of the exposed controls, a significant difference (P < 0.001). The serum concentrations of TNF-alpha correlated moderately with cancer (r = 0.3), lung cancer (r = 0.3), and Neu oncoproteins and epidermal growth factor receptor (EGFR) (r = 0.3, 0.5 respectively). Also, there was a significant correlation between development of cancer and severity or progression of asbestosis. There was no correlation between the concentrations of TNF-alpha and severity or progression of asbestosis. CONCLUSIONS--These results showed high concentrations of TNF-alpha in the patients who had cancer. TNF-alpha may offer an auxiliary method in early diagnosis of cancers related to asbestosis. PMID:7795753

  8. Proceedings, High-Precision $\\alpha_s$ Measurements from LHC to FCC-ee

    SciTech Connect

    d'Enterria, David; Skands, Peter Z.

    2015-01-01

    This document provides a writeup of all contributions to the workshop on "High precision measurements of $\\alpha_s$: From LHC to FCC-ee" held at CERN, Oct. 12--13, 2015. The workshop explored in depth the latest developments on the determination of the QCD coupling $\\alpha_s$ from 15 methods where high precision measurements are (or will be) available. Those include low-energy observables: (i) lattice QCD, (ii) pion decay factor, (iii) quarkonia and (iv) $\\tau$ decays, (v) soft parton-to-hadron fragmentation functions, as well as high-energy observables: (vi) global fits of parton distribution functions, (vii) hard parton-to-hadron fragmentation functions, (viii) jets in $e^\\pm$p DIS and $\\gamma$-p photoproduction, (ix) photon structure function in $\\gamma$-$\\gamma$, (x) event shapes and (xi) jet cross sections in $e^+e^-$ collisions, (xii) W boson and (xiii) Z boson decays, and (xiv) jets and (xv) top-quark cross sections in proton-(anti)proton collisions. The current status of the theoretical and experimental uncertainties associated to each extraction method, the improvements expected from LHC data in the coming years, and future perspectives achievable in $e^+e^-$ collisions at the Future Circular Collider (FCC-ee) with $\\cal{O}$(1--100 ab$^{-1}$) integrated luminosities yielding 10$^{12}$ Z bosons and jets, and 10$^{8}$ W bosons and $\\tau$ leptons, are thoroughly reviewed. The current uncertainty of the (preliminary) 2015 strong coupling world-average value, $\\alpha_s(m_Z)$ = 0.1177 $\\pm$ 0.0013, is about 1\\%. Some participants believed this may be reduced by a factor of three in the near future by including novel high-precision observables, although this opinion was not universally shared. At the FCC-ee facility, a factor of ten reduction in the $\\alpha_s$ uncertainty should be possible, mostly thanks to the huge Z and W data samples available.

  9. Characterization of the bovine C alpha gene.

    PubMed Central

    Brown, W R; Rabbani, H; Butler, J E; Hammarström, L

    1997-01-01

    The complete genomic sequence of a bovine C alpha gene is reported here. The genomic sequence was obtained from a C alpha phage clone that had been cloned from a genomic EMBL4 phage vector library. The C alpha sequence had previously been expressed as a chimeric antibody and identified as IgA using IgA-specific antibodies. Intron/exon boundaries were determined by comparison of the genomic sequence with an expressed bovine C alpha sequence obtained from spleen by reverse transcription-polymerase chain reaction (RT-PCR). Analysis of 50 Swedish bovine genomic DNA samples using genomic blots and five different restriction enzymes failed to detect evidence of polymorphism. However, PstI digests of Brown Swiss DNA showed a restriction fragment length polymorphism (RFLP), suggesting that at least two allelic variants of bovine IgA exist. Comparison of the deduced amino acid sequence of bovine IgA with sequences available for other species indicated that the highest homology was with that of swine, another artiodactyl. This was the highest homology observed for all mammalian IgA compared except for that between IgA1 and IgA2 in humans. Bovine IgA shares with rabbit IgA3 and IgA4, an additional N-linked glycosylation site at position 282. However, the collective data indicate that cattle are like swine and rodents and unlike rabbits in having a single locus of the gene encoding IgA of this species. Images Figure 4 PMID:9203958

  10. First Attempts at Antihydrogen Trapping in ALPHA

    SciTech Connect

    Andresen, G. B.; Bowe, P. D.; Hangst, J. S.; Bertsche, W.; Butler, E.; Charlton, M.; Humphries, A. J.; Jenkins, M. J.; Joergensen, L. V.; Madsen, N.; Werf, D. P. van der; Bray, C. C.; Chapman, S.; Fajans, J.; Povilus, A.; Wurtele, J. S.; Cesar, C. L.; Lambo, R.; Silveira, D. M.; Fujiwara, M. C.

    2008-08-08

    The ALPHA apparatus is designed to produce and trap antihydrogen atoms. The device comprises a multifunction Penning trap and a superconducting, neutral atom trap having a minimum-B configuration. The atom trap features an octupole magnet for transverse confinement and solenoidal mirror coils for longitudinal confinement. The magnetic trap employs a fast shutdown system to maximize the probability of detecting the annihilation of released antihydrogen. In this article we describe the first attempts to observe antihydrogen trapping.

  11. First Attempts at Antihydrogen Trapping in ALPHA

    NASA Astrophysics Data System (ADS)

    Andresen, G. B.; Bertsche, W.; Bowe, P. D.; Bray, C. C.; Butler, E.; Cesar, C. L.; Chapman, S.; Charlton, M.; Fajans, J.; Fujiwara, M. C.; Funakoshi, R.; Gill, D. R.; Hangst, J. S.; Hardy, W. N.; Hayano, R. S.; Hayden, M. E.; Humphries, A. J.; Hydomako, R.; Jenkins, M. J.; Jørgensen, L. V.; Kurchaninov, L.; Lambo, R.; Madsen, N.; Nolan, P.; Olchanski, K.; Olin, A.; Page, R. D.; Povilus, A.; Pusa, P.; Robicheaux, F.; Sarid, E.; El Nasr, S. Seif; Silveira, D. M.; Storey, J. W.; Thompson, R. I.; van der Werf, D. P.; Wurtele, J. S.; Yamazaki, Y.

    2008-08-01

    The ALPHA apparatus is designed to produce and trap antihydrogen atoms. The device comprises a multifunction Penning trap and a superconducting, neutral atom trap having a minimum-B configuration. The atom trap features an octupole magnet for transverse confinement and solenoidal mirror coils for longitudinal confinement. The magnetic trap employs a fast shutdown system to maximize the probability of detecting the annihilation of released antihydrogen. In this article we describe the first attempts to observe antihydrogen trapping.

  12. Diamond detector for alpha-particle spectrometry.

    PubMed

    Dueñas, J A; de la Torre Pérez, J; Martín Sánchez, A; Martel, I

    2014-08-01

    An artificially grown high purity diamond was used as a detector for alpha-particle spectrometry. Diamond detectors can match the performance of silicon detectors employed in standard continuous air monitoring systems. Its radiation hardness and electronic properties make them ideal to work under extreme condition such as high temperature and ambient lights. A 50 μm thickness single-crystal diamond detector has been compared with a 300 μm passivated implanted planar silicon detector, under ambient conditions.

  13. Fourth High Alpha Conference, volume 2

    NASA Technical Reports Server (NTRS)

    1994-01-01

    The goal of the Fourth High Alpha Conference, held at the NASA Dryden Flight Research Center on July 12-14, 1994, was to focus on the flight validation of high angle of attack technologies and provide an in-depth review of the latest high angle of attack activities. Areas that were covered include high angle of attack aerodynamics, propulsion and inlet dynamics, thrust vectoring, control laws and handling qualities, and tactical utility.

  14. Fourth High Alpha Conference, volume 1

    NASA Technical Reports Server (NTRS)

    1994-01-01

    The goal of the Fourth High Alpha Conference was to focus on the flight validation of high angle-of-attack technologies and provide an in-depth review of the latest high angle-of-attack activities. Areas that were covered include: high angle-of-attack aerodynamics, propulsion and inlet dynamics, thrust vectoring, control laws and handling qualities, tactical utility, and forebody controls.

  15. [Alpha 2-antiplasmin in bovine plasma].

    PubMed

    Piliavskaia, A S; Panchenko, N E

    1985-01-01

    Bovine and human blood plasma contains alpha 2-antiplasmin which possesses affinity to lysin-binding sites in plasmin and inhibits the human plasmin. Its isolation was conducted for two stages: separation of plasminogen on lysin-cellulose, fractionation by ammonium sulphate, desalination on molselector G-25, chromatography on DEAE-Sephadex A-50 and affinity chromatography on plasmin-sepharose with the blocked active site.

  16. Lyman Alpha Photochemistry in the Solar Nebula

    NASA Technical Reports Server (NTRS)

    Fegley, Bruce, Jr.

    1997-01-01

    The purpose of the project "Lyman Alpha Photochemistry in the Solar Nebula" was to model photochemistry in the primitive solar nebula and the early solar systems. As part of the modeling, it was necessary to model the composition of the gas and dust accreted by the solar nebula. This final report contains a list of publications where the results of this project have been published.

  17. High resolution alpha particle spectrometry through collimation

    NASA Astrophysics Data System (ADS)

    Park, Seunghoon; Kwak, Sung-Woo; Kang, Han-Byeol

    2015-06-01

    Alpha particle spectrometry with collimation is a useful method for identifying nuclear materials among various nuclides. A mesh type collimator reduces the low energy tail and broadened energy distribution by cutting off particles with a low incidence angle. The relation between the resolution and the counting efficiency can be investigated by changing a ratio of the mesh hole diameter and the collimator thickness. Through collimation, a target particle can be distinguished by a PIPS® detector under a mixture of various nuclides.

  18. Screening alpha-glucosidase and alpha-amylase inhibitors from natural compounds by molecular docking in silico.

    PubMed

    Jhong, Chien-Hung; Riyaphan, Jirawat; Lin, Shih-Hung; Chia, Yi-Chen; Weng, Ching-Feng

    2015-01-01

    The alpha-glucosidase inhibitor is a common oral anti-diabetic drug used for controlling carbohydrates normally converted into simple sugars and absorbed by the intestines. However, some adverse clinical effects have been observed. The present study seeks an alternative drug that can regulate the hyperglycemia by down-regulating alpha-glucosidase and alpha-amylase activity by molecular docking approach to screen the hyperglycemia antagonist against alpha-glucosidase and alpha-amylase activities from the 47 natural compounds. The docking data showed that Curcumin, 16-hydroxy-cleroda-3,13-dine-16,15-olide (16-H), Docosanol, Tetracosanol, Antroquinonol, Berberine, Catechin, Quercetin, Actinodaphnine, and Rutin from 47 natural compounds had binding ability towards alpha-amylase and alpha-glucosidase as well. Curcumin had a better biding ability of alpha-amylase than the other natural compounds. Analyzed alpha-glucosidase activity reveals natural compound inhibitors (below 0.5 mM) are Curcumin, Actinodaphnine, 16-H, Quercetin, Berberine, and Catechin when compared to the commercial drug Acarbose (3 mM). A natural compound with alpha-amylase inhibitors (below 0.5 mM) includes Curcumin, Berberine, Docosanol, 16-H, Actinodaphnine/Tetracosanol, Catechin, and Quercetin when compared to Acarbose (1 mM). When taken together, the implication is that molecular docking is a fast and effective way to screen alpha-glucosidase and alpha-amylase inhibitors as lead compounds of natural sources isolated from medicinal plants.

  19. Fasting induces basolateral uptake transporters of the SLC family in the liver via HNF4alpha and PGC1alpha.

    PubMed

    Dietrich, Christoph G; Martin, Ina V; Porn, Anne C; Voigt, Sebastian; Gartung, Carsten; Trautwein, Christian; Geier, Andreas

    2007-09-01

    Fasting induces numerous adaptive changes in metabolism by several central signaling pathways, the most important represented by the HNF4alpha/PGC-1alpha-pathway. Because HNF4alpha has been identified as central regulator of basolateral bile acid transporters and a previous study reports increased basolateral bile acid uptake into the liver during fasting, we hypothesized that HNF4alpha is involved in fasting-induced bile acid uptake via upregulation of basolateral bile acid transporters. In rats, mRNA of Ntcp, Oatp1, and Oatp2 were significantly increased after 48 h of fasting. Protein expression as determined by Western blot showed significant increases for all three transporters 72 h after the onset of fasting. Whereas binding activity of HNF1alpha in electrophoretic mobility shift assays remained unchanged, HNF4alpha binding activity to the Ntcp promoter was increased significantly. In line with this result, we found significantly increased mRNA expression of HNF4alpha and PGC-1alpha. Functional studies in HepG2 cells revealed an increased endogenous NTCP mRNA expression upon cotransfection with either HNF4alpha, PGC-1alpha, or a combination of both. We conclude that upregulation of the basolateral bile acid transporters Ntcp, Oatp1, and Oatp2 in fasted rats is mediated via the HNF4alpha/PGC-1alpha pathway. PMID:17640976

  20. Fasting induces basolateral uptake transporters of the SLC family in the liver via HNF4alpha and PGC1alpha.

    PubMed

    Dietrich, Christoph G; Martin, Ina V; Porn, Anne C; Voigt, Sebastian; Gartung, Carsten; Trautwein, Christian; Geier, Andreas

    2007-09-01

    Fasting induces numerous adaptive changes in metabolism by several central signaling pathways, the most important represented by the HNF4alpha/PGC-1alpha-pathway. Because HNF4alpha has been identified as central regulator of basolateral bile acid transporters and a previous study reports increased basolateral bile acid uptake into the liver during fasting, we hypothesized that HNF4alpha is involved in fasting-induced bile acid uptake via upregulation of basolateral bile acid transporters. In rats, mRNA of Ntcp, Oatp1, and Oatp2 were significantly increased after 48 h of fasting. Protein expression as determined by Western blot showed significant increases for all three transporters 72 h after the onset of fasting. Whereas binding activity of HNF1alpha in electrophoretic mobility shift assays remained unchanged, HNF4alpha binding activity to the Ntcp promoter was increased significantly. In line with this result, we found significantly increased mRNA expression of HNF4alpha and PGC-1alpha. Functional studies in HepG2 cells revealed an increased endogenous NTCP mRNA expression upon cotransfection with either HNF4alpha, PGC-1alpha, or a combination of both. We conclude that upregulation of the basolateral bile acid transporters Ntcp, Oatp1, and Oatp2 in fasted rats is mediated via the HNF4alpha/PGC-1alpha pathway.

  1. Lyman Alpha Mapping Project (LAMP) Brightness Maps

    NASA Astrophysics Data System (ADS)

    Retherford, Kurt D.; Gladstone, G.; Stern, S.; Egan, A. F.; Miles, P. F.; Parker, J. W.; Greathouse, T. K.; Davis, M. W.; Slater, D. C.; Kaufmann, D. E.; Versteeg, M. H.; Feldman, P. D.; Hurley, D. M.; Pryor, W. R.; Hendrix, A. R.

    2010-10-01

    The Lyman Alpha Mapping Project (LAMP) is an ultraviolet (UV) spectrograph on the Lunar Reconnaissance Orbiter (LRO) that is designed to map the lunar albedo at far-UV wavelengths. LAMP primarily measures interplanetary Hydrogen Lyman-alpha sky-glow and far-UV starlight reflected from the night-side lunar surface, including permanently shadowed regions (PSRs) near the poles. Dayside observations are also obtained. Brightness maps sorted by wavelength (including the Lyman-alpha wavelength of 121.6 nm) are reported for the polar regions, with a few regions of interest reported in more detail. LAMP's spectral range of 58 nm to 196 nm includes a water ice spectral feature near 160 nm, which provides a diagnostic tool for detecting water on the lunar surface that is complementary to recent discoveries using infrared and radio frequency techniques. Progress towards producing far-UV albedo maps and searching for water ice signatures will be reported. We'll discuss how LAMP data may address questions regarding how water is formed on the moon, transported through the lunar atmosphere, and deposited in the PSRs.

  2. ALPHA, Mass Generation and Quantum Information

    NASA Astrophysics Data System (ADS)

    Goradia, Shantilal

    2008-05-01

    The generation of Planck energy 10E19 Gev/Planck time during the observable age of the universe (10E60 Planck times) would generate 10E79 Gev. 10E79 Gev approximates the energy of the baryon number, implying an increase of the baryon number by 10E19/Planck time. What is the source of energy for this mass generation? The ALPHA implicated as negative entropy in [1] must create vacuum energy. Vacuum energy is negative energy. Nature must balance negative energy by generating positive energy (mass), implying ALPHA balances the increasing entropy of the visible universe and generates baryonic mass. Additionally, the successful cloning of the sheep Dolly, and observed molecular blinking dots in biochemistry support the binary BITS of ON and OFF states in [1]. Vindicating Hermite's 1873 mathematical linkage of the base of natural logarithm to transcendentality will implicate natural log based ALPHA in [1] as connected to consciousness. [1] Goradia S: www.arXiv.org/pdf/physics/0210040v3.

  3. Lunar Surface Outgassing and Alpha Particle Measurements

    NASA Astrophysics Data System (ADS)

    Lawson, S. L.; Feldman, W. C.; Lawrence, D. J.; Moore, K. R.; Elphic, R. C.; Maurice, S.; Belian, R. D.; Binder, A. B.

    2002-01-01

    The Lunar Prospector Alpha Particle Spectrometer (LP APS) searched for lunar surface gas release events and mapped their distribution by detecting alpha particles produced by the decay of gaseous radon-222 (5.5 MeV, 3.8 day half-life), solid polonium-218 (6.0 MeV, 3 minute half-life), and solid polonium-210 (5.3 MeV, 138 day half-life, but held up in production by the 21 year half-life of lead-210). These three nuclides are radioactive daughters from the decay of uranium-238. Radon reaches the lunar surface either at areas of high soil porosity or where fissures release the trapped gases in which radon is entrained. Once released, the radon spreads out by "bouncing" across the surface on ballistic trajectories in a randomwalk process. The half-life of radon-222 allows the gas to spread out by several 100 km before it decays (depositing approximately half of the polonium-218 recoil nuclides on the lunar surface) and allows the APS to detect gas release events up to several days after they occur. The long residence time of the lead-210 precursor to polonium-210 allows the mapping of gas vents which have been active over the last approximately 60 years. Because radon and polonium are daughter products of the decay of uranium, the background level of alpha particle activity is a function of the lunar crustal uranium distribution.

  4. The Alpha Dynamo Effects in Laboratory Plasmas

    SciTech Connect

    Hantao Ji; Stewart C. Prager

    2001-10-16

    A concise review of observations of the alpha dynamo effect in laboratory plasmas is given. Unlike many astrophysical systems, the laboratory pinch plasmas are driven magnetically. When the system is overdriven, the resultant instabilities cause magnetic and flow fields to fluctuate, and their correlation induces electromotive forces along the mean magnetic field. This alpha-effect drives mean parallel electric current, which, in turn, modifies the initial background mean magnetic structure towards the stable regime. This drive-and-relax cycle, or the so-called self-organization process, happens in magnetized plasmas in a timescale much shorter than resistive diffusion time, thus it is a fast and unquenched dynamo process. The observed alpha-effect redistributes magnetic helicity (a measure of twistedness and knottedness of magnetic field lines) but conserves its total value. It can be shown that fast and unquenched dynamos are natural consequences of a driven system where fluctuations are statistically either not stationary in time or not homogeneous in space, or both. Implications to astrophysical phenomena will be discussed.

  5. Multimode fiber with z-dependent alpha-value.

    PubMed

    Marcuse, D

    1979-07-01

    The width of the impulse response of multimode fibers with power law index profiles depends on the alpha-value of the power law exponent. For constant alpha, optimum pulse width is achievable only in a very narrow range of values centered around alpha = 2 - (12/5)Delta. We show in this paper that the optimum width of the impulse response is achievable for fibers with nonoptimum alpha-values provided alpha varies slowly along the fiber and deviates on average by equal amounts to either side of its (constant) optimum value.

  6. Alpha Particle Physics Experiments in the Tokamak Fusion Test Reactor

    SciTech Connect

    Budny, R.V.; Darrow, D.S.; Medley, S.S.; Nazikian, R.; Zweben, S.J.; et al.

    1998-12-14

    Alpha particle physics experiments were done on the Tokamak Fusion Test Reactor (TFTR) during its deuterium-tritium (DT) run from 1993-1997. These experiments utilized several new alpha particle diagnostics and hundreds of DT discharges to characterize the alpha particle confinement and wave-particle interactions. In general, the results from the alpha particle diagnostics agreed with the classical single-particle confinement model in magnetohydrodynamic (MHD) quiescent discharges. Also, the observed alpha particle interactions with sawteeth, toroidal Alfvén eigenmodes (TAE), and ion cyclotron resonant frequency (ICRF) waves were roughly consistent with theoretical modeling. This paper reviews what was learned and identifies what remains to be understood.

  7. Giant Resonances in the Alpha-Nucleus Interaction

    SciTech Connect

    Karpeshin, F. F.

    2010-04-30

    Tunneling of alpha particles through the Coulomb barrier for the source {sup 135}Pr nucleus is consecutively considered. The effect of sharp peaks arising in the case of coincidence of the alpha energy with that of a quasistationary state within the barrier is elucidated. Peaks' energy depend on the alpha-nucleus potential. They can give rise to 'anomalous' properties of some neutron resonances. The peaks can also be observed in the incoming alpha-nucleus channel. The method can be applied for solution of the reverse problem of the alpha-nucleus scattering.

  8. Detection of alpha radiation in a beta radiation field

    DOEpatents

    Mohagheghi, Amir H.; Reese, Robert P.

    2001-01-01

    An apparatus and method for detecting alpha particles in the presence of high activities of beta particles utilizing an alpha spectrometer. The apparatus of the present invention utilizes a magnetic field applied around the sample in an alpha spectrometer to deflect the beta particles from the sample prior to reaching the detector, thus permitting detection of low concentrations of alpha particles. In the method of the invention, the strength of magnetic field required to adequately deflect the beta particles and permit alpha particle detection is given by an algorithm that controls the field strength as a function of sample beta energy and the distance of the sample to the detector.

  9. Acidic metabolites. VI. 20 alpha-isosteroids as intermediates in 20 alpha-dihydrosteroid formation

    SciTech Connect

    Monder, C.; Bradlow, H.L.; Han, C.A.; Zumoff, B.

    1985-03-01

    We have previously shown that human subjects metabolize the 20 beta-epimer of isocortisol (11 beta, 17,20 beta-trihydroxy-3-oxo-pregn-4-en-21-al) to both 20 alpha- and 20 beta-hydroxy steroid end products. In this paper we describe the synthesis of tritium labeled 20 alpha-epimers of isocortisol and isoTHF (3 alpha, 11 beta, 17,20 alpha-tetrahydroxy-5 beta-pregnan-21-al) and their metabolic fate in humans. Both steroids yielded 20 alpha-hydroxy urinary neutral end-products (cortols and cortolones) and no 20 beta-hydroxy epimers. Regeneration of 17-ketols from aldols occurred to a small extent with isoTHF, but not with isocortisol. Isocortisol and isoTHF yielded less cortoic acids than did the corresponding ketols. The results provide further evidence that in man the stereochemistry at C-20 of the end-products of corticosteroid metabolism is determined by the configuration of the aldol at C-20 prior to subsequent metabolic events.

  10. Alpha-1, alpha-2, and beta adrenergic signal transduction in cultured uterine myocytes.

    PubMed

    Phillippe, M; Saunders, T; Bangalore, S

    1990-04-01

    The following studies were undertaken to develop a cultured uterine myocyte model which would allow further clarification of the adrenergic signal transduction mechanisms utilized by these myocytes. After mechanical removal of the endometrium, rabbit uterine myocytes were isolated by an overnight enzymatic disaggregation using collagenase and DNase I. The isolated myocytes were maintained in culture in 75-cm2 flasks containing Waymouth's MB 751/1 medium-10% fetal bovine serum along with 10(-8) M estradiol, penicillin, streptomycin, and Fungizone. The phase contrast and electron micrographic appearance of these cells was consistent with that previously reported for smooth muscle myocytes in culture. Immunocytochemical studies utilizing monoclonal anti-alpha-smooth muscle actin antibodies confirmed the presence of smooth muscle actin in these cultured myocytes. Western blot studies similarly confirmed the presence of alpha-smooth muscle actin in rabbit myometrial tissue and the cultured myocytes, both the primary and F1 generation. After prelabeling the myocytes with [3H]inositol, adrenergic stimulation experiments demonstrated alpha-1 receptor mediated stimulation of inositol phosphates. Beta receptor stimulation experiments confirmed cAMP production in these cultured myocytes, and the ability of clonidine, an alpha-2 agonist, to inhibit forskolin stimulated cAMP production confirmed the presence of functional alpha-2 adrenergic receptors in these myocytes. In conclusion, these cultured rabbit uterine myocytes have provided an in vitro model which can be utilized to further clarify the adrenergic receptor signal transduction mechanisms in genital tract smooth muscle.

  11. Identification of hydrogen peroxide oxidation sites of alpha A- and alpha B-crystallins.

    PubMed

    Smith, J B; Jiang, X; Abraham, E C

    1997-02-01

    The alpha-crystallins are the most abundant structural proteins of the lens and, because of their chaperone activity, contribute to the solubility of the other crystallins. With aging, the lens crystallins undergo a variety of modifications which correlate with a loss of solubility and the development of cataract. A recent study demonstrating that alpha-crystallins exposed in vitro to FeCl3 and H2O2 exhibit decreased chaperone activity, implicates metal catalyzed oxidations of alpha-crystallins in this loss of solubility. The present study has determined that alpha-crystallins incubated with FeCl3 and H2O2 are modified by the nearly complete oxidation of all methionine residues to methionine sulfoxide, with no other detectable reaction products. The modifications were identified from the molecular weights of peptides formed by enzymatic digestion of the alpha-crystallins and located by tandem mass spectrometric analysis of the fragmentation pattern of the mass spectra of the fragments from peptides with oxidized methionine is loss of 64 Da, which corresponds to loss of CH3SOH from the methionine sulfoxide. These fragments are useful in identifying peptides that include oxidized methionine residues.

  12. Ozone inactivation of human alpha 1-proteinase inhibitor

    SciTech Connect

    Johnson, D.A.

    1980-06-01

    Ozone decreased the trypsin, chymotrypsin, and elastase inhibitory activities of human alpha 1-proteinase inhibitor both in plasma and in solutions of the pure inhibitor. The total loss of porcine elastase inhibitory activity required 18 mol of ozone/mol of pure alpha 1-PI and approximately 850 mol of ozone/mol of alpha 1-PI in plasma. A corresponding loss of the ability to inhibit human leukocyte elastase was observed. Inactivated alpha 1-PI contains four residues of methionine sulfoxide, in addition to oxidized tryosine and tryptophan. Electrophoretic analysis demonstrated that the ozone-inactivated alpha 1-PI did not form normal complexes with serine proteinases. These findings suggest that the inhalation of ozone could inactivate alpha 1-PI on the airspace side of the lung to create a localized alpha 1-PI deficiency, which might contribute to the development of emphysema.

  13. Complex-Energy Shell-Model Description of Alpha Decay

    SciTech Connect

    Id Betan, R.; Nazarewicz, Witold

    2011-01-01

    In his pioneering work of alpha decay, Gamow assumed that the alpha particle formed inside the nucleus tunnels through the barrier of the alpha-daughter potential. The corresponding metastable state can be viewed as a complex-energy solution of the time-independent Schroedinger equation with the outgoing boundary condition. The formation of the alpha cluster, missing in the original Gamow formulation, can be described within the R-matrix theory in terms of the formation amplitude. In this work, the alpha decay process is described by computing the formation amplitude and barrier penetrability in a large complex-energy configuration space spanned by the complex-energy eigenstates of the finite Woods-Saxon (WS) potential. The proper normalization of the decay channel is essential as it strongly modifies the alpha-decay spectroscopic factor. The test calculations are carried out for the ^{212}Po alpha decay.

  14. Alpha adrenoceptors in the rabbit ear thermoregulatory microcirculation.

    PubMed

    Li, Z; Koman, L A; Smith, B P; Gordon, E S; Smith, T L

    1998-03-01

    The rabbit ear microcirculation was analyzed in a chronic unanesthetized model to evaluate alpha adrenergic microvascular control in a thermoregulatory end organ. This model allowed direct measurement of microcirculatory responses without the effects of anesthetics or inflammatory responses induced by acute surgical intervention. The ipsilateral facial artery was catheterized for drug injections into the experimental ear. Microvascular diameter changes following stimulation or blockade of adrenoceptor (AR) subtypes were observed directly through a chronic microvascular chamber implanted in the rabbit ear. Vascular alpha1- and alpha2-ARs appear to be distributed differently across the arterioles and AVAs of the rabbit ear. Both alpha1- and alpha2-ARs appear to contribute to vasoconstriction of AVAs in the conscious rabbit ear. In contrast, alpha1-AR's (vs alpha2-ARs) appear to predominate in adrenergically mediated sympathetic vasoconstriction of arterioles. PMID:9521886

  15. On the mechanism of the chemical and enzymic oxygenations of alpha-oxyprotohemin IX to Fe.biliverdin IX alpha.

    PubMed Central

    Sano, S; Sano, T; Morishima, I; Shiro, Y; Maeda, Y

    1986-01-01

    alpha-Oxyprotohemin IX, an early intermediate in heme catabolism, was synthesized and its autoxidation to biliverdin IX alpha was studied. In anaerobic aqueous pyridine, alpha-oxyprotohemin (hexacoordinated) underwent autoreduction to yield an Fe(II) alpha-oxyprotoporphyrin pi-neutral radical bis(pyridine) complex, which reacted with an equimolar amount of dioxygen to give pyridine.verdohemochrome IX alpha and CO in 75-80% yield via an intermediate with an absorption maximum at 893 nm. Verdohemochrome IX alpha did not react with further dioxygen. Reconstituted apomyoglobin.alpha-oxyprotohemin IX complex (pentacoordinated) reacted with an equimolar amount of dioxygen to form an Fe(II) oxyporphyrin pi-neutral radical intermediate, which rearranged to a green compound (lambda max 660 and 704 nm) with elision of CO. The green product, which is probably an apomyoglobin.verdoheme pi-radical complex, reacted with another equimolar amount of dioxygen to give Fe(III).biliverdin IX alpha. Demetallation of this gave biliverdin IX alpha in overall yield of 70-75%. These results indicate that the sequence of oxyheme autoxidation in the presence of apomyoglobin is alpha-oxyprotoheme IX O2----CO----verdohemochrome IX alpha pi-radical O2----Fe(III).biliverdin IX alpha. A similar mechanism may prevail in vivo. The hexa- and pentacoordinated Fe(II) pi-radical form of the oxyporphyrin is crucial in triggering the autoxidation of the complex to verdohemochrome IX alpha. Further oxygenation of verdohemochrome IX alpha to Fe(III).biliverdin IX alpha occurred only in the pentacoordinated apomyoglobin.verdoheme Fe(II) complex. PMID:3456152

  16. Kinetics of permeation and metabolism of alpha-tocopherol and alpha-tocopheryl acetate in micro-Yucatan pig sin.

    PubMed

    Rangarajan, M; Zatz, J L

    2001-01-01

    The objective of this research was to investigate the permeation and metabolism of alpha-tocopheryl acetate (alpha-TAc) and alpha-tocopherol (alpha-T) from solution and emulsion formulations and to delineate the kinetics of such metabolism. Simple formulations containing alpha-TAc and alpha-T were applied to fresh, viable micro-Yucatan skin dermatomed to a thickness of 250-300 microns, as a finite dose in a flow-through diffusion system. The experiments were stopped at time intervals of 2, 6, 12, and 24 hours. At the end of each time interval, the amounts removed by washing, retained in the stratum corneum (SC), and penetrated into the viable skin and receptor were determined by a validated HPLC method. Receptor concentrations were below the limit of detection. alpha-TAc underwent metabolism in pig skin to the active antioxidant alpha-T. The metabolite appeared as early as two hours after application. The extent of metabolism was highest at 6-12 hours after application. No metabolism was detected in the stratum corneum. Delivery of alpha-T from isopropyl myristate (IPM) solution was more efficient than utilization of alpha-TAc from the same solution. Approximately 1.5% of alpha-T yielded the same viable skin concentration as 5% alpha-TAc. Topical application of alpha-tocopherol or its prodrug acetate was capable of enhancing the overall antioxidant capacity of pig skin. The hydrolytic pathway of alpha-TAc leading to the active antioxidant alpha-T could possibly be saturable.

  17. Ovarian cancer-induced immunosuppression: relationship to tumor necrosis factor-alpha (TNF-alpha) release from ovarian tissue.

    PubMed

    Hassan, M I; Kassim, S K; Saeda, L; Laban, M; Khalifa, A

    1999-01-01

    Cytokines have been reported to be potential biological markers of, disease status in cancer patients. Tumor necrosis factor-alpha (TNF-alpha) is a key cytokine released from monocytes and macrophages. TNF-alpha is involved in essential biological functions such as immunoregulation, modulation of cell growth and differentiation. In this work, the role of TNF-alpha release in ovarian cancer patients was investigated. Fifty-five patients with ovarian cancer and 20 controls of matched age and parity were included in this study. TNF-alpha concentrations were measured in sera and cytosolic fractions of both groups. The results demonstrated a significant increase in TNF-alpha concentrations among patients compared to the control subjects (P < 0.001). Furthermore, a non-significant increase (P = 0.05, was observed between the different types (serous, Mucinous, and endometrioid) of epithelial ovarian cancers. Also TNF-alpha concentrations did not correlate with the disease stage. Moreover, immunohistochemical analysis of tissue specimens stained for TNF-alpha was positive in malignant lesions and negative for the normal ovarian tissue. These findings confirmed the TNF-alpha kinetics obtained by ELISA assays. Interestingly, TNF-alpha levels were also elevated in culture supernatants of PBMC stimulated by cytosolic fractions from malignant ovarian tissues. Blastogenic assays using cytosolic fractions from malignant ovarian specimens to stimulate healthy donor peripheral blood mononuclear cells (PBMC) showed a marked decrease in 3H-thymidine uptake compared to the cells stimulated by normal cytosols. To establish a cause-effect relationship between TNF-alpha release and inhibition of cell proliferation, the experiments showed that 3H-thymidine uptake by PBMC was markedly inhibited by recombinant human TNF-alpha (rh TNF-alpha) and that inhibition was significantly reversed when TNF-alpha monoclonal antibody was added to the cells. The data presented in this work indicate that

  18. Three new alpha-globin variants: Hb Itapira [alpha30(B11)Glu-->Val (alpha1)], Hb Bom Jesus Da Lapa [alpha30(B11)Glu-->Ala (alpha1)] and Hb Boa Esperança [alpha16(A14)Lys-->Thr (alpha2)].

    PubMed

    Jorge, Susan E Costa; Kimura, Elza M; Oliveira, Denise M; Ogo, Satie; Albuquerque, Dulcinéia M; Costa, Fernando F; Sonati, Maria de Fátima

    2007-01-01

    Three novel alpha-globin variants were found during a screening program for hemoglobinopathies in blood donors at the UNICAMP Hematology and Hemotherapy Center, Campinas, State of São Paulo, Southeastern Brazil. They were named for the town of origin of the carrier as Hb Itapira [alpha30(B11)Glu-->Val], Hb Bom Jesus da Lapa [alpha30(B11)Glu-->Ala] and Hb Boa Esperança [alpha16(A14)Lys-->Thr]. Hb Itapira, like Hb Bom Jesus da Lapa, shows an electrophoretic mobility similar to that of Hb S [beta6(A3)GluVal, GAG-->GTG] at alkaline pH; it is associated with a triplicate alpha-globin allele (alphaalphaalpha(anti 3.7)) and corresponds to only 5.5% of the total hemoglobin (Hb). Hb Boa Esperança, found in two different individuals, moves faster than Hb A and exhibits an abnormal functional performance.

  19. Producing a compound Nucleus via Inelastic Scattering: The 90Zr(alpha,alpha')90Zr* Case

    SciTech Connect

    Escher, J E; Dietrich, F S

    2008-05-23

    In a Surrogate reaction a compound nucleus is produced via a direct reaction (pickup, stripping, or inelastic scattering). For a proper application of the Surrogate approach it is necessary to predict the resulting angular momentum and parity distribution in the compound nucleus. A model for determining these distributions is developed for the case of inelastic alpha scattering off a spherical nucleus. The focus is on obtaining a first, simple description of the direct-reaction process that produces the compound nucleus and on providing the basis for a more complete treatment of the problem. The approximations employed in the present description are discussed and the extensions required for a more rigorous treatment of the problem are outlined. To illustrate the formalism, an application to {sup 90}Zr({alpha},{alpha}{prime}){sup 90}Zr* is presented.

  20. Tetrahydro-iso-alpha Acids Antagonize Estrogen Receptor Alpha Activity in MCF-7 Breast Cancer Cells.

    PubMed

    Lempereur, Maëlle; Majewska, Claire; Brunquers, Amandine; Wongpramud, Sumalee; Valet, Bénédicte; Janssens, Philippe; Dillemans, Monique; Van Nedervelde, Laurence; Gallo, Dominique

    2016-01-01

    Tetrahydro-iso-alpha acids commonly called THIAA or Tetra are modified hop acids extracted from hop (Humulus lupulus L.) which are frequently used in brewing industry mainly in order to provide beer bitterness and foam stability. Interestingly, molecular structure of tetrahydro-iso-alpha acids is close to a new type of estrogen receptor alpha (ERα) antagonists aimed at disrupting the binding of coactivators containing an LxxLL motif (NR-box). In this work we show that THIAA decreases estradiol-stimulated proliferation of MCF-7 (ERα-positive breast cancer cells). Besides, we show that it inhibits ERα transcriptional activity. Interestingly, this extract fails to compete with estradiol for ERα binding and does not significantly impact the receptor turnover rate in MCF-7 cells, suggesting that it does not act like classical antiestrogens. Hence, we demonstrate that THIAA is able to antagonize ERα estradiol-induced recruitment of the LxxLL binding motif. PMID:27190515

  1. Tetrahydro-iso-alpha Acids Antagonize Estrogen Receptor Alpha Activity in MCF-7 Breast Cancer Cells

    PubMed Central

    Lempereur, Maëlle; Majewska, Claire; Brunquers, Amandine; Wongpramud, Sumalee; Valet, Bénédicte; Janssens, Philippe; Dillemans, Monique; Van Nedervelde, Laurence; Gallo, Dominique

    2016-01-01

    Tetrahydro-iso-alpha acids commonly called THIAA or Tetra are modified hop acids extracted from hop (Humulus lupulus L.) which are frequently used in brewing industry mainly in order to provide beer bitterness and foam stability. Interestingly, molecular structure of tetrahydro-iso-alpha acids is close to a new type of estrogen receptor alpha (ERα) antagonists aimed at disrupting the binding of coactivators containing an LxxLL motif (NR-box). In this work we show that THIAA decreases estradiol-stimulated proliferation of MCF-7 (ERα-positive breast cancer cells). Besides, we show that it inhibits ERα transcriptional activity. Interestingly, this extract fails to compete with estradiol for ERα binding and does not significantly impact the receptor turnover rate in MCF-7 cells, suggesting that it does not act like classical antiestrogens. Hence, we demonstrate that THIAA is able to antagonize ERα estradiol-induced recruitment of the LxxLL binding motif. PMID:27190515

  2. Degradation of the human proteinase inhibitors alpha-1-antitrypsin and alpha-2-macroglobulin by Bacteroides gingivalis.

    PubMed Central

    Carlsson, J; Herrmann, B F; Höfling, J F; Sundqvist, G K

    1984-01-01

    Various strains of black-pigmented Bacteroides species were grown on horse blood agar and suspended in human serum. After various times of incubation the effect of the bacteria on the serum was evaluated by polyacrylamide gel electrophoresis and "rocket" immunoelectrophoresis. The formation of trichloroacetic acid-soluble material in the suspensions and the capacity of the treated sera to inhibit the activity of trypsin were also determined. The two tested strains of Bacteroides gingivalis (W83, H185) degraded most serum proteins, including the plasma proteinase inhibitors alpha-1-antitrypsin and alpha-2-macroglobulin. They did not, however, degrade alpha-1-antichymotrypsin. Bacteroides intermedius NCTC 9336, Bacteroides asaccharolyticus NCTC 9337, and an asaccharolytic oral strain different from B. gingivalis (BN11a-f) did not degrade the plasma proteinase inhibitors. These strains were, however, able to inactivate the capacity of serum to inhibit the activity of trypsin. Images PMID:6198282

  3. Alpha6 beta4 and alpha6 beta1 integrins in astrocytomas and other CNS tumors.

    PubMed

    Previtali, S; Quattrini, A; Nemni, R; Truci, G; Ducati, A; Wrabetz, L; Canal, N

    1996-04-01

    Laminin may alter the biological behavior of gliomas. Therefore, we investigated the expression of two laminin receptors, alpha6 beta1 and alpha6 beta4 integrins in normal brain, astrogliotic brain, and astrocytomas as compared to other central nervous system (CNS) tumors. In most CNS tumors, the expression of these integrins was unchanged in neoplastic as compared to normal counterpart cells. In contrast, increased numbers of reactive and neoplastic astrocytes expressed beta4 integrin as compared to normal astrocytes, whereas alpha6 and beta1 integrin expression did not change. Conversely, lower numbers of astrocytoma blood vessels expressed beta4, whereas all blood vessels in normal brain expressed beta4. These data suggest that the profile of laminin receptors changes in neoplastic astrocytes and in astrocytoma blood vessels; this change may play an important role in astrocytoma pathogenesis.

  4. Biochemical characterization of CK2alpha and alpha' paralogues and their derived holoenzymes: evidence for the existence of a heterotrimeric CK2alpha'-holoenzyme forming trimeric complexes.

    PubMed

    Olsen, Birgitte B; Rasmussen, Tine; Niefind, Karsten; Issinger, Olaf-Georg

    2008-09-01

    Altogether 2 holoenzymes and 4 catalytic CK2 constructs were expressed and characterized i.e. CK2alpha(2)1-335 beta2; CK2alpha'-derived holoenzyme; CK2alpha1-335; MBP-CK2alpha'; His-tagged CK2alpha and His-tagged CK2alpha'. The two His-tagged catalytic subunits were expressed in insect cells, all others in Escherichia coli. IC50 studies involving the established CK2 inhibitors DMAT, TBBt, TBBz, apigenin and emodin were carried out and the Ki values calculated. Although the differences in the Ki values found were modest, there was a general tendency showing that the CK2 holoenzymes were more sensitive towards the inhibitors than the free catalytic subunits. Thermal inactivation experiments involving the individual catalytic subunits showed an almost complete loss of activity after only 2 min at 45 degrees C. In the case of the two holoenzymes, the CK2alpha'-derived holoenzyme lost ca. 90% of its activity after 14 min, whereas CK2alpha2(1-335) beta2 only showed a loss of ca. 40% by this time of incubation. Gel filtration analyses were performed at high (500 mM) and low (150 mM) monovalent salt concentrations in the absence or presence of ATP. At 500 mM NaCl the CK2alpha'-derived holoenzyme eluted at a position corresponding to a molecular mass of 105 kDa which is significantly below the elution of the CK2alpha(2)1-335 beta2 holoenzyme (145 kDa). Calmodulin was not phosphorylated by either CK2alpha2(1-335) beta2 or the CK2alpha'-derived holoenzyme. However, in the presence of polylysine only the CK2alpha(2)1-335 beta2 holoenzyme could use calmodulin as a substrate such as the catalytic subunits, in contrast to the CK2alpha'-derived holoenzyme which only phosphorylated calmodulin weakly. This attenuation may be owing to a different structural interaction between the catalytic CK2alpha' subunit and non-catalytic CK2beta subunit.

  5. Far-Infrared and Millimeter Continuum Studies of K-Giants: Alpha Boo and Alpha Tau

    NASA Technical Reports Server (NTRS)

    Cohen, Martin; Carbon, Duane F.; Welch, William J.; Lim, Tanya; Forster, James R.; Goorvitch, David; Thigpen, William (Technical Monitor)

    2002-01-01

    We have imaged two normal, non-coronal, infrared-bright K-giants, alpha Boo and alpha Tau, in the 1.4-millimeter and 2.8-millimeter continuum using BIMA. These stars have been used as important absolute calibrators for several infrared satellites. Our goals are: (1) to probe the structure of their upper photospheres; (2) to establish whether these stars radiate as simple photospheres or possess long-wavelength chromospheres; and (3) to make a connection between millimeter-wave and far-infrared absolute flux calibrations. To accomplish these goals we also present ISO Long Wavelength Spectrometer (LWS) measurements of both these K-giants. The far-infrared and millimeter continuum radiation is produced in the vicinity of the temperature minimum in a Boo and a Tau, offering a direct test of the model photospheres and chromospheres for these two cool giants. We find that current photospheric models predict fluxes in reasonable agreement with those observed for those wavelengths which sample the upper photosphere, namely less than or equal to 170 micrometers in alpha Tau and less than or equal to 125 micrometers in alpha Boo. It is possible that alpha Tau is still radiative as far as 0.9 - 1.4 millimeters. We detect chromospheric radiation from both stars by 2.8 millimeters (by 1.4 millimeters in alpha Boo), and are able to establish useful bounds on the location of the temperature minimum. An attempt to interpret the chromospheric fluxes using the two-component "bifurcation model" proposed by Wiedemann et al. (1994) appears to lead to a significant contradiction.

  6. Pre-clinical immunogenicity of human papillomavirus alpha-7 and alpha-9 major capsid proteins.

    PubMed

    Bissett, Sara L; Mattiuzzo, Giada; Draper, Eve; Godi, Anna; Wilkinson, Dianna E; Minor, Philip; Page, Mark; Beddows, Simon

    2014-11-12

    Human papillomavirus (HPV) vaccines confer protection against the oncogenic genotypes HPV16 and HPV18 through the generation of type-specific neutralizing antibodies raised against the constituent virus-like particles (VLP) based upon the major capsid proteins (L1) of these genotypes. The vaccines also confer a degree of cross-protection against some genetically related types from the Alpha-9 (HPV16-like: HPV31, HPV33, HPV35, HPV52, HPV58) and Alpha-7 (HPV18-like: HPV39, HPV45, HPV59, HPV68) species groups. The mechanism of cross-protection is unclear but may involve antibodies capable of recognizing shared inter-genotype epitopes. The relationship(s) between the genetic and antigenic diversity of the L1 protein, particularly for non-vaccine genotypes, is poorly understood. We carried out a comprehensive evaluation of the immunogenicity of L1 VLP derived from genotypes within the Alpha-7 and Alpha-9 species groups in New Zealand White rabbits and used L1L2 pseudoviruses as the target antigens in neutralization assays. The majority antibody response against L1 VLP was type-specific, as expected, but several instances of robust cross-neutralization were nevertheless observed including between HPV33 and HPV58 within the Alpha-9 species and between HPV39, HPV59 and HPV68 in the Alpha-7 species. Immunization with an experimental tetravalent preparation comprising VLP based upon HPV16, HPV18, HPV39 and HPV58 was capable of generating neutralizing antibodies against all the Alpha-7 and Alpha-9 genotypes. Competition of HPV31 and HPV33 cross-neutralizing antibodies in the tetravalent sera confirmed that these antibodies originated from HPV16 and HPV58 VLP, respectively, and suggested that they represent minority specificities within the antibody repertoire generated by the immunizing antigen. These data improve our understanding of the antigenic diversity of the L1 protein per se and may inform the rational design of a next generation vaccine formulation based upon

  7. Pre-clinical immunogenicity of human papillomavirus alpha-7 and alpha-9 major capsid proteins

    PubMed Central

    Bissett, Sara L.; Mattiuzzo, Giada; Draper, Eve; Godi, Anna; Wilkinson, Dianna E.; Minor, Philip; Page, Mark; Beddows, Simon

    2014-01-01

    Human papillomavirus (HPV) vaccines confer protection against the oncogenic genotypes HPV16 and HPV18 through the generation of type-specific neutralizing antibodies raised against the constituent virus-like particles (VLP) based upon the major capsid proteins (L1) of these genotypes. The vaccines also confer a degree of cross-protection against some genetically related types from the Alpha-9 (HPV16-like: HPV31, HPV33, HPV35, HPV52, HPV58) and Alpha-7 (HPV18-like: HPV39, HPV45, HPV59, HPV68) species groups. The mechanism of cross-protection is unclear but may involve antibodies capable of recognizing shared inter-genotype epitopes. The relationship(s) between the genetic and antigenic diversity of the L1 protein, particularly for non-vaccine genotypes, is poorly understood. We carried out a comprehensive evaluation of the immunogenicity of L1 VLP derived from genotypes within the Alpha-7 and Alpha-9 species groups in New Zealand White rabbits and used L1L2 pseudoviruses as the target antigens in neutralization assays. The majority antibody response against L1 VLP was type-specific, as expected, but several instances of robust cross-neutralization were nevertheless observed including between HPV33 and HPV58 within the Alpha-9 species and between HPV39, HPV59 and HPV68 in the Alpha-7 species. Immunization with an experimental tetravalent preparation comprising VLP based upon HPV16, HPV18, HPV39 and HPV58 was capable of generating neutralizing antibodies against all the Alpha-7 and Alpha-9 genotypes. Competition of HPV31 and HPV33 cross-neutralizing antibodies in the tetravalent sera confirmed that these antibodies originated from HPV16 and HPV58 VLP, respectively, and suggested that they represent minority specificities within the antibody repertoire generated by the immunizing antigen. These data improve our understanding of the antigenic diversity of the L1 protein per se and may inform the rational design of a next generation vaccine formulation based upon

  8. Approximate formulation of redistribution in the Ly-alpha, Ly-beta, H-alpha system

    NASA Technical Reports Server (NTRS)

    Cooper, J.; Ballagh, R. J.; Hubeny, I.

    1989-01-01

    Simple approximate formulas are given for the coupled redistribution of Ly-alpha, Ly-beta, and H-alpha, by using well-defined approximations to an essentially exact formulation. These formulas incorporate all the essential physics including Raman scattering, lower state radiative decay, and correlated terms representing emission during a collision which must be retained in order that the emission coefficients are properly behaved in the line wings. Approximate expressions for the appropriate line broadening parameters are collected. Finally, practical expressions for the source functions are given. These are formulated through newly introduced nonimpact redistribution functions, which are shown to be reasonably approximated by existing (ordinary and generalized) redistribution functions.

  9. Alpha3* and alpha 7 nAChR-mediated Ca2+ transient generation in IMR-32 neuroblastoma cells.

    PubMed

    Ween, Hilde; Thorin-Hagene, Kirsten; Andersen, Elisabeth; Grønlien, Jens Halvard; Lee, Chih-Hung; Gopalakrishnan, Murali; Malysz, John

    2010-10-01

    Alpha3-containing (alpha 3*) and alpha 7 nicotinic acetylcholine receptors (nAChRs) are expressed in human IMR-32 neuroblastoma cells and implicated in Ca(2+) signaling. In this study, we investigated the intracellular Ca(2+) transient generation evoked by selective activation of alpha 3* (agonist potency rank order: epibatidine>varenicline>nicotine approximately cytisine) and alpha 7 (rank order in the presence of alpha 7 positive allosteric modulator or PAM: A-795723>NS6784 approximately PNU-282987) using, respectively, varenicline and NS6784 (+alpha 7 PAM) by Ca(2+) imaging. Effects of inhibitors of nAChRs (MLA and mecamylamine), ER Ca(2+) ATPase pump (CPA and thapsigargin), Ca(2+)-induced Ca(2+) release (ryanodine and dantrolene), Ca(2+) channels (nitrendipine, diltiazem, and Cd(2+)), and removal of extracellular Ca(2+) were examined. alpha 7 PAMs, when tested in the presence of NS6784, were more active when added first, followed by the agonist, than in the reverse order. Removal of extracellular Ca(2+) - but not CPA, thapsigargin, ryanodine, dantrolene, nitrendipine, diltiazem, or Cd(2+) - diminished the alpha 7 agonist-evoked Ca(2+) transients. In contrast, only diltiazem and nitrendipine and removal of extracellular Ca(2+) inhibited the alpha 3*-mediated Ca(2+) transients. The differential effect of diltiazem and nitrendipine versus Cd(2+) was due to direct inhibition of alpha 3* nAChRs as revealed by Ca(2+) imaging in HEK-293 cells expressing human alpha 3 beta 4 nAChRs and patch clamp in IMR-32 cells. In summary, this study provides evidence that alpha 3* and alpha 7 nAChR agonist-evoked global Ca(2+) transient generation in IMR-32 cells does not primarily involve voltage-dependent Ca(2+) channels, intracellular Ca(2+) stores, or Ca(2+)-induced Ca(2+) release. These mechanisms may, however, be still involved in other forms of nAChR-mediated Ca(2+) signaling.

  10. ON THE ORIGINS OF THE DIFFUSE H{alpha} EMISSION: IONIZED GAS OR DUST-SCATTERED H{alpha} HALOS?

    SciTech Connect

    Seon, Kwang-Il; Witt, Adolf N.

    2012-10-20

    It is known that the diffuse H{alpha} emission outside of bright H II regions not only are very extended, but also can occur in distinct patches or filaments far from H II regions, and the line ratios of [S II] {lambda}6716/H{alpha} and [N II] {lambda}6583/H{alpha} observed far from bright H II regions are generally higher than those in the H II regions. These observations have been regarded as evidence against the dust-scattering origin of the diffuse H{alpha} emission (including other optical lines), and the effect of dust scattering has been neglected in studies on the diffuse H{alpha} emission. In this paper, we reexamine the arguments against dust scattering and find that the dust-scattering origin of the diffuse H{alpha} emission cannot be ruled out. As opposed to the previous contention, the expected dust-scattered H{alpha} halos surrounding H II regions are, in fact, in good agreement with the observed H{alpha} morphology. We calculate an extensive set of photoionization models by varying elemental abundances, ionizing stellar types, and clumpiness of the interstellar medium (ISM) and find that the observed line ratios of [S II]/H{alpha}, [N II]/H{alpha}, and He I {lambda}5876/H{alpha} in the diffuse ISM accord well with the dust-scattered halos around H II regions, which are photoionized by late O- and/or early B-type stars. We also demonstrate that the H{alpha} absorption feature in the underlying continuum from the dust-scattered starlight ({sup d}iffuse galactic light{sup )} and unresolved stars is able to substantially increase the [S II]/H{alpha} and [N II]/H{alpha} line ratios in the diffuse ISM.

  11. Biosynthesis of alpha2(IV) and alpha1(IV) chains of collagen IV and interactions with matrix metalloproteinase-9.

    PubMed

    Toth, M; Sado, Y; Ninomiya, Y; Fridman, R

    1999-07-01

    In vitro binding studies with latent matrix metalloproteinase-9 (pro-MMP-9) have revealed the existence of nondisulfide-bonded alpha2(IV) chains on the cell surface capable of forming a high-affinity complex with the enzyme. Here we investigated the biosynthesis and cellular distribution of alpha2(IV) and alpha1(IV) chains in breast epithelial (MCF10A and MDA-MB-231) and fibrosarcoma (HT1080) cells by pulse-chase analysis followed by immunoprecipitation with chain-specific monoclonal antibodies (mAb). These studies showed that whereas the alpha1(IV) chain remained in the intracellular compartment, nondisulfide-bonded alpha2(IV) chains were secreted into the media in a stable form. Consistently, only alpha2(IV) was detected on the cell surface by surface biotinylation or indirect immunofluorescence. In agreement with the pulse-chase analysis, media subjected to co-precipitation experiments with pro-MMP-9 or pro-MMP-9-affinity chromatography followed by immunoblotting with chain-specific mAbs resulted in the detection of alpha2(IV). A preferential secretion of nondisulfide-bonded alpha2(IV) chains was also observed in CHO-K1 cells transiently transfected with full-length mouse alpha2(IV) or alpha (IV) cDNAs. However, a complex of mouse alpha1(IV) with pro-MMP-9 was coprecipitated with exogenous enzyme from lysates of CHO-K1 cells transfected with mouse alpha1(IV), suggesting that under overexpression conditions the enzyme can also interact with the alpha1 (IV) chain. Collectively, these studies further demonstrate the interactions of pro-MMP-9 with collagen IV chains and a unique processing and targeting of nondisulfide-bonded alpha2(IV) chains that may play a role in the surface/matrix association of pro-MMP-9.

  12. cap alpha. -2 adrenergic receptor: a radiohistochemical study

    SciTech Connect

    Unnerstall, J.R.

    1984-01-01

    ..cap alpha..-2 adrenergic agents have been shown to influence blood pressure, heart rate and other physiological and behavioral functions through interactions with adrenergic pathways within the central nervous system. Pharmacologically relevant ..cap alpha..-1 adrenergic receptors were biochemically characterized and radiohistochemically analyzed in intact tissue sections of the rat and human central nervous system. The anatomical distribution of the ..cap alpha..-2 receptors, labeled with the agonist (/sup 3/H)para-aminoclonidine, verified the concept that ..cap alpha..-2 receptors are closely associated with adrenergic nerve terminals and that ..cap alpha..-2 agents can influence autonomic and endocrine function through an action in the central nervous system. Since ..cap alpha..-2 agonists can influence sympathetic outflow, ..cap alpha..-2 binding sites were closely analyzed in the intermediolateral cell column of the thoracic spinal cord. The transport of putative presynaptic ..cap alpha..-2 binding sites in the rat sciatic nerve was analyzed by light microscopic radiohistochemical techniques. Finally, in intact tissue section of the rat central nervous system, the biochemical characteristics of (/sup 3/H)rauwolscine binding were analyzed. Data were also shown which indicates that the synthetic ..cap alpha..-2 antagonist (/sup 3/H)RX781094 also binds to ..cap alpha..-2 receptors with high-affinity. Further, the distribution of (/sup 3/H)RX781094 binding sites in the rat central nervous system was identical to the distribution seen when using (/sup 3/H)para-aminoclonidine.

  13. Structural differences determine the relative selectivity of nicotinic compounds for native alpha 4 beta 2*-, alpha 6 beta 2*-, alpha 3 beta 4*- and alpha 7-nicotine acetylcholine receptors.

    PubMed

    Grady, Sharon R; Drenan, Ryan M; Breining, Scott R; Yohannes, Daniel; Wageman, Charles R; Fedorov, Nikolai B; McKinney, Sheri; Whiteaker, Paul; Bencherif, Merouane; Lester, Henry A; Marks, Michael J

    2010-06-01

    Mammalian brain expresses multiple nicotinic acetylcholine receptor (nAChR) subtypes that differ in subunit composition, sites of expression and pharmacological and functional properties. Among known subtypes of receptors, alpha 4 beta 2* and alpha 6 beta 2*-nAChR have the highest affinity for nicotine (where * indicates possibility of other subunits). The alpha 4 beta 2*-nAChRs are widely distributed, while alpha 6 beta 2*-nAChR are restricted to a few regions. Both subtypes modulate release of dopamine from the dopaminergic neurons of the mesoaccumbens pathway thought to be essential for reward and addiction. alpha 4 beta 2*-nAChR also modulate GABA release in these areas. Identification of selective compounds would facilitate study of nAChR subtypes. An improved understanding of the role of nAChR subtypes may help in developing more effective smoking cessation aids with fewer side effects than current therapeutics. We have screened a series of nicotinic compounds that vary in the distance between the pyridine and the cationic center, in steric bulk, and in flexibility of the molecule. These compounds were screened using membrane binding and synaptosomal function assays, or recordings from GH4C1 cells expressing h alpha 7, to determine affinity, potency and efficacy at four subtypes of nAChRs found in brain, alpha 4 beta 2*, alpha 6 beta 2*, alpha 7 and alpha 3 beta 4*. In addition, physiological assays in gain-of-function mutant mice were used to assess in vivo activity at alpha 4 beta 2* and alpha 6 beta 2*-nAChRs. This approach has identified several compounds with agonist or partial agonist activity that display improved selectivity for alpha 6 beta 2*-nAChR.

  14. Characterization, cloning, and expression of porcine alpha B crystallin.

    PubMed

    Liao, J H; Hung, C C; Lee, J S; Wu, S H; Chiou, S H

    1998-03-01

    alpha-Crystallin is a major lens protein present in the lenses of all vertebrate species. Recent studies have revealed that bovine alpha-crystallins possess genuine chaperone activity similar to small heat-shock proteins. In order to compare this chaperone-like structural protein from the eye lenses of different mammalian species, we have cloned and expressed one of the main alpha-crystallin subunits, i.e., alpha B crystallin, from the porcine lenses in order to facilitate the structure-function evaluation and comparison of this chaperonin protein. cDNA encoding alpha B subunit chain was obtained using a new "Marathon cDNA amplification" protocol of Polymerase Chain Reaction (PCR). PCR-amplified product corresponding to alpha B subunit was then ligated into pGEM-T plasmid and prepared for nucleotide sequencing by the dideoxy-nucleotide chain-termination method. Sequencing several positive clones containing DNA inserts coding for alpha B-crystallin subunit constructed only one complete full-length reading frame of 525 base pairs similar to human and bovine alpha B subunits, covering a deduced protein sequence of 175 amino acids including the universal translation-initiating methionine. The porcine alpha B crystallin shows only 3 and 7 residues difference to bovine and human alpha B crystallins respectively, revealing the close relatedness among mammalian eye lens proteins. The sequence differences between porcine and sub-mammalian species such as chicken and bullfrog are much greater, especially at the N- and C-terminal regions of these alpha B crystallins. Expression of alpha B subunit chain in E. coli vector generated a polypeptide which can cross-react with the antiserum against the native and purified alpha B subunit from the native porcine lenses albeit with a much lower activity.

  15. Sterol synthesis. A novel reductive rearrangement of an alpha,beta-unsaturated steroidal epoxide; a new chemical synthesis of 5alpha-cholest-8(14)-en-3beta, 15alpha-diol.

    PubMed

    Parish, E J; Schroepfer, G J

    1977-04-01

    Reduction of 3beta-benzoyloxy-14alpha,15alpha-epoxy-5alpha-cholest-7-ene with either lithium triethylboro-hydride or lithium aluminum hydride (4 molar excess) gave 5-alpha-cholest-8(14)-en-3beta,15alpha-diol in high yield. Reduction of the epoxy ester with lithium triethylborodeuteride or lithium aluminum deuteride (4 molar excess) gave [7alpha-2-H]-5alpha-cholest-8(14)-en-3beta,15alpha-diol. Reduction of 2beta-benzoyloxy-14alpha,15alpha-epoxy-5alpha-cholest-7-ene with a large excess (24 molar excess) of lithium aluminum hydride gave, in addition to the expected 5alpha-cholest-8(14)-en-3beta,15alpha-diol, a significant yield (33%) of 5alpha-cholest-8(14)-en-3beta-o1. Reduction of the epoxy ester with a large excess (24 molar excess) of lithium aluminum deuteride gave [7alpha-2H]-5alpha-cholest-8(14)-en-3beta,15alpha-diol and 5alpha-cholest-8(14)-en-3beta-o1 which contained two atoms of stably bound deuterium. PMID:858170

  16. Alpha resonant scattering for astrophysical reaction studies

    NASA Astrophysics Data System (ADS)

    Yamaguchi, H.; Kahl, D.; Nakao, T.; Wakabayashi, Y.; Kubano, S.; Hashimoto, T.; Hayakawa, S.; Kawabata, T.; Iwasa, N.; Teranishi, T.; Kwon, Y. K.; Binh, D. N.; Khiem, L. H.; Duy, N. G.

    2014-05-01

    Several alpha-induced astrophysical reactions have been studied at CRIB (CNS Radioactive Ion Beam separator), which is a low-energy RI beam separator at Center for Nuclear Study (CNS) of the University of Tokyo. One of the methods to study them is the α resonant scattering using the thick-target method in inverse kinematics. Among the recent studies at CRIB, the measurement of 7Be+α resonant scattering is discussed. Based on the result of the experiment, we evaluated the contributions of high-lying resonances for the 7Be(α,γ) reaction, and proposed a new cluster band in 11C.

  17. Towards antihydrogen trapping and spectroscopy at ALPHA

    NASA Astrophysics Data System (ADS)

    Butler, E.; Andresen, G. B.; Ashkezari, M. D.; Baquero-Ruiz, M.; Bertsche, W.; Bowe, P. D.; Bray, C. C.; Cesar, C. L.; Chapman, S.; Charlton, M.; Fajans, J.; Friesen, T.; Fujiwara, M. C.; Gill, D. R.; Hangst, J. S.; Hardy, W. N.; Hayano, R. S.; Hayden, M. E.; Humphries, A. J.; Hydomako, R.; Jonsell, S.; Kurchaninov, L.; Lambo, R.; Madsen, N.; Menary, S.; Nolan, P.; Olchanski, K.; Olin, A.; Povilus, A.; Pusa, P.; Robicheaux, F.; Sarid, E.; Silveira, D. M.; So, C.; Storey, J. W.; Thompson, R. I.; van der Werf, D. P.; Wilding, D.; Wurtele, J. S.; Yamazaki, Y.

    2011-07-01

    Spectroscopy of antihydrogen has the potential to yield high-precision tests of the CPT theorem and shed light on the matter-antimatter imbalance in the Universe. The ALPHA antihydrogen trap at CERN's Antiproton Decelerator aims to prepare a sample of antihydrogen atoms confined in an octupole-based Ioffe trap and to measure the frequency of several atomic transitions. We describe our techniques to directly measure the antiproton temperature and a new technique to cool them to below 10 K. We also show how our unique position-sensitive annihilation detector provides us with a highly sensitive method of identifying antiproton annihilations and effectively rejecting the cosmic-ray background.

  18. [DNA diagnosis of alpha-herpesvirinae infection].

    PubMed

    Hondo, R; Ito, S

    2000-04-01

    Herpesviruses have a characteristic of the latency after the primary infection. Advanced study on the causal relation between the reactivation of latent virus and the appearance of the symptoms would need both of the detection of viral genome by the DNA diagnosis method and the analysis of the kinetics of the virus. We developed a new quantitative method for the detection and the titration of copy number in the viral genome using the combination of polymerase chain reaction and microplate hybridization. The availability of the method was confirmed by the several cases of alpha-herpesvirinae infections.

  19. Expression of human. alpha. -fetoprotein in yeast

    SciTech Connect

    Yamamoto, Ritsu; Sakamoto, Takashi; Nishi, Shinzo; Sakai, Masaharu; Morinaga, Tomonori; Tamaoki, Taiki Univ. of Calgary, Alberta )

    1990-01-01

    Human {alpha}-fetoprotein (AFP) was expressed in Saccharomyces cerevisiae, with a plasmid containing the cDNA sequence for human AFP fused with the rat AFP signal peptide. The recombinant AFP was purified from the yeast lysate by DEAE-cellulose and immunoaffinity chromatography. The amino acid composition and the molecular weight of the recombinant AFP were similar to those of hepatoma AFP. N-terminal amino acids sequence analysis indicated that the signal peptide had been processed. The recombinant and hepatoma AFP reacted identically in Ouchterlony immunodiffusion and radioimmunoassay tests. These observations indicated that the yeast recombinant protein had the properties of native AFP.

  20. Robust Hypothesis Testing with alpha -Divergence

    NASA Astrophysics Data System (ADS)

    Gul, Gokhan; Zoubir, Abdelhak M.

    2016-09-01

    A robust minimax test for two composite hypotheses, which are determined by the neighborhoods of two nominal distributions with respect to a set of distances - called $\\alpha-$divergence distances, is proposed. Sion's minimax theorem is adopted to characterize the saddle value condition. Least favorable distributions, the robust decision rule and the robust likelihood ratio test are derived. If the nominal probability distributions satisfy a symmetry condition, the design procedure is shown to be simplified considerably. The parameters controlling the degree of robustness are bounded from above and the bounds are shown to be resulting from a solution of a set of equations. The simulations performed evaluate and exemplify the theoretical derivations.

  1. Expansion-cooled Lyman-alpha clouds

    NASA Astrophysics Data System (ADS)

    Duncan, Robert C.; Vishniac, Ethan T.; Ostriker, Jeremiah P.

    1991-02-01

    It is shown that recent observations by Pettini et al. (1990) which indicate that low-N H I Ly-alpha forest lines have small velocity widths and that the velocity widths are positively correlated with N (H I) can be understood as the result of adiabatic cooling of expanding clouds. It is argued that expansion cooling can efficiently lower temperatures and velocity widths of diffuse ionized clouds, and that this trend of diminishing temperature and velocity width in a wide range of plausible cloud models is consistent with double-quasar data. Expansion can provide a natural explanation for the steep z-evolution of the cloud numbers.

  2. Spectrometer for rare alpha-decay events

    SciTech Connect

    Kuznetsov, A.N.; Kushniruk, V.F.; Nefed'ev, O.K.; Rykhlyuk, A.V.; Subbotin, V.G.; Tomin, V.I.; Kharitonov, Yu.P.; Tsyganov, Yu.S.

    1987-07-01

    A low-background alpha spectrometer with 4..pi.. registration geometry is described. Use of time measurements reduces the background level in the region of 6-7 MeV to 0.02-0.03 counts/day. For two detectors 20 mm in diameter located at a distance of 1 mm from one another in registration of decay of /sup 223/Ra applied to the surface of one of the detectors, the decay efficiency is 0.82 +/- 0.04. The resolution for the 3.18-MeV line is 60 keV.

  3. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  4. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  5. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  6. Alpha particle collective Thomson scattering in TFTR

    SciTech Connect

    Machuzak, J.S.; Woskov, P.P.; Rhee, D.Y.; Gilmore, J.; Bretz, N.L.; Park, H.K.; Aamodt, R.E.; Cheung, P.Y.; Russell, D.A.; Bindslev, H.

    1993-11-01

    A collective Thomson scattering diagnostic is being implemented on TFTR to measure alpha particle, energetic and thermal ion densities and velocity distributions. A 60 GHz, 0.1-1 kW gyrotron will be used as the transmitter source, and the scattering geometry will be perpendicular to the magnetic field in the extraordinary mode polarization. An enhanced scattered signal is anticipated from fluctuations in the lower hybrid frequency range with this scattering geometry. Millimeter wave collective Thomson scattering diagnostics have the advantage of larger scattering angles to decrease the amount of stray light, and long, high power, modulated pulses to obtain improved signal to noise through synchronous detection techniques.

  7. Alpha resonant scattering for astrophysical reaction studies

    SciTech Connect

    Yamaguchi, H.; Kahl, D.; Nakao, T.; Wakabayashi, Y.; Kubano, S.; Hashimoto, T.; Hayakawa, S.; Kawabata, T.; Iwasa, N.; Teranishi, T.; Kwon, Y. K.; Binh, D. N.; Khiem, L. H.; Duy, N. G.

    2014-05-02

    Several alpha-induced astrophysical reactions have been studied at CRIB (CNS Radioactive Ion Beam separator), which is a low-energy RI beam separator at Center for Nuclear Study (CNS) of the University of Tokyo. One of the methods to study them is the α resonant scattering using the thick-target method in inverse kinematics. Among the recent studies at CRIB, the measurement of {sup 7}Be+α resonant scattering is discussed. Based on the result of the experiment, we evaluated the contributions of high-lying resonances for the {sup 7}Be(α,γ) reaction, and proposed a new cluster band in {sup 11}C.

  8. Molecular Dynamics Simulations of Alpha-synuclein

    NASA Astrophysics Data System (ADS)

    Sammalkorpi, Maria; Schreck, Carl; Nath, Abhinav; Dewitt, David; Rhoades, Elizabeth; O'Hern, Corey

    2011-03-01

    We investigate the conformational dynamics of single alpha-synuclein proteins, which have been implicated in amyloid diseases such as Parkinson's and Alzheimer's disease, in solution using unconstrained and constrained all-atom, explicit solvent molecular dynamics simulations. The constraints on inter-residue separations are obtained from our single-molecule FRET measurements of eleven FRET pairs that span the protein. By comparing the simulation data satisfying different combinations of FRET constraints, we are able to identify those constraints that are most important in determining the radius of gyration and key features of the contact map of the protein.

  9. Alpha Channeling in a Rotating Plasma

    SciTech Connect

    Abraham J. Fetterman and Nathaniel J. Fisch

    2008-09-23

    The wave-particle α-channeling effect is generalized to include rotating plasma. Specifically, radio frequency waves can resonate with α particles in a mirror machine with E × B rotation to diffuse the α particles along constrained paths in phase space. Of major interest is that the α-particle energy, in addition to amplifying the RF waves, can directly enhance the rotation energy which in turn provides additional plasma confinement in centrifugal fusion reactors. An ancillary benefit is the rapid removal of alpha particles, which increases the fusion reactivity.

  10. [Alpha Fetoprotein-producing Lung Adenocarcinoma].

    PubMed

    Komori, Kazuyuki; Tabata, Toshiharu; Sato, Kimiaki; Katsumata, Hiroshi; Minowa, Muneo; Kondo, Takashi

    2015-11-01

    We report a case of alpha fetoprotein (AFP) -producing lung adenocarcinoma. A 53-year-old man was referred to our hospital due to right pneumothorax. Computed tomography showed right moderate pneumothorax, a solid tumor in the upper lobe (S3) and mediastinal lymph node swelling. The serum AFP level was as high as 223.0 ng/ml. Frozen examination revealed a low-differentiated adenocarcinoma. Based on the pathological and immunohistochemical findings, the tumor was diagnosed as AFP-producing lung adenocarcinoma.

  11. Characterization of the alpha-gamma and alpha-beta complex: evidence for an in vivo functional role of alpha-crystallin as a molecular chaperone

    NASA Technical Reports Server (NTRS)

    Boyle, D.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Previous studies have demonstrated that in vitro, alpha-crystallin can protect other lens proteins against extensive denaturation and aggregation. The mechanism of this protection involves preferential binding of the partially denatured protein to a central region of the native alpha-crystallin complex. To test whether a similar phenomenon might occur in vivo, a high molecular weight aggregate (HMWA) fraction was isolated from the aged bovine lens. Negative staining of this preparation revealed the presence of particles of 13-14 nm diameter, characteristic of alpha-crystallin. Immunolocalization of the same particles using antiserum specific for gamma- and beta-crystallins demonstrated preferential binding of these crystallins to the central region of the alpha-crystallin complex. Together, these results provide evidence that in the intact lens, the alpha-crystallins are functionally important molecular chaperones.

  12. A neuronal nicotinic acetylcholine receptor subunit (alpha 7) is developmentally regulated and forms a homo-oligomeric channel blocked by alpha-BTX.

    PubMed

    Couturier, S; Bertrand, D; Matter, J M; Hernandez, M C; Bertrand, S; Millar, N; Valera, S; Barkas, T; Ballivet, M

    1990-12-01

    cDNA and genomic clones encoding alpha 7, a novel neuronal nicotinic acetylcholine receptor (nAChR) alpha subunit, were isolated and sequenced. The mature alpha 7 protein (479 residues) has moderate homology with all other alpha and non-alpha nAChR subunits and probably assumes the same transmembrane topology. alpha 7 transcripts transiently accumulate in the developing optic tectum between E5 and E16. They are present in both the deep and the superficial layers of E12 tectum. In Xenopus oocytes, the alpha 7 protein assembles into a homo-oligomeric channel responding to acetylcholine and nicotine. The alpha 7 channel desensitizes very rapidly, rectifies strongly above -20 mV, and is blocked by alpha-bungarotoxin. A bacterial fusion protein encompassing residues 124-239 of alpha 7 binds labeled alpha-bungarotoxin. We conclude that alpha-bungarotoxin binding proteins in the vertebrate nervous system can function as nAChRs.

  13. Development of CD8 alpha/beta + TCR alpha beta intestinal intraepithelial lymphocytes in athymic nu/nu mice and participation in regional immune responses.

    PubMed Central

    Emoto, M; Emoto, Y; Kaufmann, S H

    1996-01-01

    On the basis of the CD8 coreceptor expression, T-cell receptor (TCR)alpha beta-bearing intestinal intraepithelial lymphocytes (i-IEL) segregate into two populations. The CD8 alpha alpha + TCR alpha beta i-IEL develop thymus independently, whereas the CD8 alpha beta + TCR alpha beta i-IEL are generally considered to be thymus dependent. Flow cytometry analysis revealed a distinct population of CD8 alpha beta + TCR alpha beta i-IEL in individual athymic nu/nu mice. The i-IEL encompassing CD8 alpha beta + TCR alpha beta cells expressed potent cytolytic and interferon-gamma-producing activities. These findings demonstrate that CD8 alpha beta + TCR alpha beta i-IEL can develop in nu/nu mice independently from a functional thymus and suggest that these cells, directly or indirectly, perform biological functions in the gut. PMID:8881753

  14. The Alpha-1A Adrenergic Receptor in the Rabbit Heart.

    PubMed

    Thomas, R Croft; Cowley, Patrick M; Singh, Abhishek; Myagmar, Bat-Erdene; Swigart, Philip M; Baker, Anthony J; Simpson, Paul C

    2016-01-01

    The alpha-1A-adrenergic receptor (AR) subtype is associated with cardioprotective signaling in the mouse and human heart. The rabbit is useful for cardiac disease modeling, but data on the alpha-1A in the rabbit heart are limited. Our objective was to test for expression and function of the alpha-1A in rabbit heart. By quantitative real-time reverse transcription PCR (qPCR) on mRNA from ventricular myocardium of adult male New Zealand White rabbits, the alpha-1B was 99% of total alpha-1-AR mRNA, with <1% alpha-1A and alpha-1D, whereas alpha-1A mRNA was over 50% of total in brain and liver. Saturation radioligand binding identified ~4 fmol total alpha-1-ARs per mg myocardial protein, with 17% alpha-1A by competition with the selective antagonist 5-methylurapidil. The alpha-1D was not detected by competition with BMY-7378, indicating that 83% of alpha-1-ARs were alpha-1B. In isolated left ventricle and right ventricle, the selective alpha-1A agonist A61603 stimulated a negative inotropic effect, versus a positive inotropic effect with the nonselective alpha-1-agonist phenylephrine and the beta-agonist isoproterenol. Blood pressure assay in conscious rabbits using an indwelling aortic telemeter showed that A61603 by bolus intravenous dosing increased mean arterial pressure by 20 mm Hg at 0.14 μg/kg, 10-fold lower than norepinephrine, and chronic A61603 infusion by iPRECIO programmable micro Infusion pump did not increase BP at 22 μg/kg/d. A myocardial slice model useful in human myocardium and an anthracycline cardiotoxicity model useful in mouse were both problematic in rabbit. We conclude that alpha-1A mRNA is very low in rabbit heart, but the receptor is present by binding and mediates a negative inotropic response. Expression and function of the alpha-1A in rabbit heart differ from mouse and human, but the vasopressor response is similar to mouse. PMID:27258143

  15. The Alpha-1A Adrenergic Receptor in the Rabbit Heart

    PubMed Central

    Myagmar, Bat-Erdene; Swigart, Philip M.; Baker, Anthony J.; Simpson, Paul C.

    2016-01-01

    The alpha-1A-adrenergic receptor (AR) subtype is associated with cardioprotective signaling in the mouse and human heart. The rabbit is useful for cardiac disease modeling, but data on the alpha-1A in the rabbit heart are limited. Our objective was to test for expression and function of the alpha-1A in rabbit heart. By quantitative real-time reverse transcription PCR (qPCR) on mRNA from ventricular myocardium of adult male New Zealand White rabbits, the alpha-1B was 99% of total alpha-1-AR mRNA, with <1% alpha-1A and alpha-1D, whereas alpha-1A mRNA was over 50% of total in brain and liver. Saturation radioligand binding identified ~4 fmol total alpha-1-ARs per mg myocardial protein, with 17% alpha-1A by competition with the selective antagonist 5-methylurapidil. The alpha-1D was not detected by competition with BMY-7378, indicating that 83% of alpha-1-ARs were alpha-1B. In isolated left ventricle and right ventricle, the selective alpha-1A agonist A61603 stimulated a negative inotropic effect, versus a positive inotropic effect with the nonselective alpha-1-agonist phenylephrine and the beta-agonist isoproterenol. Blood pressure assay in conscious rabbits using an indwelling aortic telemeter showed that A61603 by bolus intravenous dosing increased mean arterial pressure by 20 mm Hg at 0.14 μg/kg, 10-fold lower than norepinephrine, and chronic A61603 infusion by iPRECIO programmable micro Infusion pump did not increase BP at 22 μg/kg/d. A myocardial slice model useful in human myocardium and an anthracycline cardiotoxicity model useful in mouse were both problematic in rabbit. We conclude that alpha-1A mRNA is very low in rabbit heart, but the receptor is present by binding and mediates a negative inotropic response. Expression and function of the alpha-1A in rabbit heart differ from mouse and human, but the vasopressor response is similar to mouse. PMID:27258143

  16. The complete cDNA sequence of laminin alpha 4 and its relationship to the other human laminin alpha chains.

    PubMed

    Richards, A; Al-Imara, L; Pope, F M

    1996-06-15

    We previously localised the gene (LAMA4) encoding a novel laminin alpha 4 chain to chromosome 6q21. In this study, we describe the complete coding sequence and compare the protein with the other three known human laminin alpha chains. Although closely linked to LAMA2, the LAMA4 product most closely resembles laminin alpha 3, a constituent of laminin 5. Like laminin alpha 3A, the alpha 4 chain is a truncated version of the alpha 1 and alpha 2 chains, with a much reduced short arm. While the alpha 4 molecule is most similar to alpha 3, it shares some features of the C-terminal domains G4 and G5 in common with alpha 2. Unlike the LAMA3 gene, LAMA4 appears to encode only a single transcript, as determined by 5' rapid amplification of cDNA ends. The cDNA sequence encodes 1816 amino acids, which include a 24-residue signal peptide. The gene is expressed in skin, placenta, heart, lung, skeletal muscle, and pancreas. We have also shown that the mRNA can be readily reverse transcribed and amplified from cultured dermal fibroblasts. PMID:8706685

  17. alpha-decay half-lives and Q{sub a}lpha values of superheavy nuclei

    SciTech Connect

    Dong Jianmin; Zuo Wei; Gu Jianzhong; Wang Yanzhao; Peng Bangbao

    2010-06-15

    The alpha-decay half-lives of recently synthesized superheavy nuclei (SHN) are investigated by employing a unified fission model (UFM) where a new method to calculate the assault frequency of alpha emission is used. The excellent agreement with the experimental data indicates the UFM is a useful tool to investigate these alpha decays. It is found that the alpha-decay half-lives become more and more insensitive to the Q{sub a}lpha values as the atomic number increases on the whole, which is favorable for us to predict the half-lives of SHN. In addition, a formula is proposed to compute the Q{sub a}lpha values for the nuclei with Z>=92 and N>=140 with a good accuracy, according to which the long-lived SHN should be neutron rich. Several weeks ago, two isotopes of a new element with atomic number Z=117 were synthesized and their alpha-decay chains have been observed. The Q{sub a}lpha formula is found to work well for these nuclei, confirming its predictive power. The experimental half-lives are well reproduced by employing the UFM with the experimental Q{sub a}lpha values. This fact that the experimental half-lives are compatible with experimental Q{sub a}lpha values supports the synthesis of a new element 117 and the experimental measurements to a certain extent.

  18. Characterization and functional properties of the alpha-amylase inhibitor (alpha-AI) from kidney bean (Phaseolus vulgaris) seeds.

    PubMed

    Le Berre-Anton, V; Bompard-Gilles, C; Payan, F; Rougé, P

    1997-11-14

    Alpha-amylase inhibitor (alpha-AI) from kidney bean (Phaseolus vulgaris L. cv Tendergreen) seeds has been purified to homogeneity by heat treatment in acidic medium, ammonium sulphate fractionation, chromatofocusing and gel filtration. Two isoforms, alpha-AI1 and alpha-AI1', of 43 kDa have been isolated which differ from each other by their isoelectric points and neutral sugar contents. The major isoform alpha-AI1 inhibited human and porcine pancreatic alpha-amylases (PPA) but was devoid of activity on alpha-amylases of bacterial or fungal origins. As shown on the Lineweaver-Burk plots, the nature of the inhibition is explained by a mixed non-competitive inhibition mechanism. Alpha-AI1 formed a 1:2 stoichiometric complex with PPA which showed an optimum pH of 4.5 at 30 degrees C. Owing to the low optimum pH found for alpha-AI activity, inhibitor-containing diets such as beans or transgenic plants expressing alpha-AI should be devoid of any harmful effect on human health. PMID:9428656

  19. A cis-proline in alpha-hemoglobin stabilizing protein directs the structural reorganization of alpha-hemoglobin.

    PubMed

    Gell, David A; Feng, Liang; Zhou, Suiping; Jeffrey, Philip D; Bendak, Katerina; Gow, Andrew; Weiss, Mitchell J; Shi, Yigong; Mackay, Joel P

    2009-10-23

    alpha-Hemoglobin (alphaHb) stabilizing protein (AHSP) is expressed in erythropoietic tissues as an accessory factor in hemoglobin synthesis. AHSP forms a specific complex with alphaHb and suppresses the heme-catalyzed evolution of reactive oxygen species by converting alphaHb to a conformation in which the heme is coordinated at both axial positions by histidine side chains (bis-histidyl coordination). Currently, the detailed mechanism by which AHSP induces structural changes in alphaHb has not been determined. Here, we present x-ray crystallography, NMR spectroscopy, and mutagenesis data that identify, for the first time, the importance of an evolutionarily conserved proline, Pro(30), in loop 1 of AHSP. Mutation of Pro(30) to a variety of residue types results in reduced ability to convert alphaHb. In complex with alphaHb, AHSP Pro(30) adopts a cis-peptidyl conformation and makes contact with the N terminus of helix G in alphaHb. Mutations that stabilize the cis-peptidyl conformation of free AHSP, also enhance the alphaHb conversion activity. These findings suggest that AHSP loop 1 can transmit structural changes to the heme pocket of alphaHb, and, more generally, highlight the importance of cis-peptidyl prolyl residues in defining the conformation of regulatory protein loops.

  20. Solution conformation of alpha-conotoxin GIC, a novel potent antagonist of alpha3beta2 nicotinic acetylcholine receptors.

    PubMed Central

    Chi, Seung-Wook; Kim, Do-Hyoung; Olivera, Baldomero M; McIntosh, J Michael; Han, Kyou-Hoon

    2004-01-01

    Alpha-conotoxin GIC is a 16-residue peptide isolated from the venom of the cone snail Conus geographus. Alpha-conotoxin GIC potently blocks the alpha3beta2 subtype of human nicotinic acetylcholine receptor, showing a high selectivity for neuronal versus muscle subtype [McIntosh, Dowell, Watkins, Garrett, Yoshikami, and Olivera (2002) J. Biol. Chem. 277, 33610-33615]. We have now determined the three-dimensional solution structure of alpha-conotoxin GIC by NMR spectroscopy. The structure of alpha-conotoxin GIC is well defined with backbone and heavy atom root mean square deviations (residues 2-16) of 0.53 A and 0.96 A respectively. Structure and surface comparison of alpha-conotoxin GIC with the other alpha4/7 subfamily conotoxins reveals unique structural aspects of alpha-conotoxin GIC. In particular, the structural comparison between alpha-conotoxins GIC and MII indicates molecular features that may confer their similar receptor specificity profile, as well as those that provide the unique binding characteristics of alpha-conotoxin GIC. PMID:14992691

  1. Taraxacum officinale induces cytotoxicity through TNF-alpha and IL-1alpha secretion in Hep G2 cells.

    PubMed

    Koo, Hyun-Na; Hong, Seung-Heon; Song, Bong-Keun; Kim, Cheorl-Ho; Yoo, Young-Hyun; Kim, Hyung-Min

    2004-01-16

    Taraxacum officinale (TO) has been frequently used as a remedy for women's disease (e.g. breast and uterus cancer) and disorders of the liver and gallbladder. Several earlier studies have indicated that TO exhibits anti-tumor properties, but its mechanism remains to be elucidated. In this study, we investigated the effect of TO on the cytotoxicity and production of cytokines in human hepatoma cell line, Hep G2. Our results show that TO decreased the cell viability by 26%, and significantly increased the tumor necrosis factor (TNF)-alpha and interleukin (IL)-1alpha production compared with media control (about 1.6-fold for TNF-alpha, and 2.4-fold for IL-1alpha, P < 0.05). Also, TO strongly induced apoptosis of Hep G2 cells as determined by flow cytometry. Increased amounts of TNF-alpha and IL-1alpha contributed to TO-induced apoptosis. Anti-TNF-alpha and IL-1alpha antibodies almost abolished it. These results suggest that TO induces cytotoxicity through TNF-alpha and IL-1alpha secretion in Hep G2 cells.

  2. Experimental and theoretical electron density distribution of alpha,alpha-trehalose dihydrate.

    PubMed

    Stevens, Edwin D; Dowd, Michael K; Johnson, Glenn P; French, Alfred D

    2010-07-01

    alpha,alpha-Trehalose is of interest because of its cryoprotective and antidessicant properties, and because it possesses various technical anomalies such as (13)C NMR spectra that give misleading indications of intramolecular structural symmetry. It is a non-reducing disaccharide, with the glycosidic oxygen atom shared by the anomeric carbon atoms of the two glucose rings, and is therefore subject to a proposed 'overlapping'exo-anomeric effect. We report here a study of the electron density of trehalose with X-ray diffraction and quantum mechanics calculations, similar to a recent study of sucrose, also a non-reducing molecule. In particular we studied the electron density around the glycosidic linkage and the hydrogen bonding with both deformation density and Atoms in Molecules (AIM) analyses. A total of 129,952 single crystal X-ray intensity measurements were collected on alpha,alpha-trehalose dihydrate to a resolution of sintheta/lambda=1.18A(-1) at 100K and refined with an aspherical multipole model to a final agreement factor of R(1)=0.0160. Wavefunctions were calculated at three levels of theory. Redistribution of electron density due to anomeric effects was reduced in trehalose, compared to sucrose. Five new C-Hcdots, three dots, centeredO hydrogen bonds were confirmed with bond critical points and bond paths from AIM analyses, as were the previously proposed O-Hcdots, three dots, centeredO hydrogen bonds. PMID:20381017

  3. Tumor Necrosis Factor alpha (TNF{alpha}) regulates CD40 expression through SMAR1 phosphorylation

    SciTech Connect

    Singh, Kamini; Sinha, Surajit; Malonia, Sunil Kumar; Chattopadhyay, Samit

    2010-01-08

    CD40 plays an important role in mediating inflammatory response and is mainly induced by JAK/STAT phosphorylation cascade. TNF{alpha} is the key cytokine that activates CD40 during inflammation and tumorigenesis. We have earlier shown that SMAR1 can repress the transcription of Cyclin D1 promoter by forming a HDAC1 dependent repressor complex. In this study, we show that SMAR1 regulates the transcription of NF-{kappa}B target gene CD40. SMAR1 recruits HDAC1 and forms a repressor complex on CD40 promoter and keeps its basal transcription in check. Further, we show that TNF{alpha} stimulation induces SMAR1 phosphorylation at Ser-347 and promotes its cytoplasmic translocation, thus releasing its negative effect. Concomitantly, TNF{alpha} induced phosphorylation of STAT1 at Tyr-701 by JAK1 facilitates its nuclear translocation and activation of CD40 through p300 recruitment and core Histone-3 acetylation. Thus, TNF{alpha} mediated regulation of CD40 expression occurs by dual phosphorylation of SMAR1 and STAT1.

  4. Aqueous chemical growth of alpha-Fe2O3-alpha-Cr203 nanocompositethin films

    SciTech Connect

    Vayssieres, Lionel; Guo, Jinghua; Nordgren, Joseph

    2001-06-30

    We are reporting here on the inexpensive fabrication and optical properties of an iron(III) oxide chromium(III) oxide nanocomposite thin film of corundum crystal structure. Its novel and unique-designed architecture consists of uniformed, well-defined and oriented nanorods of Hematite (alpha-Fe2O3) of 50 nm in diameter and 500nm in length and homogeneously distributed nonaggregated monodisperse spherical nanoparticles of Eskolaite (alpha-Cr2O3) of 250 nm in diameter. This alpha-Fe2O3 alpha-Cr2O3 nanocomposite thin film is obtained by growing, directly onto transparent polycrystalline conducting substrate, an oriented layer of hematite nanorods and growing subsequently, the eskolaite layer. The synthesis is carried out by a template-free, low-temperature, multilayer thin film coating process using aqueous solution of metal salts as precursors. Almost 100 percent of the light is absorbed by the composite film between 300 and 525 nm and 40 percent at 800 nm which yields great expectations as photoanode materials for photovoltaic cells and photocatalytic devices.

  5. Arachidonic acid mediates the formation of abundant alpha-helical multimers of alpha-synuclein

    NASA Astrophysics Data System (ADS)

    Iljina, Marija; Tosatto, Laura; Choi, Minee L.; Sang, Jason C.; Ye, Yu; Hughes, Craig D.; Bryant, Clare E.; Gandhi, Sonia; Klenerman, David

    2016-09-01

    The protein alpha-synuclein (αS) self-assembles into toxic beta-sheet aggregates in Parkinson’s disease, while it is proposed that αS forms soluble alpha-helical multimers in healthy neurons. Here, we have made αS multimers in vitro using arachidonic acid (ARA), one of the most abundant fatty acids in the brain, and characterized them by a combination of bulk experiments and single-molecule Fӧrster resonance energy transfer (sm-FRET) measurements. The data suggest that ARA-induced oligomers are alpha-helical, resistant to fibril formation, more prone to disaggregation, enzymatic digestion and degradation by the 26S proteasome, and lead to lower neuronal damage and reduced activation of microglia compared to the oligomers formed in the absence of ARA. These multimers can be formed at physiologically-relevant concentrations, and pathological mutants of αS form less multimers than wild-type αS. Our work provides strong biophysical evidence for the formation of alpha-helical multimers of αS in the presence of a biologically relevant fatty acid, which may have a protective role with respect to the generation of beta-sheet toxic structures during αS fibrillation.

  6. Arachidonic acid mediates the formation of abundant alpha-helical multimers of alpha-synuclein

    PubMed Central

    Iljina, Marija; Tosatto, Laura; Choi, Minee L.; Sang, Jason C.; Ye, Yu; Hughes, Craig D.; Bryant, Clare E.; Gandhi, Sonia; Klenerman, David

    2016-01-01

    The protein alpha-synuclein (αS) self-assembles into toxic beta-sheet aggregates in Parkinson’s disease, while it is proposed that αS forms soluble alpha-helical multimers in healthy neurons. Here, we have made αS multimers in vitro using arachidonic acid (ARA), one of the most abundant fatty acids in the brain, and characterized them by a combination of bulk experiments and single-molecule Fӧrster resonance energy transfer (sm-FRET) measurements. The data suggest that ARA-induced oligomers are alpha-helical, resistant to fibril formation, more prone to disaggregation, enzymatic digestion and degradation by the 26S proteasome, and lead to lower neuronal damage and reduced activation of microglia compared to the oligomers formed in the absence of ARA. These multimers can be formed at physiologically-relevant concentrations, and pathological mutants of αS form less multimers than wild-type αS. Our work provides strong biophysical evidence for the formation of alpha-helical multimers of αS in the presence of a biologically relevant fatty acid, which may have a protective role with respect to the generation of beta-sheet toxic structures during αS fibrillation. PMID:27671749

  7. Tumor necrosis factor-alpha antagonist-induced sarcoidosis.

    PubMed

    Clementine, Rochelle Robicheaux; Lyman, Justin; Zakem, Jerald; Mallepalli, Jyothi; Lindsey, Stephen; Quinet, Robert

    2010-09-01

    Sarcoidosis is a multisystem granulomatous disease of unknown etiology. Tumor necrosis factor (TNF)-alpha is an important player in granuloma formation, and recent clinical trials have investigated the efficacy of TNF-alpha inhibitors in sarcoidosis. Paradoxically, there are several case reports in the medical literature describing the development of sarcoidosis in patients treated with TNF-alpha inhibitors. We describe 3 cases of TNF-alpha antagonist-induced sarcoidosis: 1 case of pulmonary, ocular and cutaneous sarcoidosis developing in a patient receiving infliximab for erosive rheumatoid arthritis, 1 case of etanercept-induced sarcoidosis in a patient with seronegative rheumatoid arthritis, and 1 case of sarcoidosis developing in a patient receiving etanercept for erosive rheumatoid arthritis. We also provide a brief discussion on the role of TNF alpha in granuloma formation and implications in the use of TNF-alpha antagonists in autoimmune disease.

  8. Turbulent transport of alpha particles in reactor plasmas

    SciTech Connect

    Estrada-Mila, C.; Candy, J.; Waltz, R. E.

    2006-11-15

    A systematic study of the behavior of energetic ions in reactor plasmas is presented. Using self-consistent gyrokinetic simulations, in concert with an analytic asymptotic theory, it is found that alpha particles can interact significantly with core ion-temperature-gradient turbulence. Specifically, the per-particle flux of energetic alphas is comparable to the per-particle flux of thermal species (deuterium or helium ash). This finding opposes the conventional wisdom that energetic ions, because of their large gyroradii, do not interact with the turbulence. For the parameters studied, a turbulent modification of the alpha-particle density profile appears to be stronger than turbulent modification of the alpha-particle pressure profile. Crude estimates indicate that the alpha density modification, which is directly proportional to the core turbulence intensity, could be in the range of 15% at midradius in a reactor. The corresponding modification of the alpha-particle pressure profile is predicted to be smaller (in the 1% range)

  9. Technical Equivalency Documentation for a New Alpha Spectroscopy System

    SciTech Connect

    Hickman, D P; Fisher, S K; Zeman, R A; Hann, P R

    2005-04-05

    The response of a new Canberra{trademark} Alpha Analyst (Chamber No.'s 101-124) used by the Hazards Control, Radiation Safety Section, WBC/Spectroscopy Team has been studied with respect to an existing Canberra system. The existing Canberra system consists of thirty six Model 7401 alpha spectrometry chambers (Chamber No.'s 1-36) and has been DOELAP qualified for the routine Alpha Spectroscopy program used in LLNL's in vitro bioassay program. The new Alpha Analyst system is an automated system that is controlled by the same software and computer system as that used for the existing Canberra system. This document compares results from the existing Alpha System with the newer Alpha Analyst system.

  10. DNA polymerase alpha and beta in the California urchin.

    PubMed Central

    Racine, F M; Morris, P W

    1978-01-01

    DNA polymerase alpha and beta were identified in the urchin, Strongylocentrotus purpuratus. The DNA polymerase beta sedimented at 3.4 S, constituted 5% of total DNA polymerase activity, and was resistant to N-ethylmaleimide and high ionic strength. The polymerase alpha sedimented at 6--8 S, was inhibited by N-ethylmalemide or 0.1 M (NH4)2SO4, and was dependent upon glycerol for preservation of activity. Both the polymerases alpha and beta were nuclear associated in embryos. The DNA polymerase alpha was markedly heterogeneous on DEAE-Sephadex ion exchange and showed three modal polymerase species. These polymerase alpha species were indistinguishable by template activity assays but the DNA polymerase associated ribonucleotidyl transferase (Biochemistry 75 : 3106-3113, 1976) was found predominantly with only one of the DNA polymerase alpha species. PMID:569291

  11. Nonlinear feedback control for high alpha flight

    NASA Technical Reports Server (NTRS)

    Stalford, Harold

    1990-01-01

    Analytical aerodynamic models are derived from a high alpha 6 DOF wind tunnel model. One detail model requires some interpolation between nonlinear functions of alpha. One analytical model requires no interpolation and as such is a completely continuous model. Flight path optimization is conducted on the basic maneuvers: half-loop, 90 degree pitch-up, and level turn. The optimal control analysis uses the derived analytical model in the equations of motion and is based on both moment and force equations. The maximum principle solution for the half-loop is poststall trajectory performing the half-loop in 13.6 seconds. The agility induced by thrust vectoring capability provided a minimum effect on reducing the maneuver time. By means of thrust vectoring control the 90 degrees pitch-up maneuver can be executed in a small place over a short time interval. The agility capability of thrust vectoring is quite beneficial for pitch-up maneuvers. The level turn results are based currently on only outer layer solutions of singular perturbation. Poststall solutions provide high turn rates but generate higher losses of energy than that of classical sustained solutions.

  12. L-alpha intensity in coronal streamers

    NASA Technical Reports Server (NTRS)

    Noci, G.; Poletto, G.; Suess, S. T.; Wang, A.-H.; Wu, S. T.

    1993-01-01

    White-light images are presently the primary source of information on physical conditions in the solar corona at distances greater than a few tenths of a solar radius above the limb. As a consequence, we still only have an incomplete description of structures extending beyond the solar limb. In particular, streamers, although observed for decades, represent a poorly known phenomenon. SOHO, to be launched in 1995, will be able to make long-term observations of these features up to heights of a few solar radii, both in white light and UV. In this paper we present simulations of L-alpha intensity in coronal streamers, based on the two-dimensional (2D) model developed by Wang et at. (1992, 1993) via a time-dependent numerical relaxation approach. Because the model is 2D, we make an a priori hypothesis about the extension of streamers in the third dimension. L-alpha data, obtained from a rocket (Kohl et al., 1983), allowed us to identify a shape which fits the observations.

  13. Clearings in Ly-alpha forests

    NASA Astrophysics Data System (ADS)

    Kovner, Israel; Rees, Martin J.

    1989-10-01

    At sufficient resolution, QSO spectra can be examined for patches of reduced H I column density in Ly-alpha clouds. Statistics of these clearings can constrain the fraction of the ionizing background contributed by compact sources and (possibly) their lifetimes and beaming. This is demonstrated first in a simple Euclidean setup and then in a model which takes into account the expansion of the universe and the cosmological evolution of the factors involved. The expected number of clearings in a Ly-alpha forest extending back to the formation epoch of compact sources of ionizing radiation (CSIRs) is about 1/4, if the CSIRs are important ionizing agents, and if the transience of CSIRs is unimportant. The particular properties of the CSIR population, e.g., their luminosity function, have little importance. However, expected number of clearings can be much larger if the CSIR lifetimes are short compared to the light crossing times of the domains of dominance, or if the CSIRs turned on sharply at a time when the ionization rate due to competing processes was low.

  14. MFTF-. cap alpha. + T progress report

    SciTech Connect

    Nelson, W.D.

    1985-04-01

    Early in FY 1983, several upgrades of the Mirror Fusion Test Facility (MFTF-B) at Lawrence Livermore National Laboratory (LLNL) were proposed to the fusion community. The one most favorably received was designated MFTF-..cap alpha..+T. The engineering design of this device, guided by LLNL, has been a principal activity of the Fusion Engineering Design Center during FY 1983. This interim progress report represents a snapshot of the device design, which was begun in FY 1983 and will continue for several years. The report is organized as a complete design description. Because it is an interim report, some parts are incomplete; they will be supplied as the design study proceeds. As described in this report, MFTF-..cap alpha..+T uses existing facilities, many MFTF-B components, and a number of innovations to improve on the physics parameters of MFTF-B. It burns deuterium-tritium and has a central-cell Q of 2, a wall loading GAMMA/sub n/ of 2 MW/m/sup 2/ (with a central-cell insert module), and an availability of 10%. The machine is fully shielded, allows hands-on maintenance of components outside the vacuum vessel 24 h after shutdown, and has provisions for repair of all operating components.

  15. L-alpha intensity in coronal streamers

    NASA Astrophysics Data System (ADS)

    Noci, G.; Poletto, G.; Suess, S. T.; Wang, A.-H.; Wu, S. T.

    1993-09-01

    White-light images are presently the primary source of information on physical conditions in the solar corona at distances greater than a few tenths of a solar radius above the limb. As a consequence, we still only have an incomplete description of structures extending beyond the solar limb. In particular, streamers, although observed for decades, represent a poorly known phenomenon. SOHO, to be launched in 1995, will be able to make long-term observations of these features up to heights of a few solar radii, both in white light and UV. In this paper we present simulations of L-alpha intensity in coronal streamers, based on the two-dimensional (2D) model developed by Wang et at. (1992, 1993) via a time-dependent numerical relaxation approach. Because the model is 2D, we make an a priori hypothesis about the extension of streamers in the third dimension. L-alpha data, obtained from a rocket (Kohl et al., 1983), allowed us to identify a shape which fits the observations.

  16. {alpha} decay of {sup 194}At

    SciTech Connect

    Andreyev, A. N.; Antalic, S.; Streicher, B.; Saro, S.; Venhart, M.; Ackermann, D.; Heinz, S.; Hessberger, F. P.; Kojouharov, I.; Kindler, B.; Lommel, B.; Mann, R.; Sulignano, B.; Bianco, L.; Page, R. D.; Sapple, P.; Thomson, J.; Franchoo, S.; Hofmann, S.; Huyse, M.

    2009-06-15

    Detailed {alpha}-decay studies of the neutron-deficient isotope {sup 194}At have been performed in the complete fusion reaction {sup 56}Fe+{sup 141}Pr{yields}{sup 194}At+3n at the velocity filter SHIP. Two {alpha}-decaying isomeric states with half-lives of T{sub 1/2}({sup 194}At{sup m1})=310(8) ms and T{sub 1/2}({sup 194}At{sup m2})=253(10) ms were identified in this nucleus. Their complex decays to the states in the daughter nucleus {sup 190}Bi are discussed in the article. We propose that similar to the case of the neighboring {sup 191,192,193,195}At isotopes, the oblate-deformed configurations based on the proton 1/2{sup +}[440] and/or 7/2{sup -}[514] Nilsson orbitals become important in {sup 194}At. A new isomeric state with the half-life of 175(8) ns was observed in {sup 190}Bi.

  17. Processing of sintered alpha SiC

    NASA Technical Reports Server (NTRS)

    Storm, R. S.

    1984-01-01

    Processing methods of sintered alpha SiC for engine applications are developed in a cost effective manner, using a submicron sized powder blended with sintering aids (boron and carbon). The processes for forming a green powder compact, such as dry pressing, cold isostatic pressing and green machining, slip casting, aqueous extrusion, plastic extrusion, and injection molding, are described. Dry pressing is the simplest route to component fabrication, and is carried out at approximately 10,000 psi pressure, while in the cold isostatic method the pressure could go as high as 20,000 psi. Surfactants are added to control settling rates and casting characteristics in the slip casting. The aqueous extrusion process is accomplished by a hydraulic ram forcing the aqueous mixture through a die. The plastic forming processes of extrusion and injection molding offer the potential of greater diversity in shape capacity. The physical properties of sintered alpha SiC (hardness, Young's modulus, shear modulus, and thermal diffusivity) are extensively tested. Corrosion resistance test results of silicon carbide are included.

  18. Waves for Alpha-Channeling in Mirror Machines

    SciTech Connect

    A. I. Zhmoginov and N. J. Fisch

    2009-07-08

    Alpha-channeling can, in principle, be implemented in mirror machines via exciting weaklydamped modes in the ion cyclotron frequency range with perpendicular wavelengths smaller than the alpha particle gyroradius. Assuming quasi-longitudinal or quasi-transverse wave propagation, we search systematically for suitable modes in mirror plasmas. Considering two device designs, a proof-of-principle facility and a fusion rector prototype, we in fact identify candidate modes suitable for alpha-channeling.

  19. Lateralized modulation of posterior alpha oscillations in children.

    PubMed

    Vollebregt, Madelon A; Zumer, Johanna M; Ter Huurne, Niels; Castricum, Jesminne; Buitelaar, Jan K; Jensen, Ole

    2015-12-01

    The evidence for a functionally inhibitory role of alpha oscillations is growing stronger, mostly derived from studies in healthy adults investigating spatial attention. It remains unexplored if the modulation of alpha band oscillations plays a similar functional role in typically developing children. The aim of this study was to characterize alpha modulations in children in relation to attentional performance. To this end, the posterior alpha activity (8-12Hz) in children between 7 and 10years old was measured using EEG while they performed a visuospatial covert attention task. We found that the alpha activity decreased in the hemisphere contralateral to the attended hemifield, whereas it relatively increased in the other hemisphere. In addition, we found that the degree of lateralized alpha modulation predicted performance on the attention task by negatively predicting the response time on invalid trials. Of note, children who were behaviorally less influenced by spatial cueing also were children with a clear lateralized alpha modulation pattern, with a significantly stronger alpha lateralization in the left hemisphere than children who were influenced more by spatial cueing. In addition, a bias to the right visual field such as that commonly observed in children, was significantly smaller or absent in the children influenced least by spatial cueing. Among all children, the magnitude of this visual field bias was positively related to the ability to modulate alpha activity. In conclusion, we have shown that the pattern of alpha oscillations modulated by attention is already present in 7-10year old typically developing children. Although a similar pattern is observed in adults, the consequences for behavior are different. The fact that alpha modulation is already present at this age opens up the possibility of using hemispheric alpha lateralization as a tool to study the physiological basis of attention deficits in clinical disorders such as ADHD.

  20. Alpha inelastic scattering and cluster structures in {sup 24}Mg

    SciTech Connect

    Kawabata, T.; Ishiguro, Y.; Nozawa, Y.; Tomida, N.; Yokota, N.; Adachi, T.; Fujiwara, M.; Hatanaka, K.; Tamii, A.; Yasuda, Y.; Zenihiro, J.; Itoh, M.; Takahashi, T.; Yoshida, H. P.; Maeda, Y.; Miyasako, H.; Saito, T.; Matsubara, H.; Sasamoto, Y.; Tokieda, H.

    2011-05-06

    The alpha inelastic scattering from {sup 24}Mg was measured to obtain the isoscalar natural-parity excitation strengths and to search for the {alpha}-condensed states. The multipole decomposition analysis for the measured cross sections was performed. The strength distributions for the {Delta}L = 0-3 were successfully obtained and the possible candidates for the {alpha}-condensed states around the {sup 16}O core were found.