USDA-ARS?s Scientific Manuscript database
Myrothecium verrucaria 3.2190 is a nonligninolytic fungus that produces bilirubin oxidase. Both Myrothecium verrucaria and the extracellular bilirubin oxidase were tested for their ability to decolorize indigo carmine. The biosorption and biodegradation of the dye were detected during the process of...
Ameri, Mehrdad; Schnaars, Henry; Sibley, John; Honor, David
2011-01-01
The most widely used method for bilirubin concentration determination is the diazo method, which measures the color of azobilirubin. The vanadate oxidase method is based on oxidation of bilirubin to biliverdin by vanadate. The objective of this study was to compare total and direct bilirubin concentration ([Bt] and [Bd], respectively) determined by the diazo and vanadate oxidase methods in pooled serum samples from dogs, monkeys, and rats spiked with panels of different concentrations of bilirubin standards. Pooled serum samples from 40 dogs, 40 monkeys, and 60 rats were spiked with either ditaurine conjugates of bilirubin or a standard reference material. The results obtained from both assays were compared using Deming regression analysis. The intra- and interassay precision, expressed as a percentage of the coefficient of variation (%CV), was determined for [Bt] and [Bd], and the mean percentage of recovery was calculated. The vanadate oxidase method displayed an excellent correlation (r = 0.99-1.00) with the diazo method. Using Deming regression, there were minimal negative or positive constant and proportional biases for [Bt] and [Bd]. The precision studies revealed that the vanadate oxidase method has comparable between-run and within-run CVs to those of the diazo method. The recovery study demonstrated that the diazo method more closely approximates the expected values of [Bt]. In conclusion, the vanadate oxidase method is a simple and rapid method that can be employed as an alternative to the diazo method when interfering substances are present in the serum samples of dog, monkey, and rat.
Dhungana, Neha; Morris, Cory; Krasowski, Matthew D
2017-08-01
The aim of this study was to compare the operational impact of using vanadate oxidase versus diazo direct bilirubin assays for an academic medical center patient population. Retrospective study was done over an approximately 3.5 year period. The main automated chemistry instrumentation was a Roche Diagnostics cobas 8000 line. The Roche Direct Bilirubin assay was compared to Diazyme Laboratories Direct Bilirubin Assay and Randox Laboratories Direct Bilirubin assay using manufacturer's guidelines for hemolysis index, lipemia index, and analytical measurement range (AMR). Retrospective data was analyzed for 47,333 serum/plasma specimens that had clinical orders for direct bilirubin. A total of 5943 specimens (12.6%) exceeded the hemolysis index limit for the Roche method compared to only 0.2% and 0.05% of specimens for the Diazyme and Randox methods, respectively. The impact was particularly large on patients less than 2 years old, for which 51.3% of specimens exceeded the hemolysis index for the Roche method. A total of 1671 specimens (3.5%) exceeded the lipemia index limit for the Roche method compared to less than 0.1% for the Randox method. Lastly, 988 (2.1%) of specimens had direct bilirubin concentrations exceeding the upper AMR limit of 10 mg/dL [171 µmol/L] for the Roche assay compared to less than 1% of specimens for the vanadate oxidase methods. Vanadate oxidase direct bilirubin methods offer advantages over diazo methods in terms of less interference by hemolysis and lipemia, as well as wider AMR. The advantages are particularly evident for neonatal and infant populations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morishita, Hirotoshi; Kurita, Daisuke; Kataoka, Kunishige
2014-07-18
Highlights: • Proton transport pathway in bilirubin oxidase was mutated. • Two intermediates in the dioxygen reduction steps were trapped and characterized. • A specific glutamate for dioxygen reduction by multicopper oxidases was identified. - Abstract: The hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase is constructed with Glu463 and water molecules to transport protons for the four-electron reduction of dioxygen. Substitutions of Glu463 with Gln or Ala were attributed to virtually complete loss or significant reduction in enzymatic activities due to an inhibition of the proton transfer steps to dioxygen. The singlemore » turnover reaction of the Glu463Gln mutant afforded the highly magnetically interacted intermediate II (native intermediate) with a broad g = 1.96 electron paramagnetic resonance signal detectable at cryogenic temperatures. Reactions of the double mutants, Cys457Ser/Glu463Gln and Cys457Ser/Glu463Ala afforded the intermediate I (peroxide intermediate) because the type I copper center to donate the fourth electron to dioxygen was vacant in addition to the interference of proton transport due to the mutation at Glu463. The intermediate I gave no electron paramagnetic resonance signal, but the type II copper signal became detectable with the decay of the intermediate I. Structural and functional similarities between multicopper oxidases are discussed based on the present mutation at Glu463 in bilirubin oxidase.« less
NASA Astrophysics Data System (ADS)
Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie
Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.
Enzymatic Removal of Bilirubin from Blood: A Potential Treatment for Neonatal Jaundice
NASA Astrophysics Data System (ADS)
Lavin, Arthur; Sung, Cynthia; Klibanov, Alexander M.; Langer, Robert
1985-11-01
Current treatments for severe jaundice can result in major complications. Neonatal jaundice is caused by excessive accumulation of bilirubin in the blood. A small blood filter containing immobilized bilirubin oxidase was developed to reduce serum bilirubin concentrations. When human or rat blood was passed through the enzyme filter, more than 90 percent of the bilirubin was degraded in a single pass. This procedure may have important applications in the clinical treatment of neonatal jaundice.
Unconjugated Bilirubin Inhibits Proteolytic Cleavage of von Willebrand Factor by ADAMTS13 Protease
Lu, Rui-Nan; Yang, Shangbin; Wu, Haifeng M.; Zheng, X. Long
2015-01-01
Summary Background Bilirubin is a yellow breakdown product of heme catabolism. Increased serum levels of unconjugated bilirubin are conditions commonly seen in premature neonates and adults with acute hemolysis including thrombotic microangiopathy. Previous studies have shown that unconjugated bilirubin lowers plasma ADAMTS13 activity, but the mechanism is not fully understood. Objectives The study is to determine whether unconjugated bilirubin directly inhibits the cleavage of von Willebrand factor (VWF) and its analogs by ADAMTS13. Methods Fluorogenic, SELDI-TOF mass spectrometric assay, and Western blotting analyses were employed to address this question. Results Unconjugated bilirubin inhibits the cleavage of F485-rVWF73-H, D633-rVWF73-H, and GST-rVWF71-11K by ADAMTS13 in a concentration-dependent manner with a half-maximal inhibitory concentration (IC50) of ~13 μM, ~70 μM, and ~17 μM, respectively. Unconjugated bilirubin also dose-dependently inhibits the cleavage of multimeric VWF by ADAMTS13 under denaturing conditions. The inhibitory activity of bilirubin on the cleavage of D633-rVWF73-H and multimeric VWF, but not F485-rVWF73-H, was eliminated after incubation with bilirubin oxidase that converts bilirubin to biliverdin. Furthermore, plasma ADAMTS13 activity in patients with hyperbilirubinemia is lower prior to than after treatment with bilirubin oxidase. Conclusions unconjugated bilirubin directly inhibits ADAMTS13’s ability to cleave both peptidyl and native VWF substrates in addition to its interference with certain fluorogenic assays. Our findings may help proper interpretation of ADAMTS13 results under pathological conditions. Whether elevated serum unconjugated bilirubin has an adverse effect in vivo remains to be determined in our future study. PMID:25782102
Inducible bilirubin oxidase: A novel function for the mouse cytochrome P450 2A5
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abu-Bakar, A'edah, E-mail: a.abubakar@uq.edu.au; Arthur, Dionne Maioha; Cooperative Research Centre for Contamination Assessment and Remediation of the Environment, Adelaide
2011-11-15
We have previously shown that bilirubin (BR), a breakdown product of haem, is a strong inhibitor and a high affinity substrate of the mouse cytochrome P450 2A5 (CYP2A5). The antioxidant BR, which is cytotoxic at high concentrations, is potentially useful in cellular protection against oxygen radicals if its intracellular levels can be strictly controlled. The mechanisms that regulate cellular BR levels are still obscure. In this paper we provide preliminary evidence for a novel function of CYP2A5 as hepatic 'BR oxidase'. A high-performance liquid chromatography/electrospray ionisation mass spectrometry screening showed that recombinant yeast microsomes expressing the CYP2A5 oxidise BR tomore » biliverdin, as the main metabolite, and to three other smaller products with m/z values of 301, 315 and 333. The metabolic profile is significantly different from that of chemical oxidation of BR. In chemical oxidation the smaller products were the main metabolites. This suggests that the enzymatic reaction is selective, towards biliverdin production. Bilirubin treatment of primary hepatocytes increased the CYP2A5 protein and activity levels with no effect on the corresponding mRNA. Co-treatment with cycloheximide (CHX), a protein synthesis inhibitor, resulted in increased half-life of the CYP2A5 compared to cells treated only with CHX. Collectively, the observations suggest that the CYP2A5 is potentially an inducible 'BR oxidase' where BR may accelerate its own metabolism through stabilization of the CYP2A5 protein. It is possible that this metabolic pathway is potentially part of the machinery controlling intracellular BR levels in transient oxidative stress situations, in which high amounts of BR are produced. -- Highlights: Black-Right-Pointing-Pointer CYP2A5 metabolizes bilirubin to biliverdin and dipyrroles. Black-Right-Pointing-Pointer Bilirubin increased the hepatic CYP2A5 protein and activity levels. Black-Right-Pointing-Pointer Bilirubin does not change the hepatic CYP2A5 mRNA levels. Black-Right-Pointing-Pointer Co-treatment with a protein synthesis inhibitor prolongs CYP2A5 half-life. Black-Right-Pointing-Pointer CYP2A5 is potentially an inducible bilirubin oxidase.« less
Navaee, Aso; Salimi, Abdollah; Jafari, Fereydoon
2015-03-23
The electrochemical conditioning of amino-carbon nanotubes (CNTs) on a graphene support in an alkaline solution is used to produce -NHOH as hydrophilic functional groups for the efficient immobilization of bilirubin oxidase enzyme. The application of the immobilized enzyme for the direct electrocatalytic reduction of O2 is investigated. The onset potential of 0.81 V versus NHE and peak current density of 2.3 mA cm(-2) for rotating modified electrode at 1250 rpm, indicate improved biocatalytic activity of the proposed system for O2 reduction. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Graphene-coated carbon fiber cloth for flexible electrodes of glucose fuel cells
NASA Astrophysics Data System (ADS)
Hoshi, Kazuki; Muramatsu, Kazuo; Sumi, Hisato; Nishioka, Yasushiro
2016-02-01
In this work, we fabricated flexible electrodes for a miniaturized, simple structured, and flexible glucose biofuel cell (BFC) using a graphene-coated carbon fiber cloth (GCFC). The areas of the anode and cathode electrodes were 3 × 10 mm2. The anode area was coated with the enzyme glucose oxidase, and the cathode area was coated with the enzyme bilirubin oxidase. No ion-exchange film was needed because glucose oxidase selectively oxidizes glucose and bilirubin oxidase selectively reduces oxygen. The power density of the BFC with GCFC electrodes in a phosphate buffer solution of 200 mM glucose solution at room temperature was 34.3 µW/cm2 at 0.43 V. The power density of a BFC using carbon fiber cloth (CFC) without graphene modification was 18.5 µW/cm2 at 0.13 V. The BFC with the GCFC electrode continued to function longer than 24 h with a power density higher than 5 µW/cm2. These effects were attributed to the much larger effective surface areas of the GCFC electrodes that maintain more enzymes than those of the CFC electrodes.
Novel Architectures for Achieving Direct Electron Transfer in Enzymatic Biofuel Cells
NASA Astrophysics Data System (ADS)
Blaik, Rita A.
Enzymatic biofuel cells are a promising source of alternative energy for small device applications, but still face the challenge of achieving direct electron transfer with high enzyme concentrations in a simple system. In this dissertation, methods of constructing electrodes consisting of enzymes attached to nanoparticle-enhanced substrates that serve as high surface area templates are evaluated. In the first method described, glucose oxidase is covalently attached to gold nanoparticles that are assembled onto genetically engineered M13 bacteriophage. The resulting anodes achieve a high peak current per area and a significant improvement in enzyme surface coverage. In the second system, fructose dehydrogenase, a membrane-bound enzyme that has the natural ability to achieve direct electron transfer, is immobilized into a matrix consisting of binders and carbon nanotubes to extend the lifetime of the anode. For the cathode, bilirubin oxidase is immobilized in a carbon nanotube and sol-gel matrix to achieve direct electron transfer. Finally, a full fuel cell consisting of both an anode and cathode is constructed and evaluated with each system described.
Gentil, Solène; Carrière, Marie; Cosnier, Serge; Gounel, Sébastien; Mano, Nicolas; Le Goff, Alan
2018-06-12
Herein, the direct electrochemistry of bilirubin oxidase from Magnaporthe orizae (MoBOD) was studied on CNTs functionalized by electrografting several types of diazonium salts. The functionalization induces favorable or unfavorable orientation of MoBOD, the latter being compared to the well-known BOD from Myrothecium verrucaria (MvBOD). On the same nanostructured electrodes, MoBOD can surpass MvBOD in terms of both current densities and minimal overpotentials. Added to the fact that MoBOD is also highly active at the gas-diffusion electrode (GDE), these findings make MoBOD one of the MCOs with the highest catalytic activity towards the oxygen reduction reaction (ORR). © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
McCarty, Mark F
2011-12-01
Exposure of human mononuclear cells to phycocyanin in vitro is reported to promote generation of Treg cells. Induction of heme oxygenase-1 (HO-1) in lymphocytes has a similar effect, and it is not likely to be accidental that a key product of HO-1 activity, biliverdin, is homologous to the structure of phycocyanin's chromophore phycocyanobilin (PhyCB). Moreover, Treg induction is observed in mice injected with bilirubin, biliverdin's chief metabolite. These considerations suggest that bilirubin, generated within lymphocytes by HO-1 activation, may play a physiological role in the promotion of Treg immunomodulation. This effect of bilirubin is likely to be independent of NADPH oxidase inhibition, since the NAPDH oxidase activity of macrophages is necessary for Treg induction, possibly because it contributes to HO-1 induction in lymphocytes. In light of numerous reports that oral phycocyanin is beneficial in various rodent models of autoimmune disorders, it is reasonable to suspect that PhyCB-enriched spirulina extracts may have clinical potential for boosting Treg activity in human autoimmune or allergic syndromes, mimicking the physiological role of HO-1 induction in this regard. Copyright © 2011 Elsevier Ltd. All rights reserved.
Korani, Aazam; Salimi, Abdollah
2013-12-15
In this study, the preparation of an integrated modified electrode based on the covalent attachment of glucose dehydrogenase (GDH) enzyme and safranin O to amine-derivative multiwalled carbon nanotubes (MWCNTs-NH2) modified glassy carbon (GC) electrode using G2.5-carboxylated PAMAM dendrimer (Den) as linking agent is reported. The obtained results indicated that the proposed system has effective bioelectrocatalytic activity toward glucose oxidation at 100 mV with onset potential of -130 mV (vs. Ag/AgCl). The performance of the prepared hybrid system of GC/MWCNTs-NH2/Den/GDH/Safranin as anode in a membraneless enzyme-based glucose/O2 biofuel cell is further evaluated. The biocathode in this system was composed of bilirubin oxidase (BOX) enzyme immobilized onto a bilirubin modified carbon nanotube GC electrode. Immobilized BOX onto CNTs/bilirubin not only show direct electron transfer but also it has excellent electrocatalytic activity toward oxygen reduction at a positive potential of 610 mV. The open circuit voltage of the cell was 590 mV. The maximum current density was 0.5 mA cm(-2), while maximum power density of 108 μW cm(-2) was achieved at voltage of 330 mV. The immobilized enzymes in anode and cathode are very stable and output power of the BFC is approximately constant after 12 h continues operation. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Mc Donagh, Antony F.; Agati, Giovanni; Fusi, Franco; Pratesi, R.
1987-07-01
The photochemistry of bilirubin (BR) is of considerable interest because of its importance in the treatment of neonatal jaundice with visible light phototherapy. Patients are irradiated with blue, white or green fluorescent lamps to induce conversion of the unexcretable and toxic bilirubin to more polar, water-soluble and easily excreted photoproducts. The molecular mechanisms responsible for the phototherapeutic action of light on jaundiced babies have not jet been completely elucidated.
Iwalokun, B A; Bamiro, S B; Ogunledun, A
2006-12-01
Elevated plasma levels of xanthine oxidase and liver function parameters have been associated with inflammatory events in several human diseases. While xanthine oxidase provides in vitro protection against malaria, its pathophysiological functions in vivo and interactions with liver function parameters remain unclear. This study examined the interactions and plasma levels of xanthine oxidase (XO) and uric acid (UA), catalase (CAT) and liver function parameters GOT, GPT and bilirubin in asymptomatic (n=20), uncomplicated (n=32), and severe (n=18) falciparum malaria children aged 3-13 years. Compared to age-matched control (n=16), significant (p<0.05) elevation in xanthine oxidase by 100-550%, uric acid by 15.4-153.8%, GOT and GPT by 22.1-102.2%, and total bilirubin by 2.3-86% according to parasitaemia (geometric mean parasite density (GMPD)=850-87100 parasites/microL) was observed in the malarial children. Further comparison with control revealed higher CAT level (16.2+/-0.5 vs 14.6+/-0.4 U/L; p<0.05) lacking significant (p>0.05) correlation with XO, but lower CAT level (13.4-5.4 U/L) with improved correlations (r=-0.53 to -0.91; p<0.05) with XO among the asymptomatic and symptomatic malaria children studied. 75% of control, 45% of asymptomatic, 21.9% of uncomplicated, and none of severe malaria children had Hb level>11.0 g/dL. Multivariate analyses further revealed significant (p<0.05) correlations between liver function parameters and xanthine oxidase (r=0.57-0.64) only in the severe malaria group. We conclude that elevated levels of XO and liver enzymes are biochemical features of Plasmodium falciparum parasitaemia in Nigerian children, with both parameters interacting differently to modulate the catalase response in asymptomatic and symptomatic falciparum malaria.
The Bilirubin Binding Panel: A Henderson-Hasselbalch Approach to Neonatal Hyperbilirubinemia.
Ahlfors, Charles E
2016-10-01
Poor plasma bilirubin binding increases the risk of bilirubin neurotoxicity in newborns with hyperbilirubinemia. New laboratory tests may soon make it possible to obtain a complete bilirubin binding panel when evaluating these babies. The 3 measured components of the panel are the plasma total bilirubin concentration (B Total ), which is currently used to guide clinical care; the bilirubin binding capacity (BBC); and the concentration of non-albumin bound or free bilirubin (B Free ). The fourth component is the bilirubin-albumin equilibrium dissociation constant, K D , which is calculated from B Total , BBC, and B Free The bilirubin binding panel is comparable to the panel of components used in the Henderson-Hasselbalch approach to acid-base assessment. Bilirubin binding population parameters (not prospective studies to determine whether the new bilirubin binding panel components are better predictors of bilirubin neurotoxicity than B Total ) are needed to expedite the clinical use of bilirubin binding. At any B Total , the B Free and the relative risk of bilirubin neurotoxicity increase as the K D /BBC ratio increases (ie, bilirubin binding worsens). Comparing the K D /BBC ratio of newborns with B Total of concern with that typical for the population helps determine whether the risk of bilirubin neurotoxicity varies significantly from the inherent risk at that B Total Furthermore, the bilirubin binding panel individualizes care because it helps to determine how aggressive intervention should be at any B Total , irrespective of whether it is above or below established B Total guidelines. The bilirubin binding panel may reduce anxiety, costs, unnecessary treatment, and the likelihood of undetected bilirubin neurotoxicity. Copyright © 2016 by the American Academy of Pediatrics.
McArdle, Trevor; McNamara, Thomas P; Fei, Fan; Singh, Kulveer; Blanford, Christopher F
2015-11-18
Two surface analysis techniques, dual polarization interferometry (DPI) and analysis by an electrochemical quartz crystal microbalance with dissipation capability (E-QCM-D), were paired to find the deposition conditions that give the highest and most stable electrocatalytic activity per adsorbed mass of enzyme. Layers were formed by adsorption from buffered solutions of bilirubin oxidase from Myrothecium verrucaria at pH 6.0 to planar surfaces, under high enzyme loading (≥1 mg mL(-1)) for contact periods of up to 2 min. Both unmodified and carboxylate-functionalized gold-coated sensors showed that a deposition solution concentration of 10-25 mg mL(-1) gave the highest activity per mass of adsorbed enzyme with an effective catalytic rate constant (k(cat)) of about 60 s(-1). The densification of adsorbed layers observed by DPI correlated with reduced bioactivity observed by parallel E-QCM-D measurements. Postadsorption changes in thickness and density observed by DPI were incorporated into Kelvin-Voigt models of the QCM-D response. The modeled response matched experimental observations when the adlayer viscosity tripled after adsorption.
Suraniti, Emmanuel; Studer, Vincent; Sojic, Neso; Mano, Nicolas
2011-04-01
Immobilization and electrical wiring of enzymes is of particular importance for the elaboration of efficient biosensors and can be cumbersome. Here, we report a fast and easy protocol for enzyme immobilization, and as a proof of concept, we applied it to the immobilization of bilirubin oxidase, a labile enzyme. In the first step, bilirubin oxidase is mixed with a redox hydrogel "wiring" the enzyme reaction centers to electrodes. Then, this adduct is covered by an outer layer of PEGDA made by photoinitiated polymerization of poly(ethylene-glycol) diacrylate (PEGDA) and a photoclivable precursor, DAROCUR. This two-step protocol is 18 times faster than the current state-of-the-art protocol and leads to currents 25% higher. In addition, the outer layer of PEGDA acts as a protective layer increasing the lifetime of the electrode by 100% when operating continuously for 2000 s and by 60% when kept in dry state for 24 h. This new protocol is particularly appropriate for labile enzymes that quickly denaturate. In addition, by tuning the ratio PEGDA/DAROCUR, it is possible to make the enzyme electrodes even more active or more stable.
Basuroy, Shyamali; Bhattacharya, Sujoy; Leffler, Charles W.; Parfenova, Helena
2009-01-01
Inflammatory brain disease may damage cerebral vascular endothelium leading to cerebral blood flow dysregulation. The proinflammatory cytokine TNF-α causes oxidative stress and apoptosis in cerebral microvascular endothelial cells (CMVEC) from newborn pigs. We investigated contribution of major cellular sources of reactive oxygen species to endothelial inflammatory response. Nitric oxide synthase and xanthine oxidase inhibitors (Nω-nitro-l-arginine and allopurinol) had no effect, while mitochondrial electron transport inhibitors (CCCP, 2-thenoyltrifluoroacetone, and rotenone) attenuated TNF-α-induced superoxide (O2•−) and apoptosis. NADPH oxidase inhibitors (diphenylene iodonium and apocynin) greatly reduced TNF-α-evoked O2•− generation and apoptosis. TNF-α rapidly increased NADPH oxidase activity in CMVEC. Nox4, the cell-specific catalytic subunit of NADPH oxidase, is highly expressed in CMVEC, contributes to basal O2•− production, and accounts for a burst of oxidative stress in response to TNF-α. Nox4 small interfering RNA, but not Nox2, knockdown prevented oxidative stress and apoptosis caused by TNF-α in CMVEC. Nox4 is colocalized with HO-2, the constitutive isoform of heme oxygenase (HO), which is critical for endothelial protection against TNF-α toxicity. The products of HO activity, bilirubin and carbon monoxide (CO, as a CO-releasing molecule, CORM-A1), inhibited Nox4-generated O2•− and apoptosis caused by TNF-α stimulation. We conclude that Nox4 is the primary source of inflammation- and TNF-α-induced oxidative stress leading to apoptosis in brain endothelial cells. The ability of CO and bilirubin to combat TNF-α-induced oxidative stress by inhibiting Nox4 activity and/or by O2•− scavenging, taken together with close intracellular compartmentalization of HO-2 and Nox4 in cerebral vascular endothelium, may contribute to HO-2 cytoprotection against inflammatory cerebrovascular disease. PMID:19118162
Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence
2015-03-01
Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(Δ) and bod2(Δ) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(Δ) bod2(Δ) double mutant was changed. The bod1(Δ) and bod2(Δ) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(Δ) and bod2(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Value of bilirubin oxidase and its mutants in the diagnosis of hyperbilirubinemia.
Zhang, Lei; Zhang, Xiao; Luo, Zhi-Ying
2005-11-01
To elucidate the significance of the coordination amino acid residues in bilirubin oxidase (BO) and their kinetic characteristics, and evaluate whether BO mutants may serve as better diagnostic agent for hyperbilirubinemia. The BO mutants I402G and C457S were obtained by site-directed mutagenesis and confirmed by amino acid sequence analysis. Ru-incorporated C457S mutant was obtained by direct incubation of ruthenium compounds with the mutant. The electron paramagnetic resonance (EPR) spectra of the recombinant BO and the mutants were investigated, and the enzyme kinetics of the recombinant BO and I402G mutant were measured with bilirubin as the substrate at 25 degrees C. The BO mutants were expressed and purified successfully. The mutant I402G showed low enzyme activity, and had C457S virtually no enzyme activity. Nevertheless Ru-incorporation conferred higher enzyme activity to C457S mutant. The enzyme kinetic investigations revealed that the kinetic parameter k(cat) of the recombinant BO and I402G mutant was 235.8 min(-1) and 6.9 min(-1), respectively, suggesting higher enzyme activity of the recombinant BO. The coordinating amino acids have important significance in maintaining the integrity of active centers and enzyme activities of recombinant BO and its mutants. The enzyme activities of the mutants I402G and C457S are much lower than those of recombinant BO, therefore they are not appropriate for diagnostic purpose. Ru-incorporation facilitates the formation of a new intact active center in C457S mutant, which therefore acquires enzyme activity.
Bilirubin present in diverse angiosperms.
Pirone, Cary; Johnson, Jodie V; Quirke, J Martin E; Priestap, Horacio A; Lee, David
2010-01-01
Bilirubin is an orange-yellow tetrapyrrole produced from the breakdown of heme by mammals and some other vertebrates. Plants, algae and cyanobacteria synthesize molecules similar to bilirubin, including the protein-bound bilins and phytochromobilin which harvest or sense light. Recently, we discovered bilirubin in the arils of Strelitzia nicolai, the White Bird of Paradise Tree, which was the first example of this molecule in a higher plant. Subsequently, we identified bilirubin in both the arils and the flowers of Strelitzia reginae, the Bird of Paradise Flower. In the arils of both species, bilirubin is present as the primary pigment, and thus functions to produce colour. Previously, no tetrapyrroles were known to generate display colour in plants. We were therefore interested in determining whether bilirubin is broadly distributed in the plant kingdom and whether it contributes to colour in other species. In this paper, we use HPLC/UV and HPLC/UV/electrospray ionization-tandem mass spectrometry (HPLC/UV/ESI-MS/MS) to search for bilirubin in 10 species across diverse angiosperm lineages. Bilirubin was present in eight species from the orders Zingiberales, Arecales and Myrtales, but only contributed to colour in species within the Strelitziaceae. The wide distribution of bilirubin in angiosperms indicates the need to re-assess some metabolic details of an important and universal biosynthetic pathway in plants, and further explore its evolutionary history and function. Although colour production was limited to the Strelitziaceae in this study, further sampling may indicate otherwise.
Bilirubin present in diverse angiosperms
Pirone, Cary; Johnson, Jodie V.; Quirke, J. Martin E.; Priestap, Horacio A.; Lee, David
2010-01-01
Background and aims Bilirubin is an orange-yellow tetrapyrrole produced from the breakdown of heme by mammals and some other vertebrates. Plants, algae and cyanobacteria synthesize molecules similar to bilirubin, including the protein-bound bilins and phytochromobilin which harvest or sense light. Recently, we discovered bilirubin in the arils of Strelitzia nicolai, the White Bird of Paradise Tree, which was the first example of this molecule in a higher plant. Subsequently, we identified bilirubin in both the arils and the flowers of Strelitzia reginae, the Bird of Paradise Flower. In the arils of both species, bilirubin is present as the primary pigment, and thus functions to produce colour. Previously, no tetrapyrroles were known to generate display colour in plants. We were therefore interested in determining whether bilirubin is broadly distributed in the plant kingdom and whether it contributes to colour in other species. Methodology In this paper, we use HPLC/UV and HPLC/UV/electrospray ionization-tandem mass spectrometry (HPLC/UV/ESI-MS/MS) to search for bilirubin in 10 species across diverse angiosperm lineages. Principal results Bilirubin was present in eight species from the orders Zingiberales, Arecales and Myrtales, but only contributed to colour in species within the Strelitziaceae. Conclusions The wide distribution of bilirubin in angiosperms indicates the need to re-assess some metabolic details of an important and universal biosynthetic pathway in plants, and further explore its evolutionary history and function. Although colour production was limited to the Strelitziaceae in this study, further sampling may indicate otherwise. PMID:22476078
Photodamage of the cells in culture sensitized with bilirubin
NASA Astrophysics Data System (ADS)
Kozlenkova, O. A.; Plavskaya, L. G.; Mikulich, A. V.; Leusenko, I. A.; Tretyakova, A. I.; Plavskii, V. Yu
2016-08-01
It has been shown that exposure to radiation of LED sources of light with an emission band maximum at about 465 and 520 nm having substantially identical damaging effects on animal cells in culture, that are in a logarithmic growth phase and preincubated with pigment. Photobiological effect is caused by photodynamic processes involving singlet oxygen generated by triplet excited sensitizer. Mono-exponential type dependence of cell survival on the energy dose indicates that it is bilirubin that acts as a sensitizer but not its photoproducts. The inclusion of bilirubin in the cells, where it is primarily localized in the mitochondria cells, it is accompanied by multiple amplification photochemical stability compared to pigment molecules bound with albumin
Cerebroprotective functions of HO-2.
Parfenova, Helena; Leffler, Charles W
2008-01-01
The constitutive isoform of heme oxygenase, HO-2, is highly expressed in the brain and in cerebral vessels. HO-2 functions in the brain have been evaluated using pharmacological inhibitors of the enzyme and HO-2 gene deletion in in vivo animal models and in cultured cells (neurons, astrocytes, cerebral vascular endothelial cells). Rapid activation of HO-2 via post-translational modifications without upregulation of HO-2 expression or HO-1 induction coincides with the increase in cerebral blood flow aimed at maintaining brain homeostasis and neuronal survival during seizures, hypoxia, and hypotension. Pharmacological inhibition or gene deletion of brain HO-2 exacerbates oxidative stress induced by seizures, glutamate, and inflammatory cytokines, and causes cerebral vascular injury. Carbon monoxide (CO) and bilirubin, the end products of HO-catalyzed heme degradation, have distinct cytoprotective functions. CO, by binding to a heme prosthetic group, regulates the key components of cell signaling, including BK(Ca) channels, guanylyl cyclase, NADPH oxidase, and the mitochondria respiratory chain. Cerebral vasodilator effects of CO are mediated via activation of BK(Ca) channels and guanylyl cyclase. CO, by inhibiting the major components of endogenous oxidant-generating machinery, NADPH oxidase and the cytochrome C oxidase of the mitochondrial respiratory chain, blocks formation of reactive oxygen species. Bilirubin, via redox cycling with biliverdin, is a potent oxidant scavenger that removes preformed oxidants. Overall, HO-2 has dual housekeeping cerebroprotective functions by maintaining autoregulation of cerebral blood flow aimed at improving neuronal survival in a changing environment, and by providing an effective defense mechanism that blocks oxidant formation and prevents cell death caused by oxidative stress.
Kulkarni, Tanmay; Slaughter, Gymama
2017-07-01
A novel biosensing system capable of simultaneously sensing glucose and powering portable electronic devices such as a digital glucometer is described. The biosensing system consists of enzymatic glucose biofuel cell bioelectrodes functionalized with pyrolloquinoline quinone glucose dehydrogenase (PQQ-GDH) and bilirubin oxidase (BOD) at the bioanode and biocathode, respectively. A dual-stage power amplification circuit is integrated with the single biofuel cell to amplify the electrical power generated. In addition, a capacitor circuit was incorporated to serve as the transducer for sensing glucose. The open circuit voltage of the optimized biofuel cell reached 0.55 V, and the maximum power density achieved was 0.23 mW/ cm 2 at 0.29 V. The biofuel cell exhibited a sensitivity of 0.312 mW/mM.cm 2 with a linear dynamic range of 3 mM - 20 mM glucose. The overall self-powered glucose biosensor is capable of selectively screening against common interfering species, such as ascorbate and urate and exhibited an operational stability of over 53 days, while maintaining 90 % of its activity. These results demonstrate the system's potential to replace the current glucose monitoring devices that rely on external power supply, such as a battery.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Muhsain, Siti Nur Fadzilah, E-mail: sitinurfadzilah077@ppinang.uitm.edu.my; Faculty of Pharmacy, University Teknologi Mara; Lang, Matti A., E-mail: m.lang@uq.edu.au
The intracellular level of bilirubin (BR), an endogenous antioxidant that is cytotoxic at high concentrations, is tightly controlled within the optimal therapeutic range. We have recently described a concerted intracellular BR regulation by two microsomal enzymes: heme oxygenase 1 (HMOX1), essential for BR production and cytochrome P450 2A5 (CYP2A5), a BR oxidase. Herein, we describe targeting of these enzymes to hepatic mitochondria during oxidative stress. The kinetics of microsomal and mitochondrial BR oxidation were compared. Treatment of DBA/2J mice with 200 mg pyrazole/kg/day for 3 days increased hepatic intracellular protein carbonyl content and induced nucleo-translocation of Nrf2. HMOX1 and CYP2A5more » proteins and activities were elevated in microsomes and mitoplasts but not the UGT1A1, a catalyst of BR glucuronidation. A CYP2A5 antibody inhibited 75% of microsomal BR oxidation. The inhibition was absent in control mitoplasts but elevated to 50% after treatment. An adrenodoxin reductase antibody did not inhibit microsomal BR oxidation but inhibited 50% of mitochondrial BR oxidation. Ascorbic acid inhibited 5% and 22% of the reaction in control and treated microsomes, respectively. In control mitoplasts the inhibition was 100%, which was reduced to 50% after treatment. Bilirubin affinity to mitochondrial and microsomal CYP2A5 enzyme is equally high. Lastly, the treatment neither released cytochrome c into cytoplasm nor dissipated membrane potential, indicating the absence of mitochondrial membrane damage. Collectively, the observations suggest that BR regulatory enzymes are recruited to mitochondria during oxidative stress and BR oxidation by mitochondrial CYP2A5 is supported by mitochondrial mono-oxygenase system. The induced recruitment potentially confers membrane protection. - Highlights: • Pyrazole induces oxidative stress in the mouse liver. • Pyrazole-induced oxidative stress induces mitochondrial targeting of key bilirubin regulatory enzymes, HMOX1, BVR and CYP2A5. • Mitochondrial cytochrome P450 2A5 (CYP2A5) can function as bilirubin oxidase. • Mitochondrial targeting of the key microsomal enzymes is not associated with mitochondrial membrane disruption.« less
Ramel, F; Amrani, A; Pieulle, L; Lamrabet, O; Voordouw, G; Seddiki, N; Brèthes, D; Company, M; Dolla, A; Brasseur, G
2013-12-01
Cytoplasmic membranes of the strictly anaerobic sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough contain two terminal oxygen reductases, a bd quinol oxidase and a cc(b/o)o3 cytochrome oxidase (Cox). Viability assays pointed out that single Δbd, Δcox and double ΔbdΔcox deletion mutant strains were more sensitive to oxygen exposure than the WT strain, showing the involvement of these oxygen reductases in the detoxification of oxygen. The Δcox strain was slightly more sensitive than the Δbd strain, pointing to the importance of the cc(b/o)o3 cytochrome oxidase in oxygen protection. Decreased O2 reduction rates were measured in mutant cells and membranes using lactate, NADH, ubiquinol and menadiol as substrates. The affinity for oxygen measured with the bd quinol oxidase (Km, 300 nM) was higher than that of the cc(b/o)o3 cytochrome oxidase (Km, 620 nM). The total membrane activity of the bd quinol oxidase was higher than that of the cytochrome oxidase activity in line with the higher expression of the bd oxidase genes. In addition, analysis of the ΔbdΔcox mutant strain indicated the presence of at least one O2-scavenging membrane-bound system able to reduce O2 with menaquinol as electron donor with an O2 affinity that was two orders of magnitude lower than that of the bd quinol oxidase. The lower O2 reductase activity in mutant cells with hydrogen as electron donor and the use of specific inhibitors indicated an electron transfer link between periplasmic H2 oxidation and membrane-bound oxygen reduction via the menaquinol pool. This linkage is crucial in defence of the strictly anaerobic bacterium Desulfovibrio against oxygen stress.
Stretchable glucose biofuel cell with wirings made of multiwall carbon nanotubes
NASA Astrophysics Data System (ADS)
Fujimagari, Yusuke; Nishioka, Yasushiro
2015-12-01
In this study, we fabricated a flexible and stretchable glucose-biofuel cell with wirings made of multi wall carbon nanotube (MWCNTs) on a polydimethylsiloxane substrate. The biofuel cell investigated consists of a porous carbon anode (area of 30 mm2) modified by glucose oxidase and ferrocene, and a cathode (area of 30 mm2) modified by bilirubin oxidase. The anode and the cathode were connected with the MWCNT wirings. The maximum power of 0.31 μW at 76.6 mV, which corresponds to a power density of 1.04 μW/cm2, was realized by immersing the biofuel cell in a phosphate buffer solution with a glucose concentration of 100 mM, at room temperature.
Camadro, J M; Matringe, M; Thome, F; Brouillet, N; Mornet, R; Labbe, P
1995-05-01
Diphenylether-type herbicides are extremely potent inhibitors of protoporphyrinogen oxidase, a membrane-bound enzyme involved in the heme and chlorophyll biosynthesis pathways. Tritiated acifluorfen and a diazoketone derivative of tritiated acifluorfen were specifically bound to a single class of high-affinity binding sites on yeast mitochondrial membranes with apparent dissociation constants of 7 nM and 12.5 nM, respectively. The maximum density of specific binding sites, determined by Scatchard analysis, was 3 pmol.mg-1 protein. Protoporphyrinogen oxidase specific activity was estimated to be 2500 nmol protoporphyrinogen oxidized h-1.mol-1 enzyme. The diazoketone derivative of tritiated acifluorfen was used to specifically photolabel yeast protoporphyrinogen oxidase. The specifically labeled polypeptide in wild-type mitochondrial membranes had an apparent molecular mass of 55 kDa, identical to the molecular mass of the purified enzyme. This photolabeled polypeptide was not detected in a protoporphyrinogen-oxidase-deficient yeast strain, but the membranes contained an equivalent amount of inactive immunoreactive protoporphyrinogen oxidase protein.
Kinetics of oxidation of bilirubin and its protein complex by hydrogen peroxide in aqueous solutions
NASA Astrophysics Data System (ADS)
Solomonov, A. V.; Rumyantsev, E. V.; Antina, E. V.
2010-12-01
A comparative study of oxidation reactions of bilirubin and its complex with albumin was carried out in aqueous solutions under the action of hydrogen peroxide and molecular oxygen at different pH values. Free radical oxidation of the pigment in both free and bound forms at pH 7.4 was shown not to lead to the formation of biliverdin, but to be associated with the decomposition of the tetrapyrrole chromophore into monopyrrolic products. The effective and true rate constants of the reactions under study were determined. It was assumed that one possible mechanism of the oxidation reaction is associated with the interaction of peroxyl radicals and protons of the NH groups of bilirubin molecules at the limiting stage with the formation of a highly reactive radical intermediate. The binding of bilirubin with albumin was found to result in a considerable reduction in the rate of the oxidation reaction associated with the kinetic manifestation of the protein protection effect. It was found that the autoxidation of bilirubin by molecular oxygen with the formation of biliverdin at the intermediate stage can be observed with an increase in the pH of solutions.
Scherbahn, V; Putze, M T; Dietzel, B; Heinlein, T; Schneider, J J; Lisdat, F
2014-11-15
Two types of carbon nanotube electrodes (1) buckypaper (BP) and (2) vertically aligned carbon nanotubes (vaCNT) have been used for elaboration of glucose/O2 enzymatic fuel cells exploiting direct electron transfer. For the anode pyrroloquinoline quinone dependent glucose dehydrogenase ((PQQ)GDH) has been immobilized on [poly(3-aminobenzoic acid-co-2-methoxyaniline-5-sulfonic acid), PABMSA]-modified electrodes. For the cathode bilirubin oxidase (BOD) has been immobilized on PQQ-modified electrodes. PABMSA and PQQ act as promoter for enzyme bioelectrocatalysis. The voltammetric characterization of each electrode shows current densities in the range of 0.7-1.3 mA/cm(2). The BP-based fuel cell exhibits maximal power density of about 107 µW/cm(2) (at 490 mV). The vaCNT-based fuel cell achieves a maximal power density of 122 µW/cm(2) (at 540 mV). Even after three days and several runs of load a power density over 110 µW/cm(2) is retained with the second system (10mM glucose). Due to a better power exhibition and an enhanced stability of the vaCNT-based fuel cells they have been studied in human serum samples and a maximal power density of 41 µW/cm(2) (390 mV) can be achieved. Copyright © 2014 Elsevier B.V. All rights reserved.
Decolorization and biodegradation of remazol brilliant blue R by bilirubin oxidase.
Liu, Youxun; Huang, Juan; Zhang, Xiaoyu
2009-12-01
The dye-decolorizing potential of bilirubin oxidase (BOX) was demonstrated for an anthraquinone dye, remazol brilliant blue R (RBBR). The dye was decolorized 40% within 4 h by the BOX alone, whereas it was more efficient in the presence of 2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), showing 91.5% decolorization within 25 min. The effects of operational parameters on decolorization were examined. The results showed that the decolorization efficiency decreased with increasing RBBR concentration, and a marked inhibition effect was exhibited when the dye concentrations were above 100 mg l(-1). The optimum temperature for enzymatic decolorization was 40 degrees C. BOX showed efficient decolorization of the dye with a wide pH range of 5-8.5. The maximum decolorization activity occurred at pH 8 with ABTS and at pH 5 without ABTS. Analysis of RBBR ultraviolet and visible (UV-VIS) spectra after BOX treatment indicated that the decolorization of RBBR was due to biodegradation. Our results suggested that ABTS can serve as an electron mediator to facilitate the oxidation of RBBR, and the BOX-ABTS mediator-involved dye decolorization mechanism was similar to that of laccase. Operation over a wide range of pH and efficient decolorization suggested that the BOX can be used to decolorize synthetic dyes from effluents, especially for anthraquinonic dyes.
Flexer, Victoria; Mano, Nicolas
2010-02-15
We propose here a new method for the direct and continuous measurement of O(2) and glucose generated during photosynthesis. Our system is based on amperometric enzyme biosensors comprising immobilized redox enzymes (glucose oxidase (GOx) and bilirubin oxidase (BOD)) and redox hydrogels "wiring" the enzyme reaction centers to electrodes. We found that these electrodes, implanted into a living plant, responded in real time to visible light as an external stimulus triggering photosynthesis. They proved to be highly selective and fast enough and may be a valuable tool in understanding photosynthesis kinetics. Furthermore, we demonstrate that with our electrodes we could harvest glucose and O(2) produced during photosynthesis to produce energy, transforming sunlight into electricity in a simple, green, renewable, and sustainable way.
Landmesser, Ulf; Spiekermann, Stephan; Dikalov, Sergey; Tatge, Helma; Wilke, Ragna; Kohler, Christoph; Harrison, David G; Hornig, Burkhard; Drexler, Helmut
2002-12-10
Impaired flow-dependent, endothelium-mediated vasodilation (FDD) in patients with chronic heart failure (CHF) results, at least in part, from accelerated degradation of nitric oxide by oxygen radicals. The mechanisms leading to increased vascular radical formation, however, remain unclear. Therefore, we determined endothelium-bound activities of extracellular superoxide dismutase (ecSOD), a major vascular antioxidant enzyme, and xanthine-oxidase, a potent radical producing enzyme, and their relation to FDD in patients with CHF. ecSOD and xanthine-oxidase activities, released from endothelium into plasma by heparin bolus injection, were determined in 14 patients with CHF and 10 control subjects. FDD of the radial artery was measured using high-resolution ultrasound and was assessed before and after administration of the antioxidant vitamin C (25 mg/min; IA). In patients with CHF, endothelium-bound ecSOD activity was substantially reduced (5.0+/-0.7 versus 14.4+/-2.6 U x mL(-1) x min(-1); P<0.01) and closely related to FDD (r=0.61). Endothelium-bound xanthine-oxidase activity was increased by >200% (38+/-10 versus 12+/-4 nmol O2*- x microL(-1); P<0.05) and inversely related to FDD (r=-0.35) in patients with CHF. In patients with low ecSOD and high xanthine-oxidase activity, a greater benefit of vitamin C on FDD was observed, ie, the portion of FDD inhibited by radicals correlated negatively with ecSOD (r=-0.71) but positively with xanthine-oxidase (r=0.75). These results demonstrate that both increased xanthine-oxidase and reduced ecSOD activity are closely associated with increased vascular oxidative stress in patients with CHF. This loss of vascular oxidative balance likely represents a novel mechanism contributing to endothelial dysfunction in CHF.
Differential Regulation of Elastic Fiber Formation by Fibulin-4 and -5*
Choudhury, Rawshan; McGovern, Amanda; Ridley, Caroline; Cain, Stuart A.; Baldwin, Andrew; Wang, Ming-Chuan; Guo, Chun; Mironov, Aleksandr; Drymoussi, Zoe; Trump, Dorothy; Shuttleworth, Adrian; Baldock, Clair; Kielty, Cay M.
2009-01-01
Fibulin-4 and -5 are extracellular glycoproteins with essential non-compensatory roles in elastic fiber assembly. We have determined how they interact with tropoelastin, lysyl oxidase, and fibrillin-1, thereby revealing how they differentially regulate assembly. Strong binding between fibulin-4 and lysyl oxidase enhanced the interaction of fibulin-4 with tropoelastin, forming ternary complexes that may direct elastin cross-linking. In contrast, fibulin-5 did not bind lysyl oxidase strongly but bound tropoelastin in terminal and central regions and could concurrently bind fibulin-4. Both fibulins differentially bound N-terminal fibrillin-1, which strongly inhibited their binding to lysyl oxidase and tropoelastin. Knockdown experiments revealed that fibulin-5 controlled elastin deposition on microfibrils, although fibulin-4 can also bind fibrillin-1. These experiments provide a molecular account of the distinct roles of fibulin-4 and -5 in elastic fiber assembly and how they act in concert to chaperone cross-linked elastin onto microfibrils. PMID:19570982
NASA Astrophysics Data System (ADS)
Nakamura, Ryuhei; Kamiya, Kazuhide; Hashimoto, Kazuhito
2010-10-01
Herein, the electron-transfer reactions occurring at the interface between bilirubin oxidase (BOD) and nanocrystalline hematite (α-Fe 2O 3) were characterized. Cyclic voltammograms indicated that BOD has an affinity for hematite surfaces and establishes a direct electron-transfer (DET) conduit between the primary electron acceptor T1 site and the conduction band of α-Fe 2O 3. DET was also confirmed photo-electrochemically, as cathodic photocurrents were generated when a nanocomposite of BOD and α-Fe 2O 3 was illuminated under oxygenated conditions. A proline residue displayed a high-binding affinity for hematite surfaces and is therefore likely part of an orientation-controlled motif which serves to locate BOD at the T1 site at a suitable distance for DET to α-Fe 2O 3.
Lalaoui, Noémie; Holzinger, Michael; Le Goff, Alan; Cosnier, Serge
2016-07-18
We report the controlled orientation of bilirubin oxidases (BOD) from Myrothecium verrucaria on multiwalled carbon nanotubes (MWCNTs) functionalised by electrografting of 6-carboxynaphthalenediazonium and 4-(2-aminoethyl)benzenediazonium salts. On negatively charged naphthoate-modified MWCNTs, a high-potential (0.44 V vs. SCE) oxygen reduction electrocatalysis is observed, occurring via the T1 copper centre. On positively charged ammonium-modified MWCNTs, a low-potential (0.15 V) oxygen reduction electrocatalysis is observed, occurring through a partially oxidised state of the T2/T3 trinuclear copper cluster. Finally, chemically modified naphthoate MWCNTs exhibit high bioelectrocatalytic current densities of 3.9 mA cm(-2) under air at gas-diffusion electrode. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A structure-based catalytic mechanism for the xanthine oxidase family of molybdenum enzymes.
Huber, R; Hof, P; Duarte, R O; Moura, J J; Moura, I; Liu, M Y; LeGall, J; Hille, R; Archer, M; Romão, M J
1996-01-01
The crystal structure of the xanthine oxidase-related molybdenum-iron protein aldehyde oxido-reductase from the sulfate reducing anaerobic Gram-negative bacterium Desulfovibrio gigas (Mop) was analyzed in its desulfo-, sulfo-, oxidized, reduced, and alcohol-bound forms at 1.8-A resolution. In the sulfo-form the molybdenum molybdopterin cytosine dinucleotide cofactor has a dithiolene-bound fac-[Mo, = O, = S, ---(OH2)] substructure. Bound inhibitory isopropanol in the inner compartment of the substrate binding tunnel is a model for the Michaelis complex of the reaction with aldehydes (H-C = O,-R). The reaction is proposed to proceed by transfer of the molybdenum-bound water molecule as OH- after proton transfer to Glu-869 to the carbonyl carbon of the substrate in concert with hydride transfer to the sulfido group to generate [MoIV, = O, -SH, ---(O-C = O, -R)). Dissociation of the carboxylic acid product may be facilitated by transient binding of Glu-869 to the molybdenum. The metal-bound water is replenished from a chain of internal water molecules. A second alcohol binding site in the spacious outer compartment may cause the strong substrate inhibition observed. This compartment is the putative binding site of large inhibitors of xanthine oxidase. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8799115
Klammt, Sebastian; Mitzner, Steffen R; Stange, Jan; Loock, Jan; Heemann, Uwe; Emmrich, Jörg; Reisinger, Emil C; Schmidt, Reinhard
2008-09-01
Extracorporeal albumin dialysis (ECAD) enables the elimination of albumin bound substances and is used as artificial liver support system. Albumin binding function for the benzodiazepine binding site specific marker Dansylsarcosine was estimated in plasma samples of 22 patients with cirrhosis and hyperbilirubinaemia (ECAD: n = 12; control: n = 10) during a period of 30 days in a randomized controlled clinical ECAD trial. Albumin Binding Capacity (ABiC) at baseline was reduced to 31.8% (median; range 24%-74%) and correlated to the severity of liver disease. Within two weeks a significant improvement of ABiC and a reduction of the albumin bound markers bilirubin and bile acids were observed in the ECAD group. During single treatments a significant decrease of albumin bound substances (bilirubin and bile acids) as well as an increase in ABiC was observed. In the control group, baseline ABiC was significantly lower in patients who died during study period (34.2% vs. 41.7%; P < 0.028), whereas no significant differences were observed for CHILD, coagulation factors, albumin, bile acids nor bilirubin. At baseline 13 patients had a severely impaired ABiC (<40%), improvement of ABiC was more frequent in the ECAD group (5/6) than in the SMT group (2/7). Reduced albumin binding function is present in decompensated liver failure and is related to severity and 30 day survival. ABiC can be improved by ECAD. The beneficial effect of this treatment may be related to the improvement of albumin binding function more than to the elimination of specific substances. Characterization of albumin function by the ABiC test may help to evaluate different liver support systems and other therapeutic measures.
NASA Astrophysics Data System (ADS)
Aquino Neto, Sidney; Milton, Ross D.; Hickey, David P.; De Andrade, Adalgisa R.; Minteer, Shelley D.
2016-08-01
The bioelectrooxidation of ethanol was investigated in a fully enzymatic membraneless ethanol/O2 biofuel cell assembly using hybrid bioanodes containing multi-walled carbon nanotube (MWCNT)-decorated gold metallic nanoparticles with either a pyrroloquinoline quinone (PQQ)-dependent alcohol dehydrogenase (ADH) enzyme or a nicotinamide adenine dinucleotide (NAD+)-dependent ADH enzyme. The biofuel cell anode was prepared with the PQQ-dependent enzyme and designed using either a direct electron transfer (DET) architecture or via a mediated electron transfer (MET) configuration through a redox polymer, 1,1‧-dimethylferrocene-modified linear polyethyleneimine (FcMe2-C3-LPEI). In the case of the bioanode containing the NAD+-dependent enzyme, only the mediated electron transfer mechanism was employed using an electropolymerized methylene green film to regenerate the NAD+ cofactor. Regardless of the enzyme being employed at the anode, a bilirubin oxidase-based biocathode prepared within a DET architecture afforded efficient electrocatalytic oxygen reduction in an ethanol/O2 biofuel cell. The power curves showed that DET-based bioanodes via the PQQ-dependent ADH still lack high current densities, whereas the MET architecture furnished maximum power density values as high as 226 ± 21 μW cm-2. Considering the complete membraneless enzymatic biofuel cell with the NAD+-dependent ADH-based bioanode, power densities as high as 111 ± 14 μW cm-2 were obtained. This shows the advantage of PQQ-dependent ADH for membraneless ethanol/O2 biofuel cell applications.
NASA Astrophysics Data System (ADS)
Mazzoni, M.; Agati, G.; Troup, G. J.; Pratesi, R.
2003-09-01
The absorption spectra of bilirubins were deconvoluted by two Gaussian curves of equal width representing the exciton bands of the non-degenerate molecular system. The two bands were used to study the wavelength dependence of the (4Z, 15Z) rightarrow (4Z, 15E) configurational photoisomerization quantum yield of the bichromophoric bilirubin-IXalpha (BR-IX), the intrinsically asymmetric bile pigment associated with jaundice and the symmetrically substituted bilirubins (bilirubin-IIIalpha and mesobilirubin-XIIIalpha), when they are irradiated in aqueous solution bound to human serum albumin (HSA). The same study was performed for BR-IX in ammoniacal methanol solution (NH4OH/MeOH). The quantum yields of the configurational photoprocesses were fitted with a combination function of the two Gaussian bands normalized to the total absorption, using the proportionality coefficients and a scaling factor as parameters. The decrease of the (4Z, 15Z) rightarrow (4Z, 15E) quantum yield with increasing wavelength, which occurs for wavelengths longer than the most probable Franck-Condon transition of the molecule, did not result in a unique function of the exciton absorptions. In particular we found two ranges corresponding to different exciton interactions with different proportionality coefficients and scaling factors. The wavelength-dependent photoisomerization of bilirubins was described as an abrupt change in quantum yield as soon as the resulting excitation was strongly localized in each chromophore. The change was correlated to a variation of the interaction between the two chromophores when the short-wavelength exciton absorption became vanishingly small. With the help of the circular dichroism (CD) spectrum of BR-IX in HSA, a small band was resolved in the bilirubin absorption spectrum, delivering part of the energy required for the (4Z, 15Z) rightarrow (4Z, 15E) photoisomerization of the molecule.
Photo-isomerization and oxidation of bilirubin in mammals is dependent on albumin binding.
Goncharova, Iryna; Jašprová, Jana; Vítek, Libor; Urbanová, Marie
2015-12-01
The bilirubin (BR) photo-conversion in the human body is a protein-dependent process; an effective photo-isomerization of the potentially neurotoxic Z,Z-BR as well as its oxidation to biliverdin in the antioxidant redox cycle is possible only when BR is bound on serum albumin. We present a novel analytical concept in the study of linear tetrapyrroles metabolic processes based on an in-depth mapping of binding sites in the structure of human serum albumin (HSA). A combination of fluorescence spectroscopy, circular dichroism (CD) spectroscopy, and molecular modeling methods was used for recognition of the binding site for BR, its derivatives (mesobilirubin and bilirubin ditaurate), and the products of the photo-isomerization and oxidation (lumirubin, biliverdin, and xanthobilirubic acid) on HSA. The CD spectra and fluorescent quenching of the Trp-HSA were used to calculate the binding constants. The results of the CD displacement experiments performed with hemin were interpreted together with the findings of molecular docking performed on the pigment-HSA complexes. We estimated that Z,Z-BR and its metabolic products bind on two independent binding sites. Our findings support the existence of a reversible antioxidant redox cycle for BR and explain an additional pathway of the photo-isomerization process (increase of HSA binding capacity; the excess free [unbound] BR can be converted and also bound to HSA). Copyright © 2015 Elsevier Inc. All rights reserved.
Miyata, Naoyuki; Tani, Yukinori; Maruo, Kanako; Tsuno, Hiroshi; Sakata, Masahiro; Iwahori, Keisuke
2006-01-01
Ascomycetes that can deposit Mn(III, IV) oxides are widespread in aquatic and soil environments, yet the mechanism(s) involved in Mn oxide deposition remains unclear. A Mn(II)-oxidizing ascomycete, Acremonium sp. strain KR21-2, produced a Mn oxide phase with filamentous nanostructures. X-ray absorption near-edge structure (XANES) spectroscopy showed that the Mn phase was primarily Mn(IV). We purified to homogeneity a laccase-like enzyme with Mn(II) oxidase activity from cultures of strain KR21-2. The purified enzyme oxidized Mn(II) to yield suspended Mn particles; XANES spectra indicated that Mn(II) had been converted to Mn(IV). The pH optimum for Mn(II) oxidation was 7.0, and the apparent half-saturation constant was 0.20 mM. The enzyme oxidized ABTS [2,2′-azinobis(3-ethylbenzothiazoline-6-sulfonic acid)] (pH optimum, 5.5; Km, 1.2 mM) and contained two copper atoms per molecule. Moreover, the N-terminal amino acid sequence (residues 3 to 25) was 61% identical with the corresponding sequence of an Acremonium polyphenol oxidase and 57% identical with that of a Myrothecium bilirubin oxidase. These results provide the first evidence that a fungal multicopper oxidase can convert Mn(II) to Mn(IV) oxide. The present study reinforces the notion of the contribution of multicopper oxidase to microbially mediated precipitation of Mn oxides and suggests that Acremonium sp. strain KR21-2 is a good model for understanding the oxidation of Mn in diverse ascomycetes. PMID:17021194
Minteer, Shelley D
2016-05-01
Anodic bioelectrodes for biofuel cells are more complex than cathodic bioelectrodes for biofuel cells, because laccase and bilirubin oxidase can individually catalyze four electron reduction of oxygen to water, whereas most anodic enzymes only do a single two electron oxidation of a complex fuel (i.e. glucose oxidase oxidizing glucose to gluconolactone while generating 2 electrons of the total 24 electrons), so enzyme cascades are typically needed for complete oxidation of the fuel. This review article will discuss the lessons learned from natural metabolic pathways about multi-step oxidation and how those lessons have been applied to minimal or artificial enzyme cascades. This article is part of a Special Issue entitled Biodesign for Bioenergetics--the design and engineering of electronic transfer cofactors, proteins and protein networks, edited by Ronald L. Koder and J.L. Ross Anderson. Copyright © 2015. Published by Elsevier B.V.
Doussiere, Jacques; Bouzidi, Farid; Vignais, Pierre V
2002-07-01
In a previous study, the S100A8/A9 protein, a Ca2+- and arachidonic acid-binding protein, abundant in neutrophil cytosol, was found to potentiate the activation of the redox component of the O2- generating oxidase in neutrophils, namely the membrane-bound flavocytochrome b, by the cytosolic phox proteins p67phox, p47phox and Rac (Doussière J., Bouzidi F. and Vignais P.V. (2001) Biochem. Biophys. Res. Commun.285, 1317-1320). This led us to check by immunoprecipitation and protein fractionation whether the cytosolic phox proteins could bind to S100A8/A9. Following incubation of a cytosolic extract from nonactivated bovine neutrophil with protein A-Sepharose bound to anti-p67phox antibodies, the recovered immunoprecipitate contained the S100 protein, p47phox and p67phox. Cytosolic protein fractionation comprised two successive chromatographic steps on hydroxyapatite and DEAE cellulose, followed by isoelectric focusing. The S100A8/A9 heterodimeric protein comigrated with the cytosolic phox proteins, and more particularly with p67phox and Rac2, whereas the isolated S100A8 protein displayed a tendancy to bind to p47phox. Using a semirecombinant cell-free system of oxidase activation consisting of recombinant p67phox, p47phox and Rac2, neutrophil membranes and arachidonic acid, we found that the S100A8/A9-dependent increase in the elicited oxidase activity corresponded to an increase in the turnover of the membrane-bound flavocytochrome b, but not to a change of affinity for NADPH or O2. In the absence of S100A8/A9, oxidase activation departed from michaelian kinetics above a critical threshold concentration of cytosolic phox proteins. Addition of S100A8/A9 to the cell-free system rendered the kinetics fully michaelian. The propensity of S100A8/A9 to bind the cytosolic phox proteins, and the effects of S100A8/A9 on the kinetics of oxidase activation, suggest that S100A8/A9 might be a scaffold protein for the cytosolic phox proteins or might help to deliver arachidonic acid to the oxidase, thus favoring the productive interaction of the cytosolic phox proteins with the membrane-bound flavocytochrome b.
Structure of caa(3) cytochrome c oxidase--a nature-made enzyme-substrate complex.
Noor, Mohamed Radzi; Soulimane, Tewfik
2013-05-01
Aerobic respiration, the energetically most favorable metabolic reaction, depends on the action of terminal oxidases that include cytochrome c oxidases. The latter forms a part of the heme-copper oxidase superfamily and consists of three different families (A, B, and C types). The crystal structures of all families have now been determined, allowing a detailed structural comparison from evolutionary and functional perspectives. The A2-type oxidase, exemplified by the Thermus thermophilus caa(3) oxidase, contains the substrate cytochrome c covalently bound to the enzyme complex. In this article, we highlight the various features of caa(3) enzyme and provide a discussion of their importance, including the variations in the proton and electron transfer pathways.
Korman, Jessica D; Volenberg, Irene; Balko, Jody; Webster, Joe; Schiodt, Frank V; Squires, Robert H; Fontana, Robert J; Lee, William M; Schilsky, Michael L
2008-10-01
Acute liver failure (ALF) due to Wilson disease (WD) is invariably fatal without emergency liver transplantation. Therefore, rapid diagnosis of WD should aid prompt transplant listing. To identify the best method for diagnosis of ALF due to WD (ALF-WD), data and serum were collected from 140 ALF patients (16 with WD), 29 with other chronic liver diseases and 17 with treated chronic WD. Ceruloplasmin (Cp) was measured by both oxidase activity and nephelometry and serum copper levels by atomic absorption spectroscopy. In patients with ALF, a serum Cp <20 mg/dL by the oxidase method provided a diagnostic sensitivity of 21% and specificity of 84% while, by nephelometry, a sensitivity of 56% and specificity of 63%. Serum copper levels exceeded 200 microg/dL in all ALF-WD patients measured (13/16), but were also elevated in non-WD ALF. An alkaline phosphatase (AP) to total bilirubin (TB) ratio <4 yielded a sensitivity of 94%, specificity of 96%, and a likelihood ratio of 23 for diagnosing fulminant WD. In addition, an AST:ALT ratio >2.2 yielded a sensitivity of 94%, a specificity of 86%, and a likelihood ratio of 7 for diagnosing fulminant WD. Combining the tests provided a diagnostic sensitivity and specificity of 100%. Conventional WD testing utilizing serum ceruloplasmin and/or serum copper levels are less sensitive and specific in identifying patients with ALF-WD than other available tests. More readily available laboratory tests including alkaline phosphatase, bilirubin and serum aminotransferases by contrast provides the most rapid and accurate method for diagnosis of ALF due to WD.
Microbe–microbe interactions trigger Mn(II)-oxidizing gene expression
Liang, Jinsong; Bai, Yaohui; Men, Yujie; Qu, Jiuhui
2017-01-01
Manganese (Mn) is an important metal in geochemical cycles. Some microorganisms can oxidize Mn(II) to Mn oxides, which can, in turn, affect the global cycles of other elements by strong sorption and oxidation effects. Microbe–microbe interactions have important roles in a number of biological processes. However, how microbial interactions affect Mn(II) oxidation still remains unknown. Here, we investigated the interactions between two bacteria (Arthrobacter sp. and Sphingopyxis sp.) in a co-culture, which exhibited Mn(II)-oxidizing activity, although neither were able to oxidize Mn(II) in isolation. We demonstrated that the Mn(II)-oxidizing activity in co-culture was most likely induced via contact-dependent interactions. The expressed Mn(II)-oxidizing protein in the co-culture was purified and identified as a bilirubin oxidase belonging to strain Arthrobacter. Full sequencing of the bilirubin oxidase-encoding gene (boxA) was performed. The Mn(II)-oxidizing protein and the transcripts of boxA were detected in the co-culture, but not in either of the isolated cultures. This indicate that boxA was silent in Arthrobacter monoculture, and was activated in response to presence of Sphingopyxis in the co-culture. Further, transcriptomic analysis by RNA-Seq, extracellular superoxide detection and cell density quantification by flow cytometry indicate induction of boxA gene expression in Arthrobacter was co-incident with a stress response triggered by co-cultivation with Sphingopyxis. Our findings suggest the potential roles of microbial physiological responses to stress induced by other microbes in Mn(II) oxidation and extracellular superoxide production. PMID:27518809
Why copper is preferred over iron for oxygen activation and reduction in haem-copper oxidases.
Bhagi-Damodaran, Ambika; Michael, Matthew A; Zhu, Qianhong; Reed, Julian; Sandoval, Braddock A; Mirts, Evan N; Chakraborty, Saumen; Moënne-Loccoz, Pierre; Zhang, Yong; Lu, Yi
2017-03-01
Haem-copper oxidase (HCO) catalyses the natural reduction of oxygen to water using a haem-copper centre. Despite decades of research on HCOs, the role of non-haem metal and the reason for nature's choice of copper over other metals such as iron remains unclear. Here, we use a biosynthetic model of HCO in myoglobin that selectively binds different non-haem metals to demonstrate 30-fold and 11-fold enhancements in the oxidase activity of Cu- and Fe-bound HCO mimics, respectively, as compared with Zn-bound mimics. Detailed electrochemical, kinetic and vibrational spectroscopic studies, in tandem with theoretical density functional theory calculations, demonstrate that the non-haem metal not only donates electrons to oxygen but also activates it for efficient O-O bond cleavage. Furthermore, the higher redox potential of copper and the enhanced weakening of the O-O bond from the higher electron density in the d orbital of copper are central to its higher oxidase activity over iron. This work resolves a long-standing question in bioenergetics, and renders a chemical-biological basis for the design of future oxygen-reduction catalysts.
NASA Astrophysics Data System (ADS)
Xia, Hong-qi; So, Keisei; Kitazumi, Yuki; Shirai, Osamu; Nishikawa, Koji; Higuchi, Yoshiki; Kano, Kenji
2016-12-01
A membraneless direct electron transfer (DET)-type dihydrogen (H2)/air-breathing biofuel cell without any mediator was constructed wherein bilirubin oxidase from Myrothecium verrucaria (BOD) and membrane-bound [NiFe] hydrogenase from Desulfovibrio vulgaris Miyazaki F (MBH) were used as biocatalysts for the cathode and the anode, respectively, and Ketjen black-modified water proof carbon paper (KB/WPCC) was used as an electrode material. The KB/WPCC surface was modified with 2-aminobenzoic acid and p-phenylenediamine, respectively, to face the positively charged electron-accepting site of BOD and the negatively charged electron-donating site of MBH to the electrode surface. A gas-diffusion system was employed for the electrodes to realize high-speed substrate supply. As result, great improvement in the current density of O2 reduction with BOD and H2 reduction with MBH were realized at negatively and postively charged surfaces, respectively. Gas diffusion system also suppressed the oxidative inactivation of MBH at high electrode potentials. Finally, based on the improved bioanode and biocathode, a dual gas-diffusion membrane- and mediatorless H2/air-breathing biofuel cell was constructed. The maximum power density reached 6.1 mW cm-2 (at 0.72 V), and the open circuit voltage was 1.12 V using 1 atm of H2 gas as a fuel at room temperature and under passive and quiescent conditions.
In vivo oxalate degradation by liposome encapsulated oxalate oxidase in rat model of hyperoxaluria
Dahiya, Tulika; Pundir, C.S.
2013-01-01
Background & objectives: High level of urinary oxalate substantially increases the risk of hyperoxaluria, a significant risk factor for urolithiasis. The primary goal of this study was to reduce urinary oxalate excretion employing liposome encapsulated oxalate oxidase in animal model. Methods: A membrane bound oxalate oxidase was purified from Bougainvillea leaves. The enzyme in its native form was less effective at the physiological pH of the recipient animal. To increase its functional viability, the enzyme was immobilized on to ethylene maleic anhydride (EMA). Rats were injected with liposome encapsulated EMA- oxalate oxidase and the effect was observed on degradation of oxalic acid. Results: The enzyme was purified to apparent homogeneity with 60-fold purification and 31 per cent yield. The optimum pH of EMA-derivative enzyme was 6.0 and it showed 70 per cent of its optimal activity at pH 7.0. The EMA-bound enzyme encapsulated into liposome showed greater oxalate degradation in 15 per cent casein vitamin B6 deficient fed rats as compared with 30 per cent casein vitamin B6 deficient fed rats and control rats. Interpretation & conclusions: EMA-oxalate oxidase encapsulated liposome caused oxalate degradation in experimental hyperoxaluria indicating that the enzyme could be used as a therapeutic agent in hyperoxaluria leading to urinary stones. PMID:23481063
Minimizing the cancer-promotional activity of cox-2 as a central strategy in cancer prevention.
McCarty, Mark F
2012-01-01
A recent meta-analysis examining long-term mortality in subjects who participated in controlled studies evaluating the impact of daily aspirin on vascular risk, has concluded that aspirin confers substantial protection from cancer mortality. Remarkably, low-dose aspirin was as effective as higher-dose regimens; hence this protection may be achievable with minimal risk. There is reason to believe that this protection stems primarily from inhibition of cox-2 in pre-neoplastic lesions. Since safe aspirin regimens can only achieve a partial and transitory inhibition of cox-2, it may be feasible to complement the cancer-protective benefit of aspirin with other measures which decrease cox-2 expression or which limit the bioactivity of cox-2-derived PGE2. Oxidative stress boosts cox-2 expression by up-regulating activation of NF-kappaB and MAP kinases; NADPH oxidase activation may thus promote carcinogenesis by increasing cox-2 expression while also amplifying oxidant-mediated mutagenesis. A prospective cohort study has observed that relatively elevated serum bilirubin levels are associated with a marked reduction in subsequent cancer mortality; this may reflect bilirubin's physiological role as a potent inhibitor of NADPH oxidase. It may be feasible to mimic this protective effect by supplementing with spirulina, a rich source of a phycobilin which shares bilirubin's ability to inhibit NADPH oxidase. Ancillary antioxidant measures - phase 2 inducing phytochemicals, melatonin, N-acetylcysteine, and astaxanthin - may also aid cox-2 down-regulation. The cancer protection often associated with high-normal vitamin D status may be attributable, in part, to the ability of the activated vitamin D receptor to decrease cox-2 expression while promoting PGE2 catabolism and suppressing the expression of PGE2 receptors. Diets with a relatively low ratio of omega-6 to long-chain omega-3 fats may achieve cancer protection by antagonizing the production and bioactivity of PGE2. Growth factors such as IGF-I increase cox-2 expression by several complementary mechanisms; hence, decreased cox-2 activity may play a role in the remarkably low mortality from "Western" cancers enjoyed by Third World cultures in which systemic growth factor activity was minimized by quasi-vegan diets complemented by leanness and excellent muscle insulin sensitivity. Practical strategies for achieving a modest degree of calorie restriction may also have potential for down-regulating cox-2 expression while decreasing cancer risk. Soy isoflavones, linked to reduced cancer risk in Asian epidemiology, may suppress cox-2 induction by activating ERbeta. In aggregate, these considerations suggest that a comprehensive lifestyle strategy targeting cox-2 expression and bioactivity may have tremendous potential for cancer prevention. Copyright © 2011 Elsevier Ltd. All rights reserved.
Zheng, Jing; Inoguchi, Toyoshi; Sasaki, Shuji; Maeda, Yasutaka; McCarty, Mark F; Fujii, Masakazu; Ikeda, Noriko; Kobayashi, Kunihisa; Sonoda, Noriyuki; Takayanagi, Ryoichi
2013-01-15
We and other investigators have reported that bilirubin and its precursor biliverdin may have beneficial effects on diabetic vascular complications, including nephropathy, via its antioxidant effects. Here, we investigated whether phycocyanin derived from Spirulina platensis, a blue-green algae, and its chromophore phycocyanobilin, which has a chemical structure similar to that of biliverdin, protect against oxidative stress and renal dysfunction in db/db mice, a rodent model for Type 2 diabetes. Oral administration of phycocyanin (300 mg/kg) for 10 wk protected against albuminuria and renal mesangial expansion in db/db mice, and normalized tumor growth factor-β and fibronectin expression. Phycocyanin also normalized urinary and renal oxidative stress markers and the expression of NAD(P)H oxidase components. Similar antioxidant effects were observed following oral administration of phycocyanobilin (15 mg/kg) for 2 wk. Phycocyanobilin, bilirubin, and biliverdin also inhibited NADPH dependent superoxide production in cultured renal mesangial cells. In conclusion, oral administration of phycocyanin and phycocyanobilin may offer a novel and feasible therapeutic approach for preventing diabetic nephropathy.
Electrochemical Performance of Glucose/Oxygen Biofuel Cells Based on Carbon Nanostructures.
Koo, Min-Hye; Das, Gautam; Yoon, Hyon Hee
2016-03-01
The electrochemical performance of glucose/oxygen biofuel cells based on carbon nanostructures was investigated in the present study. Different types of carbon nanomaterials, including multi-walled carbon nanotubes (MWCNT), functionalized MWCNT (f-MWCNT), carbon nanofibers (CNF), and functionalized CNF (f-CNF) were examined for electrode fabrications. The anode for glucose/oxygen biofuel cells were prepared by sequential coating of carbon nanomaterials, charge transfer complex (CTC), glucose oxidase (GOx) and nafion membrane. The anode was then integrated with a bilirubin oxidase-immobilized cathode for the biofuel cell test. It was found that the electrochemical performance of the enzyme electrodes was remarkably enhanced by the amalgamation of carbon nanomaterials with the CTC. The biofuel cell with anode comprising of f-CNF and the cathode with MWCNT exhibited the best electrochemical performance with a maximum power density of 210 μW/cm2 at a cell voltage of 0.44 V for 20 mM glucose concentration, which is comparable with the best power density value reported earlier.
The pH dependence of the cathodic peak potential of the active sites in bilirubin oxidase.
Filip, Jaroslav; Tkac, Jan
2014-04-01
This is the first study showing pH dependence of three distinct redox sites within bilirubin oxidase (BOD) adsorbed on a nanocomposite modified electrode. The 1st redox centre with the highest redox potential Ec(1st)=404 mV vs. Ag/AgCl (614 mV vs. NHE at pH7.0) exhibited pH dependence with a slope -dEc(1st)/dpH=66(±3) mV under a non-turnover process. The 2nd redox centre with a potential Ec(2nd)=228 mV vs. Ag/AgCl (438 mV vs. NHE at pH7.0) was not dependent on pH in the absence and presence of O2. Finally, the 3rd redox site with a redox potential Ec(3rd)=92 mV vs. Ag/AgCl (302 mV vs. NHE at pH7.0) exhibited pH dependence for a cathodic process with -dEc(3rd)/dpH=70(±6) mV and for anodic process with -dEa(3rd)/dpH=73(±2) mV, respectively. Moreover, two break points for dependence of Ec(1st) or Ec(3rd) on pH were observed for the 1st (T1) site and the 3rd site assigned to involvement of two acidic amino acids (Asp105 and Glu463). A diagram of a potential difference between cathodic peaks of BOD as a dependence on pH is shown. The results obtained can be of interest for construction of biofuel cells based on BOD such as for generation of a low level of electricity from body fluids. Copyright © 2013 Elsevier B.V. All rights reserved.
Bilirubin and bile acids removal by haemoperfusion through synthetic resin "Persorb".
Filip, K; Malý, J; Horký, J; Tlustáková, M; Kálal, J; Vrána, M
1990-01-01
A new type of styrene-divinylbenzene copolymer coated with polyhema was tested for biocompatibility and ability to remove bile acid, bilirubin, phenols and cholesterol in dogs with surgically induced biliary obstruction. After 4-hr hemoperfusion through a polypropylene column containing 325 g of resin, performed 7-10 days after the ligature of the cystic and common bile duct, the serum levels of bile acids, bilirubin, phenols and cholesterol decreased by 60.9 +/- 30.3% (p less than 0.001), 34.8 +/- 12.2% (p less than 0.001), 19.4 +/- 15.6% (p less than 0.001) and 15.3 +/- 4.2% (p less than 0.05), respectively. The procedure was well tolerated, no bleeding or other adverse reactions occurred. The average platelet count decreased by 19.4 +/- 15.6% (p less than 0.05). Hemoperfusion through the Czechoslovak resin coated with polyhema is safe and efficient for removal of bile acids and other protein-bound and lipid-soluble substances which accumulate in cholestatic syndromes and hepatic failure. Thus, it may play an important role in the treatment of such events as a method of artificial liver support.
Kim, Man Suk; Kim, Young Jae
2004-11-30
Membranes prepared from Bacillus cereus KCTC 3674, grown aerobically on a complex medium, oxidized NADH exclusively, whereas deamino-NADH was little oxidized. The respiratory chain-linked NADH oxidase exhibited an apparent K(m) value of approximately 65 microM for NADH. The maximum activity of the NADH oxidase was obtained at about pH 8.5 in the presence of 0.1 M KCl (or NaCl). Respiratory chain inhibitor 2-heptyl-4-hydroxyquinoline-N-oxide (HQNO) inhibited the activity of the NADH oxidase by about 90% at a concentration of 40 microM. Interestingly, rotenone and capsaicin inhibited the activity of the NADH oxidase by about 60% at a concentration of 40 microM and the activity was also highly sensitive to Ag(+).
Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1
Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.
2001-01-01
It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345
Heitbrink, Dirk; Sigurdson, Håkan; Bolwien, Carsten; Brzezinski, Peter; Heberle, Joachim
2002-01-01
The redox-driven proton pump cytochrome c oxidase is that enzymatic machinery of the respiratory chain that transfers electrons from cytochrome c to molecular oxygen and thereby splits molecular oxygen to form water. To investigate the reaction mechanism of cytochrome c oxidase on the single vibrational level, we used time-resolved step-scan Fourier transform infrared spectroscopy and studied the dynamics of the reduced enzyme after photodissociation of bound carbon monoxide across the mid-infrared range (2300-950 cm(-1)). Difference spectra of the bovine complex were obtained at -20 degrees C with 5 micros time resolution. The data demonstrate a dynamic link between the transient binding of CO to Cu(B) and changes in hydrogen bonding at the functionally important residue E(I-286). Variation of the pH revealed that the pK(a) of E(I-286) is >9.3 in the fully reduced CO-bound oxidase. Difference spectra of cytochrome c oxidase from beef heart are compared with those of the oxidase isolated from Rhodobacter sphaeroides. The bacterial enzyme does not show the environmental change in the vicinity of E(I-286) upon CO dissociation. The characteristic band shape appears, however, in redox-induced difference spectra of the bacterial enzyme but is absent in redox-induced difference spectra of mammalian enzyme. In conclusion, it is demonstrated that the dynamics of a large protein complex such as cytochrome c oxidase can be resolved on the single vibrational level with microsecond Fourier transform infrared spectroscopy. The applied methodology provides the basis for future investigations of the physiological reaction steps of this important enzyme. PMID:11751290
NASA Astrophysics Data System (ADS)
Yazdi, Alireza Ahmadian; Preite, Roberto; Milton, Ross D.; Hickey, David P.; Minteer, Shelley D.; Xu, Jie
2017-03-01
Enzymatic biobatteries can be implanted in living organisms to exploit the chemical energy stored in physiological fluids. Generally, commonly-used electron donors (such as sugars) are ubiquitous in physiological environments, while electron acceptors such as oxygen are limited due to many factors including solubility, temperature, and pressure. The wide range of solid-state cathodes, however, may replace the need for oxygen breathing electrodes and serve in enzymatic biobatteries for implantable devices. Here, we have fabricated a glucose biobattery suitable for in vivo applications employing a glucose oxidase (GOx) anode coupled to a solid-state Prussian Blue (PB) thin-film cathode. PB is a non-toxic material and its electrochemistry enables fast regeneration if used in a secondary cell. This novel biobattery can effectively operate in a membraneless architecture as PB can reduce the peroxide produced by some oxidase enzymes. The resulting biobattery delivers a maximum power and current density of 44 μW cm-2 and 0.9 mA cm-2 , respectively, which is ca. 37% and 180% higher than an equivalent enzymatic fuel cell equipped with a bilirubin oxidase cathode. Moreover, the biobattery demonstrated a stable performance over 20 cycles of charging and discharging periods with only ca. 3% loss of operating voltage.
The reaction pathway of membrane-bound rat liver mitochondrial monoamine oxidase
Houslay, Miles D.; Tipton, Keith F.
1973-01-01
1. A preparation of a partly purified mitochondrial outer-membrane fraction suitable for kinetic investigations of monoamine oxidase is described. 2. An apparatus suitable for varying the O2 concentration in a spectrophotometer cuvette is described. 3. The reaction catalysed by the membrane-bound enzyme is shown to proceed by a double-displacement (Ping Pong) mechanism, and a formal mechanism is proposed. 4. KCN, NaN3, benzyl cyanide and 4-cyanophenol are shown to be reversible inhibitors of the enzyme. 5. The non-linear reciprocal plot obtained with impure preparations of benzylamine, which is typical of high substrate inhibition, is shown to be due to aldehyde contamination of the substrate. PMID:4778271
Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.
Hinkkanen, A; Maly, F E; Decker, K
1983-04-01
The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.
Biofuel cell anode: NAD +/glucose dehydrogenase-coimmobilized ketjenblack electrode
NASA Astrophysics Data System (ADS)
Miyake, T.; Oike, M.; Yoshino, S.; Yatagawa, Y.; Haneda, K.; Kaji, H.; Nishizawa, M.
2009-09-01
We have studied the coimmobilization of glucose dehydrogenase (GDH) and its cofactor, oxidized nicotinamide adenine dinucleotide (NAD +), on a ketjenblack (KB) electrode as a step toward a biofuel cell anode that works without mediators. A KB electrode was first treated with a sulfuric acid/nitric acid/water mixture to lower the overvoltage for NADH oxidation, and was next chemically modified with NAD + and GDH. The improved GDH/NAD +/KB electrode is found to oxidize glucose around 0 V vs. Ag/AgCl. A biofuel cell constructed with a bilirubin oxidase-immobilized KB cathode showed a maximum power density of 52 μW/cm 2 at 0.3 V.
A Conserved Steroid Binding Site in Cytochrome c Oxidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Qin, Ling; Mills, Denise A.; Buhrow, Leann
2010-09-02
Micromolar concentrations of the bile salt deoxycholate are shown to rescue the activity of an inactive mutant, E101A, in the K proton pathway of Rhodobacter sphaeroides cytochrome c oxidase. A crystal structure of the wild-type enzyme reveals, as predicted, deoxycholate bound with its carboxyl group at the entrance of the K path. Since cholate is a known potent inhibitor of bovine oxidase and is seen in a similar position in the bovine structure, the crystallographically defined, conserved steroid binding site could reveal a regulatory site for steroids or structurally related molecules that act on the essential K proton path.
Robbins, John M; Souffrant, Michael G; Hamelberg, Donald; Gadda, Giovanni; Bommarius, Andreas S
2017-07-25
Flavins, including flavin adenine dinucleotide (FAD), are fundamental catalytic cofactors that are responsible for the redox functionality of a diverse set of proteins. Alternatively, modified flavin analogues are rarely found in nature as their incorporation typically results in inactivation of flavoproteins, thus leading to the disruption of important cellular pathways. Here, we report that the fungal flavoenzyme formate oxidase (FOX) catalyzes the slow conversion of noncovalently bound FAD to 8-formyl FAD and that this conversion results in a nearly 10-fold increase in formate oxidase activity. Although the presence of an enzyme-bound 8-formyl FMN has been reported previously as a result of site-directed mutagenesis studies of lactate oxidase, FOX is the first reported case of 8-formyl FAD in a wild-type enzyme. Therefore, the formation of the 8-formyl FAD cofactor in formate oxidase was investigated using steady-state kinetics, site-directed mutagenesis, ultraviolet-visible, circular dichroism, and fluorescence spectroscopy, liquid chromatography with mass spectrometry, and computational analysis. Surprisingly, the results from these studies indicate not only that 8-formyl FAD forms spontaneously and results in the active form of FOX but also that its autocatalytic formation is dependent on a nearby arginine residue, R87. Thus, this work describes a new enzyme cofactor and provides insight into the little-understood mechanism of enzyme-mediated 8α-flavin modifications.
Nicholls, P
2007-10-01
Alexander Bach was both revolutionary politician and biochemist. His earliest significant publication, "Tsar-golod" ("The Tsar of Hunger"), introduced Marxist thought to Russian workers. In exile for 30 years, he moved to study the dialectic of the oxidases. When his theory of oxidases as combinations of oxygenases and peroxidases was developed (circa 1900) the enzyme concept was not fully formulated, and the enzyme/substrate distinction not yet made. Peroxides however were then and remain now significant intermediates, when either free or bound, in oxidase catalyses. The aerobic dehydrogenase/peroxidase/catalase coupled systems which were studied slightly later clarified the Bach model and briefly became an oxidase paradigm. Identification of peroxidase as a metalloprotein, a key step in understanding oxidase and peroxidase mechanisms, postdated Bach's major work. Currently we recognize catalytic organic peroxides in flavoprotein oxygenases; such organic peroxides are also involved in lipid oxidation and tryptophan radical decay. But most physiologically important peroxides are now known to be bound to transition metals (either Fe or Cu) and formed both directly and indirectly (from oxygen). The typical stable metalloprotein peroxide product is the ferryl state. When both peroxide oxidizing equivalents are retained the second equivalent is held as a protein or porphyrin radical. True metal peroxide complexes are unstable. But often water molecules mark the spot where the original peroxide decayed. The cytochrome c oxidase Fe-Cu center can react with either peroxide or oxygen to form the intermediate higher oxidation states P and F. In its resting state water molecules and hydroxyl ions can be seen marking the original location of the oxygen or peroxide molecule.
Troise, Antonio Dario; Buonanno, Martina; Fiore, Alberto; Monti, Simona Maria; Fogliano, Vincenzo
2016-12-01
Thermal treatments and storage influence milk quality, particularly in low lactose milk as the higher concentration of reducing sugars can lead to the increased formation of the Maillard reaction products (MRPs). The control of the Amadori products (APs) formation is the key step to mitigate the Maillard reaction (MR) in milk. The use of fructosamine oxidases, (Faox) provided promising results. In this paper, the effects of Faox I were evaluated by monitoring the concentration of free and bound MRPs in low lactose milk during shelf life. Results showed that the enzyme reduced the formation of protein-bound MRPs down to 79% after six days at 37°C. Faox I lowered the glycation of almost all the free amino acids resulting effective on basic and polar amino acids. Data here reported corroborate previous findings on the potentiality of Faox enzymes in controlling the early stage of the MR in foods. Copyright © 2016 Elsevier Ltd. All rights reserved.
Spiekermann, Stephan; Landmesser, Ulf; Dikalov, Sergey; Bredt, Martin; Gamez, Graciela; Tatge, Helma; Reepschläger, Nina; Hornig, Burkhard; Drexler, Helmut; Harrison, David G
2003-03-18
Increased inactivation of nitric oxide by superoxide (O2*-) contributes to endothelial dysfunction in patients with coronary disease (CAD). We therefore characterized the vascular activities of xanthine oxidase and NAD(P)H oxidase, 2 major O2*--producing enzyme systems, and their relationship with flow-dependent, endothelium-mediated vasodilation (FDD) in patients with CAD. Xanthine- and NAD(P)H-mediated O*.- formation was determined in coronary arteries from 10 patients with CAD and 10 controls by using electron spin resonance spectroscopy. Furthermore, activity of endothelium-bound xanthine oxidase in vivo and FDD of the radial artery were determined in 21 patients with CAD and 10 controls. FDD was measured before and after infusion of the antioxidant vitamin C (25 mg/min i.a.) to determine the portion of FDD inhibited by radicals. In coronary arteries from patients with CAD, xanthine- and NAD(P)H-mediated O2*- formation was increased compared with controls (xanthine: 12+/-2 versus 7+/-1 nmol O2*-/ microg protein; NADH: 11+/-1 versus 7+/-1 nmol O2*-/ microg protein; and NADPH: 12+/-2 versus 9+/-1 nmol O2*-/ microg protein; each P<0.05). Endothelium-bound xanthine oxidase activity was increased by >200% in patients with CAD (25+/-4 versus 9+/-1 nmol O2*-/ microL plasma per min; P<0.05) and correlated inversely with FDD (r=-0.55; P<0.05) and positively with the effect of vitamin C on FDD (r=0.54; P<0.05). The present study represents the first electron spin resonance measurements of xanthine and NAD(P)H oxidase activity in human coronary arteries and supports the concept that increased activities of both enzymes contribute to increased vascular oxidant stress in patients with CAD. Furthermore, the present study suggests that increased xanthine oxidase activity contributes to endothelial dysfunction in patients with CAD and may thereby promote the atherosclerotic process.
Positron emitter labeled enzyme inhibitors
Fowler, Joanna S.; MacGregor, Robert R.; Wolf, Alfred P.; Langstrom, Bengt
1990-01-01
This invention involves a new strategy for imaging and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide inactivators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography.
Bremer, Daniel; Leben, Ruth; Mothes, Ronja; Radbruch, Helena; Niesner, Raluca
2017-04-03
Fluorescence-lifetime imaging microscopy (FLIM) is a technique to generate images, in which the contrast is obtained by the excited-state lifetime of fluorescent molecules instead of their intensity and emission spectrum. The ubiquitous coenzymes NADH and NADPH, hereafter NAD(P)H, in cells show a short fluorescence lifetime ≈400 psec in the free-state and a longer fluorescence lifetime when bound to enzymes. The fluorescence lifetime of NAD(P)H in this state depends on the binding-site on the specific enzyme. In the case of NADPH bound to members of the NADPH oxidases family we measured a fluorescence lifetime of 3650 psec as compared to enzymes typically active in cells, in which case fluorescence lifetimes of ∼2000 psec are measured. Here we present a robust protocol based on NAD(P)H fluorescence lifetime imaging in isolated cells to distinguish between normally active enzymes and NADPH oxidases, mainly responsible for oxidative stress. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Funabashi, Hiroto; Takeuchi, Satoshi; Tsujimura, Seiya
2017-03-23
We designed a three-dimensional (3D) hierarchical pore structure to improve the current production efficiency and stability of direct electron transfer-type biocathodes. The 3D hierarchical electrode structure was fabricated using a MgO-templated porous carbon framework produced from two MgO templates with sizes of 40 and 150 nm. The results revealed that the optimal pore composition for a bilirubin oxidase-catalysed oxygen reduction cathode was a mixture of 33% macropores and 67% mesopores (MgOC 33 ). The macropores improve mass transfer inside the carbon material, and the mesopores improve the electron transfer efficiency of the enzyme by surrounding the enzyme with carbon.
NASA Astrophysics Data System (ADS)
Funabashi, Hiroto; Takeuchi, Satoshi; Tsujimura, Seiya
2017-03-01
We designed a three-dimensional (3D) hierarchical pore structure to improve the current production efficiency and stability of direct electron transfer-type biocathodes. The 3D hierarchical electrode structure was fabricated using a MgO-templated porous carbon framework produced from two MgO templates with sizes of 40 and 150 nm. The results revealed that the optimal pore composition for a bilirubin oxidase-catalysed oxygen reduction cathode was a mixture of 33% macropores and 67% mesopores (MgOC33). The macropores improve mass transfer inside the carbon material, and the mesopores improve the electron transfer efficiency of the enzyme by surrounding the enzyme with carbon.
NASA Astrophysics Data System (ADS)
Watanabe, Toshio; Yamada, Yohei; Motonaka, Junko; Yabutani, Tomoki; Sakuraba, Haruhiko; Yasuzawa, Mikito
In this study, electrodeposition of thermostable enzyme Bacillus subtilis CotA, which is a laccase and has a bilirubin oxidase (BOD) activity, was investigated. The electrodeposition was operated in a mixture of Bacillus subtilis CotA in the PBS (pH 8.0) and TritonX-100 under applying potential (1100 mV vs. Ag/AgCl for 5 min.). The current response was measured by linear sweep voltammetry technique (LSV). The thermostable enzyme Bacillus subtilis CotA electrodeposited electrode was compared with a mesophile BOD electrodeposited electrode. As a result, the Bacillus subtilis CotA modified electrode showed better sensitivity and long-term stability than the mesophile BOD modified electrode.
Formate bound to cytochrome oxidase can be removed by cyanide and by reduction.
Chang, K T; Palmer, G
1996-12-18
Using 14C-radiolabeled formate we have found that the rapid form of oxidized cytochrome oxidase can bind up to 1 mol of formate. Treatment of this formate-ligated enzyme with excess cyanide releases 97% of the radiolabel while reduction of formate-labeled enzyme with NADH+ruthenium releases 80-85% of the radioactivity. These data are most simply interpreted by assuming that formate binds to the heme iron of cytochrome a3.
Discovery of a Xylooligosaccharide Oxidase from Myceliophthora thermophila C1.
Ferrari, Alessandro R; Rozeboom, Henriëtte J; Dobruchowska, Justyna M; van Leeuwen, Sander S; Vugts, Aniek S C; Koetsier, Martijn J; Visser, Jaap; Fraaije, Marco W
2016-11-04
By inspection of the predicted proteome of the fungus Myceliophthora thermophila C1 for vanillyl-alcohol oxidase (VAO)-type flavoprotein oxidases, a putative oligosaccharide oxidase was identified. By homologous expression and subsequent purification, the respective protein could be obtained. The protein was found to contain a bicovalently bound FAD cofactor. By screening a large number of carbohydrates, several mono- and oligosaccharides could be identified as substrates. The enzyme exhibits a strong substrate preference toward xylooligosaccharides; hence it is named xylooligosaccharide oxidase (XylO). Chemical analyses of the product formed upon oxidation of xylobiose revealed that the oxidation occurs at C1, yielding xylobionate as product. By elucidation of several XylO crystal structures (in complex with a substrate mimic, xylose, and xylobiose), the residues that tune the unique substrate specificity and regioselectivity could be identified. The discovery of this novel oligosaccharide oxidase reveals that the VAO-type flavoprotein family harbors oxidases tuned for specific oligosaccharides. The unique substrate profile of XylO hints at a role in the degradation of xylan-derived oligosaccharides by the fungus M. thermophila C1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Positron emitter labeled enzyme inhibitors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.
This invention involves a new strategy for imaging and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide inactivators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline andmore » L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography.« less
Positron emitter labeled enzyme inhibitors
Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.
1987-05-22
This invention involved a new strategy for imaging and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide in activators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography. 2 figs.
Positron emitter labeled enzyme inhibitors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.
This invention involved a new strategy for imaging and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide in activators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgylinemore » and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography. 2 figs.« less
Kerkhoff, Claus; Nacken, Wolfgang; Benedyk, Malgorzata; Dagher, Marie Claire; Sopalla, Claudia; Doussiere, Jacques
2005-03-01
The Ca2+- and arachidonic acid-binding S100A8/A9 protein complex was recently identified by in vitro studies as a novel partner of the phagocyte NADPH oxidase. The present study demonstrated its functional relevance by the impaired oxidase activity in neutrophil-like NB4 cells, after specific blockage of S100A9 expression, and bone marrow polymorphonuclear neutrophils from S100A9-/- mice. The impaired oxidase activation could also be mimicked in a cell-free system by pretreatment of neutrophil cytosol with an S100A9-specific antibody. Further analyses gave insights into the molecular mechanisms by which S100A8/A9 promoted NADPH oxidase activation. In vitro analysis of oxidase activation as well as protein-protein interaction studies revealed that S100A8 is the privileged interaction partner for the NADPH oxidase complex since it bound to p67phox and Rac, whereas S100A9 did interact with neither p67phox nor p47phox. Moreover, S100A8/A9 transferred the cofactor arachidonic acid to NADPH oxidase as shown by the impotence of a mutant S100A8/A9 complex unable to bind arachidonic acid to enhance NADPH oxidase activity. It is concluded that S100A8/A9 plays an important role in phagocyte NADPH oxidase activation.
Rodriguez, Andres I.; Gangopadhyay, Archana; Kelley, Eric E.; Pagano, Patrick J.; Zuckerbraun, Brian S.; Bauer, Philip M.
2009-01-01
Objective Heme oxygenase-1 (HO-1), via its enzymatic degradation products, exhibits cell and tissue protective effects in models of vascular injury and disease. The migration of vascular smooth muscle cells (VSMC) from the medial to the intimal layer of blood vessels plays an integral role in the development of a neointima in these models. Despite this, there are no studies addressing the effect of increased HO-1 expression on VSMC migration. Results and Methods The effects of increased HO-1 expression as well as biliverdin, bilirubin, and carbon monoxide (CO), were studied in in vitro models of VSMC migration. Induction of HO-1 or CO, but not biliverdin or bilirubin, inhibited VSMC migration. This effect was mediated by the inhibition of Nox1 as determined by a range of approaches including detection of intracellular superoxide, NADPH oxidase activity measurements, and siRNA experiments. Furthermore, CO decreased PDGF-stimulated, redox-sensitive signaling pathways. Conclusion Herein we demonstrate that increased HO-1 expression and CO decreases PDGF-stimulated VSMC migration via inhibition of Nox1 enzymatic activity. These studies reveal a novel mechanism by which HO-1 and CO may mediate their beneficial effects in arterial inflammation and injury. PMID:19875720
Regulation of tyramine oxidase synthesis in Klebsiella aerogenes.
Okamura, H; Murooka, Y; Harada, T
1976-01-01
Tyramine oxidase in Klebsiella aerogenes is highly specific for tyramine, dopamine, octopamine, and norepinephrine, and its synthesis is induced specifically by these compounds. The enzyme is present in a membrane-bound form. The Km value for tyramine is 9 X 10(-4) M. Tyramine oxidase synthesis was subjected to catabolite repression by glucose in the presence of ammonium salts. Addition of cyclic adenosine 3',5'-monophosphate (cAMP) overcame the catabolite repression. A mutant strain, K711, which can produce a high level of beta-galactosidase in the presence of glucose and ammonium chloride, can also synthesize tyramine oxidase and histidase in the presence of inducer in glucose ammonium medium. Catabolite repression of tyramine oxidase synthesis was relieved when the cells were grown under conditions of nitrogen limitation, whereas beta-galactosidase was strongly repressed under these conditions. A cAMP-requiring mutant, MK54, synthesized tyramine oxidase rapidly when tyramine was used as the sole source of nitrogen in the absence of cAMP. However, a glutamine synthetase-constitutive mutant, MK94, failed to synthesize tyramine oxidase in the presence of glucose and ammonium chloride, although it synthesized histidase rapidly under these conditions. These results suggest that catabolite repression of tyramine oxidase synthesis in K. aerogenes is regulated by the intracellular level of cAMP and an unknown cytoplasmic factor that acts independently of cAMP and is formed under conditions of nitrogen limitation. PMID:179974
R1, a novel repressor of the human monoamine oxidase A.
Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C
2005-03-25
Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.
Lee, Mark J.; Liu, Hong; Barker, Bridget M.; Snarr, Brendan D.; Gravelat, Fabrice N.; Al Abdallah, Qusai; Gavino, Christina; Baistrocchi, Shane R.; Ostapska, Hanna; Xiao, Tianli; Ralph, Benjamin; Solis, Norma V.; Lehoux, Mélanie; Baptista, Stefanie D.; Thammahong, Arsa; Cerone, Robert P.; Kaminskyj, Susan G. W.; Guiot, Marie-Christine; Latgé, Jean-Paul; Fontaine, Thierry; Vinh, Donald C.; Filler, Scott G.; Sheppard, Donald C.
2015-01-01
Of the over 250 Aspergillus species, Aspergillus fumigatus accounts for up to 80% of invasive human infections. A. fumigatus produces galactosaminogalactan (GAG), an exopolysaccharide composed of galactose and N-acetyl-galactosamine (GalNAc) that mediates adherence and is required for full virulence. Less pathogenic Aspergillus species were found to produce GAG with a lower GalNAc content than A. fumigatus and expressed minimal amounts of cell wall-bound GAG. Increasing the GalNAc content of GAG of the minimally pathogenic A. nidulans, either through overexpression of the A. nidulans epimerase UgeB or by heterologous expression of the A. fumigatus epimerase Uge3 increased the amount of cell wall bound GAG, augmented adherence in vitro and enhanced virulence in corticosteroid-treated mice to levels similar to A. fumigatus. The enhanced virulence of the overexpression strain of A. nidulans was associated with increased resistance to NADPH oxidase-dependent neutrophil extracellular traps (NETs) in vitro, and was not observed in neutropenic mice or mice deficient in NADPH-oxidase that are unable to form NETs. Collectively, these data suggest that cell wall-bound GAG enhances virulence through mediating resistance to NETs. PMID:26492565
Timing of electron and proton transfer in the ba(3) cytochrome c oxidase from Thermus thermophilus.
von Ballmoos, Christoph; Lachmann, Peter; Gennis, Robert B; Ädelroth, Pia; Brzezinski, Peter
2012-06-05
Heme-copper oxidases are membrane-bound proteins that catalyze the reduction of O(2) to H(2)O, a highly exergonic reaction. Part of the free energy of this reaction is used for pumping of protons across the membrane. The ba(3) oxidase from Thermus thermophilus presumably uses a single proton pathway for the transfer of substrate protons used during O(2) reduction as well as for the transfer of the protons that are pumped across the membrane. The pumping stoichiometry (0.5 H(+)/electron) is lower than that of most other (mitochondrial-like) oxidases characterized to date (1 H(+)/electron). We studied the pH dependence and deuterium isotope effect of the kinetics of electron and proton transfer reactions in the ba(3) oxidase. The results from these studies suggest that the movement of protons to the catalytic site and movement to a site located some distance from the catalytic site [proposed to be a "proton-loading site" (PLS) for pumped protons] are separated in time, which allows individual investigation of these reactions. A scenario in which the uptake and release of a pumped proton occurs upon every second transfer of an electron to the catalytic site would explain the decreased proton pumping stoichiometry compared to that of mitochondrial-like oxidases.
Rac-1 as a new therapeutic target in cerebro- and cardio-vascular diseases.
Carrizzo, Albino; Forte, Maurizio; Lembo, Maria; Formisano, Luigi; Puca, Annibale A; Vecchione, Carmine
2014-01-01
Growing evidence indicates that overproduction of reactive oxygen species (ROS) plays a prominent role in the development of cardio- and cerebro-vascular diseases. Among the mechanisms identified to produce oxidative stress in the vascular wall, those mediated by membrane-bound NAD(P)H oxidases represent a major one. NAD(P)H oxidases are a family of enzymes that generate ROS both in phagocytic and non-phagocytic cell types. Vascular NAD(P)H oxidase contains the membrane-bound subunits Nox1, Nox2 (gp91phox), Nox4 and p22phox, the catalytic site of the oxidase, and the cytosolic components p47phox and p67phox. Rac1 (Ras-related C3 botulinum toxin substrate1) is a small GTPase essential for the assembly and activation of NADPH oxidase. Several molecular and cellular studies have reported the involvement of Rac1 in different cardiovascular pathologies, such as vascular smooth muscle proliferation, cardiomyocyte hypertrophy, endothelial cell shape change, atherosclerosis and endothelial dysfunction in hypertension. In addition, increased activation of NADPH oxidase by Rac1 has been reported in animals and humans after myocardial infarction and heart failure. The Rac1/NADPH pathway has also been found involved in different pathologies of the cerebral district, such as ischemic stroke, cognitive impairment, subaracnoid hemorrhage and neuronal oxidative damage typical of several neurodegenerative disorders. In addition, thrombotic events are an important step in the onset of cardio- and cerebrovascular diseases. Rac1 has been found involved also in platelet activation, inducing actin polymerization and lamellipodia formation, which are necessary steps for platelet aggregation. Taken together, the evidence candidates Rac1 as a new pharmacological target of cardiovascular and cerebrovascular diseases. Although the involvement of Rac1 in the beneficial pleiotropic effects of drugs such as statins is well known, and the onset of numerous side effects has raised concern for the management of some patient groups. Interestingly, a novel selective Rac1 inhibitor, NSC23766, has recently been introduced; its use has been reported mainly in the oncology field. Future studies are needed to extend its application to cardio- and cerebro-vascular diseases, and translate its use to humans.
Measurement of plasma unbound unconjugated bilirubin.
Ahlfors, C E
2000-03-15
A method is described for measuring the unconjugated fraction of the unbound bilirubin concentration in plasma by combining the peroxidase method for determining unbound bilirubin with a diazo method for measuring conjugated and unconjugated bilirubin. The accuracy of the unbound bilirubin determination is improved by decreasing sample dilution, eliminating interference by conjugated bilirubin, monitoring changes in bilirubin concentration using diazo derivatives, and correcting for rate-limiting dissociation of bilirubin from albumin. The unbound unconjugated bilirubin concentration by the combined method in plasma from 20 jaundiced newborns was significantly greater than and poorly correlated with the unbound bilirubin determined by the existing peroxidase method (r = 0.7), possibly due to differences in sample dilution between the methods. The unbound unconjugated bilirubin was an unpredictable fraction of the unbound bilirubin in plasma samples from patients with similar total bilirubin concentrations but varying levels of conjugated bilirubin. A bilirubin-binding competitor was readily detected at a sample dilution typically used for the combined test but not at the dilution used for the existing peroxidase method. The combined method is ideally suited to measuring unbound unconjugated bilirubin in jaundiced human newborns or animal models of kernicterus. Copyright 2000 Academic Press.
Siletsky, Sergey A; Belevich, Ilya; Belevich, Nikolai P; Soulimane, Tewfik; Verkhovsky, Michael I
2011-09-01
The oxidative part of the catalytic cycle of the caa(3)-type cytochrome c oxidase from Thermus thermophilus was followed by time-resolved optical spectroscopy. Rate constants, chemical nature and the spectral properties of the catalytic cycle intermediates (Compounds A, P, F) reproduce generally the features typical for the aa(3)-type oxidases with some distinctive peculiarities caused by the presence of an additional 5-th redox-center-a heme center of the covalently bound cytochrome c. Compound A was formed with significantly smaller yield compared to aa(3) oxidases in general and to ba(3) oxidase from the same organism. Two electrons, equilibrated between three input redox-centers: heme a, Cu(A) and heme c are transferred in a single transition to the binuclear center during reduction of the compound F, converting the binuclear center through the highly reactive O(H) state into the final product of the reaction-E(H) (one-electron reduced) state of the catalytic site. In contrast to previous works on the caa(3)-type enzymes, we concluded that the finally produced E(H) state of caa(3) oxidase is characterized by the localization of the fifth electron in the binuclear center, similar to the O(H)→E(H) transition of the aa(3)-type oxidases. So, the fully-reduced caa(3) oxidase is competent in rapid electron transfer from the input redox-centers into the catalytic heme-copper site. 2011 Elsevier B.V. All rights reserved.
Tian, Rong; Ding, Yun; Peng, Yi-Yuan; Lu, Naihao
2017-03-11
Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-derived reactive oxygen species (ROS) such as superoxide and hydrogen peroxide (H 2 O 2 ), have emerged as important molecules in the pathogenesis of diabetic endothelial dysfunction. Additionally, neutrophils-derived myeloperoxidase (MPO) and MPO-catalyzed hypochlorous acid (HOCl) play important roles in the vascular injury. However, it is unknown whether MPO can use vascular-derived ROS to induce diabetic endothelial dysfunction. In the present study, we demonstrated that NADPH oxidase was the main source of ROS formation in high glucose-cultured human umbilical vein endothelial cells (HUVECs), and played a critical role in high glucose-induced endothelial dysfunction such as cell apoptosis, loss of cell viability and reduction of nitric oxide (NO). However, the addition of MPO could amplify the high glucose-induced endothelial dysfunction which was inhibited by the presence of apocynin (NADPH oxidase inhibitor), catalase (H 2 O 2 scavenger), or methionine (HOCl scavenger), demonstrating the contribution of NADPH oxidase-H 2 O 2 -MPO-HOCl pathway in the MPO/high glucose-induced vascular injury. In high glucose-incubated rat aortas, MPO also exacerbated the NADPH oxidase-induced impairment of endothelium-dependent relaxation. Consistent with these in vitro data, in diabetic rat aortas, both MPO expresion and NADPH oxidase activity were increased while the endothelial function was simultaneously impaired. The results suggested that vascular-bound MPO could amplify high glucose-induced vascular injury in diabetes. MPO-NADPH oxidase-HOCl may represent an important pathogenic pathway in diabetic vascular diseases. Copyright © 2017 Elsevier Inc. All rights reserved.
Liu, Fang; Zhao, Jin-Hong; Gan, Zhi-Lin; Ni, Yuan-Ying
2015-04-15
This study compared membrane-bound with soluble polyphenol oxidase (mPPO and sPPO, respectively) from Fuji apple. Purified mPPO and partially purified sPPO were used. mPPO was purified by temperature-induced phase partitioning and ion exchange chromatography. The specific activity of mPPO was 34.12× higher than that of sPPO. mPPO was more stable than sPPO at pH 5.0-8.5. Although mPPO was more easily inactivated at 25-55 °C, it is still more active than sPPO in this temperature range. The optimum substrate of mPPO was 4-methyl catechol, followed by catechol. L-cysteine had the highest inhibitory effects on mPPO followed by ascorbic acid and glutathione. Surprisingly, EDTA increased mPPO activity. The results revealed that purified mPPO is a dimer with a molecular weight of approximately 67 kDa. Copyright © 2014 Elsevier Ltd. All rights reserved.
... Videos for Educators Search English Español Blood Test: Bilirubin KidsHealth / For Parents / Blood Test: Bilirubin What's in ... liver or kidneys) is working. What Is a Bilirubin Test? A bilirubin test measures how much bilirubin ...
Pendse, Amruta; Jasani, Bonny; Nanavati, Ruchi; Kabra, Nandkishor
2017-08-15
To compare transcutaneous bilirubin with total serum bilirubin in preterm neonates after initiation of phototherapy. Jaundice was assessed in 30 preterm neonates with transcutaneous bilirubin and total serum bilirubin before initiation of phototherapy and at 12 hr after initiation of phototherapy. A photo-occlusive patch was applied over the sternum. Transcutaneous bilirubin has a good correlation with total serum bilirubin after initiation of phototherapy. (r=0.918, P<0.001). Transcutaneous bilirubin at 28-32 weeks of gestation (r = 0.97) was better correlated with total serum bilirubin than those at 32-37 weeks (r =0.88). The correlation was better for neonates <72 hours old (r = 0.96) than those >72 hours of age (r = 0.82). Transcutaneous bilirubin correlates significantly with total serum bilirubin at the patched sternal site after initiation of phototherapy in preterm neonates.
The Biological Effects of Bilirubin Photoisomers
Jasprova, Jana; Dal Ben, Matteo; Vianello, Eleonora; Goncharova, Iryna; Urbanova, Marie; Vyroubalova, Karolina; Gazzin, Silvia; Tiribelli, Claudio; Sticha, Martin; Cerna, Marcela; Vitek, Libor
2016-01-01
Although phototherapy was introduced as early as 1950’s, the potential biological effects of bilirubin photoisomers (PI) generated during phototherapy remain unclear. The aim of our study was to isolate bilirubin PI in their pure forms and to assess their biological effects in vitro. The three major bilirubin PI (ZE- and EZ-bilirubin and Z-lumirubin) were prepared by photo-irradiation of unconjugated bilirubin. The individual photoproducts were chromatographically separated (TLC, HPLC), and their identities verified by mass spectrometry. The role of Z-lumirubin (the principle bilirubin PI) on the dissociation of bilirubin from albumin was tested by several methods: peroxidase, fluorescence quenching, and circular dichroism. The biological effects of major bilirubin PI (cell viability, expression of selected genes, cell cycle progression) were tested on the SH-SY5Y human neuroblastoma cell line. Lumirubin was found to have a binding site on human serum albumin, in the subdomain IB (or at a close distance to it); and thus, different from that of bilirubin. Its binding constant to albumin was much lower when compared with bilirubin, and lumirubin did not affect the level of unbound bilirubin (Bf). Compared to unconjugated bilirubin, bilirubin PI did not have any effect on either SH-SY5Y cell viability, the expression of genes involved in bilirubin metabolism or cell cycle progression, nor in modulation of the cell cycle phase. The principle bilirubin PI do not interfere with bilirubin albumin binding, and do not exert any toxic effect on human neuroblastoma cells. PMID:26829016
Gulian, J M; Dalmasso, C; Millet, V; Unal, D; Charrel, M
1995-08-01
We compared data obtained with the Kodak Ektachem and Hitachi 717 Analysers and HPLC from 83 neonates under phototherapy. Total bilirubin values determined with the Kodak and Hitachi are in good agreement, but we observed a large discrepancy in the results for conjugated (Kodak) and direct (Hitachi) bilirubin. HPLC revealed that all the samples contained configurational isomers, while only 7.7% and 30.8% contained conjugated bilirubin and structural isomers, respectively. We developed a device for the specific and quantitative production of configurational or structural isomers, by irradiation with blue or green light. In vitro, total bilirubin values are coherent for the routine analysers in the presence of configurational or structural isomers. With configurational isomers, unconjugated bilirubin (Kodak) is lower than total bilirubin (Kodak), and conjugated bilirubin (Kodak) is always equal to zero, so the apparatus gives a false positive response for delta bilirubin. In contrast, the direct bilirubin (Hitachi) is constant. Furthermore, in the presence of structural isomers, unconjugated bilirubin (Kodak) is unexpectedly higher than total bilirubin (Kodak), conjugated bilirubin (Kodak) is proportional to the quantity of these isomers, and direct bilirubin (Hitachi) is constant. The contribution of photoisomers in bilirubin measurements is discussed.
NADPH Oxidase-Dependent Signaling in Endothelial Cells: Role in Physiology and Pathophysiology
Ushio-Fukai, Masuko; Malik, Asrar B.
2009-01-01
Abstract Reactive oxygen species (ROS) including superoxide (O2·−) and hydrogen peroxide (H2O2) are produced endogenously in response to cytokines, growth factors; G-protein coupled receptors, and shear stress in endothelial cells (ECs). ROS function as signaling molecules to mediate various biological responses such as gene expression, cell proliferation, migration, angiogenesis, apoptosis, and senescence in ECs. Signal transduction activated by ROS, “oxidant signaling,” has received intense investigation. Excess amount of ROS contribute to various pathophysiologies, including endothelial dysfunction, atherosclerosis, hypertension, diabetes, and acute respiratory distress syndrome (ARDS). The major source of ROS in EC is a NADPH oxidase. The prototype phagaocytic NADPH oxidase is composed of membrane-bound gp91phox and p22hox, as well as cytosolic subunits such as p47phox, p67phox and small GTPase Rac. In ECs, in addition to all the components of phagocytic NADPH oxidases, homologues of gp91phox (Nox2) including Nox1, Nox4, and Nox5 are expressed. The aim of this review is to provide an overview of the emerging area of ROS derived from NADPH oxidase and oxidant signaling in ECs linked to physiological and pathophysiological functions. Understanding these mechanisms may provide insight into the NADPH oxidase and oxidant signaling components as potential therapeutic targets. Antioxid. Redox Signal. 11, 791–810. PMID:18783313
Small-size biofuel cell on paper.
Zhang, Lingling; Zhou, Ming; Wen, Dan; Bai, Lu; Lou, Baohua; Dong, Shaojun
2012-05-15
In this work, we demonstrated a novel paper-based mediator-less and compartment-less biofuel cell (BFC) with small size (1.5 cm × 1.5 cm). Ionic liquid functionalized carbon nanotubes (CNTs-IL) nanocomposite was used as support for both stably confining the anodic biocatalyst (i.e., NAD(+)-dependent glucose dehydrogenase, GDH) for glucose electrooxidation and for facilitating direct electrochemistry of the cathodic biocatalyst (i.e., bilirubin oxidase, BOD) for O(2) electroreduction. Such BFC provided a simple approach to fabricate low-cost and portable power devices on small-size paper, which can harvest energy from a wide range of commercial beverages containing glucose (e.g., Nescafe instant coffee, Maidong vitamin water, Watermelon fresh juice, and Minute Maid grape juice). These made the low-cost paper-based biodevice potential for broad energy applications. Copyright © 2012 Elsevier B.V. All rights reserved.
Piezoelectric detection of bilirubin based on bilirubin-imprinted titania film electrode.
Yang, Zhengpeng; Yan, Jinlong; Zhang, Chunjing
2012-02-01
A novel quartz crystal microbalance (QCM) sensor with a high selectivity and sensitivity has been developed for bilirubin determination, based on the modification of bilirubin-imprinted titania film onto a quartz crystal by molecular imprinting and surface sol-gel techniques. The performance of the developed bilirubin biosensor was evaluated and the results indicated that a sensitive bilirubin biosensor could be fabricated. The obtained bilirubin biosensor presents high-selectivity monitoring of bilirubin, better reproducibility, shorter response time (30 min), wider linear range (0.1-50 μM), and lower detection limit (0.05 μM). The analytical application of the bilirubin biosensor confirms the feasibility of bilirubin determination in serum sample. Copyright © 2011 Elsevier Inc. All rights reserved.
Shimao, M; Ninomiya, K; Kuno, O; Kato, N; Sakazawa, C
1986-01-01
A novel enzyme, pyrroloquinoline quinone (PQQ)-dependent polyvinyl alcohol (PVA) dehydrogenase, was found in and partially purified from the membrane fraction of a PVA-degrading symbiont, Pseudomonas sp. strain VM15C. The enzyme required PQQ for PVA dehydrogenation with phenazine methosulfate, phenazine ethosulfate, and 2,6-dichlorophenolindophenol as electron acceptors and did not show PVA oxidase activity leading to H2O2 formation. The enzyme was active toward low-molecular-weight secondary alcohols rather than primary alcohols. A membrane-bound PVA oxidase was also present in cells of VM15C. Although the purified oxidase showed a substrate specificity similar to that of PQQ-dependent PVA dehydrogenase and about threefold-higher PVA-dehydrogenating activity with phenazine methosulfate or phenazine ethosulfate than PVA oxidase activity with H2O2 formation, it was shown that the enzyme does not contain PQQ as the coenzyme, and PQQ did not affect its activity. Incubation of the membrane fraction of cells with PVA caused a reduction in the cytochrome(s) of the fraction. Images PMID:3513704
Inherited Disorders of Bilirubin Clearance
Memon, Naureen; Weinberger, Barry I; Hegyi, Thomas; Aleksunes, Lauren M
2016-01-01
Inherited disorders of hyperbilirubinemia may be caused by increased bilirubin production or decreased bilirubin clearance. Reduced hepatic bilirubin clearance can be due to defective 1) unconjugated bilirubin uptake and intrahepatic storage, 2) conjugation of glucuronic acid to bilirubin (e.g. Gilbert syndrome, Crigler-Najjar syndrome, Lucey-Driscoll syndrome, breast milk jaundice), 3) bilirubin excretion into bile (Dubin-Johnson syndrome), or 4) conjugated bilirubin re-uptake (Rotor syndrome). In this review, the molecular mechanisms and clinical manifestations of these conditions are described, as well as current approaches to diagnosis and therapy. PMID:26595536
A microscopic evaluation of collagen-bilirubin interactions: in vitro surface phenomenon.
Usharani, N; Jayakumar, G C; Rao, J R; Chandrasekaran, B; Nair, B U
2014-02-01
This study is carried out to understand the morphology variations of collagen I matrices influenced by bilirubin. The characteristics of bilirubin interaction with collagen ascertained using various techniques like XRD, CLSM, fluorescence, SEM and AFM. These techniques are used to understand the distribution, expression and colocalization patterns of collagen-bilirubin complexes. The present investigation mimic the in vivo mechanisms created during the disorder condition like jaundice. Fluorescence technique elucidates the crucial role played by bilirubin deposition and interaction during collagen organization. Influence of bilirubin during collagen fibrillogenesis and banding patterns are clearly visualize using SEM. As a result, collagen-bilirubin complex provides different reconstructed patterns because of the influence of bilirubin concentration. Selectivity, specificity and spatial organization of collagen-bilirubin are determined through AFM imaging. Consequently, it is observed that the morphology and quantity of the bilirubin binding to collagen varied by the concentrations and the adsorption rate in protein solutions. Microscopic studies of collagen-bilirubin interaction confirms that bilirubin influence the fibrillogenesis and alter the rate of collagen organization depending on the bilirubin concentration. This knowledge helps to develop a novel drug to inhibit the interface point of interaction between collagen and bilirubin. © 2013 The Authors Journal of Microscopy © 2013 Royal Microscopical Society.
Pundir, C S; Chauhan, Nidhi; Jyoti
2011-06-01
Ascorbate oxidase purified from Lagenaria siceraria fruit was immobilized onto epoxy resin "Araldite" membrane with 79.4% retention of initial activity of free enzyme. The biosensor showed optimum response within 15s at pH 5.8 and 35°C, which was directly proportional to ascorbate concentration ranging from 1-100μM. There was a good correlation (R(2) = 0.99) between serum ascorbic acid values by standard enzymic colorimetric method and the present method. The enzyme electrode was used for 200 times without considerable loss of activity during the span of 90 days when stored at 4°C.
MacAodha, Domhnall; Ó Conghaile, Peter; Egan, Brenda; Kavanagh, Paul; Leech, Dónal
2013-07-22
Co-immobilisation of three separate multiple blue copper oxygenases, a Myceliophthora thermophila laccase, a Streptomyces coelicolor laccase and a Myrothecium verrucaria bilirubin oxidase, with an [Os(2,2'-bipyridine)2 (polyvinylimidazole)10Cl](+/2+) redox polymer in the presence of multi-walled carbon nanotubes (MWCNTs) on graphite electrodes results in enzyme electrodes that produce current densities above 0.5 mA cm(-2) for oxygen reduction at an applied potential of 0 V versus Ag/AgCl. Fully enzymatic membraneless fuel cells are assembled with the oxygen-reducing enzyme electrodes connected to glucose-oxidising anodes based on co-immobilisation of glucose oxidase or a flavin adenine dinucleotide-dependent glucose dehydrogenase with an [Os(4,4'-dimethyl-2,2'-bipyridine)2(polyvinylimidazole)10Cl](+/2+) redox polymer in the presence of MWCNTs on graphite electrodes. These fuel cells can produce power densities of up to 145 μW cm(-2) on operation in pH 7.4 phosphate buffer solution at 37 °C containing 150 mM NaCl, 5 mM glucose and 0.12 mM O2. The fuel cells based on Myceliophthora thermophila laccase enzyme electrodes produce the highest power density if combined with glucose oxidase-based anodes. Although the maximum power density of a fuel cell of glucose dehydrogenase and Myceliophthora thermophila laccase enzyme electrodes decreases from 110 μW cm(-2) in buffer to 60 μW cm(-2) on testing in artificial plasma, it provides the highest power output reported to date for a fully enzymatic glucose-oxidising, oxygen-reducing fuel cell in artificial plasma. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Gobert De Paepe, E; Munteanu, G; Schischmanoff, P O; Porquet, D
2008-01-01
Plasma bilirubin testing is crucial to prevent the occurrence of neonatal kernicterus. Haemolysis may occur during sampling and interfere with bilirubin determination. Moreover, lipidic infusions may induce plasma lipemia and also interfere with bilirubin measurement. We evaluated the interference of haemolysis and lipemia with three methods of total and direct bilirubin measurement adaptated on an Advia 1650 analyser (Siemens Medical Solutions Diagnostics) : Synermed (Sofibel), Bilirubin 2 (Siemens) and Bilirubin Auto FS (Diasys). The measurement of total bilirubin was little affected by haemolysis with all three methods. The Bilirubin 2 (Siemens) method was the less sensitive to haemolysis even at low bilirubin levels. The measurement of conjugated bilirubin was significantly altered by low heamoglobin concentrations for Bilirubin Auto FS(R) (30 microM or 0,192 g/100 mL haemoglobin) and for Synermed (60 microM or 0,484 g/100 mL haemoglobin). In marked contrast, we found no haemoglobin interference with the Direct Bilirubin 2 reagent which complied with the method validation criteria from the French Society for Biological Chemistry. The lipemia up to 2 g/L of Ivelip did not affect neither the measurement of total bilirubin for all three methods nor the measurement of conjugated bilirubin with the Diasys and Siemens reagents. However, we observed a strong interference starting at 0,5 g/L of Ivelip with the Synermed reagent. Our data suggest that both Siemens and Diasys methods allow to measure accurately total and conjugated bilirubin in hemolytic and lipemic samples, nevertheless, the Siemens methodology is less affected by these interferences.
Photoacoustic microscopy of bilirubin in tissue phantoms
NASA Astrophysics Data System (ADS)
Zhou, Yong; Zhang, Chi; Yao, Da-Kang; Wang, Lihong V.
2012-12-01
Determining both bilirubin's concentration and its spatial distribution are important in disease diagnosis. Here, for the first time, we applied quantitative multiwavelength photoacoustic microscopy (PAM) to detect bilirubin concentration and distribution simultaneously. By measuring tissue-mimicking phantoms with different bilirubin concentrations, we showed that the root-mean-square error of prediction has reached 0.52 and 0.83 mg/dL for pure bilirubin and for blood-mixed bilirubin detection (with 100% oxygen saturation), respectively. We further demonstrated the capability of the PAM system to image bilirubin distribution both with and without blood. Finally, by underlaying bilirubin phantoms with mouse skins, we showed that bilirubin can be imaged with consistent accuracy down to >400 μm in depth. Our results show that PAM has potential for noninvasive bilirubin monitoring in vivo, as well as for further clinical applications.
Muraca, M; Fevery, J; Blanckaert, N
1987-02-01
The pattern of serum bilirubins was determined in serum of humans and rats with unconjugated hyperbilirubinemia due to increased pigment load or defective hepatic conjugation. Bilirubin ester conjugates were present in all serum samples tested and were identified as bilirubin 1-O-acyl glucuronides. In Gilbert's syndrome, the concentration of total conjugates was comparable to the values in healthy control subjects. Because the concentration of unconjugated pigment was increased, the fraction of conjugated relative to total bilirubins was markedly decreased. Sera from patients with Crigler-Najjar disease differed from those with Gilbert's syndrome by the higher unconjugated bilirubin levels and the undetectability of diconjugated bilirubins. A striking finding was that in hemolytic disease, the concentration of both monoconjugates and diconjugates was enhanced in parallel with the increase of unconjugated pigment. Therefore, the fraction of conjugated relative to total bilirubins remained within the normal range. As in Gilbert's syndrome, heterozygote R/APfd-j/+ rats with impaired hepatic bilirubin conjugation exhibit an increased unconjugated bilirubin level in serum, whereas the concentration of total conjugates was comparable to the values in normal rats. In serum of normal rats loaded intraperitoneally with unconjugated bilirubin, both unconjugated and mono- and diconjugated bilirubins were increased in parallel so that the ratio of unconjugated to esterified pigment remained unaffected. Decreased hepatic conjugation or increased bilirubin load was associated with a lower percentage of diconjugates relative to total conjugates both in human and rat serum. The present results are consistent with a compartmental model in which there is bidirectional transfer across the sinusoidal membrane for unconjugated bilirubin as well as for the bilirubin glucuronides. Because typical patterns of serum bilirubins are found in Gilbert's syndrome and patients with hemolytic hyperbilirubinemia, determination of esterified bilirubins in serum is of value to study the pathophysiology and the differential diagnosis of unconjugated hyperbilirubinemia.
Zhang, Xinxing; Jones, Rachel A.; Bruner, Steven D.; Butcher, Rebecca A.
2016-01-01
Caenorhabditis elegans secretes ascarosides as pheromones to communicate with other worms and to coordinate the development and behavior of the population. Peroxisomal β-oxidation cycles shorten the side chains of ascaroside precursors to produce the short-chain ascaroside pheromones. Acyl-CoA oxidases, which catalyze the first step in these β-oxidation cycles, have different side chain-length specificities and enable C. elegans to regulate the production of specific ascaroside pheromones. Here, we determine the crystal structure of the acyl-CoA oxidase 1 (ACOX-1) homodimer and the ACOX-2 homodimer bound to its substrate. Our results provide a molecular basis for the substrate specificities of the acyl-CoA oxidases and reveal why some of these enzymes have a very broad substrate range, whereas others are quite specific. Our results also enable predictions to be made for the roles of uncharacterized acyl-CoA oxidases in C. elegans and in other nematode species. Remarkably, we show that most of the C. elegans acyl-CoA oxidases that participate in ascaroside biosynthesis contain a conserved ATP-binding pocket that lies at the dimer interface, and we identify key residues in this binding pocket. ATP binding induces a structural change that is associated with tighter binding of the FAD cofactor. Mutations that disrupt ATP binding reduce FAD binding and reduce enzyme activity. Thus, ATP may serve as a regulator of acyl-CoA oxidase activity, thereby directly linking ascaroside biosynthesis to ATP concentration and metabolic state. PMID:27551084
Newborn Jaundice Technologies: Unbound Bilirubin and Bilirubin Binding Capacity In Neonates
Amin, Sanjiv B.; Lamola, Angelo A.
2011-01-01
Neonatal jaundice (hyperbilirubinemia), extremely common in neonates, can be associated with neurotoxicity. A safe level of bilirubin has not been defined in either premature or term infants. Emerging evidence suggest that the level of unbound (or “free”) bilirubin has a better sensitivity and specificity than total serum bilirubin for bilirubin-induced neurotoxicity. Although recent studies suggest the usefulness of free bilirubin measurements in managing high-risk neonates including premature infants, there currently exists no widely available method to assay the serum free bilirubin concentration. To keep pace with the growing demand, in addition to reevaluation of old methods, several promising new methods are being developed for sensitive, accurate, and rapid measurement of free bilirubin and bilirubin binding capacity. These innovative methods need to be validated before adopting for clinical use. We provide an overview of some promising methods for free bilirubin and binding capacity measurements with the goal to enhance research in this area of active interest and apparent need. PMID:21641486
NASA Astrophysics Data System (ADS)
Kumar, Alla S.; Clark, Joseph; Beyette, Fred R., Jr.
2009-02-01
Neonatal jaundice is a medical condition which occurs in newborns as a result of an imbalance between the production and elimination of bilirubin. The excess bilirubin in the blood stream diffuses into the surrounding tissue leading to a yellowing of the skin. As the bilirubin levels rise in the blood stream, there is a continuous exchange between the extra vascular bilirubin and bilirubin in the blood stream. Exposure to phototherapy alters the concentration of bilirubin in the vascular and extra vascular regions by causing bilirubin in the skin layers to be broken down. Thus, the relative concentration of extra vascular bilirubin is reduced leading to a diffusion of bilirubin out of the vascular region. Diffuse reflectance spectra from human skin contains physiological and structural information of the skin and nearby tissue. A diffuse reflectance spectrum must be captured before and after blanching in order to isolate the intravascular and extra vascular bilirubin. A new mathematical model is proposed with extra vascular bilirubin concentration taken into consideration along with other optical parameters in defining the diffuse reflectance spectrum from human skin. A nonlinear optimization algorithm has been adopted to extract the optical properties (including bilirubin concentration) from the skin reflectance spectrum. The new system model and nonlinear algorithm have been combined to enable extraction of Bilirubin concentrations within an average error of 10%.
Nishimura, Takeshi; Tanaka, Masami; Sekioka, Risa; Itoh, Hiroshi
2015-01-01
Although relationships of serum bilirubin concentration with estimated glomerular filtration rate (eGFR) and urinary albumin excretion (UAE) in patients with type 2 diabetes have been reported, whether such relationships exist in patients with type 1 diabetes is unknown. A total of 123 patients with type 1 diabetes were investigated in this cross-sectional study. The relationship between bilirubin (total and indirect) concentrations and log(UAE) as well as eGFR was examined by Pearson's correlation analyses. Multivariate regression analyses were used to assess the association of bilirubin (total and indirect) with eGFR as well as log(UAE). A positive correlation was found between serum bilirubin concentration and eGFR; total bilirubin (r=0.223, p=0.013), indirect bilirubin (r=0.244, p=0.007). A negative correlation was found between serum bilirubin concentration and log(UAE); total bilirubin (r=-0.258, p=0.005), indirect bilirubin (r=-0.271, p=0.003). Multivariate regression analyses showed that indirect bilirubin concentration was an independent determinant of eGFR and log(UAE). Bilirubin concentration is associated with both eGFR and log(UAE) in patients with type 1 diabetes. Bilirubin might have a protective role in the progression of type 1 diabetic nephropathy. Copyright © 2015 Elsevier Inc. All rights reserved.
Is serum bilirubin associated with the severity of Guillain-Barré syndrome?
Li, Xiaohong; Li, Wenchao; Shi, Xiang; Mo, Lijun; Luo, Yuzhen; Qin, Liuqun; Yang, Zheng; Mo, Wuning
2018-07-01
Our aim was to assess the correlation between serum bilirubin levels and Guillain-Barré syndrome (GBS). One hundred and one newly diagnosed patients with Guillain-Barré syndrome and 111 healthy age- and sex-matched individuals in the First Affiliated Hospital of Guangxi Medical University (Guangxi, China) from June 2012 to May 2017 were included in this study. Clinical characteristics and laboratory parameters of Guillain-Barré syndrome patients and healthy controls were retrospectively analysed. Serum bilirubin levels in Guillain-Barré syndrome patients were significantly lower as compared with those in healthy controls (p < 0.001); besides, log C-reactive protein and erythrocyte sedimentation rate were significantly higher. We found that there was a negative correlation between GBS disability scale scores and total bilirubin, direct bilirubin, indirect bilirubin (r = -0.541, P < 0.001; r = -0.403, P < 0.001; r = -0.526, P < 0.001), respectively. Among patients with GBS, serum total bilirubin, direct bilirubin, and indirect bilirubin levels were independently associated with Guillain-Barré syndrome disability scale scores in multiple linear regression analysis, respectively. We observed that serum bilirubin levels were lower in patients with Guillain-Barré syndrome, and suggested total bilirubin, direct bilirubin, and indirect bilirubin were independently and inversely associated with Guillain-Barré syndrome severity.
Bilirubin Binding Capacity in the Preterm Neonate
Amin, Sanjiv B
2016-01-01
SYNOPSIS Total serum/plasma bilirubin (TB), the biochemical measure currently used to evaluate and manage hyperbilirubinemia, is not a useful predictor of bilirubin-induced neurotoxicity in premature infants. Altered bilirubin-albumin binding in premature infants limits the usefulness of TB in premature infants. In this article, bilirubin-albumin binding, a modifying factor for bilirubin-induced neurotoxicity, in premature infants is reviewed. PMID:27235205
Serum Bilirubin and Disease Progression in Mild COPD
Apperley, Scott; Park, Hye Yun; Holmes, Daniel T.; Wise, Robert A.; Connett, John E.
2015-01-01
BACKGROUND: COPD is a chronic inflammatory disorder associated with oxidative stress. Serum bilirubin has potent antioxidant actions, and higher concentrations have been shown to protect against oxidative stress. The relation between serum bilirubin and COPD progression is unknown. METHODS: Serum bilirubin was measured in 4,680 smokers aged 35 to 60 years old with mild to moderate airflow limitation. The relationship of serum bilirubin to postbronchodilator FEV1 and rate of FEV1 decline over 3 to 9 years was determined using regression modeling. Total and disease-specific mortality were also ascertained. RESULTS: Serum bilirubin was positively related to FEV1 (P < .001). Serum bilirubin was also negatively related to the annual decline in FEV1 when adjusted for baseline demographics, pack-years smoked, and baseline measures of lung function (P = .01). Additionally, serum bilirubin was negatively associated with risk of death from coronary heart disease (P = .03); however, the relationships between bilirubin and other mortality end points were not statistically significant (P > .05). CONCLUSIONS: Bilirubin is inversely related to COPD disease severity and progression. Higher serum bilirubin concentration was associated with a higher FEV1 and less annual decline in FEV1. Bilirubin was also associated with less coronary heart disease mortality. These data support the hypothesis that bilirubin has a protective effect on COPD disease progression, possibly through its antioxidant actions. Bilirubin may prove useful as an easily accessible and readily available blood-based COPD biomarker. PMID:25539285
Coordination chemistry controls the thiol oxidase activity of the B12-trafficking protein CblC
Li, Zhu; Shanmuganathan, Aranganathan; Ruetz, Markus; Yamada, Kazuhiro; Lesniak, Nicholas A.; Kräutler, Bernhard; Brunold, Thomas C.; Koutmos, Markos; Banerjee, Ruma
2017-01-01
The cobalamin or B12 cofactor supports sulfur and one-carbon metabolism and the catabolism of odd-chain fatty acids, branched-chain amino acids, and cholesterol. CblC is a B12-processing enzyme involved in an early cytoplasmic step in the cofactor-trafficking pathway. It catalyzes the glutathione (GSH)-dependent dealkylation of alkylcobalamins and the reductive decyanation of cyanocobalamin. CblC from Caenorhabditis elegans (ceCblC) also exhibits a robust thiol oxidase activity, converting reduced GSH to oxidized GSSG with concomitant scrubbing of ambient dissolved O2. The mechanism of thiol oxidation catalyzed by ceCblC is not known. In this study, we demonstrate that novel coordination chemistry accessible to ceCblC-bound cobalamin supports its thiol oxidase activity via a glutathionyl-cobalamin intermediate. Deglutathionylation of glutathionyl-cobalamin by a second molecule of GSH yields GSSG. The crystal structure of ceCblC provides insights into how architectural differences at the α- and β-faces of cobalamin promote the thiol oxidase activity of ceCblC but mute it in wild-type human CblC. The R161G and R161Q mutations in human CblC unmask its latent thiol oxidase activity and are correlated with increased cellular oxidative stress disease. In summary, we have uncovered key architectural features in the cobalamin-binding pocket that support unusual cob(II)alamin coordination chemistry and enable the thiol oxidase activity of ceCblC. PMID:28442570
Single mutations that redirect internal proton transfer in the ba3 oxidase from Thermus thermophilus
Smirnova, Irina; Chang, Hsin-Yang; von Ballmoos, Christoph; Ädelroth, Pia; Gennis, Robert B.; Brzezinski, Peter
2014-01-01
The ba3-type cytochrome c oxidase from Thermus thermophilus is a membrane-bound proton pump. Results from earlier studies have shown that with the aa3-type oxidases proton uptake to the catalytic site and “pump site” occur simultaneously. However, with the ba3 oxidase the pump site is loaded before proton transfer to the catalytic site because the proton transfer to the latter is slower than with the aa3 oxidases. In addition, the timing of formation and decay of catalytic intermediates is different in the two types of oxidases. In the present study, we have investigated two mutant ba3 CytcOs in which residues of the proton pathway leading to the catalytic site as well as the pump site were exchanged, Thr312Val and Tyr244Phe. Even though the ba3 CytcO uses only a single proton pathway for transfer of the substrate and “pumped” protons, the amino-acid residue substitutions had distinctly different effects on the kinetics of proton transfer to the catalytic site and the pump site, respectively. The results indicate that the rates of these reactions can be modified independently by replacement of single residues within the proton pathway. Furthermore, the data suggest that the Thr312Val and Tyr244Phe mutations interfere with a structural rearrangement in the proton pathway that is rate limiting for proton transfer to the catalytic site. PMID:24004023
Bilirubin Binding Capacity in the Preterm Neonate.
Amin, Sanjiv B
2016-06-01
Total serum/plasma bilirubin (TB), the biochemical measure currently used to evaluate and manage hyperbilirubinemia, is not a useful predictor of bilirubin-induced neurotoxicity in premature infants. Altered bilirubin-albumin binding in premature infants limits the usefulness of TB in premature infants. In this article, bilirubin-albumin binding, a modifying factor for bilirubin-induced neurotoxicity, in premature infants is reviewed. Copyright © 2016 Elsevier Inc. All rights reserved.
2006-01-24
peroxidase-conjugated goat anti-human IgG anti- body ( Kierkegaard and Perry, Gaithersburg, MD) was then added to detect bound antigen colorimetrically...Color devel- opment was stopped after a 30-min incubation by adding Per- oxidase Stop Solution ( Kierkegaard and Perry, Gaithersburg, MD). Optical
The biliverdin-bilirubin antioxidant cycle of cellular protection: Missing a wheel?
McDonagh, Antony F
2010-09-01
Bilirubin reportedly protects cultured cells from the toxicity of a 10,000-fold molar excess of H(2)O(2). A bilirubin-biliverdin cycling mechanism has been proposed to explain this remarkable effect whereby bilirubin reacts with oxyradicals specifically generating biliverdin, which is then reduced back to bilirubin by NADPH/biliverdin reductase. Chemical evidence for this mechanism was formation of biliverdin during incubation of bilirubin-albumin with 2,2'-azobis(2-amidinopropane) hydrochloride (AAPH) in vitro and the assumption that biliverdin was formed by the reaction of peroxyl radicals with bilirubin. This paper describes spectroscopic studies on the reaction of bilirubin with AAPH in the presence and absence of human serum albumin. Reactions were run in air and also under oxygen-depleted and oxygen-saturated solutions, the former to inhibit peroxyl radical formation, the latter to augment it. The results confirm that degradation of bilirubin, rather than dehydrogenation to biliverdin, predominates in the reaction of bilirubin with peroxyl radicals generated by AAPH thermolysis. They also suggest that biliverdin produced in the presence of albumin is not formed by the reaction of bilirubin with alkyl peroxyl radicals, as previously assumed. The observations undermine the plausibility of the bilirubin-biliverdin recycling mechanism proposed to explain the reported hyperprotective effect of bilirubin on mammalian cells exposed to excess H(2)O(2). Copyright 2010 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Winterbourn, C.C.; Sutton, H.C.
O2- was produced by gamma irradiation of formate solutions, by the action of xanthine oxidase on hypoxanthine and O2, and by the action of ferredoxin reductase on NADPH and paraquat in the presence of O2. Its reaction with H2O2 and various iron chelates was studied. Oxidation of deoxyribose to thiobarbituric acid-reactive products that was appropriately inhibited by OH. scavengers, or formate oxidation to CO2, was used to detect OH(.). With each source of O2-, and by these criteria, Fe(EDTA) efficiently catalyzed this (Haber-Weiss) reaction, but little catalysis was detectable with iron bound to DTPA, citrate, ADP, ATP, or pyrophosphate, ormore » without chelator in phosphate buffer. O2- produced from xanthine oxidase, but not from the other sources, underwent another iron-dependent reaction with H2O2, to produce an oxidant that did not behave as free OH(.). It was formed in phosphate or bicarbonate buffer, and caused deoxyribose oxidation that was readily inhibited by mannitol or Tris, but not by benzoate, formate, or dimethyl sulfoxide. It did not oxidize formate to CO2. Addition of EDTA changed the pattern of inhibition to that expected for a reaction of OH(.). The other chelators all inhibited deoxyribose oxidation, provided their concentrations were high enough. The results are compatible with iron bound to xanthine oxidase catalyzing production of a strong oxidant (which is not free OH.) from H2O2 and O2- produced by the enzyme.« less
Quantitative imaging of bilirubin by photoacoustic microscopy
NASA Astrophysics Data System (ADS)
Zhou, Yong; Zhang, Chi; Yao, Da-Kang; Wang, Lihong V.
2013-03-01
Noninvasive detection of both bilirubin concentration and its distribution is important for disease diagnosis. Here we implemented photoacoustic microscopy (PAM) to detect bilirubin distribution. We first demonstrate that our PAM system can measure the absorption spectra of bilirubin and blood. We also image bilirubin distributions in tissuemimicking samples, both without and with blood mixed. Our results show that PAM has the potential to quantitatively image bilirubin in vivo for clinical applications.
Utilization of Reflex Testing for Direct Bilirubin in the Early Recognition of Biliary Atresia.
Lam, Leo; Musaad, Samarina; Kyle, Campbell; Mouat, Stephen
2017-05-01
Delayed diagnosis of biliary atresia is an important cause of pediatric end-stage liver failure and liver transplantation. We sought to determine whether direct bilirubin is underutilized by retrospectively reviewing patients with biliary atresia. Further, we aimed to determine the role of reflex testing for direct bilirubin in patients suspected for jaundice. The time intervals between total bilirubin and direct bilirubin measurements were retrospectively reviewed in patients with biliary atresia. We also audited the results of two major laboratories that had implemented reflex testing for direct bilirubin. We evaluated the clinical impact and cost of reflex testing in infants with increased direct bilirubin (>1.5 mg/dL; >25 μmol/L). In patients with known biliary atresia, an isolated total bilirubin measurement preceded direct bilirubin measurement in 46% (40/87) of patients; with a median delay of 19 days (interquartile range 3-44 days). In the community setting, direct bilirubin had a higher clinical specificity for biliary atresia than in the hospital setting. Reporting direct bilirubin results in 1591 infants younger than 2 weeks of age in the community was associated with three admissions to the hospital, one of whom was diagnosed with biliary atresia. The cost for the two laboratories for direct-bilirubin testing was estimated at US$3200 (NZ$4600) for each newly diagnosed case of biliary atresia. We identified underutilization of direct bilirubin as a cause of delay in the recognition of biliary atresia and show that reflex testing for direct bilirubin in jaundiced infants is a cost-effective solution. © 2017 American Association for Clinical Chemistry.
Taylor, D G; Trudgill, P W
1986-01-01
The oxygenating component of 2,5-diketocamphane 1,2-monooxygenase from Pseudomonas putida ATCC 17453 was purified to homogeneity by a combination of ammonium sulfate fractionation and chromatography on DEAE-cellulose and polyanion SI-17 columns. It had an Mr of 78,000, bound one molecule of nonautooxidizable flavin mononucleotide (FMN), consisted of two subunits of equal molecular weight, and existed in two electrophoretically distinguishable active forms. The oxygenating complex was constructed from equimolecular amounts of an NADH oxidase, which could be purified separately (Mr, 36,000), and the oxygenating component. Most of the NADH oxidase dissociated from the oxygenating component during purification, although traces remained, to give the final preparation of the oxygenating component significant oxygenase activity. FMN did not dissociate significantly from the oxygenating component during purification, but it was not covalently bound and could be removed under a variety of conditions. Binding between the two proteins that made up the active complex was fairly weak and freely reversible. It probably occurred through the FMN which was strongly bound to the oxygenating component and for which the NADH had a weak binding site. Iron was not present at a significant level in the oxygenating component, and in common with other characterized Baeyer Villiger monooxygenases, 2,5-diketocamphane 1,2-monooxygenase was found to be a simple flavoprotein. Images PMID:3944058
Taylor, D G; Trudgill, P W
1986-02-01
The oxygenating component of 2,5-diketocamphane 1,2-monooxygenase from Pseudomonas putida ATCC 17453 was purified to homogeneity by a combination of ammonium sulfate fractionation and chromatography on DEAE-cellulose and polyanion SI-17 columns. It had an Mr of 78,000, bound one molecule of nonautooxidizable flavin mononucleotide (FMN), consisted of two subunits of equal molecular weight, and existed in two electrophoretically distinguishable active forms. The oxygenating complex was constructed from equimolecular amounts of an NADH oxidase, which could be purified separately (Mr, 36,000), and the oxygenating component. Most of the NADH oxidase dissociated from the oxygenating component during purification, although traces remained, to give the final preparation of the oxygenating component significant oxygenase activity. FMN did not dissociate significantly from the oxygenating component during purification, but it was not covalently bound and could be removed under a variety of conditions. Binding between the two proteins that made up the active complex was fairly weak and freely reversible. It probably occurred through the FMN which was strongly bound to the oxygenating component and for which the NADH had a weak binding site. Iron was not present at a significant level in the oxygenating component, and in common with other characterized Baeyer Villiger monooxygenases, 2,5-diketocamphane 1,2-monooxygenase was found to be a simple flavoprotein.
Churn, S B; DeLorenzo, R J; Shapiro, S M
1995-12-01
Excessive bilirubin levels in newborn infants result in long-term neurologic deficits that remain after bilirubin levels return to normal. Much of the observed neurologic deficits can be attributed to bilirubin-induced, delayed neuronal cell death. Inhibition of calcium/calmodulin-dependent kinase II (CaM kinase II) activity that precedes cell death is observed in conditions such as seizure activity, stroke, and glutamate excitotoxicity. Because neonatal bilirubin exposure results in neuronal loss in developing brain systems, we tested whether bilirubin exposure would induce an immediate inhibition of CaM activity, in vitro. P-81 filtration assay of basal and calcium-stimulated kinase activity was performed under standard kinase assay conditions. Bilirubin and/or albumin was added to the reaction vessels to determine the effect of these agents on kinase activity. Bilirubin exposure resulted in a concentration-dependent inhibition of CaM kinase II activity (IC50 = 16.78 microM). At concentrations above 50 microM, bilirubin exposure resulted in a 71 +/- 8% (mean +/- SD) inhibition of kinase activity (p < 0.001, t test, n = 10). Bilirubin exposure did not result in kinase inhibition if excessive bilirubin was removed by albumin binding before stimulation of kinase activity (106.9 +/- 9.6% control activity, n = 5). However, removal of bilirubin by binding with albumin after calcium addition did not restore kinase activity. (36.1 +/- 3.8% control activity, n = 5). Thus, once inhibition was observed, the activity could not be restored by addition of albumin. The data suggest that bilirubin exposure resulted in a calcium-dependent inhibition of CaM kinase II activity that, once induced, was not reversible by removing bilirubin by the addition of albumin. Because inhibition of CaM kinase II activity has been correlated with delayed neuronal cell death in many neuropathologic conditions, bilirubin-induced inhibition of this enzyme may be a cellular mechanism by which bilirubin exposure results in delayed neuronal cell death in developing brain.
Ulyanova, Yevgenia; Babanova, Sofia; Pinchon, Erica; Matanovic, Ivana; Singhal, Sameer; Atanassov, Plamen
2014-07-14
The effect of proper enzyme orientation at the electrode surface was explored for two multi-copper oxygen reducing enzymes: Bilirubin Oxidase (BOx) and Laccase (Lac). Simultaneous utilization of "tethering" agent (1-pyrenebutanoic acid, succinimidyl ester; PBSE), for stable enzyme immobilization, and syringaldazine (Syr), for enzyme orientation, of both Lac and BOx led to a notable enhancement of the electrode performance. For Lac cathodes tested in solution it was established that PBSE-Lac and PBSE-Syr-Lac modified cathodes demonstrated approximately 6 and 9 times increase in current density, respectively, compared to physically adsorbed and randomly oriented Lac cathodes. Further testing in solution utilizing BOx showed an even higher increase in achievable current densities, thus BOx was chosen for additional testing in air-breathing mode. In subsequent air-breathing experiments the incorporation of PBSE and Syr with BOx resulted in current densities of 0.65 ± 0.1 mA cm(-2); 2.5 times higher when compared to an unmodified BOx cathode. A fully tethered/oriented BOx cathode was combined with a NAD-dependent Glucose Dehydrogenase anode for the fabrication of a complete enzymatic membraneless fuel cell. A maximum power of 1.03 ± 0.06 mW cm(-2) was recorded for the complete fuel cell. The observed significant enhancement in the performance of "oriented" cathodes was a result of proper enzyme orientation, leading to facilitated enzyme/electrode interface interactions.
Johansson, K; Jönsson-Pettersson, G; Gorton, L; Marko-Varga, G; Csöregi, E
1993-12-01
A reagentless carbon paste electrode chemically modified with covalently bound alcohol oxidase and horse-radish peroxidase was examined as a selective sensor in flow injection and column liquid chromatography. A combination of carbodiimide, glutaraldehyde, and polyethyleneimine was used for immobilizing the enzymes in the paste. The surface of the electrodes was protected by first forming a layer of electropolymerized ortho-phenylenediamine followed by deposition of a cation exchange membrane (Eastman AQ 29D). The electrodes were used for detection of hydrogen peroxide, methanol, ethanol, propanol, isopropanol, and butanol. Preliminary investigations of the use of this sensor for bioprocess control are reported.
Photoacoustic microscopy of bilirubin in tissue phantoms
Zhou, Yong; Zhang, Chi; Yao, Da-Kang
2012-01-01
Abstract. Determining both bilirubin’s concentration and its spatial distribution are important in disease diagnosis. Here, for the first time, we applied quantitative multiwavelength photoacoustic microscopy (PAM) to detect bilirubin concentration and distribution simultaneously. By measuring tissue-mimicking phantoms with different bilirubin concentrations, we showed that the root-mean-square error of prediction has reached 0.52 and 0.83 mg/dL for pure bilirubin and for blood-mixed bilirubin detection (with 100% oxygen saturation), respectively. We further demonstrated the capability of the PAM system to image bilirubin distribution both with and without blood. Finally, by underlaying bilirubin phantoms with mouse skins, we showed that bilirubin can be imaged with consistent accuracy down to >400 μm in depth. Our results show that PAM has potential for noninvasive bilirubin monitoring in vivo, as well as for further clinical applications. PMID:23235894
Bilirubin Binding to PPARα Inhibits Lipid Accumulation
Stec, David E.; John, Kezia; Trabbic, Christopher J.; Luniwal, Amarjit; Hankins, Michael W.; Baum, Justin
2016-01-01
Numerous clinical and population studies have demonstrated that increased serum bilirubin levels protect against cardiovascular and metabolic diseases such as obesity and diabetes. Bilirubin is a potent antioxidant, and the beneficial actions of moderate increases in plasma bilirubin have been thought to be due to the antioxidant effects of this bile pigment. In the present study, we found that bilirubin has a new function as a ligand for PPARα. We show that bilirubin can bind directly to PPARα and increase transcriptional activity. When we compared biliverdin, the precursor to bilirubin, on PPARα transcriptional activation to known PPARα ligands, WY 14,643 and fenofibrate, it showed that fenofibrate and biliverdin have similar activation properties. Treatment of 3T3-L1 adipocytes with biliverdin suppressed lipid accumulation and upregulated PPARα target genes. We treated wild-type and PPARα KO mice on a high fat diet with fenofibrate or bilirubin for seven days and found that both signal through PPARα dependent mechanisms. Furthermore, the effect of bilirubin on lowering glucose and reducing body fat percentage was blunted in PPARα KO mice. These data demonstrate a new function for bilirubin as an agonist of PPARα, which mediates the protection from adiposity afforded by moderate increases in bilirubin. PMID:27071062
Letamendia-Richard, Emmanuelle; Ammar, Rafik Ben; Tridente, Ascanio; De Luca, Daniele
2016-12-01
Transcutaneous bilirubin (TcB) consists of the skin-deposited bilirubin. Free bilirubin represents the protein-unbound bilirubin (UB) that is able to pass into the tissues. We aimed to describe the relationship UB-TcB and study the passage of UB into the skin. We prospectively enrolled 194 neonates and we measured TcB, UB, serum bilirubin and albumin. Multiple sites TcB measurement was performed, bilirubin-albumin equilibrium constant and plasma bilirubin avidity (PBA) were calculated. TcB has a similar correlation with UB and TSB. There is a quadratic relationship between UB and TcB (R 2 =0.48; p<0.001), remaining significant (β for UB 2 =-0.8; p<0.001. β for UB=1.1; p<0.001) after adjustment for gestational age, birth weight, postnatal age and albumin (Adj-R 2 =0.72). UB contributes to the skin bilirubin deposition, as there are significant correlations between albumin and TcB (r=-0.202; p=0.01) and between PBA and ΔTcB (r=0.323; p=0.017). TcB assay does not seem to directly replace UB measurement. However, TcB and UB are linked by a quadratic relationship: UB contributes to the skin bilirubin deposition but it is not the only bilirubin species measured by transcutaneous bilirubinometry. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Hosoda, Junya; Ishikawa, Toshiyuki; Matsumoto, Katsumi; Iguchi, Kohei; Matsushita, Hirooki; Ogino, Yutaka; Taguchi, Yuka; Sugano, Teruyasu; Ishigami, Tomoaki; Kimura, Kazuo; Tamura, Kouichi
2017-11-01
Research on the correlation of serum bilirubin level with cardiac function as well as outcomes in heart failure patients with cardiac resynchronization therapy (CRT) has not yet been reported. The aim of this study was to analyze the relationship between change in serum bilirubin level and left ventricular reverse remodeling, and also to clarify the impact of bilirubin change on clinical outcomes in CRT patients. We evaluated 105 consecutive patients who underwent CRT. Patients who had no serum total-bilirubin data at both baseline and 3-9 months' follow-up or had died less than 3 months after CRT implantation were excluded. Accordingly, a total of 69 patients were included in the present analysis. The patients were divided into two groups: decreased bilirubin group (serum total-bilirubin level at follow-up≤that at baseline; n=48) and increased bilirubin group (serum total-bilirubin level at follow-up>that at baseline; n=21). Mean follow-up period was 39.3 months. In the decreased bilirubin group, mean left ventricular end-systolic diameter decreased from 54.5mm to 50.2mm (p=0.001) and mean left ventricular ejection fraction increased significantly from 29.8% to 37.0% (p=0.001). In the increased bilirubin group, there was no significant change in echocardiographic parameters from baseline to follow-up. In Kaplan-Meyer analysis, cardiac mortality combined with heart failure hospitalization in the increased bilirubin group was significantly higher than that in the decreased bilirubin group (log-rank p=0.018). Multivariate Cox regression analysis revealed that increased bilirubin was an independent predictor of cardiac mortality combined with heart failure hospitalization (OR=2.66, p=0.023). The change in serum bilirubin is useful for assessment of left ventricular reverse remodeling and prediction of outcomes in heart failure patients with CRT. Copyright © 2017 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.
Bilirubin photoisomers in rhesus monkey serum.
Okada, Hitoshi; Itoh, Susumu; Nii, Kohichiroh; Sugino, Masashiro; Fuke, Noriko; Koyano, Kosuke; Yasuda, Saneyuki; Kusaka, Takashi
2018-05-23
As rhesus monkeys exhibit physiological jaundice during the neonatal period, we used rhesus monkey serum to examine changes in bilirubin photoisomers. Bilirubin-rhesus monkey serum solution was irradiated with blue light-emitting diode, and changes in the absorbance and bilirubin fraction were compared with those in bilirubin- human serum albumin (HSA) and bilirubin-rat albumin solutions. The λ max decreased with light irradiation. The mean production rate of cyclobilirubin IXα was 1.98, 199 and 0.76 × 10 -2 /min in rhesus monkey serum, HSA and rat albumin, respectively. There was no significant difference between rhesus monkey serum and HSA. The (ZE)-bilirubin IXα/(ZZ)-bilirubin IXα ratio was 0.33, 0.45, and 0.10, respectively, differing significantly among the groups. The (EZ)-bilirubin IXα/(ZZ)-bilirubin IXα ratio was 0.020, 0.010, and 0.062, respectively, with no significant difference between rhesus monkey serum and HSA. The production rate of (EZ)-cyclobilirubin XIIIα(= (ZE)-cyclobilirubin XIIIα) was 0.73, 1.60, and 0.51 × 10 -2 /min, respectively, with differing significantly among the groups. The (EZ)-bilirubin IIIα/(ZZ)-bilirubin IIIα ratio was significantly different among the groups at 0.20, 0.38, and 0.15, respectively. This is the first report demonstrating the photoisomerization of bilirubin in rhesus monkey serum and the animal with the same cyclobilirubin production rate as HSA.Rhesus monkeys may be used as an animal model for neonatal hyperbilirubinemia in humans to evaluate the efficacy of phototherapy. Copyright © 2018 Elsevier B.V. All rights reserved.
Supramolecular Complexes Formed in Systems Bile Salt-Bilirubin-Silica
NASA Astrophysics Data System (ADS)
Vlasova, N. N.; Severinovskaya, O. V.; Golovkova, L. P.
The formation of supramolecular complexes between bilirubin and primary micelles of bile salts has been studied. The association constants of bile salts and binding of bilirubin with these associates have been determined. The adsorption of bilirubin and bile salts from individual and mixed aqueous solutions onto hydrophobic silica surfaces has been investigated. The interaction of bilirubin with primary bile salt micelles and the strong retention in mixed micelles, which are supramolecular complexes, result in the adsorption of bilirubin in free state only.
Limitations and opportunities of whole blood bilirubin measurements by GEM premier 4000®.
Wang, Li; Albert, Arianne Y K; Jung, Benjamin; Hadad, Keyvan; Lyon, Martha E; Basso, Melanie
2017-03-29
Neonatal hyperbilirubinemia has traditionally been screened by either total serum bilirubin or transcutaneous bilirubin. Whole blood bilirubin (TwB) by the GEM Premier 4000® blood gas analyzer (GEM) is a relatively new technology and it provides fast bilirubin results with a small sample volume and can measure co-oximetry and other analytes. Our clinical study was to evaluate the reliability of TwB measured by the GEM and identify analytical and clinical factors that may contribute to possible bias. 440 consecutive healthy newborn samples that had plasma bilirubin ordered for neonatal hyperbilirubinemia screening were included. TwB was first measured using the GEM, after which the remainder of the blood was spun and plasma neonatal bilirubin was measured using the VITROS 5600® (VITROS). 62 samples (14%) were excluded from analysis due to failure in obtaining GEM results. Passing-Bablok regression suggested that the GEM results were negatively biased at low concentrations of bilirubin and positively biased at higher concentrations relative to the VITROS results (y = 1.43x-61.13). Bland-Altman plots showed an overall negative bias of the GEM bilirubin with a wide range of differences compared to VITROS. Both hemoglobin concentration and hemolysis affected the accuracy of the GEM results. Clinically, male infants had higher mean bilirubin levels, and infants delivered by caesarean section had lower hemoglobin levels. When comparing the number of results below the 40th percentile and above the 95th percentile cut-offs in the Bhutani nomogram which would trigger discharge or treatment, GEM bilirubin exhibited poor sensitivity and poor specificity in contrast to VITROS bilirubin. An imperfect correlation was observed between whole blood bilirubin measured on the GEM4000® and plasma bilirubin on the VITROS 5600®. The contributors to the observed differences between the two instruments were specimen hemolysis and the accuracy of hemoglobin measurements, the latter of which affects the calculation of plasma-equivalent bilirubin. Additionally, the lack of standardization of total bilirubin calibration particularly in newborn specimens, may also account for some of the disagreement in results.
Wu, Chia-Kuei; Dailey, Tamara A.; Dailey, Harry A.; Wang, Bi-Cheng; Rose, John P.
2003-01-01
The crystal structure of recombinant rat augmenter of liver regeneration (ALRp) has been determined to 1.8 Å. The protein is a homodimer, stabilized by extensive noncovalent interactions and a network of hydrogen bonds, and possesses a noncovalently bound FAD in a motif previously found only in the related protein ERV2p. ALRp functions in vitro as a disulfide oxidase using dithiothreitol as reductant. Reduction of the flavin by DTT occurs under aerobic conditions resulting in a spectrum characteristic of a neutral semiquinone. This semiquinone is stable and is only fully reduced by addition of dithionite. Mutation of either of two cysteine residues that are located adjacent to the FAD results in inactivation of the oxidase activity. A comparison of ALRp with ERV2p is made that reveals a number of significant structural differences, which are related to the in vivo functions of these two proteins. Possible physiological roles of ALR are examined and a hypothesis that it may serve multiple roles is proposed. PMID:12717032
NEW INSIGHTS INTO THE PRESENCE OF BILIRUBIN IN A PLANT SPECIES STRELITZIA NICOLAI (STRELITZIACEAE).
Dwarka, Depika; Thaver, Veneesha; Naidu, Mickey; Baijnath, Himansu
2017-01-01
The fortuitous discovery of an animal pigment bilirubin found in the plant Strelitzia nicolai has opened an enormous number of questions regarding bilirubin's formation and its ultimate function in the human body. A methodical review of bilirubin in humans and animals was carried out, information was gathered using published scientific journals, books and conference proceedings. Articles based on case studies of elevated levels of bilirubin were analysed thoroughly. Even though for numerous years bilirubin was assumed to be merely a desecrate product of the heme catabolic pathway by greatest, and a likely lethal compound at worst; statistics from the last few decades clearly shows that placidly high serum bilirubin levels are robustly related to have abundant beneficial effects on the human body. This study reveals new insights into the presence of the only animal pigment found in Strelitzia nicolai arils, the potential advantages of bilirubin found in a plant and its therapeutic value indications. This review hopes to resuscitate researchers' credence regarding bilirubin as a toxic compound.
Shao, Beili; Bayraktutan, Ulvi
2014-01-01
Blood-brain barrier disruption represents a key feature in hyperglycaemia-aggravated cerebral damage after an ischaemic stroke. Although the underlying mechanisms remain largely unknown, activation of protein kinase C (PKC) is thought to play a critical role. This study examined whether apoptosis of human brain microvascular endothelial cells (HBMEC) might contribute to hyperglycaemia-evoked barrier damage and assessed the specific role of PKC in this phenomenon. Treatments with hyperglycaemia (25 mM) or phorbol myristate acetate (PMA, a protein kinase C activator, 100 nM) significantly increased NADPH oxidase activity, O2 (•-) generation, proapoptotic protein Bax expression, TUNEL-positive staining and caspase-3/7 activities. Pharmacological inhibition of NADPH oxidase, PKC-a, PKC-ß or PKC-ßI via their specific inhibitors and neutralisation of O2 (•-) by a cell-permeable superoxide dismutase mimetic, MnTBAP normalised all the aforementioned increases induced by hyperglycaemia. Suppression of these PKC isoforms also negated the stimulatory effects of hyperglycaemia on the protein expression of NADPH oxidase membrane-bound components, Nox2 and p22-phox which determine the overall enzymatic activity. Silencing of PKC-ßI gene through use of specific siRNAs abolished the effects of both hyperglycaemia and PMA on endothelial cell NADPH oxidase activity, O2 (•-) production and apoptosis and consequently improved the integrity and function of an in vitro model of human cerebral barrier comprising HBMEC, astrocytes and pericytes. Hyperglycaemia-mediated apoptosis of HBMEC contributes to cerebral barrier dysfunction and is modulated by sequential activations of PKC-ßI and NADPH oxidase.
Inactivation of 1-aminocyclopropane-1-carboxylate oxidase involves oxidative modifications.
Barlow, J N; Zhang, Z; John, P; Baldwin, J E; Schofield, C J
1997-03-25
1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final step in the biosynthesis of the plant signaling molecule ethylene. It is a member of the ferrous iron dependent family of oxidases and dioxygenases and is unusual in that it displays a very short half-life under catalytic conditions, typically less than 20 min, and a requirement for CO2 as an activator. The rates of inactivation of purified, recombinant ACC oxidase from tomato under various combinations of substrates and cofactors were measured. Inactivation was relatively slow in the presence of buffer alone (t1/2 > 1 h), but fast in the presence of ferrous iron and ascorbate (t1/2 approximately 10 min). The rate of iron/ascorbate-mediated inactivation was increased by the addition of ACC, unaffected by the addition of CO2 at saturation (supplied as bicarbonate) but decreased by the addition of catalase or ACC + CO2 at saturation (supplied as bicarbonate). Iron/ascorbate-mediated inactivation was accompanied by partial proteolysis as observed by SDS-PAGE analysis. The fragmentation pattern was altered when ACC was also included, suggesting that ACC can bind to ACC oxidase in the absence of bicarbonate. N-terminal sequencing of fragments resulted in identification of an internal cleavage site which we propose is proximate to active-site bound iron. Thus, ACC oxidase inactivates via relatively slow partial unfolding of the catalytically active conformation, oxidative damage mediated via hydrogen peroxide which is catalase protectable and oxidative damage to the active site which results in partial proteolysis and is not catalase protectable.
Wei, T-T; Wang, L-L; Yin, J-R; Liu, Y-T; Qin, B-D; Li, J-Y; Yin, X; Zhou, L; Zhong, R-Q
2017-10-01
Red blood cell distribution width (RDW) and bilirubin have been proved to be prognostic factors for various types of cancer. However, their prognostic value in patients with gastric cancer (GC) remains largely unknown. To verify whether RDW and bilirubin are prognostic factors for patients with GC, we performed a cross-sectional study to analyze the relationship between RDW, bilirubin, and the clinical characteristics of patients with GC. Medical records of all newly diagnosed and pathologically proved patients with GC admitted to Changzheng Hospital between January 2016 and July 2016 were retrospectively reviewed. The relationship between RDW, bilirubin, and the clinical characteristics of patients with GC was analyzed. A total of 144 patients with GC were enrolled. Patients with GC had significantly higher RDW than healthy controls, even after adjusting for hemoglobin, while total bilirubin (TBIL), direct bilirubin (DBIL) and indirect bilirubin (IBIL) were significantly decreased. Furthermore, RDW and bilirubin were significantly correlated with tumor stage, as well as carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA19-9). Our study indicated that RDW and bilirubin could be potential prognostic factors for patients of GC. © 2017 John Wiley & Sons Ltd.
Bilirubin and atherosclerotic diseases.
Vítek, L
2017-04-05
Bilirubin is the final product of heme catabolism in the systemic circulation. For decades, increased serum/plasma bilirubin levels were considered an ominous sign of an underlying liver disease. However, data from recent years convincingly suggest that mildly elevated bilirubin concentrations are associated with protection against various oxidative stress-mediated diseases, atherosclerotic conditions being the most clinically relevant. Although scarce data on beneficial effects of bilirubin had been published also in the past, it took until 1994 when the first clinical study demonstrated an increased risk of coronary heart disease in subjects with low serum bilirubin levels, and bilirubin was found to be a risk factor for atherosclerotic diseases independent of standard risk factors. Consistent with these results, we proved in our own studies, that subjects with mild elevation of serum levels of unconjugated bilirubin (benign hyperbilirubinemia, Gilbert syndrome) have much lower prevalence/incidence of coronary heart as well as peripheral vascular disease. We have also demonstrated that this association is even more general, with serum bilirubin being a biomarker of numerous other diseases, often associated with increased risk of atherosclerosis. In addition, very recent data have demonstrated biological pathways modulated by bilirubin, which are responsible for observed strong clinical associations.
Serum Bilirubin Concentrations in Patients With Takayasu Arteritis.
Peng, You-Fan; Deng, Yi-Bin
2017-06-01
- Bilirubin has strong anti-inflammatory and antioxidative stress action. Progression of inflammation involving arteries is a crucial activator in pathogenesis of Takayasu arteritis (TA). - To investigate the relationship between serum bilirubin and TA. - Our study involved 115 consecutive TA patients. Patients with active-phase disease were followed and received prednisone therapy. - Lower concentrations of serum bilirubin were detected in TA patients compared with healthy subjects (0.6 ± 0.31 versus 0.7 ± 0.22 mg/dL, P = .02). Serum bilirubin concentrations in active TA patients were lower than those in inactive patients (0.5 ± 0.20 versus 0.8 ± 0.32 mg/dL, P < .001). In all patients with TA, serum bilirubin correlated positively with total protein (r = 0.193, P = .04) and negatively with C-reactive protein and erythrocyte sedimentation rate (r = -0.213, P = .03, and r = -0.532, P < .001, respectively). Multiple logistic regression analysis showed that each decrease of 1 mg/dL in serum bilirubin was associated with a 1.10 times increase in the odds for TA compared with the controls (odds ratio = 0.913, 95% CI, 0.856-0.974; P = .006). Serum bilirubin was correlated with erythrocyte sedimentation rate (β = -0.170, P < .001) in multiple linear regression analysis. The area under the curve for serum bilirubin in predicting active TA patients was 0.802. Serum bilirubin levels were found to be significantly increased after prednisone treatment (0.5 ± 0.20 versus 0.7 ± 0.15 mg/dL, P = .002). - Lower serum bilirubin levels are associated with TA, and serum bilirubin may be influenced by prednisone therapy in active TA patients. Serum bilirubin levels in TA patients correlate negatively with erythrocyte sedimentation rate.
Bilirubin Inhibits Neointima Formation and Vascular Smooth Muscle Cell Proliferation and Migration
Peyton, Kelly J.; Shebib, Ahmad R.; Azam, Mohammad A.; Liu, Xiao-ming; Tulis, David A.; Durante, William
2012-01-01
Bilirubin is a heme metabolite generated by the concerted action of the enzymes heme oxygenase and biliverdin reductase. Although long considered a toxic byproduct of heme catabolism, recent preclinical, and clinical studies indicate the bilirubin exerts beneficial effects in the circulation. In the present study, we determined whether local administration of bilirubin attenuates neointima formation following injury of rat carotid arteries. In addition, the ability of bilirubin to regulate the proliferation and migration of human arterial smooth muscle cells (SMCs) was investigated. Local perivascular administration of bilirubin immediately following balloon injury of rat carotid arteries significantly attenuated neointima formation. Bilirubin-mediated inhibition of neointimal thickening was associated with a significant decrease in ERK activity and cyclin D1 and A protein expression, and an increase in p21 and p53 protein expression in injured blood vessels. Treatment of human aortic SMCs with bilirubin inhibited proliferation and migration in a concentration-dependent manner without affecting cell viability. In addition, bilirubin resulted in a concentration-dependent increase in the percentage of cells in the G0/G1 phase of the cell cycle and this was paralleled by a decrease in the fraction of cells in the S and G2M phases of the cell cycle. Finally, bilirubin had no effect on mitochondrial function and ATP content of vascular SMCs. In conclusion, these studies demonstrate that bilirubin inhibits neointima formation after arterial injury and this is associated with alterations in the expression of cell cycle regulatory proteins. Furthermore, bilirubin blocks proliferation and migration of human arterial SMCs and arrests SMCs in the G0/G1 phase of the cell cycle. Bilirubin represents an attractive therapeutic agent in treating occlusive vascular disease. PMID:22470341
Zhou, Jin; Tracy, Timothy S; Remmel, Rory P
2010-11-01
Bilirubin, an end product of heme catabolism, is primarily eliminated via glucuronic acid conjugation by UGT1A1. Impaired bilirubin conjugation, caused by inhibition of UGT1A1, can result in clinical consequences, including jaundice and kernicterus. Thus, evaluation of the ability of new drug candidates to inhibit UGT1A1-catalyzed bilirubin glucuronidation in vitro has become common practice. However, the instability of bilirubin and its glucuronides presents substantial technical challenges to conduct in vitro bilirubin glucuronidation assays. Furthermore, because bilirubin can be diglucuronidated through a sequential reaction, establishment of initial rate conditions can be problematic. To address these issues, a robust high-performance liquid chromatography assay to measure both bilirubin mono- and diglucuronide conjugates was developed, and the incubation conditions for bilirubin glucuronidation by human embryonic kidney 293-expressed UGT1A1 were carefully characterized. Our results indicated that bilirubin glucuronidation should be assessed at very low protein concentrations (0.05 mg/ml protein) and over a short incubation time (5 min) to assure initial rate conditions. Under these conditions, bilirubin total glucuronide formation exhibited a hyperbolic (Michaelis-Menten) kinetic profile with a K(m) of ∼0.2 μM. In addition, under these initial rate conditions, the relative proportions between the total monoglucuronide and the diglucuronide product were constant across the range of bilirubin concentration evaluated (0.05-2 μM), with the monoglucuronide being the predominant species (∼70%). In conclusion, establishment of appropriate incubation conditions (i.e., very low protein concentrations and short incubation times) is necessary to properly characterize the kinetics of bilirubin glucuronidation in a recombinant UGT1A1 system.
Bilirubin Blood Test: MedlinePlus Lab Test Information
... https://medlineplus.gov/labtests/bilirubinbloodtest.html Bilirubin Blood Test To use the sharing features on this page, please enable JavaScript. What is a Bilirubin Blood Test? A bilirubin blood test measures the levels of ...
Zhong, P; Sun, D M; Wu, D H; Li, T M; Liu, X Y; Liu, H Y
2017-01-26
We evaluated serum total bilirubin levels as a predictor for metabolic syndrome (MetS) and investigated the relationship between serum total bilirubin levels and MetS prevalence. This cross-sectional study included 1728 participants over 65 years of age from Eastern China. Anthropometric data, lifestyle information, and previous medical history were collected. We then measured serum levels of fasting blood-glucose, total cholesterol, triglycerides, and total bilirubin, as well as alanine aminotransferase activity. The prevalence of MetS and each of its individual component were calculated per quartile of total bilirubin level. Logistic regression was used to assess the correlation between serum total bilirubin levels and MetS. Total bilirubin level in the women who did not have MetS was significantly higher than in those who had MetS (P<0.001). Serum total bilirubin quartiles were linearly and negatively correlated with MetS prevalence and hypertriglyceridemia (HTG) in females (P<0.005). Logistic regression showed that serum total bilirubin was an independent predictor of MetS for females (OR: 0.910, 95%CI: 0.863-0.960; P=0.001). The present study suggests that physiological levels of serum total bilirubin might be an independent risk factor for aged Chinese women, and the prevalence of MetS and HTG are negatively correlated to serum total bilirubin levels.
Mortality associated with bilirubin levels in insurance applicants.
Fulks, Michael; Stout, Robert L; Dolan, Vera F
2009-01-01
Determine the relationship between bilirubin levels with and without other liver function test (LFT) elevations and relative mortality in life insurance applicants. By use of the Social Security Death Master File mortality was determined in 1,905,664 insurance applicants for whom blood samples were submitted to the Clinical Reference Laboratory. There were 50,174 deaths observed in this study population. Results were stratified by 3 age/sex groups: females, age <60; males, age <60; and all, age 60+. The median follow-up was 12 years. Relative mortality increased as bilirubin decreased below bilirubin levels seen for the middle 50% of the population. The known association of smoking with lower bilirubin values explained only part of the additional elevated risk at low bilirubin levels. In the absence of other LFT elevations, relative mortality remained unchanged as bilirubin increased beyond levels seen for the middle 50% of the population. When a bilirubin elevation was combined with other LFT elevations, mortality further increased only at the highest elevations of other LFTs, seen only in <2.5% of applicants. Isolated elevations of bilirubin in this healthy screening population were not associated with excess mortality but values below the midpoint were. Other investigations have suggested a cardiovascular cause may underlie the excess mortality associated with low bilirubin. In association with other LFT elevations, bilirubin elevation further increases the mortality risk only at the highest elevations of other LFTs.
Liu, Chaoqun; Zhong, Chunrong; Zhou, Xuezhen; Chen, Renjuan; Wu, Jiangyue; Wang, Weiye; Li, Xiating; Ding, Huisi; Guo, Yanfang; Gao, Qin; Hu, Xingwen; Xiong, Guoping; Yang, Xuefeng; Hao, Liping; Xiao, Mei; Yang, Nianhong
2017-01-01
Bilirubin concentrations have been recently reported to be negatively associated with type 2 diabetes mellitus. We examined the association between bilirubin concentrations and gestational diabetes mellitus. In a prospective cohort study, 2969 pregnant women were recruited prior to 16 weeks of gestation and were followed up until delivery. The value of bilirubin was tested and oral glucose tolerance test was conducted to screen gestational diabetes mellitus. The relationship between serum bilirubin concentration and gestational weeks was studied by two-piecewise linear regression. A subsample of 1135 participants with serum bilirubin test during 16-18 weeks gestation was conducted to research the association between serum bilirubin levels and risk of gestational diabetes mellitus by logistic regression. Gestational diabetes mellitus developed in 8.5 % of the participants (223 of 2969). Two-piecewise linear regression analyses demonstrated that the levels of bilirubin decreased with gestational week up to the turning point 23 and after that point, levels of bilirubin were increased slightly. In multiple logistic regression analysis, the relative risk of developing gestational diabetes mellitus was lower in the highest tertile of direct bilirubin than that in the lowest tertile (RR 0.60; 95 % CI, 0.35-0.89). The results suggested that women with higher serum direct bilirubin levels during the second trimester of pregnancy have lower risk for development of gestational diabetes mellitus.
Du, Yaran; Li, Xiqian; Lv, Xueju; Jia, Qiong
2017-09-13
Free bilirubin, a key biomarker for jaundice, was detected with a newly designed fluorescent postsynthetically modified metal organic framework (MOF) (UIO-66-PSM) sensor. UiO-66-PSM was prepared based on the aldimine condensation reaction of UiO-66-NH 2 with 2,3,4-trihydroxybenzaldehyde. The fluorescence of UIO-66-PSM could be effectively quenched by free bilirubin via a fluorescent resonant energy transfer process, thus achieving its recognition of free bilirubin. It was the first attempt to design a MOF-based fluorescent probe for sensing free bilirubin. The probe exhibited fast response time, low detection limit, wide linear range, and high selectivity toward free bilirubin. The sensing system enabled the monitor of free bilirubin in real human serum. Hence, the reported free bilirubin sensing platform has potential applications for clinical diagnosis of jaundice.
Miranda, Berta; Barrabés, José A; Figueras, Jaume; Pineda, Victor; Rodríguez-Palomares, José; Lidón, Rosa-Maria; Sambola, Antonia; Bañeras, Jordi; Otaegui, Imanol; García-Dorado, David
2016-01-01
Bilirubin may elicit cardiovascular protection and heme oxygenase-1 overexpression attenuated post-infarction ventricular remodeling in experimental animals, but the association between bilirubin levels and post-infarction remodeling is unknown. In 145 patients with a first anterior ST-segment elevation acute myocardial infarction (STEMI), we assessed whether plasma bilirubin on admission predicted adverse remodeling (left ventricular end-diastolic volume [LVEDV] increase ≥20% between discharge and 6 months, estimated by magnetic resonance imaging). Patients' baseline characteristics and management were comparable among bilirubin tertiles. LVEDV increased at 6 months (P < 0.001) with respect to the initial exam, but the magnitude of this increase was similar across increasing bilirubin tertiles (10.8 [30.2], 10.1 [22.9], and 12.7 [24.3]%, P = 0.500). Median (25-75 percentile) bilirubin values in patients with and without adverse remodeling were 0.75 (0.60-0.93) and 0.73 (0.60-0.92) mg/dL (P = 0.693). Absence of final TIMI flow grade 3 (odds ratio 3.92, 95% CI 1.12-13.66) and a history of hypertension (2.04, 0.93-4.50), but not admission bilirubin, were independently associated with adverse remodeling. Bilirubin also did not predict the increase in ejection fraction at 6 months. Admission bilirubin values are not related to LVEDV or ejection fraction progression after a first anterior STEMI and do not predict adverse ventricular remodeling. Key messages Bilirubin levels are inversely related to cardiovascular disease, and overexpression of heme oxygenase-1 (the enzyme that determines bilirubin production) has prevented post-infarction ventricular remodeling in experimental animals, but the association between bilirubin levels and the progression of ventricular volumes and function in patients with acute myocardial infarction remained unexplored. In this cohort of patients with a first acute anterior ST-segment elevation myocardial infarction receiving contemporary management, bilirubin levels on admission were not predictive of the changes in left ventricular volumes or ejection fraction at 6 months measured by serial cardiac magnetic resonance imaging. The data are contrary to a significant protective effect of bilirubin against post-infarction ventricular remodeling.
Does bilirubin prevent hepatic steatosis through activation of the PPARα nuclear receptor?
Hinds, Terry D; Adeosun, Samuel O; Alamodi, Abdulhadi A; Stec, David E
2016-10-01
Several large population studies have demonstrated a negative correlation between serum bilirubin levels and the development of obesity, hepatic steatosis, and cardiovascular disease. Despite the strong correlative data demonstrating the protective role of bilirubin, the mechanism by which bilirubin can protect against these pathologies remains unknown. Bilirubin has long been known as a powerful antioxidant and also has anti-inflammatory actions, each of which may contribute to the protection afforded by increased levels. We have recently described a novel function of bilirubin as a ligand for the peroxisome proliferator-activated receptor-alpha (PPARα), which we show specifically binds to the nuclear receptor. Bilirubin may function as a selective PPAR modulator (SPPARM) to control lipid accumulation and blood glucose. However, it is not known to what degree bilirubin activation of PPARα is responsible for the protection afforded to reduce hepatic steatosis. We hypothesize that bilirubin, acting as a novel SPPARM, increases hepatic fatty acid metabolism through a PPARα-dependent mechanism which reduces hepatic lipid accumulation and protects against hepatic steatosis and non-alcoholic fatty liver disease (NAFLD). Copyright © 2016 Elsevier Ltd. All rights reserved.
Electron Transport in Paracoccus Halodenitrificans and the Role of Ubiquinone
NASA Technical Reports Server (NTRS)
Hochstein, L. I.; Cronin, S. E.
1983-01-01
The membrane-bound NADH oxidase of Paracoccus halodenitrificans was inhibited by dicoumarol, 2-n-heptyl-4-hydroxyquinoline-N-oxide (HQNO), and exposure to ultraviolet light (at 366 nm). When the membranes were extracted with n-pentane, NADH oxidase activity was lost. Partial restoration was achieved by adding the ubiquinone fraction extracted from the membranes. Succinate oxidation was not inhibited by dicoumarol or HQNO but was affected by ultraviolet irradiation or n-pentane extraction. However, the addition of the ubiquinone fraction to the n-pentane-extracted membranes did not restore enzyme activity. These observations suggested the reducing equivalents from succinate entered the respiratory chain on the oxygen side of the HQNO-sensitive site and probably did not proceed through a quinone.
An activity transition from NADH dehydrogenase to NADH oxidase during protein denaturation.
Huston, Scott; Collins, John; Sun, Fangfang; Zhang, Ting; Vaden, Timothy D; Zhang, Y-H Percival; Fu, Jinglin
2018-05-01
A decrease in the specific activity of an enzyme is commonly observed when the enzyme is inappropriately handled or is stored over an extended period. Here, we reported a functional transition of an FMN-bound diaphorase (FMN-DI) that happened during the long-term storage process. It was found that FMN-DI did not simply lose its β-nicotinamide adenine diphosphate (NADH) dehydrogenase activity after a long-time storage, but obtained a new enzyme activity of NADH oxidase. Further mechanistic studies suggested that the alteration of the binding strength of an FMN cofactor with a DI protein could be responsible for this functional switch of the enzyme. © 2017 International Union of Biochemistry and Molecular Biology, Inc.
Electron transport in Paracoccus halodenitrificans and the role of Ubiquinone
NASA Technical Reports Server (NTRS)
Hochstein, L. I.; Cronin, S. E.
1984-01-01
The membrane-bound NADH oxidase of Paracoccus halodenitrificans was inhibited by dicoumarol, 2-n-heptyl-4-hydroxyquinoline-N-oxide (HQNO), and exposure to ultraviolet light (at 366 nm). When the membranes were extracted with n-pentane, NADH oxidase activity was lost. Partial restoration was achieved by adding the ubiquinone fraction extracted from the membranes. Succinate oxidation was not inhibited by dicoumarol or HQNO but was affected by ultraviolet irradiation or n-pentane extraction. However, the addition of the ubiquinone fraction to the n-pentane-extracted membranes did not restore enzyme activity. These observations suggested the reducing equivalents from succinate entered the respiratory chain on the oxygen side of the HQNO-sensitive site and probably did not proceed through a quinone.
High performance of a unique mesoporous polystyrene-based adsorbent for blood purification
Chen, Jian; Han, Wenyan; Chen, Jie; Zong, Wenhui; Wang, Weichao; Wang, Yue; Cheng, Guanghui; Li, Chunran; Ou, Lailiang; Yu, Yaoting
2017-01-01
A multi-functional polystyrene based adsorbent (NKU-9) with a unique mesoporous and a high surface area was prepared by suspension polymerization for removal of therapeutic toxins in blood purification. The adsorbent produced had an almost equal amount of mesopore distribution in the range from 2 to 50 nm. The adsorption of serum toxins with different molecular weights were examined by in vitro adsorption assays and compared with some clinical currently used adsorbents such as HA-330, Cytosorb and BL-300 which are produced by China, America and Japan, respectively. Test results indicated that the adsorption rate for pentobarbital by NKU-9 was 81.24% which is nearly as high as HA-330 (81.44%). The latter adsorbent is currently used for acute detoxification treatment in China. To reach adsorption equilibrium, NKU-9 was faster than HA-330, which implies short treatment time. For the removal of middle molecular toxins such as β2-microglobulin (98.88%), NKU-9 performed better adsorptive selectivity than Cytosorb (92.80%). In addition, NKU-9 showed high performance for the removal of albumin-bound toxins (e.g., bilirubin), and its adsorption rate for total bilirubin (80.79%) in plasma was 8.4% higher than that of anion exchange resin BL-300 which is currently used to eliminate bilirubin in clinic. Therefore, our results indicate that the newly developed adsorbent with a wide distribution and almost equal amount of mesopores is a multifunctional adsorbent for high efficient removal of serum toxins with different molecular weights which might be an excellent blood purification adsorbent especially to treat diseases that conventional medical methods are low or not efficient. PMID:28149527
High performance of a unique mesoporous polystyrene-based adsorbent for blood purification.
Chen, Jian; Han, Wenyan; Chen, Jie; Zong, Wenhui; Wang, Weichao; Wang, Yue; Cheng, Guanghui; Li, Chunran; Ou, Lailiang; Yu, Yaoting
2017-02-01
A multi-functional polystyrene based adsorbent (NKU-9) with a unique mesoporous and a high surface area was prepared by suspension polymerization for removal of therapeutic toxins in blood purification. The adsorbent produced had an almost equal amount of mesopore distribution in the range from 2 to 50 nm. The adsorption of serum toxins with different molecular weights were examined by in vitro adsorption assays and compared with some clinical currently used adsorbents such as HA-330, Cytosorb and BL-300 which are produced by China, America and Japan, respectively. Test results indicated that the adsorption rate for pentobarbital by NKU-9 was 81.24% which is nearly as high as HA-330 (81.44%). The latter adsorbent is currently used for acute detoxification treatment in China. To reach adsorption equilibrium, NKU-9 was faster than HA-330, which implies short treatment time. For the removal of middle molecular toxins such as β2-microglobulin (98.88%), NKU-9 performed better adsorptive selectivity than Cytosorb (92.80%). In addition, NKU-9 showed high performance for the removal of albumin-bound toxins (e.g., bilirubin), and its adsorption rate for total bilirubin (80.79%) in plasma was 8.4% higher than that of anion exchange resin BL-300 which is currently used to eliminate bilirubin in clinic. Therefore, our results indicate that the newly developed adsorbent with a wide distribution and almost equal amount of mesopores is a multifunctional adsorbent for high efficient removal of serum toxins with different molecular weights which might be an excellent blood purification adsorbent especially to treat diseases that conventional medical methods are low or not efficient.
Determination of bilirubin glucuronide and assay of glucuronyltransferase with bilirubin as acceptor
Van Roy, F. P.; Heirwegh, K. P. M.
1968-01-01
1. Conjugated bilirubin is conveniently determined by coupling with the diazonium salt of ethyl anthranilate. 2. This method has been used in the development of assays for UDP-glucuronyltransferase (EC 2.4.1.17), with bilirubin as substrate, in rat liver homogenates, microsomal preparations and partly purified fractions. 3. Chromatographic analysis suggests that bilirubin monoglucuronide is the product of the enzyme systems studied. PMID:5660631
Bilirubin-Induced Neurotoxicity in the Preterm Neonate.
Watchko, Jon F
2016-06-01
Bilirubin-induced neurotoxicity in preterm neonates remains a clinical concern. Multiple cellular and molecular cascades likely underlie bilirubin-induced neuronal injury, including plasma membrane perturbations, excitotoxicity, neuroinflammation, oxidative stress, and cell cycle arrest. Preterm newborns are particularly vulnerable secondary to central nervous system immaturity and concurrent adverse clinical conditions that may potentiate bilirubin toxicity. Acute bilirubin encephalopathy in preterm neonates may be subtle and manifest primarily as recurrent symptomatic apneic events. Low-bilirubin kernicterus continues to be reported in preterm neonates, and although multifactorial in nature, is often associated with marked hypoalbuminemia. Copyright © 2016 Elsevier Inc. All rights reserved.
Liu, Jinfeng; Dong, Huansheng; Zhang, Yong; Cao, Mingjun; Song, Lili; Pan, Qingjie; Bulmer, Andrew; Adams, David B.; Dong, Xiao; Wang, Hongjun
2015-01-01
Obesity can cause insulin resistance and type 2 diabetes. Moderate elevations in bilirubin levels have anti-diabetic effects. This study is aimed at determining the mechanisms by which bilirubin treatment reduces obesity and insulin resistance in a diet-induced obesity (DIO) mouse model. DIO mice were treated with bilirubin or vehicle for 14 days. Body weights, plasma glucose, and insulin tolerance tests were performed prior to, immediately, and 7 weeks post-treatment. Serum lipid, leptin, adiponectin, insulin, total and direct bilirubin levels were measured. Expression of factors involved in adipose metabolism including sterol regulatory element-binding protein (SREBP-1), insulin receptor (IR), and PPARγ in liver were measured by RT-PCR and Western blot. Compared to controls, bilirubin-treated mice exhibited reductions in body weight, blood glucose levels, total cholesterol (TC), leptin, total and direct bilirubin, and increases in adiponectin and expression of SREBP-1, IR, and PPARγ mRNA. The improved metabolic control achieved by bilirubin-treated mice was persistent: at two months after treatment termination, bilirubin-treated DIO mice remained insulin sensitive with lower leptin and higher adiponectin levels, together with increased PPARγ expression. These results indicate that bilirubin regulates cholesterol metabolism, adipokines and PPARγ levels, which likely contribute to increased insulin sensitivity and glucose tolerance in DIO mice. PMID:26017184
Du, Min; Zhang, Shanshan; Xiao, Lin; Xu, Yanyan; Liu, Peiyi; Tang, Yuhan; Wei, Sheng; Xing, Mingyou; Miao, Xiaoping; Yao, Ping
2016-12-09
The study probed the association between bilirubin and hepatitis B virus (HBV) infection and progression. A cross-sectional analysis of 28,500 middle aged and elderly Chinese participants was performed to analyze the differences of bilirubin in terms of hepatitis B surface antigen (HBsAg) positive or negative and the correlation between bilirubin and severity of hepatic fibrosis estimated by non-invasive indices. Bilirubin was significantly higher in the HBsAg (+) group than the HBsAg (-) group. Higher bilirubin levels were consistently associated with elevated liver fibrosis indices among HBsAg carriers. Compared with quartile 1 of total bilirubin (TBil), the multivariable-adjusted ORs (95% CIs) for elevated fibrosis indices of quartile 4 were 2.24 (95% CIs, 1.57-3.21) estimated by fibrosis 4 score (FIB-4) and 2.22 (95% CIs, 1.60-3.08) estimated by aspartate transaminase to platelet ratio index (APRI). In addition, direct bilirubin (DBil) had a stronger association with elevated liver fibrosis indices than did indirect bilirubin (IBil). Furthermore, the relationship between DBil and elevated fibrosis indices was more robust among participants who were female, overweight or had central fat distribution. These findings suggested that bilirubin levels, especially DBil, were independently associated with an increased risk of increased fibrosis indices.
Takeda, Taka-aki; Mu, Anfeng; Tai, Tran Tien; Kitajima, Sakihito; Taketani, Shigeru
2015-01-01
It is well known that haem serves as the prosthetic group of various haemoproteins that function in oxygen transport, respiratory chain, and drug metabolism. However, much less is known about the functions of the catabolites of haem in mammalian cells. Haem is enzymatically degraded to iron, carbon monoxide (CO), and biliverdin, which is then converted to bilirubin. Owing to difficulties in measuring bilirubin, however, the generation and transport of this end product remain unclear despite its clinical importance. Here, we used UnaG, the recently identified bilirubin-binding fluorescent protein, to analyse bilirubin production in a variety of human cell lines. We detected a significant amount of bilirubin with many non-blood cell types, which was sensitive to inhibitors of haem metabolism. These results suggest that there is a basal level of haem synthesis and its conversion into bilirubin. Remarkably, substantial changes were observed in the bilirubin generation when cells were exposed to stress insults. Since the stress-induced cell damage was exacerbated by the pharmacological blockade of haem metabolism but was ameliorated by the addition of biliverdin and bilirubin, it is likely that the de novo synthesis of haem and subsequent conversion to bilirubin play indispensable cytoprotective roles against cell damage. PMID:25990790
Bilirubin and its oxidation products damage brain white matter
Lakovic, Katarina; Ai, Jinglu; D'Abbondanza, Josephine; Tariq, Asma; Sabri, Mohammed; Alarfaj, Abdullah K; Vasdev, Punarjot; Macdonald, Robert Loch
2014-01-01
Brain injury after intracerebral hemorrhage (ICH) occurs in cortex and white matter and may be mediated by blood breakdown products, including hemoglobin and heme. Effects of blood breakdown products, bilirubin and bilirubin oxidation products, have not been widely investigated in adult brain. Here, we first determined the effect of bilirubin and its oxidation products on the structure and function of white matter in vitro using brain slices. Subsequently, we determined whether these compounds have an effect on the structure and function of white matter in vivo. In all, 0.5 mmol/L bilirubin treatment significantly damaged both the function and the structure of myelinated axons but not the unmyelinated axons in brain slices. Toxicity of bilirubin in vitro was prevented by dimethyl sulfoxide. Bilirubin oxidation products (BOXes) may be responsible for the toxicity of bilirubin. In in vivo experiments, unmyelinated axons were found more susceptible to damage from bilirubin injection. These results suggest that unmyelinated axons may have a major role in white-matter damage in vivo. Since bilirubin and BOXes appear in a delayed manner after ICH, preventing their toxic effects may be worth investigating therapeutically. Dimethyl sulfoxide or its structurally related derivatives may have a potential therapeutic value at antagonizing axonal damage after hemorrhagic stroke. PMID:25160671
Premkumar, Lakshmanane; Kurth, Fabian; Duprez, Wilko; Grøftehauge, Morten K.; King, Gordon J.; Halili, Maria A.; Heras, Begoña; Martin, Jennifer L.
2014-01-01
The multidrug resistant bacterium Acinetobacter baumannii is a significant cause of nosocomial infection. Biofilm formation, that requires both disulfide bond forming and chaperone-usher pathways, is a major virulence trait in this bacterium. Our biochemical characterizations show that the periplasmic A. baumannii DsbA (AbDsbA) enzyme has an oxidizing redox potential and dithiol oxidase activity. We found an unexpected non-covalent interaction between AbDsbA and the highly conserved prokaryotic elongation factor, EF-Tu. EF-Tu is a cytoplasmic protein but has been localized extracellularly in many bacterial pathogens. The crystal structure of this complex revealed that the EF-Tu switch I region binds to the non-catalytic surface of AbDsbA. Although the physiological and pathological significance of a DsbA/EF-Tu association is unknown, peptides derived from the EF-Tu switch I region bound to AbDsbA with submicromolar affinity. We also identified a seven-residue DsbB-derived peptide that bound to AbDsbA with low micromolar affinity. Further characterization confirmed that the EF-Tu- and DsbB-derived peptides bind at two distinct sites. These data point to the possibility that the non-catalytic surface of DsbA is a potential substrate or regulatory protein interaction site. The two peptides identified in this work together with the newly characterized interaction site provide a novel starting point for inhibitor design targeting AbDsbA. PMID:24860094
Trans-Cutaneous Bilirubinometery versus Serum Bilirubin in Neonatal Jaundice.
Mahram, Manoochehr; Oveisi, Sonia; Jaberi, Najmeh
2015-12-01
Hyperbilirubinemia is a common problem in neonates and causes serious complications. Thus, serial measurements of bilirubin should be done. This assessment is done through two methods of laboratory measurement in serum sample and transcutaneous bilirubinometer. This descriptive study compared transcutaneous bilirubin assessment and laboratory serum bilirubin. Bilirubin level was assessed among 256 neonates admitted to the Qods Children's Hospital in Qazvin- Iran, because of neonatal indirect jaundice, through two methods of transcutaneous bilirubinometery from two sites of forehead and sternum and laboratory measurement of bilirubin in serum. The cases were non-hemolytic icteric term neonates weighing 2500 gram or more and had not received phototherapy or other treatments. Neonates with hemolytic forms of jaundice, sepsis and suspicious to metabolic disorders were excluded. Assessments by means of KJ-8000 transcutaneous bilirubinometer from two sites of forehead and sternum and through laboratory measurement of serum bilirubin were registered and analyzed. The results of the current study showed that there was a correlation of 0.82 between serum bilirubin and transcutaneous forehead bilirubin assessment and for the used device sensitivity of 0.844; specificity of 0.842, Youden Index of 0.709 and Shortest of 0.042 for a cut-off of 12.4 in bilirubin of participants. Furthermore, Likelihood Ratio positive and negative (LR) were 5.665 and 0.164, respectively and diagnostic Odds Ratio (LR+/LR-) was 34.56. Transcutaneous bilirubinometery can be considered as a reliable tool to assess bilirubin for the screening of neonatal jaundice in term neonates.
Prognostic impact of serum bilirubin level on long-term renal survival in IgA nephropathy.
Tanaka, Shigeru; Ninomiya, Toshiharu; Masutani, Kosuke; Nagata, Masaharu; Tsuchimoto, Akihiro; Tsuruya, Kazuhiko; Kitazono, Takanari
2015-12-01
Serum bilirubin has been recognized as a novel endogenous antioxidant. The aim of our study was to evaluate the impact of serum bilirubin on kidney prognosis in IgA nephropathy (IgAN). We followed retrospectively 694 patients with IgAN diagnosed by renal biopsy between 1982 and 2010. The risk factors for developing end-stage renal disease (ESRD) were estimated using a Cox proportional hazard model. Predictive performance between models with or without serum bilirubin was evaluated by calculating the net reclassification improvement (NRI) and integrated discrimination improvement (IDI). Seventy-seven patients developed ESRD during the median 4.9 years of follow-up. Estimated glomerular filtration rate, proteinuria and histological severity were inversely related to bilirubin levels. In multivariate analysis, serum bilirubin was an independent risk factor for ESRD (hazard ratio for every 0.1 mg/dL decrease in serum bilirubin, 1.18; 95 % CI, 1.04-1.33). The incidence rate of ESRD decreased linearly with the increases in bilirubin levels (P for trend <0.01). When bilirubin was incorporated into a model with conventional ESRD risk factors, the NRI and IDI were 0.281 (P = 0.02) and 0.019 (P = 0.01), respectively. We demonstrated that lower bilirubin levels were significantly associated with higher risk of ESRD in IgAN. In addition, bilirubin provided incremental predictive value in the risk assessment for progression of IgAN beyond that provided by standard risk factors.
Van Steenbergen, W; Fevery, J; De Vos, R; Leyten, R; Heirwegh, K P; De Groote, J
1989-02-01
The effects of thyroidectomy and of thyroid hormone administration on the hepatic transport of endogenous bilirubin were investigated in the Wistar R/APfd rat. Hypothyroidism resulted in an enhanced hepatic bilirubin UDP-glucuronosyltransferase activity and in a decreased p-nitrophenol transferase activity. It caused a cholestatic condition with a 50% decrease in bile flow and bile salt excretion, and an increased proportion of conjugated bilirubin in serum. The biliary output of unconjugated and monoconjugated bilirubins decreased in parallel by about 65%, whereas the excretion rate of the diconjugate dropped by only 47%, resulting in an increased di- to monoconjugate ratio in bile. Hyperthyroidism was characterized by a decreased bilirubin and an increased p-nitrophenol transferase activity, and by an augmented bilirubin output in bile. The output of unconjugated and monoconjugated bilirubins increased in parallel by about 50 or 100%, whereas the excretion of the diconjugate increased by only 20 to 50%, depending on the dose of thyroxine administered; this resulted in a decreased di- to monoconjugate ratio in bile. A linear positive relationship was found between bilirubin UDP-glucuronosyltransferase activity and the ratio of bilirubin di- to monoconjugates present in bile or formed by in vitro incubation of liver homogenates at low concentration of bilirubin (10 to 15 microM), indicating that bile pigment composition is mainly determined by the conjugation activity in the liver. The inverse relationship observed between hepatic beta-glucuronidase activity and the ratio of di- to monoconjugates in bile warrants further investigation to analyze whether this enzyme activity also plays a possible role in the changes in bile pigment composition in hypo- and hyperthyroid rats.
Yin, Xin-Lu; Liang, Min; Shi, Hai-Bo; Wang, Lu-Yang; Li, Chun-Yan; Yin, Shan-Kai
2016-01-05
Hyperbilirubinemia is a common clinical phenomenon observed in human newborns. A high level of bilirubin can result in severe jaundice and bilirubin encephalopathy. However, the cellular mechanisms underlying bilirubin excitotoxicity are unclear. Our previous studies showed the action of gamma-aminobutyric acid (GABA)/glycine switches from excitatory to inhibitory during development in the ventral cochlear nucleus (VCN), one of the most sensitive auditory nuclei to bilirubin toxicity. In the present study, we investigated the roles of GABAA/glycine receptors in the induction of bilirubin hyperexcitation in early developing neurons. Using the patch clamp technique, GABAA/glycine receptor-mediated spontaneous inhibitory synaptic currents (sIPSCs) were recorded from bushy and stellate cells in acute brainstem slices from young mice (postnatal day 2-6). Bilirubin significantly increased the frequency of sIPSCs, and this effect was prevented by pretreatments of slices with either fast or slow Ca(2+) chelators BAPTA-AM and EGTA-AM suggesting that bilirubin can increase the release of GABA/glycine via Ca(2+)-dependent mechanisms. Using cell-attached recording configuration, we found that antagonists of GABAA and glycine receptors strongly attenuated spontaneous spiking firings in P2-6 neurons but produced opposite effect in P15-19 neurons. Furthermore, these antagonists reversed bilirubin-evoked hyperexcitability in P2-6 neurons, indicating that excitatory action of GABA/glycinergic transmission specifically contribute to bilirubin-induced hyperexcitability in the early stage of development. Our results suggest that bilirubin-induced enhancement of presynaptic release GABA/Glycine via Ca(2+)-dependent mechanisms may play a critical role in mediating neuronal hyperexcitation associated with jaundice, implicating potential new strategies for predicting, preventing, and treating bilirubin neurotoxicity. Copyright © 2015. Published by Elsevier Ireland Ltd.
Song, Sijie; Hu, Ying; Gu, Xianfang; Si, Feifei; Hua, Ziyu
2014-01-01
Background Kernicterus still occurs around the world; however, the mechanism of bilirubin neurotoxicity remains unclear, and effective treatment strategies are lacking. To solve these problems, several kernicterus (or acute bilirubin encephalopathy) animal models have been established, but these models are difficult and expensive. Therefore, the present study was performed to establish a novel kernicterus model that is simple and affordable by injecting unconjugated bilirubin solution into the cisterna magna (CM) of ordinary newborn Sprague-Dawley (SD) rats. Methods On postnatal day 5, SD rat pups were randomly divided into bilirubin and control groups. Then, either bilirubin solution or ddH2O (pH = 8.5) was injected into the CM at 10 µg/g (bodyweight). For model characterization, neurobehavioral outcomes were observed, mortality was calculated, and bodyweight was recorded after bilirubin injection and weaning. Apoptosis in the hippocampus was detected by H&E staining, TUNEL, flow cytometry and Western blotting. When the rats were 28 days old, learning and memory ability were evaluated using the Morris water maze test. Results The bilirubin-treated rats showed apparently abnormal neurological manifestations, such as clenched fists, opisthotonos and torsion spasms. Bodyweight gain in the bilirubin-treated rats was significantly lower than that in the controls (P<0.001). The early and late mortality of the bilirubin-treated rats were both dramatically higher than those of the controls (P = 0.004 and 0.017, respectively). Apoptosis and necrosis in the hippocampal nerve cells in the bilirubin-treated rats were observed. The bilirubin-treated rats performed worse than the controls on the Morris water maze test. Conclusion By injecting bilirubin into the CM, we successfully created a new kernicterus model using ordinary SD rats; the model mimics both the acute clinical manifestations and the chronic sequelae. In particular, CM injection is easy to perform; thus, more stable models for follow-up study are available. PMID:24796550
Percutaneous biliary drainage effectively lowers serum bilirubin to permit chemotherapy treatment.
Levy, Jennifer L; Sudheendra, Deepak; Dagli, Mandeep; Mondschein, Jeffrey I; Stavropoulos, S William; Shlansky-Goldberg, Richard D; Trerotola, Scott O; Teitelbaum, Ursina; Mick, Rosemarie; Soulen, Michael C
2016-02-01
For digestive tract cancers, the bilirubin threshold for administration of systemic chemotherapy can be 5 or 2 mg/dL (85.5 or 34.2 μmol/L) depending upon the regimen. We examined the ability of percutaneous biliary drainage (PBD) in patients with malignant biliary obstruction to achieve these clinically relevant endpoints. 106 consecutive patients with malignant biliary obstruction and a baseline serum bilirubin >2 mg/dL underwent PBD. Time to achieve a bilirubin of 5 mg/dL (85.5 μmol/L), 2 mg/dL (34.2 μmol/L), and survival was estimated by Kaplan-Meier analysis. Potential technical and clinical prognostic factors were subjected to univariate and multivariate analysis. Categorical variables were analyzed by the log rank test. Hazard ratios were calculated for continuous variables. Median survival was 100 days (range 1-3771 days). Among 88 patients with a pre-drainage bilirubin >5 mg/dL, 62% achieved a serum bilirubin ≤5 mg/dL within 30 days and 84% within 60 days, median 21 days. Among 106 patients with a pre-drainage bilirubin >2 mg/dL, 37% achieved a serum bilirubin ≤2 mg/dL by 30 days and 70% within 60 days, median 43 days. None of the technical or clinical factors evaluated, including pre-drainage bilirubin, were significant predictors of time to achieve a bilirubin ≤2 mg/dL (p = 0.51). Size and type of biliary device were the only technical variables found to affect time to bilirubin of 5 mg/dL (p = 0.016). PBD of malignant obstruction achieves clinically relevant reduction in serum bilirubin in the majority of patients within 1-2 months, irrespective of the pre-drainage serum bilirubin, sufficient to allow administration of systemic chemotherapy. However, the decision to undergo this procedure for this indication alone must be considered in the context of patients' prognosis and treatment goals.
Battista, C; Woodhead, JL; Stahl, SH; Mettetal, JT; Watkins, PB; Siler, SQ; Howell, BA
2017-01-01
Elevations in serum bilirubin during drug treatment may indicate global liver dysfunction and a high risk of liver failure. However, drugs also can increase serum bilirubin in the absence of hepatic injury by inhibiting specific enzymes/transporters. We constructed a mechanistic model of bilirubin disposition based on known functional polymorphisms in bilirubin metabolism/transport. Using physiologically based pharmacokinetic (PBPK) model‐predicted drug exposure and enzyme/transporter inhibition constants determined in vitro, our model correctly predicted indinavir‐mediated hyperbilirubinemia in humans and rats. Nelfinavir was predicted not to cause hyperbilirubinemia, consistent with clinical observations. We next examined a new drug candidate that caused both elevations in serum bilirubin and biochemical evidence of liver injury in rats. Simulations suggest that bilirubin elevation primarily resulted from inhibition of transporters rather than global liver dysfunction. We conclude that mechanistic modeling of bilirubin can help elucidate underlying mechanisms of drug‐induced hyperbilirubinemia, and thereby distinguish benign from clinically important elevations in serum bilirubin. PMID:28074467
Nagai, F; Homma, H; Tanase, H; Matsui, M
1988-01-01
Gunn rats, which have defects in bilirubin and 4-nitrophenol UDP-glucuronyltransferases (GT), were crossed with LA Wistar rats with a defect in androsterone GT. The F1 hybrids showed normal GT activities towards androsterone, bilirubin and 4-nitrophenol, demonstrating that Gunn and LA ('low activity') Wistar rats inherit a homozygous dominant trait for androsterone GT and bilirubin GT respectively. The F2 progeny showed four different combinations of bilirubin and androsterone GT activities: defects in both GT activities, a single defect in bilirubin GT activity, a single defect in androsterone GT activity and two normal GT activities. They were segregated in the approximate ratio of 1:3:3:9, which is compatible with Mendel's Principle of Independent Assortment. These results provide evidence that androsterone GT and bilirubin GT are located on different chromosomes. In the F2 generation, defective bilirubin and 4-nitrophenol GT activities were not segregated, indicating that these two mutant genes are closely linked on the same chromosome. PMID:3138978
Purification and Characterization of Pyranose Oxidase from the White Rot Fungus Trametes multicolor
Leitner, Christian; Volc, Jindrich; Haltrich, Dietmar
2001-01-01
We purified an intracellular pyranose oxidase from mycelial extracts of the white rot fungus Trametes multicolor by using ammonium sulfate fractionation, hydrophobic interaction, ion-exchange chromatography, and gel filtration. The native enzyme has a molecular mass of 270 kDa as determined by equilibrium ultracentrifugation and is composed of four identical 68-kDa subunits as determined by matrix-assisted laser desorption ionization mass spectrometry. Each subunit contains one covalently bound flavin adenine dinucleotide as its prosthetic group. The enzyme oxidizes several aldopyranoses specifically at position C-2, and its preferred electron donor substrates are d-glucose, d-xylose, and l-sorbose. During this oxidation reaction electrons are transferred to oxygen, yielding hydrogen peroxide. In addition, the enzyme catalyzes the two-electron reduction of 1,4-benzoquinone, several substituted benzoquinones, and 2,6-dichloroindophenol, as well as the one-electron reduction of the ABTS [2,2′-azinobis(3-ethylbenzthiazolinesulfonic acid)] cation radical. As judged by the catalytic efficiencies (kcat/Km), some of these quinone electron acceptors are much better substrates for pyranose oxidase than oxygen. The optimum pH of the pyranose oxidase-catalyzed reaction depends strongly on the electron acceptor employed and varies from 4 to 8. It has been proposed that the main metabolic function of pyranose oxidase is as a constituent of the ligninolytic system of white rot fungi that provides peroxidases with H2O2. An additional function could be reduction of quinones, key intermediates that are formed during mineralization of lignin. PMID:11472941
Richhardt, Janine; Luchterhand, Bettina; Büchs, Jochen
2013-01-01
The obligatory aerobic acetic acid bacterium Gluconobacter oxydans oxidizes a variety of substrates in the periplasm by membrane-bound dehydrogenases, which transfer the reducing equivalents to ubiquinone. Two quinol oxidases, cytochrome bo3 and cytochrome bd, then catalyze transfer of the electrons from ubiquinol to molecular oxygen. In this study, mutants lacking either of these terminal oxidases were characterized. Deletion of the cydAB genes for cytochrome bd had no obvious influence on growth, whereas the lack of the cyoBACD genes for cytochrome bo3 severely reduced the growth rate and the cell yield. Using a respiration activity monitoring system and adjusting different levels of oxygen availability, hints of a low-oxygen affinity of cytochrome bd oxidase were obtained, which were supported by measurements of oxygen consumption in a respirometer. The H+/O ratio of the ΔcyoBACD mutant with mannitol as the substrate was 0.56 ± 0.11 and more than 50% lower than that of the reference strain (1.26 ± 0.06) and the ΔcydAB mutant (1.31 ± 0.16), indicating that cytochrome bo3 oxidase is the main component for proton extrusion via the respiratory chain. Plasmid-based overexpression of cyoBACD led to increased growth rates and growth yields, both in the wild type and the ΔcyoBACD mutant, suggesting that cytochrome bo3 might be a rate-limiting factor of the respiratory chain. PMID:23852873
Dailey, T. A.; Dailey, H. A.
1996-01-01
Protoporphyrinogen oxidase (E.C.1.3.3.4) catalyzes the oxygen-dependent oxidation of protoporphyrinogen IX to protoporphyrin IX. The enzyme from human placenta has been cloned, sequenced, expressed in Escherichia coli, purified to homogeneity, and characterized. Northern blot analysis of eight different human tissues show evidence for only a single transcript in all tissue types and the size of this transcript is approximately 1.8 kb. The human cDNA has been inserted into an expression vector for E. coli and the protein produced at high levels in these cells. The protein is found in both membrane and cytoplasmic fractions. The enzyme was purified to homogeneity in the presence of detergents using a metal chelate affinity column. The purified protein is a homodimer composed of subunits of molecular weight of 51,000. The enzyme contains one noncovalently bound FAD per dimer, has a monomer extinction coefficient of 48,000 at 270 nm and contains no detectable redox active metals. The apparent K(m) and Kcat for protoporphyrinogen IX are 1.7 microM and 10.5 min-1, respectively. The enzyme does not use coproporphyrinogen III as a substrate and is inhibited by micromolar concentrations of the herbicide acifluorfen. Protein database searches reveal significant homology between protoporphyrinogen oxidase and monoamine oxidase. PMID:8771201
Chang, Jen-Ping; Chen, Mien-Cheng; Liu, Wen-Hao; Yang, Cheng-Hsu; Chen, Chien-Jen; Chen, Yung-Lung; Pan, Kuo-Li; Tsai, Tzu-Hsien; Chang, Hsueh-Wen
2011-01-01
Oxidative stress is linked with several cardiovascular diseases. However, the NADPH oxidase activity in severe mitral regurgitation patients with and without atrial fibrillation has not yet been explored. This study involved 16 adult patients (eight patients with persistent atrial fibrillation and eight with sinus rhythm) with severe mitral and moderate-to-severe tricuspid regurgitation and five control patients without mitral and tricuspid disease. Atrial tissues of the right and left atrial appendages were obtained during surgery. Superoxide anion production was measured by lucigenin-enhanced chemiluminescence, and the expression of nox2 containing NADPH oxidase mRNA was measured by quantitative real-time RT-PCR. Additionally, immunohistochemical study was performed. NADPH-stimulated superoxide release was significantly higher than basal superoxide production from right [5671.9±3498.7 vs. 232.7±70.0 relative light units per second per milligram of protein (RLU s(-1) mg protein(-1)), P=.008) and left atrial homogenates (6475.1±1890.8 vs. 229.0±79.6 RLU s(-1) mg protein(-1), P=.008) in atrial fibrillation patients. The NADPH-stimulated superoxide release from right atrial homogenates was also significantly higher than basal superoxide production in sinus patients (6809.1±1327.1 vs. 244.2±65.5 RLU s(-1) mg protein(-1), P=.008). Additionally, there was a borderline significant correlation between NADPH-stimulated superoxide production from left atrial homogenates and left atrial sizes (r=0.683, P=.062) in atrial fibrillation patients. Membrane-bound nox2 containing NADPH oxidase mRNA expression was increased and was similar in both the atrial fibrillation patients and sinus patients. The NADPH-stimulated superoxide production in right atrial homogenates in control atrial samples was 1863.7±137.2 RLU s(-1) mg protein(-1). Immunohistochemical study demonstrated increased expression of nox2 in myocytes with moderate-to-severe myolysis and hypertrophy. Results of this study demonstrate that membrane-bound nox2 containing NADPH oxidase activity and expression in the atrial myocardium is increased in patients with severe mitral regurgitation, possibly contributing to atrial remodeling in this clinical setting. Copyright © 2011 Elsevier Inc. All rights reserved.
Serum Bilirubin and Their Association With C-Reactive Protein in Patients With Migraine.
Peng, You-Fan; Xie, Li-Qiu; Xiang, Yang; Xu, Gui-Dan
2016-11-01
Increased levels of C-reactive protein (CRP) have been considered as a marker in assessing neurogenic inflammation of migraine patients. An inverse relationship between serum bilirubin and CRP has been observed in various diseases. Therefore, we analyzed serum bilirubin levels in migraine patients, and investigated the relationship between serum bilirubin and CRP in migraineurs. A total of 86 newly diagnosed migraine patients were consecutively recruited to this study. Significantly lower median serum total bilirubin, conjugated bilirubin (CB) and unconjugated bilirubin were found in patients with migraine than healthy controls, and the levels of CRP were significantly higher in migraine patients than healthy controls. A negative correlation between CRP and CB was observed in patients with migraine (r = -0.255, P = 0.018). In a multiple linear regression model, the concentrations of CRP remained negatively correlated with CB. Our study demonstrates that serum bilirubin concentrations are decreased in migraineurs, and CB levels were found to be positively correlated with CRP in migraine patents. However, larger cross-sectional and prospective studies are needed to establish whether serum bilirubin may be a useful biomarker for assessing neurogenic inflammation in migraine patients and eventually guiding the therapy. © 2016 Wiley Periodicals, Inc.
Bilirubin and Stroke Risk Using a Mendelian Randomization Design.
Lee, Sun Ju; Jee, Yon Ho; Jung, Keum Ji; Hong, Seri; Shin, Eun Soon; Jee, Sun Ha
2017-05-01
Circulating bilirubin, a natural antioxidant, is associated with decreased risk of stroke. However, the nature of the relationship between the two remains unknown. We used a Mendelian randomization analysis to assess the causal effect of serum bilirubin on stroke risk in Koreans. The 14 single-nucleotide polymorphisms (SNPs) (<10 -7 ) including rs6742078 of uridine diphosphoglucuronyl-transferase were selected from genome-wide association study of bilirubin level in the KCPS-II (Korean Cancer Prevention Study-II) Biobank subcohort consisting of 4793 healthy Korean and 806 stroke cases. Weighted genetic risk score was calculated using 14 SNPs selected from the top SNPs. Both rs6742078 (F statistics=138) and weighted genetic risk score with 14 SNPs (F statistics=187) were strongly associated with bilirubin levels. Simultaneously, serum bilirubin level was associated with decreased risk of stroke in an ordinary least-squares analysis. However, in 2-stage least-squares Mendelian randomization analysis, no causal relationship between serum bilirubin and stroke risk was found. There is no evidence that bilirubin level is causally associated with risk of stroke in Koreans. Therefore, bilirubin level is not a risk determinant of stroke. © 2017 American Heart Association, Inc.
Metabolism of bilirubin by human cytochrome P450 2A6
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abu-Bakar, A'edah, E-mail: a.abubakar@uq.edu.au; Arthur, Dionne M.; Cooperative Research Centre for Contamination Assessment and Remediation of the Environment, Adelaide
2012-05-15
The mouse cytochrome P450 (CYP) 2A5 has recently been shown to function as hepatic “Bilirubin Oxidase” (Abu-Bakar, A., et al., 2011. Toxicol. Appl. Pharmacol. 257, 14–22). To date, no information is available on human CYP isoforms involvement in bilirubin metabolism. In this paper we provide novel evidence for human CYP2A6 metabolising the tetrapyrrole bilirubin. Incubation of bilirubin with recombinant yeast microsomes expressing the CYP2A6 showed that bilirubin inhibited CYP2A6-dependent coumarin 7-hydroxylase activity to almost 100% with an estimated K{sub i} of 2.23 μM. Metabolite screening by a high-performance liquid chromatography/electrospray ionisation mass spectrometry indicated that CYP2A6 oxidised bilirubin to biliverdinmore » and to three other smaller products with m/z values of 301, 315 and 333. Molecular docking analyses indicated that bilirubin and its positively charged intermediate interacted with key amino acid residues at the enzyme's active site. They were stabilised at the site in a conformation favouring biliverdin formation. By contrast, the end product, biliverdin was less fitting to the active site with the critical central methylene bridge distanced from the CYP2A6 haem iron facilitating its release. Furthermore, bilirubin treatment of HepG2 cells increased the CYP2A6 protein and activity levels with no effect on the corresponding mRNA. Co-treatment with cycloheximide (CHX), a protein synthesis inhibitor, resulted in increased half-life of the CYP2A6 compared to cells treated only with CHX. Collectively, the observations indicate that the CYP2A6 may function as human “Bilirubin Oxidase” where bilirubin is potentially a substrate and a regulator of the enzyme. -- Highlights: ► Human CYP2A6 interacts with bilirubin with a high affinity. ► Bilirubin docking to the CYP2A6 active site is more stable than biliverdin docking. ► Recombinant CYP2A6 microsomes metabolised bilirubin to biliverdin. ► Bilirubin increased the hepatic CYP2A6 protein and activity levels but not mRNA. ► Co-treatment with a protein synthesis inhibitor prolongs CYP2A6 half-life.« less
Zhang, Chengmi; Wang, Zhenmeng; Dong, Jing; Pan, Ruirui; Qiu, Haibo; Zhang, Jinmin; Zhang, Peng; Zheng, Jijian; Yu, Weifeng
2014-01-01
Autonomic dysfunction as a partial contributing factor to cardiovascular instability in jaundiced patients is often associated with increased serum bilirubin levels. Whether increased serum bilirubin levels could directly inhibit sympathetic ganglion transmission by blocking neuronal nicotinic acetylcholine receptors (nAChRs) remains to be elucidated. Conventional patch-clamp recordings were used to study the effect of bilirubin on nAChRs currents from enzymatically dissociated rat superior cervical ganglia (SCG) neurons. The results showed that low concnetrations (0.5 and 2 μM) of bilirubin enhanced the peak ACh-evoked currents, while high concentrations (3 to 5.5 µM) of bilirubin suppressed the currents with an IC50 of 4 ± 0.5 μM. In addition, bilirubin decreased the extent of desensitization of nAChRs in a concentration-dependent manner. This inhibitory effect of bilirubin on nAChRs channel currents was non-competitive and voltage independent. Bilirubin partly improved the inhibitory effect of forskolin on ACh-induced currents without affecting the action of H-89. These data suggest that the dual effects of enhancement and suppression of bilirubin on nAChR function may be ascribed to the action mechanism of positive allosteric modulation and direct blockade. Thus, suppression of sympathetic ganglionic transmission through postganglionic nAChRs inhibition may partially contribute to the adverse cardiovascular effects in jaundiced patients. PMID:25503810
Wang, Wenwen; Zhang, Hao; Zhang, Zhifeng; Luo, Mengying; Wang, Yuedan; Liu, Qiongzhen; Chen, Yuanli; Li, Mufang; Wang, Dong
2017-02-01
In this study, poly(vinyl alcohol-co-ethylene) (PVA-co-PE) nanofibrous membrane was activated by sodium hydroxide and cyanuric chloride, and then the activated membranes were functionalized by 1,3-propanediamine, hexamethylenediamine and diethylenetriamine to be affinity membranes for bilirubin removal, respectively. The chemical structures and morphologies of membranes were investigated by SEM, FTIR and XPS. And the adsorption ability of different amine-functionalized nanofibrous membranes for bilirubin was characterized. Furthermore, the effects of temperature, initial concentration of bilirubin, NaCl concentration and BSA concentration on the adsorption capacity for bilirubin of diethylenetriamine-functionalized nanofibrous membrane were studied. Results indicated that the adsorption capacity for bilirubin of diethylenetriamine-functionalized nanofibrous membrane could reach 85mg/g membrane when the initial bilirubin concentration was 200mg/L while the adsorption capacity could be increased to 110mg/g membrane if the initial bilirubin concentration was more than 400mg/L. The dynamic adsorption of diethylenetriamine-functionalized nanofibrous membrane showed that the ligands of amine groups on the membrane surface could be used as far as possible by recirculating the plasma with certain flow rates. Therefore, the diethylenetriamine-functionalized PVA-co-PE nanofibrous membrane possessed high adsorption capacity for bilirubin and it can be candidate as affinity membrane for bilirubin removal. Copyright © 2016. Published by Elsevier B.V.
Serum bilirubin and the risk of rheumatoid arthritis.
Juping, Du; Yuan, Yuan; Shiyong, Chen; Jun, Li; Xiuxiu, Zhou; Haijian, Ying; Jianfeng, Shi; Bo, Shen
2017-11-01
Oxidative stress and immune imbalance play an important role in the pathogenesis of rheumatoid arthritis (RA). Bilirubin is a powerful antioxidant and also regarded as immunomodulator. Increased evidence shows that bilirubin should be a protective factor for autoimmune disease. However, the relationship between bilirubin and RA remain unclear. We analyzed serum bilirubin levels and other laboratory and clinical data in 130 RA patients (35 patients without any complications), 81 osteoarthritis (OA) patients and 96 healthy controls. Binary logistic regression adjusted by age and gender revealed that the levels of serum total, indirect bilirubin were significantly lower in RA patients, when compared with healthy controls (P=.015, OR=0.767, 95% CI=0.619-0.951; P=.010, OR=0.664, 95% CI=0.487-0.906, respectively) or OA patients (P=.000, OR=0.763, 95% CI=0.661-0.882; P=.000, OR=0.656, 95% CI=0.532-0.808, respectively). A reduced trend of levels of bilirubin has been detected along with increased disease activity, despite with no significance (P>.05). Spearman rank test further demonstrated that IgG and ESR were negative associated with total, indirect bilirubin, and albumin, prealbumin, APOA, HDL-C were positively associated with bilirubin. In conclusion, the levels of serum bilirubins were decreased in RA, and decreased levels could be associated with IgG, albumin and inflammatory marker ESR. © 2017 Wiley Periodicals, Inc.
Changes in erythrocytic deformability and plasma viscosity in neonatal ictericia.
Bonillo-Perales, A; Muñoz-Hoyos, A; Martínez-Morales, A; Molina-Carballo, A; Uberos-Fernández, J; Puertas-Prieto, A
1999-01-01
We studied 45 full-term newborns divided into 3 groups. Group 1: 17 newborns with bilirubin <10 mg/dL; Group 2: 18 newborns with hemolytic ictericia (bilirubin 11-20 mg/dL) and Group 3: 10 newborns with moderate hemolytic ictericia needing exchange transfusion. The following were studied: erythrocytic deformability, plasma viscosity, plasmatic osmolarity, seric bilirubin, bilirubin/albumin ratio, free fatty acids and corpuscular volume of the erythrocytes. In full-term newborns, the following are risk factors for increased erythrocytic rigidity: neonatal hemolytic illness (p = 0.004, odds ratio: 7.02), increases in total bilirubin (p = 0.02, odds ratio: 4.3) and increases in the bilirubin/albumin ratio (p = 0.025, odds ratio: 4.25). Furthermore, the most important risk factor for high plasma viscosity is also neonatal hemolytic illness (p = 0.01, odds ratio: 2.30). The role of total bilirubin is also important (p = 0.09, odds ratio: 2.10), while that of the bilirubin/albumin ratio (p = 0.012, NS) is less so. The greater the hemolysis, the greater the erythrocytic rigidity and plasma viscosity (p < 0.01). In full-term newborns with moderate ictericia, hemolytic illness and increases in the bilirubin/albumin ratio are accompanied by rheological alterations that could affect cerebral microcirculation and cause a neurological deficit not exclusively related to the levels of bilirubin in plasma.
Liu, Bin; Zhang, Yang; Sage, J. Timothy; Soltis, S. Michael; Doukov, Tzanko; Chen, Ying; Stout, C. David; Fee, James A.
2012-01-01
The purpose of the work was to provide a crystallographic demonstration of the venerable idea that CO photolyzed from ferrous heme-a3 moves to the nearby cuprous ion in the cytochrome c oxidases. Crystal structures of CO-bound cytochrome ba3-oxidase from Thermus thermophilus, determined at ~ 2.8 – 3.2 Å resolution, reveal a Fe-C distance of ~2.0 Å, a Cu-O distance of 2.4 Å and a Fe-C-O angle of ~126°. Upon photodissociation at 100 K, X-ray structures indicate loss of Fea3-CO and appearance of CuB-CO having a Cu-C distance of ~1.9 Å and an O-Fe distance of ~2.3 Å. Absolute FTIR spectra recorded from single crystals of reduced ba3–CO that had not been exposed to X-ray radiation, showed several peaks around 1975 cm−1; after photolysis at 100 K, the absolute FTIR spectra also showed a significant peak at 2050 cm−1. Analysis of the “light’ minus ‘dark’ difference spectra showed four very sharp CO stretching bands at 1970 cm−1, 1977 cm−1, 1981 cm−1, and 1985 cm−1, previously assigned to the Fea3-CO complex, and a significantly broader CO stretching band centered at ~2050 cm−1, previously assigned to the CO stretching frequency of CuB bound CO. As expected for light propagating along the tetragonal axis of the P43212 space group, the single crystal spectra exhibit negligible dichroism. Absolute FTIR spectrometry of a CO-laden ba3 crystal, exposed to an amount of X-ray radiation required to obtain structural data sets before FTIR characterization, showed a significant signal due to photogenerated CO2 at 2337 cm−1 and one from traces of CO at 2133 cm−1; while bands associated with CO bound to either Fea3 or to CuB in “light” minus “dark” FTIR difference spectra shifted and broadened in response to X-ray exposure. In spite of considerable radiation damage to the crystals, both X-ray analysis at 2.8 and 3.2 Å and FTIR spectra support the long-held position that photolysis of Fea3-CO in cytochrome c oxidases leads to significant trapping of the CO on the CuB atom; Fea3 and CuB ligation, at the resolutions reported here, are otherwise unaltered. PMID:22226917
Shao, Beili; Bayraktutan, Ulvi
2014-01-01
Blood–brain barrier disruption represents a key feature in hyperglycaemia-aggravated cerebral damage after an ischaemic stroke. Although the underlying mechanisms remain largely unknown, activation of protein kinase C (PKC) is thought to play a critical role. This study examined whether apoptosis of human brain microvascular endothelial cells (HBMEC) might contribute to hyperglycaemia-evoked barrier damage and assessed the specific role of PKC in this phenomenon. Treatments with hyperglycaemia (25 mM) or phorbol myristate acetate (PMA, a protein kinase C activator, 100 nM) significantly increased NADPH oxidase activity, O2•- generation, proapoptotic protein Bax expression, TUNEL-positive staining and caspase-3/7 activities. Pharmacological inhibition of NADPH oxidase, PKC-a, PKC-ß or PKC-ßI via their specific inhibitors and neutralisation of O2•- by a cell-permeable superoxide dismutase mimetic, MnTBAP normalised all the aforementioned increases induced by hyperglycaemia. Suppression of these PKC isoforms also negated the stimulatory effects of hyperglycaemia on the protein expression of NADPH oxidase membrane-bound components, Nox2 and p22-phox which determine the overall enzymatic activity. Silencing of PKC-ßI gene through use of specific siRNAs abolished the effects of both hyperglycaemia and PMA on endothelial cell NADPH oxidase activity, O2•- production and apoptosis and consequently improved the integrity and function of an in vitro model of human cerebral barrier comprising HBMEC, astrocytes and pericytes. Hyperglycaemia-mediated apoptosis of HBMEC contributes to cerebral barrier dysfunction and is modulated by sequential activations of PKC-ßI and NADPH oxidase. PMID:24936444
Park, Sehoon; Kim, Do Hyoung; Hwang, Jin Ho; Kim, Yong-Chul; Kim, Jin Hyuk; Lim, Chun Soo; Kim, Yon Su; Yang, Seung Hee; Lee, Jung Pyo
2017-01-01
Bilirubin has been reported to protect against kidney injury. However, further studies highlighting the beneficial effects of bilirubin on renal fibrosis and chronic renal function decline are necessary. We assessed a prospective cohort with a reference range of total bilirubin levels. The primary outcome was a 30% reduction in the estimated glomerular filtration rate (eGFR) from baseline, and the secondary outcome was a doubling of the serum creatinine levels, halving of the eGFR and the initiation of dialysis. In addition, experiments with tubular epithelial cells and C57BL/6 mice were performed to investigate the protective effects of bilirubin on kidney fibrosis. As a result, 1,080 patients were included in the study cohort. The study group with relative hyperbilirubinemia (total bilirubin 0.8-1.2 mg/dL) showed a better prognosis in terms of the primary outcome (adjusted hazard ratio (HR) 0.33, 95% confidence interval (CI) 0.19-0.59, P < 0.001) and the secondary outcome (adjusted HR 0.20, 95% CI 0.05 to 0.71, P = 0.01) than that of the control group. Moreover, the bilirubin-treated mice showed less fibrosis in the unilateral ureteral obstruction (UUO) model (P < 0.05). In addition, bilirubin treatment decreased fibronectin expression in tubular epithelial cells in a dose-dependent manner (P < 0.05). Mildly elevated serum bilirubin levels were associated with better renal prognosis, and bilirubin treatment induced a beneficial effect on renal fibrosis. Therefore, bilirubin could be a potential therapeutic target to delay fibrosis-related kidney disease progression.
Hwang, Jin Ho; Kim, Yong-Chul; Kim, Jin Hyuk; Lim, Chun Soo; Kim, Yon Su; Yang, Seung Hee; Lee, Jung Pyo
2017-01-01
Background Bilirubin has been reported to protect against kidney injury. However, further studies highlighting the beneficial effects of bilirubin on renal fibrosis and chronic renal function decline are necessary. Methods We assessed a prospective cohort with a reference range of total bilirubin levels. The primary outcome was a 30% reduction in the estimated glomerular filtration rate (eGFR) from baseline, and the secondary outcome was a doubling of the serum creatinine levels, halving of the eGFR and the initiation of dialysis. In addition, experiments with tubular epithelial cells and C57BL/6 mice were performed to investigate the protective effects of bilirubin on kidney fibrosis. Results As a result, 1,080 patients were included in the study cohort. The study group with relative hyperbilirubinemia (total bilirubin 0.8–1.2 mg/dL) showed a better prognosis in terms of the primary outcome (adjusted hazard ratio (HR) 0.33, 95% confidence interval (CI) 0.19–0.59, P < 0.001) and the secondary outcome (adjusted HR 0.20, 95% CI 0.05 to 0.71, P = 0.01) than that of the control group. Moreover, the bilirubin-treated mice showed less fibrosis in the unilateral ureteral obstruction (UUO) model (P < 0.05). In addition, bilirubin treatment decreased fibronectin expression in tubular epithelial cells in a dose-dependent manner (P < 0.05). Conclusions Mildly elevated serum bilirubin levels were associated with better renal prognosis, and bilirubin treatment induced a beneficial effect on renal fibrosis. Therefore, bilirubin could be a potential therapeutic target to delay fibrosis-related kidney disease progression. PMID:28225832
Distant Determination of Bilirubin Distribution in Skin by Multi-Spectral Imaging
NASA Astrophysics Data System (ADS)
Saknite, I.; Jakovels, D.; Spigulis, J.
2011-01-01
For mapping the bilirubin distribution in bruised skin the multi-spectral imaging technique was employed, which made it possible to observe temporal changes of the bilirubin content in skin photo-types II and III. The obtained results confirm the clinical potential of this technique for skin bilirubin diagnostics.
Brittenham, Gary M.; Billote, Genia B.; Francis, Richard O.; Ginzburg, Yelena Z.; Hendrickson, Jeanne E.; Jhang, Jeffrey; Schwartz, Joseph; Sharma, Shruti; Sheth, Sujit; Sireci, Anthony N.; Stephens, Hannah L.; Stotler, Brie A.; Wojczyk, Boguslaw S.; Zimring, James C.; Spitalnik, Steven L.
2011-01-01
Transfusions of RBCs stored for longer durations are associated with adverse effects in hospitalized patients. We prospectively studied 14 healthy human volunteers who donated standard leuko-reduced, double RBC units. One unit was autologously transfused “fresh” (3-7 days of storage), and the other “older” unit was transfused after 40 to 42 days of storage. Of the routine laboratory parameters measured at defined times surrounding transfusion, significant differences between fresh and older transfusions were only observed in iron parameters and markers of extravascular hemolysis. Compared with fresh RBCs, mean serum total bilirubin increased by 0.55 mg/dL at 4 hours after transfusion of older RBCs (P = .0003), without significant changes in haptoglobin or lactate dehydrogenase. In addition, only after the older transfusion, transferrin saturation increased progressively over 4 hours to a mean of 64%, and non–transferrin-bound iron appeared, reaching a mean of 3.2μM. The increased concentrations of non–transferrin-bound iron correlated with enhanced proliferation in vitro of a pathogenic strain of Escherichia coli (r = 0.94, P = .002). Therefore, circulating non–transferrin-bound iron derived from rapid clearance of transfused, older stored RBCs may enhance transfusion-related complications, such as infection. The trial was registered with www.clinicaltrials.gov as #NCT01319552. PMID:22021369
Preliminary development of a fiber optic sensor for measuring bilirubin.
Babin, Steven M; Sova, Raymond M
2014-01-01
Preliminary development of a fiber optic bilirubin sensor is described, where an unclad sensing portion is used to provide evanescent wave interaction of the transmitted light with the chemical environment. By using a wavelength corresponding to a bilirubin absorption peak, the Beer-Lambert Law can be used to relate the concentration of bilirubin surrounding the sensing portion to the amount of absorbed light. Initial testing in vitro suggests that the sensor response is consistent with the results of bulk absorption measurements as well as the Beer-Lambert Law. In addition, it is found that conjugated and unconjugated bilirubin have different peak absorption wavelengths, so that two optical frequencies may potentially be used to measure both types of bilirubin. Future development of this device could provide a means of real-time, point-of-care monitoring of intravenous bilirubin in critical care neonates with hyperbilirubinemia.
Preliminary Development of a Fiber Optic Sensor for Measuring Bilirubin
Babin, Steven M; Sova, Raymond M
2014-01-01
Preliminary development of a fiber optic bilirubin sensor is described, where an unclad sensing portion is used to provide evanescent wave interaction of the transmitted light with the chemical environment. By using a wavelength corresponding to a bilirubin absorption peak, the Beer–Lambert Law can be used to relate the concentration of bilirubin surrounding the sensing portion to the amount of absorbed light. Initial testing in vitro suggests that the sensor response is consistent with the results of bulk absorption measurements as well as the Beer–Lambert Law. In addition, it is found that conjugated and unconjugated bilirubin have different peak absorption wavelengths, so that two optical frequencies may potentially be used to measure both types of bilirubin. Future development of this device could provide a means of real-time, point-of-care monitoring of intravenous bilirubin in critical care neonates with hyperbilirubinemia. PMID:25057239
NEW INSIGHTS INTO THE PRESENCE OF BILIRUBIN IN A PLANT SPECIES STRELITZIA NICOLAI (STRELITZIACEAE)
Dwarka, Depika; Thaver, Veneesha; Naidu, Mickey; Baijnath, Himansu
2017-01-01
Background: The fortuitous discovery of an animal pigment bilirubin found in the plant Strelitzia nicolai has opened an enormous number of questions regarding bilirubin’s formation and its ultimate function in the human body. Materials and Methods: A methodical review of bilirubin in humans and animals was carried out, information was gathered using published scientific journals, books and conference proceedings. Articles based on case studies of elevated levels of bilirubin were analysed thoroughly. Results: Even though for numerous years bilirubin was assumed to be merely a desecrate product of the heme catabolic pathway by greatest, and a likely lethal compound at worst; statistics from the last few decades clearly shows that placidly high serum bilirubin levels are robustly related to have abundant beneficial effects on the human body. Conclusion: This study reveals new insights into the presence of the only animal pigment found in Strelitzia nicolai arils, the potential advantages of bilirubin found in a plant and its therapeutic value indications. This review hopes to resuscitate researchers’ credence regarding bilirubin as a toxic compound. PMID:28573242
van Toorn, Ronald; Brink, Philip; Smith, Johan; Ackermann, Christelle; Solomons, Regan
2016-12-01
The clinical expression of bilirubin-induced neurological dysfunction varies according to severity and location of the disease. Definitions have been proposed to describe different bilirubin-induced neurological dysfunction subtypes. Our objective was to describe the severity and clinico-radiological-neurophysiological correlation in 30 consecutive children with bilirubin-induced neurological dysfunction seen over a period of 5 years. Thirty children exposed to acute neonatal bilirubin encephalopathy were included in the study. The mean peak total serum bilirubin level was 625 μmol/L (range 480-900 μmol/L). Acoustic brainstem responses were abnormal in 73% (n = 22). Pallidal hyperintensity was observed on magnetic resonance imaging in 20 children. Peak total serum bilirubin levels correlated with motor severity (P = .03). Children with severe motor impairment were likely to manifest severe auditory neuropathy (P < .01). We found that in a resource-constrained setting, classical kernicterus was the most common bilirubin-induced neurological dysfunction subtype, and the majority of children had abnormal acoustic brainstem responses and magnetic resonance imaging. © The Author(s) 2016.
Bilirubin metabolism in the fetus
Bernstein, Ralph B.; Novy, Miles J.; Piasecki, George J.; Lester, Roger; Jackson, Benjamin T.
1969-01-01
Bilirubin metabolism was studied in dog and monkey fetuses. Bilirubin-3H was administered to fetal animals in utero by prolonged intravenous infusion. Fetal plasma disappearance, hepatic uptake, biliary excretion, and placental transfer of bilirubin-3H were measured. Bilirubin metabolism and excretion in the fetus was much less efficient than in the adult. Fetal plasma levels of tritium were elevated for prolonged periods, and the combined rate of placental and fetal hepatic excretion was lower than normal values for adult hepatic excretion. Species differences were noted. Hepatic conjugation and excretion appeared to be the primary mechanism of fetal metabolism in the dog. In contrast, the amounts of conjugated bilirubin-3H excreted in fetal monkey bile were negligible. Small amounts of 3H-labeled bilirubin derivatives were excreted in fetal bile, but 10 times as much of the administered material was transferred intact across the placenta and excreted by the maternal liver. The relationship of this functional difference to known anatomic and biochemical species differences is discussed. Preliminary observations on alternate routes of fetal bilirubin metabolism were obtained. Images PMID:4980771
Functionalized SBA-15 materials for bilirubin adsorption
NASA Astrophysics Data System (ADS)
Tang, Tao; Zhao, Yanling; Xu, Yao; Wu, Dong; Xu, Jun; Deng, Feng
2011-05-01
To investigate the driving force for bilirubin adsorption on mesoporous materials, a comparative study was carried out between pure siliceous SBA-15 and three functionalized SBA-15 mesoporous materials: CH 3-SBA-15 (MS), NH 2-SBA-15 (AS), and CH 3/NH 2-SBA-15 (AMS) that were synthesized by one-pot method. The obtained materials exhibited large surface areas (553-810 m 2/g) and pore size (6.6-7.1 nm) demonstrated by XRD and N 2-ad/desorption analysis. The SEM images showed that the materials had similar fiberlike morphology. The functionalization extent was calculated according to 29Si MAS NMR spectra and it was close to the designed value (10%). The synthesized mesoporous materials were used as bilirubin adsorbents and showed higher bilirubin adsorption capacities than the commercial active carbon. The adsorption capacities of amine functionalized samples AMS and AS were larger than those of pure siliceous SBA-15 and MS, indicating that electrostatic interaction was the dominant driving force for bilirubin adsorption on mesoporous materials. Increasing the ionic strength of bilirubin solution by adding NaCl would decrease the bilirubin adsorption capacity of mesoporous material, which further demonstrated that the electrostatic interaction was the dominant driving force for bilirubin adsorption. In addition, the hydrophobic interaction provided by methyl groups could promote the bilirubin adsorption.
Reduced total serum bilirubin levels are associated with ulcerative colitis.
Schieffer, Kathleen M; Bruffy, Shannon M; Rauscher, Richard; Koltun, Walter A; Yochum, Gregory S; Gallagher, Carla J
2017-01-01
Chronic inflammation associated with inflammatory bowel disease (IBD) results in increased oxidative stress that damages the colonic microenvironment. Low levels of serum bilirubin, an endogenous antioxidant, have been associated with increased risk for Crohn's disease (CD). Therefore, the aim of this study was to examine whether total serum bilirubin levels are associated with ulcerative colitis (UC). We identified a retrospective case-control population (n = 6,649) from a single tertiary care center, Penn State Hershey Medical Center (PSU) and a validation cohort (n = 1,996) from Virginia Commonwealth University Medical Center (VCU). Cases were age- and sex-matched to controls (PSU: CD n = 254, UC n = 187; VCU: CD n = 233, UC n = 124). Total serum bilirubin levels were obtained from de-identified medical records and segregated into quartiles. Logistic regression analysis was performed on each quartile of total serum bilirubin compared to the last quartile (highest bilirubin levels) to determine the association of total serum bilirubin with UC. Similar to CD patients, UC patients demonstrated reduced levels of total serum bilirubin compared to controls at PSU and VCU. The lowest quartile of total serum bilirubin was independently associated with UC for the PSU (OR: 1.98 [95% CI: 1.09-3.63]) and VCU cohorts (OR: 6.07 [95% CI: 3.01-12.75]). Lower levels of the antioxidant bilirubin may reduce the capability of UC patients to remove reactive oxygen species leading to an increase in intestinal injury. Therapeutics that reduce oxidative stress may be beneficial for these patients.
Wang, Xiuyan; Zheng, Liyu; Wu, Jinming; Tang, Binbin; Zhang, Mengqin; Zhu, Debin; Lin, Xianfan
2017-06-01
Increased plasma levels of bilirubin have been reported in rat models and patients with alcoholic liver disease (ALD). The constitutive androstane receptor (CAR) is a known xenobiotic receptor, which induces the detoxification and transport of bilirubin. In the present study, the bilirubin transport regulatory mechanisms, and the role of CAR activation in hepatic and extrahepatic bilirubin clearance were investigated in a murine model of ALD. The mice were fed a Lieber-DeCarli ethanol diet or an isocaloric control diet for 4 weeks, followed by the administration of CAR agonists, 1,4-bis-[2‑(3,5-dichlorpyridyloxy)]benzene (TCPOBOP) and phenobarbital (PB), and their vehicles to examine the effect of the pharmacological activation of CAR on serum levels of bilirubin and on the bilirubin clearance pathway in ALD by serological survey, western blotting and reverse transcription‑quantitative polymerase chain reaction. The results showed that chronic ethanol ingestion impaired the nuclear translocation of CAR, which was accompanied by elevated serum levels of bilirubin, suppression of the expression of hepatic and renal organic anion transporting polypeptide (OATP) 1A1 and hepatic multidrug resistance‑associated protein 2 (MRP2), and induction of the expression of UDP-glucuronosyltransferase (UGT) 1A1. The activation of CAR by TCPOBOP and PB resulted in downregulation of the serum levels of bilirubin followed by selective upregulation of the expression levels of OATP1A1, OATP1A4, UGT1A1 and MRP2 in ALD. These results revealed the bilirubin transport regulatory mechanisms and highlighted the importance of CAR in modulating the bilirubin clearance pathway in the ALD mouse model.
Bilirubin treatment suppresses pulmonary inflammation in a rat model of smoke-induced emphysema.
Wei, Jingjing; Zhao, Hui; Fan, Guoquan; Li, Jianqiang
2015-09-18
Cigarette smoking is a significant risk factor for emphysema, which is characterized by airway inflammation and oxidative damage. To assess the capacity of bilirubin to protect against smoke-induced emphysema. Smoking status and bilirubin levels were recorded in 58 patients with chronic obstructive pulmonary diseases (COPD) and 71 non-COPD participants. The impact of smoking on serum bilirubin levels and exogenous bilirubin (20 mg/kg/day) on pulmonary injury was assessed in a rat model of smoking-induced emphysema. At sacrifice lung histology, airway leukocyte accumulation and cytokine and chemokine levels in serum, bronchoalveolar lavage fluid (BALF) and lung were analyzed. Oxidative lipid damage and anti-oxidative components was assessed by measuring malondialdehyde, superoxide dismutase (SOD) activity and glutathione. Total serum bilirubin levels were lower in smokers with or without COPD than non-smoking patients without COPD (P < 0.05). Indirect serum bilirubin levels were lower in COPD patients than patients without COPD (P < 0.05). In rats, cigarette smoke reduced serum total and indirect bilirubin levels. Administration of bilirubin reduced mean linear intercept and mean alveoli area, increased mean alveoli number, reduced macrophage, neutrophil and TNF-α content of BALF, and increased BALF and serum IL-10 level, but lowered local and systemic CCL2, CXCL2, CXCL8 and IL-17 levels. Bilirubin suppressed the smoke-induced systemic and regional oxidative lipid damage associated with increased SOD activity. Bilirubin attenuated smoking-induced pulmonary injury by suppressing inflammatory cell recruitment and pro-inflammatory cytokine secretion, increasing anti-inflammatory cytokine levels, and anti-oxidant SOD activity in a rat model of smoke-induced emphysema. Copyright © 2015. Published by Elsevier Inc.
Li, Xu; Zhang, Lei; Chen, Haibing; Guo, Kaifeng; Yu, Haoyong; Zhou, Jian; Li, Ming; Li, Qing; Li, Lianxi; Yin, Jun; Liu, Fang; Bao, Yuqian; Han, Junfeng; Jia, Weiping
2017-03-31
Recent studies highlight a negative association between total bilirubin concentrations and albuminuria in patients with type 2 diabetes mellitus. Our study evaluated the relationship between bilirubin concentrations and the prevalence of diabetic nephropathy (DN) in Chinese patients with type 1 diabetes mellitus (T1DM). A total of 258 patients with T1DM were recruited and bilirubin concentrations were compared between patients with or without diabetic nephropathy. Multiple stepwise regression analysis was used to examine the relationship between bilirubin concentrations and 24 h urinary microalbumin. Binary logistic regression analysis was performed to assess independent risk factors for diabetic nephropathy. Participants were divided into four groups according to the quartile of total bilirubin concentrations (Q1, 0.20-0.60; Q2, 0.60-0.80; Q3, 0.80-1.00; Q4, 1.00-1.90 mg/dL) and the chi-square test was used to compare the prevalence of DN in patients with T1DM. The median bilirubin level was 0.56 (interquartile: 0.43-0.68 mg/dL) in the DN group, significantly lower than in the non-DN group (0.70 [interquartile: 0.58-0.89 mg/dL], P < 0.001). Spearman's correlational analysis showed bilirubin concentrations were inversely correlated with 24 h urinary microalbumin (r = -0.13, P < 0.05) and multiple stepwise regression analysis showed bilirubin concentrations were independently associated with 24 h urinary microalbumin. In logistic regression analysis, bilirubin concentrations were significantly inversely associated with nephropathy. In addition, in stratified analysis, from the first to the fourth quartile group, increased bilirubin concentrations were associated with decreased prevalence of DN from 21.90% to 2.00%. High bilirubin concentrations are independently and negatively associated with albuminuria and the prevalence of DN in patients with T1DM.
Absorption of Bile Pigments by the Gall Bladder*
Ostrow, J. Donald
1967-01-01
A technique is described for preparation in the guinea pig of an in situ, isolated, vascularized gall bladder that exhibits normal absorptive functions. Absorption of labeled bile pigments from the gall bladder was determined by the subsequent excretion of radioactivity in hepatic bile. Over a wide range of concentrations, unconjugated bilirubin-14C was well absorbed, whereas transfer of conjugated bilirubin proceeded slowly. Mesobilirubinogen-3H was absorbed poorly from whole bile, but was absorbed as rapidly as unconjugated bilirubin from a solution of pure conjugated bile salt. Bilirubin absorption was not impaired by iodoacetamide, 1.5 mM, or dinitrophenol, 1.0 mM, even though water transport was affected. This indicated that absorption of bilirubin was not dependent upon water transport, nor upon energy-dependent processes. The linear relationship between absorption and concentration of pigment at low concentrations in bile salt solutions suggested that pigment was transferred by passive diffusion. At higher pigment concentrations or in whole bile, this simple relationship was modified by interactions of pigment with bile salts and other constituents of bile. These interactions did not necessarily involve binding of bilirubin in micelles. The slow absorption of the more polar conjugates and photo-oxidative derivatives of bilirubin suggested that bilirubin was absorbed principally by nonionic, and partially, by ionic diffusion. Concentrations of pure conjugated bile salts above 3.5 mM were found to be injurious to the gall bladder mucosa. This mucosal injury did not affect the kinetics of bilirubin absorption. During in vitro incubation of bile at 37°C, decay of bilirubin and hydrolysis of the conjugate proceeded as first-order reactions. The effects of these processes on the kinetics of bilirubin absorption, and their possible role in the formation of “white bile” and in the demonstrated appearance of unconjugated bilirubin in hepatic bile, are discussed. PMID:6074006
African Swine Fever Virus pB119L Protein Is a Flavin Adenine Dinucleotide-Linked Sulfhydryl Oxidase
Rodríguez, Irene; Redrejo-Rodríguez, Modesto; Rodríguez, Javier M.; Alejo, Alí; Salas, José; Salas, María L.
2006-01-01
Protein pB119L of African swine fever virus belongs to the Erv1p/Alrp family of sulfhydryl oxidases and has been described as a late nonstructural protein required for correct virus assembly. To further our knowledge of the function of protein pB119L during the virus life cycle, we have investigated whether this protein possesses sulfhydryl oxidase activity, using a purified recombinant protein. We show that the purified protein contains bound flavin adenine dinucleotide and is capable of catalyzing the formation of disulfide bonds both in a protein substrate and in the small molecule dithiothreitol, the catalytic activity being comparable to that of the Erv1p protein. Furthermore, protein pB119L contains the cysteines of its active-site motif CXXC, predominantly in an oxidized state, and forms noncovalently bound dimers in infected cells. We also show in coimmunoprecipitation experiments that protein pB119L interacts with the viral protein pA151R, which contains a CXXC motif similar to that present in thioredoxins. Protein pA151R, in turn, was found to interact with the viral structural protein pE248R, which contains disulfide bridges and belongs to a class of myristoylated proteins related to vaccinia virus L1R, one of the substrates of the redox pathway encoded by this virus. These results suggest the existence in African swine fever virus of a system for the formation of disulfide bonds constituted at least by proteins pB119L and pA151R and identify protein pE248R as a possible final substrate of this pathway. PMID:16537584
African swine fever virus pB119L protein is a flavin adenine dinucleotide-linked sulfhydryl oxidase.
Rodríguez, Irene; Redrejo-Rodríguez, Modesto; Rodríguez, Javier M; Alejo, Alí; Salas, José; Salas, María L
2006-04-01
Protein pB119L of African swine fever virus belongs to the Erv1p/Alrp family of sulfhydryl oxidases and has been described as a late nonstructural protein required for correct virus assembly. To further our knowledge of the function of protein pB119L during the virus life cycle, we have investigated whether this protein possesses sulfhydryl oxidase activity, using a purified recombinant protein. We show that the purified protein contains bound flavin adenine dinucleotide and is capable of catalyzing the formation of disulfide bonds both in a protein substrate and in the small molecule dithiothreitol, the catalytic activity being comparable to that of the Erv1p protein. Furthermore, protein pB119L contains the cysteines of its active-site motif CXXC, predominantly in an oxidized state, and forms noncovalently bound dimers in infected cells. We also show in coimmunoprecipitation experiments that protein pB119L interacts with the viral protein pA151R, which contains a CXXC motif similar to that present in thioredoxins. Protein pA151R, in turn, was found to interact with the viral structural protein pE248R, which contains disulfide bridges and belongs to a class of myristoylated proteins related to vaccinia virus L1R, one of the substrates of the redox pathway encoded by this virus. These results suggest the existence in African swine fever virus of a system for the formation of disulfide bonds constituted at least by proteins pB119L and pA151R and identify protein pE248R as a possible final substrate of this pathway.
Snyder, Rae Ana; Butch, Susan E.; Reig, Amanda J.; ...
2015-06-19
Using the single-chain due ferri (DFsc) peptide scaffold, the differential oxidase and oxygenase reactivities of two 4A → 4G variants, one with two histidines at the diiron center (G4DFsc) and the other with three histidines (3His-G4DFsc(Mut3)), are explored. By controlling the reaction conditions, the active form responsible for 4-aminophenol (4-AP) oxidase activity in both G4DFsc and 3His-G4DFsc(Mut3) is determined to be the substrate-bound biferrous site. Using circular dichroism (CD), magnetic CD (MCD), and variable-temperature, variable-field (VTVH) MCD spectroscopies, 4-AP is found to bind directly to the biferrous sites of the DF proteins. In G4DFsc, 4-AP increases the coordination of themore » biferrous site, while in 3His-G4DFsc(Mut3), the coordination number remains the same and the substrate likely replaces the additional bound histidine. This substrate binding enables a two-electron process where 4-AP is oxidized to benzoquinone imine and O 2 is reduced to H 2O 2. In contrast, only the biferrous 3His variant is found to be active in the oxygenation of p-anisidine to 4-nitroso-methoxybenzene. From CD, MCD, and VTVH MCD, p-anisidine addition is found to minimally perturb the biferrous centers of both G4DFsc and 3His-G4DFsc(Mut3), indicating that this substrate binds near the biferrous site. Lastly, in 3His-G4DFsc(Mut3), the coordinative saturation of one iron leads to the two-electron reduction of O 2 at the second iron to generate an end-on hydroperoxo-Fe(III) active oxygenating species.« less
p67phox terminates the phospholipase A2-derived signal for activation of NADPH oxidase (NOX2)
Krishnaiah, Saikumari Y.; Dodia, Chandra; Feinstein, Sheldon I.; Fisher, Aron B.
2013-01-01
The phospholipase A2 (PLA2)activity of phosphorylated peroxiredoxin 6 (Prdx6) is required for activation of NADPH oxidase (NOX2). We investigated the interaction of Prdx6 with p67phox and its effect on NOX2 activity. With the use of specific antibodies, coimmunoprecipitation of p67phox and phosphorylated Prdx6 was demonstrated with lysates of mouse pulmonary microvascular endothelial cells (MPMVECs) that were stimulated with angiotensin II; the interaction of p67phox with nonphosphorylated Prdx6 was relatively weak. Association of p67phox and phosphoPrdx6 in intact MPMVECs after angiotensin II stimulation was demonstrated by proximity ligation assay and was abolished by U0126, a MAP kinase inhibitor. By isothermal titration calorimetry, p67phox bound strongly to phosphoPrdx6 but bound poorly to Prdx6; phosphorylated p67phox did not bind to either Prdx6 or phosphoPrdx6. PLA2 activity of recombinant phosphoPrdx6 was decreased by >98% in the presence of p67phox; the calculated dissociation constant (Kd) of the p67phox: phosphoPrdx6 complex was 65 nM. PLA2 activity (MJ33 sensitive) in cell lysates following angiotensin II treatment of MPMVECs was increased by 85% following knockdown of p67phox with siRNA. These data indicate that p67phox binds to phosphoPrdx6 and inhibits its PLA2 activity, an interaction that could function to terminate the PLA2-mediated NOX2 activation signal.—Krishnaiah, S. Y., Dodia, C., Feinstein, S. I., and Fisher, A. B. p67phox terminates the phospholipase A2-derived signal for activation of NADPH oxidase (NOX2). PMID:23401562
p67(phox) terminates the phospholipase A(2)-derived signal for activation of NADPH oxidase (NOX2).
Krishnaiah, Saikumari Y; Dodia, Chandra; Feinstein, Sheldon I; Fisher, Aron B
2013-05-01
The phospholipase A2 (PLA2)activity of phosphorylated peroxiredoxin 6 (Prdx6) is required for activation of NADPH oxidase (NOX2). We investigated the interaction of Prdx6 with p67(phox) and its effect on NOX2 activity. With the use of specific antibodies, coimmunoprecipitation of p67(phox) and phosphorylated Prdx6 was demonstrated with lysates of mouse pulmonary microvascular endothelial cells (MPMVECs) that were stimulated with angiotensin II; the interaction of p67(phox) with nonphosphorylated Prdx6 was relatively weak. Association of p67(phox) and phosphoPrdx6 in intact MPMVECs after angiotensin II stimulation was demonstrated by proximity ligation assay and was abolished by U0126, a MAP kinase inhibitor. By isothermal titration calorimetry, p67(phox) bound strongly to phosphoPrdx6 but bound poorly to Prdx6; phosphorylated p67(phox) did not bind to either Prdx6 or phosphoPrdx6. PLA2 activity of recombinant phosphoPrdx6 was decreased by >98% in the presence of p67(phox); the calculated dissociation constant (Kd) of the p67(phox): phosphoPrdx6 complex was 65 nM. PLA2 activity (MJ33 sensitive) in cell lysates following angiotensin II treatment of MPMVECs was increased by 85% following knockdown of p67(phox) with siRNA. These data indicate that p67(phox) binds to phosphoPrdx6 and inhibits its PLA2 activity, an interaction that could function to terminate the PLA2-mediated NOX2 activation signal.-Krishnaiah, S. Y., Dodia, C., Feinstein, S. I., and Fisher, A. B. p67(phox) terminates the phospholipase A2-derived signal for activation of NADPH oxidase (NOX2).
Majdecka, Dominika; Draminska, Sylwia; Janusek, Dariusz; Krysinski, Paweł; Bilewicz, Renata
2018-04-15
In this work, we propose an integrated self-powered sensing system, driven by a hybrid biofuel cell (HBFC) with carbon paper discs coated with multiwalled carbon nanotubes. The sensing system has a biocathode made from laccase or bilirubin oxidase, and the anode is made from a zinc plate. The system includes a dedicated custom-built electronic control unit for the detection of oxygen and catechol analytes, which are central to medical and environmental applications. Both the HBFC and sensors, operate in a mediatorless direct electron transfer mode. The measured characteristics of the HBFC with externally applied resistance included the power-time dependencies under flow cell conditions, the sensors performance (evaluated by cyclic voltammetry), and chronoamperometry. The HBFC is integrated with analytical devices and operating in a pulse mode form long-run monitoring experiments. The HBFC generated sufficient power for wireless data transmission to a local computer. Copyright © 2017 Elsevier B.V. All rights reserved.
A repeatedly refuelable mediated biofuel cell based on a hierarchical porous carbon electrode
NASA Astrophysics Data System (ADS)
Fujita, Shuji; Yamanoi, Shun; Murata, Kenichi; Mita, Hiroki; Samukawa, Tsunetoshi; Nakagawa, Takaaki; Sakai, Hideki; Tokita, Yuichi
2014-05-01
Biofuel cells that generate electricity from renewable fuels, such as carbohydrates, must be reusable through repeated refuelling, should these devices be used in consumer electronics. We demonstrate the stable generation of electricity from a glucose-powered mediated biofuel cell through multiple refuelling cycles. This refuelability is achieved by immobilizing nicotinamide adenine dinucleotide (NAD), an electron-transfer mediator, and redox enzymes in high concentrations on porous carbon particles constituting an anode while maintaining their electrochemical and enzymatic activities after the immobilization. This bioanode can be refuelled continuously for more than 60 cycles at 1.5 mA cm-2 without significant potential drop. Cells assembled with these bioanodes and bilirubin-oxidase-based biocathodes can be repeatedly used to power a portable music player at 1 mW cm-3 through 10 refuelling cycles. This study suggests that the refuelability within consumer electronics should facilitate the development of long and repeated use of the mediated biofuel cells as well as of NAD-based biosensors, bioreactors, and clinical applications.
A repeatedly refuelable mediated biofuel cell based on a hierarchical porous carbon electrode.
Fujita, Shuji; Yamanoi, Shun; Murata, Kenichi; Mita, Hiroki; Samukawa, Tsunetoshi; Nakagawa, Takaaki; Sakai, Hideki; Tokita, Yuichi
2014-05-13
Biofuel cells that generate electricity from renewable fuels, such as carbohydrates, must be reusable through repeated refuelling, should these devices be used in consumer electronics. We demonstrate the stable generation of electricity from a glucose-powered mediated biofuel cell through multiple refuelling cycles. This refuelability is achieved by immobilizing nicotinamide adenine dinucleotide (NAD), an electron-transfer mediator, and redox enzymes in high concentrations on porous carbon particles constituting an anode while maintaining their electrochemical and enzymatic activities after the immobilization. This bioanode can be refuelled continuously for more than 60 cycles at 1.5 mA cm(-2) without significant potential drop. Cells assembled with these bioanodes and bilirubin-oxidase-based biocathodes can be repeatedly used to power a portable music player at 1 mW cm(-3) through 10 refuelling cycles. This study suggests that the refuelability within consumer electronics should facilitate the development of long and repeated use of the mediated biofuel cells as well as of NAD-based biosensors, bioreactors, and clinical applications.
NASA Astrophysics Data System (ADS)
Babanova, Sofia; Artyushkova, Kateryna; Ulyanova, Yevgenia; Singhal, Sameer; Atanassov, Plamen
2014-01-01
Two statistical methods, design of experiments (DOE) and principal component analysis (PCA) are employed to investigate and improve performance of air-breathing gas-diffusional enzymatic electrodes. DOE is utilized as a tool for systematic organization and evaluation of various factors affecting the performance of the composite system. Based on the results from the DOE, an improved cathode is constructed. The current density generated utilizing the improved cathode (755 ± 39 μA cm-2 at 0.3 V vs. Ag/AgCl) is 2-5 times higher than the highest current density previously achieved. Three major factors contributing to the cathode performance are identified: the amount of enzyme, the volume of phosphate buffer used to immobilize the enzyme, and the thickness of the gas-diffusion layer (GDL). PCA is applied as an independent confirmation tool to support conclusions made by DOE and to visualize the contribution of factors in individual cathode configurations.
Structural studies of enzyme-based microfluidic biofuel cells
NASA Astrophysics Data System (ADS)
Togo, Makoto; Takamura, Akimasa; Asai, Tatsuya; Kaji, Hirokazu; Nishizawa, Matsuhiko
An enzyme-based glucose/O 2 biofuel cell was constructed within a microfluidic channel to study the influence of electrode configuration and fluidic channel height on cell performance. The cell was composed of a bilirubin oxidase (BOD)-adsorbed O 2 cathode and a glucose anode prepared by co-immobilization of glucose dehydrogenase (GDH), diaphorase (Dp) and VK 3-pendant poly- L-lysine. The consumption of O 2 at the upstream cathode protected the downstream anode from interfering O 2 molecules, and consequently improved the cell performance (maximum cell current) ca. 10% for the present cell. The cell performance was also affected by the channel height. The output current and power of a 0.1 mm-height cell was significantly less than those of a 1 mm-height cell because of the depletion of O 2, as determined by the shape of the E- I curve at the cathode. On the other hand, the volume density of current and power was several times higher for the narrower cell.
A repeatedly refuelable mediated biofuel cell based on a hierarchical porous carbon electrode
Fujita, Shuji; Yamanoi, Shun; Murata, Kenichi; Mita, Hiroki; Samukawa, Tsunetoshi; Nakagawa, Takaaki; Sakai, Hideki; Tokita, Yuichi
2014-01-01
Biofuel cells that generate electricity from renewable fuels, such as carbohydrates, must be reusable through repeated refuelling, should these devices be used in consumer electronics. We demonstrate the stable generation of electricity from a glucose-powered mediated biofuel cell through multiple refuelling cycles. This refuelability is achieved by immobilizing nicotinamide adenine dinucleotide (NAD), an electron-transfer mediator, and redox enzymes in high concentrations on porous carbon particles constituting an anode while maintaining their electrochemical and enzymatic activities after the immobilization. This bioanode can be refuelled continuously for more than 60 cycles at 1.5 mA cm−2 without significant potential drop. Cells assembled with these bioanodes and bilirubin-oxidase-based biocathodes can be repeatedly used to power a portable music player at 1 mW cm−3 through 10 refuelling cycles. This study suggests that the refuelability within consumer electronics should facilitate the development of long and repeated use of the mediated biofuel cells as well as of NAD-based biosensors, bioreactors, and clinical applications. PMID:24820210
Tailoring properties of reduced graphene oxide by oxygen plasma treatment
NASA Astrophysics Data System (ADS)
Kondratowicz, Izabela; Nadolska, Małgorzata; Şahin, Samet; Łapiński, Marcin; Prześniak-Welenc, Marta; Sawczak, Mirosław; Yu, Eileen H.; Sadowski, Wojciech; Żelechowska, Kamila
2018-05-01
We report an easily controllable, eco-friendly method for tailoring the properties of reduced graphene oxide (rGO) by means of oxygen plasma. The effect of oxygen plasma treatment time (1, 5 and 10 min) on the surface properties of rGO was evaluated. Physicochemical characterization using microscopic, spectroscopic and thermal techniques was performed. The results revealed that different oxygen-containing groups (e.g. carboxyl, hydroxyl) were introduced on the rGO surface enhancing its wettability. Furthermore, upon longer treatment time, other functionalities were created (e.g. quinones, lactones). Moreover, external surface of rGO was partially etched resulting in an increase of the material surface area and porosity. Finally, the oxygen plasma-treated rGO electrodes with bilirubin oxidase were tested for oxygen reduction reaction. The study showed that rGO treated for 10 min exhibited twofold higher current density than untreated rGO. The oxygen plasma treatment may improve the enzyme adsorption on rGO electrodes by introduction of oxygen moieties and increasing the porosity.
Vogel, Megan E.; Kindel, Tammy L.; Smith, Darcey L. H.; Idelman, Gila; Avissar, Uri; Kakarlapudi, Ganesh; Masnovi, Michelle E.
2015-01-01
Bilirubin is thought to exert anti-inflammatory effects by inhibiting vascular cell adhesion molecule-1 (VCAM-1)-dependent leukocyte migration and by suppressing the expression of inducible nitric oxide synthase (iNOS). As VCAM-1 and iNOS are important mediators of tissue injury in the dextran sodium sulfate (DSS) murine model of inflammatory colitis, we examined whether bilirubin prevents colonic injury in DSS-treated mice. Male C57BL/6 mice were administered 2.5% DSS in the drinking water for 7 days, while simultaneously receiving intraperitoneal injections of bilirubin (30 mg/kg) or potassium phosphate vehicle. Disease activity was monitored, peripheral blood counts and serum nitrate levels were determined, and intestinal specimens were analyzed for histological injury, leukocyte infiltration, and iNOS expression. The effect of bilirubin on IL-5 production by HSB-2 cells and on Jurkat cell transendothelial migration also was determined. DSS-treated mice that simultaneously received bilirubin lost less body weight, had lower serum nitrate levels, and exhibited reduced disease severity than vehicle-treated animals. Concordantly, histopathological analyses revealed that bilirubin-treated mice manifested significantly less colonic injury, including reduced infiltration of eosinophils, lymphocytes, and monocytes, and diminished iNOS expression. Bilirubin administration also was associated with decreased eosinophil and monocyte infiltration into the small intestine, with a corresponding increase in peripheral blood eosinophilia. Bilirubin prevented Jurkat migration but did not alter IL-5 production. In conclusion, bilirubin prevents DSS-induced colitis by inhibiting the migration of leukocytes across the vascular endothelium and by suppressing iNOS expression. PMID:26381705
Zucker, Stephen D; Vogel, Megan E; Kindel, Tammy L; Smith, Darcey L H; Idelman, Gila; Avissar, Uri; Kakarlapudi, Ganesh; Masnovi, Michelle E
2015-11-15
Bilirubin is thought to exert anti-inflammatory effects by inhibiting vascular cell adhesion molecule-1 (VCAM-1)-dependent leukocyte migration and by suppressing the expression of inducible nitric oxide synthase (iNOS). As VCAM-1 and iNOS are important mediators of tissue injury in the dextran sodium sulfate (DSS) murine model of inflammatory colitis, we examined whether bilirubin prevents colonic injury in DSS-treated mice. Male C57BL/6 mice were administered 2.5% DSS in the drinking water for 7 days, while simultaneously receiving intraperitoneal injections of bilirubin (30 mg/kg) or potassium phosphate vehicle. Disease activity was monitored, peripheral blood counts and serum nitrate levels were determined, and intestinal specimens were analyzed for histological injury, leukocyte infiltration, and iNOS expression. The effect of bilirubin on IL-5 production by HSB-2 cells and on Jurkat cell transendothelial migration also was determined. DSS-treated mice that simultaneously received bilirubin lost less body weight, had lower serum nitrate levels, and exhibited reduced disease severity than vehicle-treated animals. Concordantly, histopathological analyses revealed that bilirubin-treated mice manifested significantly less colonic injury, including reduced infiltration of eosinophils, lymphocytes, and monocytes, and diminished iNOS expression. Bilirubin administration also was associated with decreased eosinophil and monocyte infiltration into the small intestine, with a corresponding increase in peripheral blood eosinophilia. Bilirubin prevented Jurkat migration but did not alter IL-5 production. In conclusion, bilirubin prevents DSS-induced colitis by inhibiting the migration of leukocytes across the vascular endothelium and by suppressing iNOS expression. Copyright © 2015 the American Physiological Society.
Freundt, Miriam; Lunz, Dirk; Philipp, Alois; Panholzer, Bernd; Lubnow, Matthias; Friedrich, Christine; Rupprecht, Leopold; Hirt, Stephan; Haneya, Assad
2017-01-01
Veno-arterial extracorporeal life support (ECLS) is an established method to stabilize acute circulatory failure. Parameters and data on when to ideally wean circulatory support are limited. Bilirubin is a marker of end-organ damage. Therefore, the purpose of this large study was to evaluate the impact of dynamic changes of elevated bilirubin levels on survival in patients on ECLS. We reviewed 502 consecutive cases of ECLS from 2007 to 2015. Bilirubin levels were recorded before implantation and until six days after explantation. Dynamic bilirubin changes, and hemodynamic and laboratory outcome parameters were compared in survivors and nonsurvivors. Reason for ECLS implantation was cardiac arrest with ongoing resuscitation in 230 (45.8%), low cardiac output in 174 (34.7%) and inability to wean off cardiopulmonary bypass in 98 (19.5%) patients. 307 (61.2%) patients were weaned off ECLS, however, 206 (41.0%) survived. Mean duration of ECLS was 3 (2-6) days, and survivors received significantly longer ECLS (5 vs 3 days, p < 0.001). Survivors had significantly lower baseline bilirubin levels (p = 0.003). Bilirubin started to rise from day 2 in all patients. In survivors, bilirubin levels had trended down on the day of ECLS explantation and stayed at an acceptable level. However, in weaned patients who did not survive and patients who died on ECLS bilirubin levels continued to rise during the recorded period. ECLS support improves survival in patients with acute circulatory failure. Down trending bilirubin levels on veno-arterial ECLS indicate improved chances of successful weaning and survival in hemodynamically stable patients.
Reduced total serum bilirubin levels are associated with ulcerative colitis
Schieffer, Kathleen M.; Bruffy, Shannon M.; Rauscher, Richard; Koltun, Walter A.; Gallagher, Carla J.
2017-01-01
Chronic inflammation associated with inflammatory bowel disease (IBD) results in increased oxidative stress that damages the colonic microenvironment. Low levels of serum bilirubin, an endogenous antioxidant, have been associated with increased risk for Crohn’s disease (CD). Therefore, the aim of this study was to examine whether total serum bilirubin levels are associated with ulcerative colitis (UC). We identified a retrospective case-control population (n = 6,649) from a single tertiary care center, Penn State Hershey Medical Center (PSU) and a validation cohort (n = 1,996) from Virginia Commonwealth University Medical Center (VCU). Cases were age- and sex-matched to controls (PSU: CD n = 254, UC n = 187; VCU: CD n = 233, UC n = 124). Total serum bilirubin levels were obtained from de-identified medical records and segregated into quartiles. Logistic regression analysis was performed on each quartile of total serum bilirubin compared to the last quartile (highest bilirubin levels) to determine the association of total serum bilirubin with UC. Similar to CD patients, UC patients demonstrated reduced levels of total serum bilirubin compared to controls at PSU and VCU. The lowest quartile of total serum bilirubin was independently associated with UC for the PSU (OR: 1.98 [95% CI: 1.09–3.63]) and VCU cohorts (OR: 6.07 [95% CI: 3.01–12.75]). Lower levels of the antioxidant bilirubin may reduce the capability of UC patients to remove reactive oxygen species leading to an increase in intestinal injury. Therapeutics that reduce oxidative stress may be beneficial for these patients. PMID:28594959
Premkumar, Lakshmanane; Kurth, Fabian; Duprez, Wilko; Grøftehauge, Morten K; King, Gordon J; Halili, Maria A; Heras, Begoña; Martin, Jennifer L
2014-07-18
The multidrug resistant bacterium Acinetobacter baumannii is a significant cause of nosocomial infection. Biofilm formation, that requires both disulfide bond forming and chaperone-usher pathways, is a major virulence trait in this bacterium. Our biochemical characterizations show that the periplasmic A. baumannii DsbA (AbDsbA) enzyme has an oxidizing redox potential and dithiol oxidase activity. We found an unexpected non-covalent interaction between AbDsbA and the highly conserved prokaryotic elongation factor, EF-Tu. EF-Tu is a cytoplasmic protein but has been localized extracellularly in many bacterial pathogens. The crystal structure of this complex revealed that the EF-Tu switch I region binds to the non-catalytic surface of AbDsbA. Although the physiological and pathological significance of a DsbA/EF-Tu association is unknown, peptides derived from the EF-Tu switch I region bound to AbDsbA with submicromolar affinity. We also identified a seven-residue DsbB-derived peptide that bound to AbDsbA with low micromolar affinity. Further characterization confirmed that the EF-Tu- and DsbB-derived peptides bind at two distinct sites. These data point to the possibility that the non-catalytic surface of DsbA is a potential substrate or regulatory protein interaction site. The two peptides identified in this work together with the newly characterized interaction site provide a novel starting point for inhibitor design targeting AbDsbA. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Tian, Jianbo; Zhong, Rong; Liu, Cheng; Tang, Yuhan; Gong, Jing; Chang, Jiang; Lou, Jiao; Ke, Juntao; Li, Jiaoyuan; Zhang, Yi; Yang, Yang; Zhu, Ying; Gong, Yajie; Xu, Yanyan; Liu, Peiyi; Yu, Xiao; Xiao, Lin; Du, Min; Yang, Ling; Yuan, Jing; Wang, Youjie; Chen, Weihong; Wei, Sheng; Liang, Yuan; Zhang, Xiaomin; He, Meian; Wu, Tangchun; Yao, Ping; Miao, Xiaoping
2016-08-03
The study aimed to assess the association between total, direct, and indirect bilirubin and nonalcoholic fatty live disease (NAFLD) risk given its high prevalence and serious clinical prognosis. Among 27,009 subjects who participated in a healthy screening program from the Dongfeng-Tongji cohort study in 2008, 8189 eligible subjects (aged 35-86 years; males, 43.95%) were ultimately enrolled. The incidence rates of NAFLD in 2013 were compared with respect to baseline bilirubin levels among subjects free of NAFLD, and the effect sizes were estimated by logistic regression analysis. During 5 years follow-up, we observed 1956 cases of newly developed NAFLD with the overall incidence of 23.88%. Direct bilirubin was presented to inversely associate with NAFLD risk. Compared with quartile 1 of direct bilirubin, the multivariable-adjusted ORs (95% CIs) for NAFLD of quartile 2 to 4 were 1.104 (0.867-1.187), 0.843 (0.719-0.989), and 0.768 (0.652-0.905), respectively, P for trend 0.002). Similarly, inverse effects of direct bilirubin on NAFLD incidence were also observed when stratified by sex and BMI. However, no significant associations were found between total, and indirect bilirubin and NAFLD risk. Direct bilirubin reduced NAFLD risk independent of possible confounders among middle-aged and elderly Chinese population, probably based on the endogenous antioxidation of bilirubin.
Rougée, Luc RA; Miyagi, Shogo J
2016-01-01
Obesity and pregnancy both place the liver under metabolic stress, but interactions between obstetric obesity and bilirubin metabolism have not been studied. We determined associations between obesity, maternal/neonatal bilirubin levels, and uridine 5′diphosphate-glucuronosyltransferase 1A1 (UGT1A1) enzyme that eliminates bilirubin. Adult livers were analyzed for UGT1A1 expression, activity, and bilirubin clearance by pharmacokinetic modeling. Then, matched maternal and neonatal sera (N = 450) were assayed for total and unconjugated bilirubin. Associations between obesity, UGT1A1, maternal and neonatal hyperbilirubinemia were determined statistically through correlation analysis (Pearson's test) as well as binned categories (one-way ANOVA). Morbid obesity decreased hepatic UGT1A1 protein levels, activity, and bilirubin clearance (P < .001). Increasing obesity corresponded to elevated maternal unconjugated bilirubin (P < .05). Maternal obesity was also significantly positively correlated with elevated neonatal bilirubin levels (P < .01, N = 450) and this was strongest in Native Hawaiians and Pacific Islander (NHPI) women (P < .01, n = 150). Obstetric obesity is associated with maternal and neonatal hyperbilirubinemia, likely through inhibition of hepatic UGT1A1. The NHPI cohort was the most obese and had the highest levels of maternal and neonatal unconjugated bilirubin. Neonates from obese mothers may be more susceptible to jaundice and side effects from parenteral nutrition. PMID:27980881
Association of abnormal plasma bilirubin with aggressive HCC phenotype
Carr, Brian I.; Guerra, Vito; Giannini, Edoardo G.; Farinati, Fabio; Ciccarese, Francesca; Rapaccini, Gian Ludovico; Marco, Maria Di; Benvegnù, Luisa; Zoli, Marco; Borzio, Franco; Caturelli, Eugenio; Chiaramonte, Maria; Trevisani, Franco
2014-01-01
Background Cirrhosis-related abnormal liver function is associated with predisposition to HCC, features in several HCC classification systems and is an HCC prognostic factor. Aims To examine the phenotypic tumor differences in HCC patients with normal or abnormal plasma bilirubin levels. Methods A 2,416 patient HCC cohort was studied and dichotomized into normal and abnormal plasma bilirubin groups. Their HCC characteristics were compared for tumor aggressiveness features, namely blood AFP levels, tumor size, presence of PVT and tumor multifocality. Results In the total cohort, elevated bilirubin levels were associated with higher AFP levels, increased PVT and multifocality and lower survival, despite similar tumor sizes. When different tumor size terciles were compared, similar results were found, even for small tumor size patients. A multiple logistic regression model for PVT or tumor multifocality showed increased OddsRatios for elevated levels of GGTP, bilirubin and AFP and for larger tumor sizes. Conclusions HCC patients with abnormal bilirubin levels had worse prognosis than patients with normal bilirubin. They also had increased incidence of PVT and tumor multifocality and higher AFP levels, in patients with both small and larger tumors. The results show an association between bilirubin levels and indices of HCC aggressiveness. PMID:24787296
Thakkar, Pareshkumar; Chavda, Hardas; Doshi, Vikas
2017-05-15
To develop nomogram of Transcutaneous Bilirubin among healthy term and late-preterm neonates during first 96 hours of age. Longitudinal observational study. Neonatal unit of a tertiary care Hospital of Central Gujarat, India. 1075 healthy term and late preterm neonates (≥35weeks). Six-hourly transcutaneous bilirubin was obtained from birth to 96 hour of life using Drager JM 103 Transcutaneous Bilirubinometer. Main outcome measures: Nomogram of Transcutaneous Bilirubin with percentile values was obtained, rate of rise of bilirubin was calculated and predictive ability of normative data was analyzed for subsequent need of phototherapy. The age-specific percentile curves and nomogram were developed from the transcutaneous bilirubin readings of 1,010 neonates. Rate of rise in first 12 hour was 0.2 mg/dL and was 0.17 mg/dL in 12 to 24 hour of life which decreased on second day of life. Neonates who required phototherapy had consistently higher readings of transcutaneous bilirubin and also higher rate of rise in first 48 hrs. Neonates whose transcutaneous bilirubin is above the 50th percentile should be monitored for the development of significant hyperbilirubinemia.
Crystal Structures of Intermediates in the Nitroalkane Oxidase Reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Heroux, A.; Bozinovski, D; Valley, M
2009-01-01
The flavoenzyme nitroalkane oxidase is a member of the acyl-CoA dehydrogenase superfamily. Nitroalkane oxidase catalyzes the oxidation of neutral nitroalkanes to nitrite and the corresponding aldehydes or ketones. Crystal structures to 2.2 {angstrom} resolution or better of enzyme complexes with bound substrates and of a trapped substrate-flavin adduct are described. The D402N enzyme has no detectable activity with neutral nitroalkanes. The structure of the D402N enzyme crystallized in the presence of 1-nitrohexane or 1-nitrooctane shows the presence of the substrate in the binding site. The aliphatic chain of the substrate extends into a tunnel leading to the enzyme surface. Themore » oxygens of the substrate nitro group interact both with amino acid residues and with the 2'-hydroxyl of the FAD. When nitroalkane oxidase oxidizes nitroalkanes in the presence of cyanide, an electrophilic flavin imine intermediate can be trapped (Valley, M. P., Tichy, S. E., and Fitzpatrick, P. F. (2005) J. Am. Chem. Soc. 127, 2062-2066). The structure of the enzyme trapped with cyanide during oxidation of 1-nitrohexane shows the presence of the modified flavin. A continuous hydrogen bond network connects the nitrogen of the CN-hexyl-FAD through the FAD 2'-hydroxyl to a chain of water molecules extending to the protein surface. Together, our complementary approaches provide strong evidence that the flavin cofactor is in the appropriate oxidation state and correlates well with the putative intermediate state observed within each of the crystal structures. Consequently, these results provide important structural descriptions of several steps along the nitroalkane oxidase reaction cycle.« less
Low concentrations of bilirubin inhibit activation of hepatic stellate cells in vitro.
Tang, Yinhe; Zhang, Qiyu; Zhu, Yefan; Chen, Gang; Yu, Fuxiang
2017-04-01
Hepatic stellate cell (HSC) activation serves a key role in liver fibrosis, and is associated with chronic liver diseases. Bilirubin, a product of heme degradation, has been demonstrated to have antioxidant properties. The present study investigated the effects of physiological concentrations of bilirubin on rat HSC activation. Rat HSCs were isolated and cultured for several generations to induce activation. The activated HSCs were subsequently treated with 0, 1, 10 or 20 mg/l bilirubin and assayed for parameters of cell activation. As the bilirubin concentration increased, HSCs demonstrated reduced production of reactive oxygen species, reduced protein expression levels of α‑smooth muscle actin, a decreased mRNA expression ratio of tissue inhibitor of matrix metalloproteinase‑1/matrix metalloproteinase‑2, decreased proliferation and increased apoptosis. In conclusion, elevated bilirubin levels, within its physiological concentration range, appeared to inhibit HSC activation. These findings suggested a potential role for bilirubin in the treatment of fibrosis that requires further investigation.
Peng, You-Fan; Wang, Jun-Li; Pan, Guo-Gang
2017-06-01
We investigated the relationship between serum bilirubin and disease activity in patients with rheumatoid arthritis (RA). We included a total of 173 consecutive RA patients without steroid treatment and 346 healthy subjects; the disease activity score in 28 joints (DAS28) was used to assess disease activity in patients with RA. Serum bilirubin concentrations were significantly lower in RA patients than in controls. Serum bilirubin was found to be negatively correlated with C-reactive protein (CRP) concentration and erythrocyte sedimentation rate (ESR) (r=-0.165, P=0.030; r=-192, P=0.012) in patients with RA. There was a negative correlation between the serum bilirubin and DAS28 score (r=-0.331, P<0.001). Serum bilirubin was independently associated with the DAS28 score (b=-0.225, P=0.001) in the multiple linear regression analysis. Serum bilirubin concentrations are lower in patients with RA compared to controls and correlate with disease activity in patients with RA. Copyright © 2017. Published by Elsevier B.V.
Bilirubin-a potential marker of drug exposure in atazanavir-based antiretroviral therapy.
Rekić, Dinko; Clewe, Oskar; Röshammar, Daniel; Flamholc, Leo; Sönnerborg, Anders; Ormaasen, Vidar; Gisslén, Magnus; Abelö, Angela; Ashton, Michael
2011-12-01
The objective of this work was to examine the atazanavir-bilirubin relationship using a population-based approach and to assess the possible application of bilirubin as a readily available marker of atazanavir exposure. A model of atazanavir exposure and its concentration-dependent effect on bilirubin levels was developed based on 200 atazanavir and 361 bilirubin samples from 82 patients receiving atazanavir in the NORTHIV trial. The pharmacokinetics was adequately described by a one-compartment model with first-order absorption and lag-time. The maximum inhibition of bilirubin elimination rate constant (I(max)) was estimated at 91% (95% CI, 87-94) and the atazanavir concentration resulting in half of I(max) (IC50) was 0.30 μmol/L (95% CI, 0.24-0.37). At an atazanavir/ritonavir dose of 300/100 mg given once daily, the bilirubin half-life was on average increased from 1.6 to 8.1 h. A nomogram, which can be used to indicate suboptimal atazanavir exposure and non-adherence, was constructed based on model simulations.
Uthandi, Sivakumar; Saad, Boutaiba; Humbard, Matthew A.; Maupin-Furlow, Julie A.
2010-01-01
Laccases couple the oxidation of phenolic compounds to the reduction of molecular oxygen and thus span a wide variety of applications. While laccases of eukaryotes and bacteria are well characterized, these enzymes have not been described in archaea. Here, we report the purification and characterization of a laccase (LccA) from the halophilic archaeon Haloferax volcanii. LccA was secreted at high levels into the culture supernatant of a recombinant H. volcanii strain, with peak activity (170 ± 10 mU·ml−1) at stationary phase (72 to 80 h). LccA was purified 13-fold to an overall yield of 72% and a specific activity of 29.4 U·mg−1 with an absorbance spectrum typical of blue multicopper oxidases. The mature LccA was processed to expose an N-terminal Ala after the removal of 31 amino acid residues and was glycosylated to 6.9% carbohydrate content. Purified LccA oxidized a variety of organic substrates, including bilirubin, syringaldazine (SGZ), 2,2,-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), and dimethoxyphenol (DMP), with DMP oxidation requiring the addition of CuSO4. Optimal oxidation of ABTS and SGZ was at 45°C and pH 6 and pH 8.4, respectively. The apparent Km values for SGZ, bilirubin, and ABTS were 35, 236, and 670 μM, with corresponding kcat values of 22, 29, and 10 s−1, respectively. The purified LccA was tolerant of high salt, mixed organosolvents, and high temperatures, with a half-life of inactivation at 50°C of 31.5 h. PMID:19966030
The kinetics of oxidation of bilirubin and ascorbic acid in solution
NASA Astrophysics Data System (ADS)
Solomonov, A. V.; Rumyantsev, E. V.; Kochergin, B. A.; Antina, E. V.
2012-07-01
The results of a comparative study of the oxidation of bilirubin, ascorbic acid, and their mixture in aqueous solutions under the action of air oxygen and hydrogen peroxide are presented. The observed and true rate constants for the oxidation reactions were determined. It was shown that the oxidation of tetrapyrrole pigment occurred under these conditions bypassing the stage of biliverdin formation to monopyrrole products. Simultaneous oxidation of bilirubin and ascorbic acid was shown to be accompanied by the inhibition of ascorbic acid oxidation by bilirubin, whereas ascorbic acid itself activated the oxidation of bilirubin.
Edmondson, Dale E; Binda, Claudia
2018-01-01
Monoamine oxidases A and B (MAO A and B) are mammalian flavoenzymes bound to the outer mitochondrial membrane. They were discovered almost a century ago and they have been the subject of many biochemical, structural and pharmacological investigations due to their central role in neurotransmitter metabolism. Currently, the treatment of Parkinson's disease involves the use of selective MAO B inhibitors such as rasagiline and safinamide. MAO inhibition was shown to exert a general neuroprotective effect as a result of the reduction of oxidative stress produced by these enzymes, which seems to be relevant also in non-neuronal contexts. MAOs were successfully expressed as recombinant proteins in Pichia pastoris, which allowed a thorough biochemical and structural characterization. These enzymes are characterized by a globular water-soluble main body that is anchored to the mitochondrial membrane through a C-terminal α-helix, similar to other bitopic membrane proteins. In both MAO A and MAO B the enzyme active site consists of a hydrophobic cavity lined by residues that are conserved in the two isozymes, except for few details that determine substrate and inhibitor specificity. In particular, human MAO B features a dual-cavity active site whose conformation depends on the size of the bound ligand. This article provides a comprehensive and historical review of MAOs and the state-of-the-art of these enzymes as membrane drug targets.
Murakawa, Takeshi; Hayashi, Hideyuki; Sunami, Tomoko; Kurihara, Kazuo; Tamada, Taro; Kuroki, Ryota; Suzuki, Mamoru; Tanizawa, Katsuyuki; Okajima, Toshihide
2013-12-01
The crystal structure of a copper amine oxidase from Arthrobacter globiformis was determined at 1.08 Å resolution with the use of low-molecular-weight polyethylene glycol (LMW PEG; average molecular weight ∼200) as a cryoprotectant. The final crystallographic R factor and Rfree were 13.0 and 15.0%, respectively. Several molecules of LMW PEG were found to occupy cavities in the protein interior, including the active site, which resulted in a marked reduction in the overall B factor and consequently led to a subatomic resolution structure for a relatively large protein with a monomer molecular weight of ∼70,000. About 40% of the presumed H atoms were observed as clear electron densities in the Fo - Fc difference map. Multiple minor conformers were also identified for many residues. Anisotropic displacement fluctuations were evaluated in the active site, which contains a post-translationally derived quinone cofactor and a Cu atom. Furthermore, diatomic molecules, most likely to be molecular oxygen, are bound to the protein, one of which is located in a region that had previously been proposed as an entry route for the dioxygen substrate from the central cavity of the dimer interface to the active site.
Dong, Huansheng; Huang, Hu; Yun, Xinxu; Kim, Do-sung; Yue, Yinan; Wu, Hongju; Sutter, Alton; Chavin, Kenneth D.; Otterbein, Leo E.; Adams, David B.; Kim, Young-Bum
2014-01-01
Obesity-induced endoplasmic reticulum (ER) stress causes chronic inflammation in adipose tissue and steatosis in the liver, and eventually leads to insulin resistance and type 2 diabetes (T2D). The goal of this study was to understand the mechanisms by which administration of bilirubin, a powerful antioxidant, reduces hyperglycemia and ameliorates obesity in leptin-receptor-deficient (db/db) and diet-induced obese (DIO) mouse models. db/db or DIO mice were injected with bilirubin or vehicle ip. Blood glucose and body weight were measured. Activation of insulin-signaling pathways, expression of inflammatory cytokines, and ER stress markers were measured in skeletal muscle, adipose tissue, and liver of mice. Bilirubin administration significantly reduced hyperglycemia and increased insulin sensitivity in db/db mice. Bilirubin treatment increased protein kinase B (PKB/Akt) phosphorylation in skeletal muscle and suppressed expression of ER stress markers, including the 78-kDa glucose-regulated protein (GRP78), CCAAT/enhancer-binding protein (C/EBP) homologous protein, X box binding protein (XBP-1), and activating transcription factor 4 in db/db mice. In DIO mice, bilirubin treatment significantly reduced body weight and increased insulin sensitivity. Moreover, bilirubin suppressed macrophage infiltration and proinflammatory cytokine expression, including TNF-α, IL-1β, and monocyte chemoattractant protein-1, in adipose tissue. In liver and adipose tissue of DIO mice, bilirubin ameliorated hepatic steatosis and reduced expression of GRP78 and C/EBP homologous protein. These results demonstrate that bilirubin administration improves hyperglycemia and obesity by increasing insulin sensitivity in both genetically engineered and DIO mice models. Bilirubin or bilirubin-increasing drugs might be useful as an insulin sensitizer for the treatment of obesity-induced insulin resistance and type 2 diabetes based on its profound anti-ER stress and antiinflammatory properties. PMID:24424052
Kim, Lee Kyung; Roh, Eun; Kim, Min Joo; Kim, Min Kyeong; Park, Kyeong Seon; Kwak, Soo Heon; Cho, Young Min; Park, Kyong Soo; Jang, Hak Chul; Jung, Hye Seung
2016-11-01
Glycemic variability is known to induce oxidative stress. We investigated the relationships between glycemic variability and serum bilirubin levels, an endogenous anti-oxidant, in patients with diabetes. A cross-sectional study was carried out with 77 patients with type 2 diabetes who had been recruited to two clinical studies from 2008 to 2014. There were no participants with diseases of the pancreas, liver, biliary tract and chronic renal insufficiency. Glycemic variation was calculated by a continuous glucose monitoring system, and correlation analyses were carried out to evaluate their association with bilirubin levels. Multiple linear regression was carried out to identify independent factors influencing bilirubin levels and glycemic variation. Among the participants, 42.3% were men. The mean (standard deviation) age was 61.5 years (10.4 years), body mass index was 24.2 kg/m 2 (2.8 kg/m 2 ), diabetes duration was 17.7 years (9.5 years), hemoglobin A 1c was 60.7 mmol/mol (7.1 mmol/mol; 7.7 [0.7]%) and bilirubin was 11.8 μmol/L (4.10 μmol/L). Serum bilirubin levels were not different according to age, body mass index and hemoglobin A 1c . However, the mean amplitude of glucose excursion was positively associated with bilirubin levels in women (r = 0.588, P < 0.001). After adjustment with duration of diabetes, serum albumin, liver enzymes, and mean glucose, the correlation between bilirubin and mean amplitude of glucose excursion remained significant (r = 0.566, P < 0.001). Multiple linear regression analyses showed that bilirubin was an independent determinant for the mean amplitude of glucose excursion in women. 1,5-Anhydroglucitol was also associated with bilirubin levels in women. Bilirubin level within the physiological range might be an independent predictor for glycemic variability in women with type 2 diabetes. © 2016 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.
Association between bilirubin and mode of death in severe systolic heart failure.
Wu, Audrey H; Levy, Wayne C; Welch, Kathleen B; Neuberg, Gerald W; O'Connor, Christopher M; Carson, Peter E; Miller, Alan B; Ghali, Jalal K
2013-04-15
The bilirubin level has been associated with worse outcomes, but it has not been studied as a predictor for the mode of death in patients with systolic heart failure. The Prospective Randomized Amlodipine Evaluation Study (PRAISE) cohort (including New York Heart Association class IIIB-IV patients with left ventricular ejection fraction <30%, n = 1,135) was analyzed, divided by bilirubin level: ≤0.6 mg/dl, group 1; >0.6 to 1.2 mg/dl, group 2; and >1.2 mg/dl, group 3. Multivariate Cox proportional hazards models were used to determine the association of bilirubin with the risk of sudden or pump failure death. Total bilirubin was entered as a base 2 log-transformed variable (log2 bilirubin), indicating doubling of the bilirubin level corresponding to each increase in variable value. The higher bilirubin groups had a lower ejection fraction (range 19% to 21%), sodium (range 138 to 139 mmol/L), and systolic blood pressure (range 111 to 120 mm Hg), a greater heart rate (range 79 to 81 beats/min), and greater diuretic dosages (range 86 to 110 furosemide-equivalent total daily dose in mg). The overall survival rates declined with increasing bilirubin (24.3, 31.3, and 44.3 deaths per 100 person-years, respectively, for groups 1, 2, and 3). Although a positive relation was seen between log2 bilirubin and both pump failure risk and sudden death risk, the relation in multivariate modeling was significant only for pump failure mortality (hazard ratio 1.47, 95% confidence interval 1.19 to 1.82, p = 0.0004), not for sudden death mortality (hazard ratio 1.21, 95% confidence interval 0.98 to 1.49, p = 0.08). In conclusion, an increasing bilirubin level was significantly associated with the risk of pump failure death but not for sudden death in patients with severe systolic heart failure. Copyright © 2013 Elsevier Inc. All rights reserved.
Gambaro, Sabrina E; Robert, Maria C; Tiribelli, Claudio; Gazzin, Silvia
2016-02-01
In the Crigler-Najjar type I syndrome, the genetic absence of efficient hepatic glucuronidation of unconjugated bilirubin (UCB) by the uridine 5'-diphospho-glucuronosyltransferase1A1 (UGT1A1) enzyme produces the rise of UCB level in blood. Its entry to central nervous system could generate toxicity and neurological damage, and even death. In the past years, a compensatory mechanism to liver glucuronidation has been indicated in the hepatic cytochromes P450 enzymes (Cyps) which are able to oxidize bilirubin. Cyps are expressed also in the central nervous system, the target of bilirubin toxicity, thus making them theoretically important to confer a protective activity toward bilirubin accumulation and neurotoxicity. We therefore investigated the functional induction (mRNA, EROD/MROD) and the ability to oxidize bilirubin of Cyp1A1, 1A2, and 2A3 in primary astrocytes cultures obtained from two rat brain region (cortex: Cx and cerebellum: Cll). We observed that Cyp1A1 was the Cyp isoform more easily induced by beta-naphtoflavone (βNF) in both Cx and Cll astrocytes, but oxidized bilirubin only after uncoupling by 3, 4,3',4'-tetrachlorobiphenyl (TCB). On the contrary, Cyp1A2 was the most active Cyp in bilirubin clearance without uncoupling, but its induction was confined only in Cx cells. Brain Cyp2A3 was not inducible. In conclusion, the exposure of astrocytes to βNF plus TCB significantly enhanced Cyp1A1 mediating bilirubin clearance, improving cell viability in both regions. These results may be a relevant groundwork for the manipulation of brain Cyps as a therapeutic approach in reducing bilirubin-induced neurological damage.
Han, Sangbin; Yang, Ju Dong; Sinn, Dong Hyun; Ko, Justin Sangwook; Kim, Jong Man; Shin, Jun Chul; Son, Hee Jeong; Gwak, Mi Sook; Joh, Jae-Won; Kim, Gaab Soo
2016-09-01
Serum bilirubin level, which may reflect the host defense against increased oxidative stress, is inversely associated with the risk of cancer development. In liver transplantation, the intrinsic bilirubin metabolism of donor liver is subsequently translated into recipient. Thus, we hypothesized that liver transplantation conducted with living donors with higher serum bilirubin reduces hepatocellular carcinoma (HCC) recurrence. Two hundred fifty recipients who underwent liver transplantation for treating HCC within the Milan criteria were included in the study. The association between donor preoperative total bilirubin concentration and the risk of HCC recurrence was analyzed using the Fine and Gray regression model with posttransplant death as a competing risk event with adjustment for tumor biology including α-fetoprotein, histological differentiation, and microvascular invasion. All donors were confirmed to have no underlying hepatobiliary diseases or hematological disorders. Donor preoperative total bilirubin concentration was 0.7 mg/dL in median and ranged from 0.2 to 2.7 mg/dL. Thirty-five (14.0%) recipients developed HCC recurrence. Multivariable analysis demonstrated that donor preoperative total bilirubin concentration was inversely associated with the recurrence risk (hazard ratio, 0.22; 95% confidence interval, 0.07-0.72; P = 0.013). The highest (≥1.0 mg/dL) versus lowest (≤0.6 mg/dL) tertile of donor preoperative total bilirubin showed a significant reduction of the recurrence risk (hazard ratio, 0.28; 95% confidence interval, 0.11-0.70; P = 0.006). Hepatocellular carcinoma recurrence risk decreases in relation to the increase in total serum bilirubin level of healthy living donors without underlying hepatobiliary or hematological disorders. Further validation of bilirubin as a potent anticancer substance against HCC is warranted.
Acute Alcohol Consumption Elevates Serum Bilirubin, an Endogenous Antioxidant
O’Malley, Stephanie S.; Gueorguieva, Ralitza; Wu, Ran; Jatlow, Peter I.
2015-01-01
Background Moderate alcohol consumption has been associated with both negative and favorable effects on health. The mechanisms responsible for reported favorable effects remain unclear. Higher (not necessarily elevated) concentrations of serum bilirubin, an antioxidant, have also been associated with reduced risk of cardiovascular disease and all-cause mortality. This study tests the hypothesis that single dose alcohol consumption elevates bilirubin providing a potential link between these observations. Methods 18 healthy individuals (8 cigarette smokers) were administered alcohol, calibrated to achieve blood concentrations of 20, 80 and 120 mg/dL, in random order in 3 laboratory sessions separated by a week. Each session was preceded by and followed by 5–7 days of alcohol abstinence. Serum bilirubin was measured at 7:45 am prior to drinking, at 2 pm, and at 7:45 the next morning. Mixed effects regression models compared baseline and 24 hr. post-drinking bilirubin concentrations. Results Total serum bilirubin (sum of indirect and direct) concentration increased significantly after drinking from baseline to 24 hours in non-smokers (from Mean=0.38, SD=0.24 to Mean=0.51 SD=0.30, F(1, 32.2) =24.24, p<.0001) but not in smokers (from Mean=0.25, SD=0.12 to Mean=0.26, SD=0.15, F(1, 31.1) =0.04, p=0.84). In nonsmokers the indirect bilirubin concentration and the ratio of indirect (unconjugated) to direct (conjugated) bilirubin also increased significantly. Conclusions Alcohol consumption leads to increases in serum bilirubin in nonsmokers. Considering the antioxidant properties of bilirubin, our findings suggest one possible mechanism for the reported association between alcohol consumption and reduced risk of some disorders that could be tested in future longitudinal studies. PMID:25707709
Vogel, Megan E; Idelman, Gila; Konaniah, Eddy S; Zucker, Stephen D
2017-04-01
Numerous epidemiological studies support an inverse association between serum bilirubin levels and the incidence of cardiovascular disease; however, the mechanism(s) by which bilirubin may protect against atherosclerosis is undefined. The goals of the present investigations were to assess the ability of bilirubin to prevent atherosclerotic plaque formation in low-density lipoprotein receptor-deficient ( Ldlr -/- ) mice and elucidate the molecular processes underlying this effect. Bilirubin, at physiological concentrations (≤20 μmol/L), dose-dependently inhibits THP-1 monocyte migration across tumor necrosis factor α-activated human umbilical vein endothelial cell monolayers without altering leukocyte binding or cytokine production. A potent antioxidant, bilirubin effectively blocks the generation of cellular reactive oxygen species induced by the cross-linking of endothelial vascular cell adhesion molecule 1 (VCAM-1) or intercellular adhesion molecule 1 (ICAM-1). These findings were validated by treating cells with blocking antibodies or with specific inhibitors of VCAM-1 and ICAM-1 signaling. When administered to Ldlr -/- mice on a Western diet, bilirubin (30 mg/kg intraperitoneally) prevents atherosclerotic plaque formation, but does not alter circulating cholesterol or chemokine levels. Aortic roots from bilirubin-treated animals exhibit reduced lipid and collagen deposition, decreased infiltration of monocytes and lymphocytes, fewer smooth muscle cells, and diminished levels of chlorotyrosine and nitrotyrosine, without changes in VCAM-1 or ICAM-1 expression. Bilirubin suppresses atherosclerotic plaque formation in Ldlr -/- mice by disrupting endothelial VCAM-1- and ICAM-1-mediated leukocyte migration through the scavenging of reactive oxygen species signaling intermediaries. These findings suggest a potential mechanism for the apparent cardioprotective effects of bilirubin. © 2017 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.
Serum bilirubin levels are inversely associated with PAI-1 and fibrinogen in Korean subjects.
Cho, Hyun Sun; Lee, Sung Won; Kim, Eun Sook; Shin, Juyoung; Moon, Sung Dae; Han, Je Ho; Cha, Bong Yun
2016-01-01
Oxidative stress may contribute to atherosclerosis and increased activation of the coagulation pathway. Bilirubin may reduce activation of the hemostatic system to inhibit oxidative stress, which would explain its cardioprotective properties shown in many epidemiological studies. This study investigated the association of serum bilirubin with fibrinogen and plasminogen activator inhibitor-1 (PAI-1), respectively. A cross-sectional analysis was performed on 968 subjects (mean age, 56.0 ± 11.2 years; 61.1% men) undergoing a general health checkup. Serum biochemistry was analyzed including bilirubin subtypes, insulin resistance (using homeostasis model of assessment [HOMA]), C-reactive protein (CRP), fibrinogen, and PAI-1. Compared with subjects with a total bilirubin (TB) concentration of <10.0 μmol/L, those with a TB concentration of >17.1 μmol/L had a smaller waist circumference, a lower triglyceride level, a lower prevalence of metabolic syndrome, and decreased HOMA-IR and CRP levels. Correlation analysis revealed linear relationships of fibrinogen with TB and direct bilirubin (DB), whereas PAI-1 was correlated with DB. After adjustment for confounding factors, bilirubin levels were inversely associated with fibrinogen and PAI-1 levels, respectively. Multivariate regression models showed a negative linear relationship between all types of bilirubin and fibrinogen, whereas there was a significant linear relationship between PAI-1 and DB. High bilirubin concentrations were independently associated with low levels of fibrinogen and PAI-1, respectively. The association between TB and PAI-1 was confined to the highest TB concentration category whereas DB showed a linear association with PAI-1. Bilirubin may protect against the development of atherothrombosis by reducing the hemostatic response. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Bhardwaj, Kalpana; Locke, Tiffany; Biringer, Anne; Booth, Allyson; Darling, Elizabeth K; Dougan, Shelley; Harrison, Jane; Hill, Stephen; Johnson, Ana; Makin, Susan; Potter, Beth; Lacaze-Masmonteil, Thierry; Little, Julian
2017-01-01
According to the 2004 American Academy of Pediatrics guideline on the management of hyperbilirubinemia, every newborn should be assessed for the risk of developing severe hyperbilirubinemia with the help of predischarge total serum bilirubin or transcutaneous bilirubin measurements and/or assessments of clinical risk factors. The aim of this rapid review is 1) to review the evidence for 1) predicting and preventing severe hyperbilirubinemia and bilirubin encephalopathy, 2) determining the efficacy of home/community treatments (home phototherapy) in the prevention of severe hyperbilirubinemia, and 3) non-invasive/transcutaneous methods for estimating serum bilirubin level. In this rapid review, studies were identified through the Medline database. The main outcomes of interest were severe hyperbilirubinemia and encephalopathy. A subset of articles was double screened and all articles were critically appraised using the SIGN and AMSTAR checklists. This review investigated if systems approach is likely to reduce the occurrence of severe hyperbilirubinemia. Fifty-two studies met the inclusion criteria. Included studies assessed the association between bilirubin measurement early in neonatal life and the subsequent development of severe hyperbilirubinemia and chronic bilirubin encephalopathy/kernicterus. It was observed that, highest priority should be given to (i) universal bilirubin screening programs; (ii) implementation of community and midwife practice; (iii) outreach to communities for education of prospective parents; and (iv) development of clinical pathways to monitor, evaluate and track infants with severe hyperbilirubinemia. We found substantial observational evidence that severe hyperbilirubinemia can be accurately predicted and prevented through universal bilirubin screening. So far, there is no evidence of any harm. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Bilirubin levels and phototherapy use before and after neonatal red blood cell transfusions.
Carroll, Patrick D; Christensen, Robert D; Baer, Vickie L; Sheffield, Mark J; Gerday, Erick; Ilstrup, Sarah J
2016-11-01
Our previous retrospective study suggested that red blood cell (RBC) transfusion of preterm neonates can be associated with an increase in bilirubin, but this has not been tested prospectively. We studied neonates before and after RBC transfusions, recording serial bilirubin levels and whether they qualified for phototherapy. Because lysed RBCs release plasma-free hemoglobin (Hb), a precursor to bilirubin, we also measured plasma free Hb and bilirubin from the donor blood. We studied 50 transfusions given to 39 neonates. Gestation ages of transfused neonates, at birth, were 26 (24-29) weeks (median [interquartile range]); birthweights were 750 (620-1070) g. The study transfusion was given on Day of Life 9.9 (3.4-19.2). In 20% (10/50) phototherapy was being administered at the beginning of and during the transfusion. In these patients neither the 4- to 6- nor the 24- to 36-hour-posttransfusion bilirubin levels were significantly higher than before transfusion. However, in 30% of the others (12/40) phototherapy was started (or restarted) after the transfusion and 15% had a posttransfusion bilirubin increase of at least 2.5 mg/dL. These neonates received donor blood with a higher plasma-free Hb (p < 0.05). Neonates commonly qualify for phototherapy after transfusion. A minority (15% in this series) have a posttransfusion bilirubin increase of at least 2.5 mg/dL. We speculate that neonates qualifying for a RBC transfusion, who are judged to be at high risk for bilirubin-induced neurotoxicity, might benefit from checking their serum bilirubin level after the transfusion and providing donor blood with low plasma-free Hb levels. © 2016 AABB.
Inoue, Tomoaki; Sonoda, Noriyuki; Hiramatsu, Shinsuke; Kimura, Shinichiro; Ogawa, Yoshihiro; Inoguchi, Toyoshi
2018-02-01
Previous studies have shown that serum bilirubin concentration is inversely associated with the risk of cardiovascular disease. The relationship between serum bilirubin concentration and left ventricular geometry, however, has not been investigated in patients with diabetes mellitus. In this cohort study, 158 asymptomatic patients with type 2 diabetes mellitus without overt heart disease were enrolled. Left ventricular structure and function were assessed using echocardiography. Serum bilirubin concentration, glycemic control, lipid profile, and other clinical characteristics were evaluated, and their association with left ventricular geometry was determined. Patients with New York Heart Association Functional Classification greater than I, left ventricular ejection fraction less than 50%, history of coronary artery disease, severe valvulopathy, chronic atrial fibrillation, or creatinine clearance less than 30 ml/min, and those receiving insulin treatment, were excluded. Univariate analyses showed that relative wall thickness (RWT) was significantly correlated with diastolic blood pressure (P = 0.003), HbA1c (P = 0.024), total cholesterol (P = 0.043), urinary albumin (P = 0.023), and serum bilirubin concentration (P = 0.009). There was no association between left ventricular mass index and serum bilirubin concentration. Multivariate linear regression analysis showed that log RWT was positively correlated with diastolic blood pressure (P = 0.010) and that log RWT was inversely correlated with log bilirubin (P = 0.003). In addition, the patients with bilirubin less than 0.8 mg/dl had a higher prevalence of concentric left ventricular remodeling compared with those with bilirubin 0.8 mg/dl or more. Our study shows that the serum bilirubin concentration may be associated with the progression of concentric left ventricular remodeling in patients with type 2 diabetes mellitus.
Watchko, Jon F
2017-01-01
Glucose-6-phosphate dehydrogenase (G6PD) deficiency triggered and low-bilirubin kernicterus persist despite current prevention strategies. Review efforts to eradicate bilirubin induced brain injury in these two conditions including novel approaches to risk assessment and hyperbilirubinemia evaluation. In the case of G6PD deficiency, a heightened awareness of populations at risk and an expanded kernicterus prevention strategy focused on intensified parental engagement, education and counselling on neonatal jaundice is needed. In the case of low-bilirubin kernicterus, a renewed focus on identifying infants with hypoalbuminemia and implementation of hyperbilirubinemia treatment thresholds based on the bilirubin/albumin ratio is needed. Bilirubin binding panels when commercially available will prove valuable. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Adin, Christopher A; VanGundy, Zachary C; Papenfuss, Tracey L; Xu, Feng; Ghanem, Mostafa; Lakey, Jonathan; Hadley, Gregg A
2017-01-24
Bilirubin has been recognized as a powerful cytoprotectant when used at physiologic doses and was recently shown to have immunomodulatory effects in islet allograft transplantation, conveying donor-specific tolerance in a murine model. We hypothesized that bilirubin, an antioxidant, acts to suppress the innate immune response to islet allografts through two mechanisms: 1) by suppressing graft release of damage-associated molecular patterns (DAMPs) and inflammatory cytokines, and 2) by producing a tolerogenic phenotype in antigen-presenting cells. Bilirubin was administered intraperitoneally before pancreatic procurement or was added to culture media after islet isolation in AJ mice. Islets were exposed to transplant-associated nutrient deprivation and hypoxia. Bilirubin significantly decreased islet cell death after isolation and hypoxic stress. Bilirubin supplementation of islet media also decreased the release of DAMPs (HMGB1), inflammatory cytokines (IL-1β and IL-6), and chemokines (MCP-1). Cytoprotection was mediated by the antioxidant effects of bilirubin. Treatment of macrophages with bilirubin induced a regulatory phenotype, with increased expression of PD-L1. Coculture of these macrophages with splenocytes led to expansion of Foxp3+ Tregs. In conclusion, exogenous bilirubin supplementation showed cytoprotective and antioxidant effects in a relevant model of islet isolation and hypoxic stress. Suppression of DAMP release, alterations in cytokine profiles, and tolerogenic effects on macrophages suggest that the use of this natural antioxidant may provide a method of preconditioning to improve outcomes after allograft transplantation.
Adin, Christopher A.; Vangundy, Zachary C.; Papenfuss, Tracey L.; Xu, Feng; Ghanem, Mostafa; Lakey, Jonathan; Hadley, Gregg A.
2017-01-01
Bilirubin has been recognized as a powerful cytoprotectant when used at physiologic doses and was recently shown to have immunomodulatory effects in islet allograft transplantation, conveying donor-specific tolerance in a murine model. We hypothesized that bilirubin, an antioxidant, acts to suppress the innate immune response to islet allografts through two mechanisms: 1) by suppressing graft release of damage-associated molecular patterns (DAMPs) and inflammatory cytokines, and 2) by producing a tolerogenic phenotype in antigen-presenting cells. Bilirubin was administered intraperitoneally before pancreatic procurement or was added to culture media after islet isolation in AJ mice. Islets were exposed to transplant-associated nutrient deprivation and hypoxia. Bilirubin significantly decreased islet cell death after isolation and hypoxic stress. Bilirubin supplementation of islet media also decreased the release of DAMPs (HMGB1), inflammatory cytokines (IL-1β and IL-6), and chemokines (MCP-1). Cytoprotection was mediated by the antioxidant effects of bilirubin. Treatment of macrophages with bilirubin induced a regulatory phenotype, with increased expression of PD-L1. Coculture of these macrophages with splenocytes led to expansion of Foxp3+ Tregs. In conclusion, exogenous bilirubin supplementation showed cytoprotective and antioxidant effects in a relevant model of islet isolation and hypoxic stress. Suppression of DAMP release, alterations in cytokine profiles, and tolerogenic effects on macrophages suggest that the use of this natural antioxidant may provide a method of preconditioning to improve outcomes after allograft transplantation. PMID:27393133
Diagnostic Usefulness of Transcutaneous Bilirubinometry in Very Preterm Newborns
Badiee, Zohreh; Mohammadizadeh, Majid; Shamee, Masih
2012-01-01
Background: This study was performed to find out whether transcutaneous bilirubinometry could be a valid screening method for hyperbilirubinemia in preterm infants, especially for those who needed mechanical ventilation. Methods: We evaluated 63 preterm Iranian newborns who were managed in the neonatal intensive care unit of Shahidbeheshti University Hospital, Isfahan, Iran from April 2009 to April 2010. Transcutaneous bilirubin (TCB) measurements were obtained using BiliCheck™ shortly before or 10 minutes after taking blood for determination of the plasma bilirubin level in premature newborns, who did not receive phototherapy. We assessed the correlation between the transcutaneous bilirubin and plasma bilirubin level by linear regression analysis. We also analyzed the gestational age, birth weight, postnatal age, sex, and hematocrit, for determination of their effect on transcutaneous bilirubin accuracy. Results: The overall bilirubin concentration ranged from 5.4 to 17 mg/dL and from 4.8 to 17.3 mg/dl for total serum bilirubin (TSB) and transcutaneous bilirubin, respectively. The mean values obtained by transcutaneous bilirubinometry were slightly higher than the total TSB values. The correlation coefficient between TSB and TCB was r=0.82, P<0.001, and this was not influenced by gestational age, postnatal age or hematocrit, which were previously considered to be important. The correlation coefficient between TSB and TCB in mechanically ventilated preterm infants was r=0.75, P<0.001. Conclusion: Plasma bilirubin level can be accurately measured by BiliCheck™ in premature newborns, even in newborns who need mechanical ventilation. PMID:22624082
Schaefer, Betti; Schaefer, Franz; Engelmann, Guido; Meyburg, Jochen; Heckert, Karl Heinz; Zorn, Markus; Schmitt, Claus Peter
2011-11-01
Molecular Adsorbents Recirculating System (MARS) is an extracorporeal liver support system eliminating albumin-bound and water-soluble substances. While it is increasingly applied in patients with acute liver failure (ALF), no comparison with standard dialysis methods has yet been performed. This is an analysis of ten children (0.1-18 years) with ALF, who underwent a total of 22 MARS sessions. Standard adult MARS sets were used in seven (23.5-72 kg) and MARS Mini in three children (2.8-13 kg). In eight children, MARS was alternated with combined plasma exchange (PE) and haemodialysis (HD) treatments. Mean treatment duration was 7.2 (6-10) h for MARS and 5.7 (4.5-6.6) h for PE/HD. Standard MARS treatment only slightly decreased serum bilirubin (16.3 ± 6.5-13.8 ± 5.9 mg/dL) and ammonia (113 ± 62-99 ± 68 μmol/L) and international normalized ratio (INR) tended to increase (1.5 ± 0.3 and 2 ± 1.1). Mini-MARS did not reduce serum bilirubin (19.7 ± 3-20.5 ± 3.2 mg/dL), ammonia slightly decreased (70 ± 24-56 ± 9 μmol/L) and INR increased (2.5 ± 0.7-2.9 ± 1.1, all P = n.s.). In contrast, PE/HD reduced serum bilirubin (23 ± 8.4-14.7 ± 7 mg/dL), ammonia (120 ± 60-70 ± 40 μmol/L) and INR (2.4 ± 0.8-1.4 ± 0.1, all P < 0.05). Intraindividual comparison showed a slight increase in bilirubin by 2 ± 22% with MARS and a reduction by 37 ± 11% with PE/HD (P < 0.001 versus MARS) and a decrease in ammonia of 18 ± 27 and 39 ± 23% (P < 0.05). INR increased during MARS by 26 ± 41% and decreased with PE/HD by 37 ± 20% (P < 0.01). All treatment sessions were well tolerated. Five children died, including the three children treated with Mini-MARS. Our experience suggests superior efficacy of combined PE/HD as compared to intermittent MARS therapy for treating ALF.
A Product of Heme Catabolism Modulates Bacterial Function and Survival
Nobles, Christopher L.; Green, Sabrina I.; Maresso, Anthony W.
2013-01-01
Bilirubin is the terminal metabolite in heme catabolism in mammals. After deposition into bile, bilirubin is released in large quantities into the mammalian gastrointestinal (GI) tract. We hypothesized that intestinal bilirubin may modulate the function of enteric bacteria. To test this hypothesis, we investigated the effect of bilirubin on two enteric pathogens; enterohemorrhagic E. coli (EHEC), a Gram-negative that causes life-threatening intestinal infections, and E. faecalis, a Gram-positive human commensal bacterium known to be an opportunistic pathogen with broad-spectrum antibiotic resistance. We demonstrate that bilirubin can protect EHEC from exogenous and host-generated reactive oxygen species (ROS) through the absorption of free radicals. In contrast, E. faecalis was highly susceptible to bilirubin, which causes significant membrane disruption and uncoupling of respiratory metabolism in this bacterium. Interestingly, similar results were observed for other Gram-positive bacteria, including B. cereus and S. aureus. A model is proposed whereby bilirubin places distinct selective pressure on enteric bacteria, with Gram-negative bacteria being protected from ROS (positive outcome) and Gram-positive bacteria being susceptible to membrane disruption (negative outcome). This work suggests bilirubin has differential but biologically relevant effects on bacteria and justifies additional efforts to determine the role of this neglected waste catabolite in disease processes, including animal models. PMID:23935485
Influence of assessment site in measuring transcutaneous bilirubin
da Conceição, Cristiane Maria; Dornaus, Maria Fernanda Pellegrino da Silva; Portella, Maria Aparecida; Deutsch, Alice D'Agostini; Rebello, Celso Moura
2014-01-01
ABSTRACT Objective: To investigate the influence of the site of measurement of transcutaneous bilirubin (forehead or sternum) in reproducibility of results as compared to plasma bilirubin. Methods: A cohort study including 58 term newborns with no hemolytic disease. Transcutaneous measurements were performed on the forehead (halfway between the headline and the glabella, from the left toward the right side, making consecutive determinations, one-centimeter apart) and the sternum (five measurements, from the suprasternal notch to the xiphoid process with consecutive determinations, one-centimeter apart) using Bilicheck® (SpectRx Inc, Norcross, Georgia, USA). The correlation and agreement between both methods and plasma bilirubin were calculated. Results: There was a strong linear correlation between both determinations of serum bilirubin at the forehead and sternum (r=0.704; p<0.01 and r=0.653; p<0.01, respectively). There was correspondence of the mean values of transcutaneous bilirubin measured on the sternum (9.9±2.2mg/dL) compared to plasma levels (10.2±1.7mg/dL), but both differ from the values measured on the forehead (8.6±2.0mg/dL), p<0.05. Conclusion: In newborn term infants with no hemolytic disease, measuring of transcutaneous bilirubin on the sternum had higher accuracy as compared to serum bilirubin measurement on the forehead. PMID:24728239
Biology of Bilirubin Photoisomers.
Hansen, Thor Willy Ruud
2016-06-01
Phototherapy is the main treatment for neonatal hyperbilirubinemia. In acute treatment of extreme hyperbilirubinemia, intensive phototherapy may have a role in 'detoxifying' the bilirubin molecule to more polar photoisomers, which should be less prone to crossing the blood-brain barrier, providing a 'brain-sparing' effect. This article reviews the biology of bilirubin isomers. Although there is evidence supporting the lower toxicity of bilirubin photoisomers, there are studies showing the opposite. There are methodologic weaknesses in most studies and better-designed experiments are needed. In an infant acutely threatened by bilirubin-induced brain damage, intensified phototherapy should be used expediently and aggressively. Copyright © 2016 Elsevier Inc. All rights reserved.
Bilirubin in Urine: MedlinePlus Lab Test Information
... Information → Bilirubin in Urine URL of this page: https://medlineplus.gov/labtests/bilirubininurine.html Bilirubin in Urine ... 2017 Mar 23]; [about 3 screens]. Available from: https://www.liverfoundation.org/for-patients/about-the-liver/ ...
Does bilirubin protect against developing diabetes mellitus?
Breimer, Lars H; Mikhailidis, Dimitri P
2016-01-01
After 25 years of evaluating bilirubin as a possible protective agent in neonatal and cardiovascular disease, interest has moved on to a exploring a possible protective role in diabetes mellitus (DM). This review finds conflicting prospective data for a protective relationship though there are retrospective, case-controlled data, that can only show association, which is not causality. Only prospective studies can show causality. Also, it would appear that the underlying biochemical assumptions do not readily translate from the animal to the human setting. Given that many factors impact on circulating bilirubin levels, it is not surprising that a clear-cut answer is not available; the jury is still out. Any relationship between DM and bilirubin might relate to intermediates in bilirubin metabolism, including relationships involving the genes for the enzymes participating in those steps. Nevertheless, the pursuit of bilirubin in disease causation is opening new avenues for research and if it is established that serum bilirubin can predict risks, much will have been achieved. The answer may have to come from molecular genetic analyses. Copyright © 2016 Elsevier Inc. All rights reserved.
Possible roles of bilirubin and breast milk in protection against retinopathy of prematurity.
Kao, Joanna S; Dawson, Jeffrey D; Murray, Jeffrey C; Dagle, John M; Berends, Susan K; Gillen, Susan B; Bell, Edward F
2011-03-01
To explore the association of serum bilirubin level and breast milk feeding with retinopathy of prematurity (ROP) in preterm infants. We conducted a case-control study to examine the independent and combined effects of serum bilirubin and breast milk feeding on ROP risk in infants <32 weeks gestation or with birth weight <1500 g. Cases (66 infants with ROP) were matched with controls (66 infants without ROP) based on factors known to affect ROP risk. When analysed using the paired t-test, the peak bilirubin levels were lower in ROP cases than in controls (mean 7.2 vs. 7.9 mg/dL; p = 0.045). Using conditional logistic regression, we found a negative association between highest serum bilirubin level and risk of ROP (OR = 0.82 per 1-mg/dL change in bilirubin; p = 0.06). There was no significant association between breast milk feeding and risk of ROP. Bilirubin may help to protect preterm infants against ROP. © 2010 The Author(s)/Acta Paediatrica © 2010 Foundation Acta Paediatrica.
Conjugated Bilirubin Triggers Anemia by Inducing Erythrocyte Death
Lang, Elisabeth; Gatidis, Sergios; Freise, Noemi F; Bock, Hans; Kubitz, Ralf; Lauermann, Christian; Orth, Hans Martin; Klindt, Caroline; Schuier, Maximilian; Keitel, Verena; Reich, Maria; Liu, Guilai; Schmidt, Sebastian; Xu, Haifeng C; Qadri, Syed M; Herebian, Diran; Pandyra, Aleksandra A; Mayatepek, Ertan; Gulbins, Erich; Lang, Florian; Häussinger, Dieter; Lang, Karl S; Föller, Michael; Lang, Philipp A
2015-01-01
Hepatic failure is commonly associated with anemia, which may result from gastrointestinal bleeding, vitamin deficiency, or liver-damaging diseases, such as infection and alcohol intoxication. At least in theory, anemia during hepatic failure may result from accelerated clearance of circulating erythrocytes. Here we show that bile duct ligation (BDL) in mice leads to severe anemia despite increased reticulocyte numbers. Bilirubin stimulated suicidal death of human erythrocytes. Mechanistically, bilirubin triggered rapid Ca2+ influx, sphingomyelinase activation, formation of ceramide, and subsequent translocation of phosphatidylserine to the erythrocyte surface. Consistent with our in vitro and in vivo findings, incubation of erythrocytes in serum from patients with liver disease induced suicidal death of erythrocytes in relation to their plasma bilirubin concentration. Consistently, patients with hyperbilirubinemia had significantly lower erythrocyte and significantly higher reticulocyte counts compared to patients with low bilirubin levels. Conclusion: Bilirubin triggers suicidal erythrocyte death, thus contributing to anemia during liver disease. (Hepatology 2015;61:275–284) PMID:25065608
The effect of oral contraceptive steroids on bile secretion and bilirubin Tm in rats
Heikel, T. A. J.; Lathe, G. H.
1970-01-01
1. The effect of oestrogens and progestogens and their 17α-ethinyl derivatives on bile flow, maximum rate of bilirubin secretion, serum and liver bilirubin has been studied. 2. Both 17α-ethinyl substituted oestrogens and progestogens greatly reduced the basal bile flow. The parent compounds, oestradiol-17β and 19-nortestosterone had little or no effect. 3. A much larger dose of progestogens (40 mg/kg) than oestrogens (5 mg/kg) was needed. 4. Between 12 and 48 h were required for 17α-ethinyloestradiol to produce the effect. 5. Bilirubin maximum secretion rate (Tm) was little affected, the only significant reduction being produced by the 3-methyl ether of 17α-ethinyloestradiol (mestranol). 6. Rises in serum conjugated bilirubin following infusion of bilirubin were produced by 17α-ethinyloestradiol and mestranol but not by the progestogens. PMID:5441412
Oveson, Brian C.; Iwase, Takeshi; Hackett, Sean F.; Lee, Sun Young; Usui, Shinichi; Sedlak, Thomas W.; Snyder, Solomon H.; Campochiaro, Peter A.; Sung, Jennifer U.
2014-01-01
Two constituents of bile, bilirubin and tauroursodeoxycholic acid (TUDCA), have antioxidant activity. However, bilirubin can also cause damage to some neurons and glial cells, particularly immature neurons. In this study, we tested the effects of bilirubin and TUDCA in two models in which oxidative stress contributes to photoreceptor cell death, prolonged light exposure and rd10+/+ mice. In albino BALB/c mice, intraperitoneal (IP) injection of 5 mg/kg of bilirubin or 500 mg/kg of TUDCA prior to exposure to 5,000 lux of white light for 8 hours significantly reduced loss of rod and cone function assessed by electroretinograms (ERGs). Both treatments also reduced light-induced accumulation of superoxide radicals in the outer retina, rod cell death assessed by outer nuclear layer (ONL) thickness, and disruption of cone inner and outer segments. In rd10+/+ mice, IP injections of 5 or 50 mg/kg of bilirubin or 500 mg/kg of TUDCA every 3 days starting at postnatal day (P) 6, caused significant preservation of cone cell number and cone function at P50. Rods were not protected at P50, but both bilirubin and TUDCA provided modest preservation of ONL thickness and rod function at P30. These data suggest that correlation of serum bilirubin levels with rate of vision loss in patients with retinitis pigmentosa (RP) could provide a useful strategy to test the hypothesis that cones die from oxidative damage in patients with RP. If proof-of-concept is established, manipulation of bilirubin levels and administration of TUDCA could be tested in interventional trials. PMID:21054389
Bortolussi, G; Codarin, E; Antoniali, G; Vascotto, C; Vodret, S; Arena, S; Cesaratto, L; Scaloni, A; Tell, G; Muro, A F
2015-01-01
Severe hyperbilirubinemia is toxic during central nervous system development. Prolonged and uncontrolled high levels of unconjugated bilirubin lead to bilirubin-induced encephalopathy and eventually death by kernicterus. Despite extensive studies, the molecular and cellular mechanisms of bilirubin toxicity are still poorly defined. To fill this gap, we investigated the molecular processes underlying neuronal injury in a mouse model of severe neonatal jaundice, which develops hyperbilirubinemia as a consequence of a null mutation in the Ugt1 gene. These mutant mice show cerebellar abnormalities and hypoplasia, neuronal cell death and die shortly after birth because of bilirubin neurotoxicity. To identify protein changes associated with bilirubin-induced cell death, we performed proteomic analysis of cerebella from Ugt1 mutant and wild-type mice. Proteomic data pointed-out to oxidoreductase activities or antioxidant processes as important intracellular mechanisms altered during bilirubin-induced neurotoxicity. In particular, they revealed that down-representation of DJ-1, superoxide dismutase, peroxiredoxins 2 and 6 was associated with hyperbilirubinemia in the cerebellum of mutant mice. Interestingly, the reduction in protein levels seems to result from post-translational mechanisms because we did not detect significant quantitative differences in the corresponding mRNAs. We also observed an increase in neuro-specific enolase 2 both in the cerebellum and in the serum of mutant mice, supporting its potential use as a biomarker of bilirubin-induced neurological damage. In conclusion, our data show that different protective mechanisms fail to contrast oxidative burst in bilirubin-affected brain regions, ultimately leading to neurodegeneration. PMID:25950469
Gao, Chun; Fang, Long; Li, Jing-Tao; Zhao, Hong-Chuan
2016-02-28
To determine the significance of increased serum direct bilirubin level for lymph node metastasis (LNM) in Chinese rectal cancer patients, after those with known hepatobiliary and pancreatic diseases were excluded. A cohort of 469 patients, who were treated at the China-Japan Friendship Hospital, Ministry of Health (Beijing, China), in the period from January 2003 to June 2011, and with a pathological diagnosis of rectal adenocarcinoma, were recruited. They included 231 patients with LNM (49.3%) and 238 patients without LNM. Follow-up for these patients was taken through to December 31, 2012. The baseline serum direct bilirubin concentration was (median/inter-quartile range) 2.30/1.60-3.42 μmol/L. Univariate analysis showed that compared with patients without LNM, the patients with LNM had an increased level of direct bilirubin (2.50/1.70-3.42 vs 2.10/1.40-3.42, P = 0.025). Multivariate analysis showed that direct bilirubin was independently associated with LNM (OR = 1.602; 95%CI: 1.098-2.338, P = 0.015). Moreover, we found that: (1) serum direct bilirubin differs between male and female patients; a higher concentration was associated with poor tumor classification; (2) as the baseline serum direct bilirubin concentration increased, the percentage of patients with LNM increased; and (3) serum direct bilirubin was associated with the prognosis of rectal cancer patients and higher values indicated poor prognosis. Higher serum direct bilirubin concentration was associated with the increased risk of LNM and poor prognosis in our rectal cancers.
Gao, Chun; Fang, Long; Li, Jing-Tao; Zhao, Hong-Chuan
2016-01-01
AIM: To determine the significance of increased serum direct bilirubin level for lymph node metastasis (LNM) in Chinese rectal cancer patients, after those with known hepatobiliary and pancreatic diseases were excluded. METHODS: A cohort of 469 patients, who were treated at the China-Japan Friendship Hospital, Ministry of Health (Beijing, China), in the period from January 2003 to June 2011, and with a pathological diagnosis of rectal adenocarcinoma, were recruited. They included 231 patients with LNM (49.3%) and 238 patients without LNM. Follow-up for these patients was taken through to December 31, 2012. RESULTS: The baseline serum direct bilirubin concentration was (median/inter-quartile range) 2.30/1.60-3.42 μmol/L. Univariate analysis showed that compared with patients without LNM, the patients with LNM had an increased level of direct bilirubin (2.50/1.70-3.42 vs 2.10/1.40-3.42, P = 0.025). Multivariate analysis showed that direct bilirubin was independently associated with LNM (OR = 1.602; 95%CI: 1.098-2.338, P = 0.015). Moreover, we found that: (1) serum direct bilirubin differs between male and female patients; a higher concentration was associated with poor tumor classification; (2) as the baseline serum direct bilirubin concentration increased, the percentage of patients with LNM increased; and (3) serum direct bilirubin was associated with the prognosis of rectal cancer patients and higher values indicated poor prognosis. CONCLUSION: Higher serum direct bilirubin concentration was associated with the increased risk of LNM and poor prognosis in our rectal cancers. PMID:26937145
Santhosh, Mallesh; Chinnadayyala, Somasekhar R; Singh, Naveen K; Goswami, Pranab
2016-10-01
Human serum albumin (HSA)-stabilized Au18 nanoclusters (AuNCs) were synthesized and chemically immobilized on an Indium tin oxide (ITO) plate. The assembly process was characterized by advanced electrochemical and spectroscopic techniques. The bare ITO electrode generated three irreversible oxidation peaks, whereas the HSA-AuNC-modified electrode produced a pair of redox peaks for bilirubin at a formal potential of 0.27V (vs. Ag/AgCl). However, the native HSA protein immobilized on the ITO electrode failed to produce any redox peak for bilirubin. The results indicate that the AuNCs present in HSA act as electron transfer bridge between bilirubin and the ITO plate. Docking studies of AuNC with HSA revealed that the best docked structure of the nanocluster is located around the vicinity of the bilirubin binding site, with an orientation that allows specific oxidation. When the HSA-AuNC-modified electrode was employed for the detection of bilirubin using chronoamperometry at 0.3V (vs. Ag/AgCl), a steady-state current response against bilirubin in the range of 0.2μM to 7μM, with a sensitivity of 0.34μAμM(-1) and limit of detection of 86.32nM at S/N 3, was obtained. The bioelectrode was successfully applied to measure the bilirubin content in spiked serum samples. The results indicate the feasibility of using HSA-AuNC as a biorecognition element for the detection of serum bilirubin levels using an electrochemical technique. Copyright © 2016 Elsevier B.V. All rights reserved.
IN VITRO CHEMO-PREVENTATIVE ACTIVITY OF STRELITZIA NICOLAI ARIL EXTRACT CONTAINING BILIRUBIN.
Dwarka, Depika; Thaver, Veneesha; Naidu, Mickey; Koorbanally, Neil A; Baijnath, And Himansu
2017-01-01
The discovery of the only animal pigment, bilirubin, in the plant Strelitzia nicolai has triggered a vast number of questions regarding bilirubin's formation and its role in the human body. Recent studies have confirmed that bilirubin at certain levels have many medical benefits. Various case studies have revealed that bilirubin is a potent antioxidant. Cervical cancer is one of South Africa's largest womens' health crises. It is estimated that it affects one out of 41 South African women and kills approximately 8 women in the country every day. Thus, the aim of this study was to investigate if the aril extract of Strelitzia nicolai (Regel and Körn.) containing bilirubin possesses anti-cancer activity and to determine its effect on the induction of apoptosis. The DPPH activity was firstly used to determine the antioxidant effect of the extract. Thereafter, the cytotoxic effect was tested using the XTT assay. Apoptosis was confirmed and quantified using the Annexin V-PE kit and the morphology was studied using acridine orange and ethidium bromide. The aril extract decreased cell viability by 52% and induced apoptosis in HeLa cells; as shown by the Annexin V-PE Apoptosis detection kit and morphological studies with acridine orange/ethidium bromide staining. The activity of the extract as a potent antioxidant was immensely enhanced as compared to the bilirubin standard. These results suggest that S. nicolai aril extract containing bilirubin works synergistically as opposed to bilirubin on its own. Furthermore, this extract might be a good candidate for the therapeutic intervention of cervical cancer.
Tsochatzis, Emmanuel A.; Feudjo, Maurille; Rigamonti, Cristina; Vlachogiannakos, Jiannis; Carpenter, James R.; Burroughs, Andrew K.
2013-01-01
Background/Aim. In randomised controlled trials (RCTs) of ursodeoxycholic acid (UDCA), although serum bilirubin is frequently reduced, its effect on disease progression and mortality is unclear. As serum albumin is an established independent prognostic marker, one might expect less deterioration of serum albumin values in a UDCA-treated group. We therefore modelled the typical evolution of serum bilirubin and albumin levels over time in UDCA-untreated patients and compared it with the observed levels in UDCA RCTs. Methods. Multilevel modelling was used to relate the evolution of serum albumin to serum bilirubin and time since patient referral. For each considered RCT, the derived model was used to predict the relationship between final mean serum albumin and bilirubin concentration, adjusted for mean serum albumin at referral and followup duration. Results. Five RCTs were eligible in terms of available data, of which two had long followup. In all trials, serum albumin did not significantly differ between UDCA- and placebo-treated patients, despite the UDCA effect on serum bilirubin. Therefore, there is no evidence over time for changes or maintenance of albumin levels for UDCA-treated patients above the levels predicted for placebo-treated patients. Conclusions. Our findings suggest that UDCA does not alter serum albumin in a way that is consistent with its effect on serum bilirubin. Therefore, reductions in serum bilirubin of UDCA-treated PBC do not parallel another validated and independent prognostic marker, further questioning the validity of serum bilirubin reduction with UDCA as a surrogate therapeutic marker. PMID:23984317
Berkwitt, Adam; Osborn, Rachel; Grossman, Matthew
2015-02-01
There are few data evaluating the role of inpatient rebound bilirubin levels in the management of infants readmitted after their birth hospitalization for indirect hyperbilirubinemia. The goal of the present study was to evaluate the clinical utility of inpatient rebound bilirubin levels within this patient population. A retrospective cohort study was conducted of 226 infants readmitted after their birth hospitalization for indirect hyperbilirubinemia. Data from 130 infants with rebound bilirubin levels drawn at a mean of 6.1±2.4 hours after discontinuation of phototherapy were compared with data from 96 infants without rebound bilirubin levels. The primary outcome was readmission to the hospital, and secondary outcomes included length of stay and discharge time. A subgroup analysis compared characteristics of children who required repeat phototherapy versus those who did not. Overall, 5 of 130 patients from the rebound group were readmitted compared with 4 of 96 patients from the no-rebound group (P=.98). Length of stay was significantly longer for patients with rebound bilirubin levels (27.7 vs 23.2 hours; P=.001). Patients with bilirubin levels lowered to ≤14 mg/dL were less likely to receive repeat phototherapy than those with levels>14 mg/dL (2 of 129 vs 12 of 97; P=.001). Early inpatient rebound bilirubin levels do not successfully predict which patients will require hospital readmission for repeat phototherapy. Children with bilirubin levels lowered to ≤14 mg/dL with phototherapy are unlikely to receive repeat phototherapy. Copyright © 2015 by the American Academy of Pediatrics.
Bortolussi, G; Codarin, E; Antoniali, G; Vascotto, C; Vodret, S; Arena, S; Cesaratto, L; Scaloni, A; Tell, G; Muro, A F
2015-05-07
Severe hyperbilirubinemia is toxic during central nervous system development. Prolonged and uncontrolled high levels of unconjugated bilirubin lead to bilirubin-induced encephalopathy and eventually death by kernicterus. Despite extensive studies, the molecular and cellular mechanisms of bilirubin toxicity are still poorly defined. To fill this gap, we investigated the molecular processes underlying neuronal injury in a mouse model of severe neonatal jaundice, which develops hyperbilirubinemia as a consequence of a null mutation in the Ugt1 gene. These mutant mice show cerebellar abnormalities and hypoplasia, neuronal cell death and die shortly after birth because of bilirubin neurotoxicity. To identify protein changes associated with bilirubin-induced cell death, we performed proteomic analysis of cerebella from Ugt1 mutant and wild-type mice. Proteomic data pointed-out to oxidoreductase activities or antioxidant processes as important intracellular mechanisms altered during bilirubin-induced neurotoxicity. In particular, they revealed that down-representation of DJ-1, superoxide dismutase, peroxiredoxins 2 and 6 was associated with hyperbilirubinemia in the cerebellum of mutant mice. Interestingly, the reduction in protein levels seems to result from post-translational mechanisms because we did not detect significant quantitative differences in the corresponding mRNAs. We also observed an increase in neuro-specific enolase 2 both in the cerebellum and in the serum of mutant mice, supporting its potential use as a biomarker of bilirubin-induced neurological damage. In conclusion, our data show that different protective mechanisms fail to contrast oxidative burst in bilirubin-affected brain regions, ultimately leading to neurodegeneration.
The Respiratory System and Diazotrophic Activity of Acetobacter diazotrophicus PAL5
Flores-Encarnación, M.; Contreras-Zentella, M.; Soto-Urzua, L.; Aguilar, G. R.; Baca, B. E.; Escamilla, J. E.
1999-01-01
The characteristics of the respiratory system of Acetobacter diazotrophicus PAL5 were investigated. Increasing aeration (from 0.5 to 4.0 liters of air min−1 liter of medium−1) had a strong positive effect on growth and on the diazotrophic activity of cultures. Cells obtained from well-aerated and diazotrophically active cultures possessed a highly active, membrane-bound electron transport system with dehydrogenases for NADH, glucose, and acetaldehyde as the main electron donors. Ethanol, succinate, and gluconate were also oxidized but to only a minor extent. Terminal cytochrome c oxidase-type activity was poor as measured by reduced N,N,N,N′-tetramethyl-p-phenylenediamine, but quinol oxidase-type activity, as measured by 2,3,5,6-tetrachloro-1,4-benzenediol, was high. Spectral and high-pressure liquid chromatography analysis of membranes revealed the presence of cytochrome ba as a putative oxidase in cells obtained from diazotrophically active cultures. Cells were also rich in c-type cytochromes; four bands of high molecular mass (i.e., 67, 56, 52, and 45 kDa) were revealed by a peroxidase activity stain in sodium dodecyl sulfate-polyacrylamide gel electrophoresis. KCN inhibition curves of respiratory oxidase activities were biphasic, with a highly resistant component. Treatment of membranes with 0.2% Triton X-100 solubilized c-type cytochromes and resulted in a preparation that was significantly more sensitive to cyanide. Repression of diazotrophic activity in well-aerated cultures by 40 mM (NH4)2SO4 caused a significant decrease of the respiratory activities. It is noteworthy that the levels of glucose dehydrogenase and putative oxidase ba decreased 6.8- and 10-fold, respectively. In these cells, a bd-type cytochrome seems to be the major terminal oxidase. Thus, it would seem that glucose dehydrogenase and cytochrome ba are key components of the respiratory system of A. diazotrophicus during aerobic diazotrophy. PMID:10559164
Amin, Sanjiv B; Wang, Hongyue; Laroia, Nirupama; Orlando, Mark
2016-01-01
Objective To evaluate if unbound bilirubin is a better predictor of auditory neuropathy spectrum disorder (ANSD) than total serum bilirubin (TSB) or the bilirubin albumin molar ratio (BAMR) in late preterm and term neonates with severe jaundice (TSB ≥ 20 mg/dL or TSB that met exchange transfusion criteria). Study design Infants ≥ 34 weeks gestational age with severe jaundice during the first two weeks of life were eligible for the prospective observational study. A comprehensive auditory evaluation was performed within 72 hours of peak TSB. ANSD was defined as absent or abnormal auditory brainstem evoked response waveform morphology at 80 decibel click intensity in the presence of normal outer hair cell function. TSB, serum albumin, and unbound bilirubin were measured using the colorimetric, bromocresol green, and modified peroxidase method, respectively. Results Five of 44 infants developed ANSD. By logistic regression, peak unbound bilirubin but not peak TSB or peak BAMR was associated with ANSD (odds ratio 4.6, 95% CI: 1.6-13.5, p = 0.002). On comparing receiver operating characteristic curves, the area under the curve (AUC) for unbound bilirubin (0.92) was significantly greater (p = 0.04) compared with the AUC for TSB (0.50) or BAMR (0.62). Conclusions Unbound bilirubin is a more sensitive and specific predictor of ANSD than TSB or BAMR in late preterm and term infants with severe jaundice. PMID:26952116
Ma, Chun Fang; Gao, Qiang; Xia, Kai Sheng; Huang, Zhi Yuan; Han, Bo; Zhou, Cheng Gang
2017-01-01
The development of bilirubin adsorbents with high adsorption efficiencies towards albumin-bonded bilirubin is still a considerable challenge. In this work, a three-dimensionally porous graphene (3D-pGR) has been fabricated through a simple carbon dioxide (CO 2 ) activation of thermally exfoliated graphite oxide (EGO). Intriguingly, the resultant 3D-pGR material showed hierarchically micro-meso-macroporous structure, high specific surface area of up to 843m 2 g -1 , and large pore volume as high as 2.71cm 3 g -1 . Besides, the large planar π-configuration structure of 3D-pGR made it possible to compete effectively with albumin for bilirubin binding. Taking advantages of these fantastic characteristics, the 3D-pGR was demonstrated to be extraordinarily efficient for bilirubin removal from a bovine serum albumin (BSA)-rich solution. Under optimized conditions, the maximum adsorption capacity of 3D-pGR for BSA-bonded bilirubin was up to 126.1mgg -1 , which is not only significantly higher than the adsorption capacities of currently available adsorbents towards albumin-bonded bilirubin, but also superior to those of many reported adsorbents towards free bilirubin. In addition, the hemolysis assay of 3D-pGR indicated that this material had negligible hemolysis effect. Findings from this study may open up important new possibilities for removal of protein-bonded toxins. Copyright © 2016 Elsevier B.V. All rights reserved.
Change in Serum Bilirubin Level as a Predictor of Incident Metabolic Syndrome.
Lee, You-Bin; Lee, Seung-Eun; Jun, Ji Eun; Jee, Jae Hwan; Bae, Ji Cheol; Jin, Sang-Man; Kim, Jae Hyeon
2016-01-01
Serum bilirubin level was negatively associated with the prevalence of metabolic syndrome (MetS) in previous cross-sectional studies. However, bilirubin variance preceding the development of MetS has yet to be investigated. We aimed to determine the effect of change in bilirubin concentration on the risk of incident MetS in healthy Korean adults. We conducted a retrospective longitudinal study of subjects who had undergone at least four yearly health check-ups between 2006 and 2012. Of 24,185 total individuals who received annual check-ups, 11,613 non-MetS participants with a baseline bilirubin level not exceeding 34.2 μmol/l were enrolled. We evaluated the association between percent change in bilirubin and risk of incident MetS. During 55,407 person-years of follow-up, 2,439 cases of incident MetS developed (21.0%). Baseline serum bilirubin level clearly showed no association with the development of MetS in men but an independent significant inverse association in women which attenuated (hence may be mediated) by elevated homeostatic model assessment index 2 for insulin resistance (HOMA2-IR). However, increased risk for incident MetS was observed in higher percent change in bilirubin quartiles, with hazard ratios of 2.415 (95% CI 2.094-2.785) in men and 2.156 (95% CI 1.738-2.675) in women in the fourth quartile, compared to the lowest quartile, after adjusting for age, smoking status, medication history, alanine aminotransferase, uric acid, estimated glomerular filtration rate, fasting glucose, baseline diabetes mellitus prevalence, systolic blood pressure, waist circumference, and body mass index. The hazard ratios per one standard deviation increase in percent change in bilirubin as a continuous variable were 1.277 (95% CI 1.229-1.326) in men and 1.366 (95% CI 1.288-1.447) in women. Increases in serum bilirubin concentration were positively associated with a higher risk of incident MetS. Serum bilirubin increment might be a sensitive marker for the development of MetS.
Change in Serum Bilirubin Level as a Predictor of Incident Metabolic Syndrome
Lee, You-Bin; Lee, Seung-Eun; Jun, Ji Eun; Jee, Jae Hwan; Bae, Ji Cheol; Jin, Sang-Man; Kim, Jae Hyeon
2016-01-01
Aim Serum bilirubin level was negatively associated with the prevalence of metabolic syndrome (MetS) in previous cross-sectional studies. However, bilirubin variance preceding the development of MetS has yet to be investigated. We aimed to determine the effect of change in bilirubin concentration on the risk of incident MetS in healthy Korean adults. Methods We conducted a retrospective longitudinal study of subjects who had undergone at least four yearly health check-ups between 2006 and 2012. Of 24,185 total individuals who received annual check-ups, 11,613 non-MetS participants with a baseline bilirubin level not exceeding 34.2 μmol/l were enrolled. We evaluated the association between percent change in bilirubin and risk of incident MetS. Results During 55,407 person-years of follow-up, 2,439 cases of incident MetS developed (21.0%). Baseline serum bilirubin level clearly showed no association with the development of MetS in men but an independent significant inverse association in women which attenuated (hence may be mediated) by elevated homeostatic model assessment index 2 for insulin resistance (HOMA2-IR). However, increased risk for incident MetS was observed in higher percent change in bilirubin quartiles, with hazard ratios of 2.415 (95% CI 2.094–2.785) in men and 2.156 (95% CI 1.738–2.675) in women in the fourth quartile, compared to the lowest quartile, after adjusting for age, smoking status, medication history, alanine aminotransferase, uric acid, estimated glomerular filtration rate, fasting glucose, baseline diabetes mellitus prevalence, systolic blood pressure, waist circumference, and body mass index. The hazard ratios per one standard deviation increase in percent change in bilirubin as a continuous variable were 1.277 (95% CI 1.229–1.326) in men and 1.366 (95% CI 1.288–1.447) in women. Conclusions Increases in serum bilirubin concentration were positively associated with a higher risk of incident MetS. Serum bilirubin increment might be a sensitive marker for the development of MetS. PMID:27936224
Sytykiewicz, Hubert
2016-07-22
Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.
Nah, Hyunjin; Lee, Sang-Guk; Lee, Kyeong-Seob; Won, Jae-Hee; Kim, Hyun Ok; Kim, Jeong-Ho
2016-02-01
The aim of this study was to estimate bilirubin interference and accuracy of six routine methods for measuring creatinine compared with isotope dilution-liquid chromatography mass spectrometry (ID-LC/MS). A total of 40 clinical serum samples from 31 patients with serum total bilirubin concentration >68.4μmol/L were collected. Serum creatinine was measured using two enzymatic reagents and four Jaffe reagents as well as ID-LC/MS. Correlations between bilirubin concentration and percent difference in creatinine compared with ID-LC/MS were analyzed to investigate bilirubin interference. Bias estimations between the six reagents and ID-LC/MS were performed. Recovery tests using National Institute of Standards and Technology (NIST) Standard Reference Material (SRM) 967a were also performed. Both the enzymatic methods showed no bilirubin interference. However, three of the four Jaffe methods demonstrated significant bilirubin concentration-dependent interference in samples with creatinine levels <53μmol/L, and two of them showed significant bilirubin interference in samples with creatinine levels ranging from 53.0 to 97.2μmol/L. Comparison of these methods with ID-LC/MS using patients' samples with elevated bilirubin revealed that the tested methods failed to achieve the bias goal at especially low levels of creatinine. In addition, recovery test using NIST SRM 967a showed that bias in one Jaffe method and two enzymatic methods did not achieve the bias goal at either low or high level of creatinine, indicating they had calibration bias. One enzymatic method failed to achieve all the bias goals in both comparison experiment and recovery test. It is important to understand that both bilirubin interference and calibration traceability to ID-LC/MS should be considered to improve the accuracy of creatinine measurement. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
Kohlova, Michaela; Bronze-da-Rocha, Elsa; Fernandes, João; Costa, Elísio; Catarino, Cristina; Aires, Luísa; Mansilha, Helena Ferreira; Rocha-Pereira, Petronila; Quintanilha, Alexandre; Rêgo, Carla; Santos-Silva, Alice
2014-01-01
Objectives Bilirubin has potential antioxidant and anti-inflammatory properties. The UGT1A1*28 polymorphism (TA repeats in the promoter region) is a major determinant of bilirubin levels and recent evidence suggests that raised adiposity may also be a contributing factor. We aimed to study the interaction between UGT1A1 polymorphism, hematological and anthropometric variables with total bilirubin levels in young individuals. Methods 350 obese (mean age of 11.6 years; 52% females) and 79 controls (mean age of 10.5 years; 59% females) were included. Total bilirubin and C-reactive protein (CRP) plasma levels, hemogram, anthropometric data and UGT1A1 polymorphism were determined. In a subgroup of 74 obese and 40 controls body composition was analyzed by dual-energy X-ray absorptiometry. Results The UGT1A1 genotype frequencies were 49.9%, 42.7% and 7.5% for 6/6, 6/7 and 7/7 genotypes, respectively. Patients with 7/7 genotype presented the highest total bilirubin levels, followed by 6/7 and 6/6 genotypes. Compared to controls, obese patients presented higher erythrocyte count, hematocrit, hemoglobin and CRP levels, but no differences in bilirubin or in UGT1A1 genotype distribution. Body fat percentage was inversely correlated with bilirubin in obese patients but not in controls. This inverse association was observed either in 6/7 or 6/6 genotype obese patients. UGT1A1 polymorphism and body fat percentage were the main factors affecting bilirubin levels within obese patients (linear regression analysis). Conclusion In obese children and adolescents, body fat composition and UGT1A1 polymorphism are independent determinants of total bilirubin levels. Obese individuals with 6/6 UGT1A1 genotype and higher body fat mass may benefit from a closer clinical follow-up. PMID:24901842
Bockor, Luka; Bortolussi, Giulia; Vodret, Simone; Iaconcig, Alessandra; Jašprová, Jana; Zelenka, Jaroslav; Vitek, Libor; Tiribelli, Claudio; Muro, Andrés F
2017-01-01
Moderate neonatal jaundice is the most common clinical condition during newborn life. However, a combination of factors may result in acute hyperbilirubinemia, placing infants at risk of developing bilirubin encephalopathy and death by kernicterus. While most risk factors are known, the mechanisms acting to reduce susceptibility to bilirubin neurotoxicity remain unclear. The presence of modifier genes modulating the risk of developing bilirubin-induced brain damage is increasingly being recognised. The Abcb1 and Abcc1 members of the ABC family of transporters have been suggested to have an active role in exporting unconjugated bilirubin from the central nervous system into plasma. However, their role in reducing the risk of developing neurological damage and death during neonatal development is still unknown.To this end, we mated Abcb1a/b-/- and Abcc1-/- strains with Ugt1-/- mice, which develop severe neonatal hyperbilirubinemia. While about 60% of Ugt1-/- mice survived after temporary phototherapy, all Abcb1a/b-/-/Ugt1-/- mice died before postnatal day 21, showing higher cerebellar levels of unconjugated bilirubin. Interestingly, Abcc1 role appeared to be less important.In the cerebellum of Ugt1-/- mice, hyperbilirubinemia induced the expression of Car and Pxr nuclear receptors, known regulators of genes involved in the genotoxic response.We demonstrated a critical role of Abcb1 in protecting the cerebellum from bilirubin toxicity during neonatal development, the most clinically relevant phase for human babies, providing further understanding of the mechanisms regulating bilirubin neurotoxicity in vivo. Pharmacological treatments aimed to increase Abcb1 and Abcc1 expression, could represent a therapeutic option to reduce the risk of bilirubin neurotoxicity. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Bilirubin as a potential causal factor in type 2 diabetes risk: a Mendelian randomization study
Abbasi, Ali; Deetman, Petronella E.; Corpeleijn, Eva; Gansevoort, Ron T.; Gans, Rijk O.B.; Hillege, Hans L.; van der Harst, Pim; Stolk, Ronald P.; Navis, Gerjan; Alizadeh, Behrooz Z.; Bakker, Stephan J.L.
2014-01-01
Circulating bilirubin, a natural antioxidant, is associated with decreased risk of type 2 diabetes (T2D), but the nature of the relationship remains unknown. We performed Mendelian randomization in a prospective cohort of 3,381 participants free of diabetes at baseline (aged 28-75 years; women, 52.6%). We used rs6742078 located in UDP-glucuronosyltransferase (UGT1A1) locus as instrumental variable (IV) to study a potential causal effect of serum total bilirubin on T2D risk. T2D developed in a total of 210 (6.2%) participants during a median follow-up of 7.8 years. In adjusted analyses, rs6742078, which explained 19.5% of bilirubin variation, was strongly associated with total bilirubin (a 0.68-SD increase in bilirubin levels per T allele; P<1×10−122) and was also associated with T2D risk (OR 0.69 [95%CI, 0.54-0.90]; P=0.006). Per 1-SD increase in log-transformed bilirubin levels, we observed a 25% (OR 0.75 [95%CI, 0.62-0.92]; P=0.004) lower risk of T2D. In Mendelian randomization analysis, the causal risk reduction for T2D was estimated to be 42% (causal ORIVestimation per 1-SD increase in log-transformed bilirubin 0.58 [95%CI, 0.39-0.84]; P=0.005), which was comparable to the observational estimate (Durbin-Wu-Hausman chi-square test Pfor difference =0.19). These novel results provide evidence that elevated bilirubin is causally associated with risk of T2D and support its role as a protective determinant. PMID:25368098
Peeters, Bart; Geerts, Inge; Van Mullem, Mia; Micalessi, Isabel; Saegeman, Veroniek; Moerman, Jan
2016-05-01
Many hospitals opt for early postnatal discharge of newborns with a potential risk of readmission for neonatal hyperbilirubinemia. Assays/algorithms with the possibility to improve prediction of significant neonatal hyperbilirubinemia are needed to optimize screening protocols and safe discharge of neonates. This study investigated the predictive value of umbilical cord blood (UCB) testing for significant hyperbilirubinemia. Neonatal UCB bilirubin, UCB direct antiglobulin test (DAT), and blood group were determined, as well as the maternal blood group and the red blood cell antibody status. Moreover, in newborns with clinically apparent jaundice after visual assessment, plasma total bilirubin (TB) was measured. Clinical factors positively associated with UCB bilirubin were ABO incompatibility, positive DAT, presence of maternal red cell antibodies, alarming visual assessment and significant hyperbilirubinemia in the first 6 days of life. UCB bilirubin performed clinically well with an area under the receiver-operating characteristic curve (AUC) of 0.82 (95 % CI 0.80-0.84). The combined UCB bilirubin, DAT, and blood group analysis outperformed results of these parameters considered separately to detect significant hyperbilirubinemia and correlated exponentially with hyperbilirubinemia post-test probability. Post-test probabilities for neonatal hyperbilirubinemia can be calculated using exponential functions defined by UCB bilirubin, DAT, and ABO compatibility results. • The diagnostic value of the triad umbilical cord blood bilirubin measurement, direct antiglobulin testing and blood group analysis for neonatal hyperbilirubinemia remains unclear in literature. • Currently no guideline recommends screening for hyperbilirubinemia using umbilical cord blood. What is New: • Post-test probability for hyperbilirubinemia correlated exponentially with umbilical cord blood bilirubin in different risk groups defined by direct antiglobulin test and ABO blood group compatibility results. • Exponential functions can be used to calculate hyperbilirubinemia probability.
Wang, Dongdong; Tosevska, Anela; Heiß, Elke H; Ladurner, Angela; Mölzer, Christine; Wallner, Marlies; Bulmer, Andrew; Wagner, Karl-Heinz; Dirsch, Verena M; Atanasov, Atanas G
2017-04-28
Mild but chronically elevated circulating unconjugated bilirubin is associated with reduced total and low-density lipoprotein cholesterol concentration, which is associated with reduced cardiovascular disease risk. We aimed to investigate whether unconjugated bilirubin influences macrophage cholesterol efflux, as a potential mechanism for the altered circulating lipoprotein concentrations observed in hyperbilirubinemic individuals. Cholesterol efflux from THP-1 macrophages was assessed using plasma obtained from normo- and hyperbilirubinemic (Gilbert syndrome) humans (n=60 per group) or (heterozygote/homozygote Gunn) rats (n=20 per group) as an acceptor. Hyperbilirubinemic plasma from patients with Gilbert syndrome and Gunn rats induced significantly reduced cholesterol efflux compared with normobilirubinemic plasma. Unconjugated bilirubin (3-17.1 μmol/L) exogenously added to plasma- or apolipoprotein A1-supplemented media also decreased macrophage cholesterol efflux in a concentration- and time-dependent manner. We also showed reduced protein expression of the ATP-binding cassette transporter A1 (ABCA1), a transmembrane cholesterol transporter involved in apolipoprotein A1-mediated cholesterol efflux, in THP-1 macrophages treated with unconjugated bilirubin and in peripheral blood mononuclear cells obtained from hyperbilirubinemic individuals. Furthermore, we demonstrated that bilirubin accelerates the degradation rate of the ABCA1 protein in THP-1 macrophages. Cholesterol efflux from THP-1 macrophages is decreased in the presence of plasma obtained from humans and rats with mild hyperbilirubinemia. A direct effect of unconjugated bilirubin on cholesterol efflux was demonstrated and is associated with decreased ABCA1 protein expression. These data improve our knowledge concerning bilirubin's impact on cholesterol transport and represent an important advancement in our understanding of bilirubin's role in cardiovascular disease. © 2017 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.
Elevated serum bilirubin levels are inversely associated with coronary artery atherosclerosis.
Kang, Seung Joo; Kim, Donghee; Park, Hyo Eun; Chung, Goh Eun; Choi, Seung Ho; Choi, Su-Yeon; Lee, Whal; Kim, Joo Sung; Cho, Sang-Heon
2013-10-01
Inverse correlations of high serum bilirubin with metabolic and cardiovascular disease have been suggested. However, anti-atherogenic effects of bilirubin have not been well-established in terms of the presence of plaques and stenosis identified in coronary computed tomography (CT). A cross-sectional study was conducted on 2862 men who were free of cardiovascular disease and underwent coronary CT as part of a routine medical screening examination. Coronary stenotic lesions were considered to be incidences of coronary atherosclerosis, and stenosis was classified as stenosis <50% or ≥50%, according to degree of stenosis. The prevalences of coronary atherosclerosis and stenosis ≥50% in subjects with elevated bilirubin levels (>1.2 mg/dL) were lower than those in subjects with normal bilirubin levels (≤1.2 mg/dL) (19.9% vs. 27.9%, p < 0.001, 8.5% vs. 10.3%, p = 0.044). Bilirubin was inversely associated with total plaques (odds ratio [OR] 0.59, 95% confidence interval [CI] 0.48-0.73 in the 4th quartile vs. 1st quartile) and calcified plaques (OR 0.60, 95% CI 0.49-0.75) in univariate analysis. After adjusting for traditional risk factors, it was found that coronary atherosclerosis (OR 0.73, 95% CI 0.56-0.94 in the 4th quartile vs. 1st quartile) and calcified plaque (OR 0.66, 95% CI 0.53-0.84) were inversely associated with the bilirubin grade in a dose-dependent manner. The serum bilirubin level was inversely associated with coronary atherosclerosis and calcified plaques in a dose-dependent manner. These results suggested that serum bilirubin could be used as a protective biomarker of coronary artery disease. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Lano, Ian Marie; Lyon, Andrew W; Wang, Li; Ruskin, Rob; Lyon, Martha E
2018-03-01
Clinically significant variation has been reported within and between plasma and whole blood total bilirubin methods used to identify neonates for whom clinical intervention for hyperbilirubinemia may be required. To evaluate total bilirubin measurements between the Radiometer whole blood co-oximeter and plasma bilirubin methods from Roche Diagnostics and Ortho Clinical Diagnostics using neonatal specimens. Total bilirubin levels were analyzed by whole blood co-oximetry (Radiometer® ABL90). Specimens were centrifuged and plasma analyzed for total bilirubin with a diazo method (Roche Cobas® C-601) and a reflectance spectrophotometric BuBc dry film method (Ortho Clinical Diagnostics VITROS® 350). Results were evaluated by regression, Bland-Altman comparisons and t-tests. The patient correlation study yielded the following regression equations in μmol/L: a) Radiometer=1.03 Roche - 3.5μmol/L b) Radiometer=0.98 Ortho - 5.7μmol/L c) Roche=0.97 Ortho - 2.4μmol/L. The mean bias over the range of total bilirubin levels examined was -1.0μmol/L for the Radiometer versus the Roche (p≤0.305); -4.4μmol/L for the Radiometer versus Ortho (p≤0.005) and -4.4μmol/L for the Roche versus Ortho (p≤0.002). Whole blood total bilirubin measurement using the Radiometer ABL90 blood gas analyzer provides accurate and precise results compared to the Roche plasma diazo method. Compared to the reflectance spectrophotometric method, results are precise and had a small but statistically significant bias of -4.4μmol/L. Copyright © 2017 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
Changes of liver enzymes and bilirubin during ischemic stroke: mechanisms and possible significance
2014-01-01
Background Small changes of bilirubin and liver enzymes are often detected during the acute phase of stroke, but their origin and significance are still poorly understood. Methods On days 0, 3, 7, and 14 after admission, 180 patients with ischemic stroke underwent serial determinations of bilirubin, GOT, GPT, γGT, alkaline phosphatase, C-reactive protein (CRP) and complete blood count. On days 0 and 7 common bile duct diameter was measured by ultrasound, and on day 3 cerebral infarct volume (IV) was calculated from CT scan slices. Results During the first week GOT, GPT, γGT (P < 0.001) and CRP (P = 0.03) increased with subsequent plateau, while significant decrements (P < 0.001) concerned unconjugated bilirubin, erythrocytes and haemoglobin. Alkaline phosphatase, direct bilirubin and common bile duct diameter remained stable. IV correlated with CRP, leukocytes, GOT, γGT (r > 0.3, P < 0.001 for all) and direct bilirubin (r = 0.23, P = 0.008). In multivariate analysis only CRP and GOT remained independently associated with IV (P < =0.001). The correlation of IV with GOT increased progressively from admission to day 14. GOT independently correlated with GPT which, in turn, correlated with γGT. γGT was also highly correlated with leukocytes. Unconjugated bilirubin correlated with haemoglobin, which was inversely correlated with CRP. Conclusions The changes of bilirubin and liver enzymes during ischemic stroke reflect two phenomena, which are both related to IV: 1) inflammation, with consequent increment of CRP, leukocytes and γGT, and decrease of haemoglobin and unconjugated bilirubin and 2) an unknown signal, independent from inflammation, leading to increasing GOT and GPT levels. PMID:24903748
Fluorescence sensor for the quantification of unbound bilirubin concentrations.
Huber, Andrew H; Zhu, Baolong; Kwan, Thomas; Kampf, J Patrick; Hegyi, Thomas; Kleinfeld, Alan M
2012-05-01
Hyperbilirubinemia in jaundiced neonates is routinely assessed by use of total serum bilirubin. However, the unbound or free form (B(f)), not total bilirubin, crosses the blood-brain barrier and can be neurotoxic. Although the peroxidase-mediated oxidation of bilirubin can be used to measure plasma concentrations of B(f), this measurement is relatively complex and the assay is not routinely used. We describe a fluorescence sensor for quantifying B(f) in plasma. Our method uses a mutated fatty acid binding protein labeled with the fluorescent molecule acrylodan (BL22P1B11), whose fluorescence is quenched upon binding bilirubin. Another configuration (BL22P1B11-Rh) was developed that uses BL22P1B11 together with the fluorophore rhodamine B, which responds by a change in the ratio of its fluorescence. The "B(f) probes" were calibrated with aqueous solutions of bilirubin and yielded similar bilirubin dissociation constants [K(d) = 16 (1.5) nmol/L]. We used the probes to determine B(f) concentrations in equilibrium with human serum albumin (HSA) and in human plasma samples supplemented with bilirubin. We obtained equivalent B(f) values in both systems, and the B(f) probe results were in agreement with the peroxidase assay. B(f) measurements revealed that bilirubin-HSA binding was well described by 2 sites with K(d) values of 15.4 (1) nmol/L and 748 (14) nmol/L. We measured B(f) concentrations in the range expected in jaundiced neonates with a mean CV of approximately 3%. The BL22P1B11-Rh probe provides accurate plasma sample B(f) concentrations with a single measurement, in 1 min with either a handheld B(f) meter or a laboratory fluorometer.
Jung, Chang Hee; Lee, Min Jung; Kang, Yu Mi; Hwang, Jenie Yoonoo; Jang, Jung Eun; Leem, Jaechan; Park, Joong-Yeol; Kim, Hong-Kyu; Lee, Woo Je
2014-01-01
Bilirubin, a natural product of heme catabolism by heme oxygenase, one of key antioxidant enzymes, has been recognized as a substance with potent antioxidant and cytoprotective properties. Several studies have shown a significant negative relationship between serum bilirubin levels and the risk of metabolic disorders, including type 2 diabetes. However, longitudinal studies investigating the association of elevated serum bilirubin levels and type 2 diabetes are lacking. In the present study, we aimed to investigate the longitudinal effects of baseline serum bilirubin concentrations on the development of type 2 diabetes in healthy Korean men. This 4 year retrospective longitudinal observational study was conducted at the Asan Medical Center, Seoul, Republic of Korea. The study population consisted of 5960 men without type 2 diabetes who underwent routine health examinations in 2007 (baseline) and 2011 (follow-up). Baseline serum bilirubin concentrations were determined by the vanadate oxidation method. During a 4 year period, 409 incident cases of diabetes (6.9 %) were identified. Incident type 2 diabetes decreased across the baseline bilirubin quartile categories (P for trend <0.001). In multivariable-adjusted model, the relative risk (RR) for the development of type 2 diabetes was significantly lower in the highest (i.e., 1.30-2.00 mg/dl) than in the lowest bilirubin quartile category (i.e., ≤ 0.90 mg/dl), even after adjustment for confounding variables (RR=0.69, 95% confidence interval 0.48-0.99, P for trend = 0.041). The results indicate that serum total bilirubin level may provide additional information for predicting future development of type 2 diabetes in healthy subjects. © 2013.
The molecular basis of jaundice: An old symptom revisited.
Gazzin, Silvia; Masutti, Flora; Vitek, Libor; Tiribelli, Claudio
2017-08-01
Increased serum bilirubin level is a widely used diagnostic marker for hepatic illnesses. Nevertheless, mild elevation of unconjugated serum bilirubin (such as in Gilbert syndrome) has been recently demonstrated to correlate with low risk of chronic inflammatory and/or oxidative stress-mediated diseases. In accord, a low serum bilirubin level has emerged as an important predisposing factor or a biomarker of these pathologic conditions including cardiovascular, tumour, and possibly neurodegenerative diseases. Bilirubin possesses multiple biological actions with interaction in a complex network of enzymatic and signalling pathways. The fact that the liver is the main organ controlling the bioavailability of bilirubin emphasizes the central role of this organ in human health. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Kalhan, Tamara G; Bateman, David A; Bowker, Rakhee M; Hod, Eldad A; Kashyap, Sudha
2017-12-01
BackgroundProlonged storage of transfused red blood cells (RBCs) is associated with hemolysis in healthy adults and inflammation in animal models. We aimed to determine whether storage duration affects markers of hemolysis (e.g., serum bilirubin, iron, and non-transferrin-bound iron (NTBI)) and inflammation (e.g., interleukin (IL)-8 and monocyte chemoattractant protein (MCP)-1) in transfused very low birth weight (VLBW) infants.MethodsBlood samples from 23 independent transfusion events were collected by heel stick before and 2-6 h after transfusion.ResultsSerum iron, total bilirubin, NTBI, and MCP-1 levels were significantly increased after transfusion of RBCs (P<0.05 for each comparison). The storage age of transfused RBCs positively correlated with increases in NTBI following transfusion (P<0.001; R 2 =0.44). No associations between storage duration and changes in the other analytes were observed.ConclusionTransfusion of RBCs into VLBW infants is associated with increased markers of hemolysis and the inflammatory chemokine MCP-1. RBC-storage duration only correlated with increases in NTBI levels following transfusion. NTBI was only observed in healthy adults following 35 days of storage; however, this study suggests that VLBW infants are potentially more susceptible to produce this pathological form of iron, with increased levels observed after transfusion of only 20-day-old RBCs.
Influence of hemoglobin on non-invasive optical bilirubin sensing
NASA Astrophysics Data System (ADS)
Jiang, Jingying; Gong, Qiliang; Zou, Da; Xu, Kexin
2012-03-01
Since the abnormal metabolism of bilirubin could lead to diseases in the human body, especially the jaundice which is harmful to neonates. Traditional invasive measurements are difficult to be accepted by people because of pain and infection. Therefore, the real-time and non-invasive measurement of bilirubin is of great significance. However, the accuracy of currently transcutaneous bilirubinometry(TcB) is generally not high enough, and affected by many factors in the human skin, mostly by hemoglobin. In this talk, absorption spectra of hemoglobin and bilirubin have been collected and analyzed, then the Partial Least Squares (PLS) models have been built. By analyzing and comparing the Correlation and Root Mean Square Error of Prediction(RMSEP), the results show that the Correlation of bilirubin solution model is larger than that of the mixture solution added with hemoglobin, and its RMSEP value is smaller than that of mixture solution. Therefore, hemoglobin has influences on the non-invasive optical bilirubin sensing. In next step, it is necessary to investigate how to eliminate the influence.
Direct detection of formate ligation in cytochrome c oxidase by ATR-FTIR spectroscopy.
Iwaki, Masayo; Rich, Peter R
2004-03-03
The IR signature of binding of formate to the heme a(3-)Cu(B) binuclear site of bovine cytochrome c oxidase has been obtained by perfusion ATR-FTIR spectroscopy. The data show unequivocally that formate binds in its anionic form despite its binding being electroneutral overall. The bound formate can be distinguished from free ligand by the binding-induced sharpening and downshifting of vibrational bands. Formate ligation also causes shifts of vibrational modes of heme a(3) and its substituents and perturbation of histidine residues. The association of the accompanying protonation change with a carboxylate or tyrosine can be ruled out and may involve a histidine metal ligand or, more likely, a simple displacement into the bulk phase of a hydroxide ligand to heme a(3) or CU(B), a reaction which would account for stoichiometric proton uptake and maintenance of net charge within the binuclear center domain.
Ebbesen, Finn; Madsen, Poul H; Vandborg, Pernille K; Jakobsen, Lasse H; Trydal, Torleif; Vreman, Hendrik J
2016-10-01
Phototherapy using blue light is the treatment of choice worldwide for neonatal hyperbilirubinemia. However, treatment with turquoise light may be a desirable alternative. Therefore, the aim of this randomized, controlled study was to compare the bilirubin isomer distribution in serum of jaundiced neonates after 24 h of therapy with narrow-band (LED) light centered at 497 nm (turquoise) vs. 459 nm (blue), of essentially equal irradiance. Eighty-three neonates (≥33 wk gestational age) with uncomplicated hyperbilirubinemia were included in the study. Forty neonates were exposed to light centered at 497 nm and 43 infants with light centered at 459 nm. Irradiances were 5.2 × 10(15) and 5.1 × 10(15) photons/cm(2)/s, respectively. After 24 h of treatment no significant differences in serum concentrations of total bilirubin isomers and Z,Z-bilirubin were observed between the 2 groups. Interestingly, concentrations of Z,E-bilirubin, and thus also total bilirubin isomers formed during therapy, were highest for infants receiving light centered at 459 nm, while the concentration of E,Z-bilirubin was highest for those receiving light centered at 497 nm. No significant difference was found between concentrations of E,Z-lumirubin. Therapy with LED light centered at 497 nm vs. 459 nm, applied with equal irradiance on the infants, resulted in a different distribution of bilirubin isomers in serum.
Rekić, Dinko; Röshammar, Daniel; Bergstrand, Martin; Tarning, Joel; Calcagno, Andrea; D'Avolio, Antonio; Ormaasen, Vidar; Vigan, Marie; Barrail-Tran, Aurélie; Ashton, Michael; Gisslén, Magnus; Äbelö, Angela
2013-04-01
Atazanavir increases plasma bilirubin levels in a concentration-dependent manner. Due to less costly and readily available assays, bilirubin has been proposed as a marker of atazanavir exposure. In this work, a previously developed nomogram for detection of suboptimal atazanavir exposure is validated against external patient populations. The bilirubin nomogram was validated against 311 matching bilirubin and atazanavir samples from 166 HIV-1-infected Norwegian, French, and Italian patients on a ritonavir-boosted regimen. In addition, the nomogram was evaluated in 56 Italian patients on an unboosted regimen. The predictive properties of the nomogram were validated against observed atazanavir plasma concentrations. The use of the nomogram to detect non-adherence was also investigated by simulation. The bilirubin nomogram predicted suboptimal exposure in the patient populations on a ritonavir-boosted regimen with a negative predictive value of 97% (95% CI 95-100). The bilirubin nomogram and monitoring of atazanavir concentrations had similar predictive properties for detecting non-adherence based on simulations. Although both methods performed adequately during a period of non-adherence, they had lower predictive power to detect past non-adherence episodes. Using the bilirubin nomogram for detection of suboptimal atazanavir exposure in patients on a ritonavir-boosted regimen is a rapid and cost-effective alternative to routine measurements of the actual atazanavir exposure in plasma. Its application may be useful in clinical settings if atazanavir concentrations are not available.
Amin, Sanjiv B; Wang, Hongyue; Laroia, Nirupama; Orlando, Mark
2016-06-01
This study evaluates whether unbound bilirubin is a better predictor of auditory neuropathy spectrum disorder (ANSD) than total serum bilirubin (TSB) or the bilirubin:albumin molar ratio (BAMR) in late preterm and term neonates with severe jaundice (TSB ≥20 mg/dL or TSB that met exchange transfusion criteria). Infants ≥34 weeks' gestation with severe jaundice during the first 2 weeks of life were eligible for the prospective observational study. A comprehensive auditory evaluation was performed within 72 hours of peak TSB. ANSD was defined as absent or abnormal auditory brainstem evoked response waveform morphology at 80-decibel click intensity in the presence of normal outer hair cell function. TSB, serum albumin, and unbound bilirubin were measured using the colorimetric, bromocresol green, and modified peroxidase method, respectively. Five of 44 infants developed ANSD. By logistic regression, peak unbound bilirubin but not peak TSB or peak BAMR was associated with ANSD (OR, 4.6; 95% CI, 1.6-13.5; P = .002). On comparing receiver operating characteristic curves, the area under the curve for unbound bilirubin (0.92) was significantly greater (P = .04) compared with the area under the curve for TSB (0.50) or BAMR (0.62). Unbound bilirubin is a more sensitive and specific predictor of ANSD than TSB or BAMR in late preterm and term infants with severe jaundice. Copyright © 2016 Elsevier Inc. All rights reserved.
Controlled immobilisation of active enzymes on the cowpea mosaic virus capsid
NASA Astrophysics Data System (ADS)
Aljabali, Alaa A. A.; Barclay, J. Elaine; Steinmetz, Nicole F.; Lomonossoff, George P.; Evans, David J.
2012-08-01
Immobilisation of horseradish peroxidase (HRP) and glucose oxidase (GOX) via covalent attachment of modified enzyme carbohydrate to the exterior of the cowpea mosaic virus (CPMV) capsid gave high retention of enzymatic activity. The number of enzymes bound per virus was determined to be about eleven for HRP and 2-3 for GOX. This illustrates that relatively large biomacromolecules can be readily coupled to the virus surface using simple conjugation strategies. Virus-biomacromolecule hybrids have great potential for uses in catalysis, diagnostic assays or biosensors.Immobilisation of horseradish peroxidase (HRP) and glucose oxidase (GOX) via covalent attachment of modified enzyme carbohydrate to the exterior of the cowpea mosaic virus (CPMV) capsid gave high retention of enzymatic activity. The number of enzymes bound per virus was determined to be about eleven for HRP and 2-3 for GOX. This illustrates that relatively large biomacromolecules can be readily coupled to the virus surface using simple conjugation strategies. Virus-biomacromolecule hybrids have great potential for uses in catalysis, diagnostic assays or biosensors. Electronic supplementary information (ESI) available: Alternative conjugation strategies, agarose gel electrophoresis of CPMV and CPMV-HRP conjugates, UV-vis spectrum of HRP-ADHCPMV, agarose gel electrophoresis of GOX-ADHCPMV particles and corresponding TEM image, calibration curves for HRP-ADHCPMV and GOX-ADHCPMV, DLS data for GOX-ADHCPMV are made available. See DOI: 10.1039/c2nr31485a
Vidal, Juan-C; Espuelas, Javier; Castillo, Juan-R
2004-10-01
A new amperometric biosensor for determining cholesterol based on deflavination of the enzyme cholesterol oxidase (ChOx) and subsequent reconstitution of the apo-protein with a complexed flavin adenine dinucleotide (FAD) monolayer is described. The charge transfer mediator pyrroquinoline quinone (PQQ) was covalently bound to a cystamine self-assembled monolayer (SAM) on an Au electrode. Boronic acid (BA) was then bound to PQQ using the carbodiimide procedure, and the BA ligand was complexed to the FAD molecules on which the apo-ChOx was subsequently reconstituted. The effective release of the FAD from the enzyme and the successful reconstitution were verified using molecular fluorescence and cyclic voltammetry. The optimal orientation of FAD toward the PQQ mediator and the distances between FAD and PQQ and between PQQ and electrode enhance the charge transfer, very high sensitivity (about 2,500 nAmM(-1)cm(-2)) being obtained for cholesterol determination. The biosensor is selective toward electroactive interferents (ascorbic acid and uric acid) and was tested in reference serum samples, demonstrating excellent accuracy (relative errors below 3% in all cases). The biosensor activity can be successfully regenerated in a simple process by successive reconstitution with batches of recently prepared apo-ChOx on the same immobilized Au/SAM-PQQ-BA-FAD monolayer (it was tested five times); the lifetime of the biosensor is about 45-60 days.
Xue, Maoqiang; Ling, Yisheng; Wu, Guisen; Liu, Xin; Ge, Dongtao; Shi, Wei
2013-01-01
Microporous anodic aluminum oxide (AAO) membranes were modified by 3-glycidoxypropyltrimethoxysilane to produce terminal epoxy groups. These were used to covalently link hydroxyethyl celluloses (HEC) to amplify reactive groups of AAO membrane. The hydroxyl groups of HEC-AAO composite membrane were further modified with 1,4-butanediol diglycidyl ether to link arginine as an affinity ligand. The contents of HEC and arginine of arginine-immobilized HEC-AAO membrane were 52.1 and 19.7mg/g membrane, respectively. As biomedical adsorbents, the arginine-immobilized HEC-AAO membranes were tested for bilirubin removal. The non-specific bilirubin adsorption on the unmodified HEC-AAO composite membranes was 0.8mg/g membrane. Higher bilirubin adsorption values, up to 52.6mg/g membrane, were obtained with the arginine-immobilized HEC-AAO membranes. Elution of bilirubin showed desorption ratio was up to 85% using 0.3M NaSCN solution as the desorption agent. Comparisons equilibrium and dynamic capacities showed that dynamic capacities were lower than the equilibrium capacities. In addition, the adsorption mechanism of bilirubin and the effects of temperature, initial concentration of bilirubin, albumin concentration and ionic strength on adsorption were also investigated. Copyright © 2012 Elsevier B.V. All rights reserved.
Lozano, Roberto; Domeque, Nieves; Apesteguia, Alberto-Fermín
2014-02-01
The objective of the present work was to conduct an "in vivo" analysis of the atazanavir-bilirubin interaction. We developed a new mathematical approach to PK/PDPK models for competitive interaction based on the Michaelis-Menten equation, which was applied to patients with polymorphisms in the gene for UDP-glucuronosyltransferase 1A1 (UGT1A1). Atazanavir is known to induce concentration-dependent increases in bilirubin plasma levels. Thus, we employed our mathematical model to analyse rises in steady state atazanavir and bilirubin concentrations, ultimately plotting a nomogram for detection of suboptimal atazanavir exposure. Application of our model revealed that an absolute value or a steady state increase in bilirubin falling below 3.8Φ µmol/L (where Φ is a correction factor, =1 for UGT1A1 wild type and ≠1 for UGT1A1 variants) could be used to predict suboptimal atazanavir exposure and treatment failure. Thus, we have successfully established a new mathematical approach for pharmacodynamic-pharmacokinetic modelling of the interaction between atazanavir and bilirubin, as it relates to genetic variants of UGT1A1. Taken together, our findings indicate that bilirubin plasma levels represent a valuable marker of atazanavir exposure. © 2013, The American College of Clinical Pharmacology.
Eghbalian, Fatemeh; Rafienezhad, Haneyeh; Farmal, Javad
2017-11-01
Due to the effects of massage on various laboratory parameters (including those related to jaundice) in infants and the expansion of existing studies to achieve effective and safe therapy in the treatment of neonatal jaundice, this study aimed to investigate the effect of massage on bilirubin levels in cases of neonatal jaundice. In this study, 134 patients were randomly assigned to either an intervention group (massage combined with phototherapy, n=67) or a control group (phototherapy only, n=67). In both groups, serum total bilirubin level and frequency of daily bowel movements were measured and compared during each of the first four days of treatment. Baseline levels of bilirubin were similar between the two groups (P>0.05). During the measurements obtained post-intervention, significant differences surfaces between the two groups in bilirubin levels and frequency of daily bowel movements (P<0.05 for both). No significant relationship was observed during days 1 and 2 of massage therapy between daily frequency of bowel movements and serum bilirubin level (P>0.05); this relationship became significant during the third and fourth days (P<0.05). Massage therapy combined with phototherapy is an effective method for reducing serum total bilirubin in infants with neonatal jaundice. Copyright © 2017 Elsevier Inc. All rights reserved.
Bechor, Edna; Dahan, Iris; Fradin, Tanya; Berdichevsky, Yevgeny; Zahavi, Anat; Federman Gross, Aya; Rafalowski, Meirav; Pick, Edgar
2015-01-01
The superoxide (O·−2)-generating NADPH oxidase of phagocytes consists of a membrane component, cytochrome b558 (a heterodimer of Nox2 and p22phox), and four cytosolic components, p47phox, p67phox, p40phox, and Rac. The catalytic component, responsible for O·−2 generation, is Nox2. It is activated by the interaction of the dehydrogenase region (DHR) of Nox2 with the cytosolic components, principally with p67phox. Using a peptide-protein binding assay, we found that Nox2 peptides containing a 369CysGlyCys371 triad (CGC) bound p67phox with high affinity, dependent upon the establishment of a disulfide bond between the two cysteines. Serially truncated recombinant Nox2 DHR proteins bound p67phox only when they comprised the CGC triad. CGC resembles the catalytic motif (CGHC) of protein disulfide isomerases (PDIs). This led to the hypothesis that Nox2 establishes disulfide bonds with p67phox via a thiol-dilsulfide exchange reaction and, thus, functions as a PDI. Evidence for this was provided by the following: (1) Recombinant Nox2 protein, which contained the CGC triad, exhibited PDI-like disulfide reductase activity; (2) Truncation of Nox2 C-terminal to the CGC triad or mutating C369 and C371 to R, resulted in loss of PDI activity; (3) Comparison of the sequence of the DHR of Nox2 with PDI family members revealed three small regions of homology with PDIA3; (4) Two monoclonal anti-Nox2 antibodies, with epitopes corresponding to regions of Nox2/PDIA3 homology, reacted with PDIA3 but not with PDIA1; (5) A polyclonal anti-PDIA3 (but not an anti-PDIA1) antibody reacted with Nox2; (6) p67phox, in which all cysteines were mutated to serines, lost its ability to bind to a Nox2 peptide containing the CGC triad and had an impaired capacity to support oxidase activity in vitro. We propose a model of oxidase assembly in which binding of p67phox to Nox2 via disulfide bonds, by virtue of the intrinsic PDI activity of Nox2, stabilizes the primary interaction between the two components. PMID:25699251
NASA Astrophysics Data System (ADS)
Bechor, Edna; Dahan, Iris; Fradin, Tanya; Berdichevsky, Yevgeny; Zahavi, Anat; Rafalowski, Meirav; Federman-Gross, Aya; Pick, Edgar
2015-02-01
The superoxide (O2.-)-generating NADPH oxidase of phagocytes consists of a membrane component, cytochrome b558 (a heterodimer of Nox2 and p22phox), and four cytosolic components, p47phox, p67phox, p40phox, and Rac. The catalytic component, responsible for O2.- generation, is Nox2. It is activated by the interaction of the dehydrogenase region (DHR) of Nox2 with the cytosolic components, principally with p67phox. Using a peptide-protein binding assay, we found that Nox2 peptides containing a 369CysGlyCys371 triad (CGC) bound p67phox with high affinity, dependent upon the establishment of a disulfide bond between the two cysteines. Serially truncated recombinant Nox2 DHR proteins bound p67phox only when they comprised the CGC triad. CGC resembles the catalytic motif (CGHC) of protein disulfide isomerases (PDIs). This led to the hypothesis that Nox2 establishes disulfide bonds with p67phox via a thiol-dilsulfide exchange reaction and, thus, functions as a PDI. Evidence for this was provided by the following: 1. Recombinant Nox2 protein, which contained the CGC triad, exhibited PDI-like disulfide reductase activity; 2. Truncation of Nox2 C-terminal to the CGC triad or mutating C369 and C371 to R, resulted in loss of PDI activity; 3. Comparison of the sequence of the DHR of Nox2 with PDI family members revealed three small regions of homology with PDIA3; 4. Two monoclonal anti-Nox2 antibodies, with epitopes corresponding to regions of Nox2/PDIA3 homology, reacted with PDIA3 but not with PDIA1; 5. A polyclonal anti-PDIA3 (but not an anti-PDIA1) antibody reacted with Nox2; 6. p67phox, in which all cysteines were mutated to serines, lost its ability to bind to a Nox2 peptide containing the CGC triad and had an impaired capacity to support oxidase activity in vitro. We propose a model of oxidase assembly in which binding of p67phox to Nox2 via disulfide bonds, by virtue of the intrinsic PDI activity of Nox2, stabilizes the primary interaction between the two components.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia Patricia
2015-11-26
During X-ray data collection from a multicopper oxidase (MCO) crystal, electrons and protons are mainly released into the system by the radiolysis of water molecules, leading to the X-ray-induced reduction of O 2 to 2H 2O at the trinuclear copper cluster (TNC) of the enzyme. In this work, 12 crystallographic structures of Thermus thermophilus HB27 multicopper oxidase (Tth-MCO) in holo, apo and Hg-bound forms and with different X-ray absorbed doses have been determined. In holo Tth -MCO structures with four Cu atoms, the proton-donor residue Glu451 involved in O 2 reduction was found in a double conformation: Glu451a (~7 Åmore » from the TNC) and Glu451b (~4.5 Å from the TNC). A positive peak of electron density above 3.5σ in anF o-F c map for Glu451a O ε2 indicates the presence of a carboxyl functional group at the side chain, while its significant absence in Glu451b strongly suggests a carboxylate functional group. In contrast, for apo Tth -MCO and in Hg-bound structures neither the positive peak nor double conformations were observed. Together, these observations provide the first structural evidence for a proton-relay mechanism in the MCO family and also support previous studies indicating that Asp106 does not provide protons for this mechanism. In addition, eight composite structures (Tth -MCO-C1–8) with different X-ray-absorbed doses allowed the observation of different O 2-reduction states, and a total depletion of T2Cu at doses higher than 0.2 MGy showed the high susceptibility of this Cu atom to radiation damage, highlighting the importance of taking radiation effects into account in biochemical interpretations of an MCO structure.« less
Ram, Mahendra; Singh, Vishakha; Kumawat, Sanjay; Kant, Vinay; Tandan, Surendra Kumar; Kumar, Dinesh
2016-01-01
Bilirubin has shown cutaneous wound healing potential in some preliminary studies. Here we hypothesize that bilirubin facilitates wound healing in diabetic rats by modulating important healing factors/candidates and antioxidant parameters in a time-dependent manner. Diabetes was induced in male Wistar rats by streptozotocin. In all diabetic rats wounds were created under pentobarbitone anesthesia. All the rats were divided into two groups, of which one (control) was treated with ointment base and other with bilirubin ointment (0.3%). Wound closer measurement and tissue collection were done on days 3, 7, 14 and 19 post-wounding. The relative expressions of hypoxia inducible factor-1 alpha (HIF-1α), vascular endothelial growth factor (VEGF), stromal cell-derived factor-1 alpha (SDF-1α), transforming growth factor- beta1 (TGF-β1()), tumor necrosis factor-α (TNF-α) and interlukin-10 (IL-10) mRNA and proteins and the mRNA of interlukin-1 beta (IL-1β) and matrix metalloprteinase-9 (MMP-9) were determined in the wound tissues. CD-31 staining and collagen content were evaluated by immunohistochemistry and picrosirius red staining, respectively. Histopathological changes were assessed by H&E staining. The per cent wound closer was significantly higher from day 7 onwards in bilirubin-treated rats. HIF-1α, VEGF, SDF-1α, TGF-β1, IL-10 mRNA and protein levels were significantly higher on days 3, 7 and 14 in bilirubin-treated rats. The mRNA expression and protein level of TNF-α and the mRNA of IL-1β and MMP-9 were progressively and markedly reduced in bilirubin-treated rats. The collagen deposition and formation of blood vessels were greater in bilirubin-treated rats. Bilirubin markedly facilitated cutaneous wound healing in diabetic rats by modulating growth factors, cytokines, neovasculogenesis and collagen contents to the wound site. Topical application of bilirubin ointment might be of great use in cutaneous wound healing in diabetic patients. Copyright © 2015 Elsevier B.V. All rights reserved.
Transparent and flexible, nanostructured and mediatorless glucose/oxygen enzymatic fuel cells
NASA Astrophysics Data System (ADS)
Pankratov, Dmitry; Sundberg, Richard; Sotres, Javier; Maximov, Ivan; Graczyk, Mariusz; Suyatin, Dmitry B.; González-Arribas, Elena; Lipkin, Aleksey; Montelius, Lars; Shleev, Sergey
2015-10-01
Here we detail transparent, flexible, nanostructured, membrane-less and mediator-free glucose/oxygen enzymatic fuel cells, which can be reproducibly fabricated with industrial scale throughput. The electrodes were built on a biocompatible flexible polymer, while nanoimprint lithography was used for their nanostructuring. The electrodes were covered with gold, their surfaces were visualised using scanning electron and atomic force microscopies, and they were also studied spectrophotometrically and electrochemically. The enzymatic fuel cells were fabricated following our previous reports on membrane-less and mediator-free biodevices in which cellobiose dehydrogenase and bilirubin oxidase were used as anodic and cathodic biocatalysts, respectively. The following average characteristics of transparent and flexible biodevices operating in glucose and chloride containing neutral buffers were registered: 0.63 V open-circuit voltage, and 0.6 μW cm-2 maximal power density at a cell voltage of 0.35 V. A transparent and flexible enzymatic fuel cell could still deliver at least 0.5 μW cm-2 after 12 h of continuous operation. Thus, such biodevices can potentially be used as self-powered biosensors or electric power sources for smart electronic contact lenses.
Bertrand, Kouam Eric; Mathieu, Ndomou; Inocent, Gouado; Honore, Fotso Kuate
2008-06-15
Oxidative stress and changes in antioxidant status have been implicated in the pathogenesis of malaria. To assess the antioxidant level ofbilirubin and uric acid associated with falciparum malaria infection, 60 untreated patients (30 men and 30 women) in Douala, Cameroon were screened for the study. Sixty five healthy individuals (29 men and 36 women) were used as controls. Total and conjugated bilirubin were calculated using Jendrassik-Grof method while uric acid was determined using Barham-Trinder method. It was observed that total and conjugated bilirubins were significantly (p < 0.001) higher in malaria patients (10.722 +/- 4.043 and 3.627 +/- 1.571 mg L(-1), respectively) when compared to control (6.830 +/- 2.436 and 1.777 +/- 0.729 mg L(-1)) and these bilirubin levels increased significantly with parasite count (p < 0.050). There was also significant increased (p = 0.021) of uric acid in malaria patients (56.262 +/- 13.963 mg L(-1)) compared to controls (49.838 +/- 15.419 mg L(-1)). No significant differences based on sex were observed on uric acid, parasite count, total and conjugated bilirubins in malaria patients. Positive correlations were obtained between parasite count and total bilirubin (r = 0.320, p < 0.050), conjugated bilirubin (r = 0.477, p < 0.001), uric acid (r = 0.060, p > 0.050) and between total and conjugated bilirubin (r = 0.729, p < 0.001). From this study, it has been hypothesized that the augmentation of plasma level ofbilirubin and uric acid could provide more protection against oxidative stress induced by malaria.
IN VITRO CHEMO-PREVENTATIVE ACTIVITY OF STRELITZIA NICOLAI ARIL EXTRACT CONTAINING BILIRUBIN
Dwarka, Depika; Thaver, Veneesha; Naidu, Mickey; Koorbanally, Neil A; Baijnath, and Himansu
2017-01-01
Background: The discovery of the only animal pigment, bilirubin, in the plant Strelitzia nicolai has triggered a vast number of questions regarding bilirubin’s formation and its role in the human body. Recent studies have confirmed that bilirubin at certain levels have many medical benefits. Various case studies have revealed that bilirubin is a potent antioxidant. Cervical cancer is one of South Africa’s largest womens’ health crises. It is estimated that it affects one out of 41 South African women and kills approximately 8 women in the country every day. Thus, the aim of this study was to investigate if the aril extract of Strelitzia nicolai (Regel and Körn.) containing bilirubin possesses anti-cancer activity and to determine its effect on the induction of apoptosis. Materials and methods: The DPPH activity was firstly used to determine the antioxidant effect of the extract. Thereafter, the cytotoxic effect was tested using the XTT assay. Apoptosis was confirmed and quantified using the Annexin V-PE kit and the morphology was studied using acridine orange and ethidium bromide. Results: The aril extract decreased cell viability by 52% and induced apoptosis in HeLa cells; as shown by the Annexin V-PE Apoptosis detection kit and morphological studies with acridine orange/ethidium bromide staining. Conclusion: The activity of the extract as a potent antioxidant was immensely enhanced as compared to the bilirubin standard. These results suggest that S. nicolai aril extract containing bilirubin works synergistically as opposed to bilirubin on its own. Furthermore, this extract might be a good candidate for the therapeutic intervention of cervical cancer. PMID:28480426
Wang, Jing; Wu, Xiaofen; Li, Yaru; Han, Xu; Hu, Hua; Wang, Fei; Yu, Caizheng; Li, Xiulou; Yang, Kun; Yuan, Jing; Yao, Ping; Miao, Xiaoping; Wei, Sheng; Wang, Youjie; Chen, Weihong; Liang, Yuan; Guo, Huan; Yang, Handong; Wu, Tangchun; Zhang, Xiaomin; He, Meian
2017-03-01
Elevated serum bilirubin levels are associated with decreased coronary heart disease (CHD) risk in cross-sectional studies among diabetic patients, but prospective evidence is limited. We investigated the relationship of serum bilirubin levels with incident CHD risk among type 2 diabetes patients. In a prospective study of 2918 type 2 diabetes embedded in the Dongfeng-Tongji cohort, serum total bilirubin (TBil), direct bilirubin (DBil), and indirect bilirubin (IBil) were measured at baseline. Cox proportional hazards models were used to examine the association between serum bilirubin levels and CHD risk. A total of 440 CHD cases were identified during 12,017 person-years of follow-up. Compared with extreme quartiles, the adjusted hazard ratio and 95% confidence interval of incident CHD were 0.74 (0.56-0.99) with P trend = 0.08 in IBil, while in TBil and DBil, the bilirubin-CHD associations were not significant. Moreover, serum TBil and IBil levels were interacted with drinking status on the risk of incident CHD (P interaction = 0.021 and 0.037, respectively), and the associations were evident in ever drinkers. In drinkers, when serum TBil or IBil concentrations increased 1 μmol/L, the CHD risk both decreased 6% (95% CIs 0.89-0.99 and 0.87-1.00, respectively). Serum IBil levels were marginally related to decreased incident CHD risk among type 2 diabetes. Drinking could potentially enhance the associations of serum TBil and DBil levels with incident CHD risk.
Serum total bilirubin levels and coronary heart disease--Causal association or epiphenomenon?
Kunutsor, Setor K
2015-12-01
Observational epidemiological evidence supports a linear inverse and independent association between serum total bilirubin levels and coronary heart disease (CHD) risk, but whether this association is causal remains to be ascertained. A Mendelian randomization approach was employed to test whether serum total bilirubin is causally linked to CHD. The genetic variant rs6742078--well known to specifically modify levels of serum total bilirubin and accounting for up to 20% of the variance in circulating serum total bilirubin levels--was used as an instrumental variable. In pooled analysis of estimates reported from published genome-wide association studies, every copy of the T allele of rs6742078 was associated with 0.42 standard deviation (SD) higher levels of serum total bilirubin (95% confidence interval, 0.40 to 0.43). Based on combined data from the Coronary Artery Disease Genome wide Replication and Meta-analyses and the Coronary Artery Disease (C4D) Genetics Consortium involving a total of 36,763 CHD cases and 76,997 controls, the odds ratio for CHD per copy of the T allele was 1.01 (95% confidence interval, 0.99 to 1.04). The odds ratio of CHD for a 1 SD genetically elevated serum total bilirubin level was 1.03 (95% confidence interval, 0.98 to 1.09). The current findings casts doubt on a strong causal association of serum total bilirubin levels with CHD. The inverse associations demonstrated in observational studies may be driven by biases such as unmeasured confounding and/or reverse causation. However, further research in large-scale consortia is needed. Copyright © 2015 Elsevier Inc. All rights reserved.
Unbound bilirubin measurements by a novel probe in preterm infants.
Hegyi, Thomas; Kleinfeld, Alan; Huber, Andrew; Weinberger, Barry; Memon, Naureen; Shih, Weichung; Carayannopoulos, Mary; Oh, William
2018-03-12
Hyperbilirubinemia occurs in over 80% of newborns and severe bilirubin toxicity can lead to neurological dysfunction and death, especially in preterm infants. Currently, the risk of bilirubin toxicity is assessed by measuring the levels of total serum bilirubin (TSB), which are used to direct treatments including immunoglobulin administration, phototherapy, and exchange transfusion. However, free, unbound bilirubin levels (Bf) predict the risk of bilirubin neurotoxicity more accurately than TSB. To examine Bf levels in preterm infants and determine the frequency with which they exceed reported neurotoxic thresholds. One hundred thirty preterm infants (BW 500-2000 g; GA 23-34 weeks) were enrolled and Bf levels measured during the first week of life by the fluorescent Bf sensor BL22P1B11-Rh. TSB and plasma albumin were measured by standard techniques. Bilirubin-albumin dissociation constants (K d ) were calculated based on Bf and plasma albumin. Five hundred eighty samples were measured during the first week of life, with an overall mean Bf of 13.6 ± 9.0 nM. A substantial number of measurements exceeded potential toxic thresholds levels as reported in the literature. The correlation between Bf and TSB was statistically significant (r 2 0.17), but this weak relationship was lost at high Bf levels. Infants <28-week gestations had more hearing screening failures than infants ≥28-week gestation. Unbound (free) bilirubin values are extremely variable during the first week of life in preterm infants. A significant proportion of these values exceeded reported neurotoxic thresholds.
Jirásková, Alena; Bortolussi, Giulia; Dostálová, Gabriela; Eremiášová, Lenka; Golaň, Lubor; Danzig, Vilém; Linhart, Aleš; Vítek, Libor
2017-01-01
The aim of our study was to assess the possible relationships among heme oxygenase (HMOX), bilirubin UDP-glucuronosyl transferase (UGT1A1) promoter gene variations, serum bilirubin levels, and Fabry disease (FD). The study included 56 patients with FD (M : F ratio = 0.65) and 185 healthy individuals. Complete standard laboratory and clinical work-up was performed on all subjects, together with the determination of total peroxyl radical-scavenging capacity. The (GT)n and (TA)n dinucleotide variations in the HMOX1 and UGT1A1 gene promoters, respectively, were determined by DNA fragment analysis. Compared to controls, patients with FD had substantially lower serum bilirubin levels (12.0 versus 8.85 μ mol/L, p = 0.003) and also total antioxidant capacity ( p < 0.05), which showed a close positive relationship with serum bilirubin levels ( p = 0.067) and the use of enzyme replacement therapy ( p = 0.036). There was no association between HMOX1 gene promoter polymorphism and manifestation of FD. However, the presence of the TA 7 allele UGT1A1 gene promoter, responsible for higher systemic bilirubin levels, was associated with a twofold lower risk of manifestation of FD (OR = 0.51, 95% CI = 0.27-0.97, p = 0.038). Markedly lower serum bilirubin levels in FD patients seem to be due to bilirubin consumption during increased oxidative stress, although UGT1A1 promoter gene polymorphism may modify the manifestation of FD as well.
Targeted Quantification of Isoforms of a Thylakoid-Bound Protein: MRM Method Development.
Bru-Martínez, Roque; Martínez-Márquez, Ascensión; Morante-Carriel, Jaime; Sellés-Marchart, Susana; Martínez-Esteso, María José; Pineda-Lucas, José Luis; Luque, Ignacio
2018-01-01
Targeted mass spectrometric methods such as selected/multiple reaction monitoring (SRM/MRM) have found intense application in protein detection and quantification which competes with classical immunoaffinity techniques. It provides a universal procedure to develop a fast, highly specific, sensitive, accurate, and cheap methodology for targeted detection and quantification of proteins based on the direct analysis of their surrogate peptides typically generated by tryptic digestion. This methodology can be advantageously applied in the field of plant proteomics and particularly for non-model species since immunoreagents are scarcely available. Here, we describe the issues to take into consideration in order to develop a MRM method to detect and quantify isoforms of the thylakoid-bound protein polyphenol oxidase from the non-model and database underrepresented species Eriobotrya japonica Lindl.
Bilirubin nanoparticle preconditioning protects against hepatic ischemia-reperfusion injury.
Kim, Jin Yong; Lee, Dong Yun; Kang, Sukmo; Miao, Wenjun; Kim, Hyungjun; Lee, Yonghyun; Jon, Sangyong
2017-07-01
Hepatic ischemia-reperfusion injury (IRI) remains a major concern in liver transplantation and resection, despite continuing efforts to prevent it. Accumulating evidence suggests that bilirubin possesses antioxidant, anti-inflammatory and anti-apoptotic properties. However, despite obvious potential health benefits of bilirubin, its clinical applications are limited by its poor solubility. We recently developed bilirubin nanoparticles (BRNPs) consisting of polyethylene glycol (PEG)-conjugated bilirubin. Here, we sought to investigate whether BRNPs protect against IRI in the liver by preventing oxidative stress. BRNPs exerted potent antioxidant and anti-apoptotic activity in primary hepatocytes exposed to hydrogen peroxide, a precursor of reactive oxygen species (ROS). In a model of hepatic IRI in mice, BRNP preconditioning exerted profound protective effects against hepatocellular injury by reducing oxidative stress, pro-inflammatory cytokine production, and recruitment of neutrophils. They also preferentially accumulated in IRI-induced inflammatory lesions. Collectively, our findings indicate that BRNP preconditioning provides a simple and safe approach that can be easily monitored in the blood like endogenous bilirubin, and could be a promising strategy to protect against IRI in a clinical setting. Copyright © 2017 Elsevier Ltd. All rights reserved.
Kim, Min Jun; Lee, Yonghyun; Jon, Sangyong; Lee, Dong Yun
2017-07-01
Transplanted islets suffer hypoxic stress, which leads to nonspecific inflammation. This is the major cause of islet graft failure during the early stage of intrahepatic islet transplantation. Although bilirubin has shown potent anti-oxidative and anti-inflammatory functions, its clinical applications have been limited due to its insolubility and short half-life. To overcome this problem, novel amphiphilic bilirubin nanoparticles are designed. Hydrophilic poly(ethylene glycol) (PEG) is conjugated to the hydrophobic bilirubin molecule. Then, the PEG-bilirubin conjugates form nanoparticles via self-assembly, i.e., so-called to BRNPs. BRNPs can protect islet cells not only from chemically induced oxidative stress by scavenging reactive oxygen species molecules, but also from activated macrophages by suppressing cytokine release. Importantly, in vivo experiments demonstrate that BRNP treatment can dramatically and significantly prolong islet graft survival compared to bilirubin treatment. In addition, immunohistochemical analysis shows BRNPs have potent anti-oxidative and anti-inflammatory capabilities. Collectively, novel BRNPs can be a new potent remedy for successful islet transplantation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ayaz, Teslime; Kocaman, Sinan Altan; Durakoğlugil, Tuğba; Erdoğan, Turan; Şahin, Osman Zikrullah; Şahin, Serap Baydur; Çiçek, Yüksel; Şatiroğlu, Ömer
2014-01-01
Background and Objectives Left ventricular hypertrophy (LVH), a sign of subclinical cardiovascular disease, is an important predictor of cardiovascular morbidity and mortality. The aim of our study was to determine the association of left ventricular mass (LVM) with possible causative anthropometric and biochemical parameters as well as carotid intima-media thickness (CIMT) and brachial flow-mediated dilation (FMD) as surrogates of atherosclerosis and endothelial dysfunction, respectively, in previously untreated hypertensive patients. Subjects and Methods Our study included 114 consecutive previously untreated hypertensive patients who underwent echocardiography and ultrasonography to evaluate their vascular status and function via brachial artery CIMT and FMD. Results Among all study parameters, age, systolic blood pressure (BP), diastolic BP, pulse pressure, plasma glucose, uric acid, total bilirubin, direct bilirubin, hemoglobin, and CIMT were positively correlated with the LVM index. Multiple logistic regression analysis revealed that office systolic BP, age, male gender, and total bilirubin were independent predictors of LVH. Conclusion Bilirubin seems to be related to LVM and LVH. The positive association of bilirubin with these parameters is novel and requires further research. PMID:25278987
NASA Astrophysics Data System (ADS)
R. S., Aparna; J. S., Anjali Devi; John, Nebu; Abha, K.; S. S., Syamchand; George, Sony
2018-06-01
Hurdles to develop point of care diagnostic methods restrict the translation of progress in the health care sector from bench side to bedside. In this article a simple, cost effective fluorescent as well as colorimetric nanosensor was developed for the early and easy detection of hyperbilirubinemia. A stable, water soluble bovine serum albumin stabilised copper nanocluster (BSA CuNC) was used as the fluorescent probe which exhibited strong blue emission (404 nm) upon 330 nm excitation. The fluorescence of the BSA CuNC can be effectively quenched by the addition of bilirubin by the formation of copper-bilirubin complex. Meanwhile the copper-bilirubin complex resulted in an observable colour change from pale violet to green facilitating colorimetric detection. The prepared sensor displayed good selectivity and sensitivity over other co-existing molecules, and can be used for quantifying bilirubin with a detection limit down to 257 fM. Additionally, the as-prepared probe was coated on a paper strip to develop a portable paper strip sensor of bilirubin. Moreover, the method was successfully applied in real sample analysis and obtained promising result.
NASA Astrophysics Data System (ADS)
Vega-Hissi, Esteban G.; Estrada, Mario R.; Lavecchia, Martín J.; Pis Diez, Reinaldo
2013-01-01
The pKa, the negative logarithm of the acid dissociation equilibrium constant, of the carboxylic acid groups of unconjugated bilirubin in water is a discussed issue because there are quite different experimental values reported. Using quantum mechanical calculations we have studied the conformational behavior of unconjugated bilirubin species (in gas phase and in solution modeled implicitly and explicitly) to provide evidence that may clarify pKa values because of its pathophysiological relevance. Our results show that rotation of carboxylate group, which is not restricted, settles it in a suitable place to establish stronger interactions that stabilizes the monoanion and the dianion to be properly solvated, demonstrating that the rationalization used to justify the high pKa values of unconjugated bilirubin is inappropriate. Furthermore, low unconjugated bilirubin (UCB) pKa values were estimated from a linear regression analysis.
Animal pigment bilirubin discovered in plants.
Pirone, Cary; Quirke, J Martin E; Priestap, Horacio A; Lee, David W
2009-03-04
The bile pigment bilirubin-IXalpha is the degradative product of heme, distributed among mammals and some other vertebrates. It can be recognized as the pigment responsible for the yellow color of jaundice and healing bruises. In this paper we present the first example of the isolation of bilirubin in plants. The compound was isolated from the brilliant orange-colored arils of Strelitzia nicolai, the white bird of paradise tree, and characterized by HPLC-ESMS, UV-visible, (1)H NMR, and (13)C NMR spectroscopy, as well as comparison with an authentic standard. This discovery indicates that plant cyclic tetrapyrroles may undergo degradation by a previously unknown pathway. Preliminary analyses of related plants, including S. reginae, the bird of paradise, also revealed bilirubin in the arils and flowers, indicating that the occurrence of bilirubin is not limited to a single species or tissue type.
Laskar, Amaj A; Khan, Masood A; Rahmani, Arshad H; Fatima, Sana; Younus, Hina
2016-08-01
Some reports indicate that thymoquinone (TQ), the main constituent of Nigella sativa seeds, is hepatoprotective. The aim of this study was to determine whether TQ is able to bind directly to bilirubin, and whether TQ or liposomal formulation of TQ (Lip-TQ) can reduce cyclophosphamide (CYP)-induced liver toxicity, serum bilirubin level in mice. The binding of TQ with bilirubin was studied by UV-VIS, fluorescence and Near-UV CD spectroscopy. Inhibition of binding of bilirubin to erythrocytes by TQ was also examined. To increase the in vivo efficacy, Lip-TQ was prepared and used against CYP-induced toxicity. The protective role of TQ or Lip-TQ against CYP-induced toxicity was assessed by determining the liver function parameters, the levels of superoxide dismutase (SOD) and catalase (CAT), and histological studies. It was found that TQ binds to bilirubin and significantly inhibits the binding of bilirubin to erythrocytes. Lip-TQ (10 mg/kg) significantly reduced the levels of aspartate transaminase (AST) from 254 ± 48 to 66 ± 18 IU/L (P < 0.001), alanine transaminase (ALT) from 142 ± 28 to 47.8 ± 16 IU/L (P < 0.05) and serum bilirubin from 2.8 ± 0.50 to 1.24 ± 0.30 mg/dl (P < 0.05). Treatment with Lip-TQ reduced the CYP-induced inflammation and hemorrhage in liver tissues. Moreover, treatment with free or Lip-TQ protected the activity of SOD and CAT in CYP-injected mice. Therefore, TQ can reduce the level of bilirubin in systemic circulation in disease conditions that lead to hyperbilirubinemia and liver toxicity and hence may be used as a supplement in the treatment of liver ailments. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Oh, William; Stevenson, David K.; Tyson, Jon E.; Morris, Brenda H.; Ahlfors, Charles E.; Bender, G. Jesse; Wong, Ronald J.; Perritt, Rebecca; Vohr, Betty R.; Van Meurs, Krista P.; Vreman, Hendrik J.; Das, Abhik; Phelps, Dale L.; O’Shea, T. Michael; Higgins, Rosemary D.
2010-01-01
Objectives To assess the influence of clinical status on the association between total plasma bilirubin and unbound bilirubin on death or adverse neurodevelopmental outcomes at 18–22 months corrected age in extremely low birth weight infants. Method Total plasma biirubin and unbound biirubin were measured in 1,101 extremely low birth weight infants at 5±1 day of age. Clinical criteria were used to classify infants as clinically stable or unstable. Survivors were examined at 18–22 months corrected age by certified examiners. Outcome variables were death or neurodevelopmental impairment, death or cerebral palsy, death or hearing loss, and death prior to follow-up. For all outcomes, the interaction between bilirubin variables and clinical status was assessed in logistic regression analyses adjusted for multiple risk factors. Results Regardless of clinical status, an increasing level of unbound bilirubin was associated with higher rates of death or neurodevelopmental impairment, death or cerebral palsy, death or hearing loss and death before follow-up. Total plasma bilirubin values were directly associated with death or neurodevelopmental impairment, death or cerebral palsy, death or hearing loss, and death before follow-up in unstable infants, but not in stable infants. An inverse association between total plasma bilirubin and death or cerebral palsy was found in stable infants. Conclusions In extremely low birth weight infants, clinical status at 5 days of age affects the association between total plasma and unbound bilirubin and death or adverse neurodevelopmental outcomes at 18–22 months of corrected age. An increasing level of UB is associated a higher risk of death or adverse neurodevelopmental outcomes regardless of clinical status. Increasing levels of total plasma bilirubin are directly associated with increasing risk of death or adverse neurodevelopmental outcomes in unstable, but not in stable infants. PMID:20105142
Ma, Hongyue; Zhang, Junfeng; Jiang, Jiejun; Zhou, Jing; Xu, Huiqin; Zhan, Zhen; Wu, Qinan; Duan, Jinao
2012-03-01
Bufadienolides, known ligands of the sodium pump, have been shown to inhibit the proliferation of several cancer cell types. However, their development to date as anticancer agents has been impaired by a narrow therapeutic margin resulting from their potential to induce cardiotoxicity. In the present study, we examined the effects of bilirubin, an endogenous antioxidant, on the cardiotoxicity of bufadienolides (derived from toad venom) in guinea-pigs. The results showed that bufadienolides (8 mg/kg) caused ventricular arrhythmias, conduction block, cardiac dysfunction and death in guinea-pigs. Pretreatment with bilirubin (75 and 150 mg/kg) significantly prevented bufadienolide-induced premature ventricular complexes, ventricular tachycardia, ventricular fibrillation and death. Bilirubin also markedly improved the inhibition of cardiac contraction in bufadienolide-treated guinea-pigs as evidenced by increases in left ventricular systolic pressure and decreases in left ventricular diastolic pressure in vivo. Furthermore, bilirubin significantly reduced the intracellular sodium content ([Na(+)]( i )) in ex vivo bufadienolide-stimulated guinea-pig ventricular myocytes loaded with the sodium indicator Sodium Green. An antitumor study showed that bilirubin did not compromise the ability of bufadienolides to inhibit gastric cancer cell MGC-803 proliferation. These results suggested that bilirubin can attenuate bufadienolide-induced arrhythmias and cardiac dysfunction in guinea-pigs by reducing elevated [Na(+)]( i ) and may improve bufadienolide therapeutic index in cancer treatment.
Improvement of conventional transcutaneous bilirubinometry results in term newborn infants.
Felc, Zlata
2005-05-01
This prospective study was performed to determine a way to improve conventional transcutaneous bilirubinometry results in healthy term newborn infants. In 118 infants during phototherapy (group A), and in 118 infants without phototherapy (group B), bilirubin determinations were done in duplicate using the Minolta AirShields Jaundice Meter type 101 (transcutaneous bilirubin index [TcB]), and the diazometric method on the Hitachi 717 Automated Analyzer (total reacting serum bilirubin [SeB]). In 112 infants (group C), bilirubin determinations were done in triplicate, using simple direct-reading photometry on the Moltronic Bilirubinometer (direct serum bilirubin [BiB]). A close correlation between TcB and SeB values was observed in group A ( r = 0.69; p < 0.001) and in group B ( r = 0.59; p < 0.001). The 95% confidence intervals of TcB readings corresponding to SeB were +/- 80.7 micromol/L in group A and +/- 76.9 micromol/L in group B, respectively. In group C, using a correctly calibrated BiB with adult sera containing bilirubin concentration in the range 271 to 344 micromol/L, the 95% confidence intervals of parallel TcB and BiB readings corresponding to SeB were +/- 28 micromol/L. Parallel determinations of the TcB and the BiB in healthy term newborn infants give results almost identical to those of bilirubin determination by the laboratory method.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morgan, J.E.; Li, P.M.; Jang, D.J.
1989-08-22
Intramolecular electron transfer in partially reduced cytochrome c oxidase has been studied by the perturbed equilibrium method. The authors have prepared a three-electron-reduced, CO-inhibited form of the enzyme in which cytochrome a and copper A are partially reduced and in an intramolecular redox equilibrium. When these samples were irradiated with a nitrogen laser to photodissociate the bound CO, changes in absorbance at 598 and 830 nm were observed which were consistent with a fast electron transfer from cytochrome a to copper A. The absorbance changes at 598 nm gave an apparent rate of 17,000 {plus minus} 2,000 s{sup {minus}1} (1more » {sigma}), at pH 7.0 and 25.5{degree}C. These changes were not observed in either the CO mixed-valence or the CO-inhibited fully reduced forms of the enzyme. The rate was fastest at about pH 8.0, falling off toward both lower and higher pHs. There was a small but clear temperature dependence. The process was also observed in the cytochrome c-cytochrome c oxidase high-affinity complex. The electron equilibration measured between cytochrome {alpha} and copper A is far faster than any rate measured or inferred previously for this process.« less
Pushkaran, Suvarnamala; Konstantinidis, Diamantis G.; Koochaki, Sebastian; Malik, Punam; Mohandas, Narla; Zheng, Yi; Joiner, Clinton H.; Kalfa, Theodosia A.
2013-01-01
Chronic inflammation has emerged as an important pathogenic mechanism in sickle cell disease (SCD). One component of this inflammatory response is oxidant stress mediated by reactive oxygen species (ROS) generated by leukocytes, endothelial cells, plasma enzymes, and sickle red blood cells (RBC). Sickle RBC ROS generation has been attributed to sickle hemoglobin auto-oxidation and Fenton chemistry reactions catalyzed by denatured heme moieties bound to the RBC membrane. In this study, we demonstrate that a significant part of ROS production in sickle cells is mediated enzymatically by NADPH oxidase, which is regulated by protein kinase C, Rac GTPase, and intracellular Ca2+ signaling within the sickle RBC. Moreover, plasma from patients with SCD and isolated cytokines, such as transforming growth factor β1 and endothelin-1, enhance RBC NADPH oxidase activity and increase ROS generation. ROS-mediated damage to RBC membrane components is known to contribute to erythrocyte rigidity and fragility in SCD. Erythrocyte ROS generation, hemolysis, vaso-occlusion, and the inflammatory response to tissue damage may therefore act in a positive-feedback loop to drive the pathophysiology of sickle cell disease. These findings suggest a novel pathogenic mechanism in SCD and may offer new therapeutic targets to counteract inflammation and RBC rigidity and fragility in SCD. PMID:23349388
Development of a System Model for Non-Invasive Quantification of Bilirubin in Jaundice Patients
NASA Astrophysics Data System (ADS)
Alla, Suresh K.
Neonatal jaundice is a medical condition which occurs in newborns as a result of an imbalance between the production and elimination of bilirubin. Excess bilirubin in the blood stream diffuses into the surrounding tissue leading to a yellowing of the skin. An optical system integrated with a signal processing system is used as a platform to noninvasively quantify bilirubin concentration through the measurement of diffuse skin reflectance. Initial studies have lead to the generation of a clinical analytical model for neonatal jaundice which generates spectral reflectance data for jaundiced skin with varying levels of bilirubin concentration in the tissue. The spectral database built using the clinical analytical model is then used as a test database to validate the signal processing system in real time. This evaluation forms the basis for understanding the translation of this research to human trials. The clinical analytical model and signal processing system have been successful validated on three spectral databases. First spectral database is constructed using a porcine model as a surrogate for neonatal skin tissue. Samples of pig skin were soaked in bilirubin solutions of varying concentrations to simulate jaundice skin conditions. The resulting skins samples were analyzed with our skin reflectance systems producing bilirubin concentration values that show a high correlation (R2 = 0.94) to concentration of the bilirubin solution that each porcine tissue sample is soaked in. The second spectral database is the spectral measurements collected on human volunteers to quantify the different chromophores and other physical properties of the tissue such a Hematocrit, Hemoglobin etc. The third spectral database is the spectral data collected at different time periods from the moment a bruise is induced.
Zhang, Min; Wang, Lili; Wang, Yang; Tang, Jiulai
2018-04-09
The efficacy of massage to treat neonatal hyperbilirubinemia remains controversial. We conducted a systematic review and meta-analysis to explore the influence of massage on the neonatal hyperbilirubinemia. We search PubMed, Embase, Web of science, EBSCO, and Cochrane Library databases through November 2017 for randomized controlled trials (RCTs) assessing the effect of massage on neonatal hyperbilirubinemia. This meta-analysis is performed using the random-effect model. Six RCTs involving 357 patients are included in the meta-analysis. Overall, compared with the control group in neonatal hyperbilirubinemia, massage therapy is associated with substantially reduced serum bilirubin level within 4 d (mean difference (MD) = -2.31; 95% CI = -2.92 to -1.70; p < .00001) and transcutaneous bilirubin level within 4 d for neonatal hyperbilirubinemia (MD = -1.97; 95% CI = -2.55 to -1.39; p < .00001), but results no remarkable impact on serum bilirubin level on 2 d (MD = -0.82; 95% CI = -2.16-0.52; p = .23), transcutaneous bilirubin level on 2 d (MD = -0.17; 95% CI = -1.34 to 1.00; p = .77), frequency of defecation daily on 2 d (MD = 0.57; 95% CI = -0.03 to 1.16; p = .06), and frequency of defecation daily within 4 d (MD = 0.83; 95% CI = -0.11 to 1.76; p = .08). Massage therapy can significantly reduce serum bilirubin level and transcutaneous bilirubin level within 4 d, but demonstrates no influence on serum bilirubin level and transcutaneous bilirubin level on 2 d, frequency of defecation daily on 2 and 4 d for neonatal hyperbilirubinemia.
Serum bilirubin: a simple routine surrogate marker of the progression of chronic kidney disease.
Moolchandani, K; Priyadarssini, M; Rajappa, M; Parameswaran, S; Revathy, G
2016-10-01
Studies suggest that Chronic Kidney Disease (CKD) is a global burden health associated with significant comorbid conditions. Few biochemical parameters have gained significance in predicting the disease progression. The present work aimed to study the association of the simple biochemical parameter of serum bilirubin level with the estimated glomerular filtration rate (eGFR), and to assess their association with the co-morbid conditions in CKD. We recruited 188 patients with CKD who attended a Nephrology out-patient department. eGFR values were calculated based on the serum creatinine levels using CKD-EPI formula. Various biochemical parameters including glucose, creatinine, uric acid, total and direct bilirubin were assayed in all study subjects. Study subjects were categorized into subgroups based on their eGFR values and their diabetic status and the parameters were compared among the different subgroups. We observed a significantly decreased serum bilirubin levels (p < 0.001) in patients with lower eGFR values, compared to those with higher eGFR levels. There was a significant positive correlation between the eGFR levels and the total bilirubin levels (r = 0.92). We also observed a significant positive correlation between the eGFR levels and the direct bilirubin levels (r = 0.76). On multivariate linear regression analysis, we found that total and direct bilirubin independently predict eGFR, after adjusting for potential confounders (p < 0.001). Our results suggest that there is significant hypobilirubinemia in CKD, especially with increasing severity and co-existing diabetes mellitus. This finding has importance in the clinical setting, as assay of simple routine biochemical parameters such as serum bilirubin may help in predicting the early progression of CKD and more so in diabetic CKD.
Gene replacement therapy for genetic hepatocellular jaundice.
van Dijk, Remco; Beuers, Ulrich; Bosma, Piter J
2015-06-01
Jaundice results from the systemic accumulation of bilirubin, the final product of the catabolism of haem. Inherited liver disorders of bilirubin metabolism and transport can result in reduced hepatic uptake, conjugation or biliary secretion of bilirubin. In patients with Rotor syndrome, bilirubin (re)uptake is impaired due to the deficiency of two basolateral/sinusoidal hepatocellular membrane proteins, organic anion-transporting polypeptide 1B1 (OATP1B1) and OATP1B3. Dubin-Johnson syndrome is caused by a defect in the ATP-dependent canalicular transporter, multidrug resistance-associated protein 2 (MRP2), which mediates the export of conjugated bilirubin into bile. Both disorders are benign and not progressive and are characterised by elevated serum levels of mainly conjugated bilirubin. Uridine diphospho-glucuronosyl transferase 1A1 (UGT1A1) is responsible for the glucuronidation of bilirubin; deficiency of this enzyme results in unconjugated hyperbilirubinaemia. Gilbert syndrome is the mild and benign form of inherited unconjugated hyperbilirubinaemia and is mostly caused by reduced promoter activity of the UGT1A1 gene. Crigler-Najjar syndrome is the severe inherited form of unconjugated hyperbilirubinaemia due to mutations in the UGT1A1 gene, which can cause kernicterus early in life and can be even lethal when left untreated. Due to major disadvantages of the current standard treatments for Crigler-Najjar syndrome, phototherapy and liver transplantation, new effective therapeutic strategies are under development. Here, we review the clinical features, pathophysiology and genetic background of these inherited disorders of bilirubin metabolism and transport. We also discuss the upcoming treatment option of viral gene therapy for genetic disorders such as Crigler-Najjar syndrome and the possible immunological consequences of this therapy.
ERIC Educational Resources Information Center
Rubin, Rosalyn A.; And Others
The relationship of bilirubin (a red bile pigment that is sometimes found in the urine and occurs in the blood and tissues in jaundice) in infancy to later intellectual development was investigated in 241 infants with moderately elevated and high bilirubin levels. Ss were administered motor, psycholinguistic, and intelligence tests at age 8…
Conformational analysis and circular dichroism of bilirubin, the yellow pigment of jaundice
NASA Astrophysics Data System (ADS)
Lightner, David A.; Person, Richard; Peterson, Blake; Puzicha, Gisbert; Pu, Yu-Ming; Bojadziev, Stefan
1991-06-01
Conformational analysis of (4Z, 15Z)-bilirubin-IX(alpha) by molecular mechanics computations reveals a global energy minimum folded conformation. Powerful added stabilization is achieved through intramolecular hydrogen bonding. Theoretical treatment of bilirubin as a molecular exciton predicts an intense bisignate circular dichroism spectrum for the folded conformation: (Delta) (epsilon) is congruent to 270 L (DOT) mole-1 (DOT) cm-1 for the $OM450 nm electronic transition(s). Synthesis of bilirubin analogs with propionic acid groups methylated at the (alpha) or (beta) position introduces an allosteric effect that allows for an optical resolution of the pigments, with enantiomers exhibiting the theoretically predicted circular dichroism.
[Icterus of the newborn caused by indirect bilirubin--recent progress].
Hervei, Sarolta
2004-06-13
Recently a big shift has taken place in the judgment and treatment of jaundice in newborn, caused by increased unconjugated bilirubin level. New techniques evolved for assessing the prognosis of developing jaundice. An important major discovery is the antioxidant effect of bilirubin. We have a broader range of knowledge concerning the mechanism of bilirubin toxicity and for judging the chance of developing kernicterus. The prevention techniques do not stop at prohibiting anti-D immunisation but go on to preventing hydrops foetalis, the life-threatening form of haemolytic disease. There are data about the complications of phototherapy and EPO treatment for prolonged anaemia.
The impact of the UGT1A1*60 allele on bilirubin serum concentrations.
Pasternak, Amy L; Crews, Kristine R; Caudle, Kelly E; Smith, Colton; Pei, Deqing; Cheng, Cheng; Broeckel, Ulrich; Gaur, Aditya H; Hankins, Jane; Relling, Mary V; Haidar, Cyrine E
2017-01-01
Identify the functional status of the uridine-diphosphate glucuronyl transferase 1A1 (UGT1A1) -3279T>G (*60) variant. Retrospective review of clinically obtained serum bilirubin concentrations in pediatric patients to evaluate the association of the UGT1A1 -3279T>G (*60) variant with bilirubin concentrations and assessed linkage disequilibrium of the UGT1A1 -3279T>G (*60) and A(TA)7TAA (*28) variants. Total bilirubin concentration did not differ between patients who had a UGT1A1*1/*1 diplotype and patients homozygous for the UGT1A1 -3279T>G (*60/*60) variant. Total bilirubin concentration was lower in patients homozygous for the UGT1A1 -3279T>G (*60/*60) variant than in patients homozygous for the UGT1A1 A(TA)7TAA (*28/*28) variant (p < 0.01). The -3279T>G (*60) and A(TA)7TAA (*28) variants were in strong incomplete linkage disequilibrium in both black and white patients. The presence of the UGT1A1 -3279T>G (*60) variant is not associated with increased bilirubin concentrations.
Studies on the interference by haemoglobin in the determination of bilirubin.
van der Woerd-de Lange, J A; Guder, W G; Schleicher, E; Paetzke, I; Schleithoff, M; Wieland, O H
1983-07-01
Haemoglobin interference in the determination of bilirubin was compared in 7 different methods using the Jendrassik-Grof procedure, the Jendrassik-Grof-Nosslin modification, and the more recent procedures using nitrophenyldiazonium, 2,5-dichlorophenyldiazonium, 2,4-dichloraniline, and a direct reading method. To a variable degree, haemoglobin decreased the apparent absorption of the reaction product in all procedures. The extent of this decrease depended on the reagent used, the wavelength, incubation time, bilirubin concentration and the type of blank used. In an attempt to elucidate the mechanism of interference, haemoglobin was found to destroy the bilirubin diazo-compound whereas haemoglobin was ineffective. Likewise, storage of haemolytic samples for several days led to a disappearance of haemoglobin. H2O2, which had no effect in the absence of haemoglobin, potentiated the action of haemoglobin on diazobilirubin coupling. From our observations it can be concluded that haemoglobin disturbs the diazo-bilirubin reaction by a dual mechanism. H2O2, formed from oxyhaemoglobin by autoxidation, destroys the diazo bilirubin colour. In accordance with this explanation, potassium iodide stabilized the diazo compound against the peroxidative effect of oxyhaemoglobin; stabilization was not effective with superoxide dismutase, mannitol or ascorbate.
NASA Astrophysics Data System (ADS)
Ong, P. E.; K. C Huong, Audrey
2017-08-01
This paper presents the use of a point spectroscopy system to determine one’s transcutaneous bilirubin level using Modified Lambert Beer model and the developed fitting routine. This technique required a priori knowledge of extinction coefficient of bilirubin and hemoglobin components in the wavelength range of 440-500 nm for the prediction of the required parameter value. This work was conducted on different skin sites of six healthy Asians namely on the thenar region of the palm of their hand, back of the hand, posterior and anterior forearm. The obtained results revealed the lowest mean transcutaneous bilirubin concentration of 0.44±0.3 g/l predicted for palm site while the highest bilirubin level of 0.98±0.2 g/l was estimated for posterior forearm. These values were also compared with that presented in the literature. This study found considerably good consistency in the value predicted for different subjects especially at the thenar region of the palm. This work concluded that the proposed system and technique may be suitably served as an alternative means to noncontact and noninvasive measurement of one’s transcutaneous bilirubin level at palm site.
Validation of the peak bilirubin criterion for outcome after partial hepatectomy.
van Mierlo, Kim M C; Lodewick, Toine M; Dhar, Dipok K; van Woerden, Victor; Kurstjens, Ralph; Schaap, Frank G; van Dam, Ronald M; Vyas, Soumil; Malagó, Massimo; Dejong, Cornelis H C; Olde Damink, Steven W M
2016-10-01
Postoperative liver failure (PLF) is a dreaded complication after partial hepatectomy. The peak bilirubin criterion (>7.0 mg/dL or ≥120 μmol/L) is used to define PLF. This study aimed to validate the peak bilirubin criterion as postoperative risk indicator for 90-day liver-related mortality. Characteristics of 956 consecutive patients who underwent partial hepatectomy at the Maastricht University Medical Centre or Royal Free London between 2005 and 2012 were analyzed by uni- and multivariable analyses with odds ratios (OR) and 95% confidence intervals (95%CI). Thirty-five patients (3.7%) met the postoperative peak bilirubin criterion at median day 19 with a median bilirubin level of 183 [121-588] μmol/L. Sensitivity and specificity for liver-related mortality after major hepatectomy were 41.2% and 94.6%, respectively. The positive predictive value was 22.6%. Predictors of liver-related mortality were the peak bilirubin criterion (p < 0.001, OR = 15.9 [95%CI 5.2-48.7]), moderate-severe steatosis and fibrosis (p = 0.013, OR = 8.5 [95%CI 1.6-46.6]), ASA 3-4 (p = 0.047, OR = 3.0 [95%CI 1.0-8.8]) and age (p = 0.044, OR = 1.1 [95%CI 1.0-1.1]). The peak bilirubin criterion has a low sensitivity and positive predictive value for 90-day liver-related mortality after major hepatectomy. Copyright © 2016 International Hepato-Pancreato-Biliary Association Inc. Published by Elsevier Ltd. All rights reserved.
Kawamoto, Ryuichi; Ninomiya, Daisuke; Hasegawa, Yoichi; Kasai, Yoshihisa; Kusunoki, Tomo; Ohtsuka, Nobuyuki; Kumagi, Teru; Abe, Masanori
2016-01-01
Diabetes is strongly associated with several mechanisms of tissue damage such as oxidative stress. Serum bilirubin may have a beneficial role in preventing oxidative changes in cardiovascular disease (CVD). Limited information is available on whether serum bilirubin is an independent confounding factor for carotid atherosclerosis among elderly persons with type 2 diabetes. The study subjects were 169 men aged 79 ± 8 (mean ± SD) years and 205 women aged 81 ± 8 years that were enrolled consecutively from patients in the medical department. Carotid intima-media thickness (IMT) and plaque were derived via B-mode ultrasonography. Multiple linear regression analysis showed that serum total bilirubin (β = -0.160) was significantly associated with carotid IMT. Compared to subjects with a serum total bilirubin of tertile-1 (0.13-0.58 mg/dL), the multivariate-adjusted odds ratio (95% confidence interval) of carotid IMT ≥1.0 mm including plaque and carotid plaque was 0.46 (0.23-0.93) and 0.32 (0.17-0.60) in the Tertile-3 group (0.87-1.93 mg/dL), respectively. Next, data were further stratified by gender, age, smoking status, medication and prevalence of CVD. There were no significant differences in serum total bilirubin levels between selected subgroups. Our data demonstrated a negative association between serum total bilirubin and carotid atherosclerosis among elderly persons with type 2 diabetes.
Reduction of bilirubin by targeting human heme oxygenase-1 through siRNA.
Xia, Zhen-Wei; Li, Chun-E; Jin, You-Xin; Shi, Yi; Xu, Li-Qing; Zhong, Wen-Wei; Li, Yun-Zhu; Yu, Shan-Chang; Zhang, Zi-Li
2007-04-01
Neonatal hyperbilirubinemia is a common clinical condition caused mainly by the increased production and decreased excretion of bilirubin. Current treatment is aimed at reducing the serum levels of bilirubin. Heme oxygenase-1 (HO-1) is a rate-limiting enzyme that generates bilirubin. In this study we intended to suppress HO-1 using the RNA interference technique. Small interfering RNA (siRNA)-A, -B, and -C were designed based on human HO-1 (hHO-1) mRNA sequences. siRNA was transfected into a human hepatic cell line (HL-7702). hHO-1 transcription and protein levels were then determined. In addition, the inhibitory effect of siRNA on hHO-1 was assessed in cells treated with hemin or transfected with an hHO-1 plasmid. siRNA-C showed the most potent suppressive effect on hHO-1. This inhibition is dose and time dependent. Compared with control, both hemin and hHO-1 plasmids up-regulated hHO-1 expression in HL-7702 cells. However, the up-regulation was significantly attenuated by siRNA-C. Furthermore, the decrease in hHO-1 activity was coincident with the suppression of its transcription. Finally, siRNA-C was shown to reduce hHO-1 enzymatic activity and bilirubin levels. Thus, this study provides a novel therapeutic rationale by blocking bilirubin formation via siRNA for preventing and treating neonatal hyperbilirubinemia and bilirubin encephalopathy at an early clinical stage.
Xue, Guo-Chang; Ren, Ming-Xing; Shen, Lin-Na; Zhang, Li-Wen
2016-12-01
We designed a jaundice colour card that could be used by the parents of neonates and validated it by comparing it with total serum bilirubin levels. There were 106 term Chinese neonates in the study. The majority weighed between 2500 g and 3499 g (63%) and had a gestational age of 37-40 weeks (77%). The jaundice colour card and photometric determination were used to screen for neonatal jaundice and compared with serum bilirubin. The bilirubin levels were measured by mothers using the jaundice colour card, and 67% of the measurements were taken at 11-20 days (range 3-30). The measurements at the infant's forehead, cheek and sternum showed strong correlations with total serum bilirubin. The mean differences between the total serum bilirubin and the jaundice colour card measurements from the forehead, cheek and sternum were 1.9 mg/dL, 0.3 mg/dL and 1.5 mg/dL, respectively. When total serum bilirubin >13 mg/dL was used as the cut-off point, the areas under the receiver operating characteristics curves were 0.934 for the forehead, 0.985 for the cheek and 0.966 for the sternum. We established the validity of the jaundice colour card as a parental measurement tool for jaundice in Chinese neonates, and the cheek was the best measurement site. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.
Visuocortical Function in Infants With a History of Neonatal Jaundice
Hou, Chuan; Norcia, Anthony M.; Madan, Ashima; Good, William V.
2014-01-01
Purpose. High concentrations of unconjugated bilirubin are neurotoxic and cause brain damage in newborn infants. However, the exact level of bilirubin that may be neurotoxic in a given infant is unknown. The aim of this study was to use a quantitative measure of neural activity, the swept parameter visual evoked potential (sVEP) to determine the relationship between neonatal bilirubin levels and visual responsivity several months later. Methods. We compared sVEP response functions over a wide range of contrast, spatial frequency, and Vernier offset sizes in 16 full-term infants with high bilirubin levels (>10 mg/dL) and 18 age-matched infants with no visible neonatal jaundice, all enrolled at 14 to 22 weeks of age. The group means of sVEP thresholds and suprathreshold response amplitudes were compared. The correlation between individual sVEP thresholds and bilirubin levels in jaundiced infants was studied. Results. Infants who had a history of neonatal jaundice showed lower response amplitudes (P < 0.05) and worse or immeasurable sVEP thresholds compared with control infants for all three measures (P < 0.05). Swept parameter visual evoked potential thresholds for Vernier offset were correlated with bilirubin level (P < 0.05), but spatial acuity and contrast sensitivity measures in the infants with neonatal jaundice were not (P > 0.05). Conclusions. These results indicate that elevated neonatal bilirubin levels affect measures of visual function in infancy up to at least 14 to 22 weeks of postnatal age. PMID:25183760
Reductive trapping of substrate to bovine plasma amine oxidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hartmann, C.; Klinman, J.P.
1987-01-25
Plasma amine oxidases catalyze the oxidative deamination of amines to aldehydes, followed by a 2e- reduction of O/sub 2/ to H/sub 2/O/sub 2/. Pyrroloquinoline quinone (PQQ), previously believed to be restricted to prokaryotes, has recently been proposed to be the cofactor undergoing reduction in the first half-reaction of bovine plasma amine oxidase (Ameyama, M., Hayashi, U., Matsushita, K., Shinagawa, E., and Adachi, O. (1984) Agric. Biol. Chem. 48, 561-565; Lobenstein-Verbeek, C. L., Jongejan, J. A., Frank, J., and Duine, J. A. (1984) FEBS Lett. 170, 305-309). This result is unexpected, since model studies with PQQ implicate Schiff's base formation betweenmore » a reactive carbonyl and substrates, whereas experiments with bovine plasma amine oxidase have failed to provide evidence for a carbonyl cofactor. We have, therefore, re-examined putative adducts between substrate and enzyme-bound cofactor, employing a combination of (/sup 14/C)benzylamine and (/sup 3/H)NaCNBH/sub 3/. The use of the relatively weak reductant, NaCNBH/sub 3/, affords Schiff's base specificity and permits the study of enzyme below pH 7.0. As we show, enzyme can only be inactivated by NaCNBH/sub 3/ in the presence of substrate, leading to the incorporation of 1 mol of (/sup 14/C)benzylamine/mol of enzyme subunit at complete inactivation. By contrast, we are unable to detect any labeling with (/sup 3/H)NaCNBH/sub 3/, analogous to an earlier study with (/sup 3/H)NaCNBH/sub 4/ (Suva, R. H., and Abeles, R. H. (1978) Biochemistry 17, 3538-3545). We conclude, first, that our inability to obtain adducts containing both carbon 14 and tritium rules out the reductive trapping either of amine substrate with pyridoxal phosphate or of aldehyde product with a lysyl side chain and, second, that the observed pattern of labeling is fully consistent with the presence of PQQ at the active site of bovine plasma amine oxidase.« less
Lamarca, Angela; Benafif, Sarah; Ross, Paul; Bridgewater, John; Valle, Juan W
2015-09-01
The advanced biliary tract cancer (ABC)-02 study established cisplatin and gemcitabine (CisGem) as a reference 1(st)-line regimen for patients with advanced/metastatic biliary tract cancer; patients with bilirubin ⩾ 1.5 × upper limit of normal (ULN) were excluded and there are few extant data for systemic treatment in the context of elevated bilirubin. Patients with ABC, receiving CisGem with a baseline bilirubin of ⩾ 1.5 × ULN were eligible for this retrospective analysis; response, toxicity and survival data were collected. Thirty-three patients of 545 screened; median age 59 years, range 23-79; 58% male, 58% with metastases (79% in the liver) of performance status (PS) 0 (33%), 1 (64%) or 2 (3%) were eligible. The median baseline bilirubin was 55 μmol/L (range 32-286); due to biliary tract obstruction (BTO, 76%) or liver metastases (LM, 24%). Toxicity was comparable to the ABC-02 study; bilirubin normalised in 64% during chemotherapy/follow-up. The median progression-free survival (PFS) was 6.9 months (95% confidence interval (CI): 4.4-9.0) and median overall survival (OS) 9.5 months (95% CI: 5.7-12.8). Patients with BTO had a longer PFS and OS than those with LM (7.0 versus 2.6 months; p = 0.1633 and 9.8 versus 4.4 months, hazard ratio (HR) 0.74; p = 0.465, respectively); not statistically significant (due to small sample size). Normalisation of bilirubin and completion of eight CisGem cycles were associated with longer OS (11.4 versus 2.9 months, HR 0.49; p = 0.08 and 15.2 versus 5.4 months, HR 0.12 p < 0.001, respectively). No difference in OS was shown between the bilirubin percentiles (for either PFS or OS). For PS 0-1 patients with ABC and high bilirubin due to luminal disease despite optimal stenting CisGem can be used safely with results similar to those in patients with normal bilirubin. Copyright © 2015 Elsevier Ltd. All rights reserved.
Age-dependent pattern of cerebellar susceptibility to bilirubin neurotoxicity in vivo in mice
Bortolussi, Giulia; Baj, Gabriele; Vodret, Simone; Viviani, Giulia; Bittolo, Tamara; Muro, Andrés F.
2014-01-01
Neonatal jaundice is caused by high levels of unconjugated bilirubin. It is usually a temporary condition caused by delayed induction of UGT1A1, which conjugates bilirubin in the liver. To reduce bilirubin levels, affected babies are exposed to phototherapy (PT), which converts toxic bilirubin into water-soluble photoisomers that are readily excreted out. However, in some cases uncontrolled hyperbilirubinemia leads to neurotoxicity. To study the mechanisms of bilirubin-induced neurological damage (BIND) in vivo, we generated a mouse model lacking the Ugt1a1 protein and, consequently, mutant mice developed jaundice as early as 36 hours after birth. The mutation was transferred into two genetic backgrounds (C57BL/6 and FVB/NJ). We exposed mutant mice to PT for different periods and analyzed the resulting phenotypes from the molecular, histological and behavioral points of view. Severity of BIND was associated with genetic background, with 50% survival of C57BL/6‑Ugt1−/− mutant mice at postnatal day 5 (P5), and of FVB/NJ-Ugt1−/− mice at P11. Life-long exposure to PT prevented cerebellar architecture alterations and rescued neuronal damage in FVB/NJ-Ugt1−/− but not in C57BL/6-Ugt1−/− mice. Survival of FVB/NJ-Ugt1−/− mice was directly related to the extent of PT treatment. PT treatment of FVB/NJ-Ugt1−/− mice from P0 to P8 did not prevent bilirubin-induced reduction in dendritic arborization and spine density of Purkinje cells. Moreover, PT treatment from P8 to P20 did not rescue BIND accumulated up to P8. However, PT treatment administered in the time-window P0–P15 was sufficient to obtain full rescue of cerebellar damage and motor impairment in FVB/NJ-Ugt1−/− mice. The possibility to modulate the severity of the phenotype by PT makes FVB/NJ-Ugt1−/− mice an excellent and versatile model to study bilirubin neurotoxicity, the role of modifier genes, alternative therapies and cerebellar development during high bilirubin conditions. PMID:25062689
Riordan, Sean M.; Bittel, Douglas C.; Le Pichon, Jean-Baptiste; Gazzin, Silvia; Tiribelli, Claudio; Watchko, Jon F.; Wennberg, Richard P.; Shapiro, Steven M.
2016-01-01
Genetic-based susceptibility to bilirubin neurotoxicity and chronic bilirubin encephalopathy (kernicterus) is still poorly understood. Neonatal jaundice affects 60–80% of newborns, and considerable effort goes into preventing this relatively benign condition from escalating into the development of kernicterus making the incidence of this potentially devastating condition very rare in more developed countries. The current understanding of the genetic background of kernicterus is largely comprised of mutations related to alterations of bilirubin production, elimination, or both. Less is known about mutations that may predispose or protect against CNS bilirubin neurotoxicity. The lack of a monogenetic source for this risk of bilirubin neurotoxicity suggests that disease progression is dependent upon an overall decrease in the functionality of one or more essential genetically controlled metabolic pathways. In other words, a “load” is placed on key pathways in the form of multiple genetic variants that combine to create a vulnerable phenotype. The idea of epistatic interactions creating a pathway genetic load (PGL) that affects the response to a specific insult has been previously reported as a PGL score. We hypothesize that the PGL score can be used to investigate whether increased susceptibility to bilirubin-induced CNS damage in neonates is due to a mutational load being placed on key genetic pathways important to the central nervous system's response to bilirubin neurotoxicity. We propose a modification of the PGL score method that replaces the use of a canonical pathway with custom gene lists organized into three tiers with descending levels of evidence combined with the utilization of single nucleotide polymorphism (SNP) causality prediction methods. The PGL score has the potential to explain the genetic background of complex bilirubin induced neurological disorders (BIND) such as kernicterus and could be the key to understanding ranges of outcome severity in complex diseases. We anticipate that this method could be useful for improving the care of jaundiced newborns through its use as an at-risk screen. Importantly, this method would also be useful in uncovering basic knowledge about this and other polygenetic diseases whose genetic source is difficult to discern through traditional means such as a genome-wide association study. PMID:27587993
Conical intersection in a bilirubin model A possible pathway for phototherapy of neonatal jaundice
NASA Astrophysics Data System (ADS)
Zietz, Burkhard; Blomgren, Fredrik
2006-03-01
Phototherapy of neonatal jaundice involves Z- E-isomerisation around an exocyclic double bond in bilirubin. Our results of a CASSCF study on dipyrrinone, a bilirubin model, show a conical intersection between the ground and first excited singlet states associated with the Z- E-isomerisation. The conical intersection, located ca. 50 kJ/mol below the Franck-Condon-point, together with the S 1 minimum, ca. 50 kJ/mol below the conical intersection, are able to explain the available time-resolved spectroscopic data (the very short lifetime of the initially excited state and transient 'dark state' intermediate) as well as bilirubin's very low fluorescence quantum yield and the medium-efficient photoisomerisation reaction.
Molecular Insights into Human Monoamine Oxidase B Inhibition by the Glitazone Antidiabetes Drugs
2011-01-01
The widely employed antidiabetic drug pioglitazone (Actos) is shown to be a specific and reversible inhibitor of human monoamine oxidase B (MAO B). The crystal structure of the enzyme–inhibitor complex shows that the R-enantiomer is bound with the thiazolidinedione ring near the flavin. The molecule occupies both substrate and entrance cavities of the active site, establishing noncovalent interactions with the surrounding amino acids. These binding properties differentiate pioglitazone from the clinically used MAO inhibitors, which act through covalent inhibition mechanisms and do not exhibit a high degree of MAO A versus B selectivity. Rosiglitazone (Avandia) and troglitazone, other members of the glitazone class, are less selective in that they are weaker inhibitors of both MAO A and MAO B. These results suggest that pioglitazone may have utility as a “repurposed” neuroprotectant drug in retarding the progression of disease in Parkinson's patients. They also provide new insights for the development of reversible isoenzyme-specific MAO inhibitors. PMID:22282722
Treuffet, Johanne; Kubarych, Kevin J.; Lambry, Jean-Christophe; Pilet, Eric; Masson, Jean-Baptiste; Martin, Jean-Louis; Vos, Marten H.; Joffre, Manuel; Alexandrou, Antigoni
2007-01-01
We have implemented the recently demonstrated technique of chirped-pulse upconversion of midinfrared femtosecond pulses into the visible in a visible pump–midinfrared probe experiment for high-resolution, high-sensitivity measurements over a broad spectral range. We have succeeded in time-resolving the CO ligand transfer process from the heme Fe to the neighboring CuB atom in the bimetallic active site of mammalian cytochrome c oxidase, which was known to proceed in <1 ps, using the full CO vibrational signature of Fe–CO bond breaking and CuB–CO bond formation. Our differential transmission results show a delayed onset of the appearance of the CuB-bound species (200 fs), followed by a 450-fs exponential rise. Trajectories calculated by using molecular-dynamics simulations with a Morse potential for the CuB–C interaction display a similar behavior. Both experimental and calculated data strongly suggest a ballistic contribution to the transfer process. PMID:17895387
Preparation of immobilized glucose oxidase wafer enzyme on calcium-bentonite modified by surfactant
NASA Astrophysics Data System (ADS)
Widi, R. K.; Trisulo, D. C.; Budhyantoro, A.; Chrisnasari, R.
2017-07-01
Wafer glucose oxidase (GOx) enzymes was produced by addition of PAH (Poly-Allyamine Hydrochloride) polymer into immobilized GOx enzyme on modified-Tetramethylammonium Hydroxide (TMAH) 5%-calsium-bentonite. The use of surfactant molecul (TMAH) is to modify the surface properties and pore size distribution of the Ca-bentonite. These properties are very important to ensure GOx molecules can be bound on the Ca-bentonit surface to be immobilized. The addition of the polymer (PAH) is expected to lead the substrates to be adsorbed onto the enzyme. In this study, wafer enzymes were made in various concentration ratio (Ca-bentonite : PAH) which are 1:0, 1:1, 1:2 and 1:3. The effect of PAH (Poly-Allyamine Hydrochloride) polymer added with various ratios of concentrations can be shown from the capacitance value on LCR meter and enzyme activity using DNS method. The addition of the polymer (PAH) showed effect on the activity of GOx, it can be shown from the decreasing of capacitance value by increasing of PAH concentration.
A structural and functional model for the 1-aminocyclopropane-1-carboxylic acid oxidase.
Sallmann, Madleen; Oldenburg, Fabio; Braun, Beatrice; Réglier, Marius; Simaan, A Jalila; Limberg, Christian
2015-10-12
The hitherto most realistic low-molecular-weight analogue for the 1-aminocyclopropane-1-carboxylic acid oxidase (ACCO) is reported. The ACCOs 2-His-1-carboxylate iron(II) active site was mimicked by a TpFe moiety, to which the natural substrate ACC could be bound. The resulting complex [Tp(Me,Ph) FeACC] (1), according to X-ray diffraction analysis performed for the nickel analogue, represents an excellent structural model, featuring ACC coordinated in a bidentate fashion-as proposed for the enzymatic substrate complex-as well as a vacant coordination site that forms the basis for the first successful replication also of the ACCO function: 1 is the first known ACC complex that reacts with O2 to produce ethylene. As a FeOOH species had been suggested as intermediate in the catalytic cycle, H2 O2 was tested as the oxidant, too, and indeed evolution of ethylene proceeded even more rapidly to give 65 % yield. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Purification and properties of fructosyl lysine oxidase from Fusarium oxysporum S-1F4.
Sakai, Y; Yoshida, N; Isogai, A; Tani, Y; Kato, N
1995-03-01
Fructosyl lysine oxidase (FLOD) was examined for its use in the enzymatic measurement of the level of glycated albumin in blood serum. To isolate microorganisms having such an enzyme activity, we used N epsilon-fructosyl N alpha-Z-lysine (epsilon-FL) as a sole nitrogen source in the enrichment culture medium. The isolated fungus, strain S-1F4, showed a high FLOD activity in the cell-free extract and was identified as Fusarium oxysporum. FLOD was purified to an apparent homogeneity on SDS-PAGE. The molecular mass of the subunit was 50 kDa on SDS-PAGE and seemed to exist in a monomeric form. The enzyme had an absorption spectrum characteristic of a flavoprotein and the flavin was found to be covalently bound to the enzyme. The enzyme acted against N epsilon-fructosyl N alpha-Z-lysine and N alpha-fructosyl N epsilon-Z-lysine and showed specificity for fructosyl lysine residues.
Tirandamycin biosynthesis is mediated by co-dependent oxidative enzymes
NASA Astrophysics Data System (ADS)
Carlson, Jacob C.; Li, Shengying; Gunatilleke, Shamila S.; Anzai, Yojiro; Burr, Douglas A.; Podust, Larissa M.; Sherman, David H.
2011-08-01
Elucidation of natural product biosynthetic pathways provides important insights into the assembly of potent bioactive molecules, and expands access to unique enzymes able to selectively modify complex substrates. Here, we show full reconstitution, in vitro, of an unusual multi-step oxidative cascade for post-assembly-line tailoring of tirandamycin antibiotics. This pathway involves a remarkably versatile and iterative cytochrome P450 monooxygenase (TamI) and a flavin adenine dinucleotide-dependent oxidase (TamL), which act co-dependently through the repeated exchange of substrates. TamI hydroxylates tirandamycin C (TirC) to generate tirandamycin E (TirE), a previously unidentified tirandamycin intermediate. TirE is subsequently oxidized by TamL, giving rise to the ketone of tirandamycin D (TirD), after which a unique exchange back to TamI enables successive epoxidation and hydroxylation to afford, respectively, the final products tirandamycin A (TirA) and tirandamycin B (TirB). Ligand-free, substrate- and product-bound crystal structures of bicovalently flavinylated TamL oxidase reveal a likely mechanism for the C10 oxidation of TirE.
Thomas, David C.; Clare, Simon; Sowerby, John M.; Juss, Jatinder K.; Goulding, David A.; van der Weyden, Louise; Prakash, Ananth; Harcourt, Katherine; Mukhopadhyay, Subhankar; Antrobus, Robin; Bateman, Alex
2017-01-01
The phagocyte respiratory burst is crucial for innate immunity. The transfer of electrons to oxygen is mediated by a membrane-bound heterodimer, comprising gp91phox and p22phox subunits. Deficiency of either subunit leads to severe immunodeficiency. We describe Eros (essential for reactive oxygen species), a protein encoded by the previously undefined mouse gene bc017643, and show that it is essential for host defense via the phagocyte NAPDH oxidase. Eros is required for expression of the NADPH oxidase components, gp91phox and p22phox. Consequently, Eros-deficient mice quickly succumb to infection. Eros also contributes to the formation of neutrophil extracellular traps (NETS) and impacts on the immune response to melanoma metastases. Eros is an ortholog of the plant protein Ycf4, which is necessary for expression of proteins of the photosynthetic photosystem 1 complex, itself also an NADPH oxio-reductase. We thus describe the key role of the previously uncharacterized protein Eros in host defense. PMID:28351984
Raimondi, Francesco; Borrelli, Angela Carla; Ferrara, Teresa; Giannattasio, Antonietta; Capasso, Letizia
2017-09-01
To compare levels of bilirubin (using the area under the curve, AUC) in preterm infants before the onset of sepsis with healthy matched-controls. Preterm infants born between January 2011 and December 2015 with late-onset sepsis were enrolled in our retrospective study and were matched with healthy controls (sex, birth weight and gestational age). Levels of bilirubin were registered in the eight days preceding the onset of sepsis and the AUC was calculated for both groups. Eighty-eight neonates (44 cases) were studied. GA and BW did not differ between cases and controls. In cases, we found a higher value of AUC (30.7 versus 22.5; p = 0.021). In our retrospective cohort, we found that the levels of bilirubin and the AUC in the first eight days before the onset of sepsis in preterm infants were significantly higher than the healthy controls. These data suggest that the prolonged exposition to high levels of bilirubin could increase the infection susceptibility in preterm infants.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fujiwara, Ryoichi, E-mail: fujiwarar@pharm.kitasato-u.ac.jp; Maruo, Yoshihiro; Chen, Shujuan
Newborns commonly develop physiological hyperbilirubinemia (also known as jaundice). With increased bilirubin levels being observed in breast-fed infants, breast-feeding has been recognized as a contributing factor for the development of neonatal hyperbilirubinemia. Bilirubin undergoes selective metabolism by UDP-glucuronosyltransferase (UGT) 1A1 and becomes a water soluble glucuronide. Although several factors such as gestational age, dehydration and weight loss, and increased enterohepatic circulation have been associated with breast milk-induced jaundice (BMJ), deficiency in UGT1A1 expression is a known cause of BMJ. It is currently believed that unconjugated bilirubin is metabolized mainly in the liver. However, recent findings support the concept that extrahepaticmore » tissues, such as small intestine and skin, contribute to bilirubin glucuronidation during the neonatal period. We will review the recent advances made towards understanding biological and molecular events impacting BMJ, especially regarding the role of extrahepatic UGT1A1 expression. - Highlights: • Breast-feeding can be a factor for the development of neonatal hyperbilirubinemia. • UDP-glucuronosyltransferase (UGT) 1A1 is the sole bilirubin-metabolizing enzyme. • Extrahepatic UGT1A1 plays an important role in bilirubin metabolism. • We discuss the potential mechanism of breast milk-induced neonatal jaundice.« less
Marked Direct Hyperbilirubinemia due to Ceftriaxone in an Adult with Sickle Cell Disease
Khurram, Daniyeh; Shamban, Leonid; Kornas, Robert; Paul, Maryann
2015-01-01
Drugs are a significant cause of liver injury. Drug-induced liver injury (DILI) can cause acute hepatitis, cholestasis, or a mixed pattern. Ceftriaxone is a commonly used antibiotic and has been associated with reversible biliary sludge, pseudolithiasis, and cholestasis. A 32-year-old male with sickle cell disease was admitted to the hospital for acute sickle cell crisis. On the second day of hospitalization, he developed cough and rhonchi with chest X-ray revealing right middle lobe infiltrates. Ceftriaxone and azithromycin were initiated. Subsequently, he developed conjugated hyperbilirubinemia and mild transaminitis. His total bilirubin trended upwards from 3.3 mg/dL on admission to 17 mg/dL. It was predominantly conjugated bilirubin, with preadmission bilirubin levels of 3-4 mg/dL. His transaminases were mildly elevated as well compared to previous levels. Extensive workup for bilirubin elevation was unremarkable. Ceftriaxone was switched to levofloxacin and the hyperbilirubinemia improved. On ambulatory follow-up, his bilirubin remained below 4 mg/dL. Ceftriaxone may be associated with marked direct hyperbilirubinemia particularly in sickle cell patients with chronic liver chemistry abnormalities. In the case of elevated bilirubin with concomitant ceftriaxone use, elimination of the offending agent should be considered. PMID:26101675
Panahi, Rasool; Jafari, Zahra; Sheibanizade, Abdoreza; Salehi, Masoud; Esteghamati, Abdoreza; Hasani, Sara
2013-01-01
Introduction: Neonatal hyperbilirubinemia is one of the most important factors affecting the auditory system and can cause sensorineural hearing loss. This study investigated the relationship between behavioral hearing thresholds in children with a history of jaundice and the maximum level of bilirubin concentration in the blood. Materials and Methods: This study was performed on 18 children with a mean age of 5.6 years and with a history of neonatal hyperbilirubinemia. Behavioral hearing thresholds, transient evoked emissions and brainstem evoked responses were evaluated in all children. Results: Six children (33.3%) had normal hearing thresholds and the remaining (66.7%) had some degree of hearing loss. There was no significant relationship (r=-0.28, P=0.09) between the mean total bilirubin levels and behavioral hearing thresholds in all samples. A transient evoked emission was seen only in children with normal hearing thresholds however in eight cases brainstem evoked responses had not detected. Conclusion: Increased blood levels of bilirubin at the neonatal period were potentially one of the causes of hearing loss. There was a lack of a direct relationship between neonatal bilirubin levels and the average hearing thresholds which emphasizes on the necessity of monitoring the various amounts of bilirubin levels. PMID:24303432
Adlard, B. P. F.; Lathe, G. H.
1970-01-01
1. It was confirmed that bilirubin glucuronyltransferase can be obtained in solubilized form from rat liver microsomes. 2. Michaelis–Menten kinetics were not followed by the enzyme with bilirubin as substrate when the bilirubin/albumin ratio was varied. High concentrations of bilirubin were inhibitory. 3. The Km for UDP-glucuronic acid at the optimum bilirubin concentration was 0.46mm. 4. Low concentrations of Ca2+ were inhibitory in the absence of Mg2+ but stimulatory in its presence; the converse applied for EDTA. 5. UDP-N-acetylglucosamine and UDP-glucose enhanced conjugation by untreated, but not by solubilized microsomes. 6. The apparent 9.5-fold increase in activity after solubilization was probably due to the absence of UDP-glucuronic acid pyrophosphatase activity in the solubilized preparation. 7. The activation of solubilized enzyme activity by ATP was considered to be a result of chelation of inhibitory metal ions. 8. The solubilized enzyme activity was inhibited by UMP and UDP. The effect of UMP was not competitive with respect to UDP-glucuronic acid. 9. A number of steroids inhibited the solubilized enzyme activity. The competitive effects of stilboestrol, oestrone sulphate and 3β-hydroxyandrost-5-en-17-one, with respect to UDP-glucuronic acid, may be explained on an allosteric basis. PMID:4251180
Higher hydrocortisone dose increases bilirubin in hypopituitary patients- results from an RCT.
Werumeus Buning, Jorien; Kootstra-Ros, Jenny E; Brummelman, Pauline; van den Berg, Gerrit; van der Klauw, Melanie; Wolffenbuttel, Bruce H R; van Beek, André P; Dullaart, Robin P F
2016-05-01
Bilirubin has anti-oxidative and anti-inflammatory properties, which may explain its proposed protective effects on the development of cardiometabolic disorders. Glucocorticoids affect heme oxygenase regulation in vitro, which plays a key role in bilirubin production. Effects of variations in glucocorticoid exposure on circulating bilirubin levels in humans are unknown. Here we tested whether a higher hydrocortisone replacement dose affects circulating bilirubin in hypopituitary patients. A randomized double-blind cross-over study (ClinicalTrials.gov, number NCT01546992) was performed in 47 patients with secondary adrenal failure [10-week exposure to a higher hydrocortisone dose (0·4-0·6 mg/kg body weight) vs. 10 weeks of a lower hydrocortisone dose (0·2-0·3 mg/kg body weight)]. Plasma total bilirubin was increased by 10% from 7 to 8 μM in response to the higher hydrocortisone dose (P = 0·033). This effect was inversely related to age (P = 0·042), but was unaffected by sex, obesity and (replacement for) other hormonal insufficiencies. The higher hydrocortisone dose also resulted in lower alkaline phosphatase (P = 0·006) and aspartate aminotransferase activities (P = 0·001). Bilirubin is modestly increased in response to higher glucocorticoid exposure in humans, in conjunction with lower alkaline phosphatase and aspartate aminotransferase activities, which are supposed to represent biomarkers of a pro-inflammatory state and enhanced liver fat accumulation. © 2016 The Authors. European Journal of Clinical Investigation published by John Wiley & Sons Ltd on behalf of Stichting European Society for Clinical Investigation Journal Foundation.
Acute hyperbilirubinaemia induces presynaptic neurodegeneration at a central glutamatergic synapse
Haustein, Martin D; Read, David J; Steinert, Joern R; Pilati, Nadia; Dinsdale, David; Forsythe, Ian D
2010-01-01
There is a well-established link between hyperbilirubinaemia and hearing loss in paediatrics, but the cellular mechanisms have not been elucidated. Here we used the Gunn rat model of hyperbilirubinaemia to investigate bilirubin-induced hearing loss. In vivo auditory brainstem responses revealed that Gunn rats have severe auditory deficits within 18 h of exposure to high bilirubin levels. Using an in vitro preparation of the auditory brainstem from these rats, extracellular multi-electrode array recording from the medial nucleus of the trapezoid body (MNTB) showed longer latency and decreased amplitude of evoked field potentials following bilirubin exposure, suggestive of transmission failure at this synaptic relay. Whole-cell patch-clamp recordings confirmed that the electrophysiological properties of the postsynaptic MNTB neurons were unaffected by bilirubin, with no change in action potential waveforms or current–voltage relationships. However, stimulation of the trapezoid body was unable to elicit large calyceal EPSCs in MNTB neurons of hyperbilirubinaemic rats, indicative of damage at a presynaptic site. Multi-photon imaging of anterograde-labelled calyceal projections revealed axonal staining and presynaptic profiles around MNTB principal neuron somata. Following induction of hyperbilirubinaemia the giant synapses were largely destroyed. Electron microscopy confirmed loss of presynaptic calyceal terminals and supported the electrophysiological evidence for healthy postsynaptic neurons. MNTB neurons express high levels of neuronal nitric oxide synthase (nNOS). Nitric oxide has been implicated in mechanisms of bilirubin toxicity elsewhere in the brain, and antagonism of nNOS by 7-nitroindazole protected hearing during bilirubin exposure. We conclude that bilirubin-induced deafness is caused by degeneration of excitatory synaptic terminals in the auditory brainstem. PMID:20937712
Acute hyperbilirubinaemia induces presynaptic neurodegeneration at a central glutamatergic synapse.
Haustein, Martin D; Read, David J; Steinert, Joern R; Pilati, Nadia; Dinsdale, David; Forsythe, Ian D
2010-12-01
There is a well-established link between hyperbilirubinaemia and hearing loss in paediatrics, but the cellular mechanisms have not been elucidated. Here we used the Gunn rat model of hyperbilirubinaemia to investigate bilirubin-induced hearing loss. In vivo auditory brainstem responses revealed that Gunn rats have severe auditory deficits within 18 h of exposure to high bilirubin levels. Using an in vitro preparation of the auditory brainstem from these rats, extracellular multi-electrode array recording from the medial nucleus of the trapezoid body (MNTB) showed longer latency and decreased amplitude of evoked field potentials following bilirubin exposure, suggestive of transmission failure at this synaptic relay. Whole-cell patch-clamp recordings confirmed that the electrophysiological properties of the postsynaptic MNTB neurons were unaffected by bilirubin, with no change in action potential waveforms or current-voltage relationships. However, stimulation of the trapezoid body was unable to elicit large calyceal EPSCs in MNTB neurons of hyperbilirubinaemic rats, indicative of damage at a presynaptic site. Multi-photon imaging of anterograde-labelled calyceal projections revealed axonal staining and presynaptic profiles around MNTB principal neuron somata. Following induction of hyperbilirubinaemia the giant synapses were largely destroyed. Electron microscopy confirmed loss of presynaptic calyceal terminals and supported the electrophysiological evidence for healthy postsynaptic neurons. MNTB neurons express high levels of neuronal nitric oxide synthase (nNOS). Nitric oxide has been implicated in mechanisms of bilirubin toxicity elsewhere in the brain, and antagonism of nNOS by 7-nitroindazole protected hearing during bilirubin exposure. We conclude that bilirubin-induced deafness is caused by degeneration of excitatory synaptic terminals in the auditory brainstem.
Black and brown pigment gallstones differ in microstructure and microcomposition.
Malet, P F; Takabayashi, A; Trotman, B W; Soloway, R D; Weston, N E
1984-01-01
The two subtypes of pigment gallstones, black and brown stones, differ in chemical composition and pathogenesis. We examined a black bilirubinate stone and a black phosphate stone (which represented opposite ends of the compositional spectrum of black noncarbonate stones), a black carbonate stone, and a brown pigment stone using scanning electron microscopy and microchemical techniques to determine if stone microstructure and microcomposition reflected different patterns of formation. The cross-sectional surfaces of the black bilirubinate and black phosphate stones were smooth and homogenous. Electron probe microanalysis demonstrated high concentrations of sulfur and copper in the center of the black bilirubinate stone; sulfur was in a low valence state consistent with disulfide linkages in proteins. The brown stone was rough-surfaced with lamellated bands on cross-section. The lighter-colored bands in this stone contained virtually all of the detected calcium palmitate, while the darker sections contained much more calcium bilirubinate. Plasma oxygen etching demonstrated a network of protein interdigitating with calcium bilirubinate salts in the black bilirubinate and black phosphate stones but not in the black carbonate or brown stones. Argon ion etching demonstrated that calcium bilirubinate was in a closely packed rod-shaped arrangement in all three black stones but not in the brown stone. We conclude that the marked differences in structure and composition between the black noncarbonate and brown pigment gallstones support the hypothesis that the two major pigment gallstone types form by different mechanisms. In addition, the layered structures of the black carbonate and brown stones suggest that stone growth is affected by cyclic changes in biliary composition.
Shenouda, Michael M; Harb, Shady ElGhazaly; Mikhail, Sameh A A; Mokhtar, Sherif M; Osman, Ayman M A; Wassef, Arsany T S; Rizkallah, Nayer N H; Milad, Nader M; Anis, Shady E; Nabil, Tamer Mohamed; Zaki, Nader Sh; Halepian, Antoine
2018-02-01
Laparoscopic single anastomosis gastric bypass (SAGB) is increasingly performed for morbidly obese patients. This pilot study aims primarily at evaluating the incidence of bile gastritis after SAGB. The occurrence of reflux oesophagitis and reflux symptoms were also assessed. This study included 20 patients having no reflux symptoms. All patients underwent a SAGB as a primary bariatric procedure by a single surgeon. Patients included consented to have an upper GI endoscopy done at 6 months postoperatively. Gastric aspirate was sent for bilirubin level assessment. Gastric and esophageal biopsies were submitted for histopathology and campylobacter-like organism (CLO) test. In our study, the rate of bile gastritis was 30%. In 18 patients, the level of bilirubin in gastric aspirate seems to be related to the degree of mucosal inflammation. The remaining two patients had microscopic moderate to severe gastritis with normal aspirate bilirubin level. Two patients with bilirubin level in aspirate more than 20 mg/dl had severe oesophagitis, gastritis with erosions, and metaplasia. Relationship between bilirubin level and histopathological findings of gastric biopsy examination was statistically significant with a P value of 0.001. The incidence of bile gastritis in this cohort is higher than reported in the literature, and this may be worrying. The correlation between endoscopic findings and patients' symptoms is poor. Bilirubin level and pH in aspirate might be useful tools to confirm alkaline reflux. Its level might help to choose candidates for revision surgery after SAGB. This needs further validation with larger sample size.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Song, Shasha; Wang, Shuang; Biopharmaceutical Key Laboratory of Heilongjiang Province, Harbin 150081
2013-08-01
Inhibition of pulmonary arterial smooth muscle cell (PASMC) apoptosis induced by hypoxia plays an important role in pulmonary arterial remodeling leading to aggravate hypoxic pulmonary arterial hypertension. However, the mechanisms of hypoxia acting on PASMC apoptosis remain exclusive. Biliverdin reductase (BVR) has many essential biologic roles in physiological and pathological processes. Nevertheless, it is unclear whether the hypoxia-induced inhibition on PASMC apoptosis is mediated by BVR. In the present work, we found BVR majorly localized in PASMCs and was up-regulated in levels of protein and mRNA by hypoxia. Then we studied the contribution of BVR to anti-apoptotic response of hypoxiamore » in PASMCs. Our results showed that siBVR, blocking generation of bilirubin, reversed the effect of hypoxia on enhancing cell survival and apoptotic protein (Bcl-2, procasepase-9, procasepase-3) expression, preventing nuclear shrinkage, DNA fragmentation and mitochondrial depolarization in starved PASMCs, which were recovered by exogenous bilirubin. Moreover, the inhibitory effect of bilirubin on PASMC apoptosis under hypoxic condition was blocked by the inhibitor of ERK1/2 pathway. Taken together, our data indicate that BVR contributes to the inhibitory process of hypoxia on PASMC apoptosis, which is mediated by bilirubin through ERK1/2 pathway. Highlights: • BVR expresses in PASMC and is up-regulated by hypoxia in protein and mRNA levels. • BVR/bilirubin contribute to the inhibitive process of hypoxia on PASMC apoptosis. • Bilirubin protects PASMC from apoptosis under hypoxia via ERK1/2 pathway.« less
Neonatal hyperbilirubinemia and risk of autism spectrum disorders.
Croen, Lisa A; Yoshida, Cathleen K; Odouli, Roxana; Newman, Thomas B
2005-02-01
To investigate the association between neonatal hyperbilirubinemia and autism spectrum disorders (ASD). We conducted a large case-control study nested within the cohort of singleton term infants born between 1995 and 1998 at a northern California Kaiser Permanente hospital. Case subjects (n = 338) were children with an ASD diagnosis recorded in Kaiser Permanente outpatient databases; control subjects (n = 1817) were children without an ASD diagnosis, who were randomly sampled and frequency-matched to case subjects according to gender, birth year, and birth hospital. Approximately 28% of case and control subjects received > or =1 bilirubin test in the first 30 days of life. No case-control differences were observed for maximal bilirubin levels of > or =15 mg/dL (10.1% vs 12.1%), > or =20 mg/dL (2.1% vs 2.5%), or > or =25 mg/dL (0.3% vs 0.2%). Compared with children whose maximal neonatal bilirubin levels were <15 mg/dL or not measured, children with any degree of bilirubin level elevation were not at increased risk of ASD, after adjustment for gender, birth facility, maternal age, maternal race/ethnicity, maternal education, and gestational age (for bilirubin levels of 15-19.9 mg/dL: odds ratio: 0.7; 95% confidence interval: 0.5-1.2; for bilirubin levels of 20-24.9 mg/dL: odds ratio: 0.7; 95% confidence interval: 0.3-1.6; for bilirubin levels of > or =25 mg/dL: odds ratio: 1.1; 95% confidence interval: 0.1-11.2). These data suggest that neonatal hyperbilirubinemia is not a risk factor for ASD.
Ryu, Seungho; Chang, Yoosoo; Zhang, Yiyi; Woo, Hee-Yeon; Kwon, Min-Jung; Park, Hyosoon; Lee, Kyu-Beck; Son, Hee Jung; Cho, Juhee; Guallar, Eliseo
2014-01-01
Background The association between serum bilirubin levels and incident chronic kidney disease (CKD) in the general population is unknown. We aimed to examine the association between serum bilirubin concentration (total, direct, and indirect) and the risk of incident CKD. Methods and Findings Longitudinal cohort study of 12,823 Korean male workers 30 to 59 years old without CKD or proteinuria at baseline participating in medical health checkup program in a large worksite. Study participants were followed for incident CKD from 2002 through 2011. Estimated glomerular filtration rate (eGFR) was estimated by using the CKD-EPI equation. CKD was defined as eGFR <60 mL/min per 1.73 m2. Parametric Cox models and pooled logistic regression models were used to estimate adjusted hazard ratios for incident CKD. We observed 238 incident cases of CKD during 70,515.8 person-years of follow-up. In age-adjusted models, the hazard ratios for CKD comparing quartiles 2–4 vs. quartile 1 of serum direct bilirubin were 0.93 (95% CI 0.67–1.28), 0.88 (0.60–1.27) and 0.60 (0.42–0.88), respectively. In multivariable models, the adjusted hazard ratio for CKD comparing the highest to the lowest quartile of serum direct bilirubin levels was 0.60 (95% CI 0.41–0.87; P trend = 0.01). Neither serum total nor indirect bilirubin levels were significantly associated with the incidence of CKD. Conclusions Higher serum direct bilirubin levels were significantly associated with a lower risk of developing CKD, even adjusting for a variety of cardiometabolic parameters. Further research is needed to elucidate the mechanisms underlying this association and to establish the role of serum direct bilirubin as a marker for CKD risk. PMID:24586219
Hughes, J T; Barzi, F; Hoy, W E; Jones, G R D; Rathnayake, G; Majoni, S W; Thomas, M A B; Sinha, A; Cass, A; MacIsaac, R J; O'Dea, K; Maple-Brown, L J
2017-12-01
Low serum bilirubin concentrations are reported to be strongly associated with cardio-metabolic disease, but this relationship has not been reported among Indigenous Australian people who are known to be at high risk for diabetes and chronic kidney disease (CKD). serum bilirubin will be negatively associated with markers of chronic disease, including CKD and anaemia among Indigenous Australians. A cross-sectional analysis of 594 adult Aboriginal and Torres Strait Islander (TSI) people in good health or with diabetes and markers of CKD. Measures included urine albumin: creatinine ratio (ACR), estimated glomerular filtration rate (eGFR), haemoglobin (Hb) and glycated haemoglobin (HbA1c). Diabetes was defined by medical history, medications or HbA1c≥6.5% or ≥48mmol/mol. Anaemia was defined as Hb<130g/L or <120g/L in males and females respectively. A multivariate regression analysis examining factors independently associated with log-bilirubin was performed. Participants mean (SD) age was 45.1 (14.5) years, and included 62.5% females, 71.7% Aboriginal, 41.1% with diabetes, 16.7% with anaemia, 41% with ACR>3mg/mmol and 18.2% with eGFR<60mL/min/1.73m 2 . Median bilirubin concentration was lower in females than males (6 v 8μmol/L, p<0.001) and in Aboriginal than TSI participants (6 v 9.5μmol/L, p<0.001). Six factors explained 35% of the variance of log-bilirubin; Hb and cholesterol (both positively related) and ACR, triglycerides, Aboriginal ethnicity and female gender (all inversely related). Serum bilirubin concentrations were positively associated with Hb and total cholesterol, and inversely associated with ACR. Further research to determine reasons explaining lower bilirubin concentrations among Aboriginal compared with TSI participants are needed. Copyright © 2017 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
Moyle, Graeme; Else, Laura; Jackson, Akil; Back, David; Yapa, Manisha H.; Seymour, Natalia; Ringner-Nackter, Lisa; Karolia, Zeenat; Gazzard, Brian
2013-01-01
Atazanavir (ATV) causes an elevation of unconjugated hyperbilirubinemia (HBR) as a result of UDP glucuronyltransferase (UGT) 1A1 inhibition. Zinc sulfate (ZnSO4) reduces unconjugated hyperbilirubinemia in individuals with Gilbert's syndrome. We assessed the changes in total, conjugated, and unconjugated bilirubin and the effect on ATV pharmacokinetics (PK) after single and 14-day dosing of ZnSO4. HIV patients, stable on ATV/ritonavir (ATV/r)-containing regimens with a total bilirubin level of >25mmol/liter received 125 mg daily of ZnSO4 as Solvazinc tablets for 14 days. ATV/r and bilirubin concentrations were measured pre-ATV/r dose and 2, 4, 6, 8, and 24 h post-ATV/r dose; before ZnSO4 initiation (phase 1), after a single dose (phase 2) and after 14 days (phase 3). Changes in bilirubin and ATV/r concentrations in the absence or presence of ZnSO4 were evaluated by geometric mean ratios (GMRs) and 90% confidence intervals (CIs; we used phase 1 as a reference). Sixteen male patients completed the study maintaining virologic suppression; ZnSO4 was well tolerated. Statistically significant declines in total bilirubin Cmax and AUC0–24 of 16 and 17% were seen in phase2 and 20% in phase 3. Although there were no significant changes in conjugated bilirubin, unconjugated bilirubin Cmax and AUC0–24 of were lower (17 and 19%, phase 2; 20 and 23% during phase 3). The ATV GMRs (90% CI) for Ctrough, Cmax, and AUC0–24 were 0.74 (0.62 to 0.89), 0.82 (0.70 to 0.97), and 0.78 (0.70 to 0.88). Intake of ZnSO4 decreases total and unconjugated bilirubin and causes modest declines in ATV exposure. ZnSO4 supplementation may be useful in management of ATV-related HBR in selected patients. PMID:23689708
Guschin, Dmitrii A; Castillo, John; Dimcheva, Nina; Schuhmann, Wolfgang
2010-10-01
The design of polymers carrying suitable ligands for coordinating Os complexes in ligand exchange reactions against labile chloro ligands is a strategy for the synthesis of redox polymers with bound Os centers which exhibit a wide variation in their redox potential. This strategy is applied to polymers with an additional variation of the properties of the polymer backbone with respect to pH-dependent solubility, monomer composition, hydrophilicity etc. A library of Os-complex-modified electrodeposition polymers was synthesized and initially tested with respect to their electron-transfer ability in combination with enzymes such as glucose oxidase, cellobiose dehydrogenase, and PQQ-dependent glucose dehydrogenase entrapped during the pH-induced deposition process. The different polymer-bound Os complexes in a library containing 50 different redox polymers allowed the statistical evaluation of the impact of an individual ligand to the overall redox potential of an Os complex. Using a simple linear regression algorithm prediction of the redox potential of Os complexes becomes feasible. Thus, a redox polymer can now be designed to optimally interact in electron-transfer reactions with a selected enzyme.
Blind, P-J; Eriksson, S.
1991-01-01
The probability that routine hematological laboratory tests of liver and pancreatic function can discriminate between malignant and benign pancreatic tumours, incidentally detected during operation, was investigated. The records of 53 patients with a verified diagnosis of pancreatic carcinoma and 19 patients with chronic pancreatitis were reviewed with regard to preoperative total bilirubin, direct reacting bilirubin, alkaline phosphatase, glutamyltranspeptidase, aminotransferases, lactic dehydrogenase and amylase. Multivariate and discriminant analysis were performed to calculate the predictive value for cancer, using SYSTAT statistical package in a Macintosh II computer. Total and direct reacting bilirubin and glutamyltranspeptidase were significantly higher in patients with pancreatic carcinoma. However, only considerably increased levels of direct reating bilirubin were predictive of pancreatic carcinoma. PMID:1931781
Thumb Imprint Based Detection of Hyperbilirubinemia Using Luminescent Gold Nanoclusters
NASA Astrophysics Data System (ADS)
Basu, Srestha; Sahoo, Amaresh Kumar; Paul, Anumita; Chattopadhyay, Arun
2016-12-01
Early and easy detection of diseases, using point-of-care and inexpensive devices, not only provides option for early treatment but also reduces the risk of propagation. Herein we report the fabrication of a robust film based luminescence indicator of bilirubin, which can indicate hyperbilirubinemia through the thumb imprint of the patient. The UV-light induced luminescence intensity of the film, made out of chitosan stabilised gold (Au) nanoclusters, which was effectively quenched in the presence of Cu2+ ions, recovered in the presence of bilirubin from skin or blood serum. Moreover, the sensitivity of detection of bilirubin was tuneable with the amount of Cu2+ added, thereby facilitating the detection of the desired concentration range of bilirubin.
Role of the photosynthetic electron transfer chain in electrogenic activity of cyanobacteria.
Pisciotta, John M; Zou, Yongjin; Baskakov, Ilia V
2011-07-01
Certain anaerobic bacteria, termed electrogens, produce an electric current when electrons from oxidized organic molecules are deposited to extracellular metal oxide acceptors. In these heterotrophic "metal breathers", the respiratory electron transport chain (R-ETC) works in concert with membrane-bound cytochrome oxidases to transfer electrons to the extracellular acceptors. The diversity of bacteria able to generate an electric current appears more widespread than previously thought, and aerobic phototrophs, including cyanobacteria, possess electrogenic activity. However, unlike heterotrophs, cyanobacteria electrogenic activity is light dependent, which suggests that a novel pathway could exist. To elucidate the electrogenic mechanism of cyanobacteria, the current studies used site-specific inhibitors to target components of the photosynthetic electron transport chain (P-ETC) and cytochrome oxidases. Here, we show that (1) P-ETC and, particularly, water photolysed by photosystem II (PSII) is the source of electrons discharged to the environment by illuminated cyanobacteria, and (2) water-derived electrons are transmitted from PSII to extracellular electron acceptors via plastoquinone and cytochrome bd quinol oxidase. Two cyanobacterial genera (Lyngbya and Nostoc) displayed very similar electrogenic responses when treated with P-ETC site-specific inhibitors, suggesting a conserved electrogenic pathway. We propose that in cyanobacteria, electrogenic activity may represent a form of overflow metabolism to protect cells under high-intensity light. This study offers insight into electron transfer between phototrophic microorganisms and the environment and expands our knowledge into biologically based mechanisms for harnessing solar energy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fernandes, Andre T.; Lopes, Carlos; Martins, Ligia O.
2012-06-08
Highlights: Black-Right-Pointing-Pointer CotA-laccase unfolds with an intermediate state. Black-Right-Pointing-Pointer Copper stabilizes the native and the intermediate state. Black-Right-Pointing-Pointer Copper binding to the unfolded state prevents refolding through protein aggregation. Black-Right-Pointing-Pointer Copper incorporation in CotA-laccase occurs as a later step during folding. -- Abstract: Copper is a redox-active metal and the main player in electron transfer reactions occurring in multicopper oxidases. The role of copper in the unfolding pathway and refolding of the multicopper oxidase CotA laccase in vitro was solved using double-jump stopped-flow experiments. Unfolding of apo- and holo-CotA was described as a three-state process with accumulation of an intermediatemore » in between the native and unfolded state. Copper stabilizes the native holo-CotA but also the intermediate state showing that copper is still bound to this state. Also, copper binds to unfolded holo-CotA in a non-native coordination promoting CotA aggregation and preventing refolding to the native structure. These results gather information on unfolding/folding pathways of multicopper oxidases and show that copper incorporation in vivo should be a tight controlled process as copper binding to the unfolded state under native conditions promotes protein aggregation.« less
Phospholipid-sepiolite biomimetic interfaces for the immobilization of enzymes.
Wicklein, Bernd; Darder, Margarita; Aranda, Pilar; Ruiz-Hitzky, Eduardo
2011-11-01
Biomimetic interfaces based on phosphatidylcholine (PC) assembled to the natural silicate sepiolite were prepared for the stable immobilization of the urease and cholesterol oxidase enzymes. This is an important issue in practical advanced applications such as biocatalysis or biosensing. The supported lipid bilayer (BL-PC), prepared from PC adsorption, was used for immobilization of enzymes and the resulting biomimetic systems were compared to several other supported layers including a lipid monolayer (ML-PC), a mixed phosphatidylcholine/octyl-galactoside layer (PC-OGal), a cetyltrimethylammonium monolayer (CTA), and also to the bare sepiolite surface. Interfacial characteristics of these layers were investigated with a focus on layer packing density, hydrophilicity/hydrophobicity, and surface charge, which are being considered as key points for enzyme immobilization and stabilization of their biological activity. Cytoplasmic urease and membrane-bound cholesterol oxidase, which served as model enzymes, were immobilized on the different PC-based hybrid materials to probe their biomimetic character. Enzymatic activity was assessed by cyclic voltammetry and UV-vis spectrophotometry. The resulting enzyme/bio-organoclay hybrids were applied as active phase of a voltammetric urea biosensor and cholesterol bioreactor, respectively. Urease supported on sepiolite/BL-PC proved to maintain its enzymatic activity over several months while immobilized cholesterol oxidase demonstrated high reusability as biocatalyst. The results emphasize the good preservation of bioactivity due to the accommodation of the enzymatic system within the biomimetic lipid interface on sepiolite.
Maréchal, Amandine; Kido, Yasutoshi; Kita, Kiyoshi; Moore, Anthony L.; Rich, Peter R.
2009-01-01
Electrochemistry coupled with Fourier transform infrared (IR) spectroscopy was used to investigate the redox properties of recombinant alternative ubiquinol oxidase from Trypanosoma brucei, the organism responsible for African sleeping sickness. Stepwise reduction of the fully oxidized resting state of recombinant alternative ubiquinol oxidase revealed two distinct IR redox difference spectra. The first of these, signal 1, titrates in the reductive direction as an n = 2 Nernstian component with an apparent midpoint potential of 80 mV at pH 7.0. However, reoxidation of signal 1 in the same potential range under anaerobic conditions did not occur and only began with potentials in excess of 500 mV. Reoxidation by introduction of oxygen was also unsuccessful. Signal 1 contained clear features that can be assigned to protonation of at least one carboxylate group, further perturbations of carboxylic and histidine residues, bound ubiquinone, and a negative band at 1554 cm−1 that might arise from a radical in the fully oxidized protein. A second distinct IR redox difference spectrum, signal 2, appeared more slowly once signal 1 had been reduced. This component could be reoxidized with potentials above 100 mV. In addition, when both signals 1 and 2 were reduced, introduction of oxygen caused rapid oxidation of both components. These data are interpreted in terms of the possible active site structure and mechanism of oxygen reduction to water. PMID:19767647
Bernhardt, Gerwin A; Zollner, Gernot; Cerwenka, Herwig; Kornprat, Peter; Fickert, Peter; Bacher, Heinz; Werkgartner, Georg; Müller, Gabriele; Zatloukal, Kurt; Mischinger, Hans-Jörg; Trauner, Michael
2012-01-01
Post-operative hyperbilirubinaemia in patients undergoing liver resections is associated with high morbidity and mortality. Apart from different known factors responsible for the development of post-operative jaundice, little is known about the role of hepatobiliary transport systems in the pathogenesis of post-operative jaundice in humans after liver resection. Two liver tissue samples were taken from 14 patients undergoing liver resection before and after Pringle manoeuvre. Patients were retrospectively divided into two groups according to post-operative bilirubin serum levels. The two groups were analysed comparing the results of hepatobiliary transporter [Na-taurocholate cotransporter (NTCP); multidrug resistance gene/phospholipid export pump(MDR3); bile salt export pump (BSEP); canalicular bile salt export pump (MRP2)], heat shock protein 70 (HSP70) expression as well as the results of routinely taken post-operative liver chemistry tests. Patients with low post-operative bilirubin had lower levels of NTCP, MDR3 and BSEP mRNA compared to those with high bilirubin after Pringle manoeuvre. HSP70 levels were significantly higher after ischaemia-reperfusion (IR) injury in both groups resulting in 4.5-fold median increase. Baseline median mRNA expression of all four transporters prior to Pringle manoeuvre tended to be lower in the low bilirubin group whereas expression of HSP70 was higher in the low bilirubin group compared to the high bilirubin group. Higher mRNA levels of HSP70 in the low bilirubin group could indicate a possible protective effect of high HSP70 levels against IR injury. Although the exact role of hepatobiliary transport systems in the development of post-operative hyper bilirubinemia is not yet completely understood, this study provides new insights into the molecular aspects of post-operative jaundice after liver surgery. © 2011 John Wiley & Sons A/S.
Sensitizing effect of Z,Z-bilirubin IXα and its photoproducts on enzymes in model solutions
NASA Astrophysics Data System (ADS)
Plavskii, V. Yu.; Mostovnikov, V. A.; Tret'yakova, A. I.; Mostovnikova, G. R.
2008-05-01
In model systems, we have studied side effects which may be induced by light during phototherapy of hyperbilirubinemia (jaundice) in newborn infants, with the aim of reducing the Z,Z-bilirubin IXα (Z,Z-BR IXα) level. We have shown that the sensitizing effect of Z,Z-BR IXα, localized at strong binding sites of the human serum albumin (HSA) macromolecule, is primarily directed at the amino acid residues of the carrier protein and does not involve the molecules of the enzyme (lactate dehydrogenase (LDH)) present in the buffer solution. The detected photodynamic damage to LDH is due to sensitization by bilirubin photoisomers, characterized by lower HSA association constants and located (in contrast to native Z,Z-BR IXα) on the surface of the HSA protein globule. Based on study of the spectral characteristics of the photoproducts of Z,Z-BR IXα and comparison of their accumulation kinetics in solution and the enzyme photo-inactivation kinetics, we concluded that the determining role in sensitized damage to LDH is played by lumirubin. The photosensitization effect depends on the wavelength of the radiation used for photoconversion of bilirubin. When (at the beginning of exposure) we make sure that identical numbers of photons are absorbed by the pigment in the different spectral ranges, the side effect is minimal for radiation corresponding to the long-wavelength edge of the bilirubin absorption band. We have shown that for a bilirubin/HSA concentration ratio >2 (when some of the pigment molecules are sorbed on the surface of the protein globule), the bilirubin can act as a photosensitizing agent for the enzyme present in solution. We discuss methods for reducing unfavorable side effects of light on the body of newborn infants during phototherapy of hyperbilirubinemia.
Protein-encapsulated bilirubin: paving the way to a useful probe for singlet oxygen.
Pimenta, Frederico M; Jensen, Jan K; Etzerodt, Michael; Ogilby, Peter R
2015-04-01
When dissolved in a bulk solvent, bilirubin efficiently removes singlet molecular oxygen, O2(a(1)Δg), through a combination of chemical reactions and by promoting the O2(a(1)Δg)→O2(X(3)Σg(-)) nonradiative transition to populate the ground state of oxygen. To elucidate how such processes can be exploited in the development of a biologically useful fluorescent probe for O2(a(1)Δg), pertinent photophysical and photochemical parameters of bilirubin encapsulated in a protein were determined. The motivation for studying a protein-encapsulated system reflects the ultimate desire to (a) use genetic engineering to localize the probe at a specific location in a living cell, and (b) provide a controlled environment around the chromophore/fluorophore. Surprisingly, explicit values of oxygen- and O2(a(1)Δg)-dependent parameters that characterize the behavior of a given chromophore/fluorophore encased in a protein are not generally available. To the end of quantifying the effects of such an encasing protein, a recently discovered bilirubin-binding protein isolated from a Japanese eel was used. The data show that this system indeed preferentially responds to O2(a(1)Δg) and not to the superoxide ion. However, this protein not only shields bilirubin such that the rate constants for interaction with O2(a(1)Δg) decrease relative to what is observed in a bulk solvent, but the fraction of the total O2(a(1)Δg)-bilirubin interaction that results in a chemical reaction between O2(a(1)Δg) and bilirubin also decreases appreciably. The rate constants thus obtained provide a useful starting point for the general design and development of reactive protein-encased fluorescent probes for O2(a(1)Δg).
Smith, Andrew; Wu, Alan H B; Lynch, Kara L; Ko, Nerissa; Grenache, David G
2013-09-23
Cerebrospinal fluid (CSF) was examined for bilirubin, an important indicator for diagnosis of subarachnoid hemorrhage (SAH). A multi-wavelength (340, 415, and 460 nm) spectrophotometric assay was developed for the quantitative measurement of bilirubin in CSF, enabling the mathematical correction for absorbance of hemoglobin and proteins. Bilirubin and hemoglobin results were correlated to HPLC and a standard colorimetric assay, respectively. A subset of samples was sent for an absorbance reading at 450 nm following baseline correction. The multi-wavelength bilirubin assay was validated on 70 patients with confirmed SAH and 70 patients with neurologic symptoms who ruled out for SAH. The multi-wavelength spectrophometric assay demonstrated no interferences due to proteins (albumin) up to 30 g/l or oxyhemoglobin up to 260 mg/l. The assay limit of detection was 0.2 mg/l, linear to 20 mg/l, and CVs ranged from 1 to 6% at bilirubin concentrations of 0.84 and 2.1mg/l. The spectrophotometric assay correlated to HPLC and the colorimetric assay for bilirubin and hemoglobin, respectively. Results also correlated to the absorbance method (with removal of samples with high hemoglobin and proteins). The area under the ROC curve for diagnosis of SAH was 0.971 and 0.954 for the HPLC and spectrophotometric assay, respectively. At a cutoff of 0.2mg/l, the clinical specificity was 100% for both assays, and the clinical sensitivity was 94.3% and 88.6% for SAH for the HPLC and spectrophotometric asays, respectively. The multi-wavelength spectrophotometric assay is an objective alternative to visual inspection, HPLC, and absorbance for CSF bilirubin. Copyright © 2013 Elsevier B.V. All rights reserved.
Brunori, Paola; Masi, Piergiorgio; Faggiani, Luigi; Villani, Luciano; Tronchin, Michele; Galli, Claudio; Laube, Clarissa; Leoni, Antonella; Demi, Maila; La Gioia, Antonio
2011-04-11
Neonatal jaundice might lead to severe clinical consequences. Measurement of bilirubin in samples is interfered by hemolysis. Over a method-depending cut-off value of measured hemolysis, bilirubin value is not accepted and a new sample is required for evaluation although this is not always possible, especially with newborns and cachectic oncological patients. When usage of different methods, less prone to interferences, is not feasible an alternative recovery method for analytical significance of rejected data might help clinicians to take appropriate decisions. We studied the effects of hemolysis over total bilirubin measurement, comparing hemolysis-interfered bilirubin measurement with the non-interfered value. Interference curves were extrapolated over a wide range of bilirubin (0-30 mg/mL) and hemolysis (H Index 0-1100). Interference "altitude" curves were calculated and plotted. A bimodal acceptance table was calculated. Non-interfered bilirubin of given samples was calculated, by linear interpolation between the nearest lower and upper interference curves. Rejection of interference-sensitive data from hemolysed samples for every method should be based not upon the interferent concentration but upon a more complex algorithm based upon the concentration-dependent bimodal interaction between the interfered analyte and the measured interferent. The altitude-curve cartography approach to interfered assays may help laboratories to build up their own method-dependent algorithm and to improve the trueness of their data by choosing a cut-off value different from the one (-10% interference) proposed by manufacturers. When re-sampling or an alternative method is not available the altitude-curve cartography approach might also represent an alternative recovery method for analytical significance of rejected data. Copyright © 2011 Elsevier B.V. All rights reserved.
Bulum, Tomislav; Tomić, Martina; Duvnjak, Lea
2018-06-01
Previous studies suggested that total serum bilirubin levels are negatively associated with diabetic retinopathy (DR) and nephropathy in patients with diabetes mellitus. The objective of this study was to explore the relationship between serum total bilirubin levels and prevalence of DR in patients with type 1 diabetes (T1DM) and normal renal function. Study included 163 T1DM with normal renal function (urinary albumin excretion rate <30 mg/24 h, estimated glomerular filtration rate (eGFR) >60 ml min -1 1.73 m -2 ). Photo-documented retinopathy status was made according to the EURODIAB protocol. Patients with DR were older (49 vs 42 years, p = 0.001), had higher systolic blood pressure (130 vs 120 mmHg, p = 0.001), triglycerides (0.89 vs 0.77 mmol/L, p = 0.01), and lower serum total bilirubin (12 vs 15 U/L, p = 0.02) and eGFR (100 vs 106 ml min -1 1.73 m -2 , p = 0.03). In multivariate logistic regression analysis, only total serum bilirubin was significantly associated with risk of DR in our subjects (OR 0.88, CI 0.81-0.96, p = 0.006). These data suggest that serum total bilirubin levels are independently negatively associated with DR in T1DM with normal renal function. Prospective studies are needed to confirm whether lower serum total bilirubin has predictive value for the development of DR in T1DM with normal renal function.
Auditory neuropathy spectrum disorder in late preterm and term infants with severe jaundice.
Saluja, Satish; Agarwal, Asha; Kler, Neelam; Amin, Sanjiv
2010-11-01
To evaluate if severe jaundice is associated with acute auditory neuropathy spectrum disorder in otherwise healthy late preterm and term neonates. In a prospective observational study, all neonates who were admitted with severe jaundice at which exchange transfusion may be indicated as per American Academy of Pediatrics guidelines had comprehensive auditory evaluation performed before discharge to home. Neonates with infection, perinatal asphyxia, chromosomal disorders, cranio-facial malformations, or family history of childhood hearing loss were excluded. Comprehensive auditory evaluations (tympanometry, oto-acoustic emission tests, and auditory brainstem evoked responses) were performed by an audiologist unaware of the severity of jaundice. Total serum bilirubin and serum albumin were measured at the institutional chemistry laboratory using the Diazo and Bromocresol purple method, respectively. A total of 13 neonates with total serum bilirubin concentration at which exchange transfusion is indicated as per American Academy of Pediatrics were admitted to the Neonatal Intensive Care Unit over 3 month period. Six out of 13 neonates (46%) had audiological findings of acute auditory neuropathy spectrum disorder. There was no significant difference in gestational age, birth weight, hemolysis, serum albumin concentration, peak total serum bilirubin concentrations, and peak bilirubin:albumin molar ratio between six neonates who developed acute auditory neuropathy and seven neonates who had normal audiological findings. Only two out of six infants with auditory neuropathy spectrum disorder had clinical signs and symptoms of acute bilirubin encephalopathy. Our findings strongly suggest that auditory neuropathy spectrum disorder is a common manifestation of acute bilirubin-induced neurotoxicity in late preterm and term infants with severe jaundice. Our findings also suggest that comprehensive auditory evaluations should be routinely performed in neonates with severe jaundice irrespective of the presence of clinical findings of acute bilirubin encephalopathy. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Wang, Jing; Li, Yaru; Han, Xu; Hu, Hua; Wang, Fei; Yu, Caizheng; Li, Xiulou; Yang, Kun; Yuan, Jing; Yao, Ping; Miao, Xiaoping; Wei, Sheng; Wang, Youjie; Chen, Weihong; Liang, Yuan; Zhang, Xiaomin; Guo, Huan; Pan, An; Yang, Handong; Wu, Tangchun; He, Meian
2016-01-01
Studies indicate that elevated serum total bilirubin (TBil) levels are associated with lower risk of diabetic kidney disease (DKD). Few studies examined the associations of direct bilirubin (DBil) and indirect bilirubin (IBil) with the development of DKD. Type 2 diabetes patients (n=2,958) with estimated glomerular filtration (eGFR)≥60mlmin(-1) 1.73m(-2) from the Dongfeng-Tongji cohort were selected and followed up for 5years. Development of DKD was defined as decline in eGFR≥30% during follow-up. Generalize linear model was used to assess the associations of bilirubin levels with DKD development. Compared with those in the first tertile of serum TBil, the relative risks (RRs) and 95% confidence intervals (CIs) of incident eGFR decline for tertile 2 to 3 were 0.83 (0.64-1.09) and 0.74 (0.56-0.98), Ptrend=0.04. The counterpart RRs (95% CIs) in IBil were 0.74 (0.57-0.97) and 0.75 (0.57-0.98), Ptrend=0.04. No significant associations were observed in DBil. Moreover, TBil and IBil interacted with smoking, the bilirubin-DKD associations were evident in ever smokers. Our findings suggest that elevation of serum TBil or IBil levels are independent protective factors for development of DKD, particularly in smokers. Copyright © 2016 Elsevier Inc. All rights reserved.
Hemadsorption with Adult CytoSorb® in a Low Weight Pediatric Case
Barascu, Ileana; Mc Kenzie Stancu, Samantha
2017-01-01
Cytokine adsorber (CytoSorb) has been used successfully as adjunctive treatment for adult patients with elevated cytokine levels in the setting with severe sepsis and septic shock and to reduce blood myoglobin, unconjugated bilirubin, and conjugated bilirubin. In this article we present the case of a nine-month-old male infant who was admitted to the NICU due to sepsis after cardiac surgery, Fallot tetralogy, and multisystem organ failure (MSOF) including liver failure and renal failure which was successfully treated by a combination of continuous hemodiafiltration (HDF) and hemadsorption with CytoSorb. HDF was safe and effective from the first day for urea removal, but the patient's bilirubin levels kept increasing gradually, culminating on the 9th day with a maximum value of 54 mg/dL of total bilirubin and 31.67 mg/dL of direct bilirubin when we performed hemadsorption with CytoSorb. Over the 49-hour period of hemadsorption, the total bilirubin value decreased from 54 to 14 mg/dL, and the patient's general status improved considerably accompanied by a rapid drop of aminotransferases. Hemodynamic status has been improved as well and inotropes dropped rapidly. The patient's ventilation settings improved during CytoSorb treatment permitting weaning the patient from mechanical ventilation after five days of hemadsorption. The patient was discharged home after 34 days of hospitalization, in a good general status. PMID:28127473
Hemadsorption with Adult CytoSorb® in a Low Weight Pediatric Case.
Cirstoveanu, Catalin Gabriel; Barascu, Ileana; Mc Kenzie Stancu, Samantha
2017-01-01
Cytokine adsorber (CytoSorb) has been used successfully as adjunctive treatment for adult patients with elevated cytokine levels in the setting with severe sepsis and septic shock and to reduce blood myoglobin, unconjugated bilirubin, and conjugated bilirubin. In this article we present the case of a nine-month-old male infant who was admitted to the NICU due to sepsis after cardiac surgery, Fallot tetralogy, and multisystem organ failure (MSOF) including liver failure and renal failure which was successfully treated by a combination of continuous hemodiafiltration (HDF) and hemadsorption with CytoSorb. HDF was safe and effective from the first day for urea removal, but the patient's bilirubin levels kept increasing gradually, culminating on the 9th day with a maximum value of 54 mg/dL of total bilirubin and 31.67 mg/dL of direct bilirubin when we performed hemadsorption with CytoSorb. Over the 49-hour period of hemadsorption, the total bilirubin value decreased from 54 to 14 mg/dL, and the patient's general status improved considerably accompanied by a rapid drop of aminotransferases. Hemodynamic status has been improved as well and inotropes dropped rapidly. The patient's ventilation settings improved during CytoSorb treatment permitting weaning the patient from mechanical ventilation after five days of hemadsorption. The patient was discharged home after 34 days of hospitalization, in a good general status.
Thangamuthu, Madasamy; Gabriel, Willimann Eric; Santschi, Christian; Martin, Olivier J F
2018-03-07
Practice oriented point-of-care diagnostics require easy-to-handle, miniaturized, and low-cost analytical tools. In a novel approach, screen printed carbon electrodes (SPEs), which were functionalized with nanomaterials, are employed for selective measurements of bilirubin, which is an important biomarker for jaundice. Multi-walled carbon nanotubes (MWCNT) and graphene separately deposited on SPEs provide the core of an electrochemical sensor for bilirubin. The electrocatalytic activity towards bilirubin oxidation (bilirubin to biliverdin) was observed at +0.25 V. In addition, a further peak corresponding to the electrochemical conversion of biliverdin into purpurin appeared at +0.48 V. When compared to MWCNT, the graphene type shows a 3-fold lower detection limit (0.3 ± 0.022 nM and 0.1 ± 0.018 nM, respectively), moreover, the graphene type exhibits a larger linear range (0.1-600 µM) than MWCNT (0.5-500 µM) with a two-fold better sensitivity, i.e., 30 nA µM -1 cm -2 , and 15 nA µM -1 cm -2 , respectively. The viability is validated through measurements of bilirubin in blood serum samples and the selectivity is ensured by inhibiting common interfering biological substrates using an ionic nafion membrane. The presented approach enables the design and implementation of low cost and miniaturized electrochemical sensors.
A dose-response model for the conventional phototherapy of the newborn.
Osaku, Nelson Ossamu; Lopes, Heitor Silvério
2006-06-01
Jaundice of the newborn is a common problem as a consequence of the rapid increment of blood bilirubin in the first days of live. In most cases, it is considered a physiological transient situation, but unmanaged hyperbilirubinemia can lead to death or serious injuries for the survivors. For decades, phototherapy has been used as the main method for prevention and treatment of hyperbilirubinaemia of the newborn. This work aims at finding a predictive model for the decrement of blood bilirubin for patients submitted to conventional phototherapy. Data from the phototherapy of 90 term newborns were collected and used in a multiple regression method. A rigorous statistical analysis was done in order to guarantee a correct and valid model. The obtained model was able to explain 78% of the variation of the dependent variable. We show that it is possible to predict the total serum bilirubin of the patient under conventional phototherapy by knowing its birth weight, bilirubin level at the beginning of treatment and the radiant energy density (dose). Besides, it is possible to infer the time necessary for a given decrement of bilirubin, under approximately constant irradiance. Statistical analysis of the obtained model shows that it is valid for several ranges of birth weight, initial bilirubin level, and radiant energy density. It is expected that the proposed model can be useful in the clinical management of hyperbilirubinemia of the newborn.
Efficacy of Human Adipose Tissue-Derived Stem Cells on Neonatal Bilirubin Encephalopathy in Rats.
Amini, Naser; Vousooghi, Nasim; Hadjighassem, Mahmoudreza; Bakhtiyari, Mehrdad; Mousavi, Neda; Safakheil, Hosein; Jafari, Leila; Sarveazad, Arash; Yari, Abazar; Ramezani, Sara; Faghihi, Faezeh; Joghataei, Mohammad Taghi
2016-05-01
Kernicterus is a neurological syndrome associated with indirect bilirubin accumulation and damages to the basal ganglia, cerebellum and brain stem nuclei particularly the cochlear nucleus. To mimic haemolysis in a rat model such that it was similar to what is observed in a preterm human, we injected phenylhydrazine in 7-day-old rats to induce haemolysis and then infused sulfisoxazole into the same rats at day 9 to block bilirubin binding sites in the albumin. We have investigated the effectiveness of human adiposity-derived stem cells as a therapeutic paradigm for perinatal neuronal repair in a kernicterus animal model. The level of total bilirubin, indirect bilirubin, brain bilirubin and brain iron was significantly increased in the modelling group. There was a significant decreased in all severity levels of the auditory brainstem response test in the two modelling group. Akinesia, bradykinesia and slip were significantly declined in the experience group. Apoptosis in basal ganglia and cerebellum were significantly decreased in the stem cell-treated group in comparison to the vehicle group. All severity levels of the auditory brainstem response tests were significantly decreased in 2-month-old rats. Transplantation results in the substantial alleviation of walking impairment, apoptosis and auditory dysfunction. This study provides important information for the development of therapeutic strategies using human adiposity-derived stem cells in prenatal brain damage to reduce potential sensori motor deficit.
Hegyi, Thomas; Kathiravan, Suganya; Stahl, Gary E; Huber, Andrew H; Kleinfeld, Alan
2013-01-01
Extremely low birth weight (ELBW; <1,000 g) infants have poor outcomes, often compromised by bilirubin neurotoxicity. We measured unbound bilirubin (Bf) and unbound free fatty acid (FFAu) levels in 5 ELBW infants in a trial examining the effects of pharmacologic ductal closure on infants treated with Intralipid infusion (3 g/kg/day). The levels for all infants (mean ± SD) were: total serum bilirubin (TSB) 4.6 ± 1.7 mg/dl, FFAu 376 ± 496 nM, and Bf 42 ± 30 nM. Of the 3 infants who died, 2 had TSB <5.9 mg/dl but FFAu >580 nM and Bf >75 nM. Multiple regression revealed a major effect on Bf levels due to FFAu, indicating that Intralipid elevated levels of FFAu and Bf. Indomethacin or ibuprofen reduced Bf levels, most likely by reducing FFAu levels through lipase inhibition. Because displacement of Bf by FFAu decouples Bf from TSB, phototherapy may not reduce the risk of bilirubin or FFAu toxicity in Intralipid-treated ELBW infants. Copyright © 2013 S. Karger AG, Basel.
Refractometric total protein concentrations in icteric serum from dogs.
Gupta, Aradhana; Stockham, Steven L
2014-01-01
To determine whether high serum bilirubin concentrations interfere with the measurement of serum total protein concentration by refractometry and to assess potential biases among refractometer measurements. Evaluation study. Sera from 2 healthy Greyhounds. Bilirubin was dissolved in 0.1M NaOH, and the resulting solution was mixed with sera from 2 dogs from which food had been withheld to achieve various bilirubin concentrations up to 40 mg/dL. Refractometric total protein concentrations were estimated with 3 clinical refractometers. A biochemical analyzer was used to measure biuret assay-based total protein and bilirubin concentrations with spectrophotometric assays. No interference with refractometric measurement of total protein concentrations was detected with bilirubin concentrations up to 41.5 mg/dL. Biases in refractometric total protein concentrations were detected and were related to the conversion of refractive index values to total protein concentrations. Hyperbilirubinemia did not interfere with the refractometric estimation of serum total protein concentration. The agreement among total protein concentrations estimated by 3 refractometers was dependent on the method of conversion of refractive index to total protein concentration and was independent of hyperbilirubinemia.
Visual inspection versus spectrophotometry in detecting bilirubin in cerebrospinal fluid
Linn, F; Voorbij, H; Rinkel, G; Algra, A; van Gijn, J
2005-01-01
Methods: Clinicians and students assessed CSF specimens with seven degrees of extinction between 0.00 and 0.09 at 450–460 nm as "yellow," "doubtful," or "colourless" after random presentation under standard conditions. The assessments were compared with spectrophotometry, with 0.05 being taken as the cut off level for the presence of bilirubin. Results were compared between the two groups and explored by means of receiver operating characteristic (ROC) curves. Results: All 51 clinicians and 50 of 51 students scored the tubes with extinction of 0.06 or higher as "yellow" or "doubtful." Tubes without any bilirubin were scored as "yellow" by three of the students only. The ROC curves confirmed that the diagnostic properties of the visual inspection versus spectrophotometry were slightly better for the clinicians than for the students. Conclusions: If CSF is considered colourless, the extinction of bilirubin is too low to be compatible with a diagnosis of recent subarachnoid haemorrhage. If CSF is not considered colourless, spectrophotometry should be carried out to determine the level of extinction of bilirubin. PMID:16170095
... Direct bilirubin - urine Images Male urinary system References Berk PD, Korenblat KM. Approach to the patient with ... Review Date 5/21/2017 Updated by: Laura J. Martin, MD, MPH, ABIM Board Certified in Internal ...
... membranes, or eyes. The yellow color comes from bilirubin, a byproduct of old red blood cells. Jaundice ... or pancreas. Jaundice can occur when too much bilirubin builds up in the body. This may happen ...
... build in your blood. How the body normally processes bilirubin Bilirubin is a yellowish pigment made when ... endorse any of the third party products and services advertised. Advertising and sponsorship policy Advertising and sponsorship ...
Ongubo, Dennis Miyoge; Lim, Robertino; Tweya, Hannock; Stanley, Christopher Chikhosi; Tembo, Petros; Broadhurst, Richard; Gugsa, Salem; Ngongondo, McNeil; Speight, Colin; Heller, Tom; Phiri, Sam; Hosseinipour, Mina C
2017-07-03
Malawi's national antiretroviral therapy program provides atazanavir/ritonavir-based second line regimens which cause concentration-dependent rise in indirect bilirubin. We sought to determine if elevated bilirubin, as a surrogate of atazanavir/ritonavir adherence, can aid in the evaluation of second line virological failure in Malawi. We conducted a cross-sectional study of HIV-infected patients ≥15 years who were on boosted protease inhibitor-based second line antiretroviral therapy for at least 6 months in two urban HIV clinics in Lilongwe, Malawi. Antiretroviral therapy history and adherence data were extracted from the electronic medical records and blood was drawn for viral load, complete blood count, total bilirubin, and CD4 cell count at a clinic visit. Factors associated with virological failure were assessed using multivariate logistic regression model. Out of 376 patients on second line antiretroviral therapy evaluated, 372 (98.9%) were on atazanavir/ritonavir-based therapy and 142 (37.8%) were male. Mean age was 40.9 years (SD ± 10.1), mean duration on second line antiretroviral therapy was 41.9 months (SD ± 27.6) and 256 patients (68.1%) had elevated bilirubin >1.3 mg/dL. Overall, 35 (9.3%) patients had viral load >1000 copies/ml (virological failure). Among the virologically failing vs. non-failing patients, bilirubin was elevated in 34.3% vs. 72.0% respectively (p < 0.001), although adherence by pill count was similar (62.9% vs. 60.7%, p = 0.804). The odds of virological failure were higher for adults aged 25-40 years (adjusted odds ratio (aOR) 2.5, p = 0.048), those with CD4 cell count <100 (aOR 17.5, p < 0.001), and those with normal bilirubin levels (aOR 5.4, p < 0.001); but were lower for the overweight/obese patients (aOR 0.3, p = 0.026). Poor pill count adherence (aOR 0.7, p = 0.4) and male gender (aOR 1.2, p = 0.698) were not associated with second line virological failure. Among patients receiving atazanavir/ritonavir-based second line antiretroviral therapy, bilirubin levels better predicted virological failure than pill count adherence. Therefore, strategic use of bilirubin and viral load testing to target adherence counseling and support may be cost-effective in monitoring second line antiretroviral therapy adherence and virological failure. Drug resistance testing targeted for patients with virological failure despite elevated bilirubin levels would facilitate timely switch to third line antiretroviral regimens whenever available.
Use of 5-deazaFAD to study hydrogen transfer in the D-amino acid oxidase reaction.
Hersh, L B; Jorns, M S
1975-11-25
The apoprotein of hog kidney D-amino acid oxidase was reconstituted with 5-deazaflavin adenine dinucleotide (5-deazaFAD) to yield a protein which contains 1.5 mol of 5-deazaFAD/mol of enzyme. The deazaFAD-containing enzyme forms complexes with benzoate, 2-amino benzoate, and 4-aminobenzoate which are both qualitatively and quantitatively similar to those observed with native enzyme. The complex with 2-aminobenzoate exhibits a new long wavelength absorption band characteristic of a flavin charge-transfer complex. The reconstituted enzyme exhibits no activity when assayed by D-alanine oxidation. However, the bound chromophore can be reduced by alanine, phenylalanine, proline, methionine, and valine, but not by glutamate or aspartate, indicating the deazaFAD enzyme retains the substrate specificity of the native enzyme. Reduction of the enzyme by D-alanine exhibits a 1.6-fold deuterium isotope effect. Reoxidation of the reduced enzyme occurred in the presence of pyruvate plus ammonia, but not with pyruvate alone or ammonia alone. beta-Phenylpyruvate and alpha-ketobutyrate, but not alpha-ketoglutarate could replace pyruvate. Reduced enzyme isolated following reaction with [alpha-3H]alanine was found to contain 0.5 mol of tritium/mol of deazaFADH2. After denaturation of the tritium-labeled enzyme, the radioactivity was identified as deazaFADH2. Reaction of the reduced tritium-labeled enzyme with pyruvate plus ammonia prior to denaturation yields [alpha-3H]alanine and unlabeled deazaFAD. These results suggest that reduction and reoxidation of enzyme-bound deazaFAD involves the stereo-specific transfer of alpha-hydrogen from substrate to deazaFAD.
21 CFR 862.1110 - Bilirubin (total or direct) test system.
Code of Federal Regulations, 2010 CFR
2010-04-01
... (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test... or serum. Measurements of the levels of bilirubin, an organic compound formed during the normal and...
Sadler, Ryan A; Lamberski, Nadine; Christopher, Mary M
2016-06-01
Captive waterbuck ( Kobus ellipsiprymnus ) that appear clinically healthy have been noted to have high serum bilirubin concentrations compared with other ruminants; however, questions remain about the physiologic factors affecting bilirubin concentration and its potential association with underlying disease and icteric serum or mucous membranes. Serum bilirubin concentrations of healthy and diseased waterbuck housed at the San Diego Zoo Safari Park from 1989 to 2012 were retrospectively analyzed to determine any link between icteric serum, total bilirubin concentration (tBili), and disease entities in this species. Total bilirubin and direct (dBili) bilirubin concentrations and the prevalence of icteric serum were compared by subspecies, age group, and health status; associations with complete blood count and biochemical results and clinical diagnosis were assessed. No significant differences were found in tBili or dBili between Ellipsen (n = 32) and Defassa (n = 29) subspecies or in juveniles (n = 22) versus adults (n = 39). Clinically healthy waterbuck (n = 40) had significantly higher tBili (mean ± 2SD, 7.9 ± 1.2 mg/dl; P < 0.001) and dBili (3.7 ± 1.0 mg/dl; P < 0.001) than did diseased waterbuck (n = 21; tBili: 4.9 ± 2.56 mg/dl; dBili: 2.2 ± 0.8 mg/dl). No waterbuck had icteric tissues on physical examination. Twelve (19.7%) waterbuck (six healthy, six diseased) had icteric serum. Few minor correlations were seen between tBili or dBili and clinical, laboratory, or necropsy evidence of disease, though an inverse correlation between dBili and blood glucose was noted. Of the 40 healthy animals, reference intervals were calculated for tBili (5.5-10.3 mg/dl), dBili (1.7-5.7 mg/dl), and indirect bilirubin (2.2-6.2 mg/dl). These results suggest healthy waterbuck have relatively high tBili and dBili compared with related species. Icteric serum may be seen in up to 15% of healthy animals in the absence of icteric tissues.
Albumin dialysis in cirrhosis with superimposed acute liver injury: a prospective, controlled study.
Heemann, Uwe; Treichel, Ulrich; Loock, Jan; Philipp, Thomas; Gerken, Guido; Malago, Massimo; Klammt, Sebastian; Loehr, Matthias; Liebe, Stephan; Mitzner, Steffen; Schmidt, Reinhardt; Stange, Jan
2002-10-01
Patients with liver cirrhosis and a superimposed acute injury with progressive hyperbilirubinemia have a high mortality. A prospective, controlled study was performed to test whether hyperbilirubinemia, 30-day survival, and encephalopathy would be improved by extracorporeal albumin dialysis (ECAD). Twenty-four patients were studied; 23 patients had cirrhosis; 1 had a prolonged cholestatic drug reaction and was excluded from per protocol (PP) analysis. Patients had a plasma bilirubin greater than 20 mg/dL and had not responded to prior standard medical therapy (SMT). Patients were randomized to receive SMT with ECAD or without (control). ECAD was performed with an extracorporeal device that dialyzes blood in a hollow fiber dialyzer (MW cutoff < 60 kd) against 15% albumin. Albumin-bound molecules transfer to dialysate albumin that is regenerated continuously by passage through a charcoal and anion exchange column and a conventional dialyzer. ECAD was associated with improved 30-day survival (PP, 11 of 12 ECAD, 6 of 11 controls; log rank P <.05). Plasma bile acids and bilirubin decreased on average by 43% and 29%, respectively, in the ECAD group after 1 week of treatment, but not in the control group. Renal dysfunction and hepatic encephalopathy improved in the ECAD group, but worsened significantly in the control group. ECAD was safe, with adverse events being rare and identical in both groups. In conclusion, ECAD appears to be effective and safe for the short-term treatment of patients with cirrhosis and superimposed acute injury associated with progressive hyperbilirubinemia and may be useful for increasing survival in such patients awaiting liver transplantation.
21 CFR 862.1115 - Urinary bilirubin and its conjugates (nonquantitative) test system.
Code of Federal Regulations, 2010 CFR
2010-04-01
... HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1115 Urinary bilirubin and its conjugates (nonquantitative) test...
21 CFR 862.1115 - Urinary bilirubin and its conjugates (nonquantitative) test system.
Code of Federal Regulations, 2012 CFR
2012-04-01
... HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1115 Urinary bilirubin and its conjugates (nonquantitative) test...
21 CFR 862.1115 - Urinary bilirubin and its conjugates (nonquantitative) test system.
Code of Federal Regulations, 2011 CFR
2011-04-01
... HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1115 Urinary bilirubin and its conjugates (nonquantitative) test...
21 CFR 862.1115 - Urinary bilirubin and its conjugates (nonquantitative) test system.
Code of Federal Regulations, 2013 CFR
2013-04-01
... HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1115 Urinary bilirubin and its conjugates (nonquantitative) test...
21 CFR 862.1115 - Urinary bilirubin and its conjugates (nonquantitative) test system.
Code of Federal Regulations, 2014 CFR
2014-04-01
... HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1115 Urinary bilirubin and its conjugates (nonquantitative) test...
Phototherapy for jaundice; Bilirubin - bili lights; Neonatal care - bili lights; Newborn care - bili lights ... Phototherapy involves shining fluorescent light from the bili lights on bare skin. A specific wavelength of light can break down bilirubin into a form that ...
21 CFR 862.1113 - Bilirubin (total and unbound) in the neonate test system.
Code of Federal Regulations, 2010 CFR
2010-04-01
... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1113 Bilirubin (total and unbound) in the neonate test system. (a...
21 CFR 862.1113 - Bilirubin (total and unbound) in the neonate test system.
Code of Federal Regulations, 2011 CFR
2011-04-01
... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1113 Bilirubin (total and unbound) in the neonate test system. (a...
21 CFR 862.1113 - Bilirubin (total and unbound) in the neonate test system.
Code of Federal Regulations, 2013 CFR
2013-04-01
... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1113 Bilirubin (total and unbound) in the neonate test system. (a...
21 CFR 862.1113 - Bilirubin (total and unbound) in the neonate test system.
Code of Federal Regulations, 2012 CFR
2012-04-01
... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1113 Bilirubin (total and unbound) in the neonate test system. (a...
21 CFR 862.1113 - Bilirubin (total and unbound) in the neonate test system.
Code of Federal Regulations, 2014 CFR
2014-04-01
... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1113 Bilirubin (total and unbound) in the neonate test system. (a...
Relationship Between the Serum Total Bilirubin and Inflammation in Patients With Psoriasis Vulgaris.
Zhou, Zhen-Xing; Chen, Jian-Kui; Hong, Yan-Ying; Zhou, Ru; Zhou, Dong-Mei; Sun, Li-Yun; Qin, Wen-Li; Wang, Tian-Cheng
2016-09-01
Psoriasis is a chronic and recurrent inflammatory skin disease. Previous studies have shown that bilirubin has anti-inflammation and antioxidant effects. However, the various roles of bilirubin in psoriasis patients are still unclear. To investigate the serum total bilirubin (TB) level in the individuals with psoriasis vulgaris and further evaluate the relationship between serum TB concentration and C-reactive protein (CRP) to clarify the effect of bilirubin on inflammation. A total of 214 patients with psoriasis vulgaris and 165 age- and gender-matched healthy control subjects were recruited. The peripheral leukocyte count (white blood cell, WBC) and differential, serum biochemical and immunologic indexes including serum TB, immunoglobulin (Ig) G, IgA, IgM, complement C3 and C4 , as well as serum CRP concentrations were measured. Results showed that the serum TB level decreased significantly and peripheral WBC, neutrophil, and serum CRP concentrations increased significantly in patients with psoriasis vulgaris. Meanwhile, the serum CRP was negatively correlated with serum TB levels but positively correlated with peripheral WBC and the Psoriasis Area and Severity Index (PASI). Logistic regression analysis showed that the serum TB was a protective factor for psoriasis vulgaris. The present study suggests that lower serum TB is associated with the enhancement of the inflammatory response in psoriasis vulgaris. Therefore, lower serum TB has a prognostic significance for worsening psoriasis vulgaris. Bilirubin may play a crucial role in inflammation by contributing to the inhibition of the inflammatory response. © 2016 Wiley Periodicals, Inc.
Saxena, Divish; Tandon, Mrinal; Shah, Yunus; Gedam, B S
2015-01-01
The certainty of diagnosing acute appendicitis in patients presenting with right iliac fossa pain still remains a mystery though acute appendicitis being the commonest surgical procedure done in emergency. In acute appendicitis, serum bilirubin levels are raised due to hepatocellular damage as a result of direct insult caused by Gram-negative bacterial endotoxemia. The need for the study is to conclude whether the serum bilirubin can be considered as a new laboratory marker to aid in the diagnosis of acute appendicitis and if so, does it have the predictive capacity to warn us about appendicular perforation. This is a prospective study carried out at rural tertiary healthcare center and includes 213 patients clinically diagnosed as acute appendicitis. Out of 213 patients, raised serum bilirubin ≥1.2 mg/dl was present in 195 (91.5%) patients, out of which 194 (99.4%) patients had histopathologically inflamed appendix and this difference was statistically highly significant with p-value < 0.0001. In this study, 32 patients had perforated appendix. Out of those, 30 patients had bilirubin ≥ 4 mg/dl and 2 patients had bilirubin level between 1.2 and < 4 mg/dl. Raised serum bilirubin (≥4 mg/dl) was present in 35 (17.9%) patients, out of which 30 (87.7%) patients had perforated appendix. Saxena D, Tandon M, Shah Y, Gedam BS. Hyperbilirubinemia as a Diagnostic Tool for the Prediction of Appendicular Perforation: A Prospective Study. Euroasian J Hepato-Gastroenterol 2015;5(2):87-89.
Association Of Serum Total Bilirubin Level With Diabetic Retinopathy In Type 2 Diabetes Mellitus.
Ghaffar, Tahir; Marwat, Zahid Irfan; Ullah, Fahim; Khan, Salman; Hassan Aamir, Aziz Ul
2016-01-01
Serum bilirubin has anti-inflammatory, antioxidant and immunological properties. It is considered a protective substance against atherosclerotic and microvascular complications of diabetes mellitus (DM). This study was designed to find the association between total serum bilirubin concentration and diabetic retinopathy (DR). This case control study was conducted in the Department of Endocrinology, Diabetes and Metabolic Diseases, Hayatabad Medical Complex, Peshawar. Type-2 DM patients more than 18 years of age of either gender with duration of T2DM more than 6 months were included and sub categorized in two groups. Cases (DM with DR) and Controls (DM without DR) while patients with acute and chronic liver diseases, haemolytic anaemia, history of chronic alcohol consumption, use of hepatotoxic drugs (anti-tuberculous, anti-epileptic), women on oral contraceptive pills were excluded. All participants underwent ophthalmic examination at diabetic retinopathy screening clinic followed by pre designed set of investigations. A total of 152 patients, 76 cases and 76 controls were included. Serum bilirubin concentration was found inversely and independently (p 0.000) associated and inversely co related (r -0.345and p 0.000) with prevalence of DR. Cases were concentrated in the lower quartiles of serum bilirubin concentration and vice versa. Low haemoglobin (p 0.00) and longer duration of DM (0.003) were independently and directly associated with prevalence of DR. Serum bilirubin concentration is inversely and independently associated and inversely correlated with the prevalence of DR and may predict progression of DR over time.
Monte Carlo Simulation of Visible Light Diffuse Reflection in Neonatal Skin
NASA Astrophysics Data System (ADS)
Atencio, J. A. Delgado; Rodríguez, E. E.; Rodríguez, A. Cornejo; Rivas-Silva, J. F.
2008-04-01
Neonatal jaundice is a medical condition that happens commonly in newborns as result of desbalance between the production and the elimination of the bilirubin. Around 50% of newborns in term and something more of 60% of the near-term becomes jaundiced in the first week of life. This excess of bilirubin in the blood is exhibited in the skin, the sclera of the eyes and the mucous of mouth like a characteristic yellow coloration. In this work we make several numerical simulations of the spectral diffuse reflection for the skin of newborns that present different values of the biological parameters (bilirubin content, grade of pigmentation and content of blood) that characterize it. These simulations will allow us to evaluate the influence of these parameters on the experimental determination of bilirubin by noninvasive optical methods. The simulations are made in the spectral range of 400-700 nm using the Monte Carlo code MCML and two programs developed in LabVIEW by the authors. We simulated the diffuse reflection spectrum of neonatal skin for concentrations of bilirubin in skin that covers an ample range: from physiological to harmful numbers. We considered the influence of factors such as grade of pigmentation and content of blood.
Yang, Dehao; Su, Zhongqian; Wu, Shengjie; Bi, Yong; Li, Xiang; Li, Jia; Lou, Kangliang; Zhang, Hongyu; Zhang, Xu
2016-12-01
Oxidative stress and low antioxidant status play a major role in the pathogenesis of inflammatory and autoimmune diseases. Myasthenia gravis (MG) is an autoimmune condition targeting the neuromuscular junction, and its antioxidant status is still controversial. Our study aimed to investigate the correlation between the clinical characteristics of MG and the serum antioxidant status of bilirubin (Tbil, Dbil and Ibil), uric acid, albumin and creatinine. We measured serum antioxidant molecule levels of bilirubin (Tbil, Dbil and Ibil), uric acid, albumin and creatinine in 380 individuals, including 166 MG and 214 healthy controls. We found that MG patients had significantly lower serum levels of bilirubin (Tbil, Dbil and Ibil), uric acid, albumin and creatinine than healthy controls, whether male or female. Moreover, it was also shown in our study that uric acid, albumin and creatinine levels in patients with MG were correlated with disease activity and classifications performed by the Myasthenia Gravis Foundation of America. Our findings demonstrated that serum levels of bilirubin (Tbil, Dbil and Ibil), uric acid, albumin and creatinine were reduced in patients with MG. This suggested an active oxidative process in MG patients who had low antioxidant status.
Chen, Zhibo; Su, Zhongqian; Pang, Wanhui; Huang, Yuanyuan; Lin, Jie; Ding, Zhangna; Wu, Senmin; Xu, Shunyao; Quan, Weiwei; Zheng, Juzeng; Chen, Huale; Li, Zhengzheng; Li, Xiang; Li, Jia; Weng, Yiyun; Zhang, Xu
2017-07-01
Oxidative stress and variations in antioxidant status are implicated in the pathogenesis of inflammatory and autoimmune diseases. Polymyositis and dermatomyositis (PM/DM) are autoimmune diseases with inflammatory cells infiltrating into skeletal muscles, and the antioxidant status is still controversial. The aim of our study was to investigate the correlation between PM/DM and the antioxidant status of serum bilirubin (Tbil, Dbil and Ibil) and uric acid (UA). We measured serum concentrations of bilirubin (Tbil, Dbil and Ibil) and uric acid in 384 individuals, including 110 PM/DM patients and 274 healthy controls. We found that PM/DM patients had significantly lower serum concentrations of bilirubin (Tbil and Ibil) and uric acid than healthy controls, whether male or female. Also, after separately adjusting the covariances of age and gender, Tbil, Dbil, Ibil and UA were all relevant factors for PM/DM. Moreover, there were no significant differences in serum antioxidant molecule levels between PM and DM subgroups. Our study demonstrated the low serum levels of bilirubin and uric acid in patients with PM/DM. This suggested low antioxidant status in PM/DM patients with excessive oxidative stress.
Optical transcutaneous bilirubin detector
Kronberg, J.W.
1993-11-09
A transcutaneous bilirubin detector is designed comprising a source of light having spectral components absorbable and not absorbable by bilirubin, a handle assembly, electronic circuitry and a fiber optic bundle connecting the assembly to the light source and circuitry. Inside the assembly is a prism that receives the light from one end of the fiber optic bundle and directs it onto the skin and directs the reflected light back into the bundle. The other end of the bundle is trifucated, with one end going to the light source and the other two ends going to circuitry that determines how much light of each kind has been reflected. A relatively greater amount absorbed by the skin from the portion of the spectrum absorbable by bilirubin may indicate the presence of the illness. Preferably, two measurements are made, one on the kneecap and one on the forehead, and compared to determine the presence of bilirubin. To reduce the impact of light absorption by hemoglobin in the blood carried by the skin, pressure is applied with a plunger and spring in the handle assembly, the pressure limited by points of a button slidably carried in the assembly that are perceived by touch when the pressure applied is sufficient. 6 figures.
Optical transcutaneous bilirubin detector
Kronberg, J.W.
1991-03-04
This invention consists of a transcutaneous bilirubin detector comprising a source of light having spectral components absorbable and not absorbable by bilirubin, a handle assembly, electronic circuitry and a fiber optic bundle connecting the assembly to the light source and circuitry. Inside the assembly is a prism that receives the light from one end of the fiber optic bundle and directs it onto the skin and directs the reflected light back into the bundle. The other end of the bundle is trifucated, with one end going to the light source and the other two ends going to circuitry that determines how much light of each kind has been reflected. A relatively greater amount absorbed by the skin from the portion of the spectrum absorbable by bilirubin may indicate the presence of the illness. Preferably, two measurements are made, one on the kneecap and one on the forehead, and compared to determine the presence of bilirubin. To reduce the impact of light absorption by hemoglobin in the blood carried by the skin, pressure is applied with a plunger and spring in the handle assembly, the pressure limited by points of a button slidably carried in the assembly that are perceived by touch when the pressure applied is sufficient.
Optical transcutaneous bilirubin detector
Kronberg, James W.
1993-01-01
A transcutaneous bilirubin detector comprising a source of light having spectral components absorbable and not absorbable by bilirubin, a handle assembly, electronic circuitry and a fiber optic bundle connecting the assembly to the light source and circuitry. Inside the assembly is a prism that receives the light from one end of the fiber optic bundle and directs it onto the skin and directs the reflected light back into the bundle. The other end of the bundle is trifucated, with one end going to the light source and the other two ends going to circuitry that determines how much light of each kind has been reflected. A relatively greater amount absorbed by the skin from the portion of the spectrum absorbable by bilirubin may indicate the presence of the illness. Preferably, two measurements are made, one on the kneecap and one on the forehead, and compared to determine the presence of bilirubin. To reduce the impact of light absorption by hemoglobin in the blood carried by the skin, pressure is applied with a plunger and spring in the handle assembly, the pressure limited by points of a button slidably carried in the assembly that are perceived by touch when the pressure applied is sufficient.
Basiri-Moghadam, Mahdi; Basiri-Moghadam, Kokab; Kianmehr, Mojtaba; Jani, Somaye
2015-06-01
To evaluate the effects of massage therapy on transcutaneous bilirubin of stable preterm infants. The controlled clinical trial was conducted in 2014 at Shahid Hasheminejhad Hospital, Iran, and comprised preterm neonatal children in the neonatal intensive care unit. The newborns were divided into two groups of massage and control via random allocation. The children in the control group received the routine therapy whereas those in the massage group underwent the same four days of routine plus 20 minutes of massage twice a day. The transcutaneous bilirubin and the number of excretions of the newborns were noted from the first to the fourth day of the intervention and results were compared between the two groups. There were 40 newborns in the study l 20(50%) each in the two groups. There was a significant difference in the number of times of defecation (p=0.002) and in the level of bilirubin (p=0.003) between the groups with those in the massage group having a higher number of defecations as well as a lower level of transcutaneous bilirubin. Through massage therapy the bilirubin level in preterm newborns can be controlled and a need for phototherapy can also be delayed.
Karon, Brad S; Wickremasinghe, Andrea C; Lo, Stanley F; Saenger, Amy K; Cook, Walter J
2010-08-01
To determine the relationship between BiliChek TcB (Respironics, Marietta GA) and Doumas reference serum or plasma total bilirubin (TSB). Pooled samples with values assigned by the Doumas reference method were used to establish the relationship between a local laboratory and reference Doumas TSB. We then established the relationship between TcB and TSB in the 3 months before and after reassignment of calibrator setpoints undertaken to match the local laboratory to Doumas reference bilirubin values. Before calibrator setpoint reassignment TSB as measured in our laboratory overestimated Doumas reference bilirubin. After calibrator adjustment laboratory TSB was within 1.7-6.8 micromol/L (0.1-0.4 mg/dL) of Doumas reference values. Mean bias between BiliChek TcB and TSB was 42.8+/-22.2 micromol/L (2.5+/-1.3mg/dL) (n=94) before and 49.6+/-22.2 micromol/L (2.9+/-1.3mg/dL) (n=115) after calibration adjustment. BiliChek TcB significantly overestimates TSB as measured by the Doumas reference method. 2010 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
Characterization of anemia induced by avian osteopetrosis virus.
Paterson, R W; Smith, R E
1978-01-01
Chickens infected intravenously at 8 days after hatching with an avian osteopetrosis virus developed a severe, progressive anemia in the absence of osteopetrosis. The anemia was characterized as a pancytopenia, in which erythrocytes, granulocytes, and thrombocytes decreased concomitantly. Serum bilirubin levels were normal, whereas erythrocytes from infected chickens demonstrated a slightly elevated osmotic fragility. A negative Coombs test indicated that there was no evidence for erythrocyte-bound antibody. Erythrocytes from infected animals had slightly decreased 51Cr-labeled erythrocyte survival time when compared with normal. Examination of marrow histological preparations, together with ferrokinetic studies with 59Fe, indicated that marrow failure occurred during the acute phase of the anemia. Circulating virus was present during the development and acute phases of the anemia, but disappeared during the recovery phase of the disease. Neutralizing antibody appeared after the disappearance of circulating virus. It is concluded that virus infection induced both marrow failure (aplastic crisis) and decreased erythrocyte survival. Images PMID:215554
Pavkov-Keller, Tea; Bakhuis, Janny; Steinkellner, Georg; Jolink, Fenneke; Keijmel, Esther; Birner-Gruenberger, Ruth; Gruber, Karl
2016-10-10
Hydroxynitrile lyases (HNLs) catalyze the asymmetric addition of HCN to aldehydes producing enantiomerically pure cyanohydrins. These enzymes can be heterologously expressed in large quantities making them interesting candidates for industrial applications. The HNLs from Rosaceae evolved from flavin dependent dehydrogenase/oxidase structures. Here we report the high resolution X-ray structure of the highly glycosylated Prunus amygdalus HNL isoenzyme5 (PaHNL5 V317A) expressed in Aspergillus niger and its complex with benzyl alcohol. A comparison with the structure of isoenzyme PaHNL1 indicates a higher accessibility to the active site and a larger cavity for PaHNL5. Additionally, the PaHNL5 complex structure with benzyl alcohol was compared with the structurally related aryl-alcohol oxidase (AAO). Even though both enzymes contain an FAD-cofactor and histidine residues at crucial positions in the active site, PaHNL5 lacks the oxidoreductase activity. The structures indicate that in PaHNLs benzyl alcohol is bound too far away from the FAD cofactor in order to be oxidized. Copyright © 2016 Elsevier B.V. All rights reserved.
Characterization of Cu(II)-reconstituted ACC Oxidase using experimental and theoretical approaches.
El Bakkali-Tahéri, Nadia; Tachon, Sybille; Orio, Maylis; Bertaina, Sylvain; Martinho, Marlène; Robert, Viviane; Réglier, Marius; Tron, Thierry; Dorlet, Pierre; Simaan, A Jalila
2017-06-01
1-Aminocyclopropane-1-carboxylic acid oxidase (ACCO) is a non heme iron(II) containing enzyme that catalyzes the final step of the ethylene biosynthesis in plants. The iron(II) ion is bound in a facial triad composed of two histidines and one aspartate (H177, D179 and H234). Several active site variants were generated to provide alternate binding motifs and the enzymes were reconstituted with copper(II). Continuous wave (cw) and pulsed Electron Paramagnetic Resonance (EPR) spectroscopies as well as Density Functional Theory (DFT) calculations were performed and models for the copper(II) binding sites were deduced. In all investigated enzymes, the copper ion is equatorially coordinated by the two histidine residues (H177 and H234) and probably two water molecules. The copper-containing enzymes are inactive, even when hydrogen peroxide is used in peroxide shunt approach. EPR experiments and DFT calculations were undertaken to investigate substrate's (ACC) binding on the copper ion and the results were used to rationalize the lack of copper-mediated activity. Copyright © 2017 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Orville, A.M.; Lountos, G. T.; Finnegan, S.
2009-02-03
Flavin C4a-OO(H) and C4a-OH adducts are critical intermediates proposed in many flavoenzyme reaction mechanisms, but they are rarely detected even by rapid transient kinetics methods. We observe a trapped flavin C4a-OH or C4a-OO(H) adduct by single-crystal spectroscopic methods and in the 1.86 {angstrom} resolution X-ray crystal structure of choline oxidase. The microspectrophotometry results show that the adduct forms rapidly in situ at 100 K upon exposure to X-rays. Density functional theory calculations establish the electronic structures for the flavin C4a-OH and C4a-OO(H) adducts and estimate the stabilization energy of several active site hydrogen bonds deduced from the crystal structure. Wemore » propose that the enzyme-bound FAD is reduced in the X-ray beam. The aerobic crystals then form either a C4a-OH or C4a-OO(H) adduct, but an insufficient proton inventory prevents their decay at cryogenic temperatures.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Orville, A.; Lountos, G; Finnegan, S
2009-01-01
Flavin C4a-OO(H) and C4a-OH adducts are critical intermediates proposed in many flavoenzyme reaction mechanisms, but they are rarely detected even by rapid transient kinetics methods. We observe a trapped flavin C4a-OH or C4a-OO(H) adduct by single-crystal spectroscopic methods and in the 1.86 {angstrom} resolution X-ray crystal structure of choline oxidase. The microspectrophotometry results show that the adduct forms rapidly in situ at 100 K upon exposure to X-rays. Density functional theory calculations establish the electronic structures for the flavin C4a-OH and C4a-OO(H) adducts and estimate the stabilization energy of several active site hydrogen bonds deduced from the crystal structure. Wemore » propose that the enzyme-bound FAD is reduced in the X-ray beam. The aerobic crystals then form either a C4a-OH or C4a-OO(H) adduct, but an insufficient proton inventory prevents their decay at cryogenic temperatures.« less
Musatov, Andrej; Varhač, Rastislav; Hosler, Jonathan P.; Sedlák, Erik
2016-01-01
Delipidation of detergent-solubilized cytochrome c oxidase isolated from Rhodobacter sphaeroides (Rbs-CcO) has no apparent structural and/or functional effect on the protein, however affects its resistance against thermal or chemical denaturation. Phospholipase A2 (PLA2) hydrolysis of phospholipids that are co-purified with the enzyme removes all but two tightly bound phosphatidylethanolamines. Replacement of the removed phospholipids with nonionic detergent decreases both thermal stability of the enzyme and its resilience against the effect of chemical denaturants such as urea. In contrast to nondelipidated Rbs-CcO, the enzymatic activity of PLA2-treated Rbs-CcO is substantially diminished after exposure to high (>4M) urea concentration at room temperature without an alteration of its secondary structure. Absorbance spectroscopy and sedimentation velocity experiments revealed a strong correlation between intact tertiary structure of heme regions and quaternary structure, respectively, and the enzymatic activity of the protein. We concluded that phospholipid environment of Rbs-CcO has the protective role for stability of its tertiary and quaternary structures. PMID:26923069
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Thomas, David C; Clare, Simon; Sowerby, John M; Pardo, Mercedes; Juss, Jatinder K; Goulding, David A; van der Weyden, Louise; Storisteanu, Daniel; Prakash, Ananth; Espéli, Marion; Flint, Shaun; Lee, James C; Hoenderdos, Kim; Kane, Leanne; Harcourt, Katherine; Mukhopadhyay, Subhankar; Umrania, Yagnesh; Antrobus, Robin; Nathan, James A; Adams, David J; Bateman, Alex; Choudhary, Jyoti S; Lyons, Paul A; Condliffe, Alison M; Chilvers, Edwin R; Dougan, Gordon; Smith, Kenneth G C
2017-04-03
The phagocyte respiratory burst is crucial for innate immunity. The transfer of electrons to oxygen is mediated by a membrane-bound heterodimer, comprising gp91 phox and p22 phox subunits. Deficiency of either subunit leads to severe immunodeficiency. We describe Eros (essential for reactive oxygen species), a protein encoded by the previously undefined mouse gene bc017643 , and show that it is essential for host defense via the phagocyte NAPDH oxidase. Eros is required for expression of the NADPH oxidase components, gp91 phox and p22 phox Consequently, Eros -deficient mice quickly succumb to infection. Eros also contributes to the formation of neutrophil extracellular traps (NETS) and impacts on the immune response to melanoma metastases. Eros is an ortholog of the plant protein Ycf4, which is necessary for expression of proteins of the photosynthetic photosystem 1 complex, itself also an NADPH oxio-reductase. We thus describe the key role of the previously uncharacterized protein Eros in host defense. © 2017 Thomas et al.
Chen, Xiao-Tian; Yang, Song; Yang, Ya-Ming; Zhao, Hai-Long; Chen, Yan-Chun; Zhao, Xiang-Hai; Wen, Jin-Bo; Tian, Yuan-Rui; Yan, Wei-Li; Shen, Chong
2017-11-04
Total bilirubin is beneficial for protecting cardiovascular diseases in adults. The authors aimed to investigate the association of total bilirubin, red blood cell, and hemoglobin levels with the prevalence of high blood pressure in children and adolescents. A total of 3776 students (aged from 6 to 16 years old) were examined using cluster sampling. Pre-high blood pressure and high blood pressure were respectively defined as the point of 90th and 95th percentiles based on the Fourth Report on the Diagnosis, Evaluation, and Treatment of High Blood Pressure in Children and Adolescents. Both systolic and diastolic blood pressure were standardized into z-scores. Peripheral total bilirubin, red blood cell and hemoglobin levels were significantly correlated with age, and also varied with gender. Peripheral total bilirubin was negatively correlated with systolic blood pressure in 6- and 9-year-old boys, whilst positively correlated with diastolic blood pressure in the 12-year-old boys and 13- to 15-year-old girls (p<0.05). Higher levels of red blood cell and hemoglobin were observed in pre-high blood pressure and high blood pressure students when compared with their normotensive peers (p<0.01). The increases in red blood cell and hemoglobin were significantly associated with high blood pressure after adjusting for confounding factors. The ORs (95% CI) of each of the increases were 2.44 (1.52-3.92) and 1.04 (1.03-1.06), respectively. No statistical association between total bilirubin and high blood pressure was observed (p>0.05). Total bilirubin could be weakly correlated with both systolic and diastolic blood pressure, as correlations varied with age and gender in children and adolescents; in turn, the increased levels of red blood cell and hemoglobin are proposed to be positively associated with the prevalence of high blood pressure. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.
Lee, S-E; Lee, Y-B; Jun, J E; Jin, S-M; Jee, J H; Bae, J C; Kim, J H
2017-03-01
Several cross-sectional studies reported that serum bilirubin concentrations had an inverse association with type 2 diabetes mellitus (T2DM) prevalence. The aim of the current study was to investigate the relationship between percentage change in bilirubin levels (PCB) and incident risk of T2DM using a longitudinal model. 22,084 participants who received regular health check-ups between 2006 and 2012 were enrolled. Multivariable-adjusted Cox regression models were used to determine the hazard ratio (HR) of incident T2DM based on PCB. PCB was determined by subtracting baseline serum bilirubin level (BB) from the bilirubin level at the end of follow-up or a year before the last date of diagnosis, dividing by BB and multiplying by 100. Compared to non-diabetics, BB was lower in the diabetic group at the initial visit. There were 20,098 participants without T2DM at the initial visit; 1253 new cases occurred during follow-up. As PCB increased, T2DM incidence also increased (P < 0.001). After adjusting for confounders, the HR of incident T2DM in the highest PCB quartile was 2.08 (95% confidence interval [CI] 1.76-2.46). This trend remained significant when PCB was analyzed as a continuous variable (HR for 1-SD increment, 1.25; 95% CI 1.19-1.31). Additional analysis comparing the rate of PCB during the follow-up period revealed that the serum bilirubin level of the Incident T2DM group increased before T2DM development and decreased rapidly thereafter compared to others (P < 0.001). Bilirubin level increment over time is associated with T2DM development. Copyright © 2016 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.
Analysis of urobilinogen and urine bilirubin for intra-abdominal injury in blunt trauma patients.
Gorchynski, Julie; Dean, Kevin; Anderson, Craig L
2009-05-01
To determine the point prevalence of urine bilirubin, urine hemoglobin and urobilinogen in blunt trauma patients, and to evaluate its utility as a screening tool for intra-abdominal injury. Data analysis of 986 consecutive trauma patients of which 698 were adult blunt trauma patients. Five-hundred sixteen subjects had a urinalysis and a CT scan of the abdomen/pelvis or exploratory laparotomy. We reviewed initial urinalysis results from trauma patients in the emergency department (ED) for the presence of urine hemoglobin, uroblinogen and urine bilirubin. Computed tomography (CT) scan results and operative reports were reviewed from the trauma registry for evidence of liver laceration, spleen laceration, bowel or mesenteric injuries. There were 73 injuries and 57/516 patients (11%) with intra-abdominal injury. Urinalysis was positive for urobilinogen in 28/516 (5.4%) patients, urine bilirubin in 15/516 (2.9%) patients and urine hemoglobin in 313/516 (61%) patients. Nineteen/forty-seven (4%) subjects had liver lacerations, 28/56 (5%) splenic lacerations, and 15/5 (3%) bowel or mesenteric injury. Comparing the proportion of patients that had urobilinogen detected in the group with and without intra-abdominal injury, 8/28 (29%) subjects with urobilinogen, 5/15 (33%) subjects with bilirubin and 47/313 (15%) subjects with urine hemoglobin were found to have liver lacerations, spleen lacerations, or bowel/mesenteric injuries. Preexisting liver or biliary conditions were not statistically associated with elevation of urine bilirubin, urine hemoglobin or urobilinogen on initial urinalysis after blunt abdominal trauma. Point prevalence for urobilinogen, urine bilirubin and urine hemoglobin are 5.43% (28/516), 2.91% (15/516) and 60.7% (313/516) respectively. The utility of the initial routine urinalysis in the ED for adult blunt abdominal trauma patients should not be used as a screening tool for the evaluation of intra-abdominal injury.
Fox, I J; Chowdhury, N R; Gupta, S; Kondapalli, R; Schilsky, M L; Stockert, R J; Chowdhury, J R
1995-03-01
Viral vectors and protein carriers utilizing asialoglycoprotein receptor (ASGR)-mediated endocytosis are being developed to transfer genes for the correction of bilirubin-UDP-glucuronosyltransferase (bilirubin-UGT) deficiency. Ex vivo evaluation of these gene transfer vectors would be facilitated by a cell system that lacks bilirubin-UGT, but expresses differentiated liver functions, including ASGR. We immortalized primary Gunn rat hepatocytes by transduction with a recombinant Moloney murine leukemia virus expressing a thermolabile mutant SV40 large T antigen (tsA58). At 33 degrees C, the immortalized hepatocyte clones expressed SV40 large T antigen, synthesized DNA, and doubled in number every 2 to 3 days. At this temperature, differentiated hepatocyte markers, e.g., albumin, ASGR, and androsterone-UGT, were expressed at 5% to 10% of the levels found in primary hepatocytes maintained in culture for 24 hours. Glutathione-S-transferase Yp (GST-Yp), an oncofetal protein, was expressed in these cells at 33 degrees C, but was undetectable in primary hepatocytes. In contrast, when the cells were cultured at 39 degrees C or 37 degrees C, the large T antigen was degraded, DNA synthesis and cell growth stopped, and morphologic characteristics of differentiated hepatocytes were observed. The expression of albumin, ASGR, and androsterone-UGT, and their corresponding mRNAs, increased to 25% to 40% of the level in primary hepatocytes, whereas GST-Yp expression decreased. Functionality of ASGR was demonstrated by internalization of Texas red-labeled asialoorosomucoid, and binding and degradation of 125I-asialoorosomucoid. After liposome-mediated transfer of a plasmid containing the coding region of human bilirubin-UGT1, driven by the SV40 large T promoter, active human bilirubin-UGT1 was expressed in these cells. The immortalized cells were not tumorigenic after transplantation into severe combined immunodeficiency mice. These conditionally immortalized cells will be useful for ex vivo evaluation of bilirubin-UGT gene transfer vectors.
Mitsugi, Ryo; Uemura, Asuka; Itoh, Tomoo; Tukey, Robert H.
2017-01-01
Neurotoxic bilirubin is solely conjugated by UDP‐glucuronosyltransferase (UGT) 1A1. Due to an inadequate function of UGT1A1, human neonates develop mild to severe physiological hyperbilirubinemia. Accumulation of bilirubin in the brain leads to the onset of irreversible brain damage called kernicterus. Breastfeeding is one of the most significant factors that increase the risk of developing kernicterus in infants. Why does the most natural way of feeding increase the risk of brain damage or even death? This question leads to the hypothesis that breast milk‐induced neonatal hyperbilirubinemia might bring certain benefits to the body. One of the barriers to answering the above question is the lack of animal models that display mild to severe neonatal hyperbilirubinemia. A mouse model that develops neonatal hyperbilirubinemia was previously developed by a knockout of the Ugt1 locus. Deletion of Ugt1a1 results in neonatal lethality from bilirubin neurotoxicity. Bilirubin is the end product of heme catabolism in which heme oxygenase‐I is largely involved. When zinc protoporphyrin, an inhibitor of heme oxygenase I, was administered to newborn Ugt1 −/− mice, serum bilirubin levels dropped dramatically, rescuing the mice from bilirubin‐induced neonatal lethality. Zinc protoporphyrin‐treated Ugt1 −/− mice developed normally as adults capable of reproducing, but their newborns showed even more severe hyperbilirubinemia. Microarray analysis of the hyperbilirubinemic livers indicated that a number of genes associated with nucleotide, transport, and immune response were significantly down‐regulated in a serum bilirubin level‐dependent manner. Conclusion: Our study provides an opportunity to advance the development of effective therapeutics to effectively and rapidly prevent bilirubin‐induced toxicity. Neonatal hyperbilirubinemia has various impacts on the body that could be driven by the antioxidant property of bilirubin. (Hepatology Communications 2017;1:792–802) PMID:29399656
21 CFR 862.1110 - Bilirubin (total or direct) test system.
Code of Federal Regulations, 2014 CFR
2014-04-01
... abnormal distruction of red blood cells, if used in the diagnosis and treatment of liver, hemolytic... direct) test system is a device intended to measure the levels of bilirubin (total or direct) in plasma...
Evaluation of Jaundice in Adults.
Fargo, Matthew V; Grogan, Scott P; Saguil, Aaron
2017-02-01
Jaundice in adults can be an indicator of significant underlying disease. It is caused by elevated serum bilirubin levels in the unconjugated or conjugated form. The evaluation of jaundice relies on the history and physical examination. The initial laboratory evaluation should include fractionated bilirubin, a complete blood count, alanine transaminase, aspartate transaminase, alkaline phosphatase, ?-glutamyltransferase, prothrombin time and/or international normalized ratio, albumin, and protein. Imaging with ultrasonography or computed tomography can differentiate between extrahepatic obstructive and intrahepatic parenchymal disorders. Ultrasonography is the least invasive and least expensive imaging method. A more extensive evaluation may include additional cancer screening, biliary imaging, autoimmune antibody assays, and liver biopsy. Unconjugated hyperbilirubinemia occurs with increased bilirubin production caused by red blood cell destruction, such as hemolytic disorders, and disorders of impaired bilirubin conjugation, such as Gilbert syndrome. Conjugated hyperbilirubinemia occurs in disorders of hepatocellular damage, such as viral and alcoholic hepatitis, and cholestatic disorders, such as choledocholithiasis and neoplastic obstruction of the biliary tree.
NASA Astrophysics Data System (ADS)
Kakey, Musher Ismail Salih; Abdoulrahman, Kamaran Kaiani
2017-09-01
The present study aims to evaluate iron related parameters in chronic renal failure (CRF) patients on hemodialysis (HD). The study was carried out in Kidney Dialysis Center of Hawler Teaching Hospital in Erbil governorate. This study comprised (76) patients with chronic renal failure on hemodialysis and 41 healthy subjects as a control group of same ages. All hemodialysis patients were taking erythropoietin. The blood samples were taken from the patients before and after the process of hemodialysis for liver parameters and oxidative stress estimations. The results of this study showed lower levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT), albumin, total bilirubin, total protein and total antioxidant capacity (TAC), while higher levels of alkaline phosphatase (ALP), direct bilirubin and malondialdeyhde (MDA) before analysis was seen. Hemodialysis causes increasing in AST, ALT, albumin, total bilirubin, total protein and decreasing in ALP, direct bilirubin MDA and TAC.
Bilirubin measurements in neonates
NASA Astrophysics Data System (ADS)
Newman, Gregory J.
2000-04-01
Infant Jaundice is a physiologic condition of elevated bilirubin in the tissue that affects nearly 60 percent of all term newborns and virtually 100 percent of premature infants. The high production of bilirubin in the newborn circulatory system and the inability of the immature liver to process and eliminate it case the condition. When the bilirubin levels rise, it starts to deposit in the baby's skin and in the brain. The deposits in the brain can cause neurologic impairment and death. The BiliCheck is a handheld, battery-powered device that measures the level of jaundice non-invasively using BioPhotonics at the point of care. The result is displayed on an LCD screen immediately, so physicians can now make treatment decision without waiting for results to return from the lab. The BiliCheck System has been marketed worldwide since April of 1998 and has received FDA clearance for use in the USA on pre-photo therapy infants in March of 1999.
Recent Progress on the Characterization of Aldonolactone Oxidoreductases
Aboobucker, Siddique I; Lorence, Argelia
2015-01-01
l-Ascorbic acid (ascorbate, AsA, vitamin C) is essential for animal and plant health. Despite our dependence on fruits and vegetables to fulfill our requirement for this vitamin, the metabolic network leading to its formation in plants is just being fully elucidated. There is evidence supporting the operation of at least four biosynthetic pathways leading to AsA formation in plants. These routes use d-mannose/l-Galactose, l-gulose, d-galacturonate, and myo-inositol as the main precursors. This review focuses on aldonolactone oxidoreductases, a subgroup of the vanillyl alcohol oxidase (VAO; EC 1.1.3.38) superfamily, enzymes that catalyze the terminal step in AsA biosynthesis in bacteria, protozoa, animals, and plants. In this report, we review the properties of well characterized aldonolactone oxidoreductases to date. A shared feature in these proteins is the presence of a flavin cofactor as well as a thiol group. The flavin cofactor in many cases is bound to the N terminus of the enzymes or to a recently discovered HWXK motif in the C terminus. The binding between the flavin moiety and the protein can be either covalent or non-covalent. Substrate specificity and subcellular localization differ among the isozymes of each kingdom. All oxidases among these enzymes possess dehydrogenase activity, however, exclusive dehydrogenases are also found. We also discuss recent evidence indicating that plants have both l-gulono-1,4-lactone oxidases and l-Galactono-1,4-lactone dehydrogenases involved in AsA biosynthesis. PMID:26696130
Gaweska, Helena M.; Taylor, Alexander B.; Hart, P. John; Fitzpatrick, Paul F.
2013-01-01
The flavoprotein tryptophan 2-monooxygenase catalyzes the oxidative decarboxylation of tryptophan to yield indole-3-acetamide. This is the initial step in the biosynthesis of the plant growth hormone indole-acetic-acid by bacterial pathogens that cause crown gall and related diseases. The structure of the enzyme from Pseudomonas savastanoi has been determined by X-ray diffraction methods to a resolution of 1.95 Å. The overall structure of the protein shows that it has the same fold as the monoamine oxidase family of flavoproteins, with the greatest similarities to the L-amino acid oxidases. The location of bound indole-3-acetamide in the active site enables identification of residues responsible for substrate binding and specificity. Two residues in the enzyme are conserved in all members of the monoamine oxidase family, Lys365 and Trp466. The K365M mutation decreases the kcat and kcat/KTrp values by 60,000 and 2 million-fold, respectively. The deuterium kinetic isotope effect increases to 3.2, consistent with carbon-hydrogen bond cleavage becoming rate-limiting in the mutant enzyme. The W466F mutation decreases the kcat value less than 2-fold and the kcat/KTrp value only 5-fold, while the W466M mutation results in enzyme lacking flavin and detectable activity. This is consistent with a role for Trp466 in maintaining the structure of the flavin binding site in the more conserved FAD domain. PMID:23521653
Soldatova, Alexandra V; Romano, Christine A; Tao, Lizhi; Stich, Troy A; Casey, William H; Britt, R David; Tebo, Bradley M; Spiro, Thomas G
2017-08-23
The bacterial manganese oxidase MnxG of the Mnx protein complex is unique among multicopper oxidases (MCOs) in carrying out a two-electron metal oxidation, converting Mn(II) to MnO 2 nanoparticles. The reaction occurs in two stages: Mn(II) → Mn(III) and Mn(III) → MnO 2 . In a companion study , we show that the electron transfer from Mn(II) to the low-potential type 1 Cu of MnxG requires an activation step, likely forming a hydroxide bridge at a dinuclear Mn(II) site. Here we study the second oxidation step, using pyrophosphate (PP) as a Mn(III) trap. PP chelates Mn(III) produced by the enzyme and subsequently allows it to become a substrate for the second stage of the reaction. EPR spectroscopy confirms the presence of Mn(III) bound to the enzyme. The Mn(III) oxidation step does not involve direct electron transfer to the enzyme from Mn(III), which is shown by kinetic measurements to be excluded from the Mn(II) binding site. Instead, Mn(III) is proposed to disproportionate at an adjacent polynuclear site, thereby allowing indirect oxidation to Mn(IV) and recycling of Mn(II). PP plays a multifaceted role, slowing the reaction by complexing both Mn(II) and Mn(III) in solution, and also inhibiting catalysis, likely through binding at or near the active site. An overall mechanism for Mnx-catalyzed MnO 2 production from Mn(II) is presented.
A new diagnostic approach for bilious pleural effusion.
Saraya, Takeshi; Light, Richard W; Sakuma, Sho; Nakamoto, Yasuo; Wada, Shoko; Ishida, Manabu; Inui, Toshiya; Koide, Takashi; Ishii, Haruyuki; Takizawa, Hajime
2016-09-01
Bilious pleural effusion is an extremely rare condition associated with liver diseases, subphrenic or subhepatic abscess formation, biliary peritonitis, and invasive procedures (i.e., percutaneous biliary drainage or liver biopsy). The current diagnostic test is based on the measurement of the ratio of pleural total bilirubin to serum total bilirubin, which is greater than 1 in patients with bilious pleural effusion. Given the low incidence of bilious pleural effusion, the precise diagnostic yield of this ratio based test has not been evaluated. We retrospectively reviewed the medical records of our institution and searched the PubMed database for reports of bilious pleural effusion. We identified a total of 12 cases of bilious pleural effusion (9 from 8 Pubmed reports and 3 from our institutional records). The factors causing this condition were broadly classified into three categories based on the pathophysiology: 1) liver diseases (echinococcosis, tuberculosis and amebiasis); 2) subhepatic/subphrenic abscess or biliary peritonitis, with or without biliary tract obstruction; and 3) iatrogenic disease after percutaneous biliary drainage and/or liver biopsy. The sensitivity of detection was 76.9% when the ratio of pleural total bilirubin to serum total bilirubin was greater than 1. The sensitivity increased to 100% when a combination test including pleural glycoholic acid was adopted. This study demonstrates the high diagnostic yield for bilious pleural effusion using a combination of two test criteria; a ratio of pleural total bilirubin to serum total bilirubin greater than 1 and the presence of pleural glycoholic acid. Copyright © 2016 The Japanese Respiratory Society. Published by Elsevier B.V. All rights reserved.
2018-01-01
Background Neonatal jaundice affects one in two infants globally. The jaundice is the result of an accumulation of bilirubin as foetal haemoglobin is metabolised by the immature liver. High serum levels of bilirubin result in lethargy, poor feeding and kernicterus of the infant. Aim The main aim of this article was to determine the prevalence of neonatal jaundice and secondly to explore its risk factors in healthy term neonates. Setting Maternity ward, National District Hospital, Bloemfontein, South Africa. Methods In this cross-sectional study, mothers and infants were conveniently sampled after delivery and before discharge. The mothers were interviewed and their case records were reviewed for risk factors for neonatal jaundice and the clinical appearance and bilirubin levels of the infants were measured with a non-invasive transcutaneous bilirubin meter. Results A total of 96 mother-infant pairs were included in the study. The prevalence of neonatal jaundice was 55.2%; however, only 10% of black babies who were diagnosed with jaundice appeared clinically jaundiced. Normal vaginal delivery was the only risk factor associated with neonatal jaundice. Black race and maternal smoking were not protective against neonatal jaundice as in some other studies. Conclusion More than half (55.2%) of healthy term neonates developed neonatal jaundice. As it is difficult to clinically diagnose neonatal jaundice in darker pigmented babies, it is recommended that the bilirubin level of all babies should be checked with a non-invasive bilirubin meter before discharge from hospital or maternity unit as well as during the first clinic visit on day 3 after birth.
NASA Astrophysics Data System (ADS)
Nishidate, Izumi; Abdul, Wares MD.; Ohtsu, Mizuki; Nakano, Kazuya; Haneishi, Hideaki
2018-02-01
We propose a method to estimate transcutaneous bilirubin, hemoglobin, and melanin based on the diffuse reflectance spectroscopy. In the proposed method, the Monte Carlo simulation-based multiple regression analysis for an absorbance spectrum in the visible wavelength region (460-590 nm) is used to specify the concentrations of bilirubin (Cbil), oxygenated hemoglobin (Coh), deoxygenated hemoglobin (Cdh), and melanin (Cm). Using the absorbance spectrum calculated from the measured diffuse reflectance spectrum as a response variable and the extinction coefficients of bilirubin, oxygenated hemoglobin, deoxygenated hemoglobin, and melanin, as predictor variables, multiple regression analysis provides regression coefficients. Concentrations of bilirubin, oxygenated hemoglobin, deoxygenated hemoglobin, and melanin, are then determined from the regression coefficients using conversion vectors that are numerically deduced in advance by the Monte Carlo simulations for light transport in skin. Total hemoglobin concentration (Cth) and tissue oxygen saturation (StO2) are simply calculated from the oxygenated hemoglobin and deoxygenated hemoglobin. In vivo animal experiments with bile duct ligation in rats demonstrated that the estimated Cbil is increased after ligation of bile duct and reaches to around 20 mg/dl at 72 h after the onset of the ligation, which corresponds to the reference value of Cbil measured by a commercially available transcutaneous bilirubin meter. We also performed in vivo experiments with rats while varying the fraction of inspired oxygen (FiO2). Coh and Cdh decreased and increased, respectively, as FiO2 decreased. Consequently, StO2 was dramatically decreased. The results in this study indicate potential of the method for simultaneous evaluation of multiple chromophores in skin tissue.
Bilirubin Albumin Binding and Unbound Unconjugated Hyperbilirubinemia in Premature Infants.
Amin, Sanjiv B; Wang, Hongyue
2018-01-01
To evaluate the associations between unbound bilirubin (UB) and total serum bilirubin (TSB), bilirubin:albumin molar ratio (BAMR), and bilirubin albumin binding affinity (Ka) as a function of gestational age (GA) in infants born at 24-33 weeks GA. In a prospective observational study, TSB and UB were measured twice daily at least 8 hours apart during the first postnatal week. Serum albumin was measured to calculate BAMR on each day. The highest UB on each day, corresponding TSB, and serum albumin were used to calculate the Ka on each day. For the 166 infants studied, peak UB significantly correlated with concomitant Ka (r = -0.44, P = .001) but not with concomitant TSB or BAMR after adjusting for GA. On multiple regression analyses, there was a significant association of concomitant Ka (-0.06, 95% CI -0.08 to -0.04, P = .0001), but not concomitant TSB or BAMR with peak UB after controlling for GA, birth weight, race, and sex. GA group was a significant effect modifier for the association between Ka and peak UB (0.03, 95% CI 0.02-0.04, P < .001). Interaction analyses showed the association between concomitant Ka and peak UB was significant for the 24-30 weeks GA group infants, but not for the 30 1/7 -33 weeks GA group infants. Peak UB was primarily associated with a decrease in binding affinity in infants ≤30 weeks GA. Interventions aimed at improving binding affinity may be important in decreasing the risk of bilirubin-induced neurotoxicity. Copyright © 2017 Elsevier Inc. All rights reserved.
False positive acetaminophen concentrations in patients with liver injury.
Polson, Julie; Wians, Frank H; Orsulak, Paul; Fuller, Dwain; Murray, Natalie G; Koff, Jonathan M; Khan, Adil I; Balko, Jody A; Hynan, Linda S; Lee, William M
2008-05-01
Acetaminophen toxicity is the most common form of acute liver failure in the U.S. After acetaminophen overdoses, quantitation of plasma acetaminophen can aid in predicting severity of injury. However, recent case reports have suggested that acetaminophen concentrations may be falsely increased in the presence of hyperbilirubinemia. We tested sera obtained from 43 patients with acute liver failure, mostly unrelated to acetaminophen, utilizing 6 different acetaminophen quantitation systems to determine the significance of this effect. In 36 of the 43 samples with bilirubin concentrations ranging from 1.0-61.5 mg/dl no acetaminophen was detectable by gas chromatography-mass spectroscopy. These 36 samples were then utilized to test the performance characteristics of 2 immunoassay and 4 enzymatic-colorimetric methods. Three of four colorimetric methods demonstrated 'detectable' values for acetaminophen in from 4 to 27 of the 36 negative samples, low concentration positive values being observed when serum bilirubin concentrations exceeded 10 mg/dl. By contrast, the 2 immunoassay methods (EMIT, FPIA) were virtually unaffected. The false positive values obtained were, in general, proportional to the quantity of bilirubin in the sample. However, prepared samples of normal human serum with added bilirubin showed a dose-response curve for only one of the 4 colorimetric assays. False positive acetaminophen tests may result when enzymatic-colorimetric assays are used, most commonly with bilirubin concentrations >10 mg/dl, leading to potential clinical errors in this setting. Bilirubin (or possibly other substances in acute liver failure sera) appears to affect the reliable measurement of acetaminophen, particularly with enzymatic-colorimetric assays.
[Arias icterus--prolonged unconjugated hyperbilirubinemia caused by breast milk].
Mladenović, Marija; Radlović, Nedeljko; Ristić, Dragana; Leković, Zoran; Radlović, Petar; Pavlović, Momcilo; Gajić, Milan; Puskarević, Marijana; Davidović, Ivana; Djurdjević, Jelena
2007-01-01
Breast milk jaundice occurs in 1-2% of healthy breast-fed newborns and young infants. It develops as the result of liver immaturity and the inhibitory effect of mother's milk to the clearance of unconjugated bilirubin. The paper analyzes variations in the level and length of unconjugated hyperbilirubinemia in breast-fed infants. The study was conducted on a sample of 29 young infants (19 male) with breast milk jaundice. All infants were born on time, by natural delivery and without complications. All were on breast-feeding only and developed optimally. None of the infants had either haemolysis or any other disease associated with unconjugated hyperbilirubinemia. All infants had physiological jaundice in the first week after birth, with unconjugated bilirubin level of 166-260 micromol (201.50 +/- 36.37 micromol). In the postneonatal period the highest bilirubin level was recorded in the fifth week of life and was 87-273 micromol (166.82 +/- 45.06 micromol), which then spontaneously, without interruption of breast-feeding, gradually declined. The decrease of the unconjugated fraction of serum bilirubin between the fourth and fifth week was significant, and after that highly significant. The normalization of serum bilirubin occurred in the seventh and thirteenth week (10.41 +/- 1.68 micromol). Negative consequences of hyperbilirubinemia were not noted in any of the infants. Breast milk jaundice presents a harmless and transitory disorder of bilirubin metabolism. It occurs in healthy breast-fed neonates and young infants. Jaundice is most marked in early neonatal period, and then it gradually declines and disappears between the seventh and thirteenth week.
de Vries, L S; Lary, S; Dubowitz, L M
1985-09-01
During a 4-year period, 12 premature infants, all less than 34 weeks of gestation and all with a bilirubin level above 240 mumol/L (14 mg/dL) were determined to have bilateral sensorineural deafness. In order to to investigate how far the hyperbilirubinemia or any a associated factor might have been a causative factor, all infants of 34 weeks of gestation or less who had a serum bilirubin level above 240 mumol/L were investigated. For a period of 4 years, 99 infants meeting these criteria were classified as high risk or low risk on the basis of perinatal risk factors. Eight of the 22 high-risk infants with birth weight less than 1,500 g, but only two of 43 high-risk infants with birth weight greater than 1,500 g were deaf (P less than .05). The deaf infants were also matched with infants of normal hearing who had similar bilirubin levels and the same number of adverse perinatal factors. The mean duration of hyperbilirubinemia was significantly longer in the deaf infants (P less than .02), and they appeared to have a greater number of acidotic episodes while they were hyperbilirubinemic. These findings suggest that in healthy preterm infants with birth weight greater than 1,500 g, high bilirubin levels carry little risk, whereas a serum bilirubin level greater than 240 mumol/L in high-risk preterm infants with birth weight of 1,500 g or less is associated with a high risk of deafness.
Zhao, Mei; Gao, Yue; Sun, Junyong; Gao, Feng
2015-03-03
Utilization of carbon nanodots (CNDs), newcomers to the world of carbonaceous nanomaterials, in the electrochemistry realm has rarely been reported so far. In this study, CNDs were used as immobilization supports and electron carriers to promote direct electron transfer (DET) reactions of glucose oxidase (GOx) and bilirubin oxidase (BOD). At the CNDs electrode entrapped with GOx, a high rate constant (k(s)) of 6.28 ± 0.05 s(-1) for fast DET and an apparent Michaelis-Menten constant (K(M)(app)) as low as 0.85 ± 0.03 mM for affinity to glucose were found. By taking advantage of its excellent direct bioelectrocatalytic performances to glucose oxidation, a DET-based biosensor for glucose detection ranging from 0 to 0.64 mM with a high sensitivity of 6.1 μA mM(-1) and a limit of detection (LOD) of 1.07 ± 0.03 μM (S/N = 3) was proposed. Additionally, the promoted DET of BOD immobilized on CNDs was also observed and effectively catalyzed the reduction of oxygen to water at the onset potential of +0.51 V (vs Ag/AgCl). On the basis of the facilitated DET of these two enzymes at CNDs electrodes, a mediator-free DET-type glucose/air enzymatic biofuel cell (BFC), in which CNDs electrodes entrapped with GOx and BOD were employed for oxidizing glucose at the bioanode and reducing oxygen at the biocathode, respectively, was successfully fabricated. The constructed BFC displayed an open-circuit voltage (OCV) as high as 0.93 V and a maximum power density of 40.8 μW cm(-2) at 0.41 V. These important features of CNDs have implied to be promising materials for immobilizing enzymes and efficient platforms for elaborating bioelectrochemical devices such as biosensors and BFCs.
Ou Yang, Qing; Zhang, Sheng; Cheng, Qing-Bao; Li, Bin; Feng, Fei-Ling; Yu, Yong; Luo, Xiang-Ji; Lin, Zhao-Fen; Jiang, Xiao-Qing
2016-05-01
This study aims to evaluate the role of dynamic change in total bilirubin after portal vein embolization (PVE) in predicting major complications and 30-day mortality in patients with hilar cholangiocarcinoma (HCCA). Retrospective analysis of prospectively maintained data of 64 HCCA patients who underwent PVE before hepatectomy in our institution was used. Total bilirubin and other parameters were measured daily in peri-PVE period. The difference between them and the baseline value from days 0-5 to day -1 (∆D1) and days 5-14 to day -1 (∆D2) were calculated. The relationship between ∆D1 and ∆D2 of total bilirubin and major complications as well as 30-day mortality was analyzed. Out of 64 patients, 10 developed major complications (15.6 %) and 6 patients (9.3 %) had died within 30 days after surgery. The ∆D2 of total bilirubin after PVE was most significantly associated with major complications (P < 0.001) and 30-day mortality (P = 0.002). In addition, it was found to be an independent predictor of major complications after PVE (odds ratio (OR) = 1.050; 95 % CI 1.017-1.084). ASA >3 (OR = 12.048; 95 % CI 1.019-143.321), ∆D2 of total bilirubin (OR = 1.058; 95 % CI 1.007-1.112), and ∆D2 of prealbumin (OR = 0.975; 95 % CI 0.952-0.999) were associated with higher risk of 30-day mortality after PVE. Receiver operating characteristic curves showed that ∆D2 of total bilirubin were better predictors than ∆D1 for major complications (AUC (∆D2) 0.817; P = 0.002 vs. AUC (∆D1) 0.769; P = 0.007) and 30-day mortality (ACU(∆D2) 0.868; P = 0.003 vs. AUC(∆D1) 0.721;P = 0.076). Patients with increased total bilirubin in 5-14 days after PVE may indicate a higher risk of major complications and 30-day mortality if the major hepatectomy were performed.
[Hepatotoxicity of emodin based on UGT1A1 enzyme-mediated bilirubin in liver microsomes].
Wang, Qi; Dai, Zhong; Zhang, Yu-Jie; Ma, Shuang-Cheng
2016-12-01
To study the hepatotoxicity of emodin based on bilirubin metabolism mediated by glucuronidation of UGT1A1 enzyme. In this study, three different incubation systems were established by using RLM, HLM, and rUGT1A1, with bilirubin as the substrate. Different concentrations of bilirubin and emodin were added in the incubation systems. The double reciprocal Michaelis equation was drawn based on the total amount of bilirubin glucuronidation. The apparent inhibition constant Ki was then calculated with the slope curve to predict the hepatotoxicity. The results indicated that emodin had a significant inhibition to the UGT1A1 enzyme in all of the three systems, with Ki=5.400±0.956(P<0.05) in HLM system, Ki =10.020±0.611(P<0.05) in RLM system, Ki=4.850±0.528(P<0.05) in rUGT1A1 system. Meanwhile, emodin had no significant difference between rat and human in terms of inhibition of UGT1A1 enzyme. Emodin had a potential risk of the hepatotoxicity by inhibiting the UGT1A1 enzyme activity. And the method established in this study provides a new thought and new method to evaluate hepatotoxicity and safety of traditional Chinese medicines. Copyright© by the Chinese Pharmaceutical Association.
Ellairaja, Sundaram; Shenbagavalli, Kathiravan; Ponmariappan, Sarkaraisamy; Vasantha, Vairathevar Sivasamy
2017-05-15
Bilirubin, a key biomarker for the jaundice and its clinical diagnosis needs a better analytical tool. A novel and simple fluorescent platform based on (2,2'-((1E,1'E)-((6-bromopyridine-2,3-diyl) bis(azanylylidene)) bis(methanylylidene diphenol) (BAMD) was designed. BAMD showed a remarkable fluorescent intensity with a very good quantum yield of 0.85 and lifetime of 870ps. Hence, it was applied for the determination of bilirubin using both colorimetric and fluorimetric techniques in physiological and basic pH. Under optimized experimental conditions, the probe detects bilirubin selectively in the presence of other interfering biomolecules and metal ions. The linear range of detection is 1pM-500µM at pH=7.4 and LOD is 2.8 and 3.3 pM at pH=7.4 and 9.0, respectively, which were reported so far. The probe detects the bilirubin through FRET mechanism. The practical application of the probe was successfully tested in the human blood and urine samples. Based on all above advantages, this simple idea can be applied to design a simple clinical diagnostic tool for jaundice. Copyright © 2016. Published by Elsevier B.V.
Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E
2017-02-09
In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.
Ishigami, Izumi; Zatsepin, Nadia A; Hikita, Masahide; Conrad, Chelsie E; Nelson, Garrett; Coe, Jesse D; Basu, Shibom; Grant, Thomas D; Seaberg, Matthew H; Sierra, Raymond G; Hunter, Mark S; Fromme, Petra; Fromme, Raimund; Yeh, Syun-Ru; Rousseau, Denis L
2017-07-25
Cytochrome c oxidase (C c O), the terminal enzyme in the electron transfer chain, translocates protons across the inner mitochondrial membrane by harnessing the free energy generated by the reduction of oxygen to water. Several redox-coupled proton translocation mechanisms have been proposed, but they lack confirmation, in part from the absence of reliable structural information due to radiation damage artifacts caused by the intense synchrotron radiation. Here we report the room temperature, neutral pH (6.8), damage-free structure of bovine C c O (bC c O) in the carbon monoxide (CO)-bound state at a resolution of 2.3 Å, obtained by serial femtosecond X-ray crystallography (SFX) with an X-ray free electron laser. As a comparison, an equivalent structure was obtained at a resolution of 1.95 Å, from data collected at a synchrotron light source. In the SFX structure, the CO is coordinated to the heme a 3 iron atom, with a bent Fe-C-O angle of ∼142°. In contrast, in the synchrotron structure, the Fe-CO bond is cleaved; CO relocates to a new site near Cu B , which, in turn, moves closer to the heme a 3 iron by ∼0.38 Å. Structural comparison reveals that ligand binding to the heme a 3 iron in the SFX structure is associated with an allosteric structural transition, involving partial unwinding of the helix-X between heme a and a 3 , thereby establishing a communication linkage between the two heme groups, setting the stage for proton translocation during the ensuing redox chemistry.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ishigami, Izumi; Zatsepin, Nadia A.; Hikita, Masahide
Here, cytochrome c oxidase (C cO), the terminal enzyme in the electron transfer chain, translocates protons across the inner mitochondrial membrane by harnessing the free energy generated by the reduction of oxygen to water. Several redox-coupled proton translocation mechanisms have been proposed, but they lack confirmation, in part from the absence of reliable structural information due to radiation damage artifacts caused by the intense synchrotron radiation. Here we report the room temperature, neutral pH (6.8), damage-free structure of bovine C cO (bC cO) in the carbon monoxide (CO)-bound state at a resolution of 2.3 Å, obtained by serial femtosecond X-raymore » crystallography (SFX) with an X-ray free electron laser. As a comparison, an equivalent structure was obtained at a resolution of 1.95 Å, from data collected at a synchrotron light source. In the SFX structure, the CO is coordinated to the heme a3 iron atom, with a bent Fe–C–O angle of ~142°. In contrast, in the synchrotron structure, the Fe–CO bond is cleaved; CO relocates to a new site near Cu B, which, in turn, moves closer to the heme a 3 iron by ~0.38 Å. Structural comparison reveals that ligand binding to the heme a 3 iron in the SFX structure is associated with an allosteric structural transition, involving partial unwinding of the helix-X between heme a and a 3, thereby establishing a communication linkage between the two heme groups, setting the stage for proton translocation during the ensuing redox chemistry.« less
Ishigami, Izumi; Zatsepin, Nadia A.; Hikita, Masahide; ...
2017-07-11
Here, cytochrome c oxidase (C cO), the terminal enzyme in the electron transfer chain, translocates protons across the inner mitochondrial membrane by harnessing the free energy generated by the reduction of oxygen to water. Several redox-coupled proton translocation mechanisms have been proposed, but they lack confirmation, in part from the absence of reliable structural information due to radiation damage artifacts caused by the intense synchrotron radiation. Here we report the room temperature, neutral pH (6.8), damage-free structure of bovine C cO (bC cO) in the carbon monoxide (CO)-bound state at a resolution of 2.3 Å, obtained by serial femtosecond X-raymore » crystallography (SFX) with an X-ray free electron laser. As a comparison, an equivalent structure was obtained at a resolution of 1.95 Å, from data collected at a synchrotron light source. In the SFX structure, the CO is coordinated to the heme a3 iron atom, with a bent Fe–C–O angle of ~142°. In contrast, in the synchrotron structure, the Fe–CO bond is cleaved; CO relocates to a new site near Cu B, which, in turn, moves closer to the heme a 3 iron by ~0.38 Å. Structural comparison reveals that ligand binding to the heme a 3 iron in the SFX structure is associated with an allosteric structural transition, involving partial unwinding of the helix-X between heme a and a 3, thereby establishing a communication linkage between the two heme groups, setting the stage for proton translocation during the ensuing redox chemistry.« less
Yang, Ziqin; Zhong, Xiumei; Fan, Yan; Wang, Huicong; Li, Jianguo; Huang, Xuming
2015-01-01
Cutting off carbohydrate supply to longan (Dimocarpus longan Lour.) fruit by girdling and defoliation or by detachment induced 100% abscission within a few days. We used these treatments to study the involvement of reactive oxygen species (ROS) in fruit abscission. Girdling plus defoliation decreased sugar concentrations in the fruit and pedicel and depleted starch grains in the chloroplasts in the cells of abscission zone. Prior to the occurrence of intensive fruit abscission, there was a burst in ROS in the pedicel, which peaked at 1 day after treatment (DAT), when H2O2 in the abscission zone was found to be chiefly located along the plasma membrane (PM). H2O2 was found exclusively in the cell walls 2 DAT, almost disappeared 3 DAT, and reappeared in the mitochondria and cell walls 4 DAT. Signs of cell death such as cytoplasm breakdown were apparent from 3 DAT. The burst of ROS coincided with a sharp increase in the activity of PM-bound NADPH oxidase in the pedicel. At the same time, activities of antioxidant enzymes including superoxide dismutase (SOD), catalase, and peroxidase (POD) were all increased by the treatment and maintained higher than those in the control. Accompanying the reduction in H2O2 abundance, there was a sharp decrease in PM-bound NADPH oxidase activity after 1 DAT in the treated fruit. H2O2 scavenger dimethylthiourea (DMTU, 1 g L–1) significantly inhibited fruit abscission in detached fruit clusters and suppressed the increase in cellulase activity in the abscission zone. These results suggest that fruit abscission induced by carbohydrate stress is mediated by ROS. Roles of ROS in regulating fruit abscission were discussed in relation to its subcellular distribution. PMID:26074931
Acidity of a Cu-bound histidine in the binuclear center of cytochrome C oxidase.
Fadda, Elisa; Chakrabarti, Nilmadhab; Pomès, Régis
2005-12-01
Cytochrome c oxidase (CcO) is a crucial enzyme in the respiratory chain. Its function is to couple the reduction of molecular oxygen, which takes place in the Fea3-CuB binuclear center, to proton translocation across the mitochondrial membrane. Although several high-resolution structures of the enzyme are known, the molecular basis of proton pumping activation and its mechanism remain to be elucidated. We examine a recently proposed scheme (J. Am. Chem. Soc. 2004, 126, 1858; FEBS Lett. 2004, 566, 126) that involves the deprotonation of the CuB-bound imidazole ring of a histidine (H291 in mammalian CcO) as a key element in the proton pumping mechanism. The central feature of that proposed mechanism is that the pKa values of the imidazole vary significantly depending on the redox state of the metals in the binuclear center. We use density functional theory in combination with continuum electrostatics to calculate the pKa values, successively in bulk water and within the protein, of the Cu-bound imidazole in various Cu- and Cu-Fe complexes. From pKas in bulk water, we derived a value of -266.34 kcal.mol(-1) for the proton solvation free energy (Delta). This estimate is in close agreement with the experimental value of -264.61 kcal.mol(-1) (J. Am. Chem. Soc. 2001, 123, 7314), which reinforces the conclusion that Delta is more negative than previous values used for pKa calculations. Our approach, on the basis of the study of increasingly more detailed models of the CcO binuclear center at different stages of the catalysis, allows us to examine successively the effect of each of the two metals' redox states and of solvation on the acidity of imidazole, whose pKa is approximately 14 in bulk water. This analysis leads to the following conclusions: first, the effect of Cu ligation on the imidazole acidity is negligible regardless of the redox state of the metal. Second, results obtained for Cu-Fe complexes in bulk water indicate that Cu-bound imidazole pKa values lie within the range of 14.8-16.6 throughout binuclear redox states corresponding to the catalytic cycle, demonstrating that the effect of the Fe oxidation states is also negligible. Finally, the low-dielectric CcO proteic environment shifts the acid-base equilibrium toward a neutral imidazole, further increasing the corresponding pKa values. These results are inconsistent with the proposed role of the Cu-bound histidine as a key element in the pumping mechanism. Limitations of continuum solvation models in pKa calculations are discussed.
Uluisik, Rizvan; Romero, Elvira; Gadda, Giovanni
2017-11-01
The effect of temperature on the reaction of alcohol oxidation catalyzed by choline oxidase was investigated with the S101A variant of choline oxidase. Anaerobic enzyme reduction in a stopped-flow spectrophotometer was biphasic using either choline or 1,2-[ 2 H 4 ]-choline as a substrate. The limiting rate constants k lim1 and k lim2 at saturating substrate were well separated (k lim1 /k lim2 >9), and were >15-fold slower than for wild-type choline oxidase. Solvent deuterium kinetic isotope effects (KIEs) ~4 established that k lim1 probes the proton transfer from the substrate hydroxyl to a catalytic base. Primary substrate deuterium KIEs ≥7 demonstrated that k lim2 reports on hydride transfer from the choline alkoxide to the flavin. Between 15°C and 39°C the k lim1 and k lim2 values increased with increasing temperature, allowing for the analyses of H + and H - transfers using Eyring and Arrhenius formalisms. Temperature-independent KIE on the k lim1 value ( H2O k lim1 / D2O k lim1 ) suggests that proton transfer occurs within a highly reorganized tunneling-ready-state with a narrow distribution of donor-acceptor distances. Eyring analysis of the k lim2 value gave lines with the slope (choline) >slope (D-choline) , suggesting kinetic complexity. Spectral evidence for the transient occurrence of a covalent flavin-substrate adduct during the first phase of the anaerobic reaction of S101A CHO with choline is presented, supporting the notion that an important role of amino acid residues in the active site of flavin-dependent enzymes is to eliminate alternative reactions of the versatile enzyme-bound flavin for the reaction that needs to be catalyzed. Copyright © 2017 Elsevier B.V. All rights reserved.
Structure and proposed mechanism of α-glycerophosphate oxidase from Mycoplasma pneumoniae
Elkhal, Callia K.; Kean, Kelsey M.; Parsonage, Derek; ...
2015-03-14
In this study, the formation of hydrogen peroxide (H₂O₂) by the FAD-dependent α-glycerophosphate oxidase (GlpO), is important for the pathogenesis of Streptococcus pneumoniae and Mycoplasma pneumoniae. The structurally known GlpO from Streptococcus sp. ( SspGlpO) is similar to the pneumococcal protein ( SpGlpO) and provides a guide for drug design against that target. However, M. pneumoniae GlpO ( MpGlpO), having <20% sequence identity with structurally known GlpOs, appears to represent a second type of GlpO we designate as Type II GlpOs. Here, the recombinant His-tagged MpGlpO structure is described at ~2.5 Å resolution, solved by molecular replacement using as amore » search model the Bordetella pertussis protein 3253 (Bp3253) a protein of unknown function solved by structural genomics efforts. Recombinant MpGlpO is an active oxidase with a turnover number of ~580 min⁻¹ while Bp3253 showed no GlpO activity. No substantial differences exist between the oxidized and dithionite-reduced MpGlpO structures. Although, no liganded structures were determined, a comparison with the tartrate-bound Bp3253 structure and consideration of residue conservation patterns guided the construction of a model for α-glycerophosphate (Glp) recognition and turnover by MpGlpO. The predicted binding mode also appears relevant for the type I GlpOs (such as SspGlpO) despite differences in substrate recognition residues, and it implicates a histidine conserved in type I and II Glp oxidases and dehydrogenases as the catalytic acid/base. This work provides a solid foundation for guiding further studies of the mitochondrial Glp dehydrogenases as well as for continued studies of M. pneumoniae and S. pneumoniae glycerol metabolism and the development of novel therapeutics targeting MpGlpO and SpGlpO.« less
Structure and proposed mechanism of α-glycerophosphate oxidase from Mycoplasma pneumoniae
DOE Office of Scientific and Technical Information (OSTI.GOV)
Elkhal, Callia K.; Kean, Kelsey M.; Parsonage, Derek
In this study, the formation of hydrogen peroxide (H₂O₂) by the FAD-dependent α-glycerophosphate oxidase (GlpO), is important for the pathogenesis of Streptococcus pneumoniae and Mycoplasma pneumoniae. The structurally known GlpO from Streptococcus sp. ( SspGlpO) is similar to the pneumococcal protein ( SpGlpO) and provides a guide for drug design against that target. However, M. pneumoniae GlpO ( MpGlpO), having <20% sequence identity with structurally known GlpOs, appears to represent a second type of GlpO we designate as Type II GlpOs. Here, the recombinant His-tagged MpGlpO structure is described at ~2.5 Å resolution, solved by molecular replacement using as amore » search model the Bordetella pertussis protein 3253 (Bp3253) a protein of unknown function solved by structural genomics efforts. Recombinant MpGlpO is an active oxidase with a turnover number of ~580 min⁻¹ while Bp3253 showed no GlpO activity. No substantial differences exist between the oxidized and dithionite-reduced MpGlpO structures. Although, no liganded structures were determined, a comparison with the tartrate-bound Bp3253 structure and consideration of residue conservation patterns guided the construction of a model for α-glycerophosphate (Glp) recognition and turnover by MpGlpO. The predicted binding mode also appears relevant for the type I GlpOs (such as SspGlpO) despite differences in substrate recognition residues, and it implicates a histidine conserved in type I and II Glp oxidases and dehydrogenases as the catalytic acid/base. This work provides a solid foundation for guiding further studies of the mitochondrial Glp dehydrogenases as well as for continued studies of M. pneumoniae and S. pneumoniae glycerol metabolism and the development of novel therapeutics targeting MpGlpO and SpGlpO.« less
Chronically elevated bilirubin protects from cardiac reperfusion injury in the male Gunn rat.
Bakrania, B; Du Toit, E F; Ashton, K J; Wagner, K-H; Headrick, J P; Bulmer, A C
2017-08-01
Bilirubin is associated with reduced risk of cardiovascular disease, as evidenced in conditions of mild hyperbilirubinaemia (Gilbert's Syndrome). Little is known regarding myocardial stress resistance in hyperbilirubinaemic conditions or whether life-long exposure modifies cardiac function, which might contribute to protection from cardiovascular disease. Hyperbilirubinaemic rats and littermate controls underwent echocardiography at 3, 6 and 12 months of age, with hearts subsequently assessed for resistance to 30 min of ischaemia. Heart tissue was then collected for assessment of bilirubin content. No difference in baseline cardiac function was evident until 6 months onwards, where Gunn rats demonstrated aortic dilatation and reduced peak ejection velocities. Additionally, duration of ventricular ejection increased progressively, indicating a negative inotropic effect of bilirubin in vivo. Ex vivo analysis of baseline function revealed reduced left ventricular pressure development (LVDP) and contractility in hyperbilirubinaemic rats. Furthermore, stress resistance was improved in Gunn hearts: post-ischaemic recoveries of LVDP (76 ± 22% vs. 29 ± 17% Control, P < 0.01) and coronary flow (96 ± 9% vs. 86 ± 16% Control, P < 0.01) were improved in Gunn hearts, accompanied by reduced infarct area (21 ± 5% vs. 47 ± 15% Control, P < 0.01), and ventricular malondialdehyde and protein carbonyl content. Expression of myocardial nitric oxide-regulating genes including Nos1 and Noa1 were not significantly different. These data reveal life-long hyperbilirubinaemia induces age-dependent hypocontractility in male Gunn rats, and improved stress resistance. In addition, bilirubin exerts sex-independent effects on vascular structure, myocardial function and ischaemic tolerance, the latter likely mediated via bilirubin's antioxidant properties. © 2017 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.
Kim, Sung Young; Rah, Dong Kyun; Chong, Yosep; Lee, Song Hyun; Park, Tae Hwan
2016-10-01
The use of bilirubin, a well-known and powerful antioxidant, has gained popularity in recent years because of its role in the prevention of ischaemic heart disease in patients with Gilbert's syndrome. We investigate the effects of bilirubin on ischaemia-reperfusion (I/R) injury using a rat perforator flap model. Forty-eight rats were randomly divided into two groups: experimental (bilirubin) group (n = 24) and control group (n = 24). In each group, elevated bilateral deep inferior epigastric perforator (DIEP) flaps were created. The right (no ischaemia side) and left (ischaemia side) DIEP flaps were separated according to the presence of ischaemia induction. Ischaemia was induced in anaesthetised rats by perforator clamping for 15 or 30 minutes. After surgery, the flap survival was assessed daily on postoperative days 0 to 5, and overall histological changes of DIEP flaps above the perforator were analysed at postoperative day 5. The flap survival rate in the bilirubin group was significantly higher than that in the control group at the ischaemia side following perforator clamping for 15 or 30 minutes (93·42 ± 4·48% versus 89·63 ± 3·98%, P = 0·002; and 83·96 ± 4·23% versus 36·46 ± 6·38%, P < 0·001, respectively). The difference in flap survival between the two groups was the most prominent on the ischaemic side following 30 minutes of perforator clamping. From a morphologic perspective, pre-treatment with bilirubin was found to alleviate perforator flap necrosis caused by I/R injury in this experimental rat model. © 2015 Medicalhelplines.com Inc and John Wiley & Sons Ltd.
Bilirubin nanoparticles ameliorate allergic lung inflammation in a mouse model of asthma.
Kim, Dong Eon; Lee, Yonghyun; Kim, MinGyo; Lee, Soyoung; Jon, Sangyong; Lee, Seung-Hyo
2017-09-01
Although asthma, a chronic inflammatory airway disease, is relatively well-managed by inhaled corticosteroids, the side effects associated with the long-term use of these agents precipitate the need for alternative therapeutic options based on differing modes of action. Bilirubin, a potent endogenous antioxidant, and anti-inflammatory molecule have been shown to ameliorate asthmatic symptoms; however, its clinical translation has been limited owing to its water insolubility and associated potential toxicity. Here we report the first application of bilirubin-based nanoparticles (BRNPs) as a nanomedicine for the treatment of allergic lung inflammatory disease. BRNPs were prepared directly from self-assembly of PEGylated bilirubin in aqueous solution and had a hydrodynamic diameter of ∼100 nm. Because allergen-specific type 2 T-helper (Th2) cells play a key role in the pathogenesis and progression of allergic asthma, the effects of BRNPs on Th2 immune responses were investigated both in vivo and in vitro. BRNPs after intravenous injection (i.v.) showed much higher serum concentration and a longer circulation time of bilirubin than the intraperitoneal injection (i.p.) of BRNPs or unconjugated bilirubin (UCB). The anti-asthmatic effects of BRNPs were assessed in a mouse model of allergen-induced asthma. Compared with UCB, treatment with BRNPs suppressed the symptoms of experimental allergic asthma and dramatically ameliorated Th2-related allergic lung inflammation. Consistent with these results, BRNPs caused a reduction of Th2 cell populations and the expression of related cytokines by antibody-stimulated CD4 + T cells in vitro. Therefore, our results establish BRNPs as an important immunomodulatory agent that may be useful as a therapeutic for allergic lung inflammatory disease and other immune-mediated disorders. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hyperbilirubinaemia: its utility in non-perforated appendicitis.
Sandstrom, Anna; Grieve, David A
2017-07-01
The diagnosis of acute appendicitis is made using clinical findings and investigations. Recent studies have suggested that serum bilirubin, a cheap and simple biochemical test, is a positive predictor in the diagnosis of appendiceal perforation and may be more specific than C-reactive protein (CRP) and white cell count (WCC). The aim of this study was to investigate the utility of the serum bilirubin level in patients with suspected acute but non-perforative appendicitis. A retrospective chart review of 213 patients who presented with suspected appendicitis in a 6-month period to Nambour General Hospital was performed. Serum bilirubin, WCC and CRP were recorded and analysed as to their utility in relation to the final diagnosis. A total of 196 patients underwent an appendicectomy and 41 of these were negative. The specificity of hyperbilirubinaemia for appendicitis overall was 0.83 with a positive predictive value (PPV) of 0.86, compared with CRP (specificity 0.40, PPV 0.75) and WCC (specificity 0.67, PPV 0.85). The area under the receiver operating characteristic curve for bilirubin was 0.6289 compared to 0.6171 for CRP and 0.7219 for WCC. A subgroup analysis of those with complicated appendicitis demonstrated a PPV for bilirubin of 0.66 compared to 0.58 for WCC and 0.34 for CRP in agreement with the literature. Subgroup analysis of hyperbilirubinaemia in simple appendicitis demonstrated a PPV of 0.81 compared to CRP (0.71) and WCC (0.82). Bilirubin had a higher specificity than CRP and WCC overall in patients with appendicitis. Hyperbilirubinaemia had a high PPV in patients with simple appendicitis. © 2015 Royal Australasian College of Surgeons.
Castro-García, Flor P; Corral-Jara, Karla F; Escobedo-Melendez, Griselda; Sandoval-Hernandez, Monserrat A; Rosenstein, Yvonne; Roman, Sonia; Panduro, Arturo; Fierro, Nora A
2014-01-01
Hepatitis A virus (HAV) infection is the major cause of acute liver failure in paediatric patients. The clinical spectrum of infection is variable, and liver injury is determined by altered hepatic enzyme function and bilirubin concentration. We recently reported differences in cytokine profiles between distinct HAV-induced clinical courses, and bilirubin has been recognized as a potential immune-modulator. However, how bilirubin may affect cytokine profiles underlying the variability in the course of infection has not been determined. Herein, we used a transcription factor (TF) binding site identification approach to retrospectively analyse cytokine expression in HAV-infected children and to predict the entire set of TFs associated with the expression of specific cytokine profiles. The results suggested that modulation of the activity of signal transducers and activators of transcription proteins (STATs) may play a central role during HAV infection. This led us to compare the degree of STAT phosphorylation in peripheral blood lymphoid cells (PBLCs) from paediatric patients with distinct levels of conjugated bilirubin (CB). Low CB levels in sera were associated with increased STAT-1 and STAT-5 phosphorylation. A positive correlation was observed between the serum interleukin-6 (IL-6) content and CB values, whereas higher levels of CB correlated with reduced serum IL-8 values and with a reduction in the proportion of PBLCs positive for STAT-5 phosphorylation. When CB was used to stimulate patients’ PBLCs in vitro, the levels of IL-6 and tumour necrosis factor-α were increased. The data showed that bilirubin plays a role in STAT function and affects cytokine profile expression during HAV infection. PMID:24943111
Lineage-Specific Changes in Biomarkers in Great Apes and Humans.
Ronke, Claudius; Dannemann, Michael; Halbwax, Michel; Fischer, Anne; Helmschrodt, Christin; Brügel, Mathias; André, Claudine; Atencia, Rebeca; Mugisha, Lawrence; Scholz, Markus; Ceglarek, Uta; Thiery, Joachim; Pääbo, Svante; Prüfer, Kay; Kelso, Janet
2015-01-01
Although human biomedical and physiological information is readily available, such information for great apes is limited. We analyzed clinical chemical biomarkers in serum samples from 277 wild- and captive-born great apes and from 312 healthy human volunteers as well as from 20 rhesus macaques. For each individual, we determined a maximum of 33 markers of heart, liver, kidney, thyroid and pancreas function, hemoglobin and lipid metabolism and one marker of inflammation. We identified biomarkers that show differences between humans and the great apes in their average level or activity. Using the rhesus macaques as an outgroup, we identified human-specific differences in the levels of bilirubin, cholinesterase and lactate dehydrogenase, and bonobo-specific differences in the level of apolipoprotein A-I. For the remaining twenty-nine biomarkers there was no evidence for lineage-specific differences. In fact, we find that many biomarkers show differences between individuals of the same species in different environments. Of the four lineage-specific biomarkers, only bilirubin showed no differences between wild- and captive-born great apes. We show that the major factor explaining the human-specific difference in bilirubin levels may be genetic. There are human-specific changes in the sequence of the promoter and the protein-coding sequence of uridine diphosphoglucuronosyltransferase 1 (UGT1A1), the enzyme that transforms bilirubin and toxic plant compounds into water-soluble, excretable metabolites. Experimental evidence that UGT1A1 is down-regulated in the human liver suggests that changes in the promoter may be responsible for the human-specific increase in bilirubin. We speculate that since cooking reduces toxic plant compounds, consumption of cooked foods, which is specific to humans, may have resulted in relaxed constraint on UGT1A1 which has in turn led to higher serum levels of bilirubin in humans.
Lineage-Specific Changes in Biomarkers in Great Apes and Humans
Ronke, Claudius; Dannemann, Michael; Halbwax, Michel; Fischer, Anne; Helmschrodt, Christin; Brügel, Mathias; André, Claudine; Atencia, Rebeca; Mugisha, Lawrence; Scholz, Markus; Ceglarek, Uta; Thiery, Joachim; Pääbo, Svante; Prüfer, Kay; Kelso, Janet
2015-01-01
Although human biomedical and physiological information is readily available, such information for great apes is limited. We analyzed clinical chemical biomarkers in serum samples from 277 wild- and captive-born great apes and from 312 healthy human volunteers as well as from 20 rhesus macaques. For each individual, we determined a maximum of 33 markers of heart, liver, kidney, thyroid and pancreas function, hemoglobin and lipid metabolism and one marker of inflammation. We identified biomarkers that show differences between humans and the great apes in their average level or activity. Using the rhesus macaques as an outgroup, we identified human-specific differences in the levels of bilirubin, cholinesterase and lactate dehydrogenase, and bonobo-specific differences in the level of apolipoprotein A-I. For the remaining twenty-nine biomarkers there was no evidence for lineage-specific differences. In fact, we find that many biomarkers show differences between individuals of the same species in different environments. Of the four lineage-specific biomarkers, only bilirubin showed no differences between wild- and captive-born great apes. We show that the major factor explaining the human-specific difference in bilirubin levels may be genetic. There are human-specific changes in the sequence of the promoter and the protein-coding sequence of uridine diphosphoglucuronosyltransferase 1 (UGT1A1), the enzyme that transforms bilirubin and toxic plant compounds into water-soluble, excretable metabolites. Experimental evidence that UGT1A1 is down-regulated in the human liver suggests that changes in the promoter may be responsible for the human-specific increase in bilirubin. We speculate that since cooking reduces toxic plant compounds, consumption of cooked foods, which is specific to humans, may have resulted in relaxed constraint on UGT1A1 which has in turn led to higher serum levels of bilirubin in humans. PMID:26247603
Puri, Basant K; Hakkarainen-Smith, Jaana S; Derham, Anne; Monro, Jean A
2015-09-01
While pharmacotherapy with intravenous ceftriaxone, a third-generation cephalosporin, is a potential treatment of Lyme neuroborreliosis, there is concern that it can cause the formation of biliary sludge, leading to hepatobiliary complications such as biliary colic, jaundice and cholelithiasis, which are reflected in changes in serum levels of bilirubin and markers of cholestatic liver injury (alkaline phosphatase and γ-glutamyltranspeptidase). It has been suggested that the naturally occurring substances α-lipoic acid and glutathione may be helpful in preventing hepatic disease. α-Lipoic acid exhibits antioxidant, anti-inflammatory and anti-apoptotic activities in the liver, while glutathione serves as a sulfhydryl buffer. The aim of this study was to determine whether co-administration of α-lipoic acid and glutathione is associated with significant changes in serum levels of bilirubin, alkaline phosphatase and γ-glutamyltranspeptidase during the treatment of Lyme neuroborreliosis with long-term intravenous ceftriaxone. Serum levels of bilirubin, alkaline phosphatase and γ-glutamyltranspeptidase were measured in 42 serologically positive Lyme neuroborreliosis patients before and after long-term treatment with intravenous ceftriaxone (2-4 g daily) with co-administration of oral/intravenous α-lipoic acid (600 mg daily) and glutathione (100 mg orally or 0.6-2.4 g intravenously daily). None of the patients developed biliary colic and there were no significant changes in serum bilirubin, alkaline phosphatase or γ-glutamyltranspeptidase levels over the course of the intravenous ceftriaxone treatment (mean length 75.0 days). Co-administration of α-lipoic acid and glutathione is associated with no significant changes in serum bilirubin, alkaline phosphatase or γ-glutamyltranspeptidase levels during the treatment of neuroborreliosis with intravenous ceftriaxone.
Goudarzvand, Laleh; Dabirian, Akram; Nourian, Manijeh; Jafarimanesh, Hadi; Ranjbaran, Mehdi
2017-11-27
One of the adjuvant and desirable therapies is skin contact between mother and baby or Kangaroo mother care (KMC) that is a cheap, accessible, relaxing, noninvasive and easy method. This study aimed to compare the effect of conventional phototherapy method and phototherapy along with KMC on cutaneous bilirubin in neonates with physiological jaundice. In this randomized clinical trial, all infants with physiological jaundice who referred for phototherapy to Mofid Hospital of Shahid Beheshti University of Medical Sciences, Tehran, Iran were selected by convenience sampling based on inclusion criteria and were randomly assigned into two groups of conventional phototherapy (n = 35) and phototherapy along with KMC (n = 35). The results showed that there was a significant difference in the average volume of skin bilirubin before treatment with cutaneous bilirubin every 24 h after treatment (p < .001). This significant difference was present in both intervention and control groups. Although the average volume of skin bilirubin every 24 h after treatment was lower in the intervention group than the control group, this difference was not statistically significant (p = .236). Mean duration of hospitalization of infants in the intervention group was significantly lower than the control group (2.09 versus 3.03 d, p < .001). Although KMC along with phototherapy has a favorable effect on the reduction of cutaneous bilirubin in neonates with physiological jaundice, there are not significant differences in routine care. This may need to do KMC for a longer time (more than 1 h) which must be surveyed in the future studies. KMC was effective in reduction of the duration of hospitalization in jaundiced infants.
Castro-García, Flor P; Corral-Jara, Karla F; Escobedo-Melendez, Griselda; Sandoval-Hernandez, Monserrat A; Rosenstein, Yvonne; Roman, Sonia; Panduro, Arturo; Fierro, Nora A
2014-12-01
Hepatitis A virus (HAV) infection is the major cause of acute liver failure in paediatric patients. The clinical spectrum of infection is variable, and liver injury is determined by altered hepatic enzyme function and bilirubin concentration. We recently reported differences in cytokine profiles between distinct HAV-induced clinical courses, and bilirubin has been recognized as a potential immune-modulator. However, how bilirubin may affect cytokine profiles underlying the variability in the course of infection has not been determined. Herein, we used a transcription factor (TF) binding site identification approach to retrospectively analyse cytokine expression in HAV-infected children and to predict the entire set of TFs associated with the expression of specific cytokine profiles. The results suggested that modulation of the activity of signal transducers and activators of transcription proteins (STATs) may play a central role during HAV infection. This led us to compare the degree of STAT phosphorylation in peripheral blood lymphoid cells (PBLCs) from paediatric patients with distinct levels of conjugated bilirubin (CB). Low CB levels in sera were associated with increased STAT-1 and STAT-5 phosphorylation. A positive correlation was observed between the serum interleukin-6 (IL-6) content and CB values, whereas higher levels of CB correlated with reduced serum IL-8 values and with a reduction in the proportion of PBLCs positive for STAT-5 phosphorylation. When CB was used to stimulate patients' PBLCs in vitro, the levels of IL-6 and tumour necrosis factor-α were increased. The data showed that bilirubin plays a role in STAT function and affects cytokine profile expression during HAV infection. © 2014 John Wiley & Sons Ltd.
Albumin Dialysis for Liver Failure: A Systematic Review.
Tsipotis, Evangelos; Shuja, Asim; Jaber, Bertrand L
2015-09-01
Albumin dialysis is the best-studied extracorporeal nonbiologic liver support system as a bridge or destination therapy for patients with liver failure awaiting liver transplantation or recovery of liver function. We performed a systematic review to examine the efficacy and safety of 3 albumin dialysis systems (molecular adsorbent recirculating system [MARS], fractionated plasma separation, adsorption and hemodialysis [Prometheus system], and single-pass albumin dialysis) in randomized trials for supportive treatment of liver failure. PubMed, Ovid, EMBASE, Cochrane's Library, and ClinicalTrials.gov were searched. Two authors independently screened citations and extracted data on patient characteristics, quality of reports, efficacy, and safety end points. Ten trials (7 of MARS and 3 of Prometheus) were identified (620 patients). By meta-analysis, albumin dialysis achieved a net decrease in serum total bilirubin level relative to standard medical therapy of 8.0 mg/dL (95% confidence interval [CI], -10.6 to -5.4) but not in serum ammonia or bile acids. Albumin dialysis achieved an improvement in hepatic encephalopathy relative to standard medical therapy with a risk ratio of 1.55 (95% CI, 1.16-2.08) but had no effect survival with a risk ratio of 0.95 (95% CI, 0.84-1.07). Because of inconsistency in the reporting of adverse events, the safety analysis was limited but did not demonstrate major safety concerns. Use of albumin dialysis as supportive treatment for liver failure is successful at removing albumin-bound molecules, such as bilirubin and at improving hepatic encephalopathy. Additional experience is required to guide its optimal use and address safety concerns. Copyright © 2015 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.
Mitchell, P C; Pygall, C F
1979-08-01
Reactions of molybdenum-sulphur compounds with cyanide are reported which may be relevant to (1) the chemical evolution of molybdoenzymes and (2) deactivation of molybdoenzymes by cyanide. (1) With aqueous cyanide MoS2 gave thio-bridged complex anions [(Mo(CN)6)2(mu-S)]6- and [(Mo(CN)4(mu-S))2]6-. Under prebiotic conditions such complexes could have been formed similarly from molybdenite and may have been precursors of molybdoenzymes. (2) Only those compounds which contained terminal sulphur bound to molybdenum (i.e., Mo = S groups), viz. oxothiomolybdates and the complex [(Mo(mu-S)(S)(Et2NCS2))2], reacted with cyanide; thiocyanate was formed and the molybdenum underwent two-electron reduction. That the cyanolysable sulphur of xanthine oxidase reacts in the same way with cyanide suggests the presence of a Mo = S group which could be a structural feature of the enzyme or could have been formed by initial cyanolysis of a bound persulphide or cysteine residue.
Microheterogeneity in Purified Broad Bean Polyphenol Oxidase
Ganesa, Chandrashekar; Fox, Mary T.; Flurkey, William H.
1992-01-01
Polyphenoloxidase was purified from chloroplasts of broad bean leaves (Vicia faba L.) to apparent homogeneity. The enzyme was composed of two proteins with an apparent mass of 65 and 68 kilodaltons after sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The isolated enzyme contained covalently attached carbohydrates and bound concanavalin A, Phaseolus vulgaris erythroagglutinin, and Ricinus communis agglutinin lectins. Under native isoelectric focusing, several charged isoforms were present in the pH range of 4 to 6. Many, if not all, of the isoforms separated by isoelectric focusing were glycosylated and bound concanavalin A. All these isoforms shared a 65 kilodalton protein in common, and some of the isoforms were associated with both a 65 and 68 kilodalton protein. Isoforms separated by isoelectric focusing in the presence of 9 molar urea followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis showed a similar pattern of proteins within a slightly higher pH range from 5 to 6.5. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6 PMID:16668664
... causes your skin and the whites of your eyes to turn yellow. Too much bilirubin causes jaundice. Bilirubin is a yellow chemical in hemoglobin, the substance that carries oxygen in your red blood cells. As red blood cells break down, your body builds new cells to replace them. The old ones are ...
NASA Astrophysics Data System (ADS)
Plavskii, V. Yu.; Mikulich, A. V.; Leusenko, I. A.; Tretyakova, A. I.; Plavskaya, L. G.; Serdyuchenko, N. S.; Gao, J.; Xiong, D.; Wu, X.
2017-03-01
The effectiveness of phototherapy for hyperbilirubinemia of newborns using narrowband LED sources was found to depend not only on the position of the LED emission spectrum peak within the absorption band of bilirubin but also on the width of the incident radiation spectrum. Extension of the spectral range of radiation by adding a green component with λmax ≈ 505 nm to the blue light band with λmax ≈ 462 nm (provided equal integrated power density) gives a more efficient decrease in the total bilirubin level in the blood of newborns. This effect was attributed to heterogeneity of the spectral characteristics of bilirubin in different microenvironments as well as dependence of the optimal wavelength for photoisomerization of the pigment on the depth of the blood vessels where the bilirubin phototransformation reactions occur. Moreover, extension of the spectral range of the incident radiation by adding a green component increases the irradiated volumes of blood where the photoisomerization reactions with a high lumirubin quantum yield underlying this phototherapy are initiated.
Laser Transcutaneous Bilirubin Meter: A New Device For Bilirubin Monitoring In Neonatal Jaundice
NASA Astrophysics Data System (ADS)
Hamza, Mostafa; Hamza, Mohammad
1988-06-01
Neonates with jaundice require monitoring of serum bilirubin which should be repeated at frequent intervals. However, taking blood samples from neonates is not always an easy job, plus being an invasive and traumatising procedure with the additional risk of blood loss. In this paper the authors present the theory and design of a new noninvasive device for transcutaneous bilirubinometry, using a differential absorption laser system. The new technique depends upon illuminating the skin of the neonate with radiation from a two wave-length oscillation laser. The choice of the wavelengths follows the principles of optical bilirubinometry. For obtaining more accurate measurements, different pairs of two wave-lengths are incorporated in the design. The presence of hemoglobin is corrected for by appropriate selection of the laser wavelengths. The new design was tested for accuracy and precision using an argon ion laser. Correlation study between serum bilirubin determination by laser transcutaneous bilirubinometry and by American optical bilirubinometer was highly significant.
Phototherapy of the newborn: a predictive model for the outcome.
Ossamu Osaku, Nelson; Silverio Lopes, Heitor
2005-01-01
Jaundice in one of the most common problems of the newborn. In most cases, jaundice is considered a physiological transient situation, but sometimes it can lead to death or serious injuries for the survivors. For decades, phototherapy has been used as the main method for prevention and treatment of hyperbilirubinaemia of the newborn. This work aims at finding a predictive model for the decrement of blood bilirubin followed conventional phototherapy. Data from 90 patients were collected and used in the multiple regression method. A rigorous statistical analysis was done in order to guarantee a correct and valid model. The obtained model was able to explain 78% of the variation of the dependent variable We found that it is possible to predict the total sugar bilirubin of the patient under phototherapy by knowing its birth weight, bilirubin level at the beginning of treatment, duration of exposition, and irradiance. Besides, it is possible to infer the time necessary for a given decrement of bilirubin, under approximately constant irradiance.
Chandran, Prasheeda; Garg, Pradeep; Pundir, Chandra S
2005-07-01
Total cholesterol, total bilirubin, calcium, oxalate, inorganic phosphate, magnesium, iron, copper, sodium and potassium were analyzed quantitatively in gallstones, bile of gall bladder and sera of 200 patients of cholelithiasis (52 cholesterol, 76 mixed and 72 pigment stone patients) and their contents were correlated between calculi and bile and sera and bile in these three type of stone patients. A significant positive correlation was observed between total cholesterol, total bilirubin of calculi and bile, copper of bile and sera of cholesterol stone patients, copper of calculi and bile, total bilirubin, oxalate, magnesium, potassium of sera and bile of pigment stone patients and oxalate and iron of stone and bile, total bilirubin, oxalate, sodium of sera and bile of mixed stone patients. A significant negative correlation was found between magnesium of serum and bile of cholesterol stone patients, oxalate of calculi and bile of pigment stone patients and magnesium of serum and bile of mixed stone patients.
Bilgen, H; Ince, Z; Ozek, E; Bekiroglu, N; Ors, R
1998-12-01
The effectiveness of two different non-invasive transcutaneous bilirubin measurement devices was compared with serum bilirubin levels in 96 healthy newborns. Transcutaneous measurements were obtained with the Minolta Air Shields jaundice meter and the Ingram icterometer and serum bilirubin levels were determined by a direct spectrophotometric method (Bilitron 444). A linear correlation existed between serum bilirubin values and the readings on both the Minolta jaundice meter (r = 0.83) and the Ingram icterometer (r = 0.78). The Kappa coefficient was 0.66. the sensitivity, specificity and positive and negative predictive values were 100%, 56%, 33% and 100% for the Minolta jaundice meter and 100%, 48%, 29% and 100% for the Ingram icterometer, respectively. The high sensitivity and negative predictive value of both devices render them suitable for screening neonatal hyperbilirubinaemia. However, because of its low cost, the Ingram icterometer is preferable to the more complex and expensive Minolta jaundice meter, especially in countries with a high birth rate, such as Turkey.
Fujiwara, Ryoichi; Maruo, Yoshihiro; Chen, Shujuan; Tukey, Robert H
2015-11-15
Newborns commonly develop physiological hyperbilirubinemia (also known as jaundice). With increased bilirubin levels being observed in breast-fed infants, breast-feeding has been recognized as a contributing factor for the development of neonatal hyperbilirubinemia. Bilirubin undergoes selective metabolism by UDP-glucuronosyltransferase (UGT) 1A1 and becomes a water soluble glucuronide. Although several factors such as gestational age, dehydration and weight loss, and increased enterohepatic circulation have been associated with breast milk-induced jaundice (BMJ), deficiency in UGT1A1 expression is a known cause of BMJ. It is currently believed that unconjugated bilirubin is metabolized mainly in the liver. However, recent findings support the concept that extrahepatic tissues, such as small intestine and skin, contribute to bilirubin glucuronidation during the neonatal period. We will review the recent advances made towards understanding biological and molecular events impacting BMJ, especially regarding the role of extrahepatic UGT1A1 expression. Copyright © 2015 Elsevier Inc. All rights reserved.
Fujiwara, Ryoichi; Maruo, Yoshihiro; Chen, Shujuan; Tukey, Robert H.
2015-01-01
Newborns commonly develop physiological hyperbilirubinemia (also known as jaundice). With increased bilirubin levels being observed in breast-fed infants, breast-feeding has been recognized as a contributing factor for the development of neonatal hyperbilirubinemia. Bilirubin undergoes selective metabolism by UDP-glucuronosyltransferase (UGT) 1A1 and becomes a water soluble glucuronide. Although several factors such as gestational age, dehydration and weight loss, and increased enterohepatic circulation have been associated with breast milk-induced jaundice (BMJ), deficiency in UGT1A1 expression is a known cause of BMJ. It is currently believed that unconjugated bilirubin is metabolized mainly in the liver. However, recent findings support the concept that extrahepatic tissues, such as small intestine and skin, contribute to bilirubin glucuronidation during the neonatal period. We will review the recent advances made towards understanding biological and molecular events impacting BMJ, especially regarding the role of extrahepatic UGT1A1 expression. PMID:26342858
Kleiner, Oleg; Ramesh, Jagannathan; Huleihel, Mahmoud; Cohen, Beny; Kantarovich, Keren; Levi, Chen; Polyak, Boris; Marks, Robert S; Mordehai, Jacov; Cohen, Zahavi; Mordechai, Shaul
2002-01-01
Background Cholelithiasis is the gallstone disease (GSD) where stones are formed in the gallbladder. The main function of the gallbladder is to concentrate bile by the absorption of water and sodium. GSD has high prevalence among elderly adults. There are three major types of gallstones found in patients, White, Black and Brown. The major chemical component of white stones is cholesterol. Black and brown stones contain different proportions of cholesterol and bilirubin. The pathogenesis of gallstones is not clearly understood. Analysis of the chemical composition of gallstones using various spectroscopic techniques offers clues to the pathogenesis of gallstones. Recent years has seen an increasing trend in the number of cases involving children. The focus of this study is on the analysis of the chemical composition of gallstones from child and adult patients using spectroscopic methods. Methods In this report, we present FTIR spectroscopic studies and fluorescence microscopic analysis of gallstones obtained from 67 adult and 21 child patients. The gallstones were removed during surgical operations at Soroka University Medical Center. Results Our results show that black stones from adults and children are rich in bilirubin. Brown stones are composed of varying amounts of bilirubin and cholesterol. Green stones removed from an adult, which is rare, was found to be composed mainly of cholesterol. Our results also indicated that cholesterol and bilirubin could be the risk factors for gallstone formation in adults and children respectively. Fluorescence micrographs showed that the Ca-bilirubinate was present in all stones in different quantities and however, Cu-bilirubinate was present only in the mixed and black stones. Conclusions Analysis based on FTIR suggest that the composition of black and brown stones from both children and adults are similar. Various layers of the brown stone from adults differ by having varying quantities of cholesterol and calcium carbonate. Ring patterns observed mainly in the green stone using fluorescence microscopy have relevance to the mechanism of the stone formation. Our preliminary study suggests that bilirubin and cholesterol are the main risk factors of gallstone disease. PMID:11872150
A hybrid DNA-templated gold nanocluster for enhanced enzymatic reduction of oxygen
Chakraborty, Saumen; Babanova, Sofia; Rocha, Reginaldo C.; ...
2015-08-19
We report the synthesis and characterization of a new DNA-templated gold nanocluster (AuNC) of ~1 nm in diameter and possessing ~7 Au atoms. When integrated with bilirubin oxidase (BOD) and single walled carbon nanotubes (SWNTs), the AuNC acts as an enhancer of electron transfer (ET) and lowers the overpotential of electrocatalytic oxygen reduction reaction (ORR) by ~15 mV as compared to the enzyme alone. In addition, the presence of AuNC causes significant enhancements in the electrocatalytic current densities at the electrode. Control experiments show that such enhancement of ORR by the AuNC is specific to nanoclusters and not to plasmonicmore » gold particles. Rotating ring disk electrode (RRDE) measurements confirm 4e– reduction of O 2 to H 2O with minimal production of H 2O 2, suggesting that the presence of AuNC does not perturb the mechanism of ORR catalyzed by the enzyme. This unique role of the AuNC as enhancer of ET at the enzyme-electrode interface makes it a potential candidate for the development of cathodes in enzymatic fuel cells, which often suffer from poor electronic communication between the electrode surface and the enzyme active site. In conclusion, the AuNC displays phosphorescence with large Stokes shift and microsecond lifetime.« less
Highly Selective and Sensitive Self-Powered Glucose Sensor Based on Capacitor Circuit.
Slaughter, Gymama; Kulkarni, Tanmay
2017-05-03
Enzymatic glucose biosensors are being developed to incorporate nanoscale materials with the biological recognition elements to assist in the rapid and sensitive detection of glucose. Here we present a highly sensitive and selective glucose sensor based on capacitor circuit that is capable of selectively sensing glucose while simultaneously powering a small microelectronic device. Multi-walled carbon nanotubes (MWCNTs) is chemically modified with pyrroloquinoline quinone glucose dehydrogenase (PQQ-GDH) and bilirubin oxidase (BOD) at anode and cathode, respectively, in the biofuel cell arrangement. The input voltage (as low as 0.25 V) from the biofuel cell is converted to a stepped-up power and charged to the capacitor to the voltage of 1.8 V. The frequency of the charge/discharge cycle of the capacitor corresponded to the oxidation of glucose. The biofuel cell structure-based glucose sensor synergizes the advantages of both the glucose biosensor and biofuel cell. In addition, this glucose sensor favored a very high selectivity towards glucose in the presence of competing and non-competing analytes. It exhibited unprecedented sensitivity of 37.66 Hz/mM.cm 2 and a linear range of 1 to 20 mM. This innovative self-powered glucose sensor opens new doors for implementation of biofuel cells and capacitor circuits for medical diagnosis and powering therapeutic devices.
Regression approach to non-invasive determination of bilirubin in neonatal blood
NASA Astrophysics Data System (ADS)
Lysenko, S. A.; Kugeiko, M. M.
2012-07-01
A statistical ensemble of structural and biophysical parameters of neonatal skin was modeled based on experimental data. Diffuse scattering coefficients of the skin in the visible and infrared regions were calculated by applying a Monte-Carlo method to each realization of the ensemble. The potential accuracy of recovering the bilirubin concentration in dermis (which correlates closely with that in blood) was estimated from spatially resolved spectrometric measurements of diffuse scattering. The possibility to determine noninvasively the bilirubin concentration was shown by measurements of diffuse scattering at λ = 460, 500, and 660 nm at three source-detector separations under conditions of total variability of the skin biophysical parameters.
Solar Irradiation of Bilirubin: An Experiment in Photochemical Oxidation
ERIC Educational Resources Information Center
Pillay A. E.; Salih, F. M.
2006-01-01
An experiment in photochemical oxidation, which deals with bilirubin, a well-known light-sensitive biological compound that is pedagogically ideal for photochemical experiments at tertiary institutes, is presented. The experiment would benefit students in chemistry who eventually branch out into the health sciences or biochemistry.
Oxygen-17 and molybdenum-95 coupling in spectroscopic models of molybdoenzymes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilson, G.L.; Kony, M.; Tiekink, E.R.
1988-09-28
Assignment of (Mo/sup V/OS) and cis-(Mo/sup V/O(SH)) centers in active xanthine oxidase (very rapid and rapid ESR signals) are supported by generation of these species in solution. The ESR parameters were measured using /sup 17/O and /sup 95/Mo and are reported herein. The data revealed variations in relative magnitudes of the hyperfine components, and the different patterns of angles reflect significant differences in electronic structure. The same electronic differences appear to be responsible for the variations in magnitude and anisotropy of the /sup 17/O coupling, assigned to bound product Mo-/sup 17/OR in both enzyme signals.
Comparing the effect of clofibrate and phenobarbital on the newborns with hyperbilirubinemia
Hamidi, Majid; Zamanzad, Behnam; Mesripour, Azadeh
2013-01-01
The aim of treating hyperbilirubinemia is preventing the serum bilirubin to reach neurotoxic levels, which is done by phototherapy or blood transfusion. However, pharmacological treatments still remain vague. Therefore the effects of adding either clofibrate or phenobarbital on treatment outcomes was evaluated in icteric non-hemolitic newborns. Ninety neonates were divided in three groups. Two groups were prescribed 100 mg/kg clofibrate or 5 mg/kg phenobarbital orally as single dose on arrival, in addition to phototherapy. The control group only received phototherapy. Serum bilirubin was evaluated at the reception and 12, 24, 48 and 72 hours after beginning of drug therapy. Total bilirubin levels decreased in treated groups compared with the control group in all samples taken (12, 24, 48 and 72 hours). Clofibrate effect in decreasing bilirubin level was more prominent (14 % and 32 % after 12 and 72 h respectively). In addition duration of hospitalization and length of phototherapy decreased in clofibrate and phenobarbital groups compared with control group (1.5, 2 days respectively, vs. 2.6 days). Therefore using clofibrate and phenobarbital in icteric neonates are supportive not only by decreasing the serum bilirubin level, but also by lessening the duration of hospitalization and phototherapy. Thus in addition to cost benefits for the patient these drugs can reduce the risks of transfusion, and clofibrate seems more promising in this regard. PMID:26417217
Evaluation of BiliCare™ transcutaneous bilirubin device in Japanese newborns.
Yamana, Keiji; Morioka, Ichiro; Kurokawa, Daisuke; Fukushima, Sachiyo; Nishida, Kosuke; Ohyama, Shohei; Nishimura, Noriyuki; Nozu, Kandai; Taniguchi-Ikeda, Mariko; Nagase, Hiroaki; Fujioka, Kazumichi; Iwatani, Sota; Nakamura, Hajime; Iijima, Kazumoto
2017-10-01
Non-invasive transcutaneous bilirubin (TcB) monitoring has been widely used to screen for hyperbilirubinemia. TcB measured using the recently developed BiliCare™ system, however, has not been fully evaluated. One hundred and seven TcB measurements were obtained from 82 Japanese newborns ≥35 weeks' gestational age within 2 weeks after birth. Measurements were taken at the scaphoid fossa, conchal cavity, and lobe of the ear using BiliCare. BiliCare TcB were compared with total serum bilirubin (TB) and TcB obtained using another bilirubinometer (JM-105™). Transcutaneous bilirubin measured at all three sites significantly correlated with TB (r = 0.91, 0.93, and 0.93 at the scaphoid fossa, conchal cavity, and lobe, respectively). The mean differences were 0.1, -0.3, and 3.6 at the scaphoid fossa, conchal cavity, and lobe, respectively. BiliCare TcB at the scaphoid fossa significantly correlated with that using the JM-105 (r = 0.91). The mean difference was 0.0. BiliCare, however, produced a significantly higher and lower TcB than the JM-105 for TB <7 and ≥15 mg/dL, respectively. Transcutaneous bilirubin measurements taken at the scaphoid fossa or conchal cavity using BiliCare were more reliable than those at the earlobe. BiliCare TcB differed from those of the JM-105, for TB <7 or ≥15 mg/dL. © 2017 Japan Pediatric Society.
Carboxyhemoglobin - the forgotten parameter of neonatal hyperbilirubinemia.
Bailey, Douggl G N; Fuchs, Hans; Hentschel, Roland
2017-07-26
Neonatal hyperbilirubinemia is influenced by a wide variety of factors, one of which is hemolysis. Serious hyperbilirubinemia may lead to a kernicterus with detrimental neurologic sequelae. Patients suffering from hemolytic disease have a higher risk of developing kernicterus. Carbon monoxide (CO), a byproduct of hemolysis or heme degradation, was described by Sjöstrand in the 1960s. It is transported as carboxyhemoglobin (COHb) and exhaled through the lungs. We were interested in a potential correlation between COHb and total serum bilirubin (TSB) and the time course of both parameters. We used a point of care (POC) blood gas analyzer and did a retrospective analysis of bilirubin and COHb data collected over a 60-day period. An arbitrary cut-off point set at 2% COHb identified four patients with hemolytic disease of different origins who required phototherapy. In one patient with atypical hemolytic uremic syndrome (aHUS), COHb preceded the rise in bilirubin by about 2 days. Despite this displacement, there was a moderately good correlation of COHb with TSB levels <15 mg/dL (257 μmol/L) (r2: 0.80) and direct bilirubin (r2: 0.78) in the first patient. For all the four patients and all time points the correlation was slightly lower (r2: 0.59). COHb might be useful as a marker for high hemoglobin turnover to allow an earlier identification of newborns at risk to a rapid rise in bilirubin.
Point-of-care device to diagnose and monitor neonatal jaundice in low-resource settings
Keahey, Pelham A.; Simeral, Mathieu L.; Schroder, Kristofer J.; Bond, Meaghan M.; Mtenthaonnga, Prince J.; Miros, Robert H.; Dube, Queen
2017-01-01
Newborns are at increased risk of jaundice, a condition in which excess bilirubin accumulates in blood. Left untreated, jaundice can lead to neurological impairment and death. Jaundice resulting from unconjugated hyperbilirubinemia is easily treated with exposure to blue light, and phototherapy systems have been developed for low-resource settings; however, there are no appropriate solutions to diagnose and monitor jaundice in these settings. To address this need we present BiliSpec, a low-cost reader and disposable lateral flow card designed to measure the concentration of total bilirubin from several drops of blood at the point of care. We evaluated the performance of BiliSpec, using blood from normal volunteers spiked with varying amounts of bilirubin; results measured using BiliSpec correlated well with a reference laboratory bilirubinometer (r = 0.996). We then performed a pilot clinical study using BiliSpec to measure total bilirubin in neonates at risk for jaundice at Queen Elizabeth Central Hospital in Blantyre, Malawi. Concentrations measured using BiliSpec correlated well with those measured using a laboratory reference standard in 94 patient samples ranging from 1.1 mg/dL to 23.0 mg/dL in concentration (r = 0.973). The mean difference between bilirubin levels measured with BiliSpec and the reference standard was 0.3 mg/dL (95% CI: −1.7–2.2 mg/dL). PMID:29203650
Nanofibrous polymeric beads from aramid fibers for efficient bilirubin removal.
Peng, Zihang; Yang, Ye; Luo, Jiyue; Nie, Chuanxiong; Ma, Lang; Cheng, Chong; Zhao, Changsheng
2016-08-16
Polymer based hemoperfusion has been developed as an effective therapy to remove the extra bilirubin from patients. However, the currently applied materials suffer from either low removal efficiency or poor blood compatibility. In this study, we report the development of a new class of nanofibrous absorbent that exhibited high bilirubin removal efficiency and good blood compatibility. The Kevlar nanofiber was prepared by dissolving micron-sized Kevlar fiber in proper solvent, and the beads were prepared by dropping Kevlar nanofiber solutions into ethanol. Owing to the nanofiborous structure of the Kevlar nanofiber, the beads displayed porous structures and large specific areas, which would facilitate the adsorption of toxins. In the adsorption test, it was noticed that the beads possessed an adsorption capacity higher than 40 mg g(-1) towards bilirubin. In plasma mimetic solutions, the beads still showed high bilirubin removal efficiency. Furthermore, after incorporating with carbon nanotubes, the beads were found to have increased adsorption capacity for human degradation waste. Moreover, the beads showed excellent blood compatibility in terms of a low hemolysis ratio, prolonged clotting times, suppressed coagulant activation, limited platelet activation, and inhibited blood related inflammatory activation. Additionally, the beads showed good compatibility with endothelial cells. In general, the Kevlar nanofiber beads, which integrated with high adsorption capacity, good blood compatibility and low cytotoxicity, may have great potential for hemoperfusion and some other applications in biomedical fields.
Molecular Dynamic Studies of the Complex Polyethylenimine and Glucose Oxidase.
Szefler, Beata; Diudea, Mircea V; Putz, Mihai V; Grudzinski, Ireneusz P
2016-10-27
Glucose oxidase (GOx) is an enzyme produced by Aspergillus, Penicillium and other fungi species. It catalyzes the oxidation of β-d-glucose (by the molecular oxygen or other molecules, like quinones, in a higher oxidation state) to form d-glucono-1,5-lactone, which hydrolyses spontaneously to produce gluconic acid. A coproduct of this enzymatic reaction is hydrogen peroxide (H₂O₂). GOx has found several commercial applications in chemical and pharmaceutical industries including novel biosensors that use the immobilized enzyme on different nanomaterials and/or polymers such as polyethylenimine (PEI). The problem of GOx immobilization on PEI is retaining the enzyme native activity despite its immobilization onto the polymer surface. Therefore, the molecular dynamic (MD) study of the PEI ligand (C14N8_07_B22) and the GOx enzyme (3QVR) was performed to examine the final complex PEI-GOx stabilization and the affinity of the PEI ligand to the docking sites of the GOx enzyme. The docking procedure showed two places/regions of major interaction of the protein with the polymer PEI: (LIG1) of -5.8 kcal/mol and (LIG2) of -4.5 kcal/mol located inside the enzyme and on its surface, respectively. The values of enthalpy for the PEI-enzyme complex, located inside of the protein (LIG1) and on its surface (LIG2) were computed. Docking also discovered domains of the GOx protein that exhibit no interactions with the ligand or have even repulsive characteristics. The structural data clearly indicate some differences in the ligand PEI behavior bound at the two places/regions of glucose oxidase.
Energetics of Respiration and Oxidative Phosphorylation in Mycobacteria.
Cook, Gregory M; Hards, Kiel; Vilchèze, Catherine; Hartman, Travis; Berney, Michael
2014-06-01
Mycobacteria inhabit a wide range of intracellular and extracellular environments. Many of these environments are highly dynamic and therefore mycobacteria are faced with the constant challenge of redirecting their metabolic activity to be commensurate with either replicative growth or a non-replicative quiescence. A fundamental feature in this adaptation is the ability of mycobacteria to respire, regenerate reducing equivalents and generate ATP via oxidative phosphorylation. Mycobacteria harbor multiple primary dehydrogenases to fuel the electron transport chain and two terminal respiratory oxidases, an aa3 -type cytochrome c oxidase and cytochrome bd-type menaquinol oxidase, are present for dioxygen reduction coupled to the generation of a protonmotive force. Hypoxia leads to the downregulation of key respiratory complexes, but the molecular mechanisms regulating this expression are unknown. Despite being obligate aerobes, mycobacteria have the ability to metabolize in the absence of oxygen and a number of reductases are present to facilitate the turnover of reducing equivalents under these conditions (e.g. nitrate reductase, succinate dehydrogenase/fumarate reductase). Hydrogenases and ferredoxins are also present in the genomes of mycobacteria suggesting the ability of these bacteria to adapt to an anaerobic-type of metabolism in the absence of oxygen. ATP synthesis by the membrane-bound F1FO-ATP synthase is essential for growing and non-growing mycobacteria and the enzyme is able to function over a wide range of protonmotive force values (aerobic to hypoxic). The discovery of lead compounds that target respiration and oxidative phosphorylation in Mycobacterium tuberculosis highlights the importance of this area for the generation of new front line drugs to combat tuberculosis.
NASA Astrophysics Data System (ADS)
Zhou, Mowei; Yan, Jing; Romano, Christine A.; Tebo, Bradley M.; Wysocki, Vicki H.; Paša-Tolić, Ljiljana
2018-01-01
Manganese oxidation is an important biogeochemical process that is largely regulated by bacteria through enzymatic reactions. However, the detailed mechanism is poorly understood due to challenges in isolating and characterizing these unknown enzymes. A manganese oxidase, Mnx, from Bacillus sp. PL-12 has been successfully overexpressed in active form as a protein complex with a molecular mass of 211 kDa. We have recently used surface induced dissociation (SID) and ion mobility-mass spectrometry (IM-MS) to release and detect folded subcomplexes for determining subunit connectivity and quaternary structure. The data from the native mass spectrometry experiments led to a plausible structural model of this multicopper oxidase, which has been difficult to study by conventional structural biology methods. It was also revealed that each Mnx subunit binds a variable number of copper ions. Becasue of the heterogeneity of the protein and limited mass resolution, ambiguities in assigning some of the observed peaks remained as a barrier to fully understanding the role of metals and potential unknown ligands in Mnx. In this study, we performed SID in a modified Fourier transform-ion cyclotron resonance (FTICR) mass spectrometer. The high mass accuracy and resolution offered by FTICR unveiled unexpected artificial modifications on the protein that had been previously thought to be iron bound species based on lower resolution spectra. Additionally, isotopically resolved spectra of the released subcomplexes revealed the metal binding stoichiometry at different structural levels. This method holds great potential for in-depth characterization of metalloproteins and protein-ligand complexes. [Figure not available: see fulltext.
Ma, Ming-Ming; Gao, Min; Guo, Kai-Min; Wang, Mi; Li, Xiang-Yu; Zeng, Xue-Lin; Sun, Lu; Lv, Xiao-Fei; Du, Yan-Hua; Wang, Guan-Lei; Zhou, Jia-Guo; Guan, Yong-Yuan
2017-05-01
Ca 2+ -activated Cl - channels play a crucial role in various physiological processes. However, the role of TMEM16A in vascular endothelial dysfunction during hypertension is unclear. In this study, we investigated the specific involvement of TMEM16A in regulating endothelial function and blood pressure and the underlying mechanism. Reverse transcription-polymerase chain reaction, Western blotting, coimmunoprecipitation, confocal imaging, patch-clamp recordings, and TMEM16A endothelial-specific transgenic and knockout mice were used. We found that TMEM16A was expressed abundantly and functioned as a Ca 2+ -activated Cl - channel in endothelial cells. Angiotensin II induced endothelial dysfunction with an increase in TMEM16A expression. The knockout of endothelial-specific TMEM16A significantly lowered the blood pressure and ameliorated endothelial dysfunction in angiotensin II-induced hypertension, whereas the overexpression of endothelial-specific TMEM16A resulted in the opposite effects. These results were related to the increased reactive oxygen species production, Nox2-containing NADPH oxidase activation, and Nox2 and p22phox protein expression that were facilitated by TMEM16A on angiotensin II-induced hypertensive challenge. Moreover, TMEM16A directly bound with Nox2 and reduced the degradation of Nox2 through the proteasome-dependent degradation pathway. Therefore, TMEM16A is a positive regulator of endothelial reactive oxygen species generation via Nox2-containing NADPH oxidase, which induces endothelial dysfunction and hypertension. Modification of TMEM16A may be a novel therapeutic strategy for endothelial dysfunction-associated diseases. © 2017 American Heart Association, Inc.
White, Phillipa C.; Milward, Michael R.; Cooper, Paul R.
2017-01-01
ABSTRACT Oral bacteria are the main trigger for the development of periodontitis, and some species are known to modulate neutrophil function. This study aimed to explore the release of neutrophil extracellular traps (NETs), associated antimicrobial proteins, and reactive oxygen species (ROS) in response to periodontal bacteria, as well as the underlying pathways. Isolated peripheral blood neutrophils were stimulated with 19 periodontal bacteria. NET and ROS release, as well as the expression of NET-bound antimicrobial proteins, elastase, myeloperoxidase, and cathepsin G, in response to these species was measured using fluorescence-based assays. NET and ROS release was monitored after the addition of NADP (NADPH) oxidase pathway modulators and inhibitors of Toll-like receptors (TLRs). Moreover, bacterial entrapment by NETs was visualized microscopically, and bacterial killing was assessed by bacterial culture. Certain microorganisms, e.g., Veillonella parvula and Streptococcus gordonii, stimulated higher levels of ROS and NET release than others. NETs were found to entrap, but not kill, all periodontal bacteria tested. NADPH oxidase pathway modulators decreased ROS production but not NET production in response to the bacteria. Interestingly, TLR inhibitors did not impact ROS and NET release. These data suggest that the variability in the neutrophil response toward different bacteria may contribute to the pathogenesis of periodontal diseases by mechanisms such as bacterial avoidance of host responses and activation of neutrophils. Moreover, our results indicate that bacterium-stimulated NET release may arise in part via NADPH oxidase-independent mechanisms. The role of TLR signaling in bacterium-induced ROS and NET release needs to be further elucidated. PMID:28947649
Hirschfeld, Josefine; White, Phillipa C; Milward, Michael R; Cooper, Paul R; Chapple, Iain L C
2017-12-01
Oral bacteria are the main trigger for the development of periodontitis, and some species are known to modulate neutrophil function. This study aimed to explore the release of neutrophil extracellular traps (NETs), associated antimicrobial proteins, and reactive oxygen species (ROS) in response to periodontal bacteria, as well as the underlying pathways. Isolated peripheral blood neutrophils were stimulated with 19 periodontal bacteria. NET and ROS release, as well as the expression of NET-bound antimicrobial proteins, elastase, myeloperoxidase, and cathepsin G, in response to these species was measured using fluorescence-based assays. NET and ROS release was monitored after the addition of NADP (NADPH) oxidase pathway modulators and inhibitors of Toll-like receptors (TLRs). Moreover, bacterial entrapment by NETs was visualized microscopically, and bacterial killing was assessed by bacterial culture. Certain microorganisms, e.g., Veillonella parvula and Streptococcus gordonii , stimulated higher levels of ROS and NET release than others. NETs were found to entrap, but not kill, all periodontal bacteria tested. NADPH oxidase pathway modulators decreased ROS production but not NET production in response to the bacteria. Interestingly, TLR inhibitors did not impact ROS and NET release. These data suggest that the variability in the neutrophil response toward different bacteria may contribute to the pathogenesis of periodontal diseases by mechanisms such as bacterial avoidance of host responses and activation of neutrophils. Moreover, our results indicate that bacterium-stimulated NET release may arise in part via NADPH oxidase-independent mechanisms. The role of TLR signaling in bacterium-induced ROS and NET release needs to be further elucidated. Copyright © 2017 American Society for Microbiology.
NASA Astrophysics Data System (ADS)
King, Angela G.
2009-08-01
Recent "firsts" in chemical research: image of a viral capsid pinpointing 5 million atoms; isolation and identification of an "animal" pigment, bilirubin, from a plant source; evidence that humans make salicylic acid.
21 CFR 862.1110 - Bilirubin (total or direct) test system.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Bilirubin (total or direct) test system. 862.1110 Section 862.1110 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test...
21 CFR 862.1110 - Bilirubin (total or direct) test system.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Bilirubin (total or direct) test system. 862.1110 Section 862.1110 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test...
21 CFR 862.1110 - Bilirubin (total or direct) test system.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Bilirubin (total or direct) test system. 862.1110 Section 862.1110 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test...
Can Excess Bilirubin Levels Cause Learning Difficulties?
ERIC Educational Resources Information Center
Pretorius, E.; Naude, H.; Becker, P. J.
2002-01-01
Examined learning problems in South African sample of 7- to 14-year-olds whose mothers reported excessively high infant bilirubin shortly after the child's birth. Found that this sample had lowered verbal ability with the majority also showing impaired short-term and long-term memory. Findings suggested that impaired formation of astrocytes…
Metalloporphyrins for treatment of unconjugated hyperbilirubinemia in neonates.
Suresh, G K; Martin, C L; Soll, R F
2003-01-01
Metalloporphyrins are heme analogues that inhibit heme oxygenase, the rate-limiting enzyme in the catabolism of heme to bilirubin. By preventing the formation of bilirubin, they have the potential to reduce the level of unconjugated bilirubin in neonates and thereby reduce the risk of neonatal encephalopathy and long term neurodevelopmental impairment from bilirubin toxicity to the nervous system. 1. To determine the efficacy of metalloporphyrins in reducing bilirubin levels, reducing the need for phototherapy or exchange transfusion and reducing the incidence of bilirubin encephalopathy in neonates with unconjugated hyperbilirubinemia when compared to placebo, phototherapy or exchange transfusion. 2. To determine the nature and frequency of side effects of metalloporphyrins when used to treat unconjugated hyperbilirubinemia in neonates. We searched Medline (1966 - January 2003) and the Cochrane Controlled Trials Register (CCTR) from the Cochrane Library (2003, issue 1). We hand-searched the articles cited in each publication obtained. We hand searched the abstracts of the Society for Pediatric Research (USA) (published in Pediatric Research) for the years 1985 - 2002. We included only randomized controlled studies, in which preterm or term neonates (age 28 days of life or less) with unconjugated hyperbilirubinemia due to any cause were randomly allocated to receive a metalloporphyrin in the treatment arm(s), and to receive a placebo or a conventional treatment (phototherapy or exchange transfusion) or no treatment for hyperbilirubinemia in the comparison arm(s). Any preparation of metalloporphyrin could be used, in any form, by any route, at any dose. Two authors extracted data independently. Data were entered into Revman by one author and checked by a second author. Prespecified subgroup analyses were planned in term versus preterm infants, hemolytic versus non-hemolytic causes of jaundice and according to the type of metalloporphyrin used. Three small studies, enrolling a total of 170 infants, were eligible for inclusion in this review. None blinded intervention or outcome assessment. In all three studies some patients were excluded after randomization. Metalloporphyrin-treated infants appeared to have short-term benefits compared to controls, including a lower maximum plasma bilirubin level in one study, a lower frequency of severe hyperbilirubinemia in one study, a decreased need for phototherapy, fewer plasma bilirubin measurements and a shorter duration of hospitalization. None of the enrolled infants required an exchange transfusion in the two studies that described this outcome. None of the studies reported on neonatal kernicterus, death, long-term neurodevelopmental outcomes or iron deficiency anemia. Though a small number of metalloporphyrin-treated as well as control infants developed a photosensitivity rash, the trials were too small to rule out an increase in the risk of photosensitivity or other adverse effects from metalloporphyrin treatment. No subgroup analyses were possible due to the small number of included trials. Treatment of neonatal unconjugated hyperbilirubinemia with metalloporphyrins may reduce neonatal bilirubin levels and decrease the need for phototherapy and hospitalization. There is no evidence to support or refute the possibility that treatment with a metalloporphyrin decreases the risk of neonatal kernicterus or of long-term neurodevelopmental impairment due to bilirubin encephalopathy. There is no evidence to support or refute the possibility that cutaneous photosensitivity is increased with metalloporphyrin treatment. Routine treatment of neonatal unconjugated hyperbilirubinemia with a metalloporphyrin cannot be recommended at present.
Gating of proton and water transfer in the respiratory enzyme cytochrome c oxidase.
Wikström, Mårten; Ribacka, Camilla; Molin, Mika; Laakkonen, Liisa; Verkhovsky, Michael; Puustinen, Anne
2005-07-26
The membrane-bound enzyme cytochrome c oxidase is responsible for cell respiration in aerobic organisms and conserves free energy from O2 reduction into an electrochemical proton gradient by coupling the redox reaction to proton-pumping across the membrane. O2 reduction produces water at the bimetallic heme a3/CuB active site next to a hydrophobic cavity deep within the membrane. Water molecules in this cavity have been suggested to play an important role in the proton-pumping mechanism. Here, we show by molecular dynamics simulations that the conserved arginine/heme a3 delta-propionate ion pair provides a gate, which exhibits reversible thermal opening that is governed by the redox state and the water molecules in the cavity. An important role of this gate in the proton-pumping mechanism is supported by site-directed mutagenesis experiments. Transport of the product water out of the enzyme must be rigidly controlled to prevent water-mediated proton leaks that could compromise the proton-pumping function. Exit of product water is observed through the same arginine/propionate gate, which provides an explanation for the observed extraordinary spatial specificity of water expulsion from the enzyme.
Binda, Claudia; Hubálek, Frantisek; Li, Min; Herzig, Yaacov; Sterling, Jeffrey; Edmondson, Dale E; Mattevi, Andrea
2004-03-25
Monoamine oxidase B (MAO B) is an outer mitochondrial membrane enzyme that catalyzes the oxidation of arylalkylamine neurotransmitters. The crystal structures of MAO B in complex with four of the N-propargylaminoindan class of MAO covalent inhibitors (rasagiline, N-propargyl-1(S)-aminoindan, 6-hydroxy-N-propargyl-1(R)-aminoindan, and N-methyl-N-propargyl-1(R)-aminoindan) have been determined at a resolution of better than 2.1 A. Rasagiline, 6-hydroxy-N-propargyl-1(R)-aminoindan, and N-methyl-N-propargyl-1(R)-aminoindan adopt essentially the same conformation with the extended propargyl chain covalently bound to the flavin and the indan ring located in the rear of the substrate cavity. N-Propargyl-1(S)-aminoindan binds with the indan ring in a flipped conformation with respect to the other inhibitors, which causes a slight movement of the Tyr326 side chain. Four ordered water molecules are an integral part of the active site and establish H-bond interactions to the inhibitor atoms. These structural studies may guide future drug design to improve selectivity and efficacy by introducing appropriate substituents on the rasagiline molecular scaffold.
In silico identification of novel and selective monoamine oxidase B inhibitors.
Yelekçi, Kemal; Büyüktürk, Bora; Kayrak, Nurdan
2013-06-01
Monoamine oxidases (MAO) A and B are flavin adenine dinucleotides containing enzymes bound to the mitochondrial outer membranes of the cells of the brain, liver, intestine, and placenta, as well as platelets. Recently, selective MAO-B inhibitors have received increasing attention due to their neuroprotective properties and the multiple roles they can play in the therapy of neurodegenerative disorders. This study was based on 10 scaffolds that were selected from more than a million lead compounds in the ZINCv12 lead library for their structural and physicochemical properties which inhibit MAO-B. Utilizing ZINC and Accelrys 3.1 fragment-based libraries, which contain about 400 thousand fragments, we generated 200 potential candidates. GOLD, LibDock, and AutoDock 4.02 were used to identify the inhibition constants and their position in the active sites of both MAO isozymes. The dispositions of the candidate molecules within the organism were checked with ADMET PSA 2D (polar surface area) against ADMET AlogP98 (the logarithm of the partition coefficient between n-octanol and water). The MAO-B inhibition activities of the candidates were compared with the properties of rasagiline which is known to be a selective inhibitor of MAO-B.
Ferrocene-Modified Linear Poly(ethylenimine) for Enzymatic Immobilization and Electron Mediation.
Hickey, David P
2017-01-01
Enzymatic glucose biosensors and biofuel cells make use of the electrochemical transduction between an oxidoreductase enzyme, such as glucose oxidase (GOx), and an electrode to either quantify the amount of glucose in a solution or generate electrical energy. However, many enzymes including GOx are not able to electrochemically interact with an electrode surface directly, but require an external electrochemical relay to shuttle electrons to the electrode. Ferrocene-modified linear poly(ethylenimine) (Fc-LPEI) redox polymers have been designed to simultaneously immobilize glucose oxidase (GOx) at an electrode and mediate electron transfer from their flavin adenine dinucleotide (FAD) active site to the electrode surface. Cross-linked films of Fc-LPEI create hydrogel networks that allow for rapid transport of glucose, while the covalently bound ferrocene moieties are able to facilitate rapid electron transfer due to the ability of ferrocene to exchange electrons between adjacent ferrocene residues. For these reasons, Fc-LPEI films have been widely used in the development of high current density bioanode materials. This chapter describes the synthesis of a commonly used dimethylferrocene-modified linear poly(ethylenimine), as well as the subsequent preparation and electrochemical characterization of a GOx bioanode film utilizing the synthesized polymer.
NASA Astrophysics Data System (ADS)
Hamza, Mostafa; El-Ahl, Mohammad H. S.; Hamza, Ahmad M.
2001-06-01
The high efficacy of laser phototherapy combined with transcutaneous monitoring of serum bilirubin provides optimum safety for jaundiced infants from the risk of bilirubin encephalopathy. In this paper the authors introduce the design and operating principles of a new laser system that can provide simultaneous monitoring and treatment of several jaundiced babies at one time. The new system incorporates diode-based laser sources oscillating at selected wavelengths to achieve both transcutaneous differential absorption measurements of bilirubin concentration in addition to the computer controlled intermittent laser therapy through a network of optical fibers. The detailed description and operating characteristics of this system are presented.
Evanescent field: A potential light-tool for theranostics application
NASA Astrophysics Data System (ADS)
Polley, Nabarun; Singh, Soumendra; Giri, Anupam; Pal, Samir Kumar
2014-03-01
A noninvasive or minimally invasive optical approach for theranostics, which would reinforce diagnosis, treatment, and preferably guidance simultaneously, is considered to be major challenge in biomedical instrument design. In the present work, we have developed an evanescent field-based fiber optic strategy for the potential theranostics application in hyperbilirubinemia, an increased concentration of bilirubin in the blood and is a potential cause of permanent brain damage or even death in newborn babies. Potential problem of bilirubin deposition on the hydroxylated fiber surface at physiological pH (7.4), that masks the sensing efficacy and extraction of information of the pigment level, has also been addressed. Removal of bilirubin in a blood-phantom (hemoglobin and human serum albumin) solution from an enhanced level of 77 μM/l (human jaundice >50 μM/l) to ˜30 μM/l (normal level ˜25 μM/l in human) using our strategy has been successfully demonstrated. In a model experiment using chromatography paper as a mimic of biological membrane, we have shown efficient degradation of the bilirubin under continuous monitoring for guidance of immediate/future course of action.
A high risk critical mitral valve stenosis with emergency management at Apollo Hospitals Dhaka.
Zahangir, N M; Hoque, K Z; Khan, M H; Haque, M A; Haider, M Z
2013-10-01
Heart valve surgery in high-risk patients with severe jaundice, congestive hepatomegaly and renal impairment is associated with considerable morbidity and mortality. Without operation the consequences are invariably grave. A 35 years old gentleman with congestive cardiac failure was initially treated in coronary care unit (CCU). Mitral valve area was 0.5cm², pulmonary arterial systolic pressure (PASP) was 110mmHg, serum bilirubin was 20mg/dl, SGPT & SGOT were 1024iu/l and 1027iu/l respectively. Serum creatinine was 3.35mmol/l. Serum bilirubin gradually diminished to 3.1mg/dl after 12 days treatment in Coronary Care Unit but next day it increased to 3.6mg/dl. Mitral valve was replaced on an emergency basis. Echocardiogram on the 5th post operative day showed well functioning prosthetic mitral valve in situ. Serum bilirubin decreased to 2.2mg/dl, SGPT, SGOT and serum creatinine to 43iu/l, 40iu/l and 1.34mmol/l respectively. After 8 weeks of postoperative follow up his serum bilirubin decreased to 0.8mg/dl.
Analysis of the optical properties of bile
NASA Astrophysics Data System (ADS)
Baldini, Francesco; Bechi, Paolo; Cianchi, Fabio; Falai, Alida; Fiorillo, Claudia; Nassi, Paolo
2000-07-01
Invasive bile determination is very useful in the diagnosis of many gastric pathologies. At the moment, this measurement is performed with Bilitec 2000, an optical fiber sensor, that is based on absorption by bilirubin. Nevertheless, erroneous evaluations are possible, due to the different configurations which the bilirubin molecule can adopt. The optical behavior of human samples of pure bile and bile+gastric juice has been examined using an optical fiber spectrophotometer and two suitable modified Bilitec 2000 units. A protocol has been established for the treatment of biological fluids, in order to make it possible to study the behavior of their optical properties as a function of pH and concentration without causing any alteration in the samples. The analysis of pH dependence evidenced the presence of different calibration curves at different pH values: the self-aggregation of the bilirubin molecules observed in pure bile samples was almost totally absent in the gastric samples. Measurements carried out on Bilitec 2000 showed that the most appropriate wavelength for bilirubin detection in the stomach should be 470 nm.
Forrest, Elizabeth Ann; Reiling, Janske; Lipka, Geraldine; Fawcett, Jonathan
2017-01-01
AIM To identify risk factors associated with the formation of biliary strictures post liver transplantation over a period of 10-year in Queensland. METHODS Data on liver donors and recipients in Queensland between 2005 and 2014 was obtained from an electronic patient data system. In addition, intra-operative and post-operative characteristics were collected and a logistical regression analysis was performed to evaluate their association with the development of biliary strictures. RESULTS Of 296 liver transplants performed, 285 (96.3%) were from brain dead donors. Biliary strictures developed in 45 (15.2%) recipients. Anastomotic stricture formation (n = 25, 48.1%) was the commonest complication, with 14 (58.3%) of these occurred within 6-mo of transplant. A percutaneous approach or endoscopic retrograde cholangiography was used to treat 17 (37.8%) patients with biliary strictures. Biliary reconstruction was initially or ultimately required in 22 (48.9%) patients. In recipients developing biliary strictures, bilirubin was significantly increased within the first post-operative week (Day 7 total bilirubin 74 μmol/L vs 49 μmol/L, P = 0.012). In both univariate and multivariate regression analysis, Day 7 total bilirubin > 55 μmol/L was associated with the development of biliary stricture formation. In addition, hepatic artery thrombosis and primary sclerosing cholangitis were identified as independent risk factors. CONCLUSION In addition to known risk factors, bilirubin levels in the early post-operative period could be used as a clinical indicator for biliary stricture formation. PMID:29312864