An improved ternary vector system for Agrobacterium-mediated rapid maize transformation.
Anand, Ajith; Bass, Steven H; Wu, Emily; Wang, Ning; McBride, Kevin E; Annaluru, Narayana; Miller, Michael; Hua, Mo; Jones, Todd J
2018-05-01
A simple and versatile ternary vector system that utilizes improved accessory plasmids for rapid maize transformation is described. This system facilitates high-throughput vector construction and plant transformation. The super binary plasmid pSB1 is a mainstay of maize transformation. However, the large size of the base vector makes it challenging to clone, the process of co-integration is cumbersome and inefficient, and some Agrobacterium strains are known to give rise to spontaneous mutants resistant to tetracycline. These limitations present substantial barriers to high throughput vector construction. Here we describe a smaller, simpler and versatile ternary vector system for maize transformation that utilizes improved accessory plasmids requiring no co-integration step. In addition, the newly described accessory plasmids have restored virulence genes found to be defective in pSB1, as well as added virulence genes. Testing of different configurations of the accessory plasmids in combination with T-DNA binary vector as ternary vectors nearly doubles both the raw transformation frequency and the number of transformation events of usable quality in difficult-to-transform maize inbreds. The newly described ternary vectors enabled the development of a rapid maize transformation method for elite inbreds. This vector system facilitated screening different origins of replication on the accessory plasmid and T-DNA vector, and four combinations were identified that have high (86-103%) raw transformation frequency in an elite maize inbred.
Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei
2006-11-01
To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.
Wang, Gen-Ping; Yu, Xiu-Dao; Sun, Yong-Wei; Jones, Huw D; Xia, Lan-Qin
2016-01-01
Horizontal transfer of antibiotic resistance genes to animals and vertical transfer of herbicide resistance genes to the weedy relatives are perceived as major biosafety concerns in genetically modified (GM) crops. In this study, five novel vectors which used gusA and bar as a reporter gene and a selection marker gene, respectively, were constructed based on the pCLEAN dual binary vector system. Among these vectors, 1G7B and 5G7B carried two T-DNAs located on two respective plasmids with 5G7B possessing an additional virGwt gene. 5LBTG154 and 5TGTB154 carried two T-DNAs in the target plasmid with either one or double right borders, and 5BTG154 carried the selectable marker gene on the backbone outside of the T-DNA left border in the target plasmid. In addition, 5BTG154, 5LBTG154, and 5TGTB154 used pAL154 as a helper plasmid which contains Komari fragment to facilitate transformation. These five dual binary vector combinations were transformed into Agrobacterium strain AGL1 and used to transform durum wheat cv Stewart 63. Evaluation of the co-transformation efficiencies, the frequencies of marker-free transgenic plants, and integration of backbone sequences in the obtained transgenic lines indicated that two vectors (5G7B and 5TGTB154) were more efficient in generating marker-free transgenic wheat plants with no or minimal integration of backbone sequences in the wheat genome. The vector series developed in this study for generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium -mediated transformation will be useful to facilitate the creation of "clean" GM wheat containing only the foreign genes of agronomic importance.
Method: low-cost delivery of the cotton leaf crumple virus-induced gene silencing system
2012-01-01
Background We previously developed a virus-induced gene silencing (VIGS) vector for cotton from the bipartite geminivirusCotton leaf crumple virus (CLCrV). The original CLCrV VIGS vector was designed for biolistic delivery by a gene gun. This prerequisite limited the use of the system to labs with access to biolistic equipment. Here we describe the adaptation of this system for delivery by Agrobacterium (Agrobacterium tumefaciens). We also describe the construction of two low-cost particle inflow guns. Results The biolistic CLCrV vector was transferred into two Agrobacterium binary plasmids. Agroinoculation of the binary plasmids into cotton resulted in silencing and GFP expression comparable to the biolistic vector. Two homemade low-cost gene guns were used to successfully inoculate cotton (G. hirsutum) and N. benthamiana with either the CLCrV VIGS vector or the Tomato golden mosaic virus (TGMV) VIGS vector respectively. Conclusions These innovations extend the versatility of CLCrV-based VIGS for analyzing gene function in cotton. The two low-cost gene guns make VIGS experiments affordable for both research and teaching labs by providing a working alternative to expensive commercial gene guns. PMID:22853641
Novel sull binary vectors enable an inexpensive foliar selection method in Arabidopsis
USDA-ARS?s Scientific Manuscript database
Sulfonamide resistance is conferred by the sulI gene found on many Enterobacteriaceae R plasmids and Tn21 type transposons. The sulI gene encodes a sulfonamide insensitive dihydropteroate synthase enzyme required for folate biosynthesis. Transformation of tobacco, potato or Arabidopsis using sulI as...
Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou
2012-01-01
Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.
A simplified approach to construct infectious cDNA clones of a tobamovirus in a binary vector.
Junqueira, Bruna Rayane Teodoro; Nicolini, Cícero; Lucinda, Natalia; Orílio, Anelise Franco; Nagata, Tatsuya
2014-03-01
Infectious cDNA clones of RNA viruses are important tools to study molecular processes such as replication and host-virus interactions. However, the cloning steps necessary for construction of cDNAs of viral RNA genomes in binary vectors are generally laborious. In this study, a simplified method of producing an agro-infectious Pepper mild mottle virus (PMMoV) clone is described in detail. Initially, the complete genome of PMMoV was amplified by a single-step RT-PCR, cloned, and subcloned into a small plasmid vector under the T7 RNA polymerase promoter to confirm the infectivity of the cDNA clone through transcript inoculation. The complete genome was then transferred to a binary vector using a single-step, overlap-extension PCR. The selected clones were agro-infiltrated to Nicotiana benthamiana plants and showed to be infectious, causing typical PMMoV symptoms. No differences in host responses were observed when the wild-type PMMoV isolate, the T7 RNA polymerase-derived transcripts and the agroinfiltration-derived viruses were inoculated to N. benthamiana, Capsicum chinense PI 159236 and Capsicum annuum plants. Copyright © 2013 Elsevier B.V. All rights reserved.
Delbianco, Alice; Lanzoni, Chiara; Klein, Elodie; Rubies Autonell, Concepcion; Gilmer, David; Ratti, Claudio
2013-05-01
Agroinoculation is a quick and easy method for the infection of plants with viruses. This method involves the infiltration of tissue with a suspension of Agrobacterium tumefaciens carrying binary plasmids harbouring full-length cDNA copies of viral genome components. When transferred into host cells, transcription of the cDNA produces RNA copies of the viral genome that initiate infection. We produced full-length cDNA corresponding to Beet necrotic yellow vein virus (BNYVV) RNAs and derived replicon vectors expressing viral and fluorescent proteins in pJL89 binary plasmid under the control of the Cauliflower mosaic virus 35S promoter. We infected Nicotiana benthamiana and Beta macrocarpa plants with BNYVV by leaf agroinfiltration of combinations of agrobacteria carrying full-length cDNA clones of BNYVV RNAs. We validated the ability of agroclones to reproduce a complete viral cycle, from replication to cell-to-cell and systemic movement and, finally, plant-to-plant transmission by its plasmodiophorid vector. We also showed successful root agroinfection of B. vulgaris, a new tool for the assay of resistance to rhizomania, the sugar beet disease caused by BNYVV. © 2013 BSPP AND BLACKWELL PUBLISHING LTD.
Ye, Xing-Guo; Qin, Hua
2007-01-01
Obtaining marker-free plants with high efficiency will benefit the environmental release of transgenic crops. To achieve this point, a binary vector pNB35SVIP1 with three T-DNAs was constructed by using several mediate plasmids, in which one copy of bar gene expression cassette and two copies of VIP1 gene expression cassette were included. EHA101 Agrobacterium strain harboring the final construct was applied to transform soybean (Glycine max) cotyledon nodes. Through 2 - 3 months regeneration and selection on 3 - 5mg/L glufosinate containing medium, transgenic soybean plants were confirmed to be obtained at 0.83% - 3.16%, and co-transformation efficiency of both gene in the same individual reached up to 86.4%, based on southern blot test. By the analysis of PCR, southern blot and northern blot combining with leaf painting of herbicide in T1 progenies, 41 plants were confirmed to be eliminated of bar gene with the frequency of 7.6% . Among the T1 populations tested, the loss of the alien genes happened in 22.7% lines, the silence of bar gene took place in 27.3% lines, and VIP1 gene silence existed in 37.1% marker-free plants. The result also suggested that the plasmid with three T-DNAs might be an ideal vector to generate maker-free genetic modified organism.
A simple Gateway-assisted construction system of TALEN genes for plant genome editing.
Kusano, Hiroaki; Onodera, Hitomi; Kihira, Miho; Aoki, Hiromi; Matsuzaki, Hikaru; Shimada, Hiroaki
2016-07-25
TALEN is an artificial nuclease being applied for sequence-specific genome editing. For the plant genome editing, a pair of TALEN genes is expressed in the cells, and a binary plasmid for Agrobacterium-mediated transformation should be assembled. We developed a novel procedure using the Gateway-assisted plasmids, named Emerald-Gateway TALEN system. We constructed entry vectors, pPlat plasmids, for construction of a desired TALEN gene using Platinum Gate TALEN kit. We also created destination plasmid, pDual35SGw1301, which allowed two TALEN genes to both DNA strands to recruit using Gateway technology. Resultant TALEN genes were evaluated by the single-strand annealing (SSA) assay in E. coli cells. By this assay, the TALENs recognized the corresponding targets in the divided luciferase gene, and induced a specific recombination to generate an active luciferase gene. Using the TALEN genes constructed, we created a transformant potato cells in which a site-specific mutation occurred at the target site of the GBSS gene. This suggested that our system worked effectively and was applicable as a convenient tool for the plant genome editing.
Genetic transformation of tobacco NT1 cells with Agrobacterium tumefaciens.
Mayo, Kristin J; Gonzales, Barbara J; Mason, Hugh S
2006-01-01
This protocol is used to produce stably transformed tobacco (Nicotiana tabacum) NT1 cell lines, using Agrobacterium tumefaciens-mediated DNA delivery of a binary vector containing a gene encoding hepatitis B surface antigen and a gene encoding the kanamycin selection marker. The NT1 cultures, at the appropriate stage of growth, are inoculated with A. tumefaciens containing the binary vector. A 3-day cocultivation period follows, after which the cultures are rinsed and placed on solid selective medium. Transformed colonies ('calli') appear in approximately 4 weeks; they are subcultured until adequate material is obtained for analysis of antigen production. 'Elite' lines are selected based on antigen expression and growth characteristics. The time required for the procedure from preparation of the plant cell materials to callus development is approximately 5 weeks. Growth of selected calli to sufficient quantities for antigen screening may require 4-6 weeks beyond the initial selection. Creation of the plasmid constructs, transformation of the A. tumefaciens line, and ELISA and Bradford assays to assess protein production require additional time.
Burbank, Lindsey P; Stenger, Drake C
2016-08-01
The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacterial genetics but there are only a limited number of plasmid vectors available that replicate in X. fastidiosa, and even fewer that are retained without antibiotic selection. Two plasmids are described here that show stable replication in X. fastidiosa and are effective for gene complementation both in vitro and in planta. Plasmid maintenance is facilitated by incorporation of the PemI/PemK plasmid addiction system, consisting of PemK, an endoribonuclease toxin, and its cognate antitoxin, PemI. Vector pXf20pemIK utilizes a native X. fastidiosa replication origin as well as a high-copy-number pUC origin for propagation in Escherichia coli cloning strains. Broad-host-range vector pBBR5pemIK is a medium- to low-copy-number plasmid based on the pBBR1 backbone. Both plasmids are maintained for extended periods of time in the absence of antibiotic selection, as well as up to 14 weeks in grapevine, without affecting bacterial fitness. These plasmids present an alternative to traditional complementation and expression vectors which rely on antibiotic selection for plasmid retention.
Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.
2010-01-01
Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425
Frazer, LilyAnn Novak; O'Keefe, Raymond T
2007-09-01
The availability of Saccharomyces cerevisiae yeast strains with multiple auxotrophic markers allows the stable introduction and selection of more than one yeast shuttle vector containing marker genes that complement the auxotrophic markers. In certain experimental situations there is a need to recover more than one shuttle vector from yeast. To facilitate the recovery and identification of multiple plasmids from S. cerevisiae, we have constructed a series of plasmids based on the pRS series of yeast shuttle vectors. Bacterial antibiotic resistance genes to chloramphenicol, kanamycin and zeocin have been combined with the yeast centromere sequence (CEN6), the autonomously replicating sequence (ARSH4) and one of the four yeast selectable marker genes (HIS3, TRP1, LEU2 or URA3) from the pRS series of vectors. The 12 plasmids produced differ in antibiotic resistance and yeast marker gene within the backbone of the multipurpose plasmid pBluescript II. The newly constructed vectors show similar mitotic stability to the original pRS vectors. In combination with the ampicillin-resistant pRS series of yeast shuttle vectors, these plasmids now allow the recovery and identification in bacteria of up to four different vectors from S. cerevisiae. Copyright (c) 2007 John Wiley & Sons, Ltd.
Kemppainen, Minna J.; Pardo, Alejandro G.
2010-01-01
Summary pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy oriented two‐step PCR cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300‐based binary vector carrying a hygromycin resistance cassette, the pHg/pSILBAγ plasmid is used for Agrobacterium‐mediated transformation. The pHg/pSILBAγ system results in predominantly single integrations of RNA silencing triggering T‐DNAs in the fungal genome and the integration sites of the transgenes can be resolved by plasmid rescue. pSILBAγ construct and two other pSILBA plasmid variants (pSILBA and pSILBAα) were evaluated for their capacity to silence Laccaria nitrate reductase gene. While all pSILBA variants tested resulted in up to 65–76% of transformants with reduced growth on nitrate, pSILBAγ produced the highest number (65%) of strongly affected fungal strains. The strongly silenced phenotype was shown to correlate with T‐DNA integration in transcriptionally active genomic sites. pHg/pSILBAγ was shown to produce T‐DNAs with minimum CpG methylation in transgene promoter regions which assures the maximum silencing trigger production in Laccaria. Methylation of the target endogene was only slight in RNA silencing triggered with constructs carrying an intronic spacer hairpin sequence. The silencing capacity of the pHg/pSILBAγ was further tested with Laccaria inositol‐1,4,5‐triphosphate 5‐phosphatase gene. Besides its use in silencing triggering, the herein described plasmid system can also be used for transgene expression in Laccaria. pHg/pSILBAγ silencing system is optimized for L. bicolor but it should be highly useful also for other homobasidiomycetes, group of fungi currently lacking molecular tools for RNA silencing. PMID:21255319
Enhanced gene disruption by programmable nucleases delivered by a minicircle vector.
Dad, A-B K; Ramakrishna, S; Song, M; Kim, H
2014-11-01
Targeted genetic modification using programmable nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) is of great value in biomedical research, medicine and biotechnology. Minicircle vectors, which lack extraneous bacterial sequences, have several advantages over conventional plasmids for transgene delivery. Here, for the first time, we delivered programmable nucleases into human cells using transient transfection of a minicircle vector and compared the results with those obtained using a conventional plasmid. Surrogate reporter assays and T7 endonuclease analyses revealed that cells in the minicircle vector group displayed significantly higher mutation frequencies at the target sites than those in the conventional plasmid group. Quantitative PCR and reverse transcription-PCR showed higher vector copy number and programmable nuclease transcript levels, respectively, in 293T cells after minicircle versus conventional plasmid vector transfection. In addition, tryphan blue staining and flow cytometry after annexin V and propidium iodide staining showed that cell viability was also significantly higher in the minicircle group than in the conventional plasmid group. Taken together, our results show that gene disruption using minicircle vector-mediated delivery of ZFNs and TALENs is a more efficient, safer and less toxic method than using a conventional plasmid, and indicate that the minicircle vector could serve as an advanced delivery method for programmable nucleases.
Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong
2003-02-01
To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.
Saccharomyces cerevisiae Shuttle vectors.
Gnügge, Robert; Rudolf, Fabian
2017-05-01
Yeast shuttle vectors are indispensable tools in yeast research. They enable cloning of defined DNA sequences in Escherichia coli and their direct transfer into Saccharomyces cerevisiae cells. There are three types of commonly used yeast shuttle vectors: centromeric plasmids, episomal plasmids and integrating plasmids. In this review, we discuss the different plasmid systems and their characteristic features. We focus on their segregational stability and copy number and indicate how to modify these properties. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
High Efficiency Transformation of Cultured Tobacco Cells 1
An, Gynheung
1985-01-01
Tobacco calli were transformed at levels up to 50% by cocultivation of tobacco cultured cells with Agrobacterium tumefaciens harboring the binary transfer-DNA vector, pGA472, containing a kanamycin resistance marker. Transformation frequency was dependent on the physiological state of the tobacco cells, the nature of Agrobacterium strain and, less so, on the expression of the vir genes of the tumor-inducing plasmid. Maximum transformation frequency was obtained with exponentially growing plant cells, suggesting that rapid growth of plant cells is an essental factor for efficient transformation of higher plants. Images Fig. 1 PMID:16664453
Lu, Jiamiao; Williams, James A.; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A.
2017-01-01
We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5′ UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo. PMID:27903072
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.
Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E
2009-11-20
In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply transformed yeast cells have important implications for yeast library screens. The quantitative information described herein should increase awareness of this issue, and the rapid sequencing approach developed for these studies should be widely useful for identifying multiple vector transformants and avoiding complications associated with cells that have acquired more than one unique plasmid.
Sequential cloning of chromosomes
Lacks, Sanford A.
1995-07-18
A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism's chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes.
[Cloning and gene expression in lactic acid bacteria].
Bondarenko, V M; Beliavskaia, V A
2000-01-01
The possibility of using the genera Lactobacillus and Lactococcus as vector representatives is widely discussed at present. The prospects of the construction of recombinant bacteria are closely connected with the solution of a number of problems: the level of the transcription of cloned genes, the effectiveness of the translation of heterologous mRNA, the stability of protein with respect to bacterial intracellular proteases, the method by protein molecules leave the cell (by secretion or as the result of lysis). To prevent segregation instability, the construction of vector molecules on the basis of stable cryptic plasmids found in wild strains of lactic acid bacteria was proposed. High copying plasmids with low molecular weight were detected in L. plantarum and L. pentosus strains. Several plasmids with molecular weights of 1.7, 1.8 and 2.3 kb were isolated from bacterial cells to be used as the basis for the construction of vector molecules. Genes of chloramphenicol- and erythromycin-resistance from Staphylococcus aureus plasmids were used as marker genes ensuring cell transformation. The vector plasmids thus constructed exhibited high transformation activity in the electroporation of different strains, including L. casei, L. plantarum, L. acidophilus, L. fermentum and L. brevis which could be classified with the replicons of a wide circle of hosts. But the use of these plasmids was limited due to the risk of the uncontrolled dissemination of recombinant plasmids. L. acidophilus were also found to have strictly specific plasmids with good prospects of being used as the basis for the creation of vectors, incapable of dissemination. In addition to the search of strain-specific plasmids, incapable of uncontrolled gene transmission, the use of chromosome-integrated heterologous genes is recommended in cloning to ensure the maximum safety.
USDA-ARS?s Scientific Manuscript database
The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacte...
The 2-micron plasmid as a nonselectable, stable, high copy number yeast vector
NASA Technical Reports Server (NTRS)
Ludwig, D. L.; Bruschi, C. V.
1991-01-01
The endogenous 2-microns plasmid of Saccharomyces cerevisiae has been used extensively for the construction of yeast cloning and expression plasmids because it is a native yeast plasmid that is able to be maintained stably in cells at high copy number. Almost invariably, these plasmid constructs, containing some or all 2-microns sequences, exhibit copy number levels lower than 2-microns and are maintained stably only under selective conditions. We were interested in determining if there was a means by which 2-microns could be utilized for vector construction, without forfeiting either copy number or nonselective stability. We identified sites in the 2-microns plasmid that could be used for the insertion of genetic sequences without disrupting 2-microns coding elements and then assessed subsequent plasmid constructs for stability and copy number in vivo. We demonstrate the utility of a previously described 2-microns recombination chimera, pBH-2L, for the manipulation and transformation of 2-microns as a pure yeast plasmid vector. We show that the HpaI site near the STB element in the 2-microns plasmid can be utilized to clone yeast DNA of at least 3.9 kb with no loss of plasmid stability. Additionally, the copy number of these constructs is as high as levels reported for the endogenous 2-microns.
Sequential cloning of chromosomes
Lacks, S.A.
1995-07-18
A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism`s chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes. 9 figs.
PSI:Biology-Materials Repository: A Biologist’s Resource for Protein Expression Plasmids
Cormier, Catherine Y.; Park, Jin G.; Fiacco, Michael; Steel, Jason; Hunter, Preston; Kramer, Jason; Singla, Rajeev; LaBaer, Joshua
2011-01-01
The Protein Structure Initiative:Biology-Materials Repository (PSI:Biology-MR; MR; http://psimr.asu.edu) sequence-verifies, annotates, stores, and distributes the protein expression plasmids and vectors created by the Protein Structure Initiative (PSI). The MR has developed an informatics and sample processing pipeline that manages this process for thousands of samples per month from nearly a dozen PSI centers. DNASU (http://dnasu.asu.edu), a freely searchable database, stores the plasmid annotations, which include the full-length sequence, vector information, and associated publications for over 130,000 plasmids created by our laboratory, by the PSI and other consortia, and by individual laboratories for distribution to researchers worldwide. Each plasmid links to external resources, including the PSI Structural Biology Knowledgebase (http://sbkb.org), which facilitates cross-referencing of a particular plasmid to additional protein annotations and experimental data. To expedite and simplify plasmid requests, the MR uses an expedited material transfer agreement (EP-MTA) network, where researchers from network institutions can order and receive PSI plasmids without institutional delays. Currently over 39,000 protein expression plasmids and 78 empty vectors from the PSI are available upon request from DNASU. Overall, the MR’s repository of expression-ready plasmids, its automated pipeline, and the rapid process for receiving and distributing these plasmids more effectively allows the research community to dissect the biological function of proteins whose structures have been studied by the PSI. PMID:21360289
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kanungo, Jyotshna
RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less
Meira, L B; Henriques, J A; Magaña-Schwencke, N
1995-01-01
The characterization of a new system to study the induction of plasmid-chromosome recombination is described. Single-stranded and double-stranded centromeric vectors bearing 8-methoxypsoralen photoinduced lesions were used to transform a wild-type yeast strain bearing the leu2-3,112 marker. Using the SSCP methodology and DNA sequencing, it was demonstrated that repair of the lesions in plasmid DNA was mainly due to conversion of the chromosomal allele to the plasmid DNA. Images PMID:7784218
USDA-ARS?s Scientific Manuscript database
Plasmids that contain a disrupted genome of the Junonia coenia densovirus (JcDNV) integrate into the chromosomes of the somatic cells of insects. When subcloned individually, both the P9 inverted terminal repeat (P9-ITR) and the P93-ITR promote the chromosomal integration of vector plasmids in insec...
Strategy to approach stable production of recombinant nattokinase in Bacillus subtilis.
Chen, Po Ting; Chiang, Chung-Jen; Chao, Yun-Peng
2007-01-01
Bacillus subtilis (B. subtilis) is widely accepted as an excellent host cell for the secretory production of recombinant proteins. In this study, a shuttle vector was constructed by fusion of Staphylococcus aureus (S. aureus) plasmid pUB110 with Escherichia coli (E. coli) plasmid pUC18 and used for the expression of nattokinase in B. subtilis. The pUB110/pUC-based plasmid was found to exhibit high structural instability with the identification of a DNA deletion between two repeated regions. An initial attempt was made to eliminate the homologous site in the plasmid, whereas the stability of the resulting plasmid was not improved. In an alternative way, the pUC18-derived region in this hybrid vector was replaced by the suicidal R6K plasmid origin of E. coli. As a consequence, the pUB110/R6K-based plasmid displayed full structural stability, leading to a high-level production of recombinant nattokinase in the culture broth. This was mirrored by the detection of a very low level of high molecular weight DNAs generated by the plasmid. Moreover, 2-fold higher nattokinase production was obtained by B. subtilis strain carrying the pUB110/R6K-based plasmid as compared to the cell with the pAMbeta1-derived vector, a plasmid known to have high structural stability. Overall, it indicates the feasibility of the approach by fusing two compatible plasmid origins for stable and efficient production of recombinant nattokinase in B. subtilis.
Agaphonov, Michael O
2017-12-01
The use of plasmids possessing a regulatable gene coding for a site-specific recombinase together with its recognition sequences significantly facilitates genome manipulations since it allows self-excision of the portion of the genetic construct integrated into the host genome. Stable maintenance of such plasmids in Escherichia coli, which is used for plasmid preparation, requires prevention of recombinase synthesis in this host, which can be achieved by interrupting the recombinase gene with an intron. Based on this approach, Saccharomyces cerevisiae and Hansenula polymorpha self-excising vectors possessing intronated gene for Cre recombinase and its recognition sites (LoxP) were previously constructed. However, this work shows instability of the H. polymorpha vectors during plasmid maintenance in E. coli cells. This could be due to recombination between the loxP sites caused by residual expression of the cre gene. Prevention of translation reinitiation on an internal methionine codon completely solved this problem. A similar modification was made in a self-excising vector designed for S. cerevisiae. Apart from substantial improvement of yeast self-excising vectors, the obtained results also narrow down the essential part of Cre sequence. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Tolmachov, Oleg E
2010-04-01
Minimized derivatives of bacterial plasmids with removed bacterial backbones are promising vectors for the efficient delivery and for the long-term expression of therapeutic genes. The absence of the bacterial plasmid backbone, a known inducer of innate immune response and a known silencer of transgene expression, provides a partial explanation for the high efficiency of gene transfer using minimized DNA vectors. Supercoiled minicircle DNA is a type of minimized DNA vector obtained via intra-plasmid recombination in bacteria. Minicircle vectors seem to get an additional advantage from their physical compactness, which reduces DNA damage due to the mechanical stress during gene delivery. An independent topological means for DNA compression is knotting, with some knotted DNA isoforms offering superior compactness. I propose that, firstly, knotted DNA can be a suitable compact DNA form for the efficient transfection of a range of human cells with therapeutic genes, and, secondly, that knotted minimized DNA vectors without bacterial backbones ("miniknot" vectors) can surpass supercoiled minicircle DNA vectors in the efficiency of therapeutic gene delivery. Crucially, while the introduction of a single nick to a supercoiled DNA molecule leads to the loss of the compact supercoiled status, the introduction of nicks to knotted DNA does not change knotting. Tight miniknot vectors can be readily produced by the direct action of highly concentrated type II DNA topoisomerase on minicircle DNA or, alternatively, by annealing of the 19-base cohesive ends of the minimized vectors confined within the capsids of Escherichia coli bacteriophage P2 or its satellite bacteriophage P4. After reaching the nucleoplasm of the target cell, the knotted DNA is expected to be unknotted through type II topoisomerase activity and thus to become available for transcription, chromosomal integration or episomal maintenance. The hypothesis can be tested by comparing the gene transfer efficiency achieved with the proposed miniknot vectors, the minicircle vectors described previously, knotted plasmid vectors and standard plasmid vectors. Tightly-wound miniknots can be particularly useful in the gene administration procedures involving considerable forces acting on vector DNA: aerosol inhalation, jet-injection, electroporation, particle bombardment and ultrasound DNA transfer. (c) 2009 Elsevier Ltd. All rights reserved.
Guerrini, A M; Ascenzioni, F; Tribioli, C; Donini, P
1985-01-01
Linear plasmids were constructed by adding telomeres prepared from Tetrahymena pyriformis rDNA to a circular hybrid Escherichia coli-yeast vector and transforming Saccharomyces cerevisiae. The parental vector contained the entire 2 mu yeast circle and the LEU gene from S. cerevisiae. Three transformed clones were shown to contain linear plasmids which were characterized by restriction analysis and shown to be rearranged versions of the desired linear plasmids. The plasmids obtained were imperfect palindromes: part of the parental vector was present in duplicated form, part as unique sequences and part was absent. The sequences that had been lost included a large portion of the 2 mu circle. The telomeres were approximately 450 bp longer than those of T. pyriformis. DNA prepared from transformed S. cerevisiae clones was used to transform Schizosaccharomyces pombe. The transformed S. pombe clones contained linear plasmids identical in structure to their linear parents in S. cerevisiae. No structural re-arrangements or integration into S. pombe was observed. Little or no telomere growth had occurred after transfer from S. cerevisiae to S. pombe. A model is proposed to explain the genesis of the plasmids. Images Fig. 1. Fig. 2. Fig. 4. PMID:3896773
Agrobacterium-mediated transformation of lipomyces
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai, Ziyu; Magnuson, Jon K.; Deng, Shuang
This disclosure provides Agrobacterium-mediated transformation methods for the oil-producing (oleaginous) yeast Lipomyces sp., as well as yeast produced by the method. Such methods utilize Agrobacterium sp. cells that have a T-DNA binary plasmid, wherein the T-DNA binary plasmid comprises a first nucleic acid molecule encoding a first protein and a second nucleic acid molecule encoding a selective marker that permits growth of transformed Lipomyces sp. cells in selective culture media comprising an antibiotic.
Mehlmer, Norbert; Parvin, Nargis; Hurst, Charlotte H.; Knight, Marc R.; Teige, Markus; Vothknecht, Ute C.
2014-01-01
Calcium has long been acknowledged as one of the most important signalling components in plants. Many abiotic and biotic stimuli are transduced into a cellular response by temporal and spatial changes in cellular calcium concentration and the calcium-sensitive protein aequorin has been exploited as a genetically encoded calcium indicator for the measurement of calcium in planta. The objective of this work was to generate a compatible set of aequorin expression plasmids for the generation of transgenic plant lines to measure changes in calcium levels in different cellular subcompartments. Aequorin was fused to different targeting peptides or organellar proteins as a means to localize it to the cytosol, the nucleus, the plasma membrane, and the mitochondria. Furthermore, constructs were designed to localize aequorin in the stroma as well as the inner and outer surface of the chloroplast envelope membranes. The modular set-up of the plasmids also allows the easy replacement of targeting sequences to include other compartments. An additional YFP-fusion was included to verify the correct subcellular localization of all constructs by laser scanning confocal microscopy. For each construct, pBin19-based binary expression vectors driven by the 35S or UBI10 promoter were made for Agrobacterium-mediated transformation. Stable Arabidopsis lines were generated and initial tests of several lines confirmed their feasibility to measure calcium signals in vivo. PMID:22213817
Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc
2017-07-25
Besides Escherichia coli, Bacillus subtilis is an important bacterial species for the production of recombinant proteins. Recombinant genes are inserted into shuttle expression vectors which replicate in both E. coli and in B. subtilis. The ligation products are first transformed into E. coli cells, analyzed for correct insertions, and the correct recombinant plasmids are then transformed into B. subtilis. A major problem using E. coli cells can be the strong basal level of expression of the recombinant protein which may interfere with the stability of the cells. To minimize this problem, we developed strong expression vectors being repressed in E. coli and inducer-free in B. subtilis. In general, induction of IPTG-inducible expression vectors is determined by the regulatory lacI gene encoding the LacI repressor in combination with the lacO operator on the promoter. To investigate the inducer-free properties of the vectors, we constructed inducer-free expression plasmids by removing the lacI gene and characterized their properties. First, we examined the ability to repress a reporter gene in E. coli, which is a prominent property facilitating the construction of the expression vectors carrying a target gene. The β-galactosidase (bgaB gene) basal levels expressed from Pgrac01-bgaB could be repressed at least twice in the E. coli cloning strain. Second, the inducer-free production of BgaB from four different plasmids with the Pgrac01 promoter in B. subtilis was investigated. As expected, BgaB expression levels of inducer-free constructs are at least 37 times higher than that of the inducible constructs in the absence of IPTG, and comparable to those in the presence of the inducer. Third, using efficient IPTG-inducible expression vectors containing the strong promoter Pgrac100, we could convert them into inducer-free expression plasmids. The BgaB production levels from the inducer-free plasmid in the absence of the inducer were at least 4.5 times higher than that of the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.
A novel, easy and rapid method for constructing yeast two-hybrid vectors using In-Fusion technology.
Yu, Deshui; Liao, Libing; Zhang, Ju; Zhang, Yi; Xu, Kedong; Liu, Kun; Li, Xiaoli; Tan, Guangxuan; Chen, Ran; Wang, Yulu; Liu, Xia; Zhang, Xuan; Han, Xiaomeng; Wei, Zhangkun; Li, Chengwei
2018-05-01
Yeast two-hybrid systems are powerful tools for analyzing interactions between proteins. Vector construction is an essential step in yeast two-hybrid experiments, which require bait and prey plasmids. In this study, we modified the multiple cloning site sequence of the yeast plasmid pGADT7 by site-directed mutagenesis PCR to generate the pGADT7-In vector, which resulted in an easy and rapid method for constructing yeast two-hybrid vectors using the In-Fusion cloning technique. This method has three key advantages: only one pair of primers and one round of PCR are needed to generate bait and prey plasmids for each gene, it is restriction endonuclease- and ligase-independent, and it is fast and easily performed.
Reprint of "versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16".
Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra
2014-12-20
The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.
Versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16.
Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra
2014-09-30
The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96 h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.
Rhee, Mun Su; Kim, Jin-Woo; Qian, Yilei; Ingram, L O; Shanmugam, K T
2007-07-01
Bacillus coagulans is a sporogenic lactic acid bacterium that ferments glucose and xylose, major components of plant biomass, a potential feedstock for cellulosic ethanol. The temperature and pH for optimum rate of growth of B. coagulans (50 to 55 degrees C, pH 5.0) are very similar to that of commercially developed fungal cellulases (50 degrees C; pH 4.8). Due to this match, simultaneous saccharification and fermentation (SSF) of cellulose to products by B. coagulans is expected to require less cellulase than needed if the SSF is conducted at a sub-optimal temperature, such as 30 degrees C, the optimum for yeast, the main biocatalyst used by the ethanol industry. To fully exploit B. coagulans as a platform organism, we have developed an electroporation method to transfer plasmid DNA into this genetically recalcitrant bacterium. We also constructed a B. coagulans/E. coli shuttle vector, plasmid pMSR10 that contains the rep region from a native plasmid (pMSR0) present in B. coagulans strain P4-102B. The native plasmid, pMSR0 (6823bp), has 9 ORFs, and replicates by rolling-circle mode of replication. Plasmid pNW33N, developed for Geobacillus stearothermophilus, was also transformed into this host and stably maintained while several other Bacillus/Escherichia coli shuttle vector plasmids were not transformed into B. coagulans. The transformation efficiency of B. coagulans strain P4-102B using the plasmids pNW33N or pMSR10 was about 1.5x10(16) per mole of DNA. The availability of shuttle vectors and an electroporation method is expected to aid in genetic and metabolic engineering of B. coagulans.
Genetic manipulation of Bacillus methanolicus, a gram-positive, thermotolerant methylotroph.
Cue, D; Lam, H; Dillingham, R L; Hanson, R S; Flickinger, M C
1997-01-01
We report the fist genetic transformation system, shuttle vectors, and integrative vectors for the thermotolerant, methylotrophic bacterium Bacillus methanolicus. By using a polyethylene glycol-mediated transformation procedure, we have successfully transformed B. methanolicus with both integrative and multicopy plasmids. For plasmids with a single BmeTI recognition site, dam methylation of plasmid DNA (in vivo or in vitro) was found to enhance transformation efficiency from 7- to 11-fold. Two low-copy-number Escherichia coli-B, methanolicus shuttle plasmids, pDQ507 and pDQ508, are described. pDQ508 caries the replication origin cloned from a 17-kb endogenous B. methanolicus plasmid, pBM1. pDQ507 carries a cloned B. methanolicus DNA fragment, pmr-1, possibly of chromosomal origin, that supports maintenance of pDQ507 as a circular, extrachromosomal DNA molecule. Deletion analysis of pDQ507 indicated two regions required for replication, i.e., a 90-bp AT-rich segment containing a 46-bp imperfect, inverted repeat sequence and a second region 65% homologous to the B. subtilis dpp operon. We also evaluated two E. coli-B. subtilis vectors, pEN1 and pHP13, for use as E. coli-B. methanolicus shuttle vectors. The plasmids pHP13, pDQ507, and pDQ508 were segregationally and structurally stable in B. methanolicus for greater than 60 generations of growth under nonselective conditions; pEN1 was segregationally unstable. Single-stranded plasmid DNA was detected in B. methanolicus transformants carrying either pEN1, pHP13, or pDQ508, suggesting that pDQ508, like the B. subtilis plasmids, is replicated by a rolling-circle mechanism. These studies provide the basic tools for the genetic manipulation of B. methanolicus. PMID:9097439
Genetic manipulation of Bacillus methanolicus, a gram-positive, thermotolerant methylotroph.
Cue, D; Lam, H; Dillingham, R L; Hanson, R S; Flickinger, M C
1997-04-01
We report the fist genetic transformation system, shuttle vectors, and integrative vectors for the thermotolerant, methylotrophic bacterium Bacillus methanolicus. By using a polyethylene glycol-mediated transformation procedure, we have successfully transformed B. methanolicus with both integrative and multicopy plasmids. For plasmids with a single BmeTI recognition site, dam methylation of plasmid DNA (in vivo or in vitro) was found to enhance transformation efficiency from 7- to 11-fold. Two low-copy-number Escherichia coli-B, methanolicus shuttle plasmids, pDQ507 and pDQ508, are described. pDQ508 caries the replication origin cloned from a 17-kb endogenous B. methanolicus plasmid, pBM1. pDQ507 carries a cloned B. methanolicus DNA fragment, pmr-1, possibly of chromosomal origin, that supports maintenance of pDQ507 as a circular, extrachromosomal DNA molecule. Deletion analysis of pDQ507 indicated two regions required for replication, i.e., a 90-bp AT-rich segment containing a 46-bp imperfect, inverted repeat sequence and a second region 65% homologous to the B. subtilis dpp operon. We also evaluated two E. coli-B. subtilis vectors, pEN1 and pHP13, for use as E. coli-B. methanolicus shuttle vectors. The plasmids pHP13, pDQ507, and pDQ508 were segregationally and structurally stable in B. methanolicus for greater than 60 generations of growth under nonselective conditions; pEN1 was segregationally unstable. Single-stranded plasmid DNA was detected in B. methanolicus transformants carrying either pEN1, pHP13, or pDQ508, suggesting that pDQ508, like the B. subtilis plasmids, is replicated by a rolling-circle mechanism. These studies provide the basic tools for the genetic manipulation of B. methanolicus.
[Construction of plant expression plasmid of chimera SBR-CT delta A1].
Mai, Sui; Ling, Junqi
2003-08-01
The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.
Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O
2011-07-01
Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.
Dormiani, Kianoush; Mir Mohammad Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Forouzanfar, Mahboobeh; Baharvand, Hossein; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein
2017-01-01
Induced pluripotent stem cells are generated from somatic cells by direct reprogramming. These reprogrammed pluripotent cells have different applications in biomedical fields such as regenerative medicine. Although viral vectors are widely used for efficient reprogramming, they have limited applications in the clinic due to the risk for immunogenicity and insertional mutagenesis. Accordingly, we designed and developed a small, non-integrating plasmid named pLENSO/Zeo as a 2A-mediated polycistronic expression vector. In this experimental study, we developed a single plasmid which includes a single expression cassette containing open reading frames of human LIN28, NANOG, SOX2 and OCT4 along with an EGFP reporter gene. Each reprogramming factor is separated by an intervening sequence that encodes a 2A self-processing peptide. The reprogramming cassette is located downstream of a CMV promoter. The vector is easily propagated in the E. coli GT115 strain through a CpG-depleted vector backbone. We evaluated the stability of the constructed vector bioinformatically, and its ability to stoichiometric expression of the reprogramming factors using quantitative molecular methods analysis after transient transfection into HEK293 cells. In the present study, we developed a nonviral episomal vector named pLENSO/ Zeo. Our results demonstrated the general structural stability of the plasmid DNA. This relatively small vector showed concomitant, high-level expression of the four reprogramming factors with similar titers, which are considered as the critical parameters for efficient and consistent reprogramming. According to our experimental results, this stable extrachromosomal plasmid expresses reliable amounts of four reprogramming factors simultaneously. Consequently, these promising results encouraged us to evaluate the capability of pLENSO/Zeo as a simple and feasible tool for generation of induced pluripotent stem cells from primary cells in the future.
A Simple And Rapid Minicircle DNA Vector Manufacturing System
Kay, Mark A; He, Cheng-Yi; Chen, Zhi-Ying
2010-01-01
Minicircle DNA vectors consisting of a circular expression cassette devoid of the bacterial plasmid DNA backbone provides several advantages including sustained transgene expression in quiescent cells/tissues. Their use has been limited by labor-intensive production. We report on a strategy for making multiple genetic modifications in E.coli to construct a producer strain that stably expresses a set of inducible minicircle-assembly enzymes, the øC31-integrase and I-SceI homing-endonuclease. This bacterial strain is capable of producing highly purified minicircle yields in the same time frame as routine plasmid DNA. It is now feasible for minicircle DNA vectors to replace routine plasmids in mammalian transgene expression studies. PMID:21102455
Wehmeier, U F
1995-11-07
Four new shuttle vectors for Escherichia coli (Ec) and Streptomyces, pUWL218, pUWL219, pUWL-SK and pUWL-KS, which permit recognition of recombinant (re-) plasmids on XGal plates in Ec, were constructed. These vectors contain the replication functions of the Streptomyces wide-host-range multicopy plasmid pIJ101, the tsr gene conferring resistance to thiostrepton in Streptomyces, the ColEI origin of replication from the pUC plasmids for replication in Ec and the bla gene conferring resistance to ampicillin in Ec. They possess multiple cloning sites with a number of unique restriction sites and allow direct sequencing of re-derivatives using the pUC sequencing primers.
Deb, J K; Nath, N
1999-06-01
Corynebacteria are pleomorphic, asporogenous, Gram-positive bacteria. Included in this group are nonpathogenic soil corynebacteria, which are widely used for the industrial production of amino acids and detergents, and in biotransformation of steroids. Other members of this group are plant and animal pathogens. This review summarizes the current information available about the plasmids of corynebacteria. The emphasis is mainly on the small plasmids, which have been used for construction of vectors for expression of genes in these bacteria. Moreover, considerable information is now available on their nucleotide sequence, gene organization and modes of replication, which would make it possible to further manipulate these plasmids. Other plasmid properties, such as incompatibility and host range, are also discussed. Finally, use of these plasmids as cloning vectors for the expression of heterologous proteins using corynebacteria as hosts is also summarized to highlight the potential of these bacteria as hosts for recombinant DNA.
USDA-ARS?s Scientific Manuscript database
A three-plasmid yeast expression system utilizing the portable small ubiquitin-like modifier (SUMO) vector set combined with the efficient endogenous yeast protease Ulp1 was developed for production of large amounts of soluble functional protein in Saccharomyces cerevisiae. Each vector has a differ...
Yang, V W; Marks, J A; Davis, B P; Jeffries, T W
1994-01-01
This paper describes the first high-efficiency transformation system for the xylose-fermenting yeast Pichia stipitis. The system includes integrating and autonomously replicating plasmids based on the gene for orotidine-5'-phosphate decarboxylase (URA3) and an autonomous replicating sequence (ARS) element (ARS2) isolated from P. stipitis CBS 6054. Ura- auxotrophs were obtained by selecting for resistance to 5-fluoroorotic acid and were identified as ura3 mutants by transformation with P. stipitis URA3. P. stipitis URA3 was cloned by its homology to Saccharomyces cerevisiae URA3, with which it is 69% identical in the coding region. P. stipitis ARS elements were cloned functionally through plasmid rescue. These sequences confer autonomous replication when cloned into vectors bearing the P. stipitis URA3 gene. P. stipitis ARS2 has features similar to those of the consensus ARS of S. cerevisiae and other ARS elements. Circular plasmids bearing the P. stipitis URA3 gene with various amounts of flanking sequences produced 600 to 8,600 Ura+ transformants per micrograms of DNA by electroporation. Most transformants obtained with circular vectors arose without integration of vector sequences. One vector yielded 5,200 to 12,500 Ura+ transformants per micrograms of DNA after it was linearized at various restriction enzyme sites within the P. stipitis URA3 insert. Transformants arising from linearized vectors produced stable integrants, and integration events were site specific for the genomic ura3 in 20% of the transformants examined. Plasmids bearing the P. stipitis URA3 gene and ARS2 element produced more than 30,000 transformants per micrograms of plasmid DNA. Autonomously replicating plasmids were stable for at least 50 generations in selection medium and were present at an average of 10 copies per nucleus. Images PMID:7811063
SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans.
Schwartz, Matthew L; Jorgensen, Erik M
2016-04-01
In principle, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 allows genetic tags to be inserted at any locus. However, throughput is limited by the laborious construction of repair templates and guide RNA constructs and by the identification of modified strains. We have developed a reagent toolkit and plasmid assembly pipeline, called "SapTrap," that streamlines the production of targeting vectors for tag insertion, as well as the selection of modified Caenorhabditis elegans strains. SapTrap is a high-efficiency modular plasmid assembly pipeline that produces single plasmid targeting vectors, each of which encodes both a guide RNA transcript and a repair template for a particular tagging event. The plasmid is generated in a single tube by cutting modular components with the restriction enzyme SapI, which are then "trapped" in a fixed order by ligation to generate the targeting vector. A library of donor plasmids supplies a variety of protein tags, a selectable marker, and regulatory sequences that allow cell-specific tagging at either the N or the C termini. All site-specific sequences, such as guide RNA targeting sequences and homology arms, are supplied as annealed synthetic oligonucleotides, eliminating the need for PCR or molecular cloning during plasmid assembly. Each tag includes an embedded Cbr-unc-119 selectable marker that is positioned to allow concurrent expression of both the tag and the marker. We demonstrate that SapTrap targeting vectors direct insertion of 3- to 4-kb tags at six different loci in 10-37% of injected animals. Thus SapTrap vectors introduce the possibility for high-throughput generation of CRISPR/Cas9 genome modifications. Copyright © 2016 by the Genetics Society of America.
Mahant, Aakash; Saubi, Narcís; Eto, Yoshiki; Guitart, Núria; Gatell, Josep Ma; Hanke, Tomáš; Joseph, Joan
2017-08-03
One of the critical issues that should be addressed in the development of a BCG-based HIV vaccine is genetic plasmid stability. Therefore, to address this issue we have considered using integrative vectors and the auxotrophic mutant of BCG complemented with a plasmid carrying a wild-type complementing gene. In this study, we have constructed an integrative E. coli-mycobacterial shuttle plasmid, p2auxo.HIVA int , expressing the HIV-1 clade A immunogen HIVA. This shuttle vector uses an antibiotic resistance-free mechanism for plasmid selection and maintenance. It was first transformed into a glycine auxotrophic E. coli strain and subsequently transformed into a lysine auxotrophic Mycobacterium bovis BCG strain to generate the vaccine BCG.HIVA 2auxo.int . Presence of the HIVA gene sequence and protein expression was confirmed. We demonstrated that the in vitro stability of the integrative plasmid p2auxo.HIVA int was increased 4-fold, as compared with the BCG strain harboring the episomal plasmid, and was genetically and phenotypically characterized. The BCG.HIVA 2auxo.int vaccine in combination with modified vaccinia virus Ankara (MVA).HIVA was found to be safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. We have engineered a more stable and immunogenic BCG-vectored vaccine using the prototype immunogen HIVA. Thus, the use of integrative expression vectors and the antibiotic-free plasmid selection system based on "double" auxotrophic complementation are likely to improve the mycobacterial vaccine stability in vivo and immunogenicity to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective responses shortly following birth.
Fu, X; Xu, J G
2000-01-01
A chromosome-plasmid balanced lethal gene delivery system for Lactobacillus acidophilus based on the thyA gene was developed. The selected L. acidophilus DOM La strain carries a mutated thyA gene and has an obligate requirement for thymidine. This strain can be used as a host for the constructed shuttle vector pFXL03, lacking antibiotic-resistant markers but having the wild-type thyA gene from L. casei which complements the thyA chromosomal mutation. The vector also contains the replicon region from plasmid pUC19 and that of the Lactococcus plasmid pWV01, which allows the transfer between Escherichia coli, L. casei and L. acidophilus. Eight unique restriction sites (i.e., PstI, HindIII, SphI, SalI, AccI, XbaI, KpnI and SacI) are available for cloning. After 40-time transfers in modified MRS medium, no plasmid loss was observed. The vector pFXL03 is potentially useful as a food-grade vaccine delivery system for L. acidophilus.
Heuermann, D; Haas, R
1998-03-01
A versatile plasmid shuttle vector system was constructed, which is useful for genetic complementation of Helicobacter pylori strains or mutants with cloned genes of homologous or heterologous origin. The individual plasmid vectors consist of the minimal essential genetic elements, including an origin of replication for Escherichia coli, a H. pylori-specific replicon originally identified on a small cryptic H. pylori plasmid, an oriT sequence and a multiple cloning site. Shuttle plasmid pHel2 carries a chloramphenicol resistance cassette (catGC) and pHel3 contains a kanamycin resistance gene (aphA-3) as the selectable marker; both are functional in E. coli and H. pylori. The shuttle plasmids were introduced into the H. pylori strain P1 by natural transformation. A efficiency of 7.0 x 10(-7) and 4.7 x 10(-7) transformants per viable recipient was achieved with pHel2 and pHel3, respectively, and both vectors showed stable, autonomous replication in H. pylori. An approximately 100-fold higher H. pylori transformation rate was obtained when the shuttle vectors for transformation were isolated from the homologous H. pylori strain, rather than E. coli, indicating that DNA restriction and modification mechanisms play a crucial role in plasmid transformation. Interestingly, both shuttle vectors could also be mobilized efficiently from E. coli into different H. pylori recipients, with pHel2 showing an efficiency of 2.0 x 10(-5) transconjugants per viable H. pylori P1 recipient. Thus, DNA restriction seems to be strongly reduced or absent during conjugal transfer. The functional complementation of a recA-deficient H. pylori mutant by the cloned H. pylori recA+ gene, and the expression of the heterologous green fluorescent protein (GFP) in H. pylori demonstrate the general usefulness of this system, which will significantly facilitate the molecular analysis of H. pylori virulence factors in the future.
Inui, Masayuki; Roh, Jung Hyeob; Zahn, Kenneth; Yukawa, Hideaki
2000-01-01
A 15-kb cryptic plasmid was obtained from a natural isolate of Rhodopseudomonas palustris. The plasmid, designated pMG101, was able to replicate in R. palustris and in closely related strains of Bradyrhizobium japonicum and phototrophic Bradyrhizobium species. However, it was unable to replicate in the purple nonsulfur bacterium Rhodobacter sphaeroides and in Rhizobium species. The replication region of pMG101 was localized to a 3.0-kb SalI-XhoI fragment, and this fragment was stably maintained in R. palustris for over 100 generations in the absence of selection. The complete nucleotide sequence of this fragment revealed two open reading frames (ORFs), ORF1 and ORF2. The deduced amino acid sequence of ORF1 is similar to sequences of Par proteins, which mediate plasmid stability from certain plasmids, while ORF2 was identified as a putative rep gene, coding for an initiator of plasmid replication, based on homology with the Rep proteins of several other plasmids. The function of these sequences was studied by deletion mapping and gene disruptions of ORF1 and ORF2. pMG101-based Escherichia coli-R. palustris shuttle cloning vectors pMG103 and pMG105 were constructed and were stably maintained in R. palustris growing under nonselective conditions. The ability of plasmid pMG101 to replicate in R. palustris and its close phylogenetic relatives should enable broad application of these vectors within this group of α-proteobacteria. PMID:10618203
Groom, Joseph; Chung, Daehwan; Kim, Sun-Ki; Guss, Adam; Westpheling, Janet
2018-05-28
A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (≥ 60 °C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a result also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ∆recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chung, Daehwan; Groom, Joseph; Kim, Sun-Ki
A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (>/= 60 degrees C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a resultmore » also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ..delta..recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.« less
Jang, Moon-Sun; Fujita, Azusa; Ikawa, Satomi; Hanawa, Keitaro; Yamamura, Hideki; Tamura, Tomohiko; Hayakawa, Masayuki; Tezuka, Takeaki; Ohnishi, Yasuo
2015-01-01
To date, no plasmid vector has been developed for the rare actinomycete Actinoplanes missouriensis. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes. Here, a novel plasmid, designated pCAZ1, was isolated from Couchioplanes caeruleus subsp. azureus via screening for small circular plasmids in Actinoplanes (57 strains) and Couchioplanes (2 strains). Nucleotide sequencing revealed that pCAZ1 is a 5845-bp circular molecule with a G + C content of 67.5%. The pCAZ1 copy number was estimated at 30 per chromosome. pCAZ1 contains seven putative open reading frames, one of which encodes a protein containing three motifs conserved among plasmid-encoded replication proteins that are involved in the rolling-circle mechanism of replication. Detection of single-stranded DNA intermediates in C. caeruleus confirmed that pCAZ1 replicates by this mechanism. The ColE1 origin from pBluescript SK(+) and the oriT sequence with the apramycin resistance gene aac(3)IV from pIJ773 were inserted together into pCAZ1, to construct the Escherichia coli-A. missouriensis shuttle vectors, pCAM1 and pCAM2, in which the foreign DNA fragment was inserted into pCAZ1 in opposite directions. pCAM1 and pCAM2 were successfully transferred to A. missouriensis through the E. coli-mediated conjugative transfer system. The copy numbers of pCAM1 and pCAM2 in A. missouriensis were estimated to be one and four per chromosome, respectively. Thus, these vectors can be used as effective genetic tools for homologous and heterologous gene expression studies in A. missouriensis. Copyright © 2014 Elsevier Inc. All rights reserved.
Back to basics: pBR322 and protein expression systems in E. coli.
Balbás, Paulina; Bolívar, Francisco
2004-01-01
The extensive variety of plasmid-based expression systems in E. coli resulted from the fact that there is no single strategy for achieving maximal expression of every cloned gene. Although a number of strategies have been implemented to deal with problems associated to gene transcription and translation, protein folding, secretion, location, posttranslational modifications, particularities of different strains, and the like and more integrated processes have been developed, the basic plasmid-borne elements and their interaction with the particular host strain will influence the overall expression system and final productivity. Plasmid vector pBR322 is a well-established multipurpose cloning vector in laboratories worldwide, and a large number of derivatives have been created for specific applications and research purposes, including gene expression in its natural host, E. coli, and few other bacteria. The early characterization of the molecule, including its nucleotide sequence, replication and maintenance mechanisms, and determination of its coding regions, accounted for its success, not only as a universal cloning vector, but also as a provider of genes and an origin of replication for other intraspecies vectors. Since the publication of the aforementioned reviews, novel discoveries pertaining to these issues have appeared in the literature that deepen the understanding of the plasmid's features, behavior, and impact in gene expression systems, as well as some important strain characteristics that affect plasmid replication and stability. The objectives of this review include updating and discussing the new information about (1) the replication and maintenance of pBR322; (2) the host-related modulation mechanisms of plasmid replication; (3) the effects of growth rate on replication control, stability, and recombinant gene expression; (4) ways for plasmid amplification and elimination. Finally, (5) a summary of novel ancillary studies about pBR322 is presented.
Wolk, C P; Vonshak, A; Kehoe, P; Elhai, J
1984-01-01
Wild-type cyanobacteria of the genus Anabaena are capable of oxygenic photosynthesis, differentiation of cells called heterocysts at semiregular intervals along the cyanobacterial filaments, and aerobic nitrogen fixation by the heterocysts. To foster analysis of the physiological processes characteristic of these cyanobacteria, we have constructed a family of shuttle vectors capable of replication and selection in Escherichia coli and, in unaltered form, in several strains of Anabaena. Highly efficient conjugative transfer of these vectors from E. coli to Anabaena is dependent upon the presence of broad host-range plasmid RP-4 and of helper plasmids. The shuttle vectors contain portions of plasmid pBR322 required for replication and mobilization, with sites for Anabaena restriction enzymes deleted; cyanobacterial replicon pDU1, which lacks such sites; and determinants for resistance to chloramphenicol, streptomycin, neomycin, and erythromycin. Images PMID:6324204
Lee, Ju-Hoon; Halgerson, Jamie S.; Kim, Jeong-Hwan; O'Sullivan, Daniel J.
2007-01-01
While plasmids are very commonly associated with the majority of the lactic acid bacteria, they are only very rarely associated with Lactobacillus delbrueckii, with only four characterized to date. In this study, the complete sequence of a native plasmid, pDOJ1, from a strain of Lactobacillus delbrueckii subsp. bulgaricus was determined. It consisted of a circular DNA molecule of 6,220 bp with a G+C content of 44.6% and a characteristic ori and encoded six open reading frames (ORFs), of which functions could be predicted for three—a mobilization (Mob) protein, a transposase, and a fused primase-helicase replication protein. Comparative analysis of pDOJ1 and the other available L. delbrueckii plasmids (pLBB1, pJBL2, pN42, and pLL1212) revealed a very similar organization and amino acid identities between 85 and 98% for the putative proteins of all six predicted ORFs from pDOJ1, reflecting a common origin for L. delbrueckii plasmids. Analysis of the fused primase-helicase replication gene found a similar fused organization only in the theta replicating group B plasmids from Streptococcus thermophilus. This observation and the ability of the replicon to function in S. thermophilus support the idea that the origin of plasmids in L. delbrueckii was likely from S. thermophilus. This may reflect the close association of these two species in dairy fermentations, particularly yogurt production. As no vector based on plasmid replicons from L. delbrueckii has previously been constructed, an Escherichia coli-L. delbrueckii shuttle cloning vector, pDOJ4, was constructed from pDOJ1, the p15A ori, the chloramphenicol resistance gene of pCI372, and the lacZ polylinker from pUC18. This cloning vector was successfully introduced into E. coli, L. delbrueckii subsp. bulgaricus, S. thermophilus, and Lactococcus lactis. This shuttle cloning vector provides a new tool for molecular analysis of Lactobacillus delbrueckii and other lactic acid bacteria. PMID:17526779
Development of new plasmid DNA vaccine vectors with R1-based replicons
2012-01-01
Background There has been renewed interest in biopharmaceuticals based on plasmid DNA (pDNA) in recent years due to the approval of several veterinary DNA vaccines, on-going clinical trials of human pDNA-based therapies, and significant advances in adjuvants and delivery vehicles that have helped overcome earlier efficacy deficits. With this interest comes the need for high-yield, cost-effective manufacturing processes. To this end, vector engineering is one promising strategy to improve plasmid production. Results In this work, we have constructed a new DNA vaccine vector, pDMB02-GFP, containing the runaway R1 origin of replication. The runaway replication phenotype should result in plasmid copy number amplification after a temperature shift from 30°C to 42°C. However, using Escherichia coli DH5α as a host, we observed that the highest yields of pDMB02-GFP were achieved during constant-temperature culture at 30°C, with a maximum yield of approximately 19 mg pDNA/g DCW being observed. By measuring mRNA and protein levels of the R1 replication initiator protein, RepA, we determined that RepA may be limiting pDMB02-GFP yield at 42°C. A mutant plasmid, pDMB-ATG, was constructed by changing the repA start codon from the sub-optimal GTG to ATG. In cultures of DH5α[pDMB-ATG], temperature-induced plasmid amplification was more dramatic than that observed with pDMB02-GFP, and RepA protein was detectable for several hours longer than in cultures of pDMB02-GFP at 42°C. Conclusions Overall, we have demonstrated that R1-based plasmids can produce high yields of high-quality pDNA without the need for a temperature shift, and have laid the groundwork for further investigation of this class of vectors in the context of plasmid DNA production. PMID:22889338
A novel packaging system for the generation of helper-free oncolytic MVM vector stocks.
Brandenburger, A; Russell, S
1996-10-01
MVM-based autonomous parvoviral vectors have been shown to target the expression of heterologous genes in neoplastic cells and are therefore of interest for cancer gene therapy. The traditional method for production of parvoviral vectors requires the cotransfection of vector and helper plasmids into MVM-permissive cell lines, but recombination between the cotransfected plasmids invariably gives rise to vector stocks that are heavily contaminated with wild-type MVM. Therefore, to minimise recombination between the vector and helper genomes we have utilised a cell line in which the MVM helper functions are expressed inducibly from a modified MVM genome that is stably integrated into the host cell chromosome. Using this MVM packaging cell line, we could reproducibly generate MVM vector stocks that contained no detectable helper virus.
Design and construction of functional AAV vectors.
Gray, John T; Zolotukhin, Serge
2011-01-01
Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.
GeneGuard: A modular plasmid system designed for biosafety.
Wright, Oliver; Delmans, Mihails; Stan, Guy-Bart; Ellis, Tom
2015-03-20
Synthetic biology applications in biosensing, bioremediation, and biomining envision the use of engineered microbes beyond a contained laboratory. Deployment of such microbes in the environment raises concerns of unchecked cellular proliferation or unwanted spread of synthetic genes. While antibiotic-resistant plasmids are the most utilized vectors for introducing synthetic genes into bacteria, they are also inherently insecure, acting naturally to propagate DNA from one cell to another. To introduce security into bacterial synthetic biology, we here took on the task of completely reformatting plasmids to be dependent on their intended host strain and inherently disadvantageous for others. Using conditional origins of replication, rich-media compatible auxotrophies, and toxin-antitoxin pairs we constructed a mutually dependent host-plasmid platform, called GeneGuard. In this, replication initiators for the R6K or ColE2-P9 origins are provided in trans by a specified host, whose essential thyA or dapA gene is translocated from a genomic to a plasmid location. This reciprocal arrangement is stable for at least 100 generations without antibiotic selection and is compatible for use in LB medium and soil. Toxin genes ζ or Kid are also employed in an auxiliary manner to make the vector disadvantageous for strains not expressing their antitoxins. These devices, in isolation and in concert, severely reduce unintentional plasmid propagation in E. coli and B. subtilis and do not disrupt the intended E. coli host's growth dynamics. Our GeneGuard system comprises several versions of modular cargo-ready vectors, along with their requisite genomic integration cassettes, and is demonstrated here as an efficient vector for heavy-metal biosensors.
Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding
2011-07-01
To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.
Cottell, Jennifer L; Webber, Mark A; Piddock, Laura J V
2012-09-01
The treatment of infections caused by antibiotic-resistant bacteria is one of the great challenges faced by clinicians in the 21st century. Antibiotic resistance genes are often transferred between bacteria by mobile genetic vectors called plasmids. It is commonly believed that removal of antibiotic pressure will reduce the numbers of antibiotic-resistant bacteria due to the perception that carriage of resistance imposes a fitness cost on the bacterium. This study investigated the ability of the plasmid pCT, a globally distributed plasmid that carries an extended-spectrum-β-lactamase (ESBL) resistance gene (bla(CTX-M-14)), to persist and disseminate in the absence of antibiotic pressure. We investigated key attributes in plasmid success, including conjugation frequencies, bacterial-host growth rates, ability to cause infection, and impact on the fitness of host strains. We also determined the contribution of the bla(CTX-M-14) gene itself to the biology of the plasmid and host bacterium. Carriage of pCT was found to impose no detectable fitness cost on various bacterial hosts. An absence of antibiotic pressure and inactivation of the antibiotic resistance gene also had no effect on plasmid persistence, conjugation frequency, or bacterial-host biology. In conclusion, plasmids such as pCT have evolved to impose little impact on host strains. Therefore, the persistence of antibiotic resistance genes and their vectors is to be expected in the absence of antibiotic selective pressure regardless of antibiotic stewardship. Other means to reduce plasmid stability are needed to prevent the persistence of these vectors and the antibiotic resistance genes they carry.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Flores, E.; Wolk, C.P.
1985-06-01
Plasmid vectors transferable by conjugation from Escherichia coli to obligately photoautotrophic strains of Anabaena spp. are also transferred to and maintained in heterotrophic, filamentous cyanobacteria of the genus Nostoc. These organisms can be used for the genetic analysis of oxygenic photosynthesis, chromatic adaptation, nitrogen fixation, and heterocyst development.
Genetic control of ColE1 plasmid stability that is independent of plasmid copy number regulation.
Standley, Melissa S; Million-Weaver, Samuel; Alexander, David L; Hu, Shuai; Camps, Manel
2018-06-16
ColE1-like plasmid vectors are widely used for expression of recombinant genes in E. coli. For these vectors, segregation of individual plasmids into daughter cells during cell division appears to be random, making them susceptible to loss over time when no mechanisms ensuring their maintenance are present. Here we use the plasmid pGFPuv in a recA relA strain as a sensitized model to study factors affecting plasmid stability in the context of recombinant gene expression. We find that in this model, plasmid stability can be restored by two types of genetic modifications to the plasmid origin of replication (ori) sequence: point mutations and a novel 269 nt duplication at the 5' end of the plasmid ori, which we named DAS (duplicated anti-sense) ori. Combinations of these modifications produce a range of copy numbers and of levels of recombinant expression. In direct contradiction with the classic random distribution model, we find no correlation between increased plasmid copy number and increased plasmid stability. Increased stability cannot be explained by reduced levels of recombinant gene expression either. Our observations would be more compatible with a hybrid clustered and free-distribution model, which has been recently proposed based on detection of individual plasmids in vivo using super-resolution fluorescence microscopy. This work suggests a role for the plasmid ori in the control of segregation of ColE1 plasmids that is distinct from replication initiation, opening the door for the genetic regulation of plasmid stability as a strategy aimed at enhancing large-scale recombinant gene expression or bioremediation.
Lacks, Sanford A.; Balganesh, Tanjore S.
1988-01-01
Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb malM gene fragment ligated to a 4.4 Kb T.sub.c r DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems.
Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker
2016-09-01
Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.
New ΦBT1 site-specific integrative vectors with neutral phenotype in Streptomyces.
Gonzalez-Quiñonez, Nathaly; López-García, María Teresa; Yagüe, Paula; Rioseras, Beatriz; Pisciotta, Annalisa; Alduina, Rosa; Manteca, Ángel
2016-03-01
Integrative plasmids are one of the best options to introduce genes in low copy and in a stable form into bacteria. The ΦC31-derived plasmids constitute the most common integrative vectors used in Streptomyces. They integrate at different positions (attB and pseudo-attB sites) generating different mutations. The less common ΦBT1-derived vectors integrate at the unique attB site localized in the SCO4848 gene (S. coelicolor genome) or their orthologues in other streptomycetes. This work demonstrates that disruption of SCO4848 generates a delay in spore germination. SCO4848 is co-transcribed with SCO4849, and the spore germination phenotype is complemented by SCO4849. Plasmids pNG1-4 were created by modifying the ΦBT1 integrative vector pMS82 by introducing a copy of SCO4849 under the control of the promoter region of SCO4848. pNG2 and pNG4 also included a copy of the P ermE * in order to facilitate gene overexpression. pNG3 and pNG4 harboured a copy of the bla gene (ampicillin resistance) to facilitate selection in E. coli. pNG1-4 are the only integrative vectors designed to produce a neutral phenotype when they are integrated into the Streptomyces genome. The experimental approach developed in this work can be applied to create phenotypically neutral integrative plasmids in other bacteria.
Sum, Chi Hong; Nafissi, Nafiseh; Slavcev, Roderick A.; Wettig, Shawn
2015-01-01
In combination with novel linear covalently closed (LCC) DNA minivectors, referred to as DNA ministrings, a gemini surfactant-based synthetic vector for gene delivery has been shown to exhibit enhanced delivery and bioavailability while offering a heightened safety profile. Due to topological differences from conventional circular covalently closed (CCC) plasmid DNA vectors, the linear topology of LCC DNA ministrings may present differences with regards to DNA interaction and the physicochemical properties influencing DNA-surfactant interactions in the formulation of lipoplexed particles. In this study, N,N-bis(dimethylhexadecyl)-α,ω-propanediammonium(16-3-16)gemini-based synthetic vectors, incorporating either CCC plasmid or LCC DNA ministrings, were characterized and compared with respect to particle size, zeta potential, DNA encapsulation, DNase sensitivity, and in vitro transgene delivery efficacy. Through comparative analysis, differences between CCC plasmid DNA and LCC DNA ministrings led to variations in the physical properties of the resulting lipoplexes after complexation with 16-3-16 gemini surfactants. Despite the size disparities between the plasmid DNA vectors (CCC) and DNA ministrings (LCC), differences in DNA topology resulted in the generation of lipoplexes of comparable particle sizes. The capacity for ministring (LCC) derived lipoplexes to undergo complete counterion release during lipoplex formation contributed to improved DNA encapsulation, protection from DNase degradation, and in vitro transgene delivery. PMID:26561857
GoldenBraid: An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules
Sarrion-Perdigones, Alejandro; Falconi, Erica Elvira; Zandalinas, Sara I.; Juárez, Paloma; Fernández-del-Carmen, Asun; Granell, Antonio; Orzaez, Diego
2011-01-01
Synthetic Biology requires efficient and versatile DNA assembly systems to facilitate the building of new genetic modules/pathways from basic DNA parts in a standardized way. Here we present GoldenBraid (GB), a standardized assembly system based on type IIS restriction enzymes that allows the indefinite growth of reusable gene modules made of standardized DNA pieces. The GB system consists of a set of four destination plasmids (pDGBs) designed to incorporate multipartite assemblies made of standard DNA parts and to combine them binarily to build increasingly complex multigene constructs. The relative position of type IIS restriction sites inside pDGB vectors introduces a double loop (“braid”) topology in the cloning strategy that allows the indefinite growth of composite parts through the succession of iterative assembling steps, while the overall simplicity of the system is maintained. We propose the use of GoldenBraid as an assembly standard for Plant Synthetic Biology. For this purpose we have GB-adapted a set of binary plasmids for A. tumefaciens-mediated plant transformation. Fast GB-engineering of several multigene T-DNAs, including two alternative modules made of five reusable devices each, and comprising a total of 19 basic parts are also described. PMID:21750718
GoldenBraid: an iterative cloning system for standardized assembly of reusable genetic modules.
Sarrion-Perdigones, Alejandro; Falconi, Erica Elvira; Zandalinas, Sara I; Juárez, Paloma; Fernández-del-Carmen, Asun; Granell, Antonio; Orzaez, Diego
2011-01-01
Synthetic Biology requires efficient and versatile DNA assembly systems to facilitate the building of new genetic modules/pathways from basic DNA parts in a standardized way. Here we present GoldenBraid (GB), a standardized assembly system based on type IIS restriction enzymes that allows the indefinite growth of reusable gene modules made of standardized DNA pieces. The GB system consists of a set of four destination plasmids (pDGBs) designed to incorporate multipartite assemblies made of standard DNA parts and to combine them binarily to build increasingly complex multigene constructs. The relative position of type IIS restriction sites inside pDGB vectors introduces a double loop ("braid") topology in the cloning strategy that allows the indefinite growth of composite parts through the succession of iterative assembling steps, while the overall simplicity of the system is maintained. We propose the use of GoldenBraid as an assembly standard for Plant Synthetic Biology. For this purpose we have GB-adapted a set of binary plasmids for A. tumefaciens-mediated plant transformation. Fast GB-engineering of several multigene T-DNAs, including two alternative modules made of five reusable devices each, and comprising a total of 19 basic parts are also described.
Fu, Lixia; Lu, Chengping
2013-06-01
Bacterial ghost is a novel vaccine platform, and its safe and efficient production depends largely upon a suitable and functional vector. In this study, a series of temperature-inducible plasmids, carrying Phix174 lysis gene E and/or staphylococcal nuclease A (SNA) gene, were constructed and evaluated in Escherichia coli. The results showed that the direct product of SNA (pBV220-SNA) could degrade the plasmid and genomic DNA of E. coli while the fusion product of gene E and partial Cro gene (pKF396M-2) lost the ability to lyse the host strain. The insertion of enhancer T7g10 elements and Shine-Dalgarno box (ESD) between them (pKF396M-3) could resume the function of gene E. Using plasmid pKF396M-4 with gene E and SNA, respectively, under the immediate control of promoter pR and pL, the remnant plasmids and genomic DNA of E. coli were eliminated, and the rates of inactivation increased by two orders of magnitude over that obtained with the exclusive use of E-mediated lysis plasmid. By substituting these two genes with customized multiple cloning sites sequences, the plasmid could be modified to a dual expression vector (pKF396M-5).
Characterization of Endogenous Plasmids from Lactobacillus salivarius UCC118▿ †
Fang, Fang; Flynn, Sarah; Li, Yin; Claesson, Marcus J.; van Pijkeren, Jan-Peter; Collins, J. Kevin; van Sinderen, Douwe; O'Toole, Paul W.
2008-01-01
The genome of Lactobacillus salivarius UCC118 comprises a 1.83-Mb chromosome, a 242-kb megaplasmid (pMP118), and two smaller plasmids of 20 kb (pSF118-20) and 44 kb (pSF118-44). Annotation and bioinformatic analyses suggest that both of the smaller plasmids replicate by a theta replication mechanism. Furthermore, it appears that they are transmissible, although neither possesses a complete set of conjugation genes. Plasmid pSF118-20 encodes a toxin-antitoxin system composed of pemI and pemK homologs, and this plasmid could be cured when PemI was produced in trans. The minimal replicon of pSF118-20 was determined by deletion analysis. Shuttle vector derivatives of pSF118-20 were generated that included the replication region (pLS203) and the replication region plus mobilization genes (pLS208). The plasmid pLS203 was stably maintained without selection in Lactobacillus plantarum, Lactobacillus fermentum, and the pSF118-20-cured derivative strain of L. salivarius UCC118 (strain LS201). Cloning in pLS203 of genes encoding luciferase and green fluorescent protein, and expression from a constitutive L. salivarius promoter, demonstrated the utility of this vector for the expression of heterologous genes in Lactobacillus. This study thus expands the knowledge base and vector repertoire of probiotic lactobacilli. PMID:18390685
AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.
Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A
2017-06-01
Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.
Optoelectronic Inner-Product Neural Associative Memory
NASA Technical Reports Server (NTRS)
Liu, Hua-Kuang
1993-01-01
Optoelectronic apparatus acts as artificial neural network performing associative recall of binary images. Recall process is iterative one involving optical computation of inner products between binary input vector and one or more reference binary vectors in memory. Inner-product method requires far less memory space than matrix-vector method.
Lacks, S.A.; Balganesh, T.S.
1985-02-19
Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb ma1M gene fragment ligated to a 4.4 Kb Tcr DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems. 5 figs., 2 tabs.
Zhu, Weinan; Wang, Jin; Zhu, Yongzhang; Tang, Biao; Zhang, Yunyi; He, Ping; Zhang, Yan; Liu, Boyu; Guo, Xiaokui; Zhao, Guoping; Qin, Jinhong
2015-02-15
The genome of pathogenic Leptospira interrogans contains two chromosomes. Plasmids and prophages are known to play specific roles in gene transfer in bacteria and can potentially serve as efficient genetic tools in these organisms. Although plasmids and prophage remnants have recently been reported in Leptospira species, their characteristics and potential applications in leptospiral genetic transformation systems have not been fully evaluated. Three extrachromosomal replicons designated lcp1 (65,732 bp), lcp2 (56,757 bp), and lcp3 (54,986 bp) in the L. interrogans serovar Linhai strain 56609 were identified through whole genome sequencing. All three replicons were stable outside of the bacterial chromosomes. Phage particles were observed in the culture supernatant of 56609 after mitomycin C induction, and lcp3, which contained phage-related genes, was considered to be an inducible prophage. L. interrogans-Escherichia coli shuttle vectors, constructed with the predicted replication elements of single rep or rep combined with parAB loci from the three plasmids were shown to successfully transform into both saprophytic and pathogenic Leptospira species, suggesting an essential function for rep genes in supporting auto-replication of the plasmids. Additionally, a wide distribution of homologs of the three rep genes was identified in L. interrogans isolates, and correlation tests showed that the transformability of the shuttle vectors in L. interrogans isolates depended, to certain extent, on genetic compatibility between the rep sequences of both plasmid and host. Three extrachromosomal replicons co-exist in L. interrogans, one of which we consider to be an inducible prophage. The vectors constructed with the rep genes of the three replicons successfully transformed into saprophytic and pathogenic Leptospira species alike, but this was partly dependent on genetic compatibility between the rep sequences of both plasmid and host.
Meng, Jianzhou; Wang, Huiyan; Liu, Xiangmei; Lin, Jianqun; Pang, Xin; Lin, Jianqiang
2013-10-01
The genetic improvement of biomining bacteria including Acidithiobacillus caldus could facilitate the bioleaching process of sulfur-containing minerals. However, the available vectors for use in A. caldus are very scanty and limited to relatively large broad-host-range IncQ plasmids. In this study, a set of small, mobilizable plasmid vectors (pBBR1MCS-6, pMSD1 and pMSD2) were constructed based on plasmid pBBR1MCS-2, which does not belong to the IncQ, IncW, or IncP groups. The function of the tac promoter on 5.8-kb pMSD2 was determined by inserting a kanamycin-resistant reporter gene. The resulting recombinant pMSD2-Km was successfully transferred by conjugation into A. caldus MTH-04 with transfer frequency of 1.38±0.64×10(-5). The stability and plasmid copy number of pMSD2-Km in A. caldus MTH-04 were 75±2.7% and 5-6 copies per cell, respectively. By inserting an arsABC operon into pMSD2, an arsenic-resistant recombinant pMSD2-As was constructed and transferred into A. caldus MTH-04 by conjugation. The arsenic tolerance of A. caldus MTH-04 containing pMSD2-As was obviously increased up to 45mM of NaAsO2. These vectors could be applied in genetic improvement of A. caldus as well as other bioleaching bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.
Ku, Hye-Jin; Park, Myeong Soo; Lee, Ju-Hoon
2015-01-01
A 2.1-kb plasmid was previously isolated from Weissella cibaria KLC140 in kimchi and cloned into pUC19 along with the slpA and gfp genes, resulting in an 8.6-kb pKWCSLGFP construct for use as a novel surface display vector. To reduce the size of the vector, the minimal replicon of pKW2124 was determined. The pKW2124 plasmid contains a putative origin of replication (ori), a potential ribosomal binding site (RBS), and the repA gene encoding a plasmid replication protein. To conduct the minimal replicon experiment, four different PCR products (MR1, ori+RBS+repA; MR2, RBS+repA; MR2’, repA; MR3, fragment of repA) were obtained and cloned into pUC19 (pKUCm1, pKUCm2, pKUCm2’, and pKUCm3, respectively) containing the chloramphenicol acetyltransferase (CAT) gene. These constructed vectors were electroporated into W. confusa ATCC 10881 with different transformation efficiencies of 1.5 × 105 CFU/μg, 1.3 × 101 CFU/μg, and no transformation, respectively, suggesting that the putative ori, RBS, and repA gene are essential for optimum plasmid replication. Subsequent segregational plasmid stability testing of pKUCm1 and pKUCm2 showed that the vector pKUCm1 is highly stable up to 100 generations but pKUCm2 was completely lost after 60 generations, suggesting that the putative ori may be important for plasmid stability in the host strain. In addition, a host range test of pKUCm1 revealed that it has a broad host range spectrum including Weissella, Lactococcus, Leuconostoc, and even Lactobacillus. To verify the application of pKUCm1, the β-galactosidase gene and its promoter region from W. cibaria KSD1 were cloned in the vector, resulting in pKUGal. Expression of the β-galactosidase gene was confirmed using blue-white screening after IPTG induction. The small and stable pKUGal vector will be useful for gene transfer, expression, and manipulation in the Weissella genome and in other lactic acid bacteria. PMID:25691882
Tagliavia, Marcello; Cuttitta, Angela
2016-01-01
High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.
Multiclass Reduced-Set Support Vector Machines
NASA Technical Reports Server (NTRS)
Tang, Benyang; Mazzoni, Dominic
2006-01-01
There are well-established methods for reducing the number of support vectors in a trained binary support vector machine, often with minimal impact on accuracy. We show how reduced-set methods can be applied to multiclass SVMs made up of several binary SVMs, with significantly better results than reducing each binary SVM independently. Our approach is based on Burges' approach that constructs each reduced-set vector as the pre-image of a vector in kernel space, but we extend this by recomputing the SVM weights and bias optimally using the original SVM objective function. This leads to greater accuracy for a binary reduced-set SVM, and also allows vectors to be 'shared' between multiple binary SVMs for greater multiclass accuracy with fewer reduced-set vectors. We also propose computing pre-images using differential evolution, which we have found to be more robust than gradient descent alone. We show experimental results on a variety of problems and find that this new approach is consistently better than previous multiclass reduced-set methods, sometimes with a dramatic difference.
A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.
Pappas, Christopher J; Benaroudj, Nadia; Picardeau, Mathieu
2015-05-01
Leptospirosis, an emerging zoonotic disease, remains poorly understood because of a lack of genetic manipulation tools available for pathogenic leptospires. Current genetic manipulation techniques include insertion of DNA by random transposon mutagenesis and homologous recombination via suicide vectors. This study describes the construction of a shuttle vector, pMaORI, that replicates within saprophytic, intermediate, and pathogenic leptospires. The shuttle vector was constructed by the insertion of a 2.9-kb DNA segment including the parA, parB, and rep genes into pMAT, a plasmid that cannot replicate in Leptospira spp. and contains a backbone consisting of an aadA cassette, ori R6K, and oriT RK2/RP4. The inserted DNA segment was isolated from a 52-kb region within Leptospira mayottensis strain 200901116 that is not found in the closely related strain L. mayottensis 200901122. Because of the size of this region and the presence of bacteriophage-like proteins, it is possible that this region is a result of a phage-related genomic island. The stability of the pMaORI plasmid within pathogenic strains was tested by passaging cultures 10 times without selection and confirming the presence of pMaORI. Concordantly, we report the use of trans complementation in the pathogen Leptospira interrogans. Transformation of a pMaORI vector carrying a functional copy of the perR gene in a null mutant background restores the expression of PerR and susceptibility to hydrogen peroxide comparable to that of wild-type cells. In conclusion, we demonstrate the replication of a stable plasmid vector in a large panel of Leptospira strains, including pathogens. The shuttle vector described will expand our ability to perform genetic manipulation of Leptospira spp. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R
2004-07-01
The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.
High-efficiency induction of soybean hairy roots and propagation of the soybean cyst nematode.
Cho, H J; Farrand, S K; Noel, G R; Widholm, J M
2000-01-01
Cotyledon explants of 10 soybean [Glycine max (L.) Merr.] cultivars were inoculated with Agrobacterium rhizogenes strain K599 with and without binary vectors pBI121 or pBINm-gfp5-ER possessing both neomycin phosphotransferase II (nptII) and beta-glucuronidase (gus) or nptII and green fluorescent protein (gfp) genes, respectively. Hairy roots were produced from the wounded surface of 54-95% of the cotyledon explants on MXB selective medium containing 200 microg ml(-1) kanamycin and 500 microg ml(-1) carbenicillin. Putative individual transformed hairy roots were identified by cucumopine analysis and were screened for transgene incorporation using polymerase chain reaction. All of the roots tested were found to be co-transformed with T-DNA from the Ri-plasmid and the transgene from the binary vectors. Southern blot analysis confirmed the presence of the 35S-gfp5 gene in the plant genomes. Transgene expression was also confirmed by histochemical GUS assay and Western blot analysis for the GFP. Attempts to induce shoot formation from the hairy roots failed. Infection of hairy roots of the soybean cyst nematode (Heterodera glycines Ichinohe)-susceptible cultivar, Williams 82, with eggs of H. glycines race 1, resulted in the development of mature cysts about 4-5 weeks after inoculation. Thus the soybean cyst nematode could complete its entire life cycle in transformed soybean hairy-root cultures expressing GFP. This system should be ideal for testing genes that might impart resistance to soybean cyst nematode.
Erickson, J. R.; Johnston, M.
1993-01-01
We describe a technique that facilitates the isolation of yeast genes that are difficult to clone. This technique utilizes a plasmid vector that rescues lambda clones as yeast centromere plasmids. The source of these lambda clones is a set of clones whose location in the yeast genome has been determined by L. Riles et al. in 1993. The Esherichia coli-yeast shuttle plasmid carries URA3, ARS4 and CEN6, and contains DNA fragments from the lambda vector that flank the cloned yeast insert. When yeast is cotransformed with linearized plasmid and lambda clone DNA, Ura(+) transformants are obtained by a recombination event between the lambda clone and the plasmid vector that generates an autonomously replicating plasmid containing the cloned yeast DNA sequences. Genes whose genetic map positions are known can easily be identified and recovered in this plasmid by testing only those lambda clones that map to the relevant region of the yeast genome for their ability to complement the mutant phenotype. This technique facilitates the isolation of yeast genes that resist cloning either because (1) they are underrepresented in yeast genomic libraries amplified in E. coli, (2) they provide phenotypes that are too marginal to allow selection of the gene by genetic complementation or (3) they provide phenotypes that are laborious to score. We demonstrate the utility of this technique by isolating three genes, GAL83, SSN2 and MAK7, each of which presents one of these problems for cloning. PMID:8514124
Vectors for co-expression of an unrestricted number of proteins
Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad
2007-01-01
A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810
Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi
2012-01-01
TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.
2012-01-01
Background Lactic acid bacteria (LAB) play an important role in agricultural as well as industrial biotechnology. Development of improved LAB strains using e.g. library approaches is often limited by low transformation efficiencies wherefore one reason could be differences in the DNA methylation patterns between the Escherichia coli intermediate host for plasmid amplification and the final LAB host. In the present study, we examined the influence of DNA methylation on transformation efficiency in LAB and developed a direct cloning approach for Lactobacillus plantarum CD033. Therefore, we propagated plasmid pCD256 in E. coli strains with different dam/dcm-methylation properties. The obtained plasmid DNA was purified and transformed into three different L. plantarum strains and a selection of other LAB species. Results Best transformation efficiencies were obtained using the strain L. plantarum CD033 and non-methylated plasmid DNA. Thereby we achieved transformation efficiencies of ~ 109 colony forming units/μg DNA in L. plantarum CD033 which is in the range of transformation efficiencies reached with E. coli. Based on these results, we directly transformed recombinant expression vectors received from PCR/ligation reactions into L. plantarum CD033, omitting plasmid amplification in E. coli. Also this approach was successful and yielded a sufficient number of recombinant clones. Conclusions Transformation efficiency of L. plantarum CD033 was drastically increased when non-methylated plasmid DNA was used, providing the possibility to generate expression libraries in this organism. A direct cloning approach, whereby ligated PCR-products where successfully transformed directly into L. plantarum CD033, obviates the construction of shuttle vectors containing E. coli-specific sequences, as e.g. a ColEI origin of replication, and makes amplification of these vectors in E. coli obsolete. Thus, plasmid constructs become much smaller and occasional structural instability or mutagenesis during E. coli propagation is excluded. The results of our study provide new genetic tools for L. plantarum which will allow fast, forward and systems based genetic engineering of this species. PMID:23098256
DNASU plasmid and PSI:Biology-Materials repositories: resources to accelerate biological research
Seiler, Catherine Y.; Park, Jin G.; Sharma, Amit; Hunter, Preston; Surapaneni, Padmini; Sedillo, Casey; Field, James; Algar, Rhys; Price, Andrea; Steel, Jason; Throop, Andrea; Fiacco, Michael; LaBaer, Joshua
2014-01-01
The mission of the DNASU Plasmid Repository is to accelerate research by providing high-quality, annotated plasmid samples and online plasmid resources to the research community through the curated DNASU database, website and repository (http://dnasu.asu.edu or http://dnasu.org). The collection includes plasmids from grant-funded, high-throughput cloning projects performed in our laboratory, plasmids from external researchers, and large collections from consortia such as the ORFeome Collaboration and the NIGMS-funded Protein Structure Initiative: Biology (PSI:Biology). Through DNASU, researchers can search for and access detailed information about each plasmid such as the full length gene insert sequence, vector information, associated publications, and links to external resources that provide additional protein annotations and experimental protocols. Plasmids can be requested directly through the DNASU website. DNASU and the PSI:Biology-Materials Repositories were previously described in the 2010 NAR Database Issue (Cormier, C.Y., Mohr, S.E., Zuo, D., Hu, Y., Rolfs, A., Kramer, J., Taycher, E., Kelley, F., Fiacco, M., Turnbull, G. et al. (2010) Protein Structure Initiative Material Repository: an open shared public resource of structural genomics plasmids for the biological community. Nucleic Acids Res., 38, D743–D749.). In this update we will describe the plasmid collection and highlight the new features in the website redesign, including new browse/search options, plasmid annotations and a dynamic vector mapping feature that was developed in collaboration with LabGenius. Overall, these plasmid resources continue to enable research with the goal of elucidating the role of proteins in both normal biological processes and disease. PMID:24225319
pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.
Gu, Jingsong; Ye, Chunjiang
2011-03-01
A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.
Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W
2010-08-01
The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.
Survey of Navy Funded Marine Mammal Research and Studies FY 00-01
2001-05-10
protein of canine distemper virus as a reporter system in order to evaluate 103 the humoral response to DNA-mediated vaccination in cetaceans. If...PCR/ RT PCR, DNA cloning and sequencing, etc. Efforts are ongoing to design and clone a vector encoding Canine Distemper Virus, a virus closely...alternative plasmid as our reporter gene delivery vector. This alternate plasmid will encode for Canine Distemper virus genes, closely related to
Genetic transformation of Begonia tuberhybrida by Ri rol genes.
Kiyokawa, S; Kikuchi, Y; Kamada, H; Harada, H
1996-04-01
We have developed an Agrobacterium -mediated transformation system for commercial Begonia species. The leaf explants of Begonia semperflorens, Begonia x hiemalis and B. tuberhybrida were inoculated with Agrobacterium tumefaciens LBA4404 harboring a binary vector pBI121 which contains rolA, B and C genes of an agropine type Ri plasmid (pRiA4b). Kanamycin resistant shoots of B. tuberhybrida were obtained on MS agar medium supplemented with 0.1 mg/l NAA, 0.5 mg/l BA, 500 mg/l claforan and 100 mg/l kanamycin. These shoots exhibited GUS activity and Southern analysis showed a single copy insertion into the genome. When the transgenic plants were transferred to soil, they displayed the phenotype specific to the transgenic plants by A. rhizogenes such as dwarfness, delay of flowering, and wrinkled leaves and petals.
Gay, Glen; Wagner, Drew T.; Keatinge-Clay, Adrian T.; Gay, Darren C.
2014-01-01
The ability to rapidly customize an expression vector of choice is a valuable tool for any researcher involved in high-throughput molecular cloning for protein overexpression. Unfortunately, it is common practice to amend or neglect protein targets if the gene that encodes the protein of interest is incompatible with the multiple-cloning region of a preferred expression vector. To address this issue, a method was developed to quickly exchange the multiple-cloning region of the popular expression plasmid pET-28 with a ligation-independent cloning cassette, generating pGAY-28. This cassette contains dual inverted restriction sites that reduce false positive clones by generating a linearized plasmid incapable of self-annealing after a single restriction-enzyme digest. We also establish that progressively cooling the vector and insert leads to a significant increase in ligation-independent transformation efficiency, demonstrated by the incorporation of a 10.3 kb insert into the vector. The method reported to accomplish plasmid reconstruction is uniquely versatile yet simple, relying on the strategic placement of primers combined with homologous recombination of PCR products in yeast. PMID:25304917
Adeno-associated virus vectors can be efficiently produced without helper virus.
Matsushita, T; Elliger, S; Elliger, C; Podsakoff, G; Villarreal, L; Kurtzman, G J; Iwaki, Y; Colosi, P
1998-07-01
The purpose of this work was to develop an efficient method for the production of adeno-associated virus (AAV) vectors in the absence of helper virus. The adenovirus regions that mediate AAV vector replication were identified and assembled into a helper plasmid. These included the VA, E2A and E4 regions. When this helper plasmid was cotransfected into 293 cells, along with plasmids encoding the AAV vector, and rep and cap genes, AAV vector was produced as efficiently as when using adenovirus infection as a source of help. CMV-driven constructs expressing the E4orf6 and the 72-M(r), E2A proteins were able to functionally replace the E4 and E2A regions, respectively. Therefore the minimum set of genes required to produce AAV helper activity equivalent to that provided by adenovirus infection consists of, or is a subset of, the following genes: the E4orf6 gene, the 72-M(r), E2A protein gene, the VA RNA genes and the E1 region. AAV vector preparations made with adenovirus and by the helper virus-free method were essentially indistinguishable with respect to particle density, particle to infectivity ratio, capsimer ratio and efficiency of muscle transduction in vivo. Only AAV vector preparations made by the helper virus-free method were not reactive with anti-adenovirus sera.
Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.
2013-01-01
To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
Gritz, L; Davies, J
1983-11-01
The plasmid-borne gene hph coding for hygromycin B phosphotransferase (HPH) in Escherichia coli has been identified and its nucleotide sequence determined. The hph gene is 1026 nucleotides long, coding for a protein with a predicted Mr of 39 000. The hph gene was placed in a shuttle plasmid vector, downstream from the promoter region of the cyc 1 gene of Saccharomyces cerevisiae, and an hph construction containing a single AUG in the 5' noncoding region allowed direct selection following transformation in yeast and in E. coli. Thus the hph gene can be used in cloning vectors for both pro- and eukaryotes.
Lafuente, M J; Petit, T; Gancedo, C
1997-12-22
We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.
2012-01-01
Background While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. Results We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called “Super Sequence”, and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc—linear covalently closed (Tel/TelN-cell), or mini ccc—circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 105 fold lower viability than that seen with the ccc counterpart. Conclusion We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of “minicircle” DNA vectors and virtually eliminate the potential for undesirable vector integration events. PMID:23216697
Nafissi, Nafiseh; Slavcev, Roderick
2012-12-06
While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called "Super Sequence", and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc--linear covalently closed (Tel/TelN-cell), or mini ccc--circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 10(5) fold lower viability than that seen with the ccc counterpart. We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of "minicircle" DNA vectors and virtually eliminate the potential for undesirable vector integration events.
Zhang, Xi; Si, Ying-Jian; Chen, Xing-Hua; Liu, Yao; Gao, Li; Gao, Lei; Peng, Xian-Gui; Wang, Qing-Yu
2008-06-01
This study was aimed to investigate the effect of vcam-1 gene-modified human umbilical cord blood derived stromal cells (CBDSCs) on hematopoietic regulation so as to establish the experimental foundation for further study. The target gene vcam-1 was cloned into the shuttle plasmid with the report gene GFP. The recombinant shuttle plasmid was transformed into BJ5183 bacteria to recombine with backbone vector pAdeasy-l, and the recombinant adenoviral vector ad-vcam-1-gfp was confirmed after transfection with CBDSCs. The results indicated that two fragments of about 9 kb and 2 kb were obtained after digestion of recombinant plasmid pAdTrack-vcam-1 with NotIand XhoI, and single fragment of 600 bp was obtained after amplification with PCR; two fragments of about 31 kb and 4 kb were obtained after digestion of recombinant plasmid pad-vcam-1-gfp with PacI, which suggested a successful homologous recombination. The expression of vcam-1 gene in ad-vcam-1-gfp transfected CBDSCs could be detected by immunocytochemistry, RT-PCR and fluorescent microscopy. It is concluded that the recombinant adenoviral vector ad-vcam-1-gfp has been constructed successfully, and the expression of vcam-1 is up-regulated in CBDSCs transfected by gene ad-vcam-1-gfp.
Emmerling, Verena V; Pegel, Antje; Milian, Ernest G; Venereo-Sanchez, Alina; Kunz, Marion; Wegele, Jessica; Kamen, Amine A; Kochanek, Stefan; Hoerer, Markus
2016-02-01
Viral vectors used for gene and oncolytic therapy belong to the most promising biological products for future therapeutics. Clinical success of recombinant adeno-associated virus (rAAV) based therapies raises considerable demand for viral vectors, which cannot be met by current manufacturing strategies. Addressing existing bottlenecks, we improved a plasmid system termed rep/cap split packaging and designed a minimal plasmid encoding adenoviral helper function. Plasmid modifications led to a 12-fold increase in rAAV vector titers compared to the widely used pDG standard system. Evaluation of different production approaches revealed superiority of processes based on anchorage- and serum-dependent HEK293T cells, exhibiting about 15-fold higher specific and volumetric productivity compared to well-established suspension cells cultivated in serum-free medium. As for most other viral vectors, classical stirred-tank bioreactor production is thus still not capable of providing drug product of sufficient amount. We show that manufacturing strategies employing classical surface-providing culture systems can be successfully transferred to the new fully-controlled, single-use bioreactor system Integrity(TM) iCELLis(TM) . In summary, we demonstrate substantial bioprocess optimizations leading to more efficient and scalable production processes suggesting a promising way for flexible large-scale rAAV manufacturing. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Technical Reports Server (NTRS)
Liu, Hua-Kuang (Inventor); Awwal, Abdul A. S. (Inventor); Karim, Mohammad A. (Inventor)
1993-01-01
An inner-product array processor is provided with thresholding of the inner product during each iteration to make more significant the inner product employed in estimating a vector to be used as the input vector for the next iteration. While stored vectors and estimated vectors are represented in bipolar binary (1,-1), only those elements of an initial partial input vector that are believed to be common with those of a stored vector are represented in bipolar binary; the remaining elements of a partial input vector are set to 0. This mode of representation, in which the known elements of a partial input vector are in bipolar binary form and the remaining elements are set equal to 0, is referred to as trinary representation. The initial inner products corresponding to the partial input vector will then be equal to the number of known elements. Inner-product thresholding is applied to accelerate convergence and to avoid convergence to a negative input product.
The evolution of heart gene delivery vectors.
Wasala, Nalinda B; Shin, Jin-Hong; Duan, Dongsheng
2011-10-01
Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. Copyright © 2011 John Wiley & Sons, Ltd.
The evolution of heart gene delivery vectors
Wasala, Nalinda B.; Shin, Jin-Hong; Duan, Dongsheng
2012-01-01
Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. PMID:21837689
Alpert, Carl-Alfred; Crutz-Le Coq, Anne-Marie; Malleret, Christine; Zagorec, Monique
2003-01-01
The complete nucleotide sequence of the 13-kb plasmid pRV500, isolated from Lactobacillus sakei RV332, was determined. Sequence analysis enabled the identification of genes coding for a putative type I restriction-modification system, two genes coding for putative recombinases of the integrase family, and a region likely involved in replication. The structural features of this region, comprising a putative ori segment containing 11- and 22-bp repeats and a repA gene coding for a putative initiator protein, indicated that pRV500 belongs to the pUCL287 subfamily of theta-type replicons. A 3.7-kb fragment encompassing this region was fused to an Escherichia coli replicon to produce the shuttle vector pRV566 and was observed to be functional in L. sakei for plasmid replication. The L. sakei replicon alone could not support replication in E. coli. Plasmid pRV500 and its derivative pRV566 were determined to be at very low copy numbers in L. sakei. pRV566 was maintained at a reasonable rate over 20 generations in several lactobacilli, such as Lactobacillus curvatus, Lactobacillus casei, and Lactobacillus plantarum, in addition to L. sakei, making it an interesting basis for developing vectors. Sequence relationships with other plasmids are described and discussed. PMID:12957947
Takala, T M; Saris, P E J; Tynkkynen, S S H
2003-01-01
A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.
Construction of pTM series plasmids for gene expression in Brucella species.
Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing
2016-04-01
Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.
A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads
Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka; ...
2018-02-01
In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less
A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka
In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less
Saubi, Narcís; Gea-Mallorquí, Ester; Ferrer, Pau; Hurtado, Carmen; Sánchez-Úbeda, Sara; Eto, Yoshiki; Gatell, Josep M; Hanke, Tomáš; Joseph, Joan
2014-01-01
In this study, we have engineered a new mycobacterial vaccine design by using an antibiotic-free plasmid selection system. We assembled a novel Escherichia coli (E. coli)–mycobacterial shuttle plasmid p2auxo.HIVA, expressing the HIV-1 clade A immunogen HIVA. This shuttle vector employs an antibiotic resistance-free mechanism for plasmid selection and maintenance based on glycine complementation in E. coli and lysine complementation in mycobacteria. This plasmid was first transformed into glycine auxotroph of E. coli strain and subsequently transformed into lysine auxotroph of Mycobacterium bovis BCG strain to generate vaccine BCG.HIVA2auxo. We demonstrated that the episomal plasmid p2auxo.HIVA was stable in vivo over a 7-week period and genetically and phenotypically characterized the BCG.HIVA2auxo vaccine strain. The BCG.HIVA2auxo vaccine in combination with modified vaccinia virus Ankara (MVA). HIVA was safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. Polyfunctional HIV-1-specific CD8+ T cells, which produce interferon-γ and tumor necrosis factor-α and express the degranulation marker CD107a, were induced. Thus, we engineered a novel, safer, good laboratory practice–compatible BCG-vectored vaccine using prototype immunogen HIVA. This antibiotic-free plasmid selection system based on “double” auxotrophic complementation might be a new mycobacterial vaccine platform to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective response soon after birth. PMID:26015961
Perkins, Archibald S.; Kirschmeier, Paul T.; Gattoni-Celli, Sebastiano; Weinstein, I. Bernard
1983-01-01
We have developed a transfection vector for animal cells that contains long terminal repeat (LTR) sequences to promote expression. Plasmid p101/101, a derivative of plasmid pBR322 containing the complete Moloney murine sarcoma virus genome, was cut with restriction enzymes and religated so that both the 5′ and 3′ LTRs were retained and all but about 700 base pairs of the intervening viral sequences were removed. To test this vector, the Escherichia coli gene gpt was cloned into a unique PstI site, between the two LTRs, with guanine and cytosine tailing, a method that can be generalized for insertion of any DNA segment into this vector. When DNA from recombinant plasmids in which the gpt gene was inserted in the same transcriptional polarity as the LTR sequences was transfected onto murine or rat fibroblast cultures, we obtained a high yield of Gpt+ colonies. However, plasmid constructs with the gpt gene in the opposite polarity were virtually devoid of activity. With gpt in the proper orientation, restriction enzyme cuts within the LTRs or between the 5′ LTR and the gpt gene reduced transfection by more than 98%, whereas a cut between the gpt gene and the 3′ LTR gave an 80% reduction in activity. Thus, both 5′ and 3′ LTR sequences are essential for optimal gpt expression, although the 5′ LTR appears to play a more important role. When the LTR-gpt plasmid was transfected onto murine leukemia virus-infected mouse fibroblasts, we obtained evidence that RNA copies became pseudotyped into viral particles which could transfer the Gpt+ phenotype into rodent cells with extremely high efficiency. This vector should prove useful for high-efficiency transduction of a variety of genes in mammalian cells. Images PMID:6308426
Toda, Hiroshi; Itoh, Nobuya
2017-01-01
The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli - Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 ( rhsmo ) and alcohol dehydrogenase gene from Leifsonia sp. S749 ( lsadh ), in K . rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase ( gapdh ) promotor. The RhSMO-LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent-water biphasic reaction system to efficiently convert styrene into ( S )-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells.
Binder, Andreas; Lambert, Jayne; Morbitzer, Robert; Popp, Claudia; Ott, Thomas; Lahaye, Thomas; Parniske, Martin
2014-01-01
The Golden Gate (GG) modular assembly approach offers a standardized, inexpensive and reliable way to ligate multiple DNA fragments in a pre-defined order in a single-tube reaction. We developed a GG based toolkit for the flexible construction of binary plasmids for transgene expression in plants. Starting from a common set of modules, such as promoters, protein tags and transcribed regions of interest, synthetic genes are assembled, which can be further combined to multigene constructs. As an example, we created T-DNA constructs encoding multiple fluorescent proteins targeted to distinct cellular compartments (nucleus, cytosol, plastids) and demonstrated simultaneous expression of all genes in Nicotiana benthamiana, Lotus japonicus and Arabidopsis thaliana. We assembled an RNA interference (RNAi) module for the construction of intron-spliced hairpin RNA constructs and demonstrated silencing of GFP in N. benthamiana. By combination of the silencing construct together with a codon adapted rescue construct into one vector, our system facilitates genetic complementation and thus confirmation of the causative gene responsible for a given RNAi phenotype. As proof of principle, we silenced a destabilized GFP gene (dGFP) and restored GFP fluorescence by expression of a recoded version of dGFP, which was not targeted by the silencing construct. PMID:24551083
Le Pihive, E; Blaha, D; Chenavas, S; Thibault, F; Vidal, D; Valade, E
2009-11-01
Francisella tularensis is the causative agent of tularemia, a zoonotic disease often transmitted to humans by infected animals. The lack of useful specific genetic tools has long hampered the study of F. tularensis subspecies. We identified and characterized two new plasmids, pF242 and pF243, isolated from Francisella philomiragia strains ATCC 25016 and ATCC 25017, respectively. Sequence analysis revealed that pF242 and pF243 are closely related to pC194 and pFNL10 plasmids, respectively. Two generations of pF242- and pF243-based shuttle vectors, harboring several antibiotic resistance markers, were developed. We used the first generation to compare transformation efficiencies in two virulent F. tularensis subspecies. We found that electroporation was more efficient than cryotransformation: almost all vectors tested were successfully introduced by electroporation into Francisella strains with a high level of efficiency. The second generation of shuttle vectors, containing a multiple cloning site and/or gfp gene downstream of Francisella groES promotor, was used for GFP production in F. tularensis. The development of new shuttle vectors offers new perspectives in the genetic manipulation of F. tularensis, helping to elucidate the mechanisms underlying its virulence.
Du, Yong-Zhong; Lu, Ping; Yuan, Hong; Zhou, Jian-Ping; Hu, Fu-Qiang
2011-01-01
Quaternary complexes with condensed core of plasmid DNA, protamine, fish sperm DNA and shell of stearic acid grafted chitosan oligosaccharide (CSO-SA), were prepared. The CSO-SA could self-assemble to form nano-sized micelles in aqueous solution and demonstrated excellent internalization ability of tumor cells. Dynamic light scattering (DLS) measurement and transmission electrostatic microscope (TEM) images showed that quaternary complexes had spherical shape with about 25 nm number average diameter, and the size of quaternary complexes was smaller than that of CSO-SA micelles and CSO-SA micelles/plasmid DNA binary complexes. The transfection efficiencies of quaternary complexes on HEK293 and MCF-7 cells increased with incubation time, and were significantly higher than that of CSO-SA micelles/plasmid DNA binary complexes. The optimal transfection efficiency of quaternary complexes on HEK293 and MCF-7 cells measured by flow cytometer after 96 h was 23.82% and 41.43%, respectively. Whereas, the transfection efficiency of Lipofectamine™ 2000 on HEK293 and MCF-7 cells after 96 h was 32.45% and 33.23%, respectively. The data of luciferease activity measurement showed that the optimal ratio of plasmid DNA:fish sperm DNA:protamine:CSO-SA was 1:1:5:5. The results indicated that the present quaternary complexes were potential non-viral gene delivery system. Copyright © 2010 Elsevier B.V. All rights reserved.
Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors
Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro
2012-01-01
We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107
In vitro expression of erythropoietin by transfected human mesenchymal stromal cells.
Mok, P-L; Cheong, S-K; Leong, C-F; Othman, A
2008-01-01
Mesenchymal stromal cells (MSC) are pluripotent progenitor cells that can be found in human bone marrow (BM). These cells have low immunogenicity and could suppress alloreactive T-cell responses. In the current study, MSC were tested for their capacity to carry and deliver the erythropoietin (EPO) gene in vitro. Expanded BM MSC was transfected with EPO-encoded plasmid pMCV1.2 and EPO-encoded MIDGE (minimalistic immunologically defined gene expression) vector by electroporation. The expressed EPO was used to induce hematopoietic stem cells (HSC) into erythroid colonies. The results showed that the MIDGE vector was more effective and stable than the plasmid (pMCV1.2) in delivering EPO gene into MSC. The supernatants containing EPO obtained from the transfected cell culture were able to induce the differentiation of HSC into erythroid colonies. MSC hold promise as a cell factory for the production of biologic molecules, and MIDGE vector is more effective and stable than the plasmid in nucleofection involving the EPO gene.
A cell engineering strategy to enhance supercoiled plasmid DNA production for gene therapy.
Hassan, Sally; Keshavarz-Moore, Eli; Ward, John
2016-09-01
With the recent revival of the promise of plasmid DNA vectors in gene therapy, a novel synthetic biology approach was used to enhance the quantity, (yield), and quality of the plasmid DNA. Quality was measured by percentage supercoiling and supercoiling density, as well as improving segregational stability in fermentation. We examined the hypothesis that adding a Strong Gyrase binding Site (SGS) would increase DNA gyrase-mediated plasmid supercoiling. SGS from three different replicons, (the Mu bacteriophage and two plasmids, pSC101 and pBR322) were inserted into the plasmid, pUC57. Different sizes of these variants were transformed into E. coli DH5α, and their supercoiling properties and segregational stability measured. A 36% increase in supercoiling density was found in pUC57-SGS, but only when SGS was derived from the Mu phage and was the larger sized version of this fragment. These results were also confirmed at fermentation scale. Total percentage supercoiled monomer was maintained to 85-90%. A twofold increase in plasmid yield was also observed for pUC57-SGS in comparison to pUC57. pUC57-SGS displayed greater segregational stability than pUC57-cer and pUC57, demonstrating a further potential advantage of the SGS site. These findings should augment the potential of plasmid DNA vectors in plasmid DNA manufacture. Biotechnol. Bioeng. 2016;113: 2064-2071. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc.
Cloning-independent plasmid construction for genetic studies in streptococci
Xie, Zhoujie; Qi, Fengxia; Merritt, Justin
2013-01-01
Shuttle plasmids are among the few routinely utilized tools in the Streptococcus mutans genetic system that still require the use of classical cloning methodologies and intermediate hosts for genetic manipulation. Accordingly, it typically requires considerably less time and effort to introduce mutations onto the S. mutans chromosome than it does to construct shuttle vectors for expressing genes in trans. Occasionally, shuttle vector constructs also exhibit toxicity in E. coli, which prevents their proper assembly. To circumvent these limitations, we modified a prolonged overlap extension PCR (POE-PCR) protocol to facilitate direct plasmid assembly in S. mutans. Using solely PCR, we created the reporter vector pZX7, which contains a single minimal streptococcal replication origin and harbors a spectinomycin resistance cassette and the gusA gene encoding β-glucuronidase. We compared the efficiency of pZX7 assembly using multiple strains of S. mutans and were able to obtain from 5×103 – 2×105 CFU/μg PCR product. Likewise, we used pZX7 to further demonstrate that Streptococcus sanguinis and Streptococcus gordonii are also excellent hosts for cloning-independent plasmid assembly, which suggests that this system is likely to function in numerous other streptococci. Consequently, it should be possible to completely forgo the use of E. coli – Streptococcus shuttle vectors in many streptococcal species, thereby decreasing the time and effort required to assemble constructs and eliminating any toxicity issues associated with intermediate hosts. PMID:23673081
Cloning-independent plasmid construction for genetic studies in streptococci.
Xie, Zhoujie; Qi, Fengxia; Merritt, Justin
2013-08-01
Shuttle plasmids are among the few routinely utilized tools in the Streptococcus mutans genetic system that still require the use of classical cloning methodologies and intermediate hosts for genetic manipulation. Accordingly, it typically requires considerably less time and effort to introduce mutations onto the S. mutans chromosome than it does to construct shuttle vectors for expressing genes in trans. Occasionally, shuttle vector constructs also exhibit toxicity in Escherichia coli, which prevents their proper assembly. To circumvent these limitations, we modified a prolonged overlap extension PCR (POE-PCR) protocol to facilitate direct plasmid assembly in S. mutans. Using solely PCR, we created the reporter vector pZX7, which contains a single minimal streptococcal replication origin and harbors a spectinomycin resistance cassette and the gusA gene encoding β-glucuronidase. We compared the efficiency of pZX7 assembly using multiple strains of S. mutans and were able to obtain from 5 × 10³ to 2 × 10⁵ CFU/μg PCR product. Likewise, we used pZX7 to further demonstrate that Streptococcus sanguinis and Streptococcus gordonii are also excellent hosts for cloning-independent plasmid assembly, which suggests that this system is likely to function in numerous other streptococci. Consequently, it should be possible to completely forgo the use of E. coli-Streptococcus shuttle vectors in many streptococcal species, thereby decreasing the time and effort required to assemble constructs and eliminating any toxicity issues associated with intermediate hosts. Copyright © 2013 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Groom, Joseph; Chung, Daehwan; Olson, Daniel G.
2016-01-29
Clostridium thermocellum is a leading candidate for the consolidated bioprocessing of lignocellulosic biomass for the production of fuels and chemicals. A limitation to the engineering of this strain is the availability of stable replicating plasmid vectors for homologous and heterologous expression of genes that provide improved and/or novel pathways for fuel production. Current vectors relay on replicons from mesophilic bacteria and are not stable at the optimum growth temperature of C. thermocellum. To develop more thermostable genetic tools for C. thermocellum, we constructed vectors based on the hyperthermophilic Caldicellulosiruptor bescii replicon pBAS2. Autonomously replicating shuttle vectors based on pBAS2 reproduciblymore » transformed C. thermocellum at 60 °C and were maintained in multiple copy. Promoters, selectable markers and plasmid replication proteins from C. bescii were functional in C. thermocellum. Phylogenetic analyses of the proteins contained on pBAS2 revealed that the replication initiation protein RepL is unique among thermophiles. Lastly, these results suggest that pBAS2 may be a broadly useful replicon for other thermophilic Firmicutes.« less
Santander, Javier; Xin, Wei; Yang, Zhao; Curtiss, Roy
2010-01-01
asdA mutants of Gram-negative bacteria have an obligate requirement for diaminopimelic acid (DAP), which is an essential constituent of the peptidoglycan layer of the cell wall of these organisms. In environments deprived of DAP, i.e., animal tissues, they will undergo lysis. Deletion of the asdA gene has previously been exploited to develop antibiotic-sensitive strains of live attenuated recombinant bacterial vaccines. Introduction of an Asd+ plasmid into a ΔasdA mutant makes the bacterial strain plasmid-dependent. This dependence on the Asd+ plasmid vector creates a balanced-lethal complementation between the bacterial strain and the recombinant plasmid. E. ictaluri is an enteric Gram-negative fish pathogen that causes enteric septicemia in catfish. Because E. ictaluri is a nasal/oral invasive intracellular pathogen, this bacterium is a candidate to develop a bath/oral live recombinant attenuated Edwardsiella vaccine (RAEV) for the catfish aquaculture industry. As a first step to develop an antibiotic-sensitive RAEV strain, we characterized and deleted the E. ictaluri asdA gene. E. ictaluri ΔasdA01 mutants exhibit an absolute requirement for DAP to grow. The asdA gene of E. ictaluri was complemented by the asdA gene from Salmonella. Several Asd+ expression vectors with different origins of replication were transformed into E. ictaluri ΔasdA01. Asd+ vectors were compatible with the pEI1 and pEI2 E. ictaluri native plasmids. The balanced-lethal system was satisfactorily evaluated in vivo. Recombinant GFP, PspA, and LcrV proteins were synthesized by E. ictaluri ΔasdA01 harboring Asd+ plasmids. Here we constructed a balanced-lethal system, which is the first step to develop an antibiotic-sensitive RAEV for the aquaculture industry. PMID:21209920
Santander, Javier; Xin, Wei; Yang, Zhao; Curtiss, Roy
2010-12-29
asdA mutants of gram-negative bacteria have an obligate requirement for diaminopimelic acid (DAP), which is an essential constituent of the peptidoglycan layer of the cell wall of these organisms. In environments deprived of DAP, i.e., animal tissues, they will undergo lysis. Deletion of the asdA gene has previously been exploited to develop antibiotic-sensitive strains of live attenuated recombinant bacterial vaccines. Introduction of an Asd(+) plasmid into a ΔasdA mutant makes the bacterial strain plasmid-dependent. This dependence on the Asd(+) plasmid vector creates a balanced-lethal complementation between the bacterial strain and the recombinant plasmid. E. ictaluri is an enteric gram-negative fish pathogen that causes enteric septicemia in catfish. Because E. ictaluri is a nasal/oral invasive intracellular pathogen, this bacterium is a candidate to develop a bath/oral live recombinant attenuated Edwardsiella vaccine (RAEV) for the catfish aquaculture industry. As a first step to develop an antibiotic-sensitive RAEV strain, we characterized and deleted the E. ictaluri asdA gene. E. ictaluri ΔasdA01 mutants exhibit an absolute requirement for DAP to grow. The asdA gene of E. ictaluri was complemented by the asdA gene from Salmonella. Several Asd(+) expression vectors with different origins of replication were transformed into E. ictaluri ΔasdA01. Asd(+) vectors were compatible with the pEI1 and pEI2 E. ictaluri native plasmids. The balanced-lethal system was satisfactorily evaluated in vivo. Recombinant GFP, PspA, and LcrV proteins were synthesized by E. ictaluri ΔasdA01 harboring Asd(+) plasmids. Here we constructed a balanced-lethal system, which is the first step to develop an antibiotic-sensitive RAEV for the aquaculture industry.
[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].
Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I
1985-11-01
The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.
Chen, Tingfang; Luo, Na; Xie, Huaping; Wu, Xiushan; Deng, Yun
2010-02-01
In an effort to generate a desired expression construct for making heart-specific expression transgenic zebrafish, a Tol2 plasmid, which can drive EGFP reporter gene specifically expressed in the heart, was modified using subcloning technology. An IRES fragment bearing multiple cloning site (MCS) was amplified directly from pIRES2-EGFP plasmid and was inserted between the CMLC2 promoter and EGFP fragment of the pDestTol2CG vector. This recombinant expression plasmid pTol2-CMLC2-IRES-EGFP can drive any interested gene specifically expressed in the zebrafish heart along with EGFP reporter gene. To test the effectiveness of this new expression plasmid, we constructed pTol2-CMLC2-RED-IRES-EGFP plasmid by inserting another reporter gene DsRed-Monome into MCS downstream of the CMLC2 promoter and injected this transgenic recombinant plasmid into one-cell stage embryos of zebrafish. Under fluorescence microscope, both the red fluorescence and the green fluorescence produced by pTol2-CMLC2-RED-IRES-EGFP were detected specifically in the heart tissue in the same expression pattern. This novel expression construct pTol2-CMLC2-IRES-EGFP will become an important tool for our research on identifying heart development candidate genes' function using zebrafish as a model.
Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria
Taton, Arnaud; Unglaub, Federico; Wright, Nicole E.; Zeng, Wei Yue; Paz-Yepes, Javier; Brahamsha, Bianca; Palenik, Brian; Peterson, Todd C.; Haerizadeh, Farzad; Golden, Susan S.; Golden, James W.
2014-01-01
Inspired by the developments of synthetic biology and the need for improved genetic tools to exploit cyanobacteria for the production of renewable bioproducts, we developed a versatile platform for the construction of broad-host-range vector systems. This platform includes the following features: (i) an efficient assembly strategy in which modules released from 3 to 4 donor plasmids or produced by polymerase chain reaction are assembled by isothermal assembly guided by short GC-rich overlap sequences. (ii) A growing library of molecular devices categorized in three major groups: (a) replication and chromosomal integration; (b) antibiotic resistance; (c) functional modules. These modules can be assembled in different combinations to construct a variety of autonomously replicating plasmids and suicide plasmids for gene knockout and knockin. (iii) A web service, the CYANO-VECTOR assembly portal, which was built to organize the various modules, facilitate the in silico construction of plasmids, and encourage the use of this system. This work also resulted in the construction of an improved broad-host-range replicon derived from RSF1010, which replicates in several phylogenetically distinct strains including a new experimental model strain Synechocystis sp. WHSyn, and the characterization of nine antibiotic cassettes, four reporter genes, four promoters, and a ribozyme-based insulator in several diverse cyanobacterial strains. PMID:25074377
Formation of AAV Single Stranded DNA Genome from a Circular Plasmid in Saccharomyces cerevisiae
Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro
2011-01-01
Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3+ clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway. PMID:21853137
Formation of AAV single stranded DNA genome from a circular plasmid in Saccharomyces cerevisiae.
Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro
2011-01-01
Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3(+) clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway.
Plasmid DNA Delivery: Nanotopography Matters.
Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong
2017-12-20
Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.
Sakai, Y; Goh, T K; Tani, Y
1993-06-01
We have developed a transformation system which uses autonomous replicating plasmids for a methylotrophic yeast, Candida boidinii. Two autonomous replication sequences, CARS1 and CARS2, were newly cloned from the genome of C. boidinii. Plasmids having both a CARS fragment and the C. boidinii URA3 gene transformed C. boidinii ura3 cells to Ura+ phenotype at frequencies of up to 10(4) CFU/micrograms of DNA. From Southern blot analysis, CARS plasmids seemed to exist in polymeric forms as well as in monomeric forms in C. boidinii cells. The C. boidinii URA3 gene was overexpressed in C. boidinii on these CARS vectors. CARS1 and CARS2 were found to function as an autonomous replicating element in Saccharomyces cerevisiae as well. Different portions of the CARS1 sequence were needed for autonomous replicating activity in C. boidinii and S. cerevisiae. C. boidinii could also be transformed with vectors harboring a CARS fragment and the S. cerevisiae URA3 gene.
Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y
2016-01-01
Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.
Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus
Rodriguez, Michelle D.; Paul, Zubin; Wood, Charles E.; Rice, Kelly C.; Triplett, Eric W.
2017-01-01
Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus. These three reporter plasmids are available through BEI Resources. PMID:29312199
Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus.
Rodriguez, Michelle D; Paul, Zubin; Wood, Charles E; Rice, Kelly C; Triplett, Eric W
2017-01-01
Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus . These three reporter plasmids are available through BEI Resources.
Methods for Gene Transfer to the Central Nervous System
Kantor, Boris; Bailey, Rachel M.; Wimberly, Keon; Kalburgi, Sahana N.; Gray, Steven J.
2015-01-01
Gene transfer is an increasingly utilized approach for research and clinical applications involving the central nervous system (CNS). Vectors for gene transfer can be as simple as an unmodified plasmid, but more commonly involve complex modifications to viruses to make them suitable gene delivery vehicles. This chapter will explain how tools for CNS gene transfer have been derived from naturally occurring viruses. The current capabilities of plasmid, retroviral, adeno-associated virus, adenovirus, and herpes simplex virus vectors for CNS gene delivery will be described. These include both focal and global CNS gene transfer strategies, with short- or long-term gene expression. As is described in this chapter, an important aspect of any vector is the cis-acting regulatory elements incorporated into the vector genome that control when, where, and how the transgene is expressed. PMID:25311922
2008-06-01
verified the insertion of the genes in our expression plasmids and in our lentivirus vectors. Transduction/selection of the 293T with mutated E2F... mutation created in this gene is located in the PEA targeted region of EF-2, it prevents the interaction of these 2 proteins and thus the cell death...We have cloned this mutated elongation factor in an expression vector and in a lentivirus plasmid also encoding a marker gene . The mEF-2-lentivirus
Serror, Pascale; Sasaki, Takashi; Ehrlich, S. Dusko; Maguin, Emmanuelle
2002-01-01
We describe, for the first time, a detailed electroporation procedure for Lactobacillus delbrueckii. Three L. delbrueckii strains were successfully transformed. Under optimal conditions, the transformation efficiency was 104 transformants per μg of DNA. Using this procedure, we identified several plasmids able to replicate in L. delbrueckii and integrated an integrative vector based on phage integrative elements into the L. delbrueckii subsp. bulgaricus chromosome. These vectors provide a good basis for developing molecular tools for L. delbrueckii and open the field of genetic studies in L. delbrueckii. PMID:11772607
Cell Cycle Dependent Regulation of Human Progesterone Receptor in Breast Cancer
2004-10-01
wt PR or S400A PR (0.01-1.0 [tg each), CDK2 (ljig), and PRE-2x-TATA-luc reporter plasmid (lig) along with Renilla plasmid (10ng) as a control for...8 hours prior to treatment. Cells were collected following treatment with 10 nM R5020 or ETOH vehicle control for 18 hrs. Luciferase and renilla ...reporter, a renilla reporter construct as a transfection control, either wt PR-B or S400A mutant PR-B, and control parental vector or a vector encoding an
Optimal Cloning of PCR Fragments by Homologous Recombination in Escherichia coli
Jacobus, Ana Paula; Gross, Jeferson
2015-01-01
PCR fragments and linear vectors containing overlapping ends are easily assembled into a propagative plasmid by homologous recombination in Escherichia coli. Although this gap-repair cloning approach is straightforward, its existence is virtually unknown to most molecular biologists. To popularize this method, we tested critical parameters influencing the efficiency of PCR fragments cloning into PCR-amplified vectors by homologous recombination in the widely used E. coli strain DH5α. We found that the number of positive colonies after transformation increases with the length of overlap between the PCR fragment and linear vector. For most practical purposes, a 20 bp identity already ensures high-cloning yields. With an insert to vector ratio of 2:1, higher colony forming numbers are obtained when the amount of vector is in the range of 100 to 250 ng. An undesirable cloning background of empty vectors can be minimized during vector PCR amplification by applying a reduced amount of plasmid template or by using primers in which the 5′ termini are separated by a large gap. DpnI digestion of the plasmid template after PCR is also effective to decrease the background of negative colonies. We tested these optimized cloning parameters during the assembly of five independent DNA constructs and obtained 94% positive clones out of 100 colonies probed. We further demonstrated the efficient and simultaneous cloning of two PCR fragments into a vector. These results support the idea that homologous recombination in E. coli might be one of the most effective methods for cloning one or two PCR fragments. For its simplicity and high efficiency, we believe that recombinational cloning in E. coli has a great potential to become a routine procedure in most molecular biology-oriented laboratories. PMID:25774528
Production and purification of non replicative canine adenovirus type 2 derived vectors.
Szelechowski, Marion; Bergeron, Corinne; Gonzalez-Dunia, Daniel; Klonjkowski, Bernard
2013-12-03
Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 10(10) infectious particles per ml and can be directly administrated in vivo.
Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR.
Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz
2017-01-01
Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future.
Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR
Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz
2017-01-01
Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future. PMID:28085908
Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae
Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.
1991-03-26
A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 figure.
Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.
Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E
2003-11-01
We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.
Auto and hetero-associative memory using a 2-D optical logic gate
NASA Technical Reports Server (NTRS)
Chao, Tien-Hsin (Inventor)
1992-01-01
An optical system for auto-associative and hetero-associative recall utilizing Hamming distance as the similarity measure between a binary input image vector V(sup k) and a binary image vector V(sup m) in a first memory array using an optical Exclusive-OR gate for multiplication of each of a plurality of different binary image vectors in memory by the input image vector. After integrating the light of each product V(sup k) x V(sup m), a shortest Hamming distance detection electronics module determines which product has the lowest light intensity and emits a signal that activates a light emitting diode to illuminate a corresponding image vector in a second memory array for display. That corresponding image vector is identical to the memory image vector V(sup m) in the first memory array for auto-associative recall or related to it, such as by name, for hetero-associative recall.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seetharam, S.; Waters, H.L.; Seidman, M.M.
The hereditary dysplastic nevus syndrome (DNS) is an autosomal dominant disorder in which affected individuals have increased numbers of dysplastic (premalignant) nevi and a greater than 100-fold increased risk of developing cutaneous melanoma. Epstein-Barr virus-transformed lymphoblastoid cell lines from patients with hereditary DNS have been shown to be hypermutable to UV radiation. To examine the mechanism involved in this UV hypermutability, we used a shuttle vector plasmid, pZ189, which carries a 160-base pair marker gene, supF, and can replicate in human cells. pZ189 was treated with UV radiation and transfected into DNS6BE, a lymphoblastoid cell line from a patient withmore » hereditary DNS. Plasmid survival after UV was similar with the DNS6BE line and with a lymphoblastoid cell line from a normal donor. Plasmid mutation frequency was greater with the DNS line in accord with the DNS cellular hypermutability. Base sequence analysis was performed on 69 mutated plasmids recovered from the DNS line. There were significantly more plasmids with single base substitution mutations (P less than 0.01) in comparison to UV-treated plasmids passed through normal fibroblasts. pZ189 hypermutability and an increased frequency of single base substitutions was previously found with a cell line from a melanoma-prone xeroderma pigmentosum patient. These differences may be related to the increased melanoma susceptibility in both DNS and xeroderma pigmentosum.« less
Kobayashi, Miho; Nomura, Masaru; Kimoto, Hiromi
2007-11-01
This study was designed selectively to eliminate a theta-plasmid from Lactococcus lactis strains by transforming synthetic competitors. A shuttle vector for Escherichia coli and L. lactis, pDB1, was constructed by ligating a partial replicon of pDR1-1B, which is a 7.3 kb theta-plasmid in L. lactis DRC1, with an erythromycin resistance gene into pBluescript II KS(+). This versatile vector was used to construct competitors to common lactococcal theta-plasmids. pDB1 contains the 5' half of the replication origin and the 3' region of repB of pDR1-1B, but lacks the 1.1-kb region normally found between these two segments. A set of primers, Pv3 and Pv4, was designed to amplify the 1.1-kb middle parts of the general theta-replicons of lactococcal plasmids. When the PCR products were cloned into the Nru I and Xho I sites of pDB1, synthetic replicons were constructed and replication activity was restored. A number of theta-plasmids in L. lactis ssp. lactis and cremoris were eliminated selectively by transforming the synthetic competitors. These competitors were easily eliminated by subculture for a short time in the absence of selection. The resulting variants contained no exogenous DNA and are suitable for food products, since part of the phenotype was altered without altering other plasmids indispensable for fermentation.
A novel bicistronic sensor vector for detecting caspase-3 activation.
Vagner, Tatyana; Mouravlev, Alexandre; Young, Deborah
2015-01-01
Apoptosis is involved in pathological cell death of a wide range of human diseases. One of the most important biochemical markers of apoptosis is activation of caspase-3. Ability to detect caspase-3 activation early in the pathological process is important for determining the timing for interfering with apoptosis initiation and prevention of cell damage. Techniques allowing detection of caspase-3 activity at a single cell level show increased sensitivity, compared to biochemical assays; therefore, we developed a novel bicistronic caspase-3 sensor vector enabling detection of caspase-3 activity in individual cells. We employed green fluorescent protein (GFP) as a reporter for caspase-3 activation in our constructs and assessed the functionality of the generated constructs in transiently transfected Neuro2A and HEK293 cells under basal conditions and following application of okadaic acid (OA) or staurosporine (STS) to induce apoptosis. To ensure responsiveness of the new sensor vector to active caspase-3, we co-transfected the sensor with plasmid(s) overexpressing active caspase-3 and quantified GFP fluorescence using a plate reader. We observed an increase in GFP expression in cells transfected with the new bicistronic caspase-3 sensor in response to both OA and STS. We also showed a significant increase in GFP fluorescence intensity in cells co-expressing the sensor with the plasmid(s) encoding active caspase-3. We generated a novel bicistronic caspase-3 sensor vector which relies on a transcription factor/response element system. The obtained sensor combines high sensitivity of the single cell level detection with the possibility of automated quantification. Copyright © 2015 Elsevier Inc. All rights reserved.
Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying
2011-03-01
To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.
Toda, Hiroshi; Itoh, Nobuya
2017-01-01
The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli–Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 (rhsmo) and alcohol dehydrogenase gene from Leifsonia sp. S749 (lsadh), in K. rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase (gapdh) promotor. The RhSMO–LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent–water biphasic reaction system to efficiently convert styrene into (S)-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells. PMID:29230202
Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae
Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.
1987-08-28
A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of /und Streptococcus/ /und pneumoniae/. Plasmid pSM22, the vector containing the pneumococcal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 fig., 1 tab.
Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem
2017-12-16
To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).
Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying
2008-02-01
To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.
Novel Minicircle Vector for Gene Therapy in Murine Myocardial Infarction
Huang, Mei; Chen, ZhiYing; Hu, Shijun; Jia, Fangjun; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Kay, Mark A.; Wu, Joseph C.
2011-01-01
Background Conventional plasmids for gene therapy produce low-level and short-term gene expression. In this study, we develop a novel non-viral vector which robustly and persistently expresses the hypoxia inducible factor-1 alpha (HIF-1α) therapeutic gene in the heart, leading to functional benefits following myocardial infarction (MI). Methods and Results We first created minicircles carrying double fusion (MC-DF) reporter gene consisting of firefly luciferase and enhanced green fluorescent protein (Fluc-eGFP) for noninvasive measurement of transfection efficiency. Mouse C2C12 myoblasts and normal FVB mice were used for in vitro and in vivo confirmation, respectively. Bioluminescence imaging (BLI) showed stable minicircle gene expression in the heart for >12 weeks and the activity level was 5.6±1.2 fold stronger than regular plasmid at day 4 (P<0.01). Next, we created minicircles carrying hypoxia inducible factor-1 alpha (MC-HIF-1α) therapeutic gene for treatment of MI. Adult FVB mice underwent LAD ligation and were injected intramyocardially with (1) MC-HIF-1α, (2) regular plasmid carrying HIF-1α (PL-HIF-1α) as positive control, and (3) PBS as negative control (n=10/group). Echocardiographic study showed a significantly greater improvement of left ventricular ejection fraction (LVEF) in the minicircle group (51.3%±3.6%) compared to regular plasmid group (42.3%±4.1%) and saline group (30.5%±2.8%) at week 4 (P<0.05 for both). Histology demonstrated increased neoangiogenesis in both treatment groups. Finally, Western blot showed minicircles express >50% higher HIF-1α level than regular plasmid. Conclusion Taken together, this is the first study to demonstrate that minicircles can significantly improve transfection efficiency, duration of transgene expression, and cardiac contractility. Given the serious drawbacks associated with most viral vectors, we believe this novel non-viral vector can be of great value for cardiac gene therapy protocols. PMID:19752373
Yang, Shuo; Li, Jia-li; Bi, Hui-chang; Zhou, Shou-ning; Liu, Xiao-man; Zeng, Hang; Hu, Bing-fang; Huang, Min
2016-01-01
This study aims to investigate the function of two SNPs (rs8904C > T and rs696G >A) in 3' untranslated region (3'UTR) of NFKBIA gene by constructing luciferase reporter gene. A patient's genomic DNA with rs8904 CC and rs696 GA genotype was used as the PCR template. Full-length 3'UTR of NFKBIA gene was amplified by different primers. After sequencing validation, these fragments were inserted to the luciferase reporter vector, pGL3-promoter to construct recombinant plasmids containing four kinds of haplotypes, pGL3-rs8904C/rs696G, pGL3-rs8904C/rs696A, pGL3-rs8904T/rs696G and pGL3-rs8904T/rs696A. Then these plasmids were transfected into LS174T cells and the luciferase activity was detected. Compared with pGL3-vector transfected cells (negative control), the luciferase activity of the four kinds of recombinant plasmids was significantly decreased (P < 0.001). For rs696G > A, the luciferase activity of the recombinant plasmids containing A allele (pGL3-rs8904C/rs696A and pGL3-rs8904T/rs696A) was about 45.1% (P < 0.05) and 56.1% (P < 0.001) lower than those containing G allele (pGL3-rs8904C/rs696G and pGL3-rs8904T/rs696G), respectively. For rs8904C > T, there were no significant differences in the luciferase activity between the recombinant plasmids containing T allele and those with C allele. Together, the luciferase reporter gene vectors containing SNPs in NFKBIA gene 3'UTR were constructed successfully and rs696G > A could decrease the luciferase activity while rs8904C >T didn't have much effect on the luciferase activity.
USDA-ARS?s Scientific Manuscript database
A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...
Adding localization information in a fingerprint binary feature vector representation
NASA Astrophysics Data System (ADS)
Bringer, Julien; Despiegel, Vincent; Favre, Mélanie
2011-06-01
At BTAS'10, a new framework to transform a fingerprint minutiae template into a binary feature vector of fixed length is described. A fingerprint is characterized by its similarity with a fixed number set of representative local minutiae vicinities. This approach by representative leads to a fixed length binary representation, and, as the approach is local, it enables to deal with local distortions that may occur between two acquisitions. We extend this construction to incorporate additional information in the binary vector, in particular on localization of the vicinities. We explore the use of position and orientation information. The performance improvement is promising for utilization into fast identification algorithms or into privacy protection algorithms.
Keeney, Michael; van den Beucken, Jeroen J J P; van der Kraan, Peter M; Jansen, John A; Pandit, Abhay
2010-04-01
Collagen/calcium phosphate scaffolds have been used for bone reconstruction due to their inherent similarities to the bone extracellular matrix. Calcium phosphate alone has also been used as a non-viral vector for gene delivery. The aim of this study was to determine the capability of a collagen/calcium phosphate scaffold to deliver naked plasmid DNA and mediate transfection in vivo. The second goal of the study was to deliver a plasmid encoding vascular endothelial growth factor(165) (pVEGF(165)) to promote angiogenesis, and hence bone formation, in a mouse intra-femoral model. The delivery of naked plasmid DNA resulted in a 7.6-fold increase in mRNA levels of beta-Galactosidase compared to the delivery of plasmid DNA complexed with a partially degraded PAMAM dendrimer (dPAMAM) in a subcutaneous murine model. When implanted in a muirne intra-femoral model, the delivery of pVEGF(165) resulted in a 2-fold increase in bone volume at the defect site relative to control scaffolds without pVEGF(165). It was concluded that a collagen/calcium phosphate scaffold can mediate transfection without the use of additional transfection vectors and can promote bone formation in a mouse model via the delivery of pVEGF(165). 2009 Elsevier Ltd. All rights reserved.
Cell-Penetrating Peptide-Mediated Delivery of Cas9 Protein and Guide RNA for Genome Editing.
Suresh, Bharathi; Ramakrishna, Suresh; Kim, Hyongbum
2017-01-01
The clustered, regularly interspaced, short palindromic repeat (CRISPR)-associated (Cas) system represents an efficient tool for genome editing. It consists of two components: the Cas9 protein and a guide RNA. To date, delivery of these two components has been achieved using either plasmid or viral vectors or direct delivery of protein and RNA. Plasmid- and virus-free direct delivery of Cas9 protein and guide RNA has several advantages over the conventional plasmid-mediated approach. Direct delivery results in shorter exposure time at the cellular level, which in turn leads to lower toxicity and fewer off-target mutations with reduced host immune responses, whereas plasmid- or viral vector-mediated delivery can result in uncontrolled integration of the vector sequence into the host genome and unwanted immune responses. Cell-penetrating peptide (CPP), a peptide that has an intrinsic ability to translocate across cell membranes, has been adopted as a means of achieving efficient Cas9 protein and guide RNA delivery. We developed a method for treating human cell lines with CPP-conjugated recombinant Cas9 protein and CPP-complexed guide RNAs that leads to endogenous gene disruption. Here we describe a protocol for preparing an efficient CPP-conjugated recombinant Cas9 protein and CPP-complexed guide RNAs, as well as treatment methods to achieve safe genome editing in human cell lines.
Beach, D; Piper, M; Nurse, P
1982-01-01
A gene bank of partial Sau3A restriction fragments of S. pombe DNA has been constructed in the plasmid vector, pDB248', which is capable of high frequency transformation of S. pombe. Procedures are described which enable plasmids to be recovered from S. pombe by their reintroduction into E. coli. These methods have been used to detect the S. pombe genes lys 1+, ade 6+ and his 2+ in the gene bank by complementation of mutant gene functions, and to physically isolate the lys 1+ gene.
Attenuated Shigella as a DNA Delivery Vehicle for DNA-Mediated Immunization
NASA Astrophysics Data System (ADS)
Sizemore, Donata R.; Branstrom, Arthur A.; Sadoff, Jerald C.
1995-10-01
Direct inoculation of DNA, in the form of purified bacterial plasmids that are unable to replicate in mammalian cells but are able to direct cell synthesis of foreign proteins, is being explored as an approach to vaccine development. Here, a highly attenuated Shigella vector invaded mammalian cells and delivered such plasmids into the cytoplasm of cells, and subsequent production of functional foreign protein was measured. Because this Shigella vector was designed to deliver DNA to colonic mucosa, the method is a potential basis for oral and other mucosal DNA immunization and gene therapy strategies.
Martella, Andrea; Matjusaitis, Mantas; Auxillos, Jamie; Pollard, Steven M; Cai, Yizhi
2017-07-21
Mammalian plasmid expression vectors are critical reagents underpinning many facets of research across biology, biomedical research, and the biotechnology industry. Traditional cloning methods often require laborious manual design and assembly of plasmids using tailored sequential cloning steps. This process can be protracted, complicated, expensive, and error-prone. New tools and strategies that facilitate the efficient design and production of bespoke vectors would help relieve a current bottleneck for researchers. To address this, we have developed an extensible mammalian modular assembly kit (EMMA). This enables rapid and efficient modular assembly of mammalian expression vectors in a one-tube, one-step golden-gate cloning reaction, using a standardized library of compatible genetic parts. The high modularity, flexibility, and extensibility of EMMA provide a simple method for the production of functionally diverse mammalian expression vectors. We demonstrate the value of this toolkit by constructing and validating a range of representative vectors, such as transient and stable expression vectors (transposon based vectors), targeting vectors, inducible systems, polycistronic expression cassettes, fusion proteins, and fluorescent reporters. The method also supports simple assembly combinatorial libraries and hierarchical assembly for production of larger multigenetic cargos. In summary, EMMA is compatible with automated production, and novel genetic parts can be easily incorporated, providing new opportunities for mammalian synthetic biology.
Copy number variability of expression plasmids determined by cell sorting and Droplet Digital PCR.
Jahn, Michael; Vorpahl, Carsten; Hübschmann, Thomas; Harms, Hauke; Müller, Susann
2016-12-19
Plasmids are widely used for molecular cloning or production of proteins in laboratory and industrial settings. Constant modification has brought forth countless plasmid vectors whose characteristics in terms of average plasmid copy number (PCN) and stability are rarely known. The crucial factor determining the PCN is the replication system; most replication systems in use today belong to a small number of different classes and are available through repositories like the Standard European Vector Architecture (SEVA). In this study, the PCN was determined in a set of seven SEVA-based expression plasmids only differing in the replication system. The average PCN for all constructs was determined by Droplet Digital PCR and ranged between 2 and 40 per chromosome in the host organism Escherichia coli. Furthermore, a plasmid-encoded EGFP reporter protein served as a means to assess variability in reporter gene expression on the single cell level. Only cells with one type of plasmid (RSF1010 replication system) showed a high degree of heterogeneity with a clear bimodal distribution of EGFP intensity while the others showed a normal distribution. The heterogeneous RSF1010-carrying cell population and one normally distributed population (ColE1 replication system) were further analyzed by sorting cells of sub-populations selected according to EGFP intensity. For both plasmids, low and highly fluorescent sub-populations showed a remarkable difference in PCN, ranging from 9.2 to 123.4 for ColE1 and from 0.5 to 11.8 for RSF1010, respectively. The average PCN determined here for a set of standardized plasmids was generally at the lower end of previously reported ranges and not related to the degree of heterogeneity. Further characterization of a heterogeneous and a homogeneous population demonstrated considerable differences in the PCN of sub-populations. We therefore present direct molecular evidence that the average PCN does not represent the true number of plasmid molecules in individual cells.
Deterministic binary vectors for efficient automated indexing of MEDLINE/PubMed abstracts.
Wahle, Manuel; Widdows, Dominic; Herskovic, Jorge R; Bernstam, Elmer V; Cohen, Trevor
2012-01-01
The need to maintain accessibility of the biomedical literature has led to development of methods to assist human indexers by recommending index terms for newly encountered articles. Given the rapid expansion of this literature, it is essential that these methods be scalable. Document vector representations are commonly used for automated indexing, and Random Indexing (RI) provides the means to generate them efficiently. However, RI is difficult to implement in real-world indexing systems, as (1) efficient nearest-neighbor search requires retaining all document vectors in RAM, and (2) it is necessary to maintain a store of randomly generated term vectors to index future documents. Motivated by these concerns, this paper documents the development and evaluation of a deterministic binary variant of RI. The increased capacity demonstrated by binary vectors has implications for information retrieval, and the elimination of the need to retain term vectors facilitates distributed implementations, enhancing the scalability of RI.
Deterministic Binary Vectors for Efficient Automated Indexing of MEDLINE/PubMed Abstracts
Wahle, Manuel; Widdows, Dominic; Herskovic, Jorge R.; Bernstam, Elmer V.; Cohen, Trevor
2012-01-01
The need to maintain accessibility of the biomedical literature has led to development of methods to assist human indexers by recommending index terms for newly encountered articles. Given the rapid expansion of this literature, it is essential that these methods be scalable. Document vector representations are commonly used for automated indexing, and Random Indexing (RI) provides the means to generate them efficiently. However, RI is difficult to implement in real-world indexing systems, as (1) efficient nearest-neighbor search requires retaining all document vectors in RAM, and (2) it is necessary to maintain a store of randomly generated term vectors to index future documents. Motivated by these concerns, this paper documents the development and evaluation of a deterministic binary variant of RI. The increased capacity demonstrated by binary vectors has implications for information retrieval, and the elimination of the need to retain term vectors facilitates distributed implementations, enhancing the scalability of RI. PMID:23304369
Clément, Nathalie; Velu, Thierry; Brandenburger, Annick
2002-09-01
The production of currently available vectors derived from autonomous parvoviruses requires the expression of capsid proteins in trans, from helper sequences. Cotransfection of a helper plasmid always generates significant amounts of replication-competent virus (RCV) that can be reduced by the integration of helper sequences into a packaging cell line. Although stocks of minute virus of mice (MVM)-based vectors with no detectable RCV could be produced by transfection into packaging cells; the latter appear after one or two rounds of replication, precluding further amplification of the vector stock. Indeed, once RCVs become detectable, they are efficiently amplified and rapidly take over the culture. Theoretically RCV-free vector stocks could be produced if all homology between vector and helper DNA is eliminated, thus preventing homologous recombination. We constructed new vectors based on the structure of spontaneously occurring defective particles of MVM. Based on published observations related to the size of vectors and the sequence of the viral origin of replication, these vectors were modified by the insertion of foreign DNA sequences downstream of the transgene and by the introduction of a consensus NS-1 nick site near the origin of replication to optimize their production. In one of the vectors the inserted fragment of mouse genomic DNA had a synergistic effect with the modified origin of replication in increasing vector production.
Monroe, T J; Muhlmann-Diaz, M C; Kovach, M J; Carlson, J O; Bedford, J S; Beaty, B J
1992-01-01
Stable incorporation of high copy numbers (greater than 10,000 per cell) of a plasmid vector containing a gene conferring resistance to the antibiotic hygromycin was achieved in a cell line derived from the Aedes albopictus mosquito. Plasmid sequences were readily observed by ethidium bromide staining of cellular DNA after restriction endonuclease digestion and agarose gel electrophoresis. The plasmid was demonstrated by in situ hybridization to be present in large arrays integrated in metaphase chromosomes and in minute and double-minute replicating elements. In one subclone, approximately 60,000 copies of the plasmid were organized in a large array that resembles a chromosome, morphologically and in the segregation of its chromatids during anaphase. The original as well as modified versions of the plasmid were rescued by transformation of Escherichia coli using total cellular DNA. Southern blot analyses of recovered plasmids indicate the presence of mosquito-derived sequences. Images PMID:1631052
Reimer, D L; Kong, S; Monck, M; Wyles, J; Tam, P; Wasan, E K; Bally, M B
1999-05-01
The transfer of plasmid expression vectors to cells is essential for transfection after administration of lipid-based DNA formulations (lipoplexes). A murine i.p. B16/BL6 tumor model was used to characterize DNA delivery, liposomal lipid delivery, and gene transfer after regional (i.p.) administration of free plasmid DNA and DNA lipoplexes. DNA lipoplexes were prepared using cationic dioleoyldimethylammonium chloride/dioleoylphosphatidylethanolamine (50:50 mol ratio) liposomes mixed with plasmid DNA (1 microgram DNA/10 nmol lipid). The plasmid used contained the chloramphenicol acetyltransferase gene and chloramphenicol acetyltransferase expression (mU/g tumor) was measured to estimate transfection efficiency. Tumor-associated DNA and liposomal lipid levels were measured to estimate the efficiency of lipid-mediated DNA delivery to tumors. Plasmid DNA delivery was estimated using [3H]-labeled plasmid as a tracer, dot blot analysis, and/or Southern analysis. Liposomal lipid delivery was estimated using [14C]-dioleoylphosphatidylethanolamine as a liposomal lipid marker. Gene expression in the B16/BL6 tumors was highly variable, with values ranging from greater than 2,000 mU/g tumor to less than 100 mU/g tumor. There was a tendency to observe enhanced transfection in small (<250 mg) tumors. Approximately 18% of the injected dose of DNA was associated with these small tumors 2 h after i.p. administration. Southern analysis of extracted tumor DNA indicated that plasmid DNA associated with tumors was intact 24 h after administration. DNA and associated liposomal lipid are efficiently bound to tumors after regional administration; however, it is unclear whether delivery is sufficient to abet internalization and appropriate subcellular localization of the expression vector.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Williams, L.E.; Detter, C,; Barrie, K.
2006-06-01
Sequencing of the large (>50 kb), low-copy-number (<5 per cell) plasmids that mediate horizontal gene transfer has been hindered by the difficulty and expense of isolating DNA from individual plasmids of this class. We report here that a kit method previously devised for purification of bacterial artificial chromosomes (BACs) can be adapted for effective preparation of individual plasmids up to 220 kb from wild gram-negative and gram-positive bacteria. Individual plasmid DNA recovered from less than 10 ml of Escherichia coli, Staphylococcus, and Corynebacterium cultures was of sufficient quantity and quality for construction of highcoverage libraries, as shown by sequencing fivemore » native plasmids ranging in size from 30 kb to 94 kb. We also report recommendations for vector screening to optimize plasmid sequence assembly, preliminary annotation of novel plasmid genomes, and insights on mobile genetic element biology derived from these sequences. Adaptation of this BAC method for large plasmid isolation removes one major technical hurdle to expanding our knowledge of the natural plasmid gene pool.« less
Piven, Irina; Friedrich, Alexandra; Duhring, Ulf; Uliczka, Frank; Baier, Kerstin; Inaba, Masami; Shi, Tuo; Wang, Kui; Enke, Heike; Kramer, Dan
2014-09-30
A cyanobacterial host cell, Cyanobacterium sp., that harbors at least one recombinant gene for the production of a chemical compounds is provided, as well as vectors derived from an endogenous plasmid isolated from the cell.
Piven, Irina; Friedrich, Alexandra; Duhring, Ulf; Uliczka, Frank; Baier, Kerstin; Inaba, Masami; Shi, Tuo; Wang, Kui; Enke, Heike; Kramer, Dan
2016-04-19
A cyanobacterial host cell, Cyanobacterium sp., that harbors at least one recombinant gene for the production of a chemical compounds is provided, as well as vectors derived from an endogenous plasmid isolated from the cell.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bredberg, A.; Kraemer, K.H.; Seidman, M.M.
1986-11-01
A shuttle vector plasmid, pZ189, carrying a bacterial suppressor tRNA marker gene, was treated with ultraviolet radiation and propagated in cultured skin cells from a patient with the skin-cancer-prone, DNA repair-deficient disease xeroderma pigmentosum and in repair-proficient cells. After replication in the human cells, progeny plasmids were purified. Plasmid survival and mutations inactivating the marker gene were scored by transforming an indicator strain of Escherichia coli carrying a suppressible amber mutation in the beta-galactosidase gene. Plasmid survival in the xeroderma pigmentosum cells was less than that of pZ189 harvested from repair-proficient human cells. The point-mutation frequency in the 150-base-pair tRNAmore » marker gene increased up to 100-fold with ultraviolet dose. Sequence analysis of 150 mutant plasmids revealed that mutations were infrequent at potential thymine-thymine dimer sites. Ninety-three percent of the mutant plasmids from the xeroderma pigmentosum cells showed G X C----A X T transitions, compared to 73% in the normal cells (P less than 0.002). There were significantly fewer transversions (P less than 0.002) (especially G X C----T X A) and multiple base substitutions (P less than 0.00001) than when pZ189 was passaged in repair-proficient cells. The subset of mutational changes that are common to ultraviolet-treated plasmids propagated in both repair-proficient and xeroderma pigmentosum skin cells may be associated with the development of ultraviolet-induced skin cancer in humans.« less
Bleckmann, Maren; Schürig, Margitta; Chen, Fang-Fang; Yen, Zen-Zen; Lindemann, Nils; Meyer, Steffen; Spehr, Johannes; van den Heuvel, Joop
2016-01-01
The Baculovirus Expression Vector System (BEVS) is widely used to produce high amounts of recombinant proteins. Nevertheless, generating recombinant baculovirus in high quality is rather time-consuming and labor-intensive. Alternatively, virus-free expression in insect cells did not achieve similar expression levels for most proteins so far. The transactivation method is a promising approach for protein expression in Sf21 cells. It combines advantages of BEVS and plasmid-based expression by activating strong virus-dependent promoters on a transfected plasmid by baculoviral coinfection. Here, we identified expression elements required for transactivation. Therefore, we designed several vectors comprising different viral promoters or promoter combinations and tested them for eGFP expression using the automated BioLector microcultivation system. Remarkably, only the combination of the very late promoter p10 together with the homologous region 5 (hr5) could boost expression during transactivation. Other elements, like p10 alone or the late viral promoter polH, did not respond to transactivation. A new combination of hr5 and p10 with the strongest immediate early OpMNPV viral promoter OpIE2 improved the yield of eGFP by ~25% in comparison to the previous applied hr5-IE1-p10 expression cassette. Furthermore, we observed a strong influence of the transcription termination sequence and vector backbone on the level of expression. Finally, the expression levels for transactivation, BEVS and solely plasmid-based expression were compared for the marker protein eGFP, underlining the potential of transactivation for fast recombinant protein expression in Sf21 cells. In conclusion, essential elements for transactivation could be identified. The optimal elements were applied to generate an improved vector applicable in virus-free plasmid-based expression, transactivation and BEVS.
Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii
Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin
2015-01-01
The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991
Modulation of ColE1-like Plasmid Replication for Recombinant Gene Expression
Camps, Manel
2010-01-01
ColE1-like plasmids constitute the most popular vectors for recombinant protein expression. ColE1 plasmid replication is tightly controlled by an antisense RNA mechanism that is highly dynamic, tuning plasmid metabolic burden to the physiological state of the host. Plasmid homeostasis is upset upon induction of recombinant protein expression because of non-physiological levels of expression and because of the frequently biased amino acid composition of recombinant proteins. Disregulation of plasmid replication is the main cause of collapse of plasmid-based expression systems because of a simultaneous increase in the metabolic burden (due to increased average copy number) and in the probability of generation of plasmid-free cells (due to increased copy number variation). Interference between regulatory elements of co-resident plasmids causes comparable effects on plasmid stability (plasmid incompatibility). Modulating plasmid copy number for recombinant gene expression aims at achieving a high gene dosage while preserving the stability of the expression system. Here I present strategies targeting plasmid replication for optimizing recombinant gene expression. Specifically, I review approaches aimed at modulating the antisense regulatory system (as well as their implications for plasmid incompatibility) and innovative strategies involving modulation of host factors, of R-loop formation, and of the timing of recombinant gene expression. PMID:20218961
Characterization of new plasmids from methylotrophic bacteria.
Brenner, V; Holubová, I; Benada, O; Hubácek, J
1991-07-01
Several tens of methanol-utilizing bacterial strains isolated from soil were screened for the presence of plasmids. From the obligate methylotroph Methylomonas sp. strain R103a plasmid pIH36 (36 kb) was isolated and its restriction map was constructed. In pink-pigmented facultative methylotrophs (PPFM), belonging to the genus Methylobacterium four plasmids were detected: plasmids pIB200 (200 kb) and pIB14 (14 kb) in the strain R15d and plasmids pWU14 (14 kb) and pWU7 (7.8 kb) in the strain M17. Because of the small size and the presence of several unique REN sites (HindIII, EcoRI, NcoI), plasmid pWU7 was chosen for the construction of a vector for cloning in methylotrophs. Cointegrates pKWU7A and pKWU7B were formed between pWU7 and the E. coli plasmid pK19 Kmr, which were checked for conjugative transfer from E. coli into the methylotrophic host.
Rodríguez, M Carmen; Alegre, M Teresa; Martín, M Cruz; Mesas, Juan M
2015-01-01
A chimeric plasmid, pRS7Rep (6.1 kb), was constructed using the replication region of pRS7, a large plasmid from Oenococcus oeni, and pEM64, a plasmid derived from pIJ2925 and containing a gene for resistance to chloramphenicol. pRS7Rep is a shuttle vector that replicates in Escherichia coli using its pIJ2925 component and in lactic acid bacteria (LAB) using the replication region of pRS7. High levels of transformants per µg of DNA were obtained by electroporation of pRS7Rep into Pediococcus acidilactici (1.5 × 10(7)), Lactobacillus plantarum (5.7 × 10(5)), Lactobacillus casei (2.3 × 10(5)), Leuconostoc citreum (2.7 × 10(5)), and Enterococcus faecalis (2.4 × 10(5)). A preliminary optimisation of the technical conditions of electrotransformation showed that P. acidilactici and L. plantarum are better transformed at a later exponential phase of growth, whereas L. casei requires the early exponential phase for better electrotransformation efficiency. pRS7Rep contains single restriction sites useful for cloning purposes, BamHI, XbaI, SalI, HincII, SphI and PstI, and was maintained at an acceptable rate (>50%) over 100 generations without selective pressure in L. plantarum, but was less stable in L. casei and P. acidilactici. The ability of pRS7Rep to accept and express other genes was assessed. To the best of our knowledge, this is the first time that the replication region of a plasmid from O. oeni has been used to generate a cloning vector. Copyright © 2014 Elsevier Inc. All rights reserved.
Learning Compact Binary Face Descriptor for Face Recognition.
Lu, Jiwen; Liong, Venice Erin; Zhou, Xiuzhuang; Zhou, Jie
2015-10-01
Binary feature descriptors such as local binary patterns (LBP) and its variations have been widely used in many face recognition systems due to their excellent robustness and strong discriminative power. However, most existing binary face descriptors are hand-crafted, which require strong prior knowledge to engineer them by hand. In this paper, we propose a compact binary face descriptor (CBFD) feature learning method for face representation and recognition. Given each face image, we first extract pixel difference vectors (PDVs) in local patches by computing the difference between each pixel and its neighboring pixels. Then, we learn a feature mapping to project these pixel difference vectors into low-dimensional binary vectors in an unsupervised manner, where 1) the variance of all binary codes in the training set is maximized, 2) the loss between the original real-valued codes and the learned binary codes is minimized, and 3) binary codes evenly distribute at each learned bin, so that the redundancy information in PDVs is removed and compact binary codes are obtained. Lastly, we cluster and pool these binary codes into a histogram feature as the final representation for each face image. Moreover, we propose a coupled CBFD (C-CBFD) method by reducing the modality gap of heterogeneous faces at the feature level to make our method applicable to heterogeneous face recognition. Extensive experimental results on five widely used face datasets show that our methods outperform state-of-the-art face descriptors.
Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V
2007-06-15
A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.
Bacterial plasmid transfer under space flight conditions: The Mobilisatsia experience
NASA Astrophysics Data System (ADS)
de Boever, P.; Ilyin, V.; Mahillon, J.; Mergeay, M.
Background Microorganisms are subject to a genetic evolution which may lead to the capacity to colonize new environments and to cause infections Central players in this evolutionary process are mobile genetic elements phages plasmids and transposons The latter help to mobilize and reorganize genes be it within a given genome intragenomic mobility or between bacterial cells intercellular mobility Confined environment and space flight related factors such as microgravity and cosmic radiation may influence the frequency with which mobile genetic elements are exchanged between microorganisms Aim Within the frame of the Mobilisatsia experiment a triparental microbial plasmid transfer was promoted aboard the International Space Station ISS The efficiency of the plasmid exchange process was compared with a synchronously performed ground control experiment An experiment was carried out with well-characterized Gram-negative test strains and one experiment was done with Gram-positive test strains Results The experiment took place during the Soyouz Mission 8 to the ISS from April 19th until April 30th 2004 Liquid cultures of the bacterial strains Cupriavidus metallidurans AE815 final recipient Escherichia coli CM1962 carrying a mobilisable vector with a nickel-resistance marker and E coli CM140 carrying the Broad Host Range plasmid RP4 for the Gram-negative experiment and Bacillus thuringiensis Bti AND931 carrying the conjugative plasmid pXO16 Bti 4Q7 with mobilisable vector pC194 carrying a resistance to chloramphenicol and Bti GBJ002
[Construction of the superantigen SEA transfected laryngocarcinoma cells].
Ji, Xiaobin; Jingli, J V; Liu, Qicai; Xie, Jinghua
2013-04-01
To construct an eukaryotic expression vectors containing superantigen staphylococcal enterotoxin A (SEA) gene, and to identify its expression in laryngeal squamous carcinoma cells. SEA full-length gene fragment was obtained from ATCC13565 genome of the staphylococcus, referencing standard strains producing SEA. Coding sequence of SEA was artificially synthetized. Than, SEA gene fragments was subcloned into eukaryotic expression vector pIRES-EGFP. The recombinant plasmid pSEA-IRES-EGFP was constructed and was transfected to laryngocarcinoma Hep-2 cells. Resistant clones were screened by G418. The expression of SEA in laryngocarcinoma cells was identified with ELISA and RT-PCR method. The subclone of artificially synthetized SEA gene was subclone to eukaryotic expression vector pires-EGFP. Flanking sequence confirmed that SEA sequence was fully identical to the coding sequence of standard staphylococcus strains ATCC13565 in Genbank. After recombinant plasmid transfected to laryngocarcinoma cells, the resistant clones was obtained after screening for two weeks. The clones were selected. The specific gene fragment was obtained by RT-PCR amplification. ELISA assay confirmed that the content of SEA protein in supernatant fluid of cell culture had reached about Pg level. The recombinant eukaryotic expression vector containing superantigen SEA gene is successfully constructed, and is capable of effective expression and continued secretion of SEA protein in laryngochrcinoma Hep-2 cells after recombinant plasmid transfected to laryngocarcinoma cells.
Efficient generation of rat induced pluripotent stem cells using a non-viral inducible vector.
Merkl, Claudia; Saalfrank, Anja; Riesen, Nathalie; Kühn, Ralf; Pertek, Anna; Eser, Stefan; Hardt, Markus Sebastian; Kind, Alexander; Saur, Dieter; Wurst, Wolfgang; Iglesias, Antonio; Schnieke, Angelika
2013-01-01
Current methods of generating rat induced pluripotent stem cells are based on viral transduction of pluripotency inducing genes (Oct4, Sox2, c-myc and Klf4) into somatic cells. These activate endogenous pluripotency genes and reprogram the identity of the cell to an undifferentiated state. Epigenetic silencing of exogenous genes has to occur to allow normal iPS cell differentiation. To gain more control over the expression of exogenous reprogramming factors, we used a novel doxycycline-inducible plasmid vector encoding Oct4, Sox2, c-Myc and Klf4. To ensure efficient and controlled generation of iPS cells by plasmid transfection we equipped the reprogramming vector with a bacteriophage φC31 attB site and used a φC31 integrase expression vector to enhance vector integration. A series of doxycycline-independent rat iPS cell lines were established. These were characterized by immunocytochemical detection of Oct4, SSEA1 and SSEA4, alkaline phosphatase staining, methylation analysis of the endogenous Oct4 promoter and RT-PCR analysis of endogenous rat pluripotency genes. We also determined the number of vector integrations and the extent to which reprogramming factor gene expression was controlled. Protocols were developed to generate embryoid bodies and rat iPS cells demonstrated as pluripotent by generating derivatives of all three embryonic germ layers in vitro, and teratoma formation in vivo. All data suggest that our rat iPS cells, generated by plasmid based reprogramming, are similar to rat ES cells. Methods of DNA transfection, protein transduction and feeder-free monolayer culture of rat iPS cells were established to enable future applications.
Lee, Min Woo; Rogers, Elizabeth E; Stenger, Drake C
2010-12-01
Xylella fastidiosa strain riv11 harbors a 25-kbp plasmid (pXF-RIV11) belonging to the IncP-1 incompatibility group. Replication and stability factors of pXF-RIV11 were identified and used to construct plasmids able to replicate in X. fastidiosa and Escherichia coli. Replication in X. fastidiosa required a 1.4-kbp region from pXF-RIV11 containing a replication initiation gene (trfA) and the adjacent origin of DNA replication (oriV). Constructs containing trfA and oriV from pVEIS01, a related IncP-1 plasmid of the earthworm symbiont Verminephrobacter eiseniae, also were competent for replication in X. fastidiosa. Constructs derived from pXF-RIV11 but not pVEIS01 replicated in Agrobacterium tumefaciens, Xanthomonas campestris, and Pseudomonas syringae. Although plasmids bearing replication elements from pXF-RIV11 or pVEIS01 could be maintained in X. fastidiosa under antibiotic selection, removal of selection resulted in plasmid extinction after 3 weekly passages. Addition of a toxin-antitoxin addiction system (pemI/pemK) from pXF-RIV11 improved plasmid stability such that >80 to 90% of X. fastidiosa cells retained plasmid after 5 weekly passages in the absence of antibiotic selection. Expression of PemK in E. coli was toxic for cell growth, but toxicity was nullified by coexpression of PemI antitoxin. Deletion of N-terminal sequences of PemK containing the conserved motif RGD abolished toxicity. In vitro assays revealed a direct interaction of PemI with PemK, suggesting that antitoxin activity of PemI is mediated by toxin sequestration. IncP-1 plasmid replication and stability factors were added to an E. coli cloning vector to constitute a stable 6.0-kbp shuttle vector (pXF20-PEMIK) suitable for use in X. fastidiosa.
Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat
2012-01-01
The development of Lactobacillus plantarum to be used in starter cultures in the food industry has been limited because of the lack of a food-grade cloning vector for the bacterium. In this study, the plasmid pFLP1 was constructed by joining 2 DNA fragments derived from food-approved organisms. The 5.2-kb BamHI/KpnI DNA fragment of pRV566 containing the theta-type replicon of Lactobacillus sakei was ligated to the BamHI/KpnI DNA fragment of a 2.9-kb lactococcal cadmium resistance determinant amplified from pND918. The 8.1-kb newly constructed plasmid could transform L. plantarum N014, a bacteriocin-producing bacteria originally isolated from nham, a traditional Thai fermented sausage. The resulting transformant, L. plantarum N014-FLP, and its parent strain were shown to be very similar in growth rate and bacteriocin activity. In addition, the plasmid was very stable in its host bacteria under nonselective pressure for 100 generations in MRS medium and for 5 days in a nham model. These results suggest that pFLP1 is a potential food-grade cloning vector for L. plantarum.
pTcGW plasmid vectors 1.1 version: a versatile tool for Trypanosoma cruzi gene characterisation
Kugeratski, Fernanda G; Batista, Michel; Inoue, Alexandre Haruo; Ramos, Bruno Dias; Krieger, Marco Aurelio; Marchini/, Fabricio K
2015-01-01
The functional characterisation of thousands of Trypanosoma cruzi genes remains a challenge. Reverse genetics approaches compatible with high-throughput cloning strategies can provide the tool needed to tackle this challenge. We previously published the pTcGW platform, composed by plasmid vectors carrying different options of N-terminal fusion tags based on Gateway® technology. Here, we present an improved 1.1 version of pTcGW vectors, which is characterised by a fully flexible structure allowing an easy customisation of each element of the vectors in a single cloning step. Additionally, both N and C-terminal fusions are available with new tag options for protein complexes purification. Three of the newly created vectors were successfully used to determine the cellular localisation of four T. cruzi proteins. The 1.1 version of pTcGW platform can be used in a variety of assays, such as protein overexpression, identification of protein-protein interaction and protein localisation. This powerful and versatile tool allows adding valuable functional information to T. cruzi genes and is freely available for scientific community. PMID:26200713
NASA Astrophysics Data System (ADS)
Martin, Rebecca G.; Lubow, Stephen H.
2018-06-01
In a recent paper Martin & Lubow showed that a circumbinary disc around an eccentric binary can undergo damped nodal oscillations that lead to the polar (perpendicular) alignment of the disc relative to the binary orbit. The disc angular momentum vector aligns to the eccentricity vector of the binary. We explore the robustness of this mechanism for a low mass disc (0.001 of the binary mass) and its dependence on system parameters by means of hydrodynamic disc simulations. We describe how the evolution depends upon the disc viscosity, temperature, size, binary mass ratio, orbital eccentricity and inclination. We compare results with predictions of linear theory. We show that polar alignment of a low mass disc may occur over a wide range of binary-disc parameters. We discuss the application of our results to the formation of planetary systems around eccentric binary stars.
The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit
Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.
2013-01-01
IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419
Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L
2011-12-01
The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.
Avdeeva, S V; Khaĭdarova, N V; Logunov, D Iu; Neugodova, G L; Sevast'ianova, G A; Tarantul, V Z; Naroditskiĭ, B S
2003-01-01
A method was elaborated to evaluate the biological activity of expression products of gene in the plasmid vectors, which are crucial for the synthesis of growth factor of blood vessels. It was proven as possible that the chrioallantonic membrane (CAM) of chicken's embryos could be transfected by recombinant plasmids containing both the reporter and target genes. The efficiency of CAM transfection was assessed by a plasmid carrying the reporter gene of green fluorescent protein (GFP). Finally, it was demonstrated that, at an infiltration of the recombinant plasmid containing the human angiogenine gene, its expression products induce the neovascularization in the CAM cells of chicken's embryos and stimulate an accretion in vessels of the 1st, 2nd and 3d orders.
Live, attenuated Salmonella typhimurium vectoring Campylobacter antigens.
Sizemore, Donata R; Warner, Beth; Lawrence, Julie; Jones, Amy; Killeen, Kevin P
2006-05-01
We describe the evaluation of three live, attenuated deltaphoP/Q Salmonella enteric serovar Typhimurium strains expressing PEB1 minus its signal sequence (PEB1-ss) from three different plasmids: a pBR-based asd plasmid, an arabinose-based runaway plasmid, which each expressed PEB1-ss in the bacterial cytosol, and a PEB1::HlyA fusion plasmid that directs secretion of PEB1-ss into the extracellular milieu. Serum IgG responses specific for PEB1-ss were induced by pBR-derived and runaway plasmids, with 100 and 90% seroconversion, respectively, at a 1:500 dilution of anti-sera as measured by Western blot analysis, while the PEB1-ss::HlyA fusion plasmid induced serum IgG in only 20% of the mice. Although significant levels of anti-PEB serum IgG were induced, no protection against oral Campylobacter jejuni challenge was observed.
Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro
2010-01-01
Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].
Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi
2013-04-01
This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.
Plasmids from Food Lactic Acid Bacteria: Diversity, Similarity, and New Developments
Cui, Yanhua; Hu, Tong; Qu, Xiaojun; Zhang, Lanwei; Ding, Zhongqing; Dong, Aijun
2015-01-01
Plasmids are widely distributed in different sources of lactic acid bacteria (LAB) as self-replicating extrachromosomal genetic materials, and have received considerable attention due to their close relationship with many important functions as well as some industrially relevant characteristics of the LAB species. They are interesting with regard to the development of food-grade cloning vectors. This review summarizes new developments in the area of lactic acid bacteria plasmids and aims to provide up to date information that can be used in related future research. PMID:26068451
Sehgal, Lalit; Budnar, Srikanth; Bhatt, Khyati; Sansare, Sneha; Mukhopadhaya, Amitabha; Kalraiya, Rajiv D; Dalal, Sorab N
2012-10-01
The study of protein-protein interactions, protein localization, protein organization into higher order structures and organelle dynamics in live cells, has greatly enhanced the understanding of various cellular processes. Live cell imaging experiments employ plasmid or viral vectors to express the protein/proteins of interest fused to a fluorescent protein. Unlike plasmid vectors, lentiviral vectors can be introduced into both dividing and non dividing cells, can be pseudotyped to infect a broad or narrow range of cells, and can be used to generate transgenic animals. However, the currently available lentiviral vectors are limited by the choice of fluorescent protein tag, choice of restriction enzyme sites in the Multiple Cloning Sites (MCS) and promoter choice for gene expression. In this report, HIV-1 based bi-cistronic lentiviral vectors have been generated that drive the expression of multiple fluorescent tags (EGFP, mCherry, ECFP, EYFP and dsRed), using two different promoters. The presence of a unique MCS with multiple restriction sites allows the generation of fusion proteins with the fluorescent tag of choice, allowing analysis of multiple fusion proteins in live cell imaging experiments. These novel lentiviral vectors are improved delivery vehicles for gene transfer applications and are important tools for live cell imaging in vivo.
Electrotransfer of Plasmid Vector DNA into Muscle
NASA Astrophysics Data System (ADS)
Miyazaki, Satsuki; Miyazaki, Jun-Ichi
Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.
Plasmid-mediated resistance to protein biosynthesis inhibitors in staphylococci.
Schwarz, Stefan; Fessler, Andrea T; Hauschild, Tomasz; Kehrenberg, Corinna; Kadlec, Kristina
2011-12-01
Protein biosynthesis inhibitors (PBIs) represent powerful antimicrobial agents for the control of bacterial infections. In staphylococci, numerous resistance genes are known to be involved in resistance to PBIs, most of which mediate resistance to a specific class/subclass of PBIs, though a few genes do confer a multidrug resistance phenotype-up to five classes/subclasses of PBIs. Plasmids play a key role in the dissemination of PBI resistance among staphylococci, as they primarily carry plasmid-borne PBI resistance genes; however, plasmids also can be vectors for transposon-borne PBI resistance genes. Small plasmids that carry single PBI resistance genes are widespread among staphylococci of human and animal origin. Various mechanisms exist by which they can recombine, form cointegrates, or integrate into chromosomal DNA or larger plasmids. We provide an overview of the current knowledge of plasmid-mediated PBI resistance in staphylococci, with particular reference to the currently known PBI resistance genes, their association with mobile genetic elements, and the recombination/integration processes that control their mobility. © 2011 New York Academy of Sciences.
ERIC Educational Resources Information Center
Bornhorst, Joshua A.; Deibel, Michael A.; Mulnix, Amy B.
2004-01-01
A novel experimental sequence for the advanced undergraduate laboratory course has been developed at Earlham College. Utilizing recent improvements in molecular techniques for a time-sensitive environment, undergraduates were able to create a chimera of a selected gene and green fluorescent protein (GFP) in a bacterial expression plasmid over the…
Gruber, Steffen; Schwab, Helmut; Koefinger, Petra
2015-12-25
The Gram-negative bacterium Escherichia coli is currently the most efficient and widely used prokaryotic host for recombinant protein and metabolite production. However, due to some limitations and to various interesting features of other Gram-negative bacteria efficient vector systems applicable to a broad range are desired. Basic building blocks for plasmid-based vectors include besides the need for a suitable selection marker in the first line a proper replication and maintenance system. In addition to these basic requirements, further elements are needed for Gram-negative bacteria beyond E. coli, such as Pseudomonas pudita, Ralstonia eutropha, Burkholderia glumae or Acinetobacter sp.. Established building blocks have to be adapted and new building blocks providing the desired functions need to be identified and exploited. This minireview addresses so far described and used genetic elements for broad host range replication, efficient plasmid maintenance, and conjugative plasmid transfer as well as expression elements and protein secretion signals. The industrially important bacterium R. eutropha H16 was chosen as a model organism to provide specific data on the effectivity and utility of building blocks based on such genetic elements. Copyright © 2015 Elsevier B.V. All rights reserved.
Kuske, C R; Kirkpatrick, B C
1990-01-01
Supercoiled double-stranded DNA molecules (plasmids) were isolated from plants infected with three laboratory strains of western aster yellows mycoplasma-like organism (AY-MLO) by using cesium chloride-ethidium bromide density gradients. Southern blot analysis, using plasmids from the severe strain of AY-MLO (SAY-MLO) as the probe, identified at least four plasmids in celery, aster, and periwinkle plants and in Macrosteles severini leafhopper vectors infected with either the dwarf AY-MLO, Tulelake AY-MLO, or SAY-MLO strain. Plasmids were also detected in two California field isolates of AY-MLO but not in plants infected with the beet leafhopper-transmitted virescence agent, western X, or elm yellows MLOs. SAY-MLO plasmids were 5.2, 4.9, 3.4, and 1.7 kilobase pairs in size. Plasmids isolated from dwarf AY- and Tulelake AY-MLOs were 7.4, 5.1, 3.5, and 1.7 kilobase pairs in size. No evidence was obtained for integration of SAY-MLO plasmids into the MLO chromosome. Images FIG. 1 FIG. 2 FIG. 3 FIG. 4 FIG. 5 PMID:2307660
Transformation of Lesquerella fendleri with the new binary vector pGPro4-35S
USDA-ARS?s Scientific Manuscript database
Crop genetic engineering requires the use of various promoters to control the expression of introduced transgenes. Some of the binary vectors currently available for promoter characterization in dicotyledonous plants have pitfalls due to their construction, such as containing a selectable marker ca...
USDA-ARS?s Scientific Manuscript database
The Mexican fruit fly, Anastrepha ludens, is a highly significant agricultural pest species that has been genetically transformed with a piggyBac¬-based transposon vector system using independent vector and transposase helper plasmids. Estimated germ-line transformation frequencies were approximate...
Clément, Nathalie; Avalosse, Bernard; El Bakkouri, Karim; Velu, Thierry; Brandenburger, Annick
2001-01-01
The production of wild-type-free stocks of recombinant parvovirus minute virus of mice [MVM(p)] is difficult due to the presence of homologous sequences in vector and helper genomes that cannot easily be eliminated from the overlapping coding sequences. We have therefore cloned and sequenced spontaneously occurring defective particles of MVM(p) with very small genomes to identify the minimal cis-acting sequences required for DNA amplification and virus production. One of them has lost all capsid-coding sequences but is still able to replicate in permissive cells when nonstructural proteins are provided in trans by a helper plasmid. Vectors derived from this particle produce stocks with no detectable wild-type MVM after cotransfection with new, matched, helper plasmids that present no homology downstream from the transgene. PMID:11152501
Putterman, D G; Gryczan, T J; Dubnau, D; Day, L A
1983-01-01
The genome of Pf3, a filamentous single-stranded DNA bacteriophage of Pseudomonas aeruginosa (a gram-negative organism) was cloned into pBD214, a plasmid cloning vector of Bacillus subtilis (a gram-positive organism). Cloning in the gram-positive organism was done to avoid anticipated lethal effects. The entire Pf3 genome was inserted in each orientation at a unique Bc/I site within a thymidylate synthetase gene (from B. subtilis phage beta 22) on the plasmid. Additional clones were made by inserting EcoRI fragments of Pf3 DNA into a unique EcoRI site within this gene. Images PMID:6306273
Malpartida, F; Zalacaín, M; Jiménez, A; Davies, J
1983-11-30
The gene encoding the phosphotransferase enzyme that modifies hygromycin B in its producing organism Streptomyces hygroscopicus, has been cloned in the Streptomyces vector pIJ41. Two plasmids, pFM4 and pFM6, containing 2.1 and 19.6 kb inserts of Streptomyces hygroscopicus DNA, respectively, which express the modifying enzyme, have been isolated. A 3.1 kb PstI restriction fragment from pFM4 was inserted in the Streptomyces vector pIJ350 and the resulting plasmids, pMZ11.1 and pMZ11.2, express the hygromycin B-resistance phenotype. The utility of this dominant marker for cloning experiments is discussed in the text.
Expression Plasmids for Use in Candida glabrata
Zordan, Rebecca E.; Ren, Yuxia; Pan, Shih-Jung; Rotondo, Giuseppe; Peñas, Alejandro De Las; Iluore, Joseph; Cormack, Brendan P.
2013-01-01
We describe a series of CEN/ARS episomal plasmids containing different Candida glabrata promoters, allowing for a range of constitutive or regulated expression of proteins in C. glabrata. The set of promoters includes three constitutive promoters (EGD2pr, HHT2pr, PDC1pr), two macrophage/phagocytosis-induced promoters (ACO2pr, LYS21pr), and one nutritionally regulated promoter (MET3pr). Each promoter was cloned into two plasmid backbones that differ in their selectable marker, URA3, or the dominant-selectable NAT1 gene, which confers resistance to the drug nourseothricin. Expression from the 12 resulting plasmids was assessed using GFP as a reporter and flow cytometry or quantitative reverse-transcription polymerase chain reaction to assess expression levels. Together this set of plasmids expands the toolkit of expression vectors available for use with C. glabrata. PMID:23934995
Arnak, Remigiusz; Altun, Burcin; Tosato, Valentina
2016-01-01
Summary We have constructed two plasmids that can be used for cloning as templates for PCR- -based gene disruption, mutagenesis and the construction of DNA chromosome translocation cassettes. To our knowledge, these plasmids are the first vectors that confer resistance to ampicillin, kanamycin and hygromycin B in bacteria, and to geneticin (G418) and hygromycin B in Saccharomyces cerevisiae simultaneously. The option of simultaneously using up to three resistance markers provides a highly stringent control of recombinant selection and the almost complete elimination of background resistance, while unique restriction sites allow easy cloning of chosen genetic material. Moreover, we successfully used these new vectors as PCR templates for the induction of chromosome translocation in budding yeast by the bridge-induced translocation system. Cells in which translocation was induced carried chromosomal rearrangements as expected and exhibited resistance to both, G418 and hygromycin B. These features make our constructs very handy tools for many molecular biology applications. PMID:27956856
Bouvier, León A.; Cámara, María de los Milagros; Canepa, Gaspar E.; Miranda, Mariana R.; Pereira, Claudio A.
2013-01-01
The post genomic era revealed the need for developing better performing, easier to use and more sophisticated genetic manipulation tools for the study of Trypanosoma cruzi, the etiological agent of Chagas disease. In this work a series of plasmids that allow genetic manipulation of this protozoan parasite were developed. First of all we focused on useful tools to establish selection strategies for different strains and which can be employed as expression vectors. On the other hand molecular building blocks in the form of diverse selectable markers, modifiable fluorescent protein and epitope-tag coding sequences were produced. Both types of modules were harboured in backbone molecules conceived to offer multiple construction and sub-cloning strategies. These can be used to confer new properties to already available genetic manipulation tools or as starting points for whole novel designs. The performance of each plasmid and building block was determined independently. For illustration purposes, some simple direct practical applications were conducted. PMID:24205392
Sam, Mohammad Reza; Azadbakhsh, Azadeh Sadat; Farokhi, Farrah; Rezazadeh, Kobra; Sam, Sohrab; Zomorodipour, Alireza; Haddad-Mashadrizeh, Aliakbar; Delirezh, Nowruz; Mokarizadeh, Aram
2016-05-01
Ex-vivo gene therapy of hemophilias requires suitable bioreactors for secretion of hFIX into the circulation and stem cells hold great potentials in this regard. Viral vectors are widely manipulated and used to transfer hFIX gene into stem cells. However, little attention has been paid to the manipulation of hFIX transgene itself. Concurrently, the efficacy of such a therapeutic approach depends on determination of which vectors give maximal transgene expression. With this in mind, TF-1 (primary hematopoietic lineage) and rat-bone marrow mesenchymal stem cells (BMSCs) were transfected with five hFIX-expressing plasmids containing different combinations of two human β-globin (hBG) introns inside the hFIX-cDNA and Kozak element and hFIX expression was evaluated by different methods. In BMSCs and TF-1 cells, the highest hFIX level was obtained from the intron-less and hBG intron-I,II containing plasmids respectively. The highest hFIX activity was obtained from the cells that carrying the hBG intron-I,II containing plasmids. BMSCs were able to produce higher hFIX by 1.4 to 4.7-fold increase with activity by 2.4 to 4.4-fold increase compared to TF-1 cells transfected with the same constructs. BMSCs and TF-1 cells could be effectively bioengineered without the use of viral vectors and hFIX minigene containing hBG introns could represent a particular interest in stem cell-based gene therapy of hemophilias. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I
2015-01-01
We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.
Joseph, Joan; Fernández-Lloris, Raquel; Pezzat, Elías; Saubi, Narcís; Cardona, Pere-Joan; Mothe, Beatriz; Gatell, Josep Maria
2010-01-01
Mycobacterium bovis Bacillus Calmette-Guérin (BCG) as a live vector of recombinant bacterial vaccine is a promising system to be used. In this study, we evaluate the disrupted expression of heterologous HIV-1gp120 gene in BCG Pasteur host strain using replicative vectors pMV261 and pJH222. pJH222 carries a lysine complementing gene in BCG lysine auxotrophs. The HIV-1 gp120 gene expression was regulated by BCG hsp60 promoter (in plasmid pMV261) and Mycobacteria spp. α-antigen promoter (in plasmid pJH222). Among 14 rBCG:HIV-1gp120 (pMV261) colonies screened, 12 showed a partial deletion and two showed a complete deletion. However, deletion was not observed in all 10 rBCG:HIV-1gp120 (pJH222) colonies screened. In this study, we demonstrated that E. coli/Mycobacterial expression vectors bearing a weak promoter and lysine complementing gene in a recombinant lysine auxotroph of BCG could prevent genetic rearrangements and disruption of HIV 1gp120 gene expression, a key issue for engineering Mycobacterial based vaccine vectors. PMID:20617151
The vector homology problem in diagnostic nucleic acid hybridization of clinical specimens.
Ambinder, R F; Charache, P; Staal, S; Wright, P; Forman, M; Hayward, S D; Hayward, G S
1986-01-01
Nucleic acid hybridization techniques using cloned probes are finding application in assays of clinical specimens in research and diagnostic laboratories. The probes that we and others have used are recombinant plasmids composed of viral inserts and bacterial plasmid vectors such as pBR322. We suspected that there was material homologous to pBR322 present in many clinical samples. because hybridization occurred in samples which lacked evidence of virus by other techniques. If the presence of this vector-homologous material was unrecognized, hybridization in the test sample might erroneously be interpreted as indicating the presence of viral sequences. In this paper we demonstrate specific hybridization of labeled pBR322 DNA with DNA from various clinical samples. Evidence is presented that nonspecific probe trapping could not account for this phenomenon. In mixing experiments, it is shown that contamination of clinical samples with bacteria would explain such a result. Approaches tested to circumvent this problem included the use of isolated insert probes, alternate cloning vectors, and cold competitor pBR322 DNA in prehybridization and hybridization mixes. None proved entirely satisfactory. We therefore emphasize that it is essential that all hybridization detection systems use a control probe of the vector alone in order to demonstrate the absence of material with vector homology in the specimen tested. Images PMID:3013928
Roschanski, Nicole
2010-01-01
Bdellovibrio and like organisms (BALOs) form the group of predatory bacteria which require Gram-negative bacteria as prey. Genetic studies with Bdellovibrio bacteriovorus can be performed with vectors which are introduced into the predator via conjugation. The usefulness of the two vectors pSUP202 and pSUP404.2 as genetic tools were assessed. Both vectors were transferable into B. bacteriovorus by conjugative matings with an Escherichia coli K12 strain as donor. The transfer frequency was higher for vector pSUP404.2 (approx. 10−1–10−4) as for pSUP202 (approx. 10−5–10−6). Vector pSUP202 with a pMB1 origin is unstable in the predatory bacterium, whereas pSUP404.2 is stably maintained in the absence of selective antibiotics. pSUP404.2 harbors two plasmid replicons, the p15A ori and the RSF1010 replication region The copy number of pSUP404.2 was determined by quantitative PCR in B. bacteriovorus and averages seven copies per genome. pSUP404.2 harbors two resistance genes (chloramphenicol and kanamycin) which can be used for cloning either by selection for transconjugants or by insertional inactivation. PMID:20824276
Zhang, Wenli; Solanki, Manish; Müther, Nadine; Ebel, Melanie; Wang, Jichang; Sun, Chuanbo; Izsvak, Zsuzsanna; Ehrhardt, Anja
2013-01-01
Recombinant adeno-associated viral (AAV) vectors have been shown to be one of the most promising vectors for therapeutic gene delivery because they can induce efficient and long-term transduction in non-dividing cells with negligible side-effects. However, as AAV vectors mostly remain episomal, vector genomes and transgene expression are lost in dividing cells. Therefore, to stably transduce cells, we developed a novel AAV/transposase hybrid-vector. To facilitate SB-mediated transposition from the rAAV genome, we established a system in which one AAV vector contains the transposon with the gene of interest and the second vector delivers the hyperactive Sleeping Beauty (SB) transposase SB100X. Human cells were infected with the AAV-transposon vector and the transposase was provided in trans either by transient and stable plasmid transfection or by AAV vector transduction. We found that groups which received the hyperactive transposase SB100X showed significantly increased colony forming numbers indicating enhanced integration efficiencies. Furthermore, we found that transgene copy numbers in transduced cells were dose-dependent and that predominantly SB transposase-mediated transposition contributed to stabilization of the transgene. Based on a plasmid rescue strategy and a linear-amplification mediated PCR (LAM-PCR) protocol we analysed the SB100X-mediated integration profile after transposition from the AAV vector. A total of 1840 integration events were identified which revealed a close to random integration profile. In summary, we show for the first time that AAV vectors can serve as template for SB transposase mediated somatic integration. We developed the first prototype of this hybrid-vector system which with further improvements may be explored for treatment of diseases which originate from rapidly dividing cells. PMID:24116154
Cormier, Catherine Y.; Mohr, Stephanie E.; Zuo, Dongmei; Hu, Yanhui; Rolfs, Andreas; Kramer, Jason; Taycher, Elena; Kelley, Fontina; Fiacco, Michael; Turnbull, Greggory; LaBaer, Joshua
2010-01-01
The Protein Structure Initiative Material Repository (PSI-MR; http://psimr.asu.edu) provides centralized storage and distribution for the protein expression plasmids created by PSI researchers. These plasmids are a resource that allows the research community to dissect the biological function of proteins whose structures have been identified by the PSI. The plasmid annotation, which includes the full length sequence, vector information and associated publications, is stored in a freely available, searchable database called DNASU (http://dnasu.asu.edu). Each PSI plasmid is also linked to a variety of additional resources, which facilitates cross-referencing of a particular plasmid to protein annotations and experimental data. Plasmid samples can be requested directly through the website. We have also developed a novel strategy to avoid the most common concern encountered when distributing plasmids namely, the complexity of material transfer agreement (MTA) processing and the resulting delays this causes. The Expedited Process MTA, in which we created a network of institutions that agree to the terms of transfer in advance of a material request, eliminates these delays. Our hope is that by creating a repository of expression-ready plasmids and expediting the process for receiving these plasmids, we will help accelerate the accessibility and pace of scientific discovery. PMID:19906724
Vogel, R F; Lohmann, M; Weller, A N; Hugas, M; Hammes, W P
1991-11-15
Plasmid profiles of strains of Lactobacillus curvatus and L. sake isolated from meat or sauerkraut were analysed to investigate plasmid homology and distribution in relation to the ecology of these organisms in fermenting foods. A hybridisation probe was constructed by cloning of pLc2, a cryptic, 2.6-kbp plasmid from L. curvatus LTH683, into the Escherichia coli plasmid pRV50. In Southern hybridisations with the digoxygenine labeled pLc2 probe, pLc2-related small plasmids were frequently detected in meat-borne strains of L. casei subsp. pseudoplantarum, L. curvatus, L. sake, L. alimentarius, L. farciminis and L. halotolerans and in L. curvatus and L. sake isolated from sauerkraut. Among 27 Lactobacillus type strains originally isolated from habitats other than meat this type of homology was detected only with plasmids of L. buchneri and L. mali. Restriction-enzyme mapping of six small cryptic plasmids from L. curvatus and L. sake revealed strong structural homology but no similarity to previously characterized plasmids of lactobacilli. The presence of a variable region in addition to a conserved one and the occurrence of deletions during cloning of pLc2 suggest that vectors derived from these plasmids are likely to be structurally unstable.
Optimization of a one-step heat-inducible in vivo mini DNA vector production system.
Nafissi, Nafiseh; Sum, Chi Hong; Wettig, Shawn; Slavcev, Roderick A
2014-01-01
While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called "Super Sequences" that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼ 90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics.
Optimization of a One-Step Heat-Inducible In Vivo Mini DNA Vector Production System
Wettig, Shawn; Slavcev, Roderick A.
2014-01-01
While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called “Super Sequences” that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics. PMID:24586704
Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A
1996-10-01
Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure.
Shao, Huanhuan; Cao, Qinghua; Zhao, Hongyan; Tan, Xuemei; Feng, Hong
2015-01-01
A native plasmid (pSU01) was detected by genome sequencing of Bacillus subtilis strain S1-4. Two pSU01-based shuttle expression vectors pSU02-AP and pSU03-AP were constructed enabling stable replication in B. subtilis WB600. These vectors contained the reporter gene aprE, encoding an alkaline protease from Bacillus pumilus BA06. The expression vector pSU03-AP only possessed the minimal replication elements (rep, SSO, DSO) and exhibited more stability on structure, suggesting that the rest of the genes in pSU01 (ORF1, ORF2, mob, hsp) were unessential for the structural stability of plasmid in B. subtilis. In addition, recombinant production of the alkaline protease was achieved more efficiently with pSU03-AP whose copy number was estimated to be more than 100 per chromosome. Furthermore, pSU03-AP could also be used to transform and replicate in B. pumilus BA06 under selective pressure. In conclusion, pSU03-AP is expected to be a useful tool for gene expression in Bacillus subtilis and B. pumilus.
Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun
2013-08-01
To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.
Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A
1996-01-01
Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure. PMID:8824624
Li, Xinxin; Wu, Zhihao; Zhang, Chuanfu; Jia, Leili; Song, Hongbin; Xu, Yuanyong
2014-01-01
To construct a eukaryotic expression vector containing human complement receptor 2 (CR2)-Fc and express the CR2-Fc fusion protein in Chinese hamster ovary (CHO) cells. The extracellular domain of human CR2 and IgG1 Fc were respectively amplified, ligated and inserted into the eukaryotic expression vector PCI-neo. After verified by restriction enzyme digestion and sequencing, the recombinant plasmid was transfected into CHO K1 cells. The ones with stable expression of the fusion protein were obtained by means of G418 selection. The expression of the CR2-Fc fusion protein was detected and confirmed by SDS-PAGE and Western blotting. Restriction enzyme digestion and sequencing demonstrated that the recombinant plasmid was valid. SDS-PAGE showed that relative molecular mass (Mr;) of the purified product was consistent with the expected value. Western blotting further proved the single band at the same position. We constructed the eukaryotic expression vector of CR2-Fc/PCI-neo successfully. The obtained fusion protein was active and can be used for the further study of the role in HIV control.
Plasmid P1 replication: negative control by repeated DNA sequences.
Chattoraj, D; Cordes, K; Abeles, A
1984-01-01
The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pieces of the incA fragment that each contain only three repeats destabilize P1 plasmids efficiently. This result makes it unlikely that incA specifies a regulatory product. Our in vivo results suggest that the repeating DNA sequence itself negatively controls replication by titrating a P1-determined protein, RepA, that is essential for replication. Consistent with this hypothesis is the observation that the RepA protein binds to the incA fragment in vitro. Images PMID:6387706
Transformation of Schwanniomyces occidentalis with an ADE2 gene cloned from S. occidentalis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Klein, R.D.; Favreau, M.A.
1988-12-01
We have developed an efficient transformation system for the industrial yeast Schwanniomyces occidentalis (formerly Schwanniomyces castellii). The transformation system is based on ade2 mutants of S. occidentalis deficient for phosphoribosylaminoimidazole carboxylase that were generated by mutagenesis. As a selectable marker, we isolated and characterized the S. occidentalis ADE2 gene by complementation in an ade2 strain of Saccharomyces cerevisiae. S. occidentalis was transformed with the recombinant plasmid pADE, consisting of a 4.5-kilobase-pair (kbp) DNA fragment from S. occidentalis containing the ADE2 gene inserted into the S. cerevisiae expression vector pYcDE8 by a modification of the spheroplasting procedure of Beggs. Intact plasmidsmore » were recovered in Escherichia coli from whole-cell lysates of ADE+ transformants, indicating that plasmids were replicating autonomously. High-molecular-mass species of pADE2 were found by Southern hybridization analysis of intact genomic DNA preparations. The shift to higher molecular mass of these plasmids during electrophoresis in the presence ethidium bromide after exposure to shortwave UV suggests that they exist in a supercoiled form in the transformed host. Subclones of the 4.5-kbp insert indicated that ADE2-complementing activity and sequences conferring autonomous replication in S. occidentalis were located within a 2.7-kbp EcoRI-SphI fragment. Plasmids containing this region cloned into the bacterial vector pUC19 complemented ade2 mutants of S. occidentalis with efficiencies identical to those of the original plasmid pADE.« less
Wang, Jianye; Huang, Yu; Ling, Jueyi; Wang, Zhixiang; Zhu, Guoqiang
2017-12-01
For members of the family Parvoviridae, rescue of infectious virus from recombinant plasmid is usually done in cultured cells. In this study, the whole genome of the pathogenic Muscovy duck parvovirus (MDPV) strain YY was cloned into the pBluescript II (SK) vector, generating recombinant plasmid pYY. With the aid of a transfection reagent, pYY plasmid was inoculated into 11-day-old embryonated Muscovy duck eggs via the chorioallantoic membrane route, resulting in the successful rescue of infectious virus and death of the embryos. The rescued virus exhibited pathogenicity in Muscovy ducklings similar to that of its parental strain, as evaluated based on the mortality rate. The results demonstrate that plasmid transfection in embryonated Muscovy duck eggs is a convenient and efficacious method for rescue of infectious MDPV in comparison to transfection of primary cells, which is somewhat time-consuming and laborious.
Advances in Non-Viral DNA Vectors for Gene Therapy
Hardee, Cinnamon L.; Arévalo-Soliz, Lirio Milenka; Hornstein, Benjamin D.; Zechiedrich, Lynn
2017-01-01
Uses of viral vectors have thus far eclipsed uses of non-viral vectors for gene therapy delivery in the clinic. Viral vectors, however, have certain issues involving genome integration, the inability to be delivered repeatedly, and possible host rejection. Fortunately, development of non-viral DNA vectors has progressed steadily, especially in plasmid vector length reduction, now allowing these tools to fill in specifically where viral or other non-viral vectors may not be the best options. In this review, we examine the improvements made to non-viral DNA gene therapy vectors, highlight opportunities for their further development, address therapeutic needs for which their use is the logical choice, and discuss their future expansion into the clinic. PMID:28208635
Ultra-low background DNA cloning system.
Goto, Kenta; Nagano, Yukio
2013-01-01
Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r)). First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r) 5' UTR (untranslated region) and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r) 3' UTR. This cassette allowed conversion of the Amp(r)-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r) sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.
D'Costa, Susan; Blouin, Veronique; Broucque, Frederic; Penaud-Budloo, Magalie; François, Achille; Perez, Irene C; Le Bec, Christine; Moullier, Philippe; Snyder, Richard O; Ayuso, Eduard
2016-01-01
Clinical trials using recombinant adeno-associated virus (rAAV) vectors have demonstrated efficacy and a good safety profile. Although the field is advancing quickly, vector analytics and harmonization of dosage units are still a limitation for commercialization. AAV reference standard materials (RSMs) can help ensure product safety by controlling the consistency of assays used to characterize rAAV stocks. The most widely utilized unit of vector dosing is based on the encapsidated vector genome. Quantitative polymerase chain reaction (qPCR) is now the most common method to titer vector genomes (vg); however, significant inter- and intralaboratory variations have been documented using this technique. Here, RSMs and rAAV stocks were titered on the basis of an inverted terminal repeats (ITRs) sequence-specific qPCR and we found an artificial increase in vg titers using a widely utilized approach. The PCR error was introduced by using single-cut linearized plasmid as the standard curve. This bias was eliminated using plasmid standards linearized just outside the ITR region on each end to facilitate the melting of the palindromic ITR sequences during PCR. This new "Free-ITR" qPCR delivers vg titers that are consistent with titers obtained with transgene-specific qPCR and could be used to normalize in-house product-specific AAV vector standards and controls to the rAAV RSMs. The free-ITR method, including well-characterized controls, will help to calibrate doses to compare preclinical and clinical data in the field.
Bruni, C B; Musti, A M; Frunzio, R; Blasi, F
1980-01-01
A fragment of deoxyribonucleic acid 5,300 base paris long and containing the promoter-proximal portion of the histidine operon of Escherichia coli K-12, has been cloned in plasmid pBR313 (plasmids pCB2 and pCB3). Restriction mapping, partial nucleotide sequencing, and studies on functional expression in vivo and on protein synthesis in minicells have shown that the fragment contains the regulatory region of the operon, the hisG, hisD genes, and part of the hisC gene. Another plasmid (pCB5) contained the hisG gene and part of the hisD gene. Expression of the hisG gene in the latter plasmid was under control of the tetracycline promoter of the pBR313 plasmid. The in vivo expression of the two groups of plasmids described above, as well as their effect on the expression of the histidine genes not carried by the plasmids but present on the host chromosome, has been studied. The presence of multiple copies of pCB2 or pCB3, but not of pCB5, prevented derepression of the chromosomal histidine operon. Possible interpretations of this phenomenon are discussed. Images PMID:6246067
Vectorology and Factor Delivery in Induced Pluripotent Stem Cell Reprogramming
2014-01-01
Induced pluripotent stem cell (iPSC) reprogramming requires sustained expression of multiple reprogramming factors for a limited period of time (10–30 days). Conventional iPSC reprogramming was achieved using lentiviral or simple retroviral vectors. Retroviral reprogramming has flaws of insertional mutagenesis, uncontrolled silencing, residual expression and re-activation of transgenes, and immunogenicity. To overcome these issues, various technologies were explored, including adenoviral vectors, protein transduction, RNA transfection, minicircle DNA, excisable PiggyBac (PB) transposon, Cre-lox excision system, negative-sense RNA replicon, positive-sense RNA replicon, Epstein-Barr virus-based episomal plasmids, and repeated transfections of plasmids. This review provides summaries of the main vectorologies and factor delivery systems used in current reprogramming protocols. PMID:24625220
Zhou, Jingxiang; Xue, Jiangdong; Wang, Qiuju; Zhu, Xia; Li, Xingwei; Lv, Wenliang; Zhang, Dongming
2014-06-01
In order to construct the recombinant plasmid of pIRES-ORF81, the nucleic acid isolated from Koi herpes virus-CJ (KHV-CJ) strains was used as a template to insert the ORF81 gene fragments amplified by PCR into the pIRES-neo, a kind of eukaryotic expression vector. Using Western blotting analysis, it was verified that ORF81 gene protein can be expressed correctly by pIRES-ORF81, after MFC cells were transfected. The recombinant plasmid pIRES-ORF81 was set into three immunization dose gradients: 1, 10, and 50 μg/carp. Empty plasmid group, PBS group, and blank control group were set simultaneously. Giving intramuscular injections to healthy carps with an average body mass of 246 ± 20 g, indirect ELISA was used to regularly determine antibody levels after three times immunization injection. Neutralizing antibodies were detected by neutralization assay. The results of inoculation tests showed that the pIRES-ORF81 recombinant plasmid can induce the production of carp-specific antibodies. The differences of immune effect between the three different doses of immune gradients were not significant (P > 0.05), but they can induce the production of neutralizing antibodies. After 25 d of inoculation, carp mortality of pIRES-neo empty vector treatment groups was 85%, while the carp mortality of eukaryotic expression recombinant plasmid pIRES-ORF81 injected with three different doses of immune gradients was 20, 17.5, and 12.5%, respectively. Differences in comparison to the control group were highly significant (P < 0.01). However, histopathological section of immunohistochemistry organization revealed no significant changes. It demonstrated that the DNA vaccine pIRES-ORF81 constructed in the experiment displayed a good protective effect against KHV, which had the potential to industrial applications.
Application of succulent plant leaves for Agrobacterium infiltration-mediated protein production
USDA-ARS?s Scientific Manuscript database
Infiltration of tobacco leaves with a suspension of Agrobacterium tumefaciens harboring a binary plant expression plasmid provides a convenient method for laboratory scale protein production. When expressing plant cell wall degrading enzymes in the widely used tobacco (Nicotiana benthamiana), diffic...
Sieben, Michaela; Steinhorn, Gregor; Müller, Carsten; Fuchs, Simone; Ann Chin, Laura; Regestein, Lars; Büchs, Jochen
2016-11-01
Plasmids are common vectors to genetically manipulate Escherichia coli or other microorganisms. They are easy to use and considerable experience has accumulated on their application in heterologous protein production. However, plasmids can be lost during cell growth, if no selection pressure like, e.g., antibiotics is used, hampering the production of the desired protein and endangering the economic success of a biotechnological production process. Thus, in this study the Continuously Operated Shaken BIOreactor System (COSBIOS) is applied as a tool for fast parallel testing of strain stability and operation conditions and to evaluate measures to counter such plasmid loss. In specific, by applying various ampicillin concentrations, the lowest effective ampicillin dosage is investigated to secure plasmid stability while lowering adverse ecological effects. A significant difference was found in the growth rates of plasmid-bearing and plasmid-free cells. The undesired plasmid-free cells grew 30% faster than the desired plasmid-bearing cells. During the testing of plasmid stability without antibiotics, the population fraction of plasmid-bearing cells rapidly decreased in continuous culture to zero within the first 48 h. An initial single dosage of ampicillin did not prevent plasmid loss. By contrast, a continuous application of a low dosage of 10 µg/mL ampicillin in the feed medium maintained plasmid stability in the culture. Consequently, the COSBIOS is an apt reactor system for measuring plasmid stability and evaluating methods to enhance this stability. Hence, decreased production of heterologous protein can be prevented. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1418-1425, 2016. © 2016 American Institute of Chemical Engineers.
Kimura, Tetsuya; Nakao, Akihide; Murata, Sachiko; Kobayashi, Yasuyuki; Tanaka, Yuji; Shibahara, Kenta; Kawazu, Tetsu; Nakagawa, Tsuyoshi
2013-01-01
We developed the Gateway recycling cloning system, which allows multiple linking of expression cassettes by multiple rounds of the Gateway LR reaction. Employing this system, the recycling donor vector pRED419 was subjected to the first LR reaction with an attR1-attR2 type destination vector. Then conversion vector pCON was subjected to an LR reaction to restore the attR1-attR2 site on the destination vector for the next cloning cycle. By repetition of these two simple steps, we linked four expression cassettes of a reporter gene in Gateway binary vector pGWB1, introduced the constructs into tobacco BY-2 cells, and observed the expression of transgenes.
Lim, Seungmo; Nam, Moon; Kim, Kil Hyun; Lee, Su-Heon; Moon, Jung-Kyung; Lim, Hyoun-Sub; Choung, Myoung-Gun; Kim, Sang-Mok; Moon, Jae Sun
2016-02-01
A new vector using Soybean yellow common mosaic virus (SYCMV) was constructed for gene function study or heterologous protein expression in soybeans. The in vitro transcript with a 5' cap analog m7GpppG from an SYCMV full-length infectious vector driven by a T7 promoter infected soybeans (pSYCMVT7-full). The symptoms observed in the soybeans infected with either the sap from SYCMV-infected leaves or pSYCMVT7-full were indistinguishable, suggesting that the vector exhibits equivalent biological activity as the virus itself. To utilize the vector further, a DNA-based vector driven by the Cauliflower mosaic virus (CaMV) 35S promoter was constructed. The complete sequence of the SYCMV genome was inserted into a binary vector flanked by a CaMV 35S promoter at the 5' terminus of the SYCMV genome and a cis-cleaving ribozyme sequence followed by a nopaline synthase terminator at the 3' terminus of the SYCMV genome (pSYCMV-full). The SYCMV-derived vector was tested for use as a virus-induced gene silencing (VIGS) vector for the functional analysis of soybean genes. VIGS constructs containing either a fragment of the Phytoene desaturase (PDS) gene (pSYCMV-PDS1) or a fragment of the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (RbcS) gene (pSYCMV-RbcS2) were constructed. Plants infiltrated with each vector using the Agrobacterium-mediated inoculation method exhibited distinct symptoms, such as photo-bleaching in plants infiltrated with pSYCMV-PDS1 and yellow or pale green coloring in plants infiltrated with pSYCMV-RbcS2. In addition, down-regulation of the transcripts of the two target genes was confirmed via northern blot analysis. Particle bombardment and direct plasmid DNA rubbing were also confirmed as alternative inoculation methods. To determine if the SYCMV vector can be used for the expression of heterologous proteins in soybean plants, the vector encoding amino acids 135-160 of VP1 of Foot-and-mouth disease virus (FMDV) serotype O1 Campos (O1C) was constructed (pSYCMV-FMDV). Plants infiltrated with pSYCMV-FMDV were only detected via western blotting using the O1C antibody. Based on these results, we propose that the SYCMV-derived vector can be used for gene function study or expression of useful heterologous proteins in soybeans. Copyright © 2015 Elsevier B.V. All rights reserved.
Miller, A D; Metzger, M J
2011-05-01
APOBEC3 proteins are packaged into retrovirus virions and can hypermutate retroviruses during reverse transcription. We found that HT-1080 human fibrosarcoma cells hypermutate retroviruses, and that the HT-1080 cell-derived FLYA13 retrovirus packaging cells also hypermutate a retrovirus vector produced using these cells. We found no hypermutation of the same vector produced by the mouse cell-derived packaging line PT67 or by human 293 cells transfected with the vector and retrovirus packaging plasmids. We expect that avoidance of vector hypermutation will be particularly important for vectors used in gene therapy, wherein mutant proteins might stimulate deleterious immune responses.
Yao, Qingxia; Qian, Ping; Huang, Qinfeng; Cao, Yi; Chen, Huanchun
2008-01-01
The P12A3C gene from FMDV (serotype O) encoding the capsid precursor protein, and the highly immunogenic gene FHG, which encodes multiple epitopes of FMDV capsid proteins, were inserted into eukaryotic expression vectors to compare different candidate genetically engineered vaccines for foot-and-mouth disease (FMD). A modified live pseudorabies virus (MLPRV) was also used to deliver P12A3C. Guinea pigs were inoculated intramuscularly with the candidate vaccines to compare the ability to elicit immunity of the DNA vector and a live viral vector. An indirect enzyme-linked immunosorbent assay (iELISA), virus-neutralization test and lymphoproliferation assay were used to detect antibody and cellular responses. The group immunized with P12A3C delivered by MLPRV produced significantly greater antibody and cellular responses indicating that MLPRV has a greater ability to mediate exogenous gene delivery than the plasmid DNA vector. Comparison of the immune responses induced by P12A3C and FHG, which were both mediated by DNA plasmids, showed that FHG and P12A3C elicited similar cellular responses, while P12A3C induced higher antibody levels, suggesting that P12A3C is a more powerful immunogen than FHG. In challenge experiments, guinea pigs vaccinated with P12A3C delivered by MLPRV were protected fully from FMDV challenge, whereas guinea pigs vaccinated with P12A3C or FHG delivered by DNA plasmid were only protected partially. This study provides a basis for future construction of a genetically engineered vaccine for FMDV.
Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei
2015-08-01
DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.
Singer, John T; Phennicie, Ryan T; Sullivan, Matthew J; Porter, Laura A; Shaffer, Valerie J; Kim, Carol H
2010-06-01
To observe real-time interactions between green fluorescent protein-labeled immune cells and invading bacteria in the zebrafish (Danio rerio), a series of plasmids was constructed for the red fluorescent protein (RFP) labeling of a variety of fish and human pathogens. The aim of this study was to create a collection of plasmids that would express RFP pigments both constitutively and under tac promoter regulation and that would be nontoxic and broadly transmissible to a variety of Gram-negative bacteria. DNA fragments encoding the RFP dimeric (d), monomeric (m), and tandem dimeric (td) derivatives d-Tomato, td-Tomato, m-Orange, and m-Cherry were cloned into the IncQ-based vector pMMB66EH in Escherichia coli. Plasmids were mobilized into recipient strains by conjugal mating. Pigment production was inducible in Escherichia coli, Pseudomonas aeruginosa, Edwardsiella tarda, and Vibrio (Listonella) anguillarum strains by isopropyl-beta-d-thiogalactopyranoside (IPTG) treatment. A spontaneous mutant exconjugant of P. aeruginosa PA14 was isolated that expressed td-Tomato constitutively. Complementation analysis revealed that the constitutive phenotype likely was due to a mutation in lacI(q) carried on pMMB66EH. DNA sequence analysis confirmed the presence of five transitions, four transversions, and a 2-bp addition within a 14-bp region of lacI. Vector DNA was purified from this constitutive mutant, and structural DNA sequences for RFP pigments were cloned into the constitutive vector. Exconjugants of P. aeruginosa, E. tarda, and V. anguillarum expressed all pigments in an IPTG-independent fashion. Results from zebrafish infectivity studies indicate that RFP-labeled pathogens will be useful for the study of real-time interactions between host cells of the innate immune system and the infecting pathogen.
Corridon, Peter R.; Rhodes, George J.; Leonard, Ellen C.; Basile, David P.; Gattone, Vincent H.; Bacallao, Robert L.
2013-01-01
Gene therapy has been proposed as a novel alternative to treat kidney disease. This goal has been hindered by the inability to reliably deliver transgenes to target cells throughout the kidney, while minimizing injury. Since hydrodynamic forces have previously shown promising results, we optimized this approach and designed a method that utilizes retrograde renal vein injections to facilitate transgene expression in rat kidneys. We show, using intravital fluorescence two-photon microscopy, that fluorescent albumin and dextrans injected into the renal vein under defined conditions of hydrodynamic pressure distribute broadly throughout the kidney in live animals. We found injection parameters that result in no kidney injury as determined by intravital microscopy, histology, and serum creatinine measurements. Plasmids, baculovirus, and adenovirus vectors, designed to express EGFP, EGFP-actin, EGFP-occludin, EGFP-tubulin, tdTomato-H2B, or RFP-actin fusion proteins, were introduced into live kidneys in a similar fashion. Gene expression was then observed in live and ex vivo kidneys using two-photon imaging and confocal laser scanning microscopy. We recorded widespread fluorescent protein expression lasting more than 1 mo after introduction of transgenes. Plasmid and adenovirus vectors provided gene transfer efficiencies ranging from 50 to 90%, compared with 10–50% using baculovirus. Using plasmids and adenovirus, fluorescent protein expression was observed 1) in proximal and distal tubule epithelial cells; 2) within glomeruli; and 3) within the peritubular interstitium. In isolated kidneys, fluorescent protein expression was observed from the cortex to the papilla. These results provide a robust approach for gene delivery and the study of protein function in live mammal kidneys. PMID:23467422
Context-Aware Local Binary Feature Learning for Face Recognition.
Duan, Yueqi; Lu, Jiwen; Feng, Jianjiang; Zhou, Jie
2018-05-01
In this paper, we propose a context-aware local binary feature learning (CA-LBFL) method for face recognition. Unlike existing learning-based local face descriptors such as discriminant face descriptor (DFD) and compact binary face descriptor (CBFD) which learn each feature code individually, our CA-LBFL exploits the contextual information of adjacent bits by constraining the number of shifts from different binary bits, so that more robust information can be exploited for face representation. Given a face image, we first extract pixel difference vectors (PDV) in local patches, and learn a discriminative mapping in an unsupervised manner to project each pixel difference vector into a context-aware binary vector. Then, we perform clustering on the learned binary codes to construct a codebook, and extract a histogram feature for each face image with the learned codebook as the final representation. In order to exploit local information from different scales, we propose a context-aware local binary multi-scale feature learning (CA-LBMFL) method to jointly learn multiple projection matrices for face representation. To make the proposed methods applicable for heterogeneous face recognition, we present a coupled CA-LBFL (C-CA-LBFL) method and a coupled CA-LBMFL (C-CA-LBMFL) method to reduce the modality gap of corresponding heterogeneous faces in the feature level, respectively. Extensive experimental results on four widely used face datasets clearly show that our methods outperform most state-of-the-art face descriptors.
Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of streptococcus pneumontae
Lacks, Sanford A.
1990-01-01
Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252.
Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of Streptococcus pneumontae
Lacks, S.A.
1990-10-02
Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252. 9 figs.
Introduction to the ultrasound targeted microbubble destruction technique.
Walton, Chad B; Anderson, Cynthia D; Boulay, Rachel; Shohet, Ralph V
2011-06-12
In UTMD, bioactive molecules, such as negatively charged plasmid DNA vectors encoding a gene of interest, are added to the cationic shells of lipid microbubble contrast agents. In mice these vector-carrying microbubbles can be administered intravenously or directly to the left ventricle of the heart. In larger animals they can also be infused through an intracoronary catheter. The subsequent delivery from the circulation to a target organ occurs by acoustic cavitation at a resonant frequency of the microbubbles. It seems likely that the mechanical energy generated by the microbubble destruction results in transient pore formation in or between the endothelial cells of the microvasculature of the targeted region. As a result of this sonoporation effect, the transfection efficiency into and across the endothelial cells is enhanced, and transgene-encoding vectors are deposited into the surrounding tissue. Plasmid DNA remaining in the circulation is rapidly degraded by nucleases in the blood, which further reduces the likelihood of delivery to non-sonicated tissues and leads to highly specific target-organ transfection.
[Experimental study on human periodontal ligament cells transfected with human amelogenin gene].
Yu, Guang; Shu, Rong; Sun, Ying; Cheng, Lan; Song, Zhong-Chen; Zhang, Xiu-Li
2008-02-01
To construct the recombinant lentiviral vector of human amelogenin gene, infect human periodontal ligament cells with the recombinant lentivirus, and evaluate the feasibility of applying modified PDLCs as seeds for a further periodontal reconstruction. The mature peptide of hAm cDNA was cloned and linked into the vector plasmid, the recombinant plasmid FUAmW was confirmed by double enzyme digestion and sequence analysis. Recombinant lentivirus was prepared from 293T cells by polytheylenimine (PEI)-mediated transient cotransfection. The hPDLCs and 293T cells were infected with the generated lentivirus. The infection efficiency was analysed by detection of green fluorescence protein (GFP) with fluorescent microscope and flow cytometer 72 hours later. The expression of hAm gene was detected by reverse transcription polymerase chain reaction (RT-PCR). The sequence of inserted fragment in recombinant plasmid was identical to the hAm sequence reported in Genebank. Green fluorescence was visible under fluorescent microscope, FCM assay showed that positive percentage was 69.46% and 33.99% in 293T and hPDLCs, respectively. The targeted gene was obtained in the experimental groups by RT-PCR. The recombinan lentiviral vector of hAm gene is constructed successfully and it could be transfected into cultured hPDLCs. hAm gene and seed cells may be used for further study in the fields periodontal tissue engineering. Supported by National Natural Science Foundation of China (Grant No. 30672315).
Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk
2013-01-01
As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077
Ugorcáková, J; Bukovská, G; Timko, J
2000-01-01
We constructed new promoter-probe vectors for E. coli and corynebacteria based on the promoterless alpha-amylase gene originating from Bacillus subtilis. Vectors pJUPAE1 and pJUPAE2 are suitable for isolation of transcriptionally active fragments from plasmids, phages or genomic DNA. alpha-Amylase activity can be easily visually detected on agar plates containing a chromogenic substrate, or by direct measurement of alpha-amylase activity.
Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate
Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook
2014-01-01
Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987
Tsurushita, N; Fu, H; Warren, C
1996-06-12
New phage display vectors for in vivo recombination of immunoglobulin (Ig) heavy (VH) and light (VL) chain variable genes, to make single-chain Fv fragments (scFv), were constructed. The VH and VL genes of monoclonal antibody (mAb) EP-5C7, which binds to both human E- and P-selectin, were cloned into a pUC19-derived plasmid vector, pCW93, and a pACYC184-derived phagemid vector, pCW99, respectively. Upon induction of Cre recombinase (phage P1 recombinase), the VH and VL genes were efficiently recombined into the same plasmid via the two loxP sites (phage P1 recombination sites), one located downstream from a VH gene in pCW93 and another upstream from a VL gene in pCW99. In the resulting phagemid, the loxP sequence also encodes a polypeptide linker connecting the VH and VL domains to form a scFv of EP-5C7. Whether expressed on the phage surface or as a soluble form, the EP-5C7 scFv showed specific binding to human E- and P-selectin. This phagemid vector system provides a way to recombine VH and VL gene libraries efficiently in vivo to make extremely large Ig combinatorial libraries.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yagi, T.; Tatsumi-Miyajima, J.; Sato, M.
1991-06-15
To assess the contribution to mutagenesis by human DNA repair defects, a UV-treated shuttle vector plasmid, pZ189, was passed through fibroblasts derived from Japanese xeroderma pigmentosum (XP) patients in two different DNA repair complementation groups (A and F). Patients with XP have clinical and cellular UV hypersensitivity, increased frequency of skin cancer, and defects in DNA repair. The XP DNA repair defects represented by complementation groups A (XP-A) and F (XP-F) are more common in Japan than in Europe or the United States. In comparison to results with DNA repair-proficient human cells (W138-VA13), UV-treated pZ189 passed through the XP-A (XP2OS(SV))more » or XP-F (XP2YO(SV)) cells showed fewer surviving plasmids (XP-A less than XP-F) and a higher frequency of mutated plasmids (XP-A greater than XP-F). Base sequence analysis of more than 200 mutated plasmids showed the major type of base substitution mutation to be the G:C----A:T transition with all three cell lines. The XP-A and XP-F cells revealed a higher frequency of G:C----A:T transitions and a lower frequency of transversions among plasmids with single or tandem mutations and a lower frequency of plasmids with multiple point mutations compared to the normal line. The spectrum of mutations in pZ189 with the XP-A cells was similar to that with the XP-F cells. Seventy-six to 91% of the single base substitution mutations occurred at G:C base pairs in which the 5{prime}-neighboring base of the cytosine was thymine or cytosine. These studies indicate that the DNA repair defects in Japanese XP patients in complementation groups A and F result in different frequencies of plasmid survival and mutagenesis but in similar types of mutagenic abnormalities despite marked differences in clinical features.« less
Mo, Yongkai; Quanquin, Natalie M; Vecino, William H; Ranganathan, Uma Devi; Tesfa, Lydia; Bourn, William; Derbyshire, Keith M; Letvin, Norman L; Jacobs, William R; Fennelly, Glenn J
2007-10-01
Mycobacteria target and persist within phagocytic monocytes and are strong adjuvants, making them attractive candidate vectors for DNA vaccines. We characterized the ability of mycobacteria to deliver transgenes to mammalian cells and the effects of various bacterial chromosomal mutations on the efficiency of transfer in vivo and in vitro. First, we observed green fluorescent protein expression via microscopy and fluorescence-activated cell sorting analysis after infection of phagocytic and nonphagocytic cell lines by Mycobacterium smegmatis or M. bovis BCG harboring a plasmid encoding the fluorescence gene under the control of a eukaryotic promoter. Next, we compared the efficiencies of gene transfer using M. smegmatis or BCG containing chromosomal insertions or deletions that cause early lysis, hyperconjugation, or an increased plasmid copy number. We observed a significant-albeit only 1.7-fold-increase in the level of plasmid transfer to eukaryotic cells infected with M. smegmatis hyperconjugation mutants. M. smegmatis strains that overexpressed replication proteins (Rep) of pAL5000, a plasmid whose replicon is incorporated in many mycobacterial constructs, generated a 10-fold increase in plasmid copy number and 3.5-fold and 3-fold increases in gene transfer efficiency to HeLa cells and J774 cells, respectively. Although BCG strains overexpressing Rep could not be recovered, BCG harboring a plasmid with a copy-up mutation in oriM resulted in a threefold increase in gene transfer to J774 cells. Moreover, M. smegmatis strains overexpressing Rep enhanced gene transfer in vivo compared with a wild-type control. Immunization of mice with mycobacteria harboring a plasmid (pgp120(h)(E)) encoding human immunodeficiency virus gp120 elicited gp120-specific CD8 T-cell responses among splenocytes and peripheral blood mononuclear cells that were up to twofold (P < 0.05) and threefold (P < 0.001) higher, respectively, in strains supporting higher copy numbers. The magnitude of these responses was approximately one-half of that observed after intramuscular immunization with pgp120(h)(E). M. smegmatis and other nonpathogenic mycobacteria are promising candidate vectors for DNA vaccine delivery.
Karnan, Sivasundaram; Ota, Akinobu; Konishi, Yuko; Wahiduzzaman, Md; Hosokawa, Yoshitaka; Konishi, Hiroyuki
2016-01-01
The adeno-associated virus (AAV)-based targeting vector has been one of the tools commonly used for genome modification in human cell lines. It allows for relatively efficient gene targeting associated with 1–4-log higher ratios of homologous-to-random integration of targeting vectors (H/R ratios) than plasmid-based targeting vectors, without actively introducing DNA double-strand breaks. In this study, we sought to improve the efficiency of AAV-mediated gene targeting by introducing a 2A-based promoter-trap system into targeting constructs. We generated three distinct AAV-based targeting vectors carrying 2A for promoter trapping, each targeting a GFP-based reporter module incorporated into the genome, PIGA exon 6 or PIGA intron 5. The absolute gene targeting efficiencies and H/R ratios attained using these vectors were assessed in multiple human cell lines and compared with those attained using targeting vectors carrying internal ribosome entry site (IRES) for promoter trapping. We found that the use of 2A for promoter trapping increased absolute gene targeting efficiencies by 3.4–28-fold and H/R ratios by 2–5-fold compared to values obtained with IRES. In CRISPR-Cas9-assisted gene targeting using plasmid-based targeting vectors, the use of 2A did not enhance the H/R ratios but did upregulate the absolute gene targeting efficiencies compared to the use of IRES. PMID:26657635
A plasmid-based reverse genetics system for influenza A virus.
Pleschka, S; Jaskunas, R; Engelhardt, O G; Zürcher, T; Palese, P; García-Sastre, A
1996-01-01
A reverse genetics system for negative-strand RNA viruses was first successfully developed for influenza viruses. This technology involved the transfection of in vitro-reconstituted ribonucleoprotein (RNP) complexes into influenza virus-infected cells. We have now developed a method that allows intracellular reconstitution of RNP complexes from plasmid-based expression vectors. Expression of a viral RNA-like transcript is achieved from a plasmid containing a truncated human polymerase I (polI) promoter and a ribozyme sequence that generates the desired 3' end by autocatalytic cleavage. The polI-driven plasmid is cotransfected into human 293 cells with polII-responsive plasmids that express the viral PB1, PB2, PA, and NP proteins. This exclusively plasmid-driven system results in the efficient transcription and replication of the viral RNA-like reporter and allows the study of cis- and trans-acting signals involved in the transcription and replication of influenza virus RNAs. Using this system, we have also been able to rescue a synthetic neuraminidase gene into a recombinant influenza virus. This method represents a convenient alternative to the previously established RNP transfection system. PMID:8648766
Molecular cloning and physical mapping of the genome of fish lymphocystis disease virus.
Darai, G; Delius, H; Clarke, J; Apfel, H; Schnitzler, P; Flügel, R M
1985-10-30
A defined and complete gene library of the fish lymphocystis disease virus (FLDV) genome was established. FLDV DNA was cleaved with EcoRI, BamHI, EcoRI/BamHI and EcoRI/HindIII and the resulting fragments were inserted into the corresponding sites of the pACYC184 or pAT153 plasmid vectors using T4 DNA ligase. Since FLDV DNA is highly methylated at CpG sequences (Darai et al., 1983; Wagner et al., 1985), an Escherichia coli GC-3 strain was required to amplify the recombinant plasmids harboring the FLDV DNA fragments. Bacterial colonies harboring recombinant plasmids were selected. All cloned fragments were individually identified by digestion of the recombinant plasmid DNA with different restriction enzymes and screened by hybridization of recombinant plasmid DNA to viral DNA. This analysis revealed that sequences representing 100% of the viral genome were cloned. Using these recombinant plasmids, the physical maps of the genome were constructed for BamHI, EcoRI, BestEII, and PstI restriction endonucleases. Although the FLDV genome is linear, due to circular permutation the restriction maps are circular.
Kamensek, Urska; Tesic, Natasa; Sersa, Gregor; Kos, Spela; Cemazar, Maja
2017-01-01
Electrotransfer mediated delivery of interleukin-12 (IL-12) gene, encoded on a plasmid vector, has already been demonstrated to have a potent antitumor efficacy and great potential for clinical application. In the present study, our aim was to construct an optimized IL-12-encoding plasmid that is safe from the regulatory point of view. In light of previous studies demonstrating that IL-12 should be released in a tumor localized manner for optimal efficacy, the strong ubiquitous promoter was replaced with a weak endogenous promoter of the collagen 2 gene, which is specific for fibroblasts. Next, to comply with increasing regulatory demands for clinically used plasmids, the expression cassette was cloned in a plasmid lacking the antibiotic resistance gene. The constructed fibroblast-specific and antibiotic-free IL-12 plasmid was demonstrated to support low IL-12 expression after gene electrotransfer in selected cell lines. Furthermore, the removal of antibiotic resistance did not affect the plasmid expression profile and lowered its cytotoxicity. With optimal IL-12 expression and minimal transgene non-specific effects, i.e., low cytotoxicity, the constructed plasmid could be especially valuable for different modern immunological approaches to achieve localized boosting of the host's immune system. Copyright © 2016 Elsevier Inc. All rights reserved.
An 'instant gene bank' method for gene cloning by mutant complementation.
Gems, D; Aleksenko, A; Belenky, L; Robertson, S; Ramsden, M; Vinetski, Y; Clutterbuck, A J
1994-02-01
We describe a new method of gene cloning by complementation of mutant alleles which obviates the need for construction of a gene library in a plasmid vector in vitro and its amplification in Escherichia coli. The method involves simultaneous transformation of mutant strains of the fungus Aspergillus nidulans with (i) fragmented chromosomal DNA from a donor species and (ii) DNA of a plasmid without a selectable marker gene, but with a fungal origin of DNA replication ('helper plasmid'). Transformant colonies appear as the result of the joining of chromosomal DNA fragments carrying the wild-type copies of the mutant allele with the helper plasmid. Joining may occur either by ligation (if the helper plasmid is in linear form) or recombination (if it is cccDNA). This event occurs with high efficiency in vivo, and generates an autonomously replicating plasmid cointegrate. Transformants containing Penicillium chrysogenum genomic DNA complementing A. nidulans niaD, nirA and argB mutations have been obtained. While some of these cointegrates were evidently rearranged or consisted only of unaltered replicating plasmid, in other cases plasmids could be recovered into E. coli and were subsequently shown to contain the selected gene. The utility of this "instant gene bank" technique is demonstrated here by the molecular cloning of the P. canescens trpC gene.
Sequence and immunogenicity of a clinically approved novel measles virus vaccine vector
Zuniga, Amando; Liniger, Mathias; Morin, Teldja Neige Azzouz; Marty, René R.; Wiegand, Marian; Ilter, Orhan; Weibel, Sara; Billeter, Martin A.; Knuchel, Marlyse C.; Naim, Hussein Y.
2013-01-01
The measles virus vaccine (MVbv) is a clinically certified and well-tolerated vaccine strain that has been given both parenterally and mucosally. It has been extensively used in children and has proven to be safe and effective in eliciting protective immunity. This specific strain was therefore chosen to generate a measles viral vector. The genome of the commercial MVbv vaccine strain was isolated, sequenced and a plasmid, p(+)MVb, enabling transcription of the viral antigenome and rescue of MVb, was constructed. Phylogenic and phenotypic analysis revealed that MVbv and the rescued MVb constitute another evolutionary branch within the hitherto classified measles vaccines. Plasmid p(+)MVb was modified by insertion of artificial MV-type transcription units (ATUs) for the generation of recombinant viruses (rMVb) expressing additional proteins. Replication characteristics and immunogenicity of rMVb vectors were similar to the parental MVbv and to other vaccine strains. The expression of the additional proteins was stable over 10 serial virus transfers, which corresponds to an amplification greater than 1020. The excellent safety record and its efficient application as aerosol may add to the usefulness of the derived vectors. PMID:23324616
Biophysical characterization of an integrin-targeted lipopolyplex gene delivery vector.
Mustapa, M Firouz Mohd; Bell, Paul C; Hurley, Christopher A; Nicol, Alastair; Guénin, Erwann; Sarkar, Supti; Writer, Michele J; Barker, Susie E; Wong, John B; Pilkington-Miksa, Michael A; Papahadjopoulos-Sternberg, Brigitte; Shamlou, Parviz Ayazi; Hailes, Helen C; Hart, Stephen L; Zicha, Daniel; Tabor, Alethea B
2007-11-13
Nonviral gene delivery vectors now show good therapeutic potential: however, detailed characterization of the composition and macromolecular organization of such particles remains a challenge. This paper describes experiments to elucidate the structure of a ternary, targeted, lipopolyplex synthetic vector, the LID complex. This consists of a lipid component, Lipofectin (L) (1:1 DOTMA:DOPE), plasmid DNA (D), and a dual-function, cationic peptide component (I) containing DNA condensation and integrin-targeting sequences. Fluorophore-labeled lipid, peptide, and DNA components were used to formulate the vector, and the stoichiometry of the particles was established by fluorescence correlation spectroscopy (FCS). The size of the complex was measured by FCS, and the sizes of LID, L, LD, and ID complexes were measured by dynamic light scattering (DLS). Fluorescence quenching experiments and freeze-fracture electron microscopy were then used to demonstrate the arrangement of the lipid, peptide, and DNA components within the complex. These experiments showed that the cationic portion of the peptide, I, interacts with the plasmid DNA, resulting in a tightly condensed DNA-peptide inner core; this is surrounded by a disordered lipid layer, from which the integrin-targeting sequence of the peptide partially protrudes.
NASA Technical Reports Server (NTRS)
Rothschild, Lynn J.; Greenberg, Daniel T.; Takahashi, Jack R.; Thompson, Kirsten A.; Maheshwari, Akshay J.; Kent, Ryan E.; McCutcheon, Griffin; Shih, Joseph D.; Calvet, Charles; Devlin, Tyler D.;
2015-01-01
The CRISPR (Clustered, Regularly Interspaced, Short Palindromic Repeats)/Cas9 system has revolutionized genome editing by providing unprecedented DNA-targeting specificity. Here we demonstrate that this system can be also applied in vitro to fundamental cloning steps to facilitate efficient plasmid selection for transformation and selective gene insertion into plasmid vectors by cleaving unwanted plasmid byproducts with a single-guide RNA (sgRNA)-Cas9 nuclease complex. Using fluorescent and chromogenic proteins as reporters, we demonstrate that CRISPR/Cas9 cleavage excludes multiple plasmids as well as unwanted ligation byproducts resulting in an unprecedented increase in the transformation success rate from approximately 20% to nearly 100%. Thus, this CRISPR/Cas9-Assisted Transformation-Efficient Reaction (CRATER) protocol is a novel, inexpensive, and convenient application to conventional molecular cloning to achieve near-perfect selective transformation.
Kim, Jae-Eung; Huang, Rui; Chen, Hui; You, Chun; Zhang, Y-H Percival
2016-09-01
A foolproof protocol was developed for the construction of mutant DNA library for directed protein evolution. First, a library of linear mutant gene was generated by error-prone PCR or molecular shuffling, and a linear vector backbone was prepared by high-fidelity PCR. Second, the amplified insert and vector fragments were assembled by overlap-extension PCR with a pair of 5'-phosphorylated primers. Third, full-length linear plasmids with phosphorylated 5'-ends were self-ligated with T4 ligase, yielding circular plasmids encoding mutant variants suitable for high-efficiency transformation. Self-made competent Escherichia coli BL21(DE3) showed a transformation efficiency of 2.4 × 10(5) cfu/µg of the self-ligated circular plasmid. Using this method, three mutants of mCherry fluorescent protein were found to alter their colors and fluorescent intensities under visible and UV lights, respectively. Also, one mutant of 6-phosphorogluconate dehydrogenase from a thermophilic bacterium Moorella thermoacetica was found to show the 3.5-fold improved catalytic efficiency (kcat /Km ) on NAD(+) as compared to the wild-type. This protocol is DNA-sequence independent, and does not require restriction enzymes, special E. coli host, or labor-intensive optimization. In addition, this protocol can be used for subcloning the relatively long DNA sequences into any position of plasmids. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Seidman, M M; Bredberg, A; Seetharam, S; Kraemer, K H
1987-07-01
Mutagenesis was studied at the DNA-sequence level in human fibroblast and lymphoid cells by use of a shuttle vector plasmid, pZ189, containing a suppressor tRNA marker gene. In a series of experiments, 62 plasmids were recovered that had two to six base substitutions in the 160-base-pair marker gene. Approximately 20-30% of the mutant plasmids that were recovered after passing ultraviolet-treated pZ189 through a repair-proficient human fibroblast line contained these multiple mutations. In contrast, passage of ultraviolet-treated pZ189 through an excision-repair-deficient (xeroderma pigmentosum) line yielded only 2% multiple base substitution mutants. Introducing a single-strand nick in otherwise unmodified pZ189 adjacent to the marker, followed by passage through the xeroderma pigmentosum cells, resulted in about 66% multiple base substitution mutants. The multiple mutations were found in a 160-base-pair region containing the marker gene but were rarely found in an adjacent 170-base-pair region. Passing ultraviolet-treated or nicked pZ189 through a repair-proficient human B-cell line also yielded multiple base substitution mutations in 20-33% of the mutant plasmids. An explanation for these multiple mutations is that they were generated by an error-prone polymerase while filling gaps. These mutations share many of the properties displayed by mutations in the immunoglobulin hypervariable regions.
Application of methylation in improving plasmid transformation into Helicobacter pylori.
Zhao, Huilin; Xu, Linlin; Rong, Qianyu; Xu, Zheng; Ding, Yunfei; Zhang, Ying; Wu, Yulong; Li, Boqing; Ji, Xiaofei
2018-05-23
Helicobacter pylori is an important gastrointestinal pathogen. Its strains possess different levels of powerful restriction modification systems, which are significant barriers to genetic tools used for studying the role of functional genes in its pathogenesis. Methylating vectors in vitro was reported as an alternative to overcome this barrier in several bacteria. In this study we used two H. pylori-E. coli shuttle plasmids and several single/double-crossover homologous recombination gene-targeting plasmids, to test the role of methylation in H. pylori transformation. According to our results, transformants could be obtained only after shuttle plasmids were methylated before transformation. It is helpful in gene complementation and over-expression although at a low frequency. The frequency of gene-targeting transformation was also increased after methylation, especially for the single-crossover recombination plasmids, the transformants of which could only be obtained after methylation. For the double-crossover recombination targeting plasmids, the initial yield of transformants was 0.3-0.8 × 10 2 CFUs per microgram plasmid DNA. With the help of methylation, the yield was increased to 0.4-1.3 × 10 2 CFUs per microgram plasmid DNA. These results suggest that in vitro methylation can improve H. pylori transformation by different plasmids, which will benefit the pathogenic mechanism research. Copyright © 2018. Published by Elsevier B.V.
Chen, Ting; Huang, Dangsheng; Chen, Guanghui; Yang, Tingshu; Yi, Jun; Tian, Miao
2015-02-01
The adipose tissue-derived stem cells (ADSCs) represent a significant area of the cell therapy. Genetic modification of ADSCs may further improve their therapeutic potential. Here, we aimed to generate a lentiviral vector expressing insulin-like growth factor-I (IGF-1) and investigate the impact of IGF-1 transduction on the properties of cultured ADSCs. Isolated rat ADSCs were assessed by flow cytometric analysis. IGF-1 was cloned and inserted into the pLenO-DCE plasmid to acquire pLenO-DCE-IGF-1 plasmid. Lentivirus was enveloped with pRsv-REV, pMDlg-pRRE and pMD2G plasmids in 293T cells. The ADSCs were transfected with the vectors. And then IGF-1-induced anti-apoptosis was evaluated by annexin V-FITC. Besides, proliferation of cells was detected by MTT assay and EdU. Moreover, Akt phosphorylation was evaluated by Western blotting analysis. Stable expression of IGF-1 in ADSCs was confirmed. ADSCs were positive for CD90 and CD29, but negative for CD31, CD34 and CD45. The transduction of IGF-1 to the ADSCs caused a dramatic increase in P-Akt expression. Over-expression of IGF-1 in ADSCs could improve the paracine of IGF-1 in a time-dependent manner, but could not promote the proliferation of ADSCs. This study indicated that lentiviral vectors offered a promising mean of delivering IGF-1 to the ADSCs. Lentiviral-mediated over-expression of therapeutic IGF-1 gene in ADSCs could prolong the anti-apoptosis effect of IGF-1, which might be induced by the activation of the PI3K/Akt pathway. And our data would improve the efficacy of ADSC-based therapies.
Lebas, Benoît; Galley, Julien; Renaud-Gabardos, Edith; Pujol, Françoise; Lenfant, Françoise; Garmy-Susini, Barbara; Chaufour, Xavier; Prats, Anne-Catherine
2017-04-01
Critical leg ischemia (CLI) represents the ultimate stage of peripheral arterial disease. Despite current surgery advances, patients with CLI have limited therapeutic options. Therapeutic angiogenesis thus appears as a powerful approach, aiming to stimulate vessel formation by angiogenic molecules administration. In this context, combined gene therapy has been proved to be the most efficient. The present study aims to compare, in a preclinical mouse model, the therapeutic benefit of a combination of 2 angiogenic factors fibroblast growth factor 2 (FGF2) and Cyr61 using plasmid and viral vectors, able to generate short- or long-term transgene expression in the leg, respectively. Two therapeutic genes, FGF2 and Cyr61, were introduced into internal ribosome entry site-based expression vectors (FGFiCyr) allowing co-expression of the 2 transgenes. The proangiogenic plasmid pC-FGFiCyr was assessed by intramuscular administration followed by electrotransfer into ischemic legs. To generate long-term transgene expression, the FGFiCyr bicistronic cassette was introduced into an adenoassociated virus-derived vector (rAAV). The rAAV treatment was performed either before or immediately after surgery. Therapeutic effects were analyzed by laser Doppler imaging, clinical score, and angiography. The plasmid pC-FGFiCyr improved revascularization, reperfusion, and clinical score. Surprisingly, when AAV-FGFiCyr was injected 21 or 28 days before surgery, the proangiogenic rAAV was drastically deleterious on all measured parameters. In contrast, when administrated shortly after surgery, AAV-FGFiCyr generated therapeutic benefits, with a significantly better clinical score than after treatment with the plasmid. Therapeutic effects of the angiogenic combination FGF2-Cyr61 is observed with short-term transgene expression, but the treatment is significantly more efficient when a long-term expression viral vector is used. However, the rAAV-FGFiCyr generated therapeutic benefit only when injected in an ischemic leg, whereas the same dose of rAAV exhibited deleterious effects when administrated to healthy animals. These data may contribute to the understanding of the moderate success of proangiogenic treatments in CLI gene therapy clinical assays. Copyright © 2016 Elsevier Inc. All rights reserved.
Nishida, Takashi; Watanabe, Kenta; Tachibana, Masato; Shimizu, Takashi; Watarai, Masahisa
2017-03-01
In this study, a cryptic plasmid pOfk55 from Legionella pneumophila was isolated and characterized. pOfk55 comprised 2584bp with a GC content of 37.3% and contained three putative open reading frames (ORFs). orf1 encoded a protein of 195 amino acids and the putative protein shared 39% sequence identity with a putative plasmid replication protein RepL. ORF1 was needed for replication in L. pneumophila but pOfk55 did not replicate in Escherichia coli. orf2 and orf3 encoded putative hypothetical proteins of 114 amino acids and 78 amino acids, respectively, but the functions of the putative proteins ORF2 and OFR3 are not clear. The transfer mechanism for pOfk55 was independent on the type IVB secretion system in the original host. A L. pneumophila-E. coli shuttle vector, pNT562 (5058bp, Km R ), was constructed by In-Fusion Cloning of pOfk55 with a kanamycin-resistance gene from pUTmini-Tn5Km and the origin of replication from pBluescript SK(+) (pNT561). Multiple cloning sites from pBluescript SK(+) as well as the tac promoter region and lacI gene from pAM239-GFP were inserted into pNT561 to construct pNT562. The transformation efficiency of pNT562 in L. pneumophila strains ranged from 1.6×10 1 to 1.0×10 5 CFU/ng. The relative number of pNT562 was estimated at 5.7±1.0 copies and 73.6% of cells maintained the plasmid after 1week in liquid culture without kanamycin. A green fluorescent protein (GFP) expression vector, pNT563, was constructed by ligating pNT562 with the gfpmut3 gene from pAM239-GFP. pNT563 was introduced into L. pneumophila Lp02 and E. coli DH5α, and both strains expressed GFP successfully. These results suggest that the shuttle vector is useful for genetic studies in L. pneumophila. Copyright © 2017 Elsevier Inc. All rights reserved.
2013-01-01
Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins. PMID:23957834
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tratschin, J.D.; West, M.H.P.; Sandbank, T.
1984-10-01
The authors have used the defective human parvovirus adeno-associated virus (AAV) as a novel eurocaryotic vector (parvector) for the expression of a foreign gene in human cells. The recombinant, pAV2, contains the AAV genome in a pBR322-derived bacterial plasmid. When pAV2 is transfected into human cells together with helper adenovirus particles, the AAV genome is rescued from the recombinant plasmid and replicated to produce infectious AAV particles at high efficiency. To create a vector, we inserted a procaryotic sequence coding for chloramphenicol acetyltransferase (CAT) into derivatives of pAV2 following either of the AAV promoters p/sub 40/ (pAVHiCAT) and p/sub 19/more » (pAVBcCAT). When transfected into human 293 cells or HeLa cells, pAVHiCAT expressed CAT activity in the absence of adenovirus. In the presence of adenovirus, this vector produced increased amounts of CAT activity and the recombinant AAV-CAT genome was replicated. In 293 cells, pAVBcCAT expressed a similar amount of CAT activity in the absence or presence of adenovirus and the recombinant AAV-CAT genome was not replicated. In HeLa cells, pAVBcCAT expressed low levels of CAT activity, but this level was elevated by coinfection with adenovirus particles or by cotransfection with a plasmid which expressed the adenovirus early region 1A (E1A) product. The E1A product is a transcriptional activator and is expressed in 293 cells. Thus, expression from two AAV promoters is differentially regulated: expression from p/sub 19/ is increased by E1A, whereas p/sub 40/ yields high levels of constitutive expression in the absence of E1A. Both AAV vectors were packaged into AAV particles by complementation with wild-type AAV and yielded CAT activity when subsequently infected into cells in the presence of adenovirus.« less
Buj, Raquel; Iglesias, Noa; Planas, Anna M; Santalucía, Tomàs
2013-08-20
Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit's component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins.
Wang, Yibing; Kahane, Simona; Cutcliffe, Lesley T; Skilton, Rachel J; Lambden, Paul R; Persson, Kenneth; Bjartling, Carina; Clarke, Ian N
2013-01-01
Our study had three objectives: to extend the plasmid-based transformation protocol to a clinical isolate of C. trachomatis belonging to the trachoma biovar, to provide "proof of principle" that it is possible to "knock out" selected plasmid genes (retaining a replication competent plasmid) and to investigate the plasticity of the plasmid. A recently developed, plasmid-based transformation protocol for LGV isolates of C. trachomatis was modified and a plasmid-free, genital tract C. trachomatis isolate from Sweden (SWFP-) was genetically transformed. Transformation of this non-LGV C. trachomatis host required a centrifugation step, but the absence of the natural plasmid removed the need for plaque purification of transformants. Transformants expressed GFP, were penicillin resistant and iodine stain positive for accumulated glycogen. The transforming plasmid did not recombine with the host chromosome. A derivative of pGFP::SW2 carrying a deletion of the plasmid CDS5 gene was engineered. CDS5 encodes pgp3, a protein secreted from the inclusion into the cell cytoplasm. This plasmid (pCDS5KO) was used to transform C. trachomatis SWFP-, and established that pgp3 is dispensable for plasmid function. The work shows it is possible to selectively delete segments of the chlamydial plasmid, and this is the first step towards a detailed molecular dissection of the role of the plasmid. The 3.6 kb β-galactosidase cassette was inserted into the deletion site of CDS5 to produce plasmid placZ-CDS5KO. Transformants were penicillin resistant, expressed GFP and stained for glycogen. In addition, they expressed β-galactosidase showing that the lacZ cassette was functional in C. trachomatis. An assay was developed that allowed the visualisation of individual inclusions by X-gal staining. The ability to express active β-galactosidase within chlamydial inclusions is an important advance as it allows simple, rapid assays to measure directly chlamydial infectivity without the need for plaquing, fluorescence or antibody staining.
Ovchinnikov, Dmitry A; Sun, Jane; Wolvetang, Ernst J
2015-01-01
Human induced pluripotent stem cells (hiPSCs) have provided novel insights into the etiology of disease and are set to transform regenerative medicine and drug screening over the next decade. The generation of human iPSCs free of a genetic footprint of the reprogramming process is crucial for the realization of these potential uses. Here we describe in detail the generation of human iPSC from control and disease-carrying individuals' fibroblasts using episomal plasmids.
Gutiérrez, Jorge; Criado, Raquel; Martín, María; Herranz, Carmen; Cintas, Luis M.; Hernández, Pablo E.
2005-01-01
The gene encoding mature enterocin P (EntP), an antimicrobial peptide from Enterococcus faecium P13, was cloned into the pPICZαA expression vector to generate plasmid pJC31. This plasmid was integrated into the genome of P. pastoris X-33, and EntP was heterologously secreted from the recombinant P. pastoris X-33t1 derivative at a higher production and antagonistic activity than from E. faecium P13. PMID:15980385
Yin and Yang of Heparanase in Breast Tumor Initiation
2013-04-01
of heparanase in cancer metastasis and angiogenesis. Int J Biochem Cell Biol 38: 2018 -2039, 2006 2. Gotte M, Yip GW: Heparanase, hyaluronan, and...into a RCAS vector digested with a PacI and Cla I. The plasmid was designated RCAS-C. An oligonucleotide containing a Myc tag sequence (atg gaa...ligated into Not I/PacI- digested RCAS-C. The following plasmid designated as RCAS-8C was used to transfected DF-1 cells to generate RCAS-8C virus
Yin and Yang of Heparanase in Breast Cancer Initiation
2014-09-01
significance of heparanase in cancer metastasis and angiogenesis. Int J Biochem Cell Biol 38: 2018 -2039, 2006 2. Gotte M, Yip GW: Heparanase...Methods Plasmids. The C-terminus of the HPR1 gene (encoding amino acid 413-543) was cloned into a RCAS vector digested with a PacI and Cla I. An...contained a cleaved Pac I site. This fragment was directly ligated into Not I/PacI- digested RCAS-C. The following plasmid designated as RCAS-8C was used
Bacteriophage-based vectors for site-specific insertion of DNA in the chromosome of Corynebacteria.
Oram, Mark; Woolston, Joelle E; Jacobson, Andrew D; Holmes, Randall K; Oram, Diana M
2007-04-15
In Corynebacterium diphtheriae, diphtheria toxin is encoded by the tox gene of some temperate corynephages such as beta. beta-like corynephages are capable of inserting into the C. diphtheriae chromosome at two specific sites, attB1 and attB2. Transcription of the phage-encoded tox gene, and many chromosomally encoded genes, is regulated by the DtxR protein in response to Fe(2+) levels. Characterizing DtxR-dependent gene regulation is pivotal in understanding diphtheria pathogenesis and mechanisms of iron-dependent gene expression; although this has been hampered by a lack of molecular genetic tools in C. diphtheriae and related Coryneform species. To expand the systems for genetic manipulation of C. diphtheriae, we constructed plasmid vectors capable of integrating into the chromosome. These plasmids contain the beta-encoded attP site and the DIP0182 integrase gene of C. diphtheriae NCTC13129. When these vectors were delivered to the cytoplasm of non-lysogenic C. diphtheriae, they integrated into either the attB1 or attB2 sites with comparable frequency. Lysogens were also transformed with these vectors, by virtue of the second attB site. An integrated vector carrying an intact dtxR gene complemented the mutant phenotypes of a C. diphtheriae DeltadtxR strain. Additionally, strains of beta-susceptible C. ulcerans, and C. glutamicum, a species non-permissive for beta, were each transformed with these vectors. This work significantly extends the tools available for targeted transformation of both pathogenic and non-pathogenic Corynebacterium species.
Deep Hashing for Scalable Image Search.
Lu, Jiwen; Liong, Venice Erin; Zhou, Jie
2017-05-01
In this paper, we propose a new deep hashing (DH) approach to learn compact binary codes for scalable image search. Unlike most existing binary codes learning methods, which usually seek a single linear projection to map each sample into a binary feature vector, we develop a deep neural network to seek multiple hierarchical non-linear transformations to learn these binary codes, so that the non-linear relationship of samples can be well exploited. Our model is learned under three constraints at the top layer of the developed deep network: 1) the loss between the compact real-valued code and the learned binary vector is minimized, 2) the binary codes distribute evenly on each bit, and 3) different bits are as independent as possible. To further improve the discriminative power of the learned binary codes, we extend DH into supervised DH (SDH) and multi-label SDH by including a discriminative term into the objective function of DH, which simultaneously maximizes the inter-class variations and minimizes the intra-class variations of the learned binary codes with the single-label and multi-label settings, respectively. Extensive experimental results on eight widely used image search data sets show that our proposed methods achieve very competitive results with the state-of-the-arts.
Cloning of cellulase genes from acidothermus cellulolyticus
Lastick, deceased, Stanley M.; Tucker, Melvin P.; Grohmann, Karel
1996-01-01
A process is described for moving fragments that code for cellulase activity from the genome of A. cellulolyticus to several plasmid vectors and the subsequent expression of active cellulase acitivty in E. coli.
Park, Jong-Uk; Jo, Jae-Hyung; Kim, Young-Ji; Chung, So-Sun; Lee, Jin-Ho; Lee, Hyune Hwan
2008-04-01
The heat-inducible expression vectors for Corynebacterium glutamicum and C. ammoniagenes were constructed by using the lambdaOL1 and the cryptic promoters, CJ1 and CJ4 that express genes constitutively in C. ammoniagenes.. Although the promoters were isolated from C. ammoniagenes, CJ1 and CJ4 were also active in C. glutamicum. To construct vectors, the OL1 from the lambdaPL promoter was isolated and fused to the CJ1 and CJ4 promoters by recombinant PCR. The resulting artificial promoters, CJ1O and CJ4O, which have one lambdaOL1, and CJ1OX2, which has two successive lambdaOL1, were fused to the green fluorescent protein (GFP) gene followed by subcloning into pCES208. The expression of GFP in the corynebacteria harboring the vectors was regulated successfully by the temperature sensitive cI857 repressor. Among them, C. ammoniagenes harboring plasmid pCJ1OX2G containing GFP fused to CJ1OX2 showed more GFP than the other ones and the expression was tightly regulated by the repressor. To construct the generally applicable expression vector using the plasmid pCJ1OX2G, the His-tag, enterokinase (EK) moiety, and the MCS were inserted in front of the GFP gene. Using the vector, the expression of pyrR from C. glutamicum was tried by temperature shift-up. The results indicated that the constructed vectors (pCeHEMG) can be successfully used in the expression and regulation of foreign genes in corynebacteria.
Xu, Leyuan; Kittrell, Shannon; Yeudall, W Andrew; Yang, Hu
2016-11-01
Folic acid (FA)-decorated polyamidoamine dendrimer G4 (G4-FA) was synthesized and studied for targeted delivery of genes to head and neck cancer cells expressing high levels of folate receptors (FRs). Cellular uptake, targeting specificity, cytocompatibility and transfection efficiency were evaluated. G4-FA competes with free FA for the same binding site. G4-FA facilitates the cellular uptake of DNA plasmids in a FR-dependent manner and selectively delivers plasmids to FR-high cells, leading to enhanced gene expression. G4-FA is a suitable vector to deliver genes selectively to head and neck cancer cells. The fundamental understandings of G4-FA as a vector and its encouraging transfection results for head and neck cancer cells provided support for its further testing in vivo.
Ultrashort laser pulse cell manipulation using nano- and micro- materials
NASA Astrophysics Data System (ADS)
Schomaker, Markus; Killian, Doreen; Willenbrock, Saskia; Diebold, Eric; Mazur, Eric; Bintig, Willem; Ngezahayo, Anaclet; Nolte, Ingo; Murua Escobar, Hugo; Junghanß, Christian; Lubatschowski, Holger; Heisterkamp, Alexander
2010-08-01
The delivery of extra cellular molecules into cells is essential for cell manipulation. For this purpose genetic materials (DNA/RNA) or proteins have to overcome the impermeable cell membrane. To increase the delivery efficiency and cell viability of common methods different nano- and micro material based approaches were applied. To manipulate the cells, the membrane is in contact with the biocompatible material. Due to a field enhancement of the laser light at the material and the resulting effect the cell membrane gets perforated and extracellular molecules can diffuse into the cytoplasm. Membrane impermeable dyes, fluorescent labelled siRNA, as well as plasmid vectors encoded for GFP expression were used as an indicator for successful perforation or transfection, respectively. Dependent on the used material, perforation efficiencies over 90 % with a cell viability of about 80 % can be achieved. Additionally, we observed similar efficiencies for siRNA transfection. Due to the larger molecule size and the essential transport of the DNA into the nucleus cells are more difficult to transfect with GFP plasmid vectors. Proof of principle experiments show promising and adequate efficiencies by applying micro materials for plasmid vector transfection. For all methods a weakly focused fs laser beam is used to enable a high manipulation throughput for adherent and suspension cells. Furthermore, with these alternative optical manipulation methods it is possible to perforate the membrane of sensitive cell types such as primary and stem cells with a high viability.
Melman, A; Biggs, G; Davies, K; Zhao, W; Tar, M T; Christ, G J
2008-03-01
Previous reports have demonstrated that gene transfer with the alpha, or pore-forming, subunit of the human Maxi-K channel (hSlo) restores the decline in erectile capacity observed in established rat models of diabetes and aging. Preliminary data from a human clinical trial also showed safety and potential efficacy in 11 men treated with the same plasmid construct expressing the Maxi-K channel. In all instances, the original plasmid was driven by the heterologous cytomegalovirus promoter which is broadly active in a wide variety of cell and tissue types. To more precisely determine the contribution of the corporal myocyte to the observed physiological effects in vivo, we report here our initial work using a distinct vector (pSMAA-hSlo) in which hSlo gene expression was driven off the mouse smooth muscle alpha-actin (SMAA) promoter. Specifically, older rats, with diminished erectile capacity, were given a single intracorporal injection with either 100 mug pVAX-hSlo or 10, 100 or 1000 mug pSMAA-hSlo, or vector or vehicle alone. Significantly increased intracavernous pressure (ICP) responses to cavernous nerve stimulation were observed for all doses of both plasmids encoding hSlo, relative to control injections. These data confirm and extend previous observations to document that smooth muscle cell-specific expression of hSlo in corporal tissue is both necessary and sufficient to restore erectile function in aging rats.
Efficient production of antibody Fab fragment by transient gene expression in insect cells.
Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki
2017-08-01
Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Wijaya, Sony Hartono; Afendi, Farit Mochamad; Batubara, Irmanida; Darusman, Latifah K; Altaf-Ul-Amin, Md; Kanaya, Shigehiko
2016-12-07
The binary similarity and dissimilarity measures have critical roles in the processing of data consisting of binary vectors in various fields including bioinformatics and chemometrics. These metrics express the similarity and dissimilarity values between two binary vectors in terms of the positive matches, absence mismatches or negative matches. To our knowledge, there is no published work presenting a systematic way of finding an appropriate equation to measure binary similarity that performs well for certain data type or application. A proper method to select a suitable binary similarity or dissimilarity measure is needed to obtain better classification results. In this study, we proposed a novel approach to select binary similarity and dissimilarity measures. We collected 79 binary similarity and dissimilarity equations by extensive literature search and implemented those equations as an R package called bmeasures. We applied these metrics to quantify the similarity and dissimilarity between herbal medicine formulas belonging to the Indonesian Jamu and Japanese Kampo separately. We assessed the capability of binary equations to classify herbal medicine pairs into match and mismatch efficacies based on their similarity or dissimilarity coefficients using the Receiver Operating Characteristic (ROC) curve analysis. According to the area under the ROC curve results, we found Indonesian Jamu and Japanese Kampo datasets obtained different ranking of binary similarity and dissimilarity measures. Out of all the equations, the Forbes-2 similarity and the Variant of Correlation similarity measures are recommended for studying the relationship between Jamu formulas and Kampo formulas, respectively. The selection of binary similarity and dissimilarity measures for multivariate analysis is data dependent. The proposed method can be used to find the most suitable binary similarity and dissimilarity equation wisely for a particular data. Our finding suggests that all four types of matching quantities in the Operational Taxonomic Unit (OTU) table are important to calculate the similarity and dissimilarity coefficients between herbal medicine formulas. Also, the binary similarity and dissimilarity measures that include the negative match quantity d achieve better capability to separate herbal medicine pairs compared to equations that exclude d.
Content based image retrieval using local binary pattern operator and data mining techniques.
Vatamanu, Oana Astrid; Frandeş, Mirela; Lungeanu, Diana; Mihalaş, Gheorghe-Ioan
2015-01-01
Content based image retrieval (CBIR) concerns the retrieval of similar images from image databases, using feature vectors extracted from images. These feature vectors globally define the visual content present in an image, defined by e.g., texture, colour, shape, and spatial relations between vectors. Herein, we propose the definition of feature vectors using the Local Binary Pattern (LBP) operator. A study was performed in order to determine the optimum LBP variant for the general definition of image feature vectors. The chosen LBP variant is then subsequently used to build an ultrasound image database, and a database with images obtained from Wireless Capsule Endoscopy. The image indexing process is optimized using data clustering techniques for images belonging to the same class. Finally, the proposed indexing method is compared to the classical indexing technique, which is nowadays widely used.
Maj, Anna; Dziewit, Lukasz; Czarnecki, Jakub; Wlodarczyk, Miroslawa; Baj, Jadwiga; Skrzypczyk, Grazyna; Giersz, Dorota; Bartosik, Dariusz
2013-01-01
Plasmids are components of many bacterial genomes. They enable the spread of a large pool of genetic information via lateral gene transfer. Many bacterial strains contain mega-sized replicons and these are particularly common in Alphaproteobacteria. Considerably less is known about smaller alphaproteobacterial plasmids. We analyzed the genomes of 14 such plasmids residing in 4 multireplicon carotenoid-producing strains of the genus Paracoccus (Alphaproteobacteria): P. aestuarii DSM 19484, P. haeundaensis LG P-21903, P. marcusii DSM 11574 and P. marcusii OS22. Comparative analyses revealed mosaic structures of the plasmids and recombinational shuffling of diverse genetic modules involved in (i) plasmid replication, (ii) stabilization (including toxin-antitoxin systems of the relBE/parDE, tad-ata, higBA, mazEF and toxBA families) and (iii) mobilization for conjugal transfer (encoding relaxases of the MobQ, MobP or MobV families). A common feature of the majority of the plasmids is the presence of AT-rich sequence islets (located downstream of exc1-like genes) containing genes, whose homologs are conserved in the chromosomes of many bacteria (encoding e.g. RelA/SpoT, SMC-like proteins and a retron-type reverse transcriptase). The results of this study have provided insight into the diversity and plasticity of plasmids of Paracoccus spp., and of the entire Alphaproteobacteria. Some of the identified plasmids contain replication systems not described previously in this class of bacteria. The composition of the plasmid genomes revealed frequent transfer of chromosomal genes into plasmids, which significantly enriches the pool of mobile DNA that can participate in lateral transfer. Many strains of Paracoccus spp. have great biotechnological potential, and the plasmid vectors constructed in this study will facilitate genetic studies of these bacteria. PMID:24260361
Shao, Jun-Li; Long, Yue-Sheng; Chen, Gu; Xie, Jun; Xu, Zeng-Fu
2010-06-01
Agrobacterium tumefaciens transfers DNA from its Ti plasmid to plant host cells. The genes located within the transferred DNA of Ti plasmid including the octopine synthase gene (OCS) are expressed in plant host cells. The 3'-flanking region of OCS gene, known as OCS terminator, is widely used as a transcriptional terminator of the transgenes in plant expression vectors. In this study, we found the reversed OCS terminator (3'-OCS-r) could drive expression of hygromycin phosphotransferase II gene (hpt II) and beta-glucuronidase gene in Escherichia coli, and expression of hpt II in A. tumefaciens. Furthermore, reverse transcription-polymerase chain reaction analysis revealed that an open reading frame (ORF12) that is located downstream to the 3'-OCS-r was transcribed in A. tumefaciens, which overlaps in reverse with the coding region of the OCS gene in octopine Ti plasmid.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
The plasmids present in M. ethanolicum have been characterized as to size, relatedness, and curing rate. Auxotrophs have been isolated and are being tested for the ability of several plasmids to promote mobilization of these markers. A cloning vector has been identified which can be used not only to clone the genes of interest but to isolate mutants in these genes and place a selectable marker on each of the plasmids. Isolation of a series of methane and methanol mutants, determination of which of the plasmids carries the mtn gene(s), and identification of methane-specific proteins on two-dimensonal O'Farrell gels shouldmore » all be completed shortly. In addition, the cloning of the methane genes and development of a genetic system should be well underway. A more detailed appraisal of future experiments is presented in the accompanying renewal proposal. (ERB)« less
Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Singh, Surender; Kumar, Sudarshan; Kaushik, Jai K; Mohanty, Ashok K; Malakar, Dhruba
2015-12-01
Oct4, pluripotency marker and transcription factor, expresses in embryonic stem cells. It plays a pivotal role in determination of stem cells fate. Up and down regulation of Oct4 causes differentiation of embryonic stem cells. It is one of the main transcription factors which remained concerned in every study related to induced pluripotent stem cell. Here, we report the production of goat Oct4 protein using plasmid and lentiviral based vectors. Firstly, Oct4 ORF was cloned in pAcGFP1-N1 plasmid vector and positive clones were screened with colony PCR. Oct4 was over-expressed in CHO-K1 cell line and expression was confirmed by observing green florescent protein expression in CHO-K1 cells. Secondly, Oct4 lentiviral expression construct has been prepared using pLenti-gw vector. Oct4 ORF was cloned into pLenti4/V5-DEST vector and viral particles were produced in 293FT cells. Oct4 viral particles were used to infect goat fibroblast cells. Oct4 expression was observed and confirmed in transfected goat fibroblast cells using RT-PCR. Detection of Oct4 protein in western blotting assay affirmed the capacity of over-expression of our Oct4 lentiviral vector. The lentiviral expression construct and recombinant Oct4 protein may be used for reprogramming of somatic cell into induced pluripotent stem cell.
Suarez, D L; Schultz-Cherry, S
2000-01-01
Vaccination of poultry with naked plasmid DNA has been successfully demonstrated with several different poultry pathogens, but the technology needs to be further developed before it can be practically implemented. Many different methods can conceivably enhance the efficacy of DNA vaccines, and this report examines the use of different eukaryotic expression vectors with different promoters and different adjuvants to express the influenza hemagglutinin protein. Four different promoters in five different plasmids were used to express the hemagglutinin protein of an H5 avian influenza virus, including two different immediate early cytomegaloviruses (CMVs), Rous sarcoma virus, chicken actin, and simian virus 40 promoters. All five constructs expressed detectable hemagglutinin protein in cell culture, but the pCI-neo HA plasmid with the CMV promoter provided the best response in chickens when vaccinated intramuscularly at 1 day of age on the basis of antibody titer and survivability after challenge with a highly pathogenic avian influenza virus at 6 wk postinoculation. A beneficial response was observed in birds boostered at 3 wk of age, in birds given larger amounts of DNA, and with the use of multiple injection sites to administer the vaccine. With the use of the pCI-neo construct, the effects of different adjuvants designed to increase the uptake of plasmid DNA, including 25% sucrose, diethylaminoethyl dextran, calcium phosphate, polybrene, and two different cationic liposomes, were examined. Both liposomes tested enhanced antibody titers as compared with the positive controls, but the other chemical adjuvants decreased the antibody response as compared with the control chickens that received just the plasmid alone. The results observed are promising for continued studies, but continued improvements in vaccine response and reduced costs are necessary before the technology can be commercially developed.
Ultrasound-targeted hepatic delivery of factor IX in hemophiliac mice.
Anderson, C D; Moisyadi, S; Avelar, A; Walton, C B; Shohet, R V
2016-06-01
Ultrasound-targeted microbubble destruction (UTMD) was used to direct the delivery of plasmid and transposase-based vectors encoding human factor IX (hFIX) to the livers of hemophilia B (FIX-/-) mice. The DNA vectors were incorporated into cationic lipid microbubbles, injected intravenously, and transfected into hepatocytes by acoustic cavitation of the bubbles as they transited the liver. Ultrasound parameters were identified that produced transfection of hepatocytes in vivo without substantial damage or bleeding in the livers of the FIX-deficient mice. These mice were treated with a conventional expression plasmid, or one containing a piggyBac transposon construct, and hFIX levels in the plasma and liver were evaluated at multiple time points after UTMD. We detected hFIX in the plasma by western blotting from mice treated with either plasmid during the 12 days after UTMD, and in the hepatocytes of treated livers by immunofluorescence. Reductions in clotting time and improvements in the percentage of FIX activity were observed for both plasmids, conventional (4.15±1.98%), and transposon based (2.70±.75%), 4 to 5 days after UTMD compared with untreated FIX (-/-) control mice (0.92±0.78%) (P=0.001 and P=0.012, respectively). Reduced clotting times persisted for both plasmids 12 days after treatment (reflecting percentage FIX activity of 3.12±1.56%, P=0.02 and 3.08±0.10%, P=0.001, respectively). Clotting times from an additional set of mice treated with pmGENIE3-hFIX were evaluated for long-term effects and demonstrated a persistent reduction in average clotting time 160 days after a single treatment. These data suggest that UTMD could be a minimally invasive, nonviral approach to enhance hepatic FIX expression in patients with hemophilia.
Sugano, Masahiro; Tsuchida, Keiko; Tomita, Hideharu; Makino, Naoki
2002-05-01
Vascular endothelial growth factor (VEGF) can overcome a potential anti-angiogenic effect of TNF-alpha by inhibiting endothelial apoptosis induced by this cytokine. Soluble TNF-alpha receptor I (sTNFRI) is an extracellular domain of TNFRI and antagonizes the activity of TNF-alpha. Here we report that sTNFRI is able to stimulate the growth of endothelial cells not by antagonizing TNF-alpha. Exogenously added recombinant human sTNFRI stimulated significantly more cell growth of human umbilical venous endothelial cells (HUVEC) with a low dose (50-200 pg/ml) compared with smooth muscle cells. In contrast, monoclonal antibody against TNF-alpha did not stimulate growth of human HUVEC. The sTNFRI expression plasmid (pcDNA3.1 plasmid) was introduced into the cell culture using OPTI-MEM, lipofectin and transferrin. Growth of HUVEC transfected with sTNFRI vector also increased significantly compared with those transfected with control vector. HUVEC transfected with sTNFRI vector increased the extracellular domain of TNFRI mRNA levels, but did not affect the intracellular domain of TNFRI mRNA levels. Accumulation of sTNFRI significantly increased in conditioned medium from HUVEC transfected with sTNFRI vector compared with those transfected with control vector. HUVEC transfected with sTNFRI vector not only increased sTNFRI but also prevented shedding of sTNFRI from TNFRI. The TNF-alpha -induced internucleosomic fragmentation was also significantly prevented in HUVEC transfected with sTNFRI vector compared with those transfected with control vector. These results suggest that instead of growth factors such as VEGF, local transfection of the sTNFRI gene may have potential therapeutic value in vascular diseases in which TNF-alpha is also usually highly expressed.
Networking in microbes: conjugative elements and plasmids in the genus Alteromonas.
López-Pérez, Mario; Ramon-Marco, Nieves; Rodriguez-Valera, Francisco
2017-01-05
To develop evolutionary models for the free living bacterium Alteromonas the genome sequences of isolates of the genus have been extensively analyzed. However, the main genetic exchange drivers in these microbes, conjugative elements (CEs), have not been considered in detail thus far. In this work, CEs have been searched in several complete Alteromonas genomes and their sequence studied to understand their role in the evolution of this genus. Six genomes are reported here for the first time. We have found nine different plasmids of sizes ranging from 85 to 600 Kb, most of them were found in a single strain. Networks of gene similarity could be established among six of the plasmids that were also connected with another cluster of plasmids found in Shewanella strains. The cargo genes found in these plasmids included cassettes found before in chromosome flexible genomic islands of Alteromonas strains. We describe also the plasmids pAMCP48-600 and pAMCP49-600, the largest found in Alteromonas thus far (ca. 600 Kb) and containing all the hallmarks to be classified as chromids. We found in them some housekeeping genes and a cluster that code for an exocellular polysaccharide. They could represent the transport vectors for the previously described replacement flexible genomic islands. Integrative and conjugative elements (ICEs) were more common than plasmids and showed similar patterns of variation with cargo genes coding for components of additive flexible genomic islands. A nearly identical ICE was found in A. mediterranea MED64 and Vibrio cholera AHV1003 isolated from a human pathogen, indicating the potential exchange of these genes across phylogenetic distances exceeding the family threshold. We have seen evidence of how CEs can be vectors to transfer gene cassettes acquired in the chromosomal flexible genomic islands, both of the additive and replacement kind. These CEs showed evidence of how genetic material is exchanged among members of the same species but also (albeit less frequently) across genus and family barriers. These gradients of exchange frequency are probably one of the main drivers of species origin and maintenance in prokaryotes and also provide these taxa with large genetic diversity.
A Peptide-based Vector for Efficient Gene Transfer In Vitro and In Vivo
Lehto, Taavi; Simonson, Oscar E; Mäger, Imre; Ezzat, Kariem; Sork, Helena; Copolovici, Dana-Maria; Viola, Joana R; Zaghloul, Eman M; Lundin, Per; Moreno, Pedro MD; Mäe, Maarja; Oskolkov, Nikita; Suhorutšenko, Julia; Smith, CI Edvard; Andaloussi, Samir EL
2011-01-01
Finding suitable nonviral delivery vehicles for nucleic acid–based therapeutics is a landmark goal in gene therapy. Cell-penetrating peptides (CPPs) are one class of delivery vectors that has been exploited for this purpose. However, since CPPs use endocytosis to enter cells, a large fraction of peptides remain trapped in endosomes. We have previously reported that stearylation of amphipathic CPPs, such as transportan 10 (TP10), dramatically increases transfection of oligonucleotides in vitro partially by promoting endosomal escape. Therefore, we aimed to evaluate whether stearyl-TP10 could be used for the delivery of plasmids as well. Our results demonstrate that stearyl-TP10 forms stable nanoparticles with plasmids that efficiently enter different cell-types in a ubiquitous manner, including primary cells, resulting in significantly higher gene expression levels than when using stearyl-Arg9 or unmodified CPPs. In fact, the transfection efficacy of stearyl-TP10 almost reached the levels of Lipofectamine 2000 (LF2000), however, without any of the observed lipofection-associated toxicities. Most importantly, stearyl-TP10/plasmid nanoparticles are nonimmunogenic, mediate efficient gene delivery in vivo, when administrated intramuscularly (i.m.) or intradermally (i.d.) without any associated toxicity in mice. PMID:21343913
Plasmid-Mediated Antimicrobial Resistance in Staphylococci and Other Firmicutes.
Schwarz, Stefan; Shen, Jianzhong; Wendlandt, Sarah; Fessler, Andrea T; Wang, Yang; Kadlec, Kristina; Wu, Cong-Ming
2014-12-01
In staphylococci and other Firmicutes, resistance to numerous classes of antimicrobial agents, which are commonly used in human and veterinary medicine, is mediated by genes that are associated with mobile genetic elements. The gene products of some of these antimicrobial resistance genes confer resistance to only specific members of a certain class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into any of three major categories: active efflux, enzymatic inactivation, and modification/replacement/protection of the target sites of the antimicrobial agents. Among the mobile genetic elements that carry such resistance genes, plasmids play an important role as carriers of primarily plasmid-borne resistance genes, but also as vectors for nonconjugative and conjugative transposons that harbor resistance genes. Plasmids can be exchanged by horizontal gene transfer between members of the same species but also between bacteria belonging to different species and genera. Plasmids are highly flexible elements, and various mechanisms exist by which plasmids can recombine, form cointegrates, or become integrated in part or in toto into the chromosomal DNA or into other plasmids. As such, plasmids play a key role in the dissemination of antimicrobial resistance genes within the gene pool to which staphylococci and other Firmicutes have access. This chapter is intended to provide an overview of the current knowledge of plasmid-mediated antimicrobial resistance in staphylococci and other Firmicutes.
Cloning systems for Rhodococcus and related bacteria
Finnerty, W.R.; Singer, M.E.
1990-08-28
A plasmid transformation system for Rhodococcus was developed using an Escherichia coli-Rhodococcus shuttle plasmid. Rhodococcus sp. H13-A contains three cryptic indigenous plasmids, designated pMVS100, pMVS200 and pMVS300, of 75, 19.5 and 13.4 kilobases (Kb), respectively. A 3.8 Kb restriction fragment of pMVS300 was cloned into pIJ30, a 6.3 Kb pBR322 derivative, containing the E. coli origin of replication (ori) and ampicillin resistance determinant (bla) as well as a Streptomyces gene for thiostrepton resistance, tsr. The resulting 10.1 Kb recombinant plasmid, designated pMVS301, was isolated from E. coli DH1 (pMVS301) and transformed into Rhodococcus sp. AS-50, a derivative of strain H13-A, by polyethylene glycol-assisted transformation of Rhodococcus protoplasts and selection for thiostrepton-resistant transformants. This strain was deposited with the ATCC on Feb. 1, 1988 and assigned ATCC 53719. The plasmid contains the Rhodococcus origin of replication. The plasmid and derivatives thereof can therefore be used to introduce nucleic acid sequences to and from Rhodococcus for subsequent expression and translation into protein. The isolated origin of replication can also be used in the construction of new vectors. 2 figs.
Cloning systems for Rhodococcus and related bacteria
Finnerty, William R.; Singer, Mary E.
1990-01-01
A plasmid transformation system for Rhodococcus was developed using an Escherichia coli-Rhodococcus shuttle plasmid. Rhodococcus sp. H13-A contains three cryptic indigenous plasmids, designated pMVS100, pMVS200 and pMVS300, of 75, 19.5 and 13.4 kilobases (Kb), respectively. A 3.8 Kb restriction fragment of pMVS300 was cloned into pIJ30, a 6.3 Kb pBR322 derivative, containing the E. coli origin of replication (ori) and ampicillin resistance determinant (bla) as well as a Streptomyces gene for thiostrepton resistance, tsr. The resulting 10.1 Kb recombinant plasmid, designated pMVS301, was isolated from E. coli DH1 (pMVS301) and transformed into Rhodococcus sp. AS-50, a derivative of strain H13-A, by polyethylene glycol-assisted transformation of Rhodococcus protoplasts and selection for thiostrepton-resistant transformants. This strain was deposited with the ATCC on Feb. 1, 1988 and assigned ATCC 53719. The plasmid contains the Rhodococcus origin of replication. The plasmid and derivatives thereof can therefore be used to introduce nucleic acid sequences to and from Rhodococcus for subsequent expression and translation into protein. The isolated origin of replication can also be used in the construction of new vectors.
Cloning of cellulase genes from Acidothermus cellulolyticus
Lastick, S.M.; Tucker, M.P.; Grohmann, K.
1996-05-07
A process is described for moving fragments that code for cellulase activity from the genome of A. cellulolyticus to several plasmid vectors and the subsequent expression of active cellulase activity in E. coli. 5 figs.
Heilbronner, Simon; Monk, Ian R; Foster, Timothy J
2013-11-01
Staphylococcus lugdunensis is a coagulase negative staphylococcus that is a commensal of man and an opportunistic pathogen. A site-specific integrative plasmid for the use in S. lugdunensis was constructed and validated. The integrase gene ccrB of bacteriophage ϕSL01 together with its attachment site was cloned into the thermosensitive plasmid pIMAY. The resulting plasmid pIPI03 integrated RecA-independently, site-specifically and irreversibly into the S. lugdunensis chromosome. Two IPTG-inducible antibiotic resistance determinants were cloned into pIPI03 and the derivatives were used to construct strains suitable for competitive growth experiments in both in vitro and in vivo. Copyright © 2013 Elsevier Inc. All rights reserved.
Li, Ruichao; Xie, Miaomiao; Lv, Jingzhang; Wai-Chi Chan, Edward; Chen, Sheng
2017-03-01
To investigate the genetic features of three plasmids recovered from an MCR-1 and ESBL-producing Escherichia coli strain, HYEC7, and characterize the transmission mechanism of mcr-1 . The genetic profiles of three plasmids were determined by PCR, S1-PFGE, Southern hybridization and WGS analysis. The ability of the mcr-1 -bearing plasmid to undergo conjugation was also assessed. The mcr-1 -bearing transposon Tn 6330 was characterized by PCR and DNA sequencing. Complete sequences of three plasmids were obtained. A non-conjugative phage P7-like plasmid, pHYEC7- mcr1 , was found to harbour the mcr-1 -bearing transposon Tn 6330 , which could be excised from the plasmid by generating a circular intermediate harbouring mcr-1 and the IS Apl1 element. The insertion of the circular intermediate into another plasmid, pHYEC7-IncHI2, could form pHNSHP45-2, the original IncHI2-type mcr-1 -carrying plasmid that was reported. The third plasmid, pHYEC7-110, harboured two replicons, IncX1 and IncFIB, and comprised multiple antimicrobial resistance mobile elements, some of which were shared by pHYEC7-IncHI2. The Tn 6330 element located in the phage-like plasmid pHYEC7- mcr1 could be excised from the plasmid and formed a circular intermediate that could be integrated into plasmids containing the IS Apl1 element. This phenomenon indicated that Tn 6330 is a key element responsible for widespread dissemination of mcr-1 among various types of plasmids and bacterial chromosomes. The dissemination rate of such an element may be further enhanced upon translocation into phage-like vectors, which may also be transmitted via transduction events. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Obaldia, Nicanor; Stockelman, Michael G; Otero, William; Cockrill, Jennifer A; Ganeshan, Harini; Abot, Esteban N; Zhang, Jianfeng; Limbach, Keith; Charoenvit, Yupin; Doolan, Denise L; Tang, De-Chu C; Richie, Thomas L
2017-04-01
Malaria is caused by parasites of the genus Plasmodium , which are transmitted to humans by the bites of Anopheles mosquitoes. After the elimination of Plasmodium falciparum , it is predicted that Plasmodium vivax will remain an important cause of morbidity and mortality outside Africa, stressing the importance of developing a vaccine against P. vivax malaria. In this study, we assessed the immunogenicity and protective efficacy of two P. vivax antigens, apical membrane antigen 1 (AMA1) and the 42-kDa C-terminal fragment of merozoite surface protein 1 (MSP1 42 ) in a plasmid recombinant DNA prime/adenoviral (Ad) vector boost regimen in Aotus monkeys. Groups of 4 to 5 monkeys were immunized with plasmid DNA alone, Ad alone, prime/boost regimens with each antigen, prime/boost regimens with both antigens, and empty vector controls and then subjected to blood-stage challenge. The heterologous immunization regimen with the antigen pair was more protective than either antigen alone or both antigens delivered with a single vaccine platform, on the basis of their ability to induce the longest prepatent period and the longest time to the peak level of parasitemia, the lowest peak and mean levels of parasitemia, the smallest area under the parasitemia curve, and the highest self-cure rate. Overall, prechallenge MSP1 42 antibody titers strongly correlated with a decreased parasite burden. Nevertheless, a significant proportion of immunized animals developed anemia. In conclusion, the P. vivax plasmid DNA/Ad serotype 5 vaccine encoding blood-stage parasite antigens AMA1 and MSP1 42 in a heterologous prime/boost immunization regimen provided significant protection against blood-stage challenge in Aotus monkeys, indicating the suitability of these antigens and this regimen for further development. Copyright © 2017 American Society for Microbiology.
Transposon-containing DNA cloning vector and uses thereof
Berg, C.M.; Berg, D.E.; Wang, G.
1997-07-08
The present invention discloses a rapid method of restriction mapping, sequencing or localizing genetic features in a segment of deoxyribonucleic acid (DNA) that is up to 42 kb in size. The method in part comprises cloning of the DNA segment in a specialized cloning vector and then isolating nested deletions in either direction in vivo by intramolecular transposition into the cloned DNA. A plasmid has been prepared and disclosed. 4 figs.
Transposon-containing DNA cloning vector and uses thereof
Berg, Claire M.; Berg, Douglas E.; Wang, Gan
1997-01-01
The present invention discloses a rapid method of restriction mapping, sequencing or localizing genetic features in a segment of deoxyribonucleic acid (DNA) that is up to 42 kb in size. The method in part comprises cloning of the DNA segment in a specialized cloning vector and then isolating nested deletions in either direction in vivo by intramolecular transposition into the cloned DNA. A plasmid has been prepared and disclosed.
Progress in directed energy control of vectors for microbes and other cells
NASA Astrophysics Data System (ADS)
Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva; Sloan, Mark A.; Stribling, Lucille J. V.
2004-07-01
Biosynthetic semiconductor, diazoluminomelanin (DALM), is a polymer of tyrosine, luminol, and nitrite. DALM has a very large cross section of absorption for light from ultraviolet to radio frequencies. This polymer can be made efficiently in a genetically engineered E.coli, JM109/pIC2ORNR1.1 (ATCC# 69905). We have been pursuing ways to couple electromagnetic radiation to vectors using this polymer. DNA capture elements (DCEs; formerly aptamers) have made this possible. We incorporated DCEs into the plasmid of this E. coli to direct binding to whatever microbe or cell desired and to produce DALM attached to the plasmid DNA. Using two other vectors pSV2neoNR101 or pSV2neoNR8005 (ATCC # 69617 and 69618, respectively), both propagated in the E. coli host HB101, we have also inserted genes necessary for DALM production into animal and human cell lines (mouse monocytic leukemia: ATCC # CRL- 11771, -11772, -1173, mouse mammary adenocarcinoma: ATCC# CRL-12184, -12185; and human carcinoma of the cervix: ATCC # CRL-12510). The DCE/DALM vectors can be used to tag target cells, detectable by broad-spectrum light absorbance, luminescence, or fluorescence. DCE/DALM can further be activated with light, microwave energy, or by oxidative chemistry to kill the targeted microbes or other cells.
Efficient Sleeping Beauty DNA Transposition From DNA Minicircles
Sharma, Nynne; Cai, Yujia; Bak, Rasmus O; Jakobsen, Martin R; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm
2013-01-01
DNA transposon-based vectors have emerged as new potential delivery tools in therapeutic gene transfer. Such vectors are now showing promise in hematopoietic stem cells and primary human T cells, and clinical trials with transposon-engineered cells are on the way. However, the use of plasmid DNA as a carrier of the vector raises safety concerns due to the undesirable administration of bacterial sequences. To optimize vectors based on the Sleeping Beauty (SB) DNA transposon for clinical use, we examine here SB transposition from DNA minicircles (MCs) devoid of the bacterial plasmid backbone. Potent DNA transposition, directed by the hyperactive SB100X transposase, is demonstrated from MC donors, and the stable transfection rate is significantly enhanced by expressing the SB100X transposase from MCs. The stable transfection rate is inversely related to the size of circular donor, suggesting that a MC-based SB transposition system benefits primarily from an increased cellular uptake and/or enhanced expression which can be observed with DNA MCs. DNA transposon and transposase MCs are easily produced, are favorable in size, do not carry irrelevant DNA, and are robust substrates for DNA transposition. In accordance, DNA MCs should become a standard source of DNA transposons not only in therapeutic settings but also in the daily use of the SB system. PMID:23443502
Sakuma, Tetsushi; Takenaga, Mitsumasa; Kawabe, Yoshinori; Nakamura, Takahiro; Kamihira, Masamichi; Yamamoto, Takashi
2015-01-01
Gene knock-in techniques have rapidly evolved in recent years, along with the development and maturation of genome editing technology using programmable nucleases. We recently reported a novel strategy for microhomology-mediated end-joining-dependent integration of donor DNA by using TALEN or CRISPR/Cas9 and optimized targeting vectors, named PITCh (Precise Integration into Target Chromosome) vectors. Here we describe TALEN and PITCh vector-mediated integration of long gene cassettes, including a single-chain Fv-Fc (scFv-Fc) gene, in Chinese hamster ovary (CHO) cells, with comparison of targeting and cloning efficiency among several donor design and culture conditions. We achieved 9.6-kb whole plasmid integration and 7.6-kb backbone-free integration into a defined genomic locus in CHO cells. Furthermore, we confirmed the reasonable productivity of recombinant scFv-Fc protein of the knock-in cells. Using our protocol, the knock-in cell clones could be obtained by a single transfection and a single limiting dilution using a 96-well plate, without constructing targeting vectors containing long homology arms. Thus, the study described herein provides a highly practical strategy for gene knock-in of large DNA in CHO cells, which accelerates high-throughput generation of cell lines stably producing any desired biopharmaceuticals, including huge antibody proteins. PMID:26473830
Sakuma, Tetsushi; Takenaga, Mitsumasa; Kawabe, Yoshinori; Nakamura, Takahiro; Kamihira, Masamichi; Yamamoto, Takashi
2015-10-09
Gene knock-in techniques have rapidly evolved in recent years, along with the development and maturation of genome editing technology using programmable nucleases. We recently reported a novel strategy for microhomology-mediated end-joining-dependent integration of donor DNA by using TALEN or CRISPR/Cas9 and optimized targeting vectors, named PITCh (Precise Integration into Target Chromosome) vectors. Here we describe TALEN and PITCh vector-mediated integration of long gene cassettes, including a single-chain Fv-Fc (scFv-Fc) gene, in Chinese hamster ovary (CHO) cells, with comparison of targeting and cloning efficiency among several donor design and culture conditions. We achieved 9.6-kb whole plasmid integration and 7.6-kb backbone-free integration into a defined genomic locus in CHO cells. Furthermore, we confirmed the reasonable productivity of recombinant scFv-Fc protein of the knock-in cells. Using our protocol, the knock-in cell clones could be obtained by a single transfection and a single limiting dilution using a 96-well plate, without constructing targeting vectors containing long homology arms. Thus, the study described herein provides a highly practical strategy for gene knock-in of large DNA in CHO cells, which accelerates high-throughput generation of cell lines stably producing any desired biopharmaceuticals, including huge antibody proteins.
Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia
2005-12-01
RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.
A novel Streptomyces spp. integration vector derived from the S. venezuelae phage, SV1.
Fayed, Bahgat; Younger, Ellen; Taylor, Gabrielle; Smith, Margaret C M
2014-05-30
Integrating vectors based on the int/attP loci of temperate phages are convenient and used widely, particularly for cloning genes in Streptomyces spp. We have constructed and tested a novel integrating vector based on g27, encoding integrase, and attP site from the phage, SV1. This plasmid, pBF3 integrates efficiently in S. coelicolor and S. lividans but surprisingly fails to generate stable integrants in S. venezuelae, the natural host for phage SV1. pBF3 promises to be a useful addition to the range of integrating vectors currently available for Streptomyces molecular genetics.
USDA-ARS?s Scientific Manuscript database
The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV) from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacter...
Kyostio-Moore, Sirkka; Berthelette, Patricia; Cornell, Cathleen Sookdeo; Nambiar, Bindu; Figueiredo, Monica Dias
2018-05-01
OBJECTIVE To evaluate gene transfer of recombinant adeno-associated viral (rAAV) vectors with AAV2 or AAV5 capsid and encoding hyaluronic acid (HA) synthase-2 (HAS2) into joints of healthy dogs. ANIMALS 22 purpose-bred Beagles. PROCEDURES Plasmid expression cassettes encoding canine HAS2 (cHAS2) were assessed in vitro for concentration and molecular size of secreted HA. Thereafter, rAAV2-cHAS2 vectors at 3 concentrations and rAAV5-cHAS2 vectors at 1 concentration were each administered intra-articularly into the left stifle joint of 5 dogs; 2 dogs received PBS solution instead. Synovial fluid HA concentration and serum and synovial fluid titers of neutralizing antibodies against AAV capsids were measured at various points. Dogs were euthanized 28 days after treatment, and cartilage and synovium samples were collected for vector DNA and mRNA quantification and histologic examination. RESULTS Cell transfection with plasmids encoding cHAS2 resulted in an increase in production and secretion of HA in vitro. In vivo, the rAAV5-cHAS2 vector yielded uniform genome transfer and cHAS2 expression in collected synovium and cartilage samples. In contrast, rAAV2-cHAS2 vectors were detected inconsistently in synovium and cartilage samples and failed to produce clear dose-related responses. Histologic examination revealed minimal synovial inflammation in joints injected with rAAV vectors. Neutralizing antibodies against AAV capsids were detected in serum and synovial fluid samples from all vector-treated dogs. CONCLUSIONS AND CLINICAL RELEVANCE rAAV5-mediated transfer of the gene for cHAS2 into healthy joints of dogs by intra-articular injection appeared safe and resulted in vector-derived cHAS2 production by synoviocytes and chondrocytes. Whether this treatment may increase HA production by synoviocytes and chondrocytes in osteoarthritic joints remains to be determined.
Biochemistry and genetics of autotrophy in Methanococcus. Progress report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Whitman, W.B.
In the last two years of this research, the most exciting results have come from the work on the genetics of methanococci. First, the author demonstrated that the cryptic plasmid from Methanococcus maripaludis C5, pURB500, could be transformed into Methanococcus maripaludis JJ. Strain JJ is the type strain of M. maripaludis and has only about 65% DNA:DNA hybridization to strain C5. Because of the low relatedness of these strains, it was not obvious that pURB500 could be transferred between them. This goal was achieved by first transforming strain C5 with a series of suicide plasmids containing the pac cassette, whichmore » possessed the selectable puromycin resistance marker, and different cloned fragments of pURB500. From the puromycin-resistant transformants, a plasmid was isolated that transformed strain JJ. However, when this plasmid was electroporated into E. coli, only rearrangement products were obtained that contained small portions of the original pURB500. These plasmids no longer transformed Methanococcus. While these experiments did not yield a shuttle vector, they demonstrated that pURB500 could replicate in strain JJ.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seetharam, S.; Protic-Sabljic, M.; Seidman, M.M.
1987-12-01
A shuttle vector plasmid, pZ189, was utilized to assess the types of mutations that cells from a patient with xeroderma pigmentosum, complementation group D, introduce into ultraviolet (UV) damaged, replicating DNA. Patients with xeroderma pigmentosum have clinical and cellular UV hypersensitivity, increased frequency of sun-induced skin cancer, and deficient DNA repair. In comparison to UV-treated pZ189 replicated in DNA repair-proficient cells, there were fewer surviving plasmids, a higher frequency of plasmids with mutations, fewer plasmids with two or more mutations in the marker gene, and a new mutagenic hotspot. The major type of base substitution mutation was the G:C tomore » A:T transition with both cell lines. These results, together with similar findings published earlier with cells from a xeroderma pigmentosum patient in complementation group A, suggest that isolated G:C to A:T somatic mutations may be particularly important in generation of human skin cancer by UV radiation.« less
Development of Genetically Stable Escherichia coli Strains for Poly(3-Hydroxypropionate) Production
Gao, Yongqiang; Liu, Changshui; Ding, Yamei; Sun, Chao; Zhang, Rubing; Xian, Mo; Zhao, Guang
2014-01-01
Poly(3-hydroxypropionate) (P3HP) is a biodegradable and biocompatible thermoplastic. In our previous study, a pathway for P3HP production was constructed in recombinant Esecherichia coli. Seven exogenous genes in P3HP synthesis pathway were carried by two plasmid vectors. However, the P3HP production was severely suppressed by strain instability due to plasmid loss. In this paper, two strategies, chromosomal gene integration and plasmid addiction system (PAS) based on amino acid anabolism, were applied to construct a genetically stable strain. Finally, a combination of those two methods resulted in the best results. The resultant strain carried a portion of P3HP synthesis genes on chromosome and the others on plasmid, and also brought a tyrosine-auxotrophy based PAS. In aerobic fed-batch fermentation, this strain produced 25.7 g/L P3HP from glycerol, about 2.5-time higher than the previous strain with two plasmids. To the best of our knowledge, this is the highest P3HP production from inexpensive carbon sources. PMID:24837211
Zheng, Fengrong; Sun, Xiuqin; Wu, Xing'an; Liu, Hongzhan; Li, Jiye; Wu, Suqi; Zhang, Jinxing
2011-01-01
Here, we report the construction of a vaccine against lymphocystis disease virus (LCDV) using nucleic acid vaccination technology. A fragment of the major capsid protein encoding gene from an LCDV isolated from China (LCDV-cn) was cloned into an eukaryotic expression vector pEGFP-N2, yielding a recombinant plasmid pEGFP-N2-LCDV-cn0.6 kb. This plasmid was immediately expressed after liposomal transfer into the Japanese flounder embryo cell line. The recombinant plasmid was inoculated into Japanese flounder via two routes (intramuscular injection and hypodermic injection) at three doses (0.1, 5, and 15 μg), and then T-lymphopoiesis in different tissues and antibodies raised against LCDV were evaluated. The results indicated that this recombinant plasmid induced unique humoral or cell-mediated immune responses depending on the inoculation route and conferred immune protection. Furthermore, the humoral immune responses and protective effects were significantly increased at higher vaccine doses via the two injection routes. Plasmid pEGFP-N2-LCDV0.6 kb is therefore a promising vaccine candidate against LCDV in Japanese flounder. PMID:21789044
Nguyen, Khuyen Thi; Ho, Quynh Ngoc; Pham, Thu Ha; Phan, Tuan-Nghia; Tran, Van-Tuan
2016-12-01
Aspergillus oryzae is a safe mold widely used in food industry. It is also considered as a microbial cell factory for production of recombinant proteins and enzymes. Currently, genetic manipulation of filamentous fungi is achieved via Agrobacterium tumefaciens-mediated transformation methods usually employing antibiotic resistance markers. These methods are hardly usable for A. oryzae due to its strong resistance to the common antifungal compounds used for fungal transformation. In this study, we have constructed two binary vectors carrying the pyrG gene from A. oryzae as a biochemical marker than an antibiotic resistance marker, and an expression cassette for GFP or DsRed reporter gene under control of the constitutive gpdA promoter from Aspergillus nidulans. All components of these vectors are changeable to generate new versions for specific research purposes. The developed vectors are fully functional for heterologous expression of the GFP and DsRed fluorescent proteins in the uridine/uracil auxotrophic A. oryzae strain. Our study provides a new approach for A. oryzae transformation using pyrG as the selectable auxotrophic marker, A. tumefaciens as the DNA transfer tool and fungal spores as the transformation material. The binary vectors constructed can be used for gene expression studies in this industrially important filamentous fungus.
Novel method of finding extreme edges in a convex set of N-dimension vectors
NASA Astrophysics Data System (ADS)
Hu, Chia-Lun J.
2001-11-01
As we published in the last few years, for a binary neural network pattern recognition system to learn a given mapping {Um mapped to Vm, m=1 to M} where um is an N- dimension analog (pattern) vector, Vm is a P-bit binary (classification) vector, the if-and-only-if (IFF) condition that this network can learn this mapping is that each i-set in {Ymi, m=1 to M} (where Ymithere existsVmiUm and Vmi=+1 or -1, is the i-th bit of VR-m).)(i=1 to P and there are P sets included here.) Is POSITIVELY, LINEARLY, INDEPENDENT or PLI. We have shown that this PLI condition is MORE GENERAL than the convexity condition applied to a set of N-vectors. In the design of old learning machines, we know that if a set of N-dimension analog vectors form a convex set, and if the machine can learn the boundary vectors (or extreme edges) of this set, then it can definitely learn the inside vectors contained in this POLYHEDRON CONE. This paper reports a new method and new algorithm to find the boundary vectors of a convex set of ND analog vectors.
Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D
1982-01-01
An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675
Bacteriophage-based Vectors for Site-specific Insertion of DNA in the Chromosome of Corynebacteria
Oram, Mark; Woolston, Joelle E.; Jacobson, Andrew D.; Holmes, Randall K.; Oram, Diana M.
2007-01-01
In Corynebacterium diphtheriae, diphtheria toxin is encoded by the tox gene of some temperate corynephages such as β. β-like corynephages are capable of inserting into the C. diphtheriae chromosome at two specific sites, attB1 and attB2. Transcription of the phage-encoded tox gene, and many chromosomally-encoded genes, is regulated by the DtxR protein in response to Fe2+ levels. Characterizing DtxR-dependent gene regulation is pivotal in understanding diphtheria pathogenesis and mechanisms of iron-dependent gene expression; although this has been hampered by a lack of molecular genetic tools in C. diphtheriae and related Coryneform species. To expand the systems for genetic manipulation of C. diphtheriae, we constructed plasmid vectors capable of integrating into the chromosome. These plasmids contain the β-encoded attP site and the DIP0182 integrase gene of C. diphtheriae NCTC13129. When these vectors were delivered to the cytoplasm of non-lysogenic C. diphtheriae, they integrated into either the attB1 or attB2 sites with comparable frequency. Lysogens were also transformed with these vectors, by virtue of the second attB site. An integrated vector carrying an intact dtxR gene complemented the mutant phenotypes of a C. diphtheriae ΔdtxR strain. Additionally, strains of β-susceptible C. ulcerans, and C. glutamicum, a species non-permissive for β, were each transformed with these vectors. This work significantly extends the tools available for targeted transformation of both pathogenic and non-pathogenic Corynebacterium species. PMID:17275217
Walz, M; Kück, U
1995-12-01
The ascomycete Sordaria macrospora was transformed using different plasmid molecules containing the bacterial hygromycin B resistance gene (hph) under the control of different expression signals. The highest transformation frequency was obtained with vector pMW1. On this plasmid molecule, expression of the hph gene is directed by the upstream region of the isopenicillin N synthetase gene (pcbC) from the deuteromycete Acremonium chrysogenum. Southern analysis suggests that the vector copies are integrated as tandem repeats into the S. macrospora chromosomes and that duplicated sequences are most probably not inactivated by methylation during meiosis. Furthermore, the hygromycin B resistance (hygR) is not correlated with the number of integrated vector molecules. Electrophoretic karyotyping was used to further characterize S. macrospora transformants. Five chromosomal bands were separated by pulsed-field gel electrophoresis (PFGE) representing seven chromosomes with a total genome size of 39.5Mb. Hybridization analysis revealed ectopic integration of vector DNA into different chromosomes. In a few transformants, major rearrangements were detected. Transformants were sexually propagated to analyze the fate of the heterologous vector DNA. Although the hygR phenotype is stably maintained during mitosis, about a third of all lines tested showed loss of the resistance marker gene after meiosis. However, as was concluded from electrophoretic karyotyping, the resistant spores showed a Mendelian segregation of the integrated vector molecules in at least three consecutive generations. Our data indicate that heterologous marker genes can be used for transformation tagging, or the molecular mapping of chromosomal loci in S. macrospora.
Isolation and characterization of novel mutations in the pSC101 origin that increase copy number
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.
pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less
Isolation and characterization of novel mutations in the pSC101 origin that increase copy number
Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.; ...
2018-01-25
pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less
Delgado, Diego; del Pozo-Rodríguez, Ana; Solinís, Maria Ángeles; Avilés-Triqueros, Marcelino; Weber, Bernhard H F; Fernández, Eduardo; Gascón, Alicia R
2012-04-01
The goal of the present study was to analyze the potential application of nonviral vectors based on solid lipid nanoparticles (SLN) for the treatment of ocular diseases by gene therapy, specifically X-linked juvenile retinoschisis (XLRS). Vectors were prepared with SLN, dextran, protamine, and a plasmid (pCMS-EGFP or pCEP4-RS1). Formulations were characterized and the in vitro transfection capacity as well as the cellular uptake and the intracellular trafficking were studied in ARPE-19 cells. Formulations were also tested in vivo in Wistar rat eyes, and the efficacy was studied by monitoring the expression of enhanced green fluorescent protein (EGFP) after intravitreal, subretinal, and topical administration. The presence of dextran and protamine in the SLN improved greatly the expression of retinoschisin and EGFP in ARPE-19 cells. The nuclear localization signals of protamine, its ability to protect the DNA, and a shift in the entry mechanism from caveola-mediated to clathrin-mediated endocytosis promoted by the dextran, justify the increase in transfection. After ocular administration of the dextran-protamine-DNA-SLN complex to rat eyes, we detected the expression of EGFP in various types of cells depending on the administration route. Our vectors were also able to transfect corneal cells after topical application. We have demonstrated the potential usefulness of our nonviral vectors loaded with XLRS1 plasmid and provided evidence for their potential application for the management or treatment of degenerative retinal disorders as well as ocular surface diseases.
High-frequency transformation of Lobelia erinus L. by Agrobacterium-mediated gene transfer.
Tsugawa, H; Kagami, T; Suzuki, M
2004-05-01
A highly efficient transformation procedure was developed for Lobelia erinus. Leaf or cotyledon discs were inoculated with Agrobacterium tumefaciens strain EHA105 harboring the binary vector plasmid pIG121Hm, which contains a beta-glucuronidase gene with an intron as a reporter gene and both the neomycin phosphotransferase II and hygromycin phosphotransferase genes as selectable markers. The hygromycin-resistant calli produced on the selection medium were transferred to MS medium supplemented with 0.5 mg/l benzyladenine and 0.2 mg/l indole-3-acetic acid for regeneration of adventitious shoots. Transgenic plants were obtained as a result of the high regeneration rate of the transformed calli, which was as high as 83%. In contrast, no transgenic plant was obtained by the procedure of direct shoot formation following inoculation with A. tumefaciens. Transgenic plants flowered 3-4 months after transformation. Integration of the transgenes was detected using PCR and Southern blot analysis, which revealed that one to several copies were integrated into the genomes of the host plants. The transformation frequency at the stage of whole plants was very high--45% per inoculated disc. Copyright 2004 Springer-Verlag
Shchelkunov, S N; Taranov, O S; Tregubchak, T V; Maksyutov, R A; Silkov, A N; Nesterov, A E; Sennikov, S V
2016-07-01
Wistar rats with collagen-induced arthritis were intramuscularly injected with the recombinant plasmid pcDNA/sTNF-BD encoding the sequence of the TNF-binding protein domain of variola virus CrmB protein (VARV sTNF-BD) or the pcDNA3.1 vector. Quantitative analysis showed that the histopathological changes in the hind-limb joints of rats were most severe in the animals injected with pcDNA3.1 and much less severe in the group of rats injected with pcDNA/sTNF-BD, which indicates that gene therapy of rheumatoid arthritis is promising in the case of local administration of plasmids governing the synthesis of VARV immunomodulatory proteins.
Liu, Kan; Zhao, Chaofei; Chen, Jianwen; Wu, Shengpan; Yao, Yuanxin; Wu, Chong; Luo, Guoxiong; Zhang, Xu
2016-06-01
Objective To establish selenoprotein P, plasma 1 (SEPP1) gene recombinant lentiviral vector and investigate the effect of SEPP1 on the proliferation of human clear cell renal cell carcinoma (ccRCC) cells. Methods cDNA sequence of SEPP1 was cloned from the total cDNA of HEK293T cells by PCR. Then, the cDNA fragment was combined with the pLV-EGFP(2A)Puro vector and the constructed plasmid pLV-EGFP(2A)Puro-SEPP1 was transfected into HEK293T cells for packaging the virus. Forty-eight hours after transfected with the virus supernatant, the level of SEPP1 protein in 769-P and 786-O cells were tested by Western blotting. Cells were divided into recombinant lentivirus-infected cells, empty vector lentivirus-infected cells and the blank control cells. Cell proliferation rate was detected by MTS assay, colony forming ability was evaluated by plate clony formation assay and cell cycle change was assayed by flow cytometry after transfected with pLV-EGFP(2A)Puro-SEPP1 or empty pLV-EGFP(2A)Puro vector. Results Enzyme digestion analysis and DNA sequencing showed that the recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 was constructed successfully. After being infected by the virus supernatant, the 786-O and 769-P cells expressed EGFP. Compared with the empty vector group and the blank control group, expression level of SEPP1 in the experimental group was much higher. The cell proliferative ability was inhibited in the cells overexpressing SEPP1, and the colony forming ability of SEPP1-overexpressed cells evidently decreased. Cell cycle was arrested in G2/M phase in 786-O cells overexpressing SEPP1. Conclusion The recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 has been constructed successfully. Overexpression of SEPP1 could significantly reduce the proliferation rate of 786-O and 769P cells, and cause G2/M phase arrest of 786-O cells.
A simple and reliable multi-gene transformation method for switchgrass.
Ogawa, Yoichi; Shirakawa, Makoto; Koumoto, Yasuko; Honda, Masaho; Asami, Yuki; Kondo, Yasuhiro; Hara-Nishimura, Ikuko
2014-07-01
A simple and reliable Agrobacterium -mediated transformation method was developed for switchgrass. Using this method, many transgenic plants carrying multiple genes-of-interest could be produced without untransformed escape. Switchgrass (Panicum virgatum L.) is a promising biomass crop for bioenergy. To obtain transgenic switchgrass plants carrying a multi-gene trait in a simple manner, an Agrobacterium-mediated transformation method was established by constructing a Gateway-based binary vector, optimizing transformation conditions and developing a novel selection method. A MultiRound Gateway-compatible destination binary vector carrying the bar selectable marker gene, pHKGB110, was constructed to introduce multiple genes of interest in a single transformation. Two reporter gene expression cassettes, GUSPlus and gfp, were constructed independently on two entry vectors and then introduced into a single T-DNA region of pHKGB110 via sequential LR reactions. Agrobacterium tumefaciens EHA101 carrying the resultant binary vector pHKGB112 and caryopsis-derived compact embryogenic calli were used for transformation experiments. Prolonged cocultivation for 7 days followed by cultivation on media containing meropenem improved transformation efficiency without overgrowth of Agrobacterium, which was, however, not inhibited by cefotaxime or Timentin. In addition, untransformed escape shoots were completely eliminated during the rooting stage by direct dipping the putatively transformed shoots into the herbicide Basta solution for a few seconds, designated as the 'herbicide dipping method'. It was also demonstrated that more than 90 % of the bar-positive transformants carried both reporters delivered from pHKGB112. This simple and reliable transformation method, which incorporates a new selection technique and the use of a MultiRound Gateway-based binary vector, would be suitable for producing a large number of transgenic lines carrying multiple genes.
Two-dimensional PCA-based human gait identification
NASA Astrophysics Data System (ADS)
Chen, Jinyan; Wu, Rongteng
2012-11-01
It is very necessary to recognize person through visual surveillance automatically for public security reason. Human gait based identification focus on recognizing human by his walking video automatically using computer vision and image processing approaches. As a potential biometric measure, human gait identification has attracted more and more researchers. Current human gait identification methods can be divided into two categories: model-based methods and motion-based methods. In this paper a two-Dimensional Principal Component Analysis and temporal-space analysis based human gait identification method is proposed. Using background estimation and image subtraction we can get a binary images sequence from the surveillance video. By comparing the difference of two adjacent images in the gait images sequence, we can get a difference binary images sequence. Every binary difference image indicates the body moving mode during a person walking. We use the following steps to extract the temporal-space features from the difference binary images sequence: Projecting one difference image to Y axis or X axis we can get two vectors. Project every difference image in the difference binary images sequence to Y axis or X axis difference binary images sequence we can get two matrixes. These two matrixes indicate the styles of one walking. Then Two-Dimensional Principal Component Analysis(2DPCA) is used to transform these two matrixes to two vectors while at the same time keep the maximum separability. Finally the similarity of two human gait images is calculated by the Euclidean distance of the two vectors. The performance of our methods is illustrated using the CASIA Gait Database.
Minichromosome assembly of non-integrated plasmid DNA transfected into mammalian cells.
Reeves, R; Gorman, C M; Howard, B
1985-01-01
The nucleoprotein structures formed on various plasmid expression vectors transfected into mammalian cells by both the calcium phosphate and DEAE-dextran methods have been studied. We demonstrate by a variety of means that mammalian cells are capable of rapidly assembling non-integrated circular plasmids (both replicating and non-replicating) into typical "minichromosomes" containing nucleosomes with a 190 bp repetitive spacing. Treatment of recipient cells with sodium butyrate for a short period of time (12-16 h) immediately following transfection markedly increased the DNase I digestion sensitivity of the newly assembled plasmid chromatin. Furthermore, minichromosomes isolated from such butyrate-treated cells are depleted in histone H1 and contain highly acetylated forms of histone H4. These findings are entirely consistent with our earlier speculation (Gorman et al., Nucleic Acids Res. 11, 1044; 1983) that appropriate butyrate treatment might stimulate transient expression of newly transfected genes by facilitating their assembly into an "active" type of chromatin structure. Images PMID:3859838
Woltjen, Knut; Ito, Kenichi; Tsuzuki, Teruhisa; Rancourt, Derrick E
2008-01-01
In recent years, methods to address the simplification of targeting vector (TV) construction have been developed and validated. Based on in vivo recombination in Escherichia coli, these protocols have reduced dependence on restriction endonucleases, allowing the fabrication of complex TV constructs with relative ease. Using a methodology based on phage-plasmid recombination, we have developed a comprehensive TV construction protocol dubbed Orpheus recombination (ORE). The ORE system addresses all necessary requirements for TV construction; from the isolation of genespecific regions of homology to the deposition of selection/disruption cassettes. ORE makes use of a small recombination plasmid, which bears positive and negative selection markers and a cloned homologous "probe" region. This probe plasmid may be introduced into and excised from phage-borne murine genomic clones by two rounds of single crossover recombination. In this way, desired clones can be specifically isolated from a heterogeneous library of phage. Furthermore, if the probe region contains a designed mutation, it may be deposited seamlessly into the genomic clone. The complete removal of operational sequences allows unlimited repetition of the procedure to customize and finalize TVs within a few weeks. Successful gene-specific clone isolation, point mutations, large deletions, cassette insertions, and finally coincident clone isolation and mutagenesis have all been demonstrated with this method.
NASA Technical Reports Server (NTRS)
Dar, M. E.; Jorgensen, T. J.
1995-01-01
Using the radiomimetic drug, bleomycin, we have determined the mutagenic potential of DNA strand breaks in the shuttle vector pZ189 in human fibroblasts. The bleomycin treatment conditions used produce strand breaks with 3'-phosphoglycolate termini as > 95% of the detectable dose-dependent lesions. Breaks with this end group represent 50% of the strand break damage produced by ionizing radiation. We report that such strand breaks are mutagenic lesions. The type of mutation produced is largely determined by the type of strand break on the plasmid (i.e. single versus double). Mutagenesis studies with purified DNA forms showed that nicked plasmids (i.e. those containing single-strand breaks) predominantly produce base substitutions, the majority of which are multiples, which presumably originate from error-prone polymerase activity at strand break sites. In contrast, repair of linear plasmids (i.e. those containing double-strand breaks) mainly results in deletions at short direct repeat sequences, indicating the involvement of illegitimate recombination. The data characterize the nature of mutations produced by single- and double-strand breaks in human cells, and suggests that deletions at direct repeats may be a 'signature' mutation for the processing of DNA double-strand breaks.
Davidsson, Marcus; Diaz-Fernandez, Paula; Schwich, Oliver D.; Torroba, Marcos; Wang, Gang; Björklund, Tomas
2016-01-01
Detailed characterization and mapping of oligonucleotide function in vivo is generally a very time consuming effort that only allows for hypothesis driven subsampling of the full sequence to be analysed. Recent advances in deep sequencing together with highly efficient parallel oligonucleotide synthesis and cloning techniques have, however, opened up for entirely new ways to map genetic function in vivo. Here we present a novel, optimized protocol for the generation of universally applicable, barcode labelled, plasmid libraries. The libraries are designed to enable the production of viral vector preparations assessing coding or non-coding RNA function in vivo. When generating high diversity libraries, it is a challenge to achieve efficient cloning, unambiguous barcoding and detailed characterization using low-cost sequencing technologies. With the presented protocol, diversity of above 3 million uniquely barcoded adeno-associated viral (AAV) plasmids can be achieved in a single reaction through a process achievable in any molecular biology laboratory. This approach opens up for a multitude of in vivo assessments from the evaluation of enhancer and promoter regions to the optimization of genome editing. The generated plasmid libraries are also useful for validation of sequencing clustering algorithms and we here validate the newly presented message passing clustering process named Starcode. PMID:27874090
Wang, Yarong; Du, Dewei; Li, Zhanting; Wei, Junxia; Yang, Angang
2012-01-01
Relative deficiency in production of glycoprotein hormone erythropoietin (Epo) is a major cause of renal anemia. This study planned to investigate whether the hypoxia-regulated system of Epo expression, constructed by fusing Epo gene to the chimeric phosphoglycerate kinase (PGK) hypoxia response elements (HRE) in combination with cytomegalovirus immediate-early (CMV IE) basal gene promoter and delivered by plasmid intramuscular injection, might provide a long-term physiologically regulated Epo secretion expression to correct the anemia in adenine-induced uremic rats. Plasmid vectors (pHRE-Epo) were synthesized by fusing human Epo cDNA to the HRE/CMV promoter. Hypoxia-inducible activity of this promoter was evaluated first in vitro and then in vivo in healthy and uremic rats (n = 30 per group). The vectors (pCMV-Epo) in which Epo expression was directed by a constitutive CMV gene promoter served as control. ANOVA and Student's t-test were used to analyze between-group differences. A high-level expression of Epo was induced by hypoxia in vitro and in vivo. Though both pHRE-Epo and pCMV-Epo corrected anemia, the hematocrit of the pCMV-Epo-treated rats exceeded the normal (P < 0.05), but that of the pHRE-Epo-treated rats didn't. Hypoxia-regulated system of Epo gene expression constructed by fusing Epo to the HRE/CMV promoter and delivered by plasmid intramuscular injection may provide a long-term and stable Epo expression and secretion in vivo to correct the anemia in adenine-induced uremic rats. PMID:22990115
Desomer, Jan; Dhaese, Patrick; Montagu, Marc Van
1990-01-01
The analysis of the virulence determinants of phytopathogenic Rhodococcus fascians has been hampered by the lack of a system for introducing exogenous DNA. We investigated the possibility of genetic transformation of R. fascians by high-voltage electroporation of intact bacterial cells in the presence of plasmid DNA. Electrotransformation in R. fascians D188 resulted in transformation frequencies ranging from 105/μg of DNA to 107/μg of DNA, depending on the DNA concentration. The effects of different electrical parameters and composition of electroporation medium on transformation efficiency are presented. By this transformation method, a cloning vector (pRF28) for R. fascians based on an indigenous 160-kilobase (chloramphenicol and cadmium resistance-encoding) plasmid pRF2 from strain NCPPB 1675 was developed. The origin of replication and the chloramphenicol resistance gene on pRF28 were used to construct cloning vectors that are capable of replication in R. fascians and Escherichia coli. The electroporation method presented was efficient enough to allow detection of the rare integration of replication-deficient pRF28 derivatives in the R. fascians D188 genome via either homologous or illegitimate recombination. Images PMID:16348290
Mobilome and genetic modification of bifidobacteria.
Guglielmetti, S; Mayo, B; Álvarez-Martín, P
2013-06-01
Until recently, proper development of molecular studies in Bifidobacterium species has been hampered by growth difficulties, because of their exigent nutritive requirements, oxygen sensitivity and lack of efficient genetic tools. These studies, however, are critical to uncover the cross-talk between bifidobacteria and their hosts' cells and to prove unequivocally the supposed beneficial effects provided through the endogenous bifidobacterial populations or after ingestion as probiotics. The genome sequencing projects of different bifidobacterial strains have provided a wealth of genetic data that will be of much help in deciphering the molecular basis of the physiological properties of bifidobacteria. To this end, the purposeful development of stable cloning and expression vectors based on robust replicons - either from temperate phages or resident plasmids - is still needed. This review addresses the current knowledge on the mobile genetic elements of bifidobacteria (prophages, plasmids and transposons) and summarises the different types of vectors already available, together with the transformation procedures for introducing DNA into the cells. It also covers recent molecular studies performed with such vectors and incipient results on the genetic modification of these organisms, establishing the basis that would allow the use of bifidobacteria for future biotechnological applications.
Invariant correlation to position and rotation using a binary mask applied to binary and gray images
NASA Astrophysics Data System (ADS)
Álvarez-Borrego, Josué; Solorza, Selene; Bueno-Ibarra, Mario A.
2013-05-01
In this paper more alternative ways to generate the binary ring masks are studied and a new methodology is presented when in the analysis the image come with some distortion due to rotation. This new algorithm requires low computational cost. Signature vectors of the target so like signature vectors of the object to be recognized in the problem image are obtained using a binary ring mask constructed in accordance with the real or the imaginary part of their Fourier transform analyzing two different conditions in each one. In this manner, each image target or problem image, will have four unique binary ring masks. The four ways are analyzed and the best is chosen. In addition, due to any image with rotation include some distortion, the best transect is chosen in the Fourier plane in order to obtain the best signature through the different ways to obtain the binary mask. This methodology is applied to two cases: to identify different types of alphabetic letters in Arial font and to identify different fossil diatoms images. Considering the great similarity between diatom images the results obtained are excellent.
Hasnain, S; Thomas, C M
1986-07-01
Low copy number vector plasmid pCT571 was constructed to clone Bacillus subtilis genomic fragments in Escherichia coli. pCT571 confers KmR, TcR and CmR in E. coli and CmR in B. subtilis. It has unique restriction sites within the KmR and TcR markers to allow screening for recombinant plasmids by insertional inactivation of these genes. It contains the pSC101 replicon and replicates normally at six to eight copies per chromosome equivalent in E. coli. It also contains oriVRK2, which when supplied with the product of the trfA gene of RK2 in trans, allows pCT571 to replicate at 35-40 copies per chromosome equivalent. A B. subtilis gene bank was created by cloning partially Sau3A-digested and size-fractionated fragments of B. subtilis chromosomal DNA into the BamHI site of pCT571. DNA from 1097 KmR TcS transformants was extracted and analysed electrophoretically as supercoiled DNA and after digesting with EcoRI or EcoRI and SalI. Approximately 1000 hybrid plasmids were found with reasonably sized B. subtilis fragments. The mean size of the inserts in pCT571 is 8 kb, ranging from 4 to 20 kb in different plasmids. The gene bank covers most of the B. subtilis chromosome, as demonstrated by the results of screening the gene bank for selectable nutritional markers in E. coli and B. subtilis. Hybrid plasmids which complement E. coli mutants for arg, his, lys, met, pdx, pyr and thr markers were identified from the gene bank. In B. subtilis the presence of argC, cysA, dal, hisA, ilvA, leuA, lys, metB, metC, phe, purA, purB, thr and trpC was established by transformation experiments. The effects of copy number on cloning and long-term maintenance in the bacterial strains were also investigated. At high copy number some hybrid plasmids cannot be maintained at all, while others show an increased rate of structural deletions and rearrangements.
Fernandes, Alinda R; Chari, Divya M
2016-09-28
Genetically engineered neural stem cell (NSC) transplant populations offer key benefits in regenerative neurology, for release of therapeutic biomolecules in ex vivo gene therapy. NSCs are 'hard-to-transfect' but amenable to 'magnetofection'. Despite the high clinical potential of this approach, the low and transient transfection associated with the large size of therapeutic DNA constructs is a critical barrier to translation. We demonstrate for the first time that DNA minicircles (small DNA vectors encoding essential gene expression components but devoid of a bacterial backbone, thereby reducing construct size versus conventional plasmids) deployed with magnetofection achieve the highest, safe non-viral DNA transfection levels (up to 54%) reported so far for primary NSCs. Minicircle-functionalized magnetic nanoparticle (MNP)-mediated gene delivery also resulted in sustained gene expression for up to four weeks. All daughter cell types of engineered NSCs (neurons, astrocytes and oligodendrocytes) were transfected (in contrast to conventional plasmids which usually yield transfected astrocytes only), offering advantages for targeted cell engineering. In addition to enhancing MNP functionality as gene delivery vectors, minicircle technology provides key benefits from safety/scale up perspectives. Therefore, we consider the proof-of-concept of fusion of technologies used here offers high potential as a clinically translatable genetic modification strategy for cell therapy. Copyright © 2016 Elsevier B.V. All rights reserved.
Li, Junjie; Chen, Qixian; Zha, Zengshi; Li, Hui; Toh, Kazuko; Dirisala, Anjaneyulu; Matsumoto, Yu; Osada, Kensuke; Kataoka, Kazunori; Ge, Zhishen
2015-07-10
Simultaneous achievement of prolonged retention in blood circulation and efficient gene transfection activity in target tissues has always been a major challenge hindering in vivo applications of nonviral gene vectors via systemic administration. Herein, we constructed novel rod-shaped ternary polyplex micelles (TPMs) via complexation between the mixed block copolymers of poly(ethylene glycol)-b-poly{N'-[N-(2-aminoethyl)-2-aminoethyl]aspartamide} (PEG-b-PAsp(DET)) and poly(N-isopropylacrylamide)-b-PAsp(DET) (PNIPAM-b-PAsp(DET)) and plasmid DNA (pDNA) at room temperature, exhibiting distinct temperature-responsive formation of a hydrophobic intermediate layer between PEG shells and pDNA cores through facile temperature increase from room temperature to body temperature (~37 °C). As compared with binary polyplex micelles of PEG-b-PAsp(DET) (BPMs), TPMs were confirmed to condense pDNA into a more compact structure, which achieved enhanced tolerability to nuclease digestion and strong counter polyanion exchange. In vitro gene transfection results demonstrated TPMs exhibiting enhanced gene transfection efficiency due to efficient cellular uptake and endosomal escape. Moreover, in vivo performance evaluation after intravenous injection confirmed that TPMs achieved significantly prolonged blood circulation, high tumor accumulation, and promoted gene expression in tumor tissue. Moreover, TPMs loading therapeutic pDNA encoding an anti-angiogenic protein remarkably suppressed tumor growth following intravenous injection into H22 tumor-bearing mice. These results suggest TPMs with PEG shells and facilely engineered intermediate barrier to inner complexed pDNA have great potentials as systemic nonviral gene vectors for cancer gene therapy. Copyright © 2015 Elsevier B.V. All rights reserved.
Associative memory - An optimum binary neuron representation
NASA Technical Reports Server (NTRS)
Awwal, A. A.; Karim, M. A.; Liu, H. K.
1989-01-01
Convergence mechanism of vectors in the Hopfield's neural network is studied in terms of both weights (i.e., inner products) and Hamming distance. It is shown that Hamming distance should not always be used in determining the convergence of vectors. Instead, weights (which in turn depend on the neuron representation) are found to play a more dominant role in the convergence mechanism. Consequently, a new binary neuron representation for associative memory is proposed. With the new neuron representation, the associative memory responds unambiguously to the partial input in retrieving the stored information.
The abundant extrachromosomal DNA content of the Spiroplasma citri GII3-3X genome
Saillard, Colette; Carle, Patricia; Duret-Nurbel, Sybille; Henri, Raphaël; Killiny, Nabil; Carrère, Sébastien; Gouzy, Jérome; Bové, Joseph-Marie; Renaudin, Joël; Foissac, Xavier
2008-01-01
Background Spiroplama citri, the causal agent of citrus stubborn disease, is a bacterium of the class Mollicutes and is transmitted by phloem-feeding leafhopper vectors. In order to characterize candidate genes potentially involved in spiroplasma transmission and pathogenicity, the genome of S. citri strain GII3-3X is currently being deciphered. Results Assembling 20,000 sequencing reads generated seven circular contigs, none of which fit the 1.8 Mb chromosome map or carried chromosomal markers. These contigs correspond to seven plasmids: pSci1 to pSci6, with sizes ranging from 12.9 to 35.3 kbp and pSciA of 7.8 kbp. Plasmids pSci were detected as multiple copies in strain GII3-3X. Plasmid copy numbers of pSci1-6, as deduced from sequencing coverage, were estimated at 10 to 14 copies per spiroplasma cell, representing 1.6 Mb of extrachromosomal DNA. Genes encoding proteins of the TrsE-TraE, Mob, TraD-TraG, and Soj-ParA protein families were predicted in most of the pSci sequences, in addition to members of 14 protein families of unknown function. Plasmid pSci6 encodes protein P32, a marker of insect transmissibility. Plasmids pSci1-5 code for eight different S. citri adhesion-related proteins (ScARPs) that are homologous to the previously described protein P89 and the S. kunkelii SkARP1. Conserved signal peptides and C-terminal transmembrane alpha helices were predicted in all ScARPs. The predicted surface-exposed N-terminal region possesses the following elements: (i) 6 to 8 repeats of 39 to 42 amino acids each (sarpin repeats), (ii) a central conserved region of 330 amino acids followed by (iii) a more variable domain of about 110 amino acids. The C-terminus, predicted to be cytoplasmic, consists of a 27 amino acid stretch enriched in arginine and lysine (KR) and an optional 23 amino acid stretch enriched in lysine, aspartate and glutamate (KDE). Plasmids pSci mainly present a linear increase of cumulative GC skew except in regions presenting conserved hairpin structures. Conclusion The genome of S. citri GII3-3X is characterized by abundant extrachromosomal elements. The pSci plasmids could not only be vertically inherited but also horizontally transmitted, as they encode proteins usually involved in DNA element partitioning and cell to cell DNA transfer. Because plasmids pSci1-5 encode surface proteins of the ScARP family and pSci6 was recently shown to confer insect transmissibility, diversity and abundance of S. citri plasmids may essentially aid the rapid adaptation of S. citri to more efficient transmission by different insect vectors and to various plant hosts. PMID:18442384
2015-12-01
Hepatocellular Carcinoma; Hepatoma; Liver Cancer, Adult; Liver Cell Carcinoma; Liver Cell Carcinoma, Adult; Cancer of Liver; Cancer of the Liver; Cancer, Hepatocellular; Hepatic Cancer; Hepatic Neoplasms; Hepatocellular Cancer; Liver Cancer; Neoplasms, Hepatic; Neoplasms, Liver
Feeney, Mistianne; Punja, Zamir K
2015-01-01
Hemp (Cannabis sativa L.) suspension culture cells were transformed with Agrobacterium tumefaciens strain EHA101 carrying the binary plasmid pNOV3635. The plasmid contains a phosphomannose isomerase (PMI) selectable marker gene. Cells transformed with PMI are capable of metabolizing the selective agent mannose, whereas cells not expressing the gene are incapable of using the carbon source and will stop growing. Callus masses proliferating on selection medium were screened for PMI expression using a chlorophenol red assay. Genomic DNA was extracted from putatively transformed callus lines, and the presence of the PMI gene was confirmed using PCR and Southern hybridization. Using this method, an average transformation frequency of 31.23% ± 0.14 was obtained for all transformation experiments, with a range of 15.1-55.3%.
Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M
2003-05-01
Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.
Bacalocostantis, Irene; Mane, Viraj P; Kang, Michael S; Goodley, Addison S; Muro, Silvia; Kofinas, Peter
2012-05-14
Polymers have attracted much attention as potential gene delivery vectors due to their chemical and structural versatility. However, several challenges associated with polymeric carriers, including low transfection efficiencies, insufficient cargo release, and high cytotoxicity levels have prevented clinical implementation. Strong electrostatic interactions between polymeric carriers and DNA cargo can prohibit complete cargo release within the cell. As a result, cargo DNA never reaches the cell's nucleus where gene expression takes place. In addition, highly charged cationic polymers have been correlated with high cytotoxicity levels, making them unsuitable carriers in vivo. Using poly(allylamine) (PAA) as a model, we investigated how pH-sensitive disulfide cross-linked polymer networks can improve the delivery potential of cationic polymer carriers. To accomplish this, we conjugated thiol-terminated pendant chains onto the primary amines of PAA using 2-iminothiolane, developing three new polymer vectors with 5, 13, or 20% thiol modification. Unmodified PAA and thiol-conjugated polymers were tested for their ability to bind and release plasmid DNA, their capacity to protect genetic cargo from enzymatic degradation, and their potential for endolysosomal escape. Our results demonstrate that polymer-plasmid complexes (polyplexes) formed by the 13% thiolated polymer demonstrate the greatest delivery potential. At high N/P ratios, all thiolated polymers (but not unmodified counterparts) were able to resist decomplexation in the presence of heparin, a negatively charged polysaccharide used to mimic in vivo polyplex-protein interactions. Further, all thiolated polymers exhibited higher buffering capacities than unmodified PAA and, therefore, have a greater potential for endolysosomal escape. However, 5 and 20% thiolated polymers exhibited poor DNA binding-release kinetics, making them unsuitable carriers for gene delivery. The 13% thiolated polymers, on the other hand, displayed high DNA binding efficiency and pH-sensitive release.
NASA Astrophysics Data System (ADS)
Saraf, Anita
The development of novel strategies for tissue engineering entails the evolution of biopolymers into multifunctional constructs that can support the proliferation of cells and stimulate their differentiation into functional tissues. With that in mind, biocompatible polymers were fabricated into a novel gene delivery agent as well as three dimensional scaffolds that act as reservoirs and controlled release constructs. To fabricate a novel gene delivery agent a commercially available cationic polymer, poly(ethylenimine), PEI, was chemically conjugated to a ubiquitous glycosaminoglycan, hyaluronic acid (HA). The novel polymer, PEI-HA, had significantly reduced toxicity and improved transfection efficiency with multipotent human mesenchymal stem cells. This transfection efficiency could further be modulated by changing the concentration of sodium chloride and temperature used to assemble PEI-HA/DNA complexes. To facilitate the regulated delivery of these complexes in the context of tissue engineering, an emerging technology for scaffold fabrication, coaxial electrospinning was adapted to include PEI-HA and plasmid DNA within the scaffold fibers. Initially, a factorial design was employed to assess the influence of processing parameters in the absence of gene delivery vectors and plasmids. The study elucidated the role of sheath polymer concentration and core polymer concentration and molecular weight and the presence of sodium chloride on fiber diameters and morphologies. Subsequently, PEI-HA and plasmid DNA were entrapped within the sheath and core compartments of these fibers and the influence of processing parameters was assessed in the context of fiber diameter, release kinetics and transfection efficiency over a period of 60 days. The release of PEI-HA was found to be dependent upon the loading dose of the vector and plasmid. However, the transfection efficiency correlated to the core polymer properties, concentration and molecular weight. The processing parameters could modulate cell transfection for up to 21 days and continue to transfect cells for up to 60 days. Thus, scaffolds with tunable release kinetics and transfection efficiencies can be fabricated using coaxial electrospinning, which can further be used for tissue engineering and gene delivery applications.
Plasimids containing the gene for DNA polymerase I from Streptococcus pneumoniae
Lacks, Sanford A.; Martinez, Susana; Lopez, Paloma; Espinosa, Manuel
1991-01-01
A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme.
Template protection and its implementation in 3D face recognition systems
NASA Astrophysics Data System (ADS)
Zhou, Xuebing
2007-04-01
As biometric recognition systems are widely applied in various application areas, security and privacy risks have recently attracted the attention of the biometric community. Template protection techniques prevent stored reference data from revealing private biometric information and enhance the security of biometrics systems against attacks such as identity theft and cross matching. This paper concentrates on a template protection algorithm that merges methods from cryptography, error correction coding and biometrics. The key component of the algorithm is to convert biometric templates into binary vectors. It is shown that the binary vectors should be robust, uniformly distributed, statistically independent and collision-free so that authentication performance can be optimized and information leakage can be avoided. Depending on statistical character of the biometric template, different approaches for transforming biometric templates into compact binary vectors are presented. The proposed methods are integrated into a 3D face recognition system and tested on the 3D facial images of the FRGC database. It is shown that the resulting binary vectors provide an authentication performance that is similar to the original 3D face templates. A high security level is achieved with reasonable false acceptance and false rejection rates of the system, based on an efficient statistical analysis. The algorithm estimates the statistical character of biometric templates from a number of biometric samples in the enrollment database. For the FRGC 3D face database, the small distinction of robustness and discriminative power between the classification results under the assumption of uniquely distributed templates and the ones under the assumption of Gaussian distributed templates is shown in our tests.
Vector Development for the Expression of Foreign Proteins in the Vaccine Strain Brucella abortus S19
Comerci, Diego J.; Pollevick, Guido D.; Vigliocco, Ana M.; Frasch, Alberto C. C.; Ugalde, Rodolfo A.
1998-01-01
A vector for the expression of foreign antigens in the vaccine strain Brucella abortus S19 was developed by using a DNA fragment containing the regulatory sequences and the signal peptide of the Brucella bcsp31 gene. This fragment was cloned in broad-host-range plasmid pBBR4MCS, resulting in plasmid pBEV. As a reporter protein, a repetitive antigen of Trypanosoma cruzi was used. The recombinant fusion protein is stably expressed and secreted into the Brucella periplasmic space, inducing a good antibody response against the T. cruzi antigen. The expression of the repetitive antigen in Brucella neither altered its growth pattern nor generated a toxic or lethal effect during experimental infection. The application of this strategy for the generation of live recombinant vaccines and the tagging of B. abortus S19 vaccine is discussed. This is the first time that a recombinant protein has been expressed in the periplasm of brucellae. PMID:9673273
Dong, Bo; Feng, Jing; Lin, Hai; Li, Lanxiang; Su, Dingding; Tu, Di; Zhu, Weijuan; Yang, Qing; Ren, Xiaofeng
2013-11-19
Porcine circovirus type 2 (PCV2) is associated with many kinds of diseases including postweaning multisystemic wasting syndrome (PMWS). It affects the immune system of swine and causes huge epidemic losses every year. In our previous study, we provided evidence that DNA plasmid bearing porcine IL-15 (pVAX-pIL-15) might serve as an immune enhancer for DNA plasmid encoding porcine reproductive and respiratory syndrome virus GP5 gene. In this study, PCV2 open reading frame (ORF)2 gene was cloned into the eukaryotic expression vector pVAX, resulting in the plasmid pVAX-PCV2-ORF2. Transient expression of the plasmid in BHK-21 cells could be detected using immunofluorescence assay. Experimental mice were divided into 5 groups and immunized with PBS, pVAX, pVAX-pIL-15, pVAX-PCV2-ORF2 or pVAX-pIL-15 plus pVAX-PCV2-ORF2. The results showed that the mice co-inoculated with pVAX-PCV2-ORF2 plus pVAX-pIL-15 had higher humoral and cellular immune responses than the others. In addition, DNA plasmid bearing PCV2 ORF2 gene had a protective effect against challenge with PCV2 in mice which could be promoted with the utilization of pIL-15. Copyright © 2013 Elsevier Ltd. All rights reserved.
Scarless genome editing and stable inducible expression vectors for Geobacter sulfurreducens
Chan, Chi Ho; Levar, Caleb E.; Zacharoff, Lori; ...
2015-08-07
Metal reduction by members of the Geobacteraceae is encoded by multiple gene clusters, and the study of extracellular electron transfer often requires biofilm development on surfaces. Genetic tools that utilize polar antibiotic cassette insertions limit mutant construction and complementation. In addition, unstable plasmids create metabolic burdens that slow growth, and the presence of antibiotics such as kanamycin can interfere with the rate and extent of Geobacter biofilm growth. We report here genetic system improvements for the model anaerobic metal-reducing bacterium Geobacter sulfurreducens. A motile strain of G. sulfurreducens was constructed by precise removal of a transposon interrupting the fgrM flagellarmore » regulator gene using SacB/sucrose counterselection, and Fe(III) citrate reduction was eliminated by deletion of the gene encoding the inner membrane cytochrome imcH. We also show that RK2-based plasmids were maintained in G. sulfurreducens for over 15 generations in the absence of antibiotic selection in contrast to unstable pBBR1 plasmids. Therefore, we engineered a series of new RK2 vectors containing native constitutive Geobacter promoters, and modified one of these promoters for VanR-dependent induction by the small aromatic carboxylic acid vanillate. Inducible plasmids fully complemented Δ imcH mutants for Fe(III) reduction, Mn(IV) oxide reduction, and growth on poised electrodes. A real-time, high-throughput Fe(III) citrate reduction assay is described that can screen numerous G. sulfurreducens strain constructs simultaneously and shows the sensitivity of imcH expression by the vanillate system. Lastly, these tools will enable more sophisticated genetic studies in G. sulfurreducens without polar insertion effects or need for multiple antibiotics.« less
Wang, Jin Yuan; Carrasco, Jose A.; Lloyd, Scott A.; Mellado-Sanchez, Gabriela; Diaz-McNair, Jovita; Franco, Olga; Buskirk, Amanda D.; Nataro, James P.; Pasetti, Marcela F.
2014-01-01
Live attenuated bacteria hold great promise as multivalent mucosal vaccines against a variety of pathogens. A major challenge of this approach has been the successful delivery of sufficient amounts of vaccine antigens to adequately prime the immune system without overattenuating the live vaccine. Here we used a live attenuated Salmonella enterica serovar Typhi strain to create a bivalent mucosal plague vaccine that produces both the protective F1 capsular antigen of Yersinia pestis and the LcrV protein required for secretion of virulence effector proteins. To reduce the metabolic burden associated with the coexpression of F1 and LcrV within the live vector, we balanced expression of both antigens by combining plasmid-based expression of F1 with chromosomal expression of LcrV from three independent loci. The immunogenicity and protective efficacy of this novel vaccine were assessed in mice by using a heterologous prime-boost immunization strategy and compared to those of a conventional strain in which F1 and LcrV were expressed from a single low-copy-number plasmid. The serum antibody responses to lipopolysaccharide (LPS) induced by the optimized bivalent vaccine were indistinguishable from those elicited by the parent strain, suggesting an adequate immunogenic capacity maintained through preservation of bacterial fitness; in contrast, LPS titers were 10-fold lower in mice immunized with the conventional vaccine strain. Importantly, mice receiving the optimized bivalent vaccine were fully protected against lethal pulmonary challenge. These results demonstrate the feasibility of distributing foreign antigen expression across both chromosomal and plasmid locations within a single vaccine organism for induction of protective immunity. PMID:25332120
Moulton, P J; Vivian, A; Hunter, P J; Taylor, J D
1993-12-01
Transfer of RP4 and related replicons belonging to the Escherichia coli incompatibility group P (Pseudomonas aeruginosa IncP1) to races 2 and 6 of P. syringae pv. pisi was associated with the creation of two types of transconjugant, one resembling the parental race and the other showing an altered cultivar-specificity towards pea. The latter, irrespective of the parental race, exhibited a novel pattern of interaction with pea that corresponded to race 4; consequently such transconjugants were termed race 4-like. Curing of RP4 did not affect the phenotype, except in relation to the antibiotic resistances specified by RP4. The race 4-like strains were non-fluorescent when cultured on appropriate media (in contrast to the particular isolates of races 2 and 6 from which they were derived), showed an enhanced ability to inherit RP4 subsequently (at frequencies up to 10(-1) per recipient) and differed from their parental race in their pattern of plasmid profile. The plasmid profiles were similar for all race 4-like strains irrespective of origin. There was no evidence that RP4 had recombined with DNA in the recipient and probing failed to detect the retention of any part of RP4 in cured strains. The inheritance of the related cosmid vector, pLAFR3, had similar effects in races 2 and 6. This observation is important since this vector has been widely used to clone avirulence genes in plant pathogenic bacteria. Transfer of the IncW plasmids S-a and R388 did not cause any changes in the fluorescence or cultivar-specificity of races 2 or 6.(ABSTRACT TRUNCATED AT 250 WORDS)
Xue, Qing-Jie; Dai, Jun; Li, Xiu-Zhen; Zhu, Wei; Si, Chuan-Ping; Chen, Ting
2014-10-01
The signal peptide Ag85B of Bacillus Chalmette-Guerin (BCG) was used to construct a recombinant plasmid of BCG. The BCG-Ag85B gene and fused EBV LMP2A and BZLF1 genes were amplified and successively inserted into the Escherichia coli-BCG shuttle-vector pMV261. The recombinant plasmids were then amplified in E. coli DH5α and transformed into competent BCG. The expression of BZLF1 and LMP2A fusion proteins in recombinant-BCG (rBCG) was shown by Western blot. After the injection of recombinant-BCG into mice, antibodies against the fusion protein BZLF1 and LMP2A were measured by ELISA, and the cellular immune effects were determined by the lactate dehydrogenate (LDH) release assays. The results confirmed that the cloned genes of BCG-Ag85B and Z2A were correctly inserted into the vector pMV261. The recombinant plasmid pMVZ2A expressed Z2A in BCG effectively after transformation. The rBCG proteins were recognized by the BZLF1 (LMP2A) antibody. An ELISA demonstrated that rBCG could stimulate the generation of antibody against the fusion protein. The fusion gene was constructed successfully, and the rBCG induced humoral and cellular immune response in mice. © 2014 Wiley Periodicals, Inc.
Ah-Fong, Audrey M V; Judelson, Howard S
2011-09-01
Fluorescent tagging has become the strategy of choice for examining the subcellular localisation of proteins. To develop a versatile community resource for this method in oomycetes, plasmids were constructed that allow the expression of either of four spectrally distinct proteins [cyan fluorescent protein (CFP), green fluorescent protein (GFP), yellow fluorescent protein (YFP), and mCherry], alone or fused at their N- or C-termini, to sequences of interest. Equivalent sets of plasmids were made using neomycin or hygromycin phosphotransferases (nptII, hpt) as selectable markers, to facilitate double-labelling and aid work in diverse species. The fluorescent proteins and drug-resistance markers were fused to transcriptional regulatory sequences from the oomycete Bremia lactucae, which are known to function in diverse oomycetes, although the promoter in the fluorescence cassette (ham34) can be replaced easily by a promoter of interest. The function of each plasmid was confirmed in Phytophthora infestans. Moreover, fusion proteins were generated using targeting sequences for the endoplasmic reticulum, Golgi, mitochondria, nuclei, and peroxisomes. Studies of the distribution of the fusions in mycelia and sporangia provided insight into cellular organisation at different stages of development. This toolbox of vectors should advance studies of gene function and cell biology in Phytophthora and other oomycetes. Copyright © 2011 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Du, Lei; Liu, Rui-Hua; Ying, Li; Zhao, Guang-Rong
2012-01-01
Streptomyces lincolnensis is a producer of lincomycin, which is a lincosamide antibiotic for the treatment of infective diseases caused by Gram-positive bacteria. S. lincolnensis is refractory to introducing plasmid DNA into cells because of resistance of foreign DNAs and poor sporulation. In this study, a simple and efficient method of transferring plasmids into S. lincolnensis through the intergeneric Escherichia coli-mycelia conjugation was established and optimized for the first time. The recipient mycelia of S. lincolnensis were prepared in liquid SM medium containing 10.3% sucrose for three days. The dispersed mycelia were conjugated with competent E. coli donor cells. The exconjugants were regenerated efficiently on solid mannitol soya flour (MS) medium containing 20 mM MgCl2. The average conjugation frequency was observed at 1.1 × 10−4 per input donor cell and validated functionally by transferring two types of vectors containing lincomycin resistance genes lmrA, lmrB and lmrC into S. lincolnensis mycelia. The data of fermentation in shaking flasks showed the lincomycin yield of the exconjugants increased by 52.9% for the multiple copy vector and 38.3% for the integrative one, compared with the parental strain. The efficient and convenient method of intergeneric E. coli-mycelia conjugation in this study provides a promising procedure to introduce plasmid DNA into other refractory streptomycetes. PMID:22606009
Construction of KHV-CJ ORF25 DNA vaccine and immune challenge test.
Zhou, J-X; Wang, H; Li, X-W; Zhu, X; Lu, W-L; Zhang, D-M
2014-04-01
KHV ORF25 fragments were cloned from Koi Herpes Virus-CJ (KHV-CJ) strains isolated in our laboratory. The amplified products were inserted into the eukaryotic expression vector pIRES-neo, forming recombinant plasmid pIRES-ORF25. The recombinant plasmid pIRES-ORF25 at 1 μg per koi, 10 μg per koi and 50 μg per koi was intramuscularly injected into healthy kois, respectively. The results showed that the recombinant pIRES-ORF25 could induce the production of specific antibodies in koi determined by indirect ELISA. The differences of immune effect between three doses were not significant (P > 0.05), but all of them could induce the production of neutralizing antibodies. The immune challenge test showed that the mortality of koi injected with PBS, blank pIRES-neo vector and nothing was 90%, 92.5% and 85% at 25 days. While the mortalities of koi injected with eukaryotic expression plasmid pIRES-ORF25 were 20%, 17.5% and 12.5%. Differences in comparison with the control group were highly significant (P < 0.01). Histopathological staining revealed that the tissues of the immunized koi did not change apparently. In conclusion, the DNA vaccine pIRES-ORF25 construct could well protect koi against KHV and had the potential to be applied in practice. © 2013 John Wiley & Sons Ltd.
[Prokaryotic expression and histological localization of the Taenia solium CDC37 gene].
Huang, Jiang; Li, Bo; Dai, Jia-Lin; Zhang, Ai-Hua
2013-02-01
To express Taenia solium gene encoding cell division cycle 37 protein (TsCDC37) and investigate its antigenicity and localization in adults of Taenia solium. The complete coding sequence of TsCDC37 was amplified by PCR based on the recombinant plasmid clone from the cDNA library of adult Taenia solium. The PCR product was cloned into a prokaryotic expression vector pET-28a (+). The recombinant expression plasmid was identified by PCR, double endonuclease digestion and sequencing. The recombinant plasmid was transformed into E. coli BL21/DE3 and followed by expression of the protein induced by IPTG. The mice were immunized subcutaneously with purified recombinant TsCDC37 formulated in Freund's adjuvant. The antigenicity of the recombinant protein was examined by Western blotting. The localization of TsCDC37 in adult worms was demonstrated by immunofluorescent technique. The recombinant expression vector was constructed successfully. The recombinant protein was about M(r) 52 000, it was then purified and specifically recognized by immuno sera of SD rats and sera from patients infected with Taenia solium, Taenia saginata or Taenia asiatica. The immunofluorescence assay revealed that TsCDC37 located at the tegument of T. solium adult and the eggs. TsCDC37 gene has been expressed with immunoreactivity. The recombinant protein is mainly expressed in tegument and egg, and is a common antigen of the three human taenia cestodes.
[Construction and expression of recombinant human serum albumin-EPO fusion protein].
Huang, Ying-Chun; Gou, Xing-Hua; Han, Lei; Li, De-Hua; Zhao, Lan-Ying; Wu, Qia-Qing
2011-05-01
OBJECTIVE To construct the recombinant plasmid pCI-HLE encoding human serum album-EPO (HSA-EPO) fusion protein and to express it in CHO cell. The cDNA encoding human serum album and EPO were amplified by PCR, and then spliced with the synsitic DNA fragment encoding GS (GGGGS), by overlap PCR extension to form LEPO. After BamH I digestion, the HSA and LEPO was ligated to generate the fusion HSA-EPO gene and was then cloned into the expression vector pCI-neo to generate the recombinant plasmid pCI-HLE. The plasmid pCI-HLE was transfected into CHO cell by liposome protocol. Then, the recombinant cells were screened by G418 and identified by PCR and Western blot. Expression of fusion protein was evaluated by Enzyme Linked Immunosorbent Assay (ELISA). Restrictive enzymes digestion and DNA sequencing revealed that HSA-EPO fusion gene was cloned into expression vector pCI-neo successfully. PCR and Western blot analysis confirmed that the fusion gene was integrated in the genome of CHO cells and expressed successfully. The HSA-EPO production varied from 86 Iu/(mL x 10(6) x 72 h) to 637 IU/(mLx 10(6) x 72 h). The results confirmed that HSA-EPO fusion gene can be expressed in the CHO cells, with EPO immunogenicity, which could serve as foundation for the development of long-lasting recombinant HSA-EPO protein.
Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng
2008-01-01
To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Hai-Li; Zhang, Ming-Zhen; Li, Xiang-Yong
2012-11-15
Highlights: ► An easy and direct way to prepare QDs–DNA complexes was developed. ► Surface charge of QDs was tuned with different ratio of amino and glycolate. ► Transfection efficiency was dependent on the surface zeta potentials of QDs. ► Cellular toxicity of this gene vectors is much lower than commercial liposome. ► Whole intracellular behavior of QDs–DNA complexes can be monitored in real time. -- Abstract: Nanoparticle carrier has been developed by combining water-soluble quantum dots and plasmid DNA expressed enhanced green fluorescent protein (EGFP) in a convenient and direct way. First the QDs with different surface charges weremore » obtained by coating with amino and carboxyl terminals at different ratios. Then plasmid DNA was conjugated to QDs via electrostatic interaction. The resultant QDs–DNA complexes showed enhanced resistance to DNase I digestion. The following transfection experiments demonstrated that the transfection efficiency was dependent on the surface charges on QDs. The real time imaging of the transfection process showed that the nanoparticles experienced binding, penetrating the cell membrane and entering cytoplasm in the first 6 h of transfection. The green fluorescence of EGFP began to appear after 18 h transfection and plasmid DNA was fully expressed in the following 6 h. This new QDs–DNA platform showed great potential as new gene delivery carrier.« less
Chenevert, J M; Naumovski, L; Schultz, R A; Friedberg, E C
1986-04-01
The denV gene of bacteriophage T4 was reconstituted from two overlapping DNA fragments cloned in M13 vectors. The coding region of the intact gene was tailored into a series of plasmid vectors containing different promoters suitable for expression of the gene in E. coli and in yeast. Induction of the TAC promoter with IPTG resulted in overexpression of the gene, which was lethal to E. coli. Expression of the TACdenV gene in the absence of IPTG, or the use of the yeast GAL1 or ADH promoters resulted in partial complementation of the UV sensitivity of uvrA, uvrB, uvrC and recA mutants of E. coli and rad1, rad2, rad3, rad4 and rad10 mutants of S. cerevisiae. The extent of denV-mediated reactivation of excision-defective mutants was approximately equal to that of photoreactivation of such strains. Excision proficient E. coli cells transformed with a plasmid containing the denV gene were slightly more resistant to ultraviolet (UV) radiation than control cells without the denV gene. On the other hand, excision proficient yeast cells were slightly more sensitive to killing by UV radiation following transformation with a plasmid containing the denV gene. This effect was more pronounced in yeast mutants of the RAD52 epistasis group.
Scaleable processes for the manufacture of therapeutic quantities of plasmid DNA.
Shamlou, Parviz Ayazi
2003-06-01
The need for scaleable processes to manufacture therapeutic plasmid DNA (pDNA) is easy to overlook when attention is focused primarily on vector design and establishment of early clinical results. pDNA is a large molecule and has properties that are similar to those of the contaminating chromosomal DNA. These, combined with the low initial concentration of plasmids in the host cell, provide unique process challenges that require significant upfront design to establish robust manufacturing processes that can also comply with current Good Manufacturing Practice ('cGMP') and produce milligram-to-kilogram quantities of pDNA product. This review describes promising scaleable processes that are currently being assessed for production of therapeutic supercoiled pDNA. Fermentation strategies for improving supercoiled plasmid yield and reducing contaminant concentrations are reviewed, and downstream processes are assessed for their ability to efficiently remove cellular contaminants, separate the supercoiled form of the pDNA from its open circular and linear forms, and prepare the purified drug substance for formulation. Current strategies are presented for developing stable delivery systems, and approaches to quality assurance and quality control are discussed.
Almeida, A M; Queiroz, J A; Sousa, F; Sousa, A
2015-01-26
The progress of DNA vaccines is dependent on the development of suitable chromatographic procedures to successfully purify genetic vectors, such as plasmid DNA. Human Papillomavirus is associated with the development of tumours due to the oncogenic power of E6 and E7 proteins, produced by this virus. The supercoiled HPV-16 E6/E7 plasmid-based vaccine was recently purified with the arginine monolith, with 100% of purity, but only 39% of recovery was achieved. Therefore, the present study describes the application of experimental design tools, a newly explored methodology in preparative chromatography, in order to improve the supercoiled plasmid DNA recovery with the arginine monolith, maintaining the high purity degree. In addition, the importance and influence of pH in the pDNA retention to the arginine ligand was also demonstrated. The Composite Central Face design was validated and the recovery of the target molecule was successfully improved from 39% to 83.5%, with an outstanding increase of more than double, while maintaining 100% of purity. Copyright © 2014 Elsevier B.V. All rights reserved.
Fukuda, Akira; Usui, Masaru; Okubo, Torahiko; Tamura, Yutaka
2016-06-01
Houseflies are a mechanical vector for various types of bacteria, including antimicrobial-resistant bacteria (ARB). If the intestine of houseflies is a suitable site for the transfer of antimicrobial resistance genes (ARGs), houseflies could also serve as a biological vector for ARB. To clarify whether cephalosporin resistance genes are transferred efficiently in the housefly intestine, we compared with conjugation experiments in vivo (in the intestine) and in vitro by using Escherichia coli with eight combinations of four donor and two recipient strains harboring plasmid-mediated cephalosporin resistance genes and chromosomal-encoded rifampicin resistance genes, respectively. In the in vivo conjugation experiment, houseflies ingested donor strains for 6 hr and then recipient strains for 3 hr, and 24 hr later, the houseflies were surface sterilized and analyzed. In vitro conjugation experiments were conducted using the broth-mating method. In 3/8 combinations, the in vitro transfer frequency (Transconjugants/Donor) was ≥1.3 × 10(-4); the in vivo transfer rates of cephalosporin resistance genes ranged from 2.0 × 10(-4) to 5.7 × 10(-5). Moreover, cephalosporin resistance genes were transferred to other species of enteric bacteria of houseflies such as Achromobacter sp. and Pseudomonas fluorescens. These results suggest that houseflies are not only a mechanical vector for ARB but also a biological vector for the occurrence of new ARB through the horizontal transfer of ARGs in their intestine.
Pastor, Marie; Johnen, Sandra; Harmening, Nina; Quiviger, Mickäel; Pailloux, Julie; Kropp, Martina; Walter, Peter; Ivics, Zoltán; Izsvák, Zsuzsanna; Thumann, Gabriele; Scherman, Daniel; Marie, Corinne
2018-06-01
The anti-angiogenic and neurogenic pigment epithelium-derived factor (PEDF) demonstrated a potency to control choroidal neovascularization in age-related macular degeneration (AMD) patients. The goal of the present study was the development of an efficient and safe technique to integrate, ex vivo, the PEDF gene into retinal pigment epithelial (RPE) cells for later transplantation to the subretinal space of AMD patients to allow continuous PEDF secretion in the vicinity of the affected macula. Because successful gene therapy approaches require efficient gene delivery and stable gene expression, we used the antibiotic-free pFAR4 mini-plasmid vector to deliver the hyperactive Sleeping Beauty transposon system, which mediates transgene integration into the genome of host cells. In an initial study, lipofection-mediated co-transfection of HeLa cells with the SB100X transposase gene and a reporter marker delivered by pFAR4 showed a 2-fold higher level of genetically modified cells than when using the pT2 vectors. Similarly, with the pFAR4 constructs, electroporation-mediated transfection of primary human RPE cells led to 2.4-fold higher secretion of recombinant PEDF protein, which was still maintained 8 months after transfection. Thus, our results show that the pFAR4 plasmid is a superior vector for the delivery and integration of transgenes into eukaryotic cells. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Girons, Isabelle Saint; Bourhy, Pascale; Ottone, Catherine; Picardeau, Mathieu; Yelton, David; Hendrix, Roger W.; Glaser, Philippe; Charon, Nyles
2000-01-01
We have discovered that LE1, one of the plaque-forming phages previously described as lytic for the Leptospira biflexa saprophytic spirochete (I. Saint Girons, D. Margarita, P. Amouriaux, and G. Baranton, Res. Microbiol. 141:1131–1138, 1990), was indeed temperate. LE1 was found to be unusual, as Southern blot analysis indicated that it is one of the few phages to replicate in the prophage state as a circular plasmid. The unavailability of such small endogenous replicons has hindered genetic experimentation in Leptospira. We have developed a shuttle vector with DNA derived from LE1. Random LE1 DNA fragments were cloned into a pGEM 7Zf(+) derivative devoid of most of the bla gene but carrying a kanamycin resistance marker from the gram-positive bacterium Enterococcus (Streptococcus) faecalis. These constructs were transformed into L. biflexa strain Patoc 1 by electroporation, giving rise to kanamycin-resistant transformants. A 2.2-kb fragment from LE1 was responsible for replication of the vector in L. biflexa. However, a larger region including an intact parA gene homologue was necessary for the stability of the shuttle vector. Direct repeats and AT-rich regions characterized the LE1 origin of replication. Our data indicate that the replicon derived from the LE1 leptophage, together with the kanamycin resistance gene, is a promising tool with which to develop the genetics of Leptospira species. PMID:11004167
Huang, Bi; Bao, Lang; Zhong, Qi; Zhang, Huidong; Zhang, Ying
2009-04-01
This study was conducted to construct eukaryotic recombinant vector of LipL32-HlyX fusion gene from Leptospira serovar Lai and express it in mammalian cell. Both of LipL32 gene and HlyX gene were amplified from Leptospira strain O17 genomic DNA by PCR. Then with the two genes as template, LipL32-HlyX fusion gene was obtained by SOE PCR (gene splicing by overlap extension PCR). The fusion gene was then cloned into pcDNA3.1 by restriction nuclease digestion. Having been transformed into E. coli DH5alpha, the recombiant plasmid was identified by restriction nuclease digestion, PCR analysis and sequencing. The recombinant plasmid was then transfected into COS7 cell whose expression was detected by RT-PCR and Western blotting analysis. RT-PCR amplified a fragment about 2000 bp and Western blotting analysis found a specific band about 75 KD which was consistent with the expected fusion protein size. In conclusion, the successful construction of eukaryotic recombinant vector containing LipL32-HlyX fusion gene and the effective expression in mammalian have laid a foundation for the application of Leptospira DNA vaccine.
Irla, Marta; Heggeset, Tonje M B; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B; Brautaset, Trygve; Wendisch, Volker F
2016-01-01
Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium.
Irla, Marta; Heggeset, Tonje M. B.; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B.; Brautaset, Trygve; Wendisch, Volker F.
2016-01-01
Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium. PMID:27713731
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.
1989-01-01
Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector /lambda/pSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB/sup +/ clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA/sup +/ transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmidsmore » consistently transduced the markers thrB/sup +/ and lysA/sup +/. The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes.« less
Li, Yi; Sun, Hong-chen; Guo, Xue-jun; Feng, Shu-zhang
2005-02-01
To clone the recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit (Ltb) and Actinobacillus actinomycetemcomitans fimbria associative protein (Fap). Two couples of primers were designed for PCR according to the known sequence of ltb and fap. The ltb and fap gene were obtained by amplification PCR technique from plasmid EWD299 of Escherichia coli and Actinobacillus actinomycetemcomitans 310 DNA respectively, and fused them by PCR. The fusion gene ltb-fap were cloning into plasmid pET28a(+). The recombined plasmid pET28a ltb-fap was transformed into Escherichia coli DH5alpha. The recombinant was screened and identified by restriction enzyme and PCR. The cloned gene was sequenced. The ltb-fap about 531bp in size was obtained successfully, and identified by PCR, restrictive enzyme and sequence analysis. The vector of pET28a ltb-fap was obtained.
Binary dislocation junction formation and strength in hexagonal close-packed crystals
Wu, Chi -Chin; Aubry, Sylvie; Arsenlis, Athanasios; ...
2015-12-17
This work examines binary dislocation interactions, junction formation and junction strengths in hexagonal close-packed ( hcp ) crystals. Through a line-tension model and dislocation dynamics (DD) simulations, the interaction and dissociation of different sets of binary junctions are investigated involving one dislocation on the (011¯0) prismatic plane and a second dislocation on one of the following planes: (0001) basal, (11¯00) prismatic, (11¯01) primary pyramidal, or (2¯112) secondary pyramidal. Varying pairs of Burgers vectors are chosen from among the common types the basal type < a > 1/3 < 112¯0 >, prismatic type < c > <0001>, and pyramidal type
Ohlfest, John R; Freese, Andrew B; Largaespada, David A
2005-12-01
Gene therapy has the potential to improve the clinical outcome of many cancers by transferring therapeutic genes into tumor cells or normal host tissue. Gene transfer into tumor cells or tumor-associated stroma is being employed to induce tumor cell death, stimulate anti-tumor immune response, inhibit angiogenesis, and control tumor cell growth. Viral vectors have been used to achieve this proof of principle in animal models and, in select cases, in human clinical trials. Nevertheless, there has been considerable interest in developing nonviral vectors for cancer gene therapy. Nonviral vectors are simpler, more amenable to large-scale manufacture, and potentially safer for clinical use. Nonviral vectors were once limited by low gene transfer efficiency and transient or steadily declining gene expression. However, recent improvements in plasmid-based vectors and delivery methods are showing promise in circumventing these obstacles. This article reviews the current status of nonviral cancer gene therapy, with an emphasis on combination strategies, long-term gene transfer using transposons and bacteriophage integrases, and future directions.
Si, Ying-jian; Guang, Li-xia; Yuan, Fa-huan; Zhang, Ke-bin
2006-08-01
To find out a possible approach to improve the effectiveness of radiotherapy and chemotherapy for Ewing's sarcoma by constructing a eukaryotic expression vector expressing herpes simplex virus-thymidine kinase (HSV-TK) regulated by hypoxia responsive element (HRE) under hypoxia and to evaluate the effects of this HRE regulated HSV-TK system on killing effect of gancyclovir (GCV) on Ewing's sarcoma cell line SK-ES under hypoxic condition. The HRE was synthesized according to the literature and cloned into the enhancer site of pIRES(2)-EGFP vector to obtain the pHRE recombinant plasmid. The HSV-TK was amplified by PCR and cloned into the multiple clone site of pIRES(2)-EGFP and pHRE to obtain pTK and pHRE-TK recombinant plasmid. The human Ewing's sarcoma cell line SK-ES was transfected by pTK or pHRE-TK recombinant plasmid with liposome and then was exposed to normoxic (21% oxygen) or hypoxic (3% oxygen) condition. The expression of enhanced green fluorescent protein (EGFP) was monitored by fluorescent microscopy. The sensitivity of human Ewing's sarcoma cell line SK-ES transfected with pTK or pHRE-TK recombinant plasmid to the anti-tumour drug GCV was determined with the method of tetrazolium (MTT) after treating with GCV for five days. (1) The result of sequencing showed that the recombinant plasmid pHRE contained HRE, and that the recombinant plasmid pTK and pHRE-TK contained HSV-TK gene in the sense direction. (2) Comparison of fluorescent optical density (FOD) showed that (1) the EGFP FOD value of pHRE and pHRE-TK group cells exposed to hypoxia was significantly higher than those exposed to normoxia (P < 0.01); (2) when the cells were exposed to hypoxia, the EGFP FOD value of pHRE and pHRE-TK group cells was significantly higher than that of pTK and empty vector group (P < 0.01); (3) there was no significant difference among the four groups of cells when they were exposed to normoxia (P > 0.05). (3) Comparison of the sensitivity of four groups of cells to GCV showed that (1) the cells in pHRE-TK and pTK groups were much more sensitive to GCV than the cells in pHRE group under hypoxia condition (P < 0.01), the higher the GCV concentration, the greater the difference; (2) the cells of pHRE-TK group were more sensitive to GCV than those in pTK group under hypoxic condition (P < 0.01), but was almost equally sensitive under normoxic condition (P > 0.05); (3) the pHRE-TK group cells had higher sensitivity to GCV under hypoxia than normoxia (P < 0.01) while the pTK group cells had almost the same sensitivity to GCV under hypoxia and normoxia (P > 0.05). (1) The eukaryotic expression vector expressing herpes simplex virus-thymidine kinase (HSV-TK) regulated by hypoxia responsive element (HRE) under hypoxia was constructed successfully. (2) HRE could up-regulate expression of EGFP by SK-ES cells under hypoxia condition. (3) HRE could enhance the killing effect of HSV-TK/GCV system on human Ewing's sarcoma cell line SK-ES under hypoxic condition.
2010-01-01
Research in plant molecular biology involves DNA purification on a daily basis. Although different commercial kits enable convenient extraction of high-quality DNA from E. coli cells, PCR and agarose gel samples as well as plant tissues, each kit is designed for a particular type of DNA extraction work, and the cost of purchasing these kits over a long run can be considerable. Furthermore, a simple method for the isolation of binary plasmid from Agrobacterium tumefaciens cells with satisfactory yield is lacking. Here we describe an easy protocol using homemade silicon dioxide matrix and seven simple solutions for DNA extraction from E. coli and A. tumefaciens cells, PCR and restriction digests, agarose gel slices, and plant tissues. Compared with the commercial kits, this protocol allows rapid DNA purification from diverse sources with comparable yield and purity at negligible cost. Following this protocol, we have demonstrated: (1) DNA fragments as small as a MYC-epitope tag coding sequence can be successfully recovered from an agarose gel slice; (2) Miniprep DNA from E. coli can be eluted with as little as 5 μl water, leading to high DNA concentrations (>1 μg/μl) for efficient biolistic bombardment of Arabidopsis seedlings, polyethylene glycol (PEG)-mediated Arabidopsis protoplast transfection and maize protoplast electroporation; (3) Binary plasmid DNA prepared from A. tumefaciens is suitable for verification by restriction analysis without the need for large scale propagation; (4) High-quality genomic DNA is readily isolated from several plant species including Arabidopsis, tobacco and maize. Thus, the silicon dioxide matrix-based DNA purification protocol offers an easy, efficient and economical way to extract DNA for various purposes in plant research. PMID:20180960
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gottlieb, J.; Muzyczka, N.
1988-06-01
When circular recombinant plasmids containing adeno-associated virus (AAV) DNA sequences are transfected into human cells, the AAV provirus is rescued. Using these circular AAV plasmids as substrates, the authors isolated an enzyme fraction from HeLa cell nuclear extracts that excises intact AAV DNA in vitro from vector DNA and produces linear DNA products. The recognition signal for the enzyme is a polypurine-polypyrimidine sequence which is at least 9 residues long and rich in G . C base pairs. Such sequences are present in AAV recombinant plasmids as part of the first 15 base pairs of the AAV terminal repeat andmore » in some cases as the result of cloning the AAV genome by G . C tailing. The isolated enzyme fraction does not have significant endonucleolytic activity on single-stranded or double-stranded DNA. Plasmid DNA that is transfected into tissue culture cells is cleaved in vivo to produce a pattern of DNA fragments similar to that seen with purified enzyme in vitro. The activity has been called endo R for rescue, and its behavior suggests that it may have a role in recombination of cellular chromosomes.« less
Dean, Frank B.; Nelson, John R.; Giesler, Theresa L.; Lasken, Roger S.
2001-01-01
We describe a simple method of using rolling circle amplification to amplify vector DNA such as M13 or plasmid DNA from single colonies or plaques. Using random primers and φ29 DNA polymerase, circular DNA templates can be amplified 10,000-fold in a few hours. This procedure removes the need for lengthy growth periods and traditional DNA isolation methods. Reaction products can be used directly for DNA sequencing after phosphatase treatment to inactivate unincorporated nucleotides. Amplified products can also be used for in vitro cloning, library construction, and other molecular biology applications. PMID:11381035
Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli
NASA Astrophysics Data System (ADS)
Küpper, Hans; Keller, Walter; Kurz, Christina; Forss, Sonja; Schaller, Heinz
1981-02-01
Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage λ PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.
Wang, Sheng; Xing, Haiying; Hua, Chenlei; Guo, Hui-Shan; Zhang, Jie
2016-06-01
The soilborne fungal pathogen Verticillium dahliae infects a broad range of plant species to cause severe diseases. The availability of Verticillium genome sequences has provided opportunities for large-scale investigations of individual gene function in Verticillium strains using Agrobacterium tumefaciens-mediated transformation (ATMT)-based gene-disruption strategies. Traditional ATMT vectors require multiple cloning steps and elaborate characterization procedures to achieve successful gene replacement; thus, these vectors are not suitable for high-throughput ATMT-based gene deletion. Several advancements have been made that either involve simplification of the steps required for gene-deletion vector construction or increase the efficiency of the technique for rapid recombinant characterization. However, an ATMT binary vector that is both simple and efficient is still lacking. Here, we generated a USER-ATMT dual-selection (DS) binary vector, which combines both the advantages of the USER single-step cloning technique and the efficiency of the herpes simplex virus thymidine kinase negative-selection marker. Highly efficient deletion of three different genes in V. dahliae using the USER-ATMT-DS vector enabled verification that this newly-generated vector not only facilitates the cloning process but also simplifies the subsequent identification of fungal homologous recombinants. The results suggest that the USER-ATMT-DS vector is applicable for efficient gene deletion and suitable for large-scale gene deletion in V. dahliae.
Human HOXA5 homeodomain enhances protein transduction and its application to vascular inflammation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Ji Young; Park, Kyoung sook; Cho, Eun Jung
2011-07-01
Highlights: {yields} We have developed an E. coli protein expression vector including human specific gene sequences for protein cellular delivery. {yields} The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence. {yields} HOXA5-APE1/Ref-1 inhibited TNF-alpha-induced monocyte adhesion to endothelial cells. {yields} Human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins. -- Abstract: Cellular protein delivery is an emerging technique by which exogenous recombinant proteins are delivered into mammalian cells across the membrane. We have developed an Escherichia coli expression vector including humanmore » specific gene sequences for protein cellular delivery. The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence which was matched with protein transduction domain (PTD) of homeodomain protein A5 (HOXA5) into pET expression vector. The cellular uptake of HOXA5-PTD-EGFP was detected in 1 min and its transduction reached a maximum at 1 h within cell lysates. The cellular uptake of HOXA5-EGFP at 37 {sup o}C was greater than in 4 {sup o}C. For study for the functional role of human HOXA5-PTD, we purified HOXA5-APE1/Ref-1 and applied it on monocyte adhesion. Pretreatment with HOXA5-APE1/Ref-1 (100 nM) inhibited TNF-{alpha}-induced monocyte adhesion to endothelial cells, compared with HOXA5-EGFP. Taken together, our data suggested that human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gonsalves, C.; Xue, B.; Yepes, M.
1994-03-01
A single regeneration procedure using cotyledon examples effectively regenerated five commercially grown muskmelon cultivars. This regeneration scheme was used to facilitate gene transfers using either Agrobacterium tumefaciens or microprojectile bombardment methods. In both cases, the transferred genes were from the T-DNA region of the binary vector plasmid pGA482GG/cp cucumber mosaic virus-white leaf strain (CMV-WL), which contains genes that encode neomycin phosphotransferase II (NPT II), [beta]-glucuronidase (GUS), and the CMV-WL coat protein (CP). Explants treated with pGA482GG/cpCMV-WL regenerated shoots on Murashige and Skoog medium containing 4.4 [mu]m 6-benzylaminopurine (BA), kanamycin (Km) at 150 mg[center dot]liter[sup [minus]1] and carbenicillin (Cb) at 500more » mg[center dot]liter[sup [minus]1]. The authors' comparison of A. tumefaciens- and microprojectile-mediated gene transfer procedures shows that both methods effectively produce nearly the same percentage of transgenic plants. R[sub 0] plants were first tested for GUS or NPT II expression, then the polymerase chain reaction (PCR) and other tests were used to verify the transfer of the NPT II, GUS, and CMV-WL CP genes.« less
Biolistic- and Agrobacterium-mediated transformation protocols for wheat.
Tamás-Nyitrai, Cecília; Jones, Huw D; Tamás, László
2012-01-01
After rice, wheat is considered to be the most important world food crop, and the demand for high-quality wheat flour is increasing. Although there are no GM varieties currently grown, wheat is an important target for biotechnology, and we anticipate that GM wheat will be commercially available in 10-15 years. In this chapter, we summarize the main features and challenges of wheat transformation and then describe detailed protocols for the production of transgenic wheat plants both by biolistic and Agrobacterium-mediated DNA-delivery. Although these methods are used mainly for bread wheat (Triticum aestivum L.), they can also be successfully applied, with slight modifications, to tetraploid durum wheat (T. turgidum L. var. durum). The appropriate size and developmental stage of explants (immature embryo-derived scutella), the conditions to produce embryogenic callus tissues, and the methods to regenerate transgenic plants under increasing selection pressure are provided in the protocol. To illustrate the application of herbicide selection system, we have chosen to describe the use of the plasmid pAHC25 for biolistic transformation, while for Agrobacterium-mediated transformation the binary vector pAL156 (incorporating both the bar gene and the uidA gene) has been chosen. Beside the step-by-step methodology for obtaining stably transformed and normal fertile plants, procedures for screening and testing transgenic wheat plants are also discussed.
Agrobacterium tumefaciens-mediated transformation of Narcissus tazzeta var. chinensis.
Lu, Gang; Zou, Qingcheng; Guo, Deping; Zhuang, Xiaoying; Yu, Xiaolin; Xiang, Xun; Cao, Jiashu
2007-09-01
Phytoene synthase (PSY), as a key regulatory enzyme for carotene biosynthesis, plays an important role in regulating color formation in many species. In the present study, a protocol was developed for the transformation of Narcissus tazzeta var chinensis using Agrobacterium tumefaciens strain LBA4404 harboring a binary vector pCAMBIA1301 plasmid which contained an antisense phytoene synthase gene, a reporter beta-glucuronidase gene and a selectable marker hygromycin phosphotransferase gene. Effects of some factors on efficiency of transformation and regeneration were examined. Preculture of the explants for 6 days before inoculation enhanced the transient GUS expression. The addition of acetosyringone (AS) at 100 micromol l(-1) for inoculation and a period of 3 days co-cultivation yielded efficient transient GUS expression. Transformants were obtained through selection on MS medium containing 5 mg l(-1) 6-benzylaminopurine (BA), 0.1 mg l(-1)alpha-naphthalene acetic acid (NAA) and 40 mg l(-1) hygromycin. The transformation frequency was 1.24% based on PCR analysis of gus gene. One or two copies of transgene were demonstrated in different transformations by Southern blotting analyses. Northern blotting results confirmed that the transcription of the endogenous psy gene in transgenic plants was inhibited or silenced. The method reported here provides new opportunities for improvement of quality traits of Narcissus tazzeta via genetic transformation.
Synthesis and evaluation of cationic nanomicelles for in vitro and in vivo gene delivery
NASA Astrophysics Data System (ADS)
Mandke, Rhishikesh Subhash
The goal of proposed study was to contribute towards the development of a nano size, high efficiency and low toxicity non-viral polymeric vector for gene delivery in vitro and in vivo. A series of fatty acid grafted low-molecular-weight chitosan (N-acyl LMWCs) were synthesized, purified and characterized for their physicochemical properties using various analytical techniques such as infrared spectroscopy, elemental analysis and dynamic light scattering. The formulation parameters including pH, sonication duration, and filtration altered the physicochemical characteristics of N-acyl LMWC nanomicelles. The acyl chain length and degree of unsaturation in fatty acids also had an impact on the physicochemical properties and the transfection efficiency of nanomicelles. N-acyl LMWC nanomicelles showed efficient in vitro transfection as visualized and quantified using a reporter plasmid (encoding green fluorescent protein), and therapeutic plasmids (encoding for interleukin-4 and interleukin-10), respectively. The in vitro transfection efficiencies of N-acyl LMWCs with 18:1 and 18:2 grafts (oleic and linoleic acids) were comparable with FuGENERTM HD (marketed non-viral vector) but were ˜8-fold and 35-fold higher as compared to LMWC and naked DNA, respectively. The in vivo transfection efficiency of N-acyl LMWC to deliver plasmids individually encoding IL-4 and IL-10 as well as a bicistronic plasmid encoding both IL-4 and IL-10 was studied in a multiple, low-dose streptozotocin induced diabetic mouse model. The transfection efficiency of pDNA/N-acyl LMWC polyplexes injected via intramuscular route showed significant improvement (p<0.05) over passive (naked DNA) or positive (FuGENE HD) controls. Additionally, a sustained and efficient expression of IL-4 and IL-10 was observed, accompanied by a reduction in interferon-gamma (INF-gamma), and tumor necrosis factor-alpha (TNF-alpha) levels. The pancreas of pDNA/N-acyl LMWC polyplex treated animals exhibited protection from streptozotocin-induced insulitis and the delivery systems were biocompatible. Histological studies revealed that there were no signs of chronic inflammation at the injection site. The bicistronic plasmid exhibited significantly (p<0.05) greater expression of IL-4 and IL-10, and demonstrated the feasibility of bicistronic IL-4/IL-10 plasmid/N-acyl LMWC nanomicelles-based polyplexes as an efficient and biocompatible system for the prevention of autoimmune diabetes.
Wang, Xiumei; Zhu, Yao; Hua, Xin; Chen, Fuguang; Wang, Changzhen; Zhang, Yanhe; Liu, Siguo; Zhang, Wanjiang
2018-04-01
The objective of this study was to investigate the prevalence of the cfr gene in Escherichia coli isolates from domestic animals in Northeast China and to characterize the cfr-containing plasmids. Between June 2015 and April 2016, 370 E. coli isolates were collected from pigs, chickens, and dairy cows in Northeast China. Among these, 111 were florfenicol resistant, including 109 isolates carrying the floR gene and 6 positives for cfr. The prevalence of cfr in E. coli isolates from the four northeast provinces in China was 1.6% (6/370), which was higher than that previously reported (0.08% and 0.5%). All six cfr-containing E. coli isolates were highly resistant to florfenicol (100%), cefotaxime (100%), and fosfomycin (100%). Complete sequence analysis of two cfr-carrying plasmids revealed high homology of the IncX4-type pEC14cfr plasmid with two other cfr-harboring plasmids, pSD11 and pGXEC6, found in swine E. coli isolates from southern China. pEC14cfr-like plasmids have been isolated in five provinces in southern and northern China. The isolation sites were up to 2700 kilometers apart, implying that pEC14cfr-like plasmids are likely to be national epidemic cfr-carrying plasmids that mediate the dissemination of cfr in China. Moreover, the genetic structure (IS26-IS26-cfr-rec-pre/mob-ramA-IS26) of the second cfr-carrying plasmid, IncF14:A-:B- pEC295cfr, represents a novel genetic environment for cfr identified for the first time in the present study. Sequence homology analysis indicated that the cfr-carrying element was most likely introduced into a cfr-negative pEC12 plasmid backbone, which evolved into the cfr-carrying vector, pEC295cfr. Moreover, isolation of the IncF14:A-:B- pEC295cfr plasmid harboring cfr suggests that IncFII plasmids maybe have become additional effective vehicles for cfr dissemination. These results highlight the importance of surveying the prevalence of IncX4 and IncFII plasmids in gram-negative bacteria, especially in swine E. coli isolates. Copyright © 2018 Elsevier B.V. All rights reserved.
Learning moment-based fast local binary descriptor
NASA Astrophysics Data System (ADS)
Bellarbi, Abdelkader; Zenati, Nadia; Otmane, Samir; Belghit, Hayet
2017-03-01
Recently, binary descriptors have attracted significant attention due to their speed and low memory consumption; however, using intensity differences to calculate the binary descriptive vector is not efficient enough. We propose an approach to binary description called POLAR_MOBIL, in which we perform binary tests between geometrical and statistical information using moments in the patch instead of the classical intensity binary test. In addition, we introduce a learning technique used to select an optimized set of binary tests with low correlation and high variance. This approach offers high distinctiveness against affine transformations and appearance changes. An extensive evaluation on well-known benchmark datasets reveals the robustness and the effectiveness of the proposed descriptor, as well as its good performance in terms of low computation complexity when compared with state-of-the-art real-time local descriptors.
Król, J. E.; Penrod, J. T.; McCaslin, H.; Rogers, L. M.; Yano, H.; Stancik, A. D.; Dejonghe, W.; Brown, C. J.; Parales, R. E.; Wuertz, S.
2012-01-01
Broad-host-range catabolic plasmids play an important role in bacterial degradation of man-made compounds. To gain insight into the role of these plasmids in chloroaniline degradation, we determined the first complete nucleotide sequences of an IncP-1 chloroaniline degradation plasmid, pWDL7::rfp and its close relative pNB8c, as well as the expression pattern, function, and bioaugmentation potential of the putative 3-chloroaniline (3-CA) oxidation genes. Based on phylogenetic analysis of backbone proteins, both plasmids are members of a distinct clade within the IncP-1β subgroup. The plasmids are almost identical, but whereas pWDL7::rfp carries a duplicate inverted catabolic transposon, Tn6063, containing a putative 3-CA oxidation gene cluster, dcaQTA1A2BR, pNB8c contains only a single copy of the transposon. No genes for an aromatic ring cleavage pathway were detected on either plasmid, suggesting that only the upper 3-CA degradation pathway was present. The dcaA1A2B gene products expressed from a high-copy-number vector were shown to convert 3-CA to 4-chlorocatechol in Escherichia coli. Slight differences in the dca promoter region between the plasmids and lack of induction of transcription of the pNB8c dca genes by 3-CA may explain previous findings that pNB8C does not confer 3-CA transformation. Bioaugmentation of activated sludge with pWDL7::rfp accelerated removal of 3-CA, but only in the presence of an additional carbon source. Successful bioaugmentation requires complementation of the upper pathway genes with chlorocatechol cleavage genes in indigenous bacteria. The genome sequences of these plasmids thus help explain the molecular basis of their catabolic activities. PMID:22101050
Zhao, Feijun; Wu, Yimou; Zhang, Xiaohong; Yu, Jian; Gu, Weiming; Liu, Shuangquan; Zeng, Tiebing; Zhang, Yuejun; Wang, Shiping
2011-10-01
In this study, the immune-modulatory and protective efficacy of using an interleukin-2 (IL-2) expression plasmid as a genetic adjuvant and chitosan (CS) nanoparticles as vectors to enhance a Tp92 DNA vaccine candidate were investigated in a Treponema pallidum (Tp) rabbit challenge model. CS vectoring of pTp92 or pIL-2 were both demonstrated to augment anti-Tp92 antibody levels induced by pTp92 DNA vaccines. Interestingly, the combination of CS vectored Tp92 and pIL-2 led to the greatest enhancements of anti-Tp92 antibodies and T-cell proliferation (p < 0.05). At week 10 after the first immunization, 15 of the 18 rabbits in each group were challenged with Tp Nichols strain and monitored for skin lesions and ulcer lesions. Ratios of positive skin lesions and ratios of ulcer lesions in groups immunized with pTp92 were significantly lower than those of the empty vector or PBS groups (p < 0.05), demonstrating that pTp92 immunization elicited significant protective efficacy against the Tp Nichols strain challenge. CS vectored and pIL-2 adjuvanted pTp92 immunized animals exhibited the lowest rates of positive skin and ulcer lesions. Male New Zealand white rabbits were randomly assigned to groups (n = 18/group) and immunized intramuscularly with pTp92 based plasmid DNA constructs (100 μg of DNA/rabbit/immunization). Two weeks before Tp challenge (Week 8), three rabbits from each group were used to determine cytokine measurements and fifteen rabbits from each group were used for Tp challenge studies. Intramuscular injection of pTp92 induced strong humoral and cellular immune responses and conferred protection from Tp challenge in rabbits. The use of CS as a pTp92 vector or pIL-2 as an adjuvant achieved a superior level of protective efficacy against Tp challenge, however CS vectored, IL-2 adjuvanted pTp92 immunization conferred the highest level of protective efficacy.
Intranasal Delivery of pGDNF Nanoparticles for Parkinson's Disease
NASA Astrophysics Data System (ADS)
Harmon, Brendan Trevor
Parkinson's disease (PD) is a progressive neurodegenerative disorder that primarily affects the dopaminergic A9 nigrostriatal tract. For dopamine neurons specifically, glial cell-derived neurotrophic factor (GDNF) has been shown to promote their survival and proliferation both in culture and in vivo. GDNF has also proven to be neuroprotective and restorative in various animal models of PD and some human clinical trials. However, its delivery to the brain has required invasive surgical routes which are not clinically practical for many patients. The main objective of this project was to test intranasal delivery to the brain of a nanoparticle vector incorporating an expression plasmid for GDNF (pGDNF). The intranasal route circumvents the blood-brain barrier, allowing larger sized vectors into the central nervous system while avoiding peripheral distribution. This approach would provide a renewable source of GDNF within the target areas of the brain, the striatum and the substantia nigra (SN) without the need for surgical injections or frequent re-dosing. A PEGylated polylysine compacted plasmid nanoparticle vector (PEG-CK30), developed by Copernicus Therapeutics, Inc., has been shown to transfect neurons and glial cells in vivo while lacking the safety issues present with other vectors. The first goal of this work was to determine if these PEG-CK30 compacted plasmid nanoparticles can successfully transfect cells and express the reporter protein, enhanced green fluorescent protein (eGFP) in the rat brain after intranasal administration. Initial in vivo experiments utilized the expression plasmid pCG, expressing eGFP under the fast-acting cytomegalovirus (CMV) promoter. Intranasal administration of pCG nanoparticles resulted in evidence of transfection of brain cells, as shown both qualitatively, by GFP-immunohistochemistry, and quantitatively, by GFP-ELISA. Expression was detected throughout the rat brain two days post-administration. Following the proof-of-principle study with pCG, a new plasmid was created by Copernicus Therapeutics, Inc. to better mimic their long-lasting pGDNF plasmid while providing both GDNF as well as the reporter function of eGFP. This eGFP-GDNF plasmid was used to monitor expression and cell-types transfected. This expression plasmid, called pUGG, was first characterized in vitro to verify protein expression. Transfection experiments in SHEP-1 neuroblastoma cells, ventral midbrain cultures, and N27 dopaminergic cells all demonstrated that pUGG expressed bioactive eGFP and GDNF. However, cleavage of the two proteins did not occur and the expressed protein emerged as a fusion construct which was not detectable by GDNF-ELISA, although it was detected by GFP-ELISA. The next goal was to determine if pUGG was able to transfect cells in vivo in rat brain. Direct striatal injection of pUGG nanoparticles showed significant eGFP expression at the site of injection both 7 and 14 days post-administration with no difference in eGFP expression between the two time-points. GFP-immunohistochemistry at the striatal injection site revealed expression of eGFP-positive cells as well as evidence of GDNF's bioactivity as indicated by neurite outgrowth. Moving forward, we administered pUGG nanoparticles intranasally to rats and found significant expression seven days later throughout the brain, with highest levels in the forebrain areas (olfactory bulb and frontal cortex). Significant expression was also seen along the rostral-caudal axis of the brain compared with naked pUGG plasmid. The final goal of this work was to examine whether intranasal pGDNF pre-treatment could generate sufficient GDNF to protect SN dopamine neurons after a unilateral 6-hydroxydopmaine (6-OHDA) lesion, a common animal model for PD. Copernicus' pGDNF plasmid was utilized for the neuroprotection experiments to avoid possible confounds due to the GFP fusion produced by pUGG. Tyrosine hydroxylase-immunostaining density was used as a marker for dopamine neurons in the SN and their nerve terminals in the striatum. Dopamine cell counts were also performed in the SN. Intranasal delivery of pGDNF significantly protected dopamine neurons in the rat 6-OHDA model of PD. This was revealed in three ways. First, pGDNF treatments reduced amphetamine-induced circling behavior, suggesting a prevention of dopamine loss on the 6-OHDA-lesioned side. Second, pGDNF increased TH staining density and dopamine cell counts in the SN on the 6-OHDA-lesioned side. This result was direct evidence of neuroprotection of dopamine cell bodies. Third, pGDNF increased TH staining density in the striatum on the 6-OHDA-lesioned side. This result was direct evidence of protection of dopaminergic nerve terminals. Intranasal pGDNF nanoparticles provided greater neuroprotection than naked pGDNF for all measures. This result was consistent with our previous findings that pGDNF nanoparticles produce more GDNF in brain than the naked plasmid. Collectively, these results demonstrate that intranasal delivery of Copernicus' pGDNF nanoparticles has great clinical potential as a new, non-invasive and non-viral gene therapy approach for early stage Parkinson's disease. By promoting recovery of damaged neurons and preventing further cell loss, symptoms may be reversed and disease progression may be stopped.
Santangeloyz, K.S.; Bertoneyz, A.L.
2011-01-01
summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742
Burian, J; Tu, N; Kl'ucár, L; Guller, L; Lloyd-Jones, G; Stuchlík, S; Fejdi, P; Siekel, P; Turna, J
1998-01-01
A determinant encoding resistance against potassium tellurite (Te(r)) was discovered in a clinical isolate of Escherichia coli strain KL53. The strain formed typical black colonies on solid LB medium with tellurite. The determinant was located on a large conjugative plasmid designated pTE53. Electron-dense particles were observed in cells harboring pTE53 by electron microscopy. X-Ray identification analysis identified these deposits as elemental tellurium and X-ray diffraction analysis showed patterns typical of crystalline structures. Comparison with JCPDS 4-0554 (Joint Committee on Powder Diffraction Standards) reference data confirmed that these crystals were pure tellurium crystals. In common with other characterized Te(r) determinants, accumulation studies with radioactively labeled tellurite showed that reduced uptake of tellurite did not contribute to the resistance mechanism. Tellurite accumulation rates for E. coli strain AB1157 harboring pTE53 were twice higher than for the plasmid-free host strain. In addition, no efflux mechanism was detected. The potassium tellurite resistance determinant of plasmid pTE53 was cloned using both in vitro and in vivo techniques in low-copy-number vectors pACYC184 and mini-Mu derivative pPR46. Cloning of the functional Te(r) determinant into high-copy cloning vectors pTZ19R and mini-Mu derivatives pBEf and pJT2 was not successful. During in vivo cloning experiments, clones with unusual "white colony" phenotypes were found on solid LB with tellurite. All these clones were Mucts62 lysogens. Their tellurite resistance levels were in the same order as the wild type strains. Clones with the "white" phenotype had a 3.6 times lower content of tellurium than the tellurite-reducing strain. Transformation of a "white" mutant with a recombinant pACYC184 based Te(r) plasmid did not change the phenotype. However, when one clone was cured from Mucts62 the "white" phenotype reverted to the wild-type "black" phenotype. It was suggested that the "white" phenotype was the result of an insertional inactivation of an unknown chromosomal gene by Mucts62, which reduced the tellurite uptake.
Sandeu, Maurice Marcel; Moussiliou, Azizath; Moiroux, Nicolas; Padonou, Gilles G.; Massougbodji, Achille; Corbel, Vincent; Tuikue Ndam, Nicaise
2012-01-01
Background An accurate method for detecting malaria parasites in the mosquito’s vector remains an essential component in the vector control. The Enzyme linked immunosorbent assay specific for circumsporozoite protein (ELISA-CSP) is the gold standard method for the detection of malaria parasites in the vector even if it presents some limitations. Here, we optimized multiplex real-time PCR assays to accurately detect minor populations in mixed infection with multiple Plasmodium species in the African malaria vectors Anopheles gambiae and Anopheles funestus. Methods Complementary TaqMan-based real-time PCR assays that detect Plasmodium species using specific primers and probes were first evaluated on artificial mixtures of different targets inserted in plasmid constructs. The assays were further validated in comparison with the ELISA-CSP on 200 field caught Anopheles gambiae and Anopheles funestus mosquitoes collected in two localities in southern Benin. Results The validation of the duplex real-time PCR assays on the plasmid mixtures demonstrated robust specificity and sensitivity for detecting distinct targets. Using a panel of mosquito specimen, the real-time PCR showed a relatively high sensitivity (88.6%) and specificity (98%), compared to ELISA-CSP as the referent standard. The agreement between both methods was “excellent” (κ = 0.8, P<0.05). The relative quantification of Plasmodium DNA between the two Anopheles species analyzed showed no significant difference (P = 0, 2). All infected mosquito samples contained Plasmodium falciparum DNA and mixed infections with P. malariae and/or P. ovale were observed in 18.6% and 13.6% of An. gambiae and An. funestus respectively. Plasmodium vivax was found in none of the mosquito samples analyzed. Conclusion This study presents an optimized method for detecting the four Plasmodium species in the African malaria vectors. The study highlights substantial discordance with traditional ELISA-CSP pointing out the utility of employing an accurate molecular diagnostic tool for detecting malaria parasites in field mosquito populations. PMID:23285168
USDA-ARS?s Scientific Manuscript database
Transformation plasmid-derived insert number and insert site sequence in 55-1 line papaya derivatives Rainbow and SunUp was determined as part of a larger petition to allow its import into Japan (Suzuki, et al., 2007, 2008). Three insertions were detected by Southern analysis and their correspondin...
Enhancing magnetic nanoparticle-based DNA transfection: Intracellular-active cassette features
NASA Astrophysics Data System (ADS)
Vernon, Matthew Martin
Efficient plasmid DNA transfection of embryonic stem cells, mesenchymal stem cells, neural cell lines and the majority of primary cell lines is a current challenge in gene therapy research. Magnetic nanoparticle-based DNA transfection is a gene vectoring technique that is promising because it is capable of outperforming most other non-viral transfection methods in terms of both transfection efficiency and cell viability. The nature of the DNA vector implemented depends on the target cell phenotype, where the particle surface chemistry and DNA binding/unbinding kinetics of the DNA carrier molecule play a critical role in the many steps required for successful gene transfection. Accordingly, Neuromag, an iron oxide/polymer nanoparticle optimized for transfection of neural phenotypes, outperforms many other nanoparticles and lipidbased DNA carriers. Up to now, improvements to nanomagnetic transfection techniques have focused mostly on particle functionalization and transfection parameter optimization (cell confluence, growth media, serum starvation, magnet oscillation parameters, etc.). None of these parameters are capable of assisting the nuclear translocation of delivered plasmid DNA once the particle-DNA complex is released from the endosome and dissociates in the cell's cytoplasm. In this study, incorporation of a DNA targeting sequence (DTS) feature in the transfecting plasmid DNA confers improved nuclear translocation, demonstrating significant improvement in nanomagnetic transfection efficiency in differentiated SH-SY5Y neuroblastoma cells. Other parameters, such as days in vitro, are also found to play a role and represent potential targets for further optimization.
Yoneyama, T; Akatsuka, T; Miyamura, T
1988-08-01
The large BglII fragment (2.8 kilobases) of hepatitis B virus DNA including the transcription unit for the hepatitis B surface antigen (HBsAg) was inserted into a bovine papillomavirus vector containing the neomycin resistance gene. The recombinant DNA was transfected into mouse C127 cells. A stable transformed cell line (MS128) secreting a large amount of 22 nm HBsAg particles containing pre-S2 protein was established. The secreted HBsAg particles had the receptor for polymerized human serum albumin. Immunoprecipitation and Western blot analyses showed that HBsAg particles consisted of two major proteins of 22K and 26K encoded by the S gene and a minor protein of 35K encoded by the pre-S2 and S genes. Southern blot analysis revealed that the transfected plasmid was integrated into the host chromosomal DNA and that most of the plasmid sequences were present. These results suggest that the stable expression of the HBsAg in MS128 cells is related to the integrated state of the recombinant DNA.
Protection from ischemic heart injury by a vigilant heme oxygenase-1 plasmid system.
Tang, Yao Liang; Tang, Yi; Zhang, Y Clare; Qian, Keping; Shen, Leping; Phillips, M Ian
2004-04-01
Although human heme oxygenase-1 (hHO-1) could provide a useful approach for cellular protection in the ischemic heart, constitutive overexpression of hHO-1 may lead to unwanted side effects. To avoid this, we designed a hypoxia-regulated hHO-1 gene therapy system that can be switched on and off. This vigilant plasmid system is composed of myosin light chain-2v promoter and a gene switch that is based on an oxygen-dependent degradation domain from the hypoxia inducible factor-1-alpha. The vector can sense ischemia and switch on the hHO-1 gene system, specifically in the heart. In an in vivo experiment, the vigilant hHO-1 plasmid or saline was injected intramyocardially into myocardial infarction mice or sham operation mice. After gene transfer, expression of hHO-1 was only detected in the ischemic heart treated with vigilant hHO-1 plasmids. Masson trichrome staining showed significantly fewer fibrotic areas in vigilant hHO-1 plasmids-treated mice compared with saline control (43.0%+/-4.8% versus 62.5%+/-3.3%, P<0.01). The reduction of interstitial fibrosis is accompanied by an increase in myocardial hHO-1 expression in peri-infarct border areas, concomitant with higher Bcl-2 levels and lower Bax, Bak, and caspase 3 levels in the ischemic myocardium compared with saline control. By use of a cardiac catheter, heart from vigilant hHO-1 plasmids-treated mice showed improved recovery of contractile and diastolic performance after myocardial infarction compared with saline control. This study documents the beneficial regulation and therapeutic potential of vigilant plasmid-mediated hHO-1 gene transfer. This novel gene transfer strategy can provide cardiac-specific protection from future repeated bouts of ischemic injury.
Correction of the Middle Eastern M712T mutation causing GNE myopathy by trans-splicing.
Tal-Goldberg, Tzukit; Lorain, Stéphanie; Mitrani-Rosenbaum, Stella
2014-06-01
GNE myopathy is a rare neuromuscular autosomal recessive disease, resulting from mutations in the gene UDP N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE). The most frequent mutation is the single homozygous missense mutation, M712T-the Middle Eastern mutation-located ten amino acids before the end of the protein. We have used an adeno-associated virus (AAV)-based trans-splicing (TS) vector as a gene therapy tool to overcome this mutation by replacing the mutated last exon of GNE by the wild-type exon while preserving the natural endogenous regulatory machinery. We have designed relevant plasmids directed either to mouse or to human GNE. Following transfection of C2C12 murine muscle cells with the mouse TS vectors, we have been able to detect by nested RT-PCR trans-spliced molecules carrying the wild-type exon 12 of GNE. Similarly, transfection of HEK293 human cells with the human-directed TS vectors resulted in the generation of trans-spliced human GNE RNA molecules. Furthermore, infection of primary muscle cells from a GNE myopathy patient carrying the homozygous M712T mutation, with an AAV8-based viral vector carrying a human-directed TS construct, resulted in the generation of wild-type GNE transcripts in addition to the mutated ones. These studies provide a proof of concept that the TS approach could be used to partially correct the Middle Eastern mutation in GNE myopathy patients. These results provide the basis for in vivo research in animal models using the AAV platform with TS plasmids as a potential genetic therapy for GNE myopathy.
Contamination of sequence databases with adaptor sequences
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yoshikawa, Takeo; Sanders, A.R.; Detera-Wadleigh, S.D.
Because of the exponential increase in the amount of DNA sequences being added to the public databases on a daily basis, it has become imperative to identify sources of contamination rapidly. Previously, contaminations of sequence databases have been reported to alert the scientific community to the problem. These contaminations can be divided into two categories. The first category comprises host sequences that have been difficult for submitters to manage or control. Examples include anomalous sequences derived from Escherichia coli, which are inserted into the chromosomes (and plasmids) of the bacterial hosts. Insertion sequences are highly mobile and are capable ofmore » transposing themselves into plasmids during cloning manipulation. Another example of the first category is the infection with yeast genomic DNA or with bacterial DNA of some commercially available cDNA libraries from Clontech. The second category of database contamination is due to the inadvertent inclusion of nonhost sequences. This category includes incorporation of cloning-vector sequences and multicloning sites in the database submission. M13-derived artifacts have been common, since M13-based vectors have been widely used for subcloning DNA fragments. Recognizing this problem, the National Center for Biotechnology Information (NCBI) started to screen, in April 1994, all sequences directly submitted to GenBank, against a set of vector data retrieved from GenBank by use of key-word searches, such as {open_quotes}vector.{close_quotes} In this report, we present evidence for another sequence artifact that is widespread but that, to our knowledge, has not yet been reported. 11 refs., 1 tab.« less
Analysis of protein function in clinical C. albicans isolates
Gerami-Nejad, Maryam; Forche, Anja; McClellan, Mark; Berman, Judith
2012-01-01
Clinical isolates are prototrophic and hence are not amenable to genetic manipulation using nutritional markers. Here we describe a new set of plasmids carrying the NAT1 (nourseothricin) drug resistance marker (Shen et al., 2005) that can be used both in clinical isolates and in laboratory strains. We constructed novel plasmids containing HA-NAT1 or MYC-NAT1 cassettes to facilitate PCR-mediated construction of strains with C-terminal epitope-tagged proteins and a NAT1-pMet3-GFP plasmid to enable conditional expression of proteins with or without the green fluorescent protein fused at the N-terminus. Furthermore, for proteins that require both the endogenous N- and C-termini for function, we have constructed a GF-NAT1-FP cassette carrying truncated alleles that facilitate insertion of an intact, single copy of GFP internal to the coding sequence. In addition, GFP-NAT1, RFP-NAT1, and M-Cherry-NAT1 plasmids were constructed expressing two differently labeled gene products for the study of protein co-expression and co-localization in vivo. Together, these vectors provide a useful set of genetic tools for studying diverse aspects of gene function in C. albicans clinical as well as laboratory strains. PMID:22777821
Portlock, Joylette L; Keravala, Annahita; Bertoni, Carmen; Lee, Solomon; Rando, Thomas A; Calos, Michele P
2006-08-01
Peripheral vascular disease (PVD), characterized by insufficient blood supply to extremities, can be a devastating illness. Although many gene therapy strategies for PVD using vascular endothelial growth factor (VEGF) have resulted in increased blood vessel formation, the vessels are often impermanent and regress after therapy, probably because of the short-lived VEGF expression mediated by gene therapy vectors (14 days or less). phiC31 integrase is a recombinase originally isolated from a bacteriophage of Streptomyces. This integrase performs efficient chromosomal integration of plasmid DNA into mammalian genomes that results in long-term transgene expression. In this study, gene transfer was achieved by intramuscular injection of VEGF and integrase plasmid DNAs into the tibialis anterior muscle in the mouse hindlimb, followed by electroporation of the muscle with needle electrodes. We observed VEGF levels significantly above background 40 days after injection in animals that received phiC31 integrase and the VEGF plasmid. Site-specific integration of plasmid DNA in the chromosomes of muscle tissue was verified by polymerase chain reaction at a common integration site. These results suggest the possible utility of the phiC31 integrase system to treat ischemic disease.
High-level fluorescence labeling of gram-positive pathogens.
Aymanns, Simone; Mauerer, Stefanie; van Zandbergen, Ger; Wolz, Christiane; Spellerberg, Barbara
2011-01-01
Fluorescence labeling of bacterial pathogens has a broad range of interesting applications including the observation of living bacteria within host cells. We constructed a novel vector based on the E. coli streptococcal shuttle plasmid pAT28 that can propagate in numerous bacterial species from different genera. The plasmid harbors a promoterless copy of the green fluorescent variant gene egfp under the control of the CAMP-factor gene (cfb) promoter of Streptococcus agalactiae and was designated pBSU101. Upon transfer of the plasmid into streptococci, the bacteria show a distinct and easily detectable fluorescence using a standard fluorescence microscope and quantification by FACS-analysis demonstrated values that were 10-50 times increased over the respective controls. To assess the suitability of the construct for high efficiency fluorescence labeling in different gram-positive pathogens, numerous species were transformed. We successfully labeled Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. equisimilis, Enterococcus faecalis, Enterococcus faecium, Streptococcus mutans, Streptococcus anginosus and Staphylococcus aureus strains utilizing the EGFP reporter plasmid pBSU101. In all of these species the presence of the cfb promoter construct resulted in high-level EGFP expression that could be further increased by growing the streptococcal and enterococcal cultures under high oxygen conditions through continuous aeration.
Jubeli, Emile; Maginty, Amanda B; Abdul Khalique, Nada; Raju, Liji; Abdulhai, Mohamad; Nicholson, David G; Larsen, Helge; Pungente, Michael D; Goldring, William P D
2015-10-01
Previously we reported the synthesis and in vitro evaluation of four novel, short-chain cationic lipid gene delivery vectors, characterized by acyclic or macrocyclic hydrophobic regions composed of, or derived from, two 7-carbon chains. Herein we describe a revised synthesis of an expanded library of related cationic lipids to include extended chain analogues, their formulation with plasmid DNA (pDNA) and in vitro delivery into Chinese hamster ovarian (CHO-K1) cells. The formulations were evaluated against each other based on structural differences in the hydrophobic domain and headgroup. Structurally the library is divided into four sets based on lipids derived from two 7- or two 11-carbon hydrophobic chains, C7 and C11 respectively, which possess either a dimethylamine or a trimethylamine derived headgroup. Each set includes four cationic lipids based on an acyclic or macrocyclic, saturated or unsaturated hydrophobic domain. All lipids were co-formulated with the commercial cationic lipid 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (EPC) in a 1:1 molar ratio, along with one of two distinct neutral co-lipids, cholesterol or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) in an overall cationic-to-neutral lipid molar ratio of 3:2. Binding of lipid formulations with DNA, and packing morphology associated with the individual lipid-DNA complexes were characterized by gel electrophoresis and small angle X-ray diffraction (SAXD), respectively. As a general trend, lipoplex formulations based on mismatched binary cationic lipids, composed of a shorter C7 lipid and the longer lipid EPC (C14), were generally associated with higher transfection efficiency and lower cytotoxicity than their more closely matched C11/EPC binary lipid formulation counterparts. Furthermore, the cyclic lipids gave transfection levels as high as or greater than their acyclic counterparts, and formulations with cholesterol exhibited higher transfection and lower cytotoxicity than those formulated with DOPE. A number of the lipid formulations with cholesterol as co-lipid performed as well as, or better than Lipofectamine 2000™ and EPC, the two positive controls employed in these studies. These results suggest that our novel cyclic and acyclic cationic lipid vectors are effective nonviral gene transfer agents that warrant further investigation. Copyright © 2015 Elsevier Ltd. All rights reserved.
Cruz, P E; Khalil, P L; Dryden, T D; Chiou, H C; Fink, P S; Berberich, S J; Bigley, N J
1999-03-05
DNA molecules complexed with an asialoglycoprotein-polycation conjugate, consisting of asialoorosomucoid (ASOR) coupled to poly-L-lysine, can enter hepatocytes which bear receptors for ASOR. We used this receptor-mediated DNA delivery system to deliver plasmid DNA encoding glycoprotein D (gD) of herpes simplex virus type 1 to ASOR-positive cells. Maximum expression of gD protein was seen at 3 days after injection of this preparation in approximately 13% of cells from BALB/c mice [hepatocytes from mice injected intravenously (i.v.) or peritoneal exudate cells from mice injected intraperitoneally (i.p.)]. In comparison with mice injected with either the plasmid vector alone or the gD-containing plasmid uncomplexed to ASOR, mice immunized with gD-containing plasmid complexed with ASOR-poly-L-lysine induced marked antigen-specific CTL responses. BALB/c mice immunized with gD-DNA developed a T-cell-mediated CTL response against target cells expressing gD and MHC class II glycoproteins, but not against cells expressing only gD and MHC class I molecules. In C3H mice, gD-DNA induced a T-cell-mediated CTL response against target cells expressing gD and class I MHC molecules. Serum anti-gD antibody in low titers were produced in both strains of mice. DNA complexed with ASOR-poly-L-lysine induced CTL responses in mice.
CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.
Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo
2017-06-25
Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.
[Construction of thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene].
Wei, Qing; Liu, Yi-Min; Wang, Hui; Zhao, Xiao-Lin; Ren, Tie-ling; Xiao, Yong-mei
2006-09-01
To construct Thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene and to provide scientific base for deeply researching on the function of cytochrome 1A1 gene (CYP1A1) and the mechanism of carcinogenesis. According to cDNA sequence of human CYP1A1 gene, universal primers (Pm3/Pm4) and mutant primers (Pt15/Pt16 and Pt17/Pt18) containing restriction enzyme site and mutation site were designed. The first set of primers involving Pm3/Pt16 and Pm3/Pt18 amplified a forward 1.5kb fragment from pGEM-T-CYP1A1 plasmid. The second set of primers involving Pt15/Pm4 and Pt17/Pm4 amplified a reverse 177-bp fragment from 10ng pGEM-T-CYP1A1 plasmid. The third set of primers involving Pm3/Pm4 amplified a 1.5kb fragment from the fomer PCR amplifications. The third PCR products were separated, purified and recovered from 1% agarose gel, then inserted into pMD-T vector. Subsequently the conjunct products were transformed into E. coil strain DH-5alpha., then the single clone was screened out and plasmids were extracted from such clone finally verified by restriction endonuclease analysis and sequencing. A 1.5kb fragment of tricycle PCR amplifications were digested by restriction endonucleases (BamHI and SailI) and sequenced bidirectionally by universal primers(T7p and SP6). The results verified that the cloned fragment including Asn461 and Val462 mutant site had 99.9% homology with the human cDNA of CYP1A1 gene in Genebank. The objective fragment containing Asn461 and Va462 mutant site with cDNA of the CYP1A1 gene has been successfully constructed in this experiment.
Zheng, Min; Mitra, Rajendra N; Filonov, Nazar A; Han, Zongchao
2016-03-01
Previously, we compared the efficacy of nanoparticle (NP)-mediated intron-containing rhodopsin (sgRho) vs. intronless cDNA in ameliorating retinal disease phenotypes in a rhodopsin knockout (RKO) mouse model of retinitis pigmentosa. We showed that NP-mediated sgRho delivery achieved long-term expression and phenotypic improvement in RKO mice, but not NP housing cDNA. However, the protein level of the NP-sgRho construct was only 5-10% of wild-type at 8 mo postinjection. To have a better understanding of the reduced levels of long-term expression of the vectors, in the present study, we evaluated the epigenetic changes of subretinal delivering NP-cDNA vs. NP-sgRho in the RKO mouse eyes. Following the administration, DNA methylation and histone status of specific regions (bacteria plasmid backbone, promoter, rhodopsin gene, and scaffold/matrix attachment region) of the vectors were evaluated at various time points. We documented that epigenetic transgene silencing occurred in vector-mediated gene transfer, which were caused by the plasmid backbone and the cDNA of the transgene, but not the intron-containing transgene. No toxicity or inflammation was found in the treated eyes. Our results suggest that cDNA of the rhodopsin transgene and bacteria backbone interfered with the host defense mechanism of DNA methylation-mediated transgene silencing through heterochromatin-associated modifications. © FASEB.
Tsukahara, T; Iwase, N; Kawakami, K; Iwasaki, M; Yamamoto, C; Ohmine, K; Uchibori, R; Teruya, T; Ido, H; Saga, Y; Urabe, M; Mizukami, H; Kume, A; Nakamura, M; Brentjens, R; Ozawa, K
2015-02-01
Engineered T-cell therapy using a CD19-specific chimeric antigen receptor (CD19-CAR) is a promising strategy for the treatment of advanced B-cell malignancies. Gene transfer of CARs to T-cells has widely relied on retroviral vectors, but transposon-based gene transfer has recently emerged as a suitable nonviral method to mediate stable transgene expression. The advantages of transposon vectors compared with viral vectors include their simplicity and cost-effectiveness. We used the Tol2 transposon system to stably transfer CD19-CAR into human T-cells. Normal human peripheral blood lymphocytes were co-nucleofected with the Tol2 transposon donor plasmid carrying CD19-CAR and the transposase expression plasmid and were selectively propagated on NIH3T3 cells expressing human CD19. Expanded CD3(+) T-cells with stable and high-level transgene expression (~95%) produced interferon-γ upon stimulation with CD19 and specifically lysed Raji cells, a CD19(+) human B-cell lymphoma cell line. Adoptive transfer of these T-cells suppressed tumor progression in Raji tumor-bearing Rag2(-/-)γc(-/-) immunodeficient mice compared with control mice. These results demonstrate that the Tol2 transposon system could be used to express CD19-CAR in genetically engineered T-cells for the treatment of refractory B-cell malignancies.
Li, Hui; Li, Rong; Zhong, Sen; Ren, Hong; Deng, Cun-liang; Shi, Xiao-ling; Wang, Ming-yong
2006-04-01
To construct and express a chimeric Mtb8.4 with signal peptide (MS)/hIL12 eukaryotic expression plasmid, and to study the immunogenicity of the MS/hIL-12 chimeric genetic vaccines. The MS/hIL-12 chimeric gene was amplified by polymerase chain reaction (PCR) and cloned into the eukaryotic expression vector pCI-neo. The correct pCI-neo-MS/hIL12 (pMSI) recombinant plasmid was identified by PCR, restricted enzyme digestion and DNA sequencing. COS-7 cells were transfected with pMSI constructs by cationic liposome. After 48 hours, mRNA of the target gene was detected by RT-PCR, and hIL-12 protein in culture supernatant and cell lysates was detected by Western blot. C57BL/6N mice were vaccinated with MS/hIL-12 chimeric gene vaccine for three times at 3 week intervals. Four weeks after the final inoculation, three mice were sacrificed for measurement of the cytokine response and cytotoxic T lymphocyte (CTL) induction. The accuracy of plasmid construction was confirmed by a number of molecular biological techniques. Transfection of COS-7 cells with plasmids pMSI lead to transient expression of fusion proteins. The IFN-gamma and IL-2 titers were (1,521 +/- 48) ng/L and (755 +/- 41) ng/L in MS/hIL-12 chimeric gene vaccine group, (820 +/- 50) ng/L and (297 +/- 31) ng/L in MS gene vaccine group, (1,487 +/- 40) ng/L and (767 +/- 50) ng/L in BCG group, (121 +/- 16) ng/L and (62 +/- 10) ng/L in vacant vector group, and (48 +/- 16) ng/L and (32 +/- 17) ng/L in PBS group respectively. The levels of IFN-gamma and IL-2 in MS/hIL-12 chimeric gene vaccine group were higher than those of MS gene vaccine group, vacant vector group and PBS group (P < 0.01) and was similar to the BCG group (P > 0.05). The level of IL-4 in BCG group [(91 +/- 11) ng/L] increased significantly as compared to other groups (P < 0.01). When effector-cell-to-target-cell ratio (E:T ratio) were 100:1, 50:1, and 10:1 respectively, the CTL activity was 77.5%, 51.2%, 30.3% in MS/hIL-12 chimeric gene vaccine group, 56.2%, 37.8%, 11.5% in MS gene vaccine group, 28.9%, 21.4%, 9.8% in BCG group. The cytotoxicity in MS/hIL-12 chimeric gene vaccine group was higher than that of other groups (P < 0.01). When used to construct the chimeric gene vaccine, hIL-12 could improve the immunogenicity of MS gene vaccine.
Binary black hole spacetimes with a helical Killing vector
DOE Office of Scientific and Technical Information (OSTI.GOV)
Klein, Christian
Binary black hole spacetimes with a helical Killing vector, which are discussed as an approximation for the early stage of a binary system, are studied in a projection formalism. In this setting the four-dimensional Einstein equations are equivalent to a three-dimensional gravitational theory with a SL(2,R)/SO(1,1) sigma model as the material source. The sigma model is determined by a complex Ernst equation. 2+1 decompositions of the three-metric are used to establish the field equations on the orbit space of the Killing vector. The two Killing horizons of spherical topology which characterize the black holes, the cylinder of light where themore » Killing vector changes from timelike to spacelike, and infinity are singular points of the equations. The horizon and the light cylinder are shown to be regular singularities, i.e., the metric functions can be expanded in a formal power series in the vicinity. The behavior of the metric at spatial infinity is studied in terms of formal series solutions to the linearized Einstein equations. It is shown that the spacetime is not asymptotically flat in the strong sense to have a smooth null infinity under the assumption that the metric tends asymptotically to the Minkowski metric. In this case the metric functions have an oscillatory behavior in the radial coordinate in a nonaxisymmetric setting, the asymptotic multipoles are not defined. The asymptotic behavior of the Weyl tensor near infinity shows that there is no smooth null infinity.« less
2013-05-28
those of the support vector machine and relevance vector machine, and the model runs more quickly than the other algorithms . When one class occurs...incremental support vector machine algorithm for online learning when fewer than 50 data points are available. (a) Papers published in peer-reviewed journals...learning environments, where data processing occurs one observation at a time and the classification algorithm improves over time with new
Hosseinkhani, Hossein; Tabata, Yasuhiko
2003-01-09
The objective of this study is to investigate the efficiency of a non-viral gene carrier with RGD sequences, Pronectin F(+) for gene transfection. The Pronectin F(+) was cationized by introducing ethylenediamine (Ed), spermidine (Sd), and spermine (Sm) to the hydroxyl groups while the corresponding gelatin derivative was prepared similarly because gelatin also has one RGD sequence per molecule. The zeta potential and molecular size of Pronectin F(+) and gelatin derivatives were examined before and after polyion complexation with a plasmid DNA of luciferase. When complexed with the plasmid DNA at the Pronectin F(+)/plasmid DNA mixing ratio of 50, the complex exhibited a zeta potential of about 10 mV, which is similar to that of the gelatin derivative-plasmid DNA complex. Irrespective of the type of Pronectin F(+) and gelatin derivatives, their complexation enabled the apparent molecular size of plasmid DNA to reduce to about 200 nm, the size decreasing with the increased derivative/plasmid DNA weight mixing ratio. The rat gastric mucosal (RGM)-1 cells treated with both complexes exhibited significantly stronger luciferase activities than free plasmid DNA although the enhanced extent was significant for the Sm derivative compared with the corresponding Ed and Sd derivatives. Cell attachment was enhanced by the Pronectin F(+) derivative to a significant high extent compared with the gelatin derivative. The amount of plasmid DNA internalized into the cells was enhanced by the complexation with every Pronectin F(+) derivative compared with the gelatin derivative. For both of Pronectin F(+) and gelatin carriers, the buffering capacity of Sm derivatives was higher than that of Ed and Sd derivatives and comparable to that of polyethyleneimine. It is likely that the high efficiency of gene transfection for the Sm derivative is due to the superior buffering effect. We conclude that the Sm derivative of Pronectin F(+) is promising as a non-viral vector of gene transfection.
He, Zhuojing; Xu, Juan; Tao, Wei; Fu, Ting; He, Fang; Hu, Ruxi; Jia, Lan; Hong, Yan
2016-08-01
The aim of the present study was to evaluate the efficacy of a herpes simplex virus type 2 (HSV-2) DNA vaccine co‑immunized with a plasmid adjuvant containing CpG motifs. A novel eukaryotic expression plasmid vector containing kanamycin resistance gene (pcDNA3Kan) was acquired from pET‑28a(+) and pcDNA3 plasmids. A gene encoding full length HSV‑2 glycoprotein D (gD) was amplified from the pcDNA3‑gD plasmid, which was cloned into pcDNA3Kan resulting in the construction of the recombinant plasmid pcDNA3Kan‑gD (pgD). A DNA segment containing 8 CpG motifs was synthesized, and cloned into pcDNA3Kan, resulting in the recombinant plasmid pcDNA3Kan‑CpG (pCpG). Mice were co‑inoculated with pgD (used as a DNA vaccine) and pCpG (used as an adjuvant) by bilateral intramuscular injection. Mice inoculated with pgD+pCpG showed higher titers of antibodies than those inoculated with the DNA vaccine alone (P<0.05). In addition, mice inoculated with pgD+pCpG showed the highest percentage of CD4+ T cells in the blood of all the groups (P﹤0.05). Thus, the present study demonstrated that pCpG could stimulate the HSV‑2 DNA vaccine to induce a stronger cell‑mediated immune response than the DNA vaccine alone. The aim of the present study was to evaluate the efficacy of a HSV‑2 DNA vaccine (pgD) co‑immunized with a plasmid adjuvant containing CpG motifs (pCpG). Whether the pCpG would be able to stimulate the pgD to induce a stronger immune response compared with pgD alone.
Stoesser, Nicole; Sheppard, Anna E.; Pankhurst, Louise; Giess, Adam; Yeh, Anthony J.; Didelot, Xavier; Turner, Stephen D.; Sebra, Robert; Kasarskis, Andrew; Peto, Tim; Crook, Derrick; Sifri, Costi D.
2015-01-01
The global emergence of Klebsiella pneumoniae carbapenemase-producing K. pneumoniae (KPC-Kp) multilocus sequence type ST258 is widely recognized. Less is known about the molecular and epidemiological details of non-ST258 K. pneumoniae in the setting of an outbreak mediated by an endemic plasmid. We describe the interplay of blaKPC plasmids and K. pneumoniae strains and their relationship to the location of acquisition in a U.S. health care institution. Whole-genome sequencing (WGS) analysis was applied to KPC-Kp clinical isolates collected from a single institution over 5 years following the introduction of blaKPC in August 2007, as well as two plasmid transformants. KPC-Kp from 37 patients yielded 16 distinct sequence types (STs). Two novel conjugative blaKPC plasmids (pKPC_UVA01 and pKPC_UVA02), carried by the hospital index case, accounted for the presence of blaKPC in 21/37 (57%) subsequent cases. Thirteen (35%) isolates represented an emergent lineage, ST941, which contained pKPC_UVA01 in 5/13 (38%) and pKPC_UVA02 in 6/13 (46%) cases. Seven (19%) isolates were the epidemic KPC-Kp strain, ST258, mostly imported from elsewhere and not carrying pKPC_UVA01 or pKPC_UVA02. Using WGS-based analysis of clinical isolates and plasmid transformants, we demonstrate the unexpected dispersal of blaKPC to many non-ST258 lineages in a hospital through spread of at least two novel blaKPC plasmids. In contrast, ST258 KPC-Kp was imported into the institution on numerous occasions, with other blaKPC plasmid vectors and without sustained transmission. Instead, a newly recognized KPC-Kp strain, ST941, became associated with both novel blaKPC plasmids and spread locally, making it a future candidate for clinical persistence and dissemination. PMID:25561339
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leong, JoAnn Ching
A prototype subunit vaccine to IHN virus is being developed by recombinant DNA techniques. The techniques involve the isolation and characterization of the glycoprotein gene, which encodes the viral protein responsible for inducing a protective immune response in fish. The viral glycoprotein gene has been cloned and a restriction map of the cloned gene has been prepared. Preliminary DNA sequence analysis of the cloned gene has been initiated so that manipulation of the gene for maximum expression in appropriate plasmid vectors is possible. A recombinant plasmid containing the viral gene inserted in the proper orientation adjacent to a very strongmore » lambda promoter and ribosome binding site has been constructed. Evaluation of this recombinant plasmid for gene expression is being conducted. Immunization trials with purified viral glycoprotein indicate that fish are protected against lethal doses of IHNV after immersion and intraperitoneal methods of immunization. In addition, cross protection immunization trials indicate that Type 2 and Type 1 IHN virus produce glycoproteins that are cross-protective.« less
Pearson, J L; Pintel, D J
2000-03-30
Recombination within the coding region of the nonstructural genes of minute virus of mice (MVM), which generates functional levels of wild-type NS1, was observed in the absence of selective pressure following cotransfection of nonreplicating plasmids. P38 activity was used as a measure of recombinant NS1 production, which, together with direct detection of recombinant-generated products by RT-PCR, allowed an estimation of recombination efficiency. In addition, we show that very low levels of wild-type NS1 were able to significantly transactivate P38. Given that recombination following cotransfection can generate NS1 at these levels, our observations have implications for the study of parvoviral genetics, the construction of recombinant parvoviral vectors for gene therapy applications, and perhaps other systems using cotransfection of plasmids that share homologous sequences. Copyright 2000 Academic Press.
Coutinho, Eduarda; Batista, Cátia; Sousa, Fani; Queiroz, João; Costa, Diana
2017-03-06
Mitochondrial gene therapy seems to be a valuable and promising strategy to treat mitochondrial disorders. The use of a therapeutic vector based on mitochondrial DNA, along with its affinity to the site of mitochondria, can be considered a powerful tool in the reestablishment of normal mitochondrial function. In line with this and for the first time, we successfully cloned the mitochondrial gene ND1 that was stably maintained in multicopy pCAG-GFP plasmid, which is used to transform E. coli. This mitochondrial-gene-based plasmid was encapsulated into nanoparticles. Furthermore, the functionalization of nanoparticles with polymers, such as cellulose or gelatin, enhances their overall properties and performance for gene therapy. The fluorescence arising from rhodamine nanoparticles in mitochondria and a fluorescence microscopy study show pCAG-GFP-ND1-based nanoparticles' cell internalization and mitochondria targeting. The quantification of GFP expression strongly supports this finding. This work highlights the viability of gene therapy based on mitochondrial DNA instigating further in vitro research and clinical translation.
NASA Technical Reports Server (NTRS)
Chang, Chi-Yung (Inventor); Fang, Wai-Chi (Inventor); Curlander, John C. (Inventor)
1995-01-01
A system for data compression utilizing systolic array architecture for Vector Quantization (VQ) is disclosed for both full-searched and tree-searched. For a tree-searched VQ, the special case of a Binary Tree-Search VQ (BTSVQ) is disclosed with identical Processing Elements (PE) in the array for both a Raw-Codebook VQ (RCVQ) and a Difference-Codebook VQ (DCVQ) algorithm. A fault tolerant system is disclosed which allows a PE that has developed a fault to be bypassed in the array and replaced by a spare at the end of the array, with codebook memory assignment shifted one PE past the faulty PE of the array.
Non-viral gene delivery strategies for cancer therapy, tissue engineering and regenerative medicine
NASA Astrophysics Data System (ADS)
Bhise, Nupura S.
Gene therapy involves the delivery of deoxyribonucleic acid (DNA) into cells to override or replace a malfunctioning gene for treating debilitating genetic diseases, including cancer and neurodegenerative diseases. In addition to its use as a therapeutic, it can also serve as a technology to enable regenerative medicine strategies. The central challenge of the gene therapy research arena is developing a safe and effective delivery agent. Since viral vectors have critical immunogenic and tumorogenic safety issues that limit their clinical use, recent efforts have focused on developing non-viral biomaterial based delivery vectors. Cationic polymers are an attractive class of gene delivery vectors due to their structural versatility, ease of synthesis, biodegradability, ability to self-complex into nanoparticles with negatively charged DNA, capacity to carry large cargo, cellular uptake and endosomal escape capacity. In this thesis, we hypothesized that developing a biomaterial library of poly(betaamino esters) (PBAE), a newer class of cationic polymers consisting of biodegradable ester groups, would allow investigating vector design parameters and formulating effective non-viral gene delivery strategies for cancer drug delivery, tissue engineering and stem cell engineering. Consequently, a high-throughput transfection assay was developed to screen the PBAE-based nanoparticles in hard to transfect fibroblast cell lines. To gain mechanistic insights into the nanoparticle formulation process, biophysical properties of the vectors were characterized in terms of molecular weight (MW), nanoparticle size, zeta potential and plasmid per particle count. We report a novel assay developed for quantifying the plasmid per nanoparticle count and studying its implications for co-delivery of multiple genes. The MW of the polymers ranged from 10 kDa to 100 kDa, nanoparticle size was about 150 run, zeta potential was about 30 mV in sodium acetate buffer (25 mM, pH 5) and 30 to 100 plasmids were associated with a single polymeric nanoparticle. To develop PBAE vectors for application in cancer drug delivery and 3-D tissue engineered cultures, the gene delivery efficacy of PBAE nanoparticles was evaluated in mammary epithelial cells used as a model for studying normal development of mammary gland as well as the events that lead to development of breast cancer. We investigated how small molecular changes to the end-capping terminal group of the polymer and changes to the polymer MW affect gene delivery in 2-D mammary cell culture compared to 3-D primary organotypic cultured mouse mammary tissue. We reported that the polymers synthesized here are more effective for gene delivery than FuGENERTM HD, one of the leading commercially available reagents for non-viral gene delivery. We also highlighted that transfection of the 3-D organotypic cultures is more difficult than transfection of 2-D cultures, but likely models some of the key challenges for in vivo gene therapy more closely than 2-D cultures. Finally, we evaluated the use of PBAE nanotechnology for genetic manipulation of stem cell fate for regenerative medicine applications. We developed a PBAE nanoparticle based non-viral protocol and compared it with an electroporation based approach to deliver episomal plasmids encoding reprogramming factors for derivation of human induced pluripotent stem cells (hiPSC). The hiPSCs generated using these approaches can be differentiated into specific cell types for in vitro disease modeling and drug screening, specifically to study retinal degeneration.
Li, Da; Ping, Yuan; Xu, Fujian; Yu, Hai; Pan, Hongming; Huang, Hongliang; Wang, Qingqing; Tang, Guping; Li, Jun
2010-09-13
The success of cancer gene therapy highly relies on the gene delivery vector with high transfection activity and low toxicity. In the present study, eight-armed polyethylene glycol (EAP) and low molecular weight (LMW) polyethylenimine (PEI) were used as basic units to construct the architecture of a new star-shaped EAP-PEI copolymer (EAPP). MC11, a peptide capable of selectively binding fibroblast growth factor receptor (FGFR) on tumor cell membranes, was further conjugated to EAPP to produce the vector EAPP-MC11 (EAPPM) to enhance tumor targetability. This tumor-targeting vector EAPPM was observed to retard the plasmids mobility at a nitrogen/phosphorus (N/P) ratio of 3. The vector could efficiently condense plasmids within 300 nm nanoparticles with a positive zeta potential at the N/P ratio of 20 or above. While the cytotoxicity of EAPPM polyplexes was similar to that of LMW PEI, it was significantly lower than that of PEI (25 kDa) in HepG2 and PC3 cell lines. In vitro gene transfection with pDNA mediated by EAPPM showed that the transfection efficiency increased 15 times in HepG2 cells but remained at a similar level in PC3 cells in comparison with that of EAPP. By systemic injection of EAPPM/pDNA complexes into a HepG2-bearing mice model, luciferase expression detected in lung, liver, and tumor tissues demonstrated EAPPM could deliver in a targeted manner a reporter gene into tumor tissues, where the luciferase expression of EAPPM was 4 times higher than that of EAPP and even 23 times higher than that of PEI (25 kDa). Furthermore, it was found that the systemic delivery of EAPPM/pCSK-α-interferon complexes in vivo were much more effective in inhibiting tumor growth than EAPP or PEI (25 kDa). These results clearly show that EAPPM is an efficient and safe vector for FGFR-mediated targeted gene delivery both in vitro and in vivo. With low cytotoxicity and high targetability, EAPPM may have great potential as a delivery vector for future cancer gene therapy applications.
A Generic Protocol for Intracellular Expression of Recombinant Proteins in Bacillus subtilis.
Phan, Trang; Huynh, Phuong; Truong, Tuom; Nguyen, Hoang
2017-01-01
Bacillus subtilis (B. subtilis) is a potential and attractive host for the production of recombinant proteins. Different expression systems for B. subtilis have been developed recently, and various target proteins have been recombinantly synthesized and purified using this host. In this chapter, we introduce a generic protocol to express a recombinant protein in B. subtilis. It includes protocols for (1) using our typical expression vector (plasmid pHT254) to introduce a target gene, (2) transformation of the target vector into B. subtilis, and (3) evaluation of the actual expression of a recombinant protein.
Downing, Katrina J.; Leslie, Graeme; Thomson, Jennifer A.
2000-01-01
The cry1Ac7 gene of Bacillus thuringiensis strain 234, showing activity against the sugarcane borer Eldana saccharina, was cloned under the control of the tac promoter. The fusion was introduced into the broad-host-range plasmid pKT240 and the integration vector pJFF350 and without the tac promoter into the broad-host-range plasmids pML122 and pKmM0. These plasmids were introduced into a Pseudomonas fluorescens strain isolated from the phylloplane of sugarcane and the endophytic bacterium Herbaspirillum seropedicae found in sugarcane. The ptac-cry1Ac7 construct was introduced into the chromosome of P. fluorescens using the integration vector pJFF350 carrying the artificial interposon Omegon-Km. Western blot analysis showed that the expression levels of the integrated cry1Ac7 gene were much higher under the control of the tac promoter than under the control of its endogenous promoter. It was also determined that multicopy expression in P. fluorescens and H. seropedicae of ptac-cry1Ac7 carried on pKT240 caused plasmid instability with no detectable protein expression. In H. seropedicae, more Cry1Ac7 toxin was produced when the gene was cloned under the control of the Nmr promoter on pML122 than in the opposite orientation and bioassays showed that the former resulted in higher mortality of E. saccharina larvae than the latter. P. fluorescens 14::ptac-tox resulted in higher mortality of larvae than did P. fluorescens 14::tox. An increased toxic effect was observed when P. fluorescens 14::ptac-tox was combined with P. fluorescens carrying the Serratia marcescens chitinase gene chiA, under the control of the tac promoter, integrated into the chromosome. PMID:10877771
Mealey, Robert H.; Leib, Steven R.; Littke, Matt H.; Wagner, Bettina; Horohov, David W.; McGuire, Travis C.
2009-01-01
Effective DNA-based vaccines against lentiviruses will likely induce CTL against conserved viral proteins. Equine infectious anemia virus (EIAV) infects horses worldwide, and serves as a useful model for lentiviral immune control. Although attenuated live EIAV vaccines have induced protective immune responses, DNA-based vaccines have not. In particular, DNA-based vaccines have had limited success in inducing CTL responses against intracellular pathogens in the horse. We hypothesized that priming with a codon-optimized plasmid encoding EIAV Gag p15/p26 with co-administration of a plasmid encoding an equine IL-2/IgG fusion protein as a molecular adjuvant, followed by boosting with a vaccinia vector expressing Gag p15/p26, would induce protective Gag-specific CTL responses. Although the regimen induced Gag-specific CTL in four of seven vaccinated horses, CTL were not detected until after the vaccinia boost, and protective effects were not observed in EIAV challenged vaccinates. Unexpectedly, vaccinates had significantly higher viral loads and more severe clinical disease, associated with the presence of vaccine-induced CTL. It was concluded that 1.) further optimization of the timing and route of DNA immunization was needed for efficient CTL priming in vivo, 2.) co-administration of the IL-2/IgG plasmid did not enhance CTL priming by the Gag p15/p26 plasmid, 3.) vaccinia vectors are useful for lentivirus-specific CTL induction in the horse, 4.) Gag-specific CTL alone are either insufficient or a more robust Gag-specific CTL response is needed to limit EIAV viremia and clinical disease, and 5.) CTL-inducing vaccines lacking envelope immunogens can result in lentiviral disease enhancement. Although the mechanisms for enhancement associated with this vaccine regimen remain to be elucidated, these results have important implications for development of lentivirus T cell vaccines. PMID:19368787
ColE1-Plasmid Production in Escherichia coli: Mathematical Simulation and Experimental Validation.
Freudenau, Inga; Lutter, Petra; Baier, Ruth; Schleef, Martin; Bednarz, Hanna; Lara, Alvaro R; Niehaus, Karsten
2015-01-01
Plasmids have become very important as pharmaceutical gene vectors in the fields of gene therapy and genetic vaccination in the past years. In this study, we present a dynamic model to simulate the ColE1-like plasmid replication control, once for a DH5α-strain carrying a low copy plasmid (DH5α-pSUP 201-3) and once for a DH5α-strain carrying a high copy plasmid (DH5α-pCMV-lacZ) by using ordinary differential equations and the MATLAB software. The model includes the plasmid replication control by two regulatory RNA molecules (RNAI and RNAII) as well as the replication control by uncharged tRNA molecules. To validate the model, experimental data like RNAI- and RNAII concentration, plasmid copy number (PCN), and growth rate for three different time points in the exponential phase were determined. Depending on the sampled time point, the measured RNAI- and RNAII concentrations for DH5α-pSUP 201-3 reside between 6 ± 0.7 and 34 ± 7 RNAI molecules per cell and 0.44 ± 0.1 and 3 ± 0.9 RNAII molecules per cell. The determined PCNs averaged between 46 ± 26 and 48 ± 30 plasmids per cell. The experimentally determined data for DH5α-pCMV-lacZ reside between 345 ± 203 and 1086 ± 298 RNAI molecules per cell and 22 ± 2 and 75 ± 10 RNAII molecules per cell with an averaged PCN of 1514 ± 1301 and 5806 ± 4828 depending on the measured time point. As the model was shown to be consistent with the experimentally determined data, measured at three different time points within the growth of the same strain, we performed predictive simulations concerning the effect of uncharged tRNA molecules on the ColE1-like plasmid replication control. The hypothesis is that these tRNA molecules would have an enhancing effect on the plasmid production. The in silico analysis predicts that uncharged tRNA molecules would indeed increase the plasmid DNA production.
USDA-ARS?s Scientific Manuscript database
MRS926 is a livestock-associated methicillin-resistant Staphylococcus aureus (MRSA) strain of sequence type (ST) 398. In order to facilitate in vitro and in vivo studies of this strain, we sought to tag it with a fluorescent marker. We cloned a codon-optimized gene for TurboGFP into a shuttle vector...
Fechner, Henry; Vetter, Roland; Kurreck, Jens; Poller, Wolfgang
2017-01-01
Silencing of cardiac genes by RNA interference (RNAi) has developed into a powerful new method to treat cardiac diseases. Small interfering (si)RNAs are the inducers of RNAi, but cultured primary cardiomyocytes and heart are highly resistant to siRNA transfection. This can be overcome by delivery of small hairpin (sh)RNAs or artificial microRNA (amiRNAs) by cardiotropic adeno-associated virus (AAV) vectors. Here we describe as example of the silencing of a cardiac gene, the generation and cloning of shRNA, and amiRNAs directed against the cardiac protein phospholamban. We further describe the generation of AAV shuttle plasmids with self complementary vector genomes, the production of AAV vectors in roller bottles, and their purification via iodixanol gradient centrifugation and concentration with filter systems. Finally we describe the preparation of primary neonatal rat cardiomyocytes (PNRC), the transduction of PNRC with AAV vectors, and the maintenance of the transduced cell culture.
Rule-Based Design of Plant Expression Vectors Using GenoCAD.
Coll, Anna; Wilson, Mandy L; Gruden, Kristina; Peccoud, Jean
2015-01-01
Plant synthetic biology requires software tools to assist on the design of complex multi-genic expression plasmids. Here a vector design strategy to express genes in plants is formalized and implemented as a grammar in GenoCAD, a Computer-Aided Design software for synthetic biology. It includes a library of plant biological parts organized in structural categories and a set of rules describing how to assemble these parts into large constructs. Rules developed here are organized and divided into three main subsections according to the aim of the final construct: protein localization studies, promoter analysis and protein-protein interaction experiments. The GenoCAD plant grammar guides the user through the design while allowing users to customize vectors according to their needs. Therefore the plant grammar implemented in GenoCAD will help plant biologists take advantage of methods from synthetic biology to design expression vectors supporting their research projects.
Schoberle, Taylor J; Nguyen-Coleman, C Kim; May, Gregory S
2013-01-01
Fungal species are continuously being studied to not only understand disease in humans and plants but also to identify novel antibiotics and other metabolites of industrial importance. Genetic manipulations, such as gene deletion, gene complementation, and gene over-expression, are common techniques to investigate fungal gene functions. Although advances in transformation efficiency and promoter usage have improved genetic studies, some basic steps in vector construction are still laborious and time-consuming. Gateway cloning technology solves this problem by increasing the efficiency of vector construction through the use of λ phage integrase proteins and att recombination sites. We developed a series of Gateway-compatible vectors for use in genetic studies in a range of fungal species. They contain nutritional and drug-resistance markers and can be utilized to manipulate different filamentous fungal genomes. Copyright © 2013 Elsevier Inc. All rights reserved.
Black hole superradiance signatures of ultralight vectors
NASA Astrophysics Data System (ADS)
Baryakhtar, Masha; Lasenby, Robert; Teo, Mae
2017-08-01
The process of superradiance can extract angular momentum and energy from astrophysical black holes (BHs) to populate gravitationally bound states with an exponentially large number of light bosons. We analytically calculate superradiant growth rates for vectors around rotating BHs in the regime where the vector Compton wavelength is much larger than the BH size. Spin-1 bound states have superradiance times as short as a second around stellar BHs, growing up to a thousand times faster than their spin-0 counterparts. The fast rates allow us to use measurements of rapidly spinning BHs in x-ray binaries to exclude a wide range of masses for weakly coupled spin-1 particles, 5 ×10-14-2 ×10-11 eV ; lighter masses in the range 6 ×10-20-2 ×10-17 eV start to be constrained by supermassive BH spin measurements at a lower level of confidence. We also explore routes to detection of new vector particles possible with the advent of gravitational wave (GW) astronomy. The LIGO-Virgo Collaboration could discover hints of a new light vector particle in statistical analyses of masses and spins of merging BHs. Vector annihilations source continuous monochromatic gravitational radiation which could be observed by current GW observatories. At design sensitivity, Advanced LIGO may measure up to thousands of annihilation signals from within the Milky Way, while hundreds of BHs born in binary mergers across the observable Universe may superradiate vector bound states and become new beacons of monochromatic gravitational waves.
Holographic implementation of a binary associative memory for improved recognition
NASA Astrophysics Data System (ADS)
Bandyopadhyay, Somnath; Ghosh, Ajay; Datta, Asit K.
1998-03-01
Neural network associate memory has found wide application sin pattern recognition techniques. We propose an associative memory model for binary character recognition. The interconnection strengths of the memory are binary valued. The concept of sparse coding is sued to enhance the storage efficiency of the model. The question of imposed preconditioning of pattern vectors, which is inherent in a sparsely coded conventional memory, is eliminated by using a multistep correlation technique an the ability of correct association is enhanced in a real-time application. A potential optoelectronic implementation of the proposed associative memory is also described. The learning and recall is possible by using digital optical matrix-vector multiplication, where full use of parallelism and connectivity of optics is made. A hologram is used in the experiment as a longer memory (LTM) for storing all input information. The short-term memory or the interconnection weight matrix required during the recall process is configured by retrieving the necessary information from the holographic LTM.
Fast large-scale object retrieval with binary quantization
NASA Astrophysics Data System (ADS)
Zhou, Shifu; Zeng, Dan; Shen, Wei; Zhang, Zhijiang; Tian, Qi
2015-11-01
The objective of large-scale object retrieval systems is to search for images that contain the target object in an image database. Where state-of-the-art approaches rely on global image representations to conduct searches, we consider many boxes per image as candidates to search locally in a picture. In this paper, a feature quantization algorithm called binary quantization is proposed. In binary quantization, a scale-invariant feature transform (SIFT) feature is quantized into a descriptive and discriminative bit-vector, which allows itself to adapt to the classic inverted file structure for box indexing. The inverted file, which stores the bit-vector and box ID where the SIFT feature is located inside, is compact and can be loaded into the main memory for efficient box indexing. We evaluate our approach on available object retrieval datasets. Experimental results demonstrate that the proposed approach is fast and achieves excellent search quality. Therefore, the proposed approach is an improvement over state-of-the-art approaches for object retrieval.
Santangelo, K S; Bertone, A L
2011-12-01
To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.
Global, Local, and Graphical Person-Fit Analysis Using Person-Response Functions
ERIC Educational Resources Information Center
Emons, Wilco H. M.; Sijtsma, Klaas; Meijer, Rob R.
2005-01-01
Person-fit statistics test whether the likelihood of a respondent's complete vector of item scores on a test is low given the hypothesized item response theory model. This binary information may be insufficient for diagnosing the cause of a misfitting item-score vector. The authors propose a comprehensive methodology for person-fit analysis in the…
Nambiar, P. T. C.; Ma, S.-W.; Iyer, V. N.
1990-01-01
A region of DNA which determined the production of the insecticidal toxin of Bacillus thuringiensis subsp. israelensis was cloned into a derivative of a broad-host-range group IncQ plasmid vector of gram-negative bacteria. The plasmid which we constructed was transferred by conjugative mobilization into a Bradyrhizobium species that nodulates pigeon peas. In this species the construction was maintained stably in the absence of selection and expressed the gene that was installed. Experiments in a greenhouse with the strain which we constructed indicated that this organism provides protection against root nodule damage by the larvae of the insect Rivellia angulata (Diptera). Images PMID:16348294
Reverse Genetics of Newcastle Disease Virus.
Cardenas-Garcia, Stivalis; Afonso, Claudio L
2017-01-01
Reverse genetics allows for the generation of recombinant viruses or vectors used in functional studies, vaccine development, and gene therapy. This technique enables genetic manipulation and cloning of viral genomes, gene mutation through site-directed mutagenesis, along with gene insertion or deletion, among other studies. An in vitro infection-based system including the highly attenuated vaccinia virus Ankara strain expressing the T7 RNA polymerase from bacteriophage T7, with co-transfection of three helper plasmids and a full-length cDNA plasmid, was successfully developed to rescue genetically modified Newcastle disease viruses in 1999. In this chapter, the materials and the methods involved in rescuing Newcastle disease virus (NDV) from cDNA, utilizing site-directed mutagenesis and gene replacement techniques, are described in detail.
Chen, Letian; Wang, Fengpin; Wang, Xiaoyu; Liu, Yao-Guang
2013-01-01
Functional genomics requires vector construction for protein expression and functional characterization of target genes; therefore, a simple, flexible and low-cost molecular manipulation strategy will be highly advantageous for genomics approaches. Here, we describe a Ω-PCR strategy that enables multiple types of sequence modification, including precise insertion, deletion and substitution, in any position of a circular plasmid. Ω-PCR is based on an overlap extension site-directed mutagenesis technique, and is named for its characteristic Ω-shaped secondary structure during PCR. Ω-PCR can be performed either in two steps, or in one tube in combination with exonuclease I treatment. These strategies have wide applications for protein engineering, gene function analysis and in vitro gene splicing. PMID:23335613
Cloning of the active thymidine kinase gene of herpes simplex virus type 1 in Escherichia coli K-12.
Colbere-Garapin, F; Chousterman, S; Horodniceanu, F; Kourilsky, P; Garapin, A C
1979-08-01
A herpes simplex virus DNA fragment that is produced by digestion with BamHI endonuclease and carries the thymidine kinase (TK; ATP:thymidine 5'-phosphotransferase, EC 2.7.1.21) gene has been cloned in Escherichia coli. A recombinat plasmid, pFG5, has been analyzed extensively and a detailed restriction map is presented. pFG5 DNA efficiently transforms TK- mouse L cells. The TK coding sequence in the cloned fragment has been localized and a smaller recombinant plasmid, pAG0, also carrying an active TK gene, has been constructed to serve as a more convenient vector for transfer, into TK- cells, of genes previously cloned in E. coli.
Chen, Jian; Wan, Kang-Lin
2003-10-01
To recombine OspC gene from Borrelia burgdorferi PD91 of China and expressed it in E. coli for early diagnosis of Lyme disease. The OspC gene was amplified from the genome of Borrelia burgdorferi PD91 strain by polymerase chain reaction and recombined with plasmid PET-11D. The recombinant plasmid PET-11D-OspC was identified with PCR, restriction endonuclease analysis and sequencing. The antigenicity was verified with Western Blot. OspC gene was cloned correctly into vector PET-11D. The resultant sequence was definitely different from the published sequence. The recombinant OspC seemed to have had strong antigenicity. The findings laid basis for the studies on early diagnosis of Lyme disease.
Zhang, Huang-Ge; Xie, Jinfu; Dmitriev, Igor; Kashentseva, Elena; Curiel, David T; Hsu, Hui-Chen; Mountz, John D
2002-12-01
Production of large quantities of recombinant adeno-associated virus (AAV) is difficult and not cost-effective. To overcome this problem, we have explored the feasibility of creating a recombinant AAV encoding a 6xHis tag on the VP3 capsid protein. We generated a plasmid vector containing a six-His (6xHis)-tagged AAV VP3. A second plasmid vector was generated that contained the full-length AAV capsid capable of producing VP1 and VP2, but not VP3 due to a mutation at position 2809 that encodes the start codon for VP3. These plasmids, necessary for production of AAV, were transfected into 293 cells to generate a 6xHis-tagged VP3mutant recombinant AAV. The 6xHis-tagged VP3 did not affect the formation of AAV virus, and the physical properties of the 6xHis-modified AAV were equivalent to those of wild-type particles. The 6xHis-tagged AAV did not affect the production titer of recombinant AAV and could be used to purify the recombinant AAV using an Ni-nitrilotriacetic acid column. Addition of the 6xHis tag did not alter the viral tropism compared to wild-type AAV. These observations demonstrate the feasibility of producing high-titer AAV containing a 6xHis-tagged AAV VP3 capsid protein and to utilize the 6xHis-tagged VP3 capsid to achieve high-affinity purification of this recombinant AAV.
Gene therapy approaches for spinal cord injury
NASA Astrophysics Data System (ADS)
Bright, Corinne
As the biomedical engineering field expands, combination technologies are demonstrating enormous potential for treating human disease. In particular, intersections between the rapidly developing fields of gene therapy and tissue engineering hold promise to achieve tissue regeneration. Nonviral gene therapy uses plasmid DNA to deliver therapeutic proteins in vivo for extended periods of time. Tissue engineering employs biomedical materials, such as polymers, to support the regrowth of injured tissue. In this thesis, a combination strategy to deliver genes and drugs in a polymeric scaffold was applied to a spinal cord injury model. In order to develop a platform technology to treat spinal cord injury, several nonviral gene delivery systems and polymeric scaffolds were evaluated in vitro and in vivo. Nonviral vector trafficking was evaluated in primary neuronal culture to develop an understanding of the barriers to gene transfer in neurons and their supporting glia. Although the most efficient gene carrier in vitro differed from the optimal gene carrier in vivo, confocal and electron microscopy of these nonviral vectors provided insights into the interaction of these vectors with the nucleus. A novel pathway for delivering nanoparticles into the nuclei of neurons and Schwann cells via vesicle trafficking was observed in this study. Reporter gene expression levels were evaluated after direct and remote delivery to the spinal cord, and the optimal nonviral vector, dose, and delivery strategy were applied to deliver the gene encoding the basic fibroblast growth factor (bFGF) to the spinal cord. An injectable and biocompatible gel, composed of the amphiphillic polymer poly(ethylene glycol)-poly(epsilon-caprolactone)-poly(ethylene glycol) (PEG-PCL-PEG) was evaluated as a drug and gene delivery system in vitro, and combined with the optimized nonviral gene delivery system to treat spinal cord injury. Plasmid DNA encoding the bFGF gene and the therapeutic NEP1--40 peptide were incorporated in the PEG-PCL-PEG gel and injected into a lesion transecting the main dorsomedial and minor ventral medial corticospinal tract (CST). The degree of collateralization of the transected CST was quantified as an indicator of the regenerative potential of these treatments. At one month post-injury, we observed the robust rostral collateralization of the CST tract in response to the bFGF plasmid-loaded gel. In conclusion, we hope that this platform technology can be applied to the sustained local delivery of other proteins for the treatment of spinal cord injury.
Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.
Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi
2018-01-26
Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.
Tang, Yao Liang; Qian, Keping; Zhang, Y Clare; Shen, Leping; Phillips, M Ian
2005-12-01
The effect of a cardiac specific, hypoxia-regulated, human heme oxygenase-1 (hHO-1) vector to provide cardioprotection from ischemia-reperfusion injury was assessed. When myocardial ischemia and reperfusion is asymptomatic, the damaging effects are cumulative and patients miss timely treatment. A gene therapy approach that expresses therapeutic genes only when ischemia is experienced is a desirable strategy. We have developed a cardiac-specific, hypoxia-regulated gene therapy "vigilant vector'' system that amplifies cardioprotective gene expression. Vigilant hHO-1 plasmids, LacZ plasmids, or saline (n = 40 per group) were injected into mouse heart 2 days in advance of ischemia-reperfusion injury. Animals were exposed to 60 minutes of ischemia followed by 24 hours of reperfusion. For that term (24 hours) effects, the protein levels of HO-1, inflammatory responses, apoptosis, and infarct size were determined. For long-term (3 week) effects, the left ventricular remodeling and recovery of cardiac function were assessed. Ischemia-reperfusion resulted in a timely overexpression of HO-1 protein. Infarct size at 24 hours after ischemia-reperfusion was significantly reduced in the HO-1-treated animals compared with the LacZ-treated group or saline-treated group (P < .001). The reduction of infarct size was accompanied by a decrease in lipid peroxidant activity, inflammatory cell infiltration, and proapoptotic protein level in ischemia-reperfusion-injured myocardium. The long-term study demonstrated that timely, hypoxia-induced HO-1 overexpression is beneficial in conserving cardiac function and attenuating left ventricle remodelling. The vigilant HO-1 vector provides a protective therapy in the heart for reducing cellular damage during ischemia-reperfusion injury and preserving heart function.
Hong, Yang; Hondalus, Mary K
2008-10-01
Streptomyces PhiC31-based site-specific integration was used to transform the facultative intracellular pathogen Rhodococcus equi. The transformation efficiency of vectors incorporating the PhiC31 integrase and attP sites was comparable to that of replication plasmids using the same electroporation procedure. A single attB integration site was identified within an ORF encoding a pirin-like protein, which deviates slightly from the consensus sequence of Streptomyces attB sites. Vector integration was stably maintained in the R. equi chromosome for as many as 100 generations during unselected passage in vitro. In addition, integration does not appear to affect the replication of bacteria inside macrophages. Finally, this integration system was also used to successfully complement an R. equi mutant.
[Non-viral gene therapy approach for regenerative recovery of skin wounds in mammals].
Efremov, A M; Dukhovlinov, I V; Dizhe, E B; Burov, S V; Leko, M V; Akif'ev, B N; Mogilenko, D A; Ivanov, I A; Perevozchikov, A P; Orlov, S V
2010-01-01
The rate and character of skin tissue regeneration after wounds, burns and other traumas depend on the cell proliferation within damaged area. Acceleration of healing by stimulation of cell proliferation and extracellular matrix synthesis is one of the most important tasks of modern medicine. There are gene therapy approaches to wound treatment consisting in the transfer of genes encoding mitogenic growth factors to wound area. The most important step in the development of gene therapy approaches is the design of gene delivery tools. In spite of high efficacy of viral vectors, the non-viral means have some preferences (low toxicity, low immunogenity, safety and the absence of backside effects). Among non-viral gene delivery tools, molecular conjugates are the most popular because of their efficacy, simplicity, and the capacity to the targeted gene transfer. In the present work we have developed two molecular conjugates--NLS-TSF7 and NLS-TSF12 consisting of the modified signal of nuclear localization of T-antigen of SV40 virus (cationic part) and the peptide ligands of mammalian transferrin receptor (ligand part). These conjugates bind to plasmid DNA with formation of polyelectrolytic complexes and are capable to deliver plasmid DNA into cells expressing transferrin receptors by receptor-mediated endocytosis. Transfer of the expression vector of luciferase gene in the complex with molecular conjugate NLS-TSF7 to murine surface tissues led to about 100 fold increasing of luciferase activity in comparison with the transfer of free expression vector. Treatment of slash wounds in mice with the complexes of expression vector of synthetic human gene encoding insulin-like growth factor 1 with molecular conjugates NLS-TSF7 led to acceleration of healing in comparison with mice treated with free expression vector. The results obtained confirm the high efficiency of the developed regenerative gene therapy approach for the treatment of damaged skin tissues in mammals.
Breau, Cathy; Cameron, D William; Desjardins, Marc; Lee, B Craig
2012-01-31
Chancroid, a sexually transmitted genital ulcer disease caused by the Gram-negative bacterium Haemophilus ducreyi, facilitates the acquisition and transmission of HIV. An effective vaccine against chancroid has not been developed. In this preliminary study, the gene encoding the H. ducreyi outer membrane hemoglobin receptor HgbA was cloned into the plasmid pTETnir15. The recombinant construct was introduced into the attenuated Salmonella typhimurium SL3261 strain and stable expression was induced in vitro under anaerobic conditions. The vaccine strain was delivered into the temperature-dependent rabbit model of chancroid by intragastric immunization as a single dose, or as three doses administered at two-weekly intervals. No specific antibody to HgbA was elicited after either dose schedule. Although the plasmid vector survived in vivo passage for up to 15 days following single oral challenge, HgbA expression was restricted to plasmid isolates recovered one day after immunization. Rabbits inoculated with the 3-dose booster regimen achieved no protective immunity from homologous challenge. These results emphasize that refinements in plasmid design to enhance a durable heterologous protein expression are necessary for the development of a live oral vaccine against chancroid. Copyright © 2011 Elsevier B.V. All rights reserved.
High-Level Fluorescence Labeling of Gram-Positive Pathogens
Aymanns, Simone; Mauerer, Stefanie; van Zandbergen, Ger; Wolz, Christiane; Spellerberg, Barbara
2011-01-01
Fluorescence labeling of bacterial pathogens has a broad range of interesting applications including the observation of living bacteria within host cells. We constructed a novel vector based on the E. coli streptococcal shuttle plasmid pAT28 that can propagate in numerous bacterial species from different genera. The plasmid harbors a promoterless copy of the green fluorescent variant gene egfp under the control of the CAMP-factor gene (cfb) promoter of Streptococcus agalactiae and was designated pBSU101. Upon transfer of the plasmid into streptococci, the bacteria show a distinct and easily detectable fluorescence using a standard fluorescence microscope and quantification by FACS-analysis demonstrated values that were 10–50 times increased over the respective controls. To assess the suitability of the construct for high efficiency fluorescence labeling in different gram-positive pathogens, numerous species were transformed. We successfully labeled Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. equisimilis, Enterococcus faecalis, Enterococcus faecium, Streptococcus mutans, Streptococcus anginosus and Staphylococcus aureus strains utilizing the EGFP reporter plasmid pBSU101. In all of these species the presence of the cfb promoter construct resulted in high-level EGFP expression that could be further increased by growing the streptococcal and enterococcal cultures under high oxygen conditions through continuous aeration. PMID:21731607
Feng, Yong-qian; Zha, Xiao-jun; Zhai, Chao-yang
2007-07-01
To construct the eucaryotic recombinant plasmid of pYES2/LactoferricinB expressing in yeast of S. cerevisiae, of which the expressed protein antibacterial activity was verified in preliminary. By self-template PCR method, the gene of Lactoferricin B and its several sequence mutations were amplified with the parts of the pre-synthesized single chains. And then Lactoferricin B gene and its mutants were cloned into the vector of pYES2 to construct the recombined expression plasmid pYES2/Lactoferricin B etc. extracted and used to transform the yeast S. cerevisiae. The expressions of proteins were determined after induced by galactose. The expression proteins were collected and purified by hydronium-exchange column, and the bacterial inhibited test was applied to identify the protein antibacterial activities. The PCR amplifying and DNA sequencing tests indicated that the purpose plasmid contained the Lactoferricin B gene and several mutations. The induced target proteins were confirmed by SDS-PAGE electrophoresis and mass spectrum test. The protein antibacterial activities of mutations were verified in preliminary. The recombined plasmid pYES2/Lactoferricin B etc. are successfully constructed and induced to express in yeast cell of S. cerevisiae; the obtained recombined protein of Lactoferricin B provides a basis for further research work on the biological function and antibacterial activity.
Stochastic simulation of nucleation in binary alloys
NASA Astrophysics Data System (ADS)
L’vov, P. E.; Svetukhin, V. V.
2018-06-01
In this study, we simulate nucleation in binary alloys with respect to thermal fluctuations of the alloy composition. The simulation is based on the Cahn–Hilliard–Cook equation. We have considered the influence of some fluctuation parameters (wave vector cutoff and noise amplitude) on the kinetics of nucleation and growth of minority phase precipitates. The obtained results are validated by the example of iron–chromium alloys.
Novel “Superspreader” Bacteriophages Promote Horizontal Gene Transfer by Transformation
Bliskovsky, Valery V.; Malagon, Francisco; Baker, James D.; Prince, Jeffrey S.; Klaus, James S.; Adhya, Sankar L.
2017-01-01
ABSTRACT Bacteriophages infect an estimated 1023 to 1025 bacterial cells each second, many of which carry physiologically relevant plasmids (e.g., those encoding antibiotic resistance). However, even though phage-plasmid interactions occur on a massive scale and have potentially significant evolutionary, ecological, and biomedical implications, plasmid fate upon phage infection and lysis has not been investigated to date. Here we show that a subset of the natural lytic phage population, which we dub “superspreaders,” releases substantial amounts of intact, transformable plasmid DNA upon lysis, thereby promoting horizontal gene transfer by transformation. Two novel Escherichia coli phage superspreaders, SUSP1 and SUSP2, liberated four evolutionarily distinct plasmids with equal efficiency, including two close relatives of prominent antibiotic resistance vectors in natural environments. SUSP2 also mediated the extensive lateral transfer of antibiotic resistance in unbiased communities of soil bacteria from Maryland and Wyoming. Furthermore, the addition of SUSP2 to cocultures of kanamycin-resistant E. coli and kanamycin-sensitive Bacillus sp. bacteria resulted in roughly 1,000-fold more kanamycin-resistant Bacillus sp. bacteria than arose in phage-free controls. Unlike many other lytic phages, neither SUSP1 nor SUSP2 encodes homologs to known hydrolytic endonucleases, suggesting a simple potential mechanism underlying the superspreading phenotype. Consistent with this model, the deletion of endonuclease IV and the nucleoid-disrupting protein ndd from coliphage T4, a phage known to extensively degrade chromosomal DNA, significantly increased its ability to promote plasmid transformation. Taken together, our results suggest that phage superspreaders may play key roles in microbial evolution and ecology but should be avoided in phage therapy and other medical applications. PMID:28096488
Haddad, Diana; Bilcikova, Erika; Witney, Adam A.; Carlton, Jane M.; White, Charles E.; Blair, Peter L.; Chattopadhyay, Rana; Russell, Joshua; Abot, Esteban; Charoenvit, Yupin; Aguiar, Joao C.; Carucci, Daniel J.; Weiss, Walter R.
2004-01-01
We describe a novel approach for identifying target antigens for preerythrocytic malaria vaccines. Our strategy is to rapidly test hundreds of DNA vaccines encoding exons from the Plasmodium yoelii yoelii genomic sequence. In this antigen identification method, we measure reduction in parasite burden in the liver after sporozoite challenge in mice. Orthologs of protective P. y. yoelii genes can then be identified in the genomic databases of Plasmodium falciparum and Plasmodium vivax and investigated as candidate antigens for a human vaccine. A pilot study to develop the antigen identification method approach used 192 P. y. yoelii exons from genes expressed during the sporozoite stage of the life cycle. A total of 182 (94%) exons were successfully cloned into a DNA immunization vector with the Gateway cloning technology. To assess immunization strategies, mice were vaccinated with 19 of the new DNA plasmids in addition to the well-characterized protective plasmid encoding P. y. yoelii circumsporozoite protein. Single plasmid immunization by gene gun identified a novel vaccine target antigen which decreased liver parasite burden by 95% and which has orthologs in P. vivax and P. knowlesi but not P. falciparum. Intramuscular injection of DNA plasmids produced a different pattern of protective responses from those seen with gene gun immunization. Intramuscular immunization with plasmid pools could reduce liver parasite burden in mice despite the fact that none of the plasmids was protective when given individually. We conclude that high-throughput cloning of exons into DNA vaccines and their screening is feasible and can rapidly identify new malaria vaccine candidate antigens. PMID:14977966
One pyrimidine dimer inactivates expression of a transfected gene in xeroderma pigmentosum cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Protic-Sabljic, M.; Kraemer, K.H.
1985-10-01
The authors have developed a host cell reactivation assay of DNA repair utilizing UV-treated plasmid vectors. The assay primarily reflects cellular repair of transcriptional activity of damaged DNA measured indirectly as enzyme activity of the transfected genes. They studied three plasmids (pSV2cat, 5020 base pairs; pSV2catSVgpt, 7268 base pairs; and pRSVcat, 5027 base pairs) with different sizes and promoters carrying the bacterial cat gene (CAT, chloramphenicol acetyltransferase) in a construction that permits cat expression in human cells. All human simian virus 40-transformed cells studied expressed high levels of the transfected cat gene. UV treatment of the plasmids prior to transfectionmore » resulted in differential decrease in CAT activity in different cell lines. With pSV2catSVgpt, UV inactivation of CAT expression was greater in the xeroderma pigmentosum group A and D lines than in the other human cell lines tested. The D0 of the CAT inactivation curve was 50 J X m-2 for pSV2cat and for pRSVcat in the xeroderma pigmentosum group A cells. The similarity of the D0 data in the xeroderma pigmentosum group A cells for three plasmids of different size and promoters implies they all have similar UV-inactivation target size. UV-induced pyrimidine dimer formation in the plasmids was quantified by assay of the number of UV-induced T4 endonuclease V-sensitive sites. In the most sensitive xeroderma pigmentosum cells, with all three plasmids, one UV-induced pyrimidine dimer inactivates a target of about 2 kilobases, close to the size of the putative CAT mRNA.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feyereisen-Koener, J.M.
Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.
Code of Federal Regulations, 2010 CFR
2010-07-01
...-endotoxins of Bacillus thuringiensis var. kurstaki encapsulated in killed Pseudomonas fluorescens, and the... RESIDUES IN FOOD Exemptions From Tolerances § 180.1154 CryIA(c) and CryIC derived delta-endotoxins of... plasmid and cloning vector genetic constructs. CryIA(c) and CryIC derived delta-endotoxins of Bacillus...
Code of Federal Regulations, 2011 CFR
2011-07-01
...-endotoxins of Bacillus thuringiensis var. kurstaki encapsulated in killed Pseudomonas fluorescens, and the... RESIDUES IN FOOD Exemptions From Tolerances § 180.1154 CryIA(c) and CryIC derived delta-endotoxins of... plasmid and cloning vector genetic constructs. CryIA(c) and CryIC derived delta-endotoxins of Bacillus...
Code of Federal Regulations, 2013 CFR
2013-07-01
...-endotoxins of Bacillus thuringiensis var. kurstaki encapsulated in killed Pseudomonas fluorescens, and the... RESIDUES IN FOOD Exemptions From Tolerances § 180.1154 CryIA(c) and CryIC derived delta-endotoxins of... plasmid and cloning vector genetic constructs. CryIA(c) and CryIC derived delta-endotoxins of Bacillus...
Code of Federal Regulations, 2012 CFR
2012-07-01
...-endotoxins of Bacillus thuringiensis var. kurstaki encapsulated in killed Pseudomonas fluorescens, and the... RESIDUES IN FOOD Exemptions From Tolerances § 180.1154 CryIA(c) and CryIC derived delta-endotoxins of... plasmid and cloning vector genetic constructs. CryIA(c) and CryIC derived delta-endotoxins of Bacillus...
Code of Federal Regulations, 2014 CFR
2014-07-01
...-endotoxins of Bacillus thuringiensis var. kurstaki encapsulated in killed Pseudomonas fluorescens, and the... RESIDUES IN FOOD Exemptions From Tolerances § 180.1154 CryIA(c) and CryIC derived delta-endotoxins of... plasmid and cloning vector genetic constructs. CryIA(c) and CryIC derived delta-endotoxins of Bacillus...
Robust and accurate vectorization of line drawings.
Hilaire, Xavier; Tombre, Karl
2006-06-01
This paper presents a method for vectorizing the graphical parts of paper-based line drawings. The method consists of separating the input binary image into layers of homogeneous thickness, skeletonizing each layer, segmenting the skeleton by a method based on random sampling, and simplifying the result. The segmentation method is robust with a best bound of 50 percent noise reached for indefinitely long primitives. Accurate estimation of the recognized vector's parameters is enabled by explicitly computing their feasibility domains. Theoretical performance analysis and expression of the complexity of the segmentation method are derived. Experimental results and comparisons with other vectorization systems are also provided.
Zhang, Yinfeng; Sun, Caijun; Feng, Liqiang; Xiao, Lijun; Chen, Ling
2012-04-01
Accessory and regulatory proteins (nonstructural proteins) have received increasing attention as components in novel HIV/SIV vaccine design. However, the complicated interactions between nonstructural proteins and structural proteins remain poorly understood, especially their effects on immunogenicity. In this study, the immunogenicity of structural proteins in the presence and absence of nonstructural proteins was compared. First, a series of recombinant plasmids and adenoviral vectors carrying various SIVmac239 nonstructural and structural genes was constructed. Then mice were primed with DNA plasmids and boosted with corresponding Ad5 vectors of different combinations, and the resulting immune responses were measured. Our results demonstrated that when the individual Gag, Pol, or Env gene products were coimmunized with the whole repertoire of nonstructural proteins, the Gag-specific CD8(+) T response was greatly enhanced, while the Env- and Pol-specific CD8(+) T responses were significantly reduced. The same pattern was not observed in CD4(+) T cell responses. Antibody responses against both the Gag and Env proteins were elicited more effectively when these structural antigens were immunized together with nonstructural antigens. These findings may provide helpful insights into the development of novel HIV/SIV vaccines.
Carú, M; Cifuentes, V; Pincheira, G; Jiménez, A
1989-10-01
A plasmid (named pCN2) carrying a 7.6 kb BamHI DNA insert was isolated from a Neurospora crassa genomic library raised in the yeast vector YRp7. Saccharomyces cerevisiae suco and N. crassa inv strains transformed with pNC2 were able to grow on sucrose-based media and expressed invertase activity. Saccharomyces cerevisiae suco (pNC2) expressed a product which immunoreacted with antibody raised against purified invertase from wild type N. crassa, although S. cerevisiae suc+ did not. The cloned DNA hybridized with a 7.6 kb DNA fragment from BamHI-restricted wild type N. crassa DNA. Plasmid pNC2 transformed N. crassa Inv- to Inv+ by integration either near to the endogenous inv locus (40% events) or at other genomic sites (60% events). It appears therefore that the cloned DNA piece encodes the N. crassa invertase enzyme. A 3.8 kb XhoI DNA fragment, derived from pNC2, inserted in YRp7, in both orientation, was able to express invertase activity in yeast, suggesting that it contains an intact invertase gene which is not expressed from a vector promoter.
Schwach, Frank; Bushell, Ellen; Gomes, Ana Rita; Anar, Burcu; Girling, Gareth; Herd, Colin; Rayner, Julian C; Billker, Oliver
2015-01-01
The Plasmodium Genetic Modification (PlasmoGEM) database (http://plasmogem.sanger.ac.uk) provides access to a resource of modular, versatile and adaptable vectors for genome modification of Plasmodium spp. parasites. PlasmoGEM currently consists of >2000 plasmids designed to modify the genome of Plasmodium berghei, a malaria parasite of rodents, which can be requested by non-profit research organisations free of charge. PlasmoGEM vectors are designed with long homology arms for efficient genome integration and carry gene specific barcodes to identify individual mutants. They can be used for a wide array of applications, including protein localisation, gene interaction studies and high-throughput genetic screens. The vector production pipeline is supported by a custom software suite that automates both the vector design process and quality control by full-length sequencing of the finished vectors. The PlasmoGEM web interface allows users to search a database of finished knock-out and gene tagging vectors, view details of their designs, download vector sequence in different formats and view available quality control data as well as suggested genotyping strategies. We also make gDNA library clones and intermediate vectors available for researchers to produce vectors for themselves. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guss, Adam M.; Rother, Michael; Zhang, Jun Kai
A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less
Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...
2008-01-01
A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less
Shang, Yonglei; Tesar, Devin; Hötzel, Isidro
2015-10-01
A recently described dual-host phage display vector that allows expression of immunoglobulin G (IgG) in mammalian cells bypasses the need for subcloning of phage display clone inserts to mammalian vectors for IgG expression in large antibody discovery and optimization campaigns. However, antibody discovery and optimization campaigns usually need different antibody formats for screening, requiring reformatting of the clones in the dual-host phage display vector to an alternative vector. We developed a modular protein expression system mediated by RNA trans-splicing to enable the expression of different antibody formats from the same phage display vector. The heavy-chain region encoded by the phage display vector is directly and precisely fused to different downstream heavy-chain sequences encoded by complementing plasmids simply by joining exons in different pre-mRNAs by trans-splicing. The modular expression system can be used to efficiently express structurally correct IgG and Fab fragments or other antibody formats from the same phage display clone in mammalian cells without clone reformatting. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Wong, Wing Yee; Su, Ping; Allison, Gwen E.; Liu, Chun-Qiang; Dunn, Noel W.
2003-01-01
A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cdr phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus. PMID:14532023
Wong, Wing Yee; Su, Ping; Allison, Gwen E; Liu, Chun-Qiang; Dunn, Noel W
2003-10-01
A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cd(r) phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus.
Welikala, R A; Fraz, M M; Dehmeshki, J; Hoppe, A; Tah, V; Mann, S; Williamson, T H; Barman, S A
2015-07-01
Proliferative diabetic retinopathy (PDR) is a condition that carries a high risk of severe visual impairment. The hallmark of PDR is the growth of abnormal new vessels. In this paper, an automated method for the detection of new vessels from retinal images is presented. This method is based on a dual classification approach. Two vessel segmentation approaches are applied to create two separate binary vessel map which each hold vital information. Local morphology features are measured from each binary vessel map to produce two separate 4-D feature vectors. Independent classification is performed for each feature vector using a support vector machine (SVM) classifier. The system then combines these individual outcomes to produce a final decision. This is followed by the creation of additional features to generate 21-D feature vectors, which feed into a genetic algorithm based feature selection approach with the objective of finding feature subsets that improve the performance of the classification. Sensitivity and specificity results using a dataset of 60 images are 0.9138 and 0.9600, respectively, on a per patch basis and 1.000 and 0.975, respectively, on a per image basis. Copyright © 2015 Elsevier Ltd. All rights reserved.
2013-01-01
Background Halomonas sp. ZM3 was isolated from Zelazny Most post-flotation mineral waste repository (Poland), which is highly contaminated with heavy metals and various organic compounds. Mobile DNA of the strain (i.e. plasmids and transposons) were analyzed in order to identify genetic information enabling adaptation of the bacterium to the harsh environmental conditions. Results The analysis revealed that ZM3 carries plasmid pZM3H1 (31,370 bp), whose replication system may be considered as an archetype of a novel subgroup of IncU-like replicons. pZM3H1 is a narrow host range, mobilizable plasmid (encodes a relaxase of the MOBV family) containing mercury resistance operon (mer) and czcD genes (mediate resistance to zinc and cobalt), which are part of a large truncated Tn3 family transposon. Further analysis demonstrated that the phenotypes determined by the pZM3H1 resistance cassette are highly dependent on the host strain. In another strand of the study, the trap plasmid pMAT1 was employed to identify functional transposable elements of Halomonas sp. ZM3. Using the sacB positive selection strategy two insertion sequences were identified: ISHsp1 - representing IS5 group of IS5 family and ISHsp2 - a distinct member of the IS630 family. Conclusions This study provides the first detailed description of mobile DNA in a member of the family Halomonadaceae. The identified IncU plasmid pZM3H1 confers resistance phenotypes enabling adaptation of the host strain to the Zelazny Most environment. The extended comparative analysis has shed light on the distribution of related IncU plasmids among bacteria, which, in many cases, reflects the frequency and direction of horizontal gene transfer events. Our results also identify plasmid-encoded modules, which may form the basis of novel shuttle vectors, specific for this group of halophilic bacteria. PMID:23497212
Phagemid vectors for phage display: properties, characteristics and construction.
Qi, Huan; Lu, Haiqin; Qiu, Hua-Ji; Petrenko, Valery; Liu, Aihua
2012-03-30
Phagemids are filamentous-phage-derived vectors containing the replication origin of a plasmid. Phagemids usually encode no or only one kind of coat proteins. Other structural and functional proteins necessary to accomplish the life cycle of phagemid are provided by the helper phage. In addition, other elements such as molecular tags and selective markers are introduced into the phagemids to facilitate the subsequent operations, such as gene manipulation and protein purification. This review summarizes the elements of the phagemids and their corresponding functions. Finally, the possible trends and future direction to improve the characteristics of the phagemids are highlighted. Copyright © 2012 Elsevier Ltd. All rights reserved.
Schuller, D J; Fetter, C H; Banaszak, L J; Grant, G A
1989-02-15
The serA gene of Escherichia coli strain K-12, which codes for the cooperative allosteric enzyme D-3-phosphoglycerate dehydrogenase, was inserted into an inducible expression vector which produced phosphoglycerate dehydrogenase as 8% of the soluble protein of E. coli. The purified protein was used to grow several different single crystal forms. One of these, with space group P2(1), appears to contain all four subunits of the tetrameric enzyme in the asymmetric unit and diffracts to sufficient resolution to allow determination of the structure of phosphoglycerate dehydrogenase.
Abdizadeh, Rahman; Maraghi, Sharif; Ghadiri, Ata A.; Tavalla, Mehdi; Shojaee, Saeedeh
2015-01-01
Background: Toxoplasmosis is an opportunistic protozoan infection with a high prevalence in a broad range of hosts infecting up to one-third of the world human population. Toxoplasmosis leads to serious medical problems in immunocompromised individuals and fetuses and also induces abortion and mortality in domestic animals. Therefore, there is a huge demand for the development of an effective vaccine. Surface Antigen 1 (SAG1) is one of the important immunodominant surface antigens of Toxoplasma gondii, which interacts with host cells and primarily involved in adhesion, invasion and stimulation of host immune response. Surface antigen 1 is considered as the leading candidate for development of an effective vaccine against toxoplasmosis. Objectives: The purpose of this study was to clone the major surface antigen1 gene (SAG1) from the genotype 1 of T. gondii, RH strain into the eukaryotic expression vector pVAX1 in order to use for a DNA vaccine. Materials and Methods: Genomic DNA was extracted from tachyzoite of the parasite using the QIAamp DNA mini kit. After designing the specific primers, SAG1 gene was amplified by Polymerase Chain Reaction (PCR). The purified PCR products were then cloned into a pPrime plasmid vector. The aforementioned product was subcloned into the pVAX1 eukaryotic expression vector. The recombinant pVAX1-SAG1 was then transfected into Chinese Hamster Ovary (CHO) cells and expression of SAG1 antigen was evaluated using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), Immunofluorescence Assay (IFA) and Western Blotting (WB). Results: The cloning and subcloning products (pPrime-SAG1 and pVAX1-SAG1 plasmid vectors) of SAG1 gene were verified and confirmed by enzyme digestion and sequencing. A 30 kDa recombinant protein was expressed in CHO cells as shown by IFA and WB methods. Conclusions: The pVAX1 expression vector and CHO cells are a suitable system for high-level recombinant protein production for SAG1 gene from T. gondii parasites and are promising approaches for antigen preparation in vaccine development. PMID:25861441
Khanam, Saima; Rajendra, Pilankatta; Khanna, Navin; Swaminathan, Sathyamangalam
2007-02-15
Dengue is a public health problem of global significance for which there is neither an effective antiviral therapy nor a preventive vaccine. It is a mosquito-borne viral disease, caused by dengue (DEN) viruses, which are members of the Flaviviridae family. There are four closely related serotypes, DEN-1, DEN-2, DEN-3 and DEN-4, each of which is capable of causing disease. As immunity to any one serotype can potentially sensitize an individual to severe disease during exposure to a heterologous serotype, the general consensus is that an effective vaccine should be tetravalent, that is, it must be capable of affording protection against all four serotypes. The current strategy of creating tetravalent vaccine formulations by mixing together four monovalent live attenuated vaccine viruses has revealed the phenomenon of viral interference leading to the manifestation of immune responses biased towards a single serotype. This work stems from the emergence of (i) the DEN virus envelope (E) domain III (EDIII) as the most important region of the molecule from a vaccine perspective and (ii) the adenovirus (Ad) as a promising vaccine vector platform. We describe the construction of a recombinant, replication-defective Ad (rAd) vector encoding a chimeric antigen made of in-frame linked EDIIIs of DEN virus serotypes 2 and 4. Using this rAd vector, in conjunction with a plasmid vector encoding the same chimeric bivalent antigen, in a prime-boost strategy, we show that it is possible to elicit equipotent neutralizing and T cell responses specific to both DEN serotypes 2 and 4. Our data support the hypothesis that a DEN vaccine targeting more than one serotype may be based on a single DNA-based vector to circumvent viral interference. This work lays the foundation for developing a single Ad vector encoding EDIIIs of all four DEN serotypes to evoke a balanced immune response against each one of them. Thus, this work has implications for the development of safe and effective tetravalent dengue vaccines.
Oem, Jae-Ku; Xiang, Zhonghua; Zhou, Yan; Babiuk, Lorne A; Liu, Qiang
2007-09-01
Hepatitis C virus (HCV) causes severe liver diseases in a large population worldwide. HCV protein translation is controlled by an internal ribosomal entry site (IRES) within the 5'-untranslated region (UTR). HCV IRES-dependent translation is critical for HCV-associated pathogenesis. To develop a plasmid DNA transfection system by using RNA polymerase I promoter and terminator sequences for studying HCV IRES-dependent translation. A gene cassette containing HCV 5'-UTR, Renilla luciferase reporter gene, and HCV 3'-UTR was inserted between RNA polymerase I promoter and terminator sequences. HCV IRES-directed translation was determined by luciferase assay after transfection. Transfection of the RNA polymerase I-HCV IRES plasmid into human hepatoma Huh-7 and HepG2 cells resulted in luciferase gene expression. Deletion of the IIIf domain in HCV IRES dramatically reduced luciferase activity. Our results indicated that the plasmid vector system-based on RNA polymerase I promoter and terminator sequences represents an effective approach for the study of HCV IRES-dependent translation.
Rao, Xueqin; Sun, Jie
2015-09-01
Watermelon silver mottle virus (WSMoV), which belongs to the genus Tospovirus , causes significant loss in Cucurbitaceae plants. Development of a highly sensitive and reliable detection method for WSMoV. Recombinant plasmids for targeting the sequence of nucleocapsid protein gene of WSMoV were constructed. SYBR Green I real-time PCR was established and evaluated with standard recombinant plasmids and 27 watermelon samples showing WSMoV infection symptoms. The recombinant plasmid was used as template for SYBR Green I real-time PCR to generate standard and melting curves. Melting curve analysis indicated no primer-dimers and non-specific products in the assay. No cross-reaction was observed with Capsicum chlorosis virus (genus Tospovirus ) and Cucumber mosaic virus (genus Cucumovirus). Repeatability tests indicated that inter-assay variability of the Ct values was 1.6%. A highly sensitive, reliable and rapid detection method of SYBR Green I real-time PCR for timely detection of WSMoV plants and vector thrips was established, which will facilitate disease forecast and control.
Li, Yan-Jie; Cao, Jiang; Chen, Chong; Wang, Dong-Yang; Zeng, Ling-Yu; Pan, Xiu-Ying; Xu, Kai-Lin
2010-02-01
This study was purposed to construct a lentiviral vector encoding red fluorescent protein (DsRed) and transfect DsRed into EL4 cells for establishing mouse leukemia/lymphoma model expressing DsRed. The bicistronic SIN lentiviral transfer plasmid containing the genes encoding neo and internal ribosomal entry site-red fluorescent protein (IRES-DsRed) was constructed. Human embryonic kidney 293FT cells were co-transfected with the three plasmids by liposome method. The viral particles were collected and used to transfect EL4 cells, then the cells were selected by G418. The results showed that the plasmid pXZ208-neo-IRES-DsRed was constructed successfully, and the viral titer reached to 10(6) U/ml. EL4 cells were transfected by the viral solution efficiently. The transfected EL4 cells expressing DsRed survived in the final concentration 600 microg/ml of G418. The expression of DsRed in the transfected EL4 cells was demonstrated by fluorescence microscopy and flow cytometry. In conclusion, the EL4/DsRed cell line was established successfully.
Xiao, Bo; Wan, Ying; Wang, Xiaoyu; Zha, Qichen; Liu, Haoming; Qiu, Zhiye; Zhang, Shengmin
2012-03-01
A series of N-(2-hydroxy)propyl-3-trimethyl ammonium chitosan chloride (HTCC) samples with various degrees of quaternization ranging from 12.4 to 43.7% was synthesized. The structures and properties of HTCC were investigated by FT-IR, (1)H NMR, conductometric titration and XRD analysis. It was found that HTCC had a more amorphous structure than chitosan. HTCC samples showed significantly lower cytotoxicity than polyethyleneimine in HepG2 and HeLa cell lines. The samples spontaneously formed complexes with pGL3 luciferase plasmid. These complexes had desirable particle sizes (160-300 nm) and zeta potentials (10.8-18.7 mV) when the weight ratios of HTCC to plasmid altered in the range of 3:1-20:1. In vitro gene transfection results indicated that HTCC had significantly high transfection efficiency compared with chitosan for delivering pGL3 luciferase plasmid to HeLa cells. The results suggest that HTCC could be a promising non-viral vector for safe and efficient DNA delivery. Copyright © 2011 Elsevier B.V. All rights reserved.
Wide Binaries in TGAS: Search Method and First Results
NASA Astrophysics Data System (ADS)
Andrews, Jeff J.; Chanamé, Julio; Agüeros, Marcel A.
2018-04-01
Half of all stars reside in binary systems, many of which have orbital separations in excess of 1000 AU. Such binaries are typically identified in astrometric catalogs by matching the proper motions vectors of close stellar pairs. We present a fully Bayesian method that properly takes into account positions, proper motions, parallaxes, and their correlated uncertainties to identify widely separated stellar binaries. After applying our method to the >2 × 106 stars in the Tycho-Gaia astrometric solution from Gaia DR1, we identify over 6000 candidate wide binaries. For those pairs with separations less than 40,000 AU, we determine the contamination rate to be ~5%. This sample has an orbital separation (a) distribution that is roughly flat in log space for separations less than ~5000 AU and follows a power law of a -1.6 at larger separations.
Detection of osteoclastic cell-cell fusion through retroviral vector packaging.
Kondo, Takako; Ikeda, Kyoji; Matsuo, Koichi
2004-11-01
Cell-cell fusion generates multinucleated cells such as osteoclasts in bone, myotubes in muscle, and trophoblasts in placenta. Molecular details governing these fusion processes are still largely unknown. As a step toward identification of fusogenic genes, we tested the concept that retroviral vectors can be packaged as a result of cell-cell fusion. First, we introduced replication-deficient retroviral vectors expressing mCAT-1, which mediates fusogenic interaction with the retroviral envelope protein Env, into Chinese hamster ovary (CHO) cells to generate vector cells. Plasmids expressing virion proteins Gag, Pol, and Env were introduced into a separate culture of CHO cells to generate packaging cells. Co-culturing vector and packaging cells resulted in production of infectious retroviruses carrying the mCAT-1 gene as a consequence of cell-cell fusion. Second, we introduced a retroviral vector into primary osteoclast precursors and co-cultured them with established osteoclast precursor RAW264.7 cells, which turned out to harbor packaging activity. Packaged retroviral vector was detected in culture supernatants only where the osteoclast differentiation factor receptor activator for NF-kappaB ligand (RANKL) induced fusion between these two cell types. These data suggest that retrovirus production can occur as a result of cell-cell fusion. This provides a novel approach for isolating and characterizing fusogenic genes using retroviral expression vectors.
Ma, Benjiang; Hang, Changshou; Zhao, Yun; Wang, Shiwen; Xie, Yanxiang
2002-09-01
To construct a novel baculovirus vector which is capable of promoting the high-yield expression of foreign gene in mammalian cells and to express by this vector the nucleoprotein (NP) gene of Crimean-Congo hemorrhagic fever virus (CCHFV) Chinese isolate (Xinjiang hemorrhagic fever virus, XHFV) BA88166 in insect and Vero cells. Human cytomegalovirus (CMV) immediate early (IE) promoter was ligated to the baculovirus vector pFastBac1 downstream of the polyhedrin promoter to give rise to the novel vector pCB1. XHFV NP gene was cloned to this vector and was well expressed in COS-7 cells and Vero cells by means of recombinant plasmid transfection and baculovirus infection. The XHFV NP gene in vector pCB1 could be well expressed in mammalian cells. Vero cells infected with recombinant baculovirus harboring NP gene could be employed as antigens to detect XHF serum specimens whose results were in good correlation with those of ELISA and in parallel with clinical diagnoses. This novel baculovirus vector is able to express the foreign gene efficiently in both insect and mammalian cells, which provides not only the convenient diagnostic antigens but also the potential for developing recombinant virus vaccines and gene therapies.
The history of vaccination against cytomegalovirus.
Plotkin, Stanley
2015-06-01
Cytomegalovirus vaccine development started in the 1970s with attenuated strains. In the 1980s, one of the strains was shown to be safe and effective in renal transplant patients. Then, attention switched to glycoprotein gB, which was shown to give moderate but transient protection against acquisition of the virus by women. The identification of the pp65 tegument protein as the principal target of cellular immune responses resulted in new approaches, particularly DNA, plasmids to protect hematogenous stem cell recipients. The subsequent discovery of the pentameric protein complex that generates most neutralizing antibodies led to efforts to incorporate that complex into vaccines. At this point, there are many candidate CMV vaccines, including live recombinants, replication-defective virus, DNA plasmids, soluble pentameric proteins, peptides, virus-like particles and vectored envelope proteins.
PCR-mediated site-directed mutagenesis.
Carey, Michael F; Peterson, Craig L; Smale, Stephen T
2013-08-01
Unlike traditional site-directed mutagenesis, this protocol requires only a single PCR step using full plasmid amplification to generate point mutants. The method can introduce small mutations into promoter sites and is even better suited for introducing single or double mutations into proteins. It is elegant in its simplicity and can be applied quite easily in any laboratory using standard protein expression vectors and commercially available reagents.
Reduction from cost-sensitive ordinal ranking to weighted binary classification.
Lin, Hsuan-Tien; Li, Ling
2012-05-01
We present a reduction framework from ordinal ranking to binary classification. The framework consists of three steps: extracting extended examples from the original examples, learning a binary classifier on the extended examples with any binary classification algorithm, and constructing a ranker from the binary classifier. Based on the framework, we show that a weighted 0/1 loss of the binary classifier upper-bounds the mislabeling cost of the ranker, both error-wise and regret-wise. Our framework allows not only the design of good ordinal ranking algorithms based on well-tuned binary classification approaches, but also the derivation of new generalization bounds for ordinal ranking from known bounds for binary classification. In addition, our framework unifies many existing ordinal ranking algorithms, such as perceptron ranking and support vector ordinal regression. When compared empirically on benchmark data sets, some of our newly designed algorithms enjoy advantages in terms of both training speed and generalization performance over existing algorithms. In addition, the newly designed algorithms lead to better cost-sensitive ordinal ranking performance, as well as improved listwise ranking performance.
A binary plasmid system for shuffling combinatorial antibody libraries.
Collet, T A; Roben, P; O'Kennedy, R; Barbas, C F; Burton, D R; Lerner, R A
1992-11-01
We have used a binary system of replicon-compatible plasmids to test the potential for promiscuous recombination of heavy and light chains within sets of human Fab fragments isolated from combinatorial antibody libraries. Antibody molecules showed a surprising amount of promiscuity in that a particular heavy chain could recombine with multiple light chains with retention of binding to a protein antigen. The degree to which a given heavy chain productively paired with any light chain to bind antigen varied from 43% to 100% and depended strongly on the heavy-chain sequence. Such productive crosses resulted in a set of Fab fragments of similar apparent binding constants, which seemed to differ mainly in the amount of active Fab fragment produced in the bacterial cell. The dominance of the heavy chain in the antibody-antigen interaction was further explored in a set of directed crosses, in which heavy and light chains derived from antigen-specific clones were crossed with nonrelated heavy and light chains. In these crosses, an Fab fragment retained antigen binding only if it contained a heavy chain from an antigen-specific clone. In no case did the light chain confer detectable affinity when paired with indifferent heavy chains. The surprising promiscuity of heavy chains has ramifications for the evaluation of the diversity of combinatorial libraries made against protein antigens and should allow the combination of one such promiscuous heavy chain with an engineered light chain to form an Fab fragment carrying synthetic cofactors to assist in antibody catalysis.
A binary plasmid system for shuffling combinatorial antibody libraries.
Collet, T A; Roben, P; O'Kennedy, R; Barbas, C F; Burton, D R; Lerner, R A
1992-01-01
We have used a binary system of replicon-compatible plasmids to test the potential for promiscuous recombination of heavy and light chains within sets of human Fab fragments isolated from combinatorial antibody libraries. Antibody molecules showed a surprising amount of promiscuity in that a particular heavy chain could recombine with multiple light chains with retention of binding to a protein antigen. The degree to which a given heavy chain productively paired with any light chain to bind antigen varied from 43% to 100% and depended strongly on the heavy-chain sequence. Such productive crosses resulted in a set of Fab fragments of similar apparent binding constants, which seemed to differ mainly in the amount of active Fab fragment produced in the bacterial cell. The dominance of the heavy chain in the antibody-antigen interaction was further explored in a set of directed crosses, in which heavy and light chains derived from antigen-specific clones were crossed with nonrelated heavy and light chains. In these crosses, an Fab fragment retained antigen binding only if it contained a heavy chain from an antigen-specific clone. In no case did the light chain confer detectable affinity when paired with indifferent heavy chains. The surprising promiscuity of heavy chains has ramifications for the evaluation of the diversity of combinatorial libraries made against protein antigens and should allow the combination of one such promiscuous heavy chain with an engineered light chain to form an Fab fragment carrying synthetic cofactors to assist in antibody catalysis. Images PMID:1438192
Hauck, Bernd; Murphy, Samuel L; Smith, Peter H; Qu, Guang; Liu, Xingge; Zelenaia, Olga; Mingozzi, Federico; Sommer, Jürg M; High, Katherine A; Wright, J. Fraser
2008-01-01
In a gene therapy clinical trial for hemophilia B, adeno-associated virus 2 (AAV2) capsid–specific CD8+ T cells were previously implicated in the elimination of vector-transduced hepatocytes, resulting in loss of human factor IX (hFIX) transgene expression. To test the hypothesis that expression of AAV2 cap DNA impurities in the AAV2-hFIX vector was the source of epitopes presented on transduced cells, transcription of cap was assessed by quantitative reverse transcription–PCR (Q-RT-PCR) following transduction of target cells with the vector used in the clinical trial. Transcriptional profiling was also performed for residual AmpR, and adenovirus E2A and E4. Although trace amounts of DNA impurities were present in the clinical vector, transcription of these sequences was not detected after transduction of human hepatocytes, nor in mice administered a dose 26-fold above the highest dose administered in the clinical study. Two methods used to minimize encapsidated DNA impurities in the clinical vector were: (i) a vector (cis) production plasmid with a backbone exceeding the packaging limit of AAV; and (ii) a vector purification step that achieved separation of the vector from vector-related impurities (e.g., empty capsids). In conclusion, residual cap expression was undetectable following transduction with AAV2-hFIX clinical vectors. Preformed capsid protein is implicated as the source of epitopes recognized by CD8+ T cells that eliminated vector-transduced cells in the clinical study. PMID:18941440
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goodyer, P.R.; Torban, E.; Dehbi, M.
1994-09-01
The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-lengthmore » WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.« less
Cheng, Jun; Ye, Ying; Wang, Ying-ying; Li, Hui; Li, Xu; Li, Jia-bin
2008-02-01
The aim of the present study was to study the phenotypic and molecular characterization of 5 novel CTX-M-beta-1actamases carried by 5 Klebsiella pneumoniae isolates and 3 Escherichia coli isolates collected from 4 hospitals in Hefei, China. The purified PCR products were ligated with pGEM-Teasy vectors, expressed, and sequenced. The complete genes of the CTX-M-beta-lactamases were ligated with the pHSG398 vector to express prokaryotic recombinant proteins. Plasmids were extracted by rapid alkaline lysis protocol, and the PCR method was performed to determine whether the prokaryotic expression was successful or not. Antimicrobial susceptibility was tested and the phenotypes of transformants were determined according to criteria recommended by the Clinical and Laboratory Standards Institute. The kinetic parameters of enzymes were confirmed. The isoelectric points (pI) were determined by isoelectric focusing assay. Pulsed-field gel electrophoresis and plasmid profiling were performed. The PCR products had 1101 nucleotides and were determined as CTX-M-46, CTX-M-47, CTX-M-48, CTX-M-49, and CTX-M-50. All strains were resistant to cefotaxime, but most of them were susceptible or intermediate to ceftazidime. The phenotypes of novel enzymes were determined as extended-spectrum-beta-lactamases (ESBL). Penicillin G, cephalothin, cefuroxime, and cefotaxime were determined to good substrates, whereas ceftazidime hydrolysis was not detected. The pI of the 5 novel CTX-M-beta-lactamases were 8.0. CTX-M-derivatives could be the multiplex genesis in our area. This is the first report of these 5 novel plasmid-mediated CTX-M ESBL produced from China in the world. Molecular typing reveals notably different origin in genes encoding different CTX-M variants of 8 strains.
[BLG gene knockout and hLF gene knock-in at BLG locus in goat by TALENs].
Song, Shaozheng; Zhu, Mengmin; Yuan, Yuguo; Rong, Yao; Xu, Sheng; Chen, Si; Mei, Junyan; Cheng, Yong
2016-03-01
To knock out β-lactoglobulin (BLG) gene and insert human lactoferrin (hLF) coding sequence at BLG locus of goat, the transcription activator-like effector nucleases (TALEN) mediated recombination was used to edit the BLG gene of goat fetal fibroblast, then as donor cells for somatic cell nuclear transfer. We designed a pair of specific plasmid TALEN-3-L/R for goat BLG exon III recognition sites, and BLC14-TK vector containing a negative selection gene HSV-TK, was used for the knock in of hLF gene. TALENs plasmids were transfected into the goat fetal fibroblast cells, and the cells were screened three days by 2 μg/mL puromycin. DNA cleavage activities of cells were verified by PCR amplification and DNA production sequencing. Then, targeting vector BLC14-TK and plasmids TALEN-3-L/R were co-transfected into goat fetal fibroblasts, both 700 μg/mL G418 and 2 μg/mL GCV were simultaneously used to screen G418-resistant cells. Detections of integration and recombination were implemented to obtain cells with hLF gene site-specific integration. We chose targeting cells as donor cells for somatic cell nuclear transfer. The mutagenicity of TALEN-3-L/R was between 25% and 30%. A total of 335 reconstructed embryos with 6 BLG-/hLF+ targeting cell lines were transferred into 16 recipient goats. There were 9 pregnancies confirmed by ultrasound on day 30 to 35 (pregnancy rate of 39.1%), and one of 50-day-old fetus with BLG-/hLF+ was achieved. These results provide the basis for hLF gene knock-in at BLG locus of goat and cultivating transgenic goat of low allergens and rich hLF in the milk.
Rodriguez, Alberto; Martínez, Juan A; Millard, Pierre; Gosset, Guillermo; Portais, Jean-Charles; Létisse, Fabien; Bolivar, Francisco
2017-06-01
Metabolic engineering strategies applied over the last two decades to produce shikimate (SA) in Escherichia coli have resulted in a battery of strains bearing many expression systems. However, the effects that these systems have on the host physiology and how they impact the production of SA are still not well understood. In this work we utilized an engineered E. coli strain to determine the consequences of carrying a vector that promotes SA production from glucose with a high-yield but that is also expected to impose a significant cellular burden. Kinetic comparisons in fermentors showed that instead of exerting a negative effect, the sole presence of the plasmid increased glucose consumption without diminishing the growth rate. By constitutively expressing a biosynthetic operon from this vector, the more active glycolytic metabolism was exploited to redirect intermediates toward the production of SA, which further increased the glucose consumption rate and avoided excess acetate production. Fluxomics and metabolomics experiments revealed a global remodeling of the carbon and energy metabolism in the production strain, where the increased SA production reduced the carbon available for oxidative and fermentative pathways. Moreover, the results showed that the production of SA relies on a specific setup of the pentose phosphate pathway, where both its oxidative and non-oxidative branches are strongly activated to supply erythrose-4-phosphate and balance the NADPH requirements. This work improves our understanding of the metabolic reorganization observed in E. coli in response to the plasmid-based expression of the SA biosynthetic pathway. Biotechnol. Bioeng. 2017;114: 1319-1330. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Khanizadeh, Sayyad; Ravanshad, Mehrdad; Hosseini, SeyedYounes; Davoodian, Parivash; Nejati Zadeh, Azim; Sarvari, Jamal
2015-01-01
In this study, to clarify the SMAD4 blocking impact on fibrosis process, we investigated its down-regulation by shRNA on activated human LX-2 cell, in vitro. Liver fibrosis is a critical consequence of chronic damage to the liver that can progress toward advanced diseases, liver cirrhosis and hepatocellular carcinoma (HCC). Different SMAD proteins play as major mediators in the fibrogenesis activity of hepatic stellate cells through TGF-β pathways, but the extent of SMAD4 as a co-SMAD protein remained less clear. vector expressing verified shRNA targeting human SMAD4 gene was transfected into LX-2 cells. The GFP expressing plasmid was transfected in the same manner as a control group while leptin treated cells were employed as positive controls. Subsequently, total RNA was extracted and real-time PCR was performed to measure the mRNA levels of SMAD4, COL-1A1, α-SMA, TGF-β and TIMP-1. Furthermore, trypan blue exclusion was performed to test the effect of plasmid transfection and SMAD4 shutting-down on cellular viability. The results indicated that the expression of SMAD4was down-regulated following shRNA transfection intoLX-2 cells (P<0.001). The gene expression analysis of fibrotic genes in LX-2 cells showed that SMAD4 blocking by shRNA significantly reduced the expression level of fibrotic genes when compared to control plasmids (P<0.001). Vector expressing SMAD4-shRNA induced no significant cytotoxic or proliferative effects on LX-2 cells as determined by viability assay (P<0.05). The results of this study suggested that knockdown of SMAD4 expression in stellate cell can control the progression of fibrogenesis through TGF-β pathway blocking.
Brede, Dag Anders; Lothe, Sheba; Salehian, Zhian; Faye, Therese; Nes, Ingolf F.
2007-01-01
This report describes the first functional analysis of a bacteriocin immunity gene from Propionibacterium freudenreichii and its use as a selection marker for food-grade cloning. Cloning of the pcfI gene (previously orf5 [located as part of the pcfABC propionicin F operon]) rendered the sensitive host 1,000-fold more tolerant to the propionicin F bacteriocin. The physiochemical properties of the 127-residue large PcfI protein resemble those of membrane-bound immunity proteins from bacteriocin systems found in lactic acid bacteria. The high level of immunity conferred by pcfI allowed its use as a selection marker for plasmid transformation in P. freudenreichii. Electroporation of P. freudenreichii IFO12426 by use of the pcfI expression plasmid pSL102 and propionicin F selection (200 bacteriocin units/ml) yielded 107 transformants/μg DNA. The 2.7-kb P. freudenreichii food-grade cloning vector pSL104 consists of the pLME108 replicon, a multiple cloning site, and pcfI expressed from the constitutive PpampS promoter for selection. The pSL104 vector efficiently facilitated cloning of the propionicin T1 bacteriocin in P. freudenreichii. High-level propionicin T1 production (640 BU/ml) was obtained with the IFO12426 strain, and the food-grade propionicin T1 expression plasmid pSL106 was maintained by ∼91% of the cells over 25 generations in the absence of selection. To the best of our knowledge this is the first report of an efficient cloning system that facilitates the generation of food-grade recombinant P. freudenreichii strains. PMID:17933941
Brede, Dag Anders; Lothe, Sheba; Salehian, Zhian; Faye, Therese; Nes, Ingolf F
2007-12-01
This report describes the first functional analysis of a bacteriocin immunity gene from Propionibacterium freudenreichii and its use as a selection marker for food-grade cloning. Cloning of the pcfI gene (previously orf5 [located as part of the pcfABC propionicin F operon]) rendered the sensitive host 1,000-fold more tolerant to the propionicin F bacteriocin. The physiochemical properties of the 127-residue large PcfI protein resemble those of membrane-bound immunity proteins from bacteriocin systems found in lactic acid bacteria. The high level of immunity conferred by pcfI allowed its use as a selection marker for plasmid transformation in P. freudenreichii. Electroporation of P. freudenreichii IFO12426 by use of the pcfI expression plasmid pSL102 and propionicin F selection (200 bacteriocin units/ml) yielded 10(7) transformants/microg DNA. The 2.7-kb P. freudenreichii food-grade cloning vector pSL104 consists of the pLME108 replicon, a multiple cloning site, and pcfI expressed from the constitutive P(pampS) promoter for selection. The pSL104 vector efficiently facilitated cloning of the propionicin T1 bacteriocin in P. freudenreichii. High-level propionicin T1 production (640 BU/ml) was obtained with the IFO12426 strain, and the food-grade propionicin T1 expression plasmid pSL106 was maintained by approximately 91% of the cells over 25 generations in the absence of selection. To the best of our knowledge this is the first report of an efficient cloning system that facilitates the generation of food-grade recombinant P. freudenreichii strains.
Robust vector quantization for noisy channels
NASA Technical Reports Server (NTRS)
Demarca, J. R. B.; Farvardin, N.; Jayant, N. S.; Shoham, Y.
1988-01-01
The paper briefly discusses techniques for making vector quantizers more tolerant to tranmsission errors. Two algorithms are presented for obtaining an efficient binary word assignment to the vector quantizer codewords without increasing the transmission rate. It is shown that about 4.5 dB gain over random assignment can be achieved with these algorithms. It is also proposed to reduce the effects of error propagation in vector-predictive quantizers by appropriately constraining the response of the predictive loop. The constrained system is shown to have about 4 dB of SNR gain over an unconstrained system in a noisy channel, with a small loss of clean-channel performance.
Yamazaki, M; Son, L; Hayashi, T; Morita, N; Asamizu, T; Mourakoshi, I; Saito, K
1996-01-01
Transgenic herbicide-resistant Scoparia dulcis plants were obtained by using an Ri binary vector system. The chimeric bar gene encoding phosphinothricin acetyltransferase flanked by the promoter for cauliflower mosaic virus 35S RNA and the terminal sequence for nopaline synthase was introduced in the plant genome by Agrobacterium-mediated transformation by means of scratching young plants. Hairy roots resistant to bialaphos were selected and plantlets (R0) were regenerated. Progenies (S1) were obtained by self-fertilization. The transgenic state was confirmed by DNA-blot hybridization and assaying of neomycin phosphotransferase II. Expression of the bar gene in the transgenic R0 and S1 progenies was indicated by the activity of phosphinothricin acetyltransferase. Transgenic plants accumulated scopadulcic acid B, a specific secondary metabolite of S. dulcis, in amounts of 15-60% compared with that in normal plants. The transgenic plants and progenies showed resistant trait towards bialaphos and phosphinothricin. These results suggest that an Ri binary system is one of the useful tools for the transformation of medicinal plants for which a regeneration protocol has not been established.
Taverniers, Isabel; Windels, Pieter; Vaïtilingom, Marc; Milcamps, Anne; Van Bockstaele, Erik; Van den Eede, Guy; De Loose, Marc
2005-04-20
Since the 18th of April 2004, two new regulations, EC/1829/2003 on genetically modified food and feed products and EC/1830/2003 on traceability and labeling of GMOs, are in force in the EU. This new, comprehensive regulatory framework emphasizes the need of an adequate tracing system. Unique identifiers, such as the transgene genome junction region or a specific rearrangement within the transgene DNA, should form the basis of such a tracing system. In this study, we describe the development of event-specific tracing systems for transgenic maize lines Bt11, Bt176, and GA21 and for canola event GT73. Molecular characterization of the transgene loci enabled us to clone an event-specific sequence into a plasmid vector, to be used as a marker, and to develop line-specific primers. Primer specificity was tested through qualitative PCRs and dissociation curve analysis in SYBR Green I real-time PCRs. The primers were then combined with event-specific TaqMan probes in quantitative real-time PCRs. Calibration curves were set up both with genomic DNA samples and the newly synthesized plasmid DNA markers. It is shown that cloned plasmid GMO target sequences are perfectly suitable as unique identifiers and quantitative calibrators. Together with an event-specific primer pair and a highly specific TaqMan probe, the plasmid markers form crucial components of a unique and straighforward tracing system for Bt11, Bt176, and GA21 maize and GT73 canola events.