The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

PubMed

Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

2003-07-05

Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

The Receptor-Binding Site of the Measles Virus Hemagglutinin Protein Itself Constitutes a Conserved Neutralizing Epitope

PubMed Central

Ohno, Shinji; Sakai, Kouji; Ito, Yuri; Fukuhara, Hideo; Komase, Katsuhiro; Brindley, Melinda A.; Rota, Paul A.; Plemper, Richard K.; Maenaka, Katsumi; Takeda, Makoto

2013-01-01

Here, we provide direct evidence that the receptor-binding site of measles virus (MV) hemagglutinin protein itself forms an effective conserved neutralizing epitope (CNE). Several receptor-interacting residues constitute the CNE. Thus, viral escape from neutralization has to be associated with loss of receptor-binding activity. Since interactions with both the signaling lymphocyte activation molecule (SLAM) and nectin4 are critical for MV pathogenesis, its escape, which results from loss of receptor-binding activity, should not occur in nature. PMID:23283964

Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

PubMed

Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

2011-05-31

Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

RNA-binding activity of TRIM25 is mediated by its PRY/SPRY domain and is required for ubiquitination.

PubMed

Choudhury, Nila Roy; Heikel, Gregory; Trubitsyna, Maryia; Kubik, Peter; Nowak, Jakub Stanislaw; Webb, Shaun; Granneman, Sander; Spanos, Christos; Rappsilber, Juri; Castello, Alfredo; Michlewski, Gracjan

2017-11-08

TRIM25 is a novel RNA-binding protein and a member of the Tripartite Motif (TRIM) family of E3 ubiquitin ligases, which plays a pivotal role in the innate immune response. However, there is scarce knowledge about its RNA-related roles in cell biology. Furthermore, its RNA-binding domain has not been characterized. Here, we reveal that the RNA-binding activity of TRIM25 is mediated by its PRY/SPRY domain, which we postulate to be a novel RNA-binding domain. Using CLIP-seq and SILAC-based co-immunoprecipitation assays, we uncover TRIM25's endogenous RNA targets and protein binding partners. We demonstrate that TRIM25 controls the levels of Zinc Finger Antiviral Protein (ZAP). Finally, we show that the RNA-binding activity of TRIM25 is important for its ubiquitin ligase activity towards itself (autoubiquitination) and its physiologically relevant target ZAP. Our results suggest that many other proteins with the PRY/SPRY domain could have yet uncharacterized RNA-binding potential. Together, our data reveal new insights into the molecular roles and characteristics of RNA-binding E3 ubiquitin ligases and demonstrate that RNA could be an essential factor in their enzymatic activity.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caberoy, Nora B.; Zhou, Yixiong; Alvarado, Gabriela

To efficiently elucidate the biological roles of phosphatidylserine (PS), we developed open-reading-frame (ORF) phage display to identify PS-binding proteins. The procedure of phage panning was optimized with a phage clone expressing MFG-E8, a well-known PS-binding protein. Three rounds of phage panning with ORF phage display cDNA library resulted in {approx}300-fold enrichment in PS-binding activity. A total of 17 PS-binding phage clones were identified. Unlike phage display with conventional cDNA libraries, all 17 PS-binding clones were ORFs encoding 13 real proteins. Sequence analysis revealed that all identified PS-specific phage clones had dimeric basic amino acid residues. GST fusion proteins were expressedmore » for 3 PS-binding proteins and verified for their binding activity to PS liposomes, but not phosphatidylcholine liposomes. These results elucidated previously unknown PS-binding proteins and demonstrated that ORF phage display is a versatile technology capable of efficiently identifying binding proteins for non-protein molecules like PS.« less

Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

NASA Astrophysics Data System (ADS)

Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

2017-06-01

In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

Biochemical investigation of yttrium(III) complex containing 1,10-phenanthroline: DNA binding and antibacterial activity.

PubMed

Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Moodi, Asieh; Niroomand, Sona

2013-03-05

Characterization of the interaction between yttrium(III) complex containing 1,10-phenanthroline as ligand, [Y(phen)2Cl(OH2)3]Cl2⋅H2O, and DNA has been carried out by UV absorption, fluorescence spectra and viscosity measurements in order to investigate binding mode. The experimental results indicate that the yttrium(III) complex binds to DNA and absorption is decreasing in charge transfer band with the increase in amount of DNA. The binding constant (Kb) at different temperatures as well as thermodynamic parameters, enthalpy change (ΔH°) and entropy change (ΔS°), were calculated according to relevant fluorescent data and Vant' Hoff equation. The results of interaction mechanism studies, suggested that groove binding plays a major role in the binding of the complex and DNA. The activity of yttrium(III) complex against some bacteria was tested and antimicrobial screening tests shown growth inhibitory activity in the presence of yttrium(III) complex. Copyright © 2013 Elsevier B.V. All rights reserved.

Plasticity of BRCA2 Function in Homologous Recombination: Genetic Interactions of the PALB2 and DNA Binding Domains

PubMed Central

Siaud, Nicolas; Lam, Isabel; Christ, Nicole; Schlacher, Katharina; Xia, Bing; Jasin, Maria

2011-01-01

The breast cancer suppressor BRCA2 is essential for the maintenance of genomic integrity in mammalian cells through its role in DNA repair by homologous recombination (HR). Human BRCA2 is 3,418 amino acids and is comprised of multiple domains that interact with the RAD51 recombinase and other proteins as well as with DNA. To gain insight into the cellular function of BRCA2 in HR, we created fusions consisting of various BRCA2 domains and also introduced mutations into these domains to disrupt specific protein and DNA interactions. We find that a BRCA2 fusion peptide deleted for the DNA binding domain and active in HR is completely dependent on interaction with the PALB2 tumor suppressor for activity. Conversely, a BRCA2 fusion peptide deleted for the PALB2 binding domain is dependent on an intact DNA binding domain, providing a role for this conserved domain in vivo; mutagenesis suggests that both single-stranded and double-stranded DNA binding activities in the DNA binding domain are required for its activity. Given that PALB2 itself binds DNA, these results suggest alternative mechanisms to deliver RAD51 to DNA. In addition, the BRCA2 C terminus contains both RAD51-dependent and -independent activities which are essential to HR in some contexts. Finally, binding the small peptide DSS1 is essential for activity when its binding domain is present, but not when it is absent. Our results reveal functional redundancy within the BRCA2 protein and emphasize the plasticity of this large protein built for optimal HR function in mammalian cells. The occurrence of disease-causing mutations throughout BRCA2 suggests sub-optimal HR from a variety of domain modulations. PMID:22194698

Identification of AOSC-binding proteins in neurons

NASA Astrophysics Data System (ADS)

Liu, Ming; Nie, Qin; Xin, Xianliang; Geng, Meiyu

2008-11-01

Acidic oligosaccharide sugar chain (AOSC), a D-mannuronic acid oligosaccharide, derived from brown algae polysaccharide, has been completed Phase I clinical trial in China as an anti-Alzheimer’s Disease (AD) drug candidate. The identification of AOSC-binding protein(s) in neurons is very important for understanding its action mechanism. To determine the binding protein(s) of AOSC in neurons mediating its anti-AD activities, confocal microscopy, affinity chromatography, and liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis were used. Confocal microscopy analysis shows that AOSC binds to SH-SY5Y cells in concentration-, time-, and temperature-dependent fashions. The AOSC binding proteins were purified by affinity chromatography and identified by LC-MS/MS analysis. The results showed that there are 349 proteins binding AOSC, including clathrin, adaptor protein-2 (AP-2) and amyloid precursor protein (APP). These results suggest that the binding/entrance of AOSC to neurons is probably responsible for anti-AD activities.

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

NASA Astrophysics Data System (ADS)

D'Aquino, J. Alejandro; Ringe, Dagmar

2006-08-01

The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

Binding of Nickel to Testicular Glutamate–Ammonia Ligase Inhibits Its Enzymatic Activity

PubMed Central

SUN, YINGBIAO; OU, YOUNG; CHENG, MIN; RUAN, YIBING; VAN DER HOORN, FRANS A.

2016-01-01

SUMMARY Exposure to nickel has been shown to cause damage to the testis in several animal models. It is not known if the testis expresses protein(s) that can bind nickel. To test this, we used a nickel-binding assay to isolate testicular nickel-binding proteins. We identified glutamate–ammonia ligase (GLUL) as a prominent nickel-binding protein by mass spectrometry. Protein analysis and reverse transcriptase polymerase chain reaction showed that GLUL is expressed in the testis, predominantly in interstitial cells. We determined that GLUL has a higher affinity for nickel than for its regular co-factor manganese. We produced an enzymatically active, recombinant GLUL protein. Upon binding, nickel interferes with the manganese-catalyzed enzymatic activity of recombinant GLUL protein. We also determined that GLUL activity in testes of animals exposed to nickel sulfate is reduced. Our results identify testicular GLUL as the first testicular protein shown to be affected by nickel exposure. PMID:21254280

Hydroxylated polybrominated diphenyl ethers exhibit different activities on thyroid hormone receptors depending on their degree of bromination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Xiao-Min, E-mail: rxm200318@gmail.com; Guo, Liang-Hong, E-mail: LHGuo@rcees.ac.cn; Gao, Yu, E-mail: francesscototti@gmail.com

2013-05-01

Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effectmore » on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2′-OH-BDE-28, 3′-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3′-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. - Highlights: ► Thyroid hormone (TH) activity of OH-PBDEs with different Br number was evaluated. ► Four different experimental approaches were employed to investigate the mechanism. ► Low-brominated OH-PBDEs were agonists, but high-brominated ones were antagonists. ► Low-brominated OH-PBDEs bind to TH receptor differently than high-brominated ones.« less

Activation of phenylalanine hydroxylase by phenylalanine does not require binding in the active site.

PubMed

Roberts, Kenneth M; Khan, Crystal A; Hinck, Cynthia S; Fitzpatrick, Paul F

2014-12-16

Phenylalanine hydroxylase (PheH), a liver enzyme that catalyzes the hydroxylation of excess phenylalanine in the diet to tyrosine, is activated by phenylalanine. The lack of activity at low levels of phenylalanine has been attributed to the N-terminus of the protein's regulatory domain acting as an inhibitory peptide by blocking substrate access to the active site. The location of the site at which phenylalanine binds to activate the enzyme is unknown, and both the active site in the catalytic domain and a separate site in the N-terminal regulatory domain have been proposed. Binding of catecholamines to the active-site iron was used to probe the accessibility of the active site. Removal of the regulatory domain increases the rate constants for association of several catecholamines with the wild-type enzyme by ∼2-fold. Binding of phenylalanine in the active site is effectively abolished by mutating the active-site residue Arg270 to lysine. The k(cat)/K(phe) value is down 10⁴ for the mutant enzyme, and the K(m) value for phenylalanine for the mutant enzyme is >0.5 M. Incubation of the R270K enzyme with phenylalanine also results in a 2-fold increase in the rate constants for catecholamine binding. The change in the tryptophan fluorescence emission spectrum seen in the wild-type enzyme upon activation by phenylalanine is also seen with the R270K mutant enzyme in the presence of phenylalanine. Both results establish that activation of PheH by phenylalanine does not require binding of the amino acid in the active site. This is consistent with a separate allosteric site, likely in the regulatory domain.

Activation of Phenylalanine Hydroxylase by Phenylalanine Does Not Require Binding in the Active Site

PubMed Central

2015-01-01

Phenylalanine hydroxylase (PheH), a liver enzyme that catalyzes the hydroxylation of excess phenylalanine in the diet to tyrosine, is activated by phenylalanine. The lack of activity at low levels of phenylalanine has been attributed to the N-terminus of the protein’s regulatory domain acting as an inhibitory peptide by blocking substrate access to the active site. The location of the site at which phenylalanine binds to activate the enzyme is unknown, and both the active site in the catalytic domain and a separate site in the N-terminal regulatory domain have been proposed. Binding of catecholamines to the active-site iron was used to probe the accessibility of the active site. Removal of the regulatory domain increases the rate constants for association of several catecholamines with the wild-type enzyme by ∼2-fold. Binding of phenylalanine in the active site is effectively abolished by mutating the active-site residue Arg270 to lysine. The kcat/Kphe value is down 104 for the mutant enzyme, and the Km value for phenylalanine for the mutant enzyme is >0.5 M. Incubation of the R270K enzyme with phenylalanine also results in a 2-fold increase in the rate constants for catecholamine binding. The change in the tryptophan fluorescence emission spectrum seen in the wild-type enzyme upon activation by phenylalanine is also seen with the R270K mutant enzyme in the presence of phenylalanine. Both results establish that activation of PheH by phenylalanine does not require binding of the amino acid in the active site. This is consistent with a separate allosteric site, likely in the regulatory domain. PMID:25453233

Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

PubMed Central

Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

2011-01-01

Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

PubMed Central

Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

2003-01-01

Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

Molecular mechanisms of immunosuppression by cyclosporins.

PubMed

Zenke, G; Baumann, G; Wenger, R; Hiestand, P; Quesniaux, V; Andersen, E; Schreier, M H

1993-06-23

Despite the successful clinical application of the immunosuppressive drug cyclosporin A (CsA, Sandimmun), its precise mechanism of action in the process of T cell activation remains elusive. CsA binds to the high-affinity cytosolic receptor cyclophilin whose peptidyl-prolyl cis-trans isomerase activity is inhibited upon binding. The linkage of this effect with the inhibition of the T cell receptor-mediated signal transduction pathway, which leads to a suppression of lymphokine gene transcription, is still unclear. We analyzed the relationship between cyclophilin-binding and immunosuppressive activity (e.g., effect on IL-2 transcription) of cyclosporin derivatives in vitro. The results show that binding to cyclophilin is required, but not sufficient for immunosuppression. Cyclosporin analogues which completely lack immunosuppressive activity but fully retained their cyclophilin-binding capacity antagonize the immunosuppressive activity of CsA. These derivatives inhibit the isomerase activity of cyclophilin, which clearly demonstrates that inhibition of the cyclophilin isomerase activity does not lead to immunosuppression. In analogy to the other immunosuppressants of microbial origin, FK-506 and rapamycin, a specific structure of the "effector" domain of CsA, which is unrelated to the cyclophilin-binding domain, determines the biological activity. In the nucleus, CsA interferes with the DNA-binding of inducible transcription factors to their respective DNA motifs within lymphokine promoters by affecting intracellular translocation of transcription factor subunits.

Evolution of RNA-Protein Interactions: Non-Specific Binding Led to RNA Splicing Activity of Fungal Mitochondrial Tyrosyl-tRNA Synthetases

PubMed Central

Lamech, Lilian T.; Mallam, Anna L.; Lambowitz, Alan M.

2014-01-01

The Neurospora crassa mitochondrial tyrosyl-tRNA synthetase (mtTyrRS; CYT-18 protein) evolved a new function as a group I intron splicing factor by acquiring the ability to bind group I intron RNAs and stabilize their catalytically active RNA structure. Previous studies showed: (i) CYT-18 binds group I introns by using both its N-terminal catalytic domain and flexibly attached C-terminal anticodon-binding domain (CTD); and (ii) the catalytic domain binds group I introns specifically via multiple structural adaptations that occurred during or after the divergence of Peziomycotina and Saccharomycotina. However, the function of the CTD and how it contributed to the evolution of splicing activity have been unclear. Here, small angle X-ray scattering analysis of CYT-18 shows that both CTDs of the homodimeric protein extend outward from the catalytic domain, but move inward to bind opposite ends of a group I intron RNA. Biochemical assays show that the isolated CTD of CYT-18 binds RNAs non-specifically, possibly contributing to its interaction with the structurally different ends of the intron RNA. Finally, we find that the yeast mtTyrRS, which diverged from Pezizomycotina fungal mtTyrRSs prior to the evolution of splicing activity, binds group I intron and other RNAs non-specifically via its CTD, but lacks further adaptations needed for group I intron splicing. Our results suggest a scenario of constructive neutral (i.e., pre-adaptive) evolution in which an initial non-specific interaction between the CTD of an ancestral fungal mtTyrRS and a self-splicing group I intron was “fixed” by an intron RNA mutation that resulted in protein-dependent splicing. Once fixed, this interaction could be elaborated by further adaptive mutations in both the catalytic domain and CTD that enabled specific binding of group I introns. Our results highlight a role for non-specific RNA binding in the evolution of RNA-binding proteins. PMID:25536042

Evolution of RNA-protein interactions: non-specific binding led to RNA splicing activity of fungal mitochondrial tyrosyl-tRNA synthetases.

PubMed

Lamech, Lilian T; Mallam, Anna L; Lambowitz, Alan M

2014-12-01

The Neurospora crassa mitochondrial tyrosyl-tRNA synthetase (mtTyrRS; CYT-18 protein) evolved a new function as a group I intron splicing factor by acquiring the ability to bind group I intron RNAs and stabilize their catalytically active RNA structure. Previous studies showed: (i) CYT-18 binds group I introns by using both its N-terminal catalytic domain and flexibly attached C-terminal anticodon-binding domain (CTD); and (ii) the catalytic domain binds group I introns specifically via multiple structural adaptations that occurred during or after the divergence of Peziomycotina and Saccharomycotina. However, the function of the CTD and how it contributed to the evolution of splicing activity have been unclear. Here, small angle X-ray scattering analysis of CYT-18 shows that both CTDs of the homodimeric protein extend outward from the catalytic domain, but move inward to bind opposite ends of a group I intron RNA. Biochemical assays show that the isolated CTD of CYT-18 binds RNAs non-specifically, possibly contributing to its interaction with the structurally different ends of the intron RNA. Finally, we find that the yeast mtTyrRS, which diverged from Pezizomycotina fungal mtTyrRSs prior to the evolution of splicing activity, binds group I intron and other RNAs non-specifically via its CTD, but lacks further adaptations needed for group I intron splicing. Our results suggest a scenario of constructive neutral (i.e., pre-adaptive) evolution in which an initial non-specific interaction between the CTD of an ancestral fungal mtTyrRS and a self-splicing group I intron was "fixed" by an intron RNA mutation that resulted in protein-dependent splicing. Once fixed, this interaction could be elaborated by further adaptive mutations in both the catalytic domain and CTD that enabled specific binding of group I introns. Our results highlight a role for non-specific RNA binding in the evolution of RNA-binding proteins.

Site-directed mutagenesis study on DNA binding regions of the mouse homologue of Suppressor of Hairless, RBP-J kappa.

PubMed Central

Chung, C N; Hamaguchi, Y; Honjo, T; Kawaichi, M

1994-01-01

To map regions important for DNA binding of the mouse homologue of Suppressor of Hairless or RBP-J kappa protein, mutated mouse RBP-J kappa cDNAs were made by insertion of oligonucleotide linkers or base replacement. DNA binding assays using the mutated proteins expressed in COS cells showed that various mutations between 218 Arg and 227 Arg decreased the DNA binding activity drastically. The DNA binding activity was not affected by amino acid replacements within the integrase motif of the RBP-J kappa protein (230His-269His). Replacements between 291Arg and 323Tyr affected the DNA binding activity slightly but reproducibly. These results indicate that the region encompassing 218Arg-227Arg is critical for the DNA binding activity of RBP-J kappa. This region did not show any significant homology to motifs or domains of the previously described DNA binding proteins. Using a truncation mutant protein RBP-J kappa was shown to associate with DNA as a monomer. Images PMID:8065905

Active retrieval facilitates across-episode binding by modulating the content of memory

PubMed Central

Bridge, Donna J.; Voss, Joel L.

2014-01-01

The contents of memory can be updated when information from the current episode is bound with content retrieved from previous episodes. Little is known regarding factors that determine the memory content that is subject to this across-episode binding. We tested whether across-episode binding preferentially occurs for memory content that is currently “active” and identified relevant neural correlates. After studying objects at specific locations on scene backgrounds, subjects performed one of two retrieval tasks for the objects on different scene backgrounds. In an active condition, subjects recalled object locations, whereas subjects merely dragged objects to predetermined locations in a passive condition. Immediately following each object-location retrieval event, a novel face appeared on a blank screen. We hypothesized that the original episode content would be active in memory during face encoding in the active condition, but not in the passive condition (despite seeing the same content in both conditions). A ramification of the active condition would thus be preferential binding of original episode content to novel faces, with no such across-episode binding in the passive condition. Indeed, memory for faces was better when tested on the original background scenes in the active relative to passive condition, indicating that original episode content was bound with the active condition faces, whereas this occurred to a lesser extent for the passive condition faces. Likewise, early-onset negative ERP effects reflected binding of the face to the original episode content in the active but not the passive condition. In contrast, binding in the passive condition occurred only when faces were physically displayed on the original scenes during recognition testing, and a very similar early-onset negative ERP effect signaled binding in this condition. ERP correlates of binding were thus similar for across-episode and within-episode binding (and were distinct from other encoding and retrieval ERP signals in both cases), indicating that active retrieval modulated when binding occurred, not the nature of the binding process per se. These results suggest that active retrieval promotes binding of new information with contents of memory, whereas without active retrieval, these unrelated pieces of information might be bound only when they are physically paired. PMID:25173711

The Gly-54-->Asp allelic form of human mannose-binding protein (MBP) fails to bind MBP-associated serine protease.

PubMed Central

Matsushita, M; Ezekowitz, R A; Fujita, T

1995-01-01

The human mannose-binding protein (MBP) is a pattern recognition molecule that appears to play a role in initial host defence. MBP activates the complement cascade and it may act as an opsonin both in the absence and in the presence of complement. A number of distinct MBP allelic forms exist in different population groups. An allele that occurs in 5-7% of Caucasians was identified by an inability to activate the complement system. A homozygous mutation at base pair 230 of the MBP gene results in a Gly-to-Asp substitution at the fifth collagen repeat. It appears that the resultant protein, MBPD, is able to form high-order multimers that bind bacteria but do not support complement activation. Recently a novel serine protease, the MBP-associated serine protease (MASP), has been described. MBP-MASP complexes circulate in serum and result in the direct activation of a novel complement pathway (lectin pathway) in the absence of the first complement components. In this study we demonstrate that MASP and its proenzyme proMASP are unable to bind to recombinant (r)MBPD. This lack of a MASP-rMBPD association corresponds to a failure of the Gly-54-->Asp form of MBP to activate complement. Our results provide a biochemical basis for the functional deficit in the Gly-54-->Asp allelic form of MBP and suggest that the proMASP/MASP binding site maps to the fifth collagen repeat of MBP. Images Figure 1 PMID:7487919

Ubiquinol-binding site in the alternative oxidase: mutagenesis reveals features important for substrate binding and inhibition.

PubMed

Albury, Mary S; Elliott, Catherine; Moore, Anthony L

2010-12-01

The alternative oxidase (AOX) is a non-protonmotive ubiquinol oxidase that is found in all plants, some fungi, green algae, bacteria and pathogenic protozoa. The lack of AOX in the mammalian host renders this protein an important potential therapeutic target in the treatment of pathogenic protozoan infections. Bioinformatic searches revealed that, within a putative ubiquinol-binding crevice in AOX, Gln242, Asn247, Tyr253, Ser256, His261 and Arg262 were highly conserved. To confirm that these amino-acid residues are important for ubiquinol-binding and hence activity substitution mutations were generated and characterised. Assessment of AOX activity in isolated Schizosaccharomyces pombe mitochondria revealed that mutation of either Gln242, Ser256, His261 and Arg262 resulted in >90% inhibition of antimycin A-insensitive respiration suggesting that hydroxyl, guanidino, imidazole groups, polar and charged residues in addition to the size of the amino-acid chain are important for ubiquinone-binding. Substitution of Asn247 with glutamine or Tyr253 with phenylalanine had little effect upon the respiratory rate indicating that these residues are not critical for AOX activity. However replacement of Tyr253 by alanine resulted in a 72% loss of activity suggesting that the benzoquinone group and not hydroxyl group is important for quinol binding. These results provide important new insights into the ubiquinol-binding site of the alternative oxidase, the identity of which maybe important for future rational drug design. Copyright © 2010 Elsevier B.V. All rights reserved.

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

NASA Astrophysics Data System (ADS)

Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

2016-08-01

Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

PubMed

Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

2016-08-05

Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

Characterization of strychnine-sensitive glycine receptor in the intact frog retina: modulation by protein kinases.

PubMed

Salceda, Rocío; Aguirre-Ramirez, Marisela

2005-03-01

We studied 3H-glycine and 3H-strychnine specific binding to glycine receptor (GlyR) in intact isolated frog retinas. To avoid glycine binding to glycine uptake sites, experiments were performed at low ligand concentrations in a sodium-free medium. The binding of both radiolabeled ligands was saturated. Scatchard analysis of bound glycine and strychnine revealed a KD of 2.5 and 2.0 microM, respectively. Specific binding of glycine was displaced by beta-alanine, sarcosine, and strychnine. Strychnine binding was displaced 50% by glycine, and sarcosine. Properties of the strychnine-binding site in the GlyR were modified by sarcosine. Binding of both radioligands was considerably reduced by compounds that inhibit or activate adenylate cyclase and increased cAMP levels. A phorbol ester activator of PKC remarkably decreased glycine and strychnine binding. These results suggest modulation of GlyR in response to endogenous activation of protein kinases A and C, as well as protein phosphorylation modulating GlyR function in retina.

Genetic analysis of the relationship between activation loop phosphorylation and cyclin binding in the activation of the Saccharomyces cerevisiae Cdc28p cyclin-dependent kinase.

PubMed Central

Cross, F R; Levine, K

2000-01-01

We showed recently that a screen for mutant CDC28 with improved binding to a defective Cln2p G1 cyclin yielded a spectrum of mutations similar to those yielded by a screen for intragenic suppressors of the requirement for activation loop phosphorylation (T169E suppressors). Recombination among these mutations yielded CDC28 mutants that bypassed the G1 cyclin requirement. Here we analyze further the interrelationship between T169E suppression, interaction with defective cyclin, and G1 cyclin bypass. DNA shuffling of mutations from the various screens and recombination onto a T169E-encoding 3' end yielded CDC28 mutants with strong T169E suppression. Some of the strongest T169E suppressors could suppress the defective Cln2p G1 cyclin even while retaining T169E. The strong T169E suppressors did not exhibit bypass of the G1 cyclin requirement but did so when T169E was reverted to T. These results suggested that for these mutants, activation loop phosphorylation and cyclin binding might be alternative means of activation rather than independent requirements for activation (as with wild type). These results suggest mechanistic overlap between the conformational shift induced by cyclin binding and that induced by activation loop phosphorylation. This conclusion was supported by analysis of suppressors of a mutation in the Cdk phosphothreonine-binding pocket created by cyclin binding. PMID:10747052

Structural basis of PP2A activation by PTPA, an ATP-dependent activation chaperone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guo, Feng; Stanevich, Vitali; Wlodarchak, Nathan

Proper activation of protein phosphatase 2A (PP2A) catalytic subunit is central for the complex PP2A regulation and is crucial for broad aspects of cellular function. The crystal structure of PP2A bound to PP2A phosphatase activator (PTPA) and ATPγS reveals that PTPA makes broad contacts with the structural elements surrounding the PP2A active site and the adenine moiety of ATP. PTPA-binding stabilizes the protein fold of apo-PP2A required for activation, and orients ATP phosphoryl groups to bind directly to the PP2A active site. This allows ATP to modulate the metal-binding preferences of the PP2A active site and utilize the PP2A activemore » site for ATP hydrolysis. In vitro, ATP selectively and drastically enhances binding of endogenous catalytic metal ions, which requires ATP hydrolysis and is crucial for acquisition of pSer/Thr-specific phosphatase activity. Furthermore, both PP2A- and ATP-binding are required for PTPA function in cell proliferation and survival. Our results suggest novel mechanisms of PTPA in PP2A activation with structural economy and a unique ATP-binding pocket that could potentially serve as a specific therapeutic target.« less

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

2005-01-01

The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

Homotropic Cooperativity from the Activation Pathway of the Allosteric Ligand-Responsive Regulatory Protein TRAP†

PubMed Central

Kleckner, Ian R.; McElroy, Craig A.; Kuzmic, Petr; Gollnick, Paul; Foster, Mark P.

2014-01-01

The trp RNA-binding Attenuation Protein (TRAP) assembles into an 11-fold symmetric ring that regulates transcription and translation of trp-mRNA in bacilli via heterotropic allosteric activation by the amino acid tryptophan (Trp). Whereas nuclear magnetic resonance studies have revealed that Trp-induced activation coincides with both μs-ms rigidification and local structural changes in TRAP, the pathway of binding of the 11 Trp ligands to the TRAP ring remains unclear. Moreover, because each of eleven bound Trp molecules is completely surrounded by protein, its release requires flexibility of Trp-bound (holo) TRAP. Here, we used stopped-flow fluorescence to study the kinetics of Trp binding by Bacillus stearothermophilus TRAP over a range of temperatures and we observed well-separated kinetic steps. These data were analyzed using non-linear least-squares fitting of several two- and three-step models. We found that a model with two binding steps best describes the data, although the structural equivalence of the binding sites in TRAP implies a fundamental change in the time-dependent structure of the TRAP rings upon Trp binding. Application of the two binding step model reveals that Trp binding is much slower than the diffusion limit, suggesting a gating mechanism that depends on the dynamics of apo TRAP. These data also reveal that Trp dissociation from the second binding mode is much slower than after the first Trp binding mode, revealing insight into the mechanism for positive homotropic allostery, or cooperativity. Temperature dependent analyses reveal that both binding modes imbue increases in bondedness and order toward a more compressed active state. These results provide insight into mechanisms of cooperative TRAP activation, and underscore the importance of protein dynamics for ligand binding, ligand release, protein activation, and allostery. PMID:24224873

Active retrieval facilitates across-episode binding by modulating the content of memory.

PubMed

Bridge, Donna J; Voss, Joel L

2014-10-01

The contents of memory can be updated when information from the current episode is bound with content retrieved from previous episodes. Little is known regarding factors that determine the memory content that is subject to this across-episode binding. We tested whether across-episode binding preferentially occurs for memory content that is currently "active" and identified relevant neural correlates. After studying objects at specific locations on scene backgrounds, subjects performed one of two retrieval tasks for the objects on different scene backgrounds. In an active condition, subjects recalled object locations, whereas subjects merely dragged objects to predetermined locations in a passive condition. Immediately following each object-location retrieval event, a novel face appeared on a blank screen. We hypothesized that the original episode content would be active in memory during face encoding in the active condition, but not in the passive condition (despite seeing the same content in both conditions). A ramification of the active condition would thus be preferential binding of original episode content to novel faces, with no such across-episode binding in the passive condition. Indeed, memory for faces was better when tested on the original background scenes in the active relative to passive condition, indicating that original episode content was bound with the active condition faces, whereas this occurred to a lesser extent for the passive condition faces. Likewise, early-onset negative ERP effects reflected binding of the face to the original episode content in the active but not the passive condition. In contrast, binding in the passive condition occurred only when faces were physically displayed on the original scenes during recognition testing, and a very similar early-onset negative ERP effect signaled binding in this condition. ERP correlates of binding were thus similar for across-episode and within-episode binding (and were distinct from other encoding and retrieval ERP signals in both cases), indicating that active retrieval modulated when binding occurred, not the nature of the binding process per se. These results suggest that active retrieval promotes binding of new information with contents of memory, whereas without active retrieval, these unrelated pieces of information might be bound only when they are physically paired. Copyright © 2014 Elsevier Ltd. All rights reserved.

Propensity for HBZ-SP1 isoform of HTLV-I to inhibit c-Jun activity correlates with sequestration of c-Jun into nuclear bodies rather than inhibition of its DNA-binding activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clerc, Isabelle, E-mail: isabelle.clerc@univ-montp1.f; CNRS, UM5236, CPBS, F-34965 Montpellier; Universite Montpellier 2, CPBS, F-34095 Montpellier

2009-09-01

HTLV-I bZIP factor (HBZ) contains a C-terminal zipper domain involved in its interaction with c-Jun. This interaction leads to a reduction of c-Jun DNA-binding activity and prevents the protein from activating transcription of AP-1-dependent promoters. However, it remained unclear whether the negative effect of HBZ-SP1 was due to its weak DNA-binding activity or to its capacity to target cellular factors to transcriptionally-inactive nuclear bodies. To answer this question, we produced a mutant in which specific residues present in the modulatory and DNA-binding domain of HBZ-SP1 were substituted for the corresponding c-Fos amino acids to improve the DNA-binding activity of themore » c-Jun/HBZ-SP1 heterodimer. The stability of the mutant, its interaction with c-Jun, DNA-binding activity of the resulting heterodimer, and its effect on the c-Jun activity were tested. In conclusion, we demonstrate that the repression of c-Jun activity in vivo is mainly due to the HBZ-SP1-mediated sequestration of c-Jun to the HBZ-NBs.« less

Glucostatic regulation of (+)-(/sup 3/H)amphetamine binding in the hypothalamus: correlation with Na/sup +/, K/sup +/-ATPase activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Angel, I.; Hauger, R.L.; Luu, M.D.

1985-09-01

Preincubation of rat hypothalamic slices in glucose-free Krebs-Ringer buffer (37/sup 0/C) resulted in a time-dependent decrease in specific (+)-(/sup 3/H)amphetamine binding in the crude synaptosomal fraction prepared from these slices. The addition of D-glucose resulted in a dose- and time-dependent stimulation of (+)-(/sup 3/H)amphetamine binding, whereas incubations with L-glucose, 2-deoxy-D-glucose, or 3-O-methyl-D-glucose failed to increase the number of (+)-(/sup 3/H)amphetamine binding sites. Ouabain potently inhibited the glucose-induced stimulation of (+)-(/sup 3/H)amphetamine binding, suggesting the involvement of Na/sup +/, K/sup +/-ATPase. Preincubation of hypothalamic slices with glucose also resulted in an increase in Na/sup +/,K/sup +/-ATPase activity and the number ofmore » specific high-affinity binding sites for (/sup 3/H)ouabain, and a good correlation was observed between the glucose-stimulated increase in (+)-(/sup 3/H)amphetamine and (/sup 3/H)ouabain binding. These data suggest that the (+)-(/sup 3/H)amphetamine binding site in hypothalamus, previously linked to the anorectic actions of various phenylethylamines, is regulated both in vitro and in vivo by physiological concentrations of glucose. Glucose and amphetamine appear to interact at common sites in the hypothalamus to stimulate Na/sup +/,K/sup +/-ATPase activity, and the latter may be involved in the glucostatic regulation of appetite.« less

Chiral halogenated Schiff base compounds: green synthesis, anticancer activity and DNA-binding study

NASA Astrophysics Data System (ADS)

Ariyaeifar, Mahnaz; Amiri Rudbari, Hadi; Sahihi, Mehdi; Kazemi, Zahra; Kajani, Abolghasem Abbasi; Zali-Boeini, Hassan; Kordestani, Nazanin; Bruno, Giuseppe; Gharaghani, Sajjad

2018-06-01

Eight enantiomerically pure halogenated Schiff base compounds were synthesized by reaction of halogenated salicylaldehydes with 3-Amino-1,2-propanediol (R or S) in water as green solvent at ambient temperature. All compounds were characterized by elemental analyses, NMR (1H and 13C), circular dichroism (CD) and FT-IR spectroscopy. FS-DNA binding studies of these compounds carried out by fluorescence quenching and UV-vis spectroscopy. The obtained results revealed that the ligands bind to DNA as: (Rsbnd ClBr) > (Rsbnd Cl2) > (Rsbnd Br2) > (Rsbnd I2) and (Ssbnd ClBr) > (Ssbnd Cl2) > (Ssbnd Br2) > (Ssbnd I2), indicating the effect of halogen on binding constant. In addition, DNA-binding constant of the Ssbnd and R-enantiomers are different from each other. The ligands can form halogen bonds with DNA that were confirmed by molecular docking. This method was also measured the bond distances and bond angles. The study of obtained data can have concluded that binding affinity of the ligands to DNA depends on strength of halogen bonds. The potential anticancer activity of ligands were also evaluated on MCF-7 and HeLa cancer cell lines by using MTT assay. The results showed that the anticancer activity and FS-DNA interaction is significantly dependent on the stereoisomers of Schiff base compounds as R-enantiomers displayed significantly higher activity than S-enantiomers. The molecular docking was also used to illustrate the specific DNA-binding of synthesized compounds and groove binding mode of DNA interaction was proposed for them. In addition, molecular docking results indicated that there are three types of bonds (Hsbnd and X-bond and hX-bond) between synthesized compounds and base pairs of DNA.

[Separation of osteoclasts by lectin affinity chromatography].

PubMed

Itokazu, M; Tan, A; Tanaka, S

1991-09-01

Newborn rat calvaria bone cells obtained by digestion were fractionated on columns of wheat-germ agglutinin (WGA) sepharose 6MB for osteoclast isolation. The initial nonspecific binding cells which were passed through the WGA sepharose column by a buffer acquired a high enzyme activity of alkaline phosphatase, but not that of acid phosphatase. However, elution of cells using a buffer with the addition of N-acetyl-D-glucosamine resulted in a high acid phosphatase activity but no alkaline phosphatase activity. The former WGA binding negative fraction enriched osteoblasts averaging 30 microns in size. The latter WGA binding positive fraction enriched osteoclasts ranging from 20 microns to 60 microns in size. The electron-microscope clearly demonstrated the cellular details of osteoclasts. Isolated cell counts showed a ratio of six to four. These results indicate that our method of osteoclast isolation is simple and useful in lectin affinity chromatography because all cells have sugar moieties on their surface and the binding of osteoclasts can be reversed by the addition of specific lectin-binding sugars to the eluting buffer.

Cross-linking of surface Ig receptors on murine B lymphocytes stimulates the expression of nuclear tetradecanoyl phorbol acetate-response element-binding proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiles, T.C.; Liu, J.L.; Rothstein, T.L.

1991-03-15

Cross-linking of sIg on primary B lymphocytes leads to increased nuclear DNA-binding activity specific for the tetradecanoyl phorbol acetate-response element (TRE), as judged by gel mobility shift assays. Stimulation of B cells to enter S phase of the cell cycle by treatment with the combination of phorbol ester plus calcium ionophore also stimulated nuclear TRE-binding activity within 2 h, with maximal expression at 4 h; however, phorbol ester and calcium ionophore were not as effective in stimulating binding activity when examined separately. Stimulated nuclear expression of TRE-binding activity appears to require protein synthesis. Fos- and Jun/AP-1-related proteins participate directly inmore » the identified nucleoprotein complex, as shown by the ability of c-fos- and c-jun-specific antisera to either alter or completely abolish electrophoretic migration of the complex in native gels. Further, UV photo-cross-linking studies identified two major TRE-binding protein species, whose sizes correspond to TRE-binding proteins derived from HeLa cell nuclear extracts. The results suggest that in primary B cells nuclear TRE-binding activity represents a downstream signaling event that occurs subsequent to changes in protein kinase C activity and intracellular Ca2+ but that can be triggered physiologically through sIg.« less

ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

PubMed Central

Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

2013-01-01

Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

Design principles of a microtubule polymerase

PubMed Central

Geyer, Elisabeth A; Miller, Matthew P; Brautigam, Chad A; Biggins, Sue

2018-01-01

Stu2/XMAP215 microtubule polymerases use multiple tubulin-binding TOG domains and a lattice-binding basic region to processively promote faster elongation. How the domain composition and organization of these proteins dictate polymerase activity, end localization, and processivity is unknown. We show that polymerase activity does not require different kinds of TOGs, nor are there strict requirements for how the TOGs are linked. We identify an unexpected antagonism between the tubulin-binding TOGs and the lattice-binding basic region: lattice binding by the basic region is weak when at least two TOGs engage tubulins, strong when TOGs are empty. End-localization of Stu2 requires unpolymerized tubulin, at least two TOGs, and polymerase competence. We propose a ‘ratcheting’ model for processivity: transfer of tubulin from TOGs to the lattice activates the basic region, retaining the polymerase at the end for subsequent rounds of tubulin binding and incorporation. These results clarify design principles of the polymerase. PMID:29897335

Context-dependent activation of Wnt signaling by tumor suppressor RUNX3 in gastric cancer cells

PubMed Central

Ju, Xiaoli; Ishikawa, Tomo-o; Naka, Kazuhito; Ito, Kosei; Ito, Yoshiaki; Oshima, Masanobu

2014-01-01

RUNX3 is a tumor suppressor for a variety of cancers. RUNX3 suppresses the canonical Wnt signaling pathway by binding to the TCF4/β-catenin complex, resulting in the inhibition of binding of the complex to the Wnt target gene promoter. Here, we confirmed that RUNX3 suppressed Wnt signaling activity in several gastric cancer cell lines; however, we found that RUNX3 increased the Wnt signaling activity in KatoIII and SNU668 gastric cancer cells. Notably, RUNX3 expression increased the ratio of the Wnt signaling-high population in the KatoIII cells. although the maximum Wnt activation level of individual cells was similar to that in the control. As found previously, RUNX3 also binds to TCF4 and β-catenin in KatoIII cells, suggesting that these molecules form a ternary complex. Moreover, the ChIP analyses revealed that TCF4, β-catenin and RUNX3 bind the promoter region of the Wnt target genes, Axin2 and c-Myc, and the occupancy of TCF4 and β-catenin in these promoter regions is increased by the RUNX3 expression. These results suggest that RUNX3 stabilizes the TCF4/β-catenin complex on the Wnt target gene promoter in KatoIII cells, leading to activation of Wnt signaling. Although RUNX3 increased the Wnt signaling activity, its expression resulted in suppression of tumorigenesis of KatoIII cells, indicating that RUNX3 plays a tumor-suppressing role in KatoIII cells through a Wnt-independent mechanism. These results indicate that RUNX3 can either suppress or activate the Wnt signaling pathway through its binding to the TCF4/β-catenin complex by cell context-dependent mechanisms. PMID:24447505

HPK1 competes with ADAP for SLP-76 binding and via Rap1 negatively affects T-cell adhesion.

PubMed

Patzak, Irene M; Königsberger, Sebastian; Suzuki, Akira; Mak, Tak W; Kiefer, Friedemann

2010-11-01

The hematopoietic progenitor kinase 1 (HPK1) signals into MAPK and NFκB pathways downstream of immunoreceptors, but enigmatically is a negative regulator of leukocytes. Here, we report a novel role for HPK1 in regulating the activation of the adhesion molecule leukocyte function-associated antigen-1 (LFA-1). Upon TCR stimulation, mediated by binding of adhesion and degranulation promoting adaptor protein (ADAP) to SLP-76, a ternary complex composed of ADAP/55-kDa src kinase associated phosphoprotein (SKAP-55) and RIAM translocates to the membrane and causes membrane recruitment of the active small GTPase Ras-related protein 1 (Rap1). Active Rap1, via its binding to RapL (regulator for cell adhesion and polarization enriched in lymphoid tissues), mediates LFA-1 integrin activation. We show here that HPK1, which also binds SLP-76, compete with ADAP for SLP-76 binding. In addition, HPK1 dampens Rap1 activation, resulting in decreased LFA-1 activity. Analysis of HPK1-deficient T cells revealed increased ADAP recruitment to SLP-76 and elevated Rap1 activation in those cells, leading to increased adhesion to ICAM-1 and cell spreading. Altogether, these results describe a novel function for HPK1 in linking TCR signaling to cell adhesion regulation and provide a mechanistic explanation for the negative regulatory role of HPK1 in T-cell biology.

Analysis of the Binding Moiety Mediating the Interaction between Monocarboxylate Transporters and Carbonic Anhydrase II*

PubMed Central

Noor, Sina Ibne; Dietz, Steffen; Heidtmann, Hella; Boone, Christopher D.; McKenna, Robert; Deitmer, Joachim W.; Becker, Holger M.

2015-01-01

Proton-coupled monocarboxylate transporters (MCTs) mediate the exchange of high energy metabolites like lactate between different cells and tissues. We have reported previously that carbonic anhydrase II augments transport activity of MCT1 and MCT4 by a noncatalytic mechanism, while leaving transport activity of MCT2 unaltered. In the present study, we combined electrophysiological measurements in Xenopus oocytes and pulldown experiments to analyze the direct interaction between carbonic anhydrase II (CAII) and MCT1, MCT2, and MCT4, respectively. Transport activity of MCT2-WT, which lacks a putative CAII-binding site, is not augmented by CAII. However, introduction of a CAII-binding site into the C terminus of MCT2 resulted in CAII-mediated facilitation of MCT2 transport activity. Interestingly, introduction of three glutamic acid residues alone was not sufficient to establish a direct interaction between MCT2 and CAII, but the cluster had to be arranged in a fashion that allowed access to the binding moiety in CAII. We further demonstrate that functional interaction between MCT4 and CAII requires direct binding of the enzyme to the acidic cluster 431EEE in the C terminus of MCT4 in a similar fashion as previously shown for binding of CAII to the cluster 489EEE in the C terminus of MCT1. In CAII, binding to MCT1 and MCT4 is mediated by a histidine residue at position 64. Taken together, our results suggest that facilitation of MCT transport activity by CAII requires direct binding between histidine 64 in CAII and a cluster of glutamic acid residues in the C terminus of the transporter that has to be positioned in surroundings that allow access to CAII. PMID:25561737

Genome-wide specificity of DNA binding, gene regulation, and chromatin remodeling by TALE- and CRISPR/Cas9-based transcriptional activators

PubMed Central

Polstein, Lauren R.; Perez-Pinera, Pablo; Kocak, D. Dewran; Vockley, Christopher M.; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E.; Reddy, Timothy E.; Gersbach, Charles A.

2015-01-01

Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. PMID:26025803

Model of transcriptional activation by MarA in Escherichia coli.

PubMed

Wall, Michael E; Markowitz, David A; Rosner, Judah L; Martin, Robert G

2009-12-01

The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond.

RSK2 represses HSF1 activation during heat shock

PubMed Central

Wang, Xiaozhe; Asea, Alexzander; Xie, Yue; Kabingu, Edith; Stevenson, Mary Ann; Calderwood, Stuart K.

2000-01-01

Heat shock transcription factor 1(HSF1) activation is a multistep process. The conversion of a latent cytoplasmic form to a nuclear, DNA binding state appears to be activated by nonsteroidal anti-inflammatory drugs. In previous studies, we showed that HSF 1 is phosphorylated by the protein kinase RSK2 in vitro and that this effect is inhibited by nonsteroidal anti-inflammatory drugs at the concentration that leads to the activation of HSF1 in vivo (Stevenson et al 1999). In the present study, using cells from a patient with Coffin-Lowry syndrome (deficient in RSK2), we demonstrate that RSK2 slightly represses activation of HSF1 in vivo at 37°C. In Coffin-Lowry syndrome cells, HSF1-HSE DNA binding activity after treatment with sodium salicylate was slightly higher than that in untreated cells, indicating that although RSK2 is involved in HSF1 regulation, it is not the unique protein kinase that suppresses HSF1-HSE binding activity at 37°C. However, heat shock treatment resulted in significantly higher HSF1-HSE binding activity in Coffin-Lowry syndrome cells as compared with normal controls, suggesting that RSK2 represses HSF1-HSE binding activity during heat shock. PMID:11189448

RSK2 represses HSF1 activation during heat shock.

PubMed

Wang, X; Asea, A; Xie, Y; Kabingu, E; Stevenson, M A; Calderwood, S K

2000-11-01

Heat shock transcription factor 1(HSF1) activation is a multistep process. The conversion of a latent cytoplasmic form to a nuclear, DNA binding state appears to be activated by nonsteroidal anti-inflammatory drugs. In previous studies, we showed that HSF 1 is phosphorylated by the protein kinase RSK2 in vitro and that this effect is inhibited by nonsteroidal anti-inflammatory drugs at the concentration that leads to the activation of HSF1 in vivo (Stevenson et al 1999). In the present study, using cells from a patient with Coffin-Lowry syndrome (deficient in RSK2), we demonstrate that RSK2 slightly represses activation of HSF1 in vivo at 37 degrees C. In Coffin-Lowry syndrome cells, HSF1-HSE DNA binding activity after treatment with sodium salicylate was slightly higher than that in untreated cells, indicating that although RSK2 is involved in HSF1 regulation, it is not the unique protein kinase that suppresses HSF1-HSE binding activity at 37 degrees C. However, heat shock treatment resulted in significantly higher HSF1-HSE binding activity in Coffin-Lowry syndrome cells as compared with normal controls, suggesting that RSK2 represses HSF1-HSE binding activity during heat shock.

Photo-Activated Localization Microscopy of Single Carbohydrate Binding Modules on Cellulose Nanofibers

NASA Astrophysics Data System (ADS)

Hor, Amy; Dagel, Daryl; Luu, Quocanh; Savaikar, Madhusudan; Ding, Shi-You; Smith, Steve

2015-03-01

Photo Activated Localization Microscopy (PALM) is used to conduct an in vivo study of the binding affinity of polysaccharide-specific Carbohydrate Binding Modules (CBMs) to insoluble cellulose substrates. Two families of CBMs, namely TrCBM1 and CtCBM3, were modified to incorporate photo-activatable mCherry fluorescent protein (PAmCherry), and exposed to highly crystalline Valonia cellulose nano-fibrils. The resulting PALM images show CBMs binding along the nano-fibril long axis in a punctuated linear array, localized with, on average, 10 nm precision. Statistical analysis of the binding events results in nearest neighbor distributions between CBMs. A comparison between TrCBM1 and CtCBM3 reveals a similarity in the nearest neighbor distribution peaks but differences in the overall binding density. The former is attributed to steric hindrance among the CBMs on the nano-fibril whereas the latter is attributed to differences in the CBMs' binding strength. These results are compared to similar distributions derived from TEM measurements of dried samples of CtCBM3-CdSs quantum dot bioconjugates and AFM images of CtCBM3-GFP bound to similar Valonia nano-fibrils. Funding provided by NSF MPS/DMR/BMAT Award # 1206908.

In Silico Characterization of the Binding Affinity of Dendrimers to Penicillin-Binding Proteins (PBPs): Can PBPs be Potential Targets for Antibacterial Dendrimers?

PubMed

Ahmed, Shaimaa; Vepuri, Suresh B; Ramesh, Muthusamy; Kalhapure, Rahul; Suleman, Nadia; Govender, Thirumala

2016-04-01

We have shown that novel silver salts of poly (propyl ether) imine (PETIM) dendron and dendrimers developed in our group exhibit preferential antibacterial activity against methicillin-resistant Staphylococcus aureus (MRSA) and Staphylococcus aureus. This led us to examine whether molecular modeling methods could be used to identify the key structural design principles for a bioactive lead molecule, explore the mechanism of binding with biological targets, and explain their preferential antibacterial activity. The current article reports the conformational landscape as well as mechanism of binding of generation 1 PETIM dendron and dendrimers to penicillin-binding proteins (PBPs) in order to understand the antibacterial activity profiles of their silver salts. Molecular dynamics at different simulation protocols and conformational analysis were performed to elaborate on the conformational features of the studied dendrimers, as well as to create the initial structure for further binding studies. The results showed that for all compounds, there were no significant conformational changes due to variation in simulation conditions. Molecular docking calculations were performed to investigate the binding theme between the studied dendrimers and PBPs. Interestingly, in significant accordance with the experimental data, dendron and dendrimer with aliphatic cores were found to show higher activity against S. aureus than the dendrimer with an aromatic core. The latter showed higher activity against MRSA. The findings from this computational and molecular modeling report together with the experimental results serve as a road map toward designing more potent antibacterial dendrimers against resistant bacterial strains.

Affinities of penicillins and cephalosporins for the penicillin-binding proteins of Escherichia coli K-12 and their antibacterial activity.

PubMed Central

Curtis, N A; Orr, D; Ross, G W; Boulton, M G

1979-01-01

The affinities of a range of penicillins and cephalosporins for ther penicillin-binding proteins of Escherichia coli K-12 have been studied, and the results were compared with the antibacterial activity of the compounds against E. coli K-12 and an isogenic permeability mutant. Different penicillins and cephalosporins exhibited different affinities for the "essential" penicillin-binding proteins of E. coli K-12, in a manner which directly correlated with their observed effects upon bacterial morphology. Furthermore, the affinities of the compounds for their "primary" lethal penicillin-binding protein targets showed close agreement with their antibacterial activities against the permeability mutant. Images PMID:393164

Heat shock protein 70.1 (Hsp70.1) affects neuronal cell fate by regulating lysosomal acid sphingomyelinase.

PubMed

Zhu, Hong; Yoshimoto, Tanihiro; Yamashima, Tetsumori

2014-10-03

The inducible expression of heat shock protein 70.1 (Hsp70.1) plays cytoprotective roles in its molecular chaperone function. Binding of Hsp70 to an endolysosomal phospholipid, bis(monoacylglycero)phosphate (BMP), has been recently shown to stabilize lysosomal membranes by enhancing acid sphingomyelinase (ASM) activity in cancer cells. Using the monkey experimental paradigm, we have reported that calpain-mediated cleavage of oxidized Hsp70.1 causes neurodegeneration in the hippocampal cornu ammonis 1 (CA1), whereas expression of Hsp70.1 in the motor cortex without calpain activation contributes to neuroprotection. However, the molecular mechanisms of the lysosomal destabilization/stabilization determining neuronal cell fate have not been elucidated. To elucidate whether regulation of lysosomal ASM could affect the neuronal fate, we analyzed Hsp70.1-BMP binding and ASM activity by comparing the motor cortex and the CA1. We show that Hsp70.1 being localized at the lysosomal membrane, lysosomal lipid BMP levels, and the lipid binding domain of Hsp70.1 are crucial for Hsp70.1-BMP binding. In the postischemic motor cortex, Hsp70.1 being localized at the lysosomal membrane could bind to BMP without calpain activation and decreased BMP levels, resulting in increasing ASM activity and lysosomal stability. However, in the postischemic CA1, calpain activation and a concomitant decrease in the lysosomal membrane localization of Hsp70.1 and BMP levels may diminish Hsp70.1-BMP binding, resulting in decreased ASM activity and lysosomal rupture with leakage of cathepsin B into the cytosol. A TUNEL assay revealed the differential neuronal vulnerability between the CA1 and the motor cortex. These results suggest that regulation of ASM activation in vivo by Hsp70.1-BMP affects lysosomal stability and neuronal survival or death after ischemia/reperfusion. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Mycobacterium tuberculosis cAMP Receptor Protein (Rv3676) Differs from the Escherichia coli Paradigm in Its cAMP Binding and DNA Binding Properties and Transcription Activation Properties*

PubMed Central

Stapleton, Melanie; Haq, Ihtshamul; Hunt, Debbie M.; Arnvig, Kristine B.; Artymiuk, Peter J.; Buxton, Roger S.; Green, Jeffrey

2010-01-01

The pathogen Mycobacterium tuberculosis produces a burst of cAMP upon infection of macrophages. Bacterial cyclic AMP receptor proteins (CRP) are transcription factors that respond to cAMP by binding at target promoters when cAMP concentrations increase. Rv3676 (CRPMt) is a CRP family protein that regulates expression of genes (rpfA and whiB1) that are potentially involved in M. tuberculosis persistence and/or emergence from the dormant state. Here, the CRPMt homodimer is shown to bind two molecules of cAMP (one per protomer) at noninteracting sites. Furthermore, cAMP binding by CRPMt was relatively weak, entropy driven, and resulted in a relatively small enhancement in DNA binding. Tandem CRPMt-binding sites (CRP1 at −58.5 and CRP2 at −37.5) were identified at the whiB1 promoter (PwhiB1). In vitro transcription reactions showed that CRP1 is an activating site and that CRP2, which was only occupied in the presence of cAMP or at high CRPMt concentrations in the absence of cAMP, is a repressing site. Binding of CRPMt to CRP1 was not essential for open complex formation but was required for transcription activation. Thus, these data suggest that binding of CRPMt to the PwhiB1 CRP1 site activates transcription at a step after open complex formation. In contrast, high cAMP concentrations allowed occupation of both CRP1 and CRP2 sites, resulting in inhibition of open complex formation. Thus, M. tuberculosis CRP has evolved several distinct characteristics, compared with the Escherichia coli CRP paradigm, to allow it to regulate gene expression against a background of high concentrations of cAMP. PMID:20028978

Functional Analysis of the Citrate Activator CitO from Enterococcus faecalis Implicates a Divalent Metal in Ligand Binding

PubMed Central

Blancato, Víctor S.; Pagliai, Fernando A.; Magni, Christian; Gonzalez, Claudio F.; Lorca, Graciela L.

2016-01-01

The regulator of citrate metabolism, CitO, from Enterococcus faecalis belongs to the FCD family within the GntR superfamily. In the presence of citrate, CitO binds to cis-acting sequences located upstream of the cit promoters inducing the expression of genes involved in citrate utilization. The quantification of the molecular binding affinities, performed by isothermal titration calorimetry (ITC), indicated that CitO has a high affinity for citrate (KD = 1.2 ± 0.2 μM), while it did not recognize other metabolic intermediates. Based on a structural model of CitO where a putative small molecule and a metal binding site were identified, it was hypothesized that the metal ion is required for citrate binding. In agreement with this model, citrate binding to CitO sharply decreased when the protein was incubated with EDTA. This effect was reverted by the addition of Ni2+, and Zn2+ to a lesser extent. Structure-based site-directed mutagenesis was conducted and it was found that changes to alanine in residues Arg97 and His191 resulted in decreased binding affinities for citrate, as determined by EMSA and ITC. Further assays using lacZ fusions confirmed that these residues in CitO are involved in sensing citrate in vivo. These results indicate that the molecular modifications induced by a ligand and a metal binding in the C-terminal domain of CitO are required for optimal DNA binding activity, and consequently, transcriptional activation. PMID:26903980

JAB1 regulates unphosphorylated STAT3 DNA-binding activity through protein–protein interaction in human colon cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimoto, Arata, E-mail: anishimo@yamaguchi-u.ac.jp; Kugimiya, Naruji; Hosoyama, Toru

2013-08-30

Highlights: •JAB1 interacted with unphosphorylated STAT3 in the nucleus. •JAB1 knockdown tended to increase nuclear STAT3 expression. •JAB1 knockdown significantly decreased unphosphorylated STAT3 DNA-binding activity. •JAB1 knockdown significantly decreased MDR1, NANOG, and VEGF expressions. •Nuclear JAB1, but not nuclear STAT3, correlated with STAT3 DNA-binding activity. -- Abstract: Recent studies have revealed that unphosphorylated STAT3 forms a dimer, translocates to the nucleus, binds to the STAT3 binding site, and activates the transcription of STAT3 target genes, thereby playing an important role in oncogenesis in addition to phosphorylated STAT3. Among signaling steps of unphosphorylated STAT3, nuclear translocation and target DNA-binding are themore » critical steps for its activation. Therefore, elucidating the regulatory mechanism of these signaling steps of unphosphorylated STAT3 is a potential step in the discovery of a novel cancer drug. However, the mechanism of unphosphorylated STAT3 binding to the promoter of target genes remains unclear. In this study, we focused on Jun activation domain-binding protein 1 (JAB1) as a candidate protein that regulates unphosphorylated STAT3 DNA-binding activity. Initially, we observed that both unphosphorylated STAT3 and JAB1 existed in the nucleus of human colon cancer cell line COLO205 at the basal state (no cytokine stimulation). On the other hand, phosphorylated STAT3 did not exist in the nucleus of COLO205 cells at the basal state. Immunoprecipitation using nuclear extract of COLO205 cells revealed that JAB1 interacted with unphosphorylated STAT3. To investigate the effect of JAB1 on unphosphorylated STAT3 activity, RNAi studies were performed. Although JAB1 knockdown tended to increase nuclear STAT3 expression, it significantly decreased unphosphorylated STAT3 DNA-binding activity. Subsequently, JAB1 knockdown significantly decreased the expression levels of MDR1, NANOG, and VEGF, which are STAT3 target genes. Furthermore, the expression level of nuclear JAB1, but not nuclear STAT3, correlated with unphosphorylated STAT3 DNA-binding activity between COLO205 and LoVo cells. Taken together, these results suggest that nuclear JAB1 positively regulates unphosphorylated STAT3 DNA-binding activity through protein–protein interaction in human colon cancer cell line COLO205.« less

The amino acid motif L/IIxxFE defines a novel actin-binding sequence in PDZ-RhoGEF

PubMed Central

Banerjee, Jayashree; Fischer, Christopher C.; Wedegaertner, Philip B.

2009-01-01

PDZ-RhoGEF is a member of the regulator of G protein signaling (RGS) domain-containing RhoGEFs (RGS-RhoGEFs) that link activated heterotrimeric G protein α subunits of the G12 family to activation of the small GTPase RhoA. Unique among the RGS-RhoGEFs, PDZ-RhoGEF contains a short sequence that localizes the protein to the actin cytoskeleton. In this report, we demonstrate that the actin-binding domain, located between amino acids 561–585, directly binds to F-actin in vitro. Extensive mutagenesis identifies isoleucine 568, isoleucine 569, phenylalanine 572, and glutamic acid 573 as necessary for binding to actin and for co-localization with the actin cytoskeleton in cells. These results define a novel actin-binding sequence in PDZ-RhoGEF with a critical amino acid motif of IIxxFE. Moreover, sequence analysis identifies a similar actin-binding motif in the N-terminus of the RhoGEF frabin, and, as with PDZ-RhoGEF, mutagenesis and actin interaction experiments demonstrate a motif of LIxxFE, consisting of the key amino acids leucine 23, isoleucine 24, phenylalanine 27, and glutamic acid 28. Taken together, results with PDZ-RhoGEF and frabin identify a novel actin binding sequence. Lastly, inducible dimerization of the actin-binding region of PDZ-RhoGEF revealed a dimerization-dependent actin bundling activity in vitro. PDZ-RhoGEF exists in cells as a dimer, raising the possibility that PDZ-RhoGEF could influence actin structure independent of its ability to activate RhoA. PMID:19618964

Two insulin-like peptide family members from the mosquito Aedes aegypti exhibit differential biological and receptor binding activities

PubMed Central

Wen, Zhimou; Gulia, Monika; Clark, Kevin D.; Dhara, Animesh; Crim, Joe W.; Strand, Michael R.; Brown, Mark R.

2010-01-01

Insects encode multiple ILPs but only one homolog of the vertebrate IR that activates the insulin signaling pathway. However, it remains unclear whether all insect ILPs are high affinity ligands for the IR or have similar biological functions. The yellow fever mosquito, Aedes aegypti, encodes eight ILPs with prior studies strongly implicating ILPs from the brain in regulating metabolism and the maturation of eggs following blood feeding. Here we addressed whether two ILP family members expressed in the brain, ILP4 and ILP3, have overlapping functional and receptor binding activities. Our results indicated that ILP3 exhibits strong insulin-like activity by elevating carbohydrate and lipid storage in sugar-fed adult females, whereas ILP4 does not. In contrast, both ILPs exhibited dose-dependent gonadotropic activity in blood-fed females as measured by the stimulation of ovaries to produce ecdysteroids and the uptake of yolk by primary oocytes. Binding studies using ovary membranes indicated that ILP4 and ILP3 do not cross compete; a finding further corroborated by cross-linking and immunoblotting experiments showing that ILP3 binds the MIR while ILP4 binds an unknown 55 kDa membrane protein. In contrast, each ILP activated the insulin signaling pathway in ovaries as measured by enhanced phosphorylation of Akt. RNAi and inhibitor studies further indicated that the gonadotropic activity of ILP4 and ILP3 requires the MIR and a functional insulin signaling pathway. Taken together, our results indicate that two members of the Ae. aegypti ILP family exhibit partially overlapping biological activity and different binding interactions with the MIR. PMID:20643184

Effects of bisphenol S on the structures and activities of trypsin and pepsin.

PubMed

Wang, Yan-Qing; Zhang, Hong-Mei

2014-11-19

The effects of bisphenol S on the structures and activities of trypsin and pepsin were investigated by various methods like UV-visible absorbance, fluorescence, circular dichroism, and molecular docking. The secondary and tertiary structures of trypsin and pepsin were altered by bisphenol S binding, which resulted in the loosening of the skeletons of trypsin and pepsin. In addition, bisphenol S induced microenvironmental changes around tyrosine and tryptophan residues of trypsin and pepsin. The activity experimental results showed that the activity of pepsin decreases obviously with the increasing concentration of BPS, while the activity of trypsin does not change remarkably. The binding and thermodynamic parameters obtained by molecular docking and fluorescence spectroscopy showed that the bindings of bisphenol S to trypsin and pepsin were spontaneous processes and hydrogen bonding and hydrophobic interactions played a vital role in stabilizing the bisphenol S-trypsin and bisphenol S-pepsin complexes. The binding constants (K(A)) of bisphenol S with trypsin were 7.42 × 10(4) (298 K) and 5.91 × 10(4) L/mol (310 K), and those of pepsin were 5.78 × 10(4) (298 K) and 4.44 × 10(4) L/mol (310 K). Moreover, there was one main kind of binding site for bisphenol S on trypsin or pepsin.

The behavioral and neural binding phenomena during visuomotor integration of angry facial expressions.

PubMed

Coll, Sélim Yahia; Ceravolo, Leonardo; Frühholz, Sascha; Grandjean, Didier

2018-05-02

Different parts of our brain code the perceptual features and actions related to an object, causing a binding problem, in which the brain has to integrate information related to an event without any interference regarding the features and actions involved in other concurrently processed events. Using a paradigm similar to Hommel, who revealed perception-action bindings, we showed that emotion could bind with motor actions when relevant, and in specific conditions, irrelevant for the task. By adapting our protocol to a functional Magnetic Resonance Imaging paradigm we investigated, in the present study, the neural bases of the emotion-action binding with task-relevant angry faces. Our results showed that emotion bound with motor responses. This integration revealed increased activity in distributed brain areas involved in: (i) memory, including the hippocampi; (ii) motor actions with the precentral gyri; (iii) and emotion processing with the insula. Interestingly, increased activations in the cingulate gyri and putamen, highlighted their potential key role in the emotion-action binding, due to their involvement in emotion processing, motor actions, and memory. The present study confirmed our previous results and point out for the first time the functional brain activity related to the emotion-action association.

Multiple Functions of Aromatic-Carbohydrate Interactions in a Processive Cellulase Examined with Molecular Simulation*

PubMed Central

Payne, Christina M.; Bomble, Yannick J.; Taylor, Courtney B.; McCabe, Clare; Himmel, Michael E.; Crowley, Michael F.; Beckham, Gregg T.

2011-01-01

Proteins employ aromatic residues for carbohydrate binding in a wide range of biological functions. Glycoside hydrolases, which are ubiquitous in nature, typically exhibit tunnels, clefts, or pockets lined with aromatic residues for processing carbohydrates. Mutation of these aromatic residues often results in significant activity differences on insoluble and soluble substrates. However, the thermodynamic basis and molecular level role of these aromatic residues remain unknown. Here, we calculate the relative ligand binding free energy by mutating tryptophans in the Trichoderma reesei family 6 cellulase (Cel6A) to alanine. Removal of aromatic residues near the catalytic site has little impact on the ligand binding free energy, suggesting that aromatic residues immediately upstream of the active site are not directly involved in binding, but play a role in the glucopyranose ring distortion necessary for catalysis. Removal of aromatic residues at the entrance and exit of the Cel6A tunnel, however, dramatically impacts the binding affinity, suggesting that these residues play a role in chain acquisition and product stabilization, respectively. The roles suggested from differences in binding affinity are confirmed by molecular dynamics and normal mode analysis. Surprisingly, our results illustrate that aromatic-carbohydrate interactions vary dramatically depending on the position in the enzyme tunnel. As aromatic-carbohydrate interactions are present in all carbohydrate-active enzymes, these results have implications for understanding protein structure-function relationships in carbohydrate metabolism and recognition, carbon turnover in nature, and protein engineering strategies for biomass utilization. Generally, these results suggest that nature employs aromatic-carbohydrate interactions with a wide range of binding affinities for diverse functions. PMID:21965672

OMP Peptides Activate the DegS Stress-Sensor Protease by a Relief of Inhibition Mechanism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sohn, Jungsan; Grant, Robert A.; Sauer, Robert T.

2010-03-19

In the E. coli periplasm, C-terminal peptides of misfolded outer-membrane porins (OMPs) bind to the PDZ domains of the trimeric DegS protease, triggering cleavage of a transmembrane regulator and transcriptional activation of stress genes. We show that an active-site DegS mutation partially bypasses the requirement for peptide activation and acts synergistically with mutations that disrupt contacts between the protease and PDZ domains. Biochemical results support an allosteric model, in which these mutations, active-site modification, and peptide/substrate binding act in concert to stabilize proteolytically active DegS. Cocrystal structures of DegS in complex with different OMP peptides reveal activation of the proteasemore » domain with varied conformations of the PDZ domain and without specific contacts from the bound OMP peptide. Taken together, these results indicate that the binding of OMP peptides activates proteolysis principally by relieving inhibitory contacts between the PDZ domain and the protease domain of DegS.« less

The PDZ-binding motif of Yes-associated protein is required for its co-activation of TEAD-mediated CTGF transcription and oncogenic cell transforming activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shimomura, Tadanori; Miyamura, Norio; Hata, Shoji

2014-01-17

Highlights: •Loss of the PDZ-binding motif inhibits constitutively active YAP (5SA)-induced oncogenic cell transformation. •The PDZ-binding motif of YAP promotes its nuclear localization in cultured cells and mouse liver. •Loss of the PDZ-binding motif inhibits YAP (5SA)-induced CTGF transcription in cultured cells and mouse liver. -- Abstract: YAP is a transcriptional co-activator that acts downstream of the Hippo signaling pathway and regulates multiple cellular processes, including proliferation. Hippo pathway-dependent phosphorylation of YAP negatively regulates its function. Conversely, attenuation of Hippo-mediated phosphorylation of YAP increases its ability to stimulate proliferation and eventually induces oncogenic transformation. The C-terminus of YAP contains amore » highly conserved PDZ-binding motif that regulates YAP’s functions in multiple ways. However, to date, the importance of the PDZ-binding motif to the oncogenic cell transforming activity of YAP has not been determined. In this study, we disrupted the PDZ-binding motif in the YAP (5SA) protein, in which the sites normally targeted by Hippo pathway-dependent phosphorylation are mutated. We found that loss of the PDZ-binding motif significantly inhibited the oncogenic transformation of cultured cells induced by YAP (5SA). In addition, the increased nuclear localization of YAP (5SA) and its enhanced activation of TEAD-dependent transcription of the cell proliferation gene CTGF were strongly reduced when the PDZ-binding motif was deleted. Similarly, in mouse liver, deletion of the PDZ-binding motif suppressed nuclear localization of YAP (5SA) and YAP (5SA)-induced CTGF expression. Taken together, our results indicate that the PDZ-binding motif of YAP is critical for YAP-mediated oncogenesis, and that this effect is mediated by YAP’s co-activation of TEAD-mediated CTGF transcription.« less

Evaluation of OASIS QSAR Models Using ToxCast™ in Vitro Estrogen and Androgen Receptor Binding Data and Application in an Integrated Endocrine Screening Approach

PubMed Central

Bhhatarai, Barun; Wilson, Daniel M.; Price, Paul S.; Marty, Sue; Parks, Amanda K.; Carney, Edward

2016-01-01

Background: Integrative testing strategies (ITSs) for potential endocrine activity can use tiered in silico and in vitro models. Each component of an ITS should be thoroughly assessed. Objectives: We used the data from three in vitro ToxCast™ binding assays to assess OASIS, a quantitative structure-activity relationship (QSAR) platform covering both estrogen receptor (ER) and androgen receptor (AR) binding. For stronger binders (described here as AC50 < 1 μM), we also examined the relationship of QSAR predictions of ER or AR binding to the results from 18 ER and 10 AR transactivation assays, 72 ER-binding reference compounds, and the in vivo uterotrophic assay. Methods: NovaScreen binding assay data for ER (human, bovine, and mouse) and AR (human, chimpanzee, and rat) were used to assess the sensitivity, specificity, concordance, and applicability domain of two OASIS QSAR models. The binding strength relative to the QSAR-predicted binding strength was examined for the ER data. The relationship of QSAR predictions of binding to transactivation- and pathway-based assays, as well as to in vivo uterotrophic responses, was examined. Results: The QSAR models had both high sensitivity (> 75%) and specificity (> 86%) for ER as well as both high sensitivity (92–100%) and specificity (70–81%) for AR. For compounds within the domains of the ER and AR QSAR models that bound with AC50 < 1 μM, the QSAR models accurately predicted the binding for the parent compounds. The parent compounds were active in all transactivation assays where metabolism was incorporated and, except for those compounds known to require metabolism to manifest activity, all assay platforms where metabolism was not incorporated. Compounds in-domain and predicted to bind by the ER QSAR model that were positive in ToxCast™ ER binding at AC50 < 1 μM were active in the uterotrophic assay. Conclusions: We used the extensive ToxCast™ HTS binding data set to show that OASIS ER and AR QSAR models had high sensitivity and specificity when compounds were in-domain of the models. Based on this research, we recommend a tiered screening approach wherein a) QSAR is used to identify compounds in-domain of the ER or AR binding models and predicted to bind; b) those compounds are screened in vitro to assess binding potency; and c) the stronger binders (AC50 < 1 μM) are screened in vivo. This scheme prioritizes compounds for integrative testing and risk assessment. Importantly, compounds that are not in-domain, that are predicted either not to bind or to bind weakly, that are not active in in vitro, that require metabolism to manifest activity, or for which in vivo AR testing is in order, need to be assessed differently. Citation: Bhhatarai B, Wilson DM, Price PS, Marty S, Parks AK, Carney E. 2016. Evaluation of OASIS QSAR models using ToxCast™ in vitro estrogen and androgen receptor binding data and application in an integrated endocrine screening approach. Environ Health Perspect 124:1453–1461; http://dx.doi.org/10.1289/EHP184 PMID:27152837

cAMP regulates DEP domain-mediated binding of the guanine nucleotide exchange factor Epac1 to phosphatidic acid at the plasma membrane.

PubMed

Consonni, Sarah V; Gloerich, Martijn; Spanjaard, Emma; Bos, Johannes L

2012-03-06

Epac1 is a cAMP-regulated guanine nucleotide exchange factor for the small G protein Rap. Upon cAMP binding, Epac1 undergoes a conformational change that results in its release from autoinhibition. In addition, cAMP induces the translocation of Epac1 from the cytosol to the plasma membrane. This relocalization of Epac1 is required for efficient activation of plasma membrane-located Rap and for cAMP-induced cell adhesion. This translocation requires the Dishevelled, Egl-10, Pleckstrin (DEP) domain, but the molecular entity that serves as the plasma membrane anchor and the possible mechanism of regulated binding remains elusive. Here we show that Epac1 binds directly to phosphatidic acid. Similar to the cAMP-induced Epac1 translocation, this binding is regulated by cAMP and requires the DEP domain. Furthermore, depletion of phosphatidic acid by inhibition of phospholipase D1 prevents cAMP-induced translocation of Epac1 as well as the subsequent activation of Rap at the plasma membrane. Finally, mutation of a single basic residue within a polybasic stretch of the DEP domain, which abolishes translocation, also prevents binding to phosphatidic acid. From these results we conclude that cAMP induces a conformational change in Epac1 that enables DEP domain-mediated binding to phosphatidic acid, resulting in the tethering of Epac1 at the plasma membrane and subsequent activation of Rap.

Role of nitric oxide in cellular iron metabolism.

PubMed

Kim, Sangwon; Ponka, Prem

2003-03-01

Iron regulatory proteins (IRP1 and IRP2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements (IREs) which are located in the 3' untranslated region (UTR) and the 5' UTR of their respective mRNAs. Cellular iron levels affect binding of IRPs to IREs and consequently expression of TfR and ferritin. Moreover, NO*, a redox species of nitric oxide that interacts primarily with iron, can activate IRP1 RNA-binding activity resulting in an increase in TfR mRNA levels. We have shown that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO+ (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA-binding of IRP2, followed by IRP2 degradation, and these changes were associated with a decrease in TfR mRNA levels. Moreover, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP1 binding activity, whereas RNA-binding of IRP2 decreased and was followed by a degradation of this protein. Furthermore, the decrease of IRP2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. These results suggest that NO+-mediated degradation of IRP2 plays a major role in iron metabolism during inflammation.

Annexin II-binding immunoglobulins in patients with lupus nephritis and their correlation with disease manifestations.

PubMed

Cheung, Kwok Fan; Yung, Susan; Chau, Mel K M; Yap, Desmond Y H; Chan, Kwok Wah; Lee, Cheuk Kwong; Tang, Colin S O; Chan, Tak Mao

2017-04-25

Annexin II on mesangial cell surface mediates the binding of anti-dsDNA antibodies and consequent downstream inflammatory and fibrotic processes. We investigated the clinical relevance of circulating annexin II-binding immunoglobulins (Igs) in patients with severe proliferative lupus nephritis, and renal annexin II expression in relation to progression of nephritis in New Zealand Black and White F1 mice (NZBWF1/J) mice. Annexin II-binding Igs in serum were measured by ELISA. Ultrastructural localization of annexin II was determined by electron microscopy. Seropositivity rates for annexin II-binding IgG and IgM in patients with active lupus nephritis were significantly higher compared with controls (8.9%, 1.3% and 0.9% for annexin II-binding IgG and 11.1%, 4.0% and 1.9% for annexin II-binding IgM for patients with active lupus nephritis, patients with non-lupus renal disease and healthy subjects respectively). In lupus patients, annexin II-binding IgM level was higher at disease flare compared with remission. Annexin II-binding IgG and IgM levels were associated with that of anti-dsDNA and disease activity. Annexin II-binding IgG and IgM levels correlated with histological activity index in lupus nephritis biopsy samples. In NZBWF1/J mice, serum annexin II-binding IgG and IgM levels and glomerular annexin II and p11 expression increased with progression of active nephritis. Annexin II expression was present on mesangial cell surface and in the mesangial matrix, and co-localized with electron-dense deposits along the glomerular basement membrane. Our results show that circulating annexin II-binding IgG and IgM levels are associated with clinical and histological disease activity in proliferative lupus nephritis. The co-localization of annexin II and p11 expression with immune deposition in the kidney suggests pathogenic relevance. © 2017 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

Ab initio study of the binding of Trichostatin A (TSA) in the active site of histone deacetylase like protein (HDLP).

PubMed

Vanommeslaeghe, Kenno; Van Alsenoy, Christian; De Proft, Frank; Martins, José C; Tourwé, Dirk; Geerlings, Paul

2003-08-21

Histone deacetylase (HDAC) inhibitors have recently attracted considerable interest because of their therapeutic potential for the treatment of cell proliferative diseases. An X-ray structure of a very potent inhibitor, Trichostatin A (TSA), bound to HDLP (an HDAC analogue isolated from Aquifex aeolicus), is available. From this structure, an active site model (322 atoms), relevant for the binding of TSA and structural analogues, has been derived, and TSA has been minimized in this active site at HF 3-21G* level. The resulting conformation is in excellent accordance with the X-ray structure, and indicates a deprotonation of the hydroxamic acid in TSA by His 131. Also, a water molecule was minimized in the active site. In addition to a similar deprotonation, in accordance with a possible catalytic mechanism of HDAC as proposed by Finnin et al. (M. S. Finnin, J. R. Donigian, A. Cohen, V. M. Richon, R. A. Rifkind and P. A. Marks, Nature, 1999, 401, 188-193), a displacement of the resulting OH- ion in the active site was observed. Based on these results, the difference in energy of binding between TSA and water was calculated. The resulting value is realistic in respect to experimental binding affinities. Furthermore, the mechanism of action of the His 131-Asp 166 charge relay system was investigated. Although the Asp residue in this motif is known to substantially increase the basicity of the His residue, no proton transfer from His 131 to Asp 166 was observed on binding of TSA or water. However, in the empty protonated active site, this proton transfer does occur.

Biological Activity and Binding Site Characteristics of the PA1b Entomotoxin on Insects from Different Orders

PubMed Central

Gressent, Frédéric; Duport, Gabrielle; Rahioui, Isabelle; Pauchet, Yannick; Bolland, Patrice; Specty, Olivier; Rahbe, Yvan

2007-01-01

The aim of this work was to investigate both the biological activity of an entomotoxin, the pea albumin 1b (PA1b), and the presence or absence of its binding site within an array of insect species. The data obtained showed that insect sensitivity was not related to its taxonomic position. Moreover, PA1b was not toxic to several tested microorganisms. However, the binding site was found to be conserved among very different insects, displaying similar thermodynamic constants regardless of the in vivo species sensitivity. The binding site alone was, therefore, not sufficient for toxicity. One exception was the pea weevil, Bruchus pisorum, which was the only tested species without any detectable binding activity. These findings indicate that the binding site probably has an important endogenous function in insects and that adaptation to pea seeds resulted in the elimination of the toxin binding activity in two independent insect lineages. Other mechanisms are likely to interact with the toxin effects, although they are still largely unknown, but there is no evidence of any specific degradation of PA1b in the midgut of insects insensitive to the toxin, such as Drosophila melanogaster or Mamestra brassicae. PMID:20331395

Does alpha 1-acid glycoprotein act as a non-functional receptor for alpha 1-adrenergic antagonists?

PubMed

Qin, M; Oie, S

1994-11-01

The ability of a variety of alpha 1-acid glycoproteins (AAG) to affect the intrinsic activity of the alpha 1-adrenergic antagonist prazosin was studied in rabbit aortic strip preparations. From these studies, the activity of AAG appears to be linked to their ability to bind the antagonist. However, a capability to bind prazosin was not the only requirement for this effect. The removal of sialic acid and partial removal of the galactose and mannose residues by periodate oxidation of human AAG all but eliminated the ability of AAG to affect the intrinsic pharmacologic activity of prazosin, although the binding of prazosin was not significantly affected. The presence of bovine AAG, a protein that has a low ability to bind prazosin, reduced the effect of human AAG on prazosin activity. Based upon these results, we propose that AAG is able to bind in the vicinity of the alpha 1-adrenoceptors, therefore extending the binding region for antagonists in such a way as to decrease the ability of the antagonist to interact with the receptor. The carbohydrate side-chains are important for the binding of AAG in the region of the adrenoceptor.

The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

PubMed

Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

2004-11-15

Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

A DNA-binding protein from Candida albicans that binds to the RPG box of Saccharomyces cerevisiae and the telomeric repeat sequence of C. albicans.

PubMed

Ishii, N; Yamamoto, M; Lahm, H W; Iizumi, S; Yoshihara, F; Nakayama, H; Arisawa, M; Aoki, Y

1997-02-01

Electromobility shift assays with a DNA probe containing the Saccharomyces cerevisiae ENO1 RPG box identified a specific DNA-binding protein in total protein extracts of Candida albicans. The protein, named Rbf1p (RPG-box-binding protein 1), bound to other S. cerevisiae RPG boxes, although the nucleotide recognition profile was not completely the same as that of S. cerevisiae Rap 1p (repressor-activator protein 1), an RPG-box-binding protein. The repetitive sequence of the C. albicans chromosomal telomere also competed with RPG-box binding to Rbf1p. For further analysis, we purified Rbf1p 57,600-fold from C. albicans total protein extracts, raised mAbs against the purified protein and immunologically cloned the gene, whose ORF specified a protein of 527 aa. The bacterially expressed protein showed RPG-box-binding activity with the same profile as that of the purified one. The Rbf1p, containing two glutamine-rich regions that are found in many transcription factors, showed transcriptional activation capability in S. cerevisiae and was predominantly observed in nuclei. These results suggest that Rbf1p is a transcription factor with telomere-binding activity in C. albicans.

Comprehensive meta-analysis of Signal Transducers and Activators of Transcription (STAT) genomic binding patterns discerns cell-specific cis-regulatory modules

PubMed Central

2013-01-01

Background Cytokine-activated transcription factors from the STAT (Signal Transducers and Activators of Transcription) family control common and context-specific genetic programs. It is not clear to what extent cell-specific features determine the binding capacity of seven STAT members and to what degree they share genetic targets. Molecular insight into the biology of STATs was gained from a meta-analysis of 29 available ChIP-seq data sets covering genome-wide occupancy of STATs 1, 3, 4, 5A, 5B and 6 in several cell types. Results We determined that the genomic binding capacity of STATs is primarily defined by the cell type and to a lesser extent by individual family members. For example, the overlap of shared binding sites between STATs 3 and 5 in T cells is greater than that between STAT5 in T cells and non-T cells. Even for the top 1,000 highly enriched STAT binding sites, ~15% of STAT5 binding sites in mouse female liver are shared by other STATs in different cell types while in T cells ~90% of STAT5 binding sites are co-occupied by STAT3, STAT4 and STAT6. In addition, we identified 116 cis-regulatory modules (CRM), which are recognized by all STAT members across cell types defining a common JAK-STAT signature. Lastly, in liver STAT5 binding significantly coincides with binding of the cell-specific transcription factors HNF4A, FOXA1 and FOXA2 and is associated with cell-type specific gene transcription. Conclusions Our results suggest that genomic binding of STATs is primarily determined by the cell type and further specificity is achieved in part by juxtaposed binding of cell-specific transcription factors. PMID:23324445

Decorin binds myostatin and modulates its activity to muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miura, Takayuki; Kishioka, Yasuhiro; Wakamatsu, Jun-ichi

2006-02-10

Myostatin, a member of TGF-{beta} superfamily of growth factors, acts as a negative regulator of skeletal muscle mass. The mechanism whereby myostatin controls the proliferation and differentiation of myogenic cells is mostly clarified. However, the regulation of myostatin activity to myogenic cells after its secretion in the extracellular matrix (ECM) is still unknown. Decorin, a small leucine-rich proteoglycan, binds TGF-{beta} and regulates its activity in the ECM. Thus, we hypothesized that decorin could also bind to myostatin and participate in modulation of its activity to myogenic cells. In order to test the hypothesis, we investigated the interaction between myostatin andmore » decorin by surface plasmon assay. Decorin interacted with mature myostatin in the presence of concentrations of Zn{sup 2+} greater than 10 {mu}M, but not in the absence of Zn{sup 2+}. Kinetic analysis with a 1:1 binding model resulted in dissociation constants (K {sub D}) of 2.02 x 10{sup -8} M and 9.36 x 10{sup -9} M for decorin and the core protein of decorin, respectively. Removal of the glycosaminoglycan chain by chondroitinase ABC digestion did not affect binding, suggesting that decorin could bind to myostatin with its core protein. Furthermore, we demonstrated that immobilized decorin could rescue the inhibitory effect of myostatin on myoblast proliferation in vitro. These results suggest that decorin could trap myostatin and modulate its activity to myogenic cells in the ECM.« less

Biological effects of individually synthesized TNF-binding domain of variola virus CrmB protein.

PubMed

Tsyrendorzhiev, D D; Orlovskaya, I A; Sennikov, S V; Tregubchak, T V; Gileva, I P; Tsyrendorzhieva, M D; Shchelkunov, S N

2014-06-01

The biological characteristics of a 17-kDa protein synthesized in bacterial cells, a TNF-binding domain (VARV-TNF-BP) of a 47-kDa variola virus CrmB protein (VARV-CrmB) consisting of TNF-binding and chemokine-binding domains, were studied. Removal of the C-terminal chemokine-binding domain from VARV-CrmB protein was inessential for the efficiency of its inhibition of TNF cytotoxicity towards L929 mouse fibroblast culture and for TNF-induced oxidative metabolic activity of mouse blood leukocytes. The results of this study could form the basis for further studies of VARV-TNF-BP mechanisms of activity for prospective use in practical medicine.

Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

PubMed Central

Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

2015-01-01

Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

Mutational analyses of Aquifex pyrophilus DNA ligase define essential domains for self-adenylation and DNA binding activity.

PubMed

Lim, J H; Choi, J; Kim, W; Ahn, B Y; Han, Y S

2001-04-15

We constructed nine deletion mutants of NAD+-dependent DNA ligase from Aquifex pyrophilus to characterize the functional domains. All of DNA ligase deletion mutants were analyzed in biochemical assays for NAD+-dependent self-adenylation, DNA binding, and nick-closing activity. Although the mutant lsub1 (91-362) included the active site lysine (KxDG), self-adenylation was not shown. However, the mutants lsub6 (1-362), lsub7 (1-516), and lsub9 (1-635) showed the same adenylation activity as that of wild type. The lsub5 (91-719), which has the C-terminal domain (487-719) as to lsub4 (91-486), showed minimal adenylation activity. These results suggest that the presence of N-terminal 90 residues is essential for the formation of an enzyme-AMP complex, while C-terminal domain (487-719) appears to play a minimal role in adenylation. It was found that the presence of C-terminal domain (487-719) is indispensable for DNA binding activity of lsub5 (91-719). The mutant lsub9 (1-635) showed reduced DNA binding activity compared to that of wild type, suggesting the contribution of the domain (636-719) for the DNA binding activity. Thus, we concluded that the N-terminal 90 residues and C-terminal domain (487-719) of NAD+-dependent DNA ligase from A. pyrophilus are mutually indispensable for binding of DNA substrate.

Enzymes in Commercial Cellulase Preparations Bind Differently to Dioxane Extracted Lignins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yarbrough, John M.; Mittal, Ashutosh; Katahira, Rui

Commercial fungal cellulases used in biomass-to-biofuels processes can be grouped into three general classes: native, augmented, and engineered. To evaluate lignin binding affinities of different enzyme activities in various commercial cellulase formulations in order to determine if enzyme losses due to lignin binding can be modulated by using different enzymes of the same activity We used water:dioxane (1:9) to extract lignin from pretreated corn stover. Commercial cellulases were incubated with lignin and the unbound supernatants were evaluated for individual enzyme loss by SDS=PAGE and these were correlated with activity loss using various pNP-sugar substrates. Colorimetric assays for general glycosyl hydrolasemore » activities showed distinct differences in enzyme binding to lignin for each enzyme activity. Native systems demonstrated low binding of endo- and exo-cellulases, high binding of xylanase, and moderate ..beta..-glucosidase binding. Engineered cellulase mixtures exhibited low binding of exo-cellulases, very strong binding of endocellulases and ..beta..- glucosidase, and mixed binding of xylanase activity. The augmented cellulase had low binding of exocellulase, high binding of endocellulase and xylanase, and moderate binding of ..beta..-glucosidase activities. Bound and unbound activities were correlated with general molecular weight ranges of proteins as measured by loss of proteins bands in bound fractions on SDS-PAGE gels. Lignin-bound high molecular weight bands correlated with binding of ..beta..-glucosidase activity. While ..beta..-glucosidases demonstrated high binding in many cases, they have been shown to remain active. Bound low molecular weight bands correlated with xylanase activity binding. Contrary to other literature, exocellulase activity did not show strong lignin binding. The variation in enzyme activity binding between the three classes of cellulases preparations indicate that it is certainly possible to alter the binding of specific glycosyl hydrolase activities. It remains unclear whether loss of endocellulase activity to lignin binding is problematic for biomass conversion.« less

Induction of the c-myc protooncogene following antigen binding to hapten-specific B cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Snow, E.C.; Fetherston, J.; Zimmer, S.

1986-03-01

Considerable controversy has centered on the role that the surface immunoglobulin (sIg) receptor for antigen plays during the induction of B cell activation. Stimulation by anti-Ig reagents has been shown to activate G/sub 0/ B cells to enter the cell cycle. The binding of thymus-dependent antigens to hapten-specific B cell populations apparently does not result in the movement of the antigen-binding cells (ABC) into the G/sub 1/ stage of the cell cycle. However, the authors have recently demonstrated that antigen binding to such hapten-specific B cells does result in the initiation of the membrane phosphatidylinositol cycle. In the present experiments,more » hapten-specific B cells (80-90% ABC, 99% in G/sub 0/) were incubated with either the correct hapten-carrier conjugate, with the carrier protein, or only media for 2 hours at 37/sup 0/C. At that time, total cellular RNA was isolated and subsequently analyzed by either dot blots or Northern gel techniques. The blots were probed with a (/sup 32/P)-c-myc SstI-Xhol fragment. The results indicate that hapten carrier stimulation of the hapten-specific B cells induces enhanced transcription of the c-myc gene. These observations lend further support to the premise that antigen binding to the sIg receptor results in the transduction to the cell of important signals and implicates the active participation of sIg during the process of antigen-mediated B cell activation.« less

Influence of aggregate size on the binding and activation of the first component of human complement by soluble IgG aggregates.

PubMed Central

Doekes, G; Vanes, L A; Daha, M R

1982-01-01

The interaction between small aggregates of human IgG and the first component of human complement was studied. Stabilized soluble IgG aggregates of restricted size were prepared by heat aggregation of human IgG, followed by sucrose-density ultracentrifugation. Human C1 was isolated in its precursor form by euglobulin precipitation, followed by gel filtration and immunoadsorption. A C1 preparation was obtained of which more than 90% was still in its unactivated form. Soluble aggregates containing 20, 10 or 5 molecules IgG, and monomeric IgG were tested for their ability to bind and to activate C1. The binding of C1 was determined by C1 consumption, whereas the activation of C1 was measured as the increased ability of the C1 preparation to consume purified human C4 after the incubation with the aggregates. The three aggregates tested and monomeric IgG were all able to bind and to activate C1, but the efficiency of both processes markedly increased with increasing aggregate-size. Furthermore, it was found that all four preparations activated an appreciable amount of C1 at concentrations that did not result in any detectable C1 fixation. These results confirm earlier suggestion that C1 can be activated during a short, transient binding to small aggregates or immune complexes that have a low avidity for C1, after which the activated form, C1, is released into the medium. PMID:7068172

Functional Activity of the Fanconi Anemia Protein FAA Requires FAC Binding and Nuclear Localization

PubMed Central

Näf, Dieter; Kupfer, Gary M.; Suliman, Ahmed; Lambert, Kathleen; D’Andrea, Alan D.

1998-01-01

Fanconi anemia (FA) is an autosomal recessive disease characterized by genomic instability, cancer susceptibility, and cellular hypersensitivity to DNA-cross-linking agents. Eight complementation groups of FA (FA-A through FA-H) have been identified. Two FA genes, corresponding to complementation groups FA-A and FA-C, have been cloned, but the functions of the encoded FAA and FAC proteins remain unknown. We have recently demonstrated that FAA and FAC interact to form a nuclear complex. In this study, we have analyzed a series of mutant forms of the FAA protein with respect to functional activity, FAC binding, and nuclear localization. Mutation or deletion of the amino-terminal nuclear localization signal (NLS) of FAA results in loss of functional activity, loss of FAC binding, and cytoplasmic retention of FAA. Replacement of the NLS sequence with a heterologous NLS sequence, derived from the simian virus 40 T antigen, results in nuclear localization but does not rescue functional activity or FAC binding. Nuclear localization of the FAA protein is therefore necessary but not sufficient for FAA function. Mutant forms of FAA which fail to bind to FAC also fail to promote the nuclear accumulation of FAC. In addition, wild-type FAC promotes the accumulation of wild-type FAA in the nucleus. Our results suggest that FAA and FAC perform a concerted function in the cell nucleus, required for the maintenance of chromosomal stability. PMID:9742112

Immune complexes and Ross River virus disease (epidemic polyarthritis).

PubMed

Fraser, J R; Cunningham, A L; Mathews, J D; Riglar, A

1988-01-01

Immune complexes were sought in serum and synovial fluid in Ross River virus disease (epidemic polyarthritis). Multiple samples from 15 patients showing varied degrees of disease activity over a 3 month period were analysed for their content of complement components C3 and C4, and for C1q solid-phase and Raji cell binding activity. Levels of C3 and C1q binding activity were normal. C4 and Raji cell binding activity were normal except for three high levels of Raji cell binding, of which two were accompanied by low levels of C4, with normal C3 and C1q binding. Synovial fluid showed anomalous Raji cell reactivity of uncertain significance. Conglutinin solid-phase binding activity and IgG rheumatoid factor were compared in the serum of 20 patients during active disease and after recovery. The results were identical and within the normal range in both phases. One patient developed IgM rheumatoid factor in a low titre late in his illness. Although these findings do not entirely exclude a role for immune complexes formed at the onset in the circulation or tissues, it is concluded from this and other evidence that circulating complexes are not commonly responsible for the persistence of syndromes in this disease.

Baicalin promotes the bacteriostatic activity of lysozyme on S. aureus in mammary glands and neutrophilic granulocytes in mice

PubMed Central

Zhang, Zecai; Shen, Peng; Yang, Zhengtao; Zhang, Naisheng

2017-01-01

Staphylococcus aureus causes mastitis as a result of community-acquired or nosocomial infections. Lysozyme (LYSO) is an enzyme that is upregulated in many organisms during the innate immune response against infection by bacterial pathogens. Baicalin is a bioactive flavonoid that can bind to enzymes, often to potentiate their effect. Here we tested the effects of baicalin on the activity of LYSO using the S. aureus mastitis mouse model and neutrophilic granulocyte model of S. aureus infection. In our experiments, S. aureus counts decreased with increasing baicalin concentration. Furthermore, qPCR and western blot analyses showed that LYSO expression was unaffected by baicalin, while fluorescence quenching and UV fluorescence spectral analyses showed that baicalin binds to LYSO. To test whether this binding increased LYSO activity, we assessed LYSO-induced bacteriostasis in the presence of baicalin. Our results showed that LYSO-induced S. aureus bacteriostasis increased with increasing concentrations of baicalin, and that baicalin binding to LYSO synergistically increased the antibacterial activity of LYSO. These results demonstrate that baicalin enhances LYSO-induced bacteriostasis during the innate immune response to S. aureus. They suggest baicalin is a potentially useful therapeutic agent for the treatment of bacterial infections. PMID:28184027

Acteoside and Acyl-Migrated Acteoside, Compounds in Chinese Kudingcha Tea, Inhibit α-Amylase In Vitro.

PubMed

Lu, Yuqin; Zhou, Wenyu; Feng, Yue; Li, Yao; Liu, Ke; Liu, Lizhong; Lin, Dongxu; He, Zhendan; Wu, Xuli

2017-06-01

Acteoside, the predominant polyphenol of small-leaved kudingcha, the Chinese tea, has various biological activities. In this study, we examined the acyl migration of acteoside to isoacteoside with high-temperature treatment of acteoside. The inhibitory effects of acyl-migrated acteoside and acteoside on α-amylase were investigated, as were their binding interaction with α-amylase. The binding of acteoside and isoacteoside to α-amylase was investigated by using the fluorescence spectra assay, circular dichroism, and protein-ligand docking studies. Acteoside was more effective than preheated acteoside and isoacteoside in inhibiting α-amylase activity. Acteoside and isoacteoside binding to α-amylase may induce conformational changes to α-amylase, and the binding site of acteoside and isoacteoside being near the active site pocket of α-amylase may explain the decreased activity of α-amylase. The different affinities and binding sites of acteoside and isoacteoside for α-amylase resulted in different inhibition rates, which may be due to structural differences between acteoside and isoacteoside.

Calcium/calmodulin-dependent kinase II phosphorylation of the GABAA receptor alpha1 subunit modulates benzodiazepine binding.

PubMed

Churn, Severn B; Rana, Aniruddha; Lee, Kangmin; Parsons, J Travis; De Blas, Angel; Delorenzo, Robert J

2002-09-01

gamma-Aminobutyric acid (GABA) is the primary neurotransmitter that is responsible for the fast inhibitory synaptic transmission in the central nervous system. A major post-translational mechanism that can rapidly regulate GABAAR function is receptor phosphorylation. This study was designed to test the effect of endogenous calcium and calmodulin-dependent kinase II (CaM kinase II) activation on both allosteric modulator binding and GABAA receptor subunit phosphorylation. Endogenous CaM kinase II activity was stimulated, and GABAA receptors were subsequently analyzed for bothallosteric modulator binding properties and immunoprecipitated and analyzed for subunit phosphorylation levels. A significant increase in allosteric-modulator binding of the GABAAR was observed under conditions maximal for CaM kinase II activation. In addition, CaM kinase II activation resulted in a direct increase in phosphorylation of the GABAA receptor alpha1 subunit. The data suggest that the CaM kinase II-dependent phosphorylation of the GABAA receptor alpha1 subunit modulated allosteric modulator binding to the GABAA receptor.

Re-engineering specificity in 1,3-1, 4-β-glucanase to accept branched xyloglucan substrates.

PubMed

Addington, Trevor; Calisto, Barbara; Alfonso-Prieto, Mercedes; Rovira, Carme; Fita, Ignasi; Planas, Antoni

2011-02-01

Family 16 carbohydrate active enzyme members Bacillus licheniformis 1,3-1,4-β-glucanase and Populus tremula x tremuloides xyloglucan endotransglycosylase (XET16-34) are highly structurally related but display different substrate specificities. Although the first binds linear gluco-oligosaccharides, the second binds branched xylogluco-oligosaccharides. Prior engineered nucleophile mutants of both enzymes are glycosynthases that catalyze the condensation between a glycosyl fluoride donor and a glycoside acceptor. With the aim of expanding the glycosynthase technology to produce designer oligosaccharides consisting of hybrids between branched xylogluco- and linear gluco-oligosaccharides, enzyme engineering on the negative subsites of 1,3-1,4-β-glucanase to accept branched substrates has been undertaken. Removal of the 1,3-1,4-β-glucanase major loop and replacement with that of XET16-34 to open the binding cleft resulted in a folded protein, which still maintained some β-glucan hydrolase activity, but the corresponding nucleophile mutant did not display glycosynthase activity with either linear or branched glycosyl donors. Next, point mutations of the 1,3-1,4-β-glucanase β-sheets forming the binding site cleft were mutated to resemble XET16-34 residues. The final chimeric protein acquired binding affinity for xyloglucan and did not bind β-glucan. Therefore, binding specificity has been re-engineered, but affinity was low and the nucleophile mutant of the chimeric enzyme did not show glycosynthase activity to produce the target hybrid oligosaccharides. Structural analysis by X-ray crystallography explains these results in terms of changes in the protein structure and highlights further engineering approaches toward introducing the desired activity. © 2010 Wiley-Liss, Inc.

Insights into the binding mode of sulphamates and sulphamides to hCA II: crystallographic studies and binding free energy calculations.

PubMed

De Simone, Giuseppina; Langella, Emma; Esposito, Davide; Supuran, Claudiu T; Monti, Simona Maria; Winum, Jean-Yves; Alterio, Vincenzo

2017-12-01

Sulphamate and sulphamide derivatives have been largely investigated as carbonic anhydrase inhibitors (CAIs) by means of different experimental techniques. However, the structural determinants responsible for their different binding mode to the enzyme active site were not clearly defined so far. In this paper, we report the X-ray crystal structure of hCA II in complex with a sulphamate inhibitor incorporating a nitroimidazole moiety. The comparison with the structure of hCA II in complex with its sulphamide analogue revealed that the two inhibitors adopt a completely different binding mode within the hCA II active site. Starting from these results, we performed a theoretical study on sulphamate and sulphamide derivatives, demonstrating that electrostatic interactions with residues within the enzyme active site play a key role in determining their binding conformation. These findings open new perspectives in the design of effective CAIs using the sulphamate and sulphamide zinc binding groups as lead compounds.

Structural and Biochemical Characterization of Organotin and Organolead Compounds Binding to the Organomercurial Lyase MerB Provide New Insights into Its Mechanism of Carbon–Metal Bond Cleavage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wahba, Haytham M.; Stevenson, Michael J.; Mansour, Ahmed

2017-01-03

The organomercurial lyase MerB has the unique ability to cleave carbon–Hg bonds, and structural studies indicate that three residues in the active site (C96, D99, and C159 in E. coli MerB) play important roles in the carbon–Hg bond cleavage. However, the role of each residue in carbon–metal bond cleavage has not been well-defined. To do so, we have structurally and biophysically characterized the interaction of MerB with a series of organotin and organolead compounds. Studies with two known inhibitors of MerB, dimethyltin (DMT) and triethyltin (TET), reveal that they inhibit by different mechanisms. In both cases the initial binding ismore » to D99, but DMT subsequently binds to C96, which induces a conformation change in the active site. In contrast, diethyltin (DET) is a substrate for MerB and the SnIV product remains bound in the active site in a coordination similar to that of HgII following cleavage of organomercurial compounds. The results with analogous organolead compounds are similar in that trimethyllead (TML) is not cleaved and binds only to D99, whereas diethyllead (DEL) is a substrate and the PbIV product remains bound in the active site. Binding and cleavage is an exothermic reaction, while binding to D99 has negligible net heat flow. These results show that initial binding of organometallic compounds to MerB occurs at D99 followed, in some cases, by cleavage and loss of the organic moieties and binding of the metal ion product to C96, D99, and C159. The N-terminus of MerA is able to extract the bound PbVI but not the bound SnIV. These results suggest that MerB could be utilized for bioremediation applications, but certain organolead and organotin compounds may present an obstacle by inhibiting the enzyme.« less

Expression of human peroxisome proliferator-activated receptors ligand binding domain-maltose binding protein fusion protein in Escherichia coli: a convenient and reliable method for preparing receptor for screening ligands.

PubMed

Li, Changqing; Tian, Mi; Yuan, Ye; Zhou, Qinxin

2008-12-01

Human peroxisome proliferator-activated receptors (hPPARs) are ligand-activated transcription factors and are the target for the treatment of many diseases. Screening of their ligands is mainly based on assays of ligand binding to the ligand binding domain (LBD) of hPPARs.However, such assays are difficult because of the preparation of hPPARs LBD. In order to yield functional hPPARs LBD for screening ligands, hPPARs LBD was fused with maltose-binding protein(MBP) using the pMAL-p2x expression system through the gene engineering technique. The radioligand binding assay showed that MBP did not affect ligand binding with hPPARs LBD in the fusion proteins, which means that MBP-hPPARs LBD can be used instead of hPPARs LBD in ligand screening work. The results show that the new strategy using MBP as a fusion tag for preparing hPPARs LBD for screening ligands is a convenient and reliable method. It may be used to easily obtain the other nuclear receptors.

Structure of Bacillus subtilis γ-glutamyltranspeptidase in complex with acivicin: diversity of the binding mode of a classical and electrophilic active-site-directed glutamate analogue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ida, Tomoyo; Suzuki, Hideyuki; Fukuyama, Keiichi

2014-02-01

The binding modes of acivicin, a classical and an electrophilic active-site-directed glutamate analogue, to bacterial γ-glutamyltranspeptidases were found to be diverse. γ-Glutamyltranspeptidase (GGT) is an enzyme that plays a central role in glutathione metabolism, and acivicin is a classical inhibitor of GGT. Here, the structure of acivicin bound to Bacillus subtilis GGT determined by X-ray crystallography to 1.8 Å resolution is presented, in which it binds to the active site in a similar manner to that in Helicobacter pylori GGT, but in a different binding mode to that in Escherichia coli GGT. In B. subtilis GGT, acivicin is bound covalentlymore » through its C3 atom with sp{sup 2} hybridization to Thr403 O{sup γ}, the catalytic nucleophile of the enzyme. The results show that acivicin-binding sites are common, but the binding manners and orientations of its five-membered dihydroisoxazole ring are diverse in the binding pockets of GGTs.« less

Evaluation of iron-binding activity of collagen peptides prepared from the scales of four cultivated fishes in Taiwan.

PubMed

Huang, Chun-Yung; Wu, Chien-Hui; Yang, Jing-Iong; Li, Ying-Han; Kuo, Jen-Min

2015-12-01

Iron deficiency is one of the most concerning deficiency problems in the world. It may generate several adverse effects such as iron deficiency anemia (IDA) and reduced physical and intellectual working capacity. The aim of this study is to evaluate the Fe(II)-binding activity of collagen peptides from fishery by-products. Lates calcarifer, Mugil cephalus, Chanos chanos, and Oreochromis spp are four major cultivated fishes in Taiwan; thousands of scales of these fish are wasted without valuable utilization. In this study, scales of these fish were hydrolyzed by papain plus flavourzyme. Collagen peptides were obtained and compared for their Fe(II)-binding activity. Collagen peptides from Chanos chanos showed the highest Fe(II)-binding activity, followed by those from Lates calcarifer and Mugil cephalus; that from Oreochromis spp exhibited the lowest one. Fe(II)-binding activity of collagen peptides from fish scales was also confirmed with a dialysis method. Molecular weight (MW) distributions of the collagen peptides from scales of four fish are all < 10 kDa, and averaged 1.3 kDa. Hydrolysates of fish scales were further partially purified with ion exchange chromatography. Fractions having Fe(II)-binding activity were obtained and their activity compared. Data obtained showed that collagen peptides from fish scales did have Fe(II)-binding activity. This is the first observation elucidating fish scale collagen possessing this functionality. The results from this study also indicated that collagen peptides from fish scales could be applied in industry as a bioresource. Copyright © 2014. Published by Elsevier B.V.

Point mutations in the tri-helix bundle of the M-domain of cardiac myosin binding protein-C influence systolic duration and delay cardiac relaxation.

PubMed

van Dijk, Sabine J; Kooiker, Kristina B; Napierski, Nathaniel C; Touma, Katia D; Mazzalupo, Stacy; Harris, Samantha P

2018-06-01

Cardiac myosin binding protein-C (cMyBP-C) is an essential regulatory protein required for proper systolic contraction and diastolic relaxation. We previously showed that N'-terminal domains of cMyBP-C stimulate contraction by binding to actin and activating the thin filament in vitro. In principle, thin filament activating effects of cMyBP-C could influence contraction and relaxation rates, or augment force amplitude in vivo. cMyBP-C binding to actin could also contribute to an internal load that slows muscle shortening velocity as previously hypothesized. However, the functional significance of cMyBP-C binding to actin has not yet been established in vivo. We previously identified an actin binding site in the regulatory M-domain of cMyBP-C and described two missense mutations that either increased (L348P) or decreased (E330K) binding affinity of recombinant cMyBP-C N'-terminal domains for actin in vitro. Here we created transgenic mice with either the L348P or E330K mutations to determine the functional significance of cMyBP-C binding to actin in vivo. Results showed that enhanced binding of cMyBP-C to actin in L348P-Tg mice prolonged the time to end-systole and slowed relaxation rates. Reduced interactions between cMyBP-C and actin in E330K-Tg mice had the opposite effect and significantly shortened the duration of ejection. Neither mouse model displayed overt systolic dysfunction, but L348P-Tg mice showed diastolic dysfunction presumably resulting from delayed relaxation. We conclude that cMyBP-C binding to actin contributes to sustained thin filament activation at the end of systole and during isovolumetric relaxation. These results provide the first functional evidence that cMyBP-C interactions with actin influence cardiac function in vivo. Copyright © 2018 Elsevier Ltd. All rights reserved.

The cholesterol-dependent cytolysins pneumolysin and streptolysin O require binding to red blood cell glycans for hemolytic activity

PubMed Central

Shewell, Lucy K.; Harvey, Richard M.; Higgins, Melanie A.; Day, Christopher J.; Hartley-Tassell, Lauren E.; Chen, Austen Y.; Gillen, Christine M.; James, David B. A.; Alonzo, Francis; Torres, Victor J.; Walker, Mark J.; Paton, Adrienne W.; Paton, James C.; Jennings, Michael P.

2014-01-01

The cholesterol-dependent cytolysin (CDC) pneumolysin (Ply) is a key virulence factor of Streptococcus pneumoniae. Membrane cholesterol is required for the cytolytic activity of this toxin, but it is not clear whether cholesterol is the only cellular receptor. Analysis of Ply binding to a glycan microarray revealed that Ply has lectin activity and binds glycans, including the Lewis histo-blood group antigens. Surface plasmon resonance analysis showed that Ply has the highest affinity for the sialyl LewisX (sLeX) structure, with a Kd of 1.88 × 10−5 M. Ply hemolytic activity against human RBCs showed dose-dependent inhibition by sLeX. Flow cytometric analysis and Western blots showed that blocking binding of Ply to the sLeX glycolipid on RBCs prevents deposition of the toxin in the membrane. The lectin domain responsible for sLeX binding is in domain 4 of Ply, which contains candidate carbohydrate-binding sites. Mutagenesis of these predicted carbohydrate-binding residues of Ply resulted in a decrease in hemolytic activity and a reduced affinity for sLeX. This study reveals that this archetypal CDC requires interaction with the sLeX glycolipid cellular receptor as an essential step before membrane insertion. A similar analysis conducted on streptolysin O from Streptococcus pyogenes revealed that this CDC also has glycan-binding properties and that hemolytic activity against RBCs can be blocked with the glycan lacto-N-neotetraose by inhibiting binding to the cell surface. Together, these data support the emerging paradigm shift that pore-forming toxins, including CDCs, have cellular receptors other than cholesterol that define target cell tropism. PMID:25422425

The cholesterol-dependent cytolysins pneumolysin and streptolysin O require binding to red blood cell glycans for hemolytic activity.

PubMed

Shewell, Lucy K; Harvey, Richard M; Higgins, Melanie A; Day, Christopher J; Hartley-Tassell, Lauren E; Chen, Austen Y; Gillen, Christine M; James, David B A; Alonzo, Francis; Torres, Victor J; Walker, Mark J; Paton, Adrienne W; Paton, James C; Jennings, Michael P

2014-12-09

The cholesterol-dependent cytolysin (CDC) pneumolysin (Ply) is a key virulence factor of Streptococcus pneumoniae. Membrane cholesterol is required for the cytolytic activity of this toxin, but it is not clear whether cholesterol is the only cellular receptor. Analysis of Ply binding to a glycan microarray revealed that Ply has lectin activity and binds glycans, including the Lewis histo-blood group antigens. Surface plasmon resonance analysis showed that Ply has the highest affinity for the sialyl LewisX (sLeX) structure, with a K(d) of 1.88 × 10(-5) M. Ply hemolytic activity against human RBCs showed dose-dependent inhibition by sLeX. Flow cytometric analysis and Western blots showed that blocking binding of Ply to the sLeX glycolipid on RBCs prevents deposition of the toxin in the membrane. The lectin domain responsible for sLeX binding is in domain 4 of Ply, which contains candidate carbohydrate-binding sites. Mutagenesis of these predicted carbohydrate-binding residues of Ply resulted in a decrease in hemolytic activity and a reduced affinity for sLeX. This study reveals that this archetypal CDC requires interaction with the sLeX glycolipid cellular receptor as an essential step before membrane insertion. A similar analysis conducted on streptolysin O from Streptococcus pyogenes revealed that this CDC also has glycan-binding properties and that hemolytic activity against RBCs can be blocked with the glycan lacto-N-neotetraose by inhibiting binding to the cell surface. Together, these data support the emerging paradigm shift that pore-forming toxins, including CDCs, have cellular receptors other than cholesterol that define target cell tropism.

A New Family of Nuclear Receptor Coregulators That Integrate Nuclear Receptor Signaling through CREB-Binding Protein

PubMed Central

Mahajan, Muktar A.; Samuels, Herbert H.

2000-01-01

We describe the cloning and characterization of a new family of nuclear receptor coregulators (NRCs) which modulate the function of nuclear hormone receptors in a ligand-dependent manner. NRCs are expressed as alternatively spliced isoforms which may exhibit different intrinsic activities and receptor specificities. The NRCs are organized into several modular structures and contain a single functional LXXLL motif which associates with members of the steroid hormone and thyroid hormone/retinoid receptor subfamilies with high affinity. Human NRC (hNRC) harbors a potent N-terminal activation domain (AD1), which is as active as the herpesvirus VP16 activation domain, and a second activation domain (AD2) which overlaps with the receptor-interacting LXXLL region. The C-terminal region of hNRC appears to function as an inhibitory domain which influences the overall transcriptional activity of the protein. Our results suggest that NRC binds to liganded receptors as a dimer and this association leads to a structural change in NRC resulting in activation. hNRC binds CREB-binding protein (CBP) with high affinity in vivo, suggesting that hNRC may be an important functional component of a CBP complex involved in mediating the transcriptional effects of nuclear hormone receptors. PMID:10866662

In vitro binding and receptor-mediated activity of terlipressin at vasopressin receptors V1 and V2

PubMed Central

Jamil, Khurram; Pappas, Stephen Chris; Devarakonda, Krishna R

2018-01-01

Terlipressin, a synthetic, systemic vasoconstrictor with selective activity at vasopressin-1 (V1) receptors, is a pro-drug for the endogenous/natural porcine hormone [Lys8]-vasopressin (LVP). We investigated binding and receptor-mediated cellular activities of terlipressin, LVP, and endogenous human hormone [Arg8]-vasopressin (AVP) at V1 and vasopressin-2 (V2) receptors. Cell membrane homogenates of Chinese hamster ovary cells expressing human V1 and V2 receptors were used in competitive binding assays to measure receptor-binding activity. These cells were used in functional assays to measure receptor-mediated cellular activity of terlipressin, LVP, and AVP. Binding was measured by [3H]AVP counts, and the activity was measured by fluorometric detection of intracellular calcium mobilization (V1) and cyclic adenosine monophosphate (V2). Binding potency at V1 and V2 was AVP>LVP>>terlipressin. LVP and terlipressin had approximately sixfold higher affinity for V1 than for V2. Cellular activity potency was also AVP>LVP>>terlipressin. Terlipressin was a partial agonist at V1 and a full agonist at V2; LVP was a full agonist at both V1 and V2. The in vivo response to terlipressin is likely due to the partial V1 agonist activity of terlipressin and full V1 agonist activity of its metabolite, LVP. These results provide supportive evidence for previous findings and further establish terlipressin pharmacology for vasopressin receptors. PMID:29302194

In vitro binding and receptor-mediated activity of terlipressin at vasopressin receptors V1 and V2.

PubMed

Jamil, Khurram; Pappas, Stephen Chris; Devarakonda, Krishna R

2018-01-01

Terlipressin, a synthetic, systemic vasoconstrictor with selective activity at vasopressin-1 (V 1 ) receptors, is a pro-drug for the endogenous/natural porcine hormone [Lys 8 ]-vasopressin (LVP). We investigated binding and receptor-mediated cellular activities of terlipressin, LVP, and endogenous human hormone [Arg 8 ]-vasopressin (AVP) at V 1 and vasopressin-2 (V 2 ) receptors. Cell membrane homogenates of Chinese hamster ovary cells expressing human V 1 and V 2 receptors were used in competitive binding assays to measure receptor-binding activity. These cells were used in functional assays to measure receptor-mediated cellular activity of terlipressin, LVP, and AVP. Binding was measured by [ 3 H]AVP counts, and the activity was measured by fluorometric detection of intracellular calcium mobilization (V 1 ) and cyclic adenosine monophosphate (V 2 ). Binding potency at V 1 and V 2 was AVP>LVP>terlipressin. LVP and terlipressin had approximately sixfold higher affinity for V 1 than for V 2 . Cellular activity potency was also AVP>LVP>terlipressin. Terlipressin was a partial agonist at V 1 and a full agonist at V 2 ; LVP was a full agonist at both V 1 and V 2 . The in vivo response to terlipressin is likely due to the partial V 1 agonist activity of terlipressin and full V 1 agonist activity of its metabolite, LVP. These results provide supportive evidence for previous findings and further establish terlipressin pharmacology for vasopressin receptors.

Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sultatos, L.G.; Kaushik, R.

2008-08-01

The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

Role of G protein-coupled estrogen receptor-1, matrix metalloproteinases 2 and 9, and heparin binding epidermal growth factor-like growth factor in estradiol-17β-stimulated bovine satellite cell proliferation.

PubMed

Kamanga-Sollo, E; Thornton, K J; White, M E; Dayton, W R

2014-10-01

In feedlot steers, estradiol-17β (E2) and combined E2 and trenbolone acetate (a testosterone analog) implants enhance rate and efficiency of muscle growth; and, consequently, these compounds are widely used as growth promoters. Although the positive effects of E2 on rate and efficiency of bovine muscle growth are well established, the mechanisms involved in these effects are not well understood. Combined E2 and trenbolone acetate implants result in significantly increased muscle satellite cell number in feedlot steers. Additionally, E2 treatment stimulates proliferation of cultured bovine satellite cells (BSC). Studies in nonmuscle cells have shown that binding of E2 to G protein-coupled estrogen receptor (GPER)-1 results in activation of matrix metalloproteinases 2 and 9 (MMP2/9) resulting in proteolytic release of heparin binding epidermal growth factor-like growth factor (hbEGF) from the cell surface. Released hbEGF binds to and activates the epidermal growth factor receptor resulting in increased proliferation. To assess if GPER-1, MMP2/9, and/or hbEGF are involved in the mechanism of E2-stimulated BSC proliferation, we have examined the effects of G36 (a specific inhibitor of GPER-1), CRM197 (a specific inhibitor of hbEGF), and MMP-2/MMP-9 Inhibitor II (an inhibitor of MMP2/9 activity) on E2-stimulated BSC proliferation. Inhibition of GPER-1, MMP2/9, or hbEGF suppresses E2-stimulated BSC proliferation (P < 0.001) suggesting that all these are required in order for E2 to stimulate BSC proliferation. These results strongly suggest that E2 may stimulate BSC proliferation by binding to GPER-1 resulting in MMP2/9-catalyzed release of cell membrane-bound hbEGF and subsequent activation of epidermal growth factor receptor by binding of released hbEGF. Copyright © 2014 Elsevier Inc. All rights reserved.

Rational design and validation of a vanilloid-sensitive TRPV2 ion channel.

PubMed

Yang, Fan; Vu, Simon; Yarov-Yarovoy, Vladimir; Zheng, Jie

2016-06-28

Vanilloids activation of TRPV1 represents an excellent model system of ligand-gated ion channels. Recent studies using cryo-electron microcopy (cryo-EM), computational analysis, and functional quantification revealed the location of capsaicin-binding site and critical residues mediating ligand-binding and channel activation. Based on these new findings, here we have successfully introduced high-affinity binding of capsaicin and resiniferatoxin to the vanilloid-insensitive TRPV2 channel, using a rationally designed minimal set of four point mutations (F467S-S498F-L505T-Q525E, termed TRPV2_Quad). We found that binding of resiniferatoxin activates TRPV2_Quad but the ligand-induced open state is relatively unstable, whereas binding of capsaicin to TRPV2_Quad antagonizes resiniferatoxin-induced activation likely through competition for the same binding sites. Using Rosetta-based molecular docking, we observed a common structural mechanism underlying vanilloids activation of TRPV1 and TRPV2_Quad, where the ligand serves as molecular "glue" that bridges the S4-S5 linker to the S1-S4 domain to open these channels. Our analysis revealed that capsaicin failed to activate TRPV2_Quad likely due to structural constraints preventing such bridge formation. These results not only validate our current working model for capsaicin activation of TRPV1 but also should help guide the design of drug candidate compounds for this important pain sensor.

Role of the interfacial binding domain in the oxidative susceptibility of lecithin:cholesterol acyltransferase.

PubMed Central

Wang, Kewei; Subbaiah, Papasani V

2002-01-01

We had previously shown that the cholesterol esterification activity of lecithin:cholesterol acyltransferase (LCAT) is destroyed by oxidation, but still it retains the ability to hydrolyse water-soluble substrates. This suggested that the inactivation of the enzyme is not due to its catalytic function, but due to a loss of its hydrophobic binding. Since recent studies have shown that a tryptophan residue in the putative interfacial domain (Trp(61)) is critical for the activity, we determined the possible role of this residue in the oxidative susceptibility and substrate specificity of LCAT by site-directed mutagenesis. Deletion of Trp(61) resulted in a 56% loss of cholesterol esterification (LCAT) activity, but the phospholipase A(2) (PLA(2)) and the esterase activities of the enzyme were stimulated slightly. Replacing Trp(61) with another aromatic residue [Trp(61)-->Tyr (W61Y)] resulted in an increase in all activities (14-157%), whereas replacing it with an aliphatic residue [Trp(61)-->Gly (W61G)] caused a dramatic loss of LCAT (-90%) and PLA(2) (-82%) activities, but not the esterase activity (-5%). W61Y was the most sensitive to oxidation, whereas W61G was the most resistant, with respect to the LCAT and PLA(2) activities. However, the activities which do not involve interfacial binding, namely the esterase activity and the transesterification of short-chain phospholipids, were more resistant to oxidation in all LCATs, indicating a selective loss of the interfacial binding by oxidation. Furthermore, replacing the two cysteines (Cys(31) and Cys(184)) in the Trp(61) deletion mutant caused additional resistance of the enzyme to oxidizing agents, showing that both domains of the enzyme contribute independently to its oxidative susceptibility. Since the hydrolysis of truncated phospholipids, generated during the oxidation of low-density lipoproteins, does not require the interfacial-binding domain, our results suggest that LCAT may take part in the detoxification of these compounds even after the loss of its cholesterol esterification function. PMID:11966470

Genome-wide specificity of DNA binding, gene regulation, and chromatin remodeling by TALE- and CRISPR/Cas9-based transcriptional activators.

PubMed

Polstein, Lauren R; Perez-Pinera, Pablo; Kocak, D Dewran; Vockley, Christopher M; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E; Reddy, Timothy E; Gersbach, Charles A

2015-08-01

Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. © 2015 Polstein et al.; Published by Cold Spring Harbor Laboratory Press.

Modulation of GABAergic receptor binding by activation of calcium and calmodulin-dependent kinase II membrane phosphorylation.

PubMed

Churn, S B; DeLorenzo, R J

1998-10-26

gamma-Aminobutyric acid (GABA) is the primary inhibitory neurotransmitter in the central nervous system (CNS). Because of the important role that GABA plays in the CNS, alteration of GABAA receptor function would significantly affect neuronal excitability. Protein phosphorylation is a major mechanism for regulating receptor function in the brain and has been implicated in modulating GABAA receptor function. Therefore, this study was initiated to determine the role of calmodulin-dependent kinase II (CaM kinase II) membrane phosphorylation on GABAA receptor binding. Synaptosomal membrane fractions were tested for CaM kinase II activity towards endogenous substrates. In addition, muscimol binding was evaluated under equilibrium conditions in synaptosomal membrane fractions subjected to either basal (Mg2+ alone) or maximal CaM kinase II-dependent phosphorylation. Activation of endogenous CaM kinase II-dependent phosphorylation resulted in a significant enhancement of the apparent Bmax for muscimol binding without significantly altering the apparent binding affinity. The enhanced muscimol binding could be increased further by the addition of exogenous CaM kinase II to synaptosomal membrane fractions. Co-incubation with inhibitors of kinase activity during the phosphorylation reactions blocked the CaM kinase II-dependent increase in muscimol binding. The data support the hypothesis that activation of CaM kinase II-dependent phosphorylation caused an increased GABAA receptor binding and may play an important role in modulating the function of this inhibitory receptor/chloride ion channel complex. Copyright 1998 Elsevier Science B.V.

The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

PubMed Central

Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

2011-01-01

The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

A versatile assay for RNA-binding proteins in living cells

PubMed Central

Strein, Claudia; Alleaume, Anne-Marie; Rothbauer, Ulrich; Hentze, Matthias W.; Castello, Alfredo

2014-01-01

RNA-binding proteins (RBPs) control RNA fate from synthesis to decay. Since their cellular expression levels frequently do not reflect their in vivo activity, methods are needed to assess the steady state RNA-binding activity of RBPs as well as their responses to stimuli. While electrophoresis mobility shift assays (EMSA) have been used for such determinations, their results serve at best as proxies for the RBP activities in living cells. Here, we describe a quantitative dual fluorescence method to analyze protein–mRNA interactions in vivo. Known or candidate RBPs are fused to fluorescent proteins (eGFP, YFP), expressed in cells, cross-linked in vivo to RNA by ultraviolet light irradiation, and immunoprecipitated, after lysis, with a single chain antibody fragment directed against eGFP (GFP-binding protein, GBP). Polyadenylated RNA-binding activity of fusion proteins is assessed by hybridization with an oligo(DT) probe coupled with a red fluorophore. Since UV light is directly applied to living cells, the assay can be used to monitor dynamic changes in RNA-binding activities in response to biological or pharmacological stimuli. Notably, immunoprecipitation and hybridization can also be performed with commercially available GBP-coupled 96-well plates (GFP-multiTrap), allowing highly parallel RNA-binding measurements in a single experiment. Therefore, this method creates the possibility to conduct in vivo high-throughput RNA-binding assays. We believe that this fast and simple radioactivity-free method will find many useful applications in RNA biology. PMID:24664470

Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

PubMed

Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

2012-06-01

In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

DNA binding properties and biological evaluation of dihydropyrimidinones derivatives as potential antitumor agents.

PubMed

Wang, Gongke; Li, Xiangrong; Gou, Yaping; Chen, Yuhan; Yan, Changling; Lu, Yan

2013-10-01

The binding properties of two medicinally important dihydropyrimidinones derivatives 5-(Ethoxycarbonyl)-6-methyl-4-phenyl-3,4-dihydropyrimidin-2(1H)-one (EMPD) and 5-(Ethoxycarbonyl)-6-methyl-4-(4-chlorophenyl)-3,4-dihydropyrimidin-2(1H)-one (EMCD) with calf-thymus DNA (ctDNA) were investigated by spectroscopy, viscosity, isothermal titration calorimetry (ITC) and molecular modeling techniques. Simultaneously, their biological activities were evaluated with MTT assay method. The binding constants determined with spectroscopic titration and ITC were found to be in the same order of 10(4)M(-1). According to the results of viscosity studies, fluorescence competitive binding experiment and ITC investigations, intercalative binding was evaluated as the dominant binding modes between the two compounds and ctDNA. Furthermore, the results of molecular modeling corroborated those obtained from spectroscopic, viscosimetric and ITC investigations. Evaluation of the antitumor activities of the two derivatives against different tumor cell lines proved that they exhibited significant tumor cell inhibition rate, accordingly blocking DNA transcription and replication. The present results favor the development of potential drugs related with dihydropyrimidinones derivatives in the treatment of some diseases. Copyright © 2013 Elsevier B.V. All rights reserved.

Systematic optimization model and algorithm for binding sequence selection in computational enzyme design

PubMed Central

Huang, Xiaoqiang; Han, Kehang; Zhu, Yushan

2013-01-01

A systematic optimization model for binding sequence selection in computational enzyme design was developed based on the transition state theory of enzyme catalysis and graph-theoretical modeling. The saddle point on the free energy surface of the reaction system was represented by catalytic geometrical constraints, and the binding energy between the active site and transition state was minimized to reduce the activation energy barrier. The resulting hyperscale combinatorial optimization problem was tackled using a novel heuristic global optimization algorithm, which was inspired and tested by the protein core sequence selection problem. The sequence recapitulation tests on native active sites for two enzyme catalyzed hydrolytic reactions were applied to evaluate the predictive power of the design methodology. The results of the calculation show that most of the native binding sites can be successfully identified if the catalytic geometrical constraints and the structural motifs of the substrate are taken into account. Reliably predicting active site sequences may have significant implications for the creation of novel enzymes that are capable of catalyzing targeted chemical reactions. PMID:23649589

Novel multiple opioid ligands based on 4-aminobenzazepinone (Aba), azepinoindole (Aia) and tetrahydroisoquinoline (Tic) scaffolds

PubMed Central

Ballet, Steven; Marczak, Ewa D.; Feytens, Debby; Salvadori, Severo; Sasaki, Yusuke; Abell, Andrew D.; Lazarus, Lawrence H.; Balboni, Gianfranco; Tourwé, Dirk

2010-01-01

The dimerization and trimerization of the Dmt-Tic, Dmt-Aia and Dmt-Aba pharmacophores provided multiple ligands which were evaluated in vitro for opioid receptor binding and functional activity. Whereas the Tic- and Aba multimers proved to be dual and balanced δ/μ antagonists, as determined by the functional [S35]GTPγS binding assay, the dimerization of potent Aia-based ‘parent’ ligands unexpectedly resulted in substantial less efficient receptor binding and non-active dimeric compounds. PMID:20137938

Essential role of lncRNA binding for WDR5 maintenance of active chromatin and embryonic stem cell pluripotency

PubMed Central

Yang, Yul W; Flynn, Ryan A; Chen, Yong; Qu, Kun; Wan, Bingbing; Wang, Kevin C; Lei, Ming; Chang, Howard Y

2014-01-01

The WDR5 subunit of the MLL complex enforces active chromatin and can bind RNA; the relationship between these two activities is unclear. Here we identify a RNA binding pocket on WDR5, and discover a WDR5 mutant (F266A) that selectively abrogates RNA binding without affecting MLL complex assembly or catalytic activity. Complementation in ESCs shows that WDR5 F266A mutant is unable to accumulate on chromatin, and is defective in gene activation, maintenance of histone H3 lysine 4 trimethylation, and ESC self renewal. We identify a family of ESC messenger and lncRNAs that interact with wild type WDR5 but not F266A mutant, including several lncRNAs known to be important for ESC gene expression. These results suggest that specific RNAs are integral inputs into the WDR5-MLL complex for maintenance of the active chromatin state and embryonic stem cell fates. DOI: http://dx.doi.org/10.7554/eLife.02046.001 PMID:24521543

Noonan syndrome-associated SHP2/PTPN11 mutants cause EGF-dependent prolonged GAB1 binding and sustained ERK2/MAPK1 activation.

PubMed

Fragale, Alessandra; Tartaglia, Marco; Wu, Jie; Gelb, Bruce D

2004-03-01

Noonan syndrome is a developmental disorder with dysmorphic facies, short stature, cardiac defects, and skeletal anomalies, which can be caused by missense PTPN11 mutations. PTPN11 encodes Src homology 2 domain-containing tyrosine phosphatase 2 (SHP2 or SHP-2), a protein tyrosine phosphatase that acts in signal transduction downstream to growth factor, hormone, and cytokine receptors. We compared the functional effects of three Noonan syndrome-causative PTPN11 mutations on SHP2's phosphatase activity, interaction with a binding partner, and signal transduction. All SHP2 mutants had significantly increased basal phosphatase activity compared to wild type, but that activity varied significantly between mutants and was further increased after epidermal growth factor stimulation. Cells expressing SHP2 mutants had prolonged extracellular signal-regulated kinase 2 activation, which was ligand-dependent. Binding of SHP2 mutants to Grb2-associated binder-1 was increased and sustained, and tyrosine phosphorylation of both proteins was prolonged. Coexpression of Grb2-associated binder-1-FF, which lacks SHP2 binding motifs, blocked the epidermal growth factor-mediated increase in SHP2's phosphatase activity and resulted in a dramatic reduction of extracellular signal-regulated kinase 2 activation. Taken together, these results document that Noonan syndrome-associated PTPN11 mutations increase SHP2's basal phosphatase activity, with greater activation when residues directly involved in binding at the interface between the N-terminal Src homology 2 and protein tyrosine phosphatase domains are altered. The SHP2 mutants prolonged signal flux through the RAS/mitogen-activated protein kinase (ERK2/MAPK1) pathway in a ligand-dependent manner that required docking through Grb2-associated binder-1 (GAB1), leading to increased cell proliferation. Copyright 2004 Wiley-Liss, Inc.

Stress-Induced Transcriptional Regulation in the Developing Rat Brain Involves Increased Cyclic Adenosine 3′,5′-Monophosphate-Regulatory Element Binding Activity

PubMed Central

Hatalski, Carolyn G.; Baram, Tallie Z.

2012-01-01

The cAMP-regulatory element (CRE) binding protein (CREB) functions as a trans-acting regulator of genes containing the CRE sequence in their promoter. These include a number of critical genes, such as CRF, involved in the hypothalamic response to stressful stimuli in the adult. The ability of the developing rat (during the first 2 postnatal weeks) to mount the full complement of this stress response has been questioned. We have previously demonstrated the stress-induced up-regulation of the transcription of hypothalamic CRF during the second postnatal week in the rat. The focus of the current study was to explore the mechanism of transcriptional regulation in response to stress through the physiological induction of transcriptional trans-activators that bind to the CRE in the developing rat brain. CRE-binding activity was detected via gel shift analysis in extracts from both the hypothalamus and the cerebral cortex of the developing rat. CREB was identified in these extracts by Western blot analysis and was shown to be the major contributor to the CRE-binding activity by gel shift analysis with two specific antibodies directed against CREB. After acute hypothermic stress, the abundance of CRE-binding activity (but not of total immunoreactive CREB), increased in hypothalamic extracts. This enhanced CRE-binding activity was blocked by an antiserum directed against CREB and was accompanied by an apparent increase in CREB phosphorylation. These results indicate that posttranslational enhancement of CRE-binding activity is likely to constitute an important mechanism for up-regulation of genes possessing the CRE sequence in the developing rat hypothalamus by adverse external signals. PMID:9415405

The mCpG-binding domain of human MBD3 does not bind to mCpG but interacts with NuRD/Mi2 components HDAC1 and MTA2.

PubMed

Saito, Motoki; Ishikawa, Fuyuki

2002-09-20

Although mammalian MBD3 contains the mCpG-binding domain (MBD) and is highly homologous with the authentic mCpG-binding protein MBD2, it was reported that the protein does not bind to mCpG specifically. Using recombinant human wild type and mutant MBD3 proteins, we demonstrated that atypical amino acids found in MBD3 MBD, namely, His-30 and Phe-34, are responsible for the inability of MBD3 to bind to mCpG. Interestingly, although H30K/F34Y MBD3 mutant protein binds to mCpG efficiently in vitro, it was not localized at the mCpG-rich pericentromeric regions in mouse cells. We also showed that Y34F MBD2b MBD, which possesses not the mCpG-specific DNA-binding activity but the nonspecific DNA-binding activity, was localized at the pericentromeric regions. These results suggested that the mCpG-specific DNA-binding activity is largely dispensable, and another factor(s) is required for the localization of MBD proteins in vivo. MBD3 was identified as a component of the NuRD/Mi2 complex that shows chromatin remodeling and histone deacetylase activities. We demonstrated that MBD3 MBD is necessary and sufficient for binding to HDAC1 and MTA2, two components of the NuRD/Mi2 complex. It was therefore suggested that mCpG-binding-defective MBD3 has evolutionarily conserved its MBD because of the secondary role played by the MBD in protein-protein interactions.

Tandem UIMs confer Lys48 ubiquitin chain substrate preference to deubiquitinase USP25

PubMed Central

Kawaguchi, Kohei; Uo, Kazune; Tanaka, Toshiaki; Komada, Masayuki

2017-01-01

Ubiquitin-specific protease (USP) 25, belonging to the USP family of deubiquitinases, harbors two tandem ubiquitin-interacting motifs (UIMs), a ~20-amino-acid α-helical stretch that binds to ubiquitin. However, the role of the UIMs in USP25 remains unclear. Here we show that the tandem UIM region binds to Lys48-, but not Lys63-, linked ubiquitin chains, where the two UIMs played a critical and cooperative role. Purified USP25 exhibited higher ubiquitin isopeptidase activity to Lys48-, than to Lys63-, linked ubiquitin chains. Mutations that disrupted the ubiquitin-binding ability of the tandem UIMs resulted in a reduced ubiquitin isopeptidase activity of USP25, suggesting a role for the UIMs in exerting the full catalytic activity of USP25. Moreover, when mutations that convert the binding preference from Lys48- to Lys63-linked ubiquitin chains were introduced into the tandem UIM region, the USP25 mutants acquired elevated and reduced isopeptidase activity toward Lys63- and Lys48-linked ubiquitin chains, respectively. These results suggested that the binding preference of the tandem UIMs toward Lys48-linked ubiquitin chains contributes not only to the full catalytic activity but also to the ubiquitin chain substrate preference of USP25, possibly by selectively holding the Lys48-linked ubiquitin chain substrates in the proximity of the catalytic core. PMID:28327663

Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives

PubMed Central

de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; Gomes da Silva, Lúcia Patrícia Bezerra; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Gois Ruiz, Ana Lucia Tasca; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

2015-01-01

In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a–h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N-(4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

MMPP Attenuates Non-Small Cell Lung Cancer Growth by Inhibiting the STAT3 DNA-Binding Activity via Direct Binding to the STAT3 DNA-Binding Domain.

PubMed

Son, Dong Ju; Zheng, Jie; Jung, Yu Yeon; Hwang, Chul Ju; Lee, Hee Pom; Woo, Ju Rang; Baek, Song Yi; Ham, Young Wan; Kang, Min Woong; Shong, Minho; Kweon, Gi Ryang; Song, Min Jong; Jung, Jae Kyung; Han, Sang-Bae; Kim, Bo Yeon; Yoon, Do Young; Choi, Bu Young; Hong, Jin Tae

2017-01-01

Rationale: Signal transducer and activator of transcription-3 (STAT3) plays a pivotal role in cancer biology. Many small-molecule inhibitors that target STAT3 have been developed as potential anticancer drugs. While designing small-molecule inhibitors that target the SH2 domain of STAT3 remains the leading focus for drug discovery, there has been a growing interest in targeting the DNA-binding domain (DBD) of the protein. Methods: We demonstrated the potential antitumor activity of a novel, small-molecule (E)-2-methoxy-4-(3-(4-methoxyphenyl)prop-1-en-1-yl)phenol (MMPP) that directly binds to the DBD of STAT3, in patient-derived non-small cell lung cancer (NSCLC) xenograft model as well as in NCI-H460 cell xenograft model in nude mice. Results: MMPP effectively inhibited the phosphorylation of STAT3 and its DNA binding activity in vitro and in vivo . It induced G1-phase cell cycle arrest and apoptosis through the regulation of cell cycle- and apoptosis-regulating genes by directly binding to the hydroxyl residue of threonine 456 in the DBD of STAT3. Furthermore, MMPP showed a similar or better antitumor activity than that of docetaxel or cisplatin. Conclusion: MMPP is suggested to be a potential candidate for further development as an anticancer drug that targets the DBD of STAT3.

Nitric oxide-mediated modulation of iron regulatory proteins: implication for cellular iron homeostasis.

PubMed

Kim, Sangwon; Ponka, Prem

2002-01-01

Iron regulatory proteins (IRP1 and IRP2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements (IREs) that are located in the 3' untranslated region (UTR) and the 5' UTR of their respective mRNAs. Cellular iron levels affect binding of IRPs to IREs and consequently expression of TfR and ferritin. Moreover, NO(.), a redox species of nitric oxide that interacts primarily with iron, can activate IRP1 RNA-binding activity resulting in an increase in TfR mRNA levels and a decrease in ferritin synthesis. We have shown that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA-binding of IRP2, followed by IRP2 degradation, and these changes were associated with a decrease in TfR mRNA levels and a dramatic increase in ferritin synthesis. Moreover, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP1 binding activity, whereas RNA-binding of IRP2 decreased and was followed by a degradation of this protein. Furthermore, the decrease of IRP2 binding/protein levels was associated with a decrease in TfR mRNA levels and an increase in ferritin synthesis in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. These results suggest that NO(+)-mediated degradation of IRP2 plays a major role in iron metabolism during inflammation.

NF-κB DNA-binding activity in embryos responding to a teratogen, cyclophosphamide

PubMed Central

Torchinsky, Arkady; Lishanski, Lucy; Wolstein, Orit; Shepshelovich, Jeanne; Orenstein, Hasida; Savion, Shoshana; Zaslavsky, Zeev; Carp, Howard; Brill, Alexander; Dikstein, Rivka; Toder, Vladimir; Fein, Amos

2002-01-01

Background The Rel/NF-κB transcription factors have been shown to regulate apoptosis in different cell types, acting as inducers or blockers in a stimuli- and cell type-dependent fashion. One of the Rel/NF-κB subunits, RelA, has been shown to be crucial for normal embryonic development, in which it functions in the embryonic liver as a protector against TNFα-induced physiological apoptosis. This study assesses whether NF-κB may be involved in the embryo's response to teratogens. Fot this, we evaluated how NF-KappaB DNA binding activity in embryonic organs demonstraiting differential sensitivity to a reference teratogen, cyclophosphamide, correlates with dysmorphic events induced by the teratogen at the cellular level (excessive apoptosis) and at the organ level (structural anomalies). Results The embryonic brain and liver were used as target organs. We observed that the Cyclophosphamide-induced excessive apoptosis in the brain, followed by the formation of severe craniofacial structural anomalies, was accompanied by suppression of NF-κB DNA-binding activity as well as by a significant and lasting increase in the activity of caspases 3 and 8. However, in the liver, in which cyclophosphamide induced transient apoptosis was not followed by dysmorphogenesis, no suppression of NF-κB DNA-binding activity was registered and the level of active caspases 3 and 8 was significantly lower than in the brain. It has also been observed that both the brain and liver became much more sensitive to the CP-induced teratogenic insult if the embryos were exposed to a combined treatment with the teratogen and sodium salicylate that suppressed NF-κB DNA-binding activity in these organs. Conclusion The results of this study demonstrate that suppression of NF-κB DNA-binding activity in embryos responding to the teratogenic insult may be associated with their decreased resistance to this insult. They also suggest that teratogens may suppress NF-κB DNA-binding activity in the embryonic tissues in an organ type- and dose-dependent fashion. PMID:11893254

Integrin-mediated signal transduction linked to Ras pathway by GRB2 binding to focal adhesion kinase.

PubMed

Schlaepfer, D D; Hanks, S K; Hunter, T; van der Geer, P

The cytoplasmic focal adhesion protein-tyrosine kinase (FAK) localizes with surface integrin receptors at sites where cells attach to the extracellular matrix. Increased FAK tyrosine phosphorylation occurs upon integrin engagement with fibronectin. Here we show that adhesion of murine NIH3T3 fibroblasts to fibronectin promotes SH2-domain-mediated association of the GRB2 adaptor protein and the c-Src protein-tyrosine kinase (PTK) with FAK in vivo, and also results in activation of mitogen-activated protein kinase (MAPK). In v-Src-transformed NIH3T3, the association of v-Src, GRB2 and Sos with FAK is independent of cell adhesion to fibronectin. The GRB2 SH2 domain binds directly to tyrosine-phosphorylated FAK. Mutation of tyrosine residue 925 of FAK (YENV motif) to phenylalanine blocks GRB2 SH2-domain binding to FAK in vitro. Our results show that fibronectin binding to integrins on NIH3T3 fibroblasts promotes c-Src and FAK association and formation of an integrin-activated signalling complex. Phosphorylation of FAK at Tyr 925 upon fibronectin stimulation creates an SH2-binding site for GRB2 which may link integrin engagement to the activation of the Ras/MAPK signal transduction pathway.

Structural basis for ligand-dependent dimerization of phenylalanine hydroxylase regulatory domain

PubMed Central

Patel, Dipali; Kopec, Jolanta; Fitzpatrick, Fiona; McCorvie, Thomas J.; Yue, Wyatt W.

2016-01-01

The multi-domain enzyme phenylalanine hydroxylase (PAH) catalyzes the hydroxylation of dietary I-phenylalanine (Phe) to I-tyrosine. Inherited mutations that result in PAH enzyme deficiency are the genetic cause of the autosomal recessive disorder phenylketonuria. Phe is the substrate for the PAH active site, but also an allosteric ligand that increases enzyme activity. Phe has been proposed to bind, in addition to the catalytic domain, a site at the PAH N-terminal regulatory domain (PAH-RD), to activate the enzyme via an unclear mechanism. Here we report the crystal structure of human PAH-RD bound with Phe at 1.8 Å resolution, revealing a homodimer of ACT folds with Phe bound at the dimer interface. This work delivers the structural evidence to support previous solution studies that a binding site exists in the RD for Phe, and that Phe binding results in dimerization of PAH-RD. Consistent with our structural observation, a disease-associated PAH mutant impaired in Phe binding disrupts the monomer:dimer equilibrium of PAH-RD. Our data therefore support an emerging model of PAH allosteric regulation, whereby Phe binds to PAH-RD and mediates the dimerization of regulatory modules that would bring about conformational changes to activate the enzyme. PMID:27049649

Bisphenol AF and Bisphenol B Exert Higher Estrogenic Effects than Bisphenol A via G Protein-Coupled Estrogen Receptor Pathway.

PubMed

Cao, Lin-Ying; Ren, Xiao-Min; Li, Chuan-Hai; Zhang, Jing; Qin, Wei-Ping; Yang, Yu; Wan, Bin; Guo, Liang-Hong

2017-10-03

Numerous studies have indicated estrogenic disruption effects of bisphenol A (BPA) analogues. Previous mechanistic studies were mainly focused on their genomic activities on nuclear estrogen receptor pathway. However, their nongenomic effects through G protein-coupled estrogen receptor (GPER) pathway remain poorly understood. Here, using a SKBR3 cell-based fluorescence competitive binding assay, we found six BPA analogues bound to GPER directly, with bisphenol AF (BPAF) and bisphenol B (BPB) displaying much higher (∼9-fold) binding affinity than BPA. Molecular docking also demonstrated the binding of these BPA analogues to GPER. By measuring calcium mobilization and cAMP production in SKBR3 cells, we found the binding of these BPA analogues to GPER lead to the activation of subsequent signaling pathways. Consistent with the binding results, BPAF and BPB presented higher agonistic activity than BPA with the lowest effective concentration (LOEC) of 10 nM. Moreover, based on the results of Boyden chamber and wound-healing assays, BPAF and BPB displayed higher activity in promoting GPER mediated SKBR3 cell migration than BPA with the LOEC of 100 nM. Overall, we found two BPA analogues BPAF and BPB could exert higher estrogenic effects than BPA via GPER pathway at nanomolar concentrations.

Optimization of reverse chemical ecology method: false positive binding of Aenasius bambawalei odorant binding protein 1 caused by uncertain binding mechanism.

PubMed

Li, Q L; Yi, S C; Li, D Z; Nie, X P; Li, S Q; Wang, M-Q; Zhou, A M

2018-06-01

Odorant binding proteins (OBPs) are considered as the core molecular targets in reverse chemical ecology, which is a convenient and efficient method by which to screen potential semiochemicals. Herein, we identified a classic OBP, AbamOBP1 from Aenasius bambawalei, which showed high mRNA expression in male antennae. Fluorescence competitive binding assay (FCBA) results demonstrated that AbamOBP1 has higher binding affinity with ligands at acid pH, suggesting the physiologically inconsistent binding affinity of this protein. Amongst the four compounds with the highest binding affinities at acid pH, 2, 4, 4-trimethyl-2-pentene and 1-octen-3-one were shown to have attractant activity for male adults, whereas (-)-limonene and an analogue of 1-octen-3-ol exhibited nonbehavioural activity. Further homology modelling and fluorescence quenching experiments demonstrated that the stoichiometry of the binding of this protein to these ligands was not 1: 1, suggesting that the results of FCBA were false. In contrast, the apparent association constants (Ka) of fluorescence quenching experiments seemed to be more reliable, because 2, 4, 4-trimethyl-2-pentene and 1-octen-3-one had observably higher Ka than (-)-limonene and 1-octen-3-ol at neutral pH. Based on the characteristics of different OBPs, various approaches should be applied to study their binding affinities with ligands, which could modify and complement the results of FCBA and contribute to the application of reverse chemical ecology. © 2018 The Royal Entomological Society.

Ubiquitin Regulates Caspase Recruitment Domain-mediated Signaling by Nucleotide-binding Oligomerization Domain-containing Proteins NOD1 and NOD2*

PubMed Central

Ver Heul, Aaron M.; Fowler, C. Andrew; Ramaswamy, S.; Piper, Robert C.

2013-01-01

NOD1 and NOD2 (nucleotide-binding oligomerization domain-containing proteins) are intracellular pattern recognition receptors that activate inflammation and autophagy. These pathways rely on the caspase recruitment domains (CARDs) within the receptors, which serve as protein interaction platforms that coordinately regulate immune signaling. We show that NOD1 CARD binds ubiquitin (Ub), in addition to directly binding its downstream targets receptor-interacting protein kinase 2 (RIP2) and autophagy-related protein 16-1 (ATG16L1). NMR spectroscopy and structure-guided mutagenesis identified a small hydrophobic surface of NOD1 CARD that binds Ub. In vitro, Ub competes with RIP2 for association with NOD1 CARD. In vivo, we found that the ligand-stimulated activity of NOD1 with a mutant CARD lacking Ub binding but retaining ATG16L1 and RIP2 binding is increased relative to wild-type NOD1. Likewise, point mutations in the tandem NOD2 CARDs at positions analogous to the surface residues defining the Ub interface on NOD1 resulted in loss of Ub binding and increased ligand-stimulated NOD2 signaling. These data suggest that Ub binding provides a negative feedback loop upon NOD-dependent activation of RIP2. PMID:23300079

HA Antibody-Mediated FcγRIIIa Activity Is Both Dependent on FcR Engagement and Interactions between HA and Sialic Acids.

PubMed

Cox, Freek; Kwaks, Ted; Brandenburg, Boerries; Koldijk, Martin H; Klaren, Vincent; Smal, Bastiaan; Korse, Hans J W M; Geelen, Eric; Tettero, Lisanne; Zuijdgeest, David; Stoop, Esther J M; Saeland, Eirikur; Vogels, Ronald; Friesen, Robert H E; Koudstaal, Wouter; Goudsmit, Jaap

2016-01-01

Interactions with receptors for the Fc region of IgG (FcγRs) have been shown to contribute to the in vivo protection against influenza A viruses provided by broadly neutralizing antibodies (bnAbs) that bind to the viral hemagglutinin (HA) stem. In particular, Fc-mediated antibody-dependent cellular cytotoxicity (ADCC) has been shown to contribute to protection by stem-binding bnAbs. Fc-mediated effector functions appear not to contribute to protection provided by strain-specific HA head-binding antibodies. We used a panel of anti-stem and anti-head influenza A and B monoclonal antibodies with identical human IgG1 Fc domains and investigated their ability to mediate ADCC-associated FcγRIIIa activation. Antibodies which do not interfere with sialic acid binding of HA can mediate FcγRIIIa activation. However, the FcγRIIIa activation was inhibited when a mutant HA, unable to bind sialic acids, was used. Antibodies which block sialic acid receptor interactions of HA interfered with FcγRIIIa activation. The inhibition of FcγRIIIa activation by HA head-binding and sialic acid receptor-blocking antibodies was confirmed in plasma samples of H5N1 vaccinated human subjects. Together, these results suggest that in addition to Fc-FcγR binding, interactions between HA and sialic acids on immune cells are required for optimal Fc-mediated effector functions by anti-HA antibodies.

Active Participation of Cellular Chaperone Hsp90 in Regulating the Function of Rotavirus Nonstructural Protein 3 (NSP3)*

PubMed Central

Dutta, Dipanjan; Chattopadhyay, Shiladitya; Bagchi, Parikshit; Halder, Umesh Chandra; Nandi, Satabdi; Mukherjee, Anupam; Kobayashi, Nobumichi; Taniguchi, Koki; Chawla-Sarkar, Mamta

2011-01-01

Heat shock protein 90 (Hsp90) has been reported to positively regulate rotavirus replication by modulating virus induced PI3K/Akt and NFκB activation. Here, we report the active association of Hsp90 in the folding and stabilization of rotavirus nonstructural protein 3 (NSP3). In pCD-NSP3-transfected cells, treatment with Hsp90 inhibitor (17-N,N-dimethylethylenediamine-geldanamycin (17DMAG)) resulted in the proteasomal degradation of NSP3. Sequence analysis and deletion mutations revealed that the region spanning amino acids 225–258 within the C-terminal eIF4G-binding domain of NSP3 is a putative Hsp90 binding region. Co-immunoprecipitation and mammalian two-hybrid experiments revealed direct interaction of the C-terminal 12-kDa domain of Hsp90 (C90) with residues 225–258 of NSP3. NSP3-Hsp90 interaction is important for the formation of functionally active mature NSP3, because full-length NSP3 in the presence of the Hsp90 inhibitor or NSP3 lacking the amino acid 225–258 region did not show NSP3 dimers following in vitro coupled transcription-translation followed by chase. Disruption of residues 225–258 within NSP3 also resulted in poor RNA binding and eIF4G binding activity. In addition, inhibition of Hsp90 by 17DMAG resulted in reduced nuclear translocation of poly(A)-binding protein and translation of viral proteins. These results highlight the crucial role of Hsp90 chaperone in the regulation of assembly and functionality of a viral protein during the virus replication and propagation in host cells. PMID:21489987

Changes in pH and NADPH regulate the DNA binding activity of neuronal PAS domain protein 2, a mammalian circadian transcription factor.

PubMed

Yoshii, Katsuhiro; Tajima, Fumihisa; Ishijima, Sumio; Sagami, Ikuko

2015-01-20

Neuronal PAS domain protein 2 (NPAS2) is a core clock transcription factor that forms a heterodimer with BMAL1 to bind the E-box in the promoter of clock genes and is regulated by various environmental stimuli such as heme, carbon monoxide, and NAD(P)H. In this study, we investigated the effects of pH and NADPH on the DNA binding activity of NPAS2. In an electrophoretic mobility shift (EMS) assay, the pH of the reaction mixture affected the DNA binding activity of the NPAS2/BMAL1 heterodimer but not that of the BMAL1/BMAL1 homodimer. A change in pH from 7.0 to 7.5 resulted in a 1.7-fold increase in activity in the absence of NADPH, and NADPH additively enhanced the activity up to 2.7-fold at pH 7.5. The experiments using truncated mutants revealed that N-terminal amino acids 1-61 of NPAS2 were sufficient to sense the change in both pH and NADPH. We further analyzed the kinetics of formation and DNA binding of the NPAS2/BMAL1 heterodimer at various pH values. In the absence of NADPH, a change in pH from 6.5 to 8.0 decreased the KD(app) value of the E-box from 125 to 22 nM, with an 8-fold increase in the maximal level of DNA binding for the NPAS2/BMAL1 heterodimer. The addition of NADPH resulted in a further decrease in KD(app) to 9 nM at pH 8.0. Furthermore, NPAS2-dependent transcriptional activity in a luciferase assay using NIH3T3 cells also increased with the pH of the culture medium. These results suggest that NPAS2 has a role as a pH and metabolite sensor in regulating circadian rhythms.

Biochemical and pharmacological characterization of the thyrotropin releasing hormone (TRH) receptor from clonal GH sub 4 C sub 1 pituitary cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Phillips, W.J.

1987-01-01

The effect of drugs with anesthetic properties on the activity of the pituitary thyrotropin-releasing hormone (TRH) receptor was determined in the clonal GH{sub 4}C{sub 1} somatomammotropic cell line. Classic local anesthetics and other drugs with anesthetic activity inhibited binding of ({sup 3}H)methyl-TRH to cell receptors at concentrations known to produce anesthetic effects on the membrane. The inhibition of TRH receptor binding by tetracaine was competitive and temperature and pH dependent. Verapamil and tetracaine inhibited TRH-stimulated prolactin secretion at concentrations that inhibited peptide binding. TRH-stimulated prolactin secretion was equivalent with or without Ca{sup 2+} channel activity. Verapamil and tetracaine also inhibitedmore » basal prolactin and secretion stimulated by drugs that bypass membrane receptors, db-cAMP and TPA. These results indicate that inhibition of TRH binding and responses by diverse drugs results from an anesthetic effect on the cell membrane.« less

Preclinical pharmacology of bilastine, a new selective histamine H1 receptor antagonist: receptor selectivity and in vitro antihistaminic activity.

PubMed

Corcóstegui, Reyes; Labeaga, Luis; Innerárity, Ana; Berisa, Agustin; Orjales, Aurelio

2005-01-01

This study aimed to establish the receptor selectivity and antihistaminic activity of bilastine, a new selective antihistamine receptor antagonist. In vitro experiments were conducted using a receptor binding screening panel and guinea-pig and rat tissues. Antihistaminic activity was determined using H1 receptor binding studies and in vitro H1 antagonism studies conducted in guinea-pig tissues and human cell lines. Receptor selectivity was established using a receptor binding screening panel and a receptor antagonism screening conducted in guinea-pig, rat and rabbit tissues. Inhibition of inflammatory mediators was determined through the Schultz-Dale reaction in sensitised guinea-pig ileum. Bilastine binds to histamine H1-receptors as indicated by its displacement of [3H]-pyrilamine from H1-receptors expressed in guinea-pig cerebellum and human embryonic kidney (HEK) cell lines. The studies conducted on guinea-pig smooth muscle demonstrated the capability of bilastine to antagonise H1-receptors. Bilastine is selective for histamine H1-receptors as shown in receptor-binding screening conducted to determine the binding capacity of bilastine to 30 different receptors. The specificity of its H1-receptor antagonistic activity was also demonstrated in a series of in vitro experiments conducted on guinea-pig and rat tissues. The results of these studies confirmed the lack of significant antagonism against serotonin, bradykinin, leukotriene D4, calcium, muscarinic M3-receptors, alpha1-adrenoceptors, beta2-adrenoceptors, and H2- and H3-receptors. The results of the in vitro Schultz-Dale reaction demonstrated that bilastine also has anti-inflammatory activity. These preclinical studies provide evidence that bilastine has H1- antihistamine activity, with high specificity for H1-receptors, and poor or no affinity for other receptors. Bilastine has also been shown to have anti-inflammatory properties.

Zinc binding in HDAC inhibitors: a DFT study.

PubMed

Wang, Difei; Helquist, Paul; Wiest, Olaf

2007-07-06

Histone deacetylases (HDACs) are attractive targets for the treatment of cancers and a variety of other diseases. Most currently studied HDAC inhibitors contain hydroxamic acids, which are potentially problematic in the development of practical drugs. DFT calculations of the binding modes and free energies of binding for a variety of other functionalities in a model active site of HDAC are described. The protonation state of hydroxamic acids in the active site and the origin of the high affinity are discussed. These results emphasize the importance of a carefully chosen pKa for zinc binding and provide guidance for the design of novel, non-hydroxamic acid HDAC inhibitors.

Identification of functional domains of the IR2 protein of equine herpesvirus 1 required for inhibition of viral gene expression and replication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Seong K., E-mail: skim1@lsuhsc.edu; Kim, Seongman; Dai Gan

2011-09-01

The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP0, IR4, and UL5, and late ETIF genes were dramatically inhibited. Viral DNA levels were reduced to 2.1% ofmore » control infected cells, but were vey weakly affected in cells that express the N-terminal 706 residues of IR2P. These results suggest that IR2P function requires the two N-terminal domains for binding DNA and TFIIB as well as the C-terminal residues 707 to 1116 containing the TBP-binding domain. - Highlights: > We examine the functional domains of IR2P that mediates negative regulation. > IR2P inhibits at the transcriptional level. > DNA-binding mutant or TFIIB-binding mutant fails to inhibit. > C-terminal aa 707 to 1116 are required for full inhibition. > Inhibition requires the DNA-binding domain, TFIIB-binding domain, and C-terminus.« less

Pyrrole and Fused Pyrrole Compounds with Bioactivity against Inflammatory Mediators.

PubMed

Said Fatahala, Samar; Hasabelnaby, Sherifa; Goudah, Ayman; Mahmoud, Ghada I; Helmy Abd-El Hameed, Rania

2017-03-17

A new series of pyrrolopyridines and pyrrolopyridopyrimidines have been synthesized from aminocyanopyrroles. The synthesized compounds have been characterized by FTIR, ¹H-NMR and mass spectroscopy. The final compounds have been screened for in vitro pro-inflammatory cytokine inhibitory and in vivo anti-inflammatory activity. The biological results revealed that among all tested compounds some fused pyrroles, namely the pyrrolopyridines 3i and 3l , show promising activity. A docking study of the active synthesized molecules confirmed the biological results and revealed a new binding pose in the COX-2 binding site.

A nitric oxide/cysteine interaction mediates the activation of soluble guanylate cyclase

PubMed Central

Fernhoff, Nathaniel B.; Derbyshire, Emily R.; Marletta, Michael A.

2009-01-01

Nitric oxide (NO) regulates a number of essential physiological processes by activating soluble guanylate cyclase (sGC) to produce the second messenger cGMP. The mechanism of NO sensing was previously thought to result exclusively from NO binding to the sGC heme; however, recent studies indicate that heme-bound NO only partially activates sGC and additional NO is involved in the mechanism of maximal NO activation. Furthermore, thiol oxidation of sGC cysteines results in the loss of enzyme activity. Herein the role of cysteines in NO-stimulated sGC activity investigated. We find that the thiol modifying reagent methyl methanethiosulfonate specifically inhibits NO activation of sGC by blocking a non-heme site, which defines a role for sGC cysteine(s) in mediating NO binding. The nature of the NO/cysteine interaction was probed by examining the effects of redox active reagents on NO-stimulated activity. These results show that NO binding to, and dissociation from, the critical cysteine(s) does not involve a change in the thiol redox state. Evidence is provided for non-heme NO in the physiological activation of sGC in context of a primary cell culture of human umbilical vein endothelial cells. These findings have relevance to diseases involving the NO/cGMP signaling pathway. PMID:20007374

Analysis of in vitro interactions of protein tyrosine phosphatase 1B with insulin receptors.

PubMed

Wang, X Y; Bergdahl, K; Heijbel, A; Liljebris, C; Bleasdale, J E

2001-02-28

One strategy to treat the insulin resistance that is central to type II diabetes mellitus may be to maintain insulin receptors (IR) in the active (tyrosine phosphorylated) form. Because protein tyrosine phosphatase 1B (PTP1B) binds and subsequently dephosphorylates IR, inhibitors of PTP1B-IR binding are potential insulin 'sensitizers.' A Scintillation Proximity Assay (SPA) was developed to characterize and quantitate PTP1B-IR binding. Human IR were solubilized and captured on wheat germ agglutinin (WGA)-coated SPA beads. Subsequent binding of human, catalytically inactive [35S] PTP1B Cys(215)/Ser (PTP1B(C215S)) to the lectin-anchored IR results in scintillation from the SPA beads that can be quantitated. Binding of PTP1B to IR was pH- and divalent cation-sensitive. Ca(2+) and Mn(2+), but not Mg(2+), dramatically attenuated the loss of PTP1B-IR binding observed when pH was raised from 6.2 to 7.8. PTP1B binding to IR from insulin-stimulated cells was much greater than to IR from unstimulated cells and was inhibited by either an antiphosphotyrosine antibody or treatment of IR with alkaline phosphatase, suggesting that tyrosine phosphorylation of IR is required for PTP1B binding. Phosphopeptides modeled after various IR phosphotyrosine domains each only partially inhibited PTP1B-IR binding, indicating that multiple domains of IR are likely involved in binding PTP1B. However, competitive displacement of [35S]PTP1B(C215S) by PTP1B(C215S) fitted best to a single binding site with a K(d) in the range 100-1000 nM, depending upon pH and divalent cations. PNU-200898, a potent and selective inhibitor of PTP1B whose orientation in the active site of PTP1B has been solved, competitively inhibited catalysis and PTP1B-IR binding with equal potency. The results of this novel assay for PTP1B-IR binding suggest that PTP1B binds preferentially to tyrosine phosphorylated IR through its active site and that binding may be susceptible to therapeutic disruption by small molecules.

Mononuclear Pd(II) complex as a new therapeutic agent: Synthesis, characterization, biological activity, spectral and DNA binding approaches

NASA Astrophysics Data System (ADS)

Saeidifar, Maryam; Mirzaei, Hamidreza; Ahmadi Nasab, Navid; Mansouri-Torshizi, Hassan

2017-11-01

The binding ability between a new water-soluble palladium(II) complex [Pd(bpy)(bez-dtc)]Cl (where bpy is 2,2‧-bipyridine and bez-dtc is benzyl dithiocarbamate), as an antitumor agent, and calf thymus DNA was evaluated using various physicochemical methods, such as UV-Vis absorption, Competitive fluorescence studies, viscosity measurement, zeta potential and circular dichroism (CD) spectroscopy. The Pd(II) complex was synthesized and characterized using elemental analysis, molar conductivity measurements, FT-IR, 1H NMR, 13C NMR and electronic spectra studies. The anticancer activity against HeLa cell lines demonstrated lower cytotoxicity than cisplatin. The binding constants and the thermodynamic parameters were determined at different temperatures (300 K, 310 K and 320 K) and shown that the complex can bind to DNA via electrostatic forces. Furthermore, this result was confirmed by the viscosity and zeta potential measurements. The CD spectral results demonstrated that the binding of Pd(II) complex to DNA induced conformational changes in DNA. We hope that these results will provide a basis for further studies and practical clinical use of anticancer drugs.

Correlation Between Growth Inhibition and the Binding of Various Penicillins and Cephalosporins to Staphylococcus aureus

PubMed Central

Edwards, John R.; Park, James T.

1969-01-01

The concentration of penicillin (or cephalosporin) required to achieve a given rate of binding to Staphylococcus aureus H correlates well with that required for inhibition of growth. This result suggests that the irreversible binding of penicillins and cephalosporins to cells is responsible for their biological activity. PMID:5808073

The hepta-beta-glucoside elicitor-binding proteins from legumes represent a putative receptor family.

PubMed

Mithöfer, A; Fliegmann, J; Neuhaus-Url, G; Schwarz, H; Ebel, J

2000-08-01

The ability of legumes to recognize and respond to beta-glucan elicitors by synthesizing phytoalexins is consistent with the existence of a membrane-bound beta-glucan-binding site. Related proteins of approximately 75 kDa and the corresponding mRNAs were detected in various species of legumes which respond to beta-glucans. The cDNAs for the beta-glucan-binding proteins of bean and soybean were cloned. The deduced 75-kDa proteins are predominantly hydrophilic and constitute a unique class of glucan-binding proteins with no currently recognizable functional domains. Heterologous expression of the soybean beta-glucan-binding protein in tomato cells resulted in the generation of a high-affinity binding site for the elicitor-active hepta-beta-glucoside conjugate (Kd = 4.5 nM). Ligand competition experiments with the recombinant binding sites demonstrated similar ligand specificities when compared with soybean. In both soybean and transgenic tomato, membrane-bound, active forms of the glucan-binding proteins coexist with immunologically detectable, soluble but inactive forms of the proteins. Reconstitution of a soluble protein fraction into lipid vesicles regained beta-glucoside-binding activity but with lower affinity (Kd = 130 nM). We conclude that the beta-glucan elicitor receptors of legumes are composed of the 75 kDa glucan-binding proteins as the critical components for ligand-recognition, and of an as yet unknown membrane anchor constituting the plasma membrane-associated receptor complex.

Insulin enhances the peroxidase activity of heme by forming heme-insulin complex: Relevance to type 2 diabetes mellitus.

PubMed

Huang, Yi; Yang, Zhen; Xu, Huan; Zhang, Pengfei; Gao, Zhonghong; Li, Hailing

2017-09-01

Evidences have implicated the involvement of heme in the type 2 diabetes mellitus (T2Dm) pathogenesis, but possible mediators linking between heme and diabetes are still poorly understood. Here, we explored a potential mechanism that linked heme, insulin and diabetes. Our results demonstrated the formation of heme-insulin complex by two classical methods, i.e. UV-vis and capillary electrophoresis-frontal analysis (CE-FA). UV-vis results implied heme binding insulin via bis-histidine sites, and CE-FA further revealed that, when insulin uses two sites binding with heme, this interaction occurs at high affinity (K d =3.13×10 -6 M). Molecule docking supported that histidine-B5 of insulin binds with heme-Fe. In addition to that, tyrosine-B26, phenylalanine-B1 and valine-B2 are also contributed to binding heme. The binding amplified the peroxidase activity of heme itself. Under oxidative and nitrative stress, it affects pathogenesis of diabetes from two aspects: promoting insulin cross-linking that leads to permanent loss of insulin functionality on one hand, and enhancing protein tyrosine nitration that may result in inactivation of proteins associated with diabetes on the other hand. This study suggested that the enhanced peroxidase activity of heme through binding with insulin might be a previously unrecognized contributor to the pathogenesis of T2Dm in some heme-associated disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

Analysis of expression and chitin-binding activity of the wing disc cuticle protein BmWCP4 in the silkworm, Bombyx mori.

PubMed

Deng, Hui-Min; Li, Yong; Zhang, Jia-Ling; Liu, Lin; Feng, Qi-Li

2016-12-01

The insect exoskeleton is mainly composed of chitin filaments linked by cuticle proteins. When insects molt, the cuticle of the exoskeleton is renewed by degrading the old chitin and cuticle proteins and synthesizing new ones. In this study, chitin-binding activity of the wing disc cuticle protein BmWCP4 in Bombyx mori was studied. Sequence analysis showed that the protein had a conservative hydrophilic "R&R" chitin-binding domain (CBD). Western blotting showed that BmWCP4 was predominately expressed in the wing disc-containing epidermis during the late wandering and early pupal stages. The immunohistochemistry result showed that the BmWCP4 was mainly present in the wing disc tissues containing wing bud and trachea blast during day 2 of wandering stage. Recombinant full-length BmWCP4 protein, "R&R" CBD peptide (CBD), non-CBD peptide (BmWCP4-CBD - ), four single site-directed mutated peptides (M 1 , M 2 , M 3 and M 4 ) and four-sites-mutated peptide (M F ) were generated and purified, respectively, for in vitro chitin-binding assay. The results indicated that both the full-length protein and the "R&R" CBD peptide could bind with chitin, whereas the BmWCP4-CBD - could not bind with chitin. The single residue mutants M 1 , M 2 , M 3 and M 4 reduced but did not completely abolish the chitin-binding activity, while four-sites-mutated protein M F completely lost the chitin-binding activity. These data indicate that BmWCP4 protein plays a critical role by binding to the chitin filaments in the wing during larva-to-pupa transformation. The conserved aromatic amino acids are critical in the interaction between chitin and the cuticle protein. © 2015 Institute of Zoology, Chinese Academy of Sciences.

Substrate binding interferes with active site conformational dynamics in endoglucanase Cel5A from Thermobifida fusca.

PubMed

Jiang, Xukai; Wang, Yuying; Xu, Limei; Chen, Guanjun; Wang, Lushan

2017-09-09

The role of protein dynamics in enzyme catalysis is one of the most active areas in current enzymological research. Here, using endoglucanase Cel5A from Thermobifida fusca (TfCel5A) as a model, we applied molecular dynamics simulations to explore the dynamic behavior of the enzyme upon substrate binding. The collective motions of the active site revealed that the mechanism of TfCel5A substrate binding can likely be described by the conformational-selection model; however, we observed that the conformations of active site residues changed differently along with substrate binding. Although most active site residues retained their native conformational ensemble, some (Tyr163 and Glu355) generated newly induced conformations, whereas others (Phe162 and Tyr189) exhibited shifts in the equilibration of their conformational distributions. These results showed that TfCel5A substrate binding relied on a hybrid mechanism involving induced fit and conformational selection. Interestingly, we found that TfCel5A active site could only partly rebalance its conformational dynamics upon substrate dissociation within the same simulation time, which implies that the conformational rebalance upon substrate dissociation is likely more difficult than the conformational selection upon substrate binding at least in the view of the time required. Our findings offer new insight into enzyme catalysis and potential applications for future protein engineering. Copyright © 2017 Elsevier Inc. All rights reserved.

Effects of human chromosome 12 on interactions between Tat and TAR of human immunodeficiency virus type 1.

PubMed Central

Alonso, A; Cujec, T P; Peterlin, B M

1994-01-01

Rates of transcriptions of the human immunodeficiency virus are greatly increased by the viral trans activator Tat. In vitro, Tat binds to the 5' bulge of the trans-activation response (TAR) RNA stem-loop, which is present in all viral transcripts. In human cells, the central loop in TAR and its cellular RNA-binding proteins are also critical for the function of Tat. Previously, we demonstrated that in rodent cells (CHO cells), but not in those which contain the human chromosome 12 (CHO12 cells), Tat-TAR interactions are compromised. In this study, we examined the roles of the bulge and loop in TAR in Tat trans activation in these cells. Whereas low levels of trans activation depended solely on interactions between Tat and the bulge in CHO cells, high levels of trans activation depended also on interactions between Tat and the loop in CHO12 cells. Since the TAR loop binding proteins in these two cell lines were identical and different from their human counterpart, the human chromosome 12 does not encode TAR loop binding proteins. In vivo binding competition studies with TAR decoys confirmed that the binding of Tat to TAR is more efficient in CHO12 cells. Thus, the protein(s) encoded on human chromosome 12 helps to tether Tat to TAR via its loop, which results in high levels of trans activation. Images PMID:8083988

Redox process is crucial for inhibitory properties of aurintricarboxylic acid against activity of YopH: virulence factor of Yersinia pestis

PubMed Central

Kuban-Jankowska, Alicja; Gorska, Magdalena; Tuszynski, Jack A; Ossowski, Tadeusz; Wozniak, Michal

2015-01-01

YopH is a bacterial protein tyrosine phosphatase, which is essential for the viability and pathogenic virulence of the plague-causing Yersinia sp. bacteria. Inactivation of YopH activity would lead to the loss of bacterial pathogenicity. We have studied the inhibitory properties of aurintricarboxylic acid (ATA) against YopH phosphatase and found that at nanomolar concentrations ATA reversibly decreases the activity of YopH. Computational docking studies indicated that in all binding poses ATA binds in the YopH active site. Molecular dynamics simulations showed that in the predicted binding pose, ATA binds to the essential Cys403 and Arg409 residues in the active site and has a stronger binding affinity than the natural substrate (pTyr). The cyclic voltammetry experiments suggest that ATA reacts remarkably strongly with molecular oxygen. Additionally, the electrochemical reduction of ATA in the presence of a negative potential from −2.0 to 2.5 V generates a current signal, which is observed for hydrogen peroxide. Here we showed that ATA indicates a unique mechanism of YopH inactivation due to a redox process. We proposed that the potent inhibitory properties of ATA are a result of its strong binding in the YopH active site and in situ generation of hydrogen peroxide near catalytic cysteine residue. PMID:26286963

Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

PubMed

Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

2016-07-19

The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

Structures of BmrR-Drug Complexes Reveal a Rigid Multidrug Binding Pocket And Transcription Activation Through Tyrosine Expulsion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newberry, K.J.; Huffman, J.L.; Miller, M.C.

2009-05-22

BmrR is a member of the MerR family and a multidrug binding transcription factor that up-regulates the expression of the bmr multidrug efflux transporter gene in response to myriad lipophilic cationic compounds. The structural mechanism by which BmrR binds these chemically and structurally different drugs and subsequently activates transcription is poorly understood. Here, we describe the crystal structures of BmrR bound to rhodamine 6G (R6G) or berberine (Ber) and cognate DNA. These structures reveal each drug stacks against multiple aromatic residues with their positive charges most proximal to the carboxylate group of Glu-253 and that, unlike other multidrug binding pockets,more » that of BmrR is rigid. Substitution of Glu-253 with either alanine (E253A) or glutamine (E253Q) results in unpredictable binding affinities for R6G, Ber, and tetraphenylphosphonium. Moreover, these drug binding studies reveal that the negative charge of Glu-253 is not important for high affinity binding to Ber and tetraphenylphosphonium but plays a more significant, but unpredictable, role in R6G binding. In vitro transcription data show that E253A and E253Q are constitutively active, and structures of the drug-free E253A-DNA and E253Q-DNA complexes support a transcription activation mechanism requiring the expulsion of Tyr-152 from the multidrug binding pocket. In sum, these data delineate the mechanism by which BmrR binds lipophilic, monovalent cationic compounds and suggest the importance of the redundant negative electrostatic nature of this rigid drug binding pocket that can be used to discriminate against molecules that are not substrates of the Bmr multidrug efflux pump.« less

Chicoric acid binds to two sites and decreases the activity of the YopH bacterial virulence factor

PubMed Central

Kuban-Jankowska, Alicja; Sahu, Kamlesh K.; Gorska, Magdalena; Tuszynski, Jack A.; Wozniak, Michal

2016-01-01

Chicoric acid (CA) is a phenolic compound present in dietary supplements with a large spectrum of biological properties reported ranging from antioxidant, to antiviral, to immunostimulatory properties. Due to the fact that chicoric acid promotes phagocytic activity and was reported as an allosteric inhibitor of the PTP1B phosphatase, we examined the effect of CA on YopH phosphatase from pathogenic bacteria, which block phagocytic processes of a host cell. We performed computational studies of chicoric acid binding to YopH as well as validation experiments with recombinant enzymes. In addition, we performed similar studies for caffeic and chlorogenic acids to compare the results. Docking experiments demonstrated that, from the tested compounds, only CA binds to both catalytic and secondary binding sites of YopH. Our experimental results showed that CA reduces activity of recombinant YopH phosphatase from Yersinia enterocolitica and human CD45 phosphatase. The inhibition caused by CA was irreversible and did not induce oxidation of catalytic cysteine. We proposed that inactivation of YopH induced by CA is involved with allosteric inhibition by interacting with essential regions responsible for ligand binding. PMID:26735581

Chicoric acid binds to two sites and decreases the activity of the YopH bacterial virulence factor.

PubMed

Kuban-Jankowska, Alicja; Sahu, Kamlesh K; Gorska, Magdalena; Tuszynski, Jack A; Wozniak, Michal

2016-01-19

Chicoric acid (CA) is a phenolic compound present in dietary supplements with a large spectrum of biological properties reported ranging from antioxidant, to antiviral, to immunostimulatory properties. Due to the fact that chicoric acid promotes phagocytic activity and was reported as an allosteric inhibitor of the PTP1B phosphatase, we examined the effect of CA on YopH phosphatase from pathogenic bacteria, which block phagocytic processes of a host cell. We performed computational studies of chicoric acid binding to YopH as well as validation experiments with recombinant enzymes. In addition, we performed similar studies for caffeic and chlorogenic acids to compare the results. Docking experiments demonstrated that, from the tested compounds, only CA binds to both catalytic and secondary binding sites of YopH. Our experimental results showed that CA reduces activity of recombinant YopH phosphatase from Yersinia enterocolitica and human CD45 phosphatase. The inhibition caused by CA was irreversible and did not induce oxidation of catalytic cysteine. We proposed that inactivation of YopH induced by CA is involved with allosteric inhibition by interacting with essential regions responsible for ligand binding.

Evaluation of DNA, BSA binding, and antimicrobial activity of new synthesized neodymium complex containing 29-dimethyl 110-phenanthroline.

PubMed

Moradi, Zohreh; Khorasani-Motlagh, Mozhgan; Rezvani, Ali Reza; Noroozifar, Meissam

2018-02-01

In order to evaluate biological potential of a novel synthesized complex [Nd(dmp) 2 Cl 3 .OH 2 ] where dmp is 29-dimethyl 110-phenanthroline, the DNA-binding, cleavage, BSA binding, and antimicrobial activity properties of the complex are investigated by multispectroscopic techniques study in physiological buffer (pH 7.2).The intrinsic binding constant (K b ) for interaction of Nd(III) complex and FS-DNA is calculated by UV-Vis (K b  = 2.7 ± 0.07 × 10 5 ) and fluorescence spectroscopy (K b  = 1.13 ± 0.03 × 10 5 ). The Stern-Volmer constant (K SV ), thermodynamic parameters including free energy change (ΔG°), enthalpy change (∆H°), and entropy change (∆S°), are calculated by fluorescent data and Vant' Hoff equation. The experimental results show that the complex can bind to FS-DNA and the major binding mode is groove binding. Meanwhile, the interaction of Nd(III) complex with protein, bovine serum albumin (BSA), has also been studied by using absorption and emission spectroscopic tools. The experimental results show that the complex exhibits good binding propensity to BSA. The positive ΔH° and ∆S° values indicate that the hydrophobic interaction is main force in the binding of the Nd(III) complex to BSA, and the complex can quench the intrinsic fluorescence of BSA remarkably through a static quenching process. Also, DNA cleavage was investigated by agarose gel electrophoresis that according to the results cleavage of DNA increased with increasing of concentration of the complex. Antimicrobial screening test gives good results in the presence of Nd(III) complex system.

In silico investigation into the interactions between murine 5-HT3 receptor and the principle active compounds of ginger (Zingiber officinale).

PubMed

Lohning, Anna E; Marx, Wolfgang; Isenring, Liz

2016-11-01

Gingerols and shogaols are the primary non-volatile actives within ginger (Zingiber officinale). These compounds have demonstrated in vitro to exert 5-HT 3 receptor antagonism which could benefit chemotherapy-induced nausea and vomiting (CINV). The site and mechanism of action by which these compounds interact with the 5-HT 3 receptor is not fully understood although research indicates they may bind to a currently unidentified allosteric binding site. Using in silico techniques, such as molecular docking and GRID analysis, we have characterized the recently available murine 5-HT 3 receptor by identifying sites of strong interaction with particular functional groups at both the orthogonal (serotonin) site and a proposed allosteric binding site situated at the interface between the transmembrane region and the extracellular domain. These were assessed concurrently with the top-scoring poses of the docked ligands and included key active gingerols, shogaols and dehydroshogaols as well as competitive antagonists (e.g. setron class of pharmacologically active drugs), serotonin and its structural analogues, curcumin and capsaicin, non-competitive antagonists and decoys. Unexpectedly, we found that the ginger compounds and their structural analogs generally outscored other ligands at both sites. Our results correlated well with previous site-directed mutagenesis studies in identifying key binding site residues. We have identified new residues important for binding the ginger compounds. Overall, the results suggest that the ginger compounds and their structural analogues possess a high binding affinity to both sites. Notwithstanding the limitations of such theoretical analyses, these results suggest that the ginger compounds could act both competitively or non-competitively as has been shown for palonosetron and other modulators of CYS loop receptors. Copyright © 2016 Elsevier Inc. All rights reserved.

Seeking potential anticonvulsant agents that target GABAA receptors using experimental and theoretical procedures

NASA Astrophysics Data System (ADS)

Saavedra-Vélez, Margarita Virginia; Correa-Basurto, José; Matus, Myrna H.; Gasca-Pérez, Eloy; Bello, Martiniano; Cuevas-Hernández, Roberto; García-Rodríguez, Rosa Virginia; Trujillo-Ferrara, José; Ramos-Morales, Fernando Rafael

2014-12-01

The aim of this study was to identify compounds that possess anticonvulsant activity by using a pentylenetetrazol (PTZ)-induced seizure model. Theoretical studies of a set of ligands, explored the binding affinities of the ligands for the GABAA receptor (GABAAR), including some benzodiazepines. The ligands satisfy the Lipinski rules and contain a pharmacophore core that has been previously reported to be a GABAAR activator. To select the ligands with the best physicochemical properties, all of the compounds were analyzed by quantum mechanics and the energies of the highest occupied molecular orbital and lowest unoccupied molecular orbital were determined. Docking calculations between the ligands and the GABAAR were used to identify the complexes with the highest Gibbs binding energies. The identified compound D1 (dibenzo( b,f)(1,4)diazocine-6,11(5H,12H)-dione) was synthesized, experimentally tested, and the GABAAR-D1 complex was submitted to 12-ns-long molecular dynamics (MD) simulations to corroborate the binding conformation obtained by docking techniques. MD simulations were also used to analyze the decomposition of the Gibbs binding energy of the residues involved in the stabilization of the complex. To validate our theoretical results, molecular docking and MD simulations were also performed for three reference compounds that are currently in commercial use: clonazepam (CLZ), zolpidem and eszopiclone. The theoretical results show that the GABAAR-D1, and GABAAR-CLZ complexes bind to the benzodiazepine binding site, share a similar map of binding residues, and have similar Gibbs binding energies and entropic components. Experimental studies using a PTZ-induced seizure model showed that D1 possesses similar activity to CLZ, which corroborates the predicted binding free energy identified by theoretical calculations.

Mutagenesis of the C2 domain of protein kinase C-alpha. Differential roles of Ca2+ ligands and membrane binding residues.

PubMed

Medkova, M; Cho, W

1998-07-10

The C2 domains of conventional protein kinase C (PKC) have been implicated in their Ca2+-dependent membrane binding. The C2 domain of PKC-alpha contains several Ca2+ ligands that bind multiple Ca2+ ions and other putative membrane binding residues. To understand the roles of individual Ca2+ ligands and protein-bound Ca2+ ions in the membrane binding and activation of PKC-alpha, we mutated five putative Ca2+ ligands (D187N, D193N, D246N, D248N, and D254N) and measured the effects of mutations on vesicle binding, enzyme activity, and monolayer penetration of PKC-alpha. Altered properties of these mutants indicate that individual Ca2+ ions and their ligands have different roles in the membrane binding and activation of PKC-alpha. The binding of Ca2+ to Asp187, Asp193, and Asp246 of PKC-alpha is important for the initial binding of protein to membrane surfaces. On the other hand, the binding of another Ca2+ to Asp187, Asp246, Asp248, and Asp254 induces the conformational change of PKC-alpha, which in turn triggers its membrane penetration and activation. Among these Ca2+ ligands, Asp246 was shown to be most essential for both membrane binding and activation of PKC-alpha, presumably due to its coordination to multiple Ca2+ ions. Furthermore, to identify the residues in the C2 domain that are involved in membrane binding of PKC-alpha, we mutated four putative membrane binding residues (Trp245, Trp247, Arg249, and Arg252). Membrane binding and enzymatic properties of two double-site mutants (W245A/W247A and R249A/R252A) indicate that Arg249 and Arg252 are involved in electrostatic interactions of PKC-alpha with anionic membranes, whereas Trp245 and Trp247 participate in its penetration into membranes and resulting hydrophobic interactions. Taken together, these studies provide the first experimental evidence for the role of C2 domain of conventional PKC as a membrane docking unit as well as a module that triggers conformational changes to activate the protein.

The Globular Tail Domain of Myosin-5a Functions as a Dimer in Regulating the Motor Activity.

PubMed

Zhang, Wen-Bo; Yao, Lin-Lin; Li, Xiang-Dong

2016-06-24

Myosin-5a contains two heavy chains, which are dimerized via the coiled-coil regions. Thus, myosin-5a comprises two heads and two globular tail domains (GTDs). The GTD is the inhibitory domain that binds to the head and inhibits its motor function. Although the two-headed structure is essential for the processive movement of myosin-5a along actin filaments, little is known about the role of GTD dimerization. Here, we investigated the effect of GTD dimerization on its inhibitory activity. We found that the potent inhibitory activity of the GTD is dependent on its dimerization by the preceding coiled-coil regions, indicating synergistic interactions between the two GTDs and the two heads of myosin-5a. Moreover, we found that alanine mutations of the two conserved basic residues at N-terminal extension of the GTD not only weaken the inhibitory activity of the GTD but also enhance the activation of myosin-5a by its cargo-binding protein melanophilin (Mlph). These results are consistent with the GTD forming a head to head dimer, in which the N-terminal extension of the GTD interacts with the Mlph-binding site in the counterpart GTD. The Mlph-binding site at the GTD-GTD interface must be exposed prior to the binding of Mlph. We therefore propose that the inhibited Myo5a is equilibrated between the folded state, in which the Mlph-binding site is buried, and the preactivated state, in which the Mlph-binding site is exposed, and that Mlph is able to bind to the Myo5a in preactivated state and activates its motor function. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Myelin basic protein stimulates plasminogen activation via tissue plasminogen activator following binding to independent l-lysine-containing domains.

PubMed

Gonzalez-Gronow, Mario; Fiedler, Jenny L; Farias Gomez, Cristian; Wang, Fang; Ray, Rupa; Ferrell, Paul D; Pizzo, Salvatore V

2017-08-26

Myelin basic protein (MBP) is a key component of myelin, the specialized lipid membrane that encases the axons of all neurons. Both plasminogen (Pg) and tissue-type plasminogen activator (t-PA) bind to MBP with high affinity. We investigated the kinetics and mechanisms involved in this process using immobilized MBP and found that Pg activation by t-PA is significantly stimulated by MBP. This mechanism involves the binding of t-PA via a lysine-dependent mechanism to the Lys 91 residue of the MBP NH 2 -terminal region Asp 82 -Pro 99 , and the binding of Pg via a lysine-dependent mechanism to the Lys 122 residue of the MBP COOH-terminal region Leu 109 -Gly 126 . In this context, MBP mimics fibrin and because MBP is a plasmin substrate, our results suggest direct participation of the Pg activation system on MBP physiology. Copyright © 2017 Elsevier Inc. All rights reserved.

Cobra venom factor immunoconjugates: effects of carbohydrate-directed versus amino group-directed conjugation.

PubMed

Zara, J; Pomato, N; McCabe, R P; Bredehorst, R; Vogel, C W

1995-01-01

Human IgM monoclonal antibody 16-88, derived from patients immunized with autologous colon carcinoma cells, was derivatized with two different cross-linkers, S-(2-thiopyridyl)-L-cysteine hydrazide (TPCH), which is carbohydrate-directed, and N-succinimidyl-3-(2- pyridyldithio)propionate (SPDP), which is amino group-directed. Two antibody functions, antigen binding and complement activation, were assayed upon derivatization with TPCH and SPDP. TPCH allowed for extensive modification (up to 17 TPCH molecules per antibody) without impairment of antigen binding activity, while this function was significantly compromised upon derivatization with SPDP. Antibody molecules derivatized with 16 SPDP residues showed almost complete loss of their antigen binding function. The complement activating ability of antibody 16-88 was significantly decreased after derivatization with TPCH or SPDP. In the case of SPDP derivatization, this decrease of the complement activating ability is predominantly a consequence of the impaired binding function. Upon conjugation of cobra venom factor (CVF), a nontoxic 137-kDa glycoprotein which is capable of activating the alternative pathway of complement, the antigen binding activity of SPDP-derivatized antibody was further compromised, whereas that of TPCH-derivatized antibody remained unaffected even after attachment of three or four CVF molecules per antibody. In both conjugates CVF retained good functional activity. CVF was slightly more active when attached to SPDP-derivatized antibody, suggesting a better accessibility of amino group-coupled CVF for its interaction with other complement proteins. These results indicate that carbohydrate-directed conjugation compromises the antibody function of complement activation, but allows for the generation of immunoconjugates with unimpaired antigen binding capability.(ABSTRACT TRUNCATED AT 250 WORDS)

Structural Basis for Activation of Fatty Acid-binding Protein 4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gillilan,R.; Ayers, S.; Noy, N.

2007-01-01

Fatty acid-binding protein 4 (FABP4) delivers ligands from the cytosol to the nuclear receptor PPAR{gamma} in the nucleus, thereby enhancing the transcriptional activity of the receptor. Notably, FABP4 binds multiple ligands with a similar affinity but its nuclear translocation is activated only by specific compounds. To gain insight into the structural features that underlie the ligand-specificity in activation of the nuclear import of FABP4, we solved the crystal structures of the protein complexed with two compounds that induce its nuclear translocation, and compared these to the apo-protein and to FABP4 structures bound to non-activating ligands. Examination of these structures indicatesmore » that activation coincides with closure of a portal loop phenylalanine side-chain, contraction of the binding pocket, a subtle shift in a helical domain containing the nuclear localization signal of the protein, and a resultant change in oligomeric state that exposes the nuclear localization signal to the solution. Comparisons of backbone displacements induced by activating ligands with a measure of mobility derived from translation, libration, screw (TLS) refinement, and with a composite of slowest normal modes of the apo state suggest that the helical motion associated with the activation of the protein is part of the repertoire of the equilibrium motions of the apo-protein, i.e. that ligand binding does not induce the activated configuration but serves to stabilize it. Nuclear import of FABP4 can thus be understood in terms of the pre-existing equilibrium hypothesis of ligand binding.« less

A novel actin binding site of myosin required for effective muscle contraction.

PubMed

Várkuti, Boglárka H; Yang, Zhenhui; Kintses, Bálint; Erdélyi, Péter; Bárdos-Nagy, Irén; Kovács, Attila L; Hári, Péter; Kellermayer, Miklós; Vellai, Tibor; Málnási-Csizmadia, András

2012-02-12

F-actin serves as a track for myosin's motor functions and activates its ATPase activity by several orders of magnitude, enabling actomyosin to produce effective force against load. Although actin activation is a ubiquitous property of all myosin isoforms, the molecular mechanism and physiological role of this activation are unclear. Here we describe a conserved actin-binding region of myosin named the 'activation loop', which interacts with the N-terminal segment of actin. We demonstrate by biochemical, biophysical and in vivo approaches using transgenic Caenorhabditis elegans strains that the interaction between the activation loop and actin accelerates the movement of the relay, stimulating myosin's ATPase activity. This interaction results in efficient force generation, but it is not essential for the unloaded motility. We conclude that the binding of actin to myosin's activation loop specifically increases the ratio of mechanically productive to futile myosin heads, leading to efficient muscle contraction.

Activation of Plant Innate Immunity by Extracellular High Mobility Group Box 3 and Its Inhibition by Salicylic Acid

PubMed Central

Choi, Hyong Woo; Manohar, Murli; Manosalva, Patricia; Tian, Miaoying; Moreau, Magali; Klessig, Daniel F.

2016-01-01

Damage-associated molecular pattern molecules (DAMPs) signal the presence of tissue damage to induce immune responses in plants and animals. Here, we report that High Mobility Group Box 3 (HMGB3) is a novel plant DAMP. Extracellular HMGB3, through receptor-like kinases BAK1 and BKK1, induced hallmark innate immune responses, including i) MAPK activation, ii) defense-related gene expression, iii) callose deposition, and iv) enhanced resistance to Botrytis cinerea. Infection by necrotrophic B. cinerea released HMGB3 into the extracellular space (apoplast). Silencing HMGBs enhanced susceptibility to B. cinerea, while HMGB3 injection into apoplast restored resistance. Like its human counterpart, HMGB3 binds salicylic acid (SA), which results in inhibition of its DAMP activity. An SA-binding site mutant of HMGB3 retained its DAMP activity, which was no longer inhibited by SA, consistent with its reduced SA-binding activity. These results provide cross-kingdom evidence that HMGB proteins function as DAMPs and that SA is their conserved inhibitor. PMID:27007252

Molecular simulation assisted identification of Ca2+ binding residues in TMEM16A

NASA Astrophysics Data System (ADS)

Pang, Chun-Li; Yuan, Hong-Bo; Cao, Tian-Guang; Su, Ji-Guo; Chen, Ya-Fei; Liu, Hui; Yu, Hui; Zhang, Hai-Ling; Zhan, Yong; An, Hai-Long; Han, Yue-Bin

2015-11-01

Calcium-activated chloride channels (CaCCs) play vital roles in a variety of physiological processes. Transmembrane protein 16A (TMEM16A) has been confirmed as the molecular counterpart of CaCCs which greatly pushes the molecular insights of CaCCs forward. However, the detailed mechanism of Ca2+ binding and activating the channel is still obscure. Here, we utilized a combination of computational and electrophysiological approaches to discern the molecular mechanism by which Ca2+ regulates the gating of TMEM16A channels. The simulation results show that the first intracellular loop serves as a Ca2+ binding site including D439, E444 and E447. The experimental results indicate that a novel residue, E447, plays key role in Ca2+ binding. Compared with WT TMEM16A, E447Y produces a 30-fold increase in EC50 of Ca2+ activation and leads to a 100-fold increase in Ca2+ concentrations that is needed to fully activate the channel. The following steered molecular dynamic (SMD) simulation data suggests that the mutations at 447 reduce the Ca2+ dissociation energy. Our results indicated that both the electrical property and the size of the side-chain at residue 447 have significant effects on Ca2+ dependent gating of TMEM16A.

Mannheimia haemolytica leukotoxin activates a nonreceptor tyrosine kinase signaling cascade in bovine leukocytes, which induces biological effects.

PubMed

Jeyaseelan, S; Kannan, M S; Briggs, R E; Thumbikat, P; Maheswaran, S K

2001-10-01

The leukotoxin (LktA) produced by Mannheimia haemolytica binds to bovine lymphocyte function-associated antigen 1 (LFA-1) and induces biological effects in bovine leukocytes in a cellular and species-specific fashion. We have previously shown that LktA also binds to porcine LFA-1 without eliciting any effects. These findings suggest that the specificity of LktA effects must entail both binding to LFA-1 and activation of signaling pathways which are present in bovine leukocytes. However, the signaling pathways leading to biological effects upon LktA binding to LFA-1 have not been characterized. In this context, several reports have indicated that ligand binding to LFA-1 results in activation of a nonreceptor tyrosine kinase (NRTK) signaling cascade. We designed experiments with the following objectives: (i) to determine whether LktA binding to LFA-1 leads to activation of NRTKs, (ii) to examine whether LktA-induced NRTK activation is target cell specific, and (iii) to determine whether LktA-induced NRTK activation is required for biological effects. We used a biologically inactive mutant leukotoxin (DeltaLktA) for comparison with LktA. Our results indicate that LktA induces tyrosine phosphorylation (TP) of the CD18 tail of LFA-1 in bovine leukocytes. The DeltaLktA mutant does not induce TP of the CD18 tail, albeit binding to bovine LFA-1. LktA-induced TP of the CD18 tail was attenuated by an NRTK inhibitor, herbimycin A; a phosphatidylinositol 3'-kinase (PI 3-kinase) inhibitor, wortmannin; and a Src kinase inhibitor, PP2, in a concentration-dependent manner. Furthermore, LktA induces TP of the CD18 tail in bovine, but not porcine, leukocytes. Moreover, LktA-induced intracellular calcium ([Ca2+]i) elevation was also inhibited by herbimycin A, wortmannin, and PP2. Thus, our data represent the first evidence that binding of LktA to bovine LFA-1 induces a species-specific NRTK signaling cascade involving PI 3-kinase and Src kinases and that this signaling cascade is required for LktA-induced biological effects.

Mannheimia haemolytica Leukotoxin Activates a Nonreceptor Tyrosine Kinase Signaling Cascade in Bovine Leukocytes, Which Induces Biological Effects

PubMed Central

Jeyaseelan, S.; Kannan, M. S.; Briggs, R. E.; Thumbikat, P.; Maheswaran, S. K.

2001-01-01

The leukotoxin (LktA) produced by Mannheimia haemolytica binds to bovine lymphocyte function-associated antigen 1 (LFA-1) and induces biological effects in bovine leukocytes in a cellular and species-specific fashion. We have previously shown that LktA also binds to porcine LFA-1 without eliciting any effects. These findings suggest that the specificity of LktA effects must entail both binding to LFA-1 and activation of signaling pathways which are present in bovine leukocytes. However, the signaling pathways leading to biological effects upon LktA binding to LFA-1 have not been characterized. In this context, several reports have indicated that ligand binding to LFA-1 results in activation of a nonreceptor tyrosine kinase (NRTK) signaling cascade. We designed experiments with the following objectives: (i) to determine whether LktA binding to LFA-1 leads to activation of NRTKs, (ii) to examine whether LktA-induced NRTK activation is target cell specific, and (iii) to determine whether LktA-induced NRTK activation is required for biological effects. We used a biologically inactive mutant leukotoxin (ΔLktA) for comparison with LktA. Our results indicate that LktA induces tyrosine phosphorylation (TP) of the CD18 tail of LFA-1 in bovine leukocytes. The ΔLktA mutant does not induce TP of the CD18 tail, albeit binding to bovine LFA-1. LktA-induced TP of the CD18 tail was attenuated by an NRTK inhibitor, herbimycin A; a phosphatidylinositol 3′-kinase (PI 3-kinase) inhibitor, wortmannin; and a Src kinase inhibitor, PP2, in a concentration-dependent manner. Furthermore, LktA induces TP of the CD18 tail in bovine, but not porcine, leukocytes. Moreover, LktA-induced intracellular calcium ([Ca2+]i) elevation was also inhibited by herbimycin A, wortmannin, and PP2. Thus, our data represent the first evidence that binding of LktA to bovine LFA-1 induces a species-specific NRTK signaling cascade involving PI 3-kinase and Src kinases and that this signaling cascade is required for LktA-induced biological effects. PMID:11553552

Newly identified invertebrate-type lysozyme (Splys-i) in mud crab (Scylla paramamosain) exhibiting muramidase-deficient antimicrobial activity.

PubMed

Zhou, Jian; Zhao, Shu; Fang, Wen-Hong; Zhou, Jun-Fang; Zhang, Jing-Xiao; Ma, Hongyu; Lan, Jiang-Feng; Li, Xin-Cang

2017-09-01

Lysozymes are widely distributed immune effectors exerting muramidase activity against the peptidoglycan of the bacterial cell wall to trigger cell lysis. However, some invertebrate-type (i-type) lysozymes deficient of muramidase activity still exhibit antimicrobial activity. To date, the mechanism underlying the antimicrobial effect of muramidase-deficient i-type lysozymes remains unclear. Accordingly, this study characterized a novel i-type lysozyme, Splys-i, in the mud crab Scylla paramamosain. Splys-i shared the highest identity with the Litopenaeus vannamei i-type lysozyme (Lvlys-i2, 54% identity) at the amino acid level. Alignment analysis and 3D structure comparison show that Splys-i may be a muramidase-deficient i-type lysozyme because it lacks the two conserved catalytic residues (Glu and Asp) that are necessary for muramidase activity. Splys-i is mainly distributed in the intestine, stomach, gills, hepatopancreas, and hemocytes, and it is upregulated by Vibrio harveyi or Staphylococcus aureus challenge. Recombinant Splys-i protein (rSplys-i) can inhibit the growth of Gram-negative bacteria (V. harveyi, Vibrio alginolyticus, Vibrio parahemolyticus, and Escherichia coli), Gram-positive bacteria (S. aureus, Bacillus subtilis, and Bacillus megaterium), and the fungus Candida albicans to varying degrees. In this study, two binding assays and a bacterial agglutination assay were conducted to elucidate the potential antimicrobial mechanisms of Splys-i. Results demonstrated that rSplys-i could bind to all nine aforementioned microorganisms. It also exhibited a strong binding activity to lipopolysaccharide from E. coli and lipoteichoic acid and peptidoglycan (PGN) from S. aureus but a weak binding activity to PGN from B. subtilis and β-glucan from fungi. Moreover, rSplys-i could agglutinate these nine types of microorganisms in the presence of Ca 2+ at different protein concentrations. These results suggest that the binding activity and its triggered agglutinating activity might be two major mechanisms of action to realize the muramidase-deficient antibacterial activity. In addition, rSplys-i can hydrolyze the peptidoglycan of some Gram-positive bacteria because it exhibits weak isopeptidase activities in salt and protein concentration-dependent manner. This result indicates that such an isopeptidase activity may contribute to the muramidase-deficient antimicrobial activity to a certain degree. In conclusion, Splys-i is upregulated by pathogenic bacteria, and it inhibits bacterial growth by binding and agglutination activities as well as isopeptidase activity, suggesting that Splys-i is involved in immune defense against bacteria through several different mechanisms of action. Copyright © 2017 Elsevier Ltd. All rights reserved.

Class B type I scavenger receptor is responsible for the high affinity cholesterol binding activity of intestinal brush border membrane vesicles

PubMed Central

Labonté, Eric D.; Howles, Philip N.; Granholm, Norman A.; Rojas, Juan C.; Davies, Joanna P.; Ioannou, Yiannis A.; Hui, David Y.

2007-01-01

Recent studies have documented the importance of Niemann Pick C1-like 1 protein (NPC1L1), a putative physiological target of the drug ezetimibe, in mediating intestinal cholesterol absorption. However, whether NPC1L1 is the high affinity cholesterol binding protein on intestinal brush border membranes is still controversial. In this study, brush border membrane vesicles (BBMV) from wild type and NPC1L1−/− mice were isolated and assayed for micellar cholesterol binding in the presence or absence of ezetimibe. Results confirmed the loss of the high affinity component of cholesterol binding when wild type BBMV preparations were incubated with antiserum against the class B type 1 scavenger receptor (SR-BI) in the reaction mixture similar to previous studies. Subsequently, second order binding of cholesterol was observed with BBMV from wild type and NPC1L1−/− mice. The inclusion of ezetimibe in these in vitro reaction assays resulted in the loss of the high affinity component of cholesterol interaction. Surprisingly, BBMVs from NPC1L1−/− mice maintained active binding of cholesterol. These results documented that SR-BI, not NPC1L1, is the major protein responsible for the initial high affinity cholesterol ligand binding process in the cholesterol absorption pathway. Additionally, ezetimibe may inhibit BBM cholesterol binding through targets such as SR-BI in addition to its inhibition of NPC1L1. PMID:17442616

Rational design and validation of a vanilloid-sensitive TRPV2 ion channel

PubMed Central

Yang, Fan; Vu, Simon; Yarov-Yarovoy, Vladimir; Zheng, Jie

2016-01-01

Vanilloids activation of TRPV1 represents an excellent model system of ligand-gated ion channels. Recent studies using cryo-electron microcopy (cryo-EM), computational analysis, and functional quantification revealed the location of capsaicin-binding site and critical residues mediating ligand-binding and channel activation. Based on these new findings, here we have successfully introduced high-affinity binding of capsaicin and resiniferatoxin to the vanilloid-insensitive TRPV2 channel, using a rationally designed minimal set of four point mutations (F467S–S498F–L505T–Q525E, termed TRPV2_Quad). We found that binding of resiniferatoxin activates TRPV2_Quad but the ligand-induced open state is relatively unstable, whereas binding of capsaicin to TRPV2_Quad antagonizes resiniferatoxin-induced activation likely through competition for the same binding sites. Using Rosetta-based molecular docking, we observed a common structural mechanism underlying vanilloids activation of TRPV1 and TRPV2_Quad, where the ligand serves as molecular “glue” that bridges the S4–S5 linker to the S1–S4 domain to open these channels. Our analysis revealed that capsaicin failed to activate TRPV2_Quad likely due to structural constraints preventing such bridge formation. These results not only validate our current working model for capsaicin activation of TRPV1 but also should help guide the design of drug candidate compounds for this important pain sensor. PMID:27298359

Phytochrome regulates GTP-binding protein activity in the envelope of pea nuclei

NASA Technical Reports Server (NTRS)

Clark, G. B.; Memon, A. R.; Thompson, G. A. Jr; Roux, S. J.

1993-01-01

Three GTP-binding proteins with apparent molecular masses of 27, 28 and 30 kDa have been detected in isolated nuclei of etiolated pea plumules. After LDS-PAGE and transfer to nitrocellulose these proteins bind [32P]GTP in the presence of excess ATP, suggesting that they are monomeric G proteins. When nuclei are disrupted, three proteins co-purify with the nuclear envelope fraction and are highly enriched in this fraction. The level of [32P]GTP-binding for all three protein bands is significantly increased when harvested pea plumules are irradiated by red light, and this effect is reversed by far-red light. The results indicate that GTP-binding activity associated with the nuclear envelope of plant cells is photoreversibly regulated by the pigment phytochrome.

Structural insights into Cydia pomonella pheromone binding protein 2 mediated prediction of potentially active semiochemicals

NASA Astrophysics Data System (ADS)

Tian, Zhen; Liu, Jiyuan; Zhang, Yalin

2016-03-01

Given the advantages of behavioral disruption application in pest control and the damage of Cydia pomonella, due progresses have not been made in searching active semiochemicals for codling moth. In this research, 31 candidate semiochemicals were ranked for their binding potential to Cydia pomonella pheromone binding protein 2 (CpomPBP2) by simulated docking, and this sorted result was confirmed by competitive binding assay. This high predicting accuracy of virtual screening led to the construction of a rapid and viable method for semiochemicals searching. By reference to binding mode analyses, hydrogen bond and hydrophobic interaction were suggested to be two key factors in determining ligand affinity, so is the length of molecule chain. So it is concluded that semiochemicals of appropriate chain length with hydroxyl group or carbonyl group at one head tended to be favored by CpomPBP2. Residues involved in binding with each ligand were pointed out as well, which were verified by computational alanine scanning mutagenesis. Progress made in the present study helps establish an efficient method for predicting potentially active compounds and prepares for the application of high-throughput virtual screening in searching semiochemicals by taking insights into binding mode analyses.

Structural insights into Cydia pomonella pheromone binding protein 2 mediated prediction of potentially active semiochemicals

PubMed Central

Tian, Zhen; Liu, Jiyuan; Zhang, Yalin

2016-01-01

Given the advantages of behavioral disruption application in pest control and the damage of Cydia pomonella, due progresses have not been made in searching active semiochemicals for codling moth. In this research, 31 candidate semiochemicals were ranked for their binding potential to Cydia pomonella pheromone binding protein 2 (CpomPBP2) by simulated docking, and this sorted result was confirmed by competitive binding assay. This high predicting accuracy of virtual screening led to the construction of a rapid and viable method for semiochemicals searching. By reference to binding mode analyses, hydrogen bond and hydrophobic interaction were suggested to be two key factors in determining ligand affinity, so is the length of molecule chain. So it is concluded that semiochemicals of appropriate chain length with hydroxyl group or carbonyl group at one head tended to be favored by CpomPBP2. Residues involved in binding with each ligand were pointed out as well, which were verified by computational alanine scanning mutagenesis. Progress made in the present study helps establish an efficient method for predicting potentially active compounds and prepares for the application of high-throughput virtual screening in searching semiochemicals by taking insights into binding mode analyses. PMID:26928635

Regulation of TCF ETS-domain transcription factors by helix-loop-helix motifs.

PubMed

Stinson, Julie; Inoue, Toshiaki; Yates, Paula; Clancy, Anne; Norton, John D; Sharrocks, Andrew D

2003-08-15

DNA binding by the ternary complex factor (TCF) subfamily of ETS-domain transcription factors is tightly regulated by intramolecular and intermolecular interactions. The helix-loop-helix (HLH)-containing Id proteins are trans-acting negative regulators of DNA binding by the TCFs. In the TCF, SAP-2/Net/ERP, intramolecular inhibition of DNA binding is promoted by the cis-acting NID region that also contains an HLH-like motif. The NID also acts as a transcriptional repression domain. Here, we have studied the role of HLH motifs in regulating DNA binding and transcription by the TCF protein SAP-1 and how Cdk-mediated phosphorylation affects the inhibitory activity of the Id proteins towards the TCFs. We demonstrate that the NID region of SAP-1 is an autoinhibitory motif that acts to inhibit DNA binding and also functions as a transcription repression domain. This region can be functionally replaced by fusion of Id proteins to SAP-1, whereby the Id moiety then acts to repress DNA binding in cis. Phosphorylation of the Ids by cyclin-Cdk complexes results in reduction in protein-protein interactions between the Ids and TCFs and relief of their DNA-binding inhibitory activity. In revealing distinct mechanisms through which HLH motifs modulate the activity of TCFs, our results therefore provide further insight into the role of HLH motifs in regulating TCF function and how the inhibitory properties of the trans-acting Id HLH proteins are themselves regulated by phosphorylation.

The MTA family proteins as novel histone H3 binding proteins

PubMed Central

2013-01-01

Background The nucleosome remodeling and histone deacetylase complex (Mi2/NRD/NuRD/NURD) has a broad role in regulation of transcription, DNA repair and cell cycle. Previous studies have revealed a specific interaction between NURD and histone H3N-terminal tail in vitro that is not observed for another HDAC1/2-containing complex, Sin3A. However, the subunit(s) responsible for specific binding of H3 by NURD has not been defined. Results In this study, we show among several class I HDAC-containing corepressor complexes only NURD exhibits a substantial H3 tail-binding activity in vitro. We present the evidence that the MTA family proteins within the NURD complex interact directly with H3 tail. Extensive in vitro binding assays mapped the H3 tail-binding domain to the C-terminal region of MTA1 and MTA2. Significantly, although the MTA1 and MTA2 mutant proteins with deletion of the C-terminal H3 tail binding domain were assembled into the endogenous NURD complex when expressed in mammalian cells, the resulting NURD complexes were deficient in binding H3 tail in vitro, indicating that the MTA family proteins are required for the observed specific binding of H3 tail peptide by NURD in vitro. However, chromatin fractionation experiments show that the NURD complexes with impaired MTA1/2-H3 tail binding activity remained to be associated with chromatin in cells. Conclusions Together our study reveals a novel histone H3-binding activity for the MTA family proteins and provides evidence that the MTA family proteins mediate the in vitro specific binding of H3 tail peptide by NURD complex. However, multiple mechanisms are likely to contribute to the chromatin association of NURD complex in cells. Our finding also raises the possibility that the MTA family proteins may exert their diverse biological functions at least in part through their direct interaction with H3 tail. PMID:23286669

Phylogenetic survey of soluble saxitoxin-binding activity in pursuit of the function and molecular evolution of saxiphilin, a relative of transferrin.

PubMed Central

Llewellyn, L E; Bell, P M; Moczydlowski, E G

1997-01-01

Saxiphilin is a soluble protein of unknown function which binds the neurotoxin, saxitoxin (STX), with high affinity. Molecular characterization of saxiphilin from the North American bullfrog, Rana catesbeiana, has previously shown that it is a member of the transferrin family. In this study we surveyed various animal species to investigate the phylogenetic distribution of saxiphilin, as detected by the presence of soluble [3H]STX binding activity in plasma, haemolymph or tissue extracts. We found that saxiphilin activity is readily detectable in a wide variety of arthropods, fish, amphibians, and reptiles. The pharmacological characteristics of [3H]STX binding activity in phylogenetically diverse species indicates that a protein homologous to bullfrog saxiphilin is likely to be constitutively expressed in many ectothermic animals. The results suggest that the saxiphilin gene is evolutionarily as old as an ancestral gene encoding bilobed transferrin, an Fe(2+)-binding and transport protein which has been identified in several arthropods and all the vertebrates which have been studied. PMID:9225480

Simian Immunodeficiency Virus and Human Immunodeficiency Virus Type 1 Nef Proteins Show Distinct Patterns and Mechanisms of Src Kinase Activation

PubMed Central

Greenway, Alison L.; Dutartre, Hélène; Allen, Kelly; McPhee, Dale A.; Olive, Daniel; Collette, Yves

1999-01-01

The nef gene from human and simian immunodeficiency viruses (HIV and SIV) regulates cell function and viral replication, possibly through binding of the nef product to cellular proteins, including Src family tyrosine kinases. We show here that the Nef protein encoded by SIVmac239 interacts with and also activates the human Src kinases Lck and Hck. This is in direct contrast to the inhibitory effect of HIV type 1 (HIV-1) Nef on Lck catalytic activity. Unexpectedly, however, the interaction of SIV Nef with human Lck or Hck is not mediated via its consensus proline motif, which is known to mediate HIV-1 Nef binding to Src homology 3 (SH3) domains, and various experimental analyses failed to show significant interaction of SIV Nef with the SH3 domain of either kinase. Instead, SIV Nef can bind Lck and Hck SH2 domains, and its N-terminal 50 amino acid residues are sufficient for Src kinase binding and activation. Our results provide evidence for multiple mechanisms by which Nef binds to and regulates Src kinases. PMID:10364375

Structure analysis of FAAP24 reveals single-stranded DNA-binding activity and domain functions in DNA damage response

PubMed Central

Wang, Yucai; Han, Xiao; Wu, Fangming; Leung, Justin W; Lowery, Megan G; Do, Huong; Chen, Junjie; Shi, Chaowei; Tian, Changlin; Li, Lei; Gong, Weimin

2013-01-01

The FANCM/FAAP24 heterodimer has distinct functions in protecting cells from complex DNA lesions such as interstrand crosslinks. These functions rely on the biochemical activity of FANCM/FAAP24 to recognize and bind to damaged DNA or stalled replication forks. However, the DNA-binding activity of this complex was not clearly defined. We investigated how FAAP24 contributes to the DNA-interacting functions of the FANCM/FAAP24 complex by acquiring the N-terminal and C-terminal solution structures of human FAAP24. Modeling of the FAAP24 structure indicates that FAAP24 may possess a high affinity toward single-stranded DNA (ssDNA). Testing of various FAAP24 mutations in vitro and in vivo validated this prediction derived from structural analyses. We found that the DNA-binding and FANCM-interacting functions of FAAP24, although both require the C-terminal (HhH)2 domain, can be distinguished by segregation-of-function mutations. These results demonstrate dual roles of FAAP24 in DNA damage response against crosslinking lesions, one through the formation of FANCM/FAAP24 heterodimer and the other via its ssDNA-binding activity required in optimized checkpoint activation. PMID:23999858

Structures of E. coli peptide deformylase bound to formate: insight into the preference for Fe2+ over Zn2+ as the active site metal.

PubMed

Jain, Rinku; Hao, Bing; Liu, Ren-Peng; Chan, Michael K

2005-04-06

E. coli peptide deformylase (PDF) catalyzes the deformylation of nascent polypeptides generated during protein synthesis. While PDF was originally thought to be a zinc enzyme, subsequent studies revealed that the active site metal is iron. In an attempt to understand this unusual metal preference, high-resolution structures of Fe-, Co-, and Zn-PDF were determined in complex with its deformylation product, formate. In all three structures, the formate ion binds the metal and forms hydrogen-bonding interactions with the backbone nitrogen of Leu91, the amide side chain of Gln50, and the carboxylate side chain of Glu133. One key difference, however, is how the formate binds the metal. In Fe-PDF and Co-PDF, formate binds in a bidentate fashion, while in Zn-PDF, it binds in a monodentate fashion. Importantly, these structural results provide the first clues into the origins of PDF's metal-dependent activity differences. On the basis of these structures, we propose that the basis for the higher activity of Fe-PDF stems from the better ability of iron to bind and activate the tetrahedral transition state required for cleavage of the N-terminal formyl group.

Enhancement of anti-Aeromonas salmonicida activity in Atlantic salmon (Salmo salar) macrophages by a mannose-binding lectin

USGS Publications Warehouse

Ottinger, C.A.; Johnson, S.C.; Ewart, K.V.; Brown, L.L.; Ross, N.W.

1999-01-01

We investigated the effects of a calcium-dependent mannose-binding lectin isolated from the serum of Atlantic salmon on Aeromonassalmonicida viability and the anti-A. salmonicida activity of Atlantic salmon macrophages. In the absence of other factors, binding of this lectin at concentrations of 0.8, 4.0 and 20.0 ng ml−1 to virulent A. salmonicida failed to significantly reduce (P>0.05) cell viability. However, binding of the lectin to A. salmonicida did result in significant (P≤0.05) dose-dependent increases in phagocytosis, and bactericidal activity. Significant increases (P≤0.05) were also observed in phagocyte respiratory burst activity within the lectin concentration range of 4.0–20.0 ng ml−1 but the stimulation was not dose dependent at these lectin concentrations. At the lowest lectin concentration tested (0.32 ng ml−1), a significant decrease (P≤0.05) in respiratory burst was observed. The structure and activity of this lectin are similar to that of mammalian mannose-binding lectins, which are known to play a pivotal role in innate immunity. The presence of this lectin may be an important defense mechanism against Gram-negative bacteria such as A. salmonicida.

Effects of interferon-gamma and lipopolysaccharide on macrophage iron metabolism are mediated by nitric oxide-induced degradation of iron regulatory protein 2.

PubMed

Kim, S; Ponka, P

2000-03-03

Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.

A single Alal 39-to-Glu substitution in the Renibacterium salmoninarum virulence-associated protein p57 results in antigenic variation and is associated with enhanced p57 binding to Chinook salmon leukocytes

USGS Publications Warehouse

Wiens, Gregory D.; Pascho, Ron; Winton, James R.

2002-01-01

The gram-positive bacterium Renibacterium salmoninarum produces relatively large amounts of a 57-kDa protein (p57) implicated in the pathogenesis of salmonid bacterial kidney disease. Antigenic variation in p57 was identified by using monoclonal antibody 4C11, which exhibited severely decreased binding to R. salmoninarum strain 684 p57 and bound robustly to the p57 proteins of seven other R. salmoninarum strains. This difference in binding was not due to alterations in p57 synthesis, secretion, or bacterial cell association. The molecular basis of the 4C11 epitope loss was determined by amplifying and sequencing the two identical genes encoding p57, msa1 and msa2. The 5′ and coding sequences of the 684 msa1 and msa2 genes were identical to those of the ATCC 33209 msa1and msa2 genes except for a single C-to-A nucleotide mutation. This mutation was identified in both the msa1 and msa2 genes of strain 684 and resulted in an Ala139-to-Glu substitution in the amino-terminal region of p57. We examined whether this mutation in p57 altered salmonid leukocyte and rabbit erythrocyte binding activities. R. salmoninarum strain 684 extracellular protein exhibited a twofold increase in agglutinating activity for chinook salmon leukocytes and rabbit erythrocytes compared to the activity of the ATCC 33209 extracellular protein. A specific and quantitative p57 binding assay confirmed the increased binding activity of 684 p57. Monoclonal antibody 4C11 blocked the agglutinating activity of the ATCC 33209 extracellular protein but not the agglutinating activity of the 684 extracellular protein. These results indicate that the Ala139-to-Glu substitution altered immune recognition and was associated with enhanced biological activity of R. salmoninarum 684 p57.

Docking and Hydropathic Scoring of Polysubstituted Pyrrole Compounds with Anti-Tubulin Activity

PubMed Central

Tripathi, Ashutosh; Fornabaio, Micaela; Kellogg, Glen E.; Gupton, John T.; Gewirtz, David A.; Yeudall, W. Andrew; Vega, Nina E.; Mooberry, Susan L.

2008-01-01

Compounds that bind at the colchicine site of tubulin have drawn considerable attention with studies indicating that these agents suppress microtubule dynamics and inhibit tubulin polymerization. Data for eighteen polysubstituted pyrrole compounds are reported, including antiproliferative activity against human MDA-MB-435 cells and calculated free energies of binding following docking the compounds into models of αβ-tubulin. These docking calculations coupled with HINT interaction analyses are able to represent the complex structures and the binding modes of inhibitors such that calculated and measured free energies of binding correlate with an r2 of 0.76. Structural analysis of the binding pocket identifies important intermolecular contacts that mediate binding. As seen experimentally, the complex with JG-03-14 (3,5-dibromo-4-(3,4-dimethoxyphenyl)-1H-pyrrole-2- carboxylic acid ethyl ester) is the most stable. These results illuminate the binding process and should be valuable in the design of new pyrrole-based colchicine site inhibitors as these compounds have very accessible syntheses. PMID:18083520

The substrate binding interface of alkylpurine DNA glycosylase AlkD.

PubMed

Mullins, Elwood A; Rubinson, Emily H; Eichman, Brandt F

2014-01-01

Tandem helical repeats have emerged as an important DNA binding architecture. DNA glycosylase AlkD, which excises N3- and N7-alkylated nucleobases, uses repeating helical motifs to bind duplex DNA and to selectively pause at non-Watson-Crick base pairs. Remodeling of the DNA backbone promotes nucleotide flipping of the lesion and the complementary base into the solvent and toward the protein surface, respectively. The important features of this new DNA binding architecture that allow AlkD to distinguish between damaged and normal DNA without contacting the lesion are poorly understood. Here, we show through extensive mutational analysis that DNA binding and N3-methyladenine (3mA) and N7-methylguanine (7mG) excision are dependent upon each residue lining the DNA binding interface. Disrupting electrostatic or hydrophobic interactions with the DNA backbone substantially reduced binding affinity and catalytic activity. These results demonstrate that residues seemingly only involved in general DNA binding are important for catalytic activity and imply that base excision is driven by binding energy provided by the entire substrate interface of this novel DNA binding architecture. Copyright © 2013 Elsevier B.V. All rights reserved.

A non-canonical role for Rgnef in promoting integrin-stimulated focal adhesion kinase activation

PubMed Central

Miller, Nichol L. G.; Lawson, Christine; Kleinschmidt, Elizabeth G.; Tancioni, Isabelle; Uryu, Sean; Schlaepfer, David D.

2013-01-01

Summary Rgnef (also known as p190RhoGEF or ARHGEF28) is a Rho guanine-nucleotide-exchange factor (GEF) that binds focal adhesion kinase (FAK). FAK is recruited to adhesions and activated by integrin receptors binding to matrix proteins, such as fibronectin (FN). Canonical models place Rgnef downstream of integrin–FAK signaling in regulating Rho GTPase activity and cell movement. Herein, we establish a new, upstream role for Rgnef in enhancing FAK localization to early peripheral adhesions and promoting FAK activation upon FN binding. Rgnef-null mouse embryo fibroblasts (MEFs) exhibit defects in adhesion formation, levels of FAK phosphotyrosine (pY)-397 and FAK localization to peripheral adhesions upon re-plating on FN. Rgnef re-expression rescues these defects, but requires Rgnef–FAK binding. A mutation in the Rgnef pleckstrin homology (PH) domain inhibits adhesion formation, FAK localization, and FAK-Y397 and paxillin-Y118 phosphorylation without disrupting the Rgnef–FAK interaction. A GEF-inactive Rgnef mutant rescues FAK-Y397 phosphorylation and early adhesion localization, but not paxillin-Y118 phosphorylation. This suggests that, downstream of FN binding, paxillin-pY118 requires Rgnef GEF activity through a mechanism distinct from adhesion formation and FAK activation. These results support a scaffolding role for Rgnef in FAK localization and activation at early adhesions in a PH-domain-dependent but GEF-activity-independent manner. PMID:24006257

Designing small molecules to target cryptic pockets yields both positive and negative allosteric modulators

PubMed Central

Moeder, Katelyn E.; Ho, Chris M. W.; Zimmerman, Maxwell I.; Frederick, Thomas E.; Bowman, Gregory R.

2017-01-01

Allosteric drugs, which bind to proteins in regions other than their main ligand-binding or active sites, make it possible to target proteins considered “undruggable” and to develop new therapies that circumvent existing resistance. Despite growing interest in allosteric drug discovery, rational design is limited by a lack of sufficient structural information about alternative binding sites in proteins. Previously, we used Markov State Models (MSMs) to identify such “cryptic pockets,” and here we describe a method for identifying compounds that bind in these cryptic pockets and modulate enzyme activity. Experimental tests validate our approach by revealing both an inhibitor and two activators of TEM β-lactamase (TEM). To identify hits, a library of compounds is first virtually screened against either the crystal structure of a known cryptic pocket or an ensemble of structures containing the same cryptic pocket that is extracted from an MSM. Hit compounds are then screened experimentally and characterized kinetically in individual assays. We identify three hits, one inhibitor and two activators, demonstrating that screening for binding to allosteric sites can result in both positive and negative modulation. The hit compounds have modest effects on TEM activity, but all have higher affinities than previously identified inhibitors, which bind the same cryptic pocket but were found, by chance, via a computational screen targeting the active site. Site-directed mutagenesis of key contact residues predicted by the docking models is used to confirm that the compounds bind in the cryptic pocket as intended. Because hit compounds are identified from docking against both the crystal structure and structures from the MSM, this platform should prove suitable for many proteins, particularly targets whose crystal structures lack obvious druggable pockets, and for identifying both inhibitory and activating small-molecule modulators. PMID:28570708

Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

PubMed Central

Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

1994-01-01

Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

Testing Geometrical Discrimination within an Enzyme Active Site: Constrained Hydrogen Bonding in the Ketosteroid Isomerase Oxyanion Hole

PubMed Central

Sigala, Paul A.; Kraut, Daniel A.; Caaveiro, Jose M. M.; Pybus, Brandon; Ruben, Eliza A.; Ringe, Dagmar; Petsko, Gregory A.; Herschlag, Daniel

2009-01-01

Enzymes are classically proposed to accelerate reactions by binding substrates within active site environments that are structurally preorganized to optimize binding interactions with reaction transition states rather than ground states. This is a remarkably formidable task considering the limited 0.1 – 1 Å scale of most substrate rearrangements. The flexibility of active site functional groups along the coordinate of substrate rearrangement, the distance scale on which enzymes can distinguish structural rearrangement, and the energetic significance of discrimination on that scale remain open questions that are fundamental to a basic physical understanding of enzyme active sites and catalysis. We bring together high resolution X-ray crystallography, 1H and 19F NMR spectroscopy, quantum mechanical calculations, and transition state analog binding measurements to test the distance scale on which non-covalent forces can constrain side chain and ligand relaxation or translation along a specific coordinate and the energetic consequences of such geometric constraints within the active site of bacterial ketosteroid isomerase (KSI). Our results strongly suggest that packing and binding interactions within the KSI active site can constrain local side chain reorientation and prevent hydrogen bond shortening by 0.1 Å or less. Further, this constraint has substantial energetic effects on ligand binding and stabilization of negative charge within the oxyanion hole. These results provide evidence that subtle geometric effects, indistinguishable in most X-ray crystallographic structures, can have significant energetic consequences and highlight the importance of using synergistic experimental approaches to dissect enzyme function. PMID:18808119

The key DNA-binding residues in the C-terminal domain of Mycobacterium tuberculosis DNA gyrase A subunit (GyrA)

PubMed Central

Huang, You-Yi; Deng, Jiao-Yu; Gu, Jing; Zhang, Zhi-Ping; Maxwell, Anthony; Bi, Li-Jun; Chen, Yuan-Yuan; Zhou, Ya-Feng; Yu, Zi-Niu; Zhang, Xian-En

2006-01-01

As only the type II topoisomerase is capable of introducing negative supercoiling, DNA gyrase is involved in crucial cellular processes. Although the other domains of DNA gyrase are better understood, the mechanism of DNA binding by the C-terminal domain of the DNA gyrase A subunit (GyrA-CTD) is less clear. Here, we investigated the DNA-binding sites in the GyrA-CTD of Mycobacterium tuberculosis gyrase through site-directed mutagenesis. The results show that Y577, R691 and R745 are among the key DNA-binding residues in M.tuberculosis GyrA-CTD, and that the third blade of the GyrA-CTD is the main DNA-binding region in M.tuberculosis DNA gyrase. The substitutions of Y577A, D669A, R691A, R745A and G729W led to the loss of supercoiling and relaxation activities, although they had a little effect on the drug-dependent DNA cleavage and decatenation activities, and had no effect on the ATPase activity. Taken together, these results showed that the GyrA-CTD is essential to DNA gyrase of M.tuberculosis, and promote the idea that the M.tuberculosis GyrA-CTD is a new potential target for drug design. It is the first time that the DNA-binding sites in GyrA-CTD have been identified. PMID:17038336

Arginine methylation of translocated in liposarcoma (TLS) inhibits its binding to long noncoding RNA, abrogating TLS-mediated repression of CBP/p300 activity.

PubMed

Cui, Wei; Yoneda, Ryoma; Ueda, Naomi; Kurokawa, Riki

2018-05-21

Translocated in liposarcoma (TLS) is an RNA-binding protein and a transcription-regulatory sensor of DNA damage. TLS binds promoter-associated noncoding RNA (pncRNA) and inhibits histone acetyltransferase (HAT) activity of CREB-binding protein (CBP)/E1A-binding protein P300 (p300) on the cyclin D1 (CCND1) gene. Although post-translational modifications of TLS, such as arginine methylation, are known to regulate TLS's nucleocytoplasmic shuttling and assembly in stress granules, its interactions with RNAs remain poorly characterized. Herein, using various biochemical assays, we confirmed the earlier observations that TLS is methylated by protein arginine methyltransferase 1 (PRMT1) in vitro. The arginine methylation of TLS disrupted binding to pncRNA and also prevented binding of TLS to and inhibition of CBP/p300. This result indicated that arginine methylation of TLS abrogates both binding to pncRNA and TLS-mediated inhibition of CBP/p300 HAT activities. We also report that an arginine residue within the Arg-Gly-Gly domain of TLS, Arg-476, serves as the major determinant for binding to pncRNA. Either methylation or mutation of Arg-476 of TLS significantly decreased pncRNA binding and thereby prevented a pncRNA-induced allosteric alteration in TLS that is required for its interaction with CBP/p300. Moreover, unlike wildtype TLS, an R476A TLS mutant did not inhibit CCND1 promoter activity in luciferase reporter assays. Taken together, we propose the hypothesis that arginine methylation of TLS regulates both TLS-nucleic acid and TLS-protein interactions and thereby participates in transcriptional regulation. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

Studies on the synthesis, characterization, human serum albumin binding and biological activity of single chain surfactant-cobalt(III) complexes.

PubMed

Vignesh, G; Sugumar, K; Arunachalam, S; Vignesh, S; Arthur James, R; Arun, R; Premkumar, K

2016-03-01

The interaction of surfactant-cobalt(III) complexes [Co(bpy)(dien)TA](ClO4)3 · 3H2O (1) and [Co(dien)(phen)TA](ClO4)3 · 4H2O (2), where bpy = 2,2'-bipyridine, dien = diethylenetriamine, phen = 1,10-phenanthroline and TA = tetradecylamine with human serum albumin (HSA) under physiological conditions was analyzed using steady state, synchronous, 3D fluorescence, UV/visabsorption and circular dichroism spectroscopic techniques. The results show that these complexes cause the fluorescence quenching of HSA through a static mechanism. The binding constant (Kb ) and number of binding-sites (n) were obtained at different temperatures. The corresponding thermodynamic parameters (∆G°, ∆H° and ∆S°) and Ea were also obtained. According to Förster's non-radiation energy transfer theory, the binding distance (r) between the complexes and HSA were calculated. The results of synchronous and 3D fluorescence spectroscopy indicate that the binding process has changed considerably the polarity around the fluorophores, along with changes in the conformation of the protein. The antimicrobial and anticancer activities of the complexes were tested and the results show that the complexes have good activities against pathogenic microorganisms and cancer cells. Copyright © 2015 John Wiley & Sons, Ltd.

Differences in Ribosome Binding and Sarcin/Ricin Loop Depurination by Shiga and Ricin Holotoxins.

PubMed

Li, Xiao-Ping; Tumer, Nilgun E

2017-04-11

Both ricin and Shiga holotoxins display no ribosomal activity in their native forms and need to be activated to inhibit translation in a cell-free translation inhibition assay. This is because the ribosome binding site of the ricin A chain (RTA) is blocked by the B subunit in ricin holotoxin. However, it is not clear why Shiga toxin 1 (Stx1) or Shiga toxin 2 (Stx2) holotoxin is not active in a cell-free system. Here, we compare the ribosome binding and depurination activity of Stx1 and Stx2 holotoxins with the A1 subunits of Stx1 and Stx2 using either the ribosome or a 10-mer RNA mimic of the sarcin/ricin loop as substrates. Our results demonstrate that the active sites of Stx1 and Stx2 holotoxins are blocked by the A2 chain and the B subunit, while the ribosome binding sites are exposed to the solvent. Unlike ricin, which is enzymatically active, but cannot interact with the ribosome, Stx1 and Stx2 holotoxins are enzymatically inactive but can interact with the ribosome.

Removal of a putative inhibitory element reduces the calcium-dependent calmodulin activation of neuronal nitric-oxide synthase.

PubMed

Montgomery, H J; Romanov, V; Guillemette, J G

2000-02-18

Neuronal nitric-oxide synthase (NOS) and endothelial NOS are constitutive NOS isoforms that are activated by binding calmodulin in response to elevated intracellular calcium. In contrast, the inducible NOS isoform binds calmodulin at low basal levels of calcium in resting cells. Primary sequence comparisons show that each constitutive NOS isozyme contains a polypeptide segment within its reductase domain, which is absent in the inducible NOS enzyme. To study a possible link between the presence of these additional polypeptide segments in constitutive NOS enzymes and their calcium-dependent calmodulin activation, three deletion mutants were created. The putative inhibitory insert was removed from the FMN binding regions of the neuronal NOS holoenzyme and from two truncated neuronal NOS reductase enzymes in which the calmodulin binding region was either included or deleted. All three mutant enzymes showed reduced incorporation of FMN and required reconstitution with exogenous FMN for activity. The combined removal of both the calmodulin binding domain and the putative inhibitory insert did not result in a calmodulin-independent neuronal NOS reductase. Thus, although the putative inhibitory element has an effect on the calcium-dependent calmodulin activation of neuronal NOS, it does not have the properties of the typical autoinhibitory domain found in calmodulin-activated enzymes.

Designing and Testing of Novel Taxanes to Probe the Highly Complex Mechanisms by Which Taxanes Bind to Microtubules and Cause Cytotoxicity to Cancer Cells

PubMed Central

St. George, Marc; Ayoub, Ahmed T.; Banerjee, Asok; Churchill, Cassandra D. M.; Winter, Philip; Klobukowski, Mariusz; Cass, Carol E.; Ludueña, Richard F.; Tuszynski, Jack A.; Damaraju, Sambasivarao

2015-01-01

Our previous work identified an intermediate binding site for taxanes in the microtubule nanopore. The goal of this study was to test derivatives of paclitaxel designed to bind to this intermediate site differentially depending on the isotype of β-tubulin. Since β-tubulin isotypes have tissue-dependent expression—specifically, the βIII isotype is very abundant in aggressive tumors and much less common in normal tissues—this is expected to lead to tubulin targeted drugs that are more efficacious and have less side effects. Seven derivatives of paclitaxel were designed and four of these were amenable for synthesis in sufficient purity and yield for further testing in breast cancer model cell lines. None of the derivatives studied were superior to currently used taxanes, however computer simulations provided insights into the activity of the derivatives. Our results suggest that neither binding to the intermediate binding site nor the final binding site is sufficient to explain the activities of the derivative taxanes studied. These findings highlight the need to iteratively improve on the design of taxanes based on their activity in model systems. Knowledge gained on the ability of the engineered drugs to bind to targets and bring about activity in a predictable manner is a step towards personalizing therapies. PMID:26052950

A molecular dynamics study of the complete binding process of meropenem to New Delhi metallo-β-lactamase 1.

PubMed

Duan, Juan; Hu, Chuncai; Guo, Jiafan; Guo, Lianxian; Sun, Jia; Zhao, Zuguo

2018-02-28

The mechanism of substrate hydrolysis of New Delhi metallo-β-lactamase 1 (NDM-1) has been reported, but the process in which NDM-1 captures and transports the substrate into its active center remains unknown. In this study, we investigated the process of the substrate entry into the NDM-1 activity center through long unguided molecular dynamics simulations using meropenem as the substrate. A total of 550 individual simulations were performed, each of which for 200 ns, and 110 of them showed enzyme-substrate binding events. The results reveal three categories of relatively persistent and noteworthy enzyme-substrate binding configurations, which we call configurations A, B, and C. We performed binding free energy calculations of the enzyme-substrate complexes of different configurations using the molecular mechanics Poisson-Boltzmann surface area method. The role of each residue of the active site in binding the substrate was investigated using energy decomposition analysis. The simulated trajectories provide a continuous atomic-level view of the entire binding process, revealing potentially valuable regions where the enzyme and the substrate interact persistently and five possible pathways of the substrate entering into the active center, which were validated using well-tempered metadynamics. These findings provide important insights into the binding mechanism of meropenem to NDM-1, which may provide new prospects for the design of novel metallo-β-lactamase inhibitors and enzyme-resistant antibiotics.

Repeated administration of CGP 46381, a gamma-aminobutyric acidB antagonist, and ethosuximide suppresses seizure-associated cyclic adenosine 3'5' monophosphate response element- and activator protein-1 DNA-binding activities in lethargic (lh/lh) mice.

PubMed

Ishige, K; Endo, H; Saito, H; Ito, Y

2001-01-19

To characterize seizure-associated increases in cerebral cortical and thalamic cyclic AMP responsive element (CRE)- and activator protein 1 (AP-1) DNA-binding activities in lethargic (lh/lh) mice, a genetic model of absence seizures, we examined the effects of ethosuximide and CGP 46381 on these DNA-binding activities. Repeated administration (twice a day for 5 days) of ethosuximide (200 mg/kg) or CGP 46381 (60 mg/kg) attenuated both seizure behavior and the increased DNA-binding activities, and was more effective than a single administration of these drugs. These treatments did not affect either normal behavior or basal DNA-binding activities in non-epileptic control (+/+) mice. Gel supershift assays revealed that the increased CRE-binding activity was attributable to activation of the binding activity of CREB, and that the c-Fos-c-Jun complex was a component of the increased AP-1 DNA-binding activity.

P-selectin mediates Ca(2+)-dependent adhesion of activated platelets to many different types of leukocytes: detection by flow cytometry.

PubMed

de Bruijne-Admiraal, L G; Modderman, P W; Von dem Borne, A E; Sonnenberg, A

1992-07-01

Previous studies have shown that thrombin-activated platelets interact through the P-selectin with neutrophils and monocytes. To identify other types of leukocytes capable of such an interaction, eosinophils, basophils, and lymphocytes were isolated from whole blood. Binding of these cells to activated platelets was examined in a double immunofluorescence assay and the results show that activated platelets not only bind to neutrophils and monocytes, but also to eosinophils, basophils, and subpopulations of T lymphocytes. Using monoclonal antibodies (MoAbs) specific for subsets of T cells, we could further demonstrate that the T cells which bind activated platelets are natural killer (NK) cells and an undefined subpopulation of CD4+ and CD8+ cells. All these interactions were dependent on divalent cations and were completely inhibited by an MoAb against P-selectin. Thus, P-selectin mediates the binding of activated platelets to many different types of leukocytes. Studies with leukocytes treated with proteases or neuraminidase have shown that the structures recognized by P-selectin are glycoproteins carrying sialic acid residues. Because the loss of binding of activated platelets to neuraminidase-treated neutrophils was almost complete, but only partial to treated eosinophils, basophils, and monocytes, the latter cell types may have different P-selectin ligands in addition to those present on neutrophils. We found that two previously identified ligands for P-selectin, the oligosaccharides Le(x) and sialyl-Le(x), had little or no inhibitory effect on adhesion of activated platelets to leukocytes and that binding was not inhibited by MoAbs against these oligosaccharides. In addition, there was no correlation between the expression of Le(x) on several cell types and their capacity to bind activated platelets. In contrast, the expression of sialyl-Le(x) on cells was almost perfectly correlated with their ability to bind activated platelets. Thus, while Le(x) cannot be a major ligand for P-selectin, a possible role for sialyl-Le(x) in P-selectin-mediated adhesion processes cannot be dismissed. Finally, activated platelets were found to bind normally to monocytes and neutrophils of patients with paroxysmal nocturnal hemoglobulinuria (PNH) and to neutrophils from which phosphatidyl inositol (PI)-linked proteins had been removed by glycosylphosphatidyl inositol-specific phospholipase C (GPI-PLC) digestion. This suggests that at least part of the P-selectin ligands on these cells are not GPI-anchored.

Pharmacophore-based virtual screening, biological evaluation and binding mode analysis of a novel protease-activated receptor 2 antagonist

NASA Astrophysics Data System (ADS)

Cho, Nam-Chul; Seo, Seoung-Hwan; Kim, Dohee; Shin, Ji-Sun; Ju, Jeongmin; Seong, Jihye; Seo, Seon Hee; Lee, Iiyoun; Lee, Kyung-Tae; Kim, Yun Kyung; No, Kyoung Tai; Pae, Ae Nim

2016-08-01

Protease-activated receptor 2 (PAR2) is a G protein-coupled receptor, mediating inflammation and pain signaling in neurons, thus it is considered to be a potential therapeutic target for inflammatory diseases. In this study, we performed a ligand-based virtual screening of 1.6 million compounds by employing a common-feature pharmacophore model and two-dimensional similarity search to identify a new PAR2 antagonist. The common-feature pharmacophore model was established based on the biological screening results of our in-house library. The initial virtual screening yielded a total number of 47 hits, and additional biological activity tests including PAR2 antagonism and anti-inflammatory effects resulted in a promising candidate, compound 43, which demonstrated an IC50 value of 8.22 µM against PAR2. In next step, a PAR2 homology model was constructed using the crystal structure of the PAR1 as a template to explore the binding mode of the identified ligands. A molecular docking method was optimized by comparing the binding modes of a known PAR2 agonist GB110 and antagonist GB83, and applied to predict the binding mode of our hit compound 43. In-depth docking analyses revealed that the hydrophobic interaction with Phe2435.39 is crucial for PAR2 ligands to exert antagonistic activity. MD simulation results supported the predicted docking poses that PAR2 antagonist blocked a conformational rearrangement of Na+ allosteric site in contrast to PAR2 agonist that showed Na+ relocation upon GPCR activation. In conclusion, we identified new a PAR2 antagonist together with its binding mode, which provides useful insights for the design and development of PAR2 ligands.

High-Mobility Group Chromatin Proteins 1 and 2 Functionally Interact with Steroid Hormone Receptors To Enhance Their DNA Binding In Vitro and Transcriptional Activity in Mammalian Cells

PubMed Central

Boonyaratanakornkit, Viroj; Melvin, Vida; Prendergast, Paul; Altmann, Magda; Ronfani, Lorenza; Bianchi, Marco E.; Taraseviciene, Laima; Nordeen, Steven K.; Allegretto, Elizabeth A.; Edwards, Dean P.

1998-01-01

We previously reported that the chromatin high-mobility group protein 1 (HMG-1) enhances the sequence-specific DNA binding activity of progesterone receptor (PR) in vitro, thus providing the first evidence that HMG-1 may have a coregulatory role in steroid receptor-mediated gene transcription. Here we show that HMG-1 and the highly related HMG-2 stimulate DNA binding by other steroid receptors, including estrogen, androgen, and glucocorticoid receptors, but have no effect on DNA binding by several nonsteroid nuclear receptors, including retinoid acid receptor (RAR), retinoic X receptor (RXR), and vitamin D receptor (VDR). As highly purified recombinant full-length proteins, all steroid receptors tested exhibited weak binding affinity for their optimal palindromic hormone response elements (HREs), and the addition of purified HMG-1 or -2 substantially increased their affinity for HREs. Purified RAR, RXR, and VDR also exhibited little to no detectable binding to their cognate direct repeat HREs but, in contrast to results with steroid receptors, the addition of HMG-1 or HMG-2 had no stimulatory effect. Instead, the addition of purified RXR enhanced RAR and VDR DNA binding through a heterodimerization mechanism and HMG-1 or HMG-2 had no further effect on DNA binding by RXR-RAR or RXR-VDR heterodimers. HMG-1 and HMG-2 (HMG-1/-2) themselves do not bind to progesterone response elements, but in the presence of PR they were detected as part of an HMG-PR-DNA ternary complex. HMG-1/-2 can also interact transiently in vitro with PR in the absence of DNA; however, no direct protein interaction was detected with VDR. These results, taken together with the fact that PR can bend its target DNA and that HMG-1/-2 are non-sequence-specific DNA binding proteins that recognize DNA structure, suggest that HMG-1/-2 are recruited to the PR-DNA complex by the combined effect of transient protein interaction and DNA bending. In transient-transfection assays, coexpression of HMG-1 or HMG-2 increased PR-mediated transcription in mammalian cells by as much as 7- to 10-fold without altering the basal promoter activity of target reporter genes. This increase in PR-mediated gene activation by coexpression of HMG-1/-2 was observed in different cell types and with different target promoters, suggesting a generality to the functional interaction between HMG-1/-2 and PR in vivo. Cotransfection of HMG-1 also increased reporter gene activation mediated by other steroid receptors, including glucocorticoid and androgen receptors, but it had a minimal influence on VDR-dependent transcription in vivo. These results support the conclusion that HMG-1/-2 are coregulatory proteins that increase the DNA binding and transcriptional activity of the steroid hormone class of receptors but that do not functionally interact with certain nonsteroid classes of nuclear receptors. PMID:9671457

Modulation of ouabain binding and potassium pump fluxes by cellular sodium and potassium in human and sheep erythrocytes.

PubMed Central

Joiner, C H; Lauf, P K

1978-01-01

1. Erythrocytes were treated with nystatin to alter internal Na (Nai) and K (Ki) composition. Although the rates of K pumping and [3H]ouabain binding were altered dramatically, the relationship between glycoside binding and K pump inhibition was unaffected. 2. Human cells with high Nai and low Ki exhibited an increased rate of ouabain binding as compared to high Ki, low Nai cells; this paralleled the stimulated K pump activity of high Nai cells. 3. At constant Ki, increasing internal Na stimulated K pump and ouabain binding rates concomitantly. 4. At low Nai, increasing Ki inhibited both K pumping and ouabain binding. However, at high Nai, increasing Ki from 4 to 44 mM stimulated the rate of glycoside binding, parallel to its effect of increasing the rate of active K influx. 5. Anti-L, an isoantibody to low K (LK) sheep red cells, increased the rate of ouabain binding via its stimulation of K pump turnover. Since the latter effect is the result of affinity changes at the internal cation activation site(s) of the pump (Lauf, Rasmusen, Hoffman, Dunham, Cook, Parmelee & Tosteson, 1970), the antibody's effect on ouabain binding reflected the positive correlation between the rates of K pump turnover and glycoside binding. 6. These data provide the first evidence in intact cells for the occurrence of a Nai-induced conformational change in the Na/K pump during its normal operational cycle. PMID:722574

Single-Molecule Patch-Clamp FRET Anisotropy Microscopy Studies of NMDA Receptor Ion Channel Activation and Deactivation under Agonist Ligand Binding in Living Cells.

PubMed

Sasmal, Dibyendu Kumar; Yadav, Rajeev; Lu, H Peter

2016-07-20

N-methyl-d-aspartate (NMDA) receptor ion channel is activated by the binding of two pairs of glycine and glutamate along with the application of action potential. Binding and unbinding of ligands changes its conformation that plays a critical role in the open-close activities of NMDA receptor. Conformation states and their dynamics due to ligand binding are extremely difficult to characterize either by conventional ensemble experiments or single-channel electrophysiology method. Here we report the development of a new correlated technical approach, single-molecule patch-clamp FRET anisotropy imaging and demonstrate by probing the dynamics of NMDA receptor ion channel and kinetics of glycine binding with its ligand binding domain. Experimentally determined kinetics of ligand binding with receptor is further verified by computational modeling. Single-channel patch-clamp and four-channel fluorescence measurement are recorded simultaneously to get correlation among electrical on and off states, optically determined conformational open and closed states by FRET, and binding-unbinding states of the glycine ligand by anisotropy measurement at the ligand binding domain of GluN1 subunit. This method has the ability to detect the intermediate states in addition to electrical on and off states. Based on our experimental results, we have proposed that NMDA receptor gating goes through at least one electrically intermediate off state, a desensitized state, when ligands remain bound at the ligand binding domain with the conformation similar to the fully open state.

Identification of a Region in the Stalk Domain of the Nipah Virus Receptor Binding Protein That Is Critical for Fusion Activation

PubMed Central

Talekar, Aparna; DeVito, Ilaria; Salah, Zuhair; Palmer, Samantha G.; Chattopadhyay, Anasuya; Rose, John K.; Xu, Rui; Wilson, Ian A.; Moscona, Anne

2013-01-01

Paramyxoviruses, including the emerging lethal human Nipah virus (NiV) and the avian Newcastle disease virus (NDV), enter host cells through fusion of the viral and target cell membranes. For paramyxoviruses, membrane fusion is the result of the concerted action of two viral envelope glycoproteins: a receptor binding protein and a fusion protein (F). The NiV receptor binding protein (G) attaches to ephrin B2 or B3 on host cells, whereas the corresponding hemagglutinin-neuraminidase (HN) attachment protein of NDV interacts with sialic acid moieties on target cells through two regions of its globular domain. Receptor-bound G or HN via its stalk domain triggers F to undergo the conformational changes that render it competent to mediate fusion of the viral and cellular membranes. We show that chimeric proteins containing the NDV HN receptor binding regions and the NiV G stalk domain require a specific sequence at the connection between the head and the stalk to activate NiV F for fusion. Our findings are consistent with a general mechanism of paramyxovirus fusion activation in which the stalk domain of the receptor binding protein is responsible for F activation and a specific connecting region between the receptor binding globular head and the fusion-activating stalk domain is required for transmitting the fusion signal. PMID:23903846

Biological evaluation, docking and molecular dynamic simulation of some novel diaryl urea derivatives bearing quinoxalindione moiety

PubMed Central

Sadeghian-Rizi, Sedighe; Khodarahmi, Ghadamali Ali; Sakhteman, Amirhossein; Jahanian-Najafabadi, Ali; Rostami, Mahboubeh; Mirzaei, Mahmoud; Hassanzadeh, Farshid

2017-01-01

In this study a series of diarylurea derivatives containing quinoxalindione group were biologically evaluated for their cytotoxic activities using MTT assay against MCF-7 and HepG2 cell lines. Antibacterial activities of these compounds were also evaluated by Microplate Alamar Blue Assay (MABA) against three Gram-negative (Escherichia coli, Pseudomonas aeruginosa and Salmonella typhi), three Gram-positive (Staphylococcus aureus, Bacillus subtilis and Listeria monocitogenes) and one yeast-like fungus (Candida albicans) strain. Furthermore, molecular docking was carried out to study the binding pattern of the compounds to the active site of B-RAF kinase (PDB code: 1UWH). Molecular dynamics simulation was performed on the best ligand (16e) to investigate the ligand binding dynamics in the physiological environment. Cytotoxic evaluation revealed the most prominent cytotoxicity for 6 compounds with IC50 values of 10-18 μM against two mentioned cell lines. None of the synthesized compounds showed significant antimicrobial activity. The obtained results of the molecular docking study showed that all compounds fitted in the binding site of enzyme with binding energy range of -11.22 to -12.69 kcal/mol vs sorafenib binding energy -11.74 kcal/mol as the lead compound. Molecular dynamic simulation indicated that the binding of ligand (16e) was stable in the active site of B-RAF during the simulation. PMID:29204178

The transcription factor CCAAT-binding factor CBF/NF-Y regulates the proximal promoter activity in the human alpha 1(XI) collagen gene (COL11A1).

PubMed

Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu

2003-08-29

We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.

Receptor type I and type II binding regions and the peptidyl-prolyl isomerase site of cyclophilin B are required for enhancement of T-lymphocyte adhesion to fibronectin.

PubMed

Carpentier, Mathieu; Allain, Fabrice; Slomianny, Marie-Christine; Durieux, Sandrine; Vanpouille, Christophe; Haendler, Bernard; Spik, Geneviève

2002-04-23

Cyclophilin B (CyPB), a cyclosporin A (CsA) binding protein, interacts with two types of binding sites at the surface of T-lymphocytes. The type I sites correspond to functional receptors involved in endocytosis and the type II sites to sulfated glycosaminoglycans (GAGs). Mutational analysis of CyPB has revealed that W128, which is part of the CsA-binding pocket, is implicated in the binding to the functional type I receptors and that two amino acid clusters located in the N-terminus ensure the binding to GAGs. The peptidyl-prolyl isomerase activity of CyPB is not required for receptor binding. We have recently demonstrated that CyPB enhances adhesion of peripheral blood T-lymphocytes to fibronectin, a component of the extracellular matrix. We intended to identify additional amino acids involved in the binding of CyPB to its functional type I receptor and to determine regions responsible for the stimulation of peripheral blood T-lymphocyte adhesion. We determined that residues R76, G77, K132, D155, and D158 of the calcineurin (CN) interacting region were implicated in the recognition of type I receptor but not of GAGs. We also found that two different changes in the N-terminal extension that abated binding to GAGs prevented adhesion of peripheral blood T-lymphocytes to coated CyPB, whereas abbrogation of the PPIase activity had no effect. On the other hand, the adhesion of peripheral blood T-lymphocytes to coated fibronectin was not stimulated by CyPB mutants devoid of either type I receptor or GAGs binding activity or by mutants of the PPIase site. Altogether, the results demonstrate that different regions of CyPB are involved in peripheral blood T-lymphocyte activation and imply a novel important physiological function for peptidyl-prolyl isomerase activity.

Beta-Endorphin: dissociation of receptor binding activity from analgesic potency.

PubMed

Li, C H; Tseng, L F; Ferrara, P; Yamashiro, D

1980-04-01

Biological activities of synthetic camel beta-endorphin and human beta-endorphin (beta h-EP) have been measured by the radioreceptor binding assay, using [Tyr27-3H]-beta h-EP as the primary ligand and by the tail-flick test for analgesic potency. Four synthetic analogs of beta h-EP, namely [Gly31]-beta h-EP-Gly-NH2, [Gly31]-beta h-EP-Gly-Gly-NH2, [Gln8,Gly31]-beta h-EP-Gly-Gly-NH2, and [CH3(CH2)4NH231]-beta h-EP, have also been assayed by the same procedures. Results indicate a clear dissociation of radioreceptor binding activity from analgesic potency.

Beta-Endorphin: dissociation of receptor binding activity from analgesic potency.

PubMed Central

Li, C H; Tseng, L F; Ferrara, P; Yamashiro, D

1980-01-01

Biological activities of synthetic camel beta-endorphin and human beta-endorphin (beta h-EP) have been measured by the radioreceptor binding assay, using [Tyr27-3H]-beta h-EP as the primary ligand and by the tail-flick test for analgesic potency. Four synthetic analogs of beta h-EP, namely [Gly31]-beta h-EP-Gly-NH2, [Gly31]-beta h-EP-Gly-Gly-NH2, [Gln8,Gly31]-beta h-EP-Gly-Gly-NH2, and [CH3(CH2)4NH231]-beta h-EP, have also been assayed by the same procedures. Results indicate a clear dissociation of radioreceptor binding activity from analgesic potency. PMID:6246537

DNA-binding by Haemophilus influenzae and Escherichia coli YbaB, members of a widely-distributed bacterial protein family.

PubMed

Cooley, Anne E; Riley, Sean P; Kral, Keith; Miller, M Clarke; DeMoll, Edward; Fried, Michael G; Stevenson, Brian

2009-07-13

Genes orthologous to the ybaB loci of Escherichia coli and Haemophilus influenzae are widely distributed among eubacteria. Several years ago, the three-dimensional structures of the YbaB orthologs of both E. coli and H. influenzae were determined, revealing a novel "tweezer"-like structure. However, a function for YbaB had remained elusive, with an early study of the H. influenzae ortholog failing to detect DNA-binding activity. Our group recently determined that the Borrelia burgdorferi YbaB ortholog, EbfC, is a DNA-binding protein. To reconcile those results, we assessed the abilities of both the H. influenzae and E. coli YbaB proteins to bind DNA to which B. burgdorferi EbfC can bind. Both the H. influenzae and the E. coli YbaB proteins bound to tested DNAs. DNA-binding was not well competed with poly-dI-dC, indicating some sequence preferences for those two proteins. Analyses of binding characteristics determined that both YbaB orthologs bind as homodimers. Different DNA sequence preferences were observed between H. influenzae YbaB, E. coli YbaB and B. burgdorferi EbfC, consistent with amino acid differences in the putative DNA-binding domains of these proteins. Three distinct members of the YbaB/EbfC bacterial protein family have now been demonstrated to bind DNA. Members of this protein family are encoded by a broad range of bacteria, including many pathogenic species, and results of our studies suggest that all such proteins have DNA-binding activities. The functions of YbaB/EbfC family members in each bacterial species are as-yet unknown, but given the ubiquity of these DNA-binding proteins among Eubacteria, further investigations are warranted.

Characterization of two mosquito STATs, AaSTAT and CtSTAT. Differential regulation of tyrosine phosphorylation and DNA binding activity by lipopolysaccharide treatment and by Japanese encephalitis virus infection.

PubMed

Lin, Chang-Chi; Chou, Chih-Ming; Hsu, Ya-Li; Lien, Jih-Ching; Wang, Yu-Ming; Chen, Shui-Tsung; Tsai, Shu-Chuan; Hsiao, Pei-Wen; Huang, Chang-Jen

2004-01-30

Two mosquito STATs, AaSTAT and CtSTAT, have been cloned from Aedes albopictus and Culex tritaeniorhynchus mosquitoes, respectively. These two STATs are more similar to those of Drosophila, Anopheles, and mammalian STAT5 in the DNA binding and Src homology 2 domains. The mRNA transcripts are expressed at all developmental stages, and the proteins are present predominantly at the pupal and adult stages in both mosquitoes. Stimulation with lipopolysaccharide resulted in an increase of tyrosine phosphorylation and DNA binding activity of AaSTAT and CtSTAT as well as an increase of luciferase activity of a reporter gene containing Drosophila STAT binding motif in mosquito C6/36 cells. After being infected with Japanese encephalitis virus, nuclear extracts of C6/36 cells revealed a decrease of tyrosine phosphorylation and DNA binding activity of AaSTAT which could be restored by sodium orthovanadate treatment. Taking all of the data together, this is the first report to clone and characterize two mosquito STATs with 81% identity and to demonstrate a different response of tyrosine phosphorylation and DNA binding of these two STATs by lipopolysaccharide treatment and by Japanese encephalitis virus infection.

Rigidification of the autolysis loop enhances Na[superscript +] binding to thrombin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pozzi, Nicola; Chen, Raymond; Chen, Zhiwei

2011-09-20

Binding of Na{sup +} to thrombin ensures high activity toward physiological substrates and optimizes the procoagulant and prothrombotic roles of the enzyme in vivo. Under physiological conditions of pH and temperature, the binding affinity of Na{sup +} is weak due to large heat capacity and enthalpy changes associated with binding, and the K{sub d} = 80 mM ensures only 64% saturation of the site at the concentration of Na{sup +} in the blood (140 mM). Residues controlling Na{sup +} binding and activation have been identified. Yet, attempts to improve the interaction of Na{sup +} with thrombin and possibly increase catalyticmore » activity under physiological conditions have so far been unsuccessful. Here we report how replacement of the flexible autolysis loop of human thrombin with the homologous rigid domain of the murine enzyme results in a drastic (up to 10-fold) increase in Na{sup +} affinity and a significant improvement in the catalytic activity of the enzyme. Rigidification of the autolysis loop abolishes the heat capacity change associated with Na{sup +} binding observed in the wild-type and also increases the stability of thrombin. These findings have general relevance to protein engineering studies of clotting proteases and trypsin-like enzymes.« less

Mediation of CTCF transcriptional insulation by DEAD-box RNA-binding protein p68 and steroid receptor RNA activator SRA

PubMed Central

Yao, Hongjie; Brick, Kevin; Evrard, Yvonne; Xiao, Tiaojiang; Camerini-Otero, R. Daniel; Felsenfeld, Gary

2010-01-01

CCCTC-binding factor (CTCF) is a DNA-binding protein that plays important roles in chromatin organization, although the mechanism by which CTCF carries out these functions is not fully understood. Recent studies show that CTCF recruits the cohesin complex to insulator sites and that cohesin is required for insulator activity. Here we showed that the DEAD-box RNA helicase p68 (DDX5) and its associated noncoding RNA, steroid receptor RNA activator (SRA), form a complex with CTCF that is essential for insulator function. p68 was detected at CTCF sites in the IGF2/H19 imprinted control region (ICR) as well as other genomic CTCF sites. In vivo depletion of SRA or p68 reduced CTCF-mediated insulator activity at the IGF2/H19 ICR, increased levels of IGF2 expression, and increased interactions between the endodermal enhancer and IGF2 promoter. p68/SRA also interacts with members of the cohesin complex. Depletion of either p68 or SRA does not affect CTCF binding to its genomic sites, but does reduce cohesin binding. The results suggest that p68/SRA stabilizes the interaction of cohesin with CTCF by binding to both, and is required for proper insulator function. PMID:20966046

Establishment and characterization of a new and stable collagen-binding assay for the assessment of von Willebrand factor activity

PubMed Central

Ni, Y; Nesrallah, J; Agnew, M; Geske, F J; Favaloro, E J

2013-01-01

Introduction Laboratory diagnosis of von Willebrand disease (VWD) requires determination of both von Willebrand factor (VWF) protein levels and activity. Current VWF activity tests include the ristocetin cofactor assay and the collagen-binding assay (VWF:CB). The goal of this investigation is to characterize a new collagen-binding assay and to determine its effectiveness in identifying VWD. Methods Analytical studies were carried out to characterize the performance of a new VWF:CB ELISA. Additionally, samples from a normal population were tested as were well-characterized type 1 and type 2 VWD samples. Results Repeatability and within-laboratory precision studies resulted in coefficients of variation (CVs) of ≤11%. A linear range of 1–354% (0.01–3.54 IU/mL) was determined, along with a limit of detection and a lower limit of quantitation of 1.6% and 4.0% (0.016 and 0.04 IU/mL), respectively. Samples tested from apparently healthy individuals resulted in a normal range of 54–217% (0.54–2.17 IU/mL). Known VWD type 1 and type 2 samples were also analyzed by the ELISA, with 99% of samples having VWF:CB below the normal reference range and an estimated 96% sensitivity and 87% specificity using a VWF collagen-binding/antigen cutoff ratio of 0.50. Conclusion This new VWF:CB ELISA provides an accurate measure of collagen-binding activity that aids in the diagnosis and differentiation of type 1 from type 2 VWD. PMID:23107512

Identification of the HrpS binding site in the hrpL promoter and effect of the RpoN binding site of HrpS on the regulation of the type III secretion system in Erwinia amylovora.

PubMed

Lee, Jae Hoon; Sundin, George W; Zhao, Youfu

2016-06-01

The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.

Human Nup98 regulates the localization and activity of DExH/D-box helicase DHX9

PubMed Central

Capitanio, Juliana S; Montpetit, Ben; Wozniak, Richard W

2017-01-01

Beyond their role at nuclear pore complexes, some nucleoporins function in the nucleoplasm. One such nucleoporin, Nup98, binds chromatin and regulates gene expression. To gain insight into how Nup98 contributes to this process, we focused on identifying novel binding partners and understanding the significance of these interactions. Here we report on the identification of the DExH/D-box helicase DHX9 as an intranuclear Nup98 binding partner. Various results, including in vitro assays, show that the FG/GLFG region of Nup98 binds to N- and C-terminal regions of DHX9 in an RNA facilitated manner. Importantly, binding of Nup98 stimulates the ATPase activity of DHX9, and a transcriptional reporter assay suggests Nup98 supports DHX9-stimulated transcription. Consistent with these observations, our analysis revealed that Nup98 and DHX9 bind interdependently to similar gene loci and their transcripts. Based on our results, we propose that Nup98 functions as a co-factor that regulates DHX9 and, potentially, other RNA helicases. DOI: http://dx.doi.org/10.7554/eLife.18825.001 PMID:28221134

Two phenylalanines in the C-terminus of Epstein-Barr virus Rta protein reciprocally modulate its DNA binding and transactivation function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, L.-W.; Department of Molecular Biophysics and Biochemistry, Yale University School of Medicine, New Haven, CT 06520; Raghavan, Vineetha

The Rta (R transactivator) protein plays an essential role in the Epstein-Barr viral (EBV) lytic cascade. Rta activates viral gene expression by several mechanisms including direct and indirect binding to target viral promoters, synergy with EBV ZEBRA protein, and stimulation of cellular signaling pathways. We previously found that Rta proteins with C-terminal truncations of 30 aa were markedly enhanced in their capacity to bind DNA (Chen, L.W., Chang, P.J., Delecluse, H.J., and Miller, G., (2005). Marked variation in response of consensus binding elements for the Rta protein of Epstein-Barr virus. J. Virol. 79(15), 9635-9650.). Here we show that two phenylalaninesmore » (F600 and F605) in the C-terminus of Rta play a crucial role in mediating this DNA binding inhibitory function. Amino acids 555 to 605 of Rta constitute a functional DNA binding inhibitory sequence (DBIS) that markedly decreased DNA binding when transferred to a minimal DNA binding domain of Rta (aa 1-350). Alanine substitution mutants, F600A/F605A, abolished activity of the DBIS. F600 and F605 are located in the transcriptional activation domain of Rta. Alanine substitutions, F600A/F605A, decreased transcriptional activation by Rta protein, whereas aromatic substitutions, such as F600Y/F605Y or F600W/F605W, partially restored transcriptional activation. Full-length Rta protein with F600A/F605A mutations were enhanced in DNA binding compared to wild-type, whereas Rta proteins with F600Y/F605Y or F600W/F605W substitutions were, like wild-type Rta, relatively poor DNA binders. GAL4 (1-147)/Rta (416-605) fusion proteins with F600A/F605A mutations were diminished in transcriptional activation, relative to GAL4/Rta chimeras without such mutations. The results suggest that, in the context of a larger DBIS, F600 and F605 play a role in the reciprocal regulation of DNA binding and transcriptional activation by Rta. Regulation of DNA binding by Rta is likely to be important in controlling its different modes of action.« less

'Unconventional' coordination chemistry by metal chelating fragments in a metalloprotein active site.

PubMed

Martin, David P; Blachly, Patrick G; Marts, Amy R; Woodruff, Tessa M; de Oliveira, César A F; McCammon, J Andrew; Tierney, David L; Cohen, Seth M

2014-04-09

The binding of three closely related chelators: 5-hydroxy-2-methyl-4H-pyran-4-thione (allothiomaltol, ATM), 3-hydroxy-2-methyl-4H-pyran-4-thione (thiomaltol, TM), and 3-hydroxy-4H-pyran-4-thione (thiopyromeconic acid, TPMA) to the active site of human carbonic anhydrase II (hCAII) has been investigated. Two of these ligands display a monodentate mode of coordination to the active site Zn(2+) ion in hCAII that is not recapitulated in model complexes of the enzyme active site. This unprecedented binding mode in the hCAII-thiomaltol complex has been characterized by both X-ray crystallography and X-ray spectroscopy. In addition, the steric restrictions of the active site force the ligands into a 'flattened' mode of coordination compared with inorganic model complexes. This change in geometry has been shown by density functional computations to significantly decrease the strength of the metal-ligand binding. Collectively, these data demonstrate that the mode of binding by small metal-binding groups can be significantly influenced by the protein active site. Diminishing the strength of the metal-ligand bond results in unconventional modes of metal coordination not found in typical coordination compounds or even carefully engineered active site models, and understanding these effects is critical to the rational design of inhibitors that target clinically relevant metalloproteins.

Metabolic activation and nucleic acid binding of acetaminophen and related arylamine substrates by the respiratory burst of human granulocytes.

PubMed

Corbett, M D; Corbett, B R; Hannothiaux, M H; Quintana, S J

1989-01-01

Following stimulation with phorbol myristate acetate, human granulocytes were found to incorporate acetaminophen, p-phenetidine, p-aminophenol, and p-chloroaniline into cellular DNA and RNA. Phenacetin was not incorporated into nucleic acid or metabolized by such activated granulocytes. None of the substrates gave nucleic acid binding if the granulocyte cultures were not induced to undergo the respiratory burst. Additional studies on the binding of acetaminophen to DNA and RNA were made by use of both ring-14C-labeled and carbonyl-14C-labeled forms of this substrate. The finding that equivalent amounts of these two labeled acetaminophen substrates were bound to cellular DNA demonstrated that the intact acetaminophen molecule was incorporated into DNA. On the other hand, the finding that excess ring-14C-labeled acetaminophen was incorporated into cellular RNA implies partial hydrolysis of the acetaminophen substrate prior to RNA binding. Evidence was presented which strongly indicates that the nucleic acid binding of the substrates was covalent in nature. The inability of the respiratory burst to result in the binding of phenacetin to nucleic acid suggests that arylamides are not normally activated or metabolized by activated granulocytes. Acetaminophen is an exception to the recalcitrance of arylamides to such bioactivation processes because it also possesses the phenolic functional group, which, like the arylamine group, is oxidized by certain reactive oxygen species. Myeloperoxidase appears to be much more important in the binding of acetaminophen to DNA than it is in the DNA binding of arylamines in general. The role of the respiratory burst in causing the bioactivation of certain arylamines, which are not normally genotoxic via the more usual microsomal activation pathways, was extended to include certain amide substrates such as acetaminophen.

Identification and characterization of Taenia solium enolase as a plasminogen-binding protein.

PubMed

Ayón-Núñez, Dolores A; Fragoso, Gladis; Espitia, Clara; García-Varela, Martín; Soberón, Xavier; Rosas, Gabriela; Laclette, Juan P; Bobes, Raúl J

2018-06-01

The larval stage of Taenia solium (cysticerci) is the causal agent of human and swine cysticercosis. When ingested by the host, T. solium eggs are activated and hatch in the intestine, releasing oncospheres that migrate to various tissues and evolve into cysticerci. Plasminogen (Plg) receptor proteins have been reported to play a role in migration processes for several pathogens. This work is aimed to identify Plg-binding proteins in T. solium cysticerci and determine whether T. solium recombinant enolase (rTsEnoA) is capable of specifically binding and activating human Plg. To identify Plg-binding proteins, a 2D-SDS-PAGE ligand blotting was performed, and recognized spots were identified by MS/MS. Seven proteins from T. solium cysticerci were found capable of binding Plg: fascicilin-1, fasciclin-2, enolase, MAPK, annexin, actin, and cytosolic malate dehydrogenase. To determine whether rTsEnoA binds human Plg, a ligand blotting was performed and the results were confirmed by ELISA both in the presence and absence of εACA, a competitive Plg inhibitor. Finally, rTsEnoA-bound Plg was activated to plasmin in the presence of tPA. To better understand the evolution of enolase isoforms in T. solium, a phylogenetic inference analysis including 75 enolase amino acid sequences was conducted. The origin of flatworm enolase isoforms, except for Eno4, is independent of their vertebrate counterparts. Therefore, herein we propose to designate tapeworm protein isoforms as A, B, C, and 4. In conclusion, recombinant enolase showed a strong plasminogen binding and activating activity in vitro. T. solium enolase could play a role in parasite invasion along with other plasminogen-binding proteins. Copyright © 2018 Elsevier B.V. All rights reserved.

Modulation of Bacillus thuringiensis Phosphatidylinositol-Specific Phospholipase C Activity by Mutations in the Putative Dimerization Interface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, X.; Shao, C; Zhang, X

2009-01-01

Cleavage of phosphatidylinositol (PI) to inositol 1,2-(cyclic)-phosphate (cIP) and cIP hydrolysis to inositol 1-phosphate by Bacillus thuringiensis phosphatidylinositol-specific phospholipase C are activated by the enzyme binding to phosphatidylcholine (PC) surfaces. Part of this reflects improved binding of the protein to interfaces. However, crystallographic analysis of an interfacially impaired phosphatidylinositol-specific phospholipase (W47A/W242A) suggested protein dimerization might occur on the membrane. In the W47A/W242A dimer, four tyrosine residues from one monomer interact with the same tyrosine cluster of the other, forming a tight dimer interface close to the membrane binding regions. We have constructed mutant proteins in which two or more ofmore » these tyrosine residues have been replaced with serine. Phospholipid binding and enzymatic activity of these mutants have been examined to assess the importance of these residues to enzyme function. Replacing two tyrosines had small effects on enzyme activity. However, removal of three or four tyrosine residues weakened PC binding and reduced PI cleavage by the enzyme as well as PC activation of cIP hydrolysis. Crystal structures of Y247S/Y251S in the absence and presence of myo-inositol as well as Y246S/Y247S/Y248S/Y251S indicate that both mutant proteins crystallized as monomers, were very similar to one another, and had no change in the active site region. Kinetic assays, lipid binding, and structural results indicate that either (i) a specific PC binding site, critical for vesicle activities and cIP activation, has been impaired, or (ii) the reduced dimerization potential for Y246S/Y247S/Y248S and Y246S/Y247S/Y248S/Y251S is responsible for their reduced catalytic activity in all assay systems.« less

Kinetic modeling of benzodiazepine receptor binding with PET and high specific activity [(11)C]Iomazenil in healthy human subjects.

PubMed

Bremner, J D; Horti, A; Staib, L H; Zea-Ponce, Y; Soufer, R; Charney, D S; Baldwin, R

2000-01-01

Quantitation of the PET benzodiazepine receptor antagonist, [(11)C]Iomazenil, using low specific activity radioligand was recently described. The purpose of this study was to quantitate benzodiazepine receptor binding in human subjects using PET and high specific activity [(11)C]Iomazenil. Six healthy human subjects underwent PET imaging following a bolus injection of high specific activity (>100 Ci/mmol) [(11)C]iomazenil. Arterial samples were collected at multiple time points after injection for measurement of unmetabolized total and nonprotein-bound parent compound in plasma. Time activity curves of radioligand concentration in brain and plasma were analyzed using two and three compartment model. Kinetic rate constants of transfer of radioligand between plasma, nonspecifically bound brain tissue, and specifically bound brain tissue compartments were fitted to the model. Values for fitted kinetic rate constants were used in the calculation of measures of benzodiazepine receptor binding, including binding potential (the ratio of receptor density to affinity), and product of BP and the fraction of free nonprotein-bound parent compound (V(3)'). Use of the three compartment model improved the goodness of fit in comparison to the two compartment model. Values for kinetic rate constants and measures of benzodiazepine receptor binding, including BP and V(3)', were similar to results obtained with the SPECT radioligand [(123)I]iomazenil, and a prior report with low specific activity [(11)C]Iomazenil. Kinetic modeling using the three compartment model with PET and high specific activity [(11)C]Iomazenil provides a reliable measure of benzodiazepine receptor binding. Synapse 35:68-77, 2000. Published 2000 Wiley-Liss, Inc.

Disabled is a putative adaptor protein that functions during signaling by the sevenless receptor tyrosine kinase.

PubMed

Le, N; Simon, M A

1998-08-01

DRK, the Drosophila homolog of the SH2-SH3 domain adaptor protein Grb2, is required during signaling by the sevenless receptor tyrosine kinase (SEV). One role of DRK is to provide a link between activated SEV and the Ras1 activator SOS. We have investigated the possibility that DRK performs other functions by identifying additional DRK-binding proteins. We show that the phosphotyrosine-binding (PTB) domain-containing protein Disabled (DAB) binds to the DRK SH3 domains. DAB is expressed in the ommatidial clusters, and loss of DAB function disrupts ommatidial development. Moreover, reduction of DAB function attenuates signaling by a constitutively activated SEV. Our biochemical analysis suggests that DAB binds SEV directly via its PTB domain, becomes tyrosine phosphorylated upon SEV activation, and then serves as an adaptor protein for SH2 domain-containing proteins. Taken together, these results indicate that DAB is a novel component of the SEV signaling pathway.

Modeling Shear Induced Von Willebrand Factor Binding to Collagen

NASA Astrophysics Data System (ADS)

Dong, Chuqiao; Wei, Wei; Morabito, Michael; Webb, Edmund; Oztekin, Alparslan; Zhang, Xiaohui; Cheng, Xuanhong

2017-11-01

Von Willebrand factor (vWF) is a blood glycoprotein that binds with platelets and collagen on injured vessel surfaces to form clots. VWF bioactivity is shear flow induced: at low shear, binding between VWF and other biological entities is suppressed; for high shear rate conditions - as are found near arterial injury sites - VWF elongates, activating its binding with platelets and collagen. Based on parameters derived from single molecule force spectroscopy experiments, we developed a coarse-grain molecular model to simulate bond formation probability as a function of shear rate. By introducing a binding criterion that depends on the conformation of a sub-monomer molecular feature of our model, the model predicts shear-induced binding, even for conditions where binding is highly energetically favorable. We further investigate the influence of various model parameters on the ability to predict shear-induced binding (vWF length, collagen site density and distribution, binding energy landscape, and slip/catch bond length) and demonstrate parameter ranges where the model provides good agreement with existing experimental data. Our results may be important for understanding vWF activity and also for achieving targeted drug therapy via biomimetic synthetic molecules. National Science Foundation (NSF),Division of Mathematical Sciences (DMS).

Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

PubMed

Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

2008-05-01

The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

Probing the acidic residue within the integrin binding site of laminin-511 that interacts with the metal ion-dependent adhesion site of α6β1 integrin.

PubMed

Taniguchi, Yukimasa; Li, Shaoliang; Takizawa, Mamoru; Oonishi, Eriko; Toga, Junko; Yagi, Emiko; Sekiguchi, Kiyotoshi

2017-06-03

Laminins are major cell-adhesive proteins of basement membranes that interact with integrins in a divalent cation-dependent manner. Laminin-511 consists of α5, β1, and γ1 chains, of which three laminin globular domains of the α5 chain (α5/LG1-3) and a Glu residue in the C-terminal tail of chain γ1 (γ1-Glu1607) are required for binding to integrins. However, it remains unsettled whether the Glu residue in the γ1 tail is involved in integrin binding by coordinating the metal ion in the metal ion-dependent adhesion site of β1 integrin (β1-MIDAS), or by stabilizing the conformation of α5/LG1-3. To address this issue, we examined whether α5/LG1-3 contain an acidic residue required for integrin binding that is as critical as the Glu residue in the γ1 tail; to achieve this, we undertook exhaustive alanine substitutions of the 54 acidic residues present in α5/LG1-3 of the E8 fragment of laminin-511 (LM511E8). Most of the alanine mutants possessed α6β1 integrin binding activities comparable with wild-type LM511E8. Alanine substitution for α5-Asp3198 and Asp3219 caused mild reduction in integrin binding activity, and that for α5-Asp3218 caused severe reduction, possibly resulting from conformational perturbation of α5/LG1-3. When α5-Asp3218 was substituted with asparagine, the resulting mutant possessed significant binding activity to α6β1 integrin, indicating that α5-Asp3218 is not directly involved in integrin binding through coordination with the metal ion in β1-MIDAS. Given that substitution of γ1-Glu1607 with glutamine nullified the binding activity to α6β1 integrin, these results, taken together, support the possibility that the critical acidic residue coordinating the metal ion in β1-MIDAS is Glu1607 in the γ1 tail, but no such residue is present in α5/LG1-3. Copyright © 2017 Elsevier Inc. All rights reserved.

Arrestin binding to the G protein-coupled N-formyl peptide receptor is regulated by the conserved "DRY" sequence.

PubMed

Bennett, T A; Maestas, D C; Prossnitz, E R

2000-08-11

Following activation by ligand, the N-formyl peptide receptor (FPR) undergoes processing events initiated by phosphorylation that lead to receptor desensitization and internalization. Our previous results have shown that FPR internalization can occur in the absence of receptor desensitization, suggesting that FPR desensitization and internalization are controlled by distinct mechanisms. More recently, we have provided evidence that internalization of the FPR occurs via a mechanism that is independent of the actions of arrestin, dynamin, and clathrin. In the present report, we demonstrate that stimulation of the FPR with agonist leads to a significant translocation of arrestin-2 from the cytosol to the membrane. Fluorescence microscopy revealed that the translocated arrestin-2 is highly colocalized with the ligand-bound FPR. A D71A mutant FPR, which does not undergo activation or phosphorylation in response to ligand, did not colocalize with arrestin-2. Surprisingly, an R123G mutant FPR, which does not bind G protein but does become phosphorylated and subsequently internalized, also did not bind arrestin. These results indicate that arrestin binding is not required for FPR internalization and demonstrate for the first time that a common motif, the conserved "DRY" domain of G protein-coupled receptors, is essential for phosphorylation-dependent arrestin binding, as well as G protein activation.

A Pro-Nerve Growth Factor (proNGF) and NGF Binding Protein, α2-Macroglobulin, Differentially Regulates p75 and TrkA Receptors and Is Relevant to Neurodegeneration Ex Vivo and In Vivo

PubMed Central

Barcelona, Pablo F.

2015-01-01

Nerve growth factor (NGF) is generated from a precursor, proNGF, that is proteolytically processed. NGF preferentially binds a trophic tyrosine kinase receptor, TrkA, while proNGF binds a neurotrophin receptor (NTR), p75NTR, that can have neurotoxic activity. Previously, we along with others showed that the soluble protein α2-macroglobulin (α2M) is neurotoxic. Toxicity is due in part to α2M binding to NGF and inhibiting trophic activity, presumably by preventing NGF binding to TrkA. However, the mechanisms remained unclear. Here, we show ex vivo and in vivo three mechanisms for α2M neurotoxicity. First, unexpectedly the α2M-NGF complexes do bind TrkA receptors but do not induce TrkA dimerization or activation, resulting in deficient trophic support. Second, α2M makes stable complexes with proNGF, conveying resistance to proteolysis that results in more proNGF and less NGF. Third, α2M-proNGF complexes bind p75NTR and are more potent agonists than free proNGF, inducing tumor necrosis factor alpha (TNF-α) production. Hence, α2M regulates proNGF/p75NTR positively and mature NGF/TrkA negatively, causing neuronal death ex vivo. These three mechanisms are operative in vivo, and α2M causes neurodegeneration in a p75NTR- and proNGF-dependent manner. α2M could be exploited as a therapeutic target, or as a modifier of neurotrophin signals. PMID:26217017

Elucidating the Influence of Gold Nanoparticles on the Binding of Salvianolic Acid B and Rosmarinic Acid to Bovine Serum Albumin

PubMed Central

Peng, Xin; Qi, Wei; Huang, Renliang; Su, Rongxin; He, Zhimin

2015-01-01

Salvianolic acid B and rosmarinic acid are two main water-soluble active ingredients from Salvia miltiorrhiza with important pharmacological activities and clinical applications. The interactions between salvianolic acid B (or rosmarinic acid) and bovine serum albumin (BSA) in the presence and absence of gold nanoparticles (Au NPs) with three different sizes were investigated by using biophysical methods for the first time. Experimental results proved that two components quenched the fluorescence of BSA mainly through a static mechanism irrespective of the absence or presence of Au NPs. The presence of Au NPs decreased the binding constants of salvianolic acid B with BSA from 27.82% to 10.08%, while Au NPs increased the affinities of rosmarinic acid for BSA from 0.4% to 14.32%. The conformational change of BSA in the presence of Au NPs (caused by a noncompetitive binding between Au NPs and drugs at different albumin sites) induced changeable affinity and binding distance between drugs and BSA compared with no Au NPs. The competitive experiments revealed that the site I (subdomain IIA) of BSA was the primary binding site for salvianolic acid B and rosmarinic acid. Additionally, two compounds may induce conformational and micro-environmental changes of BSA. The results would provide valuable binding information between salvianolic acid B (or rosmarinic acid) and BSA, and also indicated that the Au NPs could alter the interaction mechanism and binding capability of drugs to BSA, which might be beneficial to understanding the pharmacokinetics and biological activities of the two drugs. PMID:25861047

Magnesium-adenosine diphosphate binding sites in wild-type creatine kinase and in mutants: role of aromatic residues probed by Raman and infrared spectroscopies.

PubMed

Hagemann, H; Marcillat, O; Buchet, R; Vial, C

2000-08-08

Two distinct methods were used to investigate the role of Trp residues during Mg-ADP binding to cytosolic creatine kinase (CK) from rabbit muscle: (1) Raman spectroscopy, which is very sensitive to the environment of aromatic side-chain residues, and (2) reaction-induced infrared difference spectroscopy (RIDS) and photolabile substrate (ADP[Et(PhNO(2))]), combined with site-directed mutagenesis on the four Trp residues of CK. Our Raman results indicated that the environment of Trp and of Tyr were not affected during Mg-ADP binding to CK. Analysis of RIDS of wild-type CK, inactive W227Y, and active W210,217,272Y mutants suggested that Trp227 was not involved in the stacking interactions. Results are consistent with Trp227 being essential to prevent water molecules from entering in the active site [as suggested by Gross, M., Furter-Graves, E. M., Wallimann, T., Eppenberger, H. M., and Furter, R. (1994) Protein Sci. 3, 1058-1068] and that another Trp could in addition help to steer the nucleotide in the binding site, although it is not essential for the activity of CK. Raman and infrared spectra indicated that Mg-ADP binding does not involve large secondary structure changes. Only 3-4 residues absorbing in the amide I region are directly implicated in the Mg-ADP binding (corresponding to secondary structure changes less than 1%), suggesting that movement of protein domains due to Mg-nucleotide binding do not promote large secondary structure changes.

Cloning of Novel Isoforms of the Human Gli2 Oncogene and Their Activities To Enhance Tax-Dependent Transcription of the Human T-Cell Leukemia Virus Type 1 Genome

PubMed Central

Tanimura, Akira; Dan, Shingo; Yoshida, Mitsuaki

1998-01-01

The expression of human T-cell leukemia virus type 1 (HTLV-1) is activated by interaction of a viral transactivator protein, Tax, and cellular transcription factor, CREB (cyclic AMP response element binding protein), which bind to a 21-bp enhancer in the long terminal repeats (LTR). THP (Tax-helping protein) was previously determined to enhance the transactivation by Tax protein. Here we report novel forms of the human homolog of a member of the Gli oncogene family, Gli2 (also termed Gli2/THP), an extended form of a zinc finger protein, THP, which was described previously. Four possible isoforms (hGli2 α, β, γ, and δ) are formed by combinations of two independent alternative splicings, and all the isoforms could bind to a DNA motif, TRE2S, in the LTR. The longer isoforms, α and β, were abundantly expressed in various cell lines including HTLV-1-infected T-cell lines. Fusion proteins of the hGli2 isoforms with the DNA-binding domain of Gal4 activated transcription when the reporter contained a Gal4-binding site and one copy of the 21-bp sequence, to which CREB binds. This activation was observed only in the presence of Tax. The 21-bp sequence in the reporter was also essential for the activation. These results suggest that simultaneous binding of hGli2 and CREB to the respective sites in the reporter seems to be critical for Tax protein to activate transcription. Consequently, it is probable that the LTR can be regulated by two independent signals through hGli2 and CREB, since the LTR contains the 21-bp and TRE2S sequences in the vicinity. PMID:9557682

Pharmacologically relevant receptor binding characteristics and 5alpha-reductase inhibitory activity of free Fatty acids contained in saw palmetto extract.

PubMed

Abe, Masayuki; Ito, Yoshihiko; Oyunzul, Luvsandorj; Oki-Fujino, Tomomi; Yamada, Shizuo

2009-04-01

Saw palmetto extract (SPE), used widely for the treatment of benign prostatic hyperplasia (BPH) has been shown to bind alpha(1)-adrenergic, muscarinic and 1,4-dihydropyridine (1,4-DHP) calcium channel antagonist receptors. Major constituents of SPE are lauric acid, oleic acid, myristic acid, palmitic acid and linoleic acid. The aim of this study was to investigate binding affinities of these fatty acids for pharmacologically relevant (alpha(1)-adrenergic, muscarinic and 1,4-DHP) receptors. The fatty acids inhibited specific [(3)H]prazosin binding in rat brain in a concentration-dependent manner with IC(50) values of 23.8 to 136 microg/ml, and specific (+)-[(3)H]PN 200-110 binding with IC(50) values of 24.5 to 79.5 microg/ml. Also, lauric acid, oleic acid, myristic acid and linoleic acid inhibited specific [(3)H]N-methylscopolamine ([(3)H]NMS) binding in rat brain with IC(50) values of 56.4 to 169 microg/ml. Palmitic acid had no effect on specific [(3)H]NMS binding. The affinity of oleic acid, myristic acid and linoleic acid for each receptor was greater than the affinity of SPE. Scatchard analysis revealed that oleic acid and lauric acid caused a significant decrease in the maximal number of binding sites (B(max)) for [(3)H]prazosin, [(3)H]NMS and (+)-[(3)H]PN 200-110. The results suggest that lauric acid and oleic acid bind noncompetitively to alpha(1)-adrenergic, muscarinic and 1,4-DHP calcium channel antagonist receptors. We developed a novel and convenient method of determining 5alpha-reductase activity using LC/MS. With this method, SPE was shown to inhibit 5alpha-reductase activity in rat liver with an IC(50) of 101 microg/ml. Similarly, all the fatty acids except palmitic acid inhibited 5alpha-reductase activity, with IC(50) values of 42.1 to 67.6 microg/ml. In conclusion, lauric acid, oleic acid, myristic acid, and linoleic acid, major constituents of SPE, exerted binding activities of alpha(1)-adrenergic, muscarinic and 1,4-DHP receptors and inhibited 5alpha-reductase activity.

Multivalent Display of Antifreeze Proteins by Fusion to Self-Assembling Protein Cages Enhances Ice-Binding Activities.

PubMed

Phippen, Sean W; Stevens, Corey A; Vance, Tyler D R; King, Neil P; Baker, David; Davies, Peter L

2016-12-13

Antifreeze proteins (AFPs) are small monomeric proteins that adsorb to the surface of ice to inhibit ice crystal growth and impart freeze resistance to the organisms producing them. Previously, monomeric AFPs have been conjugated to the termini of branched polymers to increase their activity through the simultaneous binding of more than one AFP to ice. Here, we describe a superior approach to increasing AFP activity through oligomerization that eliminates the need for conjugation reactions with varying levels of efficiency. A moderately active AFP from a fish and a hyperactive AFP from an Antarctic bacterium were genetically fused to the C-termini of one component of the 24-subunit protein cage T33-21, resulting in protein nanoparticles that multivalently display exactly 12 AFPs. The resulting nanoparticles exhibited freezing point depression >50-fold greater than that seen with the same concentration of monomeric AFP and a similar increase in the level of ice-recrystallization inhibition. These results support the anchored clathrate mechanism of binding of AFP to ice. The enhanced freezing point depression could be due to the difficulty of overgrowing a larger AFP on the ice surface and the improved ice-recrystallization inhibition to the ability of the nanoparticle to simultaneously bind multiple ice grains. Oligomerization of these proteins using self-assembling protein cages will be useful in a variety of biotechnology and cryobiology applications.

Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

PubMed Central

Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.

2014-01-01

The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

Electrostatic steering and ionic tethering in enzyme-ligand binding: insights from simulations.

PubMed

Wade, R C; Gabdoulline, R R; Lüdemann, S K; Lounnas, V

1998-05-26

To bind at an enzyme's active site, a ligand must diffuse or be transported to the enzyme's surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and beta-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as "ionic tethering." We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme's surroundings even when the substrate is nonpolar.

Targeting chromatin binding regulation of constitutively active AR variants to overcome prostate cancer resistance to endocrine-based therapies

PubMed Central

Chan, Siu Chiu; Selth, Luke A.; Li, Yingming; Nyquist, Michael D.; Miao, Lu; Bradner, James E.; Raj, Ganesh V.; Tilley, Wayne D.; Dehm, Scott M.

2015-01-01

Androgen receptor (AR) variants (AR-Vs) expressed in prostate cancer (PCa) lack the AR ligand binding domain (LBD) and function as constitutively active transcription factors. AR-V expression in patient tissues or circulating tumor cells is associated with resistance to AR-targeting endocrine therapies and poor outcomes. Here, we investigated the mechanisms governing chromatin binding of AR-Vs with the goal of identifying therapeutic vulnerabilities. By chromatin immunoprecipitation and sequencing (ChIP-seq) and complementary biochemical experiments, we show that AR-Vs display a binding preference for the same canonical high-affinity androgen response elements (AREs) that are preferentially engaged by AR, albeit with lower affinity. Dimerization was an absolute requirement for constitutive AR-V DNA binding and transcriptional activation. Treatment with the bromodomain and extraterminal (BET) inhibitor JQ1 resulted in inhibition of AR-V chromatin binding and impaired AR-V driven PCa cell growth in vitro and in vivo. Importantly, this was associated with a novel JQ1 action of down-regulating AR-V transcript and protein expression. Overall, this study demonstrates that AR-Vs broadly restore AR chromatin binding events that are otherwise suppressed during endocrine therapy, and provides pre-clinical rationale for BET inhibition as a strategy for inhibiting expression and chromatin binding of AR-Vs in PCa. PMID:25908785

Arginine methylation promotes translation repression activity of eIF4G-binding protein, Scd6.

PubMed

Poornima, Gopalakrishna; Shah, Shanaya; Vignesh, Venkadasubramanian; Parker, Roy; Rajyaguru, Purusharth I

2016-11-02

Regulation of translation plays a critical role in determining mRNA fate. A new role was recently reported for a subset of RGG-motif proteins in repressing translation initiation by binding eIF4G1. However the signaling mechanism(s) that leads to spatial and temporal regulation of repression activity of RGG-motif proteins remains unknown. Here we report the role of arginine methylation in regulation of repression activity of Scd6, a conserved RGG-motif protein. We demonstrate that Scd6 gets arginine methylated at its RGG-motif and Hmt1 plays an important role in its methylation. We identify specific methylated arginine residues in the Scd6 RGG-motif in vivo We provide evidence that methylation augments Scd6 repression activity. Arginine methylation defective (AMD) mutant of Scd6 rescues the growth defect caused by overexpression of Scd6, a feature of translation repressors in general. Live-cell imaging of the AMD mutant revealed that it is defective in inducing formation of stress granules. Live-cell imaging and pull-down results indicate that it fails to bind eIF4G1 efficiently. Consistent with these results, a strain lacking Hmt1 is also defective in Scd6-eIF4G1 interaction. Our results establish that arginine methylation augments Scd6 repression activity by promoting eIF4G1-binding. We propose that arginine methylation of translation repressors with RGG-motif could be a general modulator of their repression activity. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

In vitro and in vivo evidence for actin association of the naphthylphthalamic acid-binding protein from zucchini hypocotyls

NASA Technical Reports Server (NTRS)

Butler, J. H.; Hu, S.; Brady, S. R.; Dixon, M. W.; Muday, G. K.

1998-01-01

The N-1-naphthylphthalamic acid (NPA)-binding protein is part of the auxin efflux carrier, the protein complex that controls polar auxin transport in plant tissues. This study tested the hypothesis that the NPA-binding protein (NBP) is associated with the actin cytoskeleton in vitro and that an intact actin cytoskeleton is required for polar auxin transport in vivo. Cytoskeletal polymerization was altered in extracts of zucchini hypocotyls with reagents that stabilized either the polymeric or monomeric forms of actin or tubulin. Phalloidin treatment altered actin polymerization, as demonstrated by immunoblot analyses following native and denaturing electrophoresis. Phalloidin increased both filamentous actin (F-actin) and NPA-binding activity, while cytochalasin D and Tris decreased both F-actin and NPA-binding activity in cytoskeletal pellets. The microtubule stabilizing drug taxol increased pelletable tubulin, but did not alter either the amount of pelletable actin or NPA-binding activity. Treatment of etiolated zucchini hypocotyls with cytochalasin D decreased the amount of auxin transport and its regulation by NPA. These experimental results are consistent with an in vitro actin cytoskeletal association of the NPA-binding protein and with the requirement of an intact actin cytoskeleton for maximal polar auxin transport in vivo.

Effect of binding in cyclic phosphorylation-dephosphorylation process and in energy transformation.

PubMed

Sarkar, A; Beard, D A; Franza, B R

2006-07-01

The effects of binding on the phosphorylation-dephosphorylation cycle (PDPC) - one of the key components of the signal transduction processes - is analyzed based on a mathematical model. The model shows that binding of proteins, forming a complex, diminishes the ultrasensitivity of the PDPC to the differences in activity between kinase and phosphatase in the cycle. It is also found that signal amplification depends upon the strength of the binding affinity of the protein (phosphorylated or dephosphorylated) to other proteins . It is also observed that the amplification of signal is not only dependent on phosphorylation potential but also on binding properties and resulting adjustments in binding energies.

Mitogen activated protein kinase (MAPK) pathway regulates heme oxygenase-1 gene expression by hypoxia in vascular cells.

PubMed

Ryter, Stefan W; Xi, Sichuan; Hartsfield, Cynthia L; Choi, Augustine M K

2002-08-01

Hypoxia induces the stress protein heme oxygenase-1 (HO-1), which participates in cellular adaptation. The molecular pathways that regulate ho-1 gene expression under hypoxia may involve mitogen activated protein kinase (MAPK) signaling and reactive oxygen. Hypoxia (8 h) increased HO-1 mRNA in rat pulmonary aortic endothelial cells (PAEC), and also activated both extracellular signal-regulated kinase 1 (ERK1)/ERK2 and p38 MAPK pathways. The role of these kinases in hypoxia-induced ho-1 gene expression was examined using chemical inhibitors of these pathways. Surprisingly, SB203580, an inhibitor of p38 MAPK, and PD98059, an inhibitor of mitogen-activated protein kinase kinase (MEK1), strongly enhanced hypoxia-induced HO-1 mRNA expression in PAEC. UO126, a MEK1/2 inhibitor, enhanced HO-1 expression in PAEC under normoxia, but not hypoxia. Diphenylene iodonium, an inhibitor of NADPH oxidase, also induced the expression of HO-1 in PAEC under both normoxia and hypoxia. Similar results were observed in aortic vascular smooth muscle cells. Furthermore, hypoxia induced activator protein (AP-1) DNA-binding activity in PAEC. Pretreatment with SB203580 and PD98059 enhanced AP-1 binding activity under hypoxia in PAEC; UO126 stimulated AP-1 binding under normoxia, whereas diphenylene iodonium stimulated AP-1 binding under normoxia and hypoxia. These results suggest a relationship between MAPK and hypoxic regulation of ho-1 in vascular cells, involving AP-1.

TRIM25 Is Required for the Antiviral Activity of Zinc Finger Antiviral Protein

PubMed Central

Zheng, Xiaojiao; Wang, Xinlu; Tu, Fan; Wang, Qin; Fan, Zusen

2017-01-01

ABSTRACT Zinc finger antiviral protein (ZAP) is a host factor that specifically inhibits the replication of certain viruses by binding to viral mRNAs and repressing the translation and/or promoting the degradation of target mRNA. In addition, ZAP regulates the expression of certain cellular genes. Here, we report that tripartite motif-containing protein 25 (TRIM25), a ubiquitin E3 ligase, is required for the antiviral activity of ZAP. Downregulation of endogenous TRIM25 abolished ZAP's antiviral activity. The E3 ligase activity of TRIM25 is required for this regulation. TRIM25 mediated ZAP ubiquitination, but the ubiquitination of ZAP itself did not seem to be required for its antiviral activity. Downregulation of endogenous ubiquitin or overexpression of the deubiquitinase OTUB1 impaired ZAP's activity. We provide evidence indicating that TRIM25 modulates the target RNA binding activity of ZAP. These results uncover a mechanism by which the antiviral activity of ZAP is regulated. IMPORTANCE ZAP is a host antiviral factor that specifically inhibits the replication of certain viruses, including HIV-1, Sindbis virus, and Ebola virus. ZAP binds directly to target mRNA, and it represses the translation and promotes the degradation of target mRNA. While the mechanisms by which ZAP posttranscriptionally inhibits target RNA expression have been extensively studied, how its antiviral activity is regulated is not very clear. Here, we report that TRIM25, a ubiquitin E3 ligase, is required for the antiviral activity of ZAP. Downregulation of endogenous TRIM25 remarkably abolished ZAP's activity. TRIM25 is required for ZAP optimal binding to target mRNA. These results help us to better understand how the antiviral activity of ZAP is regulated. PMID:28202764

TRIM25 Is Required for the Antiviral Activity of Zinc Finger Antiviral Protein.

PubMed

Zheng, Xiaojiao; Wang, Xinlu; Tu, Fan; Wang, Qin; Fan, Zusen; Gao, Guangxia

2017-05-01

Zinc finger antiviral protein (ZAP) is a host factor that specifically inhibits the replication of certain viruses by binding to viral mRNAs and repressing the translation and/or promoting the degradation of target mRNA. In addition, ZAP regulates the expression of certain cellular genes. Here, we report that tripartite motif-containing protein 25 (TRIM25), a ubiquitin E3 ligase, is required for the antiviral activity of ZAP. Downregulation of endogenous TRIM25 abolished ZAP's antiviral activity. The E3 ligase activity of TRIM25 is required for this regulation. TRIM25 mediated ZAP ubiquitination, but the ubiquitination of ZAP itself did not seem to be required for its antiviral activity. Downregulation of endogenous ubiquitin or overexpression of the deubiquitinase OTUB1 impaired ZAP's activity. We provide evidence indicating that TRIM25 modulates the target RNA binding activity of ZAP. These results uncover a mechanism by which the antiviral activity of ZAP is regulated. IMPORTANCE ZAP is a host antiviral factor that specifically inhibits the replication of certain viruses, including HIV-1, Sindbis virus, and Ebola virus. ZAP binds directly to target mRNA, and it represses the translation and promotes the degradation of target mRNA. While the mechanisms by which ZAP posttranscriptionally inhibits target RNA expression have been extensively studied, how its antiviral activity is regulated is not very clear. Here, we report that TRIM25, a ubiquitin E3 ligase, is required for the antiviral activity of ZAP. Downregulation of endogenous TRIM25 remarkably abolished ZAP's activity. TRIM25 is required for ZAP optimal binding to target mRNA. These results help us to better understand how the antiviral activity of ZAP is regulated. Copyright © 2017 American Society for Microbiology.

Functional interaction of the DNA-binding transcription factor Sp1 through its DNA-binding domain with the histone chaperone TAF-I.

PubMed

Suzuki, Toru; Muto, Shinsuke; Miyamoto, Saku; Aizawa, Kenichi; Horikoshi, Masami; Nagai, Ryozo

2003-08-01

Transcription involves molecular interactions between general and regulatory transcription factors with further regulation by protein-protein interactions (e.g. transcriptional cofactors). Here we describe functional interaction between DNA-binding transcription factor and histone chaperone. Affinity purification of factors interacting with the DNA-binding domain of the transcription factor Sp1 showed Sp1 to interact with the histone chaperone TAF-I, both alpha and beta isoforms. This interaction was specific as Sp1 did not interact with another histone chaperone CIA nor did other tested DNA-binding regulatory factors (MyoD, NFkappaB, p53) interact with TAF-I. Interaction of Sp1 and TAF-I occurs both in vitro and in vivo. Interaction with TAF-I results in inhibition of DNA-binding, and also likely as a result of such, inhibition of promoter activation by Sp1. Collectively, we describe interaction between DNA-binding transcription factor and histone chaperone which results in negative regulation of the former. This novel regulatory interaction advances our understanding of the mechanisms of eukaryotic transcription through DNA-binding regulatory transcription factors by protein-protein interactions, and also shows the DNA-binding domain to mediate important regulatory interactions.

Identification of natural and artificial DNA substrates for the light-activated LOV-HTH transcription factor EL222

PubMed Central

Rivera-Cancel, Giomar; Motta-Mena, Laura B.; Gardner, Kevin H.

2012-01-01

Light-oxygen-voltage (LOV) domains serve as the photosensory modules for a wide range of plant and bacterial proteins, conferring blue light dependent regulation to effector activities as diverse as enzymes and DNA binding. LOV domains can also be engineered into a variety of exogenous targets, enabling similar regulation for new protein-based reagents. Common to these proteins is the ability for LOV domains to reversibly form a photochemical adduct between an internal flavin chromophore and the surrounding protein, using this to trigger conformational changes that affect output activity. Using the Erythrobacter litoralis protein EL222 model system which links LOV regulation to a helix-turn-helix (HTH) DNA binding domain, we demonstrated that the LOV domain binds and inhibits the HTH domain in the dark, releasing these interactions upon illumination [Nash et al. (2011) Proc. Natl. Acad. Sci. USA 108, 9449–9454]. Here we combine genomic and in vitro selection approaches to identify optimal DNA binding sites for EL222. Within the bacterial host, we observe binding several genomic sites using a 12 bp sequence consensus that is also found by in vitro selection methods. Sequence-specific alterations in the DNA consensus reduce EL222-binding affinity in a manner consistent with the expected binding mode: a protein dimer binding to two repeats. Finally, we demonstrate the light-dependent activation of transcription of two genes adjacent to an EL222 binding site. Taken together, these results shed light on the native function of EL222 and provide useful reagents for further basic and applications research of this versatile protein. PMID:23205774

Functional Regulation of Sugar Assimilation by N-Glycan-specific Interaction of Pancreatic α-Amylase with Glycoproteins of Duodenal Brush Border Membrane*

PubMed Central

Asanuma-Date, Kimie; Hirano, Yuki; Le, Na; Sano, Kotone; Kawasaki, Nana; Hashii, Noritaka; Hiruta, Yoko; Nakayama, Ken-ichi; Umemura, Mariko; Ishikawa, Kazuhiko; Sakagami, Hiromi; Ogawa, Haruko

2012-01-01

Porcine pancreatic α-amylase (PPA) binds to N-linked glycans of glycoproteins (Matsushita, H., Takenaka, M., and Ogawa, H. (2002) J. Biol Chem., 277, 4680–4686). Immunostaining revealed that PPA is located at the brush-border membrane (BBM) of enterocytes in the duodenum and that the binding is inhibited by mannan but not galactan, indicating that PPA binds carbohydrate-specifically to BBM. The ligands for PPA in BBM were identified as glycoprotein N-glycans that are significantly involved in the assimilation of glucose, including sucrase-isomaltase (SI) and Na+/Glc cotransporter 1 (SGLT1). Binding of SI and SGLT1 in BBM to PPA was dose-dependent and inhibited by mannan. Using BBM vesicles, we found functional changes in PPA and its ligands in BBM due to the N-glycan-specific interaction. The starch-degrading activity of PPA and maltose-degrading activity of SI were enhanced to 240 and 175%, respectively, while Glc uptake by SGLT1 was markedly inhibited by PPA at high but physiologically possible concentrations, and the binding was attenuated by the addition of mannose-specific lectins, especially from Galanthus nivalis. Additionally, recombinant human pancreatic α-amylases expressed in yeast and purified by single-step affinity chromatography exhibited the same carbohydrate binding specificity as PPA in binding assays with sugar-biotinyl polymer probes. The results indicate that mammalian pancreatic α-amylases share a common carbohydrate binding activity and specifically bind to the intestinal BBM. Interaction with N-glycans in the BBM activated PPA and SI to produce much Glc on the one hand and to inhibit Glc absorption by enterocytes via SGLT1 in order to prevent a rapid increase in blood sugar on the other. PMID:22584580

Novel thrombopoietin mimetic peptides bind c-Mpl receptor: Synthesis, biological evaluation and molecular modeling.

PubMed

Liu, Yaquan; Tian, Fang; Zhi, Dejuan; Wang, Haiqing; Zhao, Chunyan; Li, Hongyu

2017-02-01

Thrombopoietin (TPO) acts in promoting the proliferation of hematopoietic stem cells and by initiating specific maturation events in megakaryocytes. Now, TPO-mimetic peptides with amino acid sequences unrelated to TPO are of considerable pharmaceutical interest. In the present paper, four new TPO mimetic peptides that bind and activate c-Mpl receptor have been identified, synthesized and tested by Dual-Luciferase reporter gene assay for biological activities. The molecular modeling research was also approached to understand key molecular mechanisms and structural features responsible for peptide binding with c-Mpl receptor. The results presented that three of four mimetic peptides showed significant activities. In addition, the molecular modeling approaches proved hydrophobic interactions were the driven positive forces for binding behavior between peptides and c-Mpl receptor. TPO peptide residues in P7, P13 and P7' positions were identified by the analysis of hydrogen bonds and energy decompositions as the key ones for benefiting better biological activities. Our data suggested the synthesized peptides have considerable potential for the future development of stable and highly active TPO mimetic peptides. Copyright © 2016 Elsevier Ltd. All rights reserved.

Biochemical activity of a fluorescent dye rhodamine 6G: Molecular modeling, electrochemical, spectroscopic and thermodynamic studies.

PubMed

Al Masum, Abdulla; Chakraborty, Maharudra; Ghosh, Soumen; Laha, Dipranjan; Karmakar, Parimal; Islam, Md Maidul; Mukhopadhyay, Subrata

2016-11-01

Interaction of CT DNA with Rhodamine 6G (R6G) has been studied using molecular docking, electrochemical, spectroscopic and thermodynamic methods. From the study, it was illustrated that Rhodamine 6G binds to the minor groove of CT DNA. The binding was cooperative in nature. Circular voltametric study showed significant change in peak current and peak potential due to complexation. All the studies showed that the binding constant was in the order of 10 6 M -1 . Circular dichroic spectra showed significant conformational change on binding and DNA unwind during binding. Thermodynamic study showed that binding was favored by negative enthalpy and positive entropy change. From thermodynamic study it was also observed that several positive and negative free energies played significant role during binding and the unfavorable conformational free energy change was overcame by highly negative hydrophobic and salt dependent free energy changes. The experimental results were further validated using molecular docking study and the effect of structure on binding has been studied theoretically. From docking study it was found that the hydrophobic interaction and hydrogen bonds played a significant role during binding. The dye was absorbed by cell and this phenomenon was studied using fluorescent microscope. Cell survivability test showed that the dye active against Human Breast Cancer cells MDA-MB 468. ROS study showed that the activity is due to the production of reactive oxygen. Copyright © 2016 Elsevier B.V. All rights reserved.

Expression of E-selectin ligand-1 (CFR/ESL-1) on hepatic stellate cells: implications for leukocyte extravasation and liver metastasis.

PubMed

Antoine, Marianne; Tag, Carmen G; Gressner, Axel M; Hellerbrand, Claus; Kiefer, Paul

2009-02-01

Leukocytes and tumor cells use E-selectin binding ligands to attach to activated endothelial cells expressing E-selectin during inflammation or metastasis. The cysteine-rich fibroblast growth factor receptor (CFR) represents the main E-selectin ligand (ESL-1) on granulocytes and its expression is exclusively modified by alpha(1,3)-fucosyltransferases IV or VII (FucT4 and FucT7). Hepatic stellate cells (HSC) are pericytes of liver sinusoidal endothelial cells. The activation of HSC and transdifferentiation into a myofibroblastic phenotype is involved in the repair of liver tissue injury, liver regeneration and angiogenesis of liver metastases. In the present study, we demonstrated that HSC expressed CFR together with FucT7 and exhibited a functional E-selectin binding activity on their cell surface. Since HSC appear to be oxygen-sensing cells, the expression of E-selectin binding activity was analyzed in HSC under a hypoxic atmosphere. While the expression of the glycoprotein CFR was unaffected by hypoxia, the cell-associated E-selectin binding activity decreased. However, under the same conditions, mRNA expression of the modifying enzyme FucT7 increased. The loss of E-selectin binding activity, therefore, appears to be neither the result of a reduced expression of the modifying transferase nor the expression of the backbone glycoprotein. After the transient transfection of HSC with CFR cDNA, the E-selectin binding activity (ESL-1) was efficiently released into the supernatant. Therefore, we hypothesize that under hypoxia, ESL-1 is shed from activated HSC. Our findings provide a novel perspective on the function of HSC in liver metastasis and inflammatory liver diseases.

Inhibition of estrogen-responsive gene activation by the retinoid X receptor beta: evidence for multiple inhibitory pathways.

PubMed

Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K

1993-04-01

The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene driven by the vitellogenin A2 ERE were transfected into estrogen-treated MCF-7 cells. RXR beta inhibited ERE-driven reporter activity in a dose-dependent and element-specific fashion. This inhibition occurred in the absence of the RXR ligand 9-cis retinoic acid. The RXR beta-induced inhibition was specific for estrogen receptor (ER)-mediated ERE activation because inhibition was observed in ER-negative MDA-MB-231 cells only following transfection of the estrogen-activated ER. No inhibition of the basal reporter activity was observed. The inhibition was not caused by simple competition of RXR beta with the ER for ERE binding, since deletion mutants retaining DNA binding activity but lacking the N-terminal or C-terminal domain failed to inhibit reporter activity. In addition, cross-linking studies indicated the presence of an auxiliary nuclear factor present in MCF-7 cells that contributed to RXR beta binding of the ERE. Studies using known heterodimerization partners of RXR beta confirmed that RXR beta/triiodothyronine receptor alpha heterodimers avidly bind the ERE but revealed the existence of another triiodothyronine-independent pathway of ERE inhibition. These results indicate that estrogen-responsive genes may be negatively regulated by RXR beta through two distinct pathways.

Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

PubMed

Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

1997-03-14

Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

von Willebrand factor (VWF) propeptide binding to VWF D'D3 domain attenuates platelet activation and adhesion.

PubMed

Madabhushi, Sri R; Shang, Chengwei; Dayananda, Kannayakanahalli M; Rittenhouse-Olson, Kate; Murphy, Mary; Ryan, Thomas E; Montgomery, Robert R; Neelamegham, Sriram

2012-05-17

Noncovalent association between the von Willebrand factor (VWF) propeptide (VWFpp) and mature VWF aids N-terminal multimerization and protein compartmentalization in storage granules. This association is currently thought to dissipate after secretion into blood. In the present study, we examined this proposition by quantifying the affinity and kinetics of VWFpp binding to mature VWF using surface plasmon resonance and by developing novel anti-VWF D'D3 mAbs. Our results show that the only binding site for VWFpp in mature VWF is in its D'D3 domain. At pH 6.2 and 10mM Ca(2+), conditions mimicking intracellular compartments, VWFpp-VWF binding occurs with high affinity (K(D) = 0.2nM, k(off) = 8 × 10(-5) s(-1)). Significant, albeit weaker, binding (K(D) = 25nM, k(off) = 4 × 10(-3) s(-1)) occurs under physiologic conditions of pH 7.4 and 2.5mM Ca(2+). This interaction was also observed in human plasma (K(D) = 50nM). The addition of recombinant VWFpp in both flow-chamber-based platelet adhesion assays and viscometer-based shear-induced platelet aggregation and activation studies reduced platelet adhesion and activation partially. Anti-D'D3 mAb DD3.1, which blocks VWFpp binding to VWF-D'D3, also abrogated platelet adhesion, as shown by shear-induced platelet aggregation and activation studies. Our data demonstrate that VWFpp binding to mature VWF occurs in the circulation, which can regulate the hemostatic potential of VWF by reducing VWF binding to platelet GpIbα.

Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

PubMed

Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

2011-01-01

CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

Isolation and characterisation of sericin antifreeze peptides and molecular dynamics modelling of their ice-binding interaction.

PubMed

Wu, Jinhong; Rong, Yuzhi; Wang, Zhengwu; Zhou, Yanfu; Wang, Shaoyun; Zhao, Bo

2015-05-01

This study aimed to isolate and characterise a novel sericin antifreeze peptide and investigate its ice-binding molecular mechanism. The thermal hysteresis activity of ice-binding sericin peptides (I-SP) was measured and their activity reached as high as 0.94 °C. A P4 fraction, with high hypothermia protective activity and inhibition activity of ice recrystallisation, was obtained from I-SP, and a purified sericin peptide, named SM-AFP, with the sequence of TTSPTNVSTT and a molecular weight of 1009.50 Da was then isolated from the P4 fraction. Treatment of Lactobacillus delbrueckii Subsp. bulgaricus LB340 LYO with 100 μg/ml synthetic SM-AFP led to 1.4-fold increased survival (p < 0.05). Finally, an SM-AFP/ice binding model was constructed and results of molecular dynamics simulation suggested that the binding of SM-AFP with ice and prevention of ice crystal growth could be attributed to hydrogen bond formation, hydrophobic interaction and non-bond interactions. Sericin peptides could be developed into beneficial cryoprotectants and used in frozen food processing. Copyright © 2014 Elsevier Ltd. All rights reserved.

Identification of functional domains of the IR2 protein of equine herpesvirus 1 required for inhibition of viral gene expression and replication

PubMed Central

Kim, Seong K.; Kim, Seongman; Dai, Gan; Zhang, Yunfei; Ahn, Byung C.; O'Callaghan, Dennis J.

2012-01-01

The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1,487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP0, IR4, and UL5, and late ETIF genes were dramatically inhibited. Viral DNA levels were reduced to 2.1% of control infected cells, but were vey weakly affected in cells that express the N-terminal 706 residues of IR2P. These results suggest that IR2P function requires the two N-terminal domains for binding DNA and TFIIB as well as the C-terminal residues 707 to 1116 containing the TBP-binding domain. PMID:21794889

The 2-Cys Peroxiredoxin Alkyl Hydroperoxide Reductase C Binds Heme and Participates in Its Intracellular Availability in Streptococcus agalactiae*

PubMed Central

Lechardeur, Delphine; Fernandez, Annabelle; Robert, Bruno; Gaudu, Philippe; Trieu-Cuot, Patrick; Lamberet, Gilles; Gruss, Alexandra

2010-01-01

Heme is a redox-reactive molecule with vital and complex roles in bacterial metabolism, survival, and virulence. However, few intracellular heme partners were identified to date and are not well conserved in bacteria. The opportunistic pathogen Streptococcus agalactiae (group B Streptococcus) is a heme auxotroph, which acquires exogenous heme to activate an aerobic respiratory chain. We identified the alkyl hydroperoxide reductase AhpC, a member of the highly conserved thiol-dependent 2-Cys peroxiredoxins, as a heme-binding protein. AhpC binds hemin with a Kd of 0.5 μm and a 1:1 stoichiometry. Mutagenesis of cysteines revealed that hemin binding is dissociable from catalytic activity and multimerization. AhpC reductase activity was unchanged upon interaction with heme in vitro and in vivo. A group B Streptococcus ahpC mutant displayed attenuation of two heme-dependent functions, respiration and activity of a heterologous catalase, suggesting a role for AhpC in heme intracellular fate. In support of this hypothesis, AhpC-bound hemin was protected from chemical degradation in vitro. Our results reveal for the first time a role for AhpC as a heme-binding protein. PMID:20332091

Induction of cyclooxygenase-2 by ginsenoside Rd via activation of CCAAT-enhancer binding proteins and cyclic AMP response binding protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jeong, Hye Gwang; Pokharel, Yuba Raj; Han, Eun Hee

2007-07-20

Panax ginseng is a widely used herbal medicine in East Asia and is reported to have a variety of pharmacological effects against cardiovascular diseases and cancers. Here we show a unique effect of ginsenoside Rd (Rd) on cyclooxygenase-2 (COX-2) expression in RAW264.7 macrophages. Rd (100 {mu}g/ml), but not other ginsenosides induced COX-2 and increased prostaglandin E{sub 2} production. Gel shift and Western blot analyses using nuclear fractions revealed that Rd increased both the DNA binding of and the nuclear levels of CCAAT/enhancer binding protein (C/EBP){alpha}/{beta} and cyclic AMP response element binding protein (CREB), but not of p65, in RAW264.7 cells.more » Moreover, Rd increased the luciferase reporter gene activity in cells transfected with a 574-bp mouse COX-2 promoter construct. Site-specific mutation analyses confirmed that Rd-mediated transcriptional activation of COX-2 gene was regulated by C/EBP and CREB. These results provide evidence that Rd activated C/EBP and CREB, and that the activation of C/EBP and CREB appears to be essential for induction of COX-2 in RAW264.7 cells.« less

Neurotensin is an antagonist of the human neurotensin NT2 receptor expressed in Chinese hamster ovary cells.

PubMed

Vita, N; Oury-Donat, F; Chalon, P; Guillemot, M; Kaghad, M; Bachy, A; Thurneyssen, O; Garcia, S; Poinot-Chazel, C; Casellas, P; Keane, P; Le Fur, G; Maffrand, J P; Soubrie, P; Caput, D; Ferrara, P

1998-11-06

The human levocabastine-sensitive neurotensin NT2 receptor was cloned from a cortex cDNA library and stably expressed in Chinese hamster ovary (CHO) cells in order to study its binding and signalling characteristics. The receptor binds neurotensin as well as several other ligands already described for neurotensin NT1 receptor. It also binds levocabastine, a histamine H1 receptor antagonist that is not recognised by neurotensin NT1 receptor. Neurotensin binding to recombinant neurotensin NT2 receptor expressed in CHO cells does not elicit a biological response as determined by second messenger measurements. Levocabastine, and the peptides neuromedin N and xenin were also ineffective on neurotensin NT2 receptor activation. Experiments with the neurotensin NT1 receptor antagonists SR48692 and SR142948A, resulted in the unanticipated discovery that both molecules are potent agonists on neurotensin NT2 receptor. Both compounds, following binding to neurotensin NT2 receptor, enhance inositol phosphates (IP) formation with a subsequent [Ca2+]i mobilisation; induce arachidonic acid release; and stimulate mitogen-activated protein kinase (MAPK) activity. Interestingly, these activities are antagonised by neurotensin and levocabastine in a concentration-dependent manner. These activities suggest that the human neurotensin NT2 receptor may be of physiological importance and that a natural agonist for the receptor may exist.

The E7 oncoprotein associates with Mi2 and histone deacetylase activity to promote cell growth.

PubMed

Brehm, A; Nielsen, S J; Miska, E A; McCance, D J; Reid, J L; Bannister, A J; Kouzarides, T

1999-05-04

E7 is the main transforming protein of human papilloma virus type 16 (HPV16) which is implicated in the formation of cervical cancer. The transforming activity of E7 has been attributed to its interaction with the retinoblastoma (Rb) tumour suppressor. However, Rb binding is not sufficient for transformation by E7. Mutations within a zinc finger domain, which is dispensable for Rb binding, also abolish E7 transformation functions. Here we show that HPV16 E7 associates with histone deacetylase in vitro and in vivo, via its zinc finger domain. Using a genetic screen, we identify Mi2beta, a component of the recently identified NURD histone deacetylase complex, as a protein that binds directly to the E7 zinc finger. A zinc finger point mutant which is unable to bind Mi2beta and histone deacetylase but is still able to bind Rb fails to overcome cell cycle arrest in osteosarcoma cells. Our results suggest that the binding to a histone deacetylase complex is an important parameter for the growthpromoting activity of the human papilloma virus E7 protein. This provides the first indication that viral oncoproteins control cell proliferation by targeting deacetylation pathways.

Transthyretin-binding activity of contaminants in blood from polar bear (Ursus maritimus) cubs.

PubMed

Bytingsvik, Jenny; Simon, Eszter; Leonards, Pim E G; Lamoree, Marja; Lie, Elisabeth; Aars, Jon; Derocher, Andrew E; Wiig, Oystein; Jenssen, Bjørn M; Hamers, Timo

2013-05-07

We determined the transthyretin (TTR)-binding activity of blood-accumulating contaminants in blood plasma samples of approximately 4-months-old polar bear (Ursus maritimus) cubs from Svalbard sampled in 1998 and 2008. The TTR-binding activity was measured as thyroxine (T4)-like equivalents (T4-EQMeas). Our findings show that the TTR-binding activity related to contaminant levels was significantly lower (45%) in 2008 than in 1998 (mean ± standard error of mean: 1998, 2265 ± 231 nM; 2008, 1258 ± 170 nM). Although we cannot exclude a potential influence of between-year differences in capture location and cub body mass, our findings most likely reflect reductions of TTR-binding contaminants or their precursors in the arctic environment (e.g., polychlorinated biphenyls [PCBs]). The measured TTR-binding activity correlated positively with the cubs' plasma levels of hydroxylated PCBs (OH-PCBs). No such association was found between TTR-binding activity and the plasma levels of perfluoroalkyl substances (PFASs). The OH-PCBs explained 60 ± 7% and 54 ± 4% of the TTR-binding activity in 1998 and 2008, respectively, and PFASs explained ≤1.2% both years. Still, almost half the TTR-binding activity could not be explained by the contaminants we examined. The considerable levels of TTR-binding contaminants warrant further effect directed analysis (EDA) to identify the contaminants responsible for the unexplained part of the observed TTR-binding activity.

Complement activation by ligand-driven juxtaposition of discrete pattern recognition complexes

PubMed Central

Degn, Søren E.; Kjaer, Troels R.; Kidmose, Rune T.; Jensen, Lisbeth; Hansen, Annette G.; Tekin, Mustafa; Jensenius, Jens C.; Andersen, Gregers R.; Thiel, Steffen

2014-01-01

Defining mechanisms governing translation of molecular binding events into immune activation is central to understanding immune function. In the lectin pathway of complement, the pattern recognition molecules (PRMs) mannan-binding lectin (MBL) and ficolins complexed with the MBL-associated serine proteases (MASP)-1 and MASP-2 cleave C4 and C2 to generate C3 convertase. MASP-1 was recently found to be the exclusive activator of MASP-2 under physiological conditions, yet the predominant oligomeric forms of MBL carry only a single MASP homodimer. This prompted us to investigate whether activation of MASP-2 by MASP-1 occurs through PRM-driven juxtaposition on ligand surfaces. We demonstrate that intercomplex activation occurs between discrete PRM/MASP complexes. PRM ligand binding does not directly escort the transition of MASP from zymogen to active enzyme in the PRM/MASP complex; rather, clustering of PRM/MASP complexes directly causes activation. Our results support a clustering-based mechanism of activation, fundamentally different from the conformational model suggested for the classical pathway of complement. PMID:25197071

A pharmacophore model specific to active site of CYP1A2 with a novel molecular modeling explorer and CoMFA.

PubMed

Zhang, Tao; Wei, Dong-Qing; Chou, Kuo-Chen

2012-03-01

Comparative molecular field analysis (CoMFA) is a widely used 3D-QSAR method by which we can investigate the potential relation between biological activity of compounds and their structural features. In this study, a new application of this approach is presented by combining the molecular modeling with a new developed pharmacophore model specific to CYP1A2 active site. During constructing the model, we used the molecular dynamics simulation and molecular docking method to select the sensible binding conformations for 17 CYP1A2 substrates based on the experimental data. Subsequently, the results obtained via the alignment of binding conformations of substrates were projected onto the active- site residues, upon which a simple blueprint of active site was produced. It was validated by the experimental and computational results that the model did exhibit the high degree of rationality and provide useful insights into the substrate binding. It is anticipated that our approach can be extended to investigate the protein-ligand interactions for many other enzyme-catalyzed systems as well.

Cyclophilin40 isomerase activity is regulated by a temperature-dependent allosteric interaction with Hsp90.

PubMed

Blackburn, Elizabeth A; Wear, Martin A; Landré, Vivian; Narayan, Vikram; Ning, Jia; Erman, Burak; Ball, Kathryn L; Walkinshaw, Malcolm D

2015-09-01

Cyclophilin 40 (Cyp40) comprises an N-terminal cyclophilin domain with peptidyl-prolyl isomerase (PPIase) activity and a C-terminal tetratricopeptide repeat (TPR) domain that binds to the C-terminal-EEVD sequence common to both heat shock protein 70 (Hsp70) and Hsp90. We show in the present study that binding of peptides containing the MEEVD motif reduces the PPIase activity by ∼30%. CD and fluorescence assays show that the TPR domain is less stable than the cyclophilin domain and is stabilized by peptide binding. Isothermal titration calorimetry (ITC) shows that the affinity for the-MEEVD peptide is temperature sensitive in the physiological temperature range. Results from these biophysical studies fit with the MD simulations of the apo and holo (peptide-bound) structures which show a significant reduction in root mean square (RMS) fluctuation in both TPR and cyclophilin domains when-MEEVD is bound. The MD simulations of the apo-protein also highlight strong anti-correlated motions between residues around the PPIase-active site and a band of residues running across four of the seven helices in the TPR domain. Peptide binding leads to a distortion in the shape of the active site and a significant reduction in these strongly anti-correlated motions, providing an explanation for the allosteric effect of ligand binding and loss of PPIase activity. Together the experimental and MD results suggest that on heat shock, dissociation of Cyp40 from complexes mediated by the TPR domain leads to an increased pool of free Cyp40 capable of acting as an isomerase/chaperone in conditions of cellular stress. © 2015 Authors.

Cyclophilin40 isomerase activity is regulated by a temperature-dependent allosteric interaction with Hsp90

PubMed Central

Blackburn, Elizabeth A.; Wear, Martin A.; Landré, Vivian; Narayan, Vikram; Ning, Jia; Erman, Burak; Ball, Kathryn L.; Walkinshaw, Malcolm D.

2015-01-01

Cyclophilin 40 (Cyp40) comprises an N-terminal cyclophilin domain with peptidyl-prolyl isomerase (PPIase) activity and a C-terminal tetratricopeptide repeat (TPR) domain that binds to the C-terminal–EEVD sequence common to both heat shock protein 70 (Hsp70) and Hsp90. We show in the present study that binding of peptides containing the MEEVD motif reduces the PPIase activity by ∼30%. CD and fluorescence assays show that the TPR domain is less stable than the cyclophilin domain and is stabilized by peptide binding. Isothermal titration calorimetry (ITC) shows that the affinity for the–MEEVD peptide is temperature sensitive in the physiological temperature range. Results from these biophysical studies fit with the MD simulations of the apo and holo (peptide-bound) structures which show a significant reduction in root mean square (RMS) fluctuation in both TPR and cyclophilin domains when–MEEVD is bound. The MD simulations of the apo-protein also highlight strong anti-correlated motions between residues around the PPIase-active site and a band of residues running across four of the seven helices in the TPR domain. Peptide binding leads to a distortion in the shape of the active site and a significant reduction in these strongly anti-correlated motions, providing an explanation for the allosteric effect of ligand binding and loss of PPIase activity. Together the experimental and MD results suggest that on heat shock, dissociation of Cyp40 from complexes mediated by the TPR domain leads to an increased pool of free Cyp40 capable of acting as an isomerase/chaperone in conditions of cellular stress. PMID:26330616

Fragment-based identification of determinants of conformational and spectroscopic change at the ricin active site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carra,J.; McHugh, C.; Mulligan, S.

2007-01-01

We found that amide ligands can bind weakly but specifically to the ricin active site, producing significant shifts in positions of the critical active site residues Arg180 and Tyr80. These results indicate that fragment-based drug discovery methods are capable of identifying minimal bonding determinants of active-site side-chain rearrangements and the mechanistic origins of spectroscopic shifts. Our results suggest that tryptophan fluorescence provides a sensitive probe for the geometric relationship of arginine-tryptophan pairs, which often have significant roles in protein function. Using the unusual characteristics of the RTA system, we measured the still controversial thermodynamic changes of site-specific urea binding tomore » a protein, results that are relevant to understanding the physical mechanisms of protein denaturation.« less

A Network of Hydrophobic Residues Impeding Helix αC Rotation Maintains Latency of Kinase Gcn2, Which Phosphorylates the α Subunit of Translation Initiation Factor 2▿

PubMed Central

Gárriz, Andrés; Qiu, Hongfang; Dey, Madhusudan; Seo, Eun-Joo; Dever, Thomas E.; Hinnebusch, Alan G.

2009-01-01

Kinase Gcn2 is activated by amino acid starvation and downregulates translation initiation by phosphorylating the α subunit of translation initiation factor 2 (eIF2α). The Gcn2 kinase domain (KD) is inert and must be activated by tRNA binding to the adjacent regulatory domain. Previous work indicated that Saccharomyces cerevisiae Gcn2 latency results from inflexibility of the hinge connecting the N and C lobes and a partially obstructed ATP-binding site in the KD. Here, we provide strong evidence that a network of hydrophobic interactions centered on Leu-856 also promotes latency by constraining helix αC rotation in the KD in a manner relieved during amino acid starvation by tRNA binding and autophosphorylation of Thr-882 in the activation loop. Thus, we show that mutationally disrupting the hydrophobic network in various ways constitutively activates eIF2α phosphorylation in vivo and bypasses the requirement for a key tRNA binding motif (m2) and Thr-882 in Gcn2. In particular, replacing Leu-856 with any nonhydrophobic residue activates Gcn2, while substitutions with various hydrophobic residues maintain kinase latency. We further provide strong evidence that parallel, back-to-back dimerization of the KD is a step on the Gcn2 activation pathway promoted by tRNA binding and autophosphorylation. Remarkably, mutations that disrupt the L856 hydrophobic network or enhance hinge flexibility eliminate the need for the conserved salt bridge at the parallel dimer interface, implying that KD dimerization facilitates the reorientation of αC and remodeling of the active site for enhanced ATP binding and catalysis. We propose that hinge remodeling, parallel dimerization, and reorientation of αC are mutually reinforcing conformational transitions stimulated by tRNA binding and secured by the ensuing autophosphorylation of T882 for stable kinase activation. PMID:19114556

A network of hydrophobic residues impeding helix alphaC rotation maintains latency of kinase Gcn2, which phosphorylates the alpha subunit of translation initiation factor 2.

PubMed

Gárriz, Andrés; Qiu, Hongfang; Dey, Madhusudan; Seo, Eun-Joo; Dever, Thomas E; Hinnebusch, Alan G

2009-03-01

Kinase Gcn2 is activated by amino acid starvation and downregulates translation initiation by phosphorylating the alpha subunit of translation initiation factor 2 (eIF2alpha). The Gcn2 kinase domain (KD) is inert and must be activated by tRNA binding to the adjacent regulatory domain. Previous work indicated that Saccharomyces cerevisiae Gcn2 latency results from inflexibility of the hinge connecting the N and C lobes and a partially obstructed ATP-binding site in the KD. Here, we provide strong evidence that a network of hydrophobic interactions centered on Leu-856 also promotes latency by constraining helix alphaC rotation in the KD in a manner relieved during amino acid starvation by tRNA binding and autophosphorylation of Thr-882 in the activation loop. Thus, we show that mutationally disrupting the hydrophobic network in various ways constitutively activates eIF2alpha phosphorylation in vivo and bypasses the requirement for a key tRNA binding motif (m2) and Thr-882 in Gcn2. In particular, replacing Leu-856 with any nonhydrophobic residue activates Gcn2, while substitutions with various hydrophobic residues maintain kinase latency. We further provide strong evidence that parallel, back-to-back dimerization of the KD is a step on the Gcn2 activation pathway promoted by tRNA binding and autophosphorylation. Remarkably, mutations that disrupt the L856 hydrophobic network or enhance hinge flexibility eliminate the need for the conserved salt bridge at the parallel dimer interface, implying that KD dimerization facilitates the reorientation of alphaC and remodeling of the active site for enhanced ATP binding and catalysis. We propose that hinge remodeling, parallel dimerization, and reorientation of alphaC are mutually reinforcing conformational transitions stimulated by tRNA binding and secured by the ensuing autophosphorylation of T882 for stable kinase activation.

Design and Synthesis of Piperazine Sulfonamide Cores Leading to Highly Potent HIV-1 Protease Inhibitors.

PubMed

Bungard, Christopher J; Williams, Peter D; Schulz, Jurgen; Wiscount, Catherine M; Holloway, M Katharine; Loughran, H Marie; Manikowski, Jesse J; Su, Hua-Poo; Bennett, David J; Chang, Lehua; Chu, Xin-Jie; Crespo, Alejandro; Dwyer, Michael P; Keertikar, Kartik; Morriello, Gregori J; Stamford, Andrew W; Waddell, Sherman T; Zhong, Bin; Hu, Bin; Ji, Tao; Diamond, Tracy L; Bahnck-Teets, Carolyn; Carroll, Steven S; Fay, John F; Min, Xu; Morris, William; Ballard, Jeanine E; Miller, Michael D; McCauley, John A

2017-12-14

Using the HIV-1 protease binding mode of MK-8718 and PL-100 as inspiration, a novel aspartate binding bicyclic piperazine sulfonamide core was designed and synthesized. The resulting HIV-1 protease inhibitor containing this core showed an 60-fold increase in enzyme binding affinity and a 10-fold increase in antiviral activity relative to MK-8718 .

Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

PubMed Central

Kamenova, Ivanka; Warfield, Linda

2014-01-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

PubMed

Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

2014-08-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Identification of a Hydrophobic Cleft in the LytTR Domain of AgrA as a Locus for Small Molecule Interactions that Inhibit DNA Binding

PubMed Central

Leonard, Paul G.; Bezar, Ian F.; Sidote, David J.; Stock, Ann M.

2012-01-01

The AgrA transcription factor regulates the quorum-sensing response in Staphylococcus aureus, controlling the production of hemolysins and other virulence factors. AgrA binds to DNA via its C-terminal LytTR domain, a domain not found in humans but common in many pathogenic bacteria, making it a potential target for antimicrobial development. We have determined the crystal structure of the apo AgrA LytTR domain and screened a library of 500 fragment compounds to find inhibitors of AgrA DNA-binding activity. Using NMR, the binding site for five compounds has been mapped to a common locus at the C-terminal end of the LytTR domain, a site known to be important for DNA-binding activity. Three of these compounds inhibit AgrA DNA binding. These results provide the first evidence that LytTR domains can be targeted by small organic compounds. PMID:23181972

Protein unfolding as a switch from self-recognition to high-affinity client binding

PubMed Central

Groitl, Bastian; Horowitz, Scott; Makepeace, Karl A. T.; Petrotchenko, Evgeniy V.; Borchers, Christoph H.; Reichmann, Dana; Bardwell, James C. A.; Jakob, Ursula

2016-01-01

Stress-specific activation of the chaperone Hsp33 requires the unfolding of a central linker region. This activation mechanism suggests an intriguing functional relationship between the chaperone's own partial unfolding and its ability to bind other partially folded client proteins. However, identifying where Hsp33 binds its clients has remained a major gap in our understanding of Hsp33's working mechanism. By using site-specific Fluorine-19 nuclear magnetic resonance experiments guided by in vivo crosslinking studies, we now reveal that the partial unfolding of Hsp33's linker region facilitates client binding to an amphipathic docking surface on Hsp33. Furthermore, our results provide experimental evidence for the direct involvement of conditionally disordered regions in unfolded protein binding. The observed structural similarities between Hsp33's own metastable linker region and client proteins present a possible model for how Hsp33 uses protein unfolding as a switch from self-recognition to high-affinity client binding. PMID:26787517

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Jinghua; Marnell, Lorraine L.; Marjon, Kristopher D.

Pentraxins are a family of ancient innate immune mediators conserved throughout evolution. The classical pentraxins include serum amyloid P component (SAP) and C-reactive protein, which are two of the acute-phase proteins synthesized in response to infection. Both recognize microbial pathogens and activate the classical complement pathway through C1q. More recently, members of the pentraxin family were found to interact with cell-surface Fc{gamma} receptors (Fc{gamma}R) and activate leukocyte-mediated phagocytosis. Here we describe the structural mechanism for pentraxin's binding to Fc{gamma}R and its functional activation of Fc{gamma}R-mediated phagocytosis and cytokine secretion. The complex structure between human SAP and Fc{gamma}RIIa reveals a diagonallymore » bound receptor on each SAP pentamer with both D1 and D2 domains of the receptor contacting the ridge helices from two SAP subunits. The 1:1 stoichiometry between SAP and Fc{gamma}RIIa infers the requirement for multivalent pathogen binding for receptor aggregation. Mutational and binding studies show that pentraxins are diverse in their binding specificity for Fc{gamma}R isoforms but conserved in their recognition structure. The shared binding site for SAP and IgG results in competition for Fc{gamma}R binding and the inhibition of immune-complex-mediated phagocytosis by soluble pentraxins. These results establish antibody-like functions for pentraxins in the Fc{gamma}R pathway, suggest an evolutionary overlap between the innate and adaptive immune systems, and have new therapeutic implications for autoimmune diseases.« less

Examining the critical roles of human CB2 receptor residues Valine 3.32 (113) and Leucine 5.41 (192) in ligand recognition and downstream signaling activities.

PubMed

Alqarni, Mohammed; Myint, Kyaw Zeyar; Tong, Qin; Yang, Peng; Bartlow, Patrick; Wang, Lirong; Feng, Rentian; Xie, Xiang-Qun

2014-09-26

We performed molecular modeling and docking to predict a putative binding pocket and associated ligand-receptor interactions for human cannabinoid receptor 2 (CB2). Our data showed that two hydrophobic residues came in close contact with three structurally distinct CB2 ligands: CP-55,940, SR144528 and XIE95-26. Site-directed mutagenesis experiments and subsequent functional assays implicated the roles of Valine residue at position 3.32 (V113) and Leucine residue at position 5.41 (L192) in the ligand binding function and downstream signaling activities of the CB2 receptor. Four different point mutations were introduced to the wild type CB2 receptor: V113E, V113L, L192S and L192A. Our results showed that mutation of Val113 with a Glutamic acid and Leu192 with a Serine led to the complete loss of CB2 ligand binding as well as downstream signaling activities. Substitution of these residues with those that have similar hydrophobic side chains such as Leucine (V113L) and Alanine (L192A), however, allowed CB2 to retain both its ligand binding and signaling functions. Our modeling results validated by competition binding and site-directed mutagenesis experiments suggest that residues V113 and L192 play important roles in ligand binding and downstream signaling transduction of the CB2 receptor. Copyright © 2014 Elsevier Inc. All rights reserved.

Signal transducer and activator of transcription 5B (STAT5B) modulates adipocyte differentiation via MOF.

PubMed

Gao, Peng; Zhang, Yuchao; Liu, Yuantao; Chen, Jicui; Zong, Chen; Yu, Cong; Cui, Shang; Gao, Weina; Qin, Dandan; Sun, Wenchuan; Li, Xia; Wang, Xiangdong

2015-12-01

The role and mechanism of signal transducer and activator of transcription 5B (STAT5B) in adipogenesis remain unclear. In this study, our data showed that Males absent on the first (MOF) protein expression was increased during 3 T3-L1 preadipocytes differentiation accompanied with STAT5B expression increasing. Over-expression STAT5B enhanced MOF promoter trans-activation in HeLa cells. Mutagenesis assay and ChIP analysis exhibited that STAT5B was able to bind MOF promoter. Knocking-down STAT5B in 3 T3-L1 preadipocytes led to decreased expression of MOF, but resulted in increased expression of peroxisome proliferator-activated receptor γ (PPARγ), CCAAT/enhancer-binding protein α (C/EBPα) and fatty acid-binding protein 4 (Fabp4), which were important factors or enzymes for adipogenesis. We also found that knocking-down MOF in 3 T3-L1 preadipocytes resulted in increased expression of PPARγ, C/EBPα and Fabp4, which was in the same trend as STAT5B knocking-down. Over-expression MOF resulted in reduced promoter trans-activation activity of C/EBPα. These results suggest that STAT5B and MOF work as negative regulators in adipogenesis, and STAT5B modulates preadipocytes differentiation partially by regulating MOF expression. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Rubisco Activity: Effects of Drought Stress

PubMed Central

PARRY, MARTIN A. J.; ANDRALOJC, P. JOHN; KHAN, SHAHNAZ; LEA, PETER J.; KEYS, ALFRED J.

2002-01-01

Ribulose‐1,5‐bisphosphate carboxylase/oxygenase (Rubisco) activity is modulated in vivo either by reaction with CO2 and Mg2+ to carbamylate a lysine residue in the catalytic site, or by the binding of inhibitors within the catalytic site. Binding of inhibitors blocks either activity or the carbamylation of the lysine residue that is essential for activity. At night, in many species, 2‐carboxyarabinitol‐1‐phosphate (CA1P) is formed which binds tightly to Rubisco, inhibiting catalytic activity. Recent work has shown that tight‐binding inhibitors can also decrease Rubisco activity in the light and contribute to the regulation of Rubisco activity. Here we determine the influence that such inhibitors of Rubisco exert on catalytic activity during drought stress. In tobacco plants, ‘total Rubisco activity’, i.e. the activity following pre‐incubation with CO2 and Mg2+, was positively correlated with leaf relative water content. However, ‘total Rubisco activity’ in extracts from leaves with low water potential increased markedly when tightly bound inhibitors were removed, thus increasing the number of catalytic sites available. This suggests that in tobacco the decrease of Rubisco activity under drought stress is not primarily the result of changes in activation by CO2 and Mg2+ but due rather to the presence of tight‐binding inhibitors. The amounts of inhibitor present in leaves of droughted tobacco based on the decrease in Rubisco activity per mg soluble protein were usually much greater than the amounts of the known inhibitors (CA1P and ‘daytime inhibitor’) that can be recovered in acid extracts. Alternative explanations for the difference between maximal and total activities are discussed. PMID:12102509

Two classes of receptor specific for sperm-activating peptide III in sand-dollar spermatozoa.

PubMed

Yoshino, K; Suzuki, N

1992-06-15

We characterized receptors specific for sperm-activating peptide III (SAP-III: DSDSAQNLIQ) in spermatozoa of the sand dollar, Clypeaster japonicus, using both binding and cross-linking techniques. Analyses of the data obtained from the equilibrium binding of a radiolabeled SAP-III analogueto C. japonicus spermatozoa, using Klotz, Scatchard and Hill plots, showed the presence of two classes of receptors specific for SAP-III in the spermatozoa. One of the receptors (high-affinity) had a Kd of 3.4 nM and 3.4 x 10(4) binding sites/spermatozoon. The other receptor (low-affinity) had a Kd of 48 nM, with 6.1 x 10(4) binding sites/spermatozoon. The Kd of the high-affinity receptor was comparable to the median effective concentration of the intracellular-pH-increasing activity of SAP-III and that of the low-affinity receptor was comparable to the median effective concentration of the cellular-cGMP-elevating activity of the peptide. In addition, Scatchard and Hill plots of the data suggested the existence of positive cooperativity between the high-affinity members. Similar results were also obtained from a binding experiment using a sperm-membrane fraction prepared from C. japonicus spermatozoa. The incubation of intact spermatozoa or sperm plasma membranes with the radioiodinated SAP-III analogue and a chemical cross-linking reagent, disuccinimidyl suberate, resulted in the radiolabeling of three proteins with molecular masses of 126, 87 and 64 kDa, estimated by SDS/PAGE under reducing conditions.

hnRNP L controls HPV16 RNA polyadenylation and splicing in an Akt kinase-dependent manner

PubMed Central

Kajitani, Naoko; Glahder, Jacob; Wu, Chengjun; Yu, Haoran; Nilsson, Kersti

2017-01-01

Abstract Inhibition of the Akt kinase activates HPV16 late gene expression by reducing HPV16 early polyadenylation and by activating HPV16 late L1 mRNA splicing. We identified ‘hot spots’ for RNA binding proteins at the early polyA signal and at splice sites on HPV16 late mRNAs. We observed that hnRNP L was associated with sequences at all HPV16 late splice sites and at the early polyA signal. Akt kinase inhibition resulted in hnRNP L dephosphorylation and reduced association of hnRNP L with HPV16 mRNAs. This was accompanied by an increased binding of U2AF65 and Sam68 to HPV16 mRNAs. Furthermore, siRNA knock-down of hnRNP L or Akt induced HPV16 gene expression. Treatment of HPV16 immortalized keratinocytes with Akt kinase inhibitor reduced hnRNP L binding to HPV16 mRNAs and induced HPV16 L1 mRNA production. Finally, deletion of the hnRNP L binding sites in HPV16 subgenomic expression plasmids resulted in activation of HPV16 late gene expression. In conclusion, the Akt kinase inhibits HPV16 late gene expression at the level of RNA processing by controlling the RNA-binding protein hnRNP L. We speculate that Akt kinase activity upholds an intracellular milieu that favours HPV16 early gene expression and suppresses HPV16 late gene expression. PMID:28934469

Sumoylation activates the transcriptional activity of Pax-6, an important transcription factor for eye and brain development

PubMed Central

Yan, Qin; Gong, Lili; Deng, Mi; Zhang, Lan; Sun, Shuming; Liu, Jiao; Ma, Haili; Yuan, Dan; Chen, Pei-Chao; Hu, Xiaohui; Liu, Jinping; Qin, Jichao; Xiao, Ling; Huang, Xiao-Qin; Zhang, Jian; Wan-Cheng Li, David

2010-01-01

Pax-6 is an evolutionarily conserved transcription factor regulating brain and eye development. Four Pax-6 isoforms have been reported previously. Although the longer Pax-6 isoforms (p46 and p48) bear two DNA-binding domains, the paired domain (PD) and the homeodomain (HD), the shorter Pax-6 isoform p32 contains only the HD for DNA binding. Although a third domain, the proline-, serine- and threonine-enriched activation (PST) domain, in the C termini of all Pax-6 isoforms mediates their transcriptional modulation via phosphorylation, how p32 Pax-6 could regulate target genes remains to be elucidated. In the present study, we show that sumoylation at K91 is required for p32 Pax-6 to bind to a HD-specific site and regulate expression of target genes. First, in vitro-synthesized p32 Pax-6 alone cannot bind the P3 sequence, which contains the HD recognition site, unless it is preincubated with nuclear extracts precleared by anti–Pax-6 but not by anti-small ubiquitin-related modifier 1 (anti-SUMO1) antibody. Second, in vitro-synthesized p32 Pax-6 can be sumoylated by SUMO1, and the sumoylated p32 Pax-6 then can bind to the P3 sequence. Third, Pax-6 and SUMO1 are colocalized in the embryonic optic and lens vesicles and can be coimmunoprecipitated. Finally, SUMO1-conjugated p32 Pax-6 exists in both the nucleus and cytoplasm, and sumoylation significantly enhances the DNA-binding ability of p32 Pax-6 and positively regulates gene expression. Together, our results demonstrate that sumoylation activates p32 Pax-6 in both DNA-binding and transcriptional activities. In addition, our studies demonstrate that p32 and p46 Pax-6 possess differential DNA-binding and regulatory activities. PMID:21084637

Specific binding of tubeimoside-2 with proteins in hepatocarcinoma HepG2 cells: investigation by molecular spectroscopy

NASA Astrophysics Data System (ADS)

Yang, Sun; Shi-Sheng, Sun; Ying-Yong, Zhao; Jun, Fan

2012-07-01

In this study, we compared different binding interactions of TBMS2 with proteins both in hepatocarcinoma HepG2 cells and in normal embryo hepatic L02 cells by using fluorescence, absorption, and CD spectroscopy. The fluorescence data revealed that the fluorescence intensity of proteins in the HepG2 and L02 cells decreased in the presence of TBMS2 by 30.79% and 12.01%, respectively. Binding constants and thermodynamic parameters were obtained for systems of TBMS2 with the two kinds of cell proteins. The results indicated that HepG2 cell proteins had a higher TBMS2 binding activity than those in the L02 cells. Analysis of the TBMS2 cytotoxic activities showed that TBMS2 could selectively induce apoptosis of HepG2 cells by binding to them, while its apoptotic effect on L02 cells was relatively weaker.

USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1.

PubMed

Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S

1991-09-11

The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.

Cyanide does more to inhibit heme enzymes, than merely serving as an active-site ligand

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parashar, Abhinav; Venkatachalam, Avanthika; Gideon, Daniel Andrew

Highlights: • Cyanide (CN) is a well-studied toxic principle, known to inhibit heme-enzymes. • Inhibition is supposed to result from CN binding at the active site as a ligand. • Diverse heme enzymes’ CN inhibition profiles challenge prevailing mechanism. • Poor binding efficiency of CN at low enzyme concentrations and ligand pressures. • CN-based diffusible radicals cause ‘non-productive electron transfers’ (inhibition). - Abstract: The toxicity of cyanide is hitherto attributed to its ability to bind to heme proteins’ active site and thereby inhibit their activity. It is shown herein that the long-held interpretation is inadequate to explain several observations inmore » heme-enzyme reaction systems. Generation of cyanide-based diffusible radicals in heme-enzyme reaction milieu could shunt electron transfers (by non-active site processes), and thus be detrimental to the efficiency of oxidative outcomes.« less

The immunosuppressives FK 506 and cyclosporin A inhibit the generation of protein factors binding to the two purine boxes of the interleukin 2 enhancer.

PubMed Central

Brabletz, T; Pietrowski, I; Serfling, E

1991-01-01

Like Cyclosporin A (CsA), the macrolide FK 506 is a potent immunosuppressive that inhibits early steps of T cell activation, including the synthesis of Interleukin 2 (II-2) and numerous other lymphokines. The block of II-2 synthesis occurs at the transcriptional level. At concentrations that block T cell activation, FK 506 and CsA inhibit the proto-enhancer activity of Purine boxes of the II-2 promoter and the generation of lymphocyte-specific factors binding to the Purine boxes. Under the same conditions, the DNA binding of other II-2 enhancer factors remains unaffected by both compounds. These results support the view that FK 506 and CsA, which both inhibit the activity of peptidylprolyl cis/trans isomerases, suppress T cell activation by a similar, if not identical mechanism. Images PMID:1707162

The immunosuppressives FK 506 and cyclosporin A inhibit the generation of protein factors binding to the two purine boxes of the interleukin 2 enhancer.

PubMed

Brabletz, T; Pietrowski, I; Serfling, E

1991-01-11

Like Cyclosporin A (CsA), the macrolide FK 506 is a potent immunosuppressive that inhibits early steps of T cell activation, including the synthesis of Interleukin 2 (II-2) and numerous other lymphokines. The block of II-2 synthesis occurs at the transcriptional level. At concentrations that block T cell activation, FK 506 and CsA inhibit the proto-enhancer activity of Purine boxes of the II-2 promoter and the generation of lymphocyte-specific factors binding to the Purine boxes. Under the same conditions, the DNA binding of other II-2 enhancer factors remains unaffected by both compounds. These results support the view that FK 506 and CsA, which both inhibit the activity of peptidylprolyl cis/trans isomerases, suppress T cell activation by a similar, if not identical mechanism.

Spatial and temporal coherence in perceptual binding

PubMed Central

Blake, Randolph; Yang, Yuede

1997-01-01

Component visual features of objects are registered by distributed patterns of activity among neurons comprising multiple pathways and visual areas. How these distributed patterns of activity give rise to unified representations of objects remains unresolved, although one recent, controversial view posits temporal coherence of neural activity as a binding agent. Motivated by the possible role of temporal coherence in feature binding, we devised a novel psychophysical task that requires the detection of temporal coherence among features comprising complex visual images. Results show that human observers can more easily detect synchronized patterns of temporal contrast modulation within hybrid visual images composed of two components when those components are drawn from the same original picture. Evidently, time-varying changes within spatially coherent features produce more salient neural signals. PMID:9192701

Benzodiazepines: rat pinealocyte binding sites and augmentation of norepinephrine-stimulated N-acetyltransferase activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matthew, E.; Parfitt, A.G.; Sugden, D.

1984-02-01

Studies of (/sup 3/H)diazepam binding to intact rat pineal cells were carried out in tissue culture preparations. The binding was saturable, reversible and proportional to the number of cells used. Scatchard analysis resulted in a linear plot (Kd . 23 nM, maximum binding sites (Bmax) . 1.56 pmol/mg of protein for cells in monolayer culture; Kd . 7 nM, Bmax . 1.3 pmol/mg of protein for cells in suspension culture). Inhibition constants (Ki) for clonazepam (500 nM), flunitrazepam (38 nM) and Ro-5-4864 (5 nM) indicated that the binding sites were probably of the ''peripheral'' type. In addition, the effects ofmore » diazepam on norepinephrine-stimulated N-acetyltransferase (NAT) activity were studied in organ culture and dissociated cell culture. Diazepam (10-50 microM) both prolonged and increased the magnitude of the norepinephrine-induced increase in NAT activity but did not affect the initial rate of rise of enzyme activity. The effect was dose-dependent and was also seen with clonazepam, flunitrazepam and Ro-5-4864, but not with Ro-15-1788. Diazepam, by itself, at these concentrations, had no effect on NAT, but enzyme activity was increased by higher concentrations (0.1-1 mM). Although a relationship between the (/sup 3/H)diazepam binding sites described here and the effect of benzodiazepines on NAT cannot be established from these studies, the data suggest that the benzodiazepines may alter melatonin levels through their action on NAT.« less

How does huperzine A enter and leave the binding gorge of acetylcholinesterase? Steered molecular dynamics simulations.

PubMed

Xu, Yechun; Shen, Jianhua; Luo, Xiaomin; Silman, Israel; Sussman, Joel L; Chen, Kaixian; Jiang, Hualiang

2003-09-17

The entering and leaving processes of Huperzine A (HupA) binding with the long active-site gorge of Torpedo californica acetylcholinesterase (TcAChE) have been investigated by using steered molecular dynamics simulations. The analysis of the force required along the pathway shows that it is easier for HupA to bind to the active site of AChE than to disassociate from it, which for the first time interprets at the atomic level the previous experimental result that unbinding process of HupA is much slower than its binding process to AChE. The direct hydrogen bonds, water bridges, and hydrophobic interactions were analyzed during two steered molecular dynamics (SMD) simulations. Break of the direct hydrogen bond needs a great pulling force. The steric hindrance of bottleneck might be the most important factor to produce the maximal rupture force for HupA to leave the binding site but it has a little effect on the binding process of HupA with AChE. Residue Asp72 forms a lot of water bridges with HupA leaving and entering the AChE binding gorge, acting as a clamp to take out HupA from or put HupA into the active site. The flip of the peptide bond between Gly117 and Gly118 has been detected during both the conventional MD and SMD simulations. The simulation results indicate that this flip phenomenon could be an intrinsic property of AChE and the Gly117-Gly118 peptide bond in both HupA bound and unbound AChE structures tends to adopt the native enzyme structure. At last, in a vacuum the rupture force is increased up to 1500 pN while in water solution the greatest rupture force is about 800 pN, which means water molecules in the binding gorge act as lubricant to facilitate HupA entering or leaving the binding gorge.

Expression, subcellular localization and regulation of sigma receptor in retinal Müller cells

PubMed Central

Jiang, Guoliang; Mysona, Barbara; Dun, Ying; Gnana-Prakasam, Jaya P.; Pabla, Navjotsin; Li, Weiguo; Dong, Zheng; Ganapathy, Vadivel; Smith, Sylvia B.

2013-01-01

Purpose Sigma receptors (σR) are non-opioid, non-phencyclidine binding sites with robust neuroprotective properties. σR1 is expressed in brain oligodendrocytes, but its expression and binding capacity have not been analyzed in retinal glial cells. This study examined the expression, subcellular localization, binding activity and regulation of σR1 in retinal Müller cells. Methods Primary mouse Müller cells (1°MC) were analyzed by RT-PCR, immunoblotting and immunocytochemistry for the expression of σR1 and data were compared to the rat Müller cell line, rMC-1 and rat ganglion cell line, RGC-5. Confocal microscopy was used to determine the subcellular σR1 location in 1°MC. Membranes prepared from these cells were used for binding assays using [3H]-pentazocine (PTZ). The kinetics of binding, the ability of various σR1 ligands to compete with σR1 binding and the effects of nitric oxide (NO) and reactive oxygen species (ROS) donors on binding were examined. Results σR1 is expressed in 1°MC and is localized to the nuclear and endoplasmic reticulum membranes. Binding assays showed that in 1°MCs, rMC-1 and RGC-5 cells, the binding of PTZ was saturable. [3H]-PTZ bound with high affinity in RGC-5 and rMC-1 cells and the binding was similarly robust in 1°MC. Competition studies showed marked inhibition of [3H]-PTZ binding in the presence of σR1-specific ligands. Incubation of cells with NO and ROS donors markedly increased σR1 binding activity. Conclusions Müller cells express σR1 and demonstrate robust σR1 binding activity, which is inhibited by σR1 ligands and is stimulated during oxidative stress. The potential of Müller cells to bind σR1 ligands may prove beneficial in retinal degenerative diseases such as diabetic retinopathy. PMID:17122151

Reduced ability of C-type natriuretic peptide (CNP) to activate natriuretic peptide receptor B (NPR-B) causes dwarfism in lbab−/− mice

PubMed Central

Yoder, Andrea R.; Kruse, Andrew C.; Earhart, Cathleen A.; Ohlendorf, Douglas H.; Potter, Lincoln R.

2015-01-01

C-type natriuretic peptide (CNP) stimulates endochondrial ossification by activating the transmembrane guanylyl cyclase, natriuretic peptide receptor-B (NPR-B). Recently, a spontaneous autosomal recessive mutation that causes severe dwarfism in mice was identified. The mutant, called long bone abnormality (lbab), contains a single point mutation that converts an arginine to a glycine in a conserved coding region of the CNP gene, but how this mutation affects CNP activity has not been reported. Here, we determined that thirty to greater than one hundred-fold more CNPlbab was required to activate NPR-B as compared to wild-type CNP in whole cell cGMP elevation and membrane guanylyl cyclase assays. The reduced ability of CNPlbab to activate NPR-B was explained, at least in part, by decreased binding since ten-fold more CNPlbab than wild-type CNP was required to compete with [125I][Tyr0]CNP for receptor binding. Molecular modeling suggested that the conserved arginine is critical for binding to an equally conserved acidic pocket in NPR-B. These results indicate that reduced binding to and activation of NPR-B causes dwarfism in lbab−/− mice. PMID:18554750

Investigating the binding mechanism of novel 6-aminonicotinate-based antagonists with P2Y12 by 3D-QSAR, docking and molecular dynamics simulations.

PubMed

Zhou, Shengfu; Fang, Danqing; Tan, Shepei; Lin, Weicong; Wu, Wenjuan; Zheng, Kangcheng

2017-10-01

P2Y 12 receptor is an attractive target for the anti-platelet therapies, treating various thrombotic diseases. In this work, a total of 107 6-aminonicotinate-based compounds as potent P2Y 12 antagonists were studies by a molecular modeling study combining three-dimensional quantitative structure-activity relationship (3D-QSAR), molecular docking and molecular dynamics (MD) simulations to explore the decisive binding conformations of these antagonists with P2Y 12 and the structural features for the activity. The optimum CoMFA and CoMSIA models identified satisfactory robustness and good predictive ability, with R 2  = .983, q 2  = .805, [Formula: see text] = .881 for CoMFA model, and R 2  = .935, q 2  = .762, [Formula: see text] = .690 for CoMSIA model, respectively. The probable binding modes of compounds and key amino acid residues were revealed by molecular docking. MD simulations and MM/GBSA free energy calculations were further performed to validate the rationality of docking results and to compare the binding modes of several compound pairs with different activities, and the key residues (Val102, Tyr105, Tyr109, His187, Val190, Asn191, Phe252, His253, Arg256, Tyr259, Thr260, Val279, and Lys280) for the higher activity were pointed out. The binding energy decomposition indicated that the hydrophobic and hydrogen bond interactions play important roles for the binding of compounds to P2Y 12 . We hope these results could be helpful in design of potent and selective P2Y 12 antagonists.

Novel Family of Insect Salivary Inhibitors Blocks Contact Pathway Activation by Binding to Polyphosphate, Heparin, and Dextran Sulfate

PubMed Central

Alvarenga, Patricia H.; Xu, Xueqing; Oliveira, Fabiano; Chagas, Andrezza C.; Nascimento, Clarissa R.; Francischetti, Ivo M.B.; Juliano, Maria A.; Juliano, Luiz; Scharfstein, Julio; Valenzuela, Jesus G.; Ribeiro, José M.C.; Andersen, John F.

2014-01-01

Objective Polyphosphate and heparin are anionic polymers released by activated mast cells and platelets that are known to stimulate the contact pathway of coagulation. These polymers promote both the autoactivation of factor XII and the assembly of complexes containing factor XI, prekallikrein, and high-molecular-weight kininogen. We are searching for salivary proteins from blood-feeding insects that counteract the effect of procoagulant and proinflammatory factors in the host, including elements of the contact pathway. Approach and Results Here, we evaluate the ability of the sand fly salivary proteins, PdSP15a and PdSP15b, to inhibit the contact pathway by disrupting binding of its components to anionic polymers. We attempt to demonstrate binding of the proteins to polyphosphate, heparin, and dextran sulfate. We also evaluate the effect of this binding on contact pathway reactions. We also set out to determine the x-ray crystal structure of PdSP15b and examine the determinants of relevant molecular interactions. Both proteins bind polyphosphate, heparin, and dextran sulfate with high affinity. Through this mechanism they inhibit the autoactivation of factor XII and factor XI, the reciprocal activation of factor XII and prekallikrein, the activation of factor XI by thrombin and factor XIIa, the cleavage of high-molecular-weight kininogen in plasma, and plasma extravasation induced by polyphosphate. The crystal structure of PdSP15b contains an amphipathic helix studded with basic side chains that forms the likely interaction surface. Conclusions The results of these studies indicate that the binding of anionic polymers by salivary proteins is used by blood feeders as an antihemostatic/anti-inflammatory mechanism. PMID:24092749

Structural properties of the promiscuous VP16 activation domain.

PubMed

Jonker, Hendrik R A; Wechselberger, Rainer W; Boelens, Rolf; Folkers, Gert E; Kaptein, Rob

2005-01-25

Herpes simplex virion protein 16 (VP16) contains two strong activation regions that can independently and cooperatively activate transcription in vivo. We have identified the regions and residues involved in the interaction with the human transcriptional coactivator positive cofactor 4 (PC4) and the general transcription factor TFIIB. NMR and biochemical experiments revealed that both VP16 activation regions are required for the interaction and undergo a conformational transition from random coil to alpha-helix upon binding to its target PC4. The interaction is strongly electrostatically driven and the binding to PC4 is enhanced by the presence of its amino-terminal domain. We propose models for binding of VP16 to the core domains of PC4 and TFIIB that are based on two independent docking approaches using NMR chemical shift changes observed in titration experiments. The models are consistent with results from site-directed mutagenesis and provide an explanation for the contribution of both acidic and hydrophobic residues for transcriptional activation by VP16. Both intrinsically unstructured activation domains are attracted to their interaction partner by electrostatic interactions, and adopt an alpha-helical conformation around the important hydrophobic residues. The models showed multiple distinct binding surfaces upon interaction with various partners, providing an explanation for the promiscuous properties, cooperativity, and the high activity of this activation domain.

BPF-1, a pathogen-induced DNA-binding protein involved in the plant defense response.

PubMed

da Costa e Silva, O; Klein, L; Schmelzer, E; Trezzini, G F; Hahlbrock, K

1993-07-01

The mechanisms by which plants restrict the growth of pathogens include transient activation of numerous defense-related genes. Box P is a putative cis-acting element of a distinct group of such genes, including those encoding the enzyme phenylalanine ammonialyase (PAL). A DNA-binding activity to Box P was identified in nuclear extracts from cultured parsley cells and a cDNA encoding the protein BPF-1 (Box P-binding Factor) partially characterized. BPF-1 binds to this element with specificity similar to that of the binding activity in nuclear extracts. BPF-1 mRNA accumulates rapidly in elicitor-treated parsley cells and around fungal infection sites on parsley leaves. This accumulation is, at least partly, due to a rapid and transient increase in the transcription rate of BPF-1. Moreover, tight correlation between the relative amounts of BPF-1 and PAL mRNAs was observed in different organs of a parsley plant. These results are consistent with the hypothesis that BPF-1 is involved in disease resistance by modulating plant defense gene expression.

Zinc can increase the activity of protein kinase C and contributes to its binding to plasma membranes in T lymphocytes.

PubMed

Csermely, P; Szamel, M; Resch, K; Somogyi, J

1988-05-15

In the primary structure of protein kinase C, the presence of a putative metal-binding site has been suggested (Parker, P.J., Coussens, L., Totty, N., Rhee, L., Young, S., Chen, E., Stabel, S., Waterfield, M.D., and Ullrich, A. (1986) Science 233, 853-859). In the present report, we demonstrate that the most abundant intracellular heavy metal, zinc, can increase the activity of cytosolic protein kinase C. Zinc reversibly binds the enzyme to plasma membranes, and it may contribute to the calcium-induced binding as well. The intracellular heavy metal chelator N,N,N',N'-tetrakis(2-pyridylmethyl) ethylenediamine prevents the phorbol ester- and antigen-induced translocation of protein kinase C. This effect can be totally reversed by the concomitant addition of Zn2+, while Fe2+ and Mn2+ are only partially counteractive. Our results suggest that zinc can activate protein kinase C and contributes to its binding to plasma membranes in T lymphocytes induced by Ca2+, phorbol ester, or antigen.

A Chrysin Derivative Suppresses Skin Cancer Growth by Inhibiting Cyclin-dependent Kinases*

PubMed Central

Liu, Haidan; Liu, Kangdong; Huang, Zunnan; Park, Chan-Mi; Thimmegowda, N. R.; Jang, Jae-Hyuk; Ryoo, In-Ja; He, Long; Kim, Sun-Ok; Oi, Naomi; Lee, Ki Won; Soung, Nak-Kyun; Bode, Ann M.; Yang, Yifeng; Zhou, Xinmin; Erikson, Raymond L.; Ahn, Jong-Seog; Hwang, Joonsung; Kim, Kyoon Eon; Dong, Zigang; Kim, Bo-Yeon

2013-01-01

Chrysin (5,7-dihydroxyflavone), a natural flavonoid widely distributed in plants, reportedly has chemopreventive properties against various cancers. However, the anticancer activity of chrysin observed in in vivo studies has been disappointing. Here, we report that a chrysin derivative, referred to as compound 69407, more strongly inhibited EGF-induced neoplastic transformation of JB6 P+ cells compared with chrysin. It attenuated cell cycle progression of EGF-stimulated cells at the G1 phase and inhibited the G1/S transition. It caused loss of retinoblastoma phosphorylation at both Ser-795 and Ser-807/811, the preferred sites phosphorylated by Cdk4/6 and Cdk2, respectively. It also suppressed anchorage-dependent and -independent growth of A431 human epidermoid carcinoma cells. Compound 69407 reduced tumor growth in the A431 mouse xenograft model and retinoblastoma phosphorylation at Ser-795 and Ser-807/811. Immunoprecipitation kinase assay results showed that compound 69407 attenuated endogenous Cdk4 and Cdk2 kinase activities in EGF-stimulated JB6 P+ cells. Pulldown and in vitro kinase assay results indicated that compound 69407 directly binds with Cdk2 and Cdk4 in an ATP-independent manner and inhibited their kinase activities. A binding model between compound 69407 and a crystal structure of Cdk2 predicted that compound 69407 was located inside the Cdk2 allosteric binding site. The binding was further verified by a point mutation binding assay. Overall results indicated that compound 69407 is an ATP-noncompetitive cyclin-dependent kinase inhibitor with anti-tumor effects, which acts by binding inside the Cdk2 allosteric pocket. This study provides new insights for creating a general pharmacophore model to design and develop novel ATP-noncompetitive agents with chemopreventive or chemotherapeutic potency. PMID:23888052

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

Protein Binding: Do We Ever Learn?▿

PubMed Central

Zeitlinger, Markus A.; Derendorf, Hartmut; Mouton, Johan W.; Cars, Otto; Craig, William A.; Andes, David; Theuretzbacher, Ursula

2011-01-01

Although the influence of protein binding (PB) on antibacterial activity has been reported for many antibiotics and over many years, there is currently no standardization for pharmacodynamic models that account for the impact of protein binding of antimicrobial agents in vitro. This might explain the somewhat contradictory results obtained from different studies. Simple in vitro models which compare the MIC obtained in protein-free standard medium versus a protein-rich medium are prone to methodological pitfalls and may lead to flawed conclusions. Within in vitro test systems, a range of test conditions, including source of protein, concentration of the tested antibiotic, temperature, pH, electrolytes, and supplements may influence the impact of protein binding. As new antibiotics with a high degree of protein binding are in clinical development, attention and action directed toward the optimization and standardization of testing the impact of protein binding on the activity of antibiotics in vitro become even more urgent. In addition, the quantitative relationship between the effects of protein binding in vitro and in vivo needs to be established, since the physiological conditions differ. General recommendations for testing the impact of protein binding in vitro are suggested. PMID:21537013

Interactions between peroxiredoxin 2, hemichrome and the erythrocyte membrane.

PubMed

Bayer, Simone B; Low, Felicia M; Hampton, Mark B; Winterbourn, Christine C

2016-12-01

Peroxiredoxin 2 (Prx2) is an abundant antioxidant protein in erythrocytes that protects against hemolytic anemia resulting from hemoglobin oxidation and Heinz body formation. A small fraction of Prx2 is bound to the cell membrane, but the mechanism and relevance of binding are not clear. We have investigated Prx2 interactions with the erythrocyte membrane and oxidized hemoglobin and whether these interactions are dependent on Prx2 redox state. Membrane binding of Prx2 in erythrocytes decreased when the cells were treated with H 2 O 2 , but studies with purified Prx2 and isolated ghosts showed that the interaction was independent of Prx2 redox state. Hemoglobin oxidation leads to the formation of hemichrome, a denatured form of the protein that binds to Band3 protein in the cell membrane as part of the senescence process and is a precursor of Heinz bodies. Hemichrome competed with Prx2 and decreased Prx2 binding to the membrane, potentially explaining the decreased binding in oxidant-exposed cells. The increased membrane binding of Prx2 seen with increasing intracellular calcium was less sensitive to H 2 O 2 or hemichrome, suggesting an alternative mode of binding. Prx2 was also shown to exhibit chaperone-like activity by retarding the precipitation of pre-formed hemichrome. Our results suggest that Prx2, by restricting membrane binding of hemichrome, could impede Band3 clustering and exposure of senescence antigens. This mechanism, plus the observed chaperone activity for oxidized hemoglobin, may help protect against hemolytic anemia.

Mutation analysis and molecular modeling for the investigation of ligand-binding modes of GPR84.

PubMed

Nikaido, Yoshiaki; Koyama, Yuuta; Yoshikawa, Yasushi; Furuya, Toshio; Takeda, Shigeki

2015-05-01

GPR84 is a G protein-coupled receptor for medium-chain fatty acids. Capric acid and 3,3'-diindolylmethane are specific agonists for GPR84. We built a homology model of a GPR84-capric acid complex to investigate the ligand-binding mode using the crystal structure of human active-state β2-adrenergic receptor. We performed site-directed mutagenesis to subject ligand-binding sites to our model using GPR84-Giα fusion proteins and a [(35)S]GTPγS-binding assay. We compared the activity of the wild type and mutated forms of GPR84 by [(35)S]GTPγS binding to capric acid and diindolylmethane. The mutations L100D `Ballesteros-Weinstein numbering: 3.32), F101Y (3.33) and N104Q (3.36) in the transmembrane helix III and N357D (7.39) in the transmembrane helix VII resulted in reduced capric acid activity but maintained the diindolylmethane responses. Y186F (5.46) and Y186H (5.46) mutations had no characteristic effect on capric acid but with diindolylmethane they significantly affected the G protein activation efficiency. The L100D (3.32) mutant responded to decylamine, a fatty amine, instead of a natural agonist, the fatty acid capric acid, suggesting that we have identified a mutated G protein-coupled receptor-artificial ligand pairing. Our molecular model provides an explanation for these results and interactions between GPR84 and capric acid. Further, from the results of a double stimulation assay, we concluded that diindolylmethane was a positive allosteric modulator for GPR84. © The Authors 2014. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Protein F, a fibronectin-binding protein, is an adhesin of the group A streptococcus Streptococcus pyogenes.

PubMed

Hanski, E; Caparon, M

1992-07-01

Binding to fibronectin has been suggested to play an important role in adherence of the group A streptococcus Streptococcus pyrogenes to host epithelial cells; however, the identity of the streptococcal fibronectin receptor has been elusive. Here we demonstrate that the fibronectin-binding property of S. pyogenes is mediated by protein F, a bacterial surface protein that binds fibronectin at high affinity. The gene encoding protein F (prtF) produced a functional fibronectin-binding protein in Escherichia coli. Insertional mutagenesis of the cloned gene generated a mutation that resulted in the loss of fibronectin-binding activity. When this mutation was introduced into the S. pyrogenes chromosome by homologous recombination with the wild-type allele, the resulting strains no longer produced protein F and lost their ability to bind fibronectin. The mutation could be complemented by prtF introduced on a plasmid. Mutants lacking protein F had a much lower capacity to adhere to respiratory epithelial cells. These results demonstrate that protein F is an important adhesin of S. pyogenes.

Effects of flow changes on radiotracer binding: Simultaneous measurement of neuroreceptor binding and cerebral blood flow modulation.

PubMed

Sander, Christin Y; Mandeville, Joseph B; Wey, Hsiao-Ying; Catana, Ciprian; Hooker, Jacob M; Rosen, Bruce R

2017-01-01

The potential effects of changes in blood flow on the delivery and washout of radiotracers has been an ongoing question in PET bolus injection studies. This study provides practical insight into this topic by experimentally measuring cerebral blood flow (CBF) and neuroreceptor binding using simultaneous PET/MRI. Hypercapnic challenges (7% CO 2 ) were administered to non-human primates in order to induce controlled increases in CBF, measured with pseudo-continuous arterial spin labeling. Simultaneously, dopamine D 2 /D 3 receptor binding of [ 11 C]raclopride or [ 18 F]fallypride was monitored with dynamic PET. Experiments showed that neither time activity curves nor quantification of binding through binding potentials ( BP ND ) were measurably affected by CBF increases, which were larger than two-fold. Simulations of experimental procedures showed that even large changes in CBF should have little effect on the time activity curves of radiotracers, given a set of realistic assumptions. The proposed method can be applied to experimentally assess the flow sensitivity of other radiotracers. Results demonstrate that CBF changes, which often occur due to behavioral tasks or pharmacological challenges, do not affect PET [ 11 C]raclopride or [ 18 F]fallypride binding studies and their quantification. The results from this study suggest flow effects may have limited impact on many PET neuroreceptor tracers with similar properties.

RNA binding properties of the US11 protein from four primate simplexviruses

PubMed Central

2011-01-01

Background The protein encoded by the Us11 gene of herpes simplex viruses is a dsRNA binding protein which inhibits protein kinase R activity, thereby preventing the interferon-induced shut down of protein synthesis following viral infection. Us11 protein is not essential for infectivity in vitro and in mice in herpes simplex virus type 1 (HSV1), however this virus has a second, and apparently more important, inhibitor of PKR activity, the γ134.5 protein. Recently sequenced simian simplexviruses SA8, HVP2 and B virus do not have an ORF corresponding to the γ134.5 protein, yet they have similar, or greater, infectivity as HSV1 and HSV2. Methods We have expressed the US11 proteins of the simplexviruses HSV1, HSV2, HVP2 and B virus and measured their abilities to bind dsRNA, in order to investigate possible differences that could complement the absence of the γ134.5 protein. We employed a filter binding technique that allows binding of the Us11 protein under condition of excess dsRNA substrate and therefore a measurement of the true Kd value of Us11-dsRNA binding. Results and Conclusions The results show a Kd of binding in the range of 0.89 nM to 1.82 nM, with no significant difference among the four Us11 proteins. PMID:22054255

Switch II Mutants Reveal Coupling between the Nucleotide- and Actin-Binding Regions in Myosin V

PubMed Central

Trivedi, Darshan V.; David, Charles; Jacobs, Donald J.; Yengo, Christopher M.

2012-01-01

Conserved active-site elements in myosins and other P-loop NTPases play critical roles in nucleotide binding and hydrolysis; however, the mechanisms of allosteric communication among these mechanoenzymes remain unresolved. In this work we introduced the E442A mutation, which abrogates a salt-bridge between switch I and switch II, and the G440A mutation, which abolishes a main-chain hydrogen bond associated with the interaction of switch II with the γ phosphate of ATP, into myosin V. We used fluorescence resonance energy transfer between mant-labeled nucleotides or IAEDANS-labeled actin and FlAsH-labeled myosin V to examine the conformation of the nucleotide- and actin-binding regions, respectively. We demonstrate that in the absence of actin, both the G440A and E442A mutants bind ATP with similar affinity and result in only minor alterations in the conformation of the nucleotide-binding pocket (NBP). In the presence of ADP and actin, both switch II mutants disrupt the formation of a closed NBP actomyosin.ADP state. The G440A mutant also prevents ATP-induced opening of the actin-binding cleft. Our results indicate that the switch II region is critical for stabilizing the closed NBP conformation in the presence of actin, and is essential for communication between the active site and actin-binding region. PMID:22713570

Tyrosines of Human and Mouse Transferrin Covalently Labeled by Organophosphorus Agents: A New Motif for Binding to Proteins that Have No Active Site Serine

PubMed Central

Li, Bin; Schopfer, Lawrence M.; Grigoryan, Hasmik; Thompson, Charles M.; Hinrichs, Steven H.; Masson, Patrick; Lockridge, Oksana

2009-01-01

The expectation from the literature is that organophosphorus (OP) agents bind to proteins that have an active site serine. However, transferrin, a protein with no active site serine, was covalently modified in vitro by 0.5mM 10-fluoroethoxyphosphinyl-N-biotinamido pentyldecanamide, chlorpyrifos oxon, diisopropylfluorophosphate, dichlorvos, sarin, and soman. The site of covalent attachment was identified by analyzing tryptic peptides in the mass spectrometer. Tyr 238 and Tyr 574 in human transferrin and Tyr 238, Tyr 319, Tyr 429, Tyr 491, and Tyr 518 in mouse transferrin were labeled by OP. Tyrosine in the small synthetic peptide ArgTyrThrArg made a covalent bond with diisopropylfluorophosphate, chlorpyrifos oxon, and dichlorvos at pH 8.3. These results, together with our previous demonstration that albumin and tubulin bind OP on tyrosine, lead to the conclusion that OP bind covalently to tyrosine, and that OP binding to tyrosine is a new OP-binding residue. The OP-reactive tyrosines are activated by interaction with Arg or Lys. It is suggested that many proteins in addition to those already identified may be modified by OP on tyrosine. The extent to which tyrosine modification by OP can occur in vivo and the toxicological implications of such modifications require further investigation. PMID:18930948

Molecular modeling of ligand-receptor interactions in the OR5 olfactory receptor.

PubMed

Singer, M S; Shepherd, G M

1994-06-02

Olfactory receptors belong to the superfamily of seven transmembrane domain, G protein-coupled receptors. In order to begin analysis of mechanisms of receptor activation, a computer model of the OR5 olfactory receptor has been constructed and compared with other members of this superfamily. We have tested docking of the odor molecule lyral, which is known to activate the OR5 receptor. The results point to specific ligand-binding residues on helices III through VII that form a binding pocket in the receptor. Some of these residues occupy sequence positions identical to ligand-binding residues conserved among other superfamily members. The results provide new insights into possible molecular mechanisms of odor recognition and suggest hypotheses to guide future experimental studies using site-directed mutagenesis.

Stress- and Rho-activated ZO-1–associated nucleic acid binding protein binding to p21 mRNA mediates stabilization, translation, and cell survival

PubMed Central

Nie, Mei; Balda, Maria S.; Matter, Karl

2012-01-01

A central component of the cellular stress response is p21WAF1/CIP1, which regulates cell proliferation, survival, and differentiation. Inflammation and cell stress often up-regulate p21 posttranscriptionally by regulatory mechanisms that are poorly understood. ZO-1–associated nucleic acid binding protein (ZONAB)/DbpA is a Y-box transcription factor that is regulated by components of intercellular junctions that are affected by cytokines and tissue damage. We therefore asked whether ZONAB activation is part of the cellular stress response. Here, we demonstrate that ZONAB promotes cell survival in response to proinflammatory, hyperosmotic, and cytotoxic stress and that stress-induced ZONAB activation involves the Rho regulator GEF-H1. Unexpectedly, stress-induced ZONAB activation does not stimulate ZONAB’s activity as a transcription factor but leads to the posttranscriptional up-regulation of p21 protein and mRNA. Up-regulation is mediated by ZONAB binding to specific sites in the 3′-untranslated region of the p21 mRNA, resulting in mRNA stabilization and enhanced translation. Binding of ZONAB to mRNA is activated by GEF-H1 via Rho stimulation and also mediates Ras-induced p21 expression. We thus identify a unique type of stress and Rho signaling activated pathway that drives mRNA stabilization and translation and links the cellular stress response to p21 expression and cell survival. PMID:22711822

A BPTTF-based self-assembled electron-donating triangle capable of C60 binding.

PubMed

Goeb, Sébastien; Bivaud, Sébastien; Dron, Paul Ionut; Balandier, Jean-Yves; Chas, Marcos; Sallé, Marc

2012-03-25

A kinetically stable self-assembled redox-active triangle is isolated. The resulting electron-donating cavity, which incorporates three BPTTF units, exhibits a remarkable binding ability for electron-deficient C(60), supported by a favorable combination of structural and electronic features.

Mechanistic insights into metal ion activation and operator recognition by the ferric uptake regulator

NASA Astrophysics Data System (ADS)

Deng, Zengqin; Wang, Qing; Liu, Zhao; Zhang, Manfeng; Machado, Ana Carolina Dantas; Chiu, Tsu-Pei; Feng, Chong; Zhang, Qi; Yu, Lin; Qi, Lei; Zheng, Jiangge; Wang, Xu; Huo, Xinmei; Qi, Xiaoxuan; Li, Xiaorong; Wu, Wei; Rohs, Remo; Li, Ying; Chen, Zhongzhou

2015-07-01

Ferric uptake regulator (Fur) plays a key role in the iron homeostasis of prokaryotes, such as bacterial pathogens, but the molecular mechanisms and structural basis of Fur-DNA binding remain incompletely understood. Here, we report high-resolution structures of Magnetospirillum gryphiswaldense MSR-1 Fur in four different states: apo-Fur, holo-Fur, the Fur-feoAB1 operator complex and the Fur-Pseudomonas aeruginosa Fur box complex. Apo-Fur is a transition metal ion-independent dimer whose binding induces profound conformational changes and confers DNA-binding ability. Structural characterization, mutagenesis, biochemistry and in vivo data reveal that Fur recognizes DNA by using a combination of base readout through direct contacts in the major groove and shape readout through recognition of the minor-groove electrostatic potential by lysine. The resulting conformational plasticity enables Fur binding to diverse substrates. Our results provide insights into metal ion activation and substrate recognition by Fur that suggest pathways to engineer magnetotactic bacteria and antipathogenic drugs.

B 36N 36 fullerene-like nanocages: A novel material for drug delivery

NASA Astrophysics Data System (ADS)

Ganji, M. D.; Yazdani, H.; Mirnejad, A.

2010-07-01

We study interaction between B 36N 36 fullerene-like nanocage and glycine amino acid from the first- principles. Binding energy is calculated and glycine binding to the pure C 60 fullerene is compared. We also analyze the electronic structure and charge Mulliken population for the energetically most favorable complexes. Our results indicate that glycine can form stable bindings with B 36N 36 nanocage via their carbonyl oxygen (O) active site while, the C 60 fullerene might be unable to form stable bindings to glycine amino acid via their active sites, which is consistence with recent experimental and theoretical investigations. Thus, we arrive at the prediction that the B 36N 36 nanocage can be implemented as a novel material for drug delivery applications.

Transport capabilities of environmental Pseudomonads for sulfur compounds

DOE PAGES

Zerbs, Sarah; Korajczyk, Peter J.; Noirot, Philippe H.; ...

2017-01-27

Sulfur is an essential element in plant rhizospheres and microbial activity plays a key role in increasing the biological availability of sulfur in soil environments. To better understand the mechanisms facilitating the exchange of sulfur-containing molecules in soil, we profiled the binding specificities of eight previously uncharacterized ABC transporter solute-binding proteins from plant-associated Pseudomonads. A high-throughput screening procedure indicated eighteen significant organosulfur binding ligands, with at least one high-quality screening hit for each protein target. Calorimetric and spectroscopic methods were used to validate the best ligand assignments and catalog the thermodynamic properties of the protein-ligand interactions. Two novel high-affinity ligandmore » binding activities were identified and quantified in this set of solute binding proteins. Bacteria were cultured in minimal media with screening library components supplied as the sole sulfur sources, demonstrating that these organosulfur compounds can be metabolized and confirming the relevance of ligand assignments. These results expand the set of experimentally validated ligands amenable to transport by this ABC transporter family and demonstrate the complex range of protein-ligand interactions that can be accomplished by solute-binding proteins. As a result, characterizing new nutrient import pathways provides insight into Pseudomonad metabolic capabilities which can be used to further interrogate bacterial survival and participation in soil and rhizosphere communities.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zerbs, Sarah; Korajczyk, Peter J.; Noirot, Philippe H.

Sulfur is an essential element in plant rhizospheres and microbial activity plays a key role in increasing the biological availability of sulfur in soil environments. To better understand the mechanisms facilitating the exchange of sulfur-containing molecules in soil, we profiled the binding specificities of eight previously uncharacterized ABC transporter solute-binding proteins from plant-associated Pseudomonads. A high-throughput screening procedure indicated eighteen significant organosulfur binding ligands, with at least one high-quality screening hit for each protein target. Calorimetric and spectroscopic methods were used to validate the best ligand assignments and catalog the thermodynamic properties of the protein-ligand interactions. Two novel high-affinity ligandmore » binding activities were identified and quantified in this set of solute binding proteins. Bacteria were cultured in minimal media with screening library components supplied as the sole sulfur sources, demonstrating that these organosulfur compounds can be metabolized and confirming the relevance of ligand assignments. These results expand the set of experimentally validated ligands amenable to transport by this ABC transporter family and demonstrate the complex range of protein-ligand interactions that can be accomplished by solute-binding proteins. As a result, characterizing new nutrient import pathways provides insight into Pseudomonad metabolic capabilities which can be used to further interrogate bacterial survival and participation in soil and rhizosphere communities.« less

Formononetin, a phyto-oestrogen, and its metabolites up-regulate interleukin-4 production in activated T cells via increased AP-1 DNA binding activity

PubMed Central

Park, Jin; Kim, Seung H; Cho, Daeho; Kim, Tae S

2005-01-01

Phyto-oestrogens are polyphenolic non-steroidal plant compounds with oestrogen-like biological activity. Phyto-oestrogens have many biological effects including oestrogen agonist/antagonist properties. However, the effect of phyto-oestrogens on allergic responses remains unclear. In this study we investigated whether formononetin, a phyto-oestrogen, and its metabolites, daidzein and equol, affect production of interleukin-4 (IL-4), a pro-inflammatory cytokine closely associated with allergic immune response, in primary CD4+ T cells and EL4 T lymphoma cells. Formononetin, daidzein and equol significantly enhanced IL-4 production from both CD4+ T cells and EL4 cells in a dose-dependent manner. Formononetin, daidzein and equol also enhanced IL-4 gene promoter activity in EL4 cells transiently transfected with IL-4 gene promoter constructs, but this effect was impaired in EL4 cells transfected with an IL-4 promoter construct deleted of P4 site carrying nuclear factor of activated T cells (NF-AT) and activator protein-1 (AP-1) binding sites. In addition, formononetin, daidzein and equol increased AP-1 DNA binding activities while did not affect NF-AT DNA binding activities. The enhancing effects on IL-4 production and AP-1 DNA binding activities were abrogated by specific inhibitors for phosphatidylinositol-3-kinase (PI3K), protein kinase C (PKC) and p38 mitogen-activated protein kinase (MAPK), indicating that formononetin, daidzein and equol might enhance IL-4 production by increased activation of AP-1 through the PI3-K/PKC/p38 MAPK signalling pathway. These results suggest that phyto-oestrogens and some of their metabolites may increase allergic responses via the enhancement of IL-4 production in T cells. PMID:16108819

An Investigation of Molecular Docking and Molecular Dynamic Simulation on Imidazopyridines as B-Raf Kinase Inhibitors.

PubMed

Xie, Huiding; Li, Yupeng; Yu, Fang; Xie, Xiaoguang; Qiu, Kaixiong; Fu, Jijun

2015-11-16

In the recent cancer treatment, B-Raf kinase is one of key targets. Nowadays, a group of imidazopyridines as B-Raf kinase inhibitors have been reported. In order to investigate the interaction between this group of inhibitors and B-Raf kinase, molecular docking, molecular dynamic (MD) simulation and binding free energy (ΔGbind) calculation were performed in this work. Molecular docking was carried out to identify the key residues in the binding site, and MD simulations were performed to determine the detail binding mode. The results obtained from MD simulation reveal that the binding site is stable during the MD simulations, and some hydrogen bonds (H-bonds) in MD simulations are different from H-bonds in the docking mode. Based on the obtained MD trajectories, ΔGbind was computed by using Molecular Mechanics Generalized Born Surface Area (MM-GBSA), and the obtained energies are consistent with the activities. An energetic analysis reveals that both electrostatic and van der Waals contributions are important to ΔGbind, and the unfavorable polar solvation contribution results in the instability of the inhibitor with the lowest activity. These results are expected to understand the binding between B-Raf and imidazopyridines and provide some useful information to design potential B-Raf inhibitors.

Dissociation of the Tubulin-sequestering and Microtubule Catastrophe-promoting Activities of Oncoprotein 18/Stathmin

PubMed Central

Howell, Bonnie; Larsson, Niklas; Gullberg, Martin; Cassimeris, Lynne

1999-01-01

Oncoprotein 18/stathmin (Op18) has been identified recently as a protein that destabilizes microtubules, but the mechanism of destabilization is currently controversial. Based on in vitro microtubule assembly assays, evidence has been presented supporting conflicting destabilization models of either tubulin sequestration or promotion of microtubule catastrophes. We found that Op18 can destabilize microtubules by both of these mechanisms and that these activities can be dissociated by changing pH. At pH 6.8, Op18 slowed microtubule elongation and increased catastrophes at both plus and minus ends, consistent with a tubulin-sequestering activity. In contrast, at pH 7.5, Op18 promoted microtubule catastrophes, particularly at plus ends, with little effect on elongation rates at either microtubule end. Dissociation of tubulin-sequestering and catastrophe-promoting activities of Op18 was further demonstrated by analysis of truncated Op18 derivatives. Lack of a C-terminal region of Op18 (aa 100–147) resulted in a truncated protein that lost sequestering activity at pH 6.8 but retained catastrophe-promoting activity. In contrast, lack of an N-terminal region of Op18 (aa 5–25) resulted in a truncated protein that still sequestered tubulin at pH 6.8 but was unable to promote catastrophes at pH 7.5. At pH 6.8, both the full length and the N-terminal–truncated Op18 bound tubulin, whereas truncation at the C-terminus resulted in a pronounced decrease in tubulin binding. Based on these results, and a previous study documenting a pH-dependent change in binding affinity between Op18 and tubulin, it is likely that tubulin sequestering observed at lower pH resulted from the relatively tight interaction between Op18 and tubulin and that this tight binding requires the C-terminus of Op18; however, under conditions in which Op18 binds weakly to tubulin (pH 7.5), Op18 stimulated catastrophes without altering tubulin subunit association or dissociation rates, and Op18 did not depolymerize microtubules capped with guanylyl (α, β)-methylene diphosphonate–tubulin subunits. We hypothesize that weak binding between Op18 and tubulin results in free Op18, which is available to interact with microtubule ends and thereby promote catastrophes by a mechanism that likely involves GTP hydrolysis. PMID:9880330

A Single Amino Acid Substitution in the Active Site of Escherichia coli Aspartate Transcarbamoylase Prevents the Allosteric Transition

PubMed Central

Stieglitz, Kimberly A.; Pastra-Landis, Styliani C.; Xia, Jiarong; Tsuruta, Hiro; Kantrowitz, Evan R.

2005-01-01

Modeling of the tetrahedral intermediate within the active site of Escherichia coli aspartate transcarbamoylase revealed a specific interaction with the side chain of Gln137, an interaction not previously observed in the structure of the X-ray enzyme in the presence of N-phosphonacetyl-L-aspartate (PALA). Previous site-specific mutagenesis experiments showed that when Gln137 was replaced by alanine, the resulting mutant enzyme (Q137A) exhibited approximately 50-fold less activity than the wild-type enzyme, exhibited no homotropic cooperativity, and the binding of both carbamoyl phosphate and aspartate were extremely compromised. To elucidate the structural alterations in the mutant enzyme that might lead to such pronounced changes in kinetic and binding properties, the Q137A enzyme was studied by time-resolved small-angle X-ray scattering and its structure was determined in the presence of PALA to 2.7Å resolution. Time-resolved small-angle X-ray scattering established that the natural substrates, carbamoyl phosphate and L-aspartate, do not induce in the Q137A enzyme the same conformational changes as observed for the wild-type enzyme, although the scattering pattern of the Q137A and wild-type enzymes in the presence of PALA were identical. The overall structure of the Q137A enzyme is similar to that of the R-state structure of wild-type enzyme with PALA bound. However, there are differences in the manner by which the Q137A enzyme coordinates PALA, especially in the side chain positions of Arg105 and His134. The replacement of Gln137 by Ala also has a dramatic effect on the electrostatics of the active site. These data taken together suggest that the side chain of Gln137 in the wild-type enzyme is required for the binding of carbamoyl phosphate in the proper orientation so as to induce conformational changes required for the creation of the high-affinity aspartate binding site. The inability of carbamoyl phosphate to create the high-affinity binding site in the Q137A enzyme results in an enzyme locked in the low activity low affinity T state. These results emphasize the absolute requirement of the binding of carbamoyl phosphate for the creation of the high-affinity aspartate binding site and for inducing the homotropic cooperativity in aspartate transcarbamoylase. PMID:15890205

Interaction of flavonols with human serum albumin: a biophysical study showing structure-activity relationship and enhancement when coated on silver nanoparticles.

PubMed

Das, Pratyusa; Chaudhari, Sunil Kumar; Das, Asmita; Kundu, Somashree; Saha, Chabita

2018-04-24

Binding affinities of flavonols namely quercetin, myricetin, and kaempferol to human serum albumin (HSA) were determined fluorimetrically and the order was observed to be myricetin > quercetin > kaempferol demonstrating structure-activity relationship. Quercetin-coated silver nanoparticles (AgNPs) show higher binding affinity to HSA compared to free quercetin with binding constants 6.04 × 10 7  M -1 and 4.2 × 10 6  M -1 , respectively. Using site-specific markers it is concluded that free quercetin and that coated on AgNPs bind at different sites. Significant structural changes in circular dichroism (CD) spectra of HSA were recorded with quercetin-coated AgNPs compared to free quercetin. These results were further substantiated by time-resolved fluorescence spectroscopy where fluorescence life time of the tryptophan residue in HSA-quercetin-coated AgNPs complex decreased to 3.63 ns from 4.22 ns in HSA-quercetin complex. Isothermal calorimetric studies reveal two binding modes for quercetin-coated AgNPs and also higher binding constants compared to free quercetin. These higher binding affinities are attributed to altered properties of quercetin when coated on AgNPs enabling it to reach the binding sites other than site II where free quercetin mainly binds.

Impact of orientation of carbohydrate binding modules family 22 and 6 on the catalytic activity of Thermotoga maritima xylanase XynB.

PubMed

Tajwar, Razia; Shahid, Saher; Zafar, Rehan; Akhtar, Muhammad Waheed

2017-11-01

Xylanase XynB of the hyperthermophile Thermotoga maritima, which belongs to glycoside hydrolase family 10 (GH10), does not have an associated carbohydrate binding module (CBM) in the native state. CBM6 and CBM22 from a thermophile Clostridium thermocellum were fused to the catalytic domain of XynB (XynB-C) to determine the effects on activity and other properties. XynB-B22C and XynB-CB22, produced by fusing CBM22 to the N- and C-terminal of XynB-C, showed 1.7- and 3.24-fold increase in activity against the insoluble birchwood xylan, respectively. Similarly, CBM6 when attached to the C-terminal of XynB-C resulted in 2.0-fold increase in activity, whereas its attachment to the N-terminal did not show any increase of activity. XynB-B22C and XynB-CB22 retained all the activity, whereas XynB-B6C and XynB-CB6 lost 17 and 11% of activity, respectively, at 60°C for 4h. Thermostability data and the secondary structure contents obtained by molecular modelling are in agreement with the data from circular dichroism analysis. Molecular modelling analysis showed that the active site residues of the catalytic domain and the binding residues of CBM6 and CBM22 were located on the surface of molecule, except XynB-B6C, where the binding residues were found somewhat buried. In the case of XynB-CB22, the catalytic and the binding residues seem to be located favorably adjacent to each other, thus showing higher increase in activity. This study shows that the active site residues of the catalytic domain and the binding residues of the CBM are arranged in a unique fashion, not reported before. Copyright © 2017 Elsevier Inc. All rights reserved.

RACK1 binds to Smad3 to modulate transforming growth factor-beta1-stimulated alpha2(I) collagen transcription in renal tubular epithelial cells.

PubMed

Okano, Kazuhiro; Schnaper, H William; Bomsztyk, Karol; Hayashida, Tomoko

2006-09-08

Although it is clear that transforming growth factor-beta1 (TGF-beta1) is critical for renal fibrogenesis, the complexity of the involved mechanisms is increasingly apparent. TGF-beta1 stimulates phosphorylation of Smad2/3 and activates other signaling molecules as well. The molecular link between these other kinases and Smads is not known. We sought new binding partners for Smad3 in renal cells and identified receptor for activated protein kinase C 1 (RACK1) as a novel binding partner of Smad3. The linker region of Smad3 and the tryptophan-aspartic acid repeat 6 and 7 of RACK1 are sufficient for the association. RACK1 also interacts with Smad3 in the human kidney epithelial cell line, HKC. Silencing RACK1 increases transcriptional activity of TGF-beta1-responsive promoter sequences of the Smad binding element (SBE), p3TP-Lux, and alpha2(I) collagen. Conversely, overexpressed RACK1 negatively modulates alpha2(I) collagen transcriptional activity in TGF-beta1-stimulated cells. RACK1 did not affect phosphorylation of Smad3 at the C terminus or in the linker region. However, RACK1 reduced direct binding of Smad3 to the SBE motif. Mutating a RACK1 tyrosine at residue 246, but not at 228, decreased the inhibitory effect of RACK1 on both alpha2(I) collagen promoter activity and Smad binding to SBE induced by TGF-beta1. These results suggest that RACK1 modulates transcription of alpha2(I) collagen by TGF-beta1 through interference with Smad3 binding to the gene promoter.

Replication initiator protein RepE of mini-F plasmid: functional differentiation between monomers (initiator) and dimers (autogenous repressor).

PubMed Central

Ishiai, M; Wada, C; Kawasaki, Y; Yura, T

1994-01-01

Replication of mini-F plasmid requires the plasmid-encoded RepE initiator protein and several host factors including DnaJ, DnaK, and GrpE, heat shock proteins of Escherichia coli. The RepE protein plays a crucial role in replication and exhibits two major functions: initiation of replication from the origin, ori2, and autogenous repression of repE transcription. One of the mini-F plasmid mutants that can replicate in the dnaJ-defective host produces an altered RepE (RepE54) with a markedly enhanced initiator activity but little or no repressor activity. RepE54 has been purified from cell extracts primarily in monomeric form, unlike the wild-type RepE that is recovered in dimeric form. Gel-retardation assays revealed that RepE54 monomers bind to ori2 (direct repeats) with a very high efficiency but hardly bind to the repE operator (inverted repeat), in accordance with the properties of RepE54 in vivo. Furthermore, the treatment of wild-type RepE dimers with protein denaturants enhanced their binding to ori2 but reduced binding to the operator: RepE dimers were partially converted to monomers, and the ori2 binding activity was uniquely associated with monomers. These results strongly suggest that RepE monomers represent an active form by binding to ori2 to initiate replication, whereas dimers act as an autogenous repressor by binding to the operator. We propose that RepE is structurally and functionally differentiated and that monomerization of RepE dimers, presumably mediated by heat shock protein(s), activates the initiator function and participates in regulation of mini-F DNA replication. Images PMID:8170998

Analysis of DNA binding by human factor xeroderma pigmentosum complementation group A (XPA) provides insight into its interactions with nucleotide excision repair substrates.

PubMed

Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J

2017-10-13

Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

One amino acid in mouse activated factor VII defines its endothelial protein C receptor (EPCR) binding and modulates its EPCR-dependent hemostatic activity in vivo.

PubMed

Pavani, G; Zintner, S M; Ivanciu, L; Small, J C; Stafford, K A; Szeto, J H; Margaritis, P

2017-03-01

Essentials The lack of factor (F) VIIa-endothelial protein C receptor (EPCR) binding in mice is unresolved. A single substitution of Leu4 to Phe in mouse FVIIa (mFVIIa) enables its interaction with EPCR. mFVIIa with a Phe4 shows EPCR binding-dependent enhanced hemostatic function in vivo vs. mFVIIa. Defining the FVIIa-EPCR interaction in mice allows for further investigating its biology in vivo. Background Human activated factor VII (hFVIIa), which is used in hemophilia treatment, binds to the endothelial protein C (PC) receptor (EPCR) with unclear hemostatic consequences. Interestingly, mice lack the activated FVII (FVIIa)-EPCR interaction. Therefore, to investigate the hemostatic consequences of this interaction in hemophilia, we previously engineered a mouse FVIIa (mFVIIa) molecule that bound mouse EPCR (mEPCR) by using three substitutions from mouse PC (mPC), i.e. Leu4→Phe, Leu8→Met, and Trp9→Arg. The resulting molecule, mFVIIa-FMR, modeled the EPCR-binding properties of hFVIIa and showed enhanced hemostatic capacity in hemophilic mice versus mFVIIa. These data implied a role of EPCR in the action of hFVIIa in hemophilia treatment. However, the substitutions in mFVIIa-FMR only broadly defined the sequence determinants for its mEPCR interaction and enhanced function in vivo. Objectives To determine the individual contributions of mPC Phe4, Met8 and Arg9 to the in vitro/in vivo properties of mFVIIa-FMR. Methods The mEPCR-binding properties of single amino acid variants of mFVIIa or mPC at position 4, 8 or 9 were investigated. Results and conclusions Phe4 in mFVIIa or mPC was solely critical for interaction with mEPCR. In hemophilic mice, administration of mFVIIa harboring a Phe4 resulted in a 1.9-2.5-fold increased hemostatic capacity versus mFVIIa that was EPCR binding-dependent. This recapitulated previous observations made with triple-mutant mFVIIa-FMR. As Leu8 is crucial for hFVIIa-EPCR binding, we describe the sequence divergence of this interaction in mice, now allowing its further characterization in vivo. We also illustrate that modulation of the EPCR-FVIIa interaction may lead to improved FVIIa therapeutics. © 2016 International Society on Thrombosis and Haemostasis.

Predictive Modeling of Estrogen Receptor Binding Agents Using Advanced Cheminformatics Tools and Massive Public Data.

PubMed

Ribay, Kathryn; Kim, Marlene T; Wang, Wenyi; Pinolini, Daniel; Zhu, Hao

2016-03-01

Estrogen receptors (ERα) are a critical target for drug design as well as a potential source of toxicity when activated unintentionally. Thus, evaluating potential ERα binding agents is critical in both drug discovery and chemical toxicity areas. Using computational tools, e.g., Quantitative Structure-Activity Relationship (QSAR) models, can predict potential ERα binding agents before chemical synthesis. The purpose of this project was to develop enhanced predictive models of ERα binding agents by utilizing advanced cheminformatics tools that can integrate publicly available bioassay data. The initial ERα binding agent data set, consisting of 446 binders and 8307 non-binders, was obtained from the Tox21 Challenge project organized by the NIH Chemical Genomics Center (NCGC). After removing the duplicates and inorganic compounds, this data set was used to create a training set (259 binders and 259 non-binders). This training set was used to develop QSAR models using chemical descriptors. The resulting models were then used to predict the binding activity of 264 external compounds, which were available to us after the models were developed. The cross-validation results of training set [Correct Classification Rate (CCR) = 0.72] were much higher than the external predictivity of the unknown compounds (CCR = 0.59). To improve the conventional QSAR models, all compounds in the training set were used to search PubChem and generate a profile of their biological responses across thousands of bioassays. The most important bioassays were prioritized to generate a similarity index that was used to calculate the biosimilarity score between each two compounds. The nearest neighbors for each compound within the set were then identified and its ERα binding potential was predicted by its nearest neighbors in the training set. The hybrid model performance (CCR = 0.94 for cross validation; CCR = 0.68 for external prediction) showed significant improvement over the original QSAR models, particularly for the activity cliffs that induce prediction errors. The results of this study indicate that the response profile of chemicals from public data provides useful information for modeling and evaluation purposes. The public big data resources should be considered along with chemical structure information when predicting new compounds, such as unknown ERα binding agents.

Mechanism of curcumin-induced trypsin inhibition: Computational and experimental studies

NASA Astrophysics Data System (ADS)

Wang, Yan-Qing; Zhang, Hong-Mei; Kang, Yi-Jun; Gu, Yun-Lan; Cao, Jian

2016-03-01

In the present study, the experimental and theoretical methods were used to analyze the binding interaction of food dye, curcumin with trypsin. The results of fluorescence spectroscopic measurements indicated that curcumin binding resulted in the obviously intrinsic fluorescence quenching with the increase concentration of curcumin. This binding interaction is a spontaneous process with the estimated enthalpy and entropy changes being -15.70 kJ mol-1 and 40.25 J mol-1 K-1, respectively. Hydrogen bonds and hydrophobic forces played an important role in the complex formation between curcumin and trypsin. Moreover, curcumin could enter into the primary substrate-binding pocket and makes the activity of trypsin decrease remarkably with the increasing concentration of curcumin.

Computational study concerning the effect of some pesticides on the Proteus Mirabilis catalase activity

NASA Astrophysics Data System (ADS)

Isvoran, Adriana

2016-03-01

Assessment of the effects of the herbicides nicosulfuron and chlorsulfuron and the fungicides difenoconazole and drazoxlone upon catalase produced by soil microorganism Proteus mirabilis is performed using the molecular docking technique. The interactions of pesticides with the enzymes are predicted using SwissDock and PatchDock docking tools. There are correlations for predicted binding energy values for enzyme-pesticide complexes obtained using the two docking tools, all the considered pesticides revealing favorable binding to the enzyme, but only the herbicides bind to the catalytic site. These results suggest the inhibitory potential of chlorsulfuron and nicosulfuron on the catalase activity in soil.

Protein-Binding RNA Aptamers Affect Molecular Interactions Distantly from Their Binding Sites

PubMed Central

Dupont, Daniel M.; Thuesen, Cathrine K.; Bøtkjær, Kenneth A.; Behrens, Manja A.; Dam, Karen; Sørensen, Hans P.; Pedersen, Jan S.; Ploug, Michael; Jensen, Jan K.; Andreasen, Peter A.

2015-01-01

Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless, there are only a few studies on the molecular basis underlying aptamer-protease interactions and the associated mechanisms of inhibition. In the present study, we use site-directed mutagenesis to delineate the binding sites of two 2´-fluoropyrimidine RNA aptamers (upanap-12 and upanap-126) with therapeutic potential, both binding to the serine protease urokinase-type plasminogen activator (uPA). We determine the subsequent impact of aptamer binding on the well-established molecular interactions (plasmin, PAI-1, uPAR, and LRP-1A) controlling uPA activities. One of the aptamers (upanap-126) binds to the area around the C-terminal α-helix in pro-uPA, while the other aptamer (upanap-12) binds to both the β-hairpin of the growth factor domain and the kringle domain of uPA. Based on the mapping studies, combined with data from small-angle X-ray scattering analysis, we construct a model for the upanap-12:pro-uPA complex. The results suggest and highlight that the size and shape of an aptamer as well as the domain organization of a multi-domain protein such as uPA, may provide the basis for extensive sterical interference with protein ligand interactions considered distant from the aptamer binding site. PMID:25793507

Electrostatic steering and ionic tethering in enzyme–ligand binding: Insights from simulations

PubMed Central

Wade, Rebecca C.; Gabdoulline, Razif R.; Lüdemann, Susanna K.; Lounnas, Valère

1998-01-01

To bind at an enzyme’s active site, a ligand must diffuse or be transported to the enzyme’s surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and β-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as “ionic tethering.” We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme’s surroundings even when the substrate is nonpolar. PMID:9600896

Brain functional network connectivity based on a visual task: visual information processing-related brain regions are significantly activated in the task state.

PubMed

Yang, Yan-Li; Deng, Hong-Xia; Xing, Gui-Yang; Xia, Xiao-Luan; Li, Hai-Fang

2015-02-01

It is not clear whether the method used in functional brain-network related research can be applied to explore the feature binding mechanism of visual perception. In this study, we investigated feature binding of color and shape in visual perception. Functional magnetic resonance imaging data were collected from 38 healthy volunteers at rest and while performing a visual perception task to construct brain networks active during resting and task states. Results showed that brain regions involved in visual information processing were obviously activated during the task. The components were partitioned using a greedy algorithm, indicating the visual network existed during the resting state. Z-values in the vision-related brain regions were calculated, confirming the dynamic balance of the brain network. Connectivity between brain regions was determined, and the result showed that occipital and lingual gyri were stable brain regions in the visual system network, the parietal lobe played a very important role in the binding process of color features and shape features, and the fusiform and inferior temporal gyri were crucial for processing color and shape information. Experimental findings indicate that understanding visual feature binding and cognitive processes will help establish computational models of vision, improve image recognition technology, and provide a new theoretical mechanism for feature binding in visual perception.

Aptamer-based liposomes improve specific drug loading and release.

PubMed

Plourde, Kevin; Derbali, Rabeb Mouna; Desrosiers, Arnaud; Dubath, Céline; Vallée-Bélisle, Alexis; Leblond, Jeanne

2017-04-10

Aptamer technology has shown much promise in cancer therapeutics for its targeting abilities. However, its potential to improve drug loading and release from nanocarriers has not been thoroughly explored. In this study, we employed drug-binding aptamers to actively load drugs into liposomes. We designed a series of DNA aptamer sequences specific to doxorubicin, displaying multiple binding sites and various binding affinities. The binding ability of aptamers was preserved when incorporated into cationic liposomes, binding up to 15equivalents of doxorubicin per aptamer, therefore drawing the drug into liposomes. Optimization of the charge and drug/aptamer ratios resulted in ≥80% encapsulation efficiency of doxorubicin, ten times higher than classical passively-encapsulating liposomal formulations and similar to a pH-gradient active loading strategy. In addition, kinetic release profiles and cytotoxicity assay on HeLa cells demonstrated that the release and therapeutic efficacy of liposomal doxorubicin could be controlled by the aptamer's structure. Our results suggest that the aptamer exhibiting a specific intermediate affinity is the best suited to achieve high drug loading while maintaining efficient drug release and therapeutic activity. This strategy was successfully applied to tobramycin, a hydrophilic drug suffering from low encapsulation into liposomes, where its loading was improved six-fold using aptamers. Overall, we demonstrate that aptamers could act, in addition to their targeting properties, as multifunctional excipients for liposomal formulations. Copyright © 2017 Elsevier B.V. All rights reserved.

The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo

Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less

Action of insecticidal N-alkylamides at site 2 of the voltage-sensitive sodium channel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ottea, J.A.; Payne, G.T.; Soderlund, D.M.

1990-08-01

Nine synthetic N-alkylamides were examined as inhibitors of the specific binding of ({sup 3}H)batrachotoxinin A 20{alpha}-benzoate (({sup 3}H)BTX-B) to sodium channels and as activators of sodium uptake in mouse brain synaptoneurosomes. In the presence of scorpion (Leiurus quinquestriatus) venom, the six insecticidal analogues were active as both inhibitors of ({sup 3}H)BTX-B binding and stimulators of sodium uptake. These findings are consistent with an action of these compounds at the alkaloid activator recognition site (site 2) of the voltage-sensitive sodium channel. The three noninsecticidal N-alkylamides also inhibited ({sup 3}H)BTX-B binding but were ineffective as activators of sodium uptake. Concentration-response studies revealedmore » that some of the insecticidal amides also enhanced sodium uptake through a second, high-affinity interaction that does not involve site 2, but this secondary effect does not appear to be correlated with insecticidal activity. The activities of N-alkylamides as sodium channel activators were influenced by the length of the alkenyl chain and the location of unsaturation within the molecule. These results further define the actions of N-alkylamides on sodium channels and illustrate the significance of the multiple binding domains of the sodium channel as target sites for insect control agents.« less

Ubiquitin vinyl methyl ester binding orients the misaligned active site of the ubiquitin hydrolase UCHL1 into productive conformation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boudreaux, David A.; Maiti, Tushar K.; Davies, Christopher W.

Ubiquitin carboxy-terminal hydrolase L1 (UCHL1) is a Parkinson disease-associated, putative cysteine protease found abundantly and selectively expressed in neurons. The crystal structure of apo UCHL1 showed that the active-site residues are not aligned in a canonical form, with the nucleophilic cysteine being 7.7 {angstrom} from the general base histidine, an arrangement consistent with an inactive form of the enzyme. Here we report the crystal structures of the wild type and two Parkinson disease-associated variants of the enzyme, S18Y and I93M, bound to a ubiquitin-based suicide substrate, ubiquitin vinyl methyl ester. These structures reveal that ubiquitin vinyl methyl ester binds primarilymore » at two sites on the enzyme, with its carboxy terminus at the active site and with its amino-terminal {beta}-hairpin at the distal site - a surface-exposed hydrophobic crevice 17 {angstrom} away from the active site. Binding at the distal site initiates a cascade of side-chain movements in the enzyme that starts at a highly conserved, surface-exposed phenylalanine and is relayed to the active site resulting in the reorientation and proximal placement of the general base within 4 {angstrom} of the catalytic cysteine, an arrangement found in productive cysteine proteases. Mutation of the distal-site, surface-exposed phenylalanine to alanine reduces ubiquitin binding and severely impairs the catalytic activity of the enzyme. These results suggest that the activity of UCHL1 may be regulated by its own substrate.« less

Differential processing of the two subunits of human choriogonadotropin (hCG) by granulosa cells. I. Preparation and characterization of selectively labeled hCG

DOE Office of Scientific and Technical Information (OSTI.GOV)

Landefeld, T.D.; Byrne, M.D.; Campbell, K.L.

1981-12-01

The alpha- and beta-subunits of hCG were radioiodinated and recombined with unlabeled complementary subunits. The resultant recombined hormones, selectively labeled in either the alpha- or beta-subunit, were separated from unrecombined subunit by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, extracted with Triton X-100, and characterized by binding analysis. The estimates of maximum binding (active fraction) of the two resultant selectively labeled, recombined hCG preparations, determined with excess receptor were 0.41 and 0.59. These values are similar to those obtained when hCG is labeled as an intact molecule. The specific activities of the recombined preparations were estimated by four different methods, and themore » resulting values were used in combination with the active fraction estimates to determine the concentrations of active free and bound hormone. Binding analyses were run using varying concentrations of both labeled and unlabeled hormone. Estimates of the equilibrium dissociation binding constant (Kd) and receptor capacity were calculated in three different ways. The mean estimates of capacity (52.6 and 52.7 fmol/mg tissue) and Kd (66.6 and 65.7 pM) for the two preparations were indistinguishable. Additionally, these values were similar to values reported previously for hCG radioiodinated as an intact molecule. The availability of well characterized, selectively labeled hCG preparations provides new tools for studying the mechanism of action and the target cell processing of the subunits of this hormone.« less

Targeting Self-Binding Peptides as a Novel Strategy To Regulate Protein Activity and Function: A Case Study on the Proto-oncogene Tyrosine Protein Kinase c-Src.

PubMed

Bai, Zhengya; Hou, Shasha; Zhang, Shilei; Li, Zhongyan; Zhou, Peng

2017-04-24

Previously, we have reported a new biomolecular phenomenon spanning between protein folding and binding, termed as self-binding peptides (SBPs), where a short peptide segment in monomeric protein functions as a molecular switch by dynamically binding to/unbinding from its cognate domain in the monomer (Yang et al. J. Chem. Inf. 2015, 55, 329-342). Here, we attempt to raise the SBP as a new class of druggable targets to regulate the biological activity and function of proteins. A case study was performed on the proto-oncogene nonreceptor tyrosine kinase, c-Src, which contains two SBPs that bind separately to SH3 and SH2 domains of the kinase. State-of-the-art molecular dynamics (MD) simulations and post binding energetics analysis revealed that disrupting the kinase-intramolecular interactions of SH3 and SH2 domains with their cognate SBP ligands can result in totally different effects on the structural dynamics of c-Src kinase architecture; targeting the SH2 domain unlocks the autoinhibitory form of the kinase-this is very similar to the pTyr527 dephosphorylation that functionally activates the kinase, whereas targeting the SH3 domain can only release the domain from the tightly packed kinase but has a moderate effect on the kinase activity. Subsequently, based on the cognate SBP sequence we computationally designed a number of SH2-binding phosphopeptides using a motif grafting strategy. Fluorescence polarization (FP) assay observed that most of the designed phosphopeptides have higher binding affinity to SH2 domain as compared to the native SBP segment (K d = 53 nM). Kinase assay identified a typical dose-response relationship of phosphopeptides against kinase activation, substantiating that disruption of SH2-SBP interaction can mimic c-Src dephosphorylation and activate the kinase. Two rationally designed phosphopeptides, namely EPQpYEEIEN and EPQpYEELEN, were determined as strong binders of SH2 domain (K d = 8.3 and 15 nM, respectively) and potent activators of c-Src kinase (EC 50 = 3.2 and 41 μM, respectively).

Nuclear factor Y regulates ancient budgerigar hepadnavirus core promoter activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, Zhongliang; Liu, Yanfeng; Luo, Mengjun

Endogenous viral elements (EVE) in animal genomes are the fossil records of ancient viruses and provide invaluable information on the origin and evolution of extant viruses. Extant hepadnaviruses include avihepadnaviruses of birds and orthohepadnaviruses of mammals. The core promoter (Cp) of hepadnaviruses is vital for viral gene expression and replication. We previously identified in the budgerigar genome two EVEs that contain the full-length genome of an ancient budgerigar hepadnavirus (eBHBV1 and eBHBV2). Here, we found eBHBV1 Cp and eBHBV2 Cp were active in several human and chicken cell lines. A region from nt −85 to −11 in eBHBV1 Cp was critical formore » the promoter activity. Bioinformatic analysis revealed a putative binding site of nuclear factor Y (NF-Y), a ubiquitous transcription factor, at nt −64 to −50 in eBHBV1 Cp. The NF-Y core binding site (ATTGG, nt −58 to −54) was essential for eBHBV1 Cp activity. The same results were obtained with eBHBV2 Cp and duck hepatitis B virus Cp. The subunit A of NF-Y (NF-YA) was recruited via the NF-Y core binding site to eBHBV1 Cp and upregulated the promoter activity. Finally, the NF-Y core binding site is conserved in the Cps of all the extant avihepadnaviruses but not of orthohepadnaviruses. Interestingly, a putative and functionally important NF-Y core binding site is located at nt −21 to −17 in the Cp of human hepatitis B virus. In conclusion, our findings have pinpointed an evolutionary conserved and functionally critical NF-Y binding element in the Cps of avihepadnaviruses. - Highlights: • Endogenous budgerigar hepadnavirus (eBHBV) core promoters (Cps) are active in cells. • NF-Y binding site exists in the Cps of eBHBVs and all the extant avihepadnaviruses. • NF-Y binding and mediated upregulation is critical for eBHBV Cp activity.« less

Oleic acid transfer from microsomes to egg lecithin liposomes: participation of fatty acid binding protein.

PubMed

Catalá, A; Avanzati, B

1983-11-01

Oleic acid transfer from microsomes or mitochondria to egg lecithin liposomes was stimulated by fatty acid binding protein. By gel filtration, it could be demonstrated that this protein incorporates oleic acid into liposomes. Fatty acid binding protein transfer activity was higher using microsomes rather than mitochondria, which suggests a selective interaction with different kinds of membranes. Transfer of oleic acid by this soluble protein is greater than that of stearic acid. The results indicate that fatty acid binding protein may participate in the intracellular transport of fatty acids.

Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

NASA Technical Reports Server (NTRS)

D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

2002-01-01

Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

Isolated receptor binding domains of HTLV-1 and HTLV-2 envelopes bind Glut-1 on activated CD4+ and CD8+ T cells

PubMed Central

Kinet, Sandrina; Swainson, Louise; Lavanya, Madakasira; Mongellaz, Cedric; Montel-Hagen, Amélie; Craveiro, Marco; Manel, Nicolas; Battini, Jean-Luc; Sitbon, Marc; Taylor, Naomi

2007-01-01

Background We previously identified the glucose transporter Glut-1, a member of the multimembrane-spanning facilitative nutrient transporter family, as a receptor for both HTLV-1 and HTLV-2. However, a recent report concluded that Glut-1 cannot serve as a receptor for HTLV-1 on CD4 T cells: This was based mainly on their inability to detect Glut-1 on this lymphocyte subset using the commercial antibody mAb1418. It was therefore of significant interest to thoroughly assess Glut-1 expression on CD4 and CD8 T cells, and its association with HTLV-1 and -2 envelope binding. Results As previously reported, ectopic expression of Glut-1 but not Glut-3 resulted in significantly augmented binding of tagged proteins harboring the receptor binding domains of either HTLV-1 or HTLV-2 envelope glycoproteins (H1RBD or H2RBD). Using antibodies raised against the carboxy-terminal peptide of Glut-1, we found that Glut-1 expression was significantly increased in both CD4 and CD8 cells following TCR stimulation. Corresponding increases in the binding of H1RBD as well as H2RBD, not detected on quiescent T cells, were observed following TCR engagement. Furthermore, increased Glut-1 expression was accompanied by a massive augmentation in glucose uptake in TCR-stimulated CD4 and CD8 lymphocytes. Finally, we determined that the apparent contradictory results obtained by Takenouchi et al were due to their monitoring of Glut-1 with a mAb that does not bind cells expressing endogenous Glut-1, including human erythrocytes that harbor 300,000 copies per cell. Conclusion Transfection of Glut-1 directly correlates with the capacities of HTLV-1 and HTLV-2 envelope-derived ligands to bind cells. Moreover, Glut-1 is induced by TCR engagement, resulting in massive increases in glucose uptake and binding of HTLV-1 and -2 envelopes to both CD4 and CD8 T lymphocytes. Therefore, Glut-1 is a primary binding receptor for HTLV-1 and HTLV-2 envelopes on activated CD4 as well as CD8 lymphocytes. PMID:17504522

Structure of the second RRM domain of Nrd1, a fission yeast MAPK target RNA binding protein, and implication for its RNA recognition and regulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kobayashi, Ayaho; Kanaba, Teppei; Satoh, Ryosuke

Highlights: •Solution structure of the second RRM of Nrd1 was determined. •RNA binding site of the second RRM was estimated. •Regulatory mechanism of RNA binding by phosphorylation is discussed. -- Abstract: Negative regulator of differentiation 1 (Nrd1) is known as a negative regulator of sexual differentiation in fission yeast. Recently, it has been revealed that Nrd1 also regulates cytokinesis, in which physical separation of the cell is achieved by a contractile ring comprising many proteins including actin and myosin. Cdc4, a myosin II light chain, is known to be required for cytokinesis. Nrd1 binds and stabilizes Cdc4 mRNA, and therebymore » suppressing the cytokinesis defects of the cdc4 mutants. Interestingly, Pmk1 MAPK phosphorylates Nrd1, resulting in markedly reduced RNA binding activity. Furthermore, Nrd1 localizes to stress granules in response to various stresses, and Pmk1 phosphorylation enhances the localization. Nrd1 consists of four RRM domains, although the mechanism by which Pmk1 regulates the RNA binding activity of Nrd1 is unknown. In an effort to delineate the relationship between Nrd1 structure and function, we prepared each RNA binding domain of Nrd1 and examined RNA binding to chemically synthesized oligo RNA using NMR. The structure of the second RRM domain of Nrd1 was determined and the RNA binding site on the second RRM domain was mapped by NMR. A plausible mechanism pertaining to the regulation of RNA binding activity by phosphorylation is also discussed.« less

Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

PubMed

Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

2016-01-04

The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.

Full trans–activation mediated by the immediate–early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence

PubMed Central

Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.

2015-01-01

The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315

Computational characterization of how the VX nerve agent binds human serum paraoxonase 1.

PubMed

Fairchild, Steven Z; Peterson, Matthew W; Hamza, Adel; Zhan, Chang-Guo; Cerasoli, Douglas M; Chang, Wenling E

2011-01-01

Human serum paraoxonase 1 (HuPON1) is an enzyme that can hydrolyze various chemical warfare nerve agents including VX. A previous study has suggested that increasing HuPON1's VX hydrolysis activity one to two orders of magnitude would make the enzyme an effective countermeasure for in vivo use against VX. This study helps facilitate further engineering of HuPON1 for enhanced VX-hydrolase activity by computationally characterizing HuPON1's tertiary structure and how HuPON1 binds VX. HuPON1's structure is first predicted through two homology modeling procedures. Docking is then performed using four separate methods, and the stability of each bound conformation is analyzed through molecular dynamics and solvated interaction energy calculations. The results show that VX's lone oxygen atom has a strong preference for forming a direct electrostatic interaction with HuPON1's active site calcium ion. Various HuPON1 residues are also detected that are in close proximity to VX and are therefore potential targets for future mutagenesis studies. These include E53, H115, N168, F222, N224, L240, D269, I291, F292, and V346. Additionally, D183 was found to have a predicted pKa near physiological pH. Given D183's location in HuPON1's active site, this residue could potentially act as a proton donor or accepter during hydrolysis. The results from the binding simulations also indicate that steered molecular dynamics can potentially be used to obtain accurate binding predictions even when starting with a closed conformation of a protein's binding or active site.

The Human Orphan Nuclear Receptor Tailless (TLX, NR2E1) Is Druggable

PubMed Central

Benod, Cindy; Villagomez, Rosa; Filgueira, Carly S.; Hwang, Peter K.; Leonard, Paul G.; Poncet-Montange, Guillaume; Rajagopalan, Senapathy; Fletterick, Robert J.; Gustafsson, Jan-Åke; Webb, Paul

2014-01-01

Nuclear receptors (NRs) are an important group of ligand-dependent transcriptional factors. Presently, no natural or synthetic ligand has been identified for a large group of orphan NRs. Small molecules to target these orphan NRs will provide unique resources for uncovering regulatory systems that impact human health and to modulate these pathways with drugs. The orphan NR tailless (TLX, NR2E1), a transcriptional repressor, is a major player in neurogenesis and Neural Stem Cell (NSC) derived brain tumors. No chemical probes that modulate TLX activity are available, and it is not clear whether TLX is druggable. To assess TLX ligand binding capacity, we created homology models of the TLX ligand binding domain (LBD). Results suggest that TLX belongs to an emerging class of NRs that lack LBD helices α1 and α2 and that it has potential to form a large open ligand binding pocket (LBP). Using a medium throughput screening strategy, we investigated direct binding of 20,000 compounds to purified human TLX protein and verified interactions with a secondary (orthogonal) assay. We then assessed effects of verified binders on TLX activity using luciferase assays. As a result, we report identification of three compounds (ccrp1, ccrp2 and ccrp3) that bind to recombinant TLX protein with affinities in the high nanomolar to low micromolar range and enhance TLX transcriptional repressive activity. We conclude that TLX is druggable and propose that our lead compounds could serve as scaffolds to derive more potent ligands. While our ligands potentiate TLX repressive activity, the question of whether it is possible to develop ligands to de-repress TLX activity remains open. PMID:24936658

The human orphan nuclear receptor tailless (TLX, NR2E1) is druggable.

PubMed

Benod, Cindy; Villagomez, Rosa; Filgueira, Carly S; Hwang, Peter K; Leonard, Paul G; Poncet-Montange, Guillaume; Rajagopalan, Senapathy; Fletterick, Robert J; Gustafsson, Jan-Åke; Webb, Paul

2014-01-01

Nuclear receptors (NRs) are an important group of ligand-dependent transcriptional factors. Presently, no natural or synthetic ligand has been identified for a large group of orphan NRs. Small molecules to target these orphan NRs will provide unique resources for uncovering regulatory systems that impact human health and to modulate these pathways with drugs. The orphan NR tailless (TLX, NR2E1), a transcriptional repressor, is a major player in neurogenesis and Neural Stem Cell (NSC) derived brain tumors. No chemical probes that modulate TLX activity are available, and it is not clear whether TLX is druggable. To assess TLX ligand binding capacity, we created homology models of the TLX ligand binding domain (LBD). Results suggest that TLX belongs to an emerging class of NRs that lack LBD helices α1 and α2 and that it has potential to form a large open ligand binding pocket (LBP). Using a medium throughput screening strategy, we investigated direct binding of 20,000 compounds to purified human TLX protein and verified interactions with a secondary (orthogonal) assay. We then assessed effects of verified binders on TLX activity using luciferase assays. As a result, we report identification of three compounds (ccrp1, ccrp2 and ccrp3) that bind to recombinant TLX protein with affinities in the high nanomolar to low micromolar range and enhance TLX transcriptional repressive activity. We conclude that TLX is druggable and propose that our lead compounds could serve as scaffolds to derive more potent ligands. While our ligands potentiate TLX repressive activity, the question of whether it is possible to develop ligands to de-repress TLX activity remains open.

The molecular mechanism for interaction of ceruloplasmin and myeloperoxidase

NASA Astrophysics Data System (ADS)

Bakhautdin, Bakytzhan; Bakhautdin, Esen Göksöy

2016-04-01

Ceruloplasmin (Cp) is a copper-containing ferroxidase with potent antioxidant activity. Cp is expressed by hepatocytes and activated macrophages and has been known as physiologic inhibitor of myeloperoxidase (MPO). Enzymatic activity of MPO produces anti-microbial agents and strong prooxidants such as hypochlorous acid and has a potential to damage host tissue at the sites of inflammation and infection. Thus Cp-MPO interaction and inhibition of MPO has previously been suggested as an important control mechanism of excessive MPO activity. Our aim in this study was to identify minimal Cp domain or peptide that interacts with MPO. We first confirmed Cp-MPO interaction by ELISA and surface plasmon resonance (SPR). SPR analysis of the interaction yielded 30 nM affinity between Cp and MPO. We then designed and synthesized 87 overlapping peptides spanning the entire amino acid sequence of Cp. Each of the peptides was tested whether it binds to MPO by direct binding ELISA. Two of the 87 peptides, P18 and P76 strongly interacted with MPO. Amino acid sequence analysis of identified peptides revealed high sequence and structural homology between them. Further structural analysis of Cp's crystal structure by PyMOL software unfolded that both peptides represent surface-exposed sites of Cp and face nearly the same direction. To confirm our finding we raised anti-P18 antisera in rabbit and demonstrated that this antisera disrupts Cp-MPO binding and rescues MPO activity. Collectively, our results confirm Cp-MPO interaction and identify two nearly identical sites on Cp that specifically bind MPO. We propose that inhibition of MPO by Cp requires two nearly identical sites on Cp to bind homodimeric MPO simultaneously and at an angle of at least 120 degrees, which, in turn, exerts tension on MPO and results in conformational change.

Impact of autoclave sterilization on the activity and structure of formulated heparin.

PubMed

Beaudet, Julie M; Weyers, Amanda; Solakyildirim, Kemal; Yang, Bo; Takieddin, Majde; Mousa, Shaker; Zhang, Fuming; Linhardt, Robert J

2011-08-01

The stability of a formulated heparin was examined during its sterilization by autoclaving. A new method to follow loss in heparin binding to the serine protease inhibitor, antithrombin III, and the serine protease, thrombin, was developed using a surface plasmon resonance competitive binding assay. This loss in binding affinity correlated well with loss in antifactor IIa (thrombin) activity as well as antifactor Xa activity as measured using conventional amidolytic assays. Autoclaving also resulted in a modest breakdown of the heparin backbone as confirmed by a slight reduction in number-averaged and weight-averaged molecular weight and an increase in polydispersity. Although no clear changes were observed by nuclear magnetic resonance spectroscopy, disaccharide composition analysis using high-performance liquid chromatography-electrospray ionization-mass spectrometry suggested that loss of selected sulfo groups had taken place. It is this sulfo group loss that probably accounts for a decrease in the binding of autoclaved heparin to antithrombin III and thrombin as well as the observed decrease in its amidolytic activity. Copyright © 2011 Wiley-Liss, Inc.

Membrane protein GARP is a receptor for latent TGF-beta on the surface of activated human Treg.

PubMed

Stockis, Julie; Colau, Didier; Coulie, Pierre G; Lucas, Sophie

2009-12-01

Human Treg and Th clones secrete the latent form of TGF-beta, in which the mature TGF-beta protein is bound to the latency-associated peptide (LAP), and is thereby prevented from binding to the TGF-beta receptor. We previously showed that upon TCR stimulation, human Treg clones but not Th clones produce active TGF-beta and bear LAP on their surface. Here, we show that latent TGF-beta, i.e. both LAP and mature TGF-beta, binds to glycoprotein A repetitions predominant (GARP), a transmembrane protein containing leucine rich repeats, which is present on the surface of stimulated Treg clones but not on Th clones. Membrane localization of latent TGF-beta mediated by binding to GARP may be necessary for the ability of Treg to activate TGF-beta upon TCR stimulation. However, it is not sufficient as lentiviral-mediated expression of GARP in human Th cells induces binding of latent TGF-beta to the cell surface, but does not result in the production of active TGF-beta upon stimulation of these Th cells.

An external sodium ion binding site controls allosteric gating in TRPV1 channels

PubMed Central

Jara-Oseguera, Andres; Bae, Chanhyung; Swartz, Kenton J

2016-01-01

TRPV1 channels in sensory neurons are integrators of painful stimuli and heat, yet how they integrate diverse stimuli and sense temperature remains elusive. Here, we show that external sodium ions stabilize the TRPV1 channel in a closed state, such that removing the external ion leads to channel activation. In studying the underlying mechanism, we find that the temperature sensors in TRPV1 activate in two steps to favor opening, and that the binding of sodium to an extracellular site exerts allosteric control over temperature-sensor activation and opening of the pore. The binding of a tarantula toxin to the external pore also exerts control over temperature-sensor activation, whereas binding of vanilloids influences temperature-sensitivity by largely affecting the open/closed equilibrium. Our results reveal a fundamental role of the external pore in the allosteric control of TRPV1 channel gating and provide essential constraints for understanding how these channels can be tuned by diverse stimuli. DOI: http://dx.doi.org/10.7554/eLife.13356.001 PMID:26882503

Monomerization of viral entry inhibitor griffithsin elucidates the relationship between multivalent binding to carbohydrates and anti-HIV activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moulaei, Tinoush; Shenoy, Shilpa R.; Giomarelli, Barbara

2010-10-28

Mutations were introduced to the domain-swapped homodimer of the antiviral lectin griffithsin (GRFT). Whereas several single and double mutants remained dimeric, insertion of either two or four amino acids at the dimerization interface resulted in a monomeric form of the protein (mGRFT). Monomeric character of the modified proteins was confirmed by sedimentation equilibrium ultracentrifugation and by their high resolution X-ray crystal structures, whereas their binding to carbohydrates was assessed by isothermal titration calorimetry. Cell-based antiviral activity assays utilizing different variants of mGRFT indicated that the monomeric form of the lectin had greatly reduced activity against HIV-1, suggesting that the antiviralmore » activity of GRFT stems from crosslinking and aggregation of viral particles via multivalent interactions between GRFT and oligosaccharides present on HIV envelope glycoproteins. Atomic resolution crystal structure of a complex between mGRFT and nonamannoside revealed that a single mGRFT molecule binds to two different nonamannoside molecules through all three carbohydrate-binding sites present on the monomer.« less

WAVE binds Ena/VASP for enhanced Arp2/3 complex–based actin assembly

PubMed Central

Havrylenko, Svitlana; Noguera, Philippe; Abou-Ghali, Majdouline; Manzi, John; Faqir, Fahima; Lamora, Audrey; Guérin, Christophe; Blanchoin, Laurent; Plastino, Julie

2015-01-01

The WAVE complex is the main activator of the Arp2/3 complex for actin filament nucleation and assembly in the lamellipodia of moving cells. Other important players in lamellipodial protrusion are Ena/VASP proteins, which enhance actin filament elongation. Here we examine the molecular coordination between the nucleating activity of the Arp2/3 complex and the elongating activity of Ena/VASP proteins for the formation of actin networks. Using an in vitro bead motility assay, we show that WAVE directly binds VASP, resulting in an increase in Arp2/3 complex–based actin assembly. We show that this interaction is important in vivo as well, for the formation of lamellipodia during the ventral enclosure event of Caenorhabditis elegans embryogenesis. Ena/VASP's ability to bind F-actin and profilin-complexed G-actin are important for its effect, whereas Ena/VASP tetramerization is not necessary. Our data are consistent with the idea that binding of Ena/VASP to WAVE potentiates Arp2/3 complex activity and lamellipodial actin assembly. PMID:25355952

An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.

PubMed

Lee, C K; Knipe, D M

1985-06-01

An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.

Functional importance of short-range binding and long-range solvent interactions in helical antifreeze peptides.

PubMed

Ebbinghaus, Simon; Meister, Konrad; Prigozhin, Maxim B; Devries, Arthur L; Havenith, Martina; Dzubiella, Joachim; Gruebele, Martin

2012-07-18

Short-range ice binding and long-range solvent perturbation both have been implicated in the activity of antifreeze proteins and antifreeze glycoproteins. We study these two mechanisms for activity of winter flounder antifreeze peptide. Four mutants are characterized by freezing point hysteresis (activity), circular dichroism (secondary structure), Förster resonance energy transfer (end-to-end rigidity), molecular dynamics simulation (structure), and terahertz spectroscopy (long-range solvent perturbation). Our results show that the short-range model is sufficient to explain the activity of our mutants, but the long-range model provides a necessary condition for activity: the most active peptides in our data set all have an extended dynamical hydration shell. It appears that antifreeze proteins and antifreeze glycoproteins have reached different evolutionary solutions to the antifreeze problem, utilizing either a few precisely positioned OH groups or a large quantity of OH groups for ice binding, assisted by long-range solvent perturbation. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

PubMed Central

2010-01-01

Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

Genetic study of the functional organization of the colicin E1 molecule.

PubMed Central

Suit, J L; Fan, M L; Kayalar, C; Luria, S E

1985-01-01

Colicin E1 fragments obtained by genetic manipulations of the ColE1 plasmid were tested for bactericidal activity, binding to bacterial cells, and reactions with a series of anticolicin monoclonal antibodies. Two of the fragments were also tested for ability to form channels in liposomal vesicles. The results are in agreement with studies from chemically and enzymatically derived colicin fragments, assigning the receptor binding activity to the central part of the molecule and the killing activity to a region near the carboxyl terminus. PMID:2579061

Identification of B. anthracis N(5)-carboxyaminoimidazole ribonucleotide mutase (PurE) active site binding compounds via fragment library screening.

PubMed

Lei, Hao; Jones, Christopher; Zhu, Tian; Patel, Kavankumar; Wolf, Nina M; Fung, Leslie W-M; Lee, Hyun; Johnson, Michael E

2016-02-15

The de novo purine biosynthesis pathway is an attractive target for antibacterial drug design, and PurE from this pathway has been identified to be crucial for Bacillus anthracis survival in serum. In this study we adopted a fragment-based hit discovery approach, using three screening methods-saturation transfer difference nucleus magnetic resonance (STD-NMR), water-ligand observed via gradient spectroscopy (WaterLOGSY) NMR, and surface plasmon resonance (SPR), against B. anthracis PurE (BaPurE) to identify active site binding fragments by initially testing 352 compounds in a Zenobia fragment library. Competition STD NMR with the BaPurE product effectively eliminated non-active site binding hits from the primary hits, selecting active site binders only. Binding affinities (dissociation constant, KD) of these compounds varied between 234 and 301μM. Based on test results from the Zenobia compounds, we subsequently developed and applied a streamlined fragment screening strategy to screen a much larger library consisting of 3000 computationally pre-selected fragments. Thirteen final fragment hits were confirmed to exhibit binding affinities varying from 14μM to 700μM, which were categorized into five different basic scaffolds. All thirteen fragment hits have ligand efficiencies higher than 0.30. We demonstrated that at least two fragments from two different scaffolds exhibit inhibitory activity against the BaPurE enzyme. Published by Elsevier Ltd.

Minimal determinants for binding activated G-alpha from the structure of a G-alpha-i1/peptide dimer†

PubMed Central

Johnston, Christopher A.; Lobanova, Ekaterina S.; Shavkunov, Alexander S.; Low, Justin; Ramer, J. Kevin; Blaesius, Rainer; Fredericks, Zoey; Willard, Francis S.; Kuhlman, Brian; Arshavsky, Vadim Y.; Siderovski, David P.

2008-01-01

G-proteins cycle between an inactive GDP-bound state and active GTP-bound state, serving as molecular switches that coordinate cellular signaling. We recently used phage-display to identify a series of peptides that bind Gα subunits in a nucleotide-dependent manner [Johnston, C. A., Willard, F. S., Jezyk, M. R., Fredericks, Z., Bodor, E. T., Jones, M. B., Blaesius, R., Watts, V. J., Harden, T. K., Sondek, J., Ramer, J. K., and Siderovski, D. P. (2005) Structure 13, 1069–1080]. Here we describe the structural features and functions of KB-1753, a peptide that binds selectively to GDP·AlF4−- and GTPγS-bound states of Gαi subunits. KB-1753 blocks interaction of Gαtransducin with its effector, cGMP phosphodiesterase, and inhibits transducin-mediated activation of cGMP degradation. Additionally, KB-1753 interferes with RGS protein binding and resultant GAP activity. A fluorescent KB-1753 variant was found to act as a sensor for activated Gα in vitro. The crystal structure of KB-1753 bound to Gαi1·GDP·AlF4− reveals binding to a conserved hydrophobic groove between switch II and α3 helices, and, along with supporting biochemical data and previous structural analyses, supports the notion that this is the site of effector interactions for Gαi subunits. PMID:16981699

In Silico Molecular Interaction of Bisphenol Analogues with Human Nuclear Receptors Reveals their Stronger Affinity vs. Classical Bisphenol A.

PubMed

Sharma, Shikha; Ahmad, Shahzad; Faraz Khan, Mohemmed; Parvez, Suhel; Raisuddin, Sheikh

2018-06-21

Bisphenol A (BPA) is known for endocrine disrupting activity. In order to replace BPA a number of bisphenol analogues have been designed. However, their activity profile is poorly described and little information exists about their endocrine disrupting potential and interactions with nuclear receptors. An understanding of such interaction may unravel mechanism of their molecular action and provide valuable inputs for risk assessment. BPA binds and activates peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) which act as transcription factors and regulate genes involved in glucose, lipid, and cholesterol metabolism and adipogenesis. We studied binding efficiency of 18 bisphenol analogues and BPA with human PPARs and RXRs. Using Maestro Schrodinger 9.4, docking scores of bisphenols were compared with the known endogenous and exogenous ligands of hPPARs and hRXRs. BPA showed good binding efficiency. Several analogues also showed higher binding efficiency than BPA. BPPH which has high tendency to be absorbed in tissues showed the strongest binding with hPPARα, hPPARβ, hPPARγ and hRXRα whereas two of the most toxic bisphenols, BPM and BPAF showed strongest binding with hRXRβ and hRXRγ. Some of the bisphenol analogues showed a stronger binding affinity with PPAR and RXR compared to BPA implying that BPA substitutes may not be fully safe and chemico-biological interactions indicate their toxic potential. These results may also serve to plan further studies for determining safety profile of bisphenol analogues and be helpful in risk characterization.

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

Measles virus fusion machinery activated by sialic acid binding globular domain.

PubMed

Talekar, Aparna; Moscona, Anne; Porotto, Matteo

2013-12-01

Paramyxoviruses, including the human pathogen measles virus (MV) and the avian Newcastle disease virus (NDV), enter host cells through fusion of the viral envelope with the target cell membrane. This fusion is driven by the concerted action of two viral envelope glycoproteins: the receptor binding protein and the fusion protein (F). The MV receptor binding protein (hemagglutinin [H]) attaches to proteinaceous receptors on host cells, while the receptor binding protein of NDV (hemagglutinin-neuraminidase [HN]) interacts with sialic acid-containing receptors. The receptor-bound HN/H triggers F to undergo conformational changes that render it competent to mediate fusion of the viral and cellular membranes. The mechanism of fusion activation has been proposed to be different for sialic acid-binding viruses and proteinaceous receptor-binding viruses. We report that a chimeric protein containing the NDV HN receptor binding region and the MV H stalk domain can activate MV F to fuse, suggesting that the signal to the stalk of a protein-binding receptor binding molecule can be transmitted from a sialic acid binding domain. By engineering the NDV HN globular domain to interact with a proteinaceous receptor, the fusion activation signal was preserved. Our findings are consistent with a unified mechanism of fusion activation, at least for the Paramyxovirinae subfamily, in which the receptor binding domains of the receptor binding proteins are interchangeable and the stalk determines the specificity of F activation.

Mechanism of Mediator recruitment by tandem Gcn4 activation domains and three Gal11 activator-binding domains.

PubMed

Herbig, Eric; Warfield, Linda; Fish, Lisa; Fishburn, James; Knutson, Bruce A; Moorefield, Beth; Pacheco, Derek; Hahn, Steven

2010-05-01

Targets of the tandem Gcn4 acidic activation domains in transcription preinitiation complexes were identified by site-specific cross-linking. The individual Gcn4 activation domains cross-link to three common targets, Gal11/Med15, Taf12, and Tra1, which are subunits of four conserved coactivator complexes, Mediator, SAGA, TFIID, and NuA4. The Gcn4 N-terminal activation domain also cross-links to the Mediator subunit Sin4/Med16. The contribution of the two Gcn4 activation domains to transcription was gene specific and varied from synergistic to less than additive. Gcn4-dependent genes had a requirement for Gal11 ranging from 10-fold dependence to complete Gal11 independence, while the Gcn4-Taf12 interaction did not significantly contribute to the expression of any gene studied. Complementary methods identified three conserved Gal11 activator-binding domains that bind each Gcn4 activation domain with micromolar affinity. These Gal11 activator-binding domains contribute additively to transcription activation and Mediator recruitment at Gcn4- and Gal11-dependent genes. Although we found that the conserved Gal11 KIX domain contributes to Gal11 function, we found no evidence of specific Gcn4-KIX interaction and conclude that the Gal11 KIX domain does not function by specific interaction with Gcn4. Our combined results show gene-specific coactivator requirements, a surprising redundancy in activator-target interactions, and an activator-coactivator interaction mediated by multiple low-affinity protein-protein interactions.

Metal-Induced Stabilization and Activation of Plasmid Replication Initiator RepB

PubMed Central

Ruiz-Masó, José A.; Bordanaba-Ruiseco, Lorena; Sanz, Marta; Menéndez, Margarita; del Solar, Gloria

2016-01-01

Initiation of plasmid rolling circle replication (RCR) is catalyzed by a plasmid-encoded Rep protein that performs a Tyr- and metal-dependent site-specific cleavage of one DNA strand within the double-strand origin (dso) of replication. The crystal structure of RepB, the initiator protein of the streptococcal plasmid pMV158, constitutes the first example of a Rep protein structure from RCR plasmids. It forms a toroidal homohexameric ring where each RepB protomer consists of two domains: the C-terminal domain involved in oligomerization and the N-terminal domain containing the DNA-binding and endonuclease activities. Binding of Mn2+ to the active site is essential for the catalytic activity of RepB. In this work, we have studied the effects of metal binding on the structure and thermostability of full-length hexameric RepB and each of its separate domains by using different biophysical approaches. The analysis of the temperature-induced changes in RepB shows that the first thermal transition, which occurs at a range of temperatures physiologically relevant for the pMV158 pneumococcal host, represents an irreversible conformational change that affects the secondary and tertiary structure of the protein, which becomes prone to self-associate. This transition, which is also shown to result in loss of DNA binding capacity and catalytic activity of RepB, is confined to its N-terminal domain. Mn2+ protects the protein from undergoing this detrimental conformational change and the observed protection correlates well with the high-affinity binding of the cation to the active site, as substituting one of the metal-ligands at this site impairs both the protein affinity for Mn2+and the Mn2+-driven thermostabilization effect. The level of catalytic activity of the protein, especially in the case of full-length RepB, cannot be explained based only on the high-affinity binding of Mn2+ at the active site and suggests the existence of additional, lower-affinity metal binding site(s), missing in the separate catalytic domain, that must also be saturated for maximal activity. The molecular bases of the thermostabilizing effect of Mn2+ on the N-terminal domain of the protein as well as the potential location of additional metal binding sites in the entire RepB are discussed. PMID:27709114

Structural Analysis on the Pathologic Mutant Glucocorticoid Receptor Ligand-Binding Domains.

PubMed

Hurt, Darrell E; Suzuki, Shigeru; Mayama, Takafumi; Charmandari, Evangelia; Kino, Tomoshige

2016-02-01

Glucocorticoid receptor (GR) gene mutations may cause familial or sporadic generalized glucocorticoid resistance syndrome. Most of the missense forms distribute in the ligand-binding domain and impair its ligand-binding activity and formation of the activation function (AF)-2 that binds LXXLL motif-containing coactivators. We performed molecular dynamics simulations to ligand-binding domain of pathologic GR mutants to reveal their structural defects. Several calculated parameters including interaction energy for dexamethasone or the LXXLL peptide indicate that destruction of ligand-binding pocket (LBP) is a primary character. Their LBP defects are driven primarily by loss/reduction of the electrostatic interaction formed by R611 and T739 of the receptor to dexamethasone and a subsequent conformational mismatch, which deacylcortivazol resolves with its large phenylpyrazole moiety and efficiently stimulates transcriptional activity of the mutant receptors with LBP defect. Reduced affinity of the LXXLL peptide to AF-2 is caused mainly by disruption of the electrostatic bonds to the noncore leucine residues of this peptide that determine the peptide's specificity to GR, as well as by reduced noncovalent interaction against core leucines and subsequent exposure of the AF-2 surface to solvent. The results reveal molecular defects of pathologic mutant receptors and provide important insights to the actions of wild-type GR.

Genome-wide survey of DNA-binding proteins in Arabidopsis thaliana: analysis of distribution and functions.

PubMed

Malhotra, Sony; Sowdhamini, Ramanathan

2013-08-01

The interaction of proteins with their respective DNA targets is known to control many high-fidelity cellular processes. Performing a comprehensive survey of the sequenced genomes for DNA-binding proteins (DBPs) will help in understanding their distribution and the associated functions in a particular genome. Availability of fully sequenced genome of Arabidopsis thaliana enables the review of distribution of DBPs in this model plant genome. We used profiles of both structure and sequence-based DNA-binding families, derived from PDB and PFam databases, to perform the survey. This resulted in 4471 proteins, identified as DNA-binding in Arabidopsis genome, which are distributed across 300 different PFam families. Apart from several plant-specific DNA-binding families, certain RING fingers and leucine zippers also had high representation. Our search protocol helped to assign DNA-binding property to several proteins that were previously marked as unknown, putative or hypothetical in function. The distribution of Arabidopsis genes having a role in plant DNA repair were particularly studied and noted for their functional mapping. The functions observed to be overrepresented in the plant genome harbour DNA-3-methyladenine glycosylase activity, alkylbase DNA N-glycosylase activity and DNA-(apurinic or apyrimidinic site) lyase activity, suggesting their role in specialized functions such as gene regulation and DNA repair.

The E7 oncoprotein associates with Mi2 and histone deacetylase activity to promote cell growth.

PubMed Central

Brehm, A; Nielsen, S J; Miska, E A; McCance, D J; Reid, J L; Bannister, A J; Kouzarides, T

1999-01-01

E7 is the main transforming protein of human papilloma virus type 16 (HPV16) which is implicated in the formation of cervical cancer. The transforming activity of E7 has been attributed to its interaction with the retinoblastoma (Rb) tumour suppressor. However, Rb binding is not sufficient for transformation by E7. Mutations within a zinc finger domain, which is dispensable for Rb binding, also abolish E7 transformation functions. Here we show that HPV16 E7 associates with histone deacetylase in vitro and in vivo, via its zinc finger domain. Using a genetic screen, we identify Mi2beta, a component of the recently identified NURD histone deacetylase complex, as a protein that binds directly to the E7 zinc finger. A zinc finger point mutant which is unable to bind Mi2beta and histone deacetylase but is still able to bind Rb fails to overcome cell cycle arrest in osteosarcoma cells. Our results suggest that the binding to a histone deacetylase complex is an important parameter for the growthpromoting activity of the human papilloma virus E7 protein. This provides the first indication that viral oncoproteins control cell proliferation by targeting deacetylation pathways. PMID:10228159

Pot binding as a variable confounding plant phenotype: theoretical derivation and experimental observations.

PubMed

Sinclair, Thomas R; Manandhar, Anju; Shekoofa, Avat; Rosas-Anderson, Pablo; Bagherzadi, Laleh; Schoppach, Remy; Sadok, Walid; Rufty, Thomas W

2017-04-01

Theoretical derivation predicted growth retardation due to pot water limitations, i.e., pot binding. Experimental observations were consistent with these limitations. Combined, these results indicate a need for caution in high-throughput screening and phenotyping. Pot experiments are a mainstay in many plant studies, including the current emphasis on developing high-throughput, phenotyping systems. Pot studies can be vulnerable to decreased physiological activity of the plants particularly when pot volume is small, i.e., "pot binding". It is necessary to understand the conditions under which pot binding may exist to avoid the confounding influence of pot binding in interpreting experimental results. In this paper, a derivation is offered that gives well-defined conditions for the occurrence of pot binding based on restricted water availability. These results showed that not only are pot volume and plant size important variables, but the potting media is critical. Artificial potting mixtures used in many studies, including many high-throughput phenotyping systems, are particularly susceptible to the confounding influences of pot binding. Experimental studies for several crop species are presented that clearly show the existence of thresholds of plant leaf area at which various pot sizes and potting media result in the induction of pot binding even though there may be no immediate, visual plant symptoms. The derivation and experimental results showed that pot binding can readily occur in plant experiments if care is not given to have sufficiently large pots, suitable potting media, and maintenance of pot water status. Clear guidelines are provided for avoiding the confounding effects of water-limited pot binding in studying plant phenotype.

(/sup 3/H)forskolin- and (/sup 3/H)dihydroalprenolol-binding sites and adenylate cyclase activity in heart of rats fed diets containing different oils

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alam, S.Q.; Ren, Y.F.; Alam, B.S.

1988-03-01

The characteristics of the cardiac adenylate cyclase system were studied in rats fed diets containing fish oil (menhaden oil) and other oils. Adenylate cyclase activity generally was higher in cardiac homogenates and membranes of rats fed diet containing 10% menhaden oil than in the other oils. The increase in enzyme activity, especially in forskolin-stimulated activity, was associated with an increase in the concentration of the (/sup 3/H) forskolin-binding sites in cardiac membranes of rats fed menhaden oil. The beta-adrenergic receptor concentration was not significantly altered although the affinity for (/sup 3/H)dihydroalprenolol-binding was lower in membranes of rats fed menhaden oilmore » than those fed the other oils. omega-3 fatty acids from menhaden oil were incorporated into the cardiac membrane phospholipids. The results suggest that the observed increase in myocardial adenylate cyclase activity of rats fed menhaden oil may be due to an increase in the number of the catalytic subunits of the enzyme or due to a greater availability of the forskolin-binding sites.« less

Tauroursodeoxycholic acid binds to the G-protein site on light activated rhodopsin.

PubMed

Lobysheva, E; Taylor, C M; Marshall, G R; Kisselev, O G

2018-05-01

The heterotrimeric G-protein binding site on G-protein coupled receptors remains relatively unexplored regarding its potential as a new target of therapeutic intervention or as a secondary site of action by the existing drugs. Tauroursodeoxycholic acid bears structural resemblance to several compounds that were previously identified to specifically bind to the light-activated form of the visual receptor rhodopsin and to inhibit its activation of transducin. We show that TUDCA stabilizes the active form of rhodopsin, metarhodopsin II, and does not display the detergent-like effects of common amphiphilic compounds that share the cholesterol scaffold structure, such as deoxycholic acid. Computer docking of TUDCA to the model of light-activated rhodopsin revealed that it interacts using similar mode of binding to the C-terminal domain of transducin alpha subunit. The ring regions of TUDCA made hydrophobic contacts with loop 3 region of rhodopsin, while the tail of TUDCA is exposed to solvent. The results show that TUDCA interacts specifically with rhodopsin, which may contribute to its wide-ranging effects on retina physiology and as a potential therapeutic compound for retina degenerative diseases. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Berberine Suppresses Adipocyte Differentiation via Decreasing CREB Transcriptional Activity

PubMed Central

Deng, Ruyuan; Wang, Ning; Zhang, Yuqing; Wang, Yao; Liu, Yun; Li, Fengying; Wang, Xiao; Zhou, Libin

2015-01-01

Berberine, one of the major constituents of Chinese herb Rhizoma coptidis, has been demonstrated to lower blood glucose, blood lipid, and body weight in patients with type 2 diabetes mellitus. The anti-obesity effect of berberine has been attributed to its anti-adipogenic activity. However, the underlying molecular mechanism remains largely unknown. In the present study, we found that berberine significantly suppressed the expressions of CCAAT/enhancer-binding protein (C/EBP)α, peroxisome proliferators-activated receptor γ2 (PPARγ2), and other adipogenic genes in the process of adipogenesis. Berberine decreased cAMP-response element-binding protein (CREB) phosphorylation and C/EBPβ expression at the early stage of 3T3-L1 preadipocyte differentiation. In addition, CREB phosphorylation and C/EBPβ expression induced by 3-isobutyl-1-methylxanthine (IBMX) and forskolin were also attenuated by berberine. The binding activities of cAMP responsive element (CRE) stimulated by IBMX and forskolin were inhibited by berberine. The binding of phosphorylated CREB to the promoter of C/EBPβ was abrogated by berberine after the induction of preadipocyte differentiation. These results suggest that berberine blocks adipogenesis mainly via suppressing CREB activity, which leads to a decrease in C/EBPβ-triggered transcriptional cascades. PMID:25928058

4′-O-substitutions determine selectivity of aminoglycoside antibiotics

PubMed Central

Perez-Fernandez, Déborah; Shcherbakov, Dmitri; Matt, Tanja; Leong, Ng Chyan; Kudyba, Iwona; Duscha, Stefan; Boukari, Heithem; Patak, Rashmi; Dubbaka, Srinivas Reddy; Lang, Kathrin; Meyer, Martin; Akbergenov, Rashid; Freihofer, Pietro; Vaddi, Swapna; Thommes, Pia; Ramakrishnan, V.; Vasella, Andrea; Böttger, Erik C.

2014-01-01

Clinical use of 2-deoxystreptamine aminoglycoside antibiotics, which target the bacterial ribosome, is compromised by adverse effects related to limited drug selectivity. Here we present a series of 4′,6′-O-acetal and 4′-O-ether modifications on glucopyranosyl ring I of aminoglycosides. Chemical modifications were guided by measuring interactions between the compounds synthesized and ribosomes harbouring single point mutations in the drug-binding site, resulting in aminoglycosides that interact poorly with the drug-binding pocket of eukaryotic mitochondrial or cytosolic ribosomes. Yet, these compounds largely retain their inhibitory activity for bacterial ribosomes and show antibacterial activity. Our data indicate that 4′-O-substituted aminoglycosides possess increased selectivity towards bacterial ribosomes and little activity for any of the human drug-binding pockets. PMID:24473108

Sirt3 binds to and deacetylates mitochondrial pyruvate carrier 1 to enhance its activity.

PubMed

Liang, Lei; Li, Qingguo; Huang, Liyong; Li, Dawei; Li, Xinxiang

2015-12-25

Mitochondrial pyruvate carrier (MPC), composed of MPC1 and MPC2, can modulate pyruvate oxidation in mitochondrial and MPC1 expression correlates with poor prognosis of multiple cancers. Here, we reported that MPC1 is acetylated and its main acetylation sites are: K45 and K46. Sirt3 binds to and deacetylates MPC1. High glucose decreases MPC1 acetylation level by increasing Sirt3-MPC1 binding. Furthermore, acetylation mimic mutation of MPC1 reduces it activity and abolishes its function in inhibition of colon cancer cell growth. These results reveal a novel post-translational regulation of MPC1 by Sirt3, which is important for its activity and colon cancer cell growth. Copyright © 2015 Elsevier Inc. All rights reserved.

Partial agonist/antagonist mouse interleukin-2 proteins indicate that a third component of the receptor complex functions in signal transduction.

PubMed Central

Zurawski, S M; Imler, J L; Zurawski, G

1990-01-01

Some mouse interleukin-2 (mIL-2) proteins with substitutions at residue Gln141 are unable to trigger a maximal biological response. The Asp141 protein induces the lowest maximal response. The Asp141 protein can weakly antagonize the biological activity of mIL-2 and strongly antagonizes the biological activity of active mIL-2 mutant proteins that have defects in interactions with the high affinity receptor. Residue 141 mutant proteins bind with reduced affinity to T cells expressing the high affinity IL-2 receptor, yet bind normally to transfected fibroblasts expressing only the alpha and beta chains of the receptor. These results suggest that a third receptor component is important for both binding and signal transduction. PMID:2249656

Iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis

PubMed Central

Landry, Aaron P.; Cheng, Zishuo; Ding, Huangen

2013-01-01

Iron-sulphur cluster biogenesis requires coordinated delivery of iron and sulphur to scaffold proteins, followed by transfer of the assembled clusters from scaffold proteins to target proteins. This complex process is accomplished by a group of dedicated iron-sulphur cluster assembly proteins that are conserved from bacteria to humans. While sulphur in iron-sulphur clusters is provided by L-cysteine via cysteine desulfurase, the iron donor(s) for iron-sulphur cluster assembly remains largely elusive. Here we report that among the primary iron-sulphur cluster assembly proteins, IscA has a unique and strong binding activity for mononuclear iron in vitro and in vivo. Furthermore, the ferric iron centre tightly bound in IscA can be readily extruded by L-cysteine, followed by reduction to ferrous iron for iron-sulphur cluster biogenesis. Substitution of the highly conserved residue tyrosine 40 with phenylalanine (Y40F) in IscA results in a mutant protein that has a diminished iron binding affinity but retains the iron-sulphur cluster binding activity. Genetic complementation studies show that the IscA Y40F mutant is inactive in vivo, suggesting that the iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis. PMID:23258274

DNA residence time is a regulatory factor of transcription repression

PubMed Central

Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette

2017-01-01

Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492

Long-range electrostatic complementarity governs substrate recognition by human chymotrypsin C, a key regulator of digestive enzyme activation.

PubMed

Batra, Jyotica; Szabó, András; Caulfield, Thomas R; Soares, Alexei S; Sahin-Tóth, Miklós; Radisky, Evette S

2013-04-05

Human chymotrypsin C (CTRC) is a pancreatic serine protease that regulates activation and degradation of trypsinogens and procarboxypeptidases by targeting specific cleavage sites within their zymogen precursors. In cleaving these regulatory sites, which are characterized by multiple flanking acidic residues, CTRC shows substrate specificity that is distinct from that of other isoforms of chymotrypsin and elastase. Here, we report the first crystal structure of active CTRC, determined at 1.9-Å resolution, revealing the structural basis for binding specificity. The structure shows human CTRC bound to the small protein protease inhibitor eglin c, which binds in a substrate-like manner filling the S6-S5' subsites of the substrate binding cleft. Significant binding affinity derives from burial of preferred hydrophobic residues at the P1, P4, and P2' positions of CTRC, although acidic P2' residues can also be accommodated by formation of an interfacial salt bridge. Acidic residues may also be specifically accommodated in the P6 position. The most unique structural feature of CTRC is a ring of intense positive electrostatic surface potential surrounding the primarily hydrophobic substrate binding site. Our results indicate that long-range electrostatic attraction toward substrates of concentrated negative charge governs substrate discrimination, which explains CTRC selectivity in regulating active digestive enzyme levels.

Iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis.

PubMed

Landry, Aaron P; Cheng, Zishuo; Ding, Huangen

2013-03-07

Iron-sulphur cluster biogenesis requires coordinated delivery of iron and sulphur to scaffold proteins, followed by transfer of the assembled clusters from scaffold proteins to target proteins. This complex process is accomplished by a group of dedicated iron-sulphur cluster assembly proteins that are conserved from bacteria to humans. While sulphur in iron-sulphur clusters is provided by L-cysteine via cysteine desulfurase, the iron donor(s) for iron-sulphur cluster assembly remains largely elusive. Here we report that among the primary iron-sulphur cluster assembly proteins, IscA has a unique and strong binding activity for mononuclear iron in vitro and in vivo. Furthermore, the ferric iron centre tightly bound in IscA can be readily extruded by l-cysteine, followed by reduction to ferrous iron for iron-sulphur cluster biogenesis. Substitution of the highly conserved residue tyrosine 40 with phenylalanine (Y40F) in IscA results in a mutant protein that has a diminished iron binding affinity but retains the iron-sulphur cluster binding activity. Genetic complementation studies show that the IscA Y40F mutant is inactive in vivo, suggesting that the iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis.

Unveiling the molecular mechanism of brassinosteroids: Insights from structure-based molecular modeling studies.

PubMed

Lei, Beilei; Liu, Jiyuan; Yao, Xiaojun

2015-12-01

Brassinosteroid (BR) phytohormones play indispensable roles in plant growth and development. Brassinolide (BL) and 24-epibrassinolide (24-epiBL) are the most active ones among the BRs reported thus far. Unfortunately, the extremely low natural content and intricate synthesis process limit their popularization in agricultural production. Earlier reports to discover alternative compounds have resulted in molecules with nearly same scaffold structure and without diversity in chemical space. In the present study, receptors structure based BRs regulation mechanism was analyzed. First, we examined the detailed binding interactions and their dynamic stability between BL and its receptor BRI1 and co-receptor BAK1. Then, the binding modes and binding free energies for 24-epiBL and a series of representative BRs binding with BRI1 and BRI1-BAK1 were carried out by molecular docking, energy minimization and MM-PBSA free energy calculation. The obtained binding structures and energetic results provided vital insights into the structural factors affecting the activity from both receptors and BRs aspects. Subsequently, the obtained knowledge will serve as valuable guidance to build pharmacophore models for rational screening of new scaffold alternative BRs. Copyright © 2015 Elsevier Inc. All rights reserved.

The N54-αs Mutant Has Decreased Affinity for βγ and Suggests a Mechanism for Coupling Heterotrimeric G Protein Nucleotide Exchange with Subunit Dissociation.

PubMed

Cleator, John H; Wells, Christopher A; Dingus, Jane; Kurtz, David T; Hildebrandt, John D

2018-05-01

Ser54 of G s α binds guanine nucleotide and Mg 2+ as part of a conserved sequence motif in GTP binding proteins. Mutating the homologous residue in small and heterotrimeric G proteins generates dominant-negative proteins, but by protein-specific mechanisms. For α i/o , this results from persistent binding of α to βγ , whereas for small GTP binding proteins and α s this results from persistent binding to guanine nucleotide exchange factor or receptor. This work examined the role of βγ interactions in mediating the properties of the Ser54-like mutants of G α subunits. Unexpectedly, WT- α s or N54- α s coexpressed with α 1B -adrenergic receptor in human embryonic kidney 293 cells decreased receptor stimulation of IP3 production by a cAMP-independent mechanism, but WT- α s was more effective than the mutant. One explanation for this result would be that α s , like Ser47 α i/o , blocks receptor activation by sequestering βγ ; implying that N54- α S has reduced affinity for βγ since it was less effective at blocking IP3 production. This possibility was more directly supported by the observation that WT- α s was more effective than the mutant in inhibiting βγ activation of phospholipase C β 2. Further, in vitro synthesized N54- α s bound biotinylated- βγ with lower apparent affinity than did WT- α s The Cys54 mutation also decreased βγ binding but less effectively than N54- α s Substitution of the conserved Ser in α o with Cys or Asn increased βγ binding, with the Cys mutant being more effective. This suggests that Ser54 of α s is involved in coupling changes in nucleotide binding with altered subunit interactions, and has important implications for how receptors activate G proteins. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.

Cyclophilin B mediates cyclosporin A incorporation in human blood T-lymphocytes through the specific binding of complexed drug to the cell surface.

PubMed

Allain, F; Denys, A; Spik, G

1996-07-15

Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein located within intracellular vesicles and released in biological fluids. We recently reported the specific binding of this protein to T-cell surface receptor which is internalized even in the presence of CsA. These results suggest that CyPB might target the drug to lymphocytes and consequently modify its activity. To verify this hypothesis, we have first investigated the binding capacity and internalization of the CsA-CyPB complex in human peripheral blood T-lymphocytes and secondly compared the inhibitory effect of both free and CyPB-complexed CsA on the CD3-induced activation and proliferation of T-cells. Here, we present evidence that both the CsA-CyPB complex and free CyPB bind to the T-lymphocyte surface, with similar values of Kd and number of sites. At 37 degrees C, the complex is internalized but, in contrast to the protein, the drug is accumulated within the cell. Moreover, CyPB receptors are internalized together with the ligand and rapidly recycled to the cell surface. Finally, we demonstrate that CyPB-complexed CsA remains as efficient as uncomplexed CsA and that CyPB enhances the immunosuppressive activity of the drug. Taken together, our results support the hypothesis that surface CyPB receptors may be related to the selective and variable action of CsA, through specific binding and targeting of the CyPB-CsA complex to peripheral blood T-lymphocytes.

The Activation Domain of the Bovine Papillomavirus E2 Protein Mediates Association of DNA-Bound Dimers to form DNA Loops

NASA Astrophysics Data System (ADS)

Knight, Jonathan D.; Li, Rong; Botchan, Michael

1991-04-01

The E2 transactivator protein of bovine papillomavirus binds its specific DNA target sequence as a dimer. We have found that E2 dimers, performed in solution independent of DNA, exhibit substantial cooperativity of DNA binding as detected by both nitrocellulose filter retention and footprint analysis techniques. If the binding sites are widely spaced, E2 forms stable DNA loops visible by electron microscopy. When three widely separated binding sites reside on te DNA, E2 condenses the molecule into a bow-tie structure. This implies that each E2 dimer has at least two independent surfaces for multimerization. Two naturally occurring shorter forms of the protein, E2C and D8/E2, which function in vivo as repressors of transcription, do not form such loops. Thus, the looping function of E2 maps to the 161-amino acid activation domain. These results support the looping model of transcription activation by enhancers.

LtmA, a novel cyclic di-GMP-responsive activator, broadly regulates the expression of lipid transport and metabolism genes in Mycobacterium smegmatis

PubMed Central

Li, Weihui; He, Zheng-Guo

2012-01-01

In a bis-(3′-5′)-cyclic dimeric guanosine monophosphate (c-di-GMP)/transcription factor binding screen, we identified Mycobacterium smegmatis Ms6479 as the first c-di-GMP-responsive transcriptional factor in mycobacteria. Ms6479 could specifically bind with c-di-GMP and recognize the promoters of 37 lipid transport and metabolism genes. c-di-GMP could enhance the ability of Ms6479 to bind to its target DNA. Furthermore, our results establish Ms6479 as a global activator that positively regulates the expression of diverse target genes. Overexpression of Ms6479 in M. smegmatis significantly reduced the permeability of the cell wall to crystal violet and increased mycobacterial resistance to anti-tuberculosis antibiotics. Interestingly, Ms6479 lacks the previously reported c-di-GMP binding motifs. Our findings introduce Ms6479 (here designated LtmA for lipid transport and metabolism activator) as a new c-di-GMP-responsive regulator. PMID:23047950

An unfolded protein-induced conformational switch activates mammalian IRE1

PubMed Central

Acosta-Alvear, Diego; Nguyen, Hieu T; Lee, Crystal P; Chu, Feixia

2017-01-01

The unfolded protein response (UPR) adjusts the cell’s protein folding capacity in the endoplasmic reticulum (ER) according to need. IRE1 is the most conserved UPR sensor in eukaryotic cells. It has remained controversial, however, whether mammalian and yeast IRE1 use a common mechanism for ER stress sensing. Here, we show that similar to yeast, human IRE1α’s ER-lumenal domain (hIRE1α LD) binds peptides with a characteristic amino acid bias. Peptides and unfolded proteins bind to hIRE1α LD’s MHC-like groove and induce allosteric changes that lead to its oligomerization. Mutation of a hydrophobic patch at the oligomerization interface decoupled peptide binding to hIRE1α LD from its oligomerization, yet retained peptide-induced allosteric coupling within the domain. Importantly, impairing oligomerization of hIRE1α LD abolished IRE1’s activity in living cells. Our results provide evidence for a unifying mechanism of IRE1 activation that relies on unfolded protein binding-induced oligomerization. PMID:28971800

The epidermal growth factor receptor (EGFR) promotes uptake of influenza A viruses (IAV) into host cells.

PubMed

Eierhoff, Thorsten; Hrincius, Eike R; Rescher, Ursula; Ludwig, Stephan; Ehrhardt, Christina

2010-09-09

Influenza A viruses (IAV) bind to sialic-acids at cellular surfaces and enter cells by using endocytotic routes. There is evidence that this process does not occur constitutively but requires induction of specific cellular signals, including activation of PI3K that promotes virus internalization. This implies engagement of cellular signaling receptors during viral entry. Here, we present first indications for an interplay of IAV with receptor tyrosine kinases (RTKs). As representative RTK family-members the epidermal growth factor receptor (EGFR) and the c-Met receptor were studied. Modulation of expression or activity of both RTKs resulted in altered uptake of IAV, showing that these receptors transmit entry relevant signals upon virus binding. More detailed studies on EGFR function revealed that virus binding lead to clustering of lipid-rafts, suggesting that multivalent binding of IAV to cells induces a signaling platform leading to activation of EGFR and other RTKs that in turn facilitates IAV uptake.

Identification of the functional binding pocket for compounds targeting small-conductance Ca2+-activated potassium channels

PubMed Central

Zhang, Miao; Pascal, John M.; Schumann, Marcel; Armen, Roger S.; Zhang, Ji-fang

2012-01-01

Small- and intermediate-conductance Ca2+-activated potassium channels, activated by Ca2+-bound calmodulin, play an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potentials for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-EBIO class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class. PMID:22929778

Identification of the functional binding pocket for compounds targeting small-conductance Ca²⁺-activated potassium channels.

PubMed

Zhang, Miao; Pascal, John M; Schumann, Marcel; Armen, Roger S; Zhang, Ji-Fang

2012-01-01

Small- and intermediate-conductance Ca(2+)-activated potassium channels, activated by Ca(2+)-bound calmodulin, have an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potential for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-ethyl-2-benzimidazolinone (1-EBIO) class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class.

Structural Analysis of the Phenol-Responsive Sensory Domain of the Transcription Activator PoxR.

PubMed

Patil, Vinod Vikas; Park, Kwang-Hyun; Lee, Seung-Goo; Woo, Euijeon

2016-04-05

Positive phenol-degradative gene regulator (PoxR) is a σ(54)-dependent AAA+ ATPase transcription activator that regulates the catabolism of phenols. The PoxR sensory domain detects phenols and relays signals for the activation of transcription. Here we report the first structure of the phenol sensory domain bound to phenol and five derivatives. It exists as a tightly intertwined homodimer with a phenol-binding pocket buried inside, placing two C termini on the same side of the dimer. His102 and Trp130 interact with the hydroxyl group of the phenol in a cavity surrounded by rigid hydrophobic residues on one side and a flexible region on the other. Each monomer has a V4R fold with a unique zinc-binding site. A shift at the C-terminal helix suggests that there is a possible conformational change upon ligand binding. The results provide a structural basis of chemical effector binding for transcriptional regulation with broad implications for protein engineering. Copyright © 2016 Elsevier Ltd. All rights reserved.

Initiation of Phage Infection by Partial Unfolding and Prolyl Isomerization*♦

PubMed Central

Hoffmann-Thoms, Stephanie; Weininger, Ulrich; Eckert, Barbara; Jakob, Roman P.; Koch, Johanna R.; Balbach, Jochen; Schmid, Franz X.

2013-01-01

Infection of Escherichia coli by the filamentous phage fd starts with the binding of the N2 domain of the phage gene-3-protein to an F pilus. This interaction triggers partial unfolding of the gene-3-protein, cis → trans isomerization at Pro-213, and domain disassembly, thereby exposing its binding site for the ultimate receptor TolA. The trans-proline sets a molecular timer to maintain the binding-active state long enough for the phage to interact with TolA. We elucidated the changes in structure and local stability that lead to partial unfolding and thus to the activation of the gene-3-protein for phage infection. Protein folding and TolA binding experiments were combined with real-time NMR spectroscopy, amide hydrogen exchange measurements, and phage infectivity assays. In combination, the results provide a molecular picture of how a local unfolding reaction couples with prolyl isomerization not only to generate the activated state of a protein but also to maintain it for an extended time. PMID:23486474

RPA facilitates telomerase activity at chromosome ends in budding and fission yeasts

PubMed Central

Luciano, Pierre; Coulon, Stéphane; Faure, Virginie; Corda, Yves; Bos, Julia; Brill, Steven J; Gilson, Eric; Simon, Marie-Noelle; Géli, Vincent

2012-01-01

In Saccharomyces cerevisiae, the telomerase complex binds to chromosome ends and is activated in late S-phase through a process coupled to the progression of the replication fork. Here, we show that the single-stranded DNA-binding protein RPA (replication protein A) binds to the two daughter telomeres during telomere replication but only its binding to the leading-strand telomere depends on the Mre11/Rad50/Xrs2 (MRX) complex. We further demonstrate that RPA specifically co-precipitates with yKu, Cdc13 and telomerase. The interaction of RPA with telomerase appears to be mediated by both yKu and the telomerase subunit Est1. Moreover, a mutation in Rfa1 that affects both the interaction with yKu and telomerase reduces the dramatic increase in telomere length of a rif1Δ, rif2Δ double mutant. Finally, we show that the RPA/telomerase association and function are conserved in Schizosaccharomyces pombe. Our results indicate that in both yeasts, RPA directly facilitates telomerase activity at chromosome ends. PMID:22354040

RPA facilitates telomerase activity at chromosome ends in budding and fission yeasts.

PubMed

Luciano, Pierre; Coulon, Stéphane; Faure, Virginie; Corda, Yves; Bos, Julia; Brill, Steven J; Gilson, Eric; Simon, Marie-Noelle; Géli, Vincent

2012-04-18

In Saccharomyces cerevisiae, the telomerase complex binds to chromosome ends and is activated in late S-phase through a process coupled to the progression of the replication fork. Here, we show that the single-stranded DNA-binding protein RPA (replication protein A) binds to the two daughter telomeres during telomere replication but only its binding to the leading-strand telomere depends on the Mre11/Rad50/Xrs2 (MRX) complex. We further demonstrate that RPA specifically co-precipitates with yKu, Cdc13 and telomerase. The interaction of RPA with telomerase appears to be mediated by both yKu and the telomerase subunit Est1. Moreover, a mutation in Rfa1 that affects both the interaction with yKu and telomerase reduces the dramatic increase in telomere length of a rif1Δ, rif2Δ double mutant. Finally, we show that the RPA/telomerase association and function are conserved in Schizosaccharomyces pombe. Our results indicate that in both yeasts, RPA directly facilitates telomerase activity at chromosome ends.

The Epidermal Growth Factor Receptor (EGFR) Promotes Uptake of Influenza A Viruses (IAV) into Host Cells

PubMed Central

Eierhoff, Thorsten; Hrincius, Eike R.; Rescher, Ursula; Ludwig, Stephan; Ehrhardt, Christina

2010-01-01

Influenza A viruses (IAV) bind to sialic-acids at cellular surfaces and enter cells by using endocytotic routes. There is evidence that this process does not occur constitutively but requires induction of specific cellular signals, including activation of PI3K that promotes virus internalization. This implies engagement of cellular signaling receptors during viral entry. Here, we present first indications for an interplay of IAV with receptor tyrosine kinases (RTKs). As representative RTK family-members the epidermal growth factor receptor (EGFR) and the c-Met receptor were studied. Modulation of expression or activity of both RTKs resulted in altered uptake of IAV, showing that these receptors transmit entry relevant signals upon virus binding. More detailed studies on EGFR function revealed that virus binding lead to clustering of lipid-rafts, suggesting that multivalent binding of IAV to cells induces a signaling platform leading to activation of EGFR and other RTKs that in turn facilitates IAV uptake. PMID:20844577

Influence of porcine spermadhesins on the susceptibility of boar spermatozoa to high dilution.

PubMed

Centurion, Fernando; Vazquez, Juan M; Calvete, Juan J; Roca, Jordi; Sanz, Libia; Parrilla, Inmaculada; Garcia, Eva M; Martinez, Emilio A

2003-08-01

The effect of heparin-binding and non-heparin-binding spermadhesins on the viability, motility, and mitochondrial activity of boar spermatozoa at the high dilution (300,000 sperm/ml) to which sperm are exposed during the process of sex sorting by flow cytometry was investigated. Incubation of spermatozoa with heparin-binding spermadhesins caused a time- and dose-dependent decrease in the percentage of functional spermatozoa. The percentage of viable spermatozoa incubated at 38 degrees C with heparin-binding spermadhesins diluted in PBS (1 mg/ml) dropped from 75% (0.5 h) to 4% (5 h), whereas the percentage of viable spermatozoa incubated in PBS without proteins (control) decreased from 85% (0.5 h) to 19% (5 h). Addition of non-heparin-binding PSP-I/PSP-II spermadhesin to the PBS resulted in a concentration-dependent increment of the percentage of viable cells (65% after 5-h incubation), with maximum effect at 1.5 mg/ml. The heparin-binding spermadhesins totally suppressed sperm motility and mitochondrial activity after 5 h of incubation. The same parameters of sperm incubated in the presence of 1.5 mg/ml of PSP-I/PSP-II were 50% and 58%, respectively, and the percentages of control sperm displaying motility and mitochondrial activity were 21% and 26%, respectively. Moreover, the viability, motility, and mitochondrial activity all decreased on incubation of spermatozoa with mixtures of PSP-I/PSP-II and heparin-binding spermadhesins as the concentration of the latter increased. We conclude that PSP-I/PSP-II and the heparin-binding spermadhesins exert antagonistic effects on the functionality of highly diluted boar spermatozoa. The finding that PSP-I/PSP-II contributes to maintaining sperm with high viability, motility, and mitochondrial activity for at least 5 h at physiological temperature points to its potential use as an additive for sperm preservation, specifically of highly diluted, flow-sorted spermatozoa for sex preselection.

A highly Conserved Aspartic Acid Residue of the Chitosanase from Bacillus Sp. TS Is Involved in the Substrate Binding.

PubMed

Zhou, Zhanping; Zhao, Shuangzhi; Liu, Yang; Chang, Zhengying; Ma, Yanhe; Li, Jian; Song, Jiangning

2016-11-01

The chitosanase from Bacillus sp. TS (CsnTS) is an enzyme belonging to the glycoside hydrolase family 8. The sequence of CsnTS shares 98 % identity with the chitosanase from Bacillus sp. K17. Crystallography analysis and site-direct mutagenesis of the chitosanase from Bacillus sp. K17 identified the important residues involved in the catalytic interaction and substrate binding. However, despite progress in understanding the catalytic mechanism of the chitosanase from the family GH8, the functional roles of some residues that are highly conserved throughout this family have not been fully elucidated. This study focused on one of these residues, i.e., the aspartic acid residue at position 318. We found that apart from asparagine, mutation of Asp318 resulted in significant loss of enzyme activity. In-depth investigations showed that mutation of this residue not only impaired enzymatic activity but also affected substrate binding. Taken together, our results showed that Asp318 plays an important role in CsnTS activity.

Molecular actions of two synthetic brassinosteroids, iso-carbaBL and 6-deoxoBL, which cause altered physiological activities between Arabidopsis and rice.

PubMed

Nakamura, Ayako; Tochio, Naoya; Fujioka, Shozo; Ito, Shinsaku; Kigawa, Takanori; Shimada, Yukihisa; Matsuoka, Makoto; Yoshida, Shigeo; Kinoshita, Toshinori; Asami, Tadao; Seto, Hideharu; Nakano, Takeshi

2017-01-01

Brassinosteroid (BR) is an important plant hormone that is perceived by the BRASSINOSTEROID INSENSITIVE 1 (BRI1) receptor. BRI1 is conserved among dicot and monocot species; however, the molecular mechanism underlying BR perception in monocots is not fully understood. We synthesised two BRs, iso-carbabrassinolide (iso-carbaBL) and 6-deoxoBL, which have different BR activities in Arabidopsis thaliana (Arabidopsis) and rice. Our bioassay indicated that iso-carbaBL has relatively strong BR activity in Arabidopsis, but is inactive in rice and competitively inhibits BR activity. The bioactivity of 6-deoxoBL was similar to that of BL in Arabidopsis, but was much lower in rice. Binding experiments using recombinant Arabidopsis and rice BRI1 protein fragments suggested that iso-carbaBL and 6-deoxoBL bind to both receptors. These results showed that iso-carbaBL and 6-deoxoBL act as an antagonist and agonist, respectively, of BRs in rice. A docking simulation analysis suggested that iso-carbaBL fits deeper in the binding pocket to block the binding of active BR to rice BRI1. The simulated binding energy of 6-deoxoBL with rice BRI1 is much lower than that with Arabidopsis BRI1. The possible structural characteristics of rice BRI1 were determined based on the difference in the BR activities of iso-carbaBL and 6-deoxoBL in Arabidopsis and rice.

Molecular actions of two synthetic brassinosteroids, iso-carbaBL and 6-deoxoBL, which cause altered physiological activities between Arabidopsis and rice

PubMed Central

Fujioka, Shozo; Ito, Shinsaku; Kigawa, Takanori; Shimada, Yukihisa; Matsuoka, Makoto; Yoshida, Shigeo; Kinoshita, Toshinori; Asami, Tadao; Seto, Hideharu; Nakano, Takeshi

2017-01-01

Brassinosteroid (BR) is an important plant hormone that is perceived by the BRASSINOSTEROID INSENSITIVE 1 (BRI1) receptor. BRI1 is conserved among dicot and monocot species; however, the molecular mechanism underlying BR perception in monocots is not fully understood. We synthesised two BRs, iso-carbabrassinolide (iso-carbaBL) and 6-deoxoBL, which have different BR activities in Arabidopsis thaliana (Arabidopsis) and rice. Our bioassay indicated that iso-carbaBL has relatively strong BR activity in Arabidopsis, but is inactive in rice and competitively inhibits BR activity. The bioactivity of 6-deoxoBL was similar to that of BL in Arabidopsis, but was much lower in rice. Binding experiments using recombinant Arabidopsis and rice BRI1 protein fragments suggested that iso-carbaBL and 6-deoxoBL bind to both receptors. These results showed that iso-carbaBL and 6-deoxoBL act as an antagonist and agonist, respectively, of BRs in rice. A docking simulation analysis suggested that iso-carbaBL fits deeper in the binding pocket to block the binding of active BR to rice BRI1. The simulated binding energy of 6-deoxoBL with rice BRI1 is much lower than that with Arabidopsis BRI1. The possible structural characteristics of rice BRI1 were determined based on the difference in the BR activities of iso-carbaBL and 6-deoxoBL in Arabidopsis and rice. PMID:28369122

Immune complexes formed following the binding of anti-platelet factor 4 (CXCL4) antibodies to CXCL4 stimulate human neutrophil activation and cell adhesion.

PubMed

Xiao, Zhihua; Visentin, Gian P; Dayananda, Kannayakanahalli M; Neelamegham, Sriram

2008-08-15

We tested the possibility that immune complexes formed following platelet factor 4 (PF4/CXCL4) binding to anti-PF4 antibody can stimulate neutrophil activation, similar to previous reports with platelets. Monoclonal Abs against PF4 and IgG from a heparin-induced thrombocytopenia (HIT) patient were applied. We observed that although PF4 or anti-PF4 antibody alone did not alter neutrophil function, costimulation with both reagents resulted in approximately 3-fold increase in cell surface Mac-1 expression, enhanced cell adhesion via L-selectin and CD18 integrins, and degranulation of secondary and tertiary granules. The level of Mac-1 up-regulation peaked at an intermediate PF4 dose, suggesting that functional response varies with antigen-antibody stoichiometry. PF4 binding to neutrophils was blocked by chondroitinase ABC. Cell activation was inhibited by both chondroitinase ABC and anti-CD32/FcgammaRII blocking mAb, IV.3. Confocal microscopy demonstrated that immune complexes colocalize with CD32a. Studies with HIT IgG demonstrated that neutrophils could be activated in the absence of exogenous heparin. These data, together, show that leukocyte surface chondroitin sulfates promote neutrophil activation by enhancing immune-complex binding to CD32a. Studies with recombinant PF4 suggest a role for arginine 49 in stabilizing PF4-chondroitin binding. Neutrophils activated via this mechanism may contribute to thrombosis and inflammation in patients mounting an immune response to PF4-heparin.

Activation of Hsp90/NOS and increased NO generation does not impair mitochondrial respiratory chain by competitive binding at cytochrome C Oxidase in low oxygen concentrations

PubMed Central

Presley, Tennille; Vedam, Kaushik; Liu, Xiaoping; Zweier, Jay L.

2009-01-01

Nitric oxide (NO) is known to regulate mitochondrial respiration, especially during metabolic stress and disease, by nitrosation of the mitochondrial electron transport chain (ETC) complexes (irreversible) and by a competitive binding at O2 binding site of cytochrome c oxidase (CcO) in complex IV (reversible). In this study, by using bovine aortic endothelial cells, we demonstrate that the inhibitory effect of endogenously generated NO by nitric oxide synthase (NOS) activation, by either NOS stimulators or association with heat shock protein 90 (Hsp90), is significant only at high prevailing pO2 through nitrosation of mitochondrial ETC complexes, but it does not inhibit the respiration by competitive binding at CcO at very low pO2. ETC complexes activity measurements confirmed that significant reduction in complex IV activity was noticed at higher pO2, but it was unaffected at low pO2 in these cells. This was further extended to heat-shocked cells, where NOS was activated by the induction/activation of (Hsp90) through heat shock at an elevated temperature of 42°C. From these results, we conclude that the entire attenuation of respiration by endogenous NO is due to irreversible inhibition by nitrosation of ETC complexes but not through reversible inhibition by competing with O2 binding at CcO at complex IV. PMID:19412660

A single amino acid substitution in the exoplasmic domain of the human growth hormone (GH) receptor confers familial GH resistance (Laron syndrome) with positive GH-binding activity by abolishing receptor homodimerization.

PubMed Central

Duquesnoy, P; Sobrier, M L; Duriez, B; Dastot, F; Buchanan, C R; Savage, M O; Preece, M A; Craescu, C T; Blouquit, Y; Goossens, M

1994-01-01

Growth hormone (GH) elicits a variety of biological activities mainly mediated by the GH receptor (GHR), a transmembrane protein that, based on in vitro studies, seemed to function as a homodimer. To test this hypothesis directly, we investigated patients displaying the classic features of Laron syndrome (familial GH resistance characterized by severe dwarfism and metabolic dysfunction), except for the presence of normal binding activity of the plasma GH-binding protein, a molecule that derives from the exoplasmic-coding domain of the GHR gene. In two unrelated families, the same GHR mutation was identified, resulting in the substitution of a highly conserved aspartate residue by histidine at position 152 (D152H) of the exoplasmic domain, within the postulated interface sequence involved in homodimerization. The recombinant mutated receptor protein was correctly expressed at the plasma membrane. It displayed subnormal GH-binding activity, a finding in agreement with the X-ray crystal structure data inferring this aspartate residue outside the GH-binding domain. However, mAb-based studies suggested the critical role of aspartate 152 in the proper folding of the interface area. We show that a recombinant soluble form of the mutant receptor is unable to dimerize, the D152H substitution also preventing the formation of heterodimers of wild-type and mutant molecules. These results provide in vivo evidence that monomeric receptors are inactive and that receptor dimerization is involved in the primary signalling of the GH-associated growth-promoting and metabolic actions. Images PMID:8137822

DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.

PubMed

Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L

2017-09-01

Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.

A single amino acid substitution in the exoplasmic domain of the human growth hormone (GH) receptor confers familial GH resistance (Laron syndrome) with positive GH-binding activity by abolishing receptor homodimerization.

PubMed

Duquesnoy, P; Sobrier, M L; Duriez, B; Dastot, F; Buchanan, C R; Savage, M O; Preece, M A; Craescu, C T; Blouquit, Y; Goossens, M

1994-03-15

Growth hormone (GH) elicits a variety of biological activities mainly mediated by the GH receptor (GHR), a transmembrane protein that, based on in vitro studies, seemed to function as a homodimer. To test this hypothesis directly, we investigated patients displaying the classic features of Laron syndrome (familial GH resistance characterized by severe dwarfism and metabolic dysfunction), except for the presence of normal binding activity of the plasma GH-binding protein, a molecule that derives from the exoplasmic-coding domain of the GHR gene. In two unrelated families, the same GHR mutation was identified, resulting in the substitution of a highly conserved aspartate residue by histidine at position 152 (D152H) of the exoplasmic domain, within the postulated interface sequence involved in homodimerization. The recombinant mutated receptor protein was correctly expressed at the plasma membrane. It displayed subnormal GH-binding activity, a finding in agreement with the X-ray crystal structure data inferring this aspartate residue outside the GH-binding domain. However, mAb-based studies suggested the critical role of aspartate 152 in the proper folding of the interface area. We show that a recombinant soluble form of the mutant receptor is unable to dimerize, the D152H substitution also preventing the formation of heterodimers of wild-type and mutant molecules. These results provide in vivo evidence that monomeric receptors are inactive and that receptor dimerization is involved in the primary signalling of the GH-associated growth-promoting and metabolic actions.

Comparative effects of chlordecone and mirex on rat cardiac ATPases and binding of 3H-catecholamines.

PubMed

Desaiah, D

1980-08-01

The effects of chlordecone and mirex on the rat myocardial ATPases and binding of 3H-dopamine and 3H-norepinephrine to the NAK-fraction were determined both by in vitro and in vivo treatment. The in vitro data showed that chlordecone significantly inhibited mitochondrial Mg2+ ATPase and Na+--K+ ATPase in a concentration dependent manner with ID50 values of 5 x 10(-8) and 2 x 10(-6) M, respectively. Mitrex, a close structural analog of chlordecone did not inhibit mitochondrial Mg2+ ATPase but inhibited about 15% of N+--K+ ATPase activity. Rats treated with symptomatogenic doses of chlordecone showed a marked and significant decrease of myocardial Na+--K+ ATPase and the residual Mg2+ ATPase activities. The decrease in the enzyme activities was dose dependent and significant. However, mirex treated rats showed a slight decrease in the myocardial Na+--K+ ATPase. The potency of chlordecone to inhibit the ATPase system was parallel to its ability to decrease the dopamine and norepinephrine binding of the myocardial NAK-fraction. Preincubation of the NAK-fraction with various concentrations of chlordecone resulted in a decreased binding of dopamine and norepinephrine. The decrease was significant and concentration dependent. Similar findings were observed in rats pretreated with chlordecone. Mirex did not show any effect, either in vitro or in vivo treatment, on the binding of dopamine or norepinephrine to the myocardial NAK-fraction. These results suggest that chlordecone may be altering the sodium pump activity by inhibiting both ATP hydrolysis and ATP synthesis and thus reducing other cellular events such as catecholamine uptake.

Coated platelets function in platelet-dependent fibrin formation via integrin αIIbβ3 and transglutaminase factor XIII

PubMed Central

Mattheij, Nadine J.A.; Swieringa, Frauke; Mastenbroek, Tom G.; Berny-Lang, Michelle A.; May, Frauke; Baaten, Constance C.F.M.J.; van der Meijden, Paola E.J.; Henskens, Yvonne M.C.; Beckers, Erik A.M.; Suylen, Dennis P.L.; Nolte, Marc W.; Hackeng, Tilman M.; McCarty, Owen J.T.; Heemskerk, Johan W.M.; Cosemans, Judith M.E.M.

2016-01-01

Coated platelets, formed by collagen and thrombin activation, have been characterized in different ways: i) by the formation of a protein coat of α-granular proteins; ii) by exposure of procoagulant phosphatidylserine; or iii) by high fibrinogen binding. Yet, their functional role has remained unclear. Here we used a novel transglutaminase probe, Rhod-A14, to identify a subpopulation of platelets with a cross-linked protein coat, and compared this with other platelet subpopulations using a panel of functional assays. Platelet stimulation with convulxin/thrombin resulted in initial integrin αIIbβ3 activation, the appearance of a platelet population with high fibrinogen binding, (independently of active integrins, but dependent on the presence of thrombin) followed by phosphatidylserine exposure and binding of coagulation factors Va and Xa. A subpopulation of phosphatidylserine-exposing platelets bound Rhod-A14 both in suspension and in thrombi generated on a collagen surface. In suspension, high fibrinogen and Rhod-A14 binding were antagonized by combined inhibition of transglutaminase activity and integrin αIIbβ3. Markedly, in thrombi from mice deficient in transglutaminase factor XIII, platelet-driven fibrin formation and Rhod-A14 binding were abolished by blockage of integrin αIIbβ3. Vice versa, star-like fibrin formation from platelets of a patient with deficiency in αIIbβ3 (Glanzmann thrombasthenia) was abolished upon blockage of transglutaminase activity. We conclude that coated platelets, with initial αIIbβ3 activation and high fibrinogen binding, form a subpopulation of phosphatidylserine-exposing platelets, and function in platelet-dependent star-like fibrin fiber formation via transglutaminase factor XIII and integrin αIIbβ3. PMID:26721892

Arginine residues on the opposite side of the active site stimulate the catalysis of ribosome depurination by ricin A chain by interacting with the P-protein stalk.

PubMed

Li, Xiao-Ping; Kahn, Peter C; Kahn, Jennifer Nielsen; Grela, Przemyslaw; Tumer, Nilgun E

2013-10-18

Ricin inhibits protein synthesis by depurinating the α-sarcin/ricin loop (SRL). Ricin holotoxin does not inhibit translation unless the disulfide bond between the A (RTA) and B (RTB) subunits is reduced. Ricin holotoxin did not bind ribosomes or depurinate them but could depurinate free RNA. When RTA is separated from RTB, arginine residues located at the interface are exposed to the solvent. Because this positively charged region, but not the active site, is blocked by RTB, we mutated arginine residues at or near the interface of RTB to determine if they are critical for ribosome binding. These variants were structurally similar to wild type RTA but could not bind ribosomes. Their K(m) values and catalytic rates (k(cat)) for an SRL mimic RNA were similar to those of wild type, indicating that their activity was not altered. However, they showed an up to 5-fold increase in K(m) and up to 38-fold decrease in kcat toward ribosomes. These results suggest that the stalk binding stimulates the catalysis of ribosome depurination by RTA. The mutated arginines have side chains behind the active site cleft, indicating that the ribosome binding surface of RTA is on the opposite side of the surface that interacts with the SRL. We propose that stalk binding stimulates the catalysis of ribosome depurination by orienting the active site of RTA toward the SRL and thereby allows docking of the target adenine into the active site. This model may apply to the translation factors that interact with the stalk.

Structural Analysis of Charge Discrimination in the Binding of Inhibitors to Human Carbonic Anhydrases I and II

PubMed Central

Srivastava, D. K.; Jude, Kevin M.; Banerjee, Abir L.; Haldar, Manas; Manokaran, Sumathra; Kooren, Joel; Mallik, Sanku; Christianson, David W.

2008-01-01

Despite the similarity in the active site pockets of carbonic anhydrase (CA) isozymes I and II, the binding affinities of benzenesulfonamide inhibitors are invariably higher with CA II as compared to CA I. To explore the structural basis of this molecular recognition phenomenon, we have designed and synthesized simple benzenesulfonamide inhibitors substituted at the para position with positively-charged, negatively-charged, and neutral functional groups, and we have determined the affinities and X-ray crystal structures of their enzyme complexes. The para-substituents are designed to bind in the midsection of the 15 Å deep active site cleft, where interactions with enzyme residues and solvent molecules are possible. We find that a para-substituted positively-charged amino group is more poorly tolerated in the active site of CA I compared with CA II. In contrast, a para-substituted negatively-charged carboxylate substituent is tolerated equally well in the active sites of both CA isozymes. Notably, enzyme-inhibitor affinity increases upon neutralization of inhibitor charged groups by amidation or esterification. These results inform the design of short molecular linkers connecting the benzenesulfonamide group and a para-substituted tail group in “two-prong” CA inhibitors: an optimal linker segment will be electronically neutral, yet capable of engaging in at least some hydrogen bond interactions with protein residues and/or solvent. Microcalorimetric data reveal that inhibitor binding to CA I is enthalpically less favorable and entropically more favorable than inhibitor binding to CA II. This contrasting behavior may arise in part from differences in active site desolvation and the conformational entropy of inhibitor binding to each isozyme active site. PMID:17407288

Functional characterization of transcription factor binding sites for HNF1-alpha, HNF3-beta (FOXA2), HNF4-alpha, Sp1 and Sp3 in the human prothrombin gene enhancer.

PubMed

Ceelie, H; Spaargaren-Van Riel, C C; De Jong, M; Bertina, R M; Vos, H L

2003-08-01

Prothrombin is a key component in blood coagulation. Overexpression of prothrombin leads to an increased risk of venous thrombosis. Therefore, the study of the transcriptional regulation of the prothrombin gene may help to identify mechanisms of overexpression. The aim of our study was to localize the regions within the prothrombin enhancer responsible for its activity, to identify the proteins binding to these regions, and to establish their functional importance. We constructed a set of prothrombin promoter 5' deletion constructs containing the firefly luciferase reporter gene, which were transiently transfected in HepG2, HuH7 and HeLa cells. Putative transcription factor (TF) binding sites were evaluated by electrophoretic mobility shift assays. The functional importance of each TF binding site was evaluated by site directed mutagenesis and transient transfection of the mutant constructs. We confirmed the major contribution of the enhancer region to the transcriptional activity of the prothrombin promoter. Analysis of this region revealed putative binding sites for hepatocyte nuclear factor HNF4, HNF3-beta and specificity protein(Sp)1. We identified six different TFs binding to three evolutionary conserved sites in the enhancer: HNF4-alpha (site 1), HNF1-alpha, HNF3-beta and an as yet unidentified TF (site 2) and the ubiquitously expressed TFs Sp1 and Sp3 (site 3). Mutagenesis studies showed that loss of binding of HNF3-beta resulted in a considerable decrease of enhancer activity, whereas loss of HNF4-alpha or Sp1/Sp3 resulted in milder reductions. The prothrombin enhancer plays a major role in regulation of prothrombin expression. Six different TFs are able to bind to this region. At least three of these TFs, HNF4-alpha, HNF3-beta and Sp1/Sp3, are important in regulation of prothrombin expression.

Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

PubMed

Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

2012-03-01

Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

USING 19F-NMR SPECTROSCOPY TO DETERMINE TRIFLURALIN BINDING TO SOIL

EPA Science Inventory

Trifluralin is a widely used herbicide for the control of broad leaf weeds in a variety of crops. Its binding to soil may result in significant losses in herbicidal activity and a delayed pollution problem. To investigate the nature of soil-bound trifluralin residues, ¹⁴

Avoiding false positives and optimizing identification of true negatives in estrogen receptor binding and agonist/antagonist assays

EPA Science Inventory

The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented fr...

Crystal structure of a catalytically active, non-toxic endopeptidase derivative of Clostridium botulinum toxin A.

PubMed

Masuyer, Geoffrey; Thiyagarajan, Nethaji; James, Peter L; Marks, Philip M H; Chaddock, John A; Acharya, K Ravi

2009-03-27

Botulinum neurotoxins (BoNTs) modulate cholinergic nerve terminals to result in neurotransmitter blockade. BoNTs consists of catalytic (LC), translocation (Hn) and cell-binding domains (Hc). The binding function of the Hc domain is essential for BoNTs to bind the neuronal cell membrane, therefore, removal of the Hc domain results in a product that retains the endopeptidase activity of the LC but is non-toxic. Thus, a molecule consisting of LC and Hn domains of BoNTs, termed LHn, is a suitable molecule for engineering novel therapeutics. The structure of LHA at 2.6 A reported here provides an understanding of the structural implications and challenges of engineering therapeutic molecules that combine functional properties of LHn of BoNTs with specific ligand partners to target different cell types.

Steady-state kinetics of substrate binding and iron release in tomato ACC oxidase.

PubMed

Thrower, J S; Blalock, R; Klinman, J P

2001-08-14

1-Aminocyclopropane-1-carboxylate oxidase (ACC oxidase) catalyzes the last step in the biosynthetic pathway of the plant hormone, ethylene. This unusual reaction results in the oxidative ring cleavage of 1-aminocyclopropane carboxylate (ACC) into ethylene, cyanide, and CO2 and requires ferrous ion, ascorbate, and molecular oxygen for catalysis. A new purification procedure and assay method have been developed for tomato ACC oxidase that result in greatly increased enzymatic activity. This method allowed us to determine the rate of iron release from the enzyme and the effect of the activator, CO2, on this rate. Initial velocity studies support an ordered kinetic mechanism where ACC binds first followed by O2; ascorbate can bind after O2 or possibly before ACC. This kinetic mechanism differs from one recently proposed for the ACC oxidase from avocado.

p65 fragments, homologous to the C2 region of protein kinase C, bind to the intracellular receptors for protein kinase C.

PubMed

Mochly-Rosen, D; Miller, K G; Scheller, R H; Khaner, H; Lopez, J; Smith, B L

1992-09-08

Receptors for activated protein kinase C (RACKs) have been isolated from the particulate cell fraction of heart and brain. We previously demonstrated that binding of protein kinase C (PKC) to RACKs requires PKC activators and is via a site on PKC that is distinct from the substrate binding site. Here, we examine the possibility that the C2 region in the regulatory domain of PKC is involved in binding of PKC to RACKs. The synaptic vesicle-specific p65 protein contains two regions homologous to the C2 region of PKC. We found that three p65 fragments, containing either one or two of these PKC C2 homologous regions, bound to highly purified RACKs. Binding of the p65 fragments and PKC to RACKs was mutually exclusive; preincubation of RACKs with the p65 fragments inhibited PKC binding, and preincubation of RACKs with PKC inhibited binding of the p65 fragments. Preincubation of the p65 fragments with a peptide resembling the PKC binding site on RACKs also inhibited p65 binding to RACKs, suggesting that PKC and p65 bind to the same or nearby regions on RACKs. Since the only homologous region between PKC and the p65 fragments is the C2 region, these results suggest that the C2 region on PKC contains at least part of the RACK binding site.

In vivo imaging of protease activity by Probody therapeutic activation

PubMed Central

Wong, Kenneth R.; Menendez, Elizabeth; Craik, Charles S.; Kavanaugh, W. Michael; Vasiljeva, Olga

2017-01-01

Probody™ therapeutics are recombinant, proteolytically-activated antibody prodrugs, engineered to remain inert until activated locally by tumor-associated proteases. Probody therapeutics exploit the fundamental dysregulation of extracellular protease activity that exists in tumors relative to healthy tissue. Leveraging the ability of a Probody therapeutic to bind its target at the site of disease after proteolytic cleavage, we developed a novel method for profiling protease activity in living animals. Using NIR optical imaging, we demonstrated that a non-labeled anti-EGFR Probody therapeutic can become activated and compete for binding to tumor cells in vivo with a labeled anti-EGFR monoclonal antibody. Furthermore, by inhibiting matriptase activity in vivo with a blocking-matriptase antibody, we show that the ability of the Probody therapeutic to bind EGFR in vivo was dependent on protease activity. These results demonstrate that in vivo imaging of Probody therapeutic activation can be used for screening and characterization of protease activity in living animals, and provide a method that avoids some of the limitations of prior methods. This approach can improve our understanding of the activity of proteases in disease models and help to develop efficient strategies for cancer diagnosis and treatment. PMID:26546838

Activation Dependence of Stretch Activation in Mouse Skinned Myocardium: Implications for Ventricular Function

PubMed Central

Stelzer, Julian E.; Larsson, Lars; Fitzsimons, Daniel P.; Moss, Richard L.

2006-01-01

Recent evidence suggests that ventricular ejection is partly powered by a delayed development of force, i.e., stretch activation, in regions of the ventricular wall due to stretch resulting from torsional twist of the ventricle around the apex-to-base axis. Given the potential importance of stretch activation in cardiac function, we characterized the stretch activation response and its Ca2+ dependence in murine skinned myocardium at 22°C in solutions of varying Ca2+ concentrations. Stretch activation was induced by suddenly imposing a stretch of 0.5–2.5% of initial length to the isometrically contracting muscle and then holding the muscle at the new length. The force response to stretch was multiphasic: force initially increased in proportion to the amount of stretch, reached a peak, and then declined to a minimum before redeveloping to a new steady level. This last phase of the response is the delayed force characteristic of myocardial stretch activation and is presumably due to increased attachment of cross-bridges as a consequence of stretch. The amplitude and rate of stretch activation varied with Ca2+ concentration and more specifically with the level of isometric force prior to the stretch. Since myocardial force is regulated both by Ca2+ binding to troponin-C and cross-bridge binding to thin filaments, we explored the role of cross-bridge binding in the stretch activation response using NEM-S1, a strong-binding, non-force–generating derivative of myosin subfragment 1. NEM-S1 treatment at submaximal Ca2+-activated isometric forces significantly accelerated the rate of the stretch activation response and reduced its amplitude. These data show that the rate and amplitude of myocardial stretch activation vary with the level of activation and that stretch activation involves cooperative binding of cross-bridges to the thin filament. Such a mechanism would contribute to increased systolic ejection in response to increased delivery of activator Ca2+ during excitation–contraction coupling. PMID:16446502

The interaction of flavonoid-lysozyme and the relationship between molecular structure of flavonoids and their binding activity to lysozyme.

PubMed

Yang, Ran; Yu, Lanlan; Zeng, Huajin; Liang, Ruiling; Chen, Xiaolan; Qu, Lingbo

2012-11-01

In this work, the interactions of twelve structurally different flavonoids with Lysozyme (Lys) were studied by fluorescence quenching method. The interaction mechanism and binding properties were investigated. It was found that the binding capacities of flavonoids to Lys were highly depend on the number and position of hydrogen, the kind and position of glycosyl. To explore the selectivity of the bindings of flavonoids with Lys, the structure descriptors of the flavonoids were calculated under QSAR software package of Cerius2, the quantitative relationship between the structures of flavonoids and their binding activities to Lys (QSAR) was performed through genetic function approximation (GFA) regression analysis. The QSAR regression equation was K(A) = 37850.460 + 1630.01Dipole +3038.330HD-171.795MR. (r = 0.858, r(CV)(2) = 0.444, F((11,3)) = 7.48), where K(A) is binding constants, Dipole, HD and MR was dipole moment, number of hydrogen-bond donor and molecular refractivity, respectively. The obtained results make us understand better how the molecular structures influencing their binding to protein which may open up new avenues for the design of the most suitable flavonoids derivatives with structure variants.

Propeptide cleavage conditions sortilin/neurotensin receptor-3 for ligand binding.

PubMed

Munck Petersen, C; Nielsen, M S; Jacobsen, C; Tauris, J; Jacobsen, L; Gliemann, J; Moestrup, S K; Madsen, P

1999-02-01

We recently reported the isolation and sequencing of sortilin, a new putative sorting receptor that binds receptor-associated protein (RAP). The luminal N-terminus of sortilin comprises a consensus sequence for cleavage by furin, R41WRR44, which precedes a truncation originally found in sortilin isolated from human brain. We now show that the truncation results from cellular processing. Sortilin is synthesized as a proform which, in late Golgi compartments, is converted to the mature receptor by furin-mediated cleavage of a 44 residue N-terminal propeptide. We further demonstrate that the propeptide exhibits pH-dependent high affinity binding to fully processed sortilin, that the binding is competed for by RAP and the newly discovered sortilin ligand neurotensin, and that prevention of propeptide cleavage essentially prevents binding of RAP and neurotensin. The findings evidence that the propeptide sterically hinders ligands from gaining access to overlapping binding sites in prosortilin, and that cleavage and release of the propeptide preconditions sortilin for full functional activity. Although proteolytic processing is involved in the maturation of several receptors, the described exposure of previously concealed ligand-binding sites after furin-mediated cleavage of propeptide represents a novel mechanism in receptor activation.

Propeptide cleavage conditions sortilin/neurotensin receptor-3 for ligand binding.

PubMed Central

Munck Petersen, C; Nielsen, M S; Jacobsen, C; Tauris, J; Jacobsen, L; Gliemann, J; Moestrup, S K; Madsen, P

1999-01-01

We recently reported the isolation and sequencing of sortilin, a new putative sorting receptor that binds receptor-associated protein (RAP). The luminal N-terminus of sortilin comprises a consensus sequence for cleavage by furin, R41WRR44, which precedes a truncation originally found in sortilin isolated from human brain. We now show that the truncation results from cellular processing. Sortilin is synthesized as a proform which, in late Golgi compartments, is converted to the mature receptor by furin-mediated cleavage of a 44 residue N-terminal propeptide. We further demonstrate that the propeptide exhibits pH-dependent high affinity binding to fully processed sortilin, that the binding is competed for by RAP and the newly discovered sortilin ligand neurotensin, and that prevention of propeptide cleavage essentially prevents binding of RAP and neurotensin. The findings evidence that the propeptide sterically hinders ligands from gaining access to overlapping binding sites in prosortilin, and that cleavage and release of the propeptide preconditions sortilin for full functional activity. Although proteolytic processing is involved in the maturation of several receptors, the described exposure of previously concealed ligand-binding sites after furin-mediated cleavage of propeptide represents a novel mechanism in receptor activation. PMID:9927419

Precursor-product discrimination by La protein during tRNA metabolism

PubMed Central

Bayfield, Mark A.; Maraia, Richard J.

2009-01-01

SUMMARY La proteins bind pre-tRNAs at their UUU-3'OH ends, facilitating their maturation. While the mechanism by which La binds pre-tRNA 3' trailers is known, the function of the RNA-binding β-sheet surface of RRM1 is unknown. How La dissociates from UUU-3'OH-containing trailers after 3' processing is also unknown. La preferentially binds pre-tRNAs over processed tRNAs or 3' trailer products through coupled use of two sites: one on the La motif and another on the RRM1 β surface that binds elsewhere on tRNA. Two sites provide stable pre-tRNA binding while processed tRNA and 3' trailer are released from their single sites relatively fast. RRM1 loop-3 mutations decrease affinity for pre-tRNA and tRNA but not UUU-3'OH trailer, and impair tRNA maturation in vivo. We propose that RRM1 functions in activities that are more complex than UUU-3'OH binding. Accordingly, the RRM1 mutations also impair a RNA chaperone activity of La. The results suggest how La distinguishes precursor from product RNAs, allowing it to recycle onto a new pre-tRNA. PMID:19287396

D2 dopaminergic and 5-HT1A serotonergic activity of 2-(1-naphthyl)ethyl- and 2-(2-naphthyl)ethyl amines.

PubMed

Šukalović, V; Roglić, G; Husinec, S; Kostić-Rajaćić, S; Andrić, D; Šoškić, Vukić

2003-11-01

Several tertiary 2-phenylethyl, 2-(1-naphthyl)ethyl and 2-(2-naphthyl)ethyl amines were synthesized and their binding affinities for dopamine D(1), D(2) and serotonin 5-HT(1A) receptors evaluated in radioligand binding assays. All compounds were inactive in D(1) dopamine radioligand binding assay. The 2-(1-naphthyl)ethyl analogues expressed a low but significant binding affinity for the D(2) and moderate one for the 5-HT(1A) receptor subtypes. Most of the remaining compounds expressed binding affinity at the 5-HT(1A) receptor subtype but were inactive in D(2) receptor binding assay. Based on these results and considering the chemical characteristics of the compounds synthesized and evaluated for dopaminergic and serotonergic activity throughout the present study it can be concluded that hydrophobic type of interaction (stacking or edge-to-face) plays a significant role in the formation of receptor-ligand complexes of 2-(1-naphthyl)ethyl amines. This structural motive can be applied to design and synthesize new, more potent dopaminergic/serotonergic ligands by slight chemical modifications.

Exploring the binding mechanism of Heteroaryldihydropyrimidines and Hepatitis B Virus capsid combined 3D-QSAR and molecular dynamics.

PubMed

Tu, Jing; Li, Jiao Jiao; Shan, Zhi Jie; Zhai, Hong Lin

2017-01-01

The non-nucleoside drugs have been developed to treat HBV infection owing to their increased efficacy and lesser side effects, in which heteroaryldihydropyrimidines (HAPs) have been identified as effective inhibitors of HBV capsid. In this paper, the binding mechanism of HAPs targeting on HBV capsid protein was explored through three-dimensional quantitative structure-activity relationship, molecular dynamics and binding free energy decompositions. The obtained models of comparative molecular field analysis and comparative molecular similarity indices analysis enable the sufficient interpretation of structure-activity relationship of HAPs-HBV. The binding free energy analysis correlates with the experimental data. The computational results disclose that the non-polar contribution is the major driving force and Y132A mutation enhances the binding affinity for inhibitor 2 bound to HBV. The hydrogen bond interactions between the inhibitors and Trp102 help to stabilize the conformation of HAPs-HBV. The study provides insight into the binding mechanism of HAPs-HBV and would be useful for the rational design and modification of new lead compounds of HAP drugs. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Binding Mode Analyses and Pharmacophore Model Development for Stilbene Derivatives as a Novel and Competitive Class of α-Glucosidase Inhibitors

PubMed Central

Kim, Jun Young; Arooj, Mahreen; Kim, Siu; Hwang, Swan; Kim, Byeong-Woo; Park, Ki Hun; Lee, Keun Woo

2014-01-01

Stilbene urea derivatives as a novel and competitive class of non-glycosidic α-glucosidase inhibitors are effective for the treatment of type II diabetes and obesity. The main purposes of our molecular modeling study are to explore the most suitable binding poses of stilbene derivatives with analyzing the binding affinity differences and finally to develop a pharmacophore model which would represents critical features responsible for α-glucosidase inhibitory activity. Three-dimensional structure of S. cerevisiae α-glucosidase was built by homology modeling method and the structure was used for the molecular docking study to find out the initial binding mode of compound 12, which is the most highly active one. The initial structure was subjected to molecular dynamics (MD) simulations for protein structure adjustment at compound 12-bound state. Based on the adjusted conformation, the more reasonable binding modes of the stilbene urea derivatives were obtained from molecular docking and MD simulations. The binding mode of the derivatives was validated by correlation analysis between experimental Ki value and interaction energy. Our results revealed that the binding modes of the potent inhibitors were engaged with important hydrogen bond, hydrophobic, and π-interactions. With the validated compound 12-bound structure obtained from combining approach of docking and MD simulation, a proper four featured pharmacophore model was generated. It was also validated by comparison of fit values with the Ki values. Thus, these results will be helpful for understanding the relationship between binding mode and bioactivity and for designing better inhibitors from stilbene derivatives. PMID:24465730

Allosteric nature of P2X receptor activation probed by photoaffinity labelling

PubMed Central

Bhargava, Y; Rettinger, J; Mourot, A

2012-01-01

BACKGROUND AND PURPOSE In P2X receptors, agonist binding at the interface between neighbouring subunits is efficiently transduced to ion channel gating. However, the relationship between binding and gating is difficult to study because agonists continuously bind and unbind. Here, we covalently incorporated agonists in the binding pocket of P2X receptors and examined how binding site occupancy affects the ability of the channel to gate. EXPERIMENTAL APPROACH We used a strategy for tethering agonists to their ATP-binding pocket, while simultaneously probing ion channel gating using electrophysiology. The agonist 2′,3′-O-(4-benzoylbenzoyl)-ATP (BzATP), a photoaffinity analogue of ATP, enabled us to trap rat homomeric P2X2 receptor and a P2X2/1 receptor chimera in different agonist-bound states. UV light was used to control the degree of covalent occupancy of the receptors. KEY RESULTS Irradiation of the P2X2/1 receptor chimera – BzATP complex resulted in a persistent current that lasted even after extensive washout, consistent with photochemical tethering of the agonist BzATP and trapping of the receptors in an open state. Partial labelling with BzATP primed subsequent agonist binding and modulated gating efficiency for both full and partial agonists. CONCLUSIONS AND IMPLICATIONS Our photolabelling strategy provides new molecular insights into the activation mechanism of the P2X receptor. We show here that priming with full agonist molecules leads to an increase in gating efficiency after subsequent agonist binding. PMID:22725669

Arsenite-induced ROS/RNS generation causes zinc loss and inhibits the activity of poly(ADP-ribose) polymerase-1.

PubMed

Wang, Feng; Zhou, Xixi; Liu, Wenlan; Sun, Xi; Chen, Chen; Hudson, Laurie G; Jian Liu, Ke

2013-08-01

Arsenic enhances the genotoxicity of other carcinogenic agents such as ultraviolet radiation and benzo[a]pyrene. Recent reports suggest that inhibition of DNA repair is an important aspect of arsenic cocarcinogenesis, and DNA repair proteins such as poly(ADP ribose) polymerase (PARP)-1 are direct molecular targets of arsenic. Although arsenic has been shown to generate reactive oxygen/nitrogen species (ROS/RNS), little is known about the role of arsenic-induced ROS/RNS in the mechanism underlying arsenic inhibition of DNA repair. We report herein that arsenite-generated ROS/RNS inhibits PARP-1 activity in cells. Cellular exposure to arsenite, as well as hydrogen peroxide and NONOate (nitric oxide donor), decreased PARP-1 zinc content, enzymatic activity, and PARP-1 DNA binding. Furthermore, the effects of arsenite on PARP-1 activity, DNA binding, and zinc content were partially reversed by the antioxidant ascorbic acid, catalase, and the NOS inhibitor, aminoguanidine. Most importantly, arsenite incubation with purified PARP-1 protein in vitro did not alter PARP-1 activity or DNA-binding ability, whereas hydrogen peroxide or NONOate retained PARP-1 inhibitory activity. These results strongly suggest that cellular generation of ROS/RNS plays an important role in arsenite inhibition of PARP-1 activity, leading to the loss of PARP-1 DNA-binding ability and enzymatic activity. Copyright © 2013 Elsevier Inc. All rights reserved.

Jack bean urease: the effect of active-site binding inhibitors on the reactivity of enzyme thiol groups.

PubMed

Krajewska, Barbara; Zaborska, Wiesława

2007-10-01

In view of the complexity of the role of the active site flap cysteine in the urease catalysis, in this work we studied how the presence of typical active-site binding inhibitors of urease, phenylphosphorodiamidate (PPD), acetohydroxamic acid (AHA), boric acid and fluoride, affects the reactivity of enzyme thiol groups, the active site flap thiol in particular. For that the inhibitor-urease complexes were prepared with excess inhibitors and had their thiol groups titrated with DTNB. The effects observed were analyzed in terms of the structures of the inhibitor-urease complexes reported in the literature. We found that the effectiveness in preventing the active site cysteine from the modification by disulfides, varied among the inhibitors studied, even though they all bind to the active site. The variations were accounted for by different extents of geometrical distortion in the active site that the inhibitors introduced upon binding, leaving the flap either open in AHA-, boric acid- and fluoride-inhibited urease, like in the native enzyme or closed in PPD-inhibited urease. Among the inhibitors, only PPD was found to be able to thoroughly protect the flap cysteines from the further reaction with disulfides, this apparently resulting from the closed conformation of the flap. Accordingly, in practical terms PPD may be regarded as the most suitable inhibitor for active-site protection experiments in inhibition studies of urease.

Structure-activity relationship study of tetrapeptide inhibitors of the Vascular Endothelial Growth Factor A binding to Neuropilin-1.

PubMed

Tymecka, Dagmara; Lipiński, Piotr F J; Fedorczyk, Bartłomiej; Puszko, Anna; Wileńska, Beata; Perret, Gerard Y; Misicka, Aleksandra

2017-08-01

Neuropilin-1 is considered as one of the key receptors responsible for signaling pathways involved in pathological angiogenesis necessary for tumor progression, therefore targeting of VEGF 165 binding to NRP-1 could be a relevant strategy for antiangiogenic treatment. It was shown before that the VEGF 165 /NRP-1 interaction can be inhibited by short tetrapeptides with K/RXXR sequence. Here, we present a structure-activity relationship study of the systematic optimization of amino acid residues in positions 1-3 in the above tetrapeptides. All the 13 synthesized analogs possessed C-terminal arginine that is a necessary element for interaction with NRP-1. The obtained results of the inhibitory activity and modeling by molecular dynamics indicate that simultaneous interactions of the basic amino acid residues in position 1 and 4 (Arg) with Neuropilin-1 are crucial and their cooperation strongly affects the inhibitory activity. In addition, the binding strength is modulated by the flexibility of the peptide backbone (in the central part of the peptide), and the nature of the side chain of the amino acids at the second or third position. A dramatic decrease in the activity to the receptor is observed in flexible derivatives that are missing proline residues. The results described in this paper should prove useful for future studies aimed at establishing the best pharmacophore for inhibitors of VEGF 165 binding to NRP-1. Copyright © 2017 Elsevier Inc. All rights reserved.

Calorimetric study of mutant human lysozymes with partially introduced Ca2+ binding sites and its efficient refolding system from inclusion bodies.

PubMed

Koshiba, T; Tsumoto, K; Masaki, K; Kawano, K; Nitta, K; Kumagai, I

1998-08-01

During the process of evolution, ancestral lysozymes evolved into calcium-binding lysozymes by acquiring three critical aspartate residues at positions 86, 91 and 92. To investigate the process of the acquisition of calcium-binding ability, two of the aspartates were partially introduced into human lysozyme at positions 86, 91 and 92. These mutants (HLQ86D, HLA92D and HLQ86D/D91Q/A92D), having two critical aspartates in calcium-binding sites, were expressed in Escherichia coli as non-active inclusion bodies. For the preparation of lysozyme samples, a refolding system using thioredoxin was established. This system allowed for effective refolding of wild-type and mutant lysozymes, and 100% of activity was recovered within 4 days. The calcium ion dependence of the melting temperature (Tm) of wild-type and mutant lysozymes was investigated by differential scanning calorimetry at pH 4.5. The Tm values of wild-type, HLQ86D and HLA92D mutants were not dependent on calcium ion concentration. However, the Tm of HLQ86D/D91Q/A92D was 4 degrees higher in the presence of 50 mM CaCl2 than in its absence, and the calcium-binding constant of this mutant was estimated to be 2.25(+/-0.25)x10(2) M(-1) at pH 4.5. Moreover, the calcium-binding ability of this mutant was confirmed by the result using Sephadex G-25 gel chromatography. These results indicate that it is indispensable to have at least two aspartates at positions 86 and 92 for acquisition of calcium-binding ability. The process of the acquisition of calcium-binding site during evolution of calcium-binding lysozyme is discussed.

Heat Capacity Changes and Disorder-to-Order Transitions in Allosteric Activation.

PubMed

Cressman, William J; Beckett, Dorothy

2016-01-19

Allosteric coupling in proteins is ubiquitous but incompletely understood, particularly in systems characterized by coupling over large distances. Binding of the allosteric effector, bio-5'-AMP, to the Escherichia coli biotin protein ligase, BirA, enhances the protein's dimerization free energy by -4 kcal/mol. Previous studies revealed that disorder-to-order transitions at the effector binding and dimerization sites, which are separated by 33 Å, are integral to functional coupling. Perturbations to the transition at the ligand binding site alter both ligand binding and coupled dimerization. Alanine substitutions in four loops on the dimerization surface yield a range of energetic effects on dimerization. A glycine to alanine substitution at position 142 in one of these loops results in a complete loss of allosteric coupling, disruption of the disorder-to-order transitions at both functional sites, and a decreased affinity for the effector. In this work, allosteric communication between the effector binding and dimerization surfaces in BirA was further investigated by performing isothermal titration calorimetry measurements on nine proteins with alanine substitutions in three dimerization surface loops. In contrast to BirAG142A, at 20 °C all variants bind to bio-5'-AMP with free energies indistinguishable from that measured for wild-type BirA. However, the majority of the variants exhibit altered heat capacity changes for effector binding. Moreover, the ΔCp values correlate with the dimerization free energies of the effector-bound proteins. These thermodynamic results, combined with structural information, indicate that allosteric activation of the BirA monomer involves formation of a network of intramolecular interactions on the dimerization surface in response to bio-5'-AMP binding at the distant effector binding site.

The involvement of the sodium-potassium pump in postjunctional supersensitivity of the guinea-pig vas deferens as assessed by [3H]ouabain binding.

PubMed

Wong, S K; Westfall, D P; Fedan, J S; Fleming, W W

1981-10-01

Previous evidence has suggested that postjunctional supersensitivity of the guinea-pig vas deferens results, in part, from partial depolarization of the cell membrane. The depolarization is believed to result from a reduction in the activity of the Na-K pump. Indeed, the Na, K+ -adenosine triphosphatase activity of subcellular fractions from supersensitive vas deferens is reduced. In order to determine whether the biochemical alteration seen in subcellular fractions correlate with Na-K pump sites in intact tissues, we have studied the binding of [3H] ouabain to intact vas deferens. [3H]ouabain binds to membrane sites which have the characteristics expected of Na+, K+ - adenosine triphosphatase. Specific binding was saturable and reversible. Scatchard analysis of ouabain-binding in control tissues yielded a single class of binding sites with a dissociation constant (KD) of 156 +/- 7 nM and a maximum number of binding sites (Bmax) of 558.7 +/- 15.6 fmol/mg wet wt. [3H]Ouabain binding was displaceable by several cardiac glycosides and aglycones, but not by steroid hormones or sodium vanadate. Alteration of concentrations of Na+ and K+ markedly affected ouabain binding. Denervation (with 6-hydroxydopamine), decentralization or reserpine treatment for 1 day, which do not produce supersensitivity, did not alter the Bmax, whereas 5 to 7 days after these procedures, when supersensitivity was present, the Bmax was significantly reduced by 20 to 40%. The KD was not changed by any of the treatments. These data provide additional support for the concept that a reduction in the NaK pump sites contributes to postjunctional supersensitivity.

Calcineurin homologous protein as an essential cofactor for Na+/H+ exchangers.

PubMed

Pang, T; Su, X; Wakabayashi, S; Shigekawa, M

2001-05-18

The Na+/H+ exchangers (NHEs) comprise a family of transporters that catalyze cell functions such as regulation of the pH and volume of a cell and epithelial absorption of Na+ and bicarbonate. Ubiquitous calcineurin B homologous protein (CHP or p22) is co-localized and co-immunoprecipitated with expressed NHE1, NHE2, or NHE3 independently of its myristoylation and Ca2+ binding, and its binding site was identified as the juxtamembrane region within the carboxyl-terminal cytoplasmic domain of exchangers. CHP binding-defective mutations of NHE1-3 or CHP depletion by injection of the competitive CHP-binding region of NHE1 into Xenopus oocytes resulted in a dramatic reduction (>90%) in the Na+/H+ exchange activity. The data suggest that CHP serves as an essential cofactor, which supports the physiological activity of NHE family members.

Monomeric rhodopsin is the minimal functional unit required for arrestin binding.

PubMed

Tsukamoto, Hisao; Sinha, Abhinav; DeWitt, Mark; Farrens, David L

2010-06-11

We have tested whether arrestin binding requires the G-protein-coupled receptor be a dimer or a multimer. To do this, we encapsulated single-rhodopsin molecules into nanoscale phospholipid particles (so-called nanodiscs) and measured their ability to bind arrestin. Our data clearly show that both visual arrestin and beta-arrestin 1 can bind to monomeric rhodopsin and stabilize the active metarhodopsin II form. Interestingly, we find that the monomeric rhodopsin in nanodiscs has a higher affinity for wild-type arrestin binding than does oligomeric rhodopsin in liposomes or nanodiscs, as assessed by stabilization of metarhodopsin II. Together, these results establish that rhodopsin self-association is not required to enable arrestin binding. Copyright 2010 Elsevier Ltd. All rights reserved.

PI3Kδ promotes CD4(+) T-cell interactions with antigen-presenting cells by increasing LFA-1 binding to ICAM-1.

PubMed

Garçon, Fabien; Okkenhaug, Klaus

2016-05-01

Activation of T lymphocytes by peptide/major histocompatibility complex on antigen-presenting cells (APCs) involves dynamic contacts between the two cells, during which T cells undergo marked morphological changes. These interactions are facilitated by integrins. Activation of the T cells increases the binding of the integrin lymphocyte function-associated antigen 1 (LFA-1) expressed by T cells to intercellular adhesion molecule (ICAM)-1 and ICAM-2 expressed by APCs. The signalling pathways that control integrin affinities are incompletely defined. The phosphoinositide 3-kinases (PI3Ks) generate second-messenger signalling molecules that control cell growth, proliferation, differentiation and trafficking. Here we show that in T cells, PI3Kδ attenuates the activation of Rac1, but sustains the activation of Rap1. Consequently, PI3Kδ increases LFA-1-dependent adhesion to form stable conjugates with APCs. Increased Rap1 activity and LFA-1 adhesion were only in part mediated by the downstream kinase Akt, suggesting the involvement of additional phosphatidylinositol(3,4,5)P3-binding proteins. These results establish a link between PI3K activity, cytoskeletal changes and integrin binding and help explain the impaired T-cell-dependent immune responses in PI3Kδ-deficient mice.

Activation of Nrf2 is required for up-regulation of the π class of glutathione S-transferase in rat primary hepatocytes with L-methionine starvation.

PubMed

Lin, Ai-Hsuan; Chen, Haw-Wen; Liu, Cheng-Tze; Tsai, Chia-Wen; Lii, Chong-Kuei

2012-07-04

Numerous genes expression is regulated in response to amino acid shortage, which helps organisms adapt to amino acid limitation. The expression of the π class of glutathione (GSH) S-transferase (GSTP), a highly inducible phase II detoxification enzyme, is regulated mainly by activates activating protein 1 (AP-1) binding to the enhancer I of GSTP (GPEI). Here we show the critical role of nuclear factor erythroid-2-related factor 2 (Nrf2) in up-regulating GSTP gene transcription. Primary rat hepatocytes were cultured in a methionine-restricted medium, and immunoblotting and RT-PCR analyses showed that methionine restriction time-dependently increased GSTP protein and mRNA expression over a 48 h period. Nrf2 translocation to the nucleus, nuclear proteins binding to GPEI, and antioxidant response element (ARE) luciferase reporter activity were increased by methionine restriction as well as by l-buthionine sulfoximine (BSO), a GSH synthesis inhibitor. Transfection with Nrf2 siRNA knocked down Nrf2 expression and reversed the methionine-induced GSTP expression and GPEI binding activity. Chromatin immunoprecipitation assay confirmed the binding of Nrf2 to the GPEI. Phosphorylation of extracellular signal-regulated kinase 2 (ERK2) was increased in methionine-restricted and BSO-treated cells. ERK2 siRNA abolished methionine restriction-induced Nrf2 nuclear translocation, GPEI binding activity, ARE-luciferase reporter activity, and GSTP expression. Our results suggest that the up-regulation of GSTP gene transcription in response to methionine restriction likely occurs via the ERK-Nrf2-GPEI signaling pathway.

Molecular Mechanism Underlying the Action of Substituted Pro-Gly Dipeptide Noopept.

PubMed

Vakhitova, Y V; Sadovnikov, S V; Borisevich, S S; Ostrovskaya, R U; A Gudasheva, T; Seredenin, S B

2016-01-01

This study was performed in order to reveal the effect of Noopept (ethyl ester of N-phenylacetyl-Lprolylglycine, GVS-111) on the DNA-binding activity of transcriptional factors (TF) in HEK293 cells transiently transfected with luciferase reporter constructs containing sequences for CREB, NFAT, NF-κB, p53, STAT1, GAS, VDR, HSF1, and HIF-1. Noopept (10 μM) was shown to increase the DNA-binding activity of HIF-1 only, while lacking the ability to affect that of CREB, NFAT, NF-κB, p53, STAT1, GAS, VDR, and HSF1. Noopept provoked an additional increase in the DNA-binding activity of HIF-1 when applied in conditions of CoCl2-induced HIF- 1 stabilization. The degree of this HIF-positive effect of Noopept was shown to be concentration-dependent. Piracetam (1 mM) failed to affect significantly any of the TF under study. The results of molecular docking showed that Noopept (L-isomer), as well as its metabolite, L-isomer of N-phenyl-acetylprolyl, unlike its pharmacologically ineffective D-isomer, is able to bind to the active site of prolyl hydroxylase 2. Taking into account the important role of the genes activated by HIF-1 in the formation of an adaptive response to hypoxia, data on the ability of Noopept to provoke a selective increase in the DNA-binding activity of HIF-1 explain the wide spectrum of neurochemical and pharmacological effects of Noopept revealed before. The obtained data allow one to propose the HIF-positive effect as the primary mechanism of the activity of this Pro-Gly-containing dipeptide.

Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

PubMed

Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

2016-12-06

Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

Peptidyl Prolyl Isomerase PIN1 Directly Binds to and Stabilizes Hypoxia-Inducible Factor-1α

PubMed Central

Han, Hyeong-jun; Kwon, Nayoung; Choi, Min-A; Jung, Kyung Oh; Piao, Juan-Yu; Ngo, Hoang Kieu Chi; Kim, Su-Jung; Kim, Do-Hee; Chung, June-Key; Cha, Young-Nam; Youn, Hyewon; Choi, Bu Young; Min, Sang-Hyun; Surh, Young-Joon

2016-01-01

Peptidyl prolyl isomerase (PIN1) regulates the functional activity of a subset of phosphoproteins through binding to phosphorylated Ser/Thr-Pro motifs and subsequently isomerization of the phosphorylated bonds. Interestingly, PIN1 is overexpressed in many types of malignancies including breast, prostate, lung and colon cancers. However, its oncogenic functions have not been fully elucidated. Here, we report that PIN1 directly interacts with hypoxia-inducible factor (HIF)-1α in human colon cancer (HCT116) cells. PIN1 binding to HIF-1α occurred in a phosphorylation-dependent manner. We also found that PIN1 interacted with HIF-1α at both exogenous and endogenous levels. Notably, PIN1 binding stabilized the HIF-1α protein, given that their levels were significantly increased under hypoxic conditions. The stabilization of HIF-1α resulted in increased transcriptional activity, consequently upregulating expression of vascular endothelial growth factor, a major contributor to angiogenesis. Silencing of PIN1 or pharmacologic inhibition of its activity abrogated the angiogenesis. By utilizing a bioluminescence imaging technique, we were able to demonstrate that PIN1 inhibition dramatically reduced the tumor volume in a subcutaneous mouse xenograft model and angiogenesis as well as hypoxia-induced transcriptional activity of HIF-1α. These results suggest that PIN1 interacting with HIF-1α is a potential cancer chemopreventive and therapeutic target. PMID:26784107

Development of novobiocin analogues that manifest anti-proliferative activity against several cancer cell lines.

PubMed

Burlison, Joseph A; Avila, Christopher; Vielhauer, George; Lubbers, Donna J; Holzbeierlein, Jeffrey; Blagg, Brian S J

2008-03-21

Recent studies have shown that the DNA gyrase inhibitor, novobiocin, binds to a previously unrecognized ATP-binding site located at the C-terminus of Hsp90 and induces degradation of Hsp90-dependent client proteins at approximately 700 microM. As a result of these studies, several analogues of the coumarin family of antibiotics have been reported and shown to exhibit increased Hsp90 inhibitory activity; however, the monomeric species lacked the ability to manifest anti-proliferative activity against cancer cell lines at concentrations tested. In an effort to develop more efficacious compounds that produce growth inhibitory activity against cancer cell lines, structure-activity relationships were investigated surrounding the prenylated benzamide side chain of the natural product. Results obtained from these studies have produced the first novobiocin analogues that manifest anti-proliferative activity against several cancer cell lines.

Porcine bocavirus NP1 negatively regulates interferon signaling pathway by targeting the DNA-binding domain of IRF9

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Ruoxi; The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070; Fang, Liurong, E-mail: fanglr@mail.hzau.edu.cn

2015-11-15

To subvert host antiviral immune responses, many viruses have evolved countermeasures to inhibit IFN signaling pathway. Porcine bocavirus (PBoV), a newly identified porcine parvovirus, has received attention because it shows clinically high co-infection prevalence with other pathogens in post-weaning multisystemic wasting syndrome (PWMS) and diarrheic piglets. In this study, we screened the structural and non-structural proteins encoded by PBoV and found that the non-structural protein NP1 significantly suppressed IFN-stimulated response element (ISRE) activity and subsequent IFN-stimulated gene (ISG) expression. However, NP1 affected neither the activation and translocation of STAT1/STAT2, nor the formation of the heterotrimeric transcription factor complex ISGF3 (STAT1/STAT2/IRF9).more » Detailed analysis demonstrated that PBoV NP1 blocked the ISGF3 DNA-binding activity by combining with the DNA-binding domain (DBD) of IRF9. In summary, these results indicate that PBoV NP1 interferes with type I IFN signaling pathway by blocking DNA binding of ISGF3 to attenuate innate immune responses. - Highlights: • Porcine bocavirus (PBoV) NP1 interferes with the IFN α/β signaling pathway. • PBoV NP1 does not prevent STAT1/STAT2 phosphorylation and nuclear translocation. • PBoV NP1 inhibits the DNA-binding activity of ISGF3. • PBoV NP1 interacts with the DNA-binding domain of IRF9.« less

Connecting RNA Processing to Abiotic Environmental Response in Arabidopsis: the role of a polyadenylation factor

NASA Astrophysics Data System (ADS)

Li, Q. Q.; Xu, R.; Hunt, A. G.; Falcone, D. L.

Plants are constantly challenged by numerous environmental stresses both biotic and abiotic It is clear that plants have evolved to counter these stresses using all but limited means We recently discovered the potential role of a messenger RNA processing factor namely the Arabidopsis cleavage and polyadenylation specificity factor 30 kDa subunit AtCPSF30 when a mutant deficient in this factor displayed altered responses to an array of abiotic stresses This AtCPSF30 mutant named oxt6 exhibited an elevated tolerance to oxidative stress Microarray experiments of oxt6 and its complemented lines revealed an altered gene expression profile among which were antioxidative defense genes Interestingly the same gene encoding AtCPSF30 can also be transcribed into a large transcript that codes for a potential splicing factor Both protein products have a domain for RNA binding and a calmodulin binding domain activities of which have been confirmed by biochemical assays Surprisingly binding of AtCPSF30 to calmodulin inhibits the RNA-binding activity of the protein Mutational analysis shows that a small part of the protein is responsible for calmodulin binding and point mutations in this region abolished both RNA binding activity and the inhibition of this activity by calmodulin Analyses of the potential splicing factor are on going and the results will be presented The interesting possibilities for both the interplay between splicing and polyadenylation and the regulation of these processes by stimuli that act through

Eliminating Factor H-Binding Activity of Borrelia burgdorferi CspZ Combined with Virus-Like Particle Conjugation Enhances Its Efficacy as a Lyme Disease Vaccine.

PubMed

Marcinkiewicz, Ashley L; Lieknina, Ilva; Kotelovica, Svetlana; Yang, Xiuli; Kraiczy, Peter; Pal, Utpal; Lin, Yi-Pin; Tars, Kaspars

2018-01-01

The spirochete Borrelia burgdorferi is the causative agent of Lyme disease, the most common tick-borne disease in the US and Europe. No potent human vaccine is currently available. The innate immune complement system is vital to host defense against pathogens, as complement activation on the surface of spirochetes results in bacterial killing. Complement system is inhibited by the complement regulator factor H (FH). To escape killing, B. burgdorferi produces an outer surface protein CspZ that binds FH to inhibit complement activation on the cell surface. Immunization with CspZ alone does not protect mice from infection, which we speculate is because FH-binding cloaks potentially protective epitopes. We modified CspZ by conjugating to virus-like particles (VLP-CspZ) and eliminating FH binding (modified VLP-CspZ) to increase immunogenicity. We observed greater bactericidal antibody titers in mice vaccinated with modified VLP-CspZ: A serum dilution of 1:395 (modified VLP-CspZ) vs 1:143 (VLP-CspZ) yielded 50% borreliacidal activity. Immunizing mice with modified VLP-CspZ cleared spirochete infection, as did passive transfer of elicited antibodies. This work developed a novel Lyme disease vaccine candidate by conjugating CspZ to VLP and eliminating FH-binding ability. Such a strategy of conjugating an antigen to a VLP and eliminating binding to the target ligand can serve as a general model for developing vaccines against other bacterial infectious agents.

Homology modeling, molecular dynamics, and docking studies of pattern-recognition transmembrane protein-lipopolysaccharide and β-1,3 glucan-binding protein from Fenneropenaeus indicus.

PubMed

Sivakamavalli, Jeyachandran; Tripathi, Sunil Kumar; Singh, Sanjeev Kumar; Vaseeharan, Baskaralingam

2015-01-01

Lipopolysaccharide and β-1,3 glucan-binding protein (LGBP) is a family of pattern-recognition transmembrane proteins (PRPs) which plays a vital role in the immune mechanism of crustaceans in adverse conditions. Fenneropenaeus indicus LGBP-deduced amino acid has conserved potential recognition motif for β-1,3 linkages of polysaccharides and putative RGD (Arg-Gly-Asp) cell adhesion sites for the activation of innate defense mechanism. In order to understand the stimulating activity of β-1,3 glucan (β-glucan) and its interaction with LGBP, a 3D model of LGBP is generated. Molecular docking is performed with this model, and the results indicate Arg71 with strong hydrogen bond from RGD domain of LGBP. Moreover, from the docking studies, we also suggest that Arg34, Lys68, Val135, and Ala146 in LGBP are important amino acid residues in binding as they have strong bonding interaction in the active site of LGBP. In our in vitro studies, yeast agglutination results suggest that shrimp F. indicus LGBP possesses sugar binding and recognition sites in its structure, which is responsible for agglutination reaction. Our results were synchronized with the already reported evidence both in vivo and in vitro experiments. This investigation may be valuable for further experimental investigation in the synthesis of novel immunomodulator.

Arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Xi; Zhou, Xixi; Du, Libo

2014-01-15

Inhibition of DNA repair is a recognized mechanism for arsenic enhancement of ultraviolet radiation-induced DNA damage and carcinogenesis. Poly(ADP-ribose) polymerase-1 (PARP-1), a zinc finger DNA repair protein, has been identified as a sensitive molecular target for arsenic. The zinc finger domains of PARP-1 protein function as a critical structure in DNA recognition and binding. Since cellular poly(ADP-ribosyl)ation capacity has been positively correlated with zinc status in cells, we hypothesize that arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair. To test this hypothesis, we compared the effects ofmore » arsenite exposure with zinc deficiency, created by using the membrane-permeable zinc chelator TPEN, on 8-OHdG formation, PARP-1 activity and zinc binding to PARP-1 in HaCat cells. Our results show that arsenite exposure and zinc deficiency had similar effects on PARP-1 protein, whereas supplemental zinc reversed these effects. To investigate the molecular mechanism of zinc loss induced by arsenite, ICP-AES, near UV spectroscopy, fluorescence, and circular dichroism spectroscopy were utilized to examine arsenite binding and occupation of a peptide representing the first zinc finger of PARP-1. We found that arsenite binding as well as zinc loss altered the conformation of zinc finger structure which functionally leads to PARP-1 inhibition. These findings suggest that arsenite binding to PARP-1 protein created similar adverse biological effects as zinc deficiency, which establishes the molecular mechanism for zinc supplementation as a potentially effective treatment to reverse the detrimental outcomes of arsenic exposure. - Highlights: • Arsenite binding is equivalent to zinc deficiency in reducing PARP-1 function. • Zinc reverses arsenic inhibition of PARP-1 activity and enhancement of DNA damage. • Arsenite binding and zinc loss alter the conformation of zinc finger structure.« less

Actinomycin D binding mode reveals the basis for its potent HIV-1 and cancer activity

NASA Astrophysics Data System (ADS)

Paramanathan, Thayaparan; Vladescu, Ioana D.; McCauley, Micah J.; Rouzina, Ioulia; Williams, Mark C.

2011-03-01

Actinomycin D (ActD) is one of the most studied antibiotics, which has been used as an anti-cancer agent and also shown to inhibit HIV reverse transcription. Initial studies with ActD established that it intercalates double stranded DNA (dsDNA). However, recent studies have shown that ActD binds with even higher affinity to single stranded DNA (ssDNA). In our studies we use optical tweezers to stretch and hold single dsDNA molecule at constant force in the presence of varying ActD concentrations until the binding reaches equilibrium. The change in dsDNA length upon ActD binding measured as a function of time yields the rate of binding in addition to the equilibrium lengthening of DNA. The results suggest extremely slow kinetics, on the order of several minutes and 0.52 +/- 0.06 μ M binding affinity. Holding DNA at constant force while stretching and relaxing suggests that ActD binds to two single strands that are close to each other rather than to pure dsDNA or ssDNA. This suggests that biological activity of ActD that contributes towards the inhibition of cellular replication is due to its ability to bind at DNA bubbles during RNA transcription, thereby stalling the transcription process.

Mutational analysis reveals a noncontractile but interactive role of actin and profilin in viral RNA-dependent RNA synthesis.

PubMed

Harpen, Mary; Barik, Tiasha; Musiyenko, Alla; Barik, Sailen

2009-11-01

As obligatory parasites, viruses co-opt a variety of cellular functions for robust replication. The expression of the nonsegmented negative-strand RNA genome of respiratory syncytial virus (RSV), a significant pediatric pathogen, absolutely requires actin and is stimulated by the actin-regulatory protein profilin. As actin is a major contractile protein, it was important to determine whether the known functional domains of actin and profilin were important for their ability to activate RSV transcription. Analyses of recombinant mutants in a reconstituted RSV transcription system suggested that the divalent-cation-binding domain of actin is critically needed for binding to the RSV genome template and for the activation of viral RNA synthesis. In contrast, the nucleotide-binding domain and the N-terminal acidic domain were needed neither for template binding nor for transcription. Specific surface residues of actin, required for actin-actin contact during filamentation, were also nonessential for viral transcription. Unlike actin, profilin did not directly bind to the viral template but was recruited by actin. Mutation of the interactive residues of actin or profilin, resulting in the loss of actin-profilin binding, also abolished profilin's ability to stimulate viral transcription. Together, these results suggest that actin acts as a classical transcription factor for the virus by divalent-cation-dependent binding to the viral template and that profilin acts as a transcriptional cofactor, in part by associating with actin. This essential viral role of actin is independent of its contractile cellular role.

Cytochrome bo(3) from Escherichia coli: the binding and turnover of nitric oxide.

PubMed

Butler, Clive; Forte, Elena; Maria Scandurra, Francesca; Arese, Marzia; Giuffré, Alessandro; Greenwood, Colin; Sarti, Paolo

2002-09-06

The reaction of nitric oxide (NO) with fast and reduced cytochrome bo(3)(cyt bo(3)) from Escherichia coli has been investigated. The stoichiometry of NO binding to cyt bo(3) was determined using an NO electrode in the [NO] range 1-14 microM. Under reducing conditions, the initial decrease in [NO] following the addition of cyt bo(3) corresponded to binding of 1 NO molecule per cyt bo(3) functional unit. After this "rapid" NO binding phase, there was a slow, but significant rate of NO consumption ( approximately 0.3molNOmol bo(3)(-1)min(-1)), indicating that cyt bo(3) possesses a low level of NO reductase activity. The binding of NO to fast pulsed enzyme was also investigated. The results show that in the [NO] range used (1-14 microM) both fast and pulsed oxidised cyt bo(3) bind NO with a stoichiometry of 1:1 with an observed dissociation constant of K(d)=5.6+/-0.6 microM and that NO binding was inhibited by the presence of Cl(-). The binding of nitrite to the binuclear centre causes spectral changes similar to those observed upon NO binding to fast cyt bo(3). These results are discussed in relation to the model proposed by Wilson and co-workers [FEBS Lett. 414 (1997) 281] where the binding of NO to Cu(B)(II) results in the formation of the nitrosonium (Cu(B)(I)-NO(+)) complex. NO(+) then reacts with OH(-), a Cu(B) ligand, to form nitrite, which can bind at the binuclear centre. This work suggests for the first time that the binding of NO to oxidised cyt bo(3) does result in the reduction of Cu(B).

Large-scale remodeling of a repressed exon ribonucleoprotein to an exon definition complex active for splicing

PubMed Central

Wongpalee, Somsakul Pop; Vashisht, Ajay; Sharma, Shalini; Chui, Darryl; Wohlschlegel, James A; Black, Douglas L

2016-01-01

Polypyrimidine-tract binding protein PTBP1 can repress splicing during the exon definition phase of spliceosome assembly, but the assembly steps leading to an exon definition complex (EDC) and how PTBP1 might modulate them are not clear. We found that PTBP1 binding in the flanking introns allowed normal U2AF and U1 snRNP binding to the target exon splice sites but blocked U2 snRNP assembly in HeLa nuclear extract. Characterizing a purified PTBP1-repressed complex, as well as an active early complex and the final EDC by SILAC-MS, we identified extensive PTBP1-modulated changes in exon RNP composition. The active early complex formed in the absence of PTBP1 proceeded to assemble an EDC with the eviction of hnRNP proteins, the late recruitment of SR proteins, and binding of the U2 snRNP. These results demonstrate that during early stages of splicing, exon RNP complexes are highly dynamic with many proteins failing to bind during PTBP1 arrest. DOI: http://dx.doi.org/10.7554/eLife.19743.001 PMID:27882870

Molecular mechanisms underlying deoxy‐ADP.Pi activation of pre‐powerstroke myosin

PubMed Central

Nowakowski, Sarah G.

2017-01-01

Abstract Myosin activation is a viable approach to treat systolic heart failure. We previously demonstrated that striated muscle myosin is a promiscuous ATPase that can use most nucleoside triphosphates as energy substrates for contraction. When 2‐deoxy ATP (dATP) is used, it acts as a myosin activator, enhancing cross‐bridge binding and cycling. In vivo, we have demonstrated that elevated dATP levels increase basal cardiac function and rescues function of infarcted rodent and pig hearts. Here we investigate the molecular mechanism underlying this physiological effect. We show with molecular dynamics simulations that the binding of dADP.Pi (dATP hydrolysis products) to myosin alters the structure and dynamics of the nucleotide binding pocket, myosin cleft conformation, and actin binding sites, which collectively yield a myosin conformation that we predict favors weak, electrostatic binding to actin. In vitro motility assays at high ionic strength were conducted to test this prediction and we found that dATP increased motility. These results highlight alterations to myosin that enhance cross‐bridge formation and reveal a potential mechanism that may underlie dATP‐induced improvements in cardiac function. PMID:28097776

Characterization of molecular interactions between Zika virus protease and peptides derived from the C-terminus of NS2B.

PubMed

Li, Yan; Loh, Ying Ru; Hung, Alvin W; Kang, CongBao

2018-06-21

Zika virus (ZIKV) protease is a two-component complex in which NS3 contains the catalytic triad and NS2B cofactor region is important for protease folding and activity. A protease construct-eZiPro without the transmembrane domains of NS2B was designed. Structural study on eZiPro reveals that the Thr-Gly-Lys-Arg (TGKR) sequence at the C-terminus of NS2B binds to the active site after cleavage. The bZiPro construct only contains NS2B cofactor region and the N-terminus of NS3 without any artificial linker or protease cleavage site, giving rise to an empty pocket accessible to substrate and inhibitor binding. Herein, we demonstrate that the TGKR sequence of NS2B in eZiPro is dynamic. Peptides from NS2B with various lengths exhibit different binding affinities to bZiPro. TGKR binding to the active site in eZiPro does not affect protease binding to small-molecule compounds. Our results suggest that eZiPro will also be useful for evaluating small-molecule protease inhibitors. Copyright © 2018 Elsevier Inc. All rights reserved.

Elimination of a ligand gating site generates a supersensitive olfactory receptor.

PubMed

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

2016-06-21

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

Elimination of a ligand gating site generates a supersensitive olfactory receptor

PubMed Central

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

2016-01-01

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

Novobiocin and additional inhibitors of the Hsp90 C-terminal nucleotide-binding pocket.

PubMed

Donnelly, Alison; Blagg, Brian S J

2008-01-01

The 90 kDa heat shock proteins (Hsp90), which are integrally involved in cell signaling, proliferation, and survival, are ubiquitously expressed in cells. Many proteins in tumor cells are dependent upon the Hsp90 protein folding machinery for their stability, refolding, and maturation. Inhibition of Hsp90 uniquely targets client proteins associated with all six hallmarks of cancer. Thus, Hsp90 has emerged as a promising target for the treatment of cancer. Hsp90 exists as a homodimer, which contains three domains. The N-terminal domain contains an ATP-binding site that binds the natural products geldanamycin and radicicol. The middle domain is highly charged and has high affinity for co-chaperones and client proteins. Initial studies by Csermely and co-workers suggested a second ATP-binding site in the C-terminus of Hsp90. This C-terminal nucleotide binding pocket has been shown to not only bind ATP, but cisplatin, novobiocin, epilgallocatechin-3-gallate (EGCG) and taxol. The coumarin antibiotics novobiocin, clorobiocin, and coumermycin A1 were isolated from several streptomyces strains and exhibit potent activity against Gram-positive bacteria. These compounds bind type II topoisomerases, including DNA gyrase, and inhibit the enzyme-catalyzed hydrolysis of ATP. As a result, novobiocin analogues have garnered the attention of numerous researchers as an attractive agent for the treatment of bacterial infection. Novobiocin was reported to bind weakly to the newly discovered Hsp90 C-terminal ATP binding site ( approximately 700 M in SkBr3 cells) and induce degradation of Hsp90 client proteins. Structural modification of this compound has led to an increase of 1000-fold in activity in anti-proliferative assays. Recent studies of structure-activity relationship (SAR) by Renoir and co-workers highlighted the crucial role of the C-4 and/or C-7 positions of the coumarin and removal of the noviose moiety, which appeared to be essential for degradation of Hsp90 client proteins. Unlike the N-terminal ATP binding site, there is no reported co-crystal structure of Hsp90 C-terminus bound to any inhibitor. The Hsp90 C-terminal domain, however, is known to contain a conserved pentapeptide sequence (MEEVD) which is recognized by co-chaperones. Cisplatin is a platinum-containing chemotherapeutic used to treat various types of cancers, including testicular, ovarian, bladder, and small cell lung cancer. Most notably, cisplatin coordinates to DNA bases, resulting in cross-linked DNA, which prohibits rapidly dividing cells from duplicating DNA for mitosis. Itoh and co-workers reported that cisplatin decreases the chaperone activity of Hsp90. This group applied bovine brain cytosol to a cisplatin affinity column, eluted with cisplatin and detected Hsp90 in the eluent. Subsequent experiments indicated that cisplatin exhibits high affinity for Hsp90. Moreover Csermely and co-workers determined that the cisplatin binding site is located proximal to the C-terminal ATP binding site. EGCG is one of the active ingredients found in green tea. EGCG is known to inhibit the activity of many Hsp90-dependent client proteins, including telomerase, several kinases, and the aryl hydrocarbon receptor (AhR). Recently Gasiewicz and co-workers reported that EGCG manifests its antagonistic activity against AhR through binding Hsp90. Similar to novobiocin, EGCG was shown to bind the C-terminus of Hsp90. Unlike previously identified N-terminal Hsp90 inhibitors, EGCG does not appear to prevent Hsp90 from forming multiprotein complexes. Studies are currently underway to determine whether EGCG competes with novobiocin or cisplatin binding. Taxol, a well-known drug for the treatment of cancer, is responsible for the stabilization of microtubules and the inhibition of mitosis. Previous studies have shown that taxol induces the activation of kinases and transcription factors, and mimics the effect of bacterial lipopolysaccharide (LPS), an attribute unrelated to its tubulin-binding properties. Rosen and co-workers prepared a biotinylated taxol derivative and performed affinity chromatography experiments with lysates from both mouse brain and macrophage cell lines. These studies led to identification of two chaperones, Hsp70 and Hsp90, by mass spectrometry. In contrast to typical Hsp90-binding drugs, taxol exhibits a stimulatory response. Recently it was reported that the geldanamycin derivative 17-AAG behaves synergistically with taxol-induced apoptosis. This review describes the different C-terminal inhibitors of Hsp90, with specific emphasis on structure-activity relationship studies of novobiocin and their effects on anti-proliferative activity.

Novobiocin and Additional Inhibitors of the Hsp90 C-Terminal Nucleotide-binding Pocket

PubMed Central

Donnelly, Alison; Blagg, Brian S. J.

2009-01-01

The 90 kDa heal shock proteins (Hsp90), which are integrally involved in cell signaling, proliferation, and survival, are ubiquitously expressed in cells. Many proteins in tumor cells are dependent upon the Hsp90 protein folding machinery for their stability, refolding, and maturation. Inhibition of Hsp90 uniquely targets client proteins associated with all six hallmarks of cancer. Thus, Hsp90 has emerged as a promising target for the treatment of cancer. Hsp90 exists as a homodimer, which contains three domains. The N-terminal domain contains an ATP-binding site that binds the natural products geldanamycin and radicicol. The middle domain is highly charged and has high affinity for co-chaperones and client proteins. Initial studies by Csermely and co-workers suggested a second ATP-binding site in the C-terminus of Hsp90. This C-terminal nucleotide binding pocket has been shown to not only bind ATP, but cisplatin, novobiocin, epilgallocatechin-3-gallate (EGCG) and taxol. The coumarin antibiotics novobiocin, clorobiocin, and coumermycin A1 were isolated from several streptomyces strains and exhibit potent activity against Gram-positive bacteria. These compounds bind type II topoisomerases, including DNA gyrase, and inhibit the enzyme-catalyzed hydrolysis of ATP. As a result, novobiocin analogues have garnered the attention of numerous researchers as an attractive agent for the treatment of bacterial infection. Novobiocin was reported to bind weakly to the newly discovered Hsp90 C-terminal ATP binding site (~700 M in SkBr3 cells) and induce degradation of Hsp90 client proteins. Structural modification of this compound has led to an increase of 1000-fold in activity in anti-proliferative assays. Recent studies of structure-activity relationship (SAR) by Renoir and co-workers highlighted the crucial role of the C-4 and/or C-7 positions of the coumarin and removal of the noviose moiety, which appeared to be essential for degradation of Hsp90 client proteins. Unlike the N-terminal ATP binding site, there is no reported co-crystal structure of Hsp90 C-terminus bound to any inhibitor. The Hsp90 C-terminal domain, however, is known to contain a conserved pentapeptide sequence (MEEVD) which is recognized by co-chaperones. Cisplatin is a platinum-containing chemotherapeutic used to treat various types of cancers, including testicular, ovarian, bladder, and small cell lung cancer. Most notably, cisplatin coordinates to DNA bases, resulting in cross-linked DNA, which prohibits rapidly dividing cells from duplicating DNA for mitosis. Itoh and co-workers reported that cisplatin decreases the chaperone activity of Hsp90. This group applied bovine brain cytosol to a cisplatin affinity column, eluted with cisplatin and detected Hsp90 in the eluent. Subsequent experiments indicated that cisplatin exhibits high affinity for Hsp90. Moreover Csermely and co-workers determined that the cisplatin binding site is located proximal to the C-terminal ATP binding site. EGCG is one of the active ingredients found in green tea EGCG is known to inhibit the activity of many Hsp90-dependent client proteins, including telomerase, several kinases, and the aryl hydrocarbon receptor (AhR). Recently Gasiewicz and co-workers reported that EGCG manifests its antagonistic activity against AhR through binding Hsp90. Similar to novobiocin, EGCG was shown to bind the C-terminus of Hsp90. Unlike previously identified N-terminal Hsp90 inhibitors, EGCG does not appear to prevent Hsp90 from forming multiprotein complexes. Studies are currently underway to determine whether EGCG competes with novobiocin or cisplatin binding. Taxol, a well-known drug for the treatment of cancer, is responsible for the stabilization of microtubules and the inhibition of mitosis. Previous studies have shown that taxol induces the activation of kinases and transcription factors, and mimies the effect of bacterial lipopolysaccharide (LPS), an attribute unrelated to its tubulin-binding properties. Rosen and co-workers prepared a biotinylated taxol derivative and performed affinity chromatography experiments with lysates from both mouse brain and macrophage cell lines. These studies led to identification of two chaperones. Hsp70 and Hsp90, by mass spectrometry. In contrast to typical Hsp90-binding drugs, taxol exhibits a stimulatory response. Recently it was reported that the geldanamycin derivative 17-AAG behaves synergistically with taxol-induced apoptosis. This review describes the different C-terminal inhibitors of Hsp90, with specific emphasis on structure-activity relationship studies of novobiocin and their effects on anti-proliferative activity. PMID:18991631

MEK-1 Activates C-Raf Through a Ras-Independent Mechanism

PubMed Central

Leicht, Deborah T.; Balan, Vitaly; Zhu, Jun; Kaplun, Alexander; Bronisz, Agnieszka; Rana, Ajay; Tzivion, Guri

2013-01-01

C-Raf is a member of the Ras-Raf-MEK-ERK mitogen-activated protein kinase (MAPK) signaling pathway that plays key roles in diverse physiological processes and is upregulated in many human cancers. C-Raf activation involves binding to Ras, increased phosphorylation and interactions with co-factors. Here, we describe a Ras-independent in vivo pathway for C-Raf activation by its downstream target MEK. Using 32P-metabolic labeling and 2D-phosphopeptide mapping experiments, we show that MEK increases C-Raf phosphorylation by up-to 10-fold. This increase was associated with C-Raf kinase activation, matching the activity seen with growth factor stimulation. Consequently, coexpression of wildtype C-Raf and MEK was sufficient for full and constitutive activation of ERK. Notably, the ability of MEK to activate C-Raf was completely Ras independent, since mutants impaired in Ras binding that are irresponsive to growth factors or Ras were fully activated by MEK. The ability of MEK to activate C-Raf was only partially dependent on MEK kinase activity but required MEK binding to C-Raf, suggesting that the binding results in a conformational change that increases C-Raf susceptibility to phosphorylation and activation or in the stabilization of the phosphorylated-active form. These findings propose a novel Ras-independent mechanism for activating C-Raf and the MAPK pathway without the need for mutations in the pathway. This mechanism could be of significance in pathological conditions or cancers overexpressing C-Raf and MEK or in conditions where C-Raf-MEK interaction is enhanced due to the downregulation of RKIP and MST2. PMID:23360980

Functional connectivity supporting the selective maintenance of feature-location binding in visual working memory

PubMed Central

Takahama, Sachiko; Saiki, Jun

2014-01-01

Information on an object's features bound to its location is very important for maintaining object representations in visual working memory. Interactions with dynamic multi-dimensional objects in an external environment require complex cognitive control, including the selective maintenance of feature-location binding. Here, we used event-related functional magnetic resonance imaging to investigate brain activity and functional connectivity related to the maintenance of complex feature-location binding. Participants were required to detect task-relevant changes in feature-location binding between objects defined by color, orientation, and location. We compared a complex binding task requiring complex feature-location binding (color-orientation-location) with a simple binding task in which simple feature-location binding, such as color-location, was task-relevant and the other feature was task-irrelevant. Univariate analyses showed that the dorsolateral prefrontal cortex (DLPFC), hippocampus, and frontoparietal network were activated during the maintenance of complex feature-location binding. Functional connectivity analyses indicated cooperation between the inferior precentral sulcus (infPreCS), DLPFC, and hippocampus during the maintenance of complex feature-location binding. In contrast, the connectivity for the spatial updating of simple feature-location binding determined by reanalyzing the data from Takahama et al. (2010) demonstrated that the superior parietal lobule (SPL) cooperated with the DLPFC and hippocampus. These results suggest that the connectivity for complex feature-location binding does not simply reflect general memory load and that the DLPFC and hippocampus flexibly modulate the dorsal frontoparietal network, depending on the task requirements, with the infPreCS involved in the maintenance of complex feature-location binding and the SPL involved in the spatial updating of simple feature-location binding. PMID:24917833

Functional connectivity supporting the selective maintenance of feature-location binding in visual working memory.

PubMed

Takahama, Sachiko; Saiki, Jun

2014-01-01

Information on an object's features bound to its location is very important for maintaining object representations in visual working memory. Interactions with dynamic multi-dimensional objects in an external environment require complex cognitive control, including the selective maintenance of feature-location binding. Here, we used event-related functional magnetic resonance imaging to investigate brain activity and functional connectivity related to the maintenance of complex feature-location binding. Participants were required to detect task-relevant changes in feature-location binding between objects defined by color, orientation, and location. We compared a complex binding task requiring complex feature-location binding (color-orientation-location) with a simple binding task in which simple feature-location binding, such as color-location, was task-relevant and the other feature was task-irrelevant. Univariate analyses showed that the dorsolateral prefrontal cortex (DLPFC), hippocampus, and frontoparietal network were activated during the maintenance of complex feature-location binding. Functional connectivity analyses indicated cooperation between the inferior precentral sulcus (infPreCS), DLPFC, and hippocampus during the maintenance of complex feature-location binding. In contrast, the connectivity for the spatial updating of simple feature-location binding determined by reanalyzing the data from Takahama et al. (2010) demonstrated that the superior parietal lobule (SPL) cooperated with the DLPFC and hippocampus. These results suggest that the connectivity for complex feature-location binding does not simply reflect general memory load and that the DLPFC and hippocampus flexibly modulate the dorsal frontoparietal network, depending on the task requirements, with the infPreCS involved in the maintenance of complex feature-location binding and the SPL involved in the spatial updating of simple feature-location binding.

dsRNA binding properties of RDE-4 and TRBP reflect their distinct roles in RNAi.

PubMed

Parker, Greg S; Maity, Tuhin Subhra; Bass, Brenda L

2008-12-26

Double-stranded RNA (dsRNA)-binding proteins facilitate Dicer functions in RNA interference. Caenorhabditis elegans RDE-4 facilitates cleavage of long dsRNA to small interfering RNA (siRNA), while human trans-activation response RNA-binding protein (TRBP) functions downstream to pass siRNA to the RNA-induced silencing complex. We show that these distinct in vivo roles are reflected in in vitro binding properties. RDE-4 preferentially binds long dsRNA, while TRBP binds siRNA with an affinity that is independent of dsRNA length. These properties are mechanistically based on the fact that RDE-4 binds cooperatively, via contributions from multiple domains, while TRBP binds noncooperatively. Our studies offer a paradigm for how dsRNA-binding proteins, which are not sequence specific, discern dsRNA length. Additionally, analyses of the ability of RDE-4 deletion constructs and RDE-4/TRBP chimeras to reconstitute Dicer activity suggest RDE-4 promotes activity using its dsRNA-binding motif 2 to bind dsRNA, its linker region to interact with Dicer, and its C-terminus for Dicer activation.

Genome-Wide Binding Analysis of the Transcription Activator IDEAL PLANT ARCHITECTURE1 Reveals a Complex Network Regulating Rice Plant Architecture[W

PubMed Central

Lu, Zefu; Yu, Hong; Xiong, Guosheng; Wang, Jing; Jiao, Yongqing; Liu, Guifu; Jing, Yanhui; Meng, Xiangbing; Hu, Xingming; Qian, Qian; Fu, Xiangdong; Wang, Yonghong; Li, Jiayang

2013-01-01

IDEAL PLANT ARCHITECTURE1 (IPA1) is critical in regulating rice (Oryza sativa) plant architecture and substantially enhances grain yield. To elucidate its molecular basis, we first confirmed IPA1 as a functional transcription activator and then identified 1067 and 2185 genes associated with IPA1 binding sites in shoot apices and young panicles, respectively, through chromatin immunoprecipitation sequencing assays. The SQUAMOSA PROMOTER BINDING PROTEIN-box direct binding core motif GTAC was highly enriched in IPA1 binding peaks; interestingly, a previously uncharacterized indirect binding motif TGGGCC/T was found to be significantly enriched through the interaction of IPA1 with proliferating cell nuclear antigen PROMOTER BINDING FACTOR1 or PROMOTER BINDING FACTOR2. Genome-wide expression profiling by RNA sequencing revealed IPA1 roles in diverse pathways. Moreover, our results demonstrated that IPA1 could directly bind to the promoter of rice TEOSINTE BRANCHED1, a negative regulator of tiller bud outgrowth, to suppress rice tillering, and directly and positively regulate DENSE AND ERECT PANICLE1, an important gene regulating panicle architecture, to influence plant height and panicle length. The elucidation of target genes of IPA1 genome-wide will contribute to understanding the molecular mechanisms underlying plant architecture and to facilitating the breeding of elite varieties with ideal plant architecture. PMID:24170127

The role of Ca²⁺ in the activity of Mycobacterium tuberculosis DNA gyrase.

PubMed

Karkare, Shantanu; Yousafzai, Faridoon; Mitchenall, Lesley A; Maxwell, Anthony

2012-10-01

DNA gyrase is the only type II topoisomerase in Mycobacterium tuberculosis and needs to catalyse DNA supercoiling, relaxation and decatenation reactions in order to fulfil the functions normally carried out by gyrase and DNA topoisomerase IV in other bacteria. We have obtained evidence for the existence of a Ca(2+)-binding site in the GyrA subunit of M. tuberculosis gyrase. Ca(2+) cannot support topoisomerase reactions in the absence of Mg(2+), but partial removal of Ca(2+) from GyrA by dialysis against EGTA leads to a modest loss in relaxation activity that can be restored by adding back Ca(2+). More extensive removal of Ca(2+) by denaturation of GyrA and dialysis against EGTA results in an enzyme with greatly reduced enzyme activities. Mutation of the proposed Ca(2+)-binding residues also leads to loss of activity. We propose that Ca(2+) has a regulatory role in M. tuberculosis gyrase and suggest a model for the modulation of gyrase activity by Ca(2+) binding.

The role of Ca2+ in the activity of Mycobacterium tuberculosis DNA gyrase

PubMed Central

Karkare, Shantanu; Yousafzai, Faridoon; Mitchenall, Lesley A.; Maxwell, Anthony

2012-01-01

DNA gyrase is the only type II topoisomerase in Mycobacterium tuberculosis and needs to catalyse DNA supercoiling, relaxation and decatenation reactions in order to fulfil the functions normally carried out by gyrase and DNA topoisomerase IV in other bacteria. We have obtained evidence for the existence of a Ca2+-binding site in the GyrA subunit of M. tuberculosis gyrase. Ca2+ cannot support topoisomerase reactions in the absence of Mg2+, but partial removal of Ca2+ from GyrA by dialysis against EGTA leads to a modest loss in relaxation activity that can be restored by adding back Ca2+. More extensive removal of Ca2+ by denaturation of GyrA and dialysis against EGTA results in an enzyme with greatly reduced enzyme activities. Mutation of the proposed Ca2+-binding residues also leads to loss of activity. We propose that Ca2+ has a regulatory role in M. tuberculosis gyrase and suggest a model for the modulation of gyrase activity by Ca2+ binding. PMID:22844097

Interfacial binding of cutinase rather than its catalytic activity determines the steady state interfacial tension during oil drop lipid hydrolysis.

PubMed

Flipsen, J A; van Schaick, M A; Dijkman, R; van der Hijden, H T; Verheij, H M; Egmond, M R

1999-02-01

Hydrolysis of triglycerides by cutinase from Fusarium solani pisi causes in oil drop tensiometer experiments a decrease of the interfacial tension. A series of cutinase variants with amino acid substitutions at its molecular surface yielded different values of the steady state interfacial tension. This tension value poorly correlated with the specific activity as such nor with the total activity (defined as the specific activity multiplied by the amount of enzyme bound) of the cutinase variants. Moreover, it appeared that at activity levels above 15% of that of wild type cutinase the contribution of hydrolysis to the decrease of the tension is saturating. A clear positive correlation was found between the interfacial tension plateau value and the interfacial binding of cutinase, as determined with attenuated total reflection Fourier transformed infrared spectroscopy (ATR-FTIR). These results indicate that the interfacial steady state level is not determined by the rate of hydrolysis, but mainly by the interfacial binding of cutinase.

Novel Carbonyl Analogues of Tamoxifen: Design, Synthesis, and Biological Evaluation

NASA Astrophysics Data System (ADS)

Kasiotis, Konstantinos M.; Lambrinidis, George; Fokialakis, Nikolas; Tzanetou, Evangelia N.; Mikros, Emmanuel; Haroutounian, Serkos A.

2017-09-01

Aim of this work was to provide tamoxifen analogues with enhanced estrogen receptor binding affinity. Hence, several derivatives were prepared using an efficient triarylethylenes synthetic protocol. The novel compounds bioactivity was evaluated through the determination of their receptor binding affinity and their agonist/antagonist activity against breast cancer tissue using a MCF-7 cell-based assay. Phenyl esters 6a,b and 8a,b exhibited binding affinity to both ERα and ERβ higher than 4-hydroxytamoxifen while compounds 13 and 14 have shown cellular antiestrogenic activity similar to 4-hydroxytamoxifen and the known estrogen receptor inhibitor ICI182,780. Theoretical calculations and molecular modelling were applied to investigate, support and explain the biological profile of the new compounds. The relevant data indicated an agreement between calculations and demonstrated biological activity allowing to extract useful structure-activity relationships. Results herein underline that modifications of tamoxifen structure still provide molecules with substantial activity, as portrayed in the inhibition of MCF-7 cells proliferation.

Ligand-induced changes in 2-aminopurine fluorescence as a probe for small molecule binding to HIV-1 TAR RNA

PubMed Central

BRADRICK, THOMAS D.; MARINO, JOHN P.

2004-01-01

Replication of human immunodeficiency virus type 1 (HIV-1) is regulated in part through an interaction between the virally encoded trans-activator protein Tat and the trans-activator responsive region (TAR) of the viral RNA genome. Because TAR is highly conserved and its interaction with Tat is required for efficient viral replication, it has received much attention as an antiviral drug target. Here, we report a 2-aminopurine (2-AP) fluorescence-based assay for evaluating potential TAR inhibitors. Through selective incorporation of 2-AP within the bulge (C23 or U24) of a truncated form of the TAR sequence (Δ TAR-ap23 and Δ TAR-ap24), binding of argininamide, a 24-residue arginine-rich peptide derived from Tat, and Neomycin has been characterized using steady-state fluorescence. Binding of argininamide to the 2-AP ΔTAR constructs results in a four- to 11-fold increase in fluorescence intensity, thus providing a sensitive reporter of that interaction (KD ~ 1 mM). Similarly, binding of the Tat peptide results in an initial 14-fold increase in fluorescence (KD ~ 25 nM), but is then followed by a slight decrease that is attributed to an additional, lower-affinity association(s). Using the ΔTAR-ap23 and TAR-ap24 constructs, two classes of Neomycin binding sites are detected; the first molecule of antibiotic binds as a noncompetitive inhibitor of Tat/argininamide (KD ~ 200 nM), whereas the second, more weakly bound molecule(s) becomes associated in a presumably nonspecific manner (KD ~ 4 μM). Taken together, the results demonstrate that the 2-AP fluorescence-detected binding assays provide accurate and general methods for quantitatively assessing TAR interactions. PMID:15273324

Comparative analysis of activator-Eσ54 complexes formed with nucleotide-metal fluoride analogues

PubMed Central

Burrows, Patricia C.; Joly, Nicolas; Nixon, B. Tracy; Buck, Martin

2009-01-01

Bacterial RNA polymerase (RNAP) containing the major variant σ54 factor forms open promoter complexes in a reaction in which specialized activator proteins hydrolyse ATP. Here we probe binding interactions between σ54-RNAP (Eσ54) and the ATPases associated with various cellular activities (AAA+) domain of the Escherichia coli activator protein, PspF, using nucleotide-metal fluoride (BeF and AlF) analogues representing ground and transition states of ATP, which allow complexes (that are otherwise too transient with ATP) to be captured. We show that the organization and functionality of the ADP–BeF- and ADP–AlF-dependent complexes greatly overlap. Our data support an activation pathway in which the initial ATP-dependent binding of the activator to the Eσ54 closed complex results in the re-organization of Eσ54 with respect to the transcription start-site. However, the nucleotide-dependent binding interactions between the activator and the Eσ54 closed complex are in themselves insufficient for forming open promoter complexes when linear double-stranded DNA is present in the initial closed complex. PMID:19553192

The Aryl Hydrocarbon Receptor Binds to E2F1 and Inhibits E2F1-induced Apoptosis

PubMed Central

Marlowe, Jennifer L.; Fan, Yunxia; Chang, Xiaoqing; Peng, Li; Knudsen, Erik S.; Xia, Ying

2008-01-01

Cellular stress by DNA damage induces checkpoint kinase-2 (CHK2)-mediated phosphorylation and stabilization of the E2F1 transcription factor, leading to induction of apoptosis by activation of a subset of proapoptotic E2F1 target genes, including Apaf1 and p73. This report characterizes an interaction between the aryl hydrocarbon (Ah) receptor (AHR), a ligand-activated transcription factor, and E2F1 that results in the attenuation of E2F1-mediated apoptosis. In Ahr−/− fibroblasts stably transfected with a doxycycline-regulated AHR expression vector, inhibition of AHR expression causes a significant elevation of oxidative stress, γH2A.X histone phosphorylation, and E2F1-dependent apoptosis, which can be blocked by small interfering RNA-mediated knockdown of E2F1 expression. In contrast, ligand-dependent AHR activation protects these cells from etoposide-induced cell death. In cells expressing both proteins, AHR and E2F1 interact independently of the retinoblastoma protein (RB), because AHR and E2F1 coimmunoprecipitate from extracts of RB-negative cells. Additionally, chromatin immunoprecipitation assays indicate that AHR and E2F1 bind to the Apaf1 promoter at a region containing a consensus E2F1 binding site but no AHR binding sites. AHR activation represses Apaf1 and TAp73 mRNA induction by a constitutively active CHK2 expression vector. Furthermore, AHR overexpression blocks the transcriptional induction of Apaf1 and p73 and the accumulation of sub-G0/G1 cells resulting from ectopic overexpression of E2F1. These results point to a proproliferative, antiapoptotic function of the Ah receptor that likely plays a role in tumor progression. PMID:18524851

The acidic transcription activator Gcn4 binds the mediator subunit Gal11/Med15 using a simple protein interface forming a fuzzy complex.

PubMed

Brzovic, Peter S; Heikaus, Clemens C; Kisselev, Leonid; Vernon, Robert; Herbig, Eric; Pacheco, Derek; Warfield, Linda; Littlefield, Peter; Baker, David; Klevit, Rachel E; Hahn, Steven

2011-12-23

The structural basis for binding of the acidic transcription activator Gcn4 and one activator-binding domain of the Mediator subunit Gal11/Med15 was examined by NMR. Gal11 activator-binding domain 1 has a four-helix fold with a small shallow hydrophobic cleft at its center. In the bound complex, eight residues of Gcn4 adopt a helical conformation, allowing three Gcn4 aromatic/aliphatic residues to insert into the Gal11 cleft. The protein-protein interface is dynamic and surprisingly simple, involving only hydrophobic interactions. This allows Gcn4 to bind Gal11 in multiple conformations and orientations, an example of a "fuzzy" complex, where the Gcn4-Gal11 interface cannot be described by a single conformation. Gcn4 uses a similar mechanism to bind two other unrelated activator-binding domains. Functional studies in yeast show the importance of residues at the protein interface, define the minimal requirements for a functional activator, and suggest a mechanism by which activators bind to multiple unrelated targets. Copyright © 2011 Elsevier Inc. All rights reserved.

Key Structures and Interactions for Binding of Mycobacterium tuberculosis Protein Kinase B Inhibitors from Molecular Dynamics Simulation.

PubMed

Punkvang, Auradee; Kamsri, Pharit; Saparpakorn, Patchreenart; Hannongbua, Supa; Wolschann, Peter; Irle, Stephan; Pungpo, Pornpan

2015-07-01

Substituted aminopyrimidine inhibitors have recently been introduced as antituberculosis agents. These inhibitors show impressive activity against protein kinase B, a Ser/Thr protein kinase that is essential for cell growth of M. tuberculosis. However, up to now, X-ray structures of the protein kinase B enzyme complexes with the substituted aminopyrimidine inhibitors are currently unavailable. Consequently, structural details of their binding modes are questionable, prohibiting the structural-based design of more potent protein kinase B inhibitors in the future. Here, molecular dynamics simulations, in conjunction with molecular mechanics/Poisson-Boltzmann surface area binding free-energy analysis, were employed to gain insight into the complex structures of the protein kinase B inhibitors and their binding energetics. The complex structures obtained by the molecular dynamics simulations show binding free energies in good agreement with experiment. The detailed analysis of molecular dynamics results shows that Glu93, Val95, and Leu17 are key residues responsible to the binding of the protein kinase B inhibitors. The aminopyrazole group and the pyrimidine core are the crucial moieties of substituted aminopyrimidine inhibitors for interaction with the key residues. Our results provide a structural concept that can be used as a guide for the future design of protein kinase B inhibitors with highly increased antagonistic activity. © 2014 John Wiley & Sons A/S.

Multiple autophosphorylations significantly enhance the endoribonuclease activity of human inositol requiring enzyme 1α

PubMed Central

2014-01-01

Background Endoplasmic reticulum stress, caused by the presence of misfolded proteins, activates the stress sensor inositol-requiring enzyme 1α (IRE1α). The resulting increase in IRE1α RNase activity causes sequence-specific cleavage of X-box binding protein 1 (XBP1) mRNA, resulting in upregulation of the unfolded protein response and cellular adaptation to stress. The precise mechanism of human IRE1α activation is currently unclear. The role of IRE1α kinase activity is disputed, as results from the generation of various kinase-inactivating mutations in either yeast or human cells are discordant. Kinase activity can also be made redundant by small molecules which bind the ATP binding site. We set out to uncover a role for IRE1α kinase activity using wild-type cytosolic protein constructs. Results We show that concentration-dependent oligomerisation is sufficient to cause IRE1α cytosolic domain RNase activity in vitro. We demonstrate a role for the kinase activity by showing that autophosphorylation enhances RNase activity. Inclusion of the IRE1α linker domain in protein constructs allows hyperphosphorylation and further enhancement of RNase activity, highlighting the importance of kinase activity. We show that IRE1α phosphorylation status correlates with an increased propensity to form oligomeric complexes and that forced dimerisation causes great enhancement in RNase activity. In addition we demonstrate that even when IRE1α is forced to dimerise, by a GST-tag, phospho-enhancement of activity is still observed. Conclusions Taken together these experiments support the hypothesis that phosphorylation is important in modulating IRE1α RNase activity which is achieved by increasing the propensity of IRE1α to dimerise. This work supports the development of IRE1α kinase inhibitors for use in the treatment of secretory cancers. PMID:24524643

Binding and Utilization of Human Transferrin by Prevotella nigrescens

PubMed Central

Duchesne, Pascale; Grenier, Daniel; Mayrand, Denis

1999-01-01

To survive and multiply within their hosts, pathogens must possess efficient iron-scavenging mechanisms. In the present study, we investigate the capacity of Prevotella nigrescens and Prevotella intermedia to use various sources of iron for growth and characterize the transferrin-binding activity of P. nigrescens. Iron-saturated human transferrin and lactoferrin, but not ferric chloride and the iron-free form of transferrin, could be used as sources of iron by P. nigrescens and P. intermedia. Neither siderophore activity nor ferric reductase activity could be detected in P. nigrescens and P. intermedia. However, both species showed transferrin-binding activity as well as the capacity to proteolytically cleave transferrin. To various extents, all strains of P. nigrescens and P. intermedia tested demonstrated transferrin-binding activity. The activity was heat and protease sensitive. The capacity of P. nigrescens to bind transferrin was decreased when cells were grown in the presence of hemin. Preincubation of bacterial cells with hemin, hemoglobin, lactoferrin, fibrinogen, immunoglobulin G, or laminin did not affect transferrin-binding activity. The transferrin-binding protein could be extracted from the cell surface of P. nigrescens by treatment with a zwitterionic detergent. Subjecting the cell surface extract to affinity chromatography on an agarose-transferrin column revealed that it contained a protein having an estimated molecular mass of 37 kDa and possessing transferrin-binding activity. The transferrin-binding activity of P. nigrescens and P. intermedia may permit the bacteria to obtain iron for survival and growth in periodontal pockets. PMID:9916061

Role of adipocyte lipid-binding protein (ALBP) and acyl-coA binding protein (ACBP) in PPAR-mediated transactivation.

PubMed

Helledie, Torben; Jørgensen, Claus; Antonius, Marianne; Krogsdam, Ann M; Kratchmarova, Irina; Kristiansen, Karsten; Mandrup, Susanne

2002-10-01

Peroxisome proliferator-activated receptors (PPARs) are nuclear hormone receptors that are activated by a number of fatty acids and fatty acid derivatives. By contrast, we have recently shown that acyl-CoA esters display PPAR antagonistic properties in vitro. We have also shown that the adipocyte lipid binding protein (ALBP), the keratinocyte lipid binding protein (KLBP) and the acyl-CoA binding protein (ACBP) exhibit a prominent nuclear localization in differentiating 3T3-L1 adipocytes. Similarly, ectopic expression of these proteins in CV-1 cells resulted in a primarily nuclear localization. We therefore speculated that FABPs and ACBP might regulate the availability of PPAR agonists and antagonists by affecting not only their esterification in the cytoplasm but also their transport to and availability in the nucleus. We show here that coexpression of ALBP or ACBP exerts a negative effect on ligand-dependent PPAR transactivation, when tetradecylthioacetic (TTA) is used as ligand but not when the thiazolidinedione BRL49653 is used as ligand. The results presented here do not support the hypothesis that ALBP facilitates the transport of the fatty acid-type ligands to the nucleus, rather ALBP appears to sequester or increase the turn-over of the agonist. Similarly, our results are in keeping with a model in which ACBP increase the metabolism of these ligands.

Complex Actions of Thyroid Hormone Receptor Antagonist NH-3 on Gene Promoters in Different Cell Lines

PubMed Central

Shah, Vanya; Nguyen, Phuong; Nguyen, Ngoc-Ha; Togashi, Marie; Scanlan, Thomas S.; Baxter, John D.; Webb, Paul

2014-01-01

It is desirable to obtain new antagonists for thyroid hormone (TRs) and other nuclear receptors (NRs). We previously used X-ray structural models of TR ligand binding domains (LBDs) to design compounds, such as NH-3, that impair coactivator binding to activation function 2 (AF-2) and block thyroid hormone (triiodothyronine, T3) actions. However, TRs bind DNA and are transcriptionally active without ligand. Thus, NH-3 could modulate TR activity via effects on other coregulator interaction surfaces, such as activation function (AF-1) and corepressor binding sites. Here, we find that NH-3 blocks TR-LBD interactions with coactivators and corepressors and also inhibits activities of AF-1 and AF-2 in transfections. While NH-3 lacks detectable agonist activity at T3-activated genes in GC pituitary cells it nevertheless activates spot 14 (S14) in HTC liver cells with the latter effect accompanied by enhanced histone H4 acetylation and coactivator recruitment at the S14 promoter. Surprisingly, T3 promotes corepressor recruitment to target promoters. NH-3 effects vary; we observe transient recruitment of N-CoR to S14 in GC cells and dismissal and rebinding of N-CoR to the same promoter in HTC cells. We propose that NH-3 will generally behave as an antagonist by blocking AF-1 and AF-2 but that complex effects on coregulator recruitment may result in partial/mixed agonist effects that are independent of blockade of T3 binding in some contexts. These properties could ultimately be utilized in drug design and development of new selective TR modulators. PMID:18930112

Glutathione regulation of redox-sensitive signals in tumor necrosis factor-{alpha}-induced vascular endothelial dysfunction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsou, T.-C.; Yeh, S.C.; Tsai, F.-Y.

2007-06-01

We investigated the regulatory role of glutathione in tumor necrosis factor-alpha (TNF-{alpha})-induced vascular endothelial dysfunction as evaluated by using vascular endothelial adhesion molecule expression and monocyte-endothelial monolayer binding. Since TNF-{alpha} induces various biological effects on vascular cells, TNF-{alpha} dosage could be a determinant factor directing vascular cells into different biological fates. Based on the adhesion molecule expression patterns responding to different TNF-{alpha} concentrations, we adopted the lower TNF-{alpha} (0.2 ng/ml) to rule out the possible involvement of other TNF-{alpha}-induced biological effects. Inhibition of glutathione synthesis by L-buthionine-(S,R)-sulfoximine (BSO) resulted in down-regulations of the TNF-{alpha}-induced adhesion molecule expression and monocyte-endothelial monolayermore » binding. BSO attenuated the TNF-{alpha}-induced nuclear factor-kappaB (NF-{kappa}B) activation, however, with no detectable effect on AP-1 and its related mitogen-activated protein kinases (MAPKs). Deletion of an AP-1 binding site in intercellular adhesion molecule-1 (ICAM-1) promoter totally abolished its constitutive promoter activity and its responsiveness to TNF-{alpha}. Inhibition of ERK, JNK, or NF-{kappa}B attenuates TNF-{alpha}-induced ICAM-1 promoter activation and monocyte-endothelial monolayer binding. Our study indicates that TNF-{alpha} induces adhesion molecule expression and monocyte-endothelial monolayer binding mainly via activation of NF-{kappa}B in a glutathione-sensitive manner. We also demonstrated that intracellular glutathione does not modulate the activation of MAPKs and/or their downstream AP-1 induced by lower TNF-{alpha}. Although AP-1 activation by the lower TNF-{alpha} was not detected in our systems, we could not rule out the possible involvement of transiently activated MAPKs/AP-1 in the regulation of TNF-{alpha}-induced adhesion molecule expression.« less

Differential effects of HTLV-1 Tax oncoprotein on the different estrogen-induced-ER α-mediated transcriptional activities

PubMed Central

Abou-Kandil, Ammar; Eisa, Nora; Jabareen, Azhar; Huleihel, Mahmoud

2016-01-01

ABSTRACT The activated estrogen (E2) receptor α (ERα) is a potent transcription factor that is involved in the activation of various genes by 2 different pathways; a classical and non-classical. In classical pathway, ERα binds directly to E2-responsive elements (EREs) located in the appropriate genes promoters and stimulates their transcription. However, in non-classical pathway, the ERα can indirectly bind with promoters and enhance their activity. For instance, ERα activates BRCA1 expression by interacting with jun/fos complex bound to the AP-1 site in BRCA1 promoter. Interference with the expression and/or functions of BRCA1, leads to high risk of breast or/and ovarian cancer. HTLV-1Tax was found to strongly inhibit BRCA1 expression by preventing the binding of E2–ERα complex to BRCA1 promoter. Here we examined Tax effect on ERα induced activation of genes by the classical pathway by testing its influence on E2-induced expression of ERE promoter-driven luciferase reporter (ERE-Luc). Our findings showed that E2 profoundly stimulated this reporter expression and that HTLV-1Tax significantly induced this stimulation. This result is highly interesting because in our previous study Tax was found to strongly block the E2-ERα-mediated activation of BRCA1 expression. ERα was found to produce a big complex by recruiting various cofactors in the nucleus before binding to the ERE region. We also found that only part of the reqruited cofactors are required for the transcriptional activity of ERα complex. Chip assay revealed that the binding of Tax to the ERα complex, did not interfere with its link to ERE region. PMID:27420286

Prefusion F-specific antibodies determine the magnitude of RSV neutralizing activity in human sera.

PubMed

Ngwuta, Joan O; Chen, Man; Modjarrad, Kayvon; Joyce, M Gordon; Kanekiyo, Masaru; Kumar, Azad; Yassine, Hadi M; Moin, Syed M; Killikelly, April M; Chuang, Gwo-Yu; Druz, Aliaksandr; Georgiev, Ivelin S; Rundlet, Emily J; Sastry, Mallika; Stewart-Jones, Guillaume B E; Yang, Yongping; Zhang, Baoshan; Nason, Martha C; Capella, Cristina; Peeples, Mark E; Ledgerwood, Julie E; McLellan, Jason S; Kwong, Peter D; Graham, Barney S

2015-10-14

Respiratory syncytial virus (RSV) is estimated to claim more lives among infants <1 year old than any other single pathogen, except malaria, and poses a substantial global health burden. Viral entry is mediated by a type I fusion glycoprotein (F) that transitions from a metastable prefusion (pre-F) to a stable postfusion (post-F) trimer. A highly neutralization-sensitive epitope, antigenic site Ø, is found only on pre-F. We determined what fraction of neutralizing (NT) activity in human sera is dependent on antibodies specific for antigenic site Ø or other antigenic sites on F in healthy subjects from ages 7 to 93 years. Adsorption of individual sera with stabilized pre-F protein removed >90% of NT activity and depleted binding antibodies to both F conformations. In contrast, adsorption with post-F removed ~30% of NT activity, and binding antibodies to pre-F were retained. These findings were consistent across all age groups. Protein competition neutralization assays with pre-F mutants in which sites Ø or II were altered to knock out binding of antibodies to the corresponding sites showed that these sites accounted for ~35 and <10% of NT activity, respectively. Binding competition assays with monoclonal antibodies (mAbs) indicated that the amount of site Ø-specific antibodies correlated with NT activity, whereas the magnitude of binding competed by site II mAbs did not correlate with neutralization. Our results indicate that RSV NT activity in human sera is primarily derived from pre-F-specific antibodies, and therefore, inducing or boosting NT activity by vaccination will be facilitated by using pre-F antigens that preserve site Ø. Copyright © 2015, American Association for the Advancement of Science.

Resveratrol stimulates c-Fos gene transcription via activation of ERK1/2 involving multiple genetic elements.

PubMed

Thiel, Gerald; Rössler, Oliver G

2018-06-05

The polyphenol resveratrol is found in many plant and fruits and is a constituent of our diet. Resveratrol has been proposed to have chemopreventive and anti-inflammatory activities. On the cellular level, resveratrol activates stimulus-regulated transcription factors. To identify resveratrol-responsive elements within a natural gene promoter, the molecular pathway leading to c-Fos gene expression by resveratrol was dissected. The c-Fos gene encodes a basic region leucine zipper transcription factor and is a prototype of an immediate-early gene that is regulated by a wide range of signaling molecules. We analyzed chromatin-integrated c-Fos promoter-luciferase reporter genes where transcription factor binding sites were destroyed by point mutations or deletion mutagenesis. The results show that mutation of the binding sites for serum response factor (SRF), activator protein-1 (AP-1) and cAMP response element binding protein (CREB) significantly reduced reporter gene transcription following stimulation of the cells with resveratrol. Inactivation of the binding sites for signal transducer and activator of transcription (STAT) or ternary complex factors did not influence resveratrol-regulated c-Fos promoter activity. Thus, the c-Fos promoter contains three resveratrol-responsive elements, the cAMP response element (CRE), and the binding sites for SRF and AP-1. Moreover, we show that the transcriptional activation potential of the c-Fos protein is increased in resveratrol-stimulated cells, indicating that the biological activity of c-Fos is elevated by resveratrol stimulation. Pharmacological and genetic experiments revealed that the protein kinase ERK1/2 is the signal transducer that connects resveratrol treatment with the c-Fos gene. Copyright © 2018 Elsevier B.V. All rights reserved.

Identification of Nucleic Acid Binding Sites on Translin-Associated Factor X (TRAX) Protein

PubMed Central

Gupta, Gagan Deep; Kumar, Vinay

2012-01-01

Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity. PMID:22427937

The MTA family proteins as novel histone H3 binding proteins.

PubMed

Wu, Meng; Wang, Lina; Li, Qian; Li, Jiwen; Qin, Jun; Wong, Jiemin

2013-01-03

The nucleosome remodeling and histone deacetylase complex (Mi2/NRD/NuRD/NURD) has a broad role in regulation of transcription, DNA repair and cell cycle. Previous studies have revealed a specific interaction between NURD and histone H3N-terminal tail in vitro that is not observed for another HDAC1/2-containing complex, Sin3A. However, the subunit(s) responsible for specific binding of H3 by NURD has not been defined. In this study, we show among several class I HDAC-containing corepressor complexes only NURD exhibits a substantial H3 tail-binding activity in vitro. We present the evidence that the MTA family proteins within the NURD complex interact directly with H3 tail. Extensive in vitro binding assays mapped the H3 tail-binding domain to the C-terminal region of MTA1 and MTA2. Significantly, although the MTA1 and MTA2 mutant proteins with deletion of the C-terminal H3 tail binding domain were assembled into the endogenous NURD complex when expressed in mammalian cells, the resulting NURD complexes were deficient in binding H3 tail in vitro, indicating that the MTA family proteins are required for the observed specific binding of H3 tail peptide by NURD in vitro. However, chromatin fractionation experiments show that the NURD complexes with impaired MTA1/2-H3 tail binding activity remained to be associated with chromatin in cells. Together our study reveals a novel histone H3-binding activity for the MTA family proteins and provides evidence that the MTA family proteins mediate the in vitro specific binding of H3 tail peptide by NURD complex. However, multiple mechanisms are likely to contribute to the chromatin association of NURD complex in cells. Our finding also raises the possibility that the MTA family proteins may exert their diverse biological functions at least in part through their direct interaction with H3 tail.

Characterization of little skate (Leucoraja erinacea) recombinant transthyretin: Zinc-dependent 3,3',5-triiodo-l-thyronine binding.

PubMed

Suzuki, Shunsuke; Kasai, Kentaro; Yamauchi, Kiyoshi

2015-01-01

Transthyretin (TTR) diverged from an ancestral 5-hydroxyisourate hydrolase (HIUHase) by gene duplication at some early stage of chordate evolution. To clarify how TTR had participated in the thyroid system as an extracellular thyroid hormone (TH) binding protein, TH binding properties of recombinant little skate Leucoraja erinacea TTR was investigated. At the amino acid level, skate TTR showed 37-46% identities with the other vertebrate TTRs. Because the skate TTR had a unique histidine-rich segment in the N-terminal region, it could be purified by Ni-affinity chromatography. The skate TTR was a 46-kDa homotetramer of 14.5kDa subunits, and had one order of magnitude higher affinity for 3,3',5-triiodo-l-thyronine (T3) and some halogenated phenols than for l-thyroxine. However, the skate TTR had no HIUHase activity. Ethylenediaminetetraacetic acid (EDTA) treatment inhibited [(125)I]T3 binding activity whereas the addition of Zn(2+) to the EDTA-treated TTR recovered [(125)I]T3 binding activity in a Zn(2+) concentration-dependent manner. Scatchard analysis revealed the presence of two classes of binding site for T3, with dissociation constants of 0.24 and 17nM. However, the high-affinity sites were completely abolished with 1mM EDTA, whereas the remaining low-affinity sites decreased binding capacity. The number of zinc per TTR was quantified to be 4.5-6.3. Our results suggest that skate TTR has tight Zn(2+)-binding sites, which are essential for T3 binding to at least the high-affinity sites. Zn(2+) binding to the N-terminal histidine-rich segment may play an important role in acquisition or reinforcement of TH binding ability during early evolution of TTR. Copyright © 2015 Elsevier Inc. All rights reserved.

The heat-shock protein Apg-2 binds to the tight junction protein ZO-1 and regulates transcriptional activity of ZONAB.

PubMed

Tsapara, Anna; Matter, Karl; Balda, Maria S

2006-03-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1-ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G(1)/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1-ZONAB signaling in epithelial cells in response to cellular stress.

The Heat-Shock Protein Apg-2 Binds to the Tight Junction Protein ZO-1 and Regulates Transcriptional Activity of ZONAB

PubMed Central

Tsapara, Anna; Matter, Karl; Balda, Maria S.

2006-01-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1–ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G1/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1–ZONAB signaling in epithelial cells in response to cellular stress. PMID:16407410

Ca2+-independent Activation of Ca2+/Calmodulin-dependent Protein Kinase II Bound to the C-terminal Domain of CaV2.1 Calcium Channels*

PubMed Central

Magupalli, Venkat G.; Mochida, Sumiko; Yan, Jin; Jiang, Xin; Westenbroek, Ruth E.; Nairn, Angus C.; Scheuer, Todd; Catterall, William A.

2013-01-01

Ca2+/calmodulin-dependent protein kinase II (CaMKII) forms a major component of the postsynaptic density where its functions in synaptic plasticity are well established, but its presynaptic actions are poorly defined. Here we show that CaMKII binds directly to the C-terminal domain of CaV2.1 channels. Binding is enhanced by autophosphorylation, and the kinase-channel signaling complex persists after dephosphorylation and removal of the Ca2+/CaM stimulus. Autophosphorylated CaMKII can bind the CaV2.1 channel and synapsin-1 simultaneously. CaMKII binding to CaV2.1 channels induces Ca2+-independent activity of the kinase, which phosphorylates the enzyme itself as well as the neuronal substrate synapsin-1. Facilitation and inactivation of CaV2.1 channels by binding of Ca2+/CaM mediates short term synaptic plasticity in transfected superior cervical ganglion neurons, and these regulatory effects are prevented by a competing peptide and the endogenous brain inhibitor CaMKIIN, which blocks binding of CaMKII to CaV2.1 channels. These results define the functional properties of a signaling complex of CaMKII and CaV2.1 channels in which both binding partners are persistently activated by their association, and they further suggest that this complex is important in presynaptic terminals in regulating protein phosphorylation and short term synaptic plasticity. PMID:23255606

Pre-folding IkappaBalpha alters control of NF-kappaB signaling.

PubMed

Truhlar, Stephanie M E; Mathes, Erika; Cervantes, Carla F; Ghosh, Gourisankar; Komives, Elizabeth A

2008-06-27

Transcription complex components frequently show coupled folding and binding but the functional significance of this mode of molecular recognition is unclear. IkappaBalpha binds to and inhibits the transcriptional activity of NF-kappaB via its ankyrin repeat (AR) domain. The beta-hairpins in ARs 5-6 in IkappaBalpha are weakly-folded in the free protein, and their folding is coupled to NF-kappaB binding. Here, we show that introduction of two stabilizing mutations in IkappaBalpha AR 6 causes ARs 5-6 to fold cooperatively to a conformation similar to that in NF-kappaB-bound IkappaBalpha. Free IkappaBalpha is degraded by a proteasome-dependent but ubiquitin-independent mechanism, and this process is slower for the pre-folded mutants both in vitro and in cells. Interestingly, the pre-folded mutants bind NF-kappaB more weakly, as shown by both surface plasmon resonance and isothermal titration calorimetry in vitro and immunoprecipitation experiments from cells. One consequence of the weaker binding is that resting cells containing these mutants show incomplete inhibition of NF-kappaB activation; they have significant amounts of nuclear NF-kappaB. Additionally, the weaker binding combined with the slower rate of degradation of the free protein results in reduced levels of nuclear NF-kappaB upon stimulation. These data demonstrate clearly that the coupled folding and binding of IkappaBalpha is critical for its precise control of NF-kappaB transcriptional activity.

(+)-3-( sup 123 I)Iodo-MK-801: Synthesis and characterization of binding to the N-methyl-D-aspartate receptor complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ransom, R.W.; Wai-si Eng; Burns, H.D.

1990-01-01

Synthetic methods have been established for preparing high specific activity (+)-3-({sup 123}I)Iodo-MK-801 in high radiochemical yield. The binding of the radiotracer to rat cortical membranes has been examine to assess its potential use as an in vivo imaging agent for the N-methyl-D-aspartate (NMDA) receptor-ion channel complex. Under the conditions of the assay, specific (+)-3-({sup 123}I)Iodo-MK-801 binding to membrane homogenates represented greater than 95% of the total binding. Several structurally distinct, noncompetitive NMDA receptor antagonists inhibited binding with potencies in accordance with their reported inhibitory activity at the receptor complex. The concentration of ({plus minus})-3-Iodo-MK-801 required to inhibit 50% of (+)-3-({supmore » 123}I)Iodo-MK-801 binding (IC{sub 50}) was 3.4 nM when using a low ionic strength assay buffer and 5.5 nM in a physiological buffer. In a thoroughly washed membrane preparation, (+)-3-({sup 123}I)Iodo-MK-801 binding was enhanced by L-glutamate and glycine at concentrations known to activate the NMDA receptor. The results indicate that (+)-3-({sup 123}I)Iodo-MK-801 specifically labels the NMDA receptor complex in rat brain membranes and the retention of high affinity under near physiological assay conditions suggests that it may be useful as a SPECT imaging agent for the receptor in vivo.« less

Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

NASA Astrophysics Data System (ADS)

Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

2018-02-01

Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

Dynamic Repositioning of Dorsal to Two Different κB Motifs Controls Its Autoregulation during Immune Response in Drosophila

PubMed Central

Mrinal, Nirotpal; Nagaraju, Javaregowda

2010-01-01

Autoregulation is one of the mechanisms of imparting feedback control on gene expression. Positive autoregulatory feedback results in induction of a gene, and negative feedback leads to its suppression. Here, we report an interesting mechanism of autoregulation operating on Drosophila Rel gene dorsal that can activate as well as repress its expression. Using biochemical and genetic approaches, we show that upon immune challenge Dorsal regulates its activation as well as repression by dynamically binding to two different κB motifs, κBI (intronic κB) and κBP (promoter κB), present in the dorsal gene. Although the κBI motif functions as an enhancer, the κBP motif acts as a transcriptional repressor. Interestingly, Dorsal binding to these two motifs is dynamic; immediately upon immune challenge, Dorsal binds to the κBI leading to auto-activation, whereas at the terminal phase of the immune response, it is removed from the κBI and repositioned at the κBP, resulting in its repression. Furthermore, we show that repression of Dorsal as well as its binding to the κBP depends on the transcription factor AP1. Depletion of AP1 by RNA interference resulted in constitutive expression of Dorsal. In conclusion, this study suggests that during acute phase response dorsal is regulated by following two subcircuits: (i) Dl-κBI for activation and (ii) Dl-AP1-κBP for repression. These two subcircuits are temporally delineated and bring about overall regulation of dorsal during immune response. These results suggest the presence of a previously unknown mechanism of Dorsal autoregulation in immune-challenged Drosophila. PMID:20504768

Arabidopsis F-box protein containing a Nictaba-related lectin domain interacts with N-acetyllactosamine structures.

PubMed

Stefanowicz, Karolina; Lannoo, Nausicaä; Proost, Paul; Van Damme, Els J M

2012-01-01

The Arabidopsis thaliana genome contains a small group of bipartite F-box proteins, consisting of an N-terminal F-box domain and a C-terminal domain sharing sequence similarity with Nictaba, the jasmonate-induced glycan-binding protein (lectin) from tobacco. Based on the high sequence similarity between the C-terminal domain of these proteins and Nictaba, the hypothesis was put forward that the so-called F-box-Nictaba proteins possess carbohydrate-binding activity and accordingly can be considered functional homologs of the mammalian sugar-binding F-box or Fbs proteins which are involved in proteasomal degradation of glycoproteins. To obtain experimental evidence for the carbohydrate-binding activity and specificity of the A. thaliana F-box-Nictaba proteins, both the complete F-box-Nictaba sequence of one selected Arabidopsis F-box protein (in casu At2g02360) as well as the Nictaba-like domain only were expressed in Pichia pastoris and analyzed by affinity chromatography, agglutination assays and glycan micro-array binding assays. These results demonstrated that the C-terminal Nictaba-like domain provides the F-box-protein with a carbohydrate-binding activity that is specifically directed against N- and O-glycans containing N-acetyllactosamine (Galβ1-3GlcNAc and Galβ1-4GlcNAc) and poly-N-acetyllactosamine ([Galβ1-4GlcNAc]n) as well as Lewis A (Galβ1-3(Fucα1-4)GlcNAc), Lewis X (Galβ1-4(Fucα1-3)GlcNAc, Lewis Y (Fucα1-2Galβ1-4(Fucα1-3)GlcNAc) and blood type B (Galα1-3(Fucα1-2)Galβ1-3GlcNAc) motifs. Based on these findings one can reasonably conclude that at least the A. thaliana F-box-Nictaba protein encoded by At2g02360 can act as a carbohydrate-binding protein. The results from the glycan array assays revealed differences in sugar-binding specificity between the F-box protein and Nictaba, indicating that the same carbohydrate-binding motif can accommodate unrelated oligosaccharides.

Autoantibodies in Serum of Systemic Scleroderma Patients: Peptide-Based Epitope Mapping Indicates Increased Binding to Cytoplasmic Domains of CXCR3.

PubMed

Recke, Andreas; Regensburger, Ann-Katrin; Weigold, Florian; Müller, Antje; Heidecke, Harald; Marschner, Gabriele; Hammers, Christoph M; Ludwig, Ralf J; Riemekasten, Gabriela

2018-01-01

Systemic sclerosis (SSc) is a severe chronic autoimmune disease with high morbidity and mortality. Sera of patients with SSc contain a large variety of autoantibody (aab) reactivities. Among these are functionally active aab that bind to G protein-coupled receptors (GPCR) such as C-X-C motif chemokine receptor 3 (CXCR3) and 4 (CXCR4). Aab binding to the N-terminal portion of these two GPCRs have been shown to be associated with slower disease progression in SSc, especially deterioration of lung function. Aabs binding to GPCRs exhibit functional activities by stimulating or inhibiting GPCR signaling. The specific functional activity of aabs crucially depends on the epitopes they bind to. To identify the location of important epitopes on CXCR3 recognized by aabs from SSc patients, we applied an array of 36 overlapping 18-20mer peptides covering the entire CXCR3 sequence, comparing epitope specificity of SSc patient sera ( N  = 32, with positive reactivity with CXCR3) to healthy controls ( N  = 30). Binding of SSc patient and control sera to these peptides was determined by ELISA. Using a Bayesian model approach, we found increased binding of SSc patient sera to peptides corresponding to intracellular epitopes within CXCR3, while the binding signal to extracellular portions of CXCR3 was found to be reduced. Experimentally determined epitopes showed a good correspondence to those predicted by the ABCpred tool. To verify these results and to translate them into a novel diagnostic ELISA, we combined the peptides that represent SSc-associated epitopes into a single ELISA and evaluated its potential to discriminate SSc patients ( N  = 31) from normal healthy controls ( N  = 47). This ELISA had a sensitivity of 0.61 and a specificity of 0.85. Our data reveals that SSc sera preferentially bind intracellular epitopes of CXCR3, while an extracellular epitope in the N-terminal domain that appears to be target of aabs in healthy individuals is not bound by SSc sera. Based upon our results, we could devise a novel ELISA concept that may be helpful for monitoring of SSc patients.

Autoantibodies in Serum of Systemic Scleroderma Patients: Peptide-Based Epitope Mapping Indicates Increased Binding to Cytoplasmic Domains of CXCR3

PubMed Central

Recke, Andreas; Regensburger, Ann-Katrin; Weigold, Florian; Müller, Antje; Heidecke, Harald; Marschner, Gabriele; Hammers, Christoph M.; Ludwig, Ralf J.; Riemekasten, Gabriela

2018-01-01

Systemic sclerosis (SSc) is a severe chronic autoimmune disease with high morbidity and mortality. Sera of patients with SSc contain a large variety of autoantibody (aab) reactivities. Among these are functionally active aab that bind to G protein-coupled receptors (GPCR) such as C-X-C motif chemokine receptor 3 (CXCR3) and 4 (CXCR4). Aab binding to the N-terminal portion of these two GPCRs have been shown to be associated with slower disease progression in SSc, especially deterioration of lung function. Aabs binding to GPCRs exhibit functional activities by stimulating or inhibiting GPCR signaling. The specific functional activity of aabs crucially depends on the epitopes they bind to. To identify the location of important epitopes on CXCR3 recognized by aabs from SSc patients, we applied an array of 36 overlapping 18-20mer peptides covering the entire CXCR3 sequence, comparing epitope specificity of SSc patient sera (N = 32, with positive reactivity with CXCR3) to healthy controls (N = 30). Binding of SSc patient and control sera to these peptides was determined by ELISA. Using a Bayesian model approach, we found increased binding of SSc patient sera to peptides corresponding to intracellular epitopes within CXCR3, while the binding signal to extracellular portions of CXCR3 was found to be reduced. Experimentally determined epitopes showed a good correspondence to those predicted by the ABCpred tool. To verify these results and to translate them into a novel diagnostic ELISA, we combined the peptides that represent SSc-associated epitopes into a single ELISA and evaluated its potential to discriminate SSc patients (N = 31) from normal healthy controls (N = 47). This ELISA had a sensitivity of 0.61 and a specificity of 0.85. Our data reveals that SSc sera preferentially bind intracellular epitopes of CXCR3, while an extracellular epitope in the N-terminal domain that appears to be target of aabs in healthy individuals is not bound by SSc sera. Based upon our results, we could devise a novel ELISA concept that may be helpful for monitoring of SSc patients. PMID:29623076

Intrinsic mineralocorticoid agonist activity of some nonsteroidal anti-inflammatory drugs. A postulated mechanism for sodium retention.

PubMed Central

Feldman, D; Couropmitree, C

1976-01-01

Because some nonsteroidal anti-inflammatory drugs (NSAID) induce salt and water retention and exhibit other steroid-like actions, studies were performed to ascertain whether these drugs possess intrinsic mineralocorticoid agonist activity. In vitro competitive binding assays utilizing tissue from adrenalectomized rats demonstrated that some NSAID can displace [3H]-aldosterone from renal cytoplasmic mineralocorticoid receptors. Displacement potency for these sites was in the sequence: aldosterone greater than spironolactone greater than phenylbutazone (PBZ) greater than aspirin (ASA) greater than indomethacin (IDM). Concentration ratios required to obtain significant displacement of [3H]aldosterone were high but clearly within the therapeutic range for PBZ and ASA but not IDM. The analogues oxyphenbutazone (OBZ) and sodium salicylate (SS) were similar in binding activity to PBZ and ASA, respectively. Lineweaver-Burk analysis revealed that the inhibition of [3H]aldosterone binding was competitive in nature. In addition, PBZ was shown to prevent the nuclear binding of [3H]aldosterone. In vivo injection of PBZ and ASA resulted in competition for [3H]aldosterone renal binding comparable to the in vitro studies. Administration of PBZ and OBZ to adrenalectomized rats resulted in significant salt retention whereas ASA and SS did not differ significantly from controls. Salt retention elicited by PBZ and OBZ was inhibited by spironolactone, a competitive mineralocorticoid antagonist. These data suggest that, despite nonsteroidal structures, PBZ and OBZ induce salt retention via a receptor-mediated mineralocorticoid pathway analogous to aldosterone action. PMID:173739

Deletion mutants of Harvey ras p21 protein reveal the absolute requirement of at least two distant regions for GTP-binding and transforming activities.

PubMed Central

Lacal, J C; Anderson, P S; Aaronson, S A

1986-01-01

Deletions of small sequences from the viral Harvey ras gene have been generated, and resulting ras p21 mutants have been expressed in Escherichia coli. Purification of each deleted protein allowed the in vitro characterization of GTP-binding, GTPase and autokinase activity of the proteins. Microinjection of the highly purified proteins into quiescent NIH/3T3 cells, as well as transfection experiments utilizing a long terminal repeat (LTR)-containing vector, were utilized to analyze the biological activity of the deleted proteins. Two small regions located at 6-23 and 152-165 residues are shown to be absolutely required for in vitro and in vivo activities of the ras product. By contrast, the variable region comprising amino acids 165-184 was shown not to be necessary for either in vitro or in vivo activities. Thus, we demonstrate that: (i) amino acid sequences at positions 5-23 and 152-165 of ras p21 protein are probably directly involved in the GTP-binding activity; (ii) GTP-binding is required for the transforming activity of ras p21 and by extension for the normal function of the proto-oncogene product; and (iii) the variable region at the C-terminal end of the ras p21 molecule from amino acids 165 to 184 is not required for transformation. Images Fig.2. Fig.4. PMID:3011420

Chorion gene activation and repression is dependent on BmC/EBP expression and binding to cognate cis-elements.

PubMed

Papantonis, Argyris; Sourmeli, Sissy; Lecanidou, Rena

2008-05-09

From the different cis-elements clustered on silkmoth chorion gene promoters, C/EBP binding sites predominate. Their sequence composition and dispersal vary amongst promoters of diverse developmental specificity. Occupancy of these sites by BmC/EBP was examined through Southwestern and ChIP assays modified to suit ovarian follicular cells. For the genes studied, binding of BmC/EBP coincided with the respective stages of transcriptional activation. However, the factor was reloaded on promoter sequences long after individual gene repression. Furthermore, suppression of BmC/EBP transcription in developing follicles resulted in de-regulation of chorion gene expression. A biphasic function of BmC/EBP, according to which it may act as both an activator and a repressor during silkmoth choriogenesis, is considered under the light of the presented data.

A key agonist-induced conformational change in the cannabinoid receptor CB1 is blocked by the allosteric ligand Org 27569.

PubMed

Fay, Jonathan F; Farrens, David L

2012-09-28

Allosteric ligands that modulate how G protein-coupled receptors respond to traditional orthosteric drugs are an exciting and rapidly expanding field of pharmacology. An allosteric ligand for the cannabinoid receptor CB1, Org 27569, exhibits an intriguing effect; it increases agonist binding, yet blocks agonist-induced CB1 signaling. Here we explored the mechanism behind this behavior, using a site-directed fluorescence labeling approach. Our results show that Org 27569 blocks conformational changes in CB1 that accompany G protein binding and/or activation, and thus inhibit formation of a fully active CB1 structure. The underlying mechanism behind this behavior is that simultaneous binding of Org 27569 produces a unique agonist-bound conformation, one that may resemble an intermediate structure formed on the pathway to full receptor activation.

Differential regulation of transcription through distinct Suppressor of Hairless DNA binding site architectures during Notch signaling in proneural clusters.

PubMed

Cave, John W; Xia, Li; Caudy, Michael

2011-01-01

In Drosophila melanogaster, achaete (ac) and m8 are model basic helix-loop-helix activator (bHLH A) and repressor genes, respectively, that have the opposite cell expression pattern in proneural clusters during Notch signaling. Previous studies have shown that activation of m8 transcription in specific cells within proneural clusters by Notch signaling is programmed by a "combinatorial" and "architectural" DNA transcription code containing binding sites for the Su(H) and proneural bHLH A proteins. Here we show the novel result that the ac promoter contains a similar combinatorial code of Su(H) and bHLH A binding sites but contains a different Su(H) site architectural code that does not mediate activation during Notch signaling, thus programming a cell expression pattern opposite that of m8 in proneural clusters.

One base pair change abolishes the T cell-restricted activity of a kB-like proto-enhancer element from the interleukin 2 promoter.

PubMed Central

Briegel, K; Hentsch, B; Pfeuffer, I; Serfling, E

1991-01-01

The inducible, T cell-specific enhancers of murine and human Interleukin 2 (Il-2) genes contain the kB-like sequence GGGATTTCACC as an essential cis-acting enhancer motif. When cloned in multiple copies this so-called TCEd (distal T cell element) acts as an inducible proto-enhancer element in E14 T lymphoma cells, but not in HeLa cells. In extracts of induced, Il-2 secreting El4 cells three individual protein factors bind to TCEd DNA. The binding of the most prominent factor, named TCF-1 (T cell factor 1), is correlated with the proto-enhancer activity of TCEd. TCF-1 consists of two polypeptides of about 50 kD and 105 kD; the former seems to be related to the 50 kD polypeptide of NF-kB. Purified NF-kB is also able to bind to the TCEd, but TCF-1 binds stronger than NF-kB to TCEd DNA. The conversion of the TCEd to a 'perfect' NF-kB binding site leads to a tighter binding of NF-kB to TCEd DNA and, as a functional consequence, to the activity of the 'converted' TCEd motifs in HeLa cells. Thus, the substitution of the underlined A residue to a C within the GGGATTTCACC motif abolishes its T cell-restricted activity and leads to its functioning in both El4 cells and HeLa cells. These results indicate that lymphocyte-specific factors binding to the TCEd are involved in the control of T cell specific-transcription of the Il-2 gene. Images PMID:1945879

Dual Role of OhrR as a Repressor and an Activator in Response to Organic Hydroperoxides in Streptomyces coelicolor▿

PubMed Central

Oh, So-Young; Shin, Jung-Ho; Roe, Jung-Hye

2007-01-01

Organic hydroperoxide resistance in bacteria is achieved primarily through reducing oxidized membrane lipids. The soil-inhabiting aerobic bacterium Streptomyces coelicolor contains three paralogous genes for organic hydroperoxide resistance: ohrA, ohrB, and ohrC. The ohrA gene is transcribed divergently from ohrR, which encodes a putative regulator of MarR family. Both the ohrA and ohrR genes were induced highly by various organic hydroperoxides. The ohrA gene was induced through removal of repression by OhrR, whereas the ohrR gene was induced through activation by OhrR. Reduced OhrR bound to the ohrA-ohrR intergenic region, which contains a central (primary) and two adjacent (secondary) inverted-repeat motifs that overlap with promoter elements. Organic peroxide decreased the binding affinity of OhrR for the primary site, with a concomitant decrease in cooperative binding to the adjacent secondary sites. The single cysteine C28 in OhrR was involved in sensing oxidants, as determined by substitution mutagenesis. The C28S mutant of OhrR bound to the intergenic region without any change in binding affinity in response to organic peroxides. These results lead us to propose a model for the dual action of OhrR as a repressor and an activator in S. coelicolor. Under reduced conditions, OhrR binds cooperatively to the intergenic region, repressing transcription from both genes. Upon oxidation, the binding affinity of OhrR decreases, with a concomitant loss of cooperative binding, which allows RNA polymerase to bind to both the ohrA and ohrR promoters. The loosely bound oxidized OhrR can further activate transcription from the ohrR promoter. PMID:17586628

Understanding the effects on constitutive activation and drug binding of a D130N mutation in the β2 adrenergic receptor via molecular dynamics simulation.

PubMed

Zhu, Yanyan; Yuan, Yuan; Xiao, Xiuchan; Zhang, Liyun; Guo, Yanzhi; Pu, Xuemei

2014-11-01

G-protein-coupled receptors (GPCRs) are currently one of the largest families of drug targets. The constitutive activation induced by mutation of key GPCR residues is associated closely with various diseases. However, the structural basis underlying such activation and its role in drug binding has remained unclear. Herein, we used all-atom molecular dynamics simulations and free energy calculations to study the effects of a D130N mutation on the structure of β2 adrenergic receptor (β2AR) and its binding of the agonist salbutamol. The results indicate that the mutation caused significant changes in some key helices. In particular, the mutation leads to the departure of transmembrane 3 (TM3) from transmembrane 6 (TM6) and marked changes in the NPxxY region as well as the complete disruption of a key ionic lock, all of which contribute to the observed constitutive activation. In addition, the D130N mutation weakens some important H-bonds, leading to structural changes in these regions. Binding free energy calculations indicate that van der Waals and electrostatic interactions are the main driving forces in binding salbutamol; however, binding strength in the mutant β2AR is significantly enhanced mainly through modifying electrostatic interactions. Further analysis revealed that the increase in binding energy upon mutation stems mainly from the H-bonds formed between the hydroxyl group of salbutamol and the serine residues of TM5. This observation suggests that modifications of the H-bond groups of this drug could significantly influence drug efficacy in the treatment of diseases associated with this mutation.

Analogs of methyllycaconitine as novel noncompetitive inhibitors of nicotinic receptors: pharmacological characterization, computational modeling, and pharmacophore development.

PubMed

McKay, Dennis B; Chang, Cheng; González-Cestari, Tatiana F; McKay, Susan B; El-Hajj, Raed A; Bryant, Darrell L; Zhu, Michael X; Swaan, Peter W; Arason, Kristjan M; Pulipaka, Aravinda B; Orac, Crina M; Bergmeier, Stephen C

2007-05-01

As a novel approach to drug discovery involving neuronal nicotinic acetylcholine receptors (nAChRs), our laboratory targeted nonagonist binding sites (i.e., noncompetitive binding sites, negative allosteric binding sites) located on nAChRs. Cultured bovine adrenal cells were used as neuronal models to investigate interactions of 67 analogs of methyllycaconitine (MLA) on native alpha3beta4* nAChRs. The availability of large numbers of structurally related molecules presents a unique opportunity for the development of pharmacophore models for noncompetitive binding sites. Our MLA analogs inhibited nicotine-mediated functional activation of both native and recombinant alpha3beta4* nAChRs with a wide range of IC(50) values (0.9-115 microM). These analogs had little or no inhibitory effects on agonist binding to native or recombinant nAChRs, supporting noncompetitive inhibitory activity. Based on these data, two highly predictive 3D quantitative structure-activity relationship (comparative molecular field analysis and comparative molecular similarity index analysis) models were generated. These computational models were successfully validated and provided insights into the molecular interactions of MLA analogs with nAChRs. In addition, a pharmacophore model was constructed to analyze and visualize the binding requirements to the analog binding site. The pharmacophore model was subsequently applied to search structurally diverse molecular databases to prospectively identify novel inhibitors. The rapid identification of eight molecules from database mining and our successful demonstration of in vitro inhibitory activity support the utility of these computational models as novel tools for the efficient retrieval of inhibitors. These results demonstrate the effectiveness of computational modeling and pharmacophore development, which may lead to the identification of new therapeutic drugs that target novel sites on nAChRs.

Functional interaction between the two halves of the photoreceptor-specific ATP binding cassette protein ABCR (ABCA4). Evidence for a non-exchangeable ADP in the first nucleotide binding domain.

PubMed

Ahn, Jinhi; Beharry, Seelochan; Molday, Laurie L; Molday, Robert S

2003-10-10

ABCR, also known as ABCA4, is a member of the superfamily of ATP binding cassette transporters that is believed to transport retinal or retinylidene-phosphatidylethanolamine across photoreceptor disk membranes. Mutations in the ABCR gene are responsible for Stargardt macular dystrophy and related retinal dystrophies that cause severe loss in vision. ABCR consists of two tandemly arranged halves each containing a membrane spanning segment followed by a large extracellular/lumen domain, a multi-spanning membrane domain, and a nucleotide binding domain (NBD). To define the role of each NBD, we examined the nucleotide binding and ATPase activities of the N and C halves of ABCR individually and co-expressed in COS-1 cells and derived from trypsin-cleaved ABCR in disk membranes. When disk membranes or membranes from co-transfected cells were photoaffinity labeled with 8-azido-ATP and 8-azido-ADP, only the NBD2 in the C-half bound and trapped the nucleotide. Co-expressed half-molecules displayed basal and retinal-stimulated ATPase activity similar to full-length ABCR. The individually expressed N-half displayed weak 8-azido-ATP labeling and low basal ATPase activity that was not stimulated by retinal, whereas the C-half did not bind ATP and exhibited little if any ATPase activity. Purified ABCR contained one tightly bound ADP, presumably in NBD1. Our results indicate that only NBD2 of ABCR binds and hydrolyzes ATP in the presence or absence of retinal. NBD1, containing a bound ADP, associates with NBD2 to play a crucial, non-catalytic role in ABCR function.

An Arabidopsis Ran-binding protein, AtRanBP1c, is a co-activator of Ran GTPase-activating protein and requires the C-terminus for its cytoplasmic localization

NASA Technical Reports Server (NTRS)

Kim, Soo-Hwan; Roux, Stanley J.

2003-01-01

Ran-binding proteins (RanBPs) are a group of proteins that bind to Ran (Ras-related nuclear small GTP-binding protein), and thus either control the GTP/GDP-bound states of Ran or help couple the Ran GTPase cycle to a cellular process. AtRanBP1c is a Ran-binding protein from Arabidopsis thaliana (L.) Heynh. that was recently shown to be critically involved in the regulation of auxin-induced mitotic progression [S.-H. Kim et al. (2001) Plant Cell 13:2619-2630]. Here we report that AtRanBP1c inhibits the EDTA-induced release of GTP from Ran and serves as a co-activator of Ran-GTPase-activating protein (RanGAP) in vitro. Transient expression of AtRanBP1c fused to a beta-glucuronidase (GUS) reporter reveals that the protein localizes primarily to the cytosol. Neither the N- nor C-terminus of AtRanBP1c, which flank the Ran-binding domain (RanBD), is necessary for the binding of PsRan1-GTP to the protein, but both are needed for the cytosolic localization of GUS-fused AtRanBP1c. These findings, together with a previous report that AtRanBP1c is critically involved in root growth and development, imply that the promotion of GTP hydrolysis by the Ran/RanGAP/AtRanBP1c complex in the cytoplasm, and the resulting concentration gradient of Ran-GDP to Ran-GTP across the nuclear membrane could be important in the regulation of auxin-induced mitotic progression in root tips of A. thaliana.

The Influence of Glycosylation of Natural and Synthetic Prenylated Flavonoids on Binding to Human Serum Albumin and Inhibition of Cyclooxygenases COX-1 and COX-2.

PubMed

Tronina, Tomasz; Strugała, Paulina; Popłoński, Jarosław; Włoch, Aleksandra; Sordon, Sandra; Bartmańska, Agnieszka; Huszcza, Ewa

2017-07-21

The synthesis of different classes of prenylated aglycones (α,β-dihydroxanthohumol ( 2 ) and ( Z )-6,4'-dihydroxy-4-methoxy-7-prenylaurone ( 3 )) was performed in one step reactions from xanthohumol ( 1 )-major prenylated chalcone naturally occurring in hops. Obtained flavonoids ( 2 - 3 ) and xanthohumol ( 1 ) were used as substrates for regioselective fungal glycosylation catalyzed by two Absidia species and Beauveria bassiana . As a result six glycosides ( 4 - 9 ) were formed, of which four glycosides ( 6 - 9 ) have not been published so far. The influence of flavonoid skeleton and the presence of glucopyranose and 4- O -methylglucopyranose moiety in flavonoid molecule on binding to main protein in plasma, human serum albumin (HSA), and inhibition of cyclooxygenases COX-1 and COX-2 were investigated. Results showed that chalcone ( 1 ) had the highest binding affinity to HSA (8.624 × 10⁴ M -1 ) of all tested compounds. It has also exhibited the highest inhibition of cyclooxygenases activity, and it was a two-fold stronger inhibitor than α,β-dihydrochalcone ( 2 ) and aurone ( 3 ). The presence of sugar moiety in flavonoid molecule caused the loss of HSA binding activity as well as the decrease in inhibition of cyclooxygenases activity.