A novel comparative pattern count analysis reveals a chronic ethanol-induced dynamic shift in immediate early NF-κB genome-wide promoter binding during liver regeneration.

PubMed

Kuttippurathu, Lakshmi; Patra, Biswanath; Hoek, Jan B; Vadigepalli, Rajanikanth

2016-03-01

Liver regeneration after partial hepatectomy is a clinically important process that is impaired by adaptation to chronic alcohol intake. We focused on the initial time points following partial hepatectomy (PHx) to analyze the genome-wide binding activity of NF-κB, a key immediate early regulator. We investigated the effect of chronic alcohol intake on immediate early NF-κB genome-wide localization, in the adapted state as well as in response to partial hepatectomy, using chromatin immunoprecipitation followed by promoter microarray analysis. We found many ethanol-specific NF-κB binding target promoters in the ethanol-adapted state, corresponding to the regulation of biosynthetic processes, oxidation-reduction and apoptosis. Partial hepatectomy induced a diet-independent shift in NF-κB binding loci relative to the transcription start sites. We employed a novel pattern count analysis to exhaustively enumerate and compare the number of promoters corresponding to the temporal binding patterns in ethanol and pair-fed control groups. The highest pattern count corresponded to promoters with NF-κB binding exclusively in the ethanol group at 1 h post PHx. This set was associated with the regulation of cell death, response to oxidative stress, histone modification, mitochondrial function, and metabolic processes. Integration with the global gene expression profiles to identify putative transcriptional consequences of NF-κB binding patterns revealed that several of ethanol-specific 1 h binding targets showed ethanol-specific differential expression through 6 h post PHx. Motif analysis yielded co-incident binding loci for STAT3, AP-1, CREB, C/EBP-β, PPAR-γ and C/EBP-α, likely participating in co-regulatory modules with NF-κB in shaping the immediate early response to PHx. We conclude that adaptation to chronic ethanol intake disrupts the NF-κB promoter binding landscape with consequences for the immediate early gene regulatory response to the acute challenge of PHx.

In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

PubMed Central

Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

2017-01-01

In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

Computational analysis of the receptor binding specificity of novel influenza A/H7N9 viruses.

PubMed

Zhou, Xinrui; Zheng, Jie; Ivan, Fransiskus Xaverius; Yin, Rui; Ranganathan, Shoba; Chow, Vincent T K; Kwoh, Chee-Keong

2018-05-09

Influenza viruses are undergoing continuous and rapid evolution. The fatal influenza A/H7N9 has drawn attention since the first wave of infections in March 2013, and raised more grave concerns with its increased potential to spread among humans. Experimental studies have revealed several host and virulence markers, indicating differential host binding preferences which can help estimate the potential of causing a pandemic. Here we systematically investigate the sequence pattern and structural characteristics of novel influenza A/H7N9 using computational approaches. The sequence analysis highlighted mutations in protein functional domains of influenza viruses. Molecular docking and molecular dynamics simulation revealed that the hemagglutinin (HA) of A/Taiwan/1/2017(H7N9) strain enhanced the binding with both avian and human receptor analogs, compared with the previous A/Shanghai/02/2013(H7N9) strain. The Molecular Mechanics - Poisson Boltzmann Surface Area (MM-PBSA) calculation revealed the change of residue-ligand interaction energy and detected the residues with conspicuous binding preference. The results are novel and specific to the emerging influenza A/Taiwan/1/2017(H7N9) strain compared with A/Shanghai/02/2013(H7N9). Its enhanced ability to bind human receptor analogs, which are abundant in the human upper respiratory tract, may be responsible for the recent outbreak. Residues showing binding preference were detected, which could facilitate monitoring the circulating influenza viruses.

[Glutamate-binding membrane proteins from human platelets].

PubMed

Gurevich, V S; Popov, Iu G; Gorodinskiĭ, A I; Dambinova, S A

1991-09-01

Solubilization of the total membrane fraction of human platelets in a 2% solution of sodium deoxycholate and subsequent affinity chromatography on glutamate agarose resulted in two protein fractions possessing a glutamate-binding activity. As can be evidenced from radioligand binding data, the first fraction contains two types of binding sites (Kd1 = 1 microM, Bmax 1 = 100 pmol/mg of protein; Kd2 = 9.3 microMm Bmax2 = 395 pmol/mg of protein). The second fraction has only one type of binding sites (Kd = 1 microM, Bmax = = 110 pmol/mg of protein). SDS-PAAG electrophoresis revealed the presence in the first fraction of proteins with Mr of 14, 24, 56 and 155 kDa, whereas the second fraction was found to contain 14, 46, 71 and 155 kDa proteins. Solid phase immunoenzymatic analysis using poly- and monoclonal specific antibodies against mammalian brain glutamate-binding proteins revealed a marked immunochemical similarity of the isolated protein fractions with human brain synaptic membrane glutamate-binding proteins.

Target engagement and drug residence time can be observed in living cells with BRET

PubMed Central

Robers, Matthew B.; Dart, Melanie L.; Woodroofe, Carolyn C.; Zimprich, Chad A.; Kirkland, Thomas A.; Machleidt, Thomas; Kupcho, Kevin R.; Levin, Sergiy; Hartnett, James R.; Zimmerman, Kristopher; Niles, Andrew L.; Ohana, Rachel Friedman; Daniels, Danette L.; Slater, Michael; Wood, Monika G.; Cong, Mei; Cheng, Yi-Qiang; Wood, Keith V.

2015-01-01

The therapeutic action of drugs is predicated on their physical engagement with cellular targets. Here we describe a broadly applicable method using bioluminescence resonance energy transfer (BRET) to reveal the binding characteristics of a drug with selected targets within intact cells. Cell-permeable fluorescent tracers are used in a competitive binding format to quantify drug engagement with the target proteins fused to Nanoluc luciferase. The approach enabled us to profile isozyme-specific engagement and binding kinetics for a panel of histone deacetylase (HDAC) inhibitors. Our analysis was directed particularly to the clinically approved prodrug FK228 (Istodax/Romidepsin) because of its unique and largely unexplained mechanism of sustained intracellular action. Analysis of the binding kinetics by BRET revealed remarkably long intracellular residence times for FK228 at HDAC1, explaining the protracted intracellular behaviour of this prodrug. Our results demonstrate a novel application of BRET for assessing target engagement within the complex milieu of the intracellular environment. PMID:26631872

Insight on AV-45 binding in white and grey matter from histogram analysis: a study on early Alzheimer's disease patients and healthy subjects

PubMed Central

Nemmi, Federico; Saint-Aubert, Laure; Adel, Djilali; Salabert, Anne-Sophie; Pariente, Jérémie; Barbeau, Emmanuel; Payoux, Pierre; Péran, Patrice

2014-01-01

Purpose AV-45 amyloid biomarker is known to show uptake in white matter in patients with Alzheimer’s disease (AD) but also in healthy population. This binding; thought to be of a non-specific lipophilic nature has not yet been investigated. The aim of this study was to determine the differential pattern of AV-45 binding in healthy and pathological populations in white matter. Methods We recruited 24 patients presenting with AD at early stage and 17 matched, healthy subjects. We used an optimized PET-MRI registration method and an approach based on intensity histogram using several indexes. We compared the results of the intensity histogram analyses with a more canonical approach based on target-to-cerebellum Standard Uptake Value (SUVr) in white and grey matters using MANOVA and discriminant analyses. A cluster analysis on white and grey matter histograms was also performed. Results White matter histogram analysis revealed significant differences between AD and healthy subjects, which were not revealed by SUVr analysis. However, white matter histograms was not decisive to discriminate groups, and indexes based on grey matter only showed better discriminative power than SUVr. The cluster analysis divided our sample in two clusters, showing different uptakes in grey but also in white matter. Conclusion These results demonstrate that AV-45 binding in white matter conveys subtle information not detectable using SUVr approach. Although it is not better than standard SUVr to discriminate AD patients from healthy subjects, this information could reveal white matter modifications. PMID:24573658

In silico studies and fluorescence binding assays of potential anti-prion compounds reveal an important binding site for prion inhibition from PrP(C) to PrP(Sc).

PubMed

Pagadala, Nataraj S; Perez-Pineiro, Rolando; Wishart, David S; Tuszynski, Jack A

2015-02-16

To understand the pharmacophore properties of 2-aminothiazoles and design novel inhibitors against the prion protein, a highly predictive 3D quantitative structure-activity relationship (QSAR) has been developed by performing comparative molecular field analysis (CoMFA) and comparative similarity analysis (CoMSIA). Both CoMFA and CoMSIA maps reveal the presence of the oxymethyl groups in meta and para positions on the phenyl ring of compound 17 (N-[4-(3,4-dimethoxyphenyl)-1,3-thiazol-2-yl]quinolin-2-amine), is necessary for activity while electro-negative nitrogen of quinoline is highly favorable to enhance activity. The blind docking results for these compounds show that the compound with quinoline binds with higher affinity than isoquinoline and naphthalene groups. Out of 150 novel compounds retrieved using finger print analysis by pharmacophoric model predicted based on five test sets of compounds, five compounds with diverse scaffolds were selected for biological evaluation as possible PrP inhibitors. Molecular docking combined with fluorescence quenching studies show that these compounds bind to pocket-D of SHaPrP near Trp145. The new antiprion compounds 3 and 6, which bind with the interaction energies of -12.1 and -13.2 kcal/mol, respectively, show fluorescence quenching with binding constant (Kd) values of 15.5 and 44.14 μM, respectively. Further fluorescence binding assays with compound 5, which is similar to 2-aminothiazole as a positive control, also show that the molecule binds to the pocket-D with the binding constant (Kd) value of 84.7 μM. Finally, both molecular docking and a fluorescence binding assay of noscapine as a negative control reveals the same binding site on the surface of pocket-A near a rigid loop between β2 and α2 interacting with Arg164. This high level of correlation between molecular docking and fluorescence quenching studies confirm that these five compounds are likely to act as inhibitors for prion propagation while noscapine might act as a prion accelerator from PrP(C) to PrP(Sc). Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Structure of human IFIT1 with capped RNA reveals adaptable mRNA binding and mechanisms for sensing N1 and N2 ribose 2′-O methylations

PubMed Central

Laudenbach, Beatrice Theres; Martínez-Montero, Saúl; Cencic, Regina; Habjan, Matthias; Pichlmair, Andreas; Damha, Masad J.; Pelletier, Jerry; Nagar, Bhushan

2017-01-01

IFIT1 (IFN-induced protein with tetratricopeptide repeats-1) is an effector of the host innate immune antiviral response that prevents propagation of virus infection by selectively inhibiting translation of viral mRNA. It relies on its ability to compete with the translation initiation factor eIF4F to specifically recognize foreign capped mRNAs, while remaining inactive against host mRNAs marked by ribose 2′-O methylation at the first cap-proximal nucleotide (N1). We report here several crystal structures of RNA-bound human IFIT1, including a 1.6-Å complex with capped RNA. IFIT1 forms a water-filled, positively charged RNA-binding tunnel with a separate hydrophobic extension that unexpectedly engages the cap in multiple conformations (syn and anti) giving rise to a relatively plastic and nonspecific mode of binding, in stark contrast to eIF4E. Cap-proximal nucleotides encircled by the tunnel provide affinity to compete with eIF4F while allowing IFIT1 to select against N1 methylated mRNA. Gel-shift binding assays confirm that N1 methylation interferes with IFIT1 binding, but in an RNA-dependent manner, whereas translation assays reveal that N1 methylation alone is not sufficient to prevent mRNA recognition at high IFIT1 concentrations. Structural and functional analysis show that 2′-O methylation at N2, another abundant mRNA modification, is also detrimental for RNA binding, thus revealing a potentially synergistic role for it in self- versus nonself-mRNA discernment. Finally, structure-guided mutational analysis confirms the importance of RNA binding for IFIT1 restriction of a human coronavirus mutant lacking viral N1 methylation. Our structural and biochemical analysis sheds new light on the molecular basis for IFIT1 translational inhibition of capped viral RNA. PMID:28251928

Novel Functional Properties of Drosophila CNS Glutamate Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yan; Dharkar, Poorva; Han, Tae-Hee

Phylogenetic analysis reveals AMPA, kainate, and NMDA receptor families in insect genomes, suggesting conserved functional properties corresponding to their vertebrate counterparts. However, heterologous expression of the Drosophila kainate receptor DKaiR1D and the AMPA receptor DGluR1A revealed novel ligand selectivity at odds with the classification used for vertebrate glutamate receptor ion channels (iGluRs). DKaiR1D forms a rapidly activating and desensitizing receptor that is inhibited by both NMDA and the NMDA receptor antagonist AP5; crystallization of the KaiR1D ligand-binding domain reveals that these ligands stabilize open cleft conformations, explaining their action as antagonists. Surprisingly, the AMPA receptor DGluR1A shows weak activation bymore » its namesake agonist AMPA and also by quisqualate. Crystallization of the DGluR1A ligand-binding domain reveals amino acid exchanges that interfere with binding of these ligands. The unexpected ligand-binding profiles of insect iGluRs allows classical tools to be used in novel approaches for the study of synaptic regulation.« less

Novel Functional Properties of Drosophila CNS Glutamate Receptors.

PubMed

Li, Yan; Dharkar, Poorva; Han, Tae-Hee; Serpe, Mihaela; Lee, Chi-Hon; Mayer, Mark L

2016-12-07

Phylogenetic analysis reveals AMPA, kainate, and NMDA receptor families in insect genomes, suggesting conserved functional properties corresponding to their vertebrate counterparts. However, heterologous expression of the Drosophila kainate receptor DKaiR1D and the AMPA receptor DGluR1A revealed novel ligand selectivity at odds with the classification used for vertebrate glutamate receptor ion channels (iGluRs). DKaiR1D forms a rapidly activating and desensitizing receptor that is inhibited by both NMDA and the NMDA receptor antagonist AP5; crystallization of the KaiR1D ligand-binding domain reveals that these ligands stabilize open cleft conformations, explaining their action as antagonists. Surprisingly, the AMPA receptor DGluR1A shows weak activation by its namesake agonist AMPA and also by quisqualate. Crystallization of the DGluR1A ligand-binding domain reveals amino acid exchanges that interfere with binding of these ligands. The unexpected ligand-binding profiles of insect iGluRs allows classical tools to be used in novel approaches for the study of synaptic regulation. VIDEO ABSTRACT. Published by Elsevier Inc.

The Role of IQGAP1 in Breast Carcinoma

DTIC Science & Technology

2012-10-01

and"-tubulin expression was measured as described above. Statistical Analysis —All experiments were repeated inde- pendently at least three times...IQGAP1 Binds HER2—In vitro analysis with pure proteins was used to examine a possible interaction between IQGAP1 and HER2. GST alone or GST-HER2 was...incubated with puri- fied IQGAP1, and complexes were isolated with glutathione- Sepharose. Analysis by Western blotting reveals that IQGAP1 bindsHER2

Structural elucidation of estrus urinary lipocalin protein (EULP) and evaluating binding affinity with pheromones using molecular docking and fluorescence study

PubMed Central

Rajesh, Durairaj; Muthukumar, Subramanian; Saibaba, Ganesan; Siva, Durairaj; Akbarsha, Mohammad Abdulkader; Gulyás, Balázs; Padmanabhan, Parasuraman; Archunan, Govindaraju

2016-01-01

Transportation of pheromones bound with carrier proteins belonging to lipocalin superfamily is known to prolong chemo-signal communication between individuals belonging to the same species. Members of lipocalin family (MLF) proteins have three structurally conserved motifs for delivery of hydrophobic molecules to the specific recognizer. However, computational analyses are critically required to validate and emphasize the sequence and structural annotation of MLF. This study focused to elucidate the evolution, structural documentation, stability and binding efficiency of estrus urinary lipocalin protein (EULP) with endogenous pheromones adopting in-silico and fluorescence study. The results revealed that: (i) EULP perhaps originated from fatty acid binding protein (FABP) revealed in evolutionary analysis; (ii) Dynamic simulation study shows that EULP is highly stable at below 0.45 Å of root mean square deviation (RMSD); (iii) Docking evaluation shows that EULP has higher binding energy with farnesol and 2-iso-butyl-3-methoxypyrazine (IBMP) than 2-naphthol; and (iv) Competitive binding and quenching assay revealed that purified EULP has good binding interaction with farnesol. Both, In-silico and experimental studies showed that EULP is an efficient binding partner to pheromones. The present study provides impetus to create a point mutation for increasing longevity of EULP to develop pheromone trap for rodent pest management. PMID:27782155

Structural elucidation of estrus urinary lipocalin protein (EULP) and evaluating binding affinity with pheromones using molecular docking and fluorescence study.

PubMed

Rajesh, Durairaj; Muthukumar, Subramanian; Saibaba, Ganesan; Siva, Durairaj; Akbarsha, Mohammad Abdulkader; Gulyás, Balázs; Padmanabhan, Parasuraman; Archunan, Govindaraju

2016-10-26

Transportation of pheromones bound with carrier proteins belonging to lipocalin superfamily is known to prolong chemo-signal communication between individuals belonging to the same species. Members of lipocalin family (MLF) proteins have three structurally conserved motifs for delivery of hydrophobic molecules to the specific recognizer. However, computational analyses are critically required to validate and emphasize the sequence and structural annotation of MLF. This study focused to elucidate the evolution, structural documentation, stability and binding efficiency of estrus urinary lipocalin protein (EULP) with endogenous pheromones adopting in-silico and fluorescence study. The results revealed that: (i) EULP perhaps originated from fatty acid binding protein (FABP) revealed in evolutionary analysis; (ii) Dynamic simulation study shows that EULP is highly stable at below 0.45 Å of root mean square deviation (RMSD); (iii) Docking evaluation shows that EULP has higher binding energy with farnesol and 2-iso-butyl-3-methoxypyrazine (IBMP) than 2-naphthol; and (iv) Competitive binding and quenching assay revealed that purified EULP has good binding interaction with farnesol. Both, In-silico and experimental studies showed that EULP is an efficient binding partner to pheromones. The present study provides impetus to create a point mutation for increasing longevity of EULP to develop pheromone trap for rodent pest management.

Whole-Genome Analysis Reveals That Active Heat Shock Factor Binding Sites Are Mostly Associated with Non-Heat Shock Genes in Drosophila melanogaster

PubMed Central

Gonsalves, Sarah E.; Moses, Alan M.; Razak, Zak; Robert, Francois; Westwood, J. Timothy

2011-01-01

During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions. PMID:21264254

Whole-genome analysis reveals that active heat shock factor binding sites are mostly associated with non-heat shock genes in Drosophila melanogaster.

PubMed

Gonsalves, Sarah E; Moses, Alan M; Razak, Zak; Robert, Francois; Westwood, J Timothy

2011-01-14

During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions.

Crystal structure of the UBR-box from UBR6/FBXO11 reveals domain swapping mediated by zinc binding.

PubMed

Muñoz-Escobar, Juliana; Kozlov, Guennadi; Gehring, Kalle

2017-10-01

The UBR-box is a 70-residue zinc finger domain present in the UBR family of E3 ubiquitin ligases that directly binds N-terminal degradation signals in substrate proteins. UBR6, also called FBXO11, is an UBR-box containing E3 ubiquitin ligase that does not bind N-terminal signals. Here, we present the crystal structure of the UBR-box domain from human UBR6. The dimeric crystal structure reveals a unique form of domain swapping mediated by zinc coordination, where three independent protein chains come together to regenerate the topology of the monomeric UBR-box fold. Analysis of the structure suggests that the absence of N-terminal residue binding arises from the lack of an amino acid binding pocket. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.

Structure and Self-Assembly of the Calcium Binding Matrix Protein of Human Metapneumovirus

PubMed Central

Leyrat, Cedric; Renner, Max; Harlos, Karl; Huiskonen, Juha T.; Grimes, Jonathan M.

2014-01-01

Summary The matrix protein (M) of paramyxoviruses plays a key role in determining virion morphology by directing viral assembly and budding. Here, we report the crystal structure of the human metapneumovirus M at 2.8 Å resolution in its native dimeric state. The structure reveals the presence of a high-affinity Ca2+ binding site. Molecular dynamics simulations (MDS) predict a secondary lower-affinity site that correlates well with data from fluorescence-based thermal shift assays. By combining small-angle X-ray scattering with MDS and ensemble analysis, we captured the structure and dynamics of M in solution. Our analysis reveals a large positively charged patch on the protein surface that is involved in membrane interaction. Structural analysis of DOPC-induced polymerization of M into helical filaments using electron microscopy leads to a model of M self-assembly. The conservation of the Ca2+ binding sites suggests a role for calcium in the replication and morphogenesis of pneumoviruses. PMID:24316400

Characterisation of the contribution of the GABA-benzodiazepine α1 receptor subtype to [11C]Ro15-4513 PET images

PubMed Central

Myers, James FM; Rosso, Lula; Watson, Ben J; Wilson, Sue J; Kalk, Nicola J; Clementi, Nicoletta; Brooks, David J; Nutt, David J; Turkheimer, Federico E; Lingford-Hughes, Anne R

2012-01-01

This positron emission tomography (PET) study aimed to further define selectivity of [11C]Ro15-4513 binding to the GABARα5 relative to the GABARα1 benzodiazepine receptor subtype. The impact of zolpidem, a GABARα1-selective agonist, on [11C]Ro15-4513, which shows selectivity for GABARα5, and the nonselective benzodiazepine ligand [11C]flumazenil binding was assessed in humans. Compartmental modelling of the kinetics of [11C]Ro15-4513 time-activity curves was used to describe distribution volume (VT) differences in regions populated by different GABA receptor subtypes. Those with low α5 were best fitted by one-tissue compartment models; and those with high α5 required a more complex model. The heterogeneity between brain regions suggested spectral analysis as a more appropriate method to quantify binding as it does not a priori specify compartments. Spectral analysis revealed that zolpidem caused a significant VT decrease (∼10%) in [11C]flumazenil, but no decrease in [11C]Ro15-4513 binding. Further analysis of [11C]Ro15-4513 kinetics revealed additional frequency components present in regions containing both α1 and α5 subtypes compared with those containing only α1. Zolpidem reduced one component (mean±s.d.: 71%±41%), presumed to reflect α1-subtype binding, but not another (13%±22%), presumed to reflect α5. The proposed method for [11C]Ro15-4513 analysis may allow more accurate selective binding assays and estimation of drug occupancy for other nonselective ligands. PMID:22214903

Sequence characterization of S100A8 gene reveals structural differences of protein and transcriptional factor binding sites in water buffalo and yak.

PubMed

Kathiravan, P; Goyal, S; Kataria, R S; Mishra, B P; Jayakumar, S; Joshi, B K

2011-01-01

The present study was undertaken to characterize the structure of S100A8 gene and its promoter in water buffalo and yak. Sequence data of 2.067 kb, 2.071 kb, and 2.052 kb with respect to complete S100A8 gene including 5' flanking region was generated in river buffalo, swamp buffalo, and yak, respectively. BLAST analysis of coding DNA sequences (CDS) of S100A8 gene revealed 95% homology of buffalo sequence with cattle, 85% with pig and horse, 83% with dog, 72-73% with murines, and around 79% with primates and humans. Phylogenetic analysis of predicted CDS revealed distinct clustering of murines, primates, and domestic animals with bovines and bubalines forming a subcluster among farm animals. In silico translation of predicted CDS revealed a sequence of 89 amino acids with 7 amino acid changes between cattle and buffalo and 2 changes between cattle and yak. The search for Pfam family revealed the N-terminal calcium binding domain and the noncanonical EF hand domain in the carboxy terminus, with more variations being observed in the N-terminal domain among different species. Two amino acid changes observed in carboxy terminal EF hand domain resulted in altered secondary structure of yak S100A8 protein. Analysis of S100A8 gene promoter revealed 14 putative motifs for transcriptional factor binding sites. Two putative motifs viz. C/EBP and v-Myb were found to be absent in swamp buffalo as compared to river buffalo and cattle. Differences in the structure of S100A8 protein and the transcriptional factor binding sites identified in the present study need to be analyzed further for their functional significance in yak and swamp buffalo respectively. Copyright © Taylor & Francis Group, LLC

Genome wide analysis reveals Zic3 interaction with distal regulatory elements of stage specific developmental genes in zebrafish.

PubMed

Winata, Cecilia L; Kondrychyn, Igor; Kumar, Vibhor; Srinivasan, Kandhadayar G; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W; Korzh, Vladimir; Mathavan, Sinnakaruppan

2013-10-01

Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches--ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape.

Structural basis for diversity in the SAM clan of riboswitches.

PubMed

Trausch, Jeremiah J; Xu, Zhenjiang; Edwards, Andrea L; Reyes, Francis E; Ross, Phillip E; Knight, Rob; Batey, Robert T

2014-05-06

In bacteria, sulfur metabolism is regulated in part by seven known families of riboswitches that bind S-adenosyl-l-methionine (SAM). Direct binding of SAM to these mRNA regulatory elements governs a downstream secondary structural switch that communicates with the transcriptional and/or translational expression machinery. The most widely distributed SAM-binding riboswitches belong to the SAM clan, comprising three families that share a common SAM-binding core but differ radically in their peripheral architecture. Although the structure of the SAM-I member of this clan has been extensively studied, how the alternative peripheral architecture of the other families supports the common SAM-binding core remains unknown. We have therefore solved the X-ray structure of a member of the SAM-I/IV family containing the alternative "PK-2" subdomain shared with the SAM-IV family. This structure reveals that this subdomain forms extensive interactions with the helix housing the SAM-binding pocket, including a highly unusual mode of helix packing in which two helices pack in a perpendicular fashion. Biochemical and genetic analysis of this RNA reveals that SAM binding induces many of these interactions, including stabilization of a pseudoknot that is part of the regulatory switch. Despite strong structural similarity between the cores of SAM-I and SAM-I/IV members, a phylogenetic analysis of sequences does not indicate that they derive from a common ancestor.

Distinct [18F]THK5351 binding patterns in primary progressive aphasia variants.

PubMed

Schaeverbeke, Jolien; Evenepoel, Charlotte; Declercq, Lieven; Gabel, Silvy; Meersmans, Karen; Bruffaerts, Rose; Adamczuk, Kate; Dries, Eva; Van Bouwel, Karen; Sieben, Anne; Pijnenburg, Yolande; Peeters, Ronald; Bormans, Guy; Van Laere, Koen; Koole, Michel; Dupont, Patrick; Vandenberghe, Rik

2018-06-26

To assess the binding of the PET tracer [ 18 F]THK5351 in patients with different primary progressive aphasia (PPA) variants and its correlation with clinical deficits. The majority of patients with nonfluent variant (NFV) and logopenic variant (LV) PPA have underlying tauopathy of the frontotemporal lobar or Alzheimer disease type, respectively, while patients with the semantic variant (SV) have predominantly transactive response DNA binding protein 43-kDa pathology. The study included 20 PPA patients consecutively recruited through a memory clinic (12 NFV, 5 SV, 3 LV), and 20 healthy controls. All participants received an extensive neurolinguistic assessment, magnetic resonance imaging and amyloid biomarker tests. [ 18 F]THK5351 binding patterns were assessed on standardized uptake value ratio (SUVR) images with the cerebellar grey matter as the reference using statistical parametric mapping. Whole-brain voxel-wise regression analysis was performed to evaluate the association between [ 18 F]THK5351 SUVR images and neurolinguistic scores. Analyses were performed with and without partial volume correction. Patients with NFV showed increased binding in the supplementary motor area, left premotor cortex, thalamus, basal ganglia and midbrain compared with controls and patients with SV. Patients with SV had increased binding in the temporal lobes bilaterally and in the right ventromedial frontal cortex compared with controls and patients with NFV. The whole-brain voxel-wise regression analysis revealed a correlation between agrammatism and motor speech impairment, and [ 18 F]THK5351 binding in the left supplementary motor area and left postcentral gyrus. Analysis of [ 18 F]THK5351 scans without partial volume correction revealed similar results. [ 18 F]THK5351 imaging shows a topography closely matching the anatomical distribution of predicted underlying pathology characteristic of NFV and SV PPA. [ 18 F]THK5351 binding correlates with the severity of clinical impairment.

Comprehensive insight into the binding of sunitinib, a multi-targeted anticancer drug to human serum albumin

NASA Astrophysics Data System (ADS)

Kabir, Md. Zahirul; Tee, Wei-Ven; Mohamad, Saharuddin B.; Alias, Zazali; Tayyab, Saad

2017-06-01

Binding studies between a multi-targeted anticancer drug, sunitinib (SU) and human serum albumin (HSA) were made using fluorescence, UV-vis absorption, circular dichroism (CD) and molecular docking analysis. Both fluorescence quenching data and UV-vis absorption results suggested formation of SU-HSA complex. Moderate binding affinity between SU and HSA was evident from the value of the binding constant (3.04 × 104 M-1), obtained at 298 K. Involvement of hydrophobic interactions and hydrogen bonds as the leading intermolecular forces in the formation of SU-HSA complex was predicted from the thermodynamic data of the binding reaction. These results were in good agreement with the molecular docking analysis. Microenvironmental perturbations around Tyr and Trp residues as well as secondary and tertiary structural changes in HSA upon SU binding were evident from the three-dimensional fluorescence and circular dichroism results. SU binding to HSA also improved the thermal stability of the protein. Competitive displacement results and molecular docking analysis revealed the binding locus of SU to HSA in subdomain IIA (Sudlow's site I). The influence of a few common ions on the binding constant of SU-HSA complex was also noticed.

A comparative analysis on the binding characteristics of various mammalian albumins towards a multitherapeutic agent, pinostrobin

PubMed Central

FEROZ, Shevin R.; SUMI, Rumana A.; MALEK, Sri N.A.; TAYYAB, Saad

2014-01-01

The interaction of pinostrobin (PS), a multitherapeutic agent with serum albumins of various mammalian species namely, goat, bovine, human, porcine, rabbit, sheep and dog was investigated using fluorescence quench titration and competitive drug displacement experiments. Analysis of the intrinsic fluorescence quenching data revealed values of the association constant, Ka in the range of 1.49 – 6.12 × 104 M−1, with 1:1 binding stoichiometry. Based on the PS–albumin binding characteristics, these albumins were grouped into two classes. Ligand displacement studies using warfarin as the site I marker ligand correlated well with the binding data. Albumins from goat and bovine were found to be closely similar to human albumin on the basis of PS binding characteristics. PMID:25519455

Decipher the mechanisms of protein conformational changes induced by nucleotide binding through free-energy landscape analysis: ATP binding to Hsp70.

PubMed

Nicolaï, Adrien; Delarue, Patrice; Senet, Patrick

2013-01-01

ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD) simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL) of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD) of Hsp70 propagates a signal to its substrate-binding domain (SBD). Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in other proteins.

Decipher the Mechanisms of Protein Conformational Changes Induced by Nucleotide Binding through Free-Energy Landscape Analysis: ATP Binding to Hsp70

PubMed Central

Nicolaï, Adrien; Delarue, Patrice; Senet, Patrick

2013-01-01

ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD) simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL) of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD) of Hsp70 propagates a signal to its substrate-binding domain (SBD). Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in other proteins. PMID:24348227

Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carmen Herranz, Ma; Sanchez-Navarro, Jesus-Angel; Sauri, Ana

2005-08-15

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutantsmore » and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed.« less

Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement.

PubMed

Carmen Herranz, Ma; Sanchez-Navarro, Jesús-Angel; Saurí, Ana; Mingarro, Ismael; Pallás, Vicente

2005-08-15

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed.

Structural motif screening reveals a novel, conserved carbohydrate-binding surface in the pathogenesis-related protein PR-5d.

PubMed

Doxey, Andrew C; Cheng, Zhenyu; Moffatt, Barbara A; McConkey, Brendan J

2010-08-03

Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB) for coplanar aromatic motifs similar to those found in known glycan-binding proteins. The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO) enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192) in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.

Probing Dominant Negative Behavior of Glucocorticoid Receptor β through a Hybrid Structural and Biochemical Approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Min, Jungki; Perera, Lalith; Krahn, Juno M.

ABSTRACT Glucocorticoid receptor β (GRβ) is associated with glucocorticoid resistance via dominant negative regulation of GRα. To better understand how GRβ functions as a dominant negative inhibitor of GRα at a molecular level, we determined the crystal structure of the ligand binding domain of GRβ complexed with the antagonist RU-486. The structure reveals that GRβ binds RU-486 in the same ligand binding pocket as GRα, and the unique C-terminal amino acids of GRβ are mostly disordered. Binding energy analysis suggests that these C-terminal residues of GRβ do not contribute to RU-486 binding. Intriguingly, the GRβ/RU-486 complex binds corepressor peptide withmore » affinity similar to that of a GRα/RU-486 complex, despite the lack of helix 12. Our biophysical and biochemical analyses reveal that in the presence of RU-486, GRβ is found in a conformation that favors corepressor binding, potentially antagonizing GRα function. This study thus presents an unexpected molecular mechanism by which GRβ could repress transcription.« less

Identical linkage and cooperativity of oxygen and carbon monoxide binding to Octopus dofleini hemocyanin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Connelly, P.R.; Gill, S.J.; Miller, K.I.

1989-02-21

Employment of high-precision thin-layer methods has enabled detailed functional characterization of oxygen and carbon monoxide binding for (1) the fully assembled form with 70 binding sites and (2) the isolated chains with 7 binding sites of octopus dofleini hemocyanin. The striking difference in the cooperativities of the two ligands for the assembled decamer is revealed through an examination of the binding capacities and the partition coefficient, determined as functions of the activities of both ligands. A global analysis of the data sets supported by a two-state allosteric model assuming an allosteric unit of 7. Higher level allosteric interactions were notmore » indicated. This contrasts to results obtained for arthropod hemocyanins. Oxygen and carbon monoxide experiments performed on the isolated subunit chain confirmed the presence of functional heterogeneity reported previously. The analysis shows two types of binding sites in the ratio of 4:3.« less

Conformational heterogeneity in the C-terminal zinc fingers of human MTF-1: an NMR and zinc-binding study.

PubMed

Giedroc, D P; Chen, X; Pennella, M A; LiWang, A C

2001-11-09

The human metalloregulatory transcription factor, metal-response element (MRE)-binding transcription factor-1 (MTF-1), contains six TFIIIA-type Cys(2)-His(2) motifs, each of which was projected to form well-structured betabetaalpha domains upon Zn(II) binding. In this report, the structure and backbone dynamics of a fragment containing the unusual C-terminal fingers F4-F6 has been investigated. (15)N heteronuclear single quantum coherence (HSQC) spectra of uniformly (15)N-labeled hMTF-zf46 show that Zn(II) induces the folding of hMTF-zf46. Analysis of the secondary structure of Zn(3) hMTF-zf46 determined by (13)Calpha chemical shift indexing and the magnitude of (3)J(Halpha-HN) clearly reveal that zinc fingers F4 and F6 adopt typical betabetaalpha structures. An analysis of the heteronuclear backbone (15)N relaxation dynamics behavior is consistent with this picture and further reveals independent tumbling of the finger domains in solution. Titration of apo-MTF-zf46 with Zn(II) reveals that the F4 domain binds Zn(II) significantly more tightly than do the other two finger domains. In contrast to fingers F4 and F6, the betabetaalpha fold of finger F5 is unstable and only partially populated at substoichiometric Zn(II); a slight molar excess of zinc results in severe conformational exchange broadening of all F5 NH cross-peaks. Finally, although Cd(II) binds to apo-hMTF-zf46 as revealed by intense S(-)-->Cd(II) absorption, a non-native structure results; addition of stoichiometric Zn(II) to the Cd(II) complex results in quantitative refolding of the betabetaalpha structure in F4 and F6. The functional implications of these results are discussed.

A detailed spectroscopic study on the interaction of Rhodamine 6G with human hemoglobin.

PubMed

Mandal, Paulami; Bardhan, Munmun; Ganguly, Tapan

2010-05-03

UV-vis, time-resolved fluorescence and circular dichroism spectroscopic investigations have been made to reveal the nature of the interactions between xanthene dye Rhodamine 6G and the well known protein hemoglobin. From the analysis of the steady-state and time-resolved fluorescence quenching of Rhodamine 6G in aqueous solutions in presence of hemoglobin, it is revealed that the quenching is static in nature. The primary binding pattern between Rhodamine and hemoglobin has been interpreted as combined effect of hydrophobic association and electrostatic interaction. The binding constants, number of binding sites and thermodynamic parameters at various pH of the environment have been computed. The binding average distance between the energy donor Rhodamine and acceptor hemoglobin has been determined from the Forster's theory. Copyright 2010 Elsevier B.V. All rights reserved.

Complex Structure and Biochemical Characterization of the Staphylococcus aureus Cyclic Diadenylate Monophosphate (c-di-AMP)-binding Protein PstA, the Founding Member of a New Signal Transduction Protein Family*

PubMed Central

Campeotto, Ivan; Zhang, Yong; Mladenov, Miroslav G.; Freemont, Paul S.; Gründling, Angelika

2015-01-01

Signaling nucleotides are integral parts of signal transduction systems allowing bacteria to cope with and rapidly respond to changes in the environment. The Staphylococcus aureus PII-like signal transduction protein PstA was recently identified as a cyclic diadenylate monophosphate (c-di-AMP)-binding protein. Here, we present the crystal structures of the apo- and c-di-AMP-bound PstA protein, which is trimeric in solution as well as in the crystals. The structures combined with detailed bioinformatics analysis revealed that the protein belongs to a new family of proteins with a similar core fold but with distinct features to classical PII proteins, which usually function in nitrogen metabolism pathways in bacteria. The complex structure revealed three identical c-di-AMP-binding sites per trimer with each binding site at a monomer-monomer interface. Although distinctly different from other cyclic-di-nucleotide-binding sites, as the half-binding sites are not symmetrical, the complex structure also highlighted common features for c-di-AMP-binding sites. A comparison between the apo and complex structures revealed a series of conformational changes that result in the ordering of two anti-parallel β-strands that protrude from each monomer and allowed us to propose a mechanism on how the PstA protein functions as a signaling transduction protein. PMID:25505271

Modulation of enrofloxacin binding in OmpF by Mg2+ as revealed by the analysis of fast flickering single-porin current

PubMed Central

Brauser, Annemarie; Schroeder, Indra; Gutsmann, Thomas; Cosentino, Cristian; Moroni, Anna; Winterhalter, Mathias

2012-01-01

One major determinant of the efficacy of antibiotics on Gram-negative bacteria is the passage through the outer membrane. During transport of the fluoroquinolone enrofloxacin through the trimeric outer membrane protein OmpF of Escherichia coli, the antibiotic interacts with two binding sites within the pore, thus partially blocking the ionic current. The modulation of one affinity site by Mg2+ reveals further details of binding sites and binding kinetics. At positive membrane potentials, the slow blocking events induced by enrofloxacin in Mg2+-free media are converted to flickery sojourns at the highest apparent current level (all three pores flickering). This indicates weaker binding in the presence of Mg2+. Analysis of the resulting amplitude histograms with β distributions revealed the rate constants of blocking (kOB) and unblocking (kBO) in the range of 1,000 to 120,000 s−1. As expected for a bimolecular reaction, kOB was proportional to blocker concentration and kBO independent of it. kOB was approximately three times lower for enrofloxacin coming from the cis side than from the trans side. The block was not complete, leading to a residual conductivity of the blocked state being ∼25% of that of the open state. Interpretation of the results has led to the following model: fast flickering as caused by interaction of Mg2+ and enrofloxacin is related to the binding site at the trans side, whereas the cis site mediates slow blocking events which are also found without Mg2+. The difference in the accessibility of the binding sites also explains the dependency of kOB on the side of enrofloxacin addition and yields a means of determining the most plausible orientation of OmpF in the bilayer. The voltage dependence suggests that the dipole of the antibiotic has to be adequately oriented to facilitate binding. PMID:22689827

Structural Analysis of Semi-specific Oligosaccharide Recognition by a Cellulose-binding Protein of Thermotoga maritima Reveals Adaptations for Functional Diversification of the Oligopeptide Periplasmic Binding Protein Fold

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cuneo, Matthew J.; Beese, Lorena S.; Hellinga, Homme W.

Periplasmic binding proteins (PBPs) constitute a protein superfamily that binds a wide variety of ligands. In prokaryotes, PBPs function as receptors for ATP-binding cassette or tripartite ATP-independent transporters and chemotaxis systems. In many instances, PBPs bind their cognate ligands with exquisite specificity, distinguishing, for example, between sugar epimers or structurally similar anions. By contrast, oligopeptide-binding proteins bind their ligands through interactions with the peptide backbone but do not distinguish between different side chains. The extremophile Thermotoga maritima possesses a remarkable array of carbohydrate-processing metabolic systems, including the hydrolysis of cellulosic polymers. Here, we present the crystal structure of a T.more » maritima cellobiose-binding protein (tm0031) that is homologous to oligopeptide-binding proteins. T. maritima cellobiose-binding protein binds a variety of lengths of {beta}(1 {yields} 4)-linked glucose oligomers, ranging from two rings (cellobiose) to five (cellopentaose). The structure reveals that binding is semi-specific. The disaccharide at the nonreducing end binds specifically; the other rings are located in a large solvent-filled groove, where the reducing end makes several contacts with the protein, thereby imposing an upper limit of the oligosaccharides that are recognized. Semi-specific recognition, in which a molecular class rather than individual species is selected, provides an efficient solution for the uptake of complex mixtures.« less

Rational design and validation of a vanilloid-sensitive TRPV2 ion channel.

PubMed

Yang, Fan; Vu, Simon; Yarov-Yarovoy, Vladimir; Zheng, Jie

2016-06-28

Vanilloids activation of TRPV1 represents an excellent model system of ligand-gated ion channels. Recent studies using cryo-electron microcopy (cryo-EM), computational analysis, and functional quantification revealed the location of capsaicin-binding site and critical residues mediating ligand-binding and channel activation. Based on these new findings, here we have successfully introduced high-affinity binding of capsaicin and resiniferatoxin to the vanilloid-insensitive TRPV2 channel, using a rationally designed minimal set of four point mutations (F467S-S498F-L505T-Q525E, termed TRPV2_Quad). We found that binding of resiniferatoxin activates TRPV2_Quad but the ligand-induced open state is relatively unstable, whereas binding of capsaicin to TRPV2_Quad antagonizes resiniferatoxin-induced activation likely through competition for the same binding sites. Using Rosetta-based molecular docking, we observed a common structural mechanism underlying vanilloids activation of TRPV1 and TRPV2_Quad, where the ligand serves as molecular "glue" that bridges the S4-S5 linker to the S1-S4 domain to open these channels. Our analysis revealed that capsaicin failed to activate TRPV2_Quad likely due to structural constraints preventing such bridge formation. These results not only validate our current working model for capsaicin activation of TRPV1 but also should help guide the design of drug candidate compounds for this important pain sensor.

Analysis of IR spectra of mineralized deposits on human cardiac valves

NASA Astrophysics Data System (ADS)

Ivanov-Omskii, V. I.; Yastrebov, S. G.; Gulyaev, N. I.

2017-05-01

IR spectroscopy in the range of vibration of hydroxy groups has been used to analyze the binding energy of mineralized deposits to cardiac valves of patients of varied gender and age. A tendency was revealed toward a gender-independent rise in the binding energy of mineralized deposits to valve tissues with increasing age of patients. The analysis enables making recommendations concerning the early diagnostics of valve calcination, monitoring of its development, and therapy of calcinoses.

Computational analysis of a novel mutation in ETFDH gene highlights its long-range effects on the FAD-binding motif.

PubMed

Er, Tze-Kiong; Chen, Chih-Chieh; Liu, Yen-Yi; Chang, Hui-Chiu; Chien, Yin-Hsiu; Chang, Jan-Gowth; Hwang, Jenn-Kang; Jong, Yuh-Jyh

2011-10-21

Multiple acyl-coenzyme A dehydrogenase deficiency (MADD) is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH) gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. High resolution melting (HRM) analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser) and the hotspot mutation (p.Ala84Thr) from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD) binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD) simulations and normal mode analysis (NMA), we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability.

Computational analysis of a novel mutation in ETFDH gene highlights its long-range effects on the FAD-binding motif

PubMed Central

2011-01-01

Background Multiple acyl-coenzyme A dehydrogenase deficiency (MADD) is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH) gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. Results High resolution melting (HRM) analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser) and the hotspot mutation (p.Ala84Thr) from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD) binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD) simulations and normal mode analysis (NMA), we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Conclusions Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability. PMID:22013910

Leveraging cross-species transcription factor binding site patterns: from diabetes risk loci to disease mechanisms.

PubMed

Claussnitzer, Melina; Dankel, Simon N; Klocke, Bernward; Grallert, Harald; Glunk, Viktoria; Berulava, Tea; Lee, Heekyoung; Oskolkov, Nikolay; Fadista, Joao; Ehlers, Kerstin; Wahl, Simone; Hoffmann, Christoph; Qian, Kun; Rönn, Tina; Riess, Helene; Müller-Nurasyid, Martina; Bretschneider, Nancy; Schroeder, Timm; Skurk, Thomas; Horsthemke, Bernhard; Spieler, Derek; Klingenspor, Martin; Seifert, Martin; Kern, Michael J; Mejhert, Niklas; Dahlman, Ingrid; Hansson, Ola; Hauck, Stefanie M; Blüher, Matthias; Arner, Peter; Groop, Leif; Illig, Thomas; Suhre, Karsten; Hsu, Yi-Hsiang; Mellgren, Gunnar; Hauner, Hans; Laumen, Helmut

2014-01-16

Genome-wide association studies have revealed numerous risk loci associated with diverse diseases. However, identification of disease-causing variants within association loci remains a major challenge. Divergence in gene expression due to cis-regulatory variants in noncoding regions is central to disease susceptibility. We show that integrative computational analysis of phylogenetic conservation with a complexity assessment of co-occurring transcription factor binding sites (TFBS) can identify cis-regulatory variants and elucidate their mechanistic role in disease. Analysis of established type 2 diabetes risk loci revealed a striking clustering of distinct homeobox TFBS. We identified the PRRX1 homeobox factor as a repressor of PPARG2 expression in adipose cells and demonstrate its adverse effect on lipid metabolism and systemic insulin sensitivity, dependent on the rs4684847 risk allele that triggers PRRX1 binding. Thus, cross-species conservation analysis at the level of co-occurring TFBS provides a valuable contribution to the translation of genetic association signals to disease-related molecular mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

Structure and self-assembly of the calcium binding matrix protein of human metapneumovirus.

PubMed

Leyrat, Cedric; Renner, Max; Harlos, Karl; Huiskonen, Juha T; Grimes, Jonathan M

2014-01-07

The matrix protein (M) of paramyxoviruses plays a key role in determining virion morphology by directing viral assembly and budding. Here, we report the crystal structure of the human metapneumovirus M at 2.8 Å resolution in its native dimeric state. The structure reveals the presence of a high-affinity Ca²⁺ binding site. Molecular dynamics simulations (MDS) predict a secondary lower-affinity site that correlates well with data from fluorescence-based thermal shift assays. By combining small-angle X-ray scattering with MDS and ensemble analysis, we captured the structure and dynamics of M in solution. Our analysis reveals a large positively charged patch on the protein surface that is involved in membrane interaction. Structural analysis of DOPC-induced polymerization of M into helical filaments using electron microscopy leads to a model of M self-assembly. The conservation of the Ca²⁺ binding sites suggests a role for calcium in the replication and morphogenesis of pneumoviruses. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Systematic prediction of control proteins and their DNA binding sites

PubMed Central

Sorokin, Valeriy; Severinov, Konstantin; Gelfand, Mikhail S.

2009-01-01

We present here the results of a systematic bioinformatics analysis of control (C) proteins, a class of DNA-binding regulators that control time-delayed transcription of their own genes as well as restriction endonuclease genes in many type II restriction-modification systems. More than 290 C protein homologs were identified and DNA-binding sites for ∼70% of new and previously known C proteins were predicted by a combination of phylogenetic footprinting and motif searches in DNA upstream of C protein genes. Additional analysis revealed that a large proportion of C protein genes are translated from leaderless RNA, which may contribute to time-delayed nature of genetic switches operated by these proteins. Analysis of genetic contexts of newly identified C protein genes revealed that they are not exclusively associated with restriction-modification genes; numerous instances of associations with genes originating from mobile genetic elements were observed. These instances might be vestiges of ancient horizontal transfers and indicate that during evolution ancestral restriction-modification system genes were the sites of mobile elements insertions. PMID:19056824

Structure of the cobalamin-binding protein of a putative O-demethylase from Desulfitobacterium hafniense DCB-2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sjuts, Hanno; Dunstan, Mark S.; Fisher, Karl

2013-08-01

The first crystal structure of the vitamin B12-binding protein from a three-component O-demethylase enzyme system is reported. During O-demethylation methyl groups are transferred from phenyl methyl ethers to tetrahydrofolate via methyl-B12 intermediates. This study describes the identification and the structural and spectroscopic analysis of a cobalamin-binding protein (termed CobDH) implicated in O-demethylation by the organohalide-respiring bacterium Desulfitobacterium hafniense DCB-2. The 1.5 Å resolution crystal structure of CobDH is presented in the cobalamin-bound state and reveals that the protein is composed of an N-terminal helix-bundle domain and a C-terminal Rossmann-fold domain, with the cobalamin coordinated in the base-off/His-on conformation similar tomore » other cobalamin-binding domains that catalyse methyl-transfer reactions. EPR spectroscopy of CobDH confirms cobalamin binding and reveals the presence of a cob(III)alamin superoxide, indicating binding of oxygen to the fully oxidized cofactor. These data provide the first structural insights into the methyltransferase reactions that occur during O-demethylation by D. hafniense.« less

Spectroscopic characterization of metal bound phytochelatin analogue (Glu-Cys)4-Gly.

PubMed

Cheng, Yongsheng; Yan, Yong-Bin; Liu, Jinyuan

2005-10-01

The metal ion binding properties of a phytochelatin (PC) analogue, (Glu-Cys)4-Gly (named as EC4), have been studied by a divalent metal ion binding assay monitored by UV-visible spectroscopy, circular dichroism and NMR spectroscopy. Spectro- photometric titration with different divalent metal ions have revealed that the stiochoimetry of metal-bound EC4 was 1:1, and its metal binding affinities with different divalent metal ions in the order of Cd(II)>Cu(II)>Zn(II)>Pb(II)>Ni(II)>Co(II). UV-visible spectroscopic analysis of metal complexes indicated that four sulfur atoms in cysteine residues are attributable to ligand-to-metal charge transfer (LMCT) between divalent metal ions and EC4, and further confirmed by 1D H1 NMR study and Circular Dichroism. In addition, Circular Dichroism spectra of both free and metal-bound forms of EC4 revealed that metal coordination drives the nonapeptide chain to fold into a turned conformation. The comprehensive analysis of spectroscopic properties of the nonapeptide complexed with metal ions not only provides a fundamental description of the metal ion binding properties of PC analogue, but also shows a correlation between metal binding affinity of PC analogue and the induction activity of metal ions.

Insights into finding a mismatch through the structure of a mispaired DNA bound by a rhodium intercalator

PubMed Central

Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

2007-01-01

We report the 1.1-Å resolution crystal structure of a bulky rhodium complex bound to two different DNA sites, mismatched and matched in the oligonucleotide 5′-(dCGGAAATTCCCG)2-3′. At the AC mismatch site, the structure reveals ligand insertion from the minor groove with ejection of both mismatched bases and elucidates how destabilized mispairs in DNA may be recognized. This unique binding mode contrasts with major groove intercalation, observed at a matched site, where doubling of the base pair rise accommodates stacking of the intercalator. Mass spectral analysis reveals different photocleavage products associated with the two binding modes in the crystal, with only products characteristic of mismatch binding in solution. This structure, illustrating two clearly distinct binding modes for a molecule with DNA, provides a rationale for the interrogation and detection of mismatches. PMID:17194756

Genome-wide comparative analysis reveals similar types of NBS genes in hybrid Citrus sinensis genome and original Citrus clementine genome and provides new insights into non-TIR NBS genes

USDA-ARS?s Scientific Manuscript database

In this study, we identified and compared nucleotide-binding site (NBS) domain-containing genes from three Citrus genomes (C. clementina, C. sinensis from USA and C. sinensis from China). Phylogenetic analysis of all Citrus NBS genes across these three genomes revealed that there are three approxima...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akabayov, B.; Akabayov, S; Lee , S

Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

Structural Analysis of the Complex between Penta-EF-Hand ALG-2 Protein and Sec31A Peptide Reveals a Novel Target Recognition Mechanism of ALG-2

PubMed Central

Takahashi, Takeshi; Kojima, Kyosuke; Zhang, Wei; Sasaki, Kanae; Ito, Masaru; Suzuki, Hironori; Kawasaki, Masato; Wakatsuki, Soichi; Takahara, Terunao; Shibata, Hideki; Maki, Masatoshi

2015-01-01

ALG-2, a 22-kDa penta-EF-hand protein, is involved in cell death, signal transduction, membrane trafficking, etc., by interacting with various proteins in mammalian cells in a Ca2+-dependent manner. Most known ALG-2-interacting proteins contain proline-rich regions in which either PPYPXnYP (type 1 motif) or PXPGF (type 2 motif) is commonly found. Previous X-ray crystal structural analysis of the complex between ALG-2 and an ALIX peptide revealed that the peptide binds to the two hydrophobic pockets. In the present study, we resolved the crystal structure of the complex between ALG-2 and a peptide of Sec31A (outer shell component of coat complex II, COPII; containing the type 2 motif) and found that the peptide binds to the third hydrophobic pocket (Pocket 3). While amino acid substitution of Phe85, a Pocket 3 residue, with Ala abrogated the interaction with Sec31A, it did not affect the interaction with ALIX. On the other hand, amino acid substitution of Tyr180, a Pocket 1 residue, with Ala caused loss of binding to ALIX, but maintained binding to Sec31A. We conclude that ALG-2 recognizes two types of motifs at different hydrophobic surfaces. Furthermore, based on the results of serial mutational analysis of the ALG-2-binding sites in Sec31A, the type 2 motif was newly defined. PMID:25667979

Integration of element specific persistent homology and machine learning for protein-ligand binding affinity prediction.

PubMed

Cang, Zixuan; Wei, Guo-Wei

2018-02-01

Protein-ligand binding is a fundamental biological process that is paramount to many other biological processes, such as signal transduction, metabolic pathways, enzyme construction, cell secretion, and gene expression. Accurate prediction of protein-ligand binding affinities is vital to rational drug design and the understanding of protein-ligand binding and binding induced function. Existing binding affinity prediction methods are inundated with geometric detail and involve excessively high dimensions, which undermines their predictive power for massive binding data. Topology provides the ultimate level of abstraction and thus incurs too much reduction in geometric information. Persistent homology embeds geometric information into topological invariants and bridges the gap between complex geometry and abstract topology. However, it oversimplifies biological information. This work introduces element specific persistent homology (ESPH) or multicomponent persistent homology to retain crucial biological information during topological simplification. The combination of ESPH and machine learning gives rise to a powerful paradigm for macromolecular analysis. Tests on 2 large data sets indicate that the proposed topology-based machine-learning paradigm outperforms other existing methods in protein-ligand binding affinity predictions. ESPH reveals protein-ligand binding mechanism that can not be attained from other conventional techniques. The present approach reveals that protein-ligand hydrophobic interactions are extended to 40Å  away from the binding site, which has a significant ramification to drug and protein design. Copyright © 2017 John Wiley & Sons, Ltd.

Effects of ligand binding on the dynamics of rice nonspecific lipid transfer protein 1: a model from molecular simulations.

PubMed

Lai, Yen-Ting; Cheng, Chao-Sheng; Liu, Yu-Nan; Liu, Yaw-Jen; Lyu, Ping-Chiang

2008-09-01

Plant nonspecific lipid transfer proteins (nsLTPs) are small, basic proteins constituted mainly of alpha-helices and stabilized by four conserved disulfide bridges. They are characterized by the presence of a tunnel-like hydrophobic cavity, capable of transferring various lipid molecules between lipid bilayers in vitro. In this study, molecular dynamics (MD) simulations were performed at room temperature to investigate the effects of lipid binding on the dynamic properties of rice nsLTP1. Rice nsLTP1, either in the free form or complexed with one or two lipids was subjected to MD simulations. The C-terminal loop was very flexible both before and after lipid binding, as revealed by calculating the root-mean-square fluctuation. After lipid binding, the flexibility of some residues that were not in direct contact with lipid molecules increased significantly, indicating an increase of entropy in the region distal from the binding site. Essential dynamics analysis revealed clear differences in motion between unliganded and liganded rice nsLTP1s. In the free form of rice nsLTP1, loop1 exhibited the largest directional motion. This specific essential motion mode diminished after binding one or two lipid molecules. To verify the origin of the essential motion observed in the free form of rice nsLTP1, we performed multiple sequence alignments to probe the intrinsic motion encoded in the primary sequence. We found that the amino acid sequence of loop1 is highly conserved among plant nsLTP1s, thus revealing its functional importance during evolution. Furthermore, the sequence of loop1 is composed mainly of amino acids with short side chains. In this study, we show that MD simulations, together with essential dynamics analysis, can be used to determine structural and dynamic differences of rice nsLTP1 upon lipid binding. 2008 Wiley-Liss, Inc.

Binding of perlecan to transthyretin in vitro.

PubMed Central

Smeland, S; Kolset, S O; Lyon, M; Norum, K R; Blomhoff, R

1997-01-01

Transthyretin is one of two specific proteins involved in the transport of thyroid hormones in plasma; it possesses two binding sites for serum retinol-binding protein. In the present study we demonstrate that transthyretin also interacts in vitro with [35S]sulphate-labelled material from the medium of HepG2 cells. By using the same strategy as for purifying serum retinol-binding protein, [35S]sulphate-labelled medium was specifically eluted from a transthyretin-affinity column. Ion-exchange chromatography showed that the material was highly polyanionic, and its size and alkali susceptibility suggested that it was a proteoglycan. Structural analyses with chondroitinase ABC lyase and nitrous acid revealed that approx. 20% was chondroitin sulphate and 80% heparan sulphate. Immunoprecipitation showed that the [35S]sulphate-labelled material contained perlecan. Further analysis by binding studies revealed specific and saturable binding of 125I-transthyretin to perlecan-enriched Matrigel. Because inhibition of sulphation by treating HepG2 cells with sodium chlorate increased the affinity of the perlecan for transthyretin, and [3H]heparin was not retained by the transthyretin affinity column, the binding is probably mediated by the core protein and is not a protein-glycosaminoglycan interaction. Because perlecan is released from transthyretin in water, the binding might be due to hydrophobic interactions. PMID:9307034

Isolation and preliminary characterization of a Cd-binding protein from Tenebrio molitor (Coleoptera).

PubMed

Pedersen, S A; Kristiansen, E; Andersen, R A; Zachariassen, K E

2007-04-01

The effect of cadmium (Cd) exposure on Cd-binding ligands was investigated for the first time in a beetle (Coleoptera), using the mealworm Tenebrio molitor (L) as a model species. Exposure to Cd resulted in an approximate doubling of the Cd-binding capacity of the protein extracts from whole animals. Analysis showed that the increase was mainly explained by the induction of a Cd-binding protein of 7134.5 Da, with non-metallothionein characteristics. Amino acid analysis and de novo sequencing revealed that the protein has an unusually high content of the acidic amino acids aspartic and glutamic acid that may explain how this protein can bind Cd even without cysteine residues. Similarities in the amino acid composition suggest it to belong to a group of little studied proteins often referred to as "Cd-binding proteins without high cysteine content". This is the first report on isolation and peptide sequence determination of such a protein from a coleopteran.

Biophysical characterization of OprB, a glucose-inducible porin of Pseudomonas aeruginosa.

PubMed

Wylie, J L; Bernegger-Egli, C; O'Neil, J D; Worobec, E A

1993-10-01

OprB, a glucose-inducible porin of P. aeruginosa, was characterized by black lipid bilayer analysis and circular dichroism spectroscopy. Black lipid bilayer analysis of OprB revealed a single-channel conductance of 25 pS, the presence of a glucose binding site with a Ks for glucose of 380 +/- 40 mM, and the formation of channels with a strong selection for anions. Analysis of P. aeruginosa OprB circular dichroism spectra revealed a high beta sheet content (40%) which is within the range of that determined for other porins. Values obtained from black lipid bilayer analysis were compared to those previously obtained for OprB of P. putida [Saravolac et al. (1991). J. Bacteriol. 173, 4970-4976] and indicated extensive similarities in the single-channel conductance and glucose-binding properties of these two porins. Immunological and amino terminal sequence analysis revealed a high degree of homology. Of the first 14 amino terminal residues, 12 were identical. A major difference between the two porins was found in their ion selectivity. Whereas P. aeruginosa OprB is anion selective, P. putida OprB and other carbohydrate selective porins are known to be cation selective.

A viral suppressor of RNA silencing inhibits ARGONAUTE 1 function by precluding target RNA binding to pre-assembled RISC

PubMed Central

Kenesi, Erzsébet; Lózsa, Rita

2017-01-01

Abstract In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. PMID:28499009

Comparing anterior and posterior Hox complex formation reveals guidelines for predicting cis-regulatory elements

PubMed Central

Uhl, Juli D.; Cook, Tiffany A.; Gebelein, Brian

2010-01-01

Hox transcription factors specify numerous cell fates along the anterior-posterior axis by regulating the expression of downstream target genes. While expression analysis has uncovered large numbers of de-regulated genes in cells with altered Hox activity, determining which are direct versus indirect targets has remained a significant challenge. Here, we characterize the DNA binding activity of Hox transcription factor complexes on eight experimentally verified cis-regulatory elements. Hox factors regulate the activity of each element by forming protein complexes with two cofactor proteins, Extradenticle (Exd) and Homothorax (Hth). Using comparative DNA binding assays, we found that a number of flexible arrangements of Hox, Exd, and Hth binding sites mediate cooperative transcription factor complexes. Moreover, analysis of a Distal-less regulatory element (DMXR) that is repressed by abdominal Hox factors revealed that suboptimal binding sites can be combined to form high affinity transcription complexes. Lastly, we determined that the anterior Hox factors are more dependent upon Exd and Hth for complex formation than posterior Hox factors. Based upon these findings, we suggest a general set of guidelines to serve as a basis for designing bioinformatics algorithms aimed at identifying Hox regulatory elements using the wealth of recently sequenced genomes. PMID:20398649

Characterizing informative sequence descriptors and predicting binding affinities of heterodimeric protein complexes.

PubMed

Srinivasulu, Yerukala Sathipati; Wang, Jyun-Rong; Hsu, Kai-Ti; Tsai, Ming-Ju; Charoenkwan, Phasit; Huang, Wen-Lin; Huang, Hui-Ling; Ho, Shinn-Ying

2015-01-01

Protein-protein interactions (PPIs) are involved in various biological processes, and underlying mechanism of the interactions plays a crucial role in therapeutics and protein engineering. Most machine learning approaches have been developed for predicting the binding affinity of protein-protein complexes based on structure and functional information. This work aims to predict the binding affinity of heterodimeric protein complexes from sequences only. This work proposes a support vector machine (SVM) based binding affinity classifier, called SVM-BAC, to classify heterodimeric protein complexes based on the prediction of their binding affinity. SVM-BAC identified 14 of 580 sequence descriptors (physicochemical, energetic and conformational properties of the 20 amino acids) to classify 216 heterodimeric protein complexes into low and high binding affinity. SVM-BAC yielded the training accuracy, sensitivity, specificity, AUC and test accuracy of 85.80%, 0.89, 0.83, 0.86 and 83.33%, respectively, better than existing machine learning algorithms. The 14 features and support vector regression were further used to estimate the binding affinities (Pkd) of 200 heterodimeric protein complexes. Prediction performance of a Jackknife test was the correlation coefficient of 0.34 and mean absolute error of 1.4. We further analyze three informative physicochemical properties according to their contribution to prediction performance. Results reveal that the following properties are effective in predicting the binding affinity of heterodimeric protein complexes: apparent partition energy based on buried molar fractions, relations between chemical structure and biological activity in principal component analysis IV, and normalized frequency of beta turn. The proposed sequence-based prediction method SVM-BAC uses an optimal feature selection method to identify 14 informative features to classify and predict binding affinity of heterodimeric protein complexes. The characterization analysis revealed that the average numbers of beta turns and hydrogen bonds at protein-protein interfaces in high binding affinity complexes are more than those in low binding affinity complexes.

Characterizing informative sequence descriptors and predicting binding affinities of heterodimeric protein complexes

PubMed Central

2015-01-01

Background Protein-protein interactions (PPIs) are involved in various biological processes, and underlying mechanism of the interactions plays a crucial role in therapeutics and protein engineering. Most machine learning approaches have been developed for predicting the binding affinity of protein-protein complexes based on structure and functional information. This work aims to predict the binding affinity of heterodimeric protein complexes from sequences only. Results This work proposes a support vector machine (SVM) based binding affinity classifier, called SVM-BAC, to classify heterodimeric protein complexes based on the prediction of their binding affinity. SVM-BAC identified 14 of 580 sequence descriptors (physicochemical, energetic and conformational properties of the 20 amino acids) to classify 216 heterodimeric protein complexes into low and high binding affinity. SVM-BAC yielded the training accuracy, sensitivity, specificity, AUC and test accuracy of 85.80%, 0.89, 0.83, 0.86 and 83.33%, respectively, better than existing machine learning algorithms. The 14 features and support vector regression were further used to estimate the binding affinities (Pkd) of 200 heterodimeric protein complexes. Prediction performance of a Jackknife test was the correlation coefficient of 0.34 and mean absolute error of 1.4. We further analyze three informative physicochemical properties according to their contribution to prediction performance. Results reveal that the following properties are effective in predicting the binding affinity of heterodimeric protein complexes: apparent partition energy based on buried molar fractions, relations between chemical structure and biological activity in principal component analysis IV, and normalized frequency of beta turn. Conclusions The proposed sequence-based prediction method SVM-BAC uses an optimal feature selection method to identify 14 informative features to classify and predict binding affinity of heterodimeric protein complexes. The characterization analysis revealed that the average numbers of beta turns and hydrogen bonds at protein-protein interfaces in high binding affinity complexes are more than those in low binding affinity complexes. PMID:26681483

Progesterone receptor membrane component-1 (PGRMC1) is the mediator of progesterone's antiapoptotic action in spontaneously immortalized granulosa cells as revealed by PGRMC1 small interfering ribonucleic acid treatment and functional analysis of PGRMC1 mutations.

PubMed

Peluso, John J; Romak, Jonathan; Liu, Xiufang

2008-02-01

Progesterone (P4) receptor membrane component-1 (PGRMC1) and its binding partner, plasminogen activator inhibitor 1 RNA binding protein (PAIRBP1) are thought to form a complex that functions as membrane receptor for P4. The present investigations confirm PGRMC1's role in this membrane receptor complex by demonstrating that depleting PGMRC1 with PGRMC1 small interfering RNA results in a 60% decline in [(3)H]P4 binding and the loss of P4's antiapoptotic action. Studies conducted on partially purified GFP-PGRMC1 fusion protein indicate that [(3)H]P4 specifically binds to PGRMC1 at a single site with an apparent K(d) of about 35 nm. In addition, experiments using various deletion mutations reveal that the entire PGRMC1 molecule is required for maximal [(3)H]P4 binding and P4 responsiveness. Analysis of the binding data also suggests that the P4 binding site is within a segment of PGRMC1 that is composed of the transmembrane domain and the initial segment of the C terminus. Interestingly, PAIRBP1 appears to bind to the C terminus between amino acids 70-130, which is distal to the putative P4 binding site. Taken together, these data provide compelling evidence that PGRMC1 is the P4 binding protein that mediates P4's antiapoptotic action. Moreover, the deletion mutation studies indicate that each domain of PGRMC1 plays an essential role in modulating PGRMC1's capacity to both bind and respond to P4. Additional studies are required to more precisely delineate the role of each PGRMC1 domain in transducing P4's antiapoptotic action.

Cu(I)-mediated Allosteric Switching in a Copper-sensing Operon Repressor (CsoR)*

PubMed Central

Chang, Feng-Ming James; Coyne, H. Jerome; Cubillas, Ciro; Vinuesa, Pablo; Fang, Xianyang; Ma, Zhen; Ma, Dejian; Helmann, John D.; García-de los Santos, Alejandro; Wang, Yun-Xing; Dann, Charles E.; Giedroc, David P.

2014-01-01

The copper-sensing operon repressor (CsoR) is representative of a major Cu(I)-sensing family of bacterial metalloregulatory proteins that has evolved to prevent cytoplasmic copper toxicity. It is unknown how Cu(I) binding to tetrameric CsoRs mediates transcriptional derepression of copper resistance genes. A phylogenetic analysis of 227 DUF156 protein members, including biochemically or structurally characterized CsoR/RcnR repressors, reveals that Geobacillus thermodenitrificans (Gt) CsoR characterized here is representative of CsoRs from pathogenic bacilli Listeria monocytogenes and Bacillus anthracis. The 2.56 Å structure of Cu(I)-bound Gt CsoR reveals that Cu(I) binding induces a kink in the α2-helix between two conserved copper-ligating residues and folds an N-terminal tail (residues 12–19) over the Cu(I) binding site. NMR studies of Gt CsoR reveal that this tail is flexible in the apo-state with these dynamics quenched upon Cu(I) binding. Small angle x-ray scattering experiments on an N-terminally truncated Gt CsoR (Δ2–10) reveal that the Cu(I)-bound tetramer is hydrodynamically more compact than is the apo-state. The implications of these findings for the allosteric mechanisms of other CsoR/RcnR repressors are discussed. PMID:24831014

Cloning and expression of a nuclear encoded plastid specific 33 kDa ribonucleoprotein gene (33RNP) from pea that is light stimulated.

PubMed

Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K

2001-01-24

We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.

Rational design and validation of a vanilloid-sensitive TRPV2 ion channel

PubMed Central

Yang, Fan; Vu, Simon; Yarov-Yarovoy, Vladimir; Zheng, Jie

2016-01-01

Vanilloids activation of TRPV1 represents an excellent model system of ligand-gated ion channels. Recent studies using cryo-electron microcopy (cryo-EM), computational analysis, and functional quantification revealed the location of capsaicin-binding site and critical residues mediating ligand-binding and channel activation. Based on these new findings, here we have successfully introduced high-affinity binding of capsaicin and resiniferatoxin to the vanilloid-insensitive TRPV2 channel, using a rationally designed minimal set of four point mutations (F467S–S498F–L505T–Q525E, termed TRPV2_Quad). We found that binding of resiniferatoxin activates TRPV2_Quad but the ligand-induced open state is relatively unstable, whereas binding of capsaicin to TRPV2_Quad antagonizes resiniferatoxin-induced activation likely through competition for the same binding sites. Using Rosetta-based molecular docking, we observed a common structural mechanism underlying vanilloids activation of TRPV1 and TRPV2_Quad, where the ligand serves as molecular “glue” that bridges the S4–S5 linker to the S1–S4 domain to open these channels. Our analysis revealed that capsaicin failed to activate TRPV2_Quad likely due to structural constraints preventing such bridge formation. These results not only validate our current working model for capsaicin activation of TRPV1 but also should help guide the design of drug candidate compounds for this important pain sensor. PMID:27298359

Network analysis reveals the recognition mechanism for complex formation of mannose-binding lectins

NASA Astrophysics Data System (ADS)

Jian, Yiren; Zhao, Yunjie; Zeng, Chen

The specific carbohydrate binding of lectin makes the protein a powerful molecular tool for various applications including cancer cell detection due to its glycoprotein profile on the cell surface. Most biologically active lectins are dimeric. To understand the structure-function relation of lectin complex, it is essential to elucidate the short- and long-range driving forces behind the dimer formation. Here we report our molecular dynamics simulations and associated dynamical network analysis on a particular lectin, i.e., the mannose-binding lectin from garlic. Our results, further supported by sequence coevolution analysis, shed light on how different parts of the complex communicate with each other. We propose a general framework for deciphering the recognition mechanism underlying protein-protein interactions that may have potential applications in signaling pathways.

A Structural Model for Binding of the Serine-Rich Repeat Adhesin GspB to Host Carbohydrate Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pyburn, Tasia M.; Bensing, Barbara A.; Xiong, Yan Q.

2014-10-02

GspB is a serine-rich repeat (SRR) adhesin of Streptococcus gordonii that mediates binding of this organism to human platelets via its interaction with sialyl-T antigen on the receptor GPIb{alpha}. This interaction appears to be a major virulence determinant in the pathogenesis of infective endocarditis. To address the mechanism by which GspB recognizes its carbohydrate ligand, we determined the high-resolution x-ray crystal structure of the GspB binding region (GspB{sub BR}), both alone and in complex with a disaccharide precursor to sialyl-T antigen. Analysis of the GspB{sub BR} structure revealed that it is comprised of three independently folded subdomains or modules: (1)more » an Ig-fold resembling a CnaA domain from prokaryotic pathogens; (2) a second Ig-fold resembling the binding region of mammalian Siglecs; (3) a subdomain of unique fold. The disaccharide was found to bind in a pocket within the Siglec subdomain, but at a site distinct from that observed in mammalian Siglecs. Confirming the biological relevance of this binding pocket, we produced three isogenic variants of S. gordonii, each containing a single point mutation of a residue lining this binding pocket. These variants have reduced binding to carbohydrates of GPIb{alpha}. Further examination of purified GspB{sub BR}-R484E showed reduced binding to sialyl-T antigen while S. gordonii harboring this mutation did not efficiently bind platelets and showed a significant reduction in virulence, as measured by an animal model of endocarditis. Analysis of other SRR proteins revealed that the predicted binding regions of these adhesins also had a modular organization, with those known to bind carbohydrate receptors having modules homologous to the Siglec and Unique subdomains of GspBBR. This suggests that the binding specificity of the SRR family of adhesins is determined by the type and organization of discrete modules within the binding domains, which may affect the tropism of organisms for different tissues.« less

Genome-Wide Binding Analysis of the Transcription Activator IDEAL PLANT ARCHITECTURE1 Reveals a Complex Network Regulating Rice Plant Architecture[W

PubMed Central

Lu, Zefu; Yu, Hong; Xiong, Guosheng; Wang, Jing; Jiao, Yongqing; Liu, Guifu; Jing, Yanhui; Meng, Xiangbing; Hu, Xingming; Qian, Qian; Fu, Xiangdong; Wang, Yonghong; Li, Jiayang

2013-01-01

IDEAL PLANT ARCHITECTURE1 (IPA1) is critical in regulating rice (Oryza sativa) plant architecture and substantially enhances grain yield. To elucidate its molecular basis, we first confirmed IPA1 as a functional transcription activator and then identified 1067 and 2185 genes associated with IPA1 binding sites in shoot apices and young panicles, respectively, through chromatin immunoprecipitation sequencing assays. The SQUAMOSA PROMOTER BINDING PROTEIN-box direct binding core motif GTAC was highly enriched in IPA1 binding peaks; interestingly, a previously uncharacterized indirect binding motif TGGGCC/T was found to be significantly enriched through the interaction of IPA1 with proliferating cell nuclear antigen PROMOTER BINDING FACTOR1 or PROMOTER BINDING FACTOR2. Genome-wide expression profiling by RNA sequencing revealed IPA1 roles in diverse pathways. Moreover, our results demonstrated that IPA1 could directly bind to the promoter of rice TEOSINTE BRANCHED1, a negative regulator of tiller bud outgrowth, to suppress rice tillering, and directly and positively regulate DENSE AND ERECT PANICLE1, an important gene regulating panicle architecture, to influence plant height and panicle length. The elucidation of target genes of IPA1 genome-wide will contribute to understanding the molecular mechanisms underlying plant architecture and to facilitating the breeding of elite varieties with ideal plant architecture. PMID:24170127

Comparative Genomic Analysis MERS CoV Isolated from Humans and Camels with Special Reference to Virus Encoded Helicase.

PubMed

Alnazawi, Mohamed; Altaher, Abdallah; Kandeel, Mahmoud

2017-01-01

Middle East Respiratory Syndrome Coronavirus (MERS CoV) is a new emerging viral disease characterized by high fatality rate. Understanding MERS CoV genetic aspects and codon usage pattern is important to understand MERS CoV survival, adaptation, evolution, resistance to innate immunity, and help in finding the unique aspects of the virus for future drug discovery experiments. In this work, we provide comprehensive analysis of 238 MERS CoV full genomes comprised of human (hMERS) and camel (cMERS) isolates of the virus. MERS CoV genome shaping seems to be under compositional and mutational bias, as revealed by preference of A/T over G/C nucleotides, preferred codons, nucleotides at the third position of codons (NT3s), relative synonymous codon usage, hydropathicity (Gravy), and aromaticity (Aromo) indices. Effective number of codons (ENc) analysis reveals a general slight codon usage bias. Codon adaptation index reveals incomplete adaptation to host environment. MERS CoV showed high ability to resist the innate immune response by showing lower CpG frequencies. Neutrality evolution analysis revealed a more significant role of mutation pressure in cMERS over hMERS. Correspondence analysis revealed that MERS CoV genomes have three genetic clusters, which were distinct in their codon usage, host, and geographic distribution. Additionally, virtual screening and binding experiments were able to identify three new virus-encoded helicase binding compounds. These compounds can be used for further optimization of inhibitors.

An integrated workflow for analysis of ChIP-chip data.

PubMed

Weigelt, Karin; Moehle, Christoph; Stempfl, Thomas; Weber, Bernhard; Langmann, Thomas

2008-08-01

Although ChIP-chip is a powerful tool for genome-wide discovery of transcription factor target genes, the steps involving raw data analysis, identification of promoters, and correlation with binding sites are still laborious processes. Therefore, we report an integrated workflow for the analysis of promoter tiling arrays with the Genomatix ChipInspector system. We compare this tool with open-source software packages to identify PU.1 regulated genes in mouse macrophages. Our results suggest that ChipInspector data analysis, comparative genomics for binding site prediction, and pathway/network modeling significantly facilitate and enhance whole-genome promoter profiling to reveal in vivo sites of transcription factor-DNA interactions.

Crystallography Coupled with Kinetic Analysis Provide Mechanistic Underpinnings of a Nicotine-Degrading Enzyme.

PubMed

Tararina, Margarita A; Xue, Song; Smith, Lauren C; Muellers, Samantha N; Miranda, Pedro O; Janda, Kim D; Allen, Karen N

2018-05-29

Nicotine oxidoreductase (NicA2) is a bacterial flavoenzyme, which catalyzes the first step of nicotine catabolism by oxidizing S-nicotine into N-methyl-myosmine. Its use has been proposed as a biotherapeutic for nicotine addiction due to its nanomolar substrate binding affinity. The first crystal structure of NicA2 has been reported, establishing NicA2 as a member of the monoamine oxidase (MAO) family. However, substrate specificity and structural determinants of substrate binding/catalysis have not been explored. Herein, analysis of pH-rate profile, single-turnover kinetics and binding data establish that pH does not significantly affect catalytic rate and product release is not rate limiting. The X-ray crystal structure of NicA2 with S-nicotine refined to 2.65 Å resolution reveals a hydrophobic binding site with a solvent exclusive cavity. Hydrophobic interactions predominantly orient the substrate, promoting the binding of a deprotonated species and supporting a hydride-transfer mechanism. Notably, NicA2 showed no activity against neurotransmitters oxidized by the two isoforms of human MAO. To further probe the substrate range of NicA2, enzyme activity was evaluated using a series of substrate analogs, indicating that S-nicotine is the optimal substrate and substitutions within the pyridyl ring abolish NicA2 activity. Moreover, mutagenesis and kinetic analysis of active-site residues reveal that removal of a hydrogen bond between the pyridyl ring of S-nicotine and the hydroxyl group of T381 has a 10-fold effect on KM, supporting the role of this bond in positioning the catalytically competent form of the substrate. Together, crystallography combined with kinetic analysis provide a deeper understanding of this enzyme's remarkable specificity.

Characterization of the Igf-II Binding Site of the IGF-II/MAN-6-P Receptor Extracellular Domain.

NASA Astrophysics Data System (ADS)

Garmroudi, Farideh

1995-01-01

In mammals, insulin-like growth factor II (IGF -II) and glycoproteins bearing the mannose 6-phosphate (Man -6-P) recognition marker bind with high affinity to the same receptor. The functional consequences of IGF-II binding to the receptor at the cell surface are not clear. In these studies, we sought to broaden our understanding of the functional regions of the receptor regarding its IGF -II binding site. The IGF-II binding/cross-linking domain of the IGF-II/Man-6-P receptor was mapped by sequencing receptor fragments covalently attached to IGF-II. Purified rat placental or bovine liver receptors were affinity-labeled, with ^{125}I-IGF-II and digested with endoproteinase Glu-C. Analysis of digests by gel electrophoresis revealed a major radiolabeled band of 18 kDa, which was purified by gel filtration chromatography followed by reverse-phase HPLC and electroblotting. Sequence analysis revealed that, the peptide S(H)VNSXPMF, located within extracellular repeat 10 and beginning with serine 1488 of the bovine receptor, was the best candidate for the IGF-II cross-linked peptide. These data indicated that residues within repeats 10-11 were important for IGF -II binding. To define the location of the IGF-II binding site further, a nested set of six human receptor cDNA constructs was designed to produce epitope-tagged fusion proteins encompassing the region between repeats 8 and 11 of the human IGF-II/Man-6-P receptor extracellular domain. These truncated receptors were transiently expressed in COS-7 cells, immunoprecipitated and analyzed for their abilities to bind and cross-link to IGF-II. All of the constructs were capable of binding/cross-linking to IGF-II, except for the 9.0-11 construct. Displacement curve analysis indicated that the truncated receptors were approximately equivalent in IGF-II binding affinity, but were of 5- to 10-fold lower affinity than full-length receptors. Sequencing of the 9.0-11 construct indicated the presence of a point mutation substituting threonine for isoleucine at position 1621, which is located in the N-terminal half of repeat 11, and was found to abrogate IGF-II binding. Collectively, our work indicates that repeat 11 of the IGF-II/Man-6-P receptor's extracellular domain encompasses the elements both for binding and cross-linking to IGF-II.

Image Restoration and Analysis of Influenza Virions Binding to Membrane Receptors Reveal Adhesion-Strengthening Kinetics

PubMed Central

Lee, Donald W.; Hsu, Hung-Lun; Bacon, Kaitlyn B.; Daniel, Susan

2016-01-01

With the development of single-particle tracking (SPT) microscopy and host membrane mimics called supported lipid bilayers (SLBs), stochastic virus-membrane binding interactions can be studied in depth while maintaining control over host receptor type and concentration. However, several experimental design challenges and quantitative image analysis limitations prevent the widespread use of this approach. One main challenge of SPT studies is the low signal-to-noise ratio of SPT videos, which is sometimes inevitable due to small particle sizes, low quantum yield of fluorescent dyes, and photobleaching. These situations could render current particle tracking software to yield biased binding kinetic data caused by intermittent tracking error. Hence, we developed an effective image restoration algorithm for SPT applications called STAWASP that reveals particles with a signal-to-noise ratio of 2.2 while preserving particle features. We tested our improvements to the SPT binding assay experiment and imaging procedures by monitoring X31 influenza virus binding to α2,3 sialic acid glycolipids. Our interests lie in how slight changes to the peripheral oligosaccharide structures can affect the binding rate and residence times of viruses. We were able to detect viruses binding weakly to a glycolipid called GM3, which was undetected via assays such as surface plasmon resonance. The binding rate was around 28 folds higher when the virus bound to a different glycolipid called GD1a, which has a sialic acid group extending further away from the bilayer surface than GM3. The improved imaging allowed us to obtain binding residence time distributions that reflect an adhesion-strengthening mechanism via multivalent bonds. We empirically fitted these distributions using a time-dependent unbinding rate parameter, koff, which diverges from standard treatment of koff as a constant. We further explain how to convert these models to fit ensemble-averaged binding data obtained by assays such as surface plasmon resonance. PMID:27695072

Mapping Argonaute and conventional RNA-binding protein interactions with RNA at single-nucleotide resolution using HITS-CLIP and CIMS analysis

PubMed Central

Moore, Michael; Zhang, Chaolin; Gantman, Emily Conn; Mele, Aldo; Darnell, Jennifer C.; Darnell, Robert B.

2014-01-01

Summary Identifying sites where RNA binding proteins (RNABPs) interact with target RNAs opens the door to understanding the vast complexity of RNA regulation. UV-crosslinking and immunoprecipitation (CLIP) is a transformative technology in which RNAs purified from in vivo cross-linked RNA-protein complexes are sequenced to reveal footprints of RNABP:RNA contacts. CLIP combined with high throughput sequencing (HITS-CLIP) is a generalizable strategy to produce transcriptome-wide RNA binding maps with higher accuracy and resolution than standard RNA immunoprecipitation (RIP) profiling or purely computational approaches. Applying CLIP to Argonaute proteins has expanded the utility of this approach to mapping binding sites for microRNAs and other small regulatory RNAs. Finally, recent advances in data analysis take advantage of crosslinked-induced mutation sites (CIMS) to refine RNA-binding maps to single-nucleotide resolution. Once IP conditions are established, HITS-CLIP takes approximately eight days to prepare RNA for sequencing. Established pipelines for data analysis, including for CIMS, take 3-4 days. PMID:24407355

Computational analysis of protein-protein interfaces involving an alpha helix: insights for terphenyl-like molecules binding.

PubMed

Isvoran, Adriana; Craciun, Dana; Martiny, Virginie; Sperandio, Olivier; Miteva, Maria A

2013-06-14

Protein-Protein Interactions (PPIs) are key for many cellular processes. The characterization of PPI interfaces and the prediction of putative ligand binding sites and hot spot residues are essential to design efficient small-molecule modulators of PPI. Terphenyl and its derivatives are small organic molecules known to mimic one face of protein-binding alpha-helical peptides. In this work we focus on several PPIs mediated by alpha-helical peptides. We performed computational sequence- and structure-based analyses in order to evaluate several key physicochemical and surface properties of proteins known to interact with alpha-helical peptides and/or terphenyl and its derivatives. Sequence-based analysis revealed low sequence identity between some of the analyzed proteins binding alpha-helical peptides. Structure-based analysis was performed to calculate the volume, the fractal dimension roughness and the hydrophobicity of the binding regions. Besides the overall hydrophobic character of the binding pockets, some specificities were detected. We showed that the hydrophobicity is not uniformly distributed in different alpha-helix binding pockets that can help to identify key hydrophobic hot spots. The presence of hydrophobic cavities at the protein surface with a more complex shape than the entire protein surface seems to be an important property related to the ability of proteins to bind alpha-helical peptides and low molecular weight mimetics. Characterization of similarities and specificities of PPI binding sites can be helpful for further development of small molecules targeting alpha-helix binding proteins.

Global Maps of ProQ Binding In Vivo Reveal Target Recognition via RNA Structure and Stability Control at mRNA 3' Ends.

PubMed

Holmqvist, Erik; Li, Lei; Bischler, Thorsten; Barquist, Lars; Vogel, Jörg

2018-05-15

The conserved RNA-binding protein ProQ has emerged as the centerpiece of a previously unknown third large network of post-transcriptional control in enterobacteria. Here, we have used in vivo UV crosslinking and RNA sequencing (CLIP-seq) to map hundreds of ProQ binding sites in Salmonella enterica and Escherichia coli. Our analysis of these binding sites, many of which are conserved, suggests that ProQ recognizes its cellular targets through RNA structural motifs found in small RNAs (sRNAs) and at the 3' end of mRNAs. Using the cspE mRNA as a model for 3' end targeting, we reveal a function for ProQ in protecting mRNA against exoribonucleolytic activity. Taken together, our results underpin the notion that ProQ governs a post-transcriptional network distinct from those of the well-characterized sRNA-binding proteins, CsrA and Hfq, and suggest a previously unrecognized, sRNA-independent role of ProQ in stabilizing mRNAs. Copyright © 2018 Elsevier Inc. All rights reserved.

Molecular modeling and docking studies of human 5-hydroxytryptamine 2A (5-HT2A) receptor for the identification of hotspots for ligand binding.

PubMed

Kanagarajadurai, Karuppiah; Malini, Manoharan; Bhattacharya, Aditi; Panicker, Mitradas M; Sowdhamini, Ramanathan

2009-12-01

The serotonergic system has been implicated in emotional and cognitive function. In particular, 5-HT(2A) (5-hydroxytrytamine receptor 2A) is attributed to a number of disorders like schizophrenia, depression, eating disorders and anxiety. 5-HT(2A), being a GPCR (G-protein coupled receptor), is important in the pharmaceutical industry as a proven target for these disorders. Despite their extensive clinical importance, the structural studies of this protein is lacking due to difficulties in determining its crystal structure. We have performed sequence analysis and molecular modeling of 5-HT(2A) that has revealed a set of conserved residues and motifs considered to play an important role in maintaining structural integrity and function of the receptor. The analysis also revealed a set of residues specific to the receptor which distinguishes them from other members of the subclass and their orthologs. Further, starting from the model structure of human 5-HT(2A) receptor, docking studies were attempted to envisage how it might interact with eight of its ligands (such as serotonin, dopamine, DOI, LSD, haloperidol, ketanserin, risperidone and clozapine). The binding studies of dopamine to 5-HT(2A) receptor can bring up better understanding in the etiology of a number of neurological disorders involving both these two receptors. Our sequence analysis and study of interactions of this receptor with other ligands reveal additional residue hotspots such as Asn 363 and Tyr 370. The function of these residues can be further analyzed by rational design of site-directed mutagenesis. Two distinct binding sites are identified which could play important roles in ligand binding and signaling.

Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

NASA Astrophysics Data System (ADS)

Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

2018-02-01

Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

NFI Transcription Factors Interact with FOXA1 to Regulate Prostate-Specific Gene Expression

PubMed Central

Elliott, Amicia D.; DeGraff, David J.; Anderson, Philip D.; Anumanthan, Govindaraj; Yamashita, Hironobu; Sun, Qian; Friedman, David B.; Hachey, David L.; Yu, Xiuping; Sheehan, Jonathan H.; Ahn, Jung-Mo; Raj, Ganesh V.; Piston, David W.; Gronostajski, Richard M.; Matusik, Robert J.

2014-01-01

Androgen receptor (AR) action throughout prostate development and in maintenance of the prostatic epithelium is partly controlled by interactions between AR and forkhead box (FOX) transcription factors, particularly FOXA1. We sought to identity additional FOXA1 binding partners that may mediate prostate-specific gene expression. Here we identify the nuclear factor I (NFI) family of transcription factors as novel FOXA1 binding proteins. All four family members (NFIA, NFIB, NFIC, and NFIX) can interact with FOXA1, and knockdown studies in androgen-dependent LNCaP cells determined that modulating expression of NFI family members results in changes in AR target gene expression. This effect is probably mediated by binding of NFI family members to AR target gene promoters, because chromatin immunoprecipitation (ChIP) studies found that NFIB bound to the prostate-specific antigen enhancer. Förster resonance energy transfer studies revealed that FOXA1 is capable of bringing AR and NFIX into proximity, indicating that FOXA1 facilitates the AR and NFI interaction by bridging the complex. To determine the extent to which NFI family members regulate AR/FOXA1 target genes, motif analysis of publicly available data for ChIP followed by sequencing was undertaken. This analysis revealed that 34.4% of peaks bound by AR and FOXA1 contain NFI binding sites. Validation of 8 of these peaks by ChIP revealed that NFI family members can bind 6 of these predicted genomic elements, and 4 of the 8 associated genes undergo gene expression changes as a result of individual NFI knockdown. These observations suggest that NFI regulation of FOXA1/AR action is a frequent event, with individual family members playing distinct roles in AR target gene expression. PMID:24801505

Cellular level models as tools for cytokine design.

PubMed

Radhakrishnan, Mala L; Tidor, Bruce

2010-01-01

Cytokines and growth factors are critical regulators that connect intracellular and extracellular environments through binding to specific cell-surface receptors. They regulate a wide variety of immunological, growth, and inflammatory response processes. The overall signal initiated by a population of cytokine molecules over long time periods is controlled by the subtle interplay of binding, signaling, and trafficking kinetics. Building on the work of others, we abstract a simple kinetic model that captures relevant features from cytokine systems as well as related growth factor systems. We explore a large range of potential biochemical behaviors, through systematic examination of the model's parameter space. Different rates for the same reaction topology lead to a dramatic range of biochemical network properties and outcomes. Evolution might productively explore varied and different portions of parameter space to create beneficial behaviors, and effective human therapeutic intervention might be achieved through altering network kinetic properties. Quantitative analysis of the results reveals the basis for tensions among a number of different network characteristics. For example, strong binding of cytokine to receptor can increase short-term receptor activation and signal initiation but decrease long-term signaling due to internalization and degradation. Further analysis reveals the role of specific biochemical processes in modulating such tensions. For instance, the kinetics of cytokine binding and receptor activation modulate whether ligand-receptor dissociation can generally occur before signal initiation or receptor internalization. Beyond analysis, the same models and model behaviors provide an important basis for the design of more potent cytokine therapeutics by providing insight into how binding kinetics affect ligand potency. (c) 2010 American Institute of Chemical Engineers

Specific strychnine binding sites on acrosome-associated membranes of golden hamster spermatozoa.

PubMed

Llanos, Miguel N; Ronco, Ana M; Aguirre, María C

2003-06-27

This study demonstrates for the first time, that membrane vesicles originated from the hamster sperm head after the occurrence of the acrosome reaction, possess specific strychnine binding sites. [3H]Strychnine binding was saturable and reversible, being displaced by unlabeled strychnine (IC(50)=26.7+/-2.3 microM). Kinetic analysis revealed one binding site with K(d)=120nM and B(max)=142fmol/10(6) spermatozoa. Glycine receptor agonists beta-alanine and taurine inhibited strychnine binding by 20-30%. Surprisingly, glycine stimulated binding by about 40-50%. Results obtained in this study strongly suggest the presence of glycine receptors-with distinctive kinetic properties on the periacrosomal plasma membrane of hamster spermatozoa. Localization of this receptor fits well with its previously proposed role in acrosomal exocytosis during mammalian fertilization.

Structural and Functional Analysis of the Human HDAC4 Catalytic Domain Reveals a Regulatory Structural Zinc-binding Domain*S⃞

PubMed Central

Bottomley, Matthew J.; Lo Surdo, Paola; Di Giovine, Paolo; Cirillo, Agostino; Scarpelli, Rita; Ferrigno, Federica; Jones, Philip; Neddermann, Petra; De Francesco, Raffaele; Steinkühler, Christian; Gallinari, Paola; Carfí, Andrea

2008-01-01

Histone deacetylases (HDACs) regulate chromatin status and gene expression, and their inhibition is of significant therapeutic interest. To date, no biological substrate for class IIa HDACs has been identified, and only low activity on acetylated lysines has been demonstrated. Here, we describe inhibitor-bound and inhibitor-free structures of the histone deacetylase-4 catalytic domain (HDAC4cd) and of an HDAC4cd active site mutant with enhanced enzymatic activity toward acetylated lysines. The structures presented, coupled with activity data, provide the molecular basis for the intrinsically low enzymatic activity of class IIa HDACs toward acetylated lysines and reveal active site features that may guide the design of class-specific inhibitors. In addition, these structures reveal a conformationally flexible structural zinc-binding domain conserved in all class IIa enzymes. Importantly, either the mutation of residues coordinating the structural zinc ion or the binding of a class IIa selective inhibitor prevented the association of HDAC4 with the N-CoR·HDAC3 repressor complex. Together, these data suggest a key role of the structural zinc-binding domain in the regulation of class IIa HDAC functions. PMID:18614528

Structural and functional analysis of the human HDAC4 catalytic domain reveals a regulatory structural zinc-binding domain.

PubMed

Bottomley, Matthew J; Lo Surdo, Paola; Di Giovine, Paolo; Cirillo, Agostino; Scarpelli, Rita; Ferrigno, Federica; Jones, Philip; Neddermann, Petra; De Francesco, Raffaele; Steinkühler, Christian; Gallinari, Paola; Carfí, Andrea

2008-09-26

Histone deacetylases (HDACs) regulate chromatin status and gene expression, and their inhibition is of significant therapeutic interest. To date, no biological substrate for class IIa HDACs has been identified, and only low activity on acetylated lysines has been demonstrated. Here, we describe inhibitor-bound and inhibitor-free structures of the histone deacetylase-4 catalytic domain (HDAC4cd) and of an HDAC4cd active site mutant with enhanced enzymatic activity toward acetylated lysines. The structures presented, coupled with activity data, provide the molecular basis for the intrinsically low enzymatic activity of class IIa HDACs toward acetylated lysines and reveal active site features that may guide the design of class-specific inhibitors. In addition, these structures reveal a conformationally flexible structural zinc-binding domain conserved in all class IIa enzymes. Importantly, either the mutation of residues coordinating the structural zinc ion or the binding of a class IIa selective inhibitor prevented the association of HDAC4 with the N-CoR.HDAC3 repressor complex. Together, these data suggest a key role of the structural zinc-binding domain in the regulation of class IIa HDAC functions.

LeuT conformational sampling utilizing accelerated molecular dynamics and principal component analysis.

PubMed

Thomas, James R; Gedeon, Patrick C; Grant, Barry J; Madura, Jeffry D

2012-07-03

Monoamine transporters (MATs) function by coupling ion gradients to the transport of dopamine, norepinephrine, or serotonin. Despite their importance in regulating neurotransmission, the exact conformational mechanism by which MATs function remains elusive. To this end, we have performed seven 250 ns accelerated molecular dynamics simulations of the leucine transporter, a model for neurotransmitter MATs. By varying the presence of binding-pocket leucine substrate and sodium ions, we have sampled plausible conformational states representative of the substrate transport cycle. The resulting trajectories were analyzed using principal component analysis of transmembrane helices 1b and 6a. This analysis revealed seven unique structures: two of the obtained conformations are similar to the currently published crystallographic structures, one conformation is similar to a proposed open inward structure, and four conformations represent novel structures of potential importance to the transport cycle. Further analysis reveals that the presence of binding-pocket sodium ions is necessary to stabilize the locked-occluded and open-inward conformations. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Vibrational Softening of a Protein on Ligand Binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balog, Erica; Perahia, David; Smith, Jeremy C

2011-01-01

Neutron scattering experiments have demonstrated that binding of the cancer drug methotrexate softens the low-frequency vibrations of its target protein, dihydrofolate reductase (DHFR). Here, this softening is fully reproduced using atomic detail normal-mode analysis. Decomposition of the vibrational density of states demonstrates that the largest contributions arise from structural elements of DHFR critical to stability and function. Mode-projection analysis reveals an increase of the breathing-like character of the affected vibrational modes consistent with the experimentally observed increased adiabatic compressibility of the protein on complexation.

Discovery of high-affinity BCL6-binding peptide and its structure-activity relationship

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakamoto, Kotaro; Sogabe, Satoshi; Kamada, Yusuke

B cell lymphoma 6 (BCL6) is a transcriptional repressor that interacts with its corepressors BcoR and SMRT. Since this protein-protein interaction (PPI) induces activation and differentiation of B lymphocytes, BCL6 has been an attractive drug target for potential autoimmune disease treatments. Here we report a novel BCL6 inhibitory peptide, F1324 (Ac-LWYTDIRMSWRVP-OH), which we discovered using phage display technology; we also discuss this peptide's structure-activity relationship (SAR). For BCL6(5-129) binding, K{sub D} and IC{sub 50} values of F1324 were 0.57 nM and 1 nM according to the results of an SPR analysis and cell-free ELISA assay, respectively. In contrast, BcoR(Arg498-514Pro) and SMRT(Leu1422-Arg1438) exhibitedmore » relatively weak micromole-order binding to BCL6. Furthermore, Fusion protein AcGFP-F1324 transiently expressed in HEK293T cells inhibited intracellular PPI in cell-based M2H assay. By examination of the truncation and fragmentation of F1324, the C-terminal sequence WRVP, which is similar to the BcoR(509-512) sequence WVVP, was identified as being critical for BCL6 binding. In addition, subsequent single-crystal X-ray diffraction analysis of F1324/BCL6(5-129) complex revealed that the high affinity of F1324 was caused by effective interaction of its side chains while its main chain structure was similar to that of BcoR(Arg498-514Pro). To our knowledge, F1324 is the strongest BCL6-binding peptide yet reported. - Highlights: • F1324 was discovered as 5000-times higher affinity peptide to BCL6 than that of BcoR(R498-P514). • X-ray crystal structure analysis revealed the binding mode. • To our knowledge, F1324 is the strongest BCL6-binding and -inhibition peptide so far.« less

Anions mediate ligand binding in Adineta vaga glutamate receptor ion channels

PubMed Central

Lomash, Suvendu; Chittori, Sagar; Brown, Patrick; Mayer, Mark L.

2014-01-01

SUMMARY AvGluR1, a glutamate receptor ion channel from the primitive eukaryote Adineta vaga, is activated by alanine, cysteine, methionine and phenylalanine which produce lectin-sensitive desensitizing responses like those to glutamate, aspartate and serine. AvGluR1 LBD crystal structures reveal a novel scheme for binding dissimilar ligands that may be utilized by distantly related odorant/chemosensory receptors. Arginine residues in domain 2 coordinate the γ-carboxyl group of glutamate, while in the alanine, methionine and serine complexes a chloride ion acts as a surrogate ligand, replacing the γ-carboxyl group. Removal of Cl− lowers affinity for these ligands, but not for glutamate, aspartate or for phenylalanine which occludes the anion binding site and binds with low affinity. AvGluR1 LBD crystal structures and sedimentation analysis also provide insights into the evolutionary link between prokaryotic and eukaryotic iGluRs and reveal features unique to both classes, emphasizing the need for additional structure based studies on iGluR-ligand interactions. PMID:23434404

Myeloid leukemia factor 1 associates with a novel heterogeneous nuclear ribonucleoprotein U-like molecule.

PubMed

Winteringham, Louise N; Endersby, Raelene; Kobelke, Simon; McCulloch, Ross K; Williams, James H; Stillitano, Justin; Cornwall, Scott M; Ingley, Evan; Klinken, S Peter

2006-12-15

Myeloid leukemia factor 1 (MLF1) is an oncoprotein associated with hemopoietic lineage commitment and acute myeloid leukemia. Here we show that Mlf1 associated with a novel binding partner, Mlf1-associated nuclear protein (Manp), a new heterogeneous nuclear ribonucleoprotein (hnRNP) family member, related to hnRNP-U. Manp localized exclusively in the nucleus and could redirect Mlf1 from the cytoplasm into the nucleus. The nuclear content of Mlf1 was also regulated by 14-3-3 binding to a canonical 14-3-3 binding motif within the N terminus of Mlf1. Significantly Mlf1 contains a functional nuclear export signal and localized primarily to the nuclei of hemopoietic cells. Mlf1 was capable of binding DNA, and microarray analysis revealed that it affected the expression of several genes, including transcription factors. In summary, this study reveals that Mlf1 translocates between nucleus and cytoplasm, associates with a novel hnRNP, and influences gene expression.

Examining the neural correlates of active and passive forms of verbal-spatial binding in working memory.

PubMed

Grot, Stéphanie; Leclerc, Marie-Eve; Luck, David

2018-05-23

We designed an fMRI study to pinpoint the neural correlates of active and passive binding in working memory. Participants were instructed to memorize three words and three spatial locations. In the passive binding condition, words and spatial locations were directly presented as bound. Conversely, in the active binding condition, words and spatial locations were presented as separated, and participants were directed to intentionally create associations between them. Our results showed that participants performed better on passive binding relative to active binding. FMRI analysis revealed that both binding conditions induced greater activity within the hippocampus. Additionally, our analyses divulged regions specifically engaged in passive and active binding. Altogether, these data allow us to propose the hippocampus as a central candidate for working memory binding. When needed, a frontal-parietal network can contribute to the rearrangement of information. These findings may inform theories of working memory binding. Copyright © 2018. Published by Elsevier B.V.

Complementation analysis of mutants of nitric oxide synthase reveals that the active site requires two hemes.

PubMed Central

Xie, Q W; Leung, M; Fuortes, M; Sassa, S; Nathan, C

1996-01-01

For catalytic activity, nitric oxide synthases (NOSs) must be dimeric. Previous work revealed that the requirements for stable dimerization included binding of tetrahydrobiopterin (BH4), arginine, and heme. Here we asked what function is served by dimerization. We assessed the ability of individually inactive mutants of mouse inducible NOS (iNOS; NOS2), each deficient in binding a particular cofactor or cosubstrate, to complement each other by generating NO upon cotransfection into human epithelial cells. The ability of the mutants to homodimerize was gauged by gel filtration and/or PAGE under partially denaturing conditions, both followed by immunoblot. Their ability to heterodimerize was assessed by coimmunoprecipitation. Heterodimers that contained only one COOH-terminal hemimer and only one BH4-binding site could both form and function, even though the NADPH-, FAD-, and FMN-binding domains (in the COOH-terminal hemimer) and the BH4-binding sites (in the NH2-terminal hemimer) were contributed by opposite chains. Heterodimers that contained only one heme-binding site (Cys-194) could also form, either in cis or in trans to the nucleotide-binding domains. However, for NO production, both chains had to bind heme. Thus, NO production by iNOS requires dimerization because the active site requires two hemes. Images Fig. 2 Fig. 3 Fig. 4 Fig. 7 PMID:8643499

Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

PubMed

Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

1991-11-01

The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

Conformational change of Sos-derived proline-rich peptide upon binding Grb2 N-terminal SH3 domain probed by NMR

NASA Astrophysics Data System (ADS)

Ogura, Kenji; Okamura, Hideyasu

2013-10-01

Growth factor receptor-bound protein 2 (Grb2) is a small adapter protein composed of a single SH2 domain flanked by two SH3 domains. The N-terminal SH3 (nSH3) domain of Grb2 binds a proline-rich region present in the guanine nucleotide releasing factor, son of sevenless (Sos). Using NMR relaxation dispersion and chemical shift analysis methods, we investigated the conformational change of the Sos-derived proline-rich peptide during the transition between the free and Grb2 nSH3-bound states. The chemical shift analysis revealed that the peptide does not present a fully random conformation but has a relatively rigid structure. The relaxation dispersion analysis detected conformational exchange of several residues of the peptide upon binding to Grb2 nSH3.

Three-dimensional (3D) structure prediction and function analysis of the chitin-binding domain 3 protein HD73_3189 from Bacillus thuringiensis HD73.

PubMed

Zhan, Yiling; Guo, Shuyuan

2015-01-01

Bacillus thuringiensis (Bt) is capable of producing a chitin-binding protein believed to be functionally important to bacteria during the stationary phase of its growth cycle. In this paper, the chitin-binding domain 3 protein HD73_3189 from B. thuringiensis has been analyzed by computer technology. Primary and secondary structural analyses demonstrated that HD73_3189 is negatively charged and contains several α-helices, aperiodical coils and β-strands. Domain and motif analyses revealed that HD73_3189 contains a signal peptide, an N-terminal chitin binding 3 domains, two copies of a fibronectin-like domain 3 and a C-terminal carbohydrate binding domain classified as CBM_5_12. Moreover, analysis predicted the protein's associated localization site to be the cell wall. Ligand site prediction determined that amino acid residues GLU-312, TRP-334, ILE-341 and VAL-382 exposed on the surface of the target protein exhibit polar interactions with the substrate.

Curated collection of yeast transcription factor DNA binding specificity data reveals novel structural and gene regulatory insights

PubMed Central

2011-01-01

Background Transcription factors (TFs) play a central role in regulating gene expression by interacting with cis-regulatory DNA elements associated with their target genes. Recent surveys have examined the DNA binding specificities of most Saccharomyces cerevisiae TFs, but a comprehensive evaluation of their data has been lacking. Results We analyzed in vitro and in vivo TF-DNA binding data reported in previous large-scale studies to generate a comprehensive, curated resource of DNA binding specificity data for all characterized S. cerevisiae TFs. Our collection comprises DNA binding site motifs and comprehensive in vitro DNA binding specificity data for all possible 8-bp sequences. Investigation of the DNA binding specificities within the basic leucine zipper (bZIP) and VHT1 regulator (VHR) TF families revealed unexpected plasticity in TF-DNA recognition: intriguingly, the VHR TFs, newly characterized by protein binding microarrays in this study, recognize bZIP-like DNA motifs, while the bZIP TF Hac1 recognizes a motif highly similar to the canonical E-box motif of basic helix-loop-helix (bHLH) TFs. We identified several TFs with distinct primary and secondary motifs, which might be associated with different regulatory functions. Finally, integrated analysis of in vivo TF binding data with protein binding microarray data lends further support for indirect DNA binding in vivo by sequence-specific TFs. Conclusions The comprehensive data in this curated collection allow for more accurate analyses of regulatory TF-DNA interactions, in-depth structural studies of TF-DNA specificity determinants, and future experimental investigations of the TFs' predicted target genes and regulatory roles. PMID:22189060

Chimeric Plant Calcium/Calmodulin-Dependent Protein Kinase Gene with a Neural Visinin-Like Calcium-Binding Domain

NASA Technical Reports Server (NTRS)

Patil, Shameekumar; Takezawa, D.; Poovaiah, B. W.

1995-01-01

Calcium, a universal second messenger, regulates diverse cellular processes in eukaryotes. Ca-2(+) and Ca-2(+)/calmodulin-regulated protein phosphorylation play a pivotal role in amplifying and diversifying the action of Ca-2(+)- mediated signals. A chimeric Ca-2(+)/calmodulin-dependent protein kinase (CCaMK) gene with a visinin-like Ca-2(+)- binding domain was cloned and characterized from lily. The cDNA clone contains an open reading frame coding for a protein of 520 amino acids. The predicted structure of CCaMK contains a catalytic domain followed by two regulatory domains, a calmodulin-binding domain and a visinin-like Ca-2(+)-binding domain. The amino-terminal region of CCaMK contains all 11 conserved subdomains characteristic of serine/threonine protein kinases. The calmodulin-binding region of CCaMK has high homology (79%) to alpha subunit of mammalian Ca-2(+)/calmodulin-dependent protein kinase. The calmodulin-binding region is fused to a neural visinin-like domain that contains three Ca-2(+)-binding EF-hand motifs and a biotin-binding site. The Escherichia coli-expressed protein (approx. 56 kDa) binds calmodulin in a Ca-2(+)-dependent manner. Furthermore, Ca-45-binding assays revealed that CCaMK directly binds Ca-2(+). The CCaMK gene is preferentially expressed in developing anthers. Southern blot analysis revealed that CCaMK is encoded by a single gene. The structural features of the gene suggest that it has multiple regulatory controls and could play a unique role in Ca-2(+) signaling in plants.

Demonstration of a specific C3a receptor on guinea pig platelets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fukuoka, Y.; Hugli, T.E.

1988-05-15

Guinea pig platelets reportedly contain receptors specific for the anaphylatoxin C3a based on both ligand-binding studies and functional responses. A portion of the human 125I-C3a that binds to guinea pig platelets is competitively displaced by excess unlabeled C3a; however, the majority of ligand uptake was nonspecific. Uptake of 125I-C3a by guinea pig platelets is maximal in 1 min, and stimulation of guinea pig platelets by thrombin, ADP, or the Ca2+ ionophore A23187 showed little influence on binding of the ligand. Scatchard analysis indicated that approximately 1200 binding sites for C3a exist per cell with an estimated Kd of 8 xmore » 10(-10) M. Human C3a des Arg also binds to guinea pig platelets, but Scatchard analysis indicated that no specific binding occurred. Because the ligand-binding studies were complicated by high levels of nonspecific uptake, we attempted to chemically cross-link the C3a molecule to a specific component on the platelet surface. Cross-linkage of 125I-C3a to guinea pig platelets with bis(sulfosuccinimidyl)suberate revealed radioactive complexes at 105,000 and 115,000 m.w. on SDS-PAGE gels by autoradiographic analysis. In the presence of excess unlabeled C3a, complex formation was inhibited. No cross-linkage could be demonstrated between the inactive 125I-C3a des Arg and the putative C3a-R on guinea pig platelets. Human C3a, but not C3a des Arg induces serotonin release and aggregation of the guinea pig platelets. Human C3a was unable to induce either serotonin release or promote aggregation of human platelets. Uptake of human 125I-C3a by human platelets was not saturable, and Scatchard analysis was inconclusive. Attempts to cross-link 125I-C3a to components on the surface of human platelets also failed to reveal a ligand-receptor complex. Therefore, we conclude that guinea pig platelets have specific surface receptors to C3a and that human platelets appear devoid of receptors to the anaphylatoxin.« less

Binding Sites Analyser (BiSA): Software for Genomic Binding Sites Archiving and Overlap Analysis

PubMed Central

Khushi, Matloob; Liddle, Christopher; Clarke, Christine L.; Graham, J. Dinny

2014-01-01

Genome-wide mapping of transcription factor binding and histone modification reveals complex patterns of interactions. Identifying overlaps in binding patterns by different factors is a major objective of genomic studies, but existing methods to archive large numbers of datasets in a personalised database lack sophistication and utility. Therefore we have developed transcription factor DNA binding site analyser software (BiSA), for archiving of binding regions and easy identification of overlap with or proximity to other regions of interest. Analysis results can be restricted by chromosome or base pair overlap between regions or maximum distance between binding peaks. BiSA is capable of reporting overlapping regions that share common base pairs; regions that are nearby; regions that are not overlapping; and average region sizes. BiSA can identify genes located near binding regions of interest, genomic features near a gene or locus of interest and statistical significance of overlapping regions can also be reported. Overlapping results can be visualized as Venn diagrams. A major strength of BiSA is that it is supported by a comprehensive database of publicly available transcription factor binding sites and histone modifications, which can be directly compared to user data. The documentation and source code are available on http://bisa.sourceforge.net PMID:24533055

Evaluating the binding efficiency of pheromone binding protein with its natural ligand using molecular docking and fluorescence analysis

NASA Astrophysics Data System (ADS)

Ilayaraja, Renganathan; Rajkumar, Ramalingam; Rajesh, Durairaj; Muralidharan, Arumugam Ramachandran; Padmanabhan, Parasuraman; Archunan, Govindaraju

2014-06-01

Chemosignals play a crucial role in social and sexual communication among inter- and intra-species. Chemical cues are bound with protein that is present in the pheromones irrespective of sex are commonly called as pheromone binding protein (PBP). In rats, the pheromone compounds are bound with low molecular lipocalin protein α2u-globulin (α2u). We reported farnesol is a natural endogenous ligand (compound) present in rat preputial gland as a bound volatile compound. In the present study, an attempt has been made through computational method to evaluating the binding efficiency of α2u with the natural ligand (farnesol) and standard fluorescent molecule (2-naphthol). The docking analysis revealed that the binding energy of farnesol and 2-naphthol was almost equal and likely to share some binding pocket of protein. Further, to extrapolate the results generated through computational approach, the α2u protein was purified and subjected to fluorescence titration and binding assay. The results showed that the farnesol is replaced by 2-naphthol with high hydrophobicity of TYR120 in binding sites of α2u providing an acceptable dissociation constant indicating the binding efficiency of α2u. The obtained results are in corroboration with the data made through computational approach.

MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

PubMed

Ozaki, Haruka; Iwasaki, Wataru

2016-08-01

As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Transcriptional Network Analysis in Muscle Reveals AP-1 as a Partner of PGC-1α in the Regulation of the Hypoxic Gene Program

PubMed Central

Baresic, Mario; Salatino, Silvia; Kupr, Barbara

2014-01-01

Skeletal muscle tissue shows an extraordinary cellular plasticity, but the underlying molecular mechanisms are still poorly understood. Here, we use a combination of experimental and computational approaches to unravel the complex transcriptional network of muscle cell plasticity centered on the peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α), a regulatory nexus in endurance training adaptation. By integrating data on genome-wide binding of PGC-1α and gene expression upon PGC-1α overexpression with comprehensive computational prediction of transcription factor binding sites (TFBSs), we uncover a hitherto-underestimated number of transcription factor partners involved in mediating PGC-1α action. In particular, principal component analysis of TFBSs at PGC-1α binding regions predicts that, besides the well-known role of the estrogen-related receptor α (ERRα), the activator protein 1 complex (AP-1) plays a major role in regulating the PGC-1α-controlled gene program of the hypoxia response. Our findings thus reveal the complex transcriptional network of muscle cell plasticity controlled by PGC-1α. PMID:24912679

Structure of the Nucleoprotein Binding Domain of Mokola Virus Phosphoprotein▿

PubMed Central

Assenberg, René; Delmas, Olivier; Ren, Jingshan; Vidalain, Pierre-Olivier; Verma, Anil; Larrous, Florence; Graham, Stephen C.; Tangy, Frédéric; Grimes, Jonathan M.; Bourhy, Hervé

2010-01-01

Mokola virus (MOKV) is a nonsegmented, negative-sense RNA virus that belongs to the Lyssavirus genus and Rhabdoviridae family. MOKV phosphoprotein P is an essential component of the replication and transcription complex and acts as a cofactor for the viral RNA-dependent RNA polymerase. P recruits the viral polymerase to the nucleoprotein-bound viral RNA (N-RNA) via an interaction between its C-terminal domain and the N-RNA complex. Here we present a structure for this domain of MOKV P, obtained by expression of full-length P in Escherichia coli, which was subsequently truncated during crystallization. The structure has a high degree of homology with P of rabies virus, another member of Lyssavirus genus, and to a lesser degree with P of vesicular stomatitis virus (VSV), a member of the related Vesiculovirus genus. In addition, analysis of the crystal packing of this domain reveals a potential binding site for the nucleoprotein N. Using both site-directed mutagenesis and yeast two-hybrid experiments to measure P-N interaction, we have determined the relative roles of key amino acids involved in this interaction to map the region of P that binds N. This analysis also reveals a structural relationship between the N-RNA binding domain of the P proteins of the Rhabdoviridae and the Paramyxoviridae. PMID:19906936

A viral suppressor of RNA silencing inhibits ARGONAUTE 1 function by precluding target RNA binding to pre-assembled RISC.

PubMed

Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt

2017-07-27

In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Multimodal biopanning of T7 phage-displayed peptides reveals angiomotin as a potential receptor of the anti-angiogenic macrolide Roxithromycin.

PubMed

Takakusagi, Kaori; Takakusagi, Yoichi; Suzuki, Takahiro; Toizaki, Aya; Suzuki, Aiko; Kawakatsu, Yaichi; Watanabe, Madoka; Saito, Yukihiro; Fukuda, Ryushi; Nakazaki, Atsuo; Kobayashi, Susumu; Sakaguchi, Kengo; Sugawara, Fumio

2015-01-27

Roxithromycin (RXM) is a semi-synthetic fourteen-membered macrolide antibiotic that shows anti-angiogenic activity in solid tumors. In the present study, we conducted biopanning of T7 phage-displayed peptides either on a 96-well formatted microplate, a flow injection-type quartz-crystal microbalance (QCM) biosensor, or a cuvette-type QCM. RXM-selected peptides of different sequence, length and number were obtained from each mode of screening. Subsequent bioinformatics analysis of the RXM-selected peptides consistently gave positive scores for the extracellular domain (E458-T596) of angiomotin (Amot), indicating that this may comprise a binding region for RXM. Bead pull down assay and QCM analysis confirmed that RXM directly interacts with Amot via the screen-guided region, which also corresponds to the binding site for the endogenous anti-angiogenic inhibitor angiostatin (Anst). Thus, multimodal biopanning of T7PD revealed that RXM binds to the extracellular domain on Amot as a common binding site with Anst, leading to inhibition of angiogenesis-dependent tumor growth and metastasis. These data might explain the molecular basis underlying the mechanism of action for the anti-angiogenic activity of RXM. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Conservation of tubulin-binding sequences in TRPV1 throughout evolution.

PubMed

Sardar, Puspendu; Kumar, Abhishek; Bhandari, Anita; Goswami, Chandan

2012-01-01

Transient Receptor Potential Vanilloid sub type 1 (TRPV1), commonly known as capsaicin receptor can detect multiple stimuli ranging from noxious compounds, low pH, temperature as well as electromagnetic wave at different ranges. In addition, this receptor is involved in multiple physiological and sensory processes. Therefore, functions of TRPV1 have direct influences on adaptation and further evolution also. Availability of various eukaryotic genomic sequences in public domain facilitates us in studying the molecular evolution of TRPV1 protein and the respective conservation of certain domains, motifs and interacting regions that are functionally important. Using statistical and bioinformatics tools, our analysis reveals that TRPV1 has evolved about ∼420 million years ago (MYA). Our analysis reveals that specific regions, domains and motifs of TRPV1 has gone through different selection pressure and thus have different levels of conservation. We found that among all, TRP box is the most conserved and thus have functional significance. Our results also indicate that the tubulin binding sequences (TBS) have evolutionary significance as these stretch sequences are more conserved than many other essential regions of TRPV1. The overall distribution of positively charged residues within the TBS motifs is conserved throughout evolution. In silico analysis reveals that the TBS-1 and TBS-2 of TRPV1 can form helical structures and may play important role in TRPV1 function. Our analysis identifies the regions of TRPV1, which are important for structure-function relationship. This analysis indicates that tubulin binding sequence-1 (TBS-1) near the TRP-box forms a potential helix and the tubulin interactions with TRPV1 via TBS-1 have evolutionary significance. This interaction may be required for the proper channel function and regulation and may also have significance in the context of Taxol®-induced neuropathy.

A molecular dynamics investigation of CDK8/CycC and ligand binding: conformational flexibility and implication in drug discovery

NASA Astrophysics Data System (ADS)

Cholko, Timothy; Chen, Wei; Tang, Zhiye; Chang, Chia-en A.

2018-05-01

Abnormal activity of cyclin-dependent kinase 8 (CDK8) along with its partner protein cyclin C (CycC) is a common feature of many diseases including colorectal cancer. Using molecular dynamics (MD) simulations, this study determined the dynamics of the CDK8-CycC system and we obtained detailed breakdowns of binding energy contributions for four type-I and five type-II CDK8 inhibitors. We revealed system motions and conformational changes that will affect ligand binding, confirmed the essentialness of CycC for inclusion in future computational studies, and provide guidance in development of CDK8 binders. We employed unbiased all-atom MD simulations for 500 ns on twelve CDK8-CycC systems, including apoproteins and protein-ligand complexes, then performed principal component analysis (PCA) and measured the RMSF of key regions to identify protein dynamics. Binding pocket volume analysis identified conformational changes that accompany ligand binding. Next, H-bond analysis, residue-wise interaction calculations, and MM/PBSA were performed to characterize protein-ligand interactions and find the binding energy. We discovered that CycC is vital for maintaining a proper conformation of CDK8 to facilitate ligand binding and that the system exhibits motion that should be carefully considered in future computational work. Surprisingly, we found that motion of the activation loop did not affect ligand binding. Type-I and type-II ligand binding is driven by van der Waals interactions, but electrostatic energy and entropic penalties affect type-II binding as well. Binding of both ligand types affects protein flexibility. Based on this we provide suggestions for development of tighter-binding CDK8 inhibitors and offer insight that can aid future computational studies.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caberoy, Nora B.; Zhou, Yixiong; Alvarado, Gabriela

To efficiently elucidate the biological roles of phosphatidylserine (PS), we developed open-reading-frame (ORF) phage display to identify PS-binding proteins. The procedure of phage panning was optimized with a phage clone expressing MFG-E8, a well-known PS-binding protein. Three rounds of phage panning with ORF phage display cDNA library resulted in {approx}300-fold enrichment in PS-binding activity. A total of 17 PS-binding phage clones were identified. Unlike phage display with conventional cDNA libraries, all 17 PS-binding clones were ORFs encoding 13 real proteins. Sequence analysis revealed that all identified PS-specific phage clones had dimeric basic amino acid residues. GST fusion proteins were expressedmore » for 3 PS-binding proteins and verified for their binding activity to PS liposomes, but not phosphatidylcholine liposomes. These results elucidated previously unknown PS-binding proteins and demonstrated that ORF phage display is a versatile technology capable of efficiently identifying binding proteins for non-protein molecules like PS.« less

An insect-inspired model for visual binding II: functional analysis and visual attention.

PubMed

Northcutt, Brandon D; Higgins, Charles M

2017-04-01

We have developed a neural network model capable of performing visual binding inspired by neuronal circuitry in the optic glomeruli of flies: a brain area that lies just downstream of the optic lobes where early visual processing is performed. This visual binding model is able to detect objects in dynamic image sequences and bind together their respective characteristic visual features-such as color, motion, and orientation-by taking advantage of their common temporal fluctuations. Visual binding is represented in the form of an inhibitory weight matrix which learns over time which features originate from a given visual object. In the present work, we show that information represented implicitly in this weight matrix can be used to explicitly count the number of objects present in the visual image, to enumerate their specific visual characteristics, and even to create an enhanced image in which one particular object is emphasized over others, thus implementing a simple form of visual attention. Further, we present a detailed analysis which reveals the function and theoretical limitations of the visual binding network and in this context describe a novel network learning rule which is optimized for visual binding.

Characterization of the telomere complex, TERF1 and TERF2 genes in muntjac species with fusion karyotypes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hartmann, Nils; Scherthan, Harry

The telomere binding proteins TRF1 and TRF2 maintain and protect chromosome ends and confer karyotypic stability. Chromosome evolution in the genus Muntiacus is characterized by numerous tandem (end-to-end) fusions. To study TRF1 and TRF2 telomere binding proteins in Muntiacus species, we isolated and characterized the TERF1 and -2 genes from Indian muntjac (Muntiacus muntjak vaginalis; 2n = 6 female) and from Chinese muntjac (Muntiacus reveesi; 2n = 46). Expression analysis revealed that both genes are ubiquitously expressed and sequence analysis identified several transcript variants of both TERF genes. Control experiments disclosed a novel testis-specific splice variant of TERF1 in humanmore » testes. Amino acid sequence comparisons demonstrate that Muntiacus TRF1 and in particular TRF2 are highly conserved between muntjac and human. In vivo TRF2-GFP and immuno-staining studies in muntjac cell lines revealed telomeric TRF2 localization, while deletion of the DNA binding domain abrogated this localization, suggesting muntjac TRF2 represents a functional telomere protein. Finally, expression analysis of a set of telomere-related genes revealed their presence in muntjac fibroblasts and testis tissue, which suggests the presence of a conserved telomere complex in muntjacs. However, a deviation from the common theme was noted for the TERT gene, encoding the catalytic subunit of telomerase; TERT expression could not be detected in Indian or Chinese muntjac cDNA or genomic DNA using a series of conserved primers, while TRAP assay revealed functional telomerase in Chinese muntjac testis tissues. This suggests muntjacs may harbor a diverged telomerase sequence.« less

Analysis of Paracoccidioides secreted proteins reveals fructose 1,6-bisphosphate aldolase as a plasminogen-binding protein.

PubMed

Chaves, Edilânia Gomes Araújo; Weber, Simone Schneider; Báo, Sonia Nair; Pereira, Luiz Augusto; Bailão, Alexandre Melo; Borges, Clayton Luiz; Soares, Célia Maria de Almeida

2015-02-27

Despite being important thermal dimorphic fungi causing Paracoccidioidomycosis, the pathogenic mechanisms that underlie the genus Paracoccidioides remain largely unknown. Microbial pathogens express molecules that can interact with human plasminogen, a protein from blood plasma, which presents fibrinolytic activity when activated into plasmin. Additionally, plasmin exhibits the ability of degrading extracellular matrix components, favoring the pathogen spread to deeper tissues. Previous work from our group demonstrated that Paracoccidioides presents enolase, as a protein able to bind and activate plasminogen, increasing the fibrinolytic activity of the pathogen, and the potential for adhesion and invasion of the fungus to host cells. By using proteomic analysis, we aimed to identify other proteins of Paracoccidioides with the ability of binding to plasminogen. In the present study, we employed proteomic analysis of the secretome, in order to identify plasminogen-binding proteins of Paracoccidioides, Pb01. Fifteen proteins were present in the fungal secretome, presenting the ability to bind to plasminogen. Those proteins are probable targets of the fungus interaction with the host; thus, they could contribute to the invasiveness of the fungus. For validation tests, we selected the protein fructose 1,6-bisphosphate aldolase (FBA), described in other pathogens as a plasminogen-binding protein. The protein FBA at the fungus surface and the recombinant FBA (rFBA) bound human plasminogen and promoted its conversion to plasmin, potentially increasing the fibrinolytic capacity of the fungus, as demonstrated in fibrin degradation assays. The addition of rFBA or anti-rFBA antibodies was capable of reducing the interaction between macrophages and Paracoccidioides, possibly by blocking the binding sites for FBA. These data reveal the possible participation of the FBA in the processes of cell adhesion and tissue invasion/dissemination of Paracoccidioides. These data indicate that Paracoccidioides is a pathogen that has several plasminogen-binding proteins that likely play important roles in pathogen-host interaction. In this context, FBA is a protein that might be involved somehow in the processes of invasion and spread of the fungus during infection.

The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

PubMed

Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

2017-01-01

Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

Differential Dynamic Engagement within 24 SH3 Domain: Peptide Complexes Revealed by Co-Linear Chemical Shift Perturbation Analysis

PubMed Central

Stollar, Elliott J.; Lin, Hong; Davidson, Alan R.; Forman-Kay, Julie D.

2012-01-01

There is increasing evidence for the functional importance of multiple dynamically populated states within single proteins. However, peptide binding by protein-protein interaction domains, such as the SH3 domain, has generally been considered to involve the full engagement of peptide to the binding surface with minimal dynamics and simple methods to determine dynamics at the binding surface for multiple related complexes have not been described. We have used NMR spectroscopy combined with isothermal titration calorimetry to comprehensively examine the extent of engagement to the yeast Abp1p SH3 domain for 24 different peptides. Over one quarter of the domain residues display co-linear chemical shift perturbation (CCSP) behavior, in which the position of a given chemical shift in a complex is co-linear with the same chemical shift in the other complexes, providing evidence that each complex exists as a unique dynamic rapidly inter-converting ensemble. The extent the specificity determining sub-surface of AbpSH3 is engaged as judged by CCSP analysis correlates with structural and thermodynamic measurements as well as with functional data, revealing the basis for significant structural and functional diversity amongst the related complexes. Thus, CCSP analysis can distinguish peptide complexes that may appear identical in terms of general structure and percent peptide occupancy but have significant local binding differences across the interface, affecting their ability to transmit conformational change across the domain and resulting in functional differences. PMID:23251481

High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

PubMed Central

Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

2015-01-01

Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

Screening, Characterization and In Vitro Evaluation of Probiotic Properties Among Lactic Acid Bacteria Through Comparative Analysis.

PubMed

Devi, Sundru Manjulata; Archer, Ann Catherine; Halami, Prakash M

2015-09-01

The present work aimed to identify probiotic bacteria from healthy human infant faecal and dairy samples. Subsequently, an assay was developed to evaluate the probiotic properties using comparative genetic approach for marker genes involved in adhesion to the intestinal epithelial layer. Several in vitro properties including tolerance to biological barriers (such as acid and bile), antimicrobial spectrum, resistance to simulated digestive fluids and cellular hydrophobicity were assessed. The potential probiotic cultures were rapidly characterized by morphological, physiological and molecular-based methods [such as RFLP, ITS, RAPD and (GTG)5]. Further analysis by 16S rDNA sequencing revealed that the selected isolates belong to Lactobacillus, Pediococcus and Enterococcus species. Two cultures of non-lactic, non-pathogenic Staphylococcus spp. were also isolated. The native isolates were able to survive under acidic, bile and simulated intestinal conditions. In addition, these cultures inhibited the growth of tested bacterial pathogens. Further, no correlation was observed between hydrophobicity and adhesion ability. Sequencing of probiotic marker genes such as bile salt hydrolase (bsh), fibronectin-binding protein (fbp) and mucin-binding protein (mub) for selected isolates revealed nucleotide variation. The probiotic binding domains were detected by several bioinformatic tools. The approach used in the study enabled the identification of potential probiotic domains responsible for adhesion of bacteria to intestinal epithelial layer, which may further assist in screening of novel probiotic bacteria. The rapid detection of binding domains will help in revealing the beneficial properties of the probiotic cultures. Further, studies will be performed to develop a novel probiotic product which will contribute in food and feed industry.

The Bacterial Response Regulator ArcA Uses a Diverse Binding Site Architecture to Regulate Carbon Oxidation Globally

PubMed Central

Park, Dan M.; Akhtar, Md. Sohail; Ansari, Aseem Z.; Landick, Robert; Kiley, Patricia J.

2013-01-01

Despite the importance of maintaining redox homeostasis for cellular viability, how cells control redox balance globally is poorly understood. Here we provide new mechanistic insight into how the balance between reduced and oxidized electron carriers is regulated at the level of gene expression by mapping the regulon of the response regulator ArcA from Escherichia coli, which responds to the quinone/quinol redox couple via its membrane-bound sensor kinase, ArcB. Our genome-wide analysis reveals that ArcA reprograms metabolism under anaerobic conditions such that carbon oxidation pathways that recycle redox carriers via respiration are transcriptionally repressed by ArcA. We propose that this strategy favors use of catabolic pathways that recycle redox carriers via fermentation akin to lactate production in mammalian cells. Unexpectedly, bioinformatic analysis of the sequences bound by ArcA in ChIP-seq revealed that most ArcA binding sites contain additional direct repeat elements beyond the two required for binding an ArcA dimer. DNase I footprinting assays suggest that non-canonical arrangements of cis-regulatory modules dictate both the length and concentration-sensitive occupancy of DNA sites. We propose that this plasticity in ArcA binding site architecture provides both an efficient means of encoding binding sites for ArcA, σ70-RNAP and perhaps other transcription factors within the same narrow sequence space and an effective mechanism for global control of carbon metabolism to maintain redox homeostasis. PMID:24146625

An integrated computational approach of molecular dynamics simulations, receptor binding studies and pharmacophore mapping analysis in search of potent inhibitors against tuberculosis.

PubMed

Agarwal, Shivangi; Verma, Ekta; Kumar, Vivek; Lall, Namrita; Sau, Samaresh; Iyer, Arun K; Kashaw, Sushil K

2018-05-03

Tuberculosis is an infectious chronic disease caused by obligate pathogen Mycobacterium tuberculosis that affects millions of people worldwide. Although many first and second line drugs are available for its treatment, but their irrational use has adversely lead to the emerging cases of multiple drug resistant and extensively drug-resistant tuberculosis. Therefore, there is an intense need to develop novel potent analogues for its treatment. This has prompted us to develop potent analogues against TB. The Mycobacterium tuberculosis genome provides us with number of validated targets to combat against TB. Study of Mtb genome disclosed six epoxide hydrolases (A to F) which convert harmful epoxide into diols and act as a potential drug target for rational drug design. Our current strategy is to develop such analogues which inhibits epoxide hydrolase enzyme present in Mtb genome. To achieve this, we adopted an integrated computational approach involving QSAR, pharmacophore mapping, molecular docking and molecular dynamics simulation studies. The approach envisaged vital information about the role of molecular descriptors, essential pharmacophoric features and binding energy for compounds to bind into the active site of epoxide hydrolase. Molecular docking analysis revealed that analogues exhibited significant binding to Mtb epoxide hydrolase. Further, three docked complexes 2s, 37s and 15s with high, moderate and low docking scores respectively were selected for molecular dynamics simulation studies. RMSD analysis revealed that all complexes are stable with average RMSD below 2 Å throughout the 10 ns simulations. The B-factor analysis showed that the active site residues of epoxide hydrolase are flexible enough to interact with inhibitor. Moreover, to confirm the binding of these urea derivatives, MM-GBSA binding energy analysis were performed. The calculations showed that 37s has more binding affinity (ΔGtotal = -52.24 kcal/mol) towards epoxide hydrolase compared to 2s (ΔGtotal = -51.70 kcal/mol) and 15s (ΔGtotal = -49.97 kcal/mol). The structural features inferred in our study may provide the future directions to the scientists towards the discovery of new chemical entity exhibiting anti-TB property. Copyright © 2018 Elsevier Inc. All rights reserved.

Copper tolerance in Frankia sp. strain EuI1c involves surface binding and copper transport.

PubMed

Rehan, Medhat; Furnholm, Teal; Finethy, Ryan H; Chu, Feixia; El-Fadly, Gomaah; Tisa, Louis S

2014-09-01

Several Frankia strains have been shown to be copper-tolerant. The mechanism of their copper tolerance was investigated for Frankia sp. strain EuI1c. Copper binding was shown by binding studies. Unusual globular structures were observed on the surface of the bacterium. These globular structures were composed of aggregates containing many relatively smaller "leaf-like" structures. Scanning electron microscopy with energy-dispersive X-ray (SEM-EDAX) analysis of these structures indicated elevated copper and phosphate levels compared to the control cells. Fourier transform infrared spectroscopy (FTIR) analysis indicated an increase in extracellular phosphate on the cell surface of copper-stressed cells. Bioinformatics' analysis of the Frankia sp. strain EuI1c genome revealed five potential cop genes: copA, copZ, copC, copCD, and copD. Experiments with Frankia sp. strain EuI1c using qRT-PCR indicated an increase in messenger RNA (mRNA) levels of the five cop genes upon Cu(2+) stress. After 5 days of Cu(2+) stress, the copA, copZ, copC, copCD, and copD mRNA levels increased 25-, 8-, 18-, 18-, and 25-fold, respectively. The protein profile of Cu(2+)-stressed Frankia sp. strain EuI1c cells revealed the upregulation of a 36.7 kDa protein that was identified as FraEuI1c_1092 (sulfate-binding periplasmic transport protein). Homologues of this gene were only present in the genomes of the Cu(2+)-resistant Frankia strains (EuI1c, DC12, and CN3). These data indicate that copper tolerance by Frankia sp. strain EuI1c involved the binding of copper to the cell surface and transport proteins.

Structural Analysis on the Pathologic Mutant Glucocorticoid Receptor Ligand-Binding Domains.

PubMed

Hurt, Darrell E; Suzuki, Shigeru; Mayama, Takafumi; Charmandari, Evangelia; Kino, Tomoshige

2016-02-01

Glucocorticoid receptor (GR) gene mutations may cause familial or sporadic generalized glucocorticoid resistance syndrome. Most of the missense forms distribute in the ligand-binding domain and impair its ligand-binding activity and formation of the activation function (AF)-2 that binds LXXLL motif-containing coactivators. We performed molecular dynamics simulations to ligand-binding domain of pathologic GR mutants to reveal their structural defects. Several calculated parameters including interaction energy for dexamethasone or the LXXLL peptide indicate that destruction of ligand-binding pocket (LBP) is a primary character. Their LBP defects are driven primarily by loss/reduction of the electrostatic interaction formed by R611 and T739 of the receptor to dexamethasone and a subsequent conformational mismatch, which deacylcortivazol resolves with its large phenylpyrazole moiety and efficiently stimulates transcriptional activity of the mutant receptors with LBP defect. Reduced affinity of the LXXLL peptide to AF-2 is caused mainly by disruption of the electrostatic bonds to the noncore leucine residues of this peptide that determine the peptide's specificity to GR, as well as by reduced noncovalent interaction against core leucines and subsequent exposure of the AF-2 surface to solvent. The results reveal molecular defects of pathologic mutant receptors and provide important insights to the actions of wild-type GR.

Kinetic method for the large-scale analysis of the binding mechanism of histone deacetylase inhibitors.

PubMed

Meyners, Christian; Baud, Matthias G J; Fuchter, Matthew J; Meyer-Almes, Franz-Josef

2014-09-01

Performing kinetic studies on protein ligand interactions provides important information on complex formation and dissociation. Beside kinetic parameters such as association rates and residence times, kinetic experiments also reveal insights into reaction mechanisms. Exploiting intrinsic tryptophan fluorescence a parallelized high-throughput Förster resonance energy transfer (FRET)-based reporter displacement assay with very low protein consumption was developed to enable the large-scale kinetic characterization of the binding of ligands to recombinant human histone deacetylases (HDACs) and a bacterial histone deacetylase-like amidohydrolase (HDAH) from Bordetella/Alcaligenes. For the binding of trichostatin A (TSA), suberoylanilide hydroxamic acid (SAHA), and two other SAHA derivatives to HDAH, two different modes of action, simple one-step binding and a two-step mechanism comprising initial binding and induced fit, were verified. In contrast to HDAH, all compounds bound to human HDAC1, HDAC6, and HDAC8 through a two-step mechanism. A quantitative view on the inhibitor-HDAC systems revealed two types of interaction, fast binding and slow dissociation. We provide arguments for the thesis that the relationship between quantitative kinetic and mechanistic information and chemical structures of compounds will serve as a valuable tool for drug optimization. Copyright © 2014 Elsevier Inc. All rights reserved.

Spectroscopic profiling and computational study of the binding of tschimgine: A natural monoterpene derivative, with calf thymus DNA

NASA Astrophysics Data System (ADS)

Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad

2018-03-01

DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (Kb) between TMG and DNA was 2.27 × 104 M- 1, that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH < 0 and ΔS < 0) at different temperatures indicated that van der Waals forces and hydrogen bonds were involved in the binding process of TMG with CT-DNA. Competitive binding assay with methylene blue (MB) and Hoechst 33258 using fluorescence spectroscopy displayed that TMG possibly binds to the minor groove of CT-DNA. These observations were further confirmed by CD spectral analysis, viscosity measurements and molecular docking.

Cooperativity and complexity in the binding of anions and cations to a tetratopic ion-pair host.

PubMed

Howe, Ethan N W; Bhadbhade, Mohan; Thordarson, Pall

2014-05-21

Cooperative interactions play a very important role in both natural and synthetic supramolecular systems. We report here on the cooperative binding properties of a tetratopic ion-pair host 1. This host combines two isophthalamide anion recognition sites with two unusual "half-crown/two carbonyl" cation recognition sites as revealed by the combination of single-crystal X-ray analysis of the free host and the 1:2 host:calcium cation complex, together with two-dimensional NMR and computational studies. By systematically comparing all of the binding data to several possible binding models and focusing on four different variants of the 1:2 binding model, it was in most cases possible to quantify these complex cooperative interactions. The data showed strong negative cooperativity (α = 0.01-0.05) of 1 toward chloride and acetate anions, while for cations the results were more variable. Interestingly, in the competitive (CDCl3/CD3OD (9:1, v/v)) solvent, the addition of calcium cations to the tetratopic ion-pair host 1 allosterically switched "on" chloride binding that is otherwise not present in this solvent system. The insight into the complexity of cooperative interactions revealed in this study of the tetratopic ion-pair host 1 can be used to design better cooperative supramolecular systems for information transfer and catalysis.

Mutations in a CCHC zinc-binding motif of the reovirus sigma 3 protein decrease its intracellular stability.

PubMed Central

Mabrouk, T; Lemay, G

1994-01-01

It has been demonstrated that the sigma 3 protein of reovirus harbors a zinc-binding domain in its amino-terminal portion. A putative zinc finger in the CCHH form is located in this domain and was considered to be a good candidate for the zinc-binding motif. We performed site-directed mutagenesis to substitute amino acids in this region and demonstrated that many of these mutants, although expressed in COS cells, were unstable compared with the wild-type protein. Further analysis revealed that zinc-binding capability, as measured by retention on a zinc chelate affinity adsorbent, correlates with stability. These studies also allowed us to identify a CCHC box as the most probable zinc-binding motif. Images PMID:8035527

A molecular dynamics study of the complete binding process of meropenem to New Delhi metallo-β-lactamase 1.

PubMed

Duan, Juan; Hu, Chuncai; Guo, Jiafan; Guo, Lianxian; Sun, Jia; Zhao, Zuguo

2018-02-28

The mechanism of substrate hydrolysis of New Delhi metallo-β-lactamase 1 (NDM-1) has been reported, but the process in which NDM-1 captures and transports the substrate into its active center remains unknown. In this study, we investigated the process of the substrate entry into the NDM-1 activity center through long unguided molecular dynamics simulations using meropenem as the substrate. A total of 550 individual simulations were performed, each of which for 200 ns, and 110 of them showed enzyme-substrate binding events. The results reveal three categories of relatively persistent and noteworthy enzyme-substrate binding configurations, which we call configurations A, B, and C. We performed binding free energy calculations of the enzyme-substrate complexes of different configurations using the molecular mechanics Poisson-Boltzmann surface area method. The role of each residue of the active site in binding the substrate was investigated using energy decomposition analysis. The simulated trajectories provide a continuous atomic-level view of the entire binding process, revealing potentially valuable regions where the enzyme and the substrate interact persistently and five possible pathways of the substrate entering into the active center, which were validated using well-tempered metadynamics. These findings provide important insights into the binding mechanism of meropenem to NDM-1, which may provide new prospects for the design of novel metallo-β-lactamase inhibitors and enzyme-resistant antibiotics.

Screening and Characterization of a Novel RNA Aptamer That Specifically Binds to Human Prostatic Acid Phosphatase and Human Prostate Cancer Cells

PubMed Central

Kong, Hoon Young; Byun, Jonghoe

2015-01-01

Prostatic acid phosphatase (PAP) expression increases proportionally with prostate cancer progression, making it useful in prognosticating intermediate to high-risk prostate cancers. A novel ligand that can specifically bind to PAP would be very helpful for guiding prostate cancer therapy. RNA aptamers bind to target molecules with high specificity and have key advantages such as low immunogenicity and easy synthesis. Here, human PAP-specific aptamers were screened from a 2′-fluoropyrimidine (FY)-modified RNA library by SELEX. The candidate aptamer families were identified within six rounds followed by analysis of their sequences and PAP-specific binding. A gel shift assay was used to identify PAP binding aptamers and the 6N aptamer specifically bound to PAP with a Kd value of 118 nM. RT-PCR and fluorescence labeling analyses revealed that the 6N aptamer bound to PAP-positive mammalian cells, such as PC-3 and LNCaP. IMR-90 negative control cells did not bind the 6N aptamer. Systematic minimization analyses revealed that 50 nucleotide sequences and their two hairpin structures in the 6N 2′-FY RNA aptamer were equally important for PAP binding. Renewed interest in PAP combined with the versatility of RNA aptamers, including conjugation of anti-cancer drugs and nano-imaging probes, could open up a new route for early theragnosis of prostate cancer. PMID:25591398

Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

PubMed

Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

2017-07-01

Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

HITS-CLIP yields genome-wide insights into brain alternative RNA processing

NASA Astrophysics Data System (ADS)

Licatalosi, Donny D.; Mele, Aldo; Fak, John J.; Ule, Jernej; Kayikci, Melis; Chi, Sung Wook; Clark, Tyson A.; Schweitzer, Anthony C.; Blume, John E.; Wang, Xuning; Darnell, Jennifer C.; Darnell, Robert B.

2008-11-01

Protein-RNA interactions have critical roles in all aspects of gene expression. However, applying biochemical methods to understand such interactions in living tissues has been challenging. Here we develop a genome-wide means of mapping protein-RNA binding sites in vivo, by high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation (HITS-CLIP). HITS-CLIP analysis of the neuron-specific splicing factor Nova revealed extremely reproducible RNA-binding maps in multiple mouse brains. These maps provide genome-wide in vivo biochemical footprints confirming the previous prediction that the position of Nova binding determines the outcome of alternative splicing; moreover, they are sufficiently powerful to predict Nova action de novo. HITS-CLIP revealed a large number of Nova-RNA interactions in 3' untranslated regions, leading to the discovery that Nova regulates alternative polyadenylation in the brain. HITS-CLIP, therefore, provides a robust, unbiased means to identify functional protein-RNA interactions in vivo.

Fatty acids and small organic compounds bind to mineralo-organic nanoparticles derived from human body fluids as revealed by metabolomic analysis.

PubMed

Martel, Jan; Wu, Cheng-Yeu; Hung, Cheng-Yu; Wong, Tsui-Yin; Cheng, Ann-Joy; Cheng, Mei-Ling; Shiao, Ming-Shi; Young, John D

2016-03-14

Nanoparticles entering the human body instantly become coated with a "protein corona" that influences the effects and distribution of the particles in vivo. Yet, whether nanoparticles may bind to other organic compounds remains unclear. Here we use an untargeted metabolomic approach based on ultra-performance liquid chromatography and quadruple time-of-flight mass spectrometry to identify the organic compounds that bind to mineral nanoparticles formed in human body fluids (serum, plasma, saliva, and urine). A wide range of organic compounds is identified, including fatty acids, glycerophospholipids, amino acids, sugars, and amides. Our results reveal that, in addition to the proteins identified previously, nanoparticles harbor an "organic corona" containing several fatty acids which may affect particle-cell interactions in vivo. This study provides a platform to study the organic corona of biological and synthetic nanoparticles found in the human body.

Cryo-EM structures of MERS-CoV and SARS-CoV spike glycoproteins reveal the dynamic receptor binding domains.

PubMed

Yuan, Yuan; Cao, Duanfang; Zhang, Yanfang; Ma, Jun; Qi, Jianxun; Wang, Qihui; Lu, Guangwen; Wu, Ying; Yan, Jinghua; Shi, Yi; Zhang, Xinzheng; Gao, George F

2017-04-10

The envelope spike (S) proteins of MERS-CoV and SARS-CoV determine the virus host tropism and entry into host cells, and constitute a promising target for the development of prophylactics and therapeutics. Here, we present high-resolution structures of the trimeric MERS-CoV and SARS-CoV S proteins in its pre-fusion conformation by single particle cryo-electron microscopy. The overall structures resemble that from other coronaviruses including HKU1, MHV and NL63 reported recently, with the exception of the receptor binding domain (RBD). We captured two states of the RBD with receptor binding region either buried (lying state) or exposed (standing state), demonstrating an inherently flexible RBD readily recognized by the receptor. Further sequence conservation analysis of six human-infecting coronaviruses revealed that the fusion peptide, HR1 region and the central helix are potential targets for eliciting broadly neutralizing antibodies.

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

PubMed

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

2011-10-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein

PubMed Central

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S

2011-01-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373

Bio-mimicking of Proline-Rich Motif Applied to Carbon Nanotube Reveals Unexpected Subtleties Underlying Nanoparticle Functionalization

NASA Astrophysics Data System (ADS)

Zhang, Yuanzhao; Jimenez-Cruz, Camilo A.; Wang, Jian; Zhou, Bo; Yang, Zaixing; Zhou, Ruhong

2014-11-01

Here, we report computational studies of the SH3 protein domain interacting with various single-walled carbon nanotubes (SWCNT) either bare or functionalized by mimicking the proline-rich motif (PRM) ligand (PPPVPPRR) and compare it to the SH3-PRM complex binding. With prolines or a single arginine attached, the SWCNT gained slightly on specificity when compared with the bare control, whereas with multi-arginine systems the specificity dropped dramatically to our surprise. Although the electrostatic interaction provided by arginines is crucial in the recognition between PRM and SH3 domain, our results suggest that attaching multiple arginines to the SWCNT has a detrimental effect on the binding affinity. Detailed analysis of the MD trajectories found two main factors that modulate the specificity of the binding: the existence of competing acidic patches at the surface of SH3 that leads to ``trapping and clamping'' by the arginines, and the rigidity of the SWCNT introducing entropic penalties in the proper binding. Further investigation revealed that the same ``clamping'' phenomenon exits in the PRM-SH3 system, which has not been reported in previous literature. The competing effects between nanoparticle and its functionalization components revealed by our model system should be of value to current and future nanomedicine designs.

Structure of the apo form of the catabolite control protein A (CcpA) from Bacillus megaterium with a DNA-binding domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Rajesh Kumar; Palm, Gottfried J.; Panjikar, Santosh

2007-04-01

Crystal structure analysis of the apo form of catabolite control protein A reveals the three-helix bundle of the DNA-binding domain. In the crystal packing, this domain interacts with the binding site for the corepressor protein. Crystal structure determination of catabolite control protein A (CcpA) at 2.6 Å resolution reveals for the first time the structure of a full-length apo-form LacI-GalR family repressor protein. In the crystal structures of these transcription regulators, the three-helix bundle of the DNA-binding domain has only been observed in cognate DNA complexes; it has not been observed in other crystal structures owing to its mobility. Inmore » the crystal packing of apo-CcpA, the protein–protein contacts between the N-terminal three-helix bundle and the core domain consisted of interactions between the homodimers that were similar to those between the corepressor protein HPr and the CcpA N-subdomain in the ternary DNA complex. In contrast to the DNA complex, the apo-CcpA structure reveals large subdomain movements in the core, resulting in a complete loss of contacts between the N-subdomains of the homodimer.« less

Bio-mimicking of Proline-Rich Motif Applied to Carbon Nanotube Reveals Unexpected Subtleties Underlying Nanoparticle Functionalization

PubMed Central

Zhang, Yuanzhao; Jimenez-Cruz, Camilo A.; Wang, Jian; Zhou, Bo; Yang, Zaixing; Zhou, Ruhong

2014-01-01

Here, we report computational studies of the SH3 protein domain interacting with various single-walled carbon nanotubes (SWCNT) either bare or functionalized by mimicking the proline-rich motif (PRM) ligand (PPPVPPRR) and compare it to the SH3-PRM complex binding. With prolines or a single arginine attached, the SWCNT gained slightly on specificity when compared with the bare control, whereas with multi-arginine systems the specificity dropped dramatically to our surprise. Although the electrostatic interaction provided by arginines is crucial in the recognition between PRM and SH3 domain, our results suggest that attaching multiple arginines to the SWCNT has a detrimental effect on the binding affinity. Detailed analysis of the MD trajectories found two main factors that modulate the specificity of the binding: the existence of competing acidic patches at the surface of SH3 that leads to “trapping and clamping” by the arginines, and the rigidity of the SWCNT introducing entropic penalties in the proper binding. Further investigation revealed that the same “clamping” phenomenon exits in the PRM-SH3 system, which has not been reported in previous literature. The competing effects between nanoparticle and its functionalization components revealed by our model system should be of value to current and future nanomedicine designs. PMID:25427563

Chronic Beryllium Disease: Revealing the Role of Beryllium Ion and Small Peptides Binding to HLA-DP2

PubMed Central

Petukh, Marharyta; Wu, Bohua; Stefl, Shannon; Smith, Nick; Hyde-Volpe, David; Wang, Li; Alexov, Emil

2014-01-01

Chronic Beryllium (Be) Disease (CBD) is a granulomatous disorder that predominantly affects the lung. The CBD is caused by Be exposure of individuals carrying the HLA-DP2 protein of the major histocompatibility complex class II (MHCII). While the involvement of Be in the development of CBD is obvious and the binding site and the sequence of Be and peptide binding were recently experimentally revealed [1], the interplay between induced conformational changes and the changes of the peptide binding affinity in presence of Be were not investigated. Here we carry out in silico modeling and predict the Be binding to be within the acidic pocket (Glu26, Glu68 and Glu69) present on the HLA-DP2 protein in accordance with the experimental work [1]. In addition, the modeling indicates that the Be ion binds to the HLA-DP2 before the corresponding peptide is able to bind to it. Further analysis of the MD generated trajectories reveals that in the presence of the Be ion in the binding pocket of HLA-DP2, all the different types of peptides induce very similar conformational changes, but their binding affinities are quite different. Since these conformational changes are distinctly different from the changes caused by peptides normally found in the cell in the absence of Be, it can be speculated that CBD can be caused by any peptide in presence of Be ion. However, the affinities of peptides for Be loaded HLA-DP2 were found to depend of their amino acid composition and the peptides carrying acidic group at positions 4 and 7 are among the strongest binders. Thus, it is proposed that CBD is caused by the exposure of Be of an individual carrying the HLA-DP2*0201 allele and that the binding of Be to HLA-DP2 protein alters the conformational and ionization properties of HLA-DP2 such that the binding of a peptide triggers a wrong signaling cascade. PMID:25369028

Interaction of Pb(II) and biofilm associated extracellular polymeric substances of a marine bacterium Pseudomonas pseudoalcaligenes NP103

NASA Astrophysics Data System (ADS)

Kumari, Supriya; Mangwani, Neelam; Das, Surajit

2017-02-01

Three-dimensional excitation-emission matrix (3D EEM) fluorescence spectroscopy and attenuated total reflectance fourier-transformed infrared spectroscopy (ATR-FTIR) was used to evaluate the interaction of biofilm associated extracellular polymeric substances (EPS) of a marine bacterium Pseudomonas pseudoalcaligenes NP103 with lead [Pb(II)]. EEM fluorescence spectroscopic analysis revealed the presence of one protein-like fluorophore in the EPS of P. pseudoalcaligenes NP103. Stern-Volmer equation indicated the existence of only one binding site (n = 0.789) in the EPS of P. pseudoalcaligenes NP103. The interaction of Pb(II) with EPS was spontaneous at room temperature (Δ G = - 2.78 kJ/K/mol) having binding constant (Kb) of 2.59 M- 1. ATR-FTIR analysis asserted the involvement of various functional groups such as sulphydryl, phosphate and hydroxyl and amide groups of protein in Pb(II) binding. Scanning electron microscopy (SEM) and fluorescence microscopy analysis displayed reduced growth of biofilm with altered surface topology in Pb(II) supplemented medium. Energy dispersive X-ray spectroscopy (EDX) analysis revealed the entrapment of Pb in the EPS. Uronic acid, a characteristic functional group of biofilm, was observed in 1H NMR spectroscopy. The findings suggest that biofilm associated EPS are perfect organic ligands for Pb(II) complexation and may significantly augment the bioavailability of Pb(II) in the metal contaminated environment for subsequent sequestration.

SONAR Discovers RNA-Binding Proteins from Analysis of Large-Scale Protein-Protein Interactomes.

PubMed

Brannan, Kristopher W; Jin, Wenhao; Huelga, Stephanie C; Banks, Charles A S; Gilmore, Joshua M; Florens, Laurence; Washburn, Michael P; Van Nostrand, Eric L; Pratt, Gabriel A; Schwinn, Marie K; Daniels, Danette L; Yeo, Gene W

2016-10-20

RNA metabolism is controlled by an expanding, yet incomplete, catalog of RNA-binding proteins (RBPs), many of which lack characterized RNA binding domains. Approaches to expand the RBP repertoire to discover non-canonical RBPs are currently needed. Here, HaloTag fusion pull down of 12 nuclear and cytoplasmic RBPs followed by quantitative mass spectrometry (MS) demonstrates that proteins interacting with multiple RBPs in an RNA-dependent manner are enriched for RBPs. This motivated SONAR, a computational approach that predicts RNA binding activity by analyzing large-scale affinity precipitation-MS protein-protein interactomes. Without relying on sequence or structure information, SONAR identifies 1,923 human, 489 fly, and 745 yeast RBPs, including over 100 human candidate RBPs that contain zinc finger domains. Enhanced CLIP confirms RNA binding activity and identifies transcriptome-wide RNA binding sites for SONAR-predicted RBPs, revealing unexpected RNA binding activity for disease-relevant proteins and DNA binding proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

Characterization of strychnine-sensitive glycine receptor in the intact frog retina: modulation by protein kinases.

PubMed

Salceda, Rocío; Aguirre-Ramirez, Marisela

2005-03-01

We studied 3H-glycine and 3H-strychnine specific binding to glycine receptor (GlyR) in intact isolated frog retinas. To avoid glycine binding to glycine uptake sites, experiments were performed at low ligand concentrations in a sodium-free medium. The binding of both radiolabeled ligands was saturated. Scatchard analysis of bound glycine and strychnine revealed a KD of 2.5 and 2.0 microM, respectively. Specific binding of glycine was displaced by beta-alanine, sarcosine, and strychnine. Strychnine binding was displaced 50% by glycine, and sarcosine. Properties of the strychnine-binding site in the GlyR were modified by sarcosine. Binding of both radioligands was considerably reduced by compounds that inhibit or activate adenylate cyclase and increased cAMP levels. A phorbol ester activator of PKC remarkably decreased glycine and strychnine binding. These results suggest modulation of GlyR in response to endogenous activation of protein kinases A and C, as well as protein phosphorylation modulating GlyR function in retina.

Specific receptors for epidermal growth factor in rat intestinal microvillus membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thompson, J.F.

Epidermal growth factor (EGF) is present in high concentrations in milk, salivary, and pancreaticobiliary secretions. EGF, delivered to the intestinal lumen by these fluids, appears to influence intestinal proliferation. Because EGF exerts its mitogenic effect through binding to specific membrane-bound receptors, binding studies of {sup 125}I-labeled EGF to purified microvillus membrane (MVM) preparations fetal, newborn, and adult rat small intestine were performed. Using the membrane filter technique, binding of {sup 125}I-EGF to adult MVM was specific, saturable, and reversible. Adult and fetal MVM binding was rapid and reached a plateau after 30 min at both 20 and 37{degree}C. No bindingmore » was detected at 4{degree}C. Specific binding increased linearly from 0 to 75 {mu}g MVM protein. Scatchard analysis revealed a single class of receptors in fetal and adult MVM with an association constant of 1.0 {+-} 0.35 {times} 10{sup 9} and 2.3 {+-} 1.6 {times} 10{sup 9} M{sup {minus}1}, respectively. Binding capacity was 435.0 {+-} 89 and 97.7 {+-} 41.3 fmol {sup 125}I-EGF bound/mg MVM protein for fetal and adult MVM, respectively. Newborn MVM binding was negligible. After binding, cross-linking utilizing disuccinimidyl suberate, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis, autoradiography revealed a 170-kDa receptor. These data demonstrate specific receptors for EGF on MVM of rat small intestine and, thus, suggest a mechanism for the intraluminal regulation of enterocyte proliferation by EGF.« less

The Rice Resistance Protein Pair RGA4/RGA5 Recognizes the Magnaporthe oryzae Effectors AVR-Pia and AVR1-CO39 by Direct Binding[W][OA

PubMed Central

Cesari, Stella; Thilliez, Gaëtan; Ribot, Cécile; Chalvon, Véronique; Michel, Corinne; Jauneau, Alain; Rivas, Susana; Alaux, Ludovic; Kanzaki, Hiroyuki; Okuyama, Yudai; Morel, Jean-Benoit; Fournier, Elisabeth; Tharreau, Didier; Terauchi, Ryohei; Kroj, Thomas

2013-01-01

Resistance (R) proteins recognize pathogen avirulence (Avr) proteins by direct or indirect binding and are multidomain proteins generally carrying a nucleotide binding (NB) and a leucine-rich repeat (LRR) domain. Two NB-LRR protein-coding genes from rice (Oryza sativa), RGA4 and RGA5, were found to be required for the recognition of the Magnaporthe oryzae effector AVR1-CO39. RGA4 and RGA5 also mediate recognition of the unrelated M. oryzae effector AVR-Pia, indicating that the corresponding R proteins possess dual recognition specificity. For RGA5, two alternative transcripts, RGA5-A and RGA5-B, were identified. Genetic analysis showed that only RGA5-A confers resistance, while RGA5-B is inactive. Yeast two-hybrid, coimmunoprecipitation, and fluorescence resonance energy transfer–fluorescence lifetime imaging experiments revealed direct binding of AVR-Pia and AVR1-CO39 to RGA5-A, providing evidence for the recognition of multiple Avr proteins by direct binding to a single R protein. Direct binding seems to be required for resistance as an inactive AVR-Pia allele did not bind RGA5-A. A small Avr interaction domain with homology to the Avr recognition domain in the rice R protein Pik-1 was identified in the C terminus of RGA5-A. This reveals a mode of Avr protein recognition through direct binding to a novel, non-LRR interaction domain. PMID:23548743

Fluorescent carbohydrate probes for cell lectins

NASA Astrophysics Data System (ADS)

Galanina, Oxana; Feofanov, Alexei; Tuzikov, Alexander B.; Rapoport, Evgenia; Crocker, Paul R.; Grichine, Alexei; Egret-Charlier, Marguerite; Vigny, Paul; Le Pendu, Jacques; Bovin, Nicolai V.

2001-09-01

Fluorescein labeled carbohydrate (Glyc) probes were synthesized as analytical tools for the study of cellular lectins, i.e. SiaLe x-PAA-flu, Sia 2-PAA-flu, GlcNAc 2-PAA-flu, LacNAc-PAA-flu and a number of similar ones, with PAA a soluble polyacrylamide carrier. The binding of SiaLe x-PAA-flu was assessed using CHO cells transfected with E-selectin, and the binding of Sia 2-PAA-flu was assessed by COS cells transfected with siglec-9. In flow cytometry assays, the fluorescein probes demonstrated a specific binding to the lectin-transfected cells that was inhibited by unlabeled carbohydrate ligands. The intense binding of SiaLe x-PAA- 3H to the E-selectin transfected cells and the lack of binding to both native and permeabilized control cells lead to the conclusion that the polyacrylamide carrier itself and the spacer arm connecting the carbohydrate moiety with PAA did not contribute anymore to the binding. Tumors were obtained from nude mice by injection of CHO E-selectin or mock transfected cells. The fluorescent SiaLe x-PAA-flu probe could bind to the tumor sections from E-selectin positive CHO cells, but not from the control ones. Thus, these probes can be used to reveal specifically the carbohydrate binding sites on cells in culture as well as cells in tissue sections. The use of the confocal spectral imaging technique with Glyc-PAA-flu probes offered the unique possibility to detect lectins in different cells, even when the level of lectin expression was rather low. The confocal mode of spectrum recording provided an analysis of the probe localization with 3D submicron resolution. The spectral analysis (as a constituent part of the confocal spectral imaging technique) enabled interfering signals of the probe and intrinsic cellular fluorescence to be accurately separated, the distribution of the probe to be revealed and its local concentration to be measured.

Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

1987-07-01

Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid.

PubMed

Gutsche, Irina; Desfosses, Ambroise; Effantin, Grégory; Ling, Wai Li; Haupt, Melina; Ruigrok, Rob W H; Sachse, Carsten; Schoehn, Guy

2015-05-08

Measles is a highly contagious human disease. We used cryo-electron microscopy and single particle-based helical image analysis to determine the structure of the helical nucleocapsid formed by the folded domain of the measles virus nucleoprotein encapsidating an RNA at a resolution of 4.3 angstroms. The resulting pseudoatomic model of the measles virus nucleocapsid offers important insights into the mechanism of the helical polymerization of nucleocapsids of negative-strand RNA viruses, in particular via the exchange subdomains of the nucleoprotein. The structure reveals the mode of the nucleoprotein-RNA interaction and explains why each nucleoprotein of measles virus binds six nucleotides, whereas the respiratory syncytial virus nucleoprotein binds seven. It provides a rational basis for further analysis of measles virus replication and transcription, and reveals potential targets for drug design. Copyright © 2015, American Association for the Advancement of Science.

Structural and Biochemical Analyses of Glycoside Hydrolase Families 5 and 26 β-(1,4)-Mannanases from Podospora anserina Reveal Differences upon Manno-oligosaccharide Catalysis*

PubMed Central

Couturier, Marie; Roussel, Alain; Rosengren, Anna; Leone, Philippe; Stålbrand, Henrik; Berrin, Jean-Guy

2013-01-01

The microbial deconstruction of the plant cell wall is a key biological process that is of increasing importance with the development of a sustainable biofuel industry. The glycoside hydrolase families GH5 (PaMan5A) and GH26 (PaMan26A) endo-β-1,4-mannanases from the coprophilic ascomycete Podospora anserina contribute to the enzymatic degradation of lignocellulosic biomass. In this study, P. anserina mannanases were further subjected to detailed comparative analysis of their substrate specificities, active site organization, and transglycosylation capacity. Although PaMan5A displays a classical mode of action, PaMan26A revealed an atypical hydrolysis pattern with the release of mannotetraose and mannose from mannopentaose resulting from a predominant binding mode involving the −4 subsite. The crystal structures of PaMan5A and PaMan26A were solved at 1.4 and 2.85 Å resolution, respectively. Analysis of the PaMan26A structure supported strong interaction with substrate at the −4 subsite mediated by two aromatic residues Trp-244 and Trp-245. The PaMan26A structure appended to its family 35 carbohydrate binding module revealed a short and proline-rich rigid linker that anchored together the catalytic and the binding modules. PMID:23558681

Comparison and correlation of binding mode of ATP in the kinase domains of Hexokinase family

PubMed Central

Kumar, Yellapu Nanda; Kumar, Pasupuleti Santhosh; Sowjenya, Gopal; Rao, Valasani Koteswara; Yeswanth, Sthanikam; Prasad, Uppu Venkateswara; Pradeepkiran, Jangampalli Adi; Sarma, PVGK; Bhaskar, Matcha

2012-01-01

Hexokinases (HKs) are the enzymes that catalyses the ATP dependent phosphorylation of Hexose sugars to Hexose-6-Phosphate (Hex-6-P). There exist four different forms of HKs namely HK-I, HK-II, HK-III and HK-IV and all of them share a common ATP binding site core surrounded by more variable sequence that determine substrate affinities. Although they share a common binding site but they differ in their kinetic functions, hence the present study is aimed to analyze the binding mode of ATP. The analysis revealed that the four ATP binding domains are showing 13 identical, 7 similar and 6 dissimilar residues with similar structural conformation. Molecular docking of ATP into the kinase domains using Molecular Operating Environment (MOE) soft ware tool clearly showed the variation in the binding mode of ATP with variable docking scores. This probably explains the variable phosphorylation rates among hexokinases family. PMID:22829728

A putative carbohydrate-binding domain of the lactose-binding Cytisus sessilifolius anti-H(O) lectin has a similar amino acid sequence to that of the L-fucose-binding Ulex europaeus anti-H(O) lectin.

PubMed

Konami, Y; Yamamoto, K; Osawa, T; Irimura, T

1995-04-01

The complete amino acid sequence of a lactose-binding Cytisus sessilifolius anti-H(O) lectin II (CSA-II) was determined using a protein sequencer. After digestion of CSA-II with endoproteinase Lys-C or Asp-N, the resulting peptides were purified by reversed-phase high performance liquid chromatography (HPLC) and then subjected to sequence analysis. Comparison of the complete amino acid sequence of CSA-II with the sequences of other leguminous seed lectins revealed regions of extensive homology. The amino acid sequence of a putative carbohydrate-binding domain of CSA-II was found to be similar to those of several anti-H(O) leguminous lectins, especially to that of the L-fucose-binding Ulex europaeus lectin I (UEA-I).

How Structure Defines Affinity in Protein-Protein Interactions

PubMed Central

Erijman, Ariel; Rosenthal, Eran; Shifman, Julia M.

2014-01-01

Protein-protein interactions (PPI) in nature are conveyed by a multitude of binding modes involving various surfaces, secondary structure elements and intermolecular interactions. This diversity results in PPI binding affinities that span more than nine orders of magnitude. Several early studies attempted to correlate PPI binding affinities to various structure-derived features with limited success. The growing number of high-resolution structures, the appearance of more precise methods for measuring binding affinities and the development of new computational algorithms enable more thorough investigations in this direction. Here, we use a large dataset of PPI structures with the documented binding affinities to calculate a number of structure-based features that could potentially define binding energetics. We explore how well each calculated biophysical feature alone correlates with binding affinity and determine the features that could be used to distinguish between high-, medium- and low- affinity PPIs. Furthermore, we test how various combinations of features could be applied to predict binding affinity and observe a slow improvement in correlation as more features are incorporated into the equation. In addition, we observe a considerable improvement in predictions if we exclude from our analysis low-resolution and NMR structures, revealing the importance of capturing exact intermolecular interactions in our calculations. Our analysis should facilitate prediction of new interactions on the genome scale, better characterization of signaling networks and design of novel binding partners for various target proteins. PMID:25329579

Aminoglycosylation Can Enhance the G-Quadruplex Binding Activity of Epigallocatechin

PubMed Central

Bai, Li-Ping; Ho, Hing-Man; Ma, Dik-Lung; Yang, Hui; Fu, Wai-Chung; Jiang, Zhi-Hong

2013-01-01

With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18) of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC) (14) as well as natural epigallocatechin (EGC, 6). The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures. PMID:23335983

Development of estrogen receptor beta binding prediction model using large sets of chemicals.

PubMed

Sakkiah, Sugunadevi; Selvaraj, Chandrabose; Gong, Ping; Zhang, Chaoyang; Tong, Weida; Hong, Huixiao

2017-11-03

We developed an ER β binding prediction model to facilitate identification of chemicals specifically bind ER β or ER α together with our previously developed ER α binding model. Decision Forest was used to train ER β binding prediction model based on a large set of compounds obtained from EADB. Model performance was estimated through 1000 iterations of 5-fold cross validations. Prediction confidence was analyzed using predictions from the cross validations. Informative chemical features for ER β binding were identified through analysis of the frequency data of chemical descriptors used in the models in the 5-fold cross validations. 1000 permutations were conducted to assess the chance correlation. The average accuracy of 5-fold cross validations was 93.14% with a standard deviation of 0.64%. Prediction confidence analysis indicated that the higher the prediction confidence the more accurate the predictions. Permutation testing results revealed that the prediction model is unlikely generated by chance. Eighteen informative descriptors were identified to be important to ER β binding prediction. Application of the prediction model to the data from ToxCast project yielded very high sensitivity of 90-92%. Our results demonstrated ER β binding of chemicals could be accurately predicted using the developed model. Coupling with our previously developed ER α prediction model, this model could be expected to facilitate drug development through identification of chemicals that specifically bind ER β or ER α .

Genes encoding calmodulin-binding proteins in the Arabidopsis genome

NASA Technical Reports Server (NTRS)

Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

2002-01-01

Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

Insight into the Interaction of Metal Ions with TroA from Streptococcus suis

PubMed Central

Zheng, Beiwen; Zhang, Qiangmin; Gao, Jia; Han, Huiming; Li, Ming; Zhang, Jingren; Qi, Jianxun; Yan, Jinghua; Gao, George F.

2011-01-01

Background The scavenging ability of sufficient divalent metal ions is pivotal for pathogenic bacteria to survive in the host. ATP-binding cassette (ABC)-type metal transporters provide a considerable amount of different transition metals for bacterial growth. TroA is a substrate binding protein for uptake of multiple metal ions. However, the function and structure of the TroA homologue from the epidemic Streptococcus suis isolates (SsTroA) have not been characterized. Methodology/Principal Findings Here we determined the crystal structure of SsTroA from a highly pathogenic streptococcal toxic shock syndrome (STSS)-causing Streptococcus suis in complex with zinc. Inductively coupled plasma mass spectrometry (ICP-MS) analysis revealed that apo-SsTroA binds Zn2+ and Mn2+. Both metals bind to SsTroA with nanomolar affinity and stabilize the protein against thermal unfolding. Zn2+ and Mn2+ induce distinct conformational changes in SsTroA compared with the apo form as confirmed by both circular dichroism (CD) and nuclear magnetic resonance (NMR) spectra. NMR data also revealed that Zn2+/Mn2+ bind to SsTroA in either the same site or an adjacent region. Finally, we found that the folding of the metal-bound protein is more compact than the corresponding apoprotein. Conclusions/Significance Our findings reveal a mechanism for uptake of metal ions in S. suis and this mechanism provides a reasonable explanation as to how SsTroA operates in metal transport. PMID:21611125

Structural and Functional Analysis of a Lytic Polysaccharide Monooxygenase Important for Efficient Utilization of Chitin in Cellvibrio japonicus*

PubMed Central

Forsberg, Zarah; Nelson, Cassandra E.; Dalhus, Bjørn; Mekasha, Sophanit; Loose, Jennifer S. M.; Crouch, Lucy I.; Røhr, Åsmund K.; Gardner, Jeffrey G.; Eijsink, Vincent G. H.; Vaaje-Kolstad, Gustav

2016-01-01

Cellvibrio japonicus is a Gram-negative soil bacterium that is primarily known for its ability to degrade plant cell wall polysaccharides through utilization of an extensive repertoire of carbohydrate-active enzymes. Several putative chitin-degrading enzymes are also found among these carbohydrate-active enzymes, such as chitinases, chitobiases, and lytic polysaccharide monooxygenases (LPMOs). In this study, we have characterized the chitin-active LPMO, CjLPMO10A, a tri-modular enzyme containing a catalytic family AA10 LPMO module, a family 5 chitin-binding module, and a C-terminal unclassified module of unknown function. Characterization of the latter module revealed tight and specific binding to chitin, thereby unraveling a new family of chitin-binding modules (classified as CBM73). X-ray crystallographic elucidation of the CjLPMO10A catalytic module revealed that the active site of the enzyme combines structural features previously only observed in either cellulose or chitin-active LPMO10s. Analysis of the copper-binding site by EPR showed a signal signature more similar to those observed for cellulose-cleaving LPMOs. The full-length LPMO shows no activity toward cellulose but is able to bind and cleave both α- and β-chitin. Removal of the chitin-binding modules reduced LPMO activity toward α-chitin compared with the full-length enzyme. Interestingly, the full-length enzyme and the individual catalytic LPMO module boosted the activity of an endochitinase equally well, also yielding similar amounts of oxidized products. Finally, gene deletion studies show that CjLPMO10A is needed by C. japonicus to obtain efficient growth on both purified chitin and crab shell particles. PMID:26858252

Structural and Functional Analysis of a Lytic Polysaccharide Monooxygenase Important for Efficient Utilization of Chitin in Cellvibrio japonicus.

PubMed

Forsberg, Zarah; Nelson, Cassandra E; Dalhus, Bjørn; Mekasha, Sophanit; Loose, Jennifer S M; Crouch, Lucy I; Røhr, Åsmund K; Gardner, Jeffrey G; Eijsink, Vincent G H; Vaaje-Kolstad, Gustav

2016-04-01

Cellvibrio japonicusis a Gram-negative soil bacterium that is primarily known for its ability to degrade plant cell wall polysaccharides through utilization of an extensive repertoire of carbohydrate-active enzymes. Several putative chitin-degrading enzymes are also found among these carbohydrate-active enzymes, such as chitinases, chitobiases, and lytic polysaccharide monooxygenases (LPMOs). In this study, we have characterized the chitin-active LPMO,CjLPMO10A, a tri-modular enzyme containing a catalytic family AA10 LPMO module, a family 5 chitin-binding module, and a C-terminal unclassified module of unknown function. Characterization of the latter module revealed tight and specific binding to chitin, thereby unraveling a new family of chitin-binding modules (classified as CBM73). X-ray crystallographic elucidation of theCjLPMO10A catalytic module revealed that the active site of the enzyme combines structural features previously only observed in either cellulose or chitin-active LPMO10s. Analysis of the copper-binding site by EPR showed a signal signature more similar to those observed for cellulose-cleaving LPMOs. The full-length LPMO shows no activity toward cellulose but is able to bind and cleave both α- and β-chitin. Removal of the chitin-binding modules reduced LPMO activity toward α-chitin compared with the full-length enzyme. Interestingly, the full-length enzyme and the individual catalytic LPMO module boosted the activity of an endochitinase equally well, also yielding similar amounts of oxidized products. Finally, gene deletion studies show thatCjLPMO10A is needed byC. japonicusto obtain efficient growth on both purified chitin and crab shell particles. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Binding analysis for interaction of diacetylcurcumin with β-casein nanoparticles by using fluorescence spectroscopy and molecular docking calculations

NASA Astrophysics Data System (ADS)

Mehranfar, Fahimeh; Bordbar, Abdol-Khalegh; Fani, Najme; Keyhanfar, Mehrnaz

2013-11-01

The interaction of diacetylcurcumin (DAC), as a novel synthetic derivative of curcumin, with bovine β-casein (an abundant milk protein that is highly amphiphilic and self assembles into stable micellar nanoparticles in aqueous solution) was investigated using fluorescence quenching experiments, Forster energy transfer measurements and molecular docking calculations. The fluorescence quenching measurements revealed the presence of a single binding site on β-casein for DAC with the binding constant value equals to (4.40 ± 0.03) × 104 M-1. Forster energy transfer measurements suggested that the distance between bound DAC and Trp143 residue is higher than the respective critical distance, hence, the static quenching is more likely responsible for fluorescence quenching other than the mechanism of non-radiative energy transfer. Our results from molecular docking calculations indicated that binding of DAC to β-casein predominantly occurred through hydrophobic contacts in the hydrophobic core of protein. Additionally, in vitro investigation of the cytotoxicity of free DAC and DAC-β-casein complex in human breast cancer cell line MCF7 revealed the higher cytotoxic effect of DAC-β-casein complex.

Anions mediate ligand binding in Adineta vaga glutamate receptor ion channels.

PubMed

Lomash, Suvendu; Chittori, Sagar; Brown, Patrick; Mayer, Mark L

2013-03-05

AvGluR1, a glutamate receptor ion channel from the primitive eukaryote Adineta vaga, is activated by alanine, cysteine, methionine, and phenylalanine, which produce lectin-sensitive desensitizing responses like those to glutamate, aspartate, and serine. AvGluR1 LBD crystal structures reveal an unusual scheme for binding dissimilar ligands that may be utilized by distantly related odorant/chemosensory receptors. Arginine residues in domain 2 coordinate the γ-carboxyl group of glutamate, whereas in the alanine, methionine, and serine complexes a chloride ion acts as a surrogate ligand, replacing the γ-carboxyl group. Removal of Cl(-) lowers affinity for these ligands but not for glutamate or aspartate nor for phenylalanine, which occludes the anion binding site and binds with low affinity. AvGluR1 LBD crystal structures and sedimentation analysis also provide insights into the evolutionary link between prokaryotic and eukaryotic iGluRs and reveal features unique to both classes, emphasizing the need for additional structure-based studies on iGluR-ligand interactions. Copyright © 2013 Elsevier Ltd. All rights reserved.

Insights into the structural characteristics and substrate binding analysis of chondroitin AC lyase (PsPL8A) from Pedobacter saltans.

PubMed

Rani, Aruna; Dhillon, Arun; Sharma, Kedar; Goyal, Arun

2018-04-01

The structure of chondroitin AC lyase (PsPL8A) of family 8 polysaccharide lyase was characterized. Modeled PsPL8A structure showed, it contains N-terminal (α/α) 6 incomplete toroidal fold and a layered β sandwich structure at C-terminal. Ramchandran plot displayed 98.5% residues in favoured and 1.2% in generously allowed region. Secondary structure of PsPL8A by CD revealed 27.31% α helices 22.7% β sheets and 49.9% random coils. Protein melting study showed, PsPL8A completely unfolds at 60°C. SAXS analysis showed, PsPL8A is fully folded in solution form. The ab initio derived dummy model of PsPL8A superposed well with its modeled structure excluding some α-helices and loop region. Structural superposition and docking analysis showed, N153, W105, H203, Y208, Y212, R266 and E349 were involved in catalysis. Mutants N153A, H203A, Y212F, R266A and E349A created by SDM revealed no residual activity. Isothermal titration calorimetry analysis of Y212F and H203A with C4S polysaccharide, showed moderate binding by Y212F (Ka=9.56±3.81×10 5 ) and no binding with H203A, showing active contribution of Y212 in substrate binding. Residues Y212 and H203 or R266 might act as general base and general acid respectively. Residues N153 and E349 are likely contributing in charge neutralization and stabilizing enolate anion intermediate during β-elimination. Copyright © 2017 Elsevier B.V. All rights reserved.

Computational Study on Full-length Human Ku70 with Double Stranded DNA: Dynamics, Interactions and Functional Implications

NASA Technical Reports Server (NTRS)

Hu, Shaowen; Cucinotta, Francis A.

2009-01-01

The Ku70/80 heterodimer is the first repair protein in the initial binding of double-strand break (DSB) ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. In this study we constructed a full-length human Ku70 structure based on its crystal structure, and performed 20 ns conventional molecular dynamic (CMD) simulations on this protein and several other complexes with short DNA duplexes of different sequences. The trajectories of these simulations indicated that, without the topological support of Ku80, the residues in the bridge and C-terminal arm of Ku70 are more flexible than other experimentally identified domains. We studied the two missing loops in the crystal structure and predicted that they are also very flexible. Simulations revealed that they make an important contribution to the Ku70 interaction with DNA. Dislocation of the previously studied SAP domain was observed in several systems, implying its role in DNA binding. Targeted molecular dynamic (TMD) simulation was also performed for one system with a far-away 14bp DNA duplex. The TMD trajectory and energetic analysis disclosed detailed interactions of the DNA-binding residues during the DNA dislocation, and revealed a possible conformational transition for a DSB end when encountering Ku70 in solution. Compared to experimentally based analysis, this study identified more detailed interactions between DNA and Ku70. Free energy analysis indicated Ku70 alone is able to bind DNA with relatively high affinity, with consistent contributions from various domains of Ku70 in different systems. The functional implications of these domains in the processes of Ku heterodimerization and DNA damage recognition and repair can be characterized in detail based upon this analysis.

Genome-wide STAT3 binding analysis after histone deacetylase inhibition reveals novel target genes in dendritic cells

PubMed Central

Sun, Yaping; Iyer, Matthew; McEachin, Richard; Zhao, Meng; Wu, Yi-Mi; Cao, Xuhong; Oravecz-Wilson, Katherine; Zajac, Cynthia; Mathewson, Nathan; Wu, Shin-Rong Julia; Rossi, Corinne; Toubai, Tomomi; Qin, Zhaohui S.; Chinnaiya, Arul M.; Reddy, Pavan

2016-01-01

STAT3 is a master transcriptional regulator that plays an important role in the induction of both immune activation and immune tolerance in dendritic cells (DCs). The transcriptional targets of STAT3 in promoting DC activation are becoming increasingly understood; however, the mechanisms underpinning its role in causing DC suppression remain largely unknown. To determine the functional gene targets of STAT3, we compared the genome-wide binding of STAT3 using ChIP-seq coupled with gene expression microarrays to determine STAT3-dependent gene regulation in DCs after histone deacetylase (HDAC) inhibition. HDAC inhibition boosted the ability of STAT3 to bind to distinct DNA targets and regulate gene expression. Among the top 500 STAT3 binding sites, the frequency of canonical motifs was significantly higher than that of non-canonical motifs. Functional analysis revealed that after treatment with an HDAC inhibitor, the upregulated STAT3 target genes were those that were primarily the negative regulators of pro-inflammatory cytokines and those in the IL-10 signaling pathway. The downregulated STAT3-dependent targets were those involved in immune effector processes and antigen processing/presentation. The expression and functional relevance of these genes were validated. Specifically, functional studies confirmed that the upregulation of IL-10Ra by STAT3 contributed to the suppressive function of DCs following HDAC inhibition. PMID:27866206

Crystal structure at 2.8 A of the DLLRKN-containing coiled-coil domain of huntingtin-interacting protein 1 (HIP1) reveals a surface suitable for clathrin light chain binding.

PubMed

Ybe, Joel A; Mishra, Sanjay; Helms, Stephen; Nix, Jay

2007-03-16

Huntingtin interacting protein 1 (HIP1) is a member of a family of proteins whose interaction with Huntingtin is critical to prevent cells from initiating apoptosis. HIP1, and related protein HIP12/1R, can also bind to clathrin and membrane phospholipids, and HIP12/1R links the CCV to the actin cytoskeleton. HIP1 and HIP12/1R interact with the clathrin light chain EED regulatory site and stimulate clathrin lattice assembly. Here, we report the X-ray structure of the coiled-coil domain of HIP1 (residues 482-586) that includes residues crucial for binding clathrin light chain. The dimeric HIP1 crystal structure is partially splayed open. The comparison of the HIP1 model with coiled-coil predictions revealed the heptad repeat in the dimeric trunk (S2 path) is offset relative to the register of the heptad repeat from the N-terminal portion (S1 path) of the molecule. Furthermore, surface analysis showed there is a third hydrophobic path (S3) running parallel with S1 and S2. We present structural evidence supporting a role for the S3 path as an interaction surface for clathrin light chain. Finally, comparative analysis suggests the mode of binding between sla2p and clathrin light chain may be different in yeast.

Microbubble Enzyme-Linked Immunosorbent Assay for the Detection of Targeted Microbubbles in in Vitro Static Binding Assays.

PubMed

Wischhusen, Jennifer; Padilla, Frederic

2017-07-01

Targeted microbubbles (MBs) are ultrasound contrast agents that are functionalized with a ligand for ultrasound molecular imaging of endothelial markers. Novel targeted MBs are characterized in vitro by incubation in protein-coated wells, followed by binding quantification by microscopy or ultrasound imaging. Both methods provide operator-dependent results: Between 3 and 20 fields of view from a heterogeneous sample are typically selected for analysis by microscopy, and in ultrasound imaging, different acoustic settings affect signal intensities. This study proposes a new method to reproducibly quantify MB binding based on enzyme-linked immunosorbent assay (ELISA), in which bound MBs are revealed with an enzyme-linked antibody. MB-ELISA was adapted to in vitro static binding assays, incubating the MBs in inverted position or by agitation, and compared with microscopy. The specificity and sensitivity of MB-ELISA enable the reliable quantification of MB binding in a rapid, high-throughput and whole-well analysis, facilitating the characterization of new targeted contrast agents. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

Conformational dynamics of L-lysine, L-arginine, L-ornithine binding protein reveals ligand-dependent plasticity.

PubMed

Silva, Daniel-Adriano; Domínguez-Ramírez, Lenin; Rojo-Domínguez, Arturo; Sosa-Peinado, Alejandro

2011-07-01

The molecular basis of multiple ligand binding affinity for amino acids in periplasmic binding proteins (PBPs) and in the homologous domain for class C G-protein coupled receptors is an unsolved question. Here, using unrestrained molecular dynamic simulations, we studied the ligand binding mechanism present in the L-lysine, L-arginine, L-ornithine binding protein. We developed an analysis based on dihedral angles for the description of the conformational changes upon ligand binding. This analysis has an excellent correlation with each of the two main movements described by principal component analysis (PCA) and it's more convenient than RMSD measurements to describe the differences in the conformational ensembles observed. Furthermore, an analysis of hydrogen bonds showed specific interactions for each ligand studied as well as the ligand interaction with the aromatic residues Tyr-14 and Phe-52. Using uncharged histidine tautomers, these interactions are not observed. On the basis of these results, we propose a model in which hydrogen bond interactions place the ligand in the correct orientation to induce a cation-π interaction with Tyr-14 and Phe-52 thereby stabilizing the closed state. Our results also show that this protein adopts slightly different closed conformations to make available specific hydrogen bond interactions for each ligand thus, allowing a single mechanism to attain multiple ligand specificity. These results shed light on the experimental evidence for ligand-dependent conformational plasticity not explained by the previous crystallographic data. Copyright © 2011 Wiley-Liss, Inc.

Myopodin is an F-actin bundling protein with multiple independent actin-binding regions.

PubMed

Linnemann, Anja; Vakeel, Padmanabhan; Bezerra, Eduardo; Orfanos, Zacharias; Djinović-Carugo, Kristina; van der Ven, Peter F M; Kirfel, Gregor; Fürst, Dieter O

2013-02-01

The assembly of striated muscle myofibrils is a multistep process in which a variety of proteins is involved. One of the first and most important steps in myofibrillogenesis is the arrangement of thin myofilaments into ordered I-Z-I brushes, requiring the coordinated activity of numerous actin binding proteins. The early expression of myopodin prior to sarcomeric α-actinin, as well as its binding to actin, α-actinin and filamin indicate an important role for this protein in actin cytoskeleton remodelling with the precise function of myopodin in this process yet remaining to be resolved. While myopodin was previously described as a protein capable of cross-linking actin filaments into thick bundles upon transient transfections, it has remained unclear whether myopodin alone is capable of bundling actin, or if additional proteins are involved. We have therefore investigated the in vitro actin binding properties of myopodin. High speed cosedimentation assays with skeletal muscle actin confirmed direct binding of myopodin to F-actin and showed that this interaction is mediated by at least two independent actin binding sites, found in all myopodin isoforms identified to date. Furthermore, low-speed cosedimentation assays revealed that not only full length myopodin, but also the fragment containing only the second binding site, bundles microfilaments in the absence of accessory proteins. Ultrastructural analysis demonstrated that this bundling activity resembled that of α-actinin. Biochemical experiments revealed that bundling was not achieved by myopodin's ability to dimerize, indicating the presence of two individual F-actin binding sites within the second binding segment. Thus full length myopodin contains at least three F-actin binding sites. These data provide further understanding of the mechanisms by which myopodin contributes to actin reorganization during myofibril assembly.

Molecular and biochemical evidence for the involvement of calcium/calmodulin in auxin action

NASA Technical Reports Server (NTRS)

Yang, T.; Poovaiah, B. W.

2000-01-01

The use of (35)S-labeled calmodulin (CaM) to screen a corn root cDNA expression library has led to the isolation of a CaM-binding protein, encoded by a cDNA with sequence similarity to small auxin up RNAs (SAURs), a class of early auxin-responsive genes. The cDNA designated as ZmSAUR1 (Zea mays SAURs) was expressed in Escherichia coli, and the recombinant protein was purified by CaM affinity chromatography. The CaM binding assay revealed that the recombinant protein binds to CaM in a calcium-dependent manner. Deletion analysis revealed that the CaM binding site was located at the NH(2)-terminal domain. A synthetic peptide of amino acids 20-45, corresponding to the potential CaM binding region, was used for calcium-dependent mobility shift assays. The synthetic peptide formed a stable complex with CaM only in the presence of calcium. The CaM affinity assay indicated that ZmSAUR1 binds to CaM with high affinity (K(d) approximately 15 nM) in a calcium-dependent manner. Comparison of the NH(2)-terminal portions of all of the characterized SAURs revealed that they all contain a stretch of the basic alpha-amphiphilic helix similar to the CaM binding region of ZmSAUR1. CaM binds to the two synthetic peptides from the NH(2)-terminal regions of Arabidopsis SAUR-AC1 and soybean 10A5, suggesting that this is a general phenomenon for all SAURs. Northern analysis was carried out using the total RNA isolated from auxin-treated corn coleoptile segments. ZmSAUR1 gene expression began within 10 min, increased rapidly between 10 and 60 min, and peaked around 60 min after 10 microM alpha-naphthaleneacetic acid treatment. These results indicate that ZmSAUR1 is an early auxin-responsive gene. The CaM antagonist N-(6-aminohexyl)5-chloro-1-naphthalenesulfonamide hydrochloride inhibited the auxin-induced cell elongation but not the auxin-induced expression of ZmSAUR1. This suggests that calcium/CaM do not regulate ZmSAUR1 at the transcriptional level. CaM binding to ZmSAUR1 in a calcium-dependent manner suggests that calcium/CaM regulate ZmSAUR1 at the post-translational level. Our data provide the first direct evidence for the involvement of calcium/CaM-mediated signaling in auxin-mediated signal transduction.

The SANT domain of human MI-ER1 interacts with Sp1 to interfere with GC box recognition and repress transcription from its own promoter.

PubMed

Ding, Zhihu; Gillespie, Laura L; Mercer, F Corinne; Paterno, Gary D

2004-07-02

To gain insight into the regulation of hmi-er1 expression, we cloned a human genomic DNA fragment containing one of the two hmi-er1 promoters and consisting of 1460 bp upstream of the translation initiation codon of hMI-ER1. Computer-assisted sequence analysis revealed that the hmi-er1 promoter region contains a CpG island but lacks an identifiable TATA element, initiator sequence and downstream promoter element. This genomic DNA was able to direct transcription of a luciferase reporter gene in a variety of human cell lines, and the minimal promoter was shown to be located within-68/+144 bp. Several putative Sp1 binding sites were identified, and we show that Sp1 can bind to the hmi-er1 minimal promoter and increase transcription, suggesting that the level of hmi-er1 expression may depend on the availability of Sp1 protein. Functional analysis revealed that hMI-ER1 represses Sp1-activated transcription from the minimal promoter by a histone deacetylase-independent mechanism. Chromatin immunoprecipitation analysis demonstrated that both Sp1 and hMI-ER1 are associated with the chromatin of the hmi-er1 promoter and that overexpression of hMI-ER1 in cell lines that allow Tet-On-inducible expression resulted in loss of detectable Sp1 from the endogenous hmi-er1 promoter. The mechanism by which this occurs does not involve binding of hMI-ER1 to cis-acting elements. Instead, we show that hMI-ER1 physically associates with Sp1 and that endogenous complexes containing the two proteins could be detected in vivo. Furthermore, hMI-ER1 specifically interferes with binding of Sp1 to the hmi-er1 minimal promoter as well as to an Sp1 consensus oligonucleotide. Deletion analysis revealed that this interaction occurs through a region containing the SANT domain of hMI-ER1. Together, these data reveal a functional role for the SANT domain in the action of co-repressor regulatory factors and suggest that the association of hMI-ER1 with Sp1 represents a novel mechanism for the negative regulation of Sp1 target promoters.

Structural analysis of Bacillus pumilus phenolic acid decarboxylase, a lipocalin-fold enzyme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matte, Allan; Grosse, Stephan; Bergeron, Hélène

The decarboxylation of phenolic acids, including ferulic and p-coumaric acids, to their corresponding vinyl derivatives is of importance in the flavoring and polymer industries. Here, the crystal structure of phenolic acid decarboxylase (PAD) from Bacillus pumilus strain UI-670 is reported. The enzyme is a 161-residue polypeptide that forms dimers both in the crystal and in solution. The structure of PAD as determined by X-ray crystallography revealed a -barrel structure and two -helices, with a cleft formed at one edge of the barrel. The PAD structure resembles those of the lipocalin-fold proteins, which often bind hydrophobic ligands. Superposition of structurally relatedmore » proteins bound to their cognate ligands shows that they and PAD bind their ligands in a conserved location within the -barrel. Analysis of the residue-conservation pattern for PAD-related sequences mapped onto the PAD structure reveals that the conservation mainly includes residues found within the hydrophobic core of the protein, defining a common lipocalin-like fold for this enzyme family. A narrow cleft containing several conserved amino acids was observed as a structural feature and a potential ligand-binding site.« less

Conformational analysis of the Streptococcus pneumoniae hyaluronate lyase and characterization of its hyaluronan-specific carbohydrate-binding module.

PubMed

Suits, Michael D L; Pluvinage, Benjamin; Law, Adrienne; Liu, Yan; Palma, Angelina S; Chai, Wengang; Feizi, Ten; Boraston, Alisdair B

2014-09-26

For a subset of pathogenic microorganisms, including Streptococcus pneumoniae, the recognition and degradation of host hyaluronan contributes to bacterial spreading through the extracellular matrix and enhancing access to host cell surfaces. The hyaluronate lyase (Hyl) presented on the surface of S. pneumoniae performs this role. Using glycan microarray screening, affinity electrophoresis, and isothermal titration calorimetry we show that the N-terminal module of Hyl is a hyaluronan-specific carbohydrate-binding module (CBM) and the founding member of CBM family 70. The 1.2 Å resolution x-ray crystal structure of CBM70 revealed it to have a β-sandwich fold, similar to other CBMs. The electrostatic properties of the binding site, which was identified by site-directed mutagenesis, are distinct from other CBMs and complementary to its acidic ligand, hyaluronan. Dynamic light scattering and solution small angle x-ray scattering revealed the full-length Hyl protein to exist as a monomer/dimer mixture in solution. Through a detailed analysis of the small angle x-ray scattering data, we report the pseudoatomic solution structures of the monomer and dimer forms of the full-length multimodular Hyl. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

A High Throughput Protein Microarray Approach to Classify HIV Monoclonal Antibodies and Variant Antigens

PubMed Central

Dotsey, Emmanuel Y.; Gorlani, Andrea; Ingale, Sampat; Achenbach, Chad J.; Forthal, Donald N.; Felgner, Philip L.; Gach, Johannes S.

2015-01-01

In recent years, high throughput discovery of human recombinant monoclonal antibodies (mAbs) has been applied to greatly advance our understanding of the specificity, and functional activity of antibodies against HIV. Thousands of antibodies have been generated and screened in functional neutralization assays, and antibodies associated with cross-strain neutralization and passive protection in primates, have been identified. To facilitate this type of discovery, a high throughput-screening tool is needed to accurately classify mAbs, and their antigen targets. In this study, we analyzed and evaluated a prototype microarray chip comprised of the HIV-1 recombinant proteins gp140, gp120, gp41, and several membrane proximal external region peptides. The protein microarray analysis of 11 HIV-1 envelope-specific mAbs revealed diverse binding affinities and specificities across clades. Half maximal effective concentrations, generated by our chip analysis, correlated significantly (P<0.0001) with concentrations from ELISA binding measurements. Polyclonal immune responses in plasma samples from HIV-1 infected subjects exhibited different binding patterns, and reactivity against printed proteins. Examining the totality of the specificity of the humoral response in this way reveals the exquisite diversity, and specificity of the humoral response to HIV. PMID:25938510

Crystal Structure of the FERM-SH2 Module of Human Jak2.

PubMed

McNally, Randall; Toms, Angela V; Eck, Michael J

2016-01-01

Jak-family tyrosine kinases mediate signaling from diverse cytokine receptors. Binding of Jaks to their cognate receptors is mediated by their N-terminal region, which contains FERM and SH2 domains. Here we describe the crystal structure of the FERM-SH2 region of Jak2 at 3.0Å resolution. The structure reveals that these domains and their flanking linker segments interact intimately to form an integrated structural module. The Jak2 FERM-SH2 structure closely resembles that recently described for Tyk2, another member of the Jak family. While the overall architecture and interdomain orientations are preserved between Jak2 and Tyk2, we identify residues in the putative receptor-binding groove that differ between the two and may contribute to the specificity of receptor recognition. Analysis of Jak mutations that are reported to disrupt receptor binding reveals that they lie in the hydrophobic core of the FERM domain, and are thus expected to compromise the structural integrity of the FERM-SH2 unit. Similarly, analysis of mutations in Jak3 that are associated with severe combined immunodeficiency suggests that they compromise Jak3 function by destabilizing the FERM-SH2 structure.

Binding of puerarin to human serum albumin: a spectroscopic analysis and molecular docking.

PubMed

He, Yang; Wang, Yiwei; Tang, Lifei; Liu, Hui; Chen, Wei; Zheng, Zhongliang; Zou, Guolin

2008-03-01

Puerarin is a widely used compound in Chinese traditional medicine and exhibits many pharmacological activities. Binding of puerarin to human serum albumin (HSA) was investigated by ultraviolet absorbance, fluorescence, circular dichroism and molecular docking. Puerarin caused a static quenching of intrinsic fluorescence of HSA, the quenching data was analyzed by Stern-Volmer equation. There was one primary puerarin binding site on HSA with a binding constant of 4.12 x 10(4) M(-1) at 298 K. Thermodynamic analysis by Van Hoff equation found enthalpy change (DeltaH(0)) and entropy change (DeltaS(0)) were -28.01 kJ/mol and -5.63 J/mol K respectively, which indicated the hydrogen bond and Van der Waas interaction were the predominant forces in the binding process. Competitive experiments showed a displacement of warfarin by puerarin, which revealed that the binding site was located at the drug site I. Puerarin was about 2.22 nm far from the tryptophan according to the observed fluorescence resonance energy transfer between HSA and puerarin. Molecular docking suggested the hydrophobic residues such as tyrosine (Tyr) 150, Tyr 148, Tyr 149 and polar residues such as lysine (Lys) 199, Lys 195, arginine 257 and histidine 242 played an important role in the binding reaction.

Molecular modeling and SPRi investigations of interleukin 6 (IL6) protein and DNA aptamers.

PubMed

Rhinehardt, Kristen L; Vance, Stephen A; Mohan, Ram V; Sandros, Marinella; Srinivas, Goundla

2018-06-01

Interleukin 6 (IL6), an inflammatory response protein has major implications in immune-related inflammatory diseases. Identification of aptamers for the IL6 protein aids in diagnostic, therapeutic, and theranostic applications. Three different DNA aptamers and their interactions with IL6 protein were extensively investigated in a phosphate buffed saline (PBS) solution. Molecular-level modeling through molecular dynamics provided insights of structural, conformational changes and specific binding domains of these protein-aptamer complexes. Multiple simulations reveal consistent binding region for all protein-aptamer complexes. Conformational changes coupled with quantitative analysis of center of mass (COM) distance, radius of gyration (R g ), and number of intermolecular hydrogen bonds in each IL6 protein-aptamer complex was used to determine their binding performance strength and obtain molecular configurations with strong binding. A similarity comparison of the molecular configurations with strong binding from molecular-level modeling concurred with Surface Plasmon Resonance imaging (SPRi) for these three aptamer complexes, thus corroborating molecular modeling analysis findings. Insights from the natural progression of IL6 protein-aptamer binding modeled in this work has identified key features such as the orientation and location of the aptamer in the binding event. These key features are not readily feasible from wet lab experiments and impact the efficacy of the aptamers in diagnostic and theranostic applications.

Expanding RNA binding specificity and affinity of engineered PUF domains.

PubMed

Zhao, Yang-Yang; Mao, Miao-Wei; Zhang, Wen-Jing; Wang, Jue; Li, Hai-Tao; Yang, Yi; Wang, Zefeng; Wu, Jia-Wei

2018-05-18

Specific manipulation of RNA is necessary for the research in biotechnology and medicine. The RNA-binding domains of Pumilio/fem-3 mRNA binding factors (PUF domains) are programmable RNA binding scaffolds used to engineer artificial proteins that specifically modulate RNAs. However, the native PUF domains generally recognize 8-nt RNAs, limiting their applications. Here, we modify the PUF domain of human Pumilio1 to engineer PUFs that recognize RNA targets of different length. The engineered PUFs bind to their RNA targets specifically and PUFs with more repeats have higher binding affinity than the canonical eight-repeat domains; however, the binding affinity reaches the peak at those with 9 and 10 repeats. Structural analysis on PUF with nine repeats reveals a higher degree of curvature, and the RNA binding unexpectedly and dramatically opens the curved structure. Investigation of the residues positioned in between two RNA bases demonstrates that tyrosine and arginine have favored stacking interactions. Further tests on the availability of the engineered PUFs in vitro and in splicing function assays indicate that our engineered PUFs bind RNA targets with high affinity in a programmable way.

Expanding RNA binding specificity and affinity of engineered PUF domains

PubMed Central

Zhao, Yang-Yang; Zhang, Wen-Jing; Wang, Jue; Li, Hai-Tao; Yang, Yi; Wang, Zefeng; Wu, Jia-Wei

2018-01-01

Abstract Specific manipulation of RNA is necessary for the research in biotechnology and medicine. The RNA-binding domains of Pumilio/fem-3 mRNA binding factors (PUF domains) are programmable RNA binding scaffolds used to engineer artificial proteins that specifically modulate RNAs. However, the native PUF domains generally recognize 8-nt RNAs, limiting their applications. Here, we modify the PUF domain of human Pumilio1 to engineer PUFs that recognize RNA targets of different length. The engineered PUFs bind to their RNA targets specifically and PUFs with more repeats have higher binding affinity than the canonical eight-repeat domains; however, the binding affinity reaches the peak at those with 9 and 10 repeats. Structural analysis on PUF with nine repeats reveals a higher degree of curvature, and the RNA binding unexpectedly and dramatically opens the curved structure. Investigation of the residues positioned in between two RNA bases demonstrates that tyrosine and arginine have favored stacking interactions. Further tests on the availability of the engineered PUFs in vitro and in splicing function assays indicate that our engineered PUFs bind RNA targets with high affinity in a programmable way. PMID:29490074

Fragments of Bacterial Endoglycosidase S and Immunoglobulin G Reveal Subdomains of Each That Contribute to Deglycosylation*

PubMed Central

Dixon, Emma V.; Claridge, Jolyon K.; Harvey, David J.; Baruah, Kavitha; Yu, Xiaojie; Vesiljevic, Snezana; Mattick, Susan; Pritchard, Laura K.; Krishna, Benjamin; Scanlan, Christopher N.; Schnell, Jason R.; Higgins, Matthew K.; Zitzmann, Nicole; Crispin, Max

2014-01-01

Endoglycosidase S (EndoS) is a glycoside-hydrolase secreted by the bacterium Streptococcus pyogenes. EndoS preferentially hydrolyzes the N-linked glycans from the Fc region of IgG during infection. This hydrolysis impedes Fc functionality and contributes to the immune evasion strategy of S. pyogenes. Here, we investigate the mechanism of human serum IgG deactivation by EndoS. We expressed fragments of IgG1 and demonstrated that EndoS was catalytically active against all of them including the isolated CH2 domain of the Fc domain. Similarly, we sought to investigate which domains within EndoS could contribute to activity. Bioinformatics analysis of the domain organization of EndoS confirmed the previous predictions of a chitinase domain and leucine-rich repeat but also revealed a putative carbohydrate binding module (CBM) followed by a C-terminal region. Using expressed fragments of EndoS, circular dichroism of the isolated CBM, and a CBM-C-terminal region fusion revealed folded domains dominated by β sheet and α helical structure, respectively. Nuclear magnetic resonance analysis of the CBM with monosaccharides was suggestive of carbohydrate binding functionality. Functional analysis of truncations of EndoS revealed that, whereas the C-terminal of EndoS is dispensable for activity, its deletion impedes the hydrolysis of IgG glycans. PMID:24668806

Molecular dynamics and principal components of potassium binding with human telomeric intra-molecular G-quadruplex.

PubMed

Wang, Zhiguo; Chen, Ruping; Hou, Ling; Li, Jianfeng; Liu, Jun-Ping

2015-06-01

Telomere assumes intra-molecular G-quadruplex that is a significant drug target for inhibiting telomerase maintenance of telomeres in cancer. Metal cations have been recognized as playing important roles in stabilizing G-quadruplex, but their binding processes to human telomeric G-quadruplex remain uncharacterized. To investigate the detailed binding procedures, molecular dynamics simulations were conducted on the hybrid [3 + 1] form-one human telomeric intra-molecular G-quadruplex. We show here that the binding of a potassium ion to a G-tetrad core is mediated by two alternative pathways. Principal component analysis illustrated the dominant concerted motions of G-quadruplex occurred at the loop domains. MM-PBSA calculations revealed that binding was energetically favorable and driven by the electrostatic interactions. The lower binding site was found more constructive favorable for binding. Our data provide useful information on a potassium-mediated stable structure of human telomeric intra-molecular G-quadruplex, implicating in ion disorder associated conformational changes and targeted drug design.

Conformational selection in a protein-protein interaction revealed by dynamic pathway analysis

DOE PAGES

Chakrabarti, Kalyan S.; Agafonov, Roman V.; Pontiggia, Francesco; ...

2015-12-24

Molecular recognition plays a central role in biology, and protein dynamics has been acknowledged to be important in this process. However, it is highly debated whether conformational changes happen before ligand binding to produce a binding-competent state (conformational selection) or are caused in response to ligand binding (induced fit). Proposals for both mechanisms in protein/protein recognition have been primarily based on structural arguments. However, the distinction between them is a question of the probabilities of going via these two opposing pathways. Here we present a direct demonstration of exclusive conformational selection in protein/protein recognition by measuring the flux for rhodopsinmore » kinase binding to its regulator recoverin, an important molecular recognition in the vision system. Using NMR spectroscopy, stopped-flow kinetics and isothermal titration calorimetry we show that recoverin populates a minor conformation in solution that exposes a hydrophobic binding pocket responsible for binding rhodopsin kinase. Lastly, protein dynamics in free recoverin limits the overall rate of binding.« less

Human mRNA polyadenylate binding protein: evolutionary conservation of a nucleic acid binding motif.

PubMed Central

Grange, T; de Sa, C M; Oddos, J; Pictet, R

1987-01-01

We have isolated a full length cDNA (cDNA) coding for the human poly(A) binding protein. The cDNA derived 73 kd basic translation product has the same Mr, isoelectric point and peptidic map as the poly(A) binding protein. DNA sequence analysis reveals a 70,244 dalton protein. The N terminal part, highly homologous to the yeast poly(A) binding protein, is sufficient for poly(A) binding activity. This domain consists of a four-fold repeated unit of approximately 80 amino acids present in other nucleic acid binding proteins. In the C terminal part there is, as in the yeast protein, a sequence of approximately 150 amino acids, rich in proline, alanine and glutamine which together account for 48% of the residues. A 2,9 kb mRNA corresponding to this cDNA has been detected in several vertebrate cell types and in Drosophila melanogaster at every developmental stage including oogenesis. Images PMID:2885805

Conformational selection in a protein-protein interaction revealed by dynamic pathway analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakrabarti, Kalyan S.; Agafonov, Roman V.; Pontiggia, Francesco

Molecular recognition plays a central role in biology, and protein dynamics has been acknowledged to be important in this process. However, it is highly debated whether conformational changes happen before ligand binding to produce a binding-competent state (conformational selection) or are caused in response to ligand binding (induced fit). Proposals for both mechanisms in protein/protein recognition have been primarily based on structural arguments. However, the distinction between them is a question of the probabilities of going via these two opposing pathways. Here we present a direct demonstration of exclusive conformational selection in protein/protein recognition by measuring the flux for rhodopsinmore » kinase binding to its regulator recoverin, an important molecular recognition in the vision system. Using NMR spectroscopy, stopped-flow kinetics and isothermal titration calorimetry we show that recoverin populates a minor conformation in solution that exposes a hydrophobic binding pocket responsible for binding rhodopsin kinase. Lastly, protein dynamics in free recoverin limits the overall rate of binding.« less

Molecular Dissection of Xyloglucan Recognition in a Prominent Human Gut Symbiont

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tauzin, Alexandra S.; Kwiatkowski, Kurt J.; Orlovsky, Nicole I.

Polysaccharide utilization loci (PUL) within the genomes of resident human gutBacteroidetesare central to the metabolism of the otherwise indigestible complex carbohydrates known as “dietary fiber.” However, functional characterization of PUL lags significantly behind sequencing efforts, which limits physiological understanding of the human-bacterial symbiosis. In particular, the molecular basis of complex polysaccharide recognition, an essential prerequisite to hydrolysis by cell surface glycosidases and subsequent metabolism, is generally poorly understood. Here, we present the biochemical, structural, and reverse genetic characterization of two unique cell surface glycan-binding proteins (SGBPs) encoded by a xyloglucan utilization locus (XyGUL) fromBacteroides ovatus, which are integral to growthmore » on this key dietary vegetable polysaccharide. Biochemical analysis reveals that these outer membrane-anchored proteins are in fact exquisitely specific for the highly branched xyloglucan (XyG) polysaccharide. The crystal structure of SGBP-A, a SusD homolog, with a bound XyG tetradecasaccharide reveals an extended carbohydrate-binding platform that primarily relies on recognition of the β-glucan backbone. The unique, tetra-modular structure of SGBP-B is comprised of tandem Ig-like folds, with XyG binding mediated at the distal C-terminal domain. Despite displaying similar affinities for XyG, reverse-genetic analysis reveals that SGBP-B is only required for the efficient capture of smaller oligosaccharides, whereas the presence of SGBP-A is more critical than its carbohydrate-binding ability for growth on XyG. Finally, together, these data demonstrate that SGBP-A and SGBP-B play complementary, specialized roles in carbohydrate capture byB. ovatusand elaborate a model of how vegetable xyloglucans are accessed by theBacteroidetes.« less

Molecular Dissection of Xyloglucan Recognition in a Prominent Human Gut Symbiont

DOE PAGES

Tauzin, Alexandra S.; Kwiatkowski, Kurt J.; Orlovsky, Nicole I.; ...

2016-04-26

Polysaccharide utilization loci (PUL) within the genomes of resident human gutBacteroidetesare central to the metabolism of the otherwise indigestible complex carbohydrates known as “dietary fiber.” However, functional characterization of PUL lags significantly behind sequencing efforts, which limits physiological understanding of the human-bacterial symbiosis. In particular, the molecular basis of complex polysaccharide recognition, an essential prerequisite to hydrolysis by cell surface glycosidases and subsequent metabolism, is generally poorly understood. Here, we present the biochemical, structural, and reverse genetic characterization of two unique cell surface glycan-binding proteins (SGBPs) encoded by a xyloglucan utilization locus (XyGUL) fromBacteroides ovatus, which are integral to growthmore » on this key dietary vegetable polysaccharide. Biochemical analysis reveals that these outer membrane-anchored proteins are in fact exquisitely specific for the highly branched xyloglucan (XyG) polysaccharide. The crystal structure of SGBP-A, a SusD homolog, with a bound XyG tetradecasaccharide reveals an extended carbohydrate-binding platform that primarily relies on recognition of the β-glucan backbone. The unique, tetra-modular structure of SGBP-B is comprised of tandem Ig-like folds, with XyG binding mediated at the distal C-terminal domain. Despite displaying similar affinities for XyG, reverse-genetic analysis reveals that SGBP-B is only required for the efficient capture of smaller oligosaccharides, whereas the presence of SGBP-A is more critical than its carbohydrate-binding ability for growth on XyG. Finally, together, these data demonstrate that SGBP-A and SGBP-B play complementary, specialized roles in carbohydrate capture byB. ovatusand elaborate a model of how vegetable xyloglucans are accessed by theBacteroidetes.« less

Molecular Dissection of Xyloglucan Recognition in a Prominent Human Gut Symbiont

PubMed Central

Tauzin, Alexandra S.; Kwiatkowski, Kurt J.; Orlovsky, Nicole I.; Smith, Christopher J.; Creagh, A. Louise; Haynes, Charles A.; Wawrzak, Zdzislaw

2016-01-01

ABSTRACT Polysaccharide utilization loci (PUL) within the genomes of resident human gut Bacteroidetes are central to the metabolism of the otherwise indigestible complex carbohydrates known as “dietary fiber.” However, functional characterization of PUL lags significantly behind sequencing efforts, which limits physiological understanding of the human-bacterial symbiosis. In particular, the molecular basis of complex polysaccharide recognition, an essential prerequisite to hydrolysis by cell surface glycosidases and subsequent metabolism, is generally poorly understood. Here, we present the biochemical, structural, and reverse genetic characterization of two unique cell surface glycan-binding proteins (SGBPs) encoded by a xyloglucan utilization locus (XyGUL) from Bacteroides ovatus, which are integral to growth on this key dietary vegetable polysaccharide. Biochemical analysis reveals that these outer membrane-anchored proteins are in fact exquisitely specific for the highly branched xyloglucan (XyG) polysaccharide. The crystal structure of SGBP-A, a SusD homolog, with a bound XyG tetradecasaccharide reveals an extended carbohydrate-binding platform that primarily relies on recognition of the β-glucan backbone. The unique, tetra-modular structure of SGBP-B is comprised of tandem Ig-like folds, with XyG binding mediated at the distal C-terminal domain. Despite displaying similar affinities for XyG, reverse-genetic analysis reveals that SGBP-B is only required for the efficient capture of smaller oligosaccharides, whereas the presence of SGBP-A is more critical than its carbohydrate-binding ability for growth on XyG. Together, these data demonstrate that SGBP-A and SGBP-B play complementary, specialized roles in carbohydrate capture by B. ovatus and elaborate a model of how vegetable xyloglucans are accessed by the Bacteroidetes. PMID:27118585

LncRNA/DNA binding analysis reveals losses and gains and lineage specificity of genomic imprinting in mammals.

PubMed

Liu, Haihua; Shang, Xiaoxiao; Zhu, Hao

2017-05-15

Genomic imprinting is regulated by lncRNAs and is important for embryogenesis, physiology and behaviour in mammals. Aberrant imprinting causes diseases and disorders. Experimental studies have examined genomic imprinting primarily in humans and mice, thus leaving some fundamental issues poorly addressed. The cost of experimentally examining imprinted genes in many tissues in diverse species makes computational analysis of lncRNAs' DNA binding sites valuable. We performed lncRNA/DNA binding analysis in imprinting clusters from multiple mammalian clades and discovered the following: (i) lncRNAs and imprinting sites show significant losses and gains and distinct lineage-specificity; (ii) binding of lncRNAs to promoters of imprinted genes may occur widely throughout the genome; (iii) a considerable number of imprinting sites occur in only evolutionarily more derived species; and (iv) multiple lncRNAs may bind to the same imprinting sites, and some lncRNAs have multiple DNA binding motifs. These results suggest that the occurrence of abundant lncRNAs in mammalian genomes makes genomic imprinting a mechanism of adaptive evolution at the epigenome level. The data and program are available at the database LongMan at lncRNA.smu.edu.cn. zhuhao@smu.edu.cn. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Synthesis of two fluorescent GTPγS molecules and their biological relevance.

PubMed

Trans, Denise J; Bai, Ruoli; Addison, J Bennet; Liu, Ruiwu; Hamel, Ernest; Coleman, Matthew A; Henderson, Paul T

2017-06-03

Fluorescent GTP analogues are utilized for an assortment of nucleic acid and protein characterization studies. Non-hydrolysable analogues such as GTPγS offer the advantage of keeping proteins in a GTP-bound conformation due to their resistance to hydrolysis into GDP. Two novel fluorescent GTPγS molecules were developed by linking fluorescein and tetramethylrhodamine to the γ-thiophosphate of GTPγS. Chemical and biological analysis of these two compounds revealed their successful synthesis and ability to bind to the nucleotide-binding site of tubulin. These two new fluorescent non-hydrolysable nucleotides offer new possibilities for biophysical and biochemical characterization of GTP-binding proteins.

The importance of hydration thermodynamics in fragment-to-lead optimization.

PubMed

Ichihara, Osamu; Shimada, Yuzo; Yoshidome, Daisuke

2014-12-01

Using a computational approach to assess changes in solvation thermodynamics upon ligand binding, we investigated the effects of water molecules on the binding energetics of over 20 fragment hits and their corresponding optimized lead compounds. Binding activity and X-ray crystallographic data of published fragment-to-lead optimization studies from various therapeutically relevant targets were studied. The analysis reveals a distinct difference between the thermodynamic profile of water molecules displaced by fragment hits and those displaced by the corresponding optimized lead compounds. Specifically, fragment hits tend to displace water molecules with notably unfavorable excess entropies-configurationally constrained water molecules-relative to those displaced by the newly added moieties of the lead compound during the course of fragment-to-lead optimization. Herein we describe the details of this analysis with the goal of providing practical guidelines for exploiting thermodynamic signatures of binding site water molecules in the context of fragment-to-lead optimization. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

An additional substrate binding site in a bacterial phenylalanine hydroxylase

PubMed Central

Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

2014-01-01

Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

Spectroscopic profiling and computational study of the binding of tschimgine: A natural monoterpene derivative, with calf thymus DNA.

PubMed

Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad

2018-03-05

DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (K b ) between TMG and DNA was 2.27×10 4 M -1 , that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH<0 and ΔS<0) at different temperatures indicated that van der Waals forces and hydrogen bonds were involved in the binding process of TMG with CT-DNA. Competitive binding assay with methylene blue (MB) and Hoechst 33258 using fluorescence spectroscopy displayed that TMG possibly binds to the minor groove of CT-DNA. These observations were further confirmed by CD spectral analysis, viscosity measurements and molecular docking. Copyright © 2017 Elsevier B.V. All rights reserved.

The structure of the SBP-Tag–streptavidin complex reveals a novel helical scaffold bridging binding pockets on separate subunits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barrette-Ng, Isabelle H.; Wu, Sau-Ching; Tjia, Wai-Mui

2013-05-01

The structure of the SBP-Tag–streptavidin complex reveals a novel mode of peptide recognition in which a single peptide binds simultaneously to biotin-binding pockets from adjacent subunits of streptavidin. The molecular details of peptide recognition suggest how the SBP-Tag can be further modified to become an even more useful tag for a wider range of biotechnological applications. The 38-residue SBP-Tag binds to streptavidin more tightly (K{sub d} ≃ 2.5–4.9 nM) than most if not all other known peptide sequences. Crystallographic analysis at 1.75 Å resolution shows that the SBP-Tag binds to streptavidin in an unprecedented manner by simultaneously interacting with biotin-bindingmore » pockets from two separate subunits. An N-terminal HVV peptide sequence (residues 12–14) and a C-terminal HPQ sequence (residues 31–33) form the bulk of the direct interactions between the SBP-Tag and the two biotin-binding pockets. Surprisingly, most of the peptide spanning these two sites (residues 17–28) adopts a regular α-helical structure that projects three leucine side chains into a groove formed at the interface between two streptavidin protomers. The crystal structure shows that residues 1–10 and 35–38 of the original SBP-Tag identified through in vitro selection and deletion analysis do not appear to contact streptavidin and thus may not be important for binding. A 25-residue peptide comprising residues 11–34 (SBP-Tag2) was synthesized and shown using surface plasmon resonance to bind streptavidin with very similar affinity and kinetics when compared with the SBP-Tag. The SBP-Tag2 was also added to the C-terminus of β-lactamase and was shown to be just as effective as the full-length SBP-Tag in affinity purification. These results validate the molecular structure of the SBP-Tag–streptavidin complex and establish a minimal bivalent streptavidin-binding tag from which further rational design and optimization can proceed.« less

Increased thyrotropin binding in hyperfunctioning thyroid nodules.

PubMed

Müller-Gärtner, H W; Schneider, C; Bay, V; Tadt, A; Rehpenning, W; de Heer, K; Jessel, M

1987-08-01

The object of this study was to investigate TSH receptors in hyperfunctioning thyroid nodules (HFN). In HFN, obtained from seven patients, 125-I-TSH binding as determined by equilibrium binding analysis on particulate membrane preparations, was found to be significantly increased as compared with normal thyroid tissues (five patients; P less than 0.001). Scatchard analysis of TSH-binding revealed two kinds of binding sites for both normal thyroid tissue and HFN, and displayed significantly increased association constants of high- and low-affinity binding sites in HFN (Ka = 11.75 +/- 6.8 10(9) M-1, P less than 0.001 and Ka = 2.1 +/- 1.0 10(7) M-1, P less than 0.025; x +/- SEM) as compared with normal thyroid tissue (Ka = 0.25 +/- 0.06 10(9) M-1, Ka = 0.14 +/- 0.03 10(7) M-1; x +/- SEM). The capacity of the high-affinity binding sites in HFN was found to be decreased (1.8 +/- 1.1 pmol/mg protein, x +/- SEM) in comparison with normal thyroid tissue (4.26 +/- 1.27 pmol/mg protein; x +/- SEM). TSH-receptor autoradiography applied to cryostatic tissue sections confirmed increased TSH binding of the follicular epithelium in HFN. These data suggest that an increased affinity of TSH-receptor sites in HFN in iodine deficient areas may be an important event in thyroid autonomy.

Diffusional encounter of barnase and barstar.

PubMed

Spaar, Alexander; Dammer, Christian; Gabdoulline, Razif R; Wade, Rebecca C; Helms, Volkhard

2006-03-15

We present an analysis of trajectories from Brownian dynamics simulations of diffusional protein-protein encounter for the well-studied system of barnase and barstar. This analysis reveals details about the optimal association pathways, the regions of the encounter complex, possible differences of the pathways for dissociation and association, the coupling of translational and rotation motion, and the effect of mutations on the trajectories. We found that a small free-energy barrier divides the energetically most favorable region into a region of the encounter complex above the barnase binding interface and a region around a second energy minimum near the RNA binding loop. When entering the region of the encounter complex from the region near the RNA binding loop, barstar has to change its orientation to increase the electrostatic attraction between the proteins. By concentrating the analysis on the successful binding trajectories, we found that the region of the second minimum is not essential for the binding of barstar to barnase. Nevertheless, this region may be helpful to steer barstar into the region of the encounter complex. When applying the same analysis to several barnase mutants, we found that single mutations may drastically change the free-energy landscape and may significantly alter the population of the two minima. Therefore, certain protein-protein pairs may require careful adaptation of the positions of encounter and transition states when interpreting mutation effects on kinetic rates of association and/or dissociation.

Models of metal binding structures in fulvic acid from the Suwannee River, Georgia

USGS Publications Warehouse

Leenheer, J.A.; Brown, G.K.; MacCarthy, P.; Cabaniss, S.E.

1998-01-01

Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca2+, Cd2+, Cu2+, Ni2+, and Zn2+ ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca2+ ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The 'metal binding' fraction was characterized by quantitative 13C NMR, 1H NMR, and FT-1R spectrometry and elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short- chain aliphatic dibasic acid structures. The Ca2+ binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca2+, Cd2+, Cu2+, Ni2+, and Zn2+ ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca2+ ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The `metal binding' fraction was characterized by quantitative 13C NMR, 1H NMR, and FT-IR spectrometry and elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short-chain aliphatic dibasic acid structures. The Ca2+ binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.

Mycobacterium tuberculosis Universal Stress Protein Rv2623 Regulates Bacillary Growth by ATP Binding: Requirement for Establishing Chronic Persistent Infection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Drumm, J.; Mi, K; Bilder, P

Tuberculous latency and reactivation play a significant role in the pathogenesis of tuberculosis, yet the mechanisms that regulate these processes remain unclear. The Mycobacterium tuberculosisuniversal stress protein (USP) homolog, rv2623, is among the most highly induced genes when the tubercle bacillus is subjected to hypoxia and nitrosative stress, conditions thought to promote latency. Induction of rv2623 also occurs when M. tuberculosis encounters conditions associated with growth arrest, such as the intracellular milieu of macrophages and in the lungs of mice with chronic tuberculosis. Therefore, we tested the hypothesis that Rv2623 regulates tuberculosis latency. We observed that an Rv2623-deficient mutant failsmore » to establish chronic tuberculous infection in guinea pigs and mice, exhibiting a hypervirulence phenotype associated with increased bacterial burden and mortality. Consistent with this in vivo growth-regulatory role, constitutive overexpression of rv2623 attenuates mycobacterial growth in vitro. Biochemical analysis of purified Rv2623 suggested that this mycobacterial USP binds ATP, and the 2.9-A-resolution crystal structure revealed that Rv2623 engages ATP in a novel nucleotide-binding pocket. Structure-guided mutagenesis yielded Rv2623 mutants with reduced ATP-binding capacity. Analysis of mycobacteria overexpressing these mutants revealed that the in vitro growth-inhibitory property of Rv2623 correlates with its ability to bind ATP. Together, the results indicate that i M. tuberculosis Rv2623 regulates mycobacterial growth in vitro and in vivo, and ii Rv2623 is required for the entry of the tubercle bacillus into the chronic phase of infection in the host; in addition, iii Rv2623 binds ATP; and iv the growth-regulatory attribute of this USP is dependent on its ATP-binding activity. We propose that Rv2623 may function as an ATP-dependent signaling intermediate in a pathway that promotes persistent infection.« less

Focused Evolution of HIV-1 Neutralizing Antibodies Revealed by Structures and Deep Sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Xueling; Zhou, Tongqing; Zhu, Jiang

2013-03-04

Antibody VRC01 is a human immunoglobulin that neutralizes about 90% of HIV-1 isolates. To understand how such broadly neutralizing antibodies develop, we used x-ray crystallography and 454 pyrosequencing to characterize additional VRC01-like antibodies from HIV-1-infected individuals. Crystal structures revealed a convergent mode of binding for diverse antibodies to the same CD4-binding-site epitope. A functional genomics analysis of expressed heavy and light chains revealed common pathways of antibody-heavy chain maturation, confined to the IGHV1-2*02 lineage, involving dozens of somatic changes, and capable of pairing with different light chains. Broadly neutralizing HIV-1 immunity associated with VRC01-like antibodies thus involves the evolution ofmore » antibodies to a highly affinity-matured state required to recognize an invariant viral structure, with lineages defined from thousands of sequences providing a genetic roadmap of their development.« less

Genome Sequencing and Comparative Analysis of Stenotrophomonas acidaminiphila Reveal Evolutionary Insights Into Sulfamethoxazole Resistance.

PubMed

Huang, Yao-Ting; Chen, Jia-Min; Ho, Bing-Ching; Wu, Zong-Yen; Kuo, Rita C; Liu, Po-Yu

2018-01-01

Stenotrophomonas acidaminiphila is an aerobic, glucose non-fermentative, Gram-negative bacterium that been isolated from various environmental sources, particularly aquatic ecosystems. Although resistance to multiple antimicrobial agents has been reported in S. acidaminiphila , the mechanisms are largely unknown. Here, for the first time, we report the complete genome and antimicrobial resistome analysis of a clinical isolate S. acidaminiphila SUNEO which is resistant to sulfamethoxazole. Comparative analysis among closely related strains identified common and strain-specific genes. In particular, comparison with a sulfamethoxazole-sensitive strain identified a mutation within the sulfonamide-binding site of folP in SUNEO, which may reduce the binding affinity of sulfamethoxazole. Selection pressure analysis indicated folP in SUNEO is under purifying selection, which may be owing to long-term administration of sulfonamide against Stenotrophomonas .

An Investigation of Molecular Docking and Molecular Dynamic Simulation on Imidazopyridines as B-Raf Kinase Inhibitors.

PubMed

Xie, Huiding; Li, Yupeng; Yu, Fang; Xie, Xiaoguang; Qiu, Kaixiong; Fu, Jijun

2015-11-16

In the recent cancer treatment, B-Raf kinase is one of key targets. Nowadays, a group of imidazopyridines as B-Raf kinase inhibitors have been reported. In order to investigate the interaction between this group of inhibitors and B-Raf kinase, molecular docking, molecular dynamic (MD) simulation and binding free energy (ΔGbind) calculation were performed in this work. Molecular docking was carried out to identify the key residues in the binding site, and MD simulations were performed to determine the detail binding mode. The results obtained from MD simulation reveal that the binding site is stable during the MD simulations, and some hydrogen bonds (H-bonds) in MD simulations are different from H-bonds in the docking mode. Based on the obtained MD trajectories, ΔGbind was computed by using Molecular Mechanics Generalized Born Surface Area (MM-GBSA), and the obtained energies are consistent with the activities. An energetic analysis reveals that both electrostatic and van der Waals contributions are important to ΔGbind, and the unfavorable polar solvation contribution results in the instability of the inhibitor with the lowest activity. These results are expected to understand the binding between B-Raf and imidazopyridines and provide some useful information to design potential B-Raf inhibitors.

Blocking of Single α-Hemolysin Pore by Rhodamine Derivatives.

PubMed

Rokitskaya, Tatyana I; Nazarov, Pavel A; Golovin, Andrey V; Antonenko, Yuri N

2017-06-06

Measurements of ion conductance through α-hemolysin pore in a bilayer lipid membrane revealed blocking of the ion channel by a series of rhodamine 19 and rhodamine B esters. The longest dwell closed time of the blocking was observed with rhodamine 19 butyl ester (C4R1), whereas the octyl ester (C8R1) was of poor effect. Voltage asymmetry in the binding kinetics indicated that rhodamine derivatives bound to the stem part of the aqueous pore lumen. The binding frequency was proportional to a quadratic function of rhodamine concentrations, thereby showing that the dominant binding species were rhodamine dimers. Two levels of the pore conductance and two dwell closed times of the pore were found. The dwell closed times lengthened as the voltage increased, suggesting impermeability of the channel for the ligands. Molecular docking analysis revealed two distinct binding sites within the lumen of the stem of the α-hemolysin pore for the C4R1 dimer, but only one binding site for the C8R1 dimer. The blocking of the α-hemolysin nanopore by rhodamines could be utilized in DNA sequencing as additional optical sensing owing to bright fluorescence of rhodamines if used for DNA labeling. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Arabidopsis chloroplast chaperonin 10 is a calmodulin-binding protein

NASA Technical Reports Server (NTRS)

Yang, T.; Poovaiah, B. W.

2000-01-01

Calcium regulates diverse cellular activities in plants through the action of calmodulin (CaM). By using (35)S-labeled CaM to screen an Arabidopsis seedling cDNA expression library, a cDNA designated as AtCh-CPN10 (Arabidopsis thaliana chloroplast chaperonin 10) was cloned. Chloroplast CPN10, a nuclear-encoded protein, is a functional homolog of E. coli GroES. It is believed that CPN60 and CPN10 are involved in the assembly of Rubisco, a key enzyme involved in the photosynthetic pathway. Northern analysis revealed that AtCh-CPN10 is highly expressed in green tissues. The recombinant AtCh-CPN10 binds to CaM in a calcium-dependent manner. Deletion mutants revealed that there is only one CaM-binding site in the last 31 amino acids of the AtCh-CPN10 at the C-terminal end. The CaM-binding region in AtCh-CPN10 has higher homology to other chloroplast CPN10s in comparison to GroES and mitochondrial CPN10s, suggesting that CaM may only bind to chloroplast CPN10s. Furthermore, the results also suggest that the calcium/CaM messenger system is involved in regulating Rubisco assembly in the chloroplast, thereby influencing photosynthesis. Copyright 2000 Academic Press.

Computational design of an endo-1,4-[beta]-xylanase ligand binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morin, Andrew; Kaufmann, Kristian W.; Fortenberry, Carie

2012-09-05

The field of computational protein design has experienced important recent success. However, the de novo computational design of high-affinity protein-ligand interfaces is still largely an open challenge. Using the Rosetta program, we attempted the in silico design of a high-affinity protein interface to a small peptide ligand. We chose the thermophilic endo-1,4-{beta}-xylanase from Nonomuraea flexuosa as the protein scaffold on which to perform our designs. Over the course of the study, 12 proteins derived from this scaffold were produced and assayed for binding to the target ligand. Unfortunately, none of the designed proteins displayed evidence of high-affinity binding. Structural characterizationmore » of four designed proteins revealed that although the predicted structure of the protein model was highly accurate, this structural accuracy did not translate into accurate prediction of binding affinity. Crystallographic analyses indicate that the lack of binding affinity is possibly due to unaccounted for protein dynamics in the 'thumb' region of our design scaffold intrinsic to the family 11 {beta}-xylanase fold. Further computational analysis revealed two specific, single amino acid substitutions responsible for an observed change in backbone conformation, and decreased dynamic stability of the catalytic cleft. These findings offer new insight into the dynamic and structural determinants of the {beta}-xylanase proteins.« less

On binding specificity of (6-4) photolyase to a T(6-4)T DNA photoproduct*

NASA Astrophysics Data System (ADS)

Jepsen, Katrine Aalbæk; Solov'yov, Ilia A.

2017-06-01

Different factors lead to DNA damage and if it is not repaired in due time, the damaged DNA could initiate mutagenesis and cancer. To avoid this deadly scenario, specific enzymes can scavenge and repair the DNA, but the enzymes have to bind first to the damaged sites. We have investigated this binding for a specific enzyme called (6-4) photolyase, which is capable of repairing certain UV-induced damage in DNA. Through molecular dynamics simulations we describe the binding between photolyase and the DNA and reveal that several charged amino acid residues in the enzyme, such as arginines and lysines turn out to be important. Especially R421 is crucial, as it keeps the DNA strands at the damaged site inside the repair pocket of the enzyme separated. DNA photolyase is structurally highly homologous to a protein called cryptochrome. Both proteins are biologically activated similarly, namely through flavin co-factor photoexcitation. It is, however, striking that cryptochrome cannot repair UV-damaged DNA. The present investigation allowed us to conclude on the small but, apparently, critical differences between photolyase and cryptochrome. The performed analysis gives insight into important factors that govern the binding of UV-damaged DNA and reveal why cryptochrome cannot have this functionality.

Structure of the myotonic dystrophy type 2 RNA and designed small molecules that reduce toxicity.

PubMed

Childs-Disney, Jessica L; Yildirim, Ilyas; Park, HaJeung; Lohman, Jeremy R; Guan, Lirui; Tran, Tuan; Sarkar, Partha; Schatz, George C; Disney, Matthew D

2014-02-21

Myotonic dystrophy type 2 (DM2) is an incurable neuromuscular disorder caused by a r(CCUG) expansion (r(CCUG)(exp)) that folds into an extended hairpin with periodically repeating 2×2 nucleotide internal loops (5'CCUG/3'GUCC). We designed multivalent compounds that improve DM2-associated defects using information about RNA-small molecule interactions. We also report the first crystal structure of r(CCUG) repeats refined to 2.35 Å. Structural analysis of the three 5'CCUG/3'GUCC repeat internal loops (L) reveals that the CU pairs in L1 are each stabilized by one hydrogen bond and a water-mediated hydrogen bond, while CU pairs in L2 and L3 are stabilized by two hydrogen bonds. Molecular dynamics (MD) simulations reveal that the CU pairs are dynamic and stabilized by Na(+) and water molecules. MD simulations of the binding of the small molecule to r(CCUG) repeats reveal that the lowest free energy binding mode occurs via the major groove, in which one C residue is unstacked and the cross-strand nucleotides are displaced. Moreover, we modeled the binding of our dimeric compound to two 5'CCUG/3'GUCC motifs, which shows that the scaffold on which the RNA-binding modules are displayed provides an optimal distance to span two adjacent loops.

Structure of the Myotonic Dystrophy Type 2 RNA and Designed Small Molecules That Reduce Toxicity

PubMed Central

Park, HaJeung; Lohman, Jeremy R.; Guan, Lirui; Tran, Tuan; Sarkar, Partha; Schatz, George C.; Disney, Matthew D.

2014-01-01

Myotonic dystrophy type 2 (DM2) is an untreatable neuromuscular disorder caused by a r(CCUG) expansion (r(CCUG)exp) that folds into an extended hairpin with periodically repeating 2×2 nucleotide internal loops (5’CCUG/3’GUCC). We designed multivalent compounds that improve DM2-associated defects using information about RNA-small molecule interactions. We also report the first crystal structure of r(CCUG)exp refined to 2.35 Å. Structural analysis of the three 5’CCUG/3’GUCC repeat internal loops (L) reveals that the CU pairs in L1 are each stabilized by one hydrogen bond and a water-mediated hydrogen bond while CU pairs in L2 and L3 are stabilized by two hydrogen bonds. Molecular dynamics (MD) simulations reveal that the CU pairs are dynamic and stabilized by Na+ and water molecules. MD simulations of the binding of the small molecule to r(CCUG) repeats reveal that the lowest free energy binding mode occurs via the major groove, in which one C residue is unstacked and the cross-strand nucleotides are displaced. Moreover, we modeled the binding of our dimeric compound to two 5’CCUG/3’GUCC motifs, which shows that the scaffold on which the RNA-binding modules are displayed provides an optimal distance to span two adjacent loops. PMID:24341895

The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element.

PubMed

Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko

2013-07-01

AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5'-NNCCAC-3' and 5'-GCGMGN'N'-3' (M:A or C; N and N' form Watson-Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences.

The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element

PubMed Central

Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko

2013-01-01

AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5′-NNCCAC-3′ and 5′-GCGMGN′N′-3′ (M:A or C; N and N′ form Watson–Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences. PMID:23709277

Homotropic Cooperativity from the Activation Pathway of the Allosteric Ligand-Responsive Regulatory Protein TRAP†

PubMed Central

Kleckner, Ian R.; McElroy, Craig A.; Kuzmic, Petr; Gollnick, Paul; Foster, Mark P.

2014-01-01

The trp RNA-binding Attenuation Protein (TRAP) assembles into an 11-fold symmetric ring that regulates transcription and translation of trp-mRNA in bacilli via heterotropic allosteric activation by the amino acid tryptophan (Trp). Whereas nuclear magnetic resonance studies have revealed that Trp-induced activation coincides with both μs-ms rigidification and local structural changes in TRAP, the pathway of binding of the 11 Trp ligands to the TRAP ring remains unclear. Moreover, because each of eleven bound Trp molecules is completely surrounded by protein, its release requires flexibility of Trp-bound (holo) TRAP. Here, we used stopped-flow fluorescence to study the kinetics of Trp binding by Bacillus stearothermophilus TRAP over a range of temperatures and we observed well-separated kinetic steps. These data were analyzed using non-linear least-squares fitting of several two- and three-step models. We found that a model with two binding steps best describes the data, although the structural equivalence of the binding sites in TRAP implies a fundamental change in the time-dependent structure of the TRAP rings upon Trp binding. Application of the two binding step model reveals that Trp binding is much slower than the diffusion limit, suggesting a gating mechanism that depends on the dynamics of apo TRAP. These data also reveal that Trp dissociation from the second binding mode is much slower than after the first Trp binding mode, revealing insight into the mechanism for positive homotropic allostery, or cooperativity. Temperature dependent analyses reveal that both binding modes imbue increases in bondedness and order toward a more compressed active state. These results provide insight into mechanisms of cooperative TRAP activation, and underscore the importance of protein dynamics for ligand binding, ligand release, protein activation, and allostery. PMID:24224873

Computational analysis of the binding ability of heterocyclic and conformationally constrained epibatidine analogs in the neuronal nicotinic acetylcholine receptor.

PubMed

Soriano, Elena; Marco-Contelles, José; Colmena, Inés; Gandía, Luis

2010-05-01

One of the most critical issues on the study of ligand-receptor interactions in drug design is the knowledge of the bioactive conformation of the ligand. In this study, we describe a computational approach aimed at estimating the binding ability of epibatidine analogs to interact with the neuronal nicotinic acetylcholine receptor (nAChR) and get insights into the bioactive conformation. The protocol followed consists of a docking analysis and evaluation of pharmacophore parameters of the docked structures. On the basis of the biological data, the results have revealed that the docking analysis is able to predict active ligands, whereas further efforts are needed to develop a suitable and solid pharmacophore model.

(/sup 3/H)Ethylketocyclazocine binding to mouse brain membranes: evidence for a kappa opioid receptor type

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garzon, J.; Sanchez-Blazquez, P.; Lee, N.M.

1984-10-01

The binding of the putative kappa agonist ethylketocyclazocine (EKC) to synaptosomal membranes of mouse brain was studied. This benzomorphan was able to bind to different opioid receptors. A portion of this binding was not inhibited by the agonist naloxone, even at high concentrations (10 microM). This population of receptors, to which opioate alkaloids and opiod peptides display very low affinity, is probably the sigma receptor. Another class of binding sites was identified by the simultaneous addition of the selective agonists Sandoz FK-33824 and D-Ala2-D-Leu5-enkephalin, which blocked the access of EKC to mu and delta opioid receptors, respectively, leaving a portionmore » of naloxone-displaceable benzomorphan binding still detectable. Analysis of this remaining binding revealed a small population of receptors of high affinity, the kappa receptor. Therefore, EKC binds to the mu, delta, kappa and sigma receptors in the mouse brain, with similar affinities for the mu and kappa (0.22 and 0.15 nM). These results confirm the existence of a kappa opioid receptor type in the mouse brain.« less

Ulex europeus agglutinin-I binding as a potential prognostic marker in ovarian cancer.

PubMed

Blonski, Katharina; Milde-Langosch, Karin; Bamberger, Ana-Maria; Osterholz, Tina; Utler, Christian; Berger, Jürgen; Löning, Thomas; Schumacher, Udo

2007-01-01

Ovarian cancer represents the malignant tumour of the female genital tract with the worst prognosis, mainly caused by early intraperitoneal spread. Cell-to-cell and cell-to-matrix interactions play a functionally important role in this spread and are both mediated by the cell membrane. Changes in the glycosylation of the cell membrane, as detected by lectin histochemistry, are sometimes associated with a poor prognosis. The expression of lectin binding of 164 ovarian cancer patients was analysed and the staining results were correlated with the clinical data of the patients. The univariate and multivariate statistical analysis revealed an independent prognostic significance for Ulex europeus agglutinin-I (UEA-I) binding. These findings indicate that UEA-I binding can serve as a prognostic factor in ovarian cancer.

Specific binding of tubeimoside-2 with proteins in hepatocarcinoma HepG2 cells: investigation by molecular spectroscopy

NASA Astrophysics Data System (ADS)

Yang, Sun; Shi-Sheng, Sun; Ying-Yong, Zhao; Jun, Fan

2012-07-01

In this study, we compared different binding interactions of TBMS2 with proteins both in hepatocarcinoma HepG2 cells and in normal embryo hepatic L02 cells by using fluorescence, absorption, and CD spectroscopy. The fluorescence data revealed that the fluorescence intensity of proteins in the HepG2 and L02 cells decreased in the presence of TBMS2 by 30.79% and 12.01%, respectively. Binding constants and thermodynamic parameters were obtained for systems of TBMS2 with the two kinds of cell proteins. The results indicated that HepG2 cell proteins had a higher TBMS2 binding activity than those in the L02 cells. Analysis of the TBMS2 cytotoxic activities showed that TBMS2 could selectively induce apoptosis of HepG2 cells by binding to them, while its apoptotic effect on L02 cells was relatively weaker.

The fundamental ribosomal RNA transcription initiation factor-IB (TIF-IB, SL1, factor D) binds to the rRNA core promoter primarily by minor groove contacts.

PubMed

Geiss, G K; Radebaugh, C A; Paule, M R

1997-11-14

Acanthamoeba castellanii transcription initiation factor-IB (TIF-IB) is the TATA-binding protein-containing transcription factor that binds the rRNA promoter to form the committed complex. Minor groove-specific drugs inhibit TIF-IB binding, with higher concentrations needed to disrupt preformed complexes because of drug exclusion by bound TIF-IB. TIF-IB/DNA interactions were mapped by hydroxyl radical and uranyl nitrate footprinting. TIF-IB contacts four minor grooves in its binding site. TIF-IB and DNA wrap around each other in a right-handed superhelix of high pitch, so the upstream and downstream contacts are on opposite faces of the helix. Dimethyl sulfate protection assays revealed limited contact with a few guanines in the major groove. This detailed analysis suggests significant DNA conformation dependence of the interaction.

Fluctuation Dynamics Analysis of gp120 Envelope Protein Reveals a Topologically Based Communication Network

PubMed Central

Shrivastava, Indira; LaLonde, Judith M.

2012-01-01

HIV infection is initiated by binding of the viral glycoprotein gp120, to the cellular receptor CD4. Upon CD4 binding, gp120 undergoes conformational change, permitting binding to the chemokine receptor. Crystal structures of gp120 ternary complex reveal the CD4 bound conformation of gp120. We report here the application of Gaussian Network Model (GNM) to the crystal structures of gp120 bound to CD4 or CD4 mimic and 17b, to study the collective motions of the gp120 core and determine the communication propensities of the residue network. The GNM fluctuation profiles identify residues in the inner domain and outer domain that may facilitate conformational change or stability, respectively. Communication propensities delineate a residue network that is topologically suited for signal propagation from the Phe43 cavity throughout the gp120 outer domain. . These results provide a new context for interpreting gp120 core envelope structure-function relationships. PMID:20718047

The centrosomal component CEP161 of Dictyostelium discoideum interacts with the Hippo signaling pathway

PubMed Central

Sukumaran, Salil K.; Blau-Wasser, Rosemarie; Rohlfs, Meino; Gallinger, Christoph; Schleicher, Michael; Noegel, Angelika A

2015-01-01

CEP161 is a novel component of the Dictyostelium discoideum centrosome which was identified as binding partner of the pericentriolar component CP250. Here we show that the amino acids 1-763 of the 1381 amino acids CEP161 are sufficient for CP250 binding, centrosomal targeting and centrosome association. Analysis of AX2 cells over-expressing truncated and full length CEP161 proteins revealed defects in growth and development. By immunoprecipitation experiments we identified the Hippo related kinase SvkA (Hrk-svk) as binding partner for CEP161. Both proteins colocalize at the centrosome. In in vitro kinase assays the N-terminal domain of CEP161 (residues 1-763) inhibited the kinase activity of Hrk-svk. A comparison of D. discoideum Hippo kinase mutants with mutants overexpressing CEP161 polypeptides revealed similar defects. We propose that the centrosomal component CEP161 is a novel player in the Hippo signaling pathway and affects various cellular properties through this interaction. PMID:25607232

Genome-wide Analysis Reveals SR Protein Cooperation and Competition in Regulated Splicing

PubMed Central

Pandit, Shatakshi; Zhou, Yu; Shiue, Lily; Coutinho-Mansfield, Gabriela; Li, Hairi; Qiu, Jinsong; Huang, Jie; Yeo, Gene W.; Ares, Manuel; Fu, Xiang-Dong

2013-01-01

Summary SR proteins are well-characterized RNA binding proteins that promote exon inclusion by binding to exonic splicing enhancers (ESEs). However, it has been unclear whether regulatory rules deduced on model genes apply generally to activities of SR proteins in the cell. Here, we report global analyses of two prototypical SR proteins SRSF1 (SF2/ASF) and SRSF2 (SC35) using splicing-sensitive arrays and CLIP-seq on mouse embryo fibroblasts (MEFs). Unexpectedly, we find that these SR proteins promote both inclusion and skipping of exons in vivo, but their binding patterns do not explain such opposite responses. Further analyses reveal that loss of one SR protein is accompanied by coordinated loss or compensatory gain in the interaction of other SR proteins at the affected exons. Therefore, specific effects on regulated splicing by one SR protein actually depend on a complex set of relationships with multiple other SR proteins in mammalian genomes. PMID:23562324

Discovery and X-ray crystallographic analysis of a spiropiperidine iminohydantoin inhibitor of beta-secretase.

PubMed

Barrow, James C; Stauffer, Shaun R; Rittle, Kenneth E; Ngo, Phung L; Yang, ZhiQiang; Selnick, Harold G; Graham, Samuel L; Munshi, Sanjeev; McGaughey, Georgia B; Holloway, M Katharine; Simon, Adam J; Price, Eric A; Sankaranarayanan, Sethu; Colussi, Dennis; Tugusheva, Katherine; Lai, Ming-Tain; Espeseth, Amy S; Xu, Min; Huang, Qian; Wolfe, Abigail; Pietrak, Beth; Zuck, Paul; Levorse, Dorothy A; Hazuda, Daria; Vacca, Joseph P

2008-10-23

A high-throughput screen at 100 microM inhibitor concentration for the BACE-1 enzyme revealed a novel spiropiperidine iminohydantoin aspartyl protease inhibitor template. An X-ray cocrystal structure with BACE-1 revealed a novel mode of binding whereby the inhibitor interacts with the catalytic aspartates via bridging water molecules. Using the crystal structure as a guide, potent compounds with good brain penetration were designed.

Structural insights into xenobiotic and inhibitor binding to human aldehyde oxidase.

PubMed

Coelho, Catarina; Foti, Alessandro; Hartmann, Tobias; Santos-Silva, Teresa; Leimkühler, Silke; Romão, Maria João

2015-10-01

Aldehyde oxidase (AOX) is a xanthine oxidase (XO)-related enzyme with emerging importance due to its role in the metabolism of drugs and xenobiotics. We report the first crystal structures of human AOX1, substrate free (2.6-Å resolution) and in complex with the substrate phthalazine and the inhibitor thioridazine (2.7-Å resolution). Analysis of the protein active site combined with steady-state kinetic studies highlight the unique features, including binding and substrate orientation at the active site, that characterize human AOX1 as an important drug-metabolizing enzyme. Structural analysis of the complex with the noncompetitive inhibitor thioridazine revealed a new, unexpected and fully occupied inhibitor-binding site that is structurally conserved among mammalian AOXs and XO. The new structural insights into the catalytic and inhibition mechanisms of human AOX that we now report will be of great value for the rational analysis of clinical drug interactions involving inhibition of AOX1 and for the prediction and design of AOX-stable putative drugs.

Proteomic analysis of trichloroethylene-induced alterations in expression, distribution, and interactions of SET/TAF-Iα and two SET/TAF-Iα-binding proteins, eEF1A1 and eEF1A2, in hepatic L-02 cells.

PubMed

Hong, Wen-Xu; Yang, Liang; Chen, Moutong; Yang, Xifei; Ren, Xiaohu; Fang, Shisong; Ye, Jinbo; Huang, Haiyan; Peng, Chaoqiong; Zhou, Li; Huang, Xinfeng; Yang, Fan; Wu, Desheng; Zhuang, Zhixiong; Liu, Jianjun

2012-09-01

Emerging evidence indicates that trichloroethylene (TCE) exposure causes severe hepatotoxicity. However, the mechanisms of TCE hepatotoxicity remain unclear. Recently, we reported that TCE exposure up-regulated the expression of the oncoprotein SET/TAF-Iα and SET knockdown attenuated TCE-induced cytotoxicity in hepatic L-02 cells. To decipher the function of SET/TAF-Iα and its contributions to TCE-induced hepatotoxicity, we employed a proteomic analysis of SET/TAF-Iα with tandem affinity purification to identify SET/TAF-Iα-binding proteins. We identified 42 novel Gene Ontology co-annotated SET/TAF-Iα-binding proteins. The identifications of two of these proteins (eEF1A1, elongation factor 1-alpha 1; eEF1A2, elongation factor 1-alpha 2) were confirmed by Western blot analysis and co-immunoprecipitation (Co-IP). Furthermore, we analyzed the effects of TCE on the expression, distribution and interactions of eEF1A1, eEF1A2 and SET in L-02 cells. Western blot analysis reveals a significant up-regulation of eEF1A1, eEF1A2 and two isoforms of SET, and immunocytochemical analysis reveals that eEF1A1 and SET is redistributed by TCE. SET is redistributed from the nucleus to the cytoplasm, while eFE1A1 is translocated from the cytoplasm to the nucleus. Moreover, we find by Co-IP that TCE exposure significantly increases the interaction of SET with eEF1A2. Our data not only provide insights into the physiological functions of SET/TAF-Iα and complement the SET interaction networks, but also demonstrate that TCE exposure induces alterations in the expression, distribution and interactions of SET and its binding partners. These alterations may constitute the mechanisms of TCE cytotoxicity. Copyright © 2012 Elsevier Inc. All rights reserved.

Mechanism of extracellular ion exchange and binding-site occlusion in the sodium-calcium exchanger

PubMed Central

Lee, ChangKeun; Huang, Yihe; Faraldo-Gómez, José D.; Jiang, Youxing

2016-01-01

Na+/Ca2+ exchangers utilize the Na+ electrochemical gradient across the plasma membrane to extrude intracellular Ca2+, and play a central role in Ca2+ homeostasis. Here, we elucidate their mechanisms of extracellular ion recognition and exchange through a structural analysis of the exchanger from Methanococcus jannaschii (NCX_Mj) bound to Na+, Ca2+ or Sr2+ in various occupancies and in an apo state. This analysis defines the binding mode and relative affinity of these ions, establishes the structural basis for the anticipated 3Na+:1Ca2+ exchange stoichiometry, and reveals the conformational changes at the onset of the alternating-access transport mechanism. An independent analysis of the dynamics and conformational free-energy landscape of NCX_Mj in different ion-occupancy states, based on enhanced-sampling molecular-dynamics simulations, demonstrates that the crystal structures reflect mechanistically relevant, interconverting conformations. These calculations also reveal the mechanism by which the outward-to-inward transition is controlled by the ion-occupancy state, thereby explaining the emergence of strictly-coupled Na+/Ca2+ antiport. PMID:27183196

Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger

DOE PAGES

Liao, Jun; Marinelli, Fabrizio; Lee, Changkeun; ...

2016-05-16

Na +/Ca 2+ exchangers utilize the Na + electrochemical gradient across the plasma membrane to extrude intracellular Ca 2+, and play a central role in Ca 2+ homeostasis. Here, we elucidate their mechanisms of extracellular ion recognition and exchange through a structural analysis of the exchanger from Methanococcus jannaschii (NCX_Mj) bound to Na +, Ca 2+ or Sr 2+ in various occupancies and in an apo state. This analysis defines the binding mode and relative affinity of these ions, establishes the structural basis for the anticipated 3:1Na +/Ca 2+ exchange stoichiometry, and reveals the conformational changes at the onset ofmore » the alternating-access transport mechanism. An independent analysis of the dynamics and conformational free-energy landscape of NCX_Mj in different ion-occupancy states, based on enhanced-sampling molecular-dynamics simulations, demonstrates that the crystal structures reflect mechanistically relevant, interconverting conformations. Lastly, these calculations also reveal the mechanism by which the outward-to-inward transition is controlled by the ion-occupancy state, thereby explaining the emergence of strictly-coupled Na +/Ca 2+ antiport.« less

Decrypting the structural, dynamic, and energetic basis of a monomeric kinesin interacting with a tubulin dimer in three ATPase states by all-atom molecular dynamics simulation.

PubMed

Chakraborty, Srirupa; Zheng, Wenjun

2015-01-27

We have employed molecular dynamics (MD) simulation to investigate, with atomic details, the structural dynamics and energetics of three major ATPase states (ADP, APO, and ATP state) of a human kinesin-1 monomer in complex with a tubulin dimer. Starting from a recently solved crystal structure of ATP-like kinesin-tubulin complex by the Knossow lab, we have used flexible fitting of cryo-electron-microscopy maps to construct new structural models of the kinesin-tubulin complex in APO and ATP state, and then conducted extensive MD simulations (total 400 ns for each state), followed by flexibility analysis, principal component analysis, hydrogen bond analysis, and binding free energy analysis. Our modeling and simulation have revealed key nucleotide-dependent changes in the structure and flexibility of the nucleotide-binding pocket (featuring a highly flexible and open switch I in APO state) and the tubulin-binding site, and allosterically coupled motions driving the APO to ATP transition. In addition, our binding free energy analysis has identified a set of key residues involved in kinesin-tubulin binding. On the basis of our simulation, we have attempted to address several outstanding issues in kinesin study, including the possible roles of β-sheet twist and neck linker docking in regulating nucleotide release and binding, the structural mechanism of ADP release, and possible extension and shortening of α4 helix during the ATPase cycle. This study has provided a comprehensive structural and dynamic picture of kinesin's major ATPase states, and offered promising targets for future mutational and functional studies to investigate the molecular mechanism of kinesin motors.

Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

PubMed

Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

2014-06-02

The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

Biophysical study on the interaction of ceftriaxone sodium with bovine serum albumin using spectroscopic methods.

PubMed

Pan, Jiongwei; Ye, Zaiting; Cai, Xiaoping; Wang, Liangxing; Cao, Zhuo

2012-12-01

The interaction of ceftriaxone sodium (CS), a cephalosporin antibiotic, with the major transport protein, bovine serum albumin (BSA), was investigated using different spectroscopic techniques such as fluorescence, circular dichroism (CD), and UV-vis spectroscopy. Values of binding parameters for BSA-CS interaction in terms of binding constant and number of binding sides were found to be 9.00 × 10(3), 3.24 × 10(3), and 2.30 × 10(3) M(-1) at 281, 301, and 321 K, respectively. Thermodynamic analysis of the binding data obtained at different temperatures showed that the binding process was spontaneous and was primarily mediated by van der Waals force or hydrogen bonding. CS binding to BSA caused secondary structural alterations in the protein as revealed by CD results. The distance between CS and Trp of BSA was determined as 3.23 nm according to the Förster resonance energy transfer theory. © 2012 Wiley Periodicals, Inc.

Supramolecular binding and separation of hydrocarbons within a functionalized porous metal–organic framework

DOE PAGES

Yang, Sihai; Ramirez-Cuesta, Anibal J.; Newby, Ruth; ...

2014-12-01

Supramolecular interactions are fundamental to host–guest binding in many chemical and biological processes. Direct visualization of such supramolecular interactions within host–guest systems is extremely challenging, but crucial to understanding their function. Within this paper, we report a comprehensive study that combines neutron scattering, synchrotron X-ray and neutron diffraction, and computational modelling to define the detailed binding at a molecular level of acetylene, ethylene and ethane within the porous host NOTT-300. This study reveals simultaneous and cooperative hydrogen-bonding, π···π stacking interactions and intermolecular dipole interactions in the binding of acetylene and ethylene to give up to 12 individual weak supramolecular interactionsmore » aligned within the host to form an optimal geometry for the selective binding of hydrocarbons. In addition, we also report the cooperative binding of a mixture of acetylene and ethylene within the porous host, together with the corresponding breakthrough experiments and analysis of adsorption isotherms of gas mixtures.« less

Spectroscopic and thermodynamic studies on ferulic acid - Alpha-2-macroglobulin interaction

NASA Astrophysics Data System (ADS)

Rehman, Ahmed Abdur; Sarwar, Tarique; Arif, Hussain; Ali, Syed Saqib; Ahsan, Haseeb; Tabish, Mohammad; Khan, Fahim Halim

2017-09-01

Ferulic acid is a major phenolic acid found in numerous plant species in conjugated form. It binds to enzymes and oligomeric proteins and modifies their structure and function. This study was designed to examine the interaction of ferulic acid, an active ingredient of some important medicines, with α2M, a key serum proteinase, under physiological conditions. The mechanism of interaction was studied by spectroscopic techniques such as, UV-visible absorption, fluorescence spectroscopy, circular dichroism along with isothermal titration calorimetry. Fluorescence quenching of α2M by ferulic acid demonstrated the formation of α2M-ferulic acid complex by static quenching mechanism. Binding parameters calculated by Stern-Volmer method showed that ferulic acid binds to α2M with moderate affinity of the order of ∼104 M-1. The thermodynamic signatures reveal that binding was enthalpy driven and hydrogen bonding played a major role in ferulic acid-α2M binding. CD spectra analysis suggests very little conformational changes in α2M on ferulic acid binding.

Crystal structure at 2.8 Å of the DLLRKN-containing coiled-coil domain of Huntingtin-interacting protein 1 (HIP1) reveals a surface suitable for clathrin light chain binding

PubMed Central

Ybe, Joel A.; Mishra, Sanjay; Helms, Stephen; Nix, Jay

2007-01-01

Summary Huntingtin interacting protein 1 (HIP1) is a member of a family of proteins whose interaction with Huntingtin is critical to prevent cells from initiating apoptosis. HIP1, and related protein HIP12/1R, can also bind to clathrin and membrane phospholipids and HIP12/1R links the CCV to the actin cytoskeleton. HIP1 and HIP12/1R interact with the clathrin light chain EED regulatory site and stimulate clathrin lattice assembly. Here we report the X-ray structure of the coiled-coil domain of HIP1 from 482–586 that includes residues crucial for binding clathrin light chain. The dimeric HIP1 crystal structure is partially splayed open. The comparison of the HIP1 model with coiled-coil predictions revealed the heptad repeat in the dimeric trunk (S2 path) is offset relative to the register of the heptad repeat from the N-terminal portion (S1 path) of the molecule. Furthermore, surface analysis showed there is a third hydrophobic path (S3) running parallel to S1 and S2. We present structural evidence supporting a role for S3 path as an interaction surface for clathrin light chain. Finally, comparative analysis suggests the mode of binding between sla2p and clathrin light chain may be different in yeast. PMID:17257618

Structural and Spectroscopic Analysis of the Kinase Inhibitor Bosutinib and an Isomer of Bosutinib Binding to the Abl Tyrosine Kinase Domain

PubMed Central

Levinson, Nicholas M.; Boxer, Steven G.

2012-01-01

Chronic myeloid leukemia (CML) is caused by the kinase activity of the BCR-Abl fusion protein. The Abl inhibitors imatinib, nilotinib and dasatinib are currently used to treat CML, but resistance to these inhibitors is a significant clinical problem. The kinase inhibitor bosutinib has shown efficacy in clinical trials for imatinib-resistant CML, but its binding mode is unknown. We present the 2.4 Å structure of bosutinib bound to the kinase domain of Abl, which explains the inhibitor's activity against several imatinib-resistant mutants, and reveals that similar inhibitors that lack a nitrile moiety could be effective against the common T315I mutant. We also report that two distinct chemical compounds are currently being sold under the name “bosutinib”, and report spectroscopic and structural characterizations of both. We show that the fluorescence properties of these compounds allow inhibitor binding to be measured quantitatively, and that the infrared absorption of the nitrile group reveals a different electrostatic environment in the conserved ATP-binding sites of Abl and Src kinases. Exploiting such differences could lead to inhibitors with improved selectivity. PMID:22493660

DNA mimic proteins: functions, structures, and bioinformatic analysis.

PubMed

Wang, Hao-Ching; Ho, Chun-Han; Hsu, Kai-Cheng; Yang, Jinn-Moon; Wang, Andrew H-J

2014-05-13

DNA mimic proteins have DNA-like negative surface charge distributions, and they function by occupying the DNA binding sites of DNA binding proteins to prevent these sites from being accessed by DNA. DNA mimic proteins control the activities of a variety of DNA binding proteins and are involved in a wide range of cellular mechanisms such as chromatin assembly, DNA repair, transcription regulation, and gene recombination. However, the sequences and structures of DNA mimic proteins are diverse, making them difficult to predict by bioinformatic search. To date, only a few DNA mimic proteins have been reported. These DNA mimics were not found by searching for functional motifs in their sequences but were revealed only by structural analysis of their charge distribution. This review highlights the biological roles and structures of 16 reported DNA mimic proteins. We also discuss approaches that might be used to discover new DNA mimic proteins.

Interaction of a putative BH3 domain of clusterin with anti-apoptotic Bcl-2 family proteins as revealed by NMR spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Dong-Hwa; Ha, Ji-Hyang; Kim, Yul

Highlights: {yields} Identification of a conserved BH3 motif in C-terminal coiled coil region of nCLU. {yields} The nCLU BH3 domain binds to BH3 peptide-binding grooves in both Bcl-X{sub L} and Bcl-2. {yields} A conserved binding mechanism of nCLU BH3 and the other pro-apoptotic BH3 peptides with Bcl-X{sub L}. {yields} The absolutely conserved Leu323 and Asp328 of nCLU BH3 domain are critical for binding to Bcl-X{sub L.} {yields} Molecular understanding of the pro-apoptotic function of nCLU as a novel BH3-only protein. -- Abstract: Clusterin (CLU) is a multifunctional glycoprotein that is overexpressed in prostate and breast cancers. Although CLU is knownmore » to be involved in the regulation of apoptosis and cell survival, the precise molecular mechanism underlying the pro-apoptotic function of nuclear CLU (nCLU) remains unclear. In this study, we identified a conserved BH3 motif in C-terminal coiled coil (CC2) region of nCLU by sequence analysis and characterized the molecular interaction of the putative nCLU BH3 domain with anti-apoptotic Bcl-2 family proteins by nuclear magnetic resonance (NMR) spectroscopy. The chemical shift perturbation data demonstrated that the nCLU BH3 domain binds to pro-apoptotic BH3 peptide-binding grooves in both Bcl-X{sub L} and Bcl-2. A structural model of the Bcl-X{sub L}/nCLU BH3 peptide complex reveals that the binding mode is remarkably similar to those of other Bcl-X{sub L}/BH3 peptide complexes. In addition, mutational analysis confirmed that Leu323 and Asp328 of nCLU BH3 domain, absolutely conserved in the BH3 motifs of BH3-only protein family, are critical for binding to Bcl-X{sub L}. Taken altogether, our results suggest a molecular basis for the pro-apoptotic function of nCLU by elucidating the residue specific interactions of the BH3 motif in nCLU with anti-apoptotic Bcl-2 family proteins.« less

The constant region affects antigen binding of antibodies to DNA by altering secondary structure.

PubMed

Xia, Yumin; Janda, Alena; Eryilmaz, Ertan; Casadevall, Arturo; Putterman, Chaim

2013-11-01

We previously demonstrated an important role of the constant region in the pathogenicity of anti-DNA antibodies. To determine the mechanisms by which the constant region affects autoantibody binding, a panel of isotype-switch variants (IgG1, IgG2a, IgG2b) was generated from the murine PL9-11 IgG3 autoantibody. The affinity of the PL9-11 antibody panel for histone was measured by surface plasmon resonance (SPR). Tryptophan fluorescence was used to determine wavelength shifts of the antibody panel upon binding to DNA and histone. Finally, circular dichroism spectroscopy was used to measure changes in secondary structure. SPR analysis revealed significant differences in histone binding affinity between members of the PL9-11 panel. The wavelength shifts of tryptophan fluorescence emission were found to be dependent on the antibody isotype, while circular dichroism analysis determined that changes in antibody secondary structure content differed between isotypes upon antigen binding. Thus, the antigen binding affinity is dependent on the particular constant region expressed. Moreover, the effects of antibody binding to antigen were also constant region dependent. Alteration of secondary structures influenced by constant regions may explain differences in fine specificity of anti-DNA antibodies between antibodies with similar variable regions, as well as cross-reactivity of anti-DNA antibodies with non-DNA antigens. Copyright © 2013 Elsevier Ltd. All rights reserved.

[Analysis of the binding capacity of the benzodiazepine site of gabaa receptor in mice C57BL/6 and BALB/C pretreated with anxiolytics].

PubMed

Iarkova, M A

2011-01-01

The level of specific 3H-flunitrazepam binding in synaptosomal membranes of C57BL/6 and BALB/c mice brain underwent to the stress of different types has been studied. Mild stress (Elevated Plus Maze) was shown to induce the decrease of benzodiazepine binding in BALB/c mice only, while the strong one (Exposure to a predator) was revealed to cause this decrease in both strains. Behavioral effects of different non-benzodiazepine drugs possessing anxiolytic properties (Afobazol, Ladasten and Noopept) was accompanied with the normalization of the level of benzodiazepine reception, reduced by the stress of both modalities.

E-selectin ligand-1 (ESL-1) is a novel adiponectin binding protein on cell adhesion.

PubMed

Yamamoto, Hiroyasu; Kuroda, Nana; Uekita, Hiromi; Kochi, Ikoi; Matsumoto, Akane; Niinaga, Ryu; Funahashi, Tohru; Shimomura, Iichiro; Kihara, Shinji

2016-02-05

Adiponectin (APN) is an adipocyte-derived bioactive molecule with anti-diabetic and anti-atherogenic properties. Although anti-diabetic effects are mostly mediated by the adiponectin receptors AdipoR1 and AdipoR2, the anti-atherogenic mechanisms have not been fully elucidated. In this study, we identified E-selectin ligand (ESL)-1 as a novel APN-binding protein by mass spectrometry analysis of HepG2 cell-derived immunoprecipitant with an anti-APN antibody. Cell adhesion assays using fluorescence-labelled monocyte cell line THP-1 cells and human umbilical vein endothelial cells (HUVECs) revealed that APN-pre-treated THP-1 cells had reduced binding ability to HUVECs. This APN-mediated suppressive effect on monocyte binding to endothelial cells was partially abrogated by targeting ESL-1 with shRNA in THP-1 cells. In addition, serial mutagenesis analysis disclosed that five extracellular amino acids close to the N-terminus of ESL-1 were essential for binding with APN. Our results highlight the fact that interaction between APN and ESL-1 could provide a fundamental mechanism underlying the anti-atherogenic properties of APN. Copyright © 2016 Elsevier Inc. All rights reserved.

Analysis of the interactions between GMF and Arp2/3 complex in two binding sites by molecular dynamics simulation.

PubMed

Popinako, A; Antonov, M; Dibrova, D; Chemeris, A; Sokolova, O S

2018-02-05

The Arp2/3 complex plays a key role in nucleating actin filaments branching. The glia maturation factor (GMF) competes with activators for interacting with the Arp2/3 complex and initiates the debranching of actin filaments. In this study, we performed a comparative analysis of interactions between GMF and the Arp2/3 complex and identified new amino acid residues involved in GMF binding to the Arp2/3 complex at two separate sites, revealed by X-ray and single particle EM techniques. Using molecular dynamics simulations we demonstrated the quantitative and qualitative changes in hydrogen bonds upon binding with GMF. We identified the specific amino acid residues in GMF and Arp2/3 complex that stabilize the interactions and estimated the mean force profile for the GMF using umbrella sampling. Phylogenetic and structural analyses of the recently defined GMF binding site on the Arp3 subunit indicate a new mechanism for Arp2/3 complex inactivation that involves interactions between the Arp2/3 complex and GMF at two binding sites. Copyright © 2018 Elsevier Inc. All rights reserved.

Synthesis, characterization, crystal structure, DNA/BSA binding ability and antibacterial activity of asymmetric europium complex based on 1,10- phenanthroline

NASA Astrophysics Data System (ADS)

Alfi, Nafiseh; Khorasani-Motlagh, Mozhgan; Rezvani, Ali Reza; Noroozifar, Meissam; Molčanov, Krešimir

2017-06-01

A heteroleptic europium coordination compound formulated as [Eu(phen)2(OH2)2(Cl)2](Cl)(H2O) (phen = 1,10-phenanthroline), has been synthesized and characterized by elemental analysis, FT-IR spectroscopy, and single-crystal X-ray diffractometer. Crystal structure analysis reveals the complex is crystallized in orthorhombic system with Pca21 space group. Electronic absorption and various emission methods for investigation of the binding system of europium(III) complex to Fish Salmon deoxyribonucleic acid (FS-DNA) and Bovamin Serum Albumin (BSA) have been explored. Furthermore, the binding constants, binding sites and the corresponding thermodynamic parameters of the interaction system based on the van't Hoff equation for FS-DNA and BSA were calculated. The thermodynamic parameters reflect the exothermic nature of emission process (ΔH°<0 and ΔS°<0). The experimental results seem to indicate that the [Eu(phen)2(OH2)2(Cl)2](Cl)(H2O) bound to FS-DNA by non-intercalative mode which the groove binding is preferable mode. Also, the complex exhibits a brilliant antimicrobial activity in vitro against standard bacterial strains.

IBiSA_Tools: A Computational Toolkit for Ion-Binding State Analysis in Molecular Dynamics Trajectories of Ion Channels.

PubMed

Kasahara, Kota; Kinoshita, Kengo

2016-01-01

Ion conduction mechanisms of ion channels are a long-standing conundrum. Although the molecular dynamics (MD) method has been extensively used to simulate ion conduction dynamics at the atomic level, analysis and interpretation of MD results are not straightforward due to complexity of the dynamics. In our previous reports, we proposed an analytical method called ion-binding state analysis to scrutinize and summarize ion conduction mechanisms by taking advantage of a variety of analytical protocols, e.g., the complex network analysis, sequence alignment, and hierarchical clustering. This approach effectively revealed the ion conduction mechanisms and their dependence on the conditions, i.e., ion concentration and membrane voltage. Here, we present an easy-to-use computational toolkit for ion-binding state analysis, called IBiSA_tools. This toolkit consists of a C++ program and a series of Python and R scripts. From the trajectory file of MD simulations and a structure file, users can generate several images and statistics of ion conduction processes. A complex network named ion-binding state graph is generated in a standard graph format (graph modeling language; GML), which can be visualized by standard network analyzers such as Cytoscape. As a tutorial, a trajectory of a 50 ns MD simulation of the Kv1.2 channel is also distributed with the toolkit. Users can trace the entire process of ion-binding state analysis step by step. The novel method for analysis of ion conduction mechanisms of ion channels can be easily used by means of IBiSA_tools. This software is distributed under an open source license at the following URL: http://www.ritsumei.ac.jp/~ktkshr/ibisa_tools/.

Insight into microtubule destabilization mechanism of 3,4,5-trimethoxyphenyl indanone derivatives using molecular dynamics simulation and conformational modes analysis

NASA Astrophysics Data System (ADS)

Tripathi, Shubhandra; Srivastava, Gaurava; Singh, Aastha; Prakasham, A. P.; Negi, Arvind S.; Sharma, Ashok

2018-03-01

Colchicine site inhibitors are microtubule destabilizers having promising role in cancer therapeutics. In the current study, four such indanone derivatives (t1, t9, t14 and t17) with 3,4,5-trimethoxyphenyl fragment (ring A) and showing significant microtubule destabilization property have been explored. The interaction mechanism and conformational modes triggered by binding of these indanone derivatives and combretastatin at colchicine binding site (CBS) of αβ-tubulin dimer were studied using molecular dynamics (MD) simulation, principle component analysis and free energy landscape analysis. In the MD results, t1 showed binding similar to colchicine interacting in the deep hydrophobic core at the CBS. While t9, t14 and t17 showed binding conformation similar to combretastatin, with ring A superficially binding at the CBS. Results demonstrated that ring A played a vital role in binding via hydrophobic interactions and got anchored between the S8 and S9 sheets, H8 helix and T7 loop at the CBS. Conformational modes study revealed that twisting and bending conformational motions (as found in the apo system) were nearly absent in the ligand bound systems. Absence of twisting motion might causes loss of lateral contacts in microtubule, thus promoting microtubule destabilization. This study provides detailed account of microtubule destabilization mechanism by indanone ligands and combretastatin, and would be helpful for designing microtubule destabilizers with higher activity.

The Inner Membrane Complex Sub-compartment Proteins Critical for Replication of the Apicomplexan Parasite Toxoplasma gondii Adopt a Pleckstrin Homology Fold*

PubMed Central

Tonkin, Michelle L.; Beck, Josh R.; Bradley, Peter J.; Boulanger, Martin J.

2014-01-01

Toxoplasma gondii, an apicomplexan parasite prevalent in developed nations, infects up to one-third of the human population. The success of this parasite depends on several unique structures including an inner membrane complex (IMC) that lines the interior of the plasma membrane and contains proteins important for gliding motility and replication. Of these proteins, the IMC sub-compartment proteins (ISPs) have recently been shown to play a role in asexual T. gondii daughter cell formation, yet the mechanism is unknown. Complicating mechanistic characterization of the ISPs is a lack of sequence identity with proteins of known structure or function. In support of elucidating the function of ISPs, we first determined the crystal structures of representative members TgISP1 and TgISP3 to a resolution of 2.10 and 2.32 Å, respectively. Structural analysis revealed that both ISPs adopt a pleckstrin homology fold often associated with phospholipid binding or protein-protein interactions. Substitution of basic for hydrophobic residues in the region that overlays with phospholipid binding in related pleckstrin homology domains, however, suggests that ISPs do not retain phospholipid binding activity. Consistent with this observation, biochemical assays revealed no phospholipid binding activity. Interestingly, mapping of conserved surface residues combined with crystal packing analysis indicates that TgISPs have functionally repurposed the phospholipid-binding site likely to coordinate protein partners. Recruitment of larger protein complexes may also be aided through avidity-enhanced interactions resulting from multimerization of the ISPs. Overall, we propose a model where TgISPs recruit protein partners to the IMC to ensure correct progression of daughter cell formation. PMID:24675080

Functional and structural characterization of a β-glucosidase involved in saponin metabolism from intestinal bacteria.

PubMed

Yan, Shan; Wei, Peng-Cheng; Chen, Qiao; Chen, Xin; Wang, Shi-Cheng; Li, Jia-Ru; Gao, Chuan

2018-02-19

Saponins are natural glycosides widely used in medicine and the food industry. Although saponin metabolism in human is dependent on intestinal microbes, few involving bacteria enzymes have been identified. We cloned BlBG3, a GH3 β-glucosidase from Bifidobacterium longum, from human stool. We found that BlBG3 catalyzes the hydrolysis of glycoside furostanol and ginsenoside Rb1 at higher efficiency than other microbial β-glucosidases. Structural analysis of BlBG3 in complex with d-glucose revealed its three unique loops, which form a deep pocket and participate in substrate binding. To understand how substrate is bound to the pocket, molecular docking was performed and the binding interactions of protobioside with BlBG3 were revealed. Mutational study suggested that R484 and H642 are critical for enzymatic activity. Our study presents the first structural and functional analysis of a saponin-processing enzyme from human microbiota. Copyright © 2018 Elsevier Inc. All rights reserved.

Insulin-like growth factor II messenger RNA-binding protein-3 is an independent prognostic factor in uterine leiomyosarcoma.

PubMed

Yasutake, Nobuko; Ohishi, Yoshihiro; Taguchi, Kenichi; Hiraki, Yuka; Oya, Masafumi; Oshiro, Yumi; Mine, Mari; Iwasaki, Takeshi; Yamamoto, Hidetaka; Kohashi, Kenichi; Sonoda, Kenzo; Kato, Kiyoko; Oda, Yoshinao

2018-04-01

The aim of this study was to identify the prognostic factors of uterine leiomyosarcoma (ULMS). We reviewed 60 cases of surgically resected ULMSs and investigated conventional clinicopathological factors, together with the expression of insulin-like growth factor II messenger RNA-binding protein-3 (IMP3), hormone receptors and cell cycle regulatory markers by immunohistochemistry. Mediator complex subunit 12 (MED12) mutation analysis was also performed. Univariate analyses revealed that advanced stage (P < 0.0001), older age (P = 0.0244) and IMP3 expression (P = 0.0011) were significant predictors of a poor outcome. Multivariate analysis revealed advanced stage (P < 0.0001) and IMP3 (P = 0.0373) as independent predictors of a poor prognosis. Expressions of cell cycle markers and hormone receptors, and MED12 mutations (12% in ULMSs) were not identified as prognostic markers in this study. IMP3 expression in ULMS could be a marker of a poor prognosis. © 2017 John Wiley & Sons Ltd.

The Crystal Structures of Apo and cAMP-Bound GlxR from Corynebacterium glutamicum Reveal Structural and Dynamic Changes upon cAMP Binding in CRP/FNR Family Transcription Factors

PubMed Central

Townsend, Philip D.; Jungwirth, Britta; Pojer, Florence; Bußmann, Michael; Money, Victoria A.; Cole, Stewart T.; Pühler, Alfred; Tauch, Andreas; Bott, Michael; Cann, Martin J.; Pohl, Ehmke

2014-01-01

The cyclic AMP-dependent transcriptional regulator GlxR from Corynebacterium glutamicum is a member of the super-family of CRP/FNR (cyclic AMP receptor protein/fumarate and nitrate reduction regulator) transcriptional regulators that play central roles in bacterial metabolic regulatory networks. In C. glutamicum, which is widely used for the industrial production of amino acids and serves as a non-pathogenic model organism for members of the Corynebacteriales including Mycobacterium tuberculosis, the GlxR homodimer controls the transcription of a large number of genes involved in carbon metabolism. GlxR therefore represents a key target for understanding the regulation and coordination of C. glutamicum metabolism. Here we investigate cylic AMP and DNA binding of GlxR from C. glutamicum and describe the crystal structures of apo GlxR determined at a resolution of 2.5 Å, and two crystal forms of holo GlxR at resolutions of 2.38 and 1.82 Å, respectively. The detailed structural analysis and comparison of GlxR with CRP reveals that the protein undergoes a distinctive conformational change upon cyclic AMP binding leading to a dimer structure more compatible to DNA-binding. As the two binding sites in the GlxR homodimer are structurally identical dynamic changes upon binding of the first ligand are responsible for the allosteric behavior. The results presented here show how dynamic and structural changes in GlxR lead to optimization of orientation and distance of its two DNA-binding helices for optimal DNA recognition. PMID:25469635

[Binding interaction of harpagoside and bovine serum albumin: spectroscopic methodologies and molecular docking].

PubMed

Cao, Tuan-Wu; Huang, Wen-Bing; Shi, Jian-Wei; He, Wei

2018-03-01

Scrophularia ningpoensis has exhibited a variety of biological activities and been used as a pharmaceutical product for the treatment of inflammatory ailment, rheumatoid arthritis, osteoarthritis and so on. Harpagoside (HAR) is considerer as a main bioactive compound in this plant. Serum albumin has important physiological roles in transportation, distribution and metabolism of many endogenous and exogenous substances in body. It is of great significance to study the interaction mechanism between HAR and bovine serum albumin (BSA). The mechanism of interaction between HAR and BSA was investigated using 2D and 3D fluorescence, synchronous florescence, ultraviolet spectroscopy and molecular docking. According to the analysis of fluorescence spectra, HAR could strongly quench the fluorescence of BSA, and the static quenching process indicated that the decrease in the quenching constant was observed with the increase in temperature. The magnitude of binding constants (KA) was more than 1×10⁵ L·mol⁻¹, and the number of binding sites(n) was approximate to 1. The thermodynamic parameters were calculated through analysis of fluorescence data with Stern-Volmer and Van't Hoff equation. The calculated enthalpy change (ΔH) and entropy change (ΔS) implied that the main interaction forces of HAR with BSA were the bonding interaction between van der Waals forces and hydrogen. The negative values of energy (ΔG) demonstrated that the binding of HAR with BSA was a spontaneous and exothermic process. The binding distance(r) between HAR and BSA was calculated to be about 2.80 nm based on the theory of Frster's non-radiation energy transfer, which indicated that energy is likely to be transfer from BSA to HAR. Both synchronous and 3D florescence spectroscopy clearly revealed that the microenvironment and conformation of BSA changed during the binding interaction between HAR and BSA. The molecular docking analysis revealed HAR is more inclined to BSA and human serum albumin (HSA) in subdomain ⅡA (Sudlow's site I). This study will provide valuable information for understanding the action mechanism of HAR. Copyright© by the Chinese Pharmaceutical Association.

Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

PubMed Central

Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

2017-01-01

The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

Structural Basis for High Specificity of Amadori Compound and Mannopine Opine Binding in Bacterial Pathogens*

PubMed Central

Marty, Loïc; Vigouroux, Armelle; Aumont-Nicaise, Magali; Dessaux, Yves; Faure, Denis; Moréra, Solange

2016-01-01

Agrobacterium tumefaciens pathogens genetically modify their host plants to drive the synthesis of opines in plant tumors. Opines are either sugar phosphodiesters or the products of condensed amino acids with ketoacids or sugars. They are Agrobacterium nutrients and imported into the bacterial cell via periplasmic-binding proteins (PBPs) and ABC-transporters. Mannopine, an opine from the mannityl-opine family, is synthesized from an intermediate named deoxy-fructosyl-glutamine (DFG), which is also an opine and abundant Amadori compound (a name used for any derivative of aminodeoxysugars) present in decaying plant materials. The PBP MotA is responsible for mannopine import in mannopine-assimilating agrobacteria. In the nopaline-opine type agrobacteria strain, SocA protein was proposed as a putative mannopine binding PBP, and AttC protein was annotated as a mannopine binding-like PBP. Structural data on mannityl-opine-PBP complexes is currently lacking. By combining affinity data with analysis of seven x-ray structures at high resolution, we investigated the molecular basis of MotA, SocA, and AttC interactions with mannopine and its DFG precursor. Our work demonstrates that AttC is not a mannopine-binding protein and reveals a specific binding pocket for DFG in SocA with an affinity in nanomolar range. Hence, mannopine would not be imported into nopaline-type agrobacteria strains. In contrast, MotA binds both mannopine and DFG. We thus defined one mannopine and two DFG binding signatures. Unlike mannopine-PBPs, selective DFG-PBPs are present in a wide diversity of bacteria, including Actinobacteria, α-,β-, and γ-proteobacteria, revealing a common role of this Amadori compound in pathogenic, symbiotic, and opportunistic bacteria. PMID:27609514

Ipomoelin, a Jacalin-Related Lectin with a Compact Tetrameric Association and Versatile Carbohydrate Binding Properties Regulated by Its N Terminus

PubMed Central

Chang, Wei-Chieh; Liu, Kai-Lun; Hsu, Fang-Ciao; Jeng, Shih-Tong; Cheng, Yi-Sheng

2012-01-01

Many proteins are induced in the plant defense response to biotic stress or mechanical wounding. One group is lectins. Ipomoelin (IPO) is one of the wound-inducible proteins of sweet potato (Ipomoea batatas cv. Tainung 57) and is a Jacalin-related lectin (JRL). In this study, we resolved the crystal structures of IPO in its apo form and in complex with carbohydrates such as methyl α-D-mannopyranoside (Me-Man), methyl α-D-glucopyranoside (Me-Glc), and methyl α-D-galactopyranoside (Me-Gal) in different space groups. The packing diagrams indicated that IPO might represent a compact tetrameric association in the JRL family. The protomer of IPO showed a canonical β-prism fold with 12 strands of β-sheets but with 2 additional short β-strands at the N terminus. A truncated IPO (ΔN10IPO) by removing the 2 short β-strands of the N terminus was used to reveal its role in a tetrameric association. Gel filtration chromatography confirmed IPO as a tetrameric form in solution. Isothermal titration calorimetry determined the binding constants (KA) of IPO and ΔN10IPO against various carbohydrates. IPO could bind to Me-Man, Me-Glc, and Me-Gal with similar binding constants. In contrast, ΔN10IPO showed high binding ability to Me-Man and Me-Glc but could not bind to Me-Gal. Our structural and functional analysis of IPO revealed that its compact tetrameric association and carbohydrate binding polyspecificity could be regulated by the 2 additional N-terminal β-strands. The versatile carbohydrate binding properties of IPO might play a role in plant defense. PMID:22808208

Determinants of Ligand Subtype-Selectivity at α1A-Adrenoceptor Revealed Using Saturation Transfer Difference (STD) NMR.

PubMed

Yong, Kelvin J; Vaid, Tasneem M; Shilling, Patrick J; Wu, Feng-Jie; Williams, Lisa M; Deluigi, Mattia; Plückthun, Andreas; Bathgate, Ross A D; Gooley, Paul R; Scott, Daniel J

2018-04-20

α 1A - and α 1B -adrenoceptors (α 1A -AR and α 1B -AR) are closely related G protein-coupled receptors (GPCRs) that modulate the cardiovascular and nervous systems in response to binding epinephrine and norepinephrine. The GPCR gene superfamily is made up of numerous subfamilies that, like α 1A -AR and α 1B -AR, are activated by the same endogenous agonists but may modulate different physiological processes. A major challenge in GPCR research and drug discovery is determining how compounds interact with receptors at the molecular level, especially to assist in the optimization of drug leads. Nuclear magnetic resonance spectroscopy (NMR) can provide great insight into ligand-binding epitopes, modes, and kinetics. Ideally, ligand-based NMR methods require purified, well-behaved protein samples. The instability of GPCRs upon purification in detergents, however, makes the application of NMR to study ligand binding challenging. Here, stabilized α 1A -AR and α 1B -AR variants were engineered using Cellular High-throughput Encapsulation, Solubilization, and Screening (CHESS), allowing the analysis of ligand binding with Saturation Transfer Difference NMR (STD NMR). STD NMR was used to map the binding epitopes of epinephrine and A-61603 to both receptors, revealing the molecular determinants for the selectivity of A-61603 for α 1A -AR over α 1B -AR. The use of stabilized GPCRs for ligand-observed NMR experiments will lead to a deeper understanding of binding processes and assist structure-based drug design.

Conformation-selective inhibitors reveal differences in the activation and phosphate-binding loops of the tyrosine kinases Abl and Src

PubMed Central

Hari, Sanjay B.; Perera, B. Gayani K.; Ranjitkar, Pratistha; Seeliger, Markus A.; Maly, Dustin J.

2013-01-01

Over the last decade, an increasingly diverse array of potent and selective inhibitors that target the ATP-binding sites of protein kinases have been developed. Many of these inhibitors, like the clinically approved drug imatinib (Gleevec), stabilize a specific catalytically inactive ATP-binding site conformation of their kinases targets. Imatinib is notable in that it is highly selective for its kinase target, Abl, over other closely-related tyrosine kinases, like Src. In addition, imatinib is highly sensitive to the phosphorylation state of Abl's activation loop, which is believed to be a general characteristic of all inhibitors that stabilize a similar inactive ATP-binding site conformation. In this report, we perform a systematic analysis of a diverse series of ATP-competitive inhibitors that stabilize a similar inactive ATP-binding site conformation as imatinib with the tyrosine kinases Src and Abl. In contrast to imatinib, many of these inhibitors have very similar potencies against Src and Abl. Furthermore, only a subset of this class of inhibitors is sensitive to the phosphorylation state of the activation loop of these kinases. In attempting to explain this observation, we have uncovered an unexpected correlation between Abl's activation loop and another flexible active site feature, called the phosphate-binding loop (p-loop). These studies shed light on how imatinib is able to obtain its high target selectivity and reveal how the conformational preference of flexible active site regions can vary between closely related kinases. PMID:24106839

Fungal effector Ecp6 outcompetes host immune receptor for chitin binding through intrachain LysM dimerization

PubMed Central

Kombrink, Anja; Hansen, Guido; Valkenburg, Dirk-Jan

2013-01-01

While host immune receptors detect pathogen-associated molecular patterns to activate immunity, pathogens attempt to deregulate host immunity through secreted effectors. Fungi employ LysM effectors to prevent recognition of cell wall-derived chitin by host immune receptors, although the mechanism to compete for chitin binding remained unclear. Structural analysis of the LysM effector Ecp6 of the fungal tomato pathogen Cladosporium fulvum reveals a novel mechanism for chitin binding, mediated by intrachain LysM dimerization, leading to a chitin-binding groove that is deeply buried in the effector protein. This composite binding site involves two of the three LysMs of Ecp6 and mediates chitin binding with ultra-high (pM) affinity. Intriguingly, the remaining singular LysM domain of Ecp6 binds chitin with low micromolar affinity but can nevertheless still perturb chitin-triggered immunity. Conceivably, the perturbation by this LysM domain is not established through chitin sequestration but possibly through interference with the host immune receptor complex. DOI: http://dx.doi.org/10.7554/eLife.00790.001 PMID:23840930

Sequestration of cAMP response element-binding proteins by transcription factor decoys causes collateral elaboration of regenerating Aplysia motor neuron axons.

PubMed

Dash, P K; Tian, L M; Moore, A N

1998-07-07

Axonal injury increases intracellular Ca2+ and cAMP and has been shown to induce gene expression, which is thought to be a key event for regeneration. Increases in intracellular Ca2+ and/or cAMP can alter gene expression via activation of a family of transcription factors that bind to and modulate the expression of CRE (Ca2+/cAMP response element) sequence-containing genes. We have used Aplysia motor neurons to examine the role of CRE-binding proteins in axonal regeneration after injury. We report that axonal injury increases the binding of proteins to a CRE sequence-containing probe. In addition, Western blot analysis revealed that the level of ApCREB2, a CRE sequence-binding repressor, was enhanced as a result of axonal injury. The sequestration of CRE-binding proteins by microinjection of CRE sequence-containing plasmids enhanced axon collateral formation (both number and length) as compared with control plasmid injections. These findings show that Ca2+/cAMP-mediated gene expression via CRE-binding transcription factors participates in the regeneration of motor neuron axons.

Hormone activation induces nucleosome positioning in vivo

PubMed Central

Belikov, Sergey; Gelius, Birgitta; Almouzni, Geneviève; Wrange, Örjan

2000-01-01

The mouse mammary tumor virus (MMTV) promoter is induced by glucocorticoid hormone. A robust hormone- and receptor-dependent activation could be reproduced in Xenopus laevis oocytes. The homogeneous response in this system allowed a detailed analysis of the transition in chromatin structure following hormone activation. This revealed two novel findings: hormone activation led to the establishment of specific translational positioning of nucleosomes despite the lack of significant positioning in the inactive state; and, in the active promoter, a subnucleosomal particle encompassing the glucocorticoid receptor (GR)-binding region was detected. The presence of only a single GR-binding site was sufficient for the structural transition to occur. Both basal promoter elements and ongoing transcription were dispensable. These data reveal a stepwise process in the transcriptional activation by glucocorticoid hormone. PMID:10698943

Crystal Structure of the Marburg Virus Nucleoprotein Core Domain Chaperoned by a VP35 Peptide Reveals a Conserved Drug Target for Filovirus.

PubMed

Zhu, Tengfei; Song, Hao; Peng, Ruchao; Shi, Yi; Qi, Jianxun; Gao, George F

2017-09-15

Filovirus nucleoprotein (NP), viral protein 35 (VP35), and polymerase L are essential for viral replication and nucleocapsid formation. Here, we identify a 28-residue peptide (NP binding peptide [NPBP]) from Marburg virus (MARV) VP35 through sequence alignment with previously identified Ebola virus (EBOV) NPBP, which bound to the core region (residues 18 to 344) of the N-terminal portion of MARV NP with high affinity. The crystal structure of the MARV NP core/NPBP complex at a resolution of 2.6 Å revealed that NPBP binds to the C-terminal region of the NP core via electrostatic and nonpolar interactions. Further structural analysis revealed that the MARV and EBOV NP cores hold a conserved binding pocket for NPBP, and this pocket could serve as a promising target for the design of universal drugs against filovirus infection. In addition, cross-binding assays confirmed that the NP core of MARV or EBOV can bind the NPBP from the other virus, although with moderately reduced binding affinities that result from termini that are distinct between the MARV and EBOV NPBPs. IMPORTANCE Historically, Marburg virus (MARV) has caused severe disease with up to 90% lethality. Among the viral proteins produced by MARV, NP and VP35 are both multifunctional proteins that are essential for viral replication. In its relative, Ebola virus (EBOV), an N-terminal peptide from VP35 binds to the NP N-terminal region with high affinity. Whether this is a common mechanism among filoviruses is an unsolved question. Here, we present the crystal structure of a complex that consists of the core domain of MARV NP and the NPBP peptide from VP35. As we compared MARV NPBP with EBOV NPBP, several different features at the termini were identified. Although these differences reduce the affinity of the NP core for NPBPs across genera, a conserved pocket in the C-terminal region of the NP core makes cross-species binding possible. Our results expand our knowledge of filovirus NP-VP35 interactions and provide more details for therapeutic intervention. Copyright © 2017 American Society for Microbiology.

Evidence for a single class of somatostatin receptors in ground squirrel cerebral cortex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krantic, S.; Petrovic, V.M.; Quirion, R.

1989-01-01

In the present study we characterized high-affinity somatostatin (SRIF) binding sites (Kd = 2.06 +/- 0.32 nM and Bmax = 295 +/- 28 fmol/mg protein) in cerebral cortex membrane preparations of European ground squirrel using /sup 125/I-(Tyr0-D-Trp8)-SRIF14 as a radioligand. The inhibition of radioligand specific binding by SRIF14, as well as by its agonists (SRIF28, Tyr0-D-Trp8-SRIF14, SMS 201 995) was complete and monophasic, thus revealing a single population of somatostatinergic binding sites. Radioautographic analysis of /sup 125/I-(Tyr0-D-Trp8)-SRIF14 labeled brain sections confirmed the results of our biochemical study. The homogeneity of SRIF binding sites in the ground squirrel neocortex was notmore » dependent on the animal's life-cycle phase.« less

Crystal structure of a cocaine-binding antibody.

PubMed

Larsen, N A; Zhou, B; Heine, A; Wirsching, P; Janda, K D; Wilson, I A

2001-08-03

Murine monoclonal antibody GNC92H2 was elicited by active immunization with a cocaine immunoconjugate and binds free cocaine with excellent specificity and moderate affinity. Improvement of affinity, as well as humanization of GNC92H2, would be advantageous in immunopharmacotherapy for cocaine addiction, and for emergency cases of drug overdose. Toward this end, the crystal structure of an engineered murine-human chimeric Fab of GNC92H2 complexed with cocaine was determined at 2.3 A resolution. Structural analysis reveals a binding pocket with high shape and charge complementarity to the cocaine framework, which explains the specificity for cocaine, as opposed to the pharmacologically inactive cocaine metabolites. Importantly, the structure provides a foundation for mutagenesis to enhance the binding affinity for cocaine and potent cocaine derivatives, such as cocaethylene, and for additional humanization of the antibody. Copyright 2001 Academic Press.

Inhibitor-binding mode of homobelactosin C to proteasomes: New insights into class I MHC ligand generation

PubMed Central

Groll, Michael; Larionov, Oleg V.; Huber, Robert; de Meijere, Armin

2006-01-01

Most class I MHC ligands are generated from the vast majority of cellular proteins by proteolysis within the ubiquitin–proteasome pathway and are presented on the cell surface by MHC class I molecules. Here, we present the crystallographic analysis of yeast 20S proteasome in complex with the inhibitor homobelactosin C. The structure reveals a unique inhibitor-binding mode and provides information about the composition of proteasomal primed substrate-binding sites. IFN-γ inducible substitution of proteasomal constitutive subunits by immunosubunits modulates characteristics of generated peptides, thus producing fragments with higher preference for binding to MHC class I molecules. The structural data for the proteasome:homobelactosin C complex provide an explanation for involvement of immunosubunits in antigen generation and open perspectives for rational design of ligands, inhibiting exclusively constitutive proteasomes or immunoproteasomes. PMID:16537370

WAVE2 serves a functional partner of IRSp53 by regulating its interaction with Rac.

PubMed

Miki, Hiroaki; Takenawa, Tadaomi

2002-04-26

We previously reported that IRSp53 binds both Rac and WAVE2, inducing formation of Rac/IRSp53/WAVE2 complex that is important for membrane ruffling. However, recent reports noted a specific interaction between IRSp53 and Cdc42 but not Rac, which led us to re-examine the binding of IRSp53 to Rac. Immunoprecipitation analysis and pull-down assay reveal that full-length IRSp53 binds Rac much less efficiently than the N-terminal fragment, which may be caused by intramolecular interaction. Interestingly, the intramolecular interaction is interrupted by the binding of WAVE2 and full-length IRSp53 associates with Rac in the presence of WAVE2. We also report that IRSp53 induces spreading and neurite formation of N1E-115 cells, which presumably reflect functional cooperation with Rac.

Generation of tumour-necrosis-factor-alpha-specific affibody molecules capable of blocking receptor binding in vitro.

PubMed

Jonsson, Andreas; Wållberg, Helena; Herne, Nina; Ståhl, Stefan; Frejd, Fredrik Y

2009-08-17

Affibody molecules specific for human TNF-alpha (tumour necrosis factor-alpha) were selected by phage-display technology from a library based on the 58-residue Protein A-derived Z domain. TNF-alpha is a proinflammatory cytokine involved in several inflammatory diseases and, to this day, four TNF-alpha-blocking protein pharmaceuticals have been approved for clinical use. The phage selection generated 18 unique cysteine-free affibody sequences of which 12 were chosen, after sequence cluster analysis, for characterization as proteins. Biosensor binding studies of the 12 Escherichia coli-produced and IMAC (immobilized-metal-ion affinity chromatography)-purified affibody molecules revealed three variants that demonstrated the strongest binding to human TNF-alpha. These three affibody molecules were subjected to kinetic binding analysis and also tested for their binding to mouse, rat and pig TNF-alpha. For ZTNF-alpha:185, subnanomolar affinity (KD=0.1-0.5 nM) for human TNF-alpha was demonstrated, as well as significant binding to TNF-alpha from the other species. Furthermore, the binding site was found to overlap with the binding site for the TNF-alpha receptor, since this interaction could be efficiently blocked by the ZTNF-alpha:185 affibody. When investigating six dimeric affibody constructs with different linker lengths, and one trimeric construct, it was found that the inhibition of the TNF-alpha binding to its receptor could be further improved by using dimers with extended linkers and/or a trimeric affibody construct. The potential implication of the results for the future design of affibody-based reagents for the diagnosis of inflammation is discussed.

Functional and Structural Analysis of the Conserved EFhd2 Protein

PubMed Central

Acosta, Yancy Ferrer; Rodríguez Cruz, Eva N.; Vaquer, Ana del C.; Vega, Irving E.

2013-01-01

EFhd2 is a novel protein conserved from C. elegans to H. sapiens. This novel protein was originally identified in cells of the immune and central nervous systems. However, it is most abundant in the central nervous system, where it has been found associated with pathological forms of the microtubule-associated protein tau. The physiological or pathological roles of EFhd2 are poorly understood. In this study, a functional and structural analysis was carried to characterize the molecular requirements for EFhd2’s calcium binding activity. The results showed that mutations of a conserved aspartate on either EF-hand motif disrupted the calcium binding activity, indicating that these motifs work in pair as a functional calcium binding domain. Furthermore, characterization of an identified single-nucleotide polymorphisms (SNP) that introduced a missense mutation indicates the importance of a conserved phenylalanine on EFhd2 calcium binding activity. Structural analysis revealed that EFhd2 is predominantly composed of alpha helix and random coil structures and that this novel protein is thermostable. EFhd2’s thermo stability depends on its N-terminus. In the absence of the N-terminus, calcium binding restored EFhd2’s thermal stability. Overall, these studies contribute to our understanding on EFhd2 functional and structural properties, and introduce it into the family of canonical EF-hand domain containing proteins. PMID:22973849

Comparison of S. cerevisiae F-BAR domain structures reveals a conserved inositol phosphate binding site

PubMed Central

Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; Kenniston, Jon A.; Mendrola, Jeannine M.; Ferguson, Kathryn M.; Lemmon, Mark A.

2015-01-01

SUMMARY F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here, we compare membrane-binding properties of the S. cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound to an inositol phosphate. The structures explain phospholipid-binding selectivity differences, and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip, and is partly retained in certain other F-BAR domains. Our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity, and provide a basis for its prediction from sequence. PMID:25620000

Binding free energy calculations to rationalize the interactions of huprines with acetylcholinesterase.

PubMed

Nascimento, Érica C M; Oliva, Mónica; Andrés, Juan

2018-05-01

In the present study, the binding free energy of a family of huprines with acetylcholinesterase (AChE) is calculated by means of the free energy perturbation method, based on hybrid quantum mechanics and molecular mechanics potentials. Binding free energy calculations and the analysis of the geometrical parameters highlight the importance of the stereochemistry of huprines in AChE inhibition. Binding isotope effects are calculated to unravel the interactions between ligands and the gorge of AChE. New chemical insights are provided to explain and rationalize the experimental results. A good correlation with the experimental data is found for a family of inhibitors with moderate differences in the enzyme affinity. The analysis of the geometrical parameters and interaction energy per residue reveals that Asp72, Glu199, and His440 contribute significantly to the network of interactions between active site residues, which stabilize the inhibitors in the gorge. It seems that a cooperative effect of the residues of the gorge determines the affinity of the enzyme for these inhibitors, where Asp72, Glu199, and His440 make a prominent contribution.

Isolation and cDNA cloning of a novel red colour-related pigment-binding protein derived from the shell of the shrimp, Litopenaeus vannamei.

PubMed

Pan, Chuang; Ishizaki, Shoichiro; Nagashima, Yuji; Gao, Jialong; Watabe, Shugo

2018-02-15

Pigment-binding proteins play important roles in crustacean shell colour change. In this study, a red colour-related pigment-binding protein, designated LvPBP75, was purified from the shell of Litopenaeus vannamei. HPLC and PAGE analysis showed that LvPBP75 was a homogeneous monomer with molecular mass of 75kDa. Peptide mass fingerprint analysis revealed that LvPBP75 belonged to hemocyanin, and the released pigment from heated LvPBP75 showed a λ max at 481nm in acetone. The significant red-colour change temperatures were detected at 30 and 80°C, respectively. Based on the determined amino acid fragments, a full-length cDNA of LvPBP75 was cloned and sequenced. The ORF encodes a protein of 662 amino acids having 80% identity with penaeidae hemocyanin. These results strongly suggest a novel function of hemocyanin, namely binding with pigment, and its involvement in L. vannamei shell colour change. Copyright © 2017 Elsevier Ltd. All rights reserved.

Binding free energy calculations to rationalize the interactions of huprines with acetylcholinesterase

NASA Astrophysics Data System (ADS)

Nascimento, Érica C. M.; Oliva, Mónica; Andrés, Juan

2018-03-01

In the present study, the binding free energy of a family of huprines with acetylcholinesterase (AChE) is calculated by means of the free energy perturbation method, based on hybrid quantum mechanics and molecular mechanics potentials. Binding free energy calculations and the analysis of the geometrical parameters highlight the importance of the stereochemistry of huprines in AChE inhibition. Binding isotope effects are calculated to unravel the interactions between ligands and the gorge of AChE. New chemical insights are provided to explain and rationalize the experimental results. A good correlation with the experimental data is found for a family of inhibitors with moderate differences in the enzyme affinity. The analysis of the geometrical parameters and interaction energy per residue reveals that Asp72, Glu199, and His440 contribute significantly to the network of interactions between active site residues, which stabilize the inhibitors in the gorge. It seems that a cooperative effect of the residues of the gorge determines the affinity of the enzyme for these inhibitors, where Asp72, Glu199, and His440 make a prominent contribution.

Antagonism of ligand-gated ion channel receptors: two domains of the glycine receptor alpha subunit form the strychnine-binding site.

PubMed Central

Vandenberg, R J; French, C R; Barry, P H; Shine, J; Schofield, P R

1992-01-01

The inhibitory glycine receptor (GlyR) is a member of the ligand-gated ion channel receptor superfamily. Glycine activation of the receptor is antagonized by the convulsant alkaloid strychnine. Using in vitro mutagenesis and functional analysis of the cDNA encoding the alpha 1 subunit of the human GlyR, we have identified several amino acid residues that form the strychnine-binding site. These residues were identified by transient expression of mutated cDNAs in mammalian (293) cells and examination of resultant [3H]strychnine binding, glycine displacement of [3H]strychnine, and electrophysiological responses to the application of glycine and strychnine. This mutational analysis revealed that residues from two separate domains within the alpha 1 subunit form the binding site for the antagonist strychnine. The first domain includes the amino acid residues Gly-160 and Tyr-161, and the second domain includes the residues Lys-200 and Tyr-202. These results, combined with analyses of other ligand-gated ion channel receptors, suggest a conserved tertiary structure and a common mechanism for antagonism in this receptor superfamily. PMID:1311851

Binding free energy calculations to rationalize the interactions of huprines with acetylcholinesterase

NASA Astrophysics Data System (ADS)

Nascimento, Érica C. M.; Oliva, Mónica; Andrés, Juan

2018-05-01

In the present study, the binding free energy of a family of huprines with acetylcholinesterase (AChE) is calculated by means of the free energy perturbation method, based on hybrid quantum mechanics and molecular mechanics potentials. Binding free energy calculations and the analysis of the geometrical parameters highlight the importance of the stereochemistry of huprines in AChE inhibition. Binding isotope effects are calculated to unravel the interactions between ligands and the gorge of AChE. New chemical insights are provided to explain and rationalize the experimental results. A good correlation with the experimental data is found for a family of inhibitors with moderate differences in the enzyme affinity. The analysis of the geometrical parameters and interaction energy per residue reveals that Asp72, Glu199, and His440 contribute significantly to the network of interactions between active site residues, which stabilize the inhibitors in the gorge. It seems that a cooperative effect of the residues of the gorge determines the affinity of the enzyme for these inhibitors, where Asp72, Glu199, and His440 make a prominent contribution.

Studies on interaction of norbixin with DNA: Multispectroscopic and in silico analysis

NASA Astrophysics Data System (ADS)

Anantharaman, Amrita; Priya, Rajendra Rao; Hemachandran, Hridya; Sivaramakrishna, Akella; Babu, Subramanian; Siva, Ramamoorthy

2015-06-01

The interaction of food colorant norbixin with calf thymus DNA (CTDNA) was investigated through UV-Visible spectroscopy, Fourier Transform Infrared (FTIR), Circular Dichroism (CD), Nuclear Magnetic Resonance (NMR), DNA melting studies, electrophoretic analysis, histological staining technique and molecular docking studies. The results indicated that norbixin interacted with CTDNA by partial intercalation mode. The binding constant (K) of norbixin with CTDNA was calculated to be 5.08 × 105 Mol-1 L. FTIR and CD studies were coupled with 1H NMR spectra revealed that norbixin intercalates partially and binds to the groove's, phosphate group, deoxyribose sugar of DNA and also induces conformational transition of B-form to A-form DNA. Agarose gel electrophoretic and histological staining technique results further prove that, norbixin specifically binds to the DNA in the cell. Moreover, molecular docking studies on the specific binding of norbixin with CTDNA have exhibited lowest conformation energy score of -3.2. Therefore, this food colorant has the ability to interact with DNA and it could emerge as a promising class of natural DNA targeted therapeutic.

Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase

PubMed Central

Guo, Chunguang; Zhang, Xiaodong; Fink, Stephen P; Platzer, Petra; Wilson, Keith; Willson, James K. V.; Wang, Zhenghe; Markowitz, Sanford D

2008-01-01

Expression microarrays identified a novel transcript, designated as Ugene, whose expression is absent in normal colon and colon adenomas, but that is commonly induced in malignant colon cancers. These findings were validated by real-time PCR and Northern blot analysis in an independent panel of colon cancer cases. In addition, Ugene expression was found to be elevated in many other common cancer types, including, breast, lung, uterus, and ovary. Immunofluorescence of V5-tagged Ugene revealed it to have a nuclear localization. In a pull-down assay, uracil DNA-glycosylase 2 (UNG2), an important enzyme in the base excision repair pathway, was identified as a partner protein that binds to Ugene. Co-immunoprecipitation and Western blot analysis confirmed the binding between the endogenous Ugene and UNG2 proteins. Using deletion constructs, we find that Ugene binds to the first 25 amino acids of the UNG2 NH2-terminus. We suggest Ugene induction in cancer may contribute to the cancer phenotype by interacting with the base excision repair pathway. PMID:18676834

Analysis of the bacterial luciferase mobile loop by replica-exchange molecular dynamics.

PubMed

Campbell, Zachary T; Baldwin, Thomas O; Miyashita, Osamu

2010-12-15

Bacterial luciferase contains an extended 29-residue mobile loop. Movements of this loop are governed by binding of either flavin mononucleotide (FMNH2) or polyvalent anions. To understand this process, loop dynamics were investigated using replica-exchange molecular dynamics that yielded conformational ensembles in either the presence or absence of FMNH2. The resulting data were analyzed using clustering and network analysis. We observed the closed conformations that are visited only in the simulations with the ligand. Yet the mobile loop is intrinsically flexible, and FMNH2 binding modifies the relative populations of conformations. This model provides unique information regarding the function of a crystallographically disordered segment of the loop near the binding site. Structures at or near the fringe of this network were compatible with flavin binding or release. Finally, we demonstrate that the crystallographically observed conformation of the mobile loop bound to oxidized flavin was influenced by crystal packing. Thus, our study has revealed what we believe are novel conformations of the mobile loop and additional context for experimentally determined structures. Copyright © 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Analysis of correlated domain motions in IgG light chain reveals possible mechanisms of immunological signal transduction.

PubMed

Król, Marcin; Roterman, Irena; Piekarska, Barbara; Konieczny, Leszek; Rybarska, Janina; Stopa, Barbara; Spólnik, Paweł

2005-05-15

It was shown experimentally that binding of a micelle composed of Congo red molecules to immunological complexes leads to the enhanced stability of the latter, and simultaneously prevents binding of a complement molecule (C1q). The dye binds in a cavity created by the removal of N-terminal polypeptide chain, as observed experimentally in a model system-immunoglobulin G (IgG) light chain dimer. Molecular Dynamics (MD) simulations of three forms of IgG light chain dimer, with and without the dye, were performed to investigate the role of N-terminal fragment and self-assembled ligand in coupling between V and C domains. Root-mean-square distance (RMSD) time profiles show that removal of N-terminal fragment leads to destabilization of V domain. A micelle composed of four self-assembled dye molecules stabilizes and fixes the domain. Analysis of root-mean-square fluctuation (RMSF) values and dynamic cross-correlation matrices (DCCM) reveals that removal of N-terminal fragment results in complete decoupling between V and C domains. Binding of self-assembled Congo red molecules improves the coupling, albeit slightly. The disruption of a small beta-sheet composed of N- and C-terminal fragments of the domain (NC sheet) is the most likely reason for the decoupling. Self-assembled ligand, bound in the place originally occupied by N-terminal fragment, is not able to take over the function of the beta-sheet. Lack of correlation of motions between residues in V and C domains denotes that light chain-Congo red complexes have hampered ability to transmit conformational changes between domains. This is a likely explanation of the lack of complement binding by immunological complexes, which bind Congo red, and supports the idea that the NC sheet is the key structural fragment taking part in immunological signal transduction. Copyright 2005 Wiley-Liss, Inc.

Characterization of diverse subvariants of the meningococcal factor H (fH) binding protein for their ability to bind fH, to mediate serum resistance, and to induce bactericidal antibodies.

PubMed

Seib, Kate L; Brunelli, Brunella; Brogioni, Barbara; Palumbo, Emmanuelle; Bambini, Stefania; Muzzi, Alessandro; DiMarcello, Federica; Marchi, Sara; van der Ende, Arie; Aricó, Beatrice; Savino, Silvana; Scarselli, Maria; Comanducci, Maurizio; Rappuoli, Rino; Giuliani, Marzia M; Pizza, Mariagrazia

2011-02-01

Neisseria meningitidis is a commensal of the human nasopharynx but is also a major cause of septicemia and meningitis. The meningococcal factor H binding protein (fHbp) binds human factor H (fH), enabling downregulation of complement activation on the bacterial surface. fHbp is a component of two serogroup B meningococcal vaccines currently in clinical development. Here we characterize 12 fHbp subvariants for their level of surface exposure and ability to bind fH, to mediate serum resistance, and to induce bactericidal antibodies. Flow cytometry and Western analysis revealed that all strains examined expressed fHbp on their surface to different extents and bound fH in an fHbp-dependent manner. However, differences in fH binding did not always correlate with the level of fHbp expression, indicating that this is not the only factor affecting the amount of fH bound. To overcome the issue of strain variability in fHbp expression, the MC58ΔfHbp strain was genetically engineered to express different subvariants from a constitutive heterologous promoter. These recombinant strains were characterized for fH binding, and the data confirmed that each subvariant binds different levels of fH. Surface plasmon resonance revealed differences in the stability of the fHbp-fH complexes that ranged over 2 orders of magnitude, indicating that differences in residues between and within variant groups can influence fH binding. Interestingly, the level of survival in human sera of recombinant MC58 strains expressing diverse subvariants did not correlate with the level of fH binding, suggesting that the interaction of fHbp with fH is not the only function of fHbp that influences serum resistance. Furthermore, cross-reactive bactericidal activity was seen within each variant group, although the degree of activity varied, suggesting that amino acid differences within each variant group influence the bactericidal antibody response.

PilN binding modulates the structure and binding partners of the Pseudomonas aeruginosa type IVa pilus protein PilM

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCallum, Matthew; Tammam, Stephanie; Little, Dustin J.

Pseudomonas aeruginosa is an opportunistic bacterial pathogen that expresses type IVa pili. The pilus assembly system, which promotes surface-associated twitching motility and virulence, is composed of inner and outer membrane subcomplexes, connected by an alignment subcomplex composed of PilMNOP. PilM binds to the N terminus of PilN, and we hypothesize that this interaction causes functionally significant structural changes in PilM. To characterize this interaction, we determined the crystal structures of PilM and a PilM chimera where PilM was fused to the first 12 residues of PilN (PilM·PilN(1–12)). Structural analysis, multiangle light scattering coupled with size exclusion chromatography, and bacterial two-hybridmore » data revealed that PilM forms dimers mediated by the binding of a novel conserved motif in the N terminus of PilM, and binding PilN abrogates this binding interface, resulting in PilM monomerization. Structural comparison of PilM with PilM·PilN(1–12) revealed that upon PilN binding, there is a large domain closure in PilM that alters its ATP binding site. Using biolayer interferometry, we found that the association rate of PilN with PilM is higher in the presence of ATP compared with ADP. Bacterial two-hybrid data suggested the connectivity of the cytoplasmic and inner membrane components of the type IVa pilus machinery in P. aeruginosa, with PilM binding to PilB, PilT, and PilC in addition to PilN. Pull-down experiments demonstrated direct interactions of PilM with PilB and PilT. As a result, we propose a working model in which dynamic binding of PilN facilitates functionally relevant structural changes in PilM.« less

Insights into the binding specificity of wild type and mutated wheat germ agglutinin towards Neu5Acα(2-3)Gal: a study by in silico mutations and molecular dynamics simulations.

PubMed

Parasuraman, Ponnusamy; Murugan, Veeramani; Selvin, Jeyasigamani F A; Gromiha, M Michael; Fukui, Kazuhiko; Veluraja, Kasinadar

2014-08-01

Wheat germ agglutinin (WGA) is a plant lectin, which specifically recognizes the sugars NeuNAc and GlcNAc. Mutated WGA with enhanced binding specificity can be used as biomarkers for cancer. In silico mutations are performed at the active site of WGA to enhance the binding specificity towards sialylglycans, and molecular dynamics simulations of 20 ns are carried out for wild type and mutated WGAs (WGA1, WGA2, and WGA3) in complex with sialylgalactose to examine the change in binding specificity. MD simulations reveal the change in binding specificity of wild type and mutated WGAs towards sialylgalactose and bound conformational flexibility of sialylgalactose. The mutated polar amino acid residues Asn114 (S114N), Lys118 (G118K), and Arg118 (G118R) make direct and water mediated hydrogen bonds and hydrophobic interactions with sialylgalactose. An analysis of possible hydrogen bonds, hydrophobic interactions, total pair wise interaction energy between active site residues and sialylgalactose and MM-PBSA free energy calculation reveals the plausible binding modes and the role of water in stabilizing different binding modes. An interesting observation is that the binding specificity of mutated WGAs (cyborg lectin) towards sialylgalactose is found to be higher in double point mutation (WGA3). One of the substituted residues Arg118 plays a crucial role in sugar binding. Based on the interactions and energy calculations, it is concluded that the order of binding specificity of WGAs towards sialylgalactose is WGA3 > WGA1 > WGA2 > WGA. On comparing with the wild type, double point mutated WGA (WGA3) exhibits increased specificity towards sialylgalactose, and thus, it can be effectively used in targeted drug delivery and as biological cell marker in cancer therapeutics. Copyright © 2014 John Wiley & Sons, Ltd.

PilN binding modulates the structure and binding partners of the Pseudomonas aeruginosa type IVa pilus protein PilM

DOE PAGES

McCallum, Matthew; Tammam, Stephanie; Little, Dustin J.; ...

2016-03-28

Pseudomonas aeruginosa is an opportunistic bacterial pathogen that expresses type IVa pili. The pilus assembly system, which promotes surface-associated twitching motility and virulence, is composed of inner and outer membrane subcomplexes, connected by an alignment subcomplex composed of PilMNOP. PilM binds to the N terminus of PilN, and we hypothesize that this interaction causes functionally significant structural changes in PilM. To characterize this interaction, we determined the crystal structures of PilM and a PilM chimera where PilM was fused to the first 12 residues of PilN (PilM·PilN(1–12)). Structural analysis, multiangle light scattering coupled with size exclusion chromatography, and bacterial two-hybridmore » data revealed that PilM forms dimers mediated by the binding of a novel conserved motif in the N terminus of PilM, and binding PilN abrogates this binding interface, resulting in PilM monomerization. Structural comparison of PilM with PilM·PilN(1–12) revealed that upon PilN binding, there is a large domain closure in PilM that alters its ATP binding site. Using biolayer interferometry, we found that the association rate of PilN with PilM is higher in the presence of ATP compared with ADP. Bacterial two-hybrid data suggested the connectivity of the cytoplasmic and inner membrane components of the type IVa pilus machinery in P. aeruginosa, with PilM binding to PilB, PilT, and PilC in addition to PilN. Pull-down experiments demonstrated direct interactions of PilM with PilB and PilT. As a result, we propose a working model in which dynamic binding of PilN facilitates functionally relevant structural changes in PilM.« less

Identification of a novel calcium binding motif based on the detection of sequence insertions in the animal peroxidase domain of bacterial proteins.

PubMed

Santamaría-Hernando, Saray; Krell, Tino; Ramos-González, María-Isabel

2012-01-01

Proteins of the animal heme peroxidase (ANP) superfamily differ greatly in size since they have either one or two catalytic domains that match profile PS50292. The orf PP_2561 of Pseudomonas putida KT2440 that we have called PepA encodes a two-domain ANP. The alignment of these domains with those of PepA homologues revealed a variable number of insertions with the consensus G-x-D-G-x-x-[GN]-[TN]-x-D-D. This motif has also been detected in the structure of pseudopilin (pdb 3G20), where it was found to be involved in Ca(2+) coordination although a sequence analysis did not reveal the presence of any known calcium binding motifs in this protein. Isothermal titration calorimetry revealed that a peptide containing this consensus motif bound specifically calcium ions with affinities ranging between 33-79 µM depending on the pH. Microcalorimetric titrations of the purified N-terminal ANP-like domain of PepA revealed Ca(2+) binding with a K(D) of 12 µM and stoichiometry of 1.25 calcium ions per protein monomer. This domain exhibited peroxidase activity after its reconstitution with heme. These data led to the definition of a novel calcium binding motif that we have termed PERCAL and which was abundantly present in animal peroxidase-like domains of bacterial proteins. Bacterial heme peroxidases thus possess two different types of calcium binding motifs, namely PERCAL and the related hemolysin type calcium binding motif, with the latter being located outside the catalytic domains and in their C-terminal end. A phylogenetic tree of ANP-like catalytic domains of bacterial proteins with PERCAL motifs, including single domain peroxidases, was divided into two major clusters, representing domains with and without PERCAL motif containing insertions. We have verified that the recently reported classification of bacterial heme peroxidases in two families (cd09819 and cd09821) is unrelated to these insertions. Sequences matching PERCAL were detected in all kingdoms of life.

Genome-wide Expression Profiling, In Vivo DNA Binding Analysis, and Probabilistic Motif Prediction Reveal Novel Abf1 Target Genes during Fermentation, Respiration, and Sporulation in Yeast

PubMed Central

Schlecht, Ulrich; Erb, Ionas; Demougin, Philippe; Robine, Nicolas; Borde, Valérie; van Nimwegen, Erik; Nicolas, Alain

2008-01-01

The autonomously replicating sequence binding factor 1 (Abf1) was initially identified as an essential DNA replication factor and later shown to be a component of the regulatory network controlling mitotic and meiotic cell cycle progression in budding yeast. The protein is thought to exert its functions via specific interaction with its target site as part of distinct protein complexes, but its roles during mitotic growth and meiotic development are only partially understood. Here, we report a comprehensive approach aiming at the identification of direct Abf1-target genes expressed during fermentation, respiration, and sporulation. Computational prediction of the protein's target sites was integrated with a genome-wide DNA binding assay in growing and sporulating cells. The resulting data were combined with the output of expression profiling studies using wild-type versus temperature-sensitive alleles. This work identified 434 protein-coding loci as being transcriptionally dependent on Abf1. More than 60% of their putative promoter regions contained a computationally predicted Abf1 binding site and/or were bound by Abf1 in vivo, identifying them as direct targets. The present study revealed numerous loci previously unknown to be under Abf1 control, and it yielded evidence for the protein's variable DNA binding pattern during mitotic growth and meiotic development. PMID:18305101

Binding and thermodynamics of REV peptide-ctDNA interaction.

PubMed

Upadhyay, Santosh Kumar

2017-03-01

The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically driven. ITC based analysis of salt dependence of binding constant gave a charge value (Z) = +4.01, as determined for the δlnK/δln[Na + ] parameter, suggesting the participation of only 3-4 Arg out of 11 Arg charge from REV peptide. The stoichiometry observed for the complex was three molar charge of REV peptide binding per molar charge of ctDNA. ITC based analysis further confirmed that the binding between ctDNA and REV peptide is governed by electrostatic interaction. Molecular interactions including H-bonding, van der Waals forces, and solvent molecules rearrangement, underlie the binding of REV peptide to ctDNA. © 2016 Wiley Periodicals, Inc.

Structure-Function Analysis of Friedreich's Ataxia Mutants Reveals Determinants of Frataxin Binding and Activation of the Fe-S Assembly Complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bridwell-Rabb, Jennifer; Winn, Andrew M; Barondeau, David P

2012-08-01

Friedreich's ataxia (FRDA) is a progressive neurodegenerative disease associated with the loss of function of the protein frataxin (FXN) that results from low FXN levels due to a GAA triplet repeat expansion or, occasionally, from missense mutations in the FXN gene. Here biochemical and structural properties of FXN variants, including three FRDA missense mutations (N146K, Q148R, and R165C) and three related mutants (N146A, Q148G, and Q153A), were determined in an effort to understand the structural basis for the loss of function. In vitro assays revealed that although the three FRDA missense mutations exhibited similar losses of cysteine desulfurase and Fe-Smore » cluster assembly activities, the causes for these activation defects were distinct. The R165C variant exhibited a k cat/K M higher than that of native FXN but weak binding to the NFS1, ISD11, and ISCU2 (SDU) complex, whereas the Q148R variant exhibited the lowest k cat/K M of the six tested FXN variants and only a modest binding deficiency. The order of the FXN binding affinities for the SDU Fe-S assembly complex was as follows: FXN > Q148R > N146A > Q148G > N146K > Q153A > R165C. Four different classes of FXN variants were identified on the basis of their biochemical properties. Together, these structure-function studies reveal determinants for the binding and allosteric activation of the Fe-S assembly complex and provide insight into how FRDA missense mutations are functionally compromised.« less

Thermodynamics of Aryl-Dihydroxyphenyl-Thiadiazole Binding to Human Hsp90

PubMed Central

Kazlauskas, Egidijus; Petrikaitė, Vilma; Michailovienė, Vilma; Revuckienė, Jurgita; Matulienė, Jurgita; Grinius, Leonas; Matulis, Daumantas

2012-01-01

The design of specific inhibitors against the Hsp90 chaperone and other enzyme relies on the detailed and correct understanding of both the thermodynamics of inhibitor binding and the structural features of the protein-inhibitor complex. Here we present a detailed thermodynamic study of binding of aryl-dihydroxyphenyl-thiadiazole inhibitor series to recombinant human Hsp90 alpha isozyme. The inhibitors are highly potent, with the intrinsic Kd approximately equal to 1 nM as determined by isothermal titration calorimetry (ITC) and thermal shift assay (TSA). Dissection of protonation contributions yielded the intrinsic thermodynamic parameters of binding, such as enthalpy, entropy, Gibbs free energy, and the heat capacity. The differences in binding thermodynamic parameters between the series of inhibitors revealed contributions of the functional groups, thus providing insight into molecular reasons for improved or diminished binding efficiency. The inhibitor binding to Hsp90 alpha primarily depended on a large favorable enthalpic contribution combined with the smaller favorable entropic contribution, thus suggesting that their binding was both enthalpically and entropically optimized. The enthalpy-entropy compensation phenomenon was highly evident when comparing the inhibitor binding enthalpies and entropies. This study illustrates how detailed thermodynamic analysis helps to understand energetic reasons for the binding efficiency and develop more potent inhibitors that could be applied for therapeutic use as Hsp90 inhibitors. PMID:22655030

Binding Isotherms and Time Courses Readily from Magnetic Resonance.

PubMed

Xu, Jia; Van Doren, Steven R

2016-08-16

Evidence is presented that binding isotherms, simple or biphasic, can be extracted directly from noninterpreted, complex 2D NMR spectra using principal component analysis (PCA) to reveal the largest trend(s) across the series. This approach renders peak picking unnecessary for tracking population changes. In 1:1 binding, the first principal component captures the binding isotherm from NMR-detected titrations in fast, slow, and even intermediate and mixed exchange regimes, as illustrated for phospholigand associations with proteins. Although the sigmoidal shifts and line broadening of intermediate exchange distorts binding isotherms constructed conventionally, applying PCA directly to these spectra along with Pareto scaling overcomes the distortion. Applying PCA to time-domain NMR data also yields binding isotherms from titrations in fast or slow exchange. The algorithm readily extracts from magnetic resonance imaging movie time courses such as breathing and heart rate in chest imaging. Similarly, two-step binding processes detected by NMR are easily captured by principal components 1 and 2. PCA obviates the customary focus on specific peaks or regions of images. Applying it directly to a series of complex data will easily delineate binding isotherms, equilibrium shifts, and time courses of reactions or fluctuations.

A computational analysis of the three isoforms of glutamate dehydrogenase reveals structural features of the isoform EC 1.4.1.4 supporting a key role in ammonium assimilation by plants

PubMed Central

Jaspard, Emmanuel

2006-01-01

Background There are three isoforms of glutamate dehydrogenase. The isoform EC 1.4.1.4 (GDH4) catalyses glutamate synthesis from 2-oxoglutarate and ammonium, using NAD(P)H. Ammonium assimilation is critical for plant growth. Although GDH4 from animals and prokaryotes are well characterized, there are few data concerning plant GDH4, even from those whose genomes are well annotated. Results A large set of the three GDH isoforms was built resulting in 116 non-redundant full polypeptide sequences. A computational analysis was made to gain more information concerning the structure – function relationship of GDH4 from plants (Eukaryota, Viridiplantae). The tested plant GDH4 sequences were the two ones known to date, those of Chlorella sorokiniana. This analysis revealed several structural features specific of plant GDH4: (i) the lack of a structure called "antenna"; (ii) the NAD(P)-binding motif GAGNVA; and (iii) a second putative coenzyme-binding motif GVLTGKG together with four residues involved in the binding of the reduced form of NADP. Conclusion A number of structural features specific of plant GDH4 have been found. The results reinforce the probable key role of GDH4 in ammonium assimilation by plants. Reviewers This article was reviewed by Tina Bakolitsa (nominated by Eugene Koonin), Martin Jambon (nominated by Laura Landweber), Sandor Pangor and Franck Eisenhaber. PMID:17173671

Structural Basis for Antifreeze Activity of Ice-binding Protein from Arctic Yeast*

PubMed Central

Lee, Jun Hyuck; Park, Ae Kyung; Do, Hackwon; Park, Kyoung Sun; Moh, Sang Hyun; Chi, Young Min; Kim, Hak Jun

2012-01-01

Arctic yeast Leucosporidium sp. produces a glycosylated ice-binding protein (LeIBP) with a molecular mass of ∼25 kDa, which can lower the freezing point below the melting point once it binds to ice. LeIBP is a member of a large class of ice-binding proteins, the structures of which are unknown. Here, we report the crystal structures of non-glycosylated LeIBP and glycosylated LeIBP at 1.57- and 2.43-Å resolution, respectively. Structural analysis of the LeIBPs revealed a dimeric right-handed β-helix fold, which is composed of three parts: a large coiled structural domain, a long helix region (residues 96–115 form a long α-helix that packs along one face of the β-helix), and a C-terminal hydrophobic loop region (243PFVPAPEVV251). Unexpectedly, the C-terminal hydrophobic loop region has an extended conformation pointing away from the body of the coiled structural domain and forms intertwined dimer interactions. In addition, structural analysis of glycosylated LeIBP with sugar moieties attached to Asn185 provides a basis for interpreting previous biochemical analyses as well as the increased stability and secretion of glycosylated LeIBP. We also determined that the aligned Thr/Ser/Ala residues are critical for ice binding within the B face of LeIBP using site-directed mutagenesis. Although LeIBP has a common β-helical fold similar to that of canonical hyperactive antifreeze proteins, the ice-binding site is more complex and does not have a simple ice-binding motif. In conclusion, we could identify the ice-binding site of LeIBP and discuss differences in the ice-binding modes compared with other known antifreeze proteins and ice-binding proteins. PMID:22303017

Conformational dynamics and ligand binding in the multi-domain protein PDC109.

PubMed

Kim, Hyun Jin; Choi, Moo Young; Kim, Hyung J; Llinás, Miguel

2010-02-18

PDC109 is a modular multi-domain protein with two fibronectin type II (Fn2) repeats joined by a linker. It plays a major role in bull sperm binding to the oviductal epithelium through its interactions with phosphorylcholines (PhCs), a head group of sperm cell membrane lipids. The crystal structure of the PDC109-PhC complex shows that each PhC binds to the corresponding Fn2 domain, while the two domains are on the same face of the protein. Long timescale explicit solvent molecular dynamics (MD) simulations of PDC109, in the presence and absence of PhC, suggest that PhC binding strongly correlates with the relative orientation of choline-phospholipid binding sites of the two Fn2 domains; unless the two domains tightly bind PhCs, they tend to change their relative orientation by deforming the flexible linker. The effective PDC109-PhC association constant of 28 M(-1), estimated from their potential of mean force is consistent with the experimental result. Principal component analysis of the long timescale MD simulations was compared to the significantly less expensive normal mode analysis of minimized structures. The comparison indicates that difference between relative domain motions of PDC109 with bound and unbound PhC is captured by the first principal component in the principal component analysis as well as the three lowest normal modes in the normal mode analysis. The present study illustrates the use of detailed MD simulations to clarify the energetics of specific ligand-domain interactions revealed by a static crystallographic model, as well as their influence on relative domain motions in a multi-domain protein.

Structural characterization and expression analysis of a beta-thymosin homologue (Tβ) in disk abalone, Haliotis discus discus.

PubMed

Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee

2013-09-15

Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

Gene cloning, expression and functional characterization of a proliferation-inducing ligand (APRIL) from hedgehog (Erinaceus europaeus).

PubMed

Cui, Xian-Wei; Xiao, Wen; Ji, Chen-Bo; Tian, Ai-Ying; Zhang, Jie; Zhang, Shuang-Quan

2012-05-01

Here we describe the identification of the hedgehog Erinaceus europaeus homologue of a proliferation-inducing ligand (APRIL) of the TNF family (designated heAPRIL). Hedgehog APRIL contains two cysteine residues (Cys(196) and Cys(211)), a furin protease cleavage site and a conserved putative N-glycosylation site (Asn(124)). Real-time quantitative PCR (qPCR) analysis revealed that heAPRIL could be detected in various tissues. MTT assays and flow cytometric analysis revealed that Nus-hesAPRIL and hesAPRIL could promote the survival/proliferation of splenic B cells. Laser scanning confocal microscopy analysis showed GFP-hesAPRIL could successfully bind to the APRIL receptors of lymphocytes.

Expression of hybrid fusion protein (Cry1Ac::ASAL) in transgenic rice plants imparts resistance against multiple insect pests.

PubMed

Boddupally, Dayakar; Tamirisa, Srinath; Gundra, Sivakrishna Rao; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

2018-05-31

To evolve rice varieties resistant to different groups of insect pests a fusion gene, comprising DI and DII domains of Bt Cry1Ac and carbohydrate binding domain of garlic lectin (ASAL), was constructed. Transgenic rice lines were generated and evaluated to assess the efficacy of Cry1Ac::ASAL fusion protein against three major pests, viz., yellow stem borer (YSB), leaf folder (LF) and brown planthopper (BPH). Molecular analyses of transgenic plants revealed stable integration and expression of the fusion gene. In planta insect bioassays on transgenics disclosed enhanced levels of resistance compared to the control plants. High insect mortality of YSB, LF and BPH was observed on transgenics compared to that of control plants. Furthermore, honeydew assays revealed significant decreases in the feeding ability of BPH on transgenic plants as compared to the controls. Ligand blot analysis, using BPH insects fed on cry1Ac::asal transgenic rice plants, revealed a modified receptor protein-binding pattern owing to its ability to bind to additional receptors in insects. The overall results authenticate that Cry1Ac::ASAL protein is endowed with remarkable entomotoxic effects against major lepidopteran and hemipteran insects. As such, the fusion gene appears promising and can be introduced into various other crops to control multiple insect pests.

The isolated MUC5AC gene product from human ocular mucin displays intramolecular conformational heterogeneity.

PubMed

Round, Andrew N; McMaster, Terence J; Miles, Mervyn J; Corfield, Anthony P; Berry, Monica

2007-06-01

Atomic force microscopy (AFM) has been used to show that human ocular mucins contain at least three distinct polymer conformations, separable by isopycnic density gradient centrifugation. In this work we have used affinity purification against the anti(mucin peptide core) monoclonal antibody 45M1 to isolate MUC5AC gene products, a major component of human ocular mucins. AFM images confirm that the affinity-purified polymers adopt distinct conformations that coidentify with two of those observed in the parent population, and further reveal that these two different conformations can be present within the same polymer. AFM images of the complexes formed after incubation of 45M1 with the parent sample reveal different rates of binding to the two MUC5AC polymer types. The variability of gene products within a mucin population was revealed by analyzing the height distributions along the polymer contour and periodicities in distances between occupied antibody binding sites. AFM analysis of mucin polymers at the single molecule level provides new information about the genetic origins of individual polymers and the contributions of glycosylation to the physicochemical properties of mucins, which can be correlated with information obtained from biochemistry, antibody binding assays, and molecular biology techniques.

Penicillin-binding protein 1A, 2B, and 2X alterations in Canadian isolates of penicillin-resistant Streptococcus pneumoniae.

PubMed

Nichol, Kimberly A; Zhanel, George G; Hoban, Daryl J

2002-10-01

Alterations within the penicillin-binding domain of penicillin-binding protein (PBP) genes pbp1a, pbp2b, and pbp2x were determined for 15 Canadian isolates of Streptococcus pneumoniae. All penicillin-nonsusceptible S. pneumoniae isolates showed a variety of PBP 2X substitutions and contained a Thr445-Ala change after the PBP 2B SSN motif. Only isolates for which penicillin MICs were > or =0.5 micro g/ml had PBP 1A alterations near the STMK and SRN motifs. Sequence analysis revealed identical PBP 1A, PBP 2B, and PBP 2X substitution patterns among all isolates for which penicillin MICs were > or =1 micro g/ml.

Penicillin-Binding Protein 1A, 2B, and 2X Alterations in Canadian Isolates of Penicillin-Resistant Streptococcus pneumoniae

PubMed Central

Nichol, Kimberly A.; Zhanel, George G.; Hoban, Daryl J.

2002-01-01

Alterations within the penicillin-binding domain of penicillin-binding protein (PBP) genes pbp1a, pbp2b, and pbp2x were determined for 15 Canadian isolates of Streptococcus pneumoniae. All penicillin-nonsusceptible S. pneumoniae isolates showed a variety of PBP 2X substitutions and contained a Thr445-Ala change after the PBP 2B SSN motif. Only isolates for which penicillin MICs were ≥0.5 μg/ml had PBP 1A alterations near the STMK and SRN motifs. Sequence analysis revealed identical PBP 1A, PBP 2B, and PBP 2X substitution patterns among all isolates for which penicillin MICs were ≥1 μg/ml. PMID:12234855

Theoretical and experimental study of organic nano-material for acetate anion based on 1, 10-phenanthroline.

PubMed

Shang, Xuefang; Zhao, Yuan; Wei, Xiaofang; Feng, Yaqian; Li, Xin; Gao, Shuyan; Xu, Xiufang

2015-01-01

New phenanthroline derivatives (1, 2, 3, 4) containing phenol groups have been synthesized and optimized. The nano-material of compound 2 was also developed. Their binding properties were evaluated for various biological anions (F(-), Cl(-), Br(-), I(-), AcO(-) and H(2)PO(4)(-)) by theoretical investigation, UV-vis, fluorescence, (1)HNMR titration experiments and these compounds all showed strong binding ability for AcO(-) without the interference of other anions tested. The anion binding ability could be regularized by electron push-pull properties of the ortho- or para- substituent on benzene. Theoretical investigation analysis revealed the effect of intramolecular hydrogen bond existed between -OH and other atoms in the structure of these compounds.

Characterization of human DHRS6, an orphan short chain dehydrogenase/reductase enzyme: a novel, cytosolic type 2 R-beta-hydroxybutyrate dehydrogenase.

PubMed

Guo, Kunde; Lukacik, Petra; Papagrigoriou, Evangelos; Meier, Marc; Lee, Wen Hwa; Adamski, Jerzy; Oppermann, Udo

2006-04-14

Human DHRS6 is a previously uncharacterized member of the short chain dehydrogenases/reductase family and displays significant homologies to bacterial hydroxybutyrate dehydrogenases. Substrate screening reveals sole NAD(+)-dependent conversion of (R)-hydroxybutyrate to acetoacetate with K(m) values of about 10 mm, consistent with plasma levels of circulating ketone bodies in situations of starvation or ketoacidosis. The structure of human DHRS6 was determined at a resolution of 1.8 A in complex with NAD(H) and reveals a tetrameric organization with a short chain dehydrogenases/reductase-typical folding pattern. A highly conserved triad of Arg residues ("triple R" motif consisting of Arg(144), Arg(188), and Arg(205)) was found to bind a sulfate molecule at the active site. Docking analysis of R-beta-hydroxybutyrate into the active site reveals an experimentally consistent model of substrate carboxylate binding and catalytically competent orientation. GFP reporter gene analysis reveals a cytosolic localization upon transfection into mammalian cells. These data establish DHRS6 as a novel, cytosolic type 2 (R)-hydroxybutyrate dehydrogenase, distinct from its well characterized mitochondrial type 1 counterpart. The properties determined for DHRS6 suggest a possible physiological role in cytosolic ketone body utilization, either as a secondary system for energy supply in starvation or to generate precursors for lipid and sterol synthesis.

Inhibition of Human Metapneumovirus Binding to Heparan Sulfate Blocks Infection in Human Lung Cells and Airway Tissues

PubMed Central

Klimyte, Edita M.; Smith, Stacy E.; Oreste, Pasqua; Lembo, David

2016-01-01

ABSTRACT Human metapneumovirus (HMPV), a recently discovered paramyxovirus, infects nearly 100% of the world population and causes severe respiratory disease in infants, the elderly, and immunocompromised patients. We previously showed that HMPV binds heparan sulfate proteoglycans (HSPGs) and that HMPV binding requires only the viral fusion (F) protein. To characterize the features of this interaction critical for HMPV binding and the role of this interaction in infection in relevant models, we utilized sulfated polysaccharides, heparan sulfate mimetics, and occluding compounds. Iota-carrageenan demonstrated potent anti-HMPV activity by inhibiting binding to lung cells mediated by the F protein. Furthermore, analysis of a minilibrary of variably sulfated derivatives of Escherichia coli K5 polysaccharide mimicking the HS structure revealed that the highly O-sulfated K5 polysaccharides inhibited HMPV infection, identifying a potential feature of HS critical for HMPV binding. The peptide dendrimer SB105-A10, which binds HS, reduced binding and infection in an F-dependent manner, suggesting that occlusion of HS at the target cell surface is sufficient to prevent infection. HMPV infection was also inhibited by these compounds during apical infection of polarized airway tissues, suggesting that these interactions take place during HMPV infection in a physiologically relevant model. These results reveal key features of the interaction between HMPV and HS, supporting the hypothesis that apical HS in the airway serves as a binding factor during infection, and HS modulating compounds may serve as a platform for potential antiviral development. IMPORTANCE Human metapneumovirus (HMPV) is a paramyxovirus that causes respiratory disease worldwide. It has been previously shown that HMPV requires binding to heparan sulfate on the surfaces of target cells for attachment and infection. In this study, we characterize the key features of this binding interaction using heparan sulfate mimetics, identify an important sulfate modification, and demonstrate that these interactions occur at the apical surface of polarized airway tissues. These findings provide insights into the initial binding step of HMPV infection that has potential for antiviral development. PMID:27489270

Probing the association between serotonin-1A autoreceptor binding and amygdala reactivity in healthy volunteers.

PubMed

Kranz, Georg S; Hahn, Andreas; Kraus, Christoph; Spies, Marie; Pichler, Verena; Jungwirth, Johannes; Mitterhauser, Markus; Wadsak, Wolfgang; Windischberger, Christian; Kasper, Siegfried; Lanzenberger, Rupert

2018-05-01

The serotonergic system modulates affect and is a target in the treatment of mood disorders. 5-HT 1A autoreceptors in the raphe control serotonin release by means of negative feedback inhibition. Hence, 5-HT 1A autoreceptor function should influence the serotonergic regulation of emotional reactivity in limbic regions. Previous findings suggest an inverse relationship between 5-HT 1A autoreceptor binding and amygdala reactivity to facial emotional expressions. The aim of the current multimodal neuroimaging study was to replicate the previous finding in a larger cohort. 31 healthy participants underwent fMRI as well as PET using the radioligand [carbonyl- 11 C]WAY-100635 to quantify 5-HT 1A autoreceptor binding in the dorsal raphe. The binding potential (BP ND ) was quantified using the multilinear reference tissue model (MRTM2) and cerebellar white matter as reference tissue. Functional MRI was done at 3T using a well-established facial emotion discrimination task (EDT). Here, participants had to match the emotional valence of facial expressions, while in a control condition they had to match geometric shapes. Effects of 5-HT 1A autoreceptor binding on amygdala reactivity were investigated using linear regression analysis with SPM8. Regression analysis between 5-HT 1A autoreceptor binding and mean amygdala reactivity revealed no statistically significant associations. Investigating amygdala reactivity in a voxel-wise approach revealed a positive association in the right amygdala (peak-T = 3.64, p < .05 FWE corrected for the amygdala volume) which was however conditional on the omission of age and sex as covariates in the model. Despite highly significant amygdala reactivity to facial emotional expressions, we were unable to replicate the inverse relationship between 5-HT 1A autoreceptor binding in the DRN and amygdala reactivity. Our results oppose previous multimodal imaging studies but seem to be in line with recent animal research. Deviation in results may be explained by methodological differences between our and previous multimodal studies. Copyright © 2018 Elsevier Inc. All rights reserved.

Structural landscape of base pairs containing post-transcriptional modifications in RNA

PubMed Central

Seelam, Preethi P.; Sharma, Purshotam

2017-01-01

Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

Thermodynamic dissection of the binding energetics of proline-rich peptides to the Abl-SH3 domain: implications for rational ligand design.

PubMed

Palencia, Andrés; Cobos, Eva S; Mateo, Pedro L; Martínez, Jose C; Luque, Irene

2004-02-13

The inhibition of the interactions between SH3 domains and their targets is emerging as a promising therapeutic strategy. To date, rational design of potent ligands for these domains has been hindered by the lack of understanding of the origins of the binding energy. We present here a complete thermodynamic analysis of the binding energetics of the p41 proline-rich decapeptide (APSYSPPPPP) to the SH3 domain of the c-Abl oncogene. Isothermal titration calorimetry experiments have revealed a thermodynamic signature for this interaction (very favourable enthalpic contributions opposed by an unfavourable binding entropy) inconsistent with the highly hydrophobic nature of the p41 ligand and the Abl-SH3 binding site. Our structural and thermodynamic analyses have led us to the conclusion, having once ruled out any possible ionization events or conformational changes coupled to the association, that the establishment of a complex hydrogen-bond network mediated by water molecules buried at the binding interface is responsible for the observed thermodynamic behaviour. The origin of the binding energetics for proline-rich ligands to the Abl-SH3 domain is further investigated by a comparative calorimetric analysis of a set of p41-related ligands. The striking effects upon the enthalpic and entropic contributions provoked by conservative substitutions at solvent-exposed positions in the ligand confirm the complexity of the interaction. The implications of these results for rational ligand design are discussed.

Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

PubMed

Seal, S N; Davis, D L; Burch, J B

1991-05-01

The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

Structures of human thymidylate synthase R163K with dUMP, FdUMP and glutathione show asymmetric ligand binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gibson, Lydia M.; Celeste, Lesa R.; Lovelace, Leslie L.

Thymidylate synthase (TS) is a well validated target in cancer chemotherapy. Here, a new crystal form of the R163K variant of human TS (hTS) with five subunits per asymmetric part of the unit cell, all with loop 181-197 in the active conformation, is reported. This form allows binding studies by soaking crystals in artificial mother liquors containing ligands that bind in the active site. Using this approach, crystal structures of hTS complexes with FdUMP and dUMP were obtained, indicating that this form should facilitate high-throughput analysis of hTS complexes with drug candidates. Crystal soaking experiments using oxidized glutathione revealed thatmore » hTS binds this ligand. Interestingly, the two types of binding observed are both asymmetric. In one subunit of the physiological dimer covalent modification of the catalytic nucleophile Cys195 takes place, while in another dimer a noncovalent adduct with reduced glutathione is formed in one of the active sites.« less

Molecular basis of splotch and Waardenburg Pax-3 mutations.

PubMed Central

Chalepakis, G; Goulding, M; Read, A; Strachan, T; Gruss, P

1994-01-01

Pax genes control certain aspects of development, as mutations result in (semi)dominant defects apparent during embryogenesis. Pax-3 has been associated with the mouse mutant splotch (Sp) and the human Waardenburg syndrome type 1 (WS1). We have examined the molecular basis of splotch and WS1 by studying the effect of mutations on DNA binding, using a defined target sequence. Pax-3 contains two different types of functional DNA-binding domains, a paired domain and a homeodomain. Mutational analysis of Pax-3 reveals different modes of DNA binding depending on the presence of these domains. A segment of Pax-3 located between the two DNA-binding domains, including a conserved octapeptide, participates in protein homodimerization. Pax-3 mutations found in splotch alleles and WS1 individuals change DNA binding and, in the case of a protein product of the Sp allele, dimerization. These findings were taken as a basis to define the molecular nature of the mutants. Images PMID:7909605

Nuclear export receptor CRM1 recognizes diverse conformations in nuclear export signals.

PubMed

Fung, Ho Yee Joyce; Fu, Szu-Chin; Chook, Yuh Min

2017-03-10

Nuclear export receptor CRM1 binds highly variable nuclear export signals (NESs) in hundreds of different cargoes. Previously we have shown that CRM1 binds NESs in both polypeptide orientations (Fung et al., 2015). Here, we show crystal structures of CRM1 bound to eight additional NESs which reveal diverse conformations that range from loop-like to all-helix, which occupy different extents of the invariant NES-binding groove. Analysis of all NES structures show 5-6 distinct backbone conformations where the only conserved secondary structural element is one turn of helix that binds the central portion of the CRM1 groove. All NESs also participate in main chain hydrogen bonding with human CRM1 Lys568 side chain, which acts as a specificity filter that prevents binding of non-NES peptides. The large conformational range of NES backbones explains the lack of a fixed pattern for its 3-5 hydrophobic anchor residues, which in turn explains the large array of peptide sequences that can function as NESs.

The Possible Mechanism of Idiosyncratic Lapatinib-Induced Liver Injury in Patients Carrying Human Leukocyte Antigen-DRB1*07:01

PubMed Central

Hirasawa, Makoto; Hagihara, Katsunobu; Okudaira, Noriko; Izumi, Takashi

2015-01-01

Idiosyncratic lapatinib-induced liver injury has been reported to be associated with human leukocyte antigen (HLA)-DRB1*07:01. In order to investigate its mechanism, interaction of lapatinib with HLA-DRB1*07:01 and its ligand peptide derived from tetanus toxoid, has been evaluated in vitro. Here we show that lapatinib enhances binding of the ligand peptide to HLA-DRB1*07:01. Furthermore in silico molecular dynamics analysis revealed that lapatinib could change the β chain helix in the HLA-DRB1*07:01 specifically to form a tightly closed binding groove structure and modify a large part of the binding groove. These results indicate that lapatinib affects the ligand binding to HLA-DRB1*07:01 and idiosyncratic lapatinib-induced liver injury might be triggered by this mechanism. This is the first report showing that the clinically available drug can enhance the binding of ligand peptide to HLA class II molecules in vitro and in silico. PMID:26098642

Identification of neuronal target genes for CCAAT/Enhancer Binding Proteins

PubMed Central

Kfoury, N.; Kapatos, G.

2009-01-01

CCAAT/Enhancer Binding Proteins (C/EBPs) play pivotal roles in development and plasticity of the nervous system. Identification of the physiological targets of C/EBPs (C/EBP target genes) should therefore provide insight into the underlying biology of these processes. We used unbiased genome-wide mapping to identify 115 C/EBPβ target genes in PC12 cells that include transcription factors, neurotransmitter receptors, ion channels, protein kinases and synaptic vesicle proteins. C/EBPβ binding sites were located primarily within introns, suggesting novel regulatory functions, and were associated with binding sites for other developmentally important transcription factors. Experiments using dominant negatives showed C/EBPβ to repress transcription of a subset of target genes. Target genes in rat brain were subsequently found to preferentially bind C/EBPα, β and δ. Analysis of the hippocampal transcriptome of C/EBPβ knockout mice revealed dysregulation of a high percentage of transcripts identified as C/EBP target genes. These results support the hypothesis that C/EBPs play non-redundant roles in the brain. PMID:19103292

Mapping and analysis of Caenorhabditis elegans transcription factor sequence specificities

PubMed Central

Narasimhan, Kamesh; Lambert, Samuel A; Yang, Ally WH; Riddell, Jeremy; Mnaimneh, Sanie; Zheng, Hong; Albu, Mihai; Najafabadi, Hamed S; Reece-Hoyes, John S; Fuxman Bass, Juan I; Walhout, Albertha JM; Weirauch, Matthew T; Hughes, Timothy R

2015-01-01

Caenorhabditis elegans is a powerful model for studying gene regulation, as it has a compact genome and a wealth of genomic tools. However, identification of regulatory elements has been limited, as DNA-binding motifs are known for only 71 of the estimated 763 sequence-specific transcription factors (TFs). To address this problem, we performed protein binding microarray experiments on representatives of canonical TF families in C. elegans, obtaining motifs for 129 TFs. Additionally, we predict motifs for many TFs that have DNA-binding domains similar to those already characterized, increasing coverage of binding specificities to 292 C. elegans TFs (∼40%). These data highlight the diversification of binding motifs for the nuclear hormone receptor and C2H2 zinc finger families and reveal unexpected diversity of motifs for T-box and DM families. Motif enrichment in promoters of functionally related genes is consistent with known biology and also identifies putative regulatory roles for unstudied TFs. DOI: http://dx.doi.org/10.7554/eLife.06967.001 PMID:25905672

Cdc45-induced loading of human RPA onto single-stranded DNA

PubMed Central

Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut

2017-01-01

Abstract Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8–10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. PMID:28100698

Mechanisms of Zn(II) binded to collagen and its effect on the capacity of eco-friendly Zn-Cr combination tanning system.

PubMed

Cao, Shan; Liu, Bing; Cheng, Baozhen; Lu, Fuping; Wang, Yanping; Li, Yu

2017-01-05

The eco-friendly combination tanning process has been developed to reduce chromium in existing researches, which is based on zinc tanning agents. This can be considered as a less-chrome substitute for current tanning process. To gain deeper understanding of the binding mechanisms of zinc-collagen interaction, which are affected by tanning pH, experiments have been carried out. Analysis in this paper reveals how chemical bonds from the collagen's main function groups combine with zinc. XPS and NIR data was analyzed for further understanding of where the zinc binding sites lie on collagen fibers at different pH. The results indicate that high pH is helpful to amino-binding sites while low pH promotes carboxyl-binding sites on collagen fibers. Furthermore, from the effect of Zinc-chrome combination tanning, we can see that the new method reduces the chromium dosage in tanning process compared to the conventional chrome tanning method. Copyright © 2016 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osipiuk, J.; Gornicki, P.; Maj, L.

The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 Angstroms. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 Angstroms from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer {alpha}/{beta} sandwich with the overall shape of a cylinder and shows no structural homology to proteins of knownmore » structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the {alpha}-{beta} plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.« less

Streptococcus pneumonia YlxR at 1.35 A shows a putative new fold.

PubMed

Osipiuk, J; Górnicki, P; Maj, L; Dementieva, I; Laskowski, R; Joachimiak, A

2001-11-01

The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 A. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 A from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer alpha/beta sandwich with the overall shape of a cylinder and shows no structural homology to proteins of known structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the alpha-beta plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.

Mechanism of Disruption of the Amt-GlnK Complex by PII-Mediated Sensing of 2-Oxoglutarate

PubMed Central

Maier, Sarah; Schleberger, Paula; Lü, Wei; Wacker, Tobias; Pflüger, Tobias; Litz, Claudia; Andrade, Susana L. A.

2011-01-01

GlnK proteins regulate the active uptake of ammonium by Amt transport proteins by inserting their regulatory T-loops into the transport channels of the Amt trimer and physically blocking substrate passage. They sense the cellular nitrogen status through 2-oxoglutarate, and the energy level of the cell by binding both ATP and ADP with different affinities. The hyperthermophilic euryarchaeon Archaeoglobus fulgidus possesses three Amt proteins, each encoded in an operon with a GlnK ortholog. One of these proteins, GlnK2 was recently found to be incapable of binding 2-OG, and in order to understand the implications of this finding we conducted a detailed structural and functional analysis of a second GlnK protein from A. fulgidus, GlnK3. Contrary to Af-GlnK2 this protein was able to bind both ATP/2-OG and ADP to yield inactive and functional states, respectively. Due to the thermostable nature of the protein we could observe the exact positioning of the notoriously flexible T-loops and explain the binding behavior of GlnK proteins to their interaction partner, the Amt proteins. A thermodynamic analysis of these binding events using microcalorimetry evaluated by microstate modeling revealed significant differences in binding cooperativity compared to other characterized PII proteins, underlining the diversity and adaptability of this class of regulatory signaling proteins. PMID:22039461

Investigation of the complex structure, comparative DNA-binding and DNA cleavage of two water-soluble mono-nuclear lanthanum(III) complexes and cytotoxic activity of chitosan-coated magnetic nanoparticles as drug delivery for the complexes

NASA Astrophysics Data System (ADS)

Asadi, Zahra; Nasrollahi, Neda; Karbalaei-Heidari, Hamidreza; Eigner, Vaclav; Dusek, Michal; Mobaraki, Nabiallah; Pournejati, Roya

2017-05-01

Two water-soluble mono-nuclear macrocyclic lanthanum(III) complexes of 2,6-diformyl-4-methylphenol with 1,3-diamino-2-propanol (C1) or 1,3-propylenediamine (C2) were synthesized and characterized by UV-Vis, FT-IR, 13C and 1H NMR spectroscopy and elemental analysis. C1 complex was structurally characterized by single-crystal X-ray diffraction, which revealed that the complex was mononuclear and ten-coordinated. The coordination sites around lanthanum(III) were occupied with a five-dentate ligand, two bidentate nitrates, and one water molecule. The interaction of complexes with DNA was studied in buffered aqueous solution at pH 7.4. UV-Vis absorption spectroscopy, emission spectroscopy, circular dichroism (CD) and viscometric measurements provided clear evidence of the intercalation mechanism of binding. The obtained intrinsic binding constants (Kb) 9.3 × 103 and 1.2 × 103 M- 1 for C1 and C2, respectively confirmed that C1 is better intercalator than C2. The DNA docking studies suggested that the complexes bind with DNA in a groove binding mode with the binding affinity of C1 > C2. Moreover, agarose gel electrophoresis study of the DNA-complex for both compounds revealed that the C1 intercalation cause ethidium bromide replacement in a competitive manner which confirms the suggested mechanism of binding. Finally, the anticancer experiments for the treated cancerous cell lines with both synthesized compounds show that these hydrophilic molecules need a suitable carrier to pass through the hydrophobic nature of cell membrane efficiently.

Distinct molecular features facilitating ice-binding mechanisms in hyperactive antifreeze proteins closely related to an Antarctic sea ice bacterium.

PubMed

Banerjee, Rachana; Chakraborti, Pratim; Bhowmick, Rupa; Mukhopadhyay, Subhasish

2015-01-01

Antifreeze proteins or ice-binding proteins (IBPs) facilitate the survival of certain cellular organisms in freezing environment by inhibiting the growth of ice crystals in solution. Present study identifies orthologs of the IBP of Colwellia sp. SLW05, which were obtained from a wide range of taxa. Phylogenetic analysis on the basis of conserved regions (predicted as the 'ice-binding domain' [IBD]) present in all the orthologs, separates the bacterial and archaeal orthologs from that of the eukaryotes'. Correspondence analysis pointed out that the bacterial and archaeal IBDs have relatively higher average hydrophobicity than the eukaryotic members. IBDs belonging to bacterial as well as archaeal AFPs contain comparatively more strands, and therefore are revealed to be under higher evolutionary selection pressure. Molecular docking studies prove that the ice crystals form more stable complex with the bacterial as well as archaeal proteins than the eukaryotic orthologs. Analysis of the docked structures have traced out the ice-binding sites (IBSs) in all the orthologs which continue to facilitate ice-binding activity even after getting mutated with respect to the well-studied IBSs of Typhula ishikariensis and notably, all these mutations performing ice-binding using 'anchored clathrate mechanism' have been found to prefer polar and hydrophilic amino acids. Horizontal gene transfer studies point toward a strong selection pressure favoring independent evolution of the IBPs in some polar organisms including prokaryotes as well as eukaryotes because these proteins facilitate the polar organisms to acclimatize to the adversities in their niche, thus safeguarding their existence.

Tissue expression analysis, cloning and characterization of the 5'-regulatory region of the bovine FABP3 gene.

PubMed

Li, Anning; Wu, Lijuan; Wang, Xiaoyu; Xin, Yaping; Zan, Linsen

2016-09-01

Fatty acid binding protein 3 (FABP3) is a member of the FABP family which bind fatty acids and have an important role in fatty acid metabolism. A large number of studies have shown that the genetic polymorphisms of FABP3 are positively correlated with intramuscular fat (IMF) content in domestic animals, however, the function and transcriptional characteristics of FABP3 in cattle remain unclear. Real-time PCR analysis revealed that bovine FABP3 was highly expressed in cardiac tissue. The 5'-regulatory region of bovine FABP3 was cloned and its transcription initiation sites were identified. Sequence analysis showed that many transcriptional factor binding sites including TATA-box and CCAAT-box were present on the 5'-flanking region of bovine FABP3, and four CpG islands were found on nucleotides from -891 to +118. Seven serial deletion constructs of the 5'-regulatory region evaluated in dual-luciferase reporter assay indicated that its core promoter was 384 base pairs upstream from the transcription initiation site. The transcriptional factor binding sites RXRα, KLF15, CREB and Sp1 were conserved in the core promoter of cattle, sheep, pigs and dogs. These results provide further understanding of the function and regulation mechanism of bovine FABP3.

Hydropathic analysis and biological evaluation of stilbene derivatives as colchicine site microtubule inhibitors with anti-leukemic activity

PubMed Central

TRIPATHI, ASHUTOSH; DURRANT, DAVID; LEE, RAY M.; BARUCHELLO, RICCARDO; ROMAGNOLI, ROMEO; SIMONI, DANIELE; KELLOGG, GLEN E.

2009-01-01

The crucial role of the microtubule in the cell division has identified tubulin as a target for the development of therapeutics for cancer; in particular tubulin is a target for antineoplastic agents that act by interfering with the dynamic stability of microtubules. A molecular modeling study was carried out to accurately represent the complex structure and the binding mode of a new class of stilbene-based tubulin inhibitors that bind at the αβ-tubulin colchicine site. Computational docking along with HINT score analysis fitted these inhibitors into the colchicine site and revealed detailed structure-activity information useful for inhibitor design. Quantitative analysis of the results was in good agreement with the in vitro antiproliferative activity of these derivatives (ranging from 3 nM to 100 μM) such that calculated and measured free energies of binding correlate with an r2 of 0.89 (standard error ± 0.85 kcal mol−1). This correlation suggests that the activity of unknown compounds may be predicted. PMID:19912057

Computational Analysis of Sterol Ligand Specificity of the Niemann Pick C2 Protein.

PubMed

Poongavanam, Vasanthanathan; Kongsted, Jacob; Wüstner, Daniel

2016-09-13

Transport of cholesterol derived from hydrolysis of lipoprotein associated cholesteryl esters out of late endosomes depends critically on the function of the Niemann Pick C1 (NPC1) and C2 (NPC2) proteins. Both proteins bind cholesterol but also various other sterols and both with strongly varying affinity. The molecular mechanisms underlying this multiligand specificity are not known. On the basis of the crystal structure of NPC2, we have here investigated structural details of NPC2-sterol interactions using molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) calculations. We found that an aliphatic side chain in the sterol ligand results in strong binding to NPC2, while side-chain oxidized sterols gave weaker binding. Estradiol and the hydrophobic amine U18666A had the lowest affinity of all tested ligands and at the same time showed the highest flexibility within the NPC2 binding pocket. The binding affinity of all ligands correlated highly with their calculated partitioning coefficient (logP) between octanol/water phases and with the potential of sterols to stabilize the protein backbone. From molecular dynamics simulations, we suggest a general mechanism for NPC2 mediated sterol transfer, in which Phe66, Val96, and Tyr100 act as reversible gate keepers. These residues stabilize the sterol in the binding pose via π-π stacking but move transiently apart during sterol release. A computational mutation analysis revealed that the binding of various ligands depends critically on the same specific amino acid residues within the binding pocket providing shape complementary to sterols, but also on residues in distal regions of the protein.

Structure-based Understanding of Binding Affinity and Mode ...

EPA Pesticide Factsheets

The flexible hydrophobic ligand binding pocket (LBP) of estrogen receptor α (ERα) allows the binding of a wide variety of endocrine disruptors. Upon ligand binding, the LBP reshapes around the contours of the ligand and stabilizes the complex by complementary hydrophobic interactions and specific hydrogen bonds with the ligand. Here we present a framework for quantitative analysis of the steric and electronic features of the human ERα-ligand complex using three dimensional (3D) protein-ligand interaction description combined with 3D-QSAR approach. An empirical hydrophobicity density field is applied to account for hydrophobic contacts of ligand within the LBP. The obtained 3D-QSAR model revealed that hydrophobic contacts primarily determine binding affinity and govern binding mode with hydrogen bonds. Several residues of the LBP appear to be quite flexible and adopt a spectrum of conformations in various ERα-ligand complexes, in particular His524. The 3D-QSAR was combined with molecular docking based on three receptor conformations to accommodate receptor flexibility. The model indicates that the dynamic character of the LBP allows accommodation and stable binding of structurally diverse ligands, and proper representation of the protein flexibility is critical for reasonable description of binding of the ligands. Our results provide a quantitative and mechanistic understanding of binding affinity and mode of ERα agonists and antagonists that may be applicab

Two-sided block of a dual-topology F- channel.

PubMed

Turman, Daniel L; Nathanson, Jacob T; Stockbridge, Randy B; Street, Timothy O; Miller, Christopher

2015-05-05

The Fluc family is a set of small membrane proteins forming F(-)-specific electrodiffusive ion channels that rescue microorganisms from F(-) toxicity during exposure to weakly acidic environments. The functional channel is built as a dual-topology homodimer with twofold symmetry parallel to the membrane plane. Fluc channels are blocked by nanomolar-affinity fibronectin-domain monobodies originally selected from phage-display libraries. The unusual symmetrical antiparallel dimeric architecture of Flucs demands that the two chemically equivalent monobody-binding epitopes reside on opposite ends of the channel, a double-sided blocking situation that has never before presented itself in ion channel biophysics. However, it is not known if both sites can be simultaneously occupied, and if so, whether monobodies bind independently or cooperatively to their transmembrane epitopes. Here, we use direct monobody-binding assays and single-channel recordings of a Fluc channel homolog to reveal a novel trimolecular blocking behavior that reveals a doubly occupied blocked state. Kinetic analysis of single-channel recordings made with monobody on both sides of the membrane shows substantial negative cooperativity between the two blocking sites.

Novel biphenyl ester derivatives as tyrosinase inhibitors: Synthesis, crystallographic, spectral analysis and molecular docking studies.

PubMed

Kwong, Huey Chong; Chidan Kumar, C S; Mah, Siau Hui; Chia, Tze Shyang; Quah, Ching Kheng; Loh, Zi Han; Chandraju, Siddegowda; Lim, Gin Keat

2017-01-01

Biphenyl-based compounds are clinically important for the treatments of hypertension and inflammatory, while many more are under development for pharmaceutical uses. In the present study, a series of 2-([1,1'-biphenyl]-4-yl)-2-oxoethyl benzoates, 2(a-q), and 2-([1,1'-biphenyl]-4-yl)-2-oxoethyl pyridinecarboxylate, 2(r-s) were synthesized by reacting 1-([1,1'-biphenyl]-4-yl)-2-bromoethan-1-one with various carboxylic acids using potassium carbonate in dimethylformamide at ambient temperature. Single-crystal X-ray diffraction studies revealed a more closely packed crystal structure can be produced by introduction of biphenyl moiety. Five of the compounds among the reported series exhibited significant anti-tyrosinase activities, in which 2p, 2r and 2s displayed good inhibitions which are comparable to standard inhibitor kojic acid at concentrations of 100 and 250 μg/mL. The inhibitory effects of these active compounds were further confirmed by computational molecular docking studies and the results revealed the primary binding site is active-site entrance instead of inner copper binding site which acted as the secondary binding site.

Structural Basis of Pullulanase Membrane Binding and Secretion Revealed by X-Ray Crystallography, Molecular Dynamics and Biochemical Analysis.

PubMed

East, Alexandra; Mechaly, Ariel E; Huysmans, Gerard H M; Bernarde, Cédric; Tello-Manigne, Diana; Nadeau, Nathalie; Pugsley, Anthony P; Buschiazzo, Alejandro; Alzari, Pedro M; Bond, Peter J; Francetic, Olivera

2016-01-05

The Klebsiella lipoprotein pullulanase (PulA) is exported to the periplasm, triacylated, and anchored via lipids in the inner membrane (IM) prior to its transport to the bacterial surface through a type II secretion system (T2SS). X-Ray crystallography and atomistic molecular dynamics (MD) simulations of PulA in a 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) model membrane provided an unprecedented molecular view of an N-terminal unstructured tether and the IM lipoprotein retention signal, and revealed novel interactions with the IM via N-terminal immunoglobulin-like domains in PulA. An efficiently secreted nonacylated variant (PulANA) showed similar peripheral membrane association during MD simulations, consistent with the binding of purified PulANA to liposomes. Remarkably, combined X-ray, MD, and functional studies identified a novel subdomain, Ins, inserted in the α-amylase domain, which is required for PulA secretion. Available data support a model in which PulA binding to the IM promotes interactions with the T2SS, possibly via the Ins subdomain. Copyright © 2016 Elsevier Ltd. All rights reserved.

ChIP-Chip Identifies SEC23A, CFDP1, and NSD1 as TFII-I Target Genes in Human Neural Crest Progenitor Cells.

PubMed

Makeyev, Aleksandr V; Bayarsaihan, Dashzeveg

2013-05-01

Objectives :  GTF2I and GTF2IRD1 genes located in Williams-Beuren syndrome (WBS) critical region encode TFII-I family transcription factors. The aim of this study was to map genomic sites bound by these proteins across promoter regions of developmental regulators associated with craniofacial development. Design :  Chromatin was isolated from human neural crest progenitor cells and the DNA-binding profile was generated using the human RefSeq tiling promoter ChIP-chip arrays. Results :  TFII-I transcription factors are recruited to the promoters of SEC23A, CFDP1, and NSD1 previously defined as TFII-I target genes. Moreover, our analysis revealed additional binding elements that contain E-boxes and initiator-like motifs. Conclusions :  Genome-wide promoter binding studies revealed SEC23A, CFDP1, and NSD1 linked to craniofacial or dental development as direct TFII-I targets. Developmental regulation of these genes by TFII-I factors could contribute to the WBS-specific facial dysmorphism.

Comparison of Saccharomyces cerevisiae F-BAR domain structures reveals a conserved inositol phosphate binding site.

PubMed

Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R; Kenniston, Jon A; Mendrola, Jeannine M; Ferguson, Kathryn M; Lemmon, Mark A

2015-02-03

F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although they are generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here, we compare membrane-binding properties of the Saccharomyces cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound to an inositol phosphate. The structures explain phospholipid-binding selectivity differences and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip and is partly retained in certain other F-BAR domains. Our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity and provide a basis for its prediction from sequence. Copyright © 2015 Elsevier Ltd. All rights reserved.

Comparison of Saccharomyces cerevisiae F-BAR Domain Structures Reveals a Conserved Inositol Phosphate Binding Site

DOE PAGES

Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; ...

2015-01-22

F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although they are generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here in this paper, we compare membrane-binding properties of the Saccharomyces cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound tomore » an inositol phosphate. The structures explain phospholipid-binding selectivity differences and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip and is partly retained in certain other F-BAR domains. In conclusion, our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity and provide a basis for its prediction from sequence.« less

Contributions of molecular size, charge distribution, and specific amino acids to the iron-binding capacity of sea cucumber (Stichopus japonicus) ovum hydrolysates.

PubMed

Sun, Na; Cui, Pengbo; Jin, Ziqi; Wu, Haitao; Wang, Yixing; Lin, Songyi

2017-09-01

This study investigated the contributions of molecular size, charge distribution and specific amino acids to the iron-binding capacity of sea cucumber (Stichopus japonicus) ovum hydrolysates (SCOHs), and further explored their iron-binding sites. It was demonstrated that enzyme type and degree of hydrolysis (DH) significantly influenced the iron-binding capacity of the SCOHs. The SCOHs produced by alcalase at a DH of 25.9% possessed the highest iron-binding capacity at 92.1%. As the hydrolysis time increased, the molecular size of the SCOHs decreased, the negative charges increased, and the hydrophilic amino acids were exposed to the surface, facilitating iron binding. Furthermore, the Fourier transform infrared spectra, combined with amino acid composition analysis, revealed that iron bound to the SCOHs primarily through interactions with carboxyl oxygen of Asp, guanidine nitrogen of Arg or nitrogen atoms in imidazole group of His. The formed SCOHs-iron complexes exhibited a fold and crystal structure with spherical particles. Copyright © 2017 Elsevier Ltd. All rights reserved.

An odorant-binding protein as a new allergen from Siberian hamster (Phodopus sungorus).

PubMed

Torres, J A; Pastor-Vargas, C; de las Heras, M; Vivanco, F; Cuesta, Javier; Sastre, J

2012-01-01

A case of anaphylaxis following a bite from a Siberian hamster (SH; Phodopus sungorus) is described. Skin prick tests with hair, urine and salivary gland extracts from SH were positive, while the tests were negative for hair extracts from other rodents. IgE immunoblotting with the patient serum revealed 3 IgE-binding bands of about 18, 21 and 23 kDa. When the patient's serum was preincubated with rabbit, mouse and gerbil hair extracts, no inhibition of the 3 SH IgE-binding bands was demonstrated. Proteins extracted from the 3 bands were analyzed by N-terminal sequencing and matrix-assisted laser desorption/ionization time-of-flight tandem mass spectrometry, and peptides were sequenced. IgE-binding bands were identified as being an odorant-binding protein belonging to the lipocalin family. Analysis of the 3 IgE-binding bands found in the hair, urine and salivary glands of SH showed a new allergenic protein lacking cross-reactivity with allergens from other rodents. The 3 bands likely correspond to isoforms of a single allergen. Copyright © 2011 S. Karger AG, Basel.

Load-dependent ADP binding to myosins V and VI: Implications for subunit coordination and function

PubMed Central

Oguchi, Yusuke; Mikhailenko, Sergey V.; Ohki, Takashi; Olivares, Adrian O.; De La Cruz, Enrique M.; Ishiwata, Shin'ichi

2008-01-01

Dimeric myosins V and VI travel long distances in opposite directions along actin filaments in cells, taking multiple steps in a “hand-over-hand” fashion. The catalytic cycles of both myosins are limited by ADP dissociation, which is considered a key step in the walking mechanism of these motors. Here, we demonstrate that external loads applied to individual actomyosin V or VI bonds asymmetrically affect ADP affinity, such that ADP binds weaker under loads assisting motility. Model-based analysis reveals that forward and backward loads modulate the kinetics of ADP binding to both myosins, although the effect is less pronounced for myosin VI. ADP dissociation is modestly accelerated by forward loads and inhibited by backward loads. Loads applied in either direction slow ADP binding to myosin V but accelerate binding to myosin VI. We calculate that the intramolecular load generated during processive stepping is ≈2 pN for both myosin V and myosin VI. The distinct load dependence of ADP binding allows these motors to perform different cellular functions. PMID:18509050

Analysis of Perforin Assembly by Quartz Crystal Microbalance Reveals a Role for Cholesterol and Calcium-independent Membrane Binding.

PubMed

Stewart, Sarah E; Bird, Catherina H; Tabor, Rico F; D'Angelo, Michael E; Piantavigna, Stefania; Whisstock, James C; Trapani, Joseph A; Martin, Lisandra L; Bird, Phillip I

2015-12-25

Perforin is an essential component in the cytotoxic lymphocyte-mediated cell death pathway. The traditional view holds that perforin monomers assemble into pores in the target cell membrane via a calcium-dependent process and facilitate translocation of cytotoxic proteases into the cytoplasm to induce apoptosis. Although many studies have examined the structure and role of perforin, the mechanics of pore assembly and granzyme delivery remain unclear. Here we have employed quartz crystal microbalance with dissipation monitoring (QCM-D) to investigate binding and assembly of perforin on lipid membranes, and show that perforin monomers bind to the membrane in a cooperative manner. We also found that cholesterol influences perforin binding and activity on intact cells and model membranes. Finally, contrary to current thinking, perforin efficiently binds membranes in the absence of calcium. When calcium is added to perforin already on the membrane, the QCM-D response changes significantly, indicating that perforin becomes membranolytic only after calcium binding. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Ubiquitin Interacts with the Tollip C2 and CUE Domains and Inhibits Binding of Tollip to Phosphoinositides*

PubMed Central

Mitra, Sharmistha; Traughber, C. Alicia; Brannon, Mary K.; Gomez, Stephanie; Capelluto, Daniel G. S.

2013-01-01

A large number of cellular signaling processes are directed through internalization, via endocytosis, of polyubiquitinated cargo proteins. Tollip is an adaptor protein that facilitates endosomal cargo sorting for lysosomal degradation. Tollip preferentially binds phosphatidylinositol 3-phosphate (PtdIns(3)P) via its C2 domain, an association that may be required for endosomal membrane targeting. Here, we show that Tollip binds ubiquitin through its C2 and CUE domains and that its association with the C2 domain inhibits PtdIns(3)P binding. NMR analysis demonstrates that the C2 and CUE domains bind to overlapping sites on ubiquitin, suggesting that two ubiquitin molecules associate with Tollip simultaneously. Hydrodynamic studies reveal that ubiquitin forms heterodimers with the CUE domain, indicating that the association disrupts the dimeric state of the CUE domain. We propose that, in the absence of polyubiquitinated cargo, the dual binding of ubiquitin partitions Tollip into membrane-bound and membrane-free states, a function that contributes to the engagement of Tollip in both membrane trafficking and cytosolic pathways. PMID:23880770

Crystal structure of Anoxybacillus α-amylase provides insights into maltose binding of a new glycosyl hydrolase subclass.

PubMed

Chai, Kian Piaw; Othman, Noor Farhan Binti; Teh, Aik-Hong; Ho, Kok Lian; Chan, Kok-Gan; Shamsir, Mohd Shahir; Goh, Kian Mau; Ng, Chyan Leong

2016-03-15

A new subfamily of glycosyl hydrolase family GH13 was recently proposed for α-amylases from Anoxybacillus species (ASKA and ADTA), Geobacillus thermoleovorans (GTA, Pizzo, and GtamyII), Bacillus aquimaris (BaqA), and 95 other putative protein homologues. To understand this new GH13 subfamily, we report crystal structures of truncated ASKA (TASKA). ASKA is a thermostable enzyme capable of producing high levels of maltose. Unlike GTA, biochemical analysis showed that Ca(2+) ion supplementation enhances the catalytic activities of ASKA and TASKA. The crystal structures reveal the presence of four Ca(2+) ion binding sites, with three of these binding sites are highly conserved among Anoxybacillus α-amylases. This work provides structural insights into this new GH13 subfamily both in the apo form and in complex with maltose. Furthermore, structural comparison of TASKA and GTA provides an overview of the conformational changes accompanying maltose binding at each subsite.

Structure-function analysis of the auxilin J-domain reveals an extended Hsc70 interaction interface.

PubMed

Jiang, Jianwen; Taylor, Alexander B; Prasad, Kondury; Ishikawa-Brush, Yumiko; Hart, P John; Lafer, Eileen M; Sousa, Rui

2003-05-20

J-domains are widespread protein interaction modules involved in recruiting and stimulating the activity of Hsp70 family chaperones. We have determined the crystal structure of the J-domain of auxilin, a protein which is involved in uncoating clathrin-coated vesicles. Comparison to the known structures of J-domains from four other proteins reveals that the auxilin J-domain is the most divergent of all J-domain structures described to date. In addition to the canonical J-domain features described previously, the auxilin J-domain contains an extra N-terminal helix and a long loop inserted between helices I and II. The latter loop extends the positively charged surface which forms the Hsc70 binding site, and is shown by directed mutagenesis and surface plasmon resonance to contain side chains important for binding to Hsc70.

Structural Analysis of HMGD-DNA Complexes Reveal Influence of Intercalation on Sequence Selectivity and DNA Bending

PubMed Central

Churchill, Mair E.A.; Klass, Janet; Zoetewey, David L.

2010-01-01

The ubiquitous eukaryotic High-Mobility-Group-Box (HMGB) chromosomal proteins promote many chromatin-mediated cellular activities through their non-sequence-specific binding and bending of DNA. Minor groove DNA binding by the HMG box results in substantial DNA bending toward the major groove owing to electrostatic interactions, shape complementarity and DNA intercalation that occurs at two sites. Here, the structures of the complexes formed with DNA by a partially DNA intercalation-deficient mutant of Drosophila melanogaster HMGD have been determined by X-ray crystallography at a resolution of 2.85 Å. The six proteins and fifty base pairs of DNA in the crystal structure revealed a variety of bound conformations. All of the proteins bound in the minor groove, bridging DNA molecules, presumably because these DNA regions are easily deformed. The loss of the primary site of DNA intercalation decreased overall DNA bending and shape complementarity. However, DNA bending at the secondary site of intercalation was retained and most protein-DNA contacts were preserved. The mode of binding resembles the HMGB1-boxA-cisplatin-DNA complex, which also lacks a primary intercalating residue. This study provides new insights into the binding mechanisms used by HMG boxes to recognize varied DNA structures and sequences as well as modulate DNA structure and DNA bending. PMID:20800069

Genome-Wide Mapping of Collier In Vivo Binding Sites Highlights Its Hierarchical Position in Different Transcription Regulatory Networks

PubMed Central

Dubois, Laurence; Bataillé, Laetitia; Painset, Anaïs; Le Gras, Stéphanie; Jost, Bernard; Crozatier, Michèle; Vincent, Alain

2015-01-01

Collier, the single Drosophila COE (Collier/EBF/Olf-1) transcription factor, is required in several developmental processes, including head patterning and specification of muscle and neuron identity during embryogenesis. To identify direct Collier (Col) targets in different cell types, we used ChIP-seq to map Col binding sites throughout the genome, at mid-embryogenesis. In vivo Col binding peaks were associated to 415 potential direct target genes. Gene Ontology analysis revealed a strong enrichment in proteins with DNA binding and/or transcription-regulatory properties. Characterization of a selection of candidates, using transgenic CRM-reporter assays, identified direct Col targets in dorso-lateral somatic muscles and specific neuron types in the central nervous system. These data brought new evidence that Col direct control of the expression of the transcription regulators apterous and eyes-absent (eya) is critical to specifying neuronal identities. They also showed that cross-regulation between col and eya in muscle progenitor cells is required for specification of muscle identity, revealing a new parallel between the myogenic regulatory networks operating in Drosophila and vertebrates. Col regulation of eya, both in specific muscle and neuronal lineages, may illustrate one mechanism behind the evolutionary diversification of Col biological roles. PMID:26204530

Structural, kinetic and computational investigation of Vitis vinifera DHDPS reveals new insight into the mechanism of lysine-mediated allosteric inhibition.

PubMed

Atkinson, Sarah C; Dogovski, Con; Downton, Matthew T; Czabotar, Peter E; Dobson, Renwick C J; Gerrard, Juliet A; Wagner, John; Perugini, Matthew A

2013-03-01

Lysine is one of the most limiting amino acids in plants and its biosynthesis is carefully regulated through inhibition of the first committed step in the pathway catalyzed by dihydrodipicolinate synthase (DHDPS). This is mediated via a feedback mechanism involving the binding of lysine to the allosteric cleft of DHDPS. However, the precise allosteric mechanism is yet to be defined. We present a thorough enzyme kinetic and thermodynamic analysis of lysine inhibition of DHDPS from the common grapevine, Vitis vinifera (Vv). Our studies demonstrate that lysine binding is both tight (relative to bacterial DHDPS orthologs) and cooperative. The crystal structure of the enzyme bound to lysine (2.4 Å) identifies the allosteric binding site and clearly shows a conformational change of several residues within the allosteric and active sites. Molecular dynamics simulations comparing the lysine-bound (PDB ID 4HNN) and lysine free (PDB ID 3TUU) structures show that Tyr132, a key catalytic site residue, undergoes significant rotational motion upon lysine binding. This suggests proton relay through the catalytic triad is attenuated in the presence of lysine. Our study reveals for the first time the structural mechanism for allosteric inhibition of DHDPS from the common grapevine.

A novel class of dual-family immunophilins.

PubMed

Adams, Brian; Musiyenko, Alla; Kumar, Rajinder; Barik, Sailen

2005-07-01

Immunophilins are protein chaperones with peptidylprolyl isomerase activity that belong to one of two large families, the cyclosporin-binding cyclophilins (CyPs) and the FK506-binding proteins (FKBPs). Each family displays characteristic and conserved sequence features that differ between the two families. We report a novel group of dual-family immunophilins that contain both CyP and FKBP domains for which we propose the name FCBP (FK506- and cyclosporin-binding protein). The FCBP of Toxoplasma gondii, a protozoan parasite, contained N-terminal FKBP and C-terminal CyP domains joined by tetratricopeptide repeats. Structure-function analysis revealed that both domains were functional and exhibited family-specific drug sensitivity. The individual domains of FCBP inhibited calcineurin (protein phosphatase 2B) in the presence of the appropriate drugs. In binding studies, FCBP recruited calcineurin in the presence of FK506 and a putative target of rapamycin homolog in the presence of rapamycin. Two additional FCBP sequences in Flavobacterium and one in Treponema (spirochete) were also identified in which the CyP and FKBP domains were in the reverse order. T. gondii growth was inhibited by cyclosporin and FK506 in a moderately synergistic manner. The knockdown of FCBP by RNA interference revealed its essentiality for T. gondii growth. Clearly, the FCBPs are novel chaperones and potential targets of multiple immunosuppressant drugs.

Mechanism for pH-dependent gene regulation by amino-terminus-mediated homooligomerization of Bacillus subtilis anti-trp RNA-binding attenuation protein

PubMed Central

Sachleben, Joseph R.; McElroy, Craig A.; Gollnick, Paul; Foster, Mark P.

2010-01-01

Anti-TRAP (AT) is a small zinc-binding protein that regulates tryptophan biosynthesis in Bacillus subtilis by binding to tryptophan-bound trp RNA-binding attenuation protein (TRAP), thereby preventing it from binding RNA, and allowing transcription and translation of the trpEDCFBA operon. Crystallographic and sedimentation studies have shown that AT can homooligomerize to form a dodecamer, AT12, composed of a tetramer of trimers, AT3. Structural and biochemical studies suggest that only trimeric AT is active for binding to TRAP. Our chromatographic and spectroscopic data revealed that a large fraction of recombinantly overexpressed AT retains the N-formyl group (fAT), presumably due to incomplete N-formyl-methionine processing by peptide deformylase. Hydrodynamic parameters from NMR relaxation and diffusion measurements showed that fAT is exclusively trimeric (AT3), while (deformylated) AT exhibits slow exchange between both trimeric and dodecameric forms. We examined this equilibrium using NMR spectroscopy and found that oligomerization of active AT3 to form inactive AT12 is linked to protonation of the amino terminus. Global analysis of the pH dependence of the trimer-dodecamer equilibrium revealed a near physiological pKa for the N-terminal amine of AT and yielded a pH-dependent oligomerization equilibrium constant. Estimates of excluded volume effects due to molecular crowding suggest the oligomerization equilibrium may be physiologically important. Because deprotonation favors “active” trimeric AT and protonation favors “inactive” dodecameric AT, our findings illuminate a possible mechanism for sensing and responding to changes in cellular pH. PMID:20713740

Investigating the interaction of anticancer drug temsirolimus with human transferrin: Molecular docking and spectroscopic approach.

PubMed

Shamsi, Anas; Ahmed, Azaj; Khan, Mohd Shahnawaz; Husain, Fohad Mabood; Amani, Samreen; Bano, Bilqees

2018-05-16

In our present study, binding between an important anti renal cancer drug temsirolimus and human transferrin (hTF) was investigated employing spectroscopic and molecular docking approach. In the presence of temsirolimus, hyper chromaticity is observed in hTF in UV spectroscopy suggestive of complex formation between hTF and temsirolimus. Fluorescence spectroscopy revealed the occurrence of quenching in hTF in the presence of temsirolimus implying complex formation taking place between hTF and temsirolimus. Further, the mode of interaction between hTF and temsirolimus was revealed to be static by fluorescence quenching analysis at 3 different temperatures. Binding constant values obtained employing fluorescence spectroscopy depicts strong interaction between hTF and temsirolimus; temsirolimus binds to hTF at 298 K with a binding constant of .32 × 10 4  M -1 implying the strength of this interaction. The negative Gibbs free energy obtained through quenching experiments is evident of the fact that the binding is spontaneous. CD spectra of hTF also showed a downward shift in the presence of temsirolimus as compared with free hTF implying complex formation between hTF and temsirolimus. Molecular docking was performed with a view to find out which residues are key players in this interaction. The importance of our study stems from the fact it will provide an insight into binding pattern of commonly administered renal cancer drug with an important protein that plays a pivotal role in many physiological processes. Copyright © 2018 John Wiley & Sons, Ltd.

Proteomic analysis in peritoneal dialysis patients with different peritoneal transport characteristics.

PubMed

Wen, Qiong; Zhang, Li; Mao, Hai-Ping; Tang, Xue-Qing; Rong, Rong; Fan, Jin-Jin; Yu, Xue-Qing

2013-08-30

Peritoneal membranes can be categorized as high, high average, low average, and low transporters, based on the removal or transport rate of solutes. In this study, we used proteomic analysis to determine the differences in proteins removed by different types of peritoneal membranes. Peritoneal transport characteristics in patients who received peritoneal dialysis therapy were assessed by a peritoneal equilibration test. Two-dimensional differential gel electrophoresis technology followed by quantitative analysis was performed to study the variation in protein expression from peritoneal dialysis effluents (PDE) among different groups. Proteins were identified by MALDI-TOF-MS/MS analyses. Further validation in PDE or serum was performed utilizing ELISA analysis. Proteomics analysis revealed ten protein spots with significant differences in intensity levels among different groups, including vitamin D-binding protein, complement C3, apolipoprotein-A1, complement factor C4A, haptoglobin, alpha-1 antitrypsin, immunoglobulin kappa light chain, alpha-2-microglobulin, retinol-binding protein 4 and transthyretin. The levels of vitamin D-binding protein, complement C3, and apolipoprotein-A1 in PDE derived from different groups were greatly varied (P<0.05). However, no significant difference was found in the serum levels of these proteins among different groups (P>0.05 for all groups). This study provides a novel overview of the differences in PDE proteomes of four types of peritoneal membranes. Vitamin D-binding protein, complement C3, and apolipoprotein-A1 showed enhanced expression in PDE of patients with high transporter. Copyright © 2013 Elsevier Inc. All rights reserved.

A Comparative Study of the Application of Fluorescence Excitation-Emission Matrices Combined with Parallel Factor Analysis and Nonnegative Matrix Factorization in the Analysis of Zn Complexation by Humic Acids

PubMed Central

Boguta, Patrycja; Pieczywek, Piotr M.; Sokołowska, Zofia

2016-01-01

The main aim of this study was the application of excitation-emission fluorescence matrices (EEMs) combined with two decomposition methods: parallel factor analysis (PARAFAC) and nonnegative matrix factorization (NMF) to study the interaction mechanisms between humic acids (HAs) and Zn(II) over a wide concentration range (0–50 mg·dm−3). The influence of HA properties on Zn(II) complexation was also investigated. Stability constants, quenching degree and complexation capacity were estimated for binding sites found in raw EEM, EEM-PARAFAC and EEM-NMF data using mathematical models. A combination of EEM fluorescence analysis with one of the proposed decomposition methods enabled separation of overlapping binding sites and yielded more accurate calculations of the binding parameters. PARAFAC and NMF processing allowed finding binding sites invisible in a few raw EEM datasets as well as finding totally new maxima attributed to structures of the lowest humification. Decomposed data showed an increase in Zn complexation with an increase in humification, aromaticity and molecular weight of HAs. EEM-PARAFAC analysis also revealed that the most stable compounds were formed by structures containing the highest amounts of nitrogen. The content of oxygen-functional groups did not influence the binding parameters, mainly due to fact of higher competition of metal cation with protons. EEM spectra coupled with NMF and especially PARAFAC processing gave more adequate assessments of interactions as compared to raw EEM data and should be especially recommended for modeling of complexation processes where the fluorescence intensities (FI) changes are weak or where the processes are interfered with by the presence of other fluorophores. PMID:27782078

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leenheer, J.A.; Brown, G.K.; Cabaniss, S.E.

Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca{sup 2+}, Cd{sup 2+}, Cu{sup 2+}, Ni{sup 2+}, and Zn{sup 2+} ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca{sup 2+} ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The metal binding fraction was characterized by quantitative {sup 13}C NMR, {sup 1}H NMR, and FT-IR spectrometry andmore » elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short-chain aliphatic dibasic acid structures. The Ca{sup 2+} binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.« less

Characterization of the high affinity binding of epsilon toxin from Clostridium perfringens to the renal system.

PubMed

Dorca-Arévalo, Jonatan; Martín-Satué, Mireia; Blasi, Juan

2012-05-25

Epsilon toxin (ε-toxin), produced by Clostridium perfringens types B and D, causes fatal enterotoxaemia in livestock. In the renal system, the toxin binds to target cells before oligomerization, pore formation and cell death. Still, there is little information about the cellular and molecular mechanism involved in the initial steps of the cytotoxic action of ε-toxin, including the specific binding to the target sensitive cells. In the present report, the binding step of ε-toxin to the MDCK cell line is characterized by means of an ELISA-based binding assay with recombinant ε-toxin-green fluorescence protein (ε-toxin-GFP) and ε-prototoxin-GFP. In addition, different treatments with Pronase E, detergents, N-glycosidase F and beta-elimination on MDCK cells and renal cryosections have been performed to further characterize the ε-toxin binding. The ELISA assays revealed a single binding site with a similar dissociation constant (K(d)) for ε-toxin-GFP and ε-prototoxin-GFP, but a three-fold increase in B(max) levels in the case of ε-toxin-GFP. Double staining on kidney cryoslices with lectins and ε-prototoxin-GFP revealed specific binding to distal and collecting tubule cells. In addition, experiments on kidney and bladder cryoslices demonstrated the specific binding to distal tubule of a range of mammalian renal systems. Pronase E and beta-elimination treatments on kidney cryoslices and MDCK cells revealed that the binding of ε-toxin in renal system is mediated by a O-glycoprotein. Detergent treatments revealed that the integrity of the plasma membrane is required for the binding of ε-toxin to its receptor. Copyright © 2011 Elsevier B.V. All rights reserved.

Fungal toxins bind to the URF13 protein in maize mitochondria and Escherichia coli.

PubMed Central

Braun, C J; Siedow, J N; Levings, C S

1990-01-01

Expression of the maize mitochondrial T-urf13 gene results in a sensitivity to a family of fungal pathotoxins and to methomyl, a structurally unrelated systemic insecticide. Similar effects of pathotoxins and methomyl are observed when T-urf13 is cloned and expressed in Escherichia coli. An interaction between these compounds and the membrane-bound URF13 protein permeabilizes the inner mitochondrial and bacterial plasma membranes. To understand the toxin-URF13 effects, we have investigated whether toxin specifically binds to the URF13 protein. Our studies indicate that toxin binds to the URF13 protein in maize mitochondria and in E. coli expressing URF13. Binding analysis in E. coli reveals cooperative toxin binding. A low level of specific toxin binding is also demonstrated in cms-T and cms-T-restored mitochondria; however, binding does not appear to be cooperative in maize mitochondria. Competition and displacement studies in E. coli demonstrate that toxin binding is reversible and that the toxins and methomyl compete for the same, or for overlapping, binding sites. Two toxin-insensitive URF13 mutants display a diminished capability to bind toxin in E. coli, which identifies residues of URF13 important in toxin binding. A third toxin-insensitive URF13 mutant shows considerable toxin binding in E. coli, demonstrating that toxin binding can occur without causing membrane permeabilization. Our results indicate that toxin-mediated membrane permeabilization only occurs when toxin or methomyl is bound to URF13. PMID:2136632

Binding affinities of Schiff base Fe(II) complex with BSA and calf-thymus DNA: Spectroscopic investigations and molecular docking analysis

NASA Astrophysics Data System (ADS)

Rudra, Suparna; Dasmandal, Somnath; Patra, Chiranjit; Kundu, Arjama; Mahapatra, Ambikesh

2016-09-01

The binding interaction of a synthesized Schiff base Fe(II) complex with biological macromolecules viz., bovine serum albumin (BSA) and calf thymus(ct)-DNA have been investigated using different spectroscopic techniques coupled with viscosity measurements at physiological pH and 298 K. Regular amendments in emission intensities of BSA upon the action of the complex indicate significant interaction between them, and the binding interaction have been characterized by Stern Volmer plots and thermodynamic binding parameters. On the basis of this quenching technique one binding site with binding constant (Kb = (7.6 ± 0.21) × 105) between complex and protein have been obtained at 298 K. Time-resolved fluorescence studies have also been encountered to understand the mechanism of quenching induced by the complex. Binding affinities of the complex to the fluorophores of BSA namely tryptophan (Trp) and tyrosine (Tyr) have been judged by synchronous fluorescence studies. Secondary structural changes of BSA rooted by the complex has been revealed by CD spectra. On the other hand, hypochromicity of absorption spectra of the complex with the addition of ct-DNA and the gradual reduction in emission intensities of ethidium bromide bound ct-DNA in presence of the complex indicate noticeable interaction between ct-DNA and the complex with the binding constant (4.2 ± 0.11) × 106 M- 1. Life-time measurements have been studied to determine the relative amplitude of binding of the complex to ct-DNA base pairs. Mode of binding interaction of the complex with ct-DNA has been deciphered by viscosity measurements. CD spectra have also been used to understand the changes in ct-DNA structure upon binding with the metal complex. Density functional theory (DFT) and molecular docking analysis have been employed in highlighting the interactive phenomenon and binding location of the complex with the macromolecules.

CXCL4 is a novel nickel-binding protein and augments nickel allergy.

PubMed

Kuroishi, T; Bando, K; Tanaka, Y; Shishido, K; Kinbara, M; Ogawa, T; Muramoto, K; Endo, Y; Sugawara, S

2017-08-01

Nickel (Ni) is the most frequent metal allergen and induces a TH 1 -dependent type-IV allergy. Although Ni 2+ is considered to bind to endogenous proteins, it currently remains unclear whether these Ni-binding proteins are involved in Ni allergy in vivo. We previously reported the adjuvant effects of lipopolysaccharide (LPS) in a Ni allergy mouse model. As LPS induces a number of inflammatory mediators, we hypothesized that Ni-binding protein(s) are also induced by LPS. The objective of this study was to purify and identify Ni-binding protein(s) from serum taken from LPS-injected mice (referred as LPS serum) and examined the augmenting effects of these Ni-binding protein(s) on Ni allergy in an in vivo model. BALB/cA mice were sensitized with an i.p. injection of NiCl 2 and LPS. Ten days after sensitization, mice were challenged with NiCl 2 by an i.d. injection into ear pinnae. Ni-binding protein(s) were purified by Ni-affinity column chromatography and gel filtration. Lipopolysaccharide serum, but not serum taken from saline-injected mice, augmented ear swelling induced by Ni-allergic inflammation. Ni-binding, but not non-binding fraction, purified from LPS serum augmented Ni-allergic inflammation. Mass spectrometry and Western blotting detected CXCL4 in the active fraction. A batch analysis with Ni-sepharose and a surface plasmon resonance analysis revealed direct binding between CXCL4 and Ni 2+ . Recombinant CXCL4 augmented Ni-allergic inflammation and exerted adjuvant effects at the sensitization phase. These results indicate that CXCL4 is a novel Ni-binding protein that augments Ni allergy at the elicitation and sensitization phases. This is the first study to demonstrate that the Ni-binding protein augments Ni allergy in vivo. © 2017 John Wiley & Sons Ltd.

Glomerular anionic site distribution in nonproteinuric rats. A computer-assisted morphometric analysis.

PubMed

Pilia, P A; Swain, R P; Williams, A V; Loadholt, C B; Ainsworth, S K

1985-12-01

The cationic ultrastructural tracer polyethyleneimine (PEI: pI approximately equal to 11.0), binds electrophysically to uniformly spaced discrete electron-dense anionic sites present in the laminae rarae of the rat glomerular basement membrane (GBM), mesangial reflections of the GBM, Bowman's capsule, and tubular basement membranes when administered intravenously. Computer-assisted morphometric analysis of glomerular anionic sites reveals that the maximum concentration of stainable lamina rara externa (lre) sites (21/10,000 A GBM) occurs 60 minutes after PEI injection with a site-site interspacing of 460 A. Lamina rara interna (lri) sites similarly demonstrate a maximum concentration (20/10,000 A GBM) at 60 minutes with a periodicity of 497 A. The concentration and distribution of anionic sites within the lri was irregular in pattern and markedly decreased in number, while the lre possesses an electrical field that is highly regular at all time intervals analyzed (15, 30, 60, 120, 180, 240, and 300 minutes). Immersion and perfusion of renal tissue with PEI reveals additional heavy staining of the epithelial and endothelial cell sialoprotein coatings. PEI appears to bind to glomerular anionic sites reversibly: ie, between 60 and 180 minutes the concentration of stained sites decreases. At 300 minutes, the interspacing once again approaches the 60-minute concentration. This suggests a dynamic turnover or dissociation followed by a reassociation of glomerular negatively charged PEI binding sites. In contrast, morphometric analysis of anionic sites stained with lysozyme and protamine sulfate reveals interspacings of 642 A and 585 A, respectively; in addition, these tracers produce major glomerular ultrastructural alterations and induce transient proteinuria. PEI does not induce proteinuria in rats, nor does it produce glomerular morphologic alterations when ten times the tracer dosage is administered intravenously. These findings indicate that the choice of ultrastructural charge tracer, the method of administering the tracer, and the time selected for analysis of tissue after administration of tracer significantly influences results. Morphometric analysis of the distribution of glomerular anionic sites in nonproteinuric rats provides a method of evaluating quantitative alterations of the glomerular charge barrier in renal disease models.

Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function.

PubMed

Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E

2008-09-01

WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.

The Liverwort Contains a Lectin That Is Structurally and Evolutionary Related to the Monocot Mannose-Binding Lectins1

PubMed Central

Peumans, Willy J.; Barre, Annick; Bras, Julien; Rougé, Pierre; Proost, Paul; Van Damme, Els J.M.

2002-01-01

A mannose (Man)-binding lectin has been isolated and characterized from the thallus of the liverwort Marchantia polymorpha. N-terminal sequencing indicated that the M. polymorpha agglutinin (Marpola) shares sequence similarity with the superfamily of monocot Man-binding lectins. Searches in the databases yielded expressed sequence tags encoding Marpola. Sequence analysis, molecular modeling, and docking experiments revealed striking structural similarities between Marpola and the monocot Man-binding lectins. Activity and specificity studies further indicated that Marpola is a much stronger agglutinin than the Galanthus nivalis agglutinin and exhibits a preference for methylated Man and glucose, which is unprecedented within the family of monocot Man-binding lectins. The discovery of Marpola allows us, for the first time, to corroborate the evolutionary relationship between a lectin from a lower plant and a well-established lectin family from flowering plants. In addition, the identification of Marpola sheds a new light on the molecular evolution of the superfamily of monocot Man-binding lectins. Beside evolutionary considerations, the occurrence of a G. nivalis agglutinin homolog in a lower plant necessitates the rethinking of the physiological role of the whole family of monocot Man-binding lectins. PMID:12114560

Evaluation of water displacement energetics in protein binding sites with grid cell theory.

PubMed

Gerogiokas, G; Southey, M W Y; Mazanetz, M P; Heifetz, A; Hefeitz, A; Bodkin, M; Law, R J; Michel, J

2015-04-07

Excess free energies, enthalpies and entropies of water in protein binding sites were computed via classical simulations and Grid Cell Theory (GCT) analyses for three pairs of congeneric ligands in complex with the proteins scytalone dehydratase, p38α MAP kinase and EGFR kinase respectively. Comparative analysis is of interest since the binding modes for each ligand pair differ in the displacement of one binding site water molecule, but significant variations in relative binding affinities are observed. Protocols that vary in their use of restraints on protein and ligand atoms were compared to determine the influence of protein-ligand flexibility on computed water structure and energetics, and to assess protocols for routine analyses of protein-ligand complexes. The GCT-derived binding affinities correctly reproduce experimental trends, but the magnitude of the predicted changes in binding affinities is exaggerated with respect to results from a previous Monte Carlo Free Energy Perturbation study. Breakdown of the GCT water free energies into enthalpic and entropic components indicates that enthalpy changes dominate the observed variations in energetics. In EGFR kinase GCT analyses revealed that replacement of a pyrimidine by a cyanopyridine perturbs water energetics up three hydration shells away from the ligand.

CorA Is a Copper Repressible Surface-Associated Copper(I)-Binding Protein Produced in Methylomicrobium album BG8

PubMed Central

Johnson, Kenneth A.; Ve, Thomas; Larsen, Øivind; Pedersen, Rolf B.; Lillehaug, Johan R.; Jensen, Harald B.; Helland, Ronny; Karlsen, Odd A.

2014-01-01

CorA is a copper repressible protein previously identified in the methanotrophic bacterium Methylomicrobium album BG8. In this work, we demonstrate that CorA is located on the cell surface and binds one copper ion per protein molecule, which, based on X-ray Absorption Near Edge Structure analysis, is in the reduced state (Cu(I)). The structure of endogenously expressed CorA was solved using X-ray crystallography. The 1.6 Å three-dimensional structure confirmed the binding of copper and revealed that the copper atom was coordinated in a mononuclear binding site defined by two histidines, one water molecule, and the tryptophan metabolite, kynurenine. This arrangement of the copper-binding site is similar to that of its homologous protein MopE* from Metylococcus capsulatus Bath, confirming the importance of kynurenine for copper binding in these proteins. Our findings show that CorA has an overall fold similar to MopE, including the unique copper(I)-binding site and most of the secondary structure elements. We suggest that CorA plays a role in the M. album BG8 copper acquisition. PMID:24498370

Photo-Activated Localization Microscopy of Single Carbohydrate Binding Modules on Cellulose Nanofibers

NASA Astrophysics Data System (ADS)

Hor, Amy; Dagel, Daryl; Luu, Quocanh; Savaikar, Madhusudan; Ding, Shi-You; Smith, Steve

2015-03-01

Photo Activated Localization Microscopy (PALM) is used to conduct an in vivo study of the binding affinity of polysaccharide-specific Carbohydrate Binding Modules (CBMs) to insoluble cellulose substrates. Two families of CBMs, namely TrCBM1 and CtCBM3, were modified to incorporate photo-activatable mCherry fluorescent protein (PAmCherry), and exposed to highly crystalline Valonia cellulose nano-fibrils. The resulting PALM images show CBMs binding along the nano-fibril long axis in a punctuated linear array, localized with, on average, 10 nm precision. Statistical analysis of the binding events results in nearest neighbor distributions between CBMs. A comparison between TrCBM1 and CtCBM3 reveals a similarity in the nearest neighbor distribution peaks but differences in the overall binding density. The former is attributed to steric hindrance among the CBMs on the nano-fibril whereas the latter is attributed to differences in the CBMs' binding strength. These results are compared to similar distributions derived from TEM measurements of dried samples of CtCBM3-CdSs quantum dot bioconjugates and AFM images of CtCBM3-GFP bound to similar Valonia nano-fibrils. Funding provided by NSF MPS/DMR/BMAT Award # 1206908.

Comparison and analysis on the serum-binding characteristics of aspirin-zinc complex and aspirin.

PubMed

Zhang, Hua-Xin; Zhang, Qun; Wang, Hong-Lin; Li, Li-Wei

2017-09-01

This study was designed to compare the protein-binding characteristics of aspirin-zinc complex (AZN) with those of aspirin itself. AZN was synthesized and interacted with a model transport protein, human serum albumin (HSA). Three-dimensional fluorescence, ultraviolet-visible and circular dichroism (CD) spectra were used to characterize the interaction of AZN with HSA under physiological conditions. The interaction mechanism was explored using a fluorescence quenching method and thermodynamic calculation. The binding site and binding locality of AZN on HSA were demonstrated using a fluorescence probe technique and Förster non-radiation energy transfer theory. Synchronous fluorescence and CD spectra were employed to reveal the effect of AZN on the native conformation of the protein. The HSA-binding results for AZN were compared with those for aspirin under consistent experimental conditions, and indicated that aspirin acts as a guide in AZN when binding to Sudlow's site I, in subdomain IIA of the HSA molecule. Moreover, compared with aspirin, AZN showed greater observed binding constants with, but smaller changes in the α-helicity of, HSA, which proved that AZN might be easier to transport and have less toxicity in vivo. Copyright © 2017 John Wiley & Sons, Ltd.

Interaction of S17 Antibody with the Functional Binding Region of the Hepatitis B Virus Pre-S2 Epitope.

PubMed

Chang, Chang-Yu; Chang, Fu-Ling; Chiang, Chen-Wei; Lo, Yan-Ni; Lin, Tsai-Yu; Chen, Wang-Chuan; Tsai, Keng-Chang; Lee, Yu-Ching

2018-05-30

To understand the mechanism for inhibition of hepatitis B virus (HBV) infection is important. In this study, single-chain variable fragment (scFv) antibodies were generated and directed to the pre-S2 epitope of HBV surface antigen (HBsAg). These human scFvs were isolated from a person with history of HBV infection by phage display technology. An evaluation of panning efficiency revealed that the eluted phage titer was increased, indicating that specific clones were enriched after panning. Selected scFvs were characterized with the recombinant HBsAg through Western blotting and enzyme-linked immunosorbent assay to confirm the binding ability. Flow cytometry analysis and immunocytochemical staining revealed that one scFv, S17, could recognize endogenous HBsAg expressed on the HepG2215 cell membrane. Moreover, the binding affinity of scFv S17 to the pre-S2 epitope was determined to be 4.2 × 10 -8 M. Two ion interactions were observed as the major driving forces for scFv S17 interacting with pre-S2 by performing a rational molecular docking analysis. This study provides insights into the structural basis to understand the interactions between an antibody and the pre-S2 epitope. The functional scFv format can potentially be used in future immunotherapeutic applications.

Mathematical Modeling of Herpes Simplex Virus Distribution in Solid Tumors: Implications for Cancer Gene Therapy

PubMed Central

Mok, Wilson; Stylianopoulos, Triantafyllos; Boucher, Yves; Jain, Rakesh K.

2010-01-01

Purpose Although oncolytic viral vectors show promise for the treatment of various cancers, ineffective initial distribution and propagation throughout the tumor mass often limit the therapeutic response. A mathematical model is developed to describe the spread of herpes simplex virus from the initial injection site. Experimental Design The tumor is modeled as a sphere of radius R. The model incorporates reversible binding, interstitial diffusion, viral degradation, and internalization and physiologic parameters. Three species are considered as follows: free interstitial virus, virus bound to cell surfaces, and internalized virus. Results This analysis reveals that both rapid binding and internalization as well as hindered diffusion contain the virus to the initial injection volume, with negligible spread to the surrounding tissue. Unfortunately, increasing the dose to saturate receptors and promote diffusion throughout the tumor is not a viable option: the concentration necessary would likely compromise safety. However, targeted modifications to the virus that decrease the binding affinity have the potential to increase the number of infected cells by 1.5-fold or more. An increase in the effective diffusion coefficient can result in similar gains. Conclusions This analysis suggests criteria by which the potential response of a tumor to oncolytic herpes simplex virus therapy can be assessed. Furthermore, it reveals the potential of modifications to the vector delivery method, physicochemical properties of the virus, and tumor extracellular matrix composition to enhance efficacy. PMID:19318482

Binding of DNA-binding alkaloids berberine and palmatine to tRNA and comparison to ethidium: Spectroscopic and molecular modeling studies

NASA Astrophysics Data System (ADS)

Islam, Md. Maidul; Pandya, Prateek; Chowdhury, Sebanti Roy; Kumar, Surat; Kumar, Gopinatha Suresh

2008-11-01

The interaction of two natural protoberberine plant alkaloids berberine and palmatine with tRNA phe was studied using various biophysical techniques and molecular modeling and the data were compared with the binding of the classical DNA intercalator, ethidium. Circular dichroic studies revealed that the tRNA conformation was moderately perturbed on binding of the alkaloids. The cooperative binding of both the alkaloids and ethidium to tRNA was revealed from absorbance and fluorescence studies. Fluorescence quenching studies advanced a conclusion that while berberine and palmatine are partially intercalated, ethidium is fully intercalated on the tRNA molecule. The binding of the alkaloids as well as ethidium stabilized the tRNA melting, and the binding constant evaluated from the averaged optical melting temperature data was in agreement with fluorescence spectral-binding data. Differential scanning calorimetry revealed that the tRNA melting showed three close transitions that were affected on binding of these small molecules. Molecular docking calculations performed showed the preferred regions of binding of these small molecules on the tRNA. Taken together, the results suggest that the binding of the alkaloids berberine and palmatine on the tRNA structure appears to be mostly by partial intercalation while ethidium intercalates fully on the tRNA. These results further advance our knowledge on the molecular aspects on the interaction of these alkaloids to tRNA.

A novel site contributing to growth-arrest-specific gene 6 binding to its receptors as revealed by a human monoclonal antibody

PubMed Central

2004-01-01

Gas6 (growth-arrest-specific gene 6) is a vitamin K-dependent protein known to activate the Axl family of receptor tyrosine kinases. It is an important regulator of thrombosis and many other biological functions. The C-terminus of Gas6 binds to receptors and consists of two laminin-like globular domains LG1 and LG2. It has been reported that a Ca2+-binding site at the junction of LG1 and LG2 domains and a hydrophobic patch at the LG2 domain are important for receptor binding [Sasaki, Knyazev, Cheburkin, Gohring, Tisi, Ullrich, Timpl and Hohenester (2002) J. Biol. Chem. 277, 44164–44170]. In the present study, we developed a neutralizing human monoclonal antibody, named CNTO300, for Gas6. The antibody was generated by immunization of human IgG-expressing transgenic mice with recombinant human Gas6 protein and the anti-Gas6 IgG sequences were rescued from an unstable hybridoma clone. Binding of Gas6 to its receptors was partially inhibited by the CNTO300 antibody in a dose-dependent manner. To characterize further the interaction between Gas6 and this antibody, the binding kinetics of CNTO300 for recombinant Gas6 were compared with independently expressed LG1 and LG2. The CNTO300 antibody showed comparable binding affinity, yet different dependence on Ca2+, to Gas6 and LG1. No binding to LG2 was detected. In the presence of EDTA, binding of the antibody to Gas6 was disrupted, but no significant effect of EDTA on LG1 binding was evident. Further epitope mapping identified a Gas6 peptide sequence recognized by the CNTO300 antibody. This peptide sequence was found to be located at the LG1 domain distant from the Ca2+-binding site and the hydrophobic patch. Co-interaction of Gas6 with its receptor and CNTO300 antibody was detected by BIAcore analysis, suggesting a second receptor-binding site on the LG1 domain. This hypothesis was further supported by direct binding of Gas6 receptors to an independently expressed LG1 domain. Our results revealed, for the first time, a second binding site for Gas6–receptor interaction. PMID:15579134

Structural analysis of a putative SAM-dependent methyltransferase, YtqB, from Bacillus subtilis.

PubMed

Park, Sun Cheol; Song, Wan Seok; Yoon, Sung-il

2014-04-18

S-adenosyl-L-methionine (SAM)-dependent methyltransferases (MTases) methylate diverse biological molecules using a SAM cofactor. The ytqB gene of Bacillus subtilis encodes a putative MTase and its biological function has never been characterized. To reveal the structural features and the cofactor binding mode of YtqB, we have determined the crystal structures of YtqB alone and in complex with its cofactor, SAM, at 1.9 Å and 2.2 Å resolutions, respectively. YtqB folds into a β-sheet sandwiched by two α-helical layers, and assembles into a dimeric form. Each YtqB monomer contains one SAM binding site, which shapes SAM into a slightly curved conformation and exposes the reactive methyl group of SAM potentially to a substrate. Our comparative structural analysis of YtqB and its homologues indicates that YtqB is a SAM-dependent class I MTase, and provides insights into the substrate binding site of YtqB. Copyright © 2014 Elsevier Inc. All rights reserved.

Small leucine-rich repeat proteoglycans associated with mature insoluble elastin serve as binding sites for galectins.

PubMed

Itoh, Aiko; Nonaka, Yasuhiro; Ogawa, Takashi; Nakamura, Takanori; Nishi, Nozomu

2017-11-01

We previously reported that galectin-9 (Gal-9), an immunomodulatory animal lectin, could bind to insoluble collagen preparations and exerted direct cytocidal effects on immune cells. In the present study, we found that mature insoluble elastin is capable of binding Gal-9 and other members of the human galectin family. Lectin blot analysis of a series of commercial water-soluble elastin preparations, PES-(A) ~ PES-(E), revealed that only PES-(E) contained substances recognized by Gal-9. Gal-9-interacting substances in PES-(E) were affinity-purified, digested with trypsin and then analyzed by reversed-phase HPLC. Peptide fragments derived from five members of the small leucine-rich repeat proteoglycan family, versican, lumican, osteoglycin/mimecan, prolargin, and fibromodulin, were identified by N-terminal amino acid sequence analysis. The results indicate that Gal-9 and possibly other galectins recognize glycans attached to small leucine-rich repeat proteoglycans associated with insoluble elastin and also indicate the possibility that mature insoluble elastin serves as an extracellular reservoir for galectins.

Polymerase/DNA interactions and enzymatic activity: multi-parameter analysis with electro-switchable biosurfaces

NASA Astrophysics Data System (ADS)

Langer, Andreas; Schräml, Michael; Strasser, Ralf; Daub, Herwin; Myers, Thomas; Heindl, Dieter; Rant, Ulrich

2015-07-01

The engineering of high-performance enzymes for future sequencing and PCR technologies as well as the development of many anticancer drugs requires a detailed analysis of DNA/RNA synthesis processes. However, due to the complex molecular interplay involved, real-time methodologies have not been available to obtain comprehensive information on both binding parameters and enzymatic activities. Here we introduce a chip-based method to investigate polymerases and their interactions with nucleic acids, which employs an electrical actuation of DNA templates on microelectrodes. Two measurement modes track both the dynamics of the induced switching process and the DNA extension simultaneously to quantitate binding kinetics, dissociation constants and thermodynamic energies. The high sensitivity of the method reveals previously unidentified tight binding states for Taq and Pol I (KF) DNA polymerases. Furthermore, the incorporation of label-free nucleotides can be followed in real-time and changes in the DNA polymerase conformation (finger closing) during enzymatic activity are observable.

A novel progesterone receptor membrane component (PGRMC) in the human and swine parasite Taenia solium: implications to the host-parasite relationship.

PubMed

Aguilar-Díaz, Hugo; Nava-Castro, Karen E; Escobedo, Galileo; Domínguez-Ramírez, Lenin; García-Varela, Martín; Del Río-Araiza, Víctor H; Palacios-Arreola, Margarita I; Morales-Montor, Jorge

2018-03-09

We have previously reported that progesterone (P 4 ) has a direct in vitro effect on the scolex evagination and growth of Taenia solium cysticerci. Here, we explored the hypothesis that the P 4 direct effect on T. solium might be mediated by a novel steroid-binding parasite protein. By way of using immunofluorescent confocal microscopy, flow cytometry analysis, double-dimension electrophoresis analysis, and sequencing the corresponding protein spot, we detected a novel PGRMC in T. solium. Molecular modeling studies accompanied by computer docking using the sequenced protein, together with phylogenetic analysis and sequence alignment clearly demonstrated that T. solium PGRMC is from parasite origin. Our results show that P 4 in vitro increases parasite evagination and scolex size. Using immunofluorescent confocal microscopy, we detected that parasite cells showed expression of a P 4 -binding like protein exclusively located at the cysticercus subtegumental tissue. Presence of the P 4 -binding protein in cyst cells was also confirmed by flow cytometry. Double-dimension electrophoresis analysis, followed by sequencing the corresponding protein spot, revealed a protein that was previously reported in the T. solium genome belonging to a membrane-associated progesterone receptor component (PGRMC). Molecular modeling studies accompanied by computer docking using the sequenced protein showed that PGRMC is potentially able to bind steroid hormones such as progesterone, estradiol, testosterone and dihydrodrotestosterone with different affinities. Phylogenetic analysis and sequence alignment clearly demonstrated that T. solium PGRMC is related to a steroid-binding protein of Echinoccocus granulosus, both of them being nested within a cluster including similar proteins present in platyhelminths such as Schistocephalus solidus and Schistosoma haematobium. Progesterone may directly act upon T. solium cysticerci probably by binding to PGRMC. This research has implications in the field of host-parasite co-evolution as well as the sex-associated susceptibility to this infection. In a more practical matter, present results may contribute to the molecular design of new drugs with anti-parasite actions.

Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation

PubMed Central

Zhang, Yong; Gu, Lianfeng; Hou, Yifeng; Wang, Lulu; Deng, Xian; Hang, Runlai; Chen, Dong; Zhang, Xiansheng; Zhang, Yi; Liu, Chunyan; Cao, Xiaofeng

2015-01-01

Alternative polyadenylation (APA) is a widespread mechanism for gene regulation and has been implicated in flowering, but the molecular basis governing the choice of a specific poly(A) site during the vegetative-to-reproductive growth transition remains unclear. Here we characterize HLP1, an hnRNP A/B protein as a novel regulator for pre-mRNA 3′-end processing in Arabidopsis. Genetic analysis reveals that HLP1 suppresses Flowering Locus C (FLC), a key repressor of flowering in Arabidopsis. Genome-wide mapping of HLP1-RNA interactions indicates that HLP1 binds preferentially to A-rich and U-rich elements around cleavage and polyadenylation sites, implicating its role in 3′-end formation. We show HLP1 is significantly enriched at transcripts involved in RNA metabolism and flowering. Comprehensive profiling of the poly(A) site usage reveals that HLP1 mutations cause thousands of poly(A) site shifts. A distal-to-proximal poly(A) site shift in the flowering regulator FCA, a direct target of HLP1, leads to upregulation of FLC and delayed flowering. Our results elucidate that HLP1 is a novel factor involved in 3′-end processing and controls reproductive timing via targeting APA. PMID:26099751

Parish apprenticeship and the old poor law in London1

PubMed Central

Levene, Alysa

2010-01-01

This article offers an examination of the patterns and motivations behind parish apprenticeship in late eighteenth- and early nineteenth-century London. It stresses continuity in outlook from parish officials binding children, which involved placements in both the traditional and industrializing sectors of the economy. Evidence on the ages, employment types, and locations of 3,285 pauper apprentices bound from different parts of London between 1767 and 1833 indicates a variety of local patterns. The analysis reveals a pattern of youthful age at binding, a range of employment experiences, and parish-specific links to particular trades and manufactures. PMID:20939134

Parish apprenticeship and the old poor law in London.

PubMed

Levene, Alysa

2010-01-01

This article offers an examination of the patterns and motivations behind parish apprenticeship in late eighteenth- and early nineteenth-century London. It stresses continuity in outlook from parish officials binding children, which involved placements in both the traditional and industrializing sectors of the economy. Evidence on the ages, employment types, and locations of 3,285 pauper apprentices bound from different parts of London between 1767 and 1833 indicates a variety of local patterns. The analysis reveals a pattern of youthful age at binding, a range of employment experiences, and parish-specific links to particular trades and manufactures.

CW EPR parameters reveal cytochrome P450 ligand binding modes.

PubMed

Lockart, Molly M; Rodriguez, Carlo A; Atkins, William M; Bowman, Michael K

2018-06-01

Cytochrome P450 (CYP) monoxygenses utilize heme cofactors to catalyze oxidation reactions. They play a critical role in metabolism of many classes of drugs, are an attractive target for drug development, and mediate several prominent drug interactions. Many substrates and inhibitors alter the spin state of the ferric heme by displacing the heme's axial water ligand in the resting enzyme to yield a five-coordinate iron complex, or they replace the axial water to yield a nitrogen-ligated six-coordinate iron complex, which are traditionally assigned by UV-vis spectroscopy. However, crystal structures and recent pulsed electron paramagnetic resonance (EPR) studies find a few cases where molecules hydrogen bond to the axial water. The water-bridged drug-H 2 O-heme has UV-vis spectra similar to nitrogen-ligated, six-coordinate complexes, but are closer to "reverse type I" complexes described in older liteature. Here, pulsed and continuous wave (CW) EPR demonstrate that water-bridged complexes are remarkably common among a range of nitrogenous drugs or drug fragments that bind to CYP3A4 or CYP2C9. Principal component analysis reveals a distinct clustering of CW EPR spectral parameters for water-bridged complexes. CW EPR reveals heterogeneous mixtures of ligated states, including multiple directly-coordinated complexes and water-bridged complexes. These results suggest that water-bridged complexes are under-represented in CYP structural databases and can have energies similar to other ligation modes. The data indicates that water-bridged binding modes can be identified and distinguished from directly-coordinated binding by CW EPR. Copyright © 2018 Elsevier Inc. All rights reserved.

Structures of the flax-rust effector AvrM reveal insights into the molecular basis of plant-cell entry and effector-triggered immunity.

PubMed

Ve, Thomas; Williams, Simon J; Catanzariti, Ann-Maree; Rafiqi, Maryam; Rahman, Motiur; Ellis, Jeffrey G; Hardham, Adrienne R; Jones, David A; Anderson, Peter A; Dodds, Peter N; Kobe, Bostjan

2013-10-22

Fungal and oomycete pathogens cause some of the most devastating diseases in crop plants, and facilitate infection by delivering a large number of effector molecules into the plant cell. AvrM is a secreted effector protein from flax rust (Melampsora lini) that can internalize into plant cells in the absence of the pathogen, binds to phosphoinositides (PIPs), and is recognized directly by the resistance protein M in flax (Linum usitatissimum), resulting in effector-triggered immunity. We determined the crystal structures of two naturally occurring variants of AvrM, AvrM-A and avrM, and both reveal an L-shaped fold consisting of a tandem duplicated four-helix motif, which displays similarity to the WY domain core in oomycete effectors. In the crystals, both AvrM variants form a dimer with an unusual nonglobular shape. Our functional analysis of AvrM reveals that a hydrophobic surface patch conserved between both variants is required for internalization into plant cells, whereas the C-terminal coiled-coil domain mediates interaction with M. AvrM binding to PIPs is dependent on positive surface charges, and mutations that abrogate PIP binding have no significant effect on internalization, suggesting that AvrM binding to PIPs is not essential for transport of AvrM across the plant membrane. The structure of AvrM and the identification of functionally important surface regions advance our understanding of the molecular mechanisms underlying how effectors enter plant cells and how they are detected by the plant immune system.

Crystal structure of mouse coronavirus receptor-binding domain complexed with its murine receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peng, Guiqing; Sun, Dawei; Rajashankar, Kanagalaghatta R.

2011-09-28

Coronaviruses have evolved diverse mechanisms to recognize different receptors for their cross-species transmission and host-range expansion. Mouse hepatitis coronavirus (MHV) uses the N-terminal domain (NTD) of its spike protein as its receptor-binding domain. Here we present the crystal structure of MHV NTD complexed with its receptor murine carcinoembryonic antigen-related cell adhesion molecule 1a (mCEACAM1a). Unexpectedly, MHV NTD contains a core structure that has the same {beta}-sandwich fold as human galectins (S-lectins) and additional structural motifs that bind to the N-terminal Ig-like domain of mCEACAM1a. Despite its galectin fold, MHV NTD does not bind sugars, but instead binds mCEACAM1a through exclusivemore » protein-protein interactions. Critical contacts at the interface have been confirmed by mutagenesis, providing a structural basis for viral and host specificities of coronavirus/CEACAM1 interactions. Sugar-binding assays reveal that galectin-like NTDs of some coronaviruses such as human coronavirus OC43 and bovine coronavirus bind sugars. Structural analysis and mutagenesis localize the sugar-binding site in coronavirus NTDs to be above the {beta}-sandwich core. We propose that coronavirus NTDs originated from a host galectin and retained sugar-binding functions in some contemporary coronaviruses, but evolved new structural features in MHV for mCEACAM1a binding.« less

Muscarinic and alpha 1-adrenergic receptor binding characteristics of saw palmetto extract in rat lower urinary tract.

PubMed

Suzuki, Mayumi; Oki, Tomomi; Sugiyama, Tomomi; Umegaki, Keizo; Uchida, Shinya; Yamada, Shizuo

2007-06-01

To elucidate the in vitro and ex vivo effects of saw palmetto extract (SPE) on autonomic receptors in the rat lower urinary tract. The in vitro binding affinities for alpha 1-adrenergic, muscarinic, and purinergic receptors in the rat prostate and bladder were measured by radioligand binding assays. Rats received vehicle or SPE (0.6 to 60 mg/kg/day) orally for 4 weeks, and alpha 1-adrenergic and muscarinic receptor binding in tissues of these rats were measured. Saw palmetto extract inhibited specific binding of [3H]prazosin and [N-methyl-3H]scopolamine methyl chloride (NMS) but not alpha, beta-methylene adenosine triphosphate [2,8-(3)H]tetrasodium salt in the rat prostate and bladder. The binding activity of SPE for muscarinic receptors was four times greater than that for alpha 1-adrenergic receptors. Scatchard analysis revealed that SPE significantly reduced the maximal number of binding sites (Bmax) for each radioligand in the prostate and bladder under in vitro condition. Repeated oral administration of SPE to rats brought about significant alteration in Bmax for prostatic [3H]prazosin binding and for bladder [3H]NMS binding. Such alteration by SPE was selective to the receptors in the lower urinary tract. Saw palmetto extract exerts significant binding activity on autonomic receptors in the lower urinary tract under in vitro and in vivo conditions.

Large-scale analysis of pedigree and sperm-typing data reveals PRDM9 allele-specific recombination maps in cattle

USDA-ARS?s Scientific Manuscript database

Meiotic recombination is a major driving force in promoting genetic and phenotypic variations in sexually reproducing organisms. Although PRDM9 is known to modulate the binding-specificity and location of recombination hotspots in humans and mice, its role, especially in domesticated animals like ca...

Two proximal activating protein-1-binding sites are sufficient to stimulate transcription of the ovine follicle-stimulating hormone-beta gene

EPA Science Inventory

FSH is an important regulator of mammalian gametogenesis and the female reproductive cycle. Although little is known about the transcriptional regulation of the beta-subunit (the rate-limiting subunit of FSH synthesis), sequence analysis of the ovine FSHbeta promoter has revealed...

The Shine-Dalgarno sequence of riboswitch-regulated single mRNAs shows ligand-dependent accessibility bursts

NASA Astrophysics Data System (ADS)

Rinaldi, Arlie J.; Lund, Paul E.; Blanco, Mario R.; Walter, Nils G.

2016-01-01

In response to intracellular signals in Gram-negative bacteria, translational riboswitches--commonly embedded in messenger RNAs (mRNAs)--regulate gene expression through inhibition of translation initiation. It is generally thought that this regulation originates from occlusion of the Shine-Dalgarno (SD) sequence upon ligand binding; however, little direct evidence exists. Here we develop Single Molecule Kinetic Analysis of RNA Transient Structure (SiM-KARTS) to investigate the ligand-dependent accessibility of the SD sequence of an mRNA hosting the 7-aminomethyl-7-deazaguanine (preQ1)-sensing riboswitch. Spike train analysis reveals that individual mRNA molecules alternate between two conformational states, distinguished by `bursts' of probe binding associated with increased SD sequence accessibility. Addition of preQ1 decreases the lifetime of the SD's high-accessibility (bursting) state and prolongs the time between bursts. In addition, ligand-jump experiments reveal imperfect riboswitching of single mRNA molecules. Such complex ligand sensing by individual mRNA molecules rationalizes the nuanced ligand response observed during bulk mRNA translation.

Quantitative Glycoproteomics Analysis Reveals Changes in N-Glycosylation Level Associated with Pancreatic Ductal Adenocarcinoma

PubMed Central

2015-01-01

Glycosylation plays an important role in epithelial cancers, including pancreatic ductal adenocarcinoma. However, little is known about the glycoproteome of the human pancreas or its alterations associated with pancreatic tumorigenesis. Using quantitative glycoproteomics approach, we investigated protein N-glycosylation in pancreatic tumor tissue in comparison with normal pancreas and chronic pancreatitis tissue. The study lead to the discovery of a roster of glycoproteins with aberrant N-glycosylation level associated with pancreatic cancer, including mucin-5AC (MUC5AC), carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5), insulin-like growth factor binding protein (IGFBP3), and galectin-3-binding protein (LGALS3BP). Pathway analysis of cancer-associated aberrant glycoproteins revealed an emerging phenomenon that increased activity of N-glycosylation was implicated in several pancreatic cancer pathways, including TGF-β, TNF, NF-kappa-B, and TFEB-related lysosomal changes. In addition, the study provided evidence that specific N-glycosylation sites within certain individual proteins can have significantly altered glycosylation occupancy in pancreatic cancer, reflecting the complexity of the molecular mechanisms underlying cancer-associated glycosylation events. PMID:24471499

Quantitative glycoproteomics analysis reveals changes in N-glycosylation level associated with pancreatic ductal adenocarcinoma.

PubMed

Pan, Sheng; Chen, Ru; Tamura, Yasuko; Crispin, David A; Lai, Lisa A; May, Damon H; McIntosh, Martin W; Goodlett, David R; Brentnall, Teresa A

2014-03-07

Glycosylation plays an important role in epithelial cancers, including pancreatic ductal adenocarcinoma. However, little is known about the glycoproteome of the human pancreas or its alterations associated with pancreatic tumorigenesis. Using quantitative glycoproteomics approach, we investigated protein N-glycosylation in pancreatic tumor tissue in comparison with normal pancreas and chronic pancreatitis tissue. The study lead to the discovery of a roster of glycoproteins with aberrant N-glycosylation level associated with pancreatic cancer, including mucin-5AC (MUC5AC), carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5), insulin-like growth factor binding protein (IGFBP3), and galectin-3-binding protein (LGALS3BP). Pathway analysis of cancer-associated aberrant glycoproteins revealed an emerging phenomenon that increased activity of N-glycosylation was implicated in several pancreatic cancer pathways, including TGF-β, TNF, NF-kappa-B, and TFEB-related lysosomal changes. In addition, the study provided evidence that specific N-glycosylation sites within certain individual proteins can have significantly altered glycosylation occupancy in pancreatic cancer, reflecting the complexity of the molecular mechanisms underlying cancer-associated glycosylation events.

Mechanism of human antibody-mediated neutralization of Marburg virus.

PubMed

Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E

2015-02-26

The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.

Structural and functional analysis of the YAP-binding domain of human TEAD2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tian, Wei; Yu, Jianzhong; Tomchick, Diana R.

2010-06-15

The Hippo pathway controls organ size and suppresses tumorigenesis in metazoans by blocking cell proliferation and promoting apoptosis. The TEAD1-4 proteins (which contain a DNA-binding domain but lack an activation domain) interact with YAP (which lacks a DNA-binding domain but contains an activation domain) to form functional heterodimeric transcription factors that activate proliferative and prosurvival gene expression programs. The Hippo pathway inhibits the YAP-TEAD hybrid transcription factors by phosphorylating and promoting cytoplasmic retention of YAP. Here we report the crystal structure of the YAP-binding domain (YBD) of human TEAD2. TEAD2 YBD adopts an immunoglobulin-like {beta}-sandwich fold with two extra helix-turn-helixmore » inserts. NMR studies reveal that the TEAD-binding domain of YAP is natively unfolded and that TEAD binding causes localized conformational changes in YAP. In vitro binding and in vivo functional assays define an extensive conserved surface of TEAD2 YBD as the YAP-binding site. Therefore, our studies suggest that a short segment of YAP adopts an extended conformation and forms extensive contacts with a rigid surface of TEAD. Targeting a surface-exposed pocket of TEAD might be an effective strategy to disrupt the YAP-TEAD interaction and to reduce the oncogenic potential of YAP.« less

Molecular fingerprinting of complex grass allergoids: size assessments reveal new insights in epitope repertoires and functional capacities.

PubMed

Starchenka, S; Bell, A J; Mwange, J; Skinner, M A; Heath, M D

2017-01-01

Subcutaneous allergen immunotherapy (SCIT) is a well-documented treatment for allergic disease which involves injections of native allergen or modified (allergoid) extracts. The use of allergoid vaccines is a growing sector of the allergy immunotherapy market, associated with shorter-course therapy. The aim of this study was the structural and immunological characterisation of group 1 (Lol p 1) IgG-binding epitopes within a complex mix grass allergoid formulation containing rye grass. HP-SEC was used to resolve a mix grass allergoid preparation of high molecular weight into several distinct fractions with defined molecular weight and elution profiles. Allergen verification of the HP-SEC allergoid fractions was confirmed by mass spectrometry analysis. IgE and IgG immunoreactivity of the allergoid preparations was explored and Lol p 1 specific IgG-binding epitopes mapped by SPOT synthesis technology (PepSpot™) with structural analysis based on a Lol p 1 homology model. Grass specific IgE reactivity of the mix grass modified extract (allergoid) was diminished in comparison with the mix grass native extract. A difference in IgG profiles was observed between an intact mix grass allergoid preparation and HP-SEC allergoid fractions, which indicated enhancement of accessible reactive IgG epitopes across size distribution profiles of the mix grass allergoid formulation. Detailed analysis of the epitope specificity showed retention of six Lol p 1 IgG-binding epitopes in the mix grass modified extract. The structural and immunological changes which take place following the grass allergen modification process was further unravelled revealing distinct IgG immunological profiles. All epitopes were mapped on the solvent exposed area of Lol p 1 homology model accessible for IgG binding. One of the epitopes was identified as an 'immunodominant' Lol p 1 IgG-binding epitope (62-IFKDGRGCGSCFEIK-76) and classified as a novel epitope. The results from this study support the concept that modification allows shorter-course therapy options as a result of providing an IgG epitope repertoire important for efficacy. Additionally, the work paves the way to help further develop methods for standardising allergoid platforms.

Molecular dynamics simulations revealed structural differences among WRKY domain-DNA interaction in barley (Hordeum vulgare).

PubMed

Pandey, Bharati; Grover, Abhinav; Sharma, Pradeep

2018-02-12

The WRKY transcription factors are a class of DNA-binding proteins involved in diverse plant processes play critical roles in response to abiotic and biotic stresses. Genome-wide divergence analysis of WRKY gene family in Hordeum vulgare provided a framework for molecular evolution and functional roles. So far, the crystal structure of WRKY from barley has not been resolved; moreover, knowledge of the three-dimensional structure of WRKY domain is pre-requisites for exploring the protein-DNA recognition mechanisms. Homology modelling based approach was used to generate structures for WRKY DNA binding domain (DBD) and its variants using AtWRKY1 as a template. Finally, the stability and conformational changes of the generated model in unbound and bound form was examined through atomistic molecular dynamics (MD) simulations for 100 ns time period. In this study, we investigated the comparative binding pattern of WRKY domain and its variants with W-box cis-regulatory element using molecular docking and dynamics (MD) simulations assays. The atomic insight into WRKY domain exhibited significant variation in the intermolecular hydrogen bonding pattern, leading to the structural anomalies in the variant type and differences in the DNA-binding specificities. Based on the MD analysis, residual contribution and interaction contour, wild-type WRKY (HvWRKY46) were found to interact with DNA through highly conserved heptapeptide in the pre- and post-MD simulated complexes, whereas heptapeptide interaction with DNA was missing in variants (I and II) in post-MD complexes. Consequently, through principal component analysis, wild-type WRKY was also found to be more stable by obscuring a reduced conformational space than the variant I (HvWRKY34). Lastly, high binding free energy for wild-type and variant II allowed us to conclude that wild-type WRKY-DNA complex was more stable relative to variants I. The results of our study revealed complete dynamic and structural information about WRKY domain-DNA interactions. However, no structure base information reported to date for WRKY variants and their mechanism of interaction with DNA. Our findings highlighted the importance of selecting a sequence to generate newer transgenic plants that would be increasingly tolerance to stress conditions.

Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer.

PubMed

Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

2010-05-01

The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq-RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq-RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 A, while the type 2 Hfq-RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 A. Diffraction data were collected to a resolution of 2.20 A from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis.

Characterization of monomeric DNA-binding protein Histone H1 in Leishmania braziliensis.

PubMed

Carmelo, Emma; González, Gloria; Cruz, Teresa; Osuna, Antonio; Hernández, Mariano; Valladares, Basilio

2011-08-01

Histone H1 in Leishmania presents relevant differences compared to higher eukaryote counterparts, such as the lack of a DNA-binding central globular domain. Despite that, it is apparently fully functional since its differential expression levels have been related to changes in chromatin condensation and infectivity, among other features. The localization and the aggregation state of L. braziliensis H1 has been determined by immunolocalization, mass spectrometry, cross-linking and electrophoretic mobility shift assays. Analysis of H1 sequences from the Leishmania Genome Database revealed that our protein is included in a very divergent group of histones H1 that is present only in L. braziliensis. An antibody raised against recombinant L. braziliensis H1 recognized specifically that protein by immunoblot in L. braziliensis extracts, but not in other Leishmania species, a consequence of the sequence divergences observed among Leishmania species. Mass spectrometry analysis and in vitro DNA-binding experiments have also proven that L. braziliensis H1 is monomeric in solution, but oligomerizes upon binding to DNA. Finally, despite the lack of a globular domain, L. braziliensis H1 is able to form complexes with DNA in vitro, with higher affinity for supercoiled compared to linear DNA.

Effect of protonation of the N-acetyl neuraminic acid residue of sialyl Lewis(X): a molecular orbital study with insights into its binding properties toward the carbohydrate recognition domain of E-selectin.

PubMed

Pichierri, Fabio; Matsuo, Yo

2002-08-01

Semiempirical molecular orbital (MO) calculations with an implicit treatment of the water environment were employed in order to assess whether the sialyl Lewis(X) (sLe(X)) tetrasaccharide binds to E-selectin in the anionic or neutral (i.e., protonated) state. The analysis of the frontier molecular orbitals, electrostatic potential surfaces, and conformational behavior of the sugar indicates that its neutral form possesses the necessary characteristics for binding. In particular, the LUMO level of the neutral sLe(X) molecule is localized both on the carboxylic group of the N-acetyl neuraminic acid (NeuNAc) residue and on the nearby glycosidic linkage. These two moieties interact with the Arg97 residue of E-selectin, as revealed by a recent crystal structure analysis of the E-selectin/sLe(X) complex. The energetics of this specific interaction was investigated with the aid of ab initio Hartree-Fock MO calculations, which resulted in a BSSE-corrected binding energy of 16.63 kcal/mol. Our observations could open up new perspectives in the design of sLe(X) mimics.

H-binding of size- and polarity-fractionated soil and lignite humic acids after removal of metal and ash components.

PubMed

Drosos, Marios; Leenheer, Jerry A; Avgeropoulos, Apostolos; Deligiannakis, Yiannis

2014-03-01

A fractionation technique, combining dialysis removal of metal and ash components with hydrofluoric acid and pH 10 citrate buffer followed by chromatography of dialysis permeate on XAD-8 resin at decreasing pH values, has been applied to lignite humic acid (lignite-HA) and soil humic acid (soil-HA). H-binding data and non ideal competitive adsorption-Donnan model parameters were obtained for the HA fractions by theoretical analysis of H-binding data which reveal a significant increase of the carboxyl and the phenolic charge for the lignite-HA fractions vs. the parental lignite humic acid (LParentalHA). The fractionated lignite-HA material consisted mainly of permeate fractions, some of which were fulvic acid-like. The fractionated soil-HA material consisted mainly of large macromolecular structures that did not permeate the dialysis membrane during deashing. Chargeable groups had comparable concentrations in soil-HA fractions and parental soil humic acid (SParentalHA), indicating minimal interference of ash components with carboxyl and phenolic (and/or enolic) groups. Fractionation of HA, combined with theoretical analysis of H-binding, can distinguish the supramolecular vs. macromolecular nature of fractions within the same parental HA.

H-binding of size- and polarity-fractionated soil and lignite humic acids after removal of metal and ash components

USGS Publications Warehouse

Drosos, Marios; Leenheer, Jerry A.; Avgeropoulos, Apostolos; Deligiannakis, Yiannis

2014-01-01

A fractionation technique, combining dialysis removal of metal and ash components with hydrofluoric acid and pH 10 citrate buffer followed by chromatography of dialysis permeate on XAD-8 resin at decreasing pH values, has been applied to lignite humic acid (lignite-HA) and soil humic acid (soil-HA). H-binding data and non ideal competitive adsorption-Donnan model parameters were obtained for the HA fractions by theoretical analysis of H-binding data which reveal a significant increase of the carboxyl and the phenolic charge for the lignite-HA fractions vs. the parental lignite humic acid (LParentalHA). The fractionated lignite-HA material consisted mainly of permeate fractions, some of which were fulvic acid-like. The fractionated soil-HA material consisted mainly of large macromolecular structures that did not permeate the dialysis membrane during deashing. Chargeable groups had comparable concentrations in soil-HA fractions and parental soil humic acid (SParentalHA), indicating minimal interference of ash components with carboxyl and phenolic (and/or enolic) groups. Fractionation of HA, combined with theoretical analysis of H-binding, can distinguish the supramolecular vs. macromolecular nature of fractions within the same parental HA.

Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

PubMed Central

Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

2011-01-01

Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

Structural and Functional Studies of gpX of Escherichia coli Phage P2 Reveal a Widespread Role for LysM Domains in the Baseplates of Contractile-Tailed Phages

PubMed Central

Fatehi Hassanabad, Mostafa; Chang, Tom; Pirani, Nawaz; Bona, Diane; Edwards, Aled M.

2013-01-01

A variety of bacterial pathogenicity determinants, including the type VI secretion system and the virulence cassettes from Photorhabdus and Serratia, share an evolutionary origin with contractile-tailed myophages. The well-characterized Escherichia coli phage P2 provides an excellent system for studies related to these systems, as its protein composition appears to represent the “minimal” myophage tail. In this study, we used nuclear magnetic resonance (NMR) spectroscopy to determine the solution structure of gpX, a 68-residue tail baseplate protein. Although the sequence and structure of gpX are similar to those of LysM domains, which are a large family associated with peptidoglycan binding, we did not detect a peptidoglycan-binding activity for gpX. However, bioinformatic analysis revealed that half of all myophages, including all that possess phage T4-like baseplates, encode a tail protein with a LysM-like domain, emphasizing a widespread role for this domain in baseplate function. While phage P2 gpX comprises only a single LysM domain, many myophages display LysM domain fusions with other tail proteins, such as the DNA circulation protein found in Mu-like phages and gp53 of T4-like phages. Electron microscopy of P2 phage particles with an incorporated gpX-maltose binding protein fusion revealed that gpX is located at the top of the baseplate, near the junction of the baseplate and tail tube. gpW, the orthologue of phage T4 gp25, was also found to localize to this region. A general colocalization of LysM-like domains and gpW homologues in diverse phages is supported by our bioinformatic analysis. PMID:24097944

Efficient Characterization of Protein Cavities within Molecular Simulation Trajectories: trj_cavity.

PubMed

Paramo, Teresa; East, Alexandra; Garzón, Diana; Ulmschneider, Martin B; Bond, Peter J

2014-05-13

Protein cavities and tunnels are critical in determining phenomena such as ligand binding, molecular transport, and enzyme catalysis. Molecular dynamics (MD) simulations enable the exploration of the flexibility and conformational plasticity of protein cavities, extending the information available from static experimental structures relevant to, for example, drug design. Here, we present a new tool (trj_cavity) implemented within the GROMACS ( www.gromacs.org ) framework for the rapid identification and characterization of cavities detected within MD trajectories. trj_cavity is optimized for usability and computational efficiency and is applicable to the time-dependent analysis of any cavity topology, and optional specialized descriptors can be used to characterize, for example, protein channels. Its novel grid-based algorithm performs an efficient neighbor search whose calculation time is linear with system size, and a comparison of performance with other widely used cavity analysis programs reveals an orders-of-magnitude improvement in the computational cost. To demonstrate its potential for revealing novel mechanistic insights, trj_cavity has been used to analyze long-time scale simulation trajectories for three diverse protein cavity systems. This has helped to reveal, respectively, the lipid binding mechanism in the deep hydrophobic cavity of a soluble mite-allergen protein, Der p 2; a means for shuttling carbohydrates between the surface-exposed substrate-binding and catalytic pockets of a multidomain, membrane-proximal pullulanase, PulA; and the structural basis for selectivity in the transmembrane pore of a voltage-gated sodium channel (NavMs), embedded within a lipid bilayer environment. trj_cavity is available for download under an open-source license ( http://sourceforge.net/projects/trjcavity ). A simplified, GROMACS-independent version may also be compiled.

Bovine papillomavirus type 2 (BPV-2) E5 oncoprotein binds to the subunit D of the V₁-ATPase proton pump in naturally occurring urothelial tumors of the urinary bladder of cattle.

PubMed

Roperto, Sante; Russo, Valeria; Borzacchiello, Giuseppe; Urraro, Chiara; Lucà, Roberta; Esposito, Iolanda; Riccardi, Marita Georgia; Raso, Cinzia; Gaspari, Marco; Ceccarelli, Dora Maria; Galasso, Rocco; Roperto, Franco

2014-01-01

Active infection by bovine papillomavirus type 2 (BPV-2) was documented for fifteen urinary bladder tumors in cattle. Two were diagnosed as papillary urothelial neoplasm of low malignant potential (PUNLMP), nine as papillary and four as invasive urothelial cancers. In all cancer samples, PCR analysis revealed a BPV-2-specific 503 bp DNA fragment. E5 protein, the major oncoprotein of the virus, was shown both by immunoprecipitation and immunohistochemical analysis. E5 was found to bind to the activated (phosphorylated) form of the platelet derived growth factor β receptor. PDGFβR immunoprecipitation from bladder tumor samples and from normal bladder tissue used as control revealed a protein band which was present in the pull-down from bladder cancer samples only. The protein was identified with mass spectrometry as "V₁-ATPase subunit D", a component of the central stalk of the V₁-ATPase vacuolar pump. The subunit D was confirmed in this complex by coimmunoprecipitation investigations and it was found to colocalize with the receptor. The subunit D was also shown to be overexpressed by Western blot, RT-PCR and immunofluorescence analyses. Immunoprecipitation and immunofluorescence also revealed that E5 oncoprotein was bound to the subunit D. For the first time, a tri-component complex composed of E5/PDGFβR/subunit D has been documented in vivo. Previous in vitro studies have shown that the BPV-2 E5 oncoprotein binds to the proteolipid c ring of the V₀-ATPase sector. We suggest that the E5/PDGFβR/subunit D complex may perturb proteostasis, organelle and cytosol homeostasis, which can result in altered protein degradation and in autophagic responses.

Structural Characterisation Reveals Mechanism of IL-13-Neutralising Monoclonal Antibody Tralokinumab as Inhibition of Binding to IL-13Rα1 and IL-13Rα2.

PubMed

Popovic, B; Breed, J; Rees, D G; Gardener, M J; Vinall, L M K; Kemp, B; Spooner, J; Keen, J; Minter, R; Uddin, F; Colice, G; Wilkinson, T; Vaughan, T; May, R D

2017-01-20

Interleukin (IL)-13 is a pleiotropic T helper type 2 cytokine frequently associated with asthma and atopic dermatitis. IL-13-mediated signalling is initiated by binding to IL-13Rα1, which then recruits IL-4Rα to form a heterodimeric receptor complex. IL-13 also binds to IL-13Rα2, considered as either a decoy or a key mediator of fibrosis. IL-13-neutralising antibodies act by preventing IL-13 binding to IL-13Rα1, IL-4Rα and/or IL-13Rα2. Tralokinumab (CAT-354) is an IL-13-neutralising human IgG4 monoclonal antibody that has shown clinical benefit in patients with asthma. To decipher how tralokinumab inhibits the effects of IL-13, we determined the structure of tralokinumab Fab in complex with human IL-13 to 2 Å resolution. The structure analysis reveals that tralokinumab prevents IL-13 from binding to both IL-13Rα1 and IL-13Rα2. This is supported by biochemical ligand-receptor interaction assay data. The tralokinumab epitope is mainly composed of residues in helices D and A of IL-13. It is mostly light chain complementarity-determining regions that are driving paratope interactions; the variable light complementarity-determining region 2 plays a key role by providing residue contacts for a network of hydrogen bonds and a salt bridge in the core of binding. The key residues within the paratope contributing to binding were identified as Asp50, Asp51, Ser30 and Lys31. This study demonstrates that tralokinumab prevents the IL-13 pharmacodynamic effect by binding to IL-13 helices A and D, thus preventing IL-13 from interacting with IL-13Rα1 and IL-13Rα2. Copyright © 2016 AstraZeneca. Published by Elsevier Ltd.. All rights reserved.

Mouse strain differences in immobility and sensitivity to fluvoxamine and desipramine in the forced swimming test: analysis of serotonin and noradrenaline transporter binding.

PubMed

Sugimoto, Yumi; Kajiwara, Yoshinobu; Hirano, Kazufumi; Yamada, Shizuo; Tagawa, Noriko; Kobayashi, Yoshiharu; Hotta, Yoshihiro; Yamada, Jun

2008-09-11

Strain differences in immobility time in the forced swimming test were investigated in five strains of mice, namely, ICR, ddY, C57BL/6, DBA/2 and BALB/c mice. There were significant strain differences. The immobility times of ICR, ddY and C57BL/6 mice were longer than those of DBA/2 and BALB/c mice. Immobility times were not significantly related to locomotor activity in these strains. There were also differences in sensitivity to the selective serotonin reuptake inhibitor (SSRI) fluvoxamine. In ICR, ddY and C57BL/6 mice, fluvoxamine did not affect immobility time, while it reduced the immobility time of DBA/2 and BALB/c mice dose-dependently. The noradrenaline reuptake inhibitor desipramine decreased immobility time in all strains of mice. Serotonin (5-HT) transporter binding in the brains of all five strains of mice was also investigated. Analysis of 5-HT transporter binding revealed significant strain differences, being lower in DBA/2 and BALB/c mice than in other strains of mice. The amount of 5-HT transporter binding was correlated to baseline immobility time. However, there was no significant relation between noradrenaline transporter binding and immobility time. These results suggest that the duration of baseline immobility depends on the levels of 5-HT transporter binding, leading to apparent strain differences in immobility time in the forced swimming test. Furthermore, differences in 5-HT transporter binding may cause variations in responses to fluvoxamine.

The gene for stinging nettle lectin (Urtica dioica agglutinin) encodes both a lectin and a chitinase.

PubMed

Lerner, D R; Raikhel, N V

1992-06-05

Chitin-binding proteins are present in a wide range of plant species, including both monocots and dicots, even though these plants contain no chitin. To investigate the relationship between in vitro antifungal and insecticidal activities of chitin-binding proteins and their unknown endogenous functions, the stinging nettle lectin (Urtica dioica agglutinin, UDA) cDNA was cloned using a synthetic gene as the probe. The nettle lectin cDNA clone contained an open reading frame encoding 374 amino acids. Analysis of the deduced amino acid sequence revealed a 21-amino acid putative signal sequence and the 86 amino acids encoding the two chitin-binding domains of nettle lectin. These domains were fused to a 19-amino acid "spacer" domain and a 244-amino acid carboxyl extension with partial identity to a chitinase catalytic domain. The authenticity of the cDNA clone was confirmed by deduced amino acid sequence identity with sequence data obtained from tryptic digests, RNA gel blot, and polymerase chain reaction analyses. RNA gel blot analysis also showed the nettle lectin message was present primarily in rhizomes and inflorescence (with immature seeds) but not in leaves or stems. Chitinase enzymatic activity was found when the chitinase-like domain alone or the chitinase-like domain with the chitin-binding domains were expressed in Escherichia coli. This is the first example of a chitin-binding protein with both a duplication of the 43-amino acid chitin-binding domain and a fusion of the chitin-binding domains to a structurally unrelated domain, the chitinase domain.

Predicting cancer-relevant proteins using an improved molecular similarity ensemble approach.

PubMed

Zhou, Bin; Sun, Qi; Kong, De-Xin

2016-05-31

In this study, we proposed an improved algorithm for identifying proteins relevant to cancer. The algorithm was named two-layer molecular similarity ensemble approach (TL-SEA). We applied TL-SEA to analyzing the correlation between anticancer compounds (against cell lines K562, MCF7 and A549) and active compounds against separate target proteins listed in BindingDB. Several associations between cancer types and related proteins were revealed using this chemoinformatics approach. An analysis of the literature showed that 26 of 35 predicted proteins were correlated with cancer cell proliferation, apoptosis or differentiation. Additionally, interactions between proteins in BindingDB and anticancer chemicals were also predicted. We discuss the roles of the most important predicted proteins in cancer biology and conclude that TL-SEA could be a useful tool for inferring novel proteins involved in cancer and revealing underlying molecular mechanisms.

Quantitative Proteomic Analysis Reveals That Anti-Cancer Effects of Selenium-Binding Protein 1 In Vivo Are Associated with Metabolic Pathways

PubMed Central

Ying, Qi; Ansong, Emmanuel; Diamond, Alan M.; Lu, Zhaoxin; Yang, Wancai; Bie, Xiaomei

2015-01-01

Previous studies have shown the tumor-suppressive role of selenium-binding protein 1 (SBP1), but the underlying mechanisms are unclear. In this study, we found that induction of SBP1 showed significant inhibition of colorectal cancer cell growth and metastasis in mice. We further employed isobaric tags for relative and absolute quantitation (iTRAQ) to identify proteins that were involved in SBP1-mediated anti-cancer effects in tumor tissues. We identified 132 differentially expressed proteins, among them, 53 proteins were upregulated and 79 proteins were downregulated. Importantly, many of the differentially altered proteins were associated with lipid/glucose metabolism, which were also linked to Glycolysis, MAPK, Wnt, NF-kB, NOTCH and epithelial-mesenchymal transition (EMT) signaling pathways. These results have revealed a novel mechanism that SBP1-mediated cancer inhibition is through altering lipid/glucose metabolic signaling pathways. PMID:25974208

A combined spectroscopic, molecular docking and molecular dynamic simulation study on the interaction of quercetin with β-casein nanoparticles.

PubMed

Mehranfar, Fahimeh; Bordbar, Abdol-Khalegh; Parastar, Hadi

2013-10-05

The interaction of quercetin with β-casein nanoparticle micelle was studied at various temperatures in order to do a complete thermodynamic and molecular analysis on the binding process. The results of fluorescence studies showed the possibility of fluorescence energy transfer between excited tryptophan and quercetin. The determined values of critical transfers distance and the mean distance of ligand from Trp-143 residues in β-casein micelle represents a non-radiative energy transfer mechanism for quenching and the existence of a significant interaction between this flavonoid and β-casein nanoparticle. The equilibrium binding of quercetin with β-casein micelle at different temperatures was studied by using UV-Vis absorption spectroscopy. The chemometric analysis (principal component analysis (PCA) and multivariate curve resolution-alternating least squares (MCR-ALS) methods) on spectrophotometric data revealed the existence of two components in solution (quercetin and β-casein-quercetin complex) and resolved their pure concentration and spectral profiles. This information let us to calculate the equilibrium binding constant at various temperatures and the relevant thermodynamic parameters of interaction (enthalpy, entropy and Gibbs free energy) with low uncertainty. The negative values of entropy and enthalpy changes represent the predominate role of hydrogen binding and van der Waals interactions in the binding process. Docking calculations showed the probable binding site of quercetin is located in the hydrophobic core of β-casein where the quercetin molecule is lined by hydrophobic residues and make five hydrogen bonds and several van der Waals contacts with them. Moreover, molecular dynamic (MD) simulation results suggested that this flavonoid can interact with β-casein, without affecting the secondary structure of β-casein. Simulations, molecular docking and experimental data reciprocally supported each other. Copyright © 2013 Elsevier B.V. All rights reserved.

The Galectin CvGal1 from the Eastern Oyster (Crassostrea virginica) Binds to Blood Group A Oligosaccharides on the Hemocyte Surface*

PubMed Central

Feng, Chiguang; Ghosh, Anita; Amin, Mohammed N.; Giomarelli, Barbara; Shridhar, Surekha; Banerjee, Aditi; Fernández-Robledo, José A.; Bianchet, Mario A.; Wang, Lai-Xi; Wilson, Iain B. H.; Vasta, Gerardo R.

2013-01-01

The galectin CvGal1 from the eastern oyster (Crassostrea virginica), which possesses four tandemly arrayed carbohydrate recognition domains, was previously shown to display stronger binding to galactosamine and N-acetylgalactosamine relative to d-galactose. CvGal1 expressed by phagocytic cells is “hijacked” by the parasite Perkinsus marinus to enter the host, where it proliferates and causes systemic infection and death. In this study, a detailed glycan array analysis revealed that CvGal1 preferentially recognizes type 2 blood group A oligosaccharides. Homology modeling of the protein and its oligosaccharide ligands supported this preference over type 1 blood group A and B oligosaccharides. The CvGal ligand models were further validated by binding, inhibition, and competitive binding studies of CvGal1 and ABH-specific monoclonal antibodies with intact and deglycosylated glycoproteins, hemocyte extracts, and intact hemocytes and by surface plasmon resonance analysis. A parallel glycomic study carried out on oyster hemocytes (Kurz, S., Jin, C., Hykollari, A., Gregorich, D., Giomarelli, B., Vasta, G. R., Wilson, I. B. H., and Paschinger, K. (2013) J. Biol. Chem. 288,) determined the structures of oligosaccharides recognized by CvGal1. Proteomic analysis of the hemocyte glycoproteins identified β-integrin and dominin as CvGal1 “self”-ligands. Despite strong CvGal1 binding to P. marinus trophozoites, no binding of ABH blood group antibodies was observed. Thus, parasite glycans structurally distinct from the blood group A oligosaccharides on the hemocyte surface may function as potentially effective ligands for CvGal1. We hypothesize that carbohydrate-based mimicry resulting from the host/parasite co-evolution facilitates CvGal1-mediated cross-linking to β-integrin, located on the hemocyte surface, leading to cell activation, phagocytosis, and host infection. PMID:23824193

Comparative analysis of allyl isothiocyanate (AITC)-induced carbohydrate oxidation changes via TRPV1 between mice and chickens.

PubMed

Kawabata, Fuminori; Kawabata, Yuko; Liang, Ruojun; Nishimura, Shotaro; Tabata, Shoji

2017-01-01

Postprandial hyperglycemia is a risk factor for cardiovascular diseases. It has been reported that intragastric administration of allyl isothiocyanate (AITC), which is one of the pungent ingredients of wasabi and horseradish but it is not included in hot chili pepper, increased carbohydrate oxidation and reduced postprandial increase of blood glucose via transient receptor potential vanilloid 1 (TRPV1)in mice. However, the action site of AITC on TRPV1 for increasing carbohydrate oxidation is unclear. Both mammalian and chicken TRPV1 (cTRPV1) are activated by heat and acid, but unlike its mammalian counterpart, cTRPV1 is only faintly activated by capsaicin. This difference is due to the 8 chicken-specific amino acid residues around transmembrane 3, which is the main site of capsaicin-binding in rat TRPV1. Moreover, AITC-induced activation of mouse TRPV1 (mTRPV1) is largely dependent on S513, a residue that is involved in capsaicin-binding. Thus, we hypothesized that the increase of carbohydrate oxidation by AITC in mammals is induced by the binding of AITC to the capsaicin-binding site of TRPV1. In this study, we performed a comparative study using chickens and mice, since chickens are thought to partly lack the capsaicin-binding site of TRPV1. We examined the effects of AITC on the respiratory quotient (RQ), the index of carbohydrate oxidation and fat oxidation, in chickens and mice. Respiratory gas analysis revealed that AITC does not increase the RQ in chickens, and Ca 2+ imaging methods and a whole cell-patch clamp analysis showed that AITC does not activate cTRPV1. These results implied that the capsaicin-binding site is an important region for increasing carbohydrate oxidation by AITC administration in animals.

Development of a Novel Tetravalent Synthetic Peptide That Binds to Phosphatidic Acid.

PubMed

Ogawa, Rina; Nagao, Kohjiro; Taniuchi, Kentaro; Tsuchiya, Masaki; Kato, Utako; Hara, Yuji; Inaba, Takehiko; Kobayashi, Toshihide; Sasaki, Yoshihiro; Akiyoshi, Kazunari; Watanabe-Takahashi, Miho; Nishikawa, Kiyotaka; Umeda, Masato

2015-01-01

We employed a multivalent peptide-library screening technique to identify a peptide motif that binds to phosphatidic acid (PA), but not to other phospholipids such as phosphatidylcholine (PC), phosphatidylethanolamine (PE), and phosphatidylserine (PS). A tetravalent peptide with the sequence motif of MARWHRHHH, designated as PAB-TP (phosphatidic acid-binding tetravalent peptide), was shown to bind as low as 1 mol% of PA in the bilayer membrane composed of PC and cholesterol. Kinetic analysis of the interaction between PAB-TP and the membranes containing 10 mol% of PA showed that PAB-TP associated with PA with a low dissociation constant of KD = 38 ± 5 nM. Coexistence of cholesterol or PE with PA in the membrane enhanced the PAB-TP binding to PA by increasing the ionization of the phosphomonoester head group as well as by changing the microenvironment of PA molecules in the membrane. Amino acid replacement analysis demonstrated that the tryptophan residue at position 4 of PAB-TP was involved in the interaction with PA. Furthermore, a series of amino acid substitutions at positions 5 to 9 of PAB-TP revealed the involvement of consecutive histidine and arginine residues in recognition of the phosphomonoester head group of PA. Our results demonstrate that the recognition of PA by PAB-TP is achieved by a combination of hydrophobic, electrostatic and hydrogen-bond interactions, and that the tetravalent structure of PAB-TP contributes to the high affinity binding to PA in the membrane. The novel PA-binding tetravalent peptide PAB-TP will provide insight into the molecular mechanism underlying the recognition of PA by PA-binding proteins that are involved in various cellular events.

The kangaroo cation-independent mannose 6-phosphate receptor binds insulin-like growth factor II with low affinity.

PubMed

Yandell, C A; Dunbar, A J; Wheldrake, J F; Upton, Z

1999-09-17

The mammalian cation-independent mannose 6-phosphate receptor (CI-MPR) binds mannose 6-phosphate-bearing glycoproteins and insulin-like growth factor (IGF)-II. However, the CI-MPR from the opossum has been reported to bind bovine IGF-II with low affinity (Dahms, N. M., Brzycki-Wessell, M. A., Ramanujam, K. S., and Seetharam, B. (1993) Endocrinology 133, 440-446). This may reflect the use of a heterologous ligand, or it may represent the intrinsic binding affinity of this receptor. To examine the binding of IGF-II to a marsupial CI-MPR in a homologous system, we have previously purified kangaroo IGF-II (Yandell, C. A., Francis, G. L., Wheldrake, J. F., and Upton, Z. (1998) J. Endocrinol. 156, 195-204), and we now report the purification and characterization of the CI-MPR from kangaroo liver. The interaction of the kangaroo CI-MPR with IGF-II has been examined by ligand blotting, radioreceptor assay, and real-time biomolecular interaction analysis. Using both a heterologous and homologous approach, we have demonstrated that the kangaroo CI-MPR has a lower binding affinity for IGF-II than its eutherian (placental mammal) counterparts. Furthermore, real-time biomolecular interaction analysis revealed that the kangaroo CI-MPR has a higher affinity for kangaroo IGF-II than for human IGF-II. The cDNA sequence of the kangaroo CI-MPR indicates that there is considerable divergence in the area corresponding to the IGF-II binding site of the eutherian receptor. Thus, the acquisition of a high-affinity binding site for regulating IGF-II appears to be a recent event specific to the eutherian lineage.

In Silico Characterization and Analysis of RTBP1 and NgTRF1 Protein Through MD Simulation and Molecular Docking: A Comparative Study.

PubMed

Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran

2015-09-01

Gaining access to sequence and structure information of telomere-binding proteins helps in understanding the essential biological processes involve in conserved sequence-specific interaction between DNA and the proteins. Rice telomere-binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix-turn-helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain, but till now there is very less communication on the in silico studies of these complete proteins. Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK Web server. By digging up all the facts about the proteins, it was revealed that around 120 amino acids in the tail part were showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicate the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA-binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.

Molecular principles behind Boceprevir resistance due to mutations in hepatitis C NS3/4A protease.

PubMed

Nagpal, Neha; Goyal, Sukriti; Wahi, Divya; Jain, Ritu; Jamal, Salma; Singh, Aditi; Rana, Preeti; Grover, Abhinav

2015-10-01

The hepatitis C virus (HCV) infection is a primary cause of chronic hepatitis which eventually progresses to cirrhosis and in some instances might advance to hepatocellular carcinoma. According to the WHO report, HCV infects 130-150 million people globally and every year 350,000 to 500,000 people die from hepatitis C virus infection. Great achievement has been made in viral treatment evolution, after the development of HCV NS3/4A protease inhibitor (Boceprevir). However, efficacy of Boceprevir is compromised by the emergence of drug resistant variants. The molecular principle behind drug resistance of the protease mutants such as (V36M, T54S and R155K) is still poorly understood. Therefore in this study, we employed a series of computational strategies to analyze the binding of antiviral drug, Boceprevir to HCV NS3/4A protease mutants. Our results clearly demonstrate that the point mutations (V36M, T54S and R155K) in protease are associated with lowering of its binding affinity with Boceprevir. Exhaustive analysis of the simulated Boceprevir-bound wild and mutant complexes revealed variations in hydrophobic interactions, hydrogen bond occupancy and salt bridge interactions. Also, substrate envelope analysis scrutinized that the studied mutations reside outside the substrate envelope which may affect the Boceprevir affinity towards HCV protease but not the protease enzymatic activity. Furthermore, structural analyses of the binding site volume and flexibility show impairment in flexibility and stability of the binding site residues in mutant structures. In order to combat Boceprevir resistance, renovation of binding interactions between the drug and protease may be valuable. The structural insight from this study reveals the mechanism of the Boceprevir resistance and the results can be valuable for the design of new PIs with improved efficiency. Copyright © 2015 Elsevier B.V. All rights reserved.

Organization, chromosomal localization and promoter analysis of the gene encoding human acidic fibroblast growth factor intracellular binding protein.

PubMed Central

Kolpakova, E; Frengen, E; Stokke, T; Olsnes, S

2000-01-01

Acidic fibroblast growth factor (aFGF) intracellular binding protein (FIBP) is a protein found mainly in the nucleus that might be involved in the intracellular function of aFGF. Here we present a comparative analysis of the deduced amino acid sequences of human, murine and Drosophila FIBP analogues and demonstrate that FIBP is an evolutionarily conserved protein. The human gene spans more than 5 kb, comprising ten exons and nine introns, and maps to chromosome 11q13.1. Two slightly different splice variants found in different tissues were isolated and characterized. Sequence analysis of the region surrounding the translation start revealed a CpG island, a classical feature of widely expressed genes. Functional studies of the promoter region with a luciferase reporter system suggested a strong transcriptional activity residing within 600 bp of the 5' flanking region. PMID:11104667

Mutated form (G52E) of inactive diphtheria toxin CRM197: molecular simulations clearly display effect of the mutation to NAD binding.

PubMed

Salmas, Ramin Ekhteiari; Mestanoglu, Mert; Unlu, Ayhan; Yurtsever, Mine; Durdagi, Serdar

2016-11-01

Mutated form (G52E) of diphtheria toxin (DT) CRM197 is an inactive and nontoxic enzyme. Here, we provided a molecular insight using comparative molecular dynamics (MD) simulations to clarify the influence of a single point mutation on overall protein and active-site loop. Post-processing MD analysis (i.e. stability, principal component analysis, hydrogen-bond occupancy, etc.) is carried out on both wild and mutated targets to investigate and to better understand the mechanistic differences of structural and dynamical properties on an atomic scale especially at nicotinamide adenine dinucleotide (NAD) binding site when a single mutation (G52E) happens at the DT. In addition, a docking simulation is performed for wild and mutated forms. The docking scoring analysis and docking poses results revealed that mutant form is not able to properly accommodate the NAD molecule.

Comprehensive analysis of all triple helical repeats in beta-spectrins reveals patterns of selective evolutionary conservation.

PubMed

Baines, Anthony J

2003-01-01

The spectrin superfamily (spectrin, alpha-actinin, utrophin and dystrophin) has in common a triple helical repeating unit of ~106 amino acid residues. In spectrin, alpha and beta chains contain multiple copies of this repeat. beta-spectrin chains contain the majority of binding activities in spectrin and are essential for animal life. Canonical beta-spectrins have 17 repeats; beta-heavy spectrins have 30. Here, the repeats of five human beta-spectrins, plus beta-spectrins from several other vertebrates and invertebrates, have been analysed. Repeats 1, 2, 14 and 17 in canonical beta are highly conserved between invertebrates and vertebrates, and repeat 8 in some isoforms. This is consistent with conservation of critical functions, since repeats 1, 2 and 17 bind alpha-spectrin. Repeats 1 of beta-spectrins are not always detected by SMART or Pfam tools. A profile hidden Markov model of beta-spectrin repeat 1 detects alpha-actinins, but not utrophin or dystrophin. Novel examples of repeat 1 were detected in the spectraplakins MACF1, BPAG1 and plectin close to the actin-binding domain. Ankyrin binds to the C-terminal portion of repeat 14; the high conservation of this entire repeat may point to additional, undiscovered ligand-binding activities. This analysis indicates that the basic triple helical repeat pattern was adapted early in the evolution of the spectrin superfamily to encompass essential binding activities, which characterise individual repeats in proteins extant today.

Binding of fluorescent acridine dyes acridine orange and 9-aminoacridine to hemoglobin: Elucidation of their molecular recognition by spectroscopy, calorimetry and molecular modeling techniques.

PubMed

Chatterjee, Sabyasachi; Kumar, Gopinatha Suresh

2016-06-01

The molecular interaction between hemoglobin (HHb), the major human heme protein, and the acridine dyes acridine orange (AO) and 9-aminoacridine (9AA) was studied by various spectroscopic, calorimetric and molecular modeling techniques. The dyes formed stable ground state complex with HHb as revealed from spectroscopic data. Temperature dependent fluorescence data showed the strength of the dye-protein complexation to be inversely proportional to temperature and the fluorescence quenching was static in nature. The binding-induced conformational change in the protein was investigated using circular dichroism, synchronous fluorescence, 3D fluorescence and FTIR spectroscopy results. Circular dichroism data also quantified the α-helicity change in hemoglobin due to the binding of acridine dyes. Calorimetric studies revealed the binding to be endothermic in nature for both AO and 9AA, though the latter had higher affinity, and this was also observed from spectroscopic data. The binding of both dyes was entropy driven. pH dependent fluorescence studies revealed the existence of electrostatic interaction between the protein and dye molecules. Molecular modeling studies specified the binding site and the non-covalent interactions involved in the association. Overall, the results revealed that a small change in the acridine chromophore leads to remarkable alteration in the structural and thermodynamic aspects of binding to HHb. Copyright © 2016 Elsevier B.V. All rights reserved.

Mo-CBP3, an Antifungal Chitin-Binding Protein from Moringa oleifera Seeds, Is a Member of the 2S Albumin Family

PubMed Central

Freire, José E. C.; Vasconcelos, Ilka M.; Moreno, Frederico B. M. B.; Batista, Adelina B.; Lobo, Marina D. P.; Pereira, Mirella L.; Lima, João P. M. S.; Almeida, Ricardo V. M.; Sousa, Antônio J. S.; Monteiro-Moreira, Ana C. O.; Oliveira, José T. A.; Grangeiro, Thalles B.

2015-01-01

Mo-CBP3 is a chitin-binding protein from M. oleifera seeds that inhibits the germination and mycelial growth of phytopathogenic fungi. This protein is highly thermostable and resistant to pH changes, and therefore may be useful in the development of new antifungal drugs. However, the relationship of MoCBP3 with the known families of carbohydrate-binding domains has not been established. In the present study, full-length cDNAs encoding 4 isoforms of Mo-CBP3 (Mo-CBP3-1, Mo-CBP3-2, Mo-CBP3-3 and Mo-CBP3-4) were cloned from developing seeds. The polypeptides encoded by the Mo-CBP3 cDNAs were predicted to contain 160 (Mo-CBP3-3) and 163 amino acid residues (Mo-CBP3-1, Mo-CBP3-2 and Mo-CBP3-4) with a signal peptide of 20-residues at the N-terminal region. A comparative analysis of the deduced amino acid sequences revealed that Mo-CBP3 is a typical member of the 2S albumin family, as shown by the presence of an eight-cysteine motif, which is a characteristic feature of the prolamin superfamily. Furthermore, mass spectrometry analysis demonstrated that Mo-CBP3 is a mixture of isoforms that correspond to different mRNA products. The identification of Mo-CBP3 as a genuine member of the 2S albumin family reinforces the hypothesis that these seed storage proteins are involved in plant defense. Moreover, the chitin-binding ability of Mo-CBP3 reveals a novel functionality for a typical 2S albumin. PMID:25789746

Genome-wide characterization reveals complex interplay between TP53 and TP63 in response to genotoxic stress

PubMed Central

McDade, Simon S.; Patel, Daksha; Moran, Michael; Campbell, James; Fenwick, Kerry; Kozarewa, Iwanka; Orr, Nicholas J.; Lord, Christopher J.; Ashworth, Alan A.; McCance, Dennis J.

2014-01-01

In response to genotoxic stress the TP53 tumour suppressor activates target gene expression to induce cell cycle arrest or apoptosis depending on the extent of DNA damage. These canonical activities can be repressed by TP63 in normal stratifying epithelia to maintain proliferative capacity or drive proliferation of squamous cell carcinomas, where TP63 is frequently overexpressed/amplified. Here we use ChIP-sequencing, integrated with microarray analysis, to define the genome-wide interplay between TP53 and TP63 in response to genotoxic stress in normal cells. We reveal that TP53 and TP63 bind to overlapping, but distinct cistromes of sites through utilization of distinctive consensus motifs and that TP53 is constitutively bound to a number of sites. We demonstrate that cisplatin and adriamycin elicit distinct effects on TP53 and TP63 binding events, through which TP53 can induce or repress transcription of an extensive network of genes by direct binding and/or modulation of TP63 activity. Collectively, this results in a global TP53-dependent repression of cell cycle progression, mitosis and DNA damage repair concomitant with activation of anti-proliferative and pro-apoptotic canonical target genes. Further analyses reveal that in the absence of genotoxic stress TP63 plays an important role in maintaining expression of DNA repair genes, loss of which results in defective repair. PMID:24823795

Structural Studies of E. coli Topoisomerase III-DNA Complexes Reveal A Novel Type IA Topoisomerase-DNA Conformational Intermediate

PubMed Central

Changela, Anita; DiGate, Russell J.; Mondragón, Alfonso

2007-01-01

Summary E. coli DNA topoisomerase III belongs to the type IA family of DNA topoisomerases, which transiently cleave single-stranded DNA (ssDNA) via a 5′ phosphotyrosine intermediate. We have solved crystal structures of wild-type E. coli topoisomerase III bound to an 8-base ssDNA molecule in three different pH environments. The structures reveal the enzyme in three distinct conformational states while bound to DNA. One conformation resembles the one observed previously with a DNA-bound, catalytically inactive mutant of topoisomerase III where DNA binding realigns catalytic residues to form a functional active site. Another conformation represents a novel intermediate in which DNA is bound along the ssDNA-binding groove but does not enter the active site, which remains in a catalytically inactive, closed state. A third conformation shows an intermediate state where the enzyme is still in a closed state, but the ssDNA is starting to invade the active site. For the first time, the active site region in the presence of both the catalytic tyrosine and ssDNA substrate is revealed for a type IA DNA topoisomerase, although there is no evidence of ssDNA cleavage. Comparative analysis of the various conformational states suggests a sequence of domain movements undertaken by the enzyme upon substrate binding. PMID:17331537

Structure-based design of Aurora A & B inhibitors

NASA Astrophysics Data System (ADS)

Poulsen, Anders; William, Anthony; Lee, Angeline; Blanchard, Stéphanie; Teo, Eeling; Deng, Weiping; Tu, Noah; Tan, Evelyn; Sun, Eric; Goh, Kay Lin; Ong, Wai Chung; Ng, Chee Pang; Goh, Kee Chuan; Bonday, Zahid

2008-12-01

The Aurora family of serine/threonine kinases are mitotic regulators involved in centrosome duplication, formation of the bipolar mitotic spindle and the alignment of the chromosomes along the spindle. These proteins are frequently overexpressed in tumor cells as compared to normal cells and are therefore potential therapeutic oncology targets. An Aurora A high throughput screen revealed a promising sub-micromolar indazole-benzimidazole lead. Modification of the benzimidazole portion of the lead to a C2 linker with a phenyl ring was proposed to achieve novelty. Docking revealed that a conjugated linker was optimal and the resulting compounds were equipotent with the lead. Further structure-guided optimization of substituents on the 5 & 6 position of the indazole led to single digit nanomolar potency. The homology between the Aurora A & Aurora B kinase domains is 71% but their binding sites only differ at residues 212 & 217 (Aurora A numbering). However interactions with only the latter residue may be used for obtaining selectivity. An analysis of published Aurora A and Aurora B X-ray structures reveals subtle differences in the shape of the binding sites. This was exploited by introduction of appropriately sized substituents in the 4 & 6 position of the indazole leading to Aurora B selective inhibitors. Finally we calculate the conformational energy penalty of the putative bioactive conformation of our inhibitors and show that this property correlates well with the Aurora A binding affinity.

Further Insights into Metal-DOM Interaction: Consideration of Both Fluorescent and Non-Fluorescent Substances

PubMed Central

Xu, Huacheng; Zhong, Jicheng; Yu, Guanghui; Wu, Jun; Jiang, Helong; Yang, Liuyan

2014-01-01

Information on metal binding with fluorescent substances has been widely studied. By contrast, information on metal binding with non-fluorescent substances remains lacking despite the dominance of these substances in aquatic systems. In this study, the metal binding properties of both fluorescent and non-fluorescent substances were investigated by using metal titration combined with two-dimensional correlation spectroscopy (2D–COS) analysis. The organic matters in the eutrophic algae-rich lake, including natural organic matters (NOM) and algae-induced extracellular polymeric substances (EPS), both contained fluorescent and non-fluorescent substances. The peaks in the one-dimensional spectra strongly overlapped, while 2D–COS can decompose the overlapped peaks and thus enhanced the spectral resolution. Moreover, 2D FTIR COS demonstrated that the binding susceptibility of organic ligands in both NOM and algal EPS matrices followed the order: 3400>1380>1650 cm−1, indicative the significant contribution of non-fluorescent ligands in metal binding. The modified Stern-Volmer equation also revealed a substantial metal binding potential for the non-fluorescent substances (logKM: 3.57∼4.92). As for the effects of organic ligands on metal binding, EPS was characterized with higher binding ability than NOM for both fluorescent and non-fluorescent ligands. Algae-induced EPS and the non-fluorescent substances in eutrophic algae-rich lakes should not be overlooked because of their high metal binding potential. PMID:25380246

DNA binding of a proflavine derivative bearing a platinum hanging residue.

PubMed

Biagini, Silvia; Bianchi, Antonio; Biver, Tarita; Boggioni, Alessia; Nikolayenko, Igor V; Secco, Fernando; Venturini, Marcella

2011-04-01

New platinum(II) complex of 3,6-diamine-9-[6,6-bis(2-aminohethyl)-1,6-diaminohexyl]acridine, AzaPt, has been synthesised and characterised. Behaviour of AzaPt in solution (protonation and possible self-aggregation phenomena) has been investigated by spectral methods (absorbance and fluorescence) at I=0.1M and 25°C, and the equilibrium parameters of binding to calf thymus DNA have been established. Two different modes of DNA binding by the complex were detected, which depend on the polymer to dye molar ratio (P/D). At relatively low P/D values the mode was interpreted as binding by the polyamine residue external to the base pairs, while at high P/D values the binding corresponds to intercalation of the proflavine residue. Such interpretation is supported by the observed salt effect on binding and the temperature variation of the binding constants, which allowed estimating the ΔH and ΔS values contributions. Spectrophotometric analysis of the long time range binding revealed that AzaPt is involved in a slow reaction, interpreted as an attack by the platinum ion on the nucleobases. The time constant for such interaction was calculated and found to be the same order of magnitude as for processes responsible for the action of anti-tumour drugs that do covalently bind to polynucleotides. Copyright © 2010 Elsevier Inc. All rights reserved.

Molecular Dynamics of CYP2D6 Polymorphisms in the Absence and Presence of a Mechanism-Based Inactivator Reveals Changes in Local Flexibility and Dominant Substrate Access Channels

PubMed Central

de Waal, Parker W.; Sunden, Kyle F.; Furge, Laura Lowe

2014-01-01

Cytochrome P450 enzymes (CYPs) represent an important enzyme superfamily involved in metabolism of many endogenous and exogenous small molecules. CYP2D6 is responsible for ∼15% of CYP-mediated drug metabolism and exhibits large phenotypic diversity within CYPs with over 100 different allelic variants. Many of these variants lead to functional changes in enzyme activity and substrate selectivity. Herein, a molecular dynamics comparative analysis of four different variants of CYP2D6 was performed. The comparative analysis included simulations with and without SCH 66712, a ligand that is also a mechanism-based inactivator, in order to investigate the possible structural basis of CYP2D6 inactivation. Analysis of protein stability highlighted significantly altered flexibility in both proximal and distal residues from the variant residues. In the absence of SCH 66712, *34, *17-2, and *17-3 displayed more flexibility than *1, and *53 displayed more rigidity. SCH 66712 binding reversed flexibility in *17-2 and *17-3, through *53 remained largely rigid. Throughout simulations with docked SCH 66712, ligand orientation within the heme-binding pocket was consistent with previously identified sites of metabolism and measured binding energies. Subsequent tunnel analysis of substrate access, egress, and solvent channels displayed varied bottle-neck radii. Taken together, our results indicate that SCH 66712 should inactivate these allelic variants, although varied flexibility and substrate binding-pocket accessibility may alter its interaction abilities. PMID:25286176

Identification of Immunoglobulin E-Binding Proteins of the Xerophilic Fungus Aspergillus penicillioides Crude Mycelial Mat Extract and Serological Reactivity Assessment in Subjects with Different Allergen Reactivity Profiles.

PubMed

González De León, Joenice; González Méndez, Ricardo; Cadilla, Carmen L; Rivera-Mariani, Félix E; Bolaños-Rosero, Benjamín

2018-01-01

Aspergillus penicillioides is a very common indoor xerophilic fungus and potential causative agent of respiratory conditions. Although people are constantly exposed to A. penicillioides, no proteins with allergenic potential have been described. Therefore, we aim to confirm allergic sensitization to A. penicillioides through reactivity in serological assays and detect immunoglobulin E (IgE)-binding proteins. In an indirect ELISA, we compared the serological reactivity to A. penicillioides between subjects with specific IgE (sIgE) (group 1, n = 54) and no sIgE reactivity (group 2, n = 15) against commercial allergens. Correlations and principal component analysis were performed to identify associations between reactivity to commercial allergens and A. penicillioides. IgE-binding proteins in A. penicillioides were visualized using Western blotting (WB) in group 1. The IgE-binding proteins with the highest reactivity were analyzed by mass spectrometry and confirmed by transcript matching. There was no statistical significance (p = 0.1656) between the study groups in serological reactivity. Correlations between reactivity to A. penicillioides, dog epithelia, Aspergillus fumigatus, and Penicillium chrysogenum were observed. WB experiments showed 6 IgE-binding proteins with molecular weights ranging from 45 to 145 kDa. Proteins of 108, 83, and 56 kDa showed higher reactivity. Mass spectrometry analysis of these 3 proteins led to the putative identification of NADP-specific glutamate dehydrogenase and catalase B. This was confirmed with transcriptome analysis. These results provide evidence of the presence of potential allergenic components in A. penicillioides. Further analysis of the putatively identified proteins should reveal their allergenic potential. © 2018 S. Karger AG, Basel.

Generation of Affibody ligands binding interleukin-2 receptor alpha/CD25.

PubMed

Grönwall, Caroline; Snelders, Eveline; Palm, Anna Jarelöv; Eriksson, Fredrik; Herne, Nina; Ståhl, Stefan

2008-06-01

Affibody molecules specific for human IL-2Ralpha, the IL-2 (interleukin-2) receptor alpha subunit, also known as CD25, were selected by phage-display technology from a combinatorial protein library based on the 58-residue Protein A-derived Z domain. The IL-2R system plays a major role in T-cell activation and the regulation of cellular immune responses. Moreover, CD25 has been found to be overexpressed in organ rejections, a number of autoimmune diseases and T-cell malignancies. The phage-display selection using Fc-fused target protein generated 16 unique Affibody molecules targeting CD25. The two most promising binders were characterized in more detail using biosensor analysis and demonstrated strong and selective binding to CD25. Kinetic biosensor analysis revealed that the two monomeric Affibody molecules bound to CD25 with apparent affinities of 130 and 240 nM respectively. The Affibody molecules were, on biosensor analysis, found to compete for the same binding site as the natural ligand IL-2 and the IL-2 blocking monoclonal antibody 2A3. Hence the Affibody molecules were assumed to have an overlapping binding site with IL-2 and antibodies targeting the IL-2 blocking Tac epitope (for example, the monoclonal antibodies Daclizumab and Basiliximab, both of which have been approved for therapeutic use). Furthermore, immunofluorescence microscopy and flow-cytometric analysis of CD25-expressing cells demonstrated that the selected Affibody molecules bound to CD4+ CD25+ PMBCs (peripheral-blood mononuclear cells), the IL-2-dependent cell line NK92 and phytohaemagglutinin-activated PMBCs. The potential use of the CD25-binding Affibody molecules as targeting agents for medical imaging and for therapeutic applications is discussed.

Differential flap dynamics in l,d-transpeptidase2 from mycobacterium tuberculosis revealed by molecular dynamics.

PubMed

Fakhar, Zeynab; Govender, Thavendran; Maguire, Glenn E M; Lamichhane, Gyanu; Walker, Ross C; Kruger, Hendrik G; Honarparvar, Bahareh

2017-06-01

Despite the advances in tuberculosis treatment, TB is still one the most deadly infectious diseases and remains a major global health quandary. Mycobacterium tuberculosis (Mtb) is the only known mycobacterium with a high content of 3→3 crosslinks in the biosynthesis of peptidoglycan, which is negligible in most bacterial species. An Mtb lacking Ldt Mt2 leads to alteration of the colony morphology and loss of virulence which makes this enzyme an attractive target. Regardless of the vital role of Ldt Mt2 for cell wall survival, the impact of ligand binding on the dynamics of the β-hairpin flap is still unknown. Understanding the structural and dynamical behaviour of the flap regions provides clear insight into the design of the effective inhibitors against Ldt Mt2 . Carbapenems, an specific class of β-lactam family, have been shown to inactivate this enzyme. Herein a comprehensive investigation of the flap dynamics of Ldt Mt2 complex with substrate and three carbapenems namely, ertapenem, imipenem and meropenem is discussed and analyzed for the first account using 140 ns molecular dynamics simulations. The structural features (RMSD, RMSF and R g ) derived by MD trajectories were analyzed. Distance analysis, particularly tip-tip SER135-ASN167 index, identified conformational changes in terms of flap opening and closure within binding process. Principal component analysis (PCA) was employed to qualitatively understand the divergent effects of different inhibitors on the dominant motion of each residue. To probe different internal dynamics induced by ligand binding, dynamic cross-correlation marix (DCCM) analysis was used. The binding free energies of the selected complexes were assessed using MM-GBSA method and per residue free energy decomposition analysis were performed to characterize the contribution of the key residues to the total binding free energies.

MGA, L3MBTL2 and E2F6 determine genomic binding of the non-canonical Polycomb repressive complex PRC1.6

PubMed Central

Stielow, Bastian; Finkernagel, Florian; Stiewe, Thorsten

2018-01-01

Diverse Polycomb repressive complexes 1 (PRC1) play essential roles in gene regulation, differentiation and development. Six major groups of PRC1 complexes that differ in their subunit composition have been identified in mammals. How the different PRC1 complexes are recruited to specific genomic sites is poorly understood. The Polycomb Ring finger protein PCGF6, the transcription factors MGA and E2F6, and the histone-binding protein L3MBTL2 are specific components of the non-canonical PRC1.6 complex. In this study, we have investigated their role in genomic targeting of PRC1.6. ChIP-seq analysis revealed colocalization of MGA, L3MBTL2, E2F6 and PCGF6 genome-wide. Ablation of MGA in a human cell line by CRISPR/Cas resulted in complete loss of PRC1.6 binding. Rescue experiments revealed that MGA recruits PRC1.6 to specific loci both by DNA binding-dependent and by DNA binding-independent mechanisms. Depletion of L3MBTL2 and E2F6 but not of PCGF6 resulted in differential, locus-specific loss of PRC1.6 binding illustrating that different subunits mediate PRC1.6 loading to distinct sets of promoters. Mga, L3mbtl2 and Pcgf6 colocalize also in mouse embryonic stem cells, where PRC1.6 has been linked to repression of germ cell-related genes. Our findings unveil strikingly different genomic recruitment mechanisms of the non-canonical PRC1.6 complex, which specify its cell type- and context-specific regulatory functions. PMID:29381691

Exploration of nucleoprotein α-MoRE and XD interactions of Nipah and Hendra viruses.

PubMed

Shang, Xu; Chu, Wenting; Chu, Xiakun; Xu, Liufang; Longhi, Sonia; Wang, Jin

2018-04-24

Henipavirus, including Hendra virus (HeV) and Nipah virus (NiV), is a newly discovered human pathogen genus. The nucleoprotein of Henipavirus contains an α-helical molecular recognition element (α-MoRE) that folds upon binding to the X domain (XD) of the phosphoprotein (P). In order to explore the conformational dynamics of free α-MoREs and the underlying binding-folding mechanism with XD, atomic force field-based and hybrid structure-based MD simulations were carried out. In our empirical force field-based simulations, characteristic structures and helicities of α-MoREs reveal the co-existence of partially structured and disordered conformations, as in the case of the well characterized cognate measles virus (MeV) α-MoRE. In spite of their overall similarity, the two α-MoREs display subtle helicity differences in their C-terminal region, but much different from that of MeV. For the α-MoRE/XD complexes, the results of our hybrid structure-based simulations provide the coupled binding-folding landscapes, and unveil a wide conformational selection mechanism at early binding stages, followed by a final induce-fit mechanism selection process. However, the HeV and NiV complexes have a lower binding barrier compared to that of MeV. Moreover, the HeV α-MoRE/XD complex shows much less coupling effects between binding and folding compared to that from both NiV and MeV. Our analysis revealed that contrary to NiV and MeV, the N- and C-terminal regions of the HeV α-MoRE maintains a low helicity also in the bound form.

Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.

PubMed

Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

2013-12-06

Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.

Presenilins Regulate Neurotrypsin Gene Expression and Neurotrypsin-dependent Agrin Cleavage via Cyclic AMP Response Element-binding Protein (CREB) Modulation*

PubMed Central

Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.

2013-01-01

Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

Prevention of cross-talk in conserved regulatory systems: identification of specificity determinants in RNA-binding anti-termination proteins of the BglG family

PubMed Central

Hübner, Sebastian; Declerck, Nathalie; Diethmaier, Christine; Le Coq, Dominique; Aymerich, Stephane; Stülke, Jörg

2011-01-01

Each family of signal transduction systems requires specificity determinants that link individual signals to the correct regulatory output. In Bacillus subtilis, a family of four anti-terminator proteins controls the expression of genes for the utilisation of alternative sugars. These regulatory systems contain the anti-terminator proteins and a RNA structure, the RNA anti-terminator (RAT) that is bound by the anti-terminator proteins. We have studied three of these proteins (SacT, SacY, and LicT) to understand how they can transmit a specific signal in spite of their strong structural homology. A screen for random mutations that render SacT capable to bind a RNA structure recognized by LicT only revealed a substitution (P26S) at one of the few non-conserved residues that are in contact with the RNA. We have randomly modified this position in SacT together with another non-conserved RNA-contacting residue (Q31). Surprisingly, the mutant proteins could bind all RAT structures that are present in B. subtilis. In a complementary approach, reciprocal amino acid exchanges have been introduced in LicT and SacY at non-conserved positions of the RNA-binding site. This analysis revealed the key role of an arginine side-chain for both the high affinity and specificity of LicT for its cognate RAT. Introduction of this Arg at the equivalent position of SacY (A26) increased the RNA binding in vitro but also resulted in a relaxed specificity. Altogether our results suggest that this family of anti-termination proteins has evolved to reach a compromise between RNA binding efficacy and specific interaction with individual target sequences. PMID:21278164

Single-Nucleotide-Specific Targeting of the Tf1 Retrotransposon Promoted by the DNA-Binding Protein Sap1 of Schizosaccharomyces pombe.

PubMed

Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R; McQueen, Philip G; Yang, Andrew X; Mizuguchi, Takeshi; Grewal, Shiv I S; Levin, Henry L

2015-11-01

Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and -9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. Copyright © 2015 by the Genetics Society of America.

Single-Nucleotide-Specific Targeting of the Tf1 Retrotransposon Promoted by the DNA-Binding Protein Sap1 of Schizosaccharomyces pombe

PubMed Central

Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R.; McQueen, Philip G.; Yang, Andrew X.; Mizuguchi, Takeshi; Grewal, Shiv I. S.; Levin, Henry L.

2015-01-01

Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and −9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. PMID:26358720

Guanine nucleotide-binding protein regulation of melatonin receptors in lizard brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rivkees, S.A.; Carlson, L.L.; Reppert, S.M.

Melatonin receptors were identified and characterized in crude membrane preparations from lizard brain by using {sup 125}I-labeled melatonin ({sup 125}I-Mel), a potent melatonin agonist. {sup 125}I-Mel binding sites were saturable; Scatchard analysis revealed high-affinity and lower affinity binding sites, with apparent K{sub d} of 2.3 {plus minus} 1.0 {times} 10{sup {minus}11} M and 2.06 {plus minus} 0.43 {times} 10{sup {minus}10} M, respectively. Binding was reversible and inhibited by melatonin and closely related analogs but not by serotonin or norepinephrine. Treatment of crude membranes with the nonhydrolyzable GTP analog guanosine 5{prime}-({gamma}-thio)triphosphate (GTP({gamma}S)), significantly reduced the number of high-affinity receptors and increasedmore » the dissociation rate of {sup 125}I-Mel from its receptor. Furthermore, GTP({gamma}S) treatment of ligand-receptor complexes solubilized by Triton X-100 also led to a rapid dissociation of {sup 125}I-Mel from solubilized ligand-receptor complexes. Gel filtration chromatography of solubilized ligand-receptor complexes revealed two major peaks of radioactivity corresponding to M{sub r} > 400,000 and M{sub r} ca. 110,000. This elution profile was markedly altered by pretreatment with GTP({gamma}S) before solubilization; only the M{sub r} 110,000 peak was present in GTP({gamma}S)-pretreated membranes. The results strongly suggest that {sup 125}I-mel binding sites in lizard brain are melatonin receptors, with agonist-promoted guanine nucleotide-binding protein (G protein) coupling and that the apparent molecular size of receptors uncoupled from G proteins is about 110,000.« less

Effect-directed analysis to explore the polar bear exposome: identification of thyroid hormone disrupting compounds in plasma.

PubMed

Simon, Eszter; van Velzen, Martin; Brandsma, Sicco H; Lie, Elisabeth; Løken, Katharina; de Boer, Jacob; Bytingsvik, Jenny; Jenssen, Bjørn M; Aars, Jon; Hamers, Timo; Lamoree, Marja H

2013-08-06

Compounds with transthyretin (TTR)-binding potency in the blood plasma of polar bear cubs were identified with effect-directed analysis (EDA). This approach contributes to the understanding of the thyroid disrupting exposome of polar bears. The selection of these samples for in-depth EDA was based on the difference between the observed TTR-binding potency on the one hand and the calculated potency (based on known concentrations of TTR-binding compounds and their relative potencies) on the other. A library-based identification was applied to the liquid chromatography-time-of-flight-mass spectrometry (LC-ToF-MS) data by screening for matches between compound lists and the LC-ToF-MS data regarding accurate mass and isotope pattern. Then, isotope cluster analysis (ICA) was applied to the LC-ToF-MS data allowing specific screening for halogen isotope patterns. The presence of linear and branched nonylphenol (NP) was observed for the first time in polar bears. Furthermore, the presence of one di- and two monohydroxylated octachlorinated biphenyls (octaCBs) was revealed in the extracts. Linear and branched NP, 4'-OH-CB201 and 4,4'-OH-CB202 could be successfully confirmed with respect to their retention time in the analytical system. In addition, branched NP, mono- and dihydroxylated-octaCBs showed TTR-binding potencies and could explain another 32 ± 2% of the total measured activities in the extracts.

Systematic evaluation of the impact of ChIP-seq read designs on genome coverage, peak identification, and allele-specific binding detection.

PubMed

Zhang, Qi; Zeng, Xin; Younkin, Sam; Kawli, Trupti; Snyder, Michael P; Keleş, Sündüz

2016-02-24

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) experiments revolutionized genome-wide profiling of transcription factors and histone modifications. Although maturing sequencing technologies allow these experiments to be carried out with short (36-50 bps), long (75-100 bps), single-end, or paired-end reads, the impact of these read parameters on the downstream data analysis are not well understood. In this paper, we evaluate the effects of different read parameters on genome sequence alignment, coverage of different classes of genomic features, peak identification, and allele-specific binding detection. We generated 101 bps paired-end ChIP-seq data for many transcription factors from human GM12878 and MCF7 cell lines. Systematic evaluations using in silico variations of these data as well as fully simulated data, revealed complex interplay between the sequencing parameters and analysis tools, and indicated clear advantages of paired-end designs in several aspects such as alignment accuracy, peak resolution, and most notably, allele-specific binding detection. Our work elucidates the effect of design on the downstream analysis and provides insights to investigators in deciding sequencing parameters in ChIP-seq experiments. We present the first systematic evaluation of the impact of ChIP-seq designs on allele-specific binding detection and highlights the power of pair-end designs in such studies.

Draft whole genome sequence of groundnut stem rot fungus Athelia rolfsii revealing genetic architect of its pathogenicity and virulence.

PubMed

Iquebal, M A; Tomar, Rukam S; Parakhia, M V; Singla, Deepak; Jaiswal, Sarika; Rathod, V M; Padhiyar, S M; Kumar, Neeraj; Rai, Anil; Kumar, Dinesh

2017-07-13

Groundnut (Arachis hypogaea L.) is an important oil seed crop having major biotic constraint in production due to stem rot disease caused by fungus, Athelia rolfsii causing 25-80% loss in productivity. As chemical and biological combating strategies of this fungus are not very effective, thus genome sequencing can reveal virulence and pathogenicity related genes for better understanding of the host-parasite interaction. We report draft assembly of Athelia rolfsii genome of ~73 Mb having 8919 contigs. Annotation analysis revealed 16830 genes which are involved in fungicide resistance, virulence and pathogenicity along with putative effector and lethal genes. Secretome analysis revealed CAZY genes representing 1085 enzymatic genes, glycoside hydrolases, carbohydrate esterases, carbohydrate-binding modules, auxillary activities, glycosyl transferases and polysaccharide lyases. Repeat analysis revealed 11171 SSRs, LTR, GYPSY and COPIA elements. Comparative analysis with other existing ascomycotina genome predicted conserved domain family of WD40, CYP450, Pkinase and ABC transporter revealing insight of evolution of pathogenicity and virulence. This study would help in understanding pathogenicity and virulence at molecular level and development of new combating strategies. Such approach is imperative in endeavour of genome based solution in stem rot disease management leading to better productivity of groundnut crop in tropical region of world.

Characterization of R5020 and RU486 binding to progesterone receptor from calf uterus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hurd, C.; Moudgil, V.K.

1988-05-17

The authors have examined and compared the binding characteristics of the progesterone agonist R5020 (promegestrone, 17,21-dimethylpregna-4,9(10)-diene-3,20-dione) and the progesterone antagonist RU486 (mifepristone, 17..beta..-hydroxy-11..beta..-(4-(dimethylamino)phenyl)-17..cap alpha..-(prop-1-ynyl)-estra-4,9-dien-3-one) in calf uterine cytosol. Both steroids bound cytosol macromolecule(s) with high affinity, exhibiting K/sub d/ values of 5.6 and 3.6 nM for R5020 and RU486 binding, respectively. The binding of the steroids to the macromolecule(s) was rapid at 4/sup 0/C, showing saturation of binding sites at 1-2 h for (/sup 3/H)progesterone and 2-4 h for both (/sup 3/H)R5020 and (/sup 3/H)RU486. Addition of molybdate and glycerol to cytosol increased the extent of (/sup 3/H)R5020 binding. Themore » extent of (/sup 3/H)RU486 binding remained unchanged in the presence of molybdate, whereas glycerol had an inhibitory effect. Molybdate alone or in combination with glycerol stabilized the (/sup 3/H)R5020- and (/sup 3/H)RU486-receptor complexes at 37/sup 0/C. Competitive steroid binding analysis revealed that (/sup 3/H)progesterone, (/sup 3/H)R5020, and (/sup 3/H)RU486 compete for the same site(s) in the uterine cytosol, suggesting that all three bind to the progesterone receptor (PR). Sedimentation rate analysis showed that both steroids were bound to a molecule that sediments in the 8S region. The 8S (/sup 3/H)R5020 and (/sup 3/H)RU486 peaks were abolished by excess radioinert progesterone, RU486, or R5020. The results of this study suggest that, although there are some differences in the nature of their interaction with the PR, both R5020 and RU486 bind to the same 8S receptor in calf uterine cytosol.« less

Massive GGAAs in genomic repetitive sequences serve as a nuclear reservoir of NF-κB.

PubMed

Wu, Jian; Wang, Qiao; Dai, Wei; Wang, Wei; Yue, Ming; Wang, Jinke

2018-04-13

Nuclear factor κB (NF-κB) is a DNA-binding transcription factor. Characterizing its genomic binding sites is crucial for understanding its gene regulatory function and mechanism in cells. This study characterized the binding sites of NF-κB RelA/p65 in the tumor neurosis factor-α (TNFα) stimulated HeLa cells by a precise chromatin immunoprecipitation-sequencing (ChIP-seq). The results revealed that NF-κB binds nontraditional motifs (nt-motifs) containing conserved GGAA quadruplet. Moreover, nt-motifs mainly distribute in the peaks nearby centromeres that contain a larger number of repetitive elements such as satellite, simple repeats and short interspersed nuclear elements (SINEs). This intracellular binding pattern was then confirmed by the in vitro detection, indicating that NF-κB dimers can bind the nontraditional κB (nt-κB) sites with low affinity. However, this binding hardly activates transcription. This study thus deduced that NF-κB binding nt-motifs may realize functions other than gene regulation as NF-κB binding traditional motifs (t-motifs). To testify the deduction, many ChIP-seq data of other cell lines were then analyzed. The results indicate that NF-κB binding nt-motifs is also widely present in other cells. The ChIP-seq data analysis also revealed that nt-motifs more widely distribute in the peaks with low-fold enrichment. Importantly, it was also found that NF-κB binding nt-motifs is mainly present in the resting cells, whereas NF-κB binding t-motifs is mainly present in the stimulated cells. Astonishingly, no known function was enriched by the gene annotation of nt-motif peaks. Based on these results, this study proposed that the nt-κB sites that extensively distribute in larger numbers of repeat elements function as a nuclear reservoir of NF-κB. The nuclear NF-κB proteins stored at nt-κB sites in the resting cells may be recruited to the t-κB sites for regulating its target genes upon stimulation. Copyright © 2018 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

Structural Transformation Detection Contributes to Screening of Behaviorally Active Compounds: Dynamic Binding Process Analysis of DhelOBP21 from Dastarcus helophoroides.

PubMed

Yang, Rui-Nan; Li, Dong-Zhen; Yu, Guangqiang; Yi, Shan-Cheng; Zhang, Yinan; Kong, De-Xin; Wang, Man-Qun

2017-12-01

In light of reverse chemical ecology, the fluorescence competitive binding assays of functional odorant binding proteins (OBPs) is a recent advanced approach for screening behaviorally active compounds of insects. Previous research on Dastareus helophoroides identified a minus-C OBP, DhelOBP21, which preferably binds to several ligands. In this study, only (+)-β-pinene proved attractive to unmated adult beetles. To obtain a more in-depth explanation of the lack of behavioral activity of other ligands we selected compounds with high (camphor) and low (β-caryophyllene) binding affinities. The structural transformation of OBPs was investigated using well-established approaches for studying binding processes, such as fluorescent quenching assays, circular dichroism, and molecular dynamics. The dynamic binding process revealed that the flexibility of DhelOBP21 seems conducive to binding specific ligands, as opposed to broad substrate binding. The compound (+)-β-pinene and DhelOBP21 formed a stable complex through a secondary structural transformation of DhelOBP21, in which its amino-terminus transformed from random coil to an α-helix to cover the binding pocket. On the other hand, camphor could not efficiently induce a stable structural transformation, and its high binding affinities were due to strong hydrogen-bonding, compromising the structure of the protein. The other compound, β-caryophyllene, only collided with DhelOBP21 and could not be positioned in the binding pocket. Studying structural transformation of these proteins through examining the dynamic binding process rather than using approaches that just measure binding affinities such as fluorescence competitive binding assays can provide a more efficient and reliable approach for screening behaviorally active compounds.

Structural basis for genome wide recognition of 5-bp GC motifs by SMAD transcription factors.

PubMed

Martin-Malpartida, Pau; Batet, Marta; Kaczmarska, Zuzanna; Freier, Regina; Gomes, Tiago; Aragón, Eric; Zou, Yilong; Wang, Qiong; Xi, Qiaoran; Ruiz, Lidia; Vea, Angela; Márquez, José A; Massagué, Joan; Macias, Maria J

2017-12-12

Smad transcription factors activated by TGF-β or by BMP receptors form trimeric complexes with Smad4 to target specific genes for cell fate regulation. The CAGAC motif has been considered as the main binding element for Smad2/3/4, whereas Smad1/5/8 have been thought to preferentially bind GC-rich elements. However, chromatin immunoprecipitation analysis in embryonic stem cells showed extensive binding of Smad2/3/4 to GC-rich cis-regulatory elements. Here, we present the structural basis for specific binding of Smad3 and Smad4 to GC-rich motifs in the goosecoid promoter, a nodal-regulated differentiation gene. The structures revealed a 5-bp consensus sequence GGC(GC)|(CG) as the binding site for both TGF-β and BMP-activated Smads and for Smad4. These 5GC motifs are highly represented as clusters in Smad-bound regions genome-wide. Our results provide a basis for understanding the functional adaptability of Smads in different cellular contexts, and their dependence on lineage-determining transcription factors to target specific genes in TGF-β and BMP pathways.

Investigations of Takeout proteins' ligand binding and release mechanism using molecular dynamics simulation.

PubMed

Zhang, Huijing; Yu, Hui; Zhao, Xi; Liu, Xiaoguang; Feng, Xianli; Huang, Xuri

2017-05-01

Takeout (To) proteins exist in a diverse range of insect species. They are involved in many important processes of insect physiology and behaviors. As the ligand carriers, To proteins can transport the small molecule to the target tissues. However, ligand release mechanism of To proteins is unclear so far. In this contribution, the process and pathway of the ligand binding and release are revealed by conventional molecular dynamics simulation, steered molecular dynamics simulation and umbrella sampling methods. Our results show that the α4-side of the protein is the unique gate for the ligand binding and release. The structural analysis confirms that the internal cavity of the protein has high rigidity, which is in accordance with the recent experimental results. By using the potential of mean force calculations in combination with residue cross correlation calculation, we concluded that the binding between the ligand and To proteins is a process of conformational selection. Furthermore, the conformational changes of To proteins and the hydrophobic interactions both are the key factors for ligand binding and release.

A single mutation in Taiwanese H6N1 influenza hemagglutinin switches binding to human-type receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

de Vries, Robert P.; Tzarum, Netanel; Peng, Wenjie

In June 2013, the first case of human infection with an avian H6N1 virus was reported in a Taiwanese woman. Although this was a single non-fatal case, the virus continues to circulate in Taiwanese poultry. As with any emerging avian virus that infects humans, there is concern that acquisition of human-type receptor specificity could enable transmission in the human population. Despite mutations in the receptor-binding pocket of the human H6N1 isolate, it has retained avian-type (NeuAcα2-3Gal) receptor specificity. However, we show here that a single nucleotide substitution, resulting in a change from Gly to Asp at position 225 (G225D), completelymore » switches specificity to human-type (NeuAcα2-6Gal) receptors. Significantly, G225D H6 loses binding to chicken trachea epithelium and is now able to bind to human tracheal tissue. Structural analysis reveals that Asp225 directly interacts with the penultimate Gal of the human-type receptor, stabilizing human receptor binding.« less

In silico molecular docking analysis of the human Argonaute 2 PAZ domain reveals insights into RNA interference.

PubMed

Kandeel, Mahmoud; Kitade, Yukio

2013-07-01

RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.

A Structure-Based Mechanism for Arf1-Dependent Recruitment of Coatomer to Membranes

PubMed Central

Yu, Xinchao; Breitman, Marianna; Goldberg, Jonathan

2012-01-01

Summary Budding of COPI-coated vesicles from Golgi membranes requires an Arf-family G protein and the coatomer complex recruited from cytosol. Arf is also required with coatomer-related clathrin adaptor complexes to bud vesicles from the trans-Golgi network and endosomal compartments. To understand the structural basis for Arf-dependent recruitment of a vesicular coat to the membrane, we determined the structure of Arf1 bound to the γζ-COP subcomplex of coatomer. Structure-guided biochemical analysis reveals that a second Arf1-GTP molecule binds to βδ-COP at a site common to the γ- and β-COP subunits. The Arf1-binding sites on coatomer are spatially related to PtdIns4,5P2-binding sites on the endocytic AP2 complex, providing evidence that the orientation of membrane binding is general for this class of vesicular coat proteins. A bivalent GTP-dependent binding mode has implications for the dynamics of coatomer interaction with the Golgi and for the selection of cargo molecules. PMID:22304919

Cdc45-induced loading of human RPA onto single-stranded DNA.

PubMed

Szambowska, Anna; Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut; Grosse, Frank

2017-04-07

Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8-10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Human Nup98 regulates the localization and activity of DExH/D-box helicase DHX9

PubMed Central

Capitanio, Juliana S; Montpetit, Ben; Wozniak, Richard W

2017-01-01

Beyond their role at nuclear pore complexes, some nucleoporins function in the nucleoplasm. One such nucleoporin, Nup98, binds chromatin and regulates gene expression. To gain insight into how Nup98 contributes to this process, we focused on identifying novel binding partners and understanding the significance of these interactions. Here we report on the identification of the DExH/D-box helicase DHX9 as an intranuclear Nup98 binding partner. Various results, including in vitro assays, show that the FG/GLFG region of Nup98 binds to N- and C-terminal regions of DHX9 in an RNA facilitated manner. Importantly, binding of Nup98 stimulates the ATPase activity of DHX9, and a transcriptional reporter assay suggests Nup98 supports DHX9-stimulated transcription. Consistent with these observations, our analysis revealed that Nup98 and DHX9 bind interdependently to similar gene loci and their transcripts. Based on our results, we propose that Nup98 functions as a co-factor that regulates DHX9 and, potentially, other RNA helicases. DOI: http://dx.doi.org/10.7554/eLife.18825.001 PMID:28221134

Interaction of cinnamic acid derivatives with serum albumins: A fluorescence spectroscopic study

NASA Astrophysics Data System (ADS)

Singh, T. Sanjoy; Mitra, Sivaprasad

2011-03-01

Cinnamic acid (CA) derivatives are known to possess broad therapeutic applications including anti-tumor activity. The present study was designed to determine the underlying mechanism and thermodynamic parameters for the binding of two CA based intramolecular charge transfer (ICT) fluorescent probes, namely, 4-(dimethylamino) cinnamic acid (DMACA) and trans-ethyl p-(dimethylamino) cinnamate (EDAC), with albumins by fluorescence spectroscopy. Stern-Volmer analysis of the tryptophan fluorescence quenching data in presence of the added ligand reveals fluorescence quenching constant ( κq), Stern-Volmer constant ( KSV) and also the ligand-protein association constant ( Ka). The thermodynamic parameters like enthalpy (Δ H) and entropy (Δ S) change corresponding to the ligand binding process were also estimated. The results show that the ligands bind into the sub-domain IIA of the proteins in 1:1 stoichiometry with an apparent binding constant value in the range of 10 4 dm 3 mol -1. In both the cases, the spontaneous ligand binding to the proteins occur through entropy driven mechanism, although the interaction of DMACA is relatively stronger in comparison with EDAC. The temperature dependence of the binding constant indicates the induced change in protein secondary structure.

The Binding of Four Licorice Flavonoids to Bovine Serum Albumin by Multi-Spectroscopic and Molecular Docking Methods: Structure-Affinity Relationship

NASA Astrophysics Data System (ADS)

Hou, J.; Liang, Q.; Shao, S.

2017-03-01

Flavanones are the main compound of licorice, and the C'-4 position substitution is a significant structural feature for their biological activity. The ability of three selected flavanones (liquiritigenin, liquiritin, and liquiritin apioside) bearing different substituents (hydroxyl groups, glucose, and glucose-apiose sugar moiety) at the C'-4 position and a chalcone ( isoliquiritigenin, an isomer of liquiritigenin) to bind bovine serum albumin (BSA) was studied by multispectroscopic and molecular docking methods under physiological conditions. The binding mechanism of fl avonoids to BSA can be explained by the formation of a flavonoids-BSA complex, and the binding affinity is the strongest for isoliquiritigenin, followed by liquiritin apioside, liquiritin, and liquiritigenin. The thermodynamic analysis and the molecular docking indicated that the interaction between flavonoids and BSA was dominated by the hydrophobic force and hydrogen bonds. The competitive experiments as well as the molecular docking results suggested the most possible binding site of licorice flavonoids on BSA at subdomain IIA. These results revealed that the basic skeleton structure and the substituents at the C'-4 position of flavanones significantly affect the structure-affinity relationships of the licorice flavonoid binding to BSA.

Broad and potent HIV-1 neutralization by a human antibody that binds the gp41-120 interface

PubMed Central

Huang, Jinghe; Kang, Byong H.; Pancera, Marie; Lee, Jeong Hyun; Tong, Tommy; Feng, Yu; Georgiev, Ivelin S.; Chuang, Gwo-Yu; Druz, Aliaksandr; Doria-Rose, Nicole A.; Laub, Leo; Sliepen, Kwinten; van Gils, Marit J.; de la Peña, Alba Torrents; Derking, Ronald; Klasse, Per-Johan; Migueles, Stephen A.; Bailer, Robert T.; Alam, Munir; Pugach, Pavel; Haynes, Barton F.; Wyatt, Richard T.; Sanders, Rogier W.; Binley, James M.; Ward, Andrew B.; Mascola, John R.; Kwong, Peter D.; Connors, Mark

2014-01-01

The isolation of human monoclonal antibodies (mAbs) is providing important insights regarding the specificities that underlie broad neutralization of HIV-1 (reviewed in1). Here we report a broad and extremely potent HIV-specific mAb, termed 35O22, which binds novel HIV-1 envelope glycoprotein (Env) epitope. 35O22 neutralized 62% of 181 pseudoviruses with an IC50<50 μg/ml. The median IC50 of neutralized viruses was 0.033 μg/ml, among the most potent thus far described. 35O22 did not bind monomeric forms of Env tested, but did bind the trimeric BG505 SOSIP.664. Mutagenesis and a reconstruction by negative-stain electron microscopy of the Fab in complex with trimer revealed it to bind a conserved epitope, which stretched across gp120 and gp41. The specificity of 35O22 represents a novel site of vulnerability on HIV Env, which serum analysis indicates to be commonly elicited by natural infection. Binding to this new site of vulnerability may thus be an important complement to current mAb-based approaches to immunotherapies, prophylaxis, and vaccine design. PMID:25186731

Unique Ganglioside Recognition Strategies for Clostridial Neurotoxins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Benson, Marc A.; Fu, Zhuji; Kim, Jung-Ja P.

2012-03-15

Botulinum neurotoxins (BoNTs) and tetanus neurotoxin are the causative agents of the paralytic diseases botulism and tetanus, respectively. The potency of the clostridial neurotoxins (CNTs) relies primarily on their highly specific binding to nerve terminals and cleavage of SNARE proteins. Although individual CNTs utilize distinct proteins for entry, they share common ganglioside co-receptors. Here, we report the crystal structure of the BoNT/F receptor-binding domain in complex with the sugar moiety of ganglioside GD1a. GD1a binds in a shallow groove formed by the conserved peptide motif E ... H ... SXWY ... G, with additional stabilizing interactions provided by two argininemore » residues. Comparative analysis of BoNT/F with other CNTs revealed several differences in the interactions of each toxin with ganglioside. Notably, exchange of BoNT/F His-1241 with the corresponding lysine residue of BoNT/E resulted in increased affinity for GD1a and conferred the ability to bind ganglioside GM1a. Conversely, BoNT/E was not able to bind GM1a, demonstrating a discrete mechanism of ganglioside recognition. These findings provide a structural basis for ganglioside binding among the CNTs and show that individual toxins utilize unique ganglioside recognition strategies.« less

Identification of a New Interaction Mode between the Src Homology 2 Domain of C-terminal Src Kinase (Csk) and Csk-binding Protein/Phosphoprotein Associated with Glycosphingolipid Microdomains♦

PubMed Central

Tanaka, Hiroaki; Akagi, Ken-ichi; Oneyama, Chitose; Tanaka, Masakazu; Sasaki, Yuichi; Kanou, Takashi; Lee, Young-Ho; Yokogawa, Daisuke; Dobenecker, Marc-Werner; Nakagawa, Atsushi; Okada, Masato; Ikegami, Takahisa

2013-01-01

Proteins with Src homology 2 (SH2) domains play major roles in tyrosine kinase signaling. Structures of many SH2 domains have been studied, and the regions involved in their interactions with ligands have been elucidated. However, these analyses have been performed using short peptides consisting of phosphotyrosine followed by a few amino acids, which are described as the canonical recognition sites. Here, we report the solution structure of the SH2 domain of C-terminal Src kinase (Csk) in complex with a longer phosphopeptide from the Csk-binding protein (Cbp). This structure, together with biochemical experiments, revealed the existence of a novel binding region in addition to the canonical phosphotyrosine 314-binding site of Cbp. Mutational analysis of this second region in cells showed that both canonical and novel binding sites are required for tumor suppression through the Cbp-Csk interaction. Furthermore, the data indicate an allosteric connection between Cbp binding and Csk activation that arises from residues in the βB/βC loop of the SH2 domain. PMID:23548896

Single-molecule multiparameter fluorescence spectroscopy reveals directional MutS binding to mismatched bases in DNA

PubMed Central

Cristóvão, Michele; Sisamakis, Evangelos; Hingorani, Manju M.; Marx, Andreas D.; Jung, Caroline P.; Rothwell, Paul J.; Seidel, Claus A. M.; Friedhoff, Peter

2012-01-01

Mismatch repair (MMR) corrects replication errors such as mismatched bases and loops in DNA. The evolutionarily conserved dimeric MMR protein MutS recognizes mismatches by stacking a phenylalanine of one subunit against one base of the mismatched pair. In all crystal structures of G:T mismatch-bound MutS, phenylalanine is stacked against thymine. To explore whether these structures reflect directional mismatch recognition by MutS, we monitored the orientation of Escherichia coli MutS binding to mismatches by FRET and anisotropy with steady state, pre-steady state and single-molecule multiparameter fluorescence measurements in a solution. The results confirm that specifically bound MutS bends DNA at the mismatch. We found additional MutS–mismatch complexes with distinct conformations that may have functional relevance in MMR. The analysis of individual binding events reveal significant bias in MutS orientation on asymmetric mismatches (G:T versus T:G, A:C versus C:A), but not on symmetric mismatches (G:G). When MutS is blocked from binding a mismatch in the preferred orientation by positioning asymmetric mismatches near the ends of linear DNA substrates, its ability to authorize subsequent steps of MMR, such as MutH endonuclease activation, is almost abolished. These findings shed light on prerequisites for MutS interactions with other MMR proteins for repairing the appropriate DNA strand. PMID:22367846

Cloning and characterization of mouse ACF7, a novel member of the dystonin subfamily of actin binding proteins.

PubMed

Bernier, G; Mathieu, M; De Repentigny, Y; Vidal, S M; Kothary, R

1996-11-15

We have recently cloned the gene responsible for the mouse neurological disorder dystonia musculorum. The predicted product of this gene, dystonin (Dst), is a neural isoform of bullous pemphigoid antigen 1 (Bpag1) with an N-terminal actin binding domain. Here we report on the cloning and characterization of mouse ACF7. Sequence analysis revealed extended homology of mACF7 with both the actin binding domain (ABD) and the Bpag1 portions of dystonin. Moreover, mACF7 and Dst display similar isoform diversity and encode similar sized transcripts in the nervous system. Phylogenetic analysis of mACF7 and dystonin ABD sequences suggests a recent evolutionary origin and that these proteins form a separate novel subfamily within the beta-spectrin superfamily of actin binding proteins. Given the implication of several actin binding proteins in genetic disorders, it is important to know the pattern of mACF7 expression. mACF7 transcripts are detected principally in lung, brain, spinal cord, skeletal and cardiac muscle, and skin. Intriguingly, mACF7 expression in lung is strongly induced just before birth and is restricted to type II alveolar cells. To determine whether spontaneous mutants that may be defective in mACF7 exist, we have mapped the mACF7 gene to mouse chromosome 4.

Variable ligand- and receptor-binding hot spots in key strains of influenza neuraminidase

PubMed Central

Votapka, Lane; Demir, Özlem; Swift, Robert V; Walker, Ross C; Amaro, Rommie E

2012-01-01

Influenza A continues to be a major public health concern due to its ability to cause epidemic and pandemic disease outbreaks in humans. Computational investigations of structural dynamics of the major influenza glycoproteins, especially the neuraminidase (NA) enzyme, are able to provide key insights beyond what is currently accessible with standard experimental techniques. In particular, all-atom molecular dynamics simulations reveal the varying degrees of flexibility for such enzymes. Here we present an analysis of the relative flexibility of the ligand- and receptor-binding area of three key strains of influenza A: highly pathogenic H5N1, the 2009 pandemic H1N1, and a human N2 strain. Through computational solvent mapping, we investigate the various ligand- and receptor-binding “hot spots” that exist on the surface of NA which interacts with both sialic acid receptors on the host cells and antiviral drugs. This analysis suggests that the variable cavities found in the different strains and their corresponding capacities to bind ligand functional groups may play an important role in the ability of NA to form competent reaction encounter complexes with other species of interest, including antiviral drugs, sialic acid receptors on the host cell surface, and the hemagglutinin protein. Such considerations may be especially useful for the prediction of how such complexes form and with what binding capacity. PMID:22872804

Binding preference of p62 towards LC3-ll during dopaminergic neurotoxin-induced impairment of autophagic flux.

PubMed

Lim, Junghyun; Kim, Hyun-Wook; Youdim, Moussa B H; Rhyu, Im Joo; Choe, Kwang-Min; Oh, Young J

2011-01-01

Accumulating evidence has revealed that autophagy may be beneficial for treatment of neurodegenerative diseases through removal of abnormal protein aggregates. However, the critical autophagic events during neurodegeneration remain to be elucidated. Here, we investigated whether prototypic autophagic events occur in the MN9D dopaminergic neuronal cell line upon exposure to N-methyl-4-phenylpyridinium (MPP (+) ), a well-known dopaminergic neurotoxin. MPP (+) treatment induced both morphological and biochemical characteristics of autophagy, such as accumulation of autophagic vacuoles and LC3-II form and decreased p62 levels. Further investigation revealed that these phenomena were largely the consequences of blocked autophagic flux. Following MPP (+) treatment, levels of LC3-II formed and p62 dramatically increased in the Triton X-100-insoluble fraction. Levels of ubiquitinated proteins also increased in this fraction. Further colocalization analyses revealed that the punctated spots positive for both p62 and LC3 were more intense following MPP (+) treatment, suggesting drug-induced enrichment of these two proteins in the insoluble fraction. Intriguingly, reciprocal immunoprecipitation analysis revealed that p62 mainly precipitated with LC3-II form following MPP (+) treatment. Transient transfection of the mutant form of Atg4B, Atg4B (C74A) , which inhibits LC3 processing, dramatically decreased binding between p62 and LC3-II form. Taken together, our results indicate that p62 can be efficiently localized to autophagic compartments via preferential binding with LC3-II form. This colocalization may assist in removal of detergent-insoluble forms of damaged cellular proteins during dopaminergic neurotoxin-induced impairment of autophagic flux.

Fatty acids and small organic compounds bind to mineralo-organic nanoparticles derived from human body fluids as revealed by metabolomic analysis

NASA Astrophysics Data System (ADS)

Martel, Jan; Wu, Cheng-Yeu; Hung, Cheng-Yu; Wong, Tsui-Yin; Cheng, Ann-Joy; Cheng, Mei-Ling; Shiao, Ming-Shi; Young, John D.

2016-03-01

Nanoparticles entering the human body instantly become coated with a ``protein corona'' that influences the effects and distribution of the particles in vivo. Yet, whether nanoparticles may bind to other organic compounds remains unclear. Here we use an untargeted metabolomic approach based on ultra-performance liquid chromatography and quadruple time-of-flight mass spectrometry to identify the organic compounds that bind to mineral nanoparticles formed in human body fluids (serum, plasma, saliva, and urine). A wide range of organic compounds is identified, including fatty acids, glycerophospholipids, amino acids, sugars, and amides. Our results reveal that, in addition to the proteins identified previously, nanoparticles harbor an ``organic corona'' containing several fatty acids which may affect particle-cell interactions in vivo. This study provides a platform to study the organic corona of biological and synthetic nanoparticles found in the human body.Nanoparticles entering the human body instantly become coated with a ``protein corona'' that influences the effects and distribution of the particles in vivo. Yet, whether nanoparticles may bind to other organic compounds remains unclear. Here we use an untargeted metabolomic approach based on ultra-performance liquid chromatography and quadruple time-of-flight mass spectrometry to identify the organic compounds that bind to mineral nanoparticles formed in human body fluids (serum, plasma, saliva, and urine). A wide range of organic compounds is identified, including fatty acids, glycerophospholipids, amino acids, sugars, and amides. Our results reveal that, in addition to the proteins identified previously, nanoparticles harbor an ``organic corona'' containing several fatty acids which may affect particle-cell interactions in vivo. This study provides a platform to study the organic corona of biological and synthetic nanoparticles found in the human body. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr08116e

Non-covalent binding analysis of sulfamethoxazole to human serum albumin: Fluorescence spectroscopy, UV-vis, FT-IR, voltammetric and molecular modeling.

PubMed

Naik, Praveen N; Nandibewoor, Sharanappa T; Chimatadar, Shivamurthi A

2015-06-01

This study was designed to examine the interaction of sulfamethoxazole (SMZ) with human serum albumin(HSA). Spectroscopic analysis of the emission quenching at different temperatures revealed that the quenching mechanism of human serum albumin by SMZ was static mechanism. The binding constant values for the SMZ-HSA system were obtained to be 22,500 L/mol at 288 K, 15,600 L/mol at 298 K, and 8500 L/mol at 308 K. The distance r between donor and acceptor was evaluated according to the theory of Föster energy transfer. The results of spectroscopic analysis and molecular modeling techniques showed that the conformation of human serum albumin had been changed in the presence of SMZ. The thermodynamic parameters, namely enthalpy change (∆ H 0 ) -36.0 kJ/mol, entropy change (∆ S 0 ) -41.3 J/mol K and free energy change (∆ G 0 ) -23.7 kJ/mol, were calculated by using van׳t Hoff equation. The effect of common ions on the binding of SMZ to HSA was tested.

Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum.

PubMed

Hollin, Thomas; De Witte, Caroline; Lenne, Astrid; Pierrot, Christine; Khalife, Jamal

2016-03-17

Protein Phosphatase 1 (PP1) is an enzyme essential to cell viability in the malaria parasite Plasmodium falciparum (Pf). The activity of PP1 is regulated by the binding of regulatory subunits, of which there are up to 200 in humans, but only 3 have been so far reported for the parasite. To better understand the P. falciparum PP1 (PfPP1) regulatory network, we here report the use of three strategies to characterize the PfPP1 interactome: co-affinity purified proteins identified by mass spectrometry, yeast two-hybrid (Y2H) screening and in silico analysis of the P. falciparum predicted proteome. Co-affinity purification followed by MS analysis identified 6 PfPP1 interacting proteins (Pips) of which 3 contained the RVxF consensus binding, 2 with a Fxx[RK]x[RK] motif, also shown to be a PP1 binding motif and one with both binding motifs. The Y2H screens identified 134 proteins of which 30 present the RVxF binding motif and 20 have the Fxx[RK]x[RK] binding motif. The in silico screen of the Pf predicted proteome using a consensus RVxF motif as template revealed the presence of 55 potential Pips. As further demonstration, 35 candidate proteins were validated as PfPP1 interacting proteins in an ELISA-based assay. To the best of our knowledge, this is the first study on PfPP1 interactome. The data reports several conserved PP1 interacting proteins as well as a high number of specific interactors to PfPP1. Their analysis indicates a high diversity of biological functions for PP1 in Plasmodium. Based on the present data and on an earlier study of the Pf interactome, a potential implication of Pips in protein folding/proteolysis, transcription and pathogenicity networks is proposed. The present work provides a starting point for further studies on the structural basis of these interactions and their functions in P. falciparum.

Binding of Phenazinium Dye Safranin T to Polyriboadenylic Acid: Spectroscopic and Thermodynamic Study

PubMed Central

Roy, Snigdha; Das, Suman

2014-01-01

Here, we report results from experiments designed to explore the association of the phenazinium dye safranin T (ST, 3,7-diamino-2,8-dimethyl-5-phenylphenazinium chloride) with single and double stranded form of polyriboadenylic acid (hereafter poly-A) using several spectroscopic techniques. We demonstrate that the dye binds to single stranded polyriboadenylic acid (hereafter ss poly-A) with high affinity while it does not interact at all with the double stranded (ds) form of the polynucleotide. Fluorescence and absorption spectral studies reveal the molecular aspects of binding of ST to single stranded form of the polynucleotide. This observation is also supported by the circular dichroism study. Thermodynamic data obtained from temperature dependence of binding constant reveals that association is driven by negative enthalpy change and opposed by negative entropy change. Ferrocyanide quenching studies have shown intercalative binding of ST to ss poly-A. Experiments on viscosity measurements confirm the binding mode of the dye to be intercalative. The effect of [Na+] ion concentration on the binding process suggests the role of electrostatic forces in the complexation. Present studies reveal the utility of the dye in probing nucleic acid structure. PMID:24498422

Binding of phenazinium dye safranin T to polyriboadenylic acid: spectroscopic and thermodynamic study.

PubMed

Pradhan, Ankur Bikash; Haque, Lucy; Roy, Snigdha; Das, Suman

2014-01-01

Here, we report results from experiments designed to explore the association of the phenazinium dye safranin T (ST, 3,7-diamino-2,8-dimethyl-5-phenylphenazinium chloride) with single and double stranded form of polyriboadenylic acid (hereafter poly-A) using several spectroscopic techniques. We demonstrate that the dye binds to single stranded polyriboadenylic acid (hereafter ss poly-A) with high affinity while it does not interact at all with the double stranded (ds) form of the polynucleotide. Fluorescence and absorption spectral studies reveal the molecular aspects of binding of ST to single stranded form of the polynucleotide. This observation is also supported by the circular dichroism study. Thermodynamic data obtained from temperature dependence of binding constant reveals that association is driven by negative enthalpy change and opposed by negative entropy change. Ferrocyanide quenching studies have shown intercalative binding of ST to ss poly-A. Experiments on viscosity measurements confirm the binding mode of the dye to be intercalative. The effect of [Na⁺] ion concentration on the binding process suggests the role of electrostatic forces in the complexation. Present studies reveal the utility of the dye in probing nucleic acid structure.

The Vibrio cholerae Colonization Factor GbpA Possesses a Modular Structure that Governs Binding to Different Host Surfaces

PubMed Central

Wong, Edmond; Vaaje-Kolstad, Gustav; Ghosh, Avishek; Hurtado-Guerrero, Ramon; Konarev, Peter V.; Ibrahim, Adel F. M.; Svergun, Dmitri I.; Eijsink, Vincent G. H.; Chatterjee, Nabendu S.; van Aalten, Daan M. F.

2012-01-01

Vibrio cholerae is a bacterial pathogen that colonizes the chitinous exoskeleton of zooplankton as well as the human gastrointestinal tract. Colonization of these different niches involves an N-acetylglucosamine binding protein (GbpA) that has been reported to mediate bacterial attachment to both marine chitin and mammalian intestinal mucin through an unknown molecular mechanism. We report structural studies that reveal that GbpA possesses an unusual, elongated, four-domain structure, with domains 1 and 4 showing structural homology to chitin binding domains. A glycan screen revealed that GbpA binds to GlcNAc oligosaccharides. Structure-guided GbpA truncation mutants show that domains 1 and 4 of GbpA interact with chitin in vitro, whereas in vivo complementation studies reveal that domain 1 is also crucial for mucin binding and intestinal colonization. Bacterial binding studies show that domains 2 and 3 bind to the V. cholerae surface. Finally, mouse virulence assays show that only the first three domains of GbpA are required for colonization. These results explain how GbpA provides structural/functional modular interactions between V. cholerae, intestinal epithelium and chitinous exoskeletons. PMID:22253590

Gelsolin in Onychophora and Tardigrada with notes on its variability in the Ecdysozoa.

PubMed

Thiruketheeswaran, Prasath; Greven, Hartmut; D'Haese, Jochen

2017-01-01

Rearrangements of the filamentous actin network involve a broad range of actin binding proteins. Among these, the gelsolin proteins sever actin filaments, cap their fast growing end and nucleate actin assembly in a calcium-dependent manner. Here, we focus on the gelsolin of the onychophoran Peripatoides novaezealandiae and the eutardigrade Hypsibius dujardini. From the cDNA of P. novaezealandiae we obtained the complete coding sequence with an open reading frame of 2178bp. It encodes a protein of 726 amino acids with a calculated molecular mass of 82,610.9Da and a pI of 5.57. This sequence is comprised of six segments (S1-S6). However, analysis of data from TardiBase reveals that the gelsolin of the eutardigrade Hypsibius dujardini has only three segments (S1-S3). The coding sequence consist of 1119bp for 373 amino acids with a calculated molecular mass of 42,440.95Da and a pI of 6.17. The Peripatoides and Hypsibius gelsolin revealed both conserved binding motifs for G-actin, F-actin and phosphatidylinositol 4,5-bisphosphate (PIP 2 ), along with a full set of type-1 and type-2 Ca 2+ -binding sites which could result in the binding of eight and four calcium ions, respectively. Both gelsolin proteins lack a C-terminal latch-helix indicating a more rapid activation in the submicromolar Ca 2+ range. We suggest that a gelsolin with three segments was present in the last common ancestor of the ecdysozoan clade Panarthropoda (Onychophora, Tardigrada, Arthropoda), primarily because the gelsolin of all non-Ecdysozoa studied so far (except Chordata) reveals this number of segments. Mapping of our molecular data onto a well-established phylogeny revealed that the number of gelsolin segments does not correlate with the phylogenetic lineage but rather with particular functional demands to alter the kinetics of actin polymerization. Copyright © 2016 Elsevier Inc. All rights reserved.

Insight into Buffalo (Bubalus bubalis) RIG1 and MDA5 Receptors: A Comparative Study on dsRNA Recognition and In-Vitro Antiviral Response

PubMed Central

Singh, Manvender; Brahma, Biswajit; Maharana, Jitendra; Patra, Mahesh Chandra; Kumar, Sushil; Mishra, Purusottam; Saini, Megha; De, Bidhan Chandra; Mahanty, Sourav; Datta, Tirtha Kumar; De, Sachinandan

2014-01-01

RIG1 and MDA5 have emerged as important intracellular innate pattern recognition receptors that recognize viral RNA and mediate cellular signals controlling Type I interferon (IFN-I) response. Buffalo RIG1 and MDA5 genes were investigated to understand the mechanism of receptor induced antiviral response. Sequence analysis revealed that RIG1 and MDA5 maintain a domain arrangement that is common in mammals. Critical binding site residues of the receptors are evolutionary conserved among mammals. Molecular dynamics simulations suggested that RIG1 and MDA5 follow a similar, if not identical, dsRNA binding pattern that has been previously reported in human. Moreover, binding free energy calculation revealed that MDA5 had a greater affinity towards dsRNA compared to RIG1. Constitutive expressions of RLR genes were ubiquitous in different tissues without being specific to immune organs. Poly I:C stimulation induced elevated expressions of IFN-β and IFN-stimulated genes (ISGs) through interferon regulatory factors (IRFs) mediated pathway in buffalo foetal fibroblast cells. The present study provides crucial insights into the structure and function of RIG1 and MDA5 receptors in buffalo. PMID:24587036

Water channel in the binding site of a high affinity anti-methotrexate antibody.

PubMed

Gayda, Susan; Longenecker, Kenton L; Manoj, Sharmila; Judge, Russell A; Saldana, Sylvia C; Ruan, Qiaoqiao; Swift, Kerry M; Tetin, Sergey Y

2014-06-17

In the present study, we report the structure of the free and drug-bound Fab fragment of a high affinity anti-methotrexate antibody and perform a thermodynamic analysis of the binding process. The anti-methotrexate Fab fragment features a remarkably rigid tunnel-like binding site that extends into a water channel serving as a specialized route to move solvent out and into the site upon ligand binding and dissociation. This new finding in antibody structure-function relationships directly relates to the fast association (1 × 10⁷ M⁻¹ s⁻¹) and slow dissociation (4 × 10⁻⁵ s⁻¹) rates determined for mAb ADD056, resulting in a very strong binding with a K(D) ~ 3.6 pM at 20 °C. As follows from the X-ray data analysis, the methotrexate-antibody complex is stabilized by an extended network of hydrogen bonds and stacking interactions. The analysis also shows structural involvement of the CDR H3 in formation of the water channel revealing another important role of this hypervariable region. This suggests a new direction in natural affinity maturation and opens a new possibility in antibody engineering. Methotrexate is a widely used therapeutic agent for many malignant diseases and inflammatory disorders. Unfortunately, it may also interfere with central aspects of metabolism and thereby cause inevitable side effects. Therefore, methotrexate therapy requires careful monitoring of drug blood levels, which is traditionally done by immunoassays. An understanding of the structure-function properties of antibodies selected for drug monitoring substantiates the performance and robustness of such tests.

Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

PubMed

Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

2016-12-15

The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

A tool for calculating binding-site residues on proteins from PDB structures.

PubMed

Hu, Jing; Yan, Changhui

2009-08-03

In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

Genome-Wide Identification, Characterization and Phylogenetic Analysis of ATP-Binding Cassette (ABC) Transporter Genes in Common Carp (Cyprinus carpio).

PubMed

Liu, Xiang; Li, Shangqi; Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A; Xu, Peng

2016-01-01

The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp.

Genome-Wide Identification, Characterization and Phylogenetic Analysis of ATP-Binding Cassette (ABC) Transporter Genes in Common Carp (Cyprinus carpio)

PubMed Central

Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A.

2016-01-01

The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp. PMID:27058731

IL-3 specifically inhibits GM-CSF binding to the higher affinity receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taketazu, F.; Chiba, S.; Shibuya, K.

1991-02-01

The inhibition of binding between human granulocyte-macrophage colony-stimulating factor (GM-CSF) and its receptor by human interleukin-3 (IL-3) was observed in myelogenous leukemia cell line KG-1 which bore the receptors both for GM-CSF and IL-3. In contrast, this phenomenon was not observed in histiocytic lymphoma cell line U-937 or in gastric carcinoma cell line KATO III, both of which have apparent GM-CSF receptor but an undetectable IL-3 receptor. In KG-1 cells, the cross-inhibition was preferentially observed when the binding of GM-CSF was performed under the high-affinity binding condition; i.e., a low concentration of 125I-GM-CSF was incubated. Scatchard analysis of 125I-GM-CSF bindingmore » to KG-1 cells in the absence and in the presence of unlabeled IL-3 demonstrated that IL-3 inhibited GM-CSF binding to the higher-affinity component of GM-CSF receptor on KG-1 cells. Moreover, a chemical cross-linking study has revealed that the cross-inhibition of the GM-CSF binding observed in KG-1 cells is specific for the beta-chain, Mr 135,000 binding protein which has been identified as a component forming the high-affinity GM-CSF receptor existing specifically on hemopoietic cells.« less

Probing the behavior of bovine serum albumin upon binding to atenolol: insights from spectroscopic and molecular docking approaches.

PubMed

Jiang, Tuo-Ying; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi; Shi, Jie-Hua

2018-04-01

Molecular interaction of atenolol, a selective β 1 receptor antagonist with the major carrier protein, bovine serum albumin (BSA), was investigated under imitated physiological conditions (pH 7.4) by means of fluorescence spectroscopy, UV absorption spectroscopy, Fourier transform infrared spectroscopy (FT-IR), and molecular modeling studies. The steady-state fluorescence spectra manifested that static type, due to formation of the atenolol-BSA complex, was the dominant mechanism for fluorescence quenching. The characteristic information about the binding interaction of atenolol with BSA in terms of binding constant (K b ) were determined by the UV-vis absorption titration, and were found to be in the order of 10 3  M -1 at different temperatures, indicating the existence of a weak binding in this system. Thermodynamic analysis revealed that the binding process was primarily mediated by van der Waals force and hydrogen bonds due to the negative sign for enthalpy change (ΔH 0 ), entropy change (ΔS 0 ). The molecular docking results elucidated that atenolol preferred binding on the site II of BSA according to the findings observed in competitive binding experiments. Moreover, via alterations in synchronous fluorescence, three-dimensional fluorescence and FT-IR spectral properties, it was concluded that atenolol could arouse slight configurational and micro-environmental changes of BSA.

Multi-spectroscopic and molecular docking studies on the interaction of darunavir, a HIV protease inhibitor with calf thymus DNA

NASA Astrophysics Data System (ADS)

Shi, Jie-Hua; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi

2018-03-01

Molecular interaction of darunavir (DRV), a HIV protease inhibitor with calf thymus deoxyribonucleic acid (ct-DNA) was studied in physiological buffer (pH 7.4) by multi-spectroscopic approaches hand in hand with viscosity measurements and molecular docking technique. The UV absorption and fluorescence results together revealed the formation of a DRV-ct-DNA complex having binding affinities of the order of 103 M- 1, which was more in keeping with the groove binding. The results that DRV bound to ct-DNA via groove binding mode was further evidenced by KI quenching studies, viscosity measurements, competitive binding investigations with EB and Rhodamine B and CD spectral analysis. The effect of ionic strength indicated the negligible involvement of electrostatic interaction between DRV and ct-DNA. The thermodynamic parameters regarding the binding interaction of DRV with ct-DNA in terms of enthalpy change (ΔH0) and entropy change (ΔS0) were - 63.19 kJ mol- 1 and - 141.92 J mol- 1 K- 1, indicating that hydrogen bonds and van der Waals forces played a predominant role in the binding process. Furthermore, molecular simulation studies suggested that DRV molecule was prone to bind in the A-T rich region of the minor groove of DNA.

Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy

PubMed Central

Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.

2016-01-01

There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806

Distribution of localized states from fine analysis of electron spin resonance spectra of organic semiconductors: Physical meaning and methodology

NASA Astrophysics Data System (ADS)

Mishchenko, Andrey S.; Matsui, Hiroyuki; Hasegawa, Tatsuo

2012-02-01

We develop an analytical method for the processing of electron spin resonance (ESR) spectra. The goal is to obtain the distributions of trapped carriers over both their degree of localization and their binding energy in semiconductor crystals or films composed of regularly aligned organic molecules [Phys. Rev. Lett.PRLTAO0031-900710.1103/PhysRevLett.104.056602 104, 056602 (2010)]. Our method has two steps. We first carry out a fine analysis of the shape of the ESR spectra due to the trapped carriers; this reveals the distribution of the trap density of the states over the degree of localization. This analysis is based on the reasonable assumption that the linewidth of the trapped carriers is predetermined by their degree of localization because of the hyperfine mechanism. We then transform the distribution over the degree of localization into a distribution over the binding energies. The transformation uses the relationships between the binding energies and the localization parameters of the trapped carriers. The particular relation for the system under study is obtained by the Holstein model for trapped polarons using a diagrammatic Monte Carlo analysis. We illustrate the application of the method to pentacene organic thin-film transistors.

Ugi 4-CR Synthesis of γ- and δ-Lactams providing new access to diverse enzyme interactions, a PDB analysis.

PubMed

Boltjes, André; Liao, George P; Zhao, Ting; Herdtweck, Eberhardt; Dömling, Alexander

2014-07-01

A three step synthesis of N -unsubstituted tetrazolo γ- and δ-lactams involving a key Ugi-4CR is presented. The compounds, otherwise difficult to access, are conveniently synthesized in overall good yields by our route. PDB analysis of the N -unsubstituted γ- and δ-lactam fragment reveals a strongly tri-directional hydrogen bond donor acceptor interaction with the amino acids of the binding sites.

Allosteric site-mediated active site inhibition of PBP2a using Quercetin 3-O-rutinoside and its combination.

PubMed

Rani, Nidhi; Vijayakumar, Saravanan; P T V, Lakshmi; Arunachalam, Annamalai

2016-08-01

Recent crystallographic study revealed the involvement of allosteric site in active site inhibition of penicillin binding protein (PBP2a), where one molecule of Ceftaroline (Cef) binds to the allosteric site of PBP2a and paved way for the other molecule (Cef) to bind at the active site. Though Cef has the potency to inhibit the PBP2a, its adverse side effects are of major concern. Previous studies have reported the antibacterial property of Quercetin derivatives, a group of natural compounds. Hence, the present study aims to evaluate the effect of Quercetin 3-o-rutinoside (Rut) in allosteric site-mediated active site inhibition of PBP2a. The molecular docking studies between allosteric site and ligands (Rut, Que, and Cef) revealed a better binding efficiency (G-score) of Rut (-7.790318) and Cef (-6.194946) with respect to Que (-5.079284). Molecular dynamic (MD) simulation studies showed significant changes at the active site in the presence of ligands (Rut and Cef) at allosteric site. Four different combinations of Rut and Cef were docked and their G-scores ranged between -6.320 and -8.623. MD studies revealed the stability of the key residue (Ser403) with Rut being at both sites, compared to other complexes. Morphological analysis through electron microscopy confirmed that combination of Rut and Cefixime was able to disturb the bacterial cell membrane in a similar fashion to that of Rut and Cefixime alone. The results of this study indicate that the affinity of Rut at both sites were equally good, with further validations Rut could be considered as an alternative for inhibiting MRSA growth.

RapA2 Is a Calcium-binding Lectin Composed of Two Highly Conserved Cadherin-like Domains That Specifically Recognize Rhizobium leguminosarum Acidic Exopolysaccharides*

PubMed Central

Abdian, Patricia L.; Caramelo, Julio J.; Ausmees, Nora; Zorreguieta, Angeles

2013-01-01

In silico analyses have revealed a conserved protein domain (CHDL) widely present in bacteria that has significant structural similarity to eukaryotic cadherins. A CHDL domain was shown to be present in RapA, a protein that is involved in autoaggregation of Rhizobium cells, biofilm formation, and adhesion to plant roots as shown by us and others. Structural similarity to cadherins suggested calcium-dependent oligomerization of CHDL domains as a mechanistic basis for RapA action. Here we show by circular dichroism spectroscopy, light scattering, isothermal titration calorimetry, and other methods that RapA2 from Rhizobium leguminosarum indeed exhibits a cadherin-like β-sheet conformation and that its proper folding and stability are dependent on the binding of one calcium ion per protein molecule. By further in silico analysis we also reveal that RapA2 consists of two CHDL domains and expand the range of CHDL-containing proteins in bacteria and archaea. However, light scattering assays at various concentrations of added calcium revealed that RapA2 formed neither homo-oligomers nor hetero-oligomers with RapB (a distinct CHDL protein), indicating that RapA2 does not mediate cellular interactions through a cadherin-like mechanism. Instead, we demonstrate that RapA2 interacts specifically with the acidic exopolysaccharides (EPSs) produced by R. leguminosarum in a calcium-dependent manner, sustaining a role of these proteins in the development of the biofilm matrix made of EPS. Because EPS binding by RapA2 can only be attributed to its two CHDL domains, we propose that RapA2 is a calcium-dependent lectin and that CHDL domains in various bacterial and archaeal proteins confer carbohydrate binding activity to these proteins. PMID:23235153

Interaction of methotrexate with trypsin analyzed by spectroscopic and molecular modeling methods

NASA Astrophysics Data System (ADS)

Wang, Yanqing; Zhang, Hongmei; Cao, Jian; Zhou, Qiuhua

2013-11-01

Trypsin is one of important digestive enzymes that have intimate correlation with human health and illness. In this work, the interaction of trypsin with methotrexate was investigated by spectroscopic and molecular modeling methods. The results revealed that methotrexate could interact with trypsin with about one binding site. Methotrexate molecule could enter into the primary substrate-binding pocket, resulting in inhibition of trypsin activity. Furthermore, the thermodynamic analysis implied that electrostatic force, hydrogen bonding, van der Waals and hydrophobic interactions were the main interactions for stabilizing the trypsin-methotrexate system, which agreed well with the results from the molecular modeling study.

Conformational Sampling and Binding Site Assessment of Suppression of Tumorigenicity 2 Ectodomain

PubMed Central

Yang, Chao-Yie; Delproposto, James; Chinnaswamy, Krishnapriya; Brown, William Clay; Wang, Shuying; Stuckey, Jeanne A.; Wang, Xinquan

2016-01-01

Suppression of Tumorigenicity 2 (ST2), a member of the interleukin-1 receptor (IL-1R) family, activates type 2 immune responses to pathogens and tissue damage via binding to IL-33. Dysregulated responses contribute to asthma, graft-versus-host and autoinflammatory diseases and disorders. To study ST2 structure for inhibitor development, we performed the principal component (PC) analysis on the crystal structures of IL1-1R1, IL1-1R2, ST2 and the refined ST2 ectodomain (ST2ECD) models, constructed from previously reported small-angle X-ray scattering data. The analysis facilitates mapping of the ST2ECD conformations to PC subspace for characterizing structural changes. Extensive coverage of ST2ECD conformations was then obtained using the accelerated molecular dynamics simulations started with the IL-33 bound ST2ECD structure as instructed by their projected locations on the PC subspace. Cluster analysis of all conformations further determined representative conformations of ST2ECD ensemble in solution. Alignment of the representative conformations with the ST2/IL-33 structure showed that the D3 domain of ST2ECD (containing D1-D3 domains) in most conformations exhibits no clashes with IL-33 in the crystal structure. Our experimental binding data informed that the D1-D2 domain of ST2ECD contributes predominantly to the interaction between ST2ECD and IL-33 underscoring the importance of the D1-D2 domain in binding. Computational binding site assessment revealed one third of the total detected binding sites in the representative conformations may be suitable for binding to potent small molecules. Locations of these sites include the D1-D2 domain ST2ECD and modulation sites conformed to ST2ECD conformations. Our study provides structural models and analyses of ST2ECD that could be useful for inhibitor discovery. PMID:26735493

Mechanical Unfolding Studies on Single-Domain SUMO and Multi-Domain Periplasmic Binding Proteins

NASA Astrophysics Data System (ADS)

Kotamarthi, Hema Chandra; Ainavarapu, Sri Rama Koti

Protein mechanics is a key component of many cellular and sub-cellular processes. The current review focuses on recent studies from our laboratory that probe the effect of sequence on the mechanical stability of structurally similar proteins and the unfolding mechanisms of multi-domain periplasmic binding proteins. Ubiquitin and small ubiquitin-related modifiers (SUMOs) are structurally similar and possess different mechanical stabilities, ubiquitin being stronger than SUMOs as revealed from their unfolding forces. These differences are plausibly due to the variation in number of inter-residue contacts. The unfolding potential widths determined from the pulling speed-dependent studies revealed that SUMOs are mechanically more flexible than ubiquitin. This flexibility of SUMOs plays a role in ligand binding and our single-molecule studies on SUMO interaction with SUMO binding motifs (SBMs) have shown that ligand binding decreases the SUMO flexibility and increases its mechanical stability. Studies on multi-domain periplasmic binding proteins have revealed that the unfolding energy landscape of these proteins is complex and they follow kinetic partitioning between two-state and multiple three-state pathways.

Destination memory in schizophrenia: "Did I told Elvis Presley about the thief?"

PubMed

El Haj, Mohamad; Altman, Rosalie; Bortolon, Catherine; Capdevielle, Delphine; Raffard, Stéphane

2017-02-01

Destination memory refers to the ability to remember to whom a piece of information was previously transmitted. Our paper assessed this ability in schizophrenia. Twenty-five patients with schizophrenia and 25 control participants told proverbs (e.g., "send a thief to catch a thief") to pictures of celebrities (e.g., Elvis Presley). Afterward, participants had to indicate to which celebrity they had previously said the proverbs. Participants also completed a binding task in which they were required to associate letters with their corresponding context (i.e., location). Analysis revealed worse destination memory and binding in patients with schizophrenia than in controls. In both populations, destination memory was significantly correlated with performances on the binding task. Our findings suggest difficulty in the ability to attribute information to its appropriate destination in schizophrenia. This difficulty may be related to compromise in binding separate cues together to form a coherent representation of an event in memory. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Affinity improvement of a therapeutic antibody to methamphetamine and amphetamine through structure-based antibody engineering

PubMed Central

Thakkar, Shraddha; Nanaware-Kharade, Nisha; Celikel, Reha; Peterson, Eric C.; Varughese, Kottayil I.

2014-01-01

Methamphetamine (METH) abuse is a worldwide threat, without any FDA approved medications. Anti-METH IgGs and single chain fragments (scFvs) have shown efficacy in preclinical studies. Here we report affinity enhancement of an anti-METH scFv for METH and its active metabolite amphetamine (AMP), through the introduction of point mutations, rationally designed to optimize the shape and hydrophobicity of the antibody binding pocket. The binding affinity was measured using saturation binding technique. The mutant scFv-S93T showed 3.1 fold enhancement in affinity for METH and 26 fold for AMP. The scFv-I37M and scFv-Y34M mutants showed enhancement of 94, and 8 fold for AMP, respectively. Structural analysis of scFv-S93T:METH revealed that the substitution of Ser residue by Thr caused the expulsion of a water molecule from the cavity, creating a more hydrophobic environment for the binding that dramatically increases the affinities for METH and AMP. PMID:24419156

Structural Basis of Arc Binding to Synaptic Proteins: Implications for Cognitive Disease

DOE PAGES

Zhang, Wenchi; Wu, Jing; Ward, Matthew D.; ...

2015-04-09

Arc is a cellular immediate-early gene (IEG) that functions at excitatory synapses and is required for learning and memory. Here we report crystal structures of Arc subdomains that form a bi-lobar architecture remarkably similar to the capsid domain of human immunodeficiency virus (HIV) gag protein. Analysis indicates Arc originated from the Ty3/Gypsy retrotransposon family and was “domesticated” in higher vertebrates for synaptic functions. The Arc N-terminal lobe evolved a unique hydrophobic pocket that mediates intermolecular binding with synaptic proteins as resolved in complexes with TARPγ2 (Stargazin) and CaMKII peptides and is essential for Arc’s synaptic function. A consensus sequence formore » Arc binding identifies several additional partners that include genes implicated in schizophrenia. Arc N-lobe binding is inhibited by small chemicals suggesting Arc’s synaptic action may be druggable. Finally, these studies reveal the remarkable evolutionary origin of Arc and provide a structural basis for understanding Arc’s contribution to neural plasticity and disease.« less

Analysis of neonatal brain lacking ATRX or MeCP2 reveals changes in nucleosome density, CTCF binding and chromatin looping

PubMed Central

Kernohan, Kristin D.; Vernimmen, Douglas; Gloor, Gregory B.; Bérubé, Nathalie G.

2014-01-01

ATRX and MeCP2 belong to an expanding group of chromatin-associated proteins implicated in human neurodevelopmental disorders, although their gene-regulatory activities are not fully resolved. Loss of ATRX prevents full repression of an imprinted gene network in the postnatal brain and in this study we address the mechanistic aspects of this regulation. We show that ATRX binds many imprinted domains individually but that transient co-localization between imprinted domains in the nuclei of neurons does not require ATRX. We demonstrate that MeCP2 is required for ATRX recruitment and that deficiency of either ATRX or MeCP2 causes decreased frequency of long-range chromatin interactions associated with altered nucleosome density at CTCF-binding sites and reduced CTCF occupancy. These findings indicate that MeCP2 and ATRX regulate gene expression at a subset of imprinted domains by maintaining a nucleosome configuration conducive to CTCF binding and to the maintenance of higher order chromatin structure. PMID:24990380

Structural Basis of Arc Binding to Synaptic Proteins: Implications for Cognitive Disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Wenchi; Wu, Jing; Ward, Matthew D.

Arc is a cellular immediate-early gene (IEG) that functions at excitatory synapses and is required for learning and memory. Here we report crystal structures of Arc subdomains that form a bi-lobar architecture remarkably similar to the capsid domain of human immunodeficiency virus (HIV) gag protein. Analysis indicates Arc originated from the Ty3/Gypsy retrotransposon family and was “domesticated” in higher vertebrates for synaptic functions. The Arc N-terminal lobe evolved a unique hydrophobic pocket that mediates intermolecular binding with synaptic proteins as resolved in complexes with TARPγ2 (Stargazin) and CaMKII peptides and is essential for Arc’s synaptic function. A consensus sequence formore » Arc binding identifies several additional partners that include genes implicated in schizophrenia. Arc N-lobe binding is inhibited by small chemicals suggesting Arc’s synaptic action may be druggable. Finally, these studies reveal the remarkable evolutionary origin of Arc and provide a structural basis for understanding Arc’s contribution to neural plasticity and disease.« less

High-resolution structure of TBP with TAF1 reveals anchoring patterns in transcriptional regulation

PubMed Central

Anandapadamanaban, Madhanagopal; Andresen, Cecilia; Helander, Sara; Ohyama, Yoshifumi; Siponen, Marina I.; Lundström, Patrik; Kokubo, Tetsuro; Ikura, Mitsuhiko; Moche, Martin; Sunnerhagen, Maria

2016-01-01

The general transcription factor TFIID provides a regulatory platform for transcription initiation. Here we present the crystal structure (1.97 Å) and NMR analysis of yeast TAF1 N-terminal domains TAND1 and TAND2 when bound to yeast TBP, together with mutational data. The yTAF1-TAND1, which in itself acts as a transcriptional activator, binds into the DNA-binding TBP concave surface by presenting similar anchor residues to TBP as E. coli Mot1 but from a distinct structural scaffold. Furthermore, we show how yTAF1-TAND2 employs an aromatic and acidic anchoring pattern to bind a conserved yTBP surface groove traversing the basic helix region, and we find highly similar TBP-binding motifs also presented by the structurally distinct TFIIA, Mot1 and Brf1 proteins. Our identification of these anchoring patterns, which can be easily disrupted or enhanced, provides compelling insight into the competitive multiprotein TBP interplay critical to transcriptional regulation. PMID:23851461

High-resolution structure of TBP with TAF1 reveals anchoring patterns in transcriptional regulation.

PubMed

Anandapadamanaban, Madhanagopal; Andresen, Cecilia; Helander, Sara; Ohyama, Yoshifumi; Siponen, Marina I; Lundström, Patrik; Kokubo, Tetsuro; Ikura, Mitsuhiko; Moche, Martin; Sunnerhagen, Maria

2013-08-01

The general transcription factor TFIID provides a regulatory platform for transcription initiation. Here we present the crystal structure (1.97 Å) and NMR analysis of yeast TAF1 N-terminal domains TAND1 and TAND2 bound to yeast TBP, together with mutational data. We find that yeast TAF1-TAND1, which in itself acts as a transcriptional activator, binds TBP's concave DNA-binding surface by presenting similar anchor residues to TBP as does Mot1 but from a distinct structural scaffold. Furthermore, we show how TAF1-TAND2 uses an aromatic and acidic anchoring pattern to bind a conserved TBP surface groove traversing the basic helix region, and we find highly similar TBP-binding motifs also presented by the structurally distinct TFIIA, Mot1 and Brf1 proteins. Our identification of these anchoring patterns, which can be easily disrupted or enhanced, provides insight into the competitive multiprotein TBP interplay critical to transcriptional regulation.

Crystal structure of Anoxybacillus α-amylase provides insights into maltose binding of a new glycosyl hydrolase subclass

PubMed Central

Chai, Kian Piaw; Othman, Noor Farhan Binti; Teh, Aik-Hong; Ho, Kok Lian; Chan, Kok-Gan; Shamsir, Mohd Shahir; Goh, Kian Mau; Ng, Chyan Leong

2016-01-01

A new subfamily of glycosyl hydrolase family GH13 was recently proposed for α-amylases from Anoxybacillus species (ASKA and ADTA), Geobacillus thermoleovorans (GTA, Pizzo, and GtamyII), Bacillus aquimaris (BaqA), and 95 other putative protein homologues. To understand this new GH13 subfamily, we report crystal structures of truncated ASKA (TASKA). ASKA is a thermostable enzyme capable of producing high levels of maltose. Unlike GTA, biochemical analysis showed that Ca2+ ion supplementation enhances the catalytic activities of ASKA and TASKA. The crystal structures reveal the presence of four Ca2+ ion binding sites, with three of these binding sites are highly conserved among Anoxybacillus α-amylases. This work provides structural insights into this new GH13 subfamily both in the apo form and in complex with maltose. Furthermore, structural comparison of TASKA and GTA provides an overview of the conformational changes accompanying maltose binding at each subsite. PMID:26975884

Synergistic binding of transcription factors to cell-specific enhancers programs motor neuron identity

PubMed Central

Mazzoni, Esteban O; Mahony, Shaun; Closser, Michael; Morrison, Carolyn A; Nedelec, Stephane; Williams, Damian J; An, Disi; Gifford, David K; Wichterle, Hynek

2013-01-01

Efficient transcriptional programming promises to open new frontiers in regenerative medicine. However, mechanisms by which programming factors transform cell fate are unknown, preventing more rational selection of factors to generate desirable cell types. Three transcription factors, Ngn2, Isl1 and Lhx3, were sufficient to program rapidly and efficiently spinal motor neuron identity when expressed in differentiating mouse embryonic stem cells. Replacement of Lhx3 by Phox2a led to specification of cranial, rather than spinal, motor neurons. Chromatin immunoprecipitation–sequencing analysis of Isl1, Lhx3 and Phox2a binding sites revealed that the two cell fates were programmed by the recruitment of Isl1-Lhx3 and Isl1-Phox2a complexes to distinct genomic locations characterized by a unique grammar of homeodomain binding motifs. Our findings suggest that synergistic interactions among transcription factors determine the specificity of their recruitment to cell type–specific binding sites and illustrate how a single transcription factor can be repurposed to program different cell types. PMID:23872598

Structural Basis of Arc Binding to Synaptic Proteins: Implications for Cognitive Disease

PubMed Central

Zhang, Wenchi; Wu, Jing; Ward, Matthew D.; Yang, Sunggu; Chuang, Yang-An; Xiao, Meifang; Li, Ruojing; Leahy, Daniel J.; Worley, Paul F.

2015-01-01

SUMMARY Arc is a cellular immediate early gene (IEG) that functions at excitatory synapses and is required for learning and memory. We report crystal structures of Arc subdomains that form a bi-lobar architecture remarkably similar to the capsid domain of human immunodeficiency virus (HIV) gag protein. Analysis indicates Arc originated from the Ty3/Gypsy retrotransposon family and was “domesticated” in higher vertebrates for synaptic functions. The Arc N-terminal lobe evolved a unique hydrophobic pocket that mediates intermolecular binding with synaptic proteins as resolved in complexes with TARPγ2 (Stargazin) and CaMKII peptides, and is essential for Arc’s synaptic function. A consensus sequence for Arc binding identifies several additional partners that include genes implicated in schizophrenia. Arc N-lobe binding is inhibited by small chemicals suggesting Arc’s synaptic action may be druggable. These studies reveal the remarkable evolutionary origin of Arc and provide a structural basis for understanding Arc’s contribution to neural plasticity and disease. PMID:25864631

The Replication Focus Targeting Sequence (RFTS) Domain Is a DNA-competitive Inhibitor of Dnmt1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Syeda, Farisa; Fagan, Rebecca L.; Wean, Matthew

Dnmt1 (DNA methyltransferase 1) is the principal enzyme responsible for maintenance of cytosine methylation at CpG dinucleotides in the mammalian genome. The N-terminal replication focus targeting sequence (RFTS) domain of Dnmt1 has been implicated in subcellular localization, protein association, and catalytic function. However, progress in understanding its function has been limited by the lack of assays for and a structure of this domain. Here, we show that the naked DNA- and polynucleosome-binding activities of Dnmt1 are inhibited by the RFTS domain, which functions by virtue of binding the catalytic domain to the exclusion of DNA. Kinetic analysis with a fluorogenicmore » DNA substrate established the RFTS domain as a 600-fold inhibitor of Dnmt1 enzymatic activity. The crystal structure of the RFTS domain reveals a novel fold and supports a mechanism in which an RFTS-targeted Dnmt1-binding protein, such as Uhrf1, may activate Dnmt1 for DNA binding.« less

An allosteric conduit facilitates dynamic multisite substrate recognition by the SCFCdc4 ubiquitin ligase

NASA Astrophysics Data System (ADS)

Csizmok, Veronika; Orlicky, Stephen; Cheng, Jing; Song, Jianhui; Bah, Alaji; Delgoshaie, Neda; Lin, Hong; Mittag, Tanja; Sicheri, Frank; Chan, Hue Sun; Tyers, Mike; Forman-Kay, Julie D.

2017-01-01

The ubiquitin ligase SCFCdc4 mediates phosphorylation-dependent elimination of numerous substrates by binding one or more Cdc4 phosphodegrons (CPDs). Methyl-based NMR analysis of the Cdc4 WD40 domain demonstrates that Cyclin E, Sic1 and Ash1 degrons have variable effects on the primary Cdc4WD40 binding pocket. Unexpectedly, a Sic1-derived multi-CPD substrate (pSic1) perturbs methyls around a previously documented allosteric binding site for the chemical inhibitor SCF-I2. NMR cross-saturation experiments confirm direct contact between pSic1 and the allosteric pocket. Phosphopeptide affinity measurements reveal negative allosteric communication between the primary CPD and allosteric pockets. Mathematical modelling indicates that the allosteric pocket may enhance ultrasensitivity by tethering pSic1 to Cdc4. These results suggest negative allosteric interaction between two distinct binding pockets on the Cdc4WD40 domain may facilitate dynamic exchange of multiple CPD sites to confer ultrasensitive dependence on substrate phosphorylation.

Theoretical and Experimental: The Synthetic and Anion-Binding Properties of Tripodal Salicylaldehyde Derivatives.

PubMed

Xu, Zhong-Jie; Zhang, Li-Rong

2016-05-19

A series of colorimetric anion probes 1-6 containing OH and NO₂ groups were synthesized, and their recognition properties toward various anions were investigated by visual observation, ultraviolet-visible spectroscopy, fluorescence, ¹H nuclear magnetic resonance titration spectra and theoretical investigation. Nanomaterials of three compounds 2-4 were prepared successfully. Four compounds 3-6 that contain electron-withdrawing substituents showed a high binding ability for AcO(-). The host-guest complex formed through a 1:1 binding ratio, and color changes were detectable during the recognition process. Theoretical investigation analysis revealed that an intramolecular hydrogen bond existed in the structures of compounds and the roles of molecular frontier orbitals in molecular interplay. These studies suggested that this series of compounds could be used as colorimetric probes to detect of AcO(-).

Integrative analysis of the Caenorhabditis elegans genome by the modENCODE project.

PubMed

Gerstein, Mark B; Lu, Zhi John; Van Nostrand, Eric L; Cheng, Chao; Arshinoff, Bradley I; Liu, Tao; Yip, Kevin Y; Robilotto, Rebecca; Rechtsteiner, Andreas; Ikegami, Kohta; Alves, Pedro; Chateigner, Aurelien; Perry, Marc; Morris, Mitzi; Auerbach, Raymond K; Feng, Xin; Leng, Jing; Vielle, Anne; Niu, Wei; Rhrissorrakrai, Kahn; Agarwal, Ashish; Alexander, Roger P; Barber, Galt; Brdlik, Cathleen M; Brennan, Jennifer; Brouillet, Jeremy Jean; Carr, Adrian; Cheung, Ming-Sin; Clawson, Hiram; Contrino, Sergio; Dannenberg, Luke O; Dernburg, Abby F; Desai, Arshad; Dick, Lindsay; Dosé, Andréa C; Du, Jiang; Egelhofer, Thea; Ercan, Sevinc; Euskirchen, Ghia; Ewing, Brent; Feingold, Elise A; Gassmann, Reto; Good, Peter J; Green, Phil; Gullier, Francois; Gutwein, Michelle; Guyer, Mark S; Habegger, Lukas; Han, Ting; Henikoff, Jorja G; Henz, Stefan R; Hinrichs, Angie; Holster, Heather; Hyman, Tony; Iniguez, A Leo; Janette, Judith; Jensen, Morten; Kato, Masaomi; Kent, W James; Kephart, Ellen; Khivansara, Vishal; Khurana, Ekta; Kim, John K; Kolasinska-Zwierz, Paulina; Lai, Eric C; Latorre, Isabel; Leahey, Amber; Lewis, Suzanna; Lloyd, Paul; Lochovsky, Lucas; Lowdon, Rebecca F; Lubling, Yaniv; Lyne, Rachel; MacCoss, Michael; Mackowiak, Sebastian D; Mangone, Marco; McKay, Sheldon; Mecenas, Desirea; Merrihew, Gennifer; Miller, David M; Muroyama, Andrew; Murray, John I; Ooi, Siew-Loon; Pham, Hoang; Phippen, Taryn; Preston, Elicia A; Rajewsky, Nikolaus; Rätsch, Gunnar; Rosenbaum, Heidi; Rozowsky, Joel; Rutherford, Kim; Ruzanov, Peter; Sarov, Mihail; Sasidharan, Rajkumar; Sboner, Andrea; Scheid, Paul; Segal, Eran; Shin, Hyunjin; Shou, Chong; Slack, Frank J; Slightam, Cindie; Smith, Richard; Spencer, William C; Stinson, E O; Taing, Scott; Takasaki, Teruaki; Vafeados, Dionne; Voronina, Ksenia; Wang, Guilin; Washington, Nicole L; Whittle, Christina M; Wu, Beijing; Yan, Koon-Kiu; Zeller, Georg; Zha, Zheng; Zhong, Mei; Zhou, Xingliang; Ahringer, Julie; Strome, Susan; Gunsalus, Kristin C; Micklem, Gos; Liu, X Shirley; Reinke, Valerie; Kim, Stuart K; Hillier, LaDeana W; Henikoff, Steven; Piano, Fabio; Snyder, Michael; Stein, Lincoln; Lieb, Jason D; Waterston, Robert H

2010-12-24

We systematically generated large-scale data sets to improve genome annotation for the nematode Caenorhabditis elegans, a key model organism. These data sets include transcriptome profiling across a developmental time course, genome-wide identification of transcription factor-binding sites, and maps of chromatin organization. From this, we created more complete and accurate gene models, including alternative splice forms and candidate noncoding RNAs. We constructed hierarchical networks of transcription factor-binding and microRNA interactions and discovered chromosomal locations bound by an unusually large number of transcription factors. Different patterns of chromatin composition and histone modification were revealed between chromosome arms and centers, with similarly prominent differences between autosomes and the X chromosome. Integrating data types, we built statistical models relating chromatin, transcription factor binding, and gene expression. Overall, our analyses ascribed putative functions to most of the conserved genome.

Synthesis of a zinc(II) complex with hexadentate N4S2 donor thioether ligand: X-ray structure, DNA binding study and DFT computation

NASA Astrophysics Data System (ADS)

Mondal, Apurba Sau; Jana, Mahendra Sekhar; Manna, Chandan Kumar; Naskar, Rahul; Mondal, Tapan Kumar

2018-07-01

A new zinc(II) complex, [Zn(L)](ClO4) with hexadentate N4S2 donor azo-thioether ligand (HL) was synthesized and characterized by several spectroscopic techniques. The structure was confirmed by single crystal X-ray analysis. The interaction of the complex with CT DNA was investigated by UV-vis method and binding constant is found to be 6.6 × 104 M-1. Competitive binding titration with ethidium bromide (EB) by fluorescence titration method reveals that the complex efficiently displaces EB from EB-DNA system and the Stern-Volmer dynamic quenching constant, Ksv is found to be 2.6 × 104 M-1. DFT and TDDFT calculations were carried out to interpret the electronic structure and electronic spectra of the complex.

Large-Scale Conformational Dynamics Control H5N1 Influenza Polymerase PB2 Binding to Importin α.

PubMed

Delaforge, Elise; Milles, Sigrid; Bouvignies, Guillaume; Bouvier, Denis; Boivin, Stephane; Salvi, Nicola; Maurin, Damien; Martel, Anne; Round, Adam; Lemke, Edward A; Jensen, Malene Ringkjøbing; Hart, Darren J; Blackledge, Martin

2015-12-09

Influenza A RNA polymerase complex is formed from three components, PA, PB1, and PB2. PB2 is independently imported into the nucleus prior to polymerase reconstitution. All crystallographic structures of the PB2 C-terminus (residues 536-759) reveal two globular domains, 627 and NLS, that form a tightly packed heterodimer. The molecular basis of the affinity of 627-NLS for importins remained unclear from these structures, apparently requiring large-scale conformational changes prior to importin binding. Using a combination of solution-state NMR, small-angle neutron scattering, small-angle X-ray scattering (SAXS), and Förster resonance energy transfer (FRET), we show that 627-NLS populates a temperature-dependent dynamic equilibrium between closed and open states. The closed state is stabilized by a tripartite salt bridge involving the 627-NLS interface and the linker, that becomes flexible in the open state, with 627 and NLS dislocating into a highly dynamic ensemble. Activation enthalpies and entropies associated with the rupture of this interface were derived from simultaneous analysis of temperature-dependent chemical exchange saturation transfer measurements, revealing a strong temperature dependence of both open-state population and exchange rate. Single-molecule FRET and SAXS demonstrate that only the open-form is capable of binding to importin α and that, upon binding, the 627 domain samples a dynamic conformational equilibrium in the vicinity of the C-terminus of importin α. This intrinsic large-scale conformational flexibility therefore enables 627-NLS to bind importin through conformational selection from a temperature-dependent equilibrium comprising both functional forms of the protein.

An affinity improved single-chain antibody from phage display of a library derived from monoclonal antibodies detects fumonisins by immunoassay.

PubMed

Hu, Zu-Quan; Li, He-Ping; Wu, Ping; Li, Ya-Bo; Zhou, Zhu-Qing; Zhang, Jing-Bo; Liu, Jin-Long; Liao, Yu-Cai

2015-03-31

Fumonisin B analogs, particularly FB1, FB2, and FB3, are major mycotoxins found in cereals. Single-chain fragment variable (scFv) antibodies represent a promising alternative immunoassay system. A phage-displayed antibody library derived from four monoclonal antibodies (mAbs) generated against FB1 was used to screen high binding affinity scFv antibodies; the best candidate was designated H2. Surface plasmon resonance measurements confirmed that the H2 scFv displayed a 82-fold higher binding affinity than its parent mAb. Direct competitive enzyme-linked immunosorbent assay demonstrated that the H2 antibody could competitively bind to free FB1, FB2, and FB3, with an IC50 of 0.11, 0.04, and 0.10 μM, respectively; it had no cross-reactivity to deoxynivalenol, nivalenol and aflatoxin. Validation assays with naturally contaminated samples revealed a linear relationship between the H2 antibody-based assay results and chemical analysis results, that could be expressed as y=1.7072x+5.5606 (R(2)=0.8883). Homology modeling of H2 revealed a favorable binding structure highly complementary to the three fumonisins. Molecular docking analyses suggested that the preferential binding of the H2 scFv to FB2 was due to the presence of a hydrogen radical in its R1 position, leading to a proper electrostatic matching and hydrophobic interaction. The H2 scFv antibody can be used for the rapid, accurate, and specific detection of fumonisin contamination in agricultural samples. Copyright © 2015 Elsevier B.V. All rights reserved.

Allosteric regulation of focal adhesion kinase by PIP₂ and ATP.

PubMed

Zhou, Jing; Bronowska, Agnieszka; Le Coq, Johanne; Lietha, Daniel; Gräter, Frauke

2015-02-03

Focal adhesion kinase (FAK) is a nonreceptor tyrosine kinase that regulates cell signaling, proliferation, migration, and development. A major mechanism of regulation of FAK activity is an intramolecular autoinhibitory interaction between two of its domains--the catalytic and FERM domains. Upon cell adhesion to the extracellular matrix, FAK is being translocated toward focal adhesion sites and activated. Interactions of FAK with phosphoinositide phosphatidylinsositol-4,5-bis-phosphate (PIP₂) are required to activate FAK. However, the molecular mechanism of the activation remains poorly understood. Recent fluorescence resonance energy transfer experiments revealed a closure of the FERM-kinase interface upon ATP binding, which is reversed upon additional binding of PIP₂. Here, we addressed the allosteric regulation of FAK by performing all-atom molecular-dynamics simulations of a FAK fragment containing the catalytic and FERM domains, and comparing the dynamics in the absence or presence of ATP and PIP₂. As a major conformational change, we observe a closing and opening motion upon ATP and additional PIP₂ binding, respectively, in good agreement with the fluorescence resonance energy transfer experiments. To reveal how the binding of the regulatory PIP₂ to the FERM F2 lobe is transduced to the very distant F1/N-lobe interface, we employed force distribution analysis. We identified a network of mainly charged residue-residue interactions spanning from the PIP₂ binding site to the distant interface between the kinase and FERM domains, comprising candidate residues for mutagenesis to validate the predicted mechanism of FAK activation. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Epitope mapping of the variable repetitive region with the MB antigen of Ureaplasma urealyticum.

PubMed Central

Zheng, X; Lau, K; Frazier, M; Cassell, G H; Watson, H L

1996-01-01

One of the major surface structures of Ureaplasma urealyticum recognized by antibodies of patients during infection is the MB antigen. Previously, we showed by Western blot (immunoblot) analysis that any one of the anti-MB monoclonal antibodies (MAbs) 3B1.5, 5B1.1, and 10C6.6 could block the binding of patient antibodies to MB. Subsequent DNA sequencing revealed that a unique six-amino-acid direct tandem repeat region composed the carboxy two-thirds of this antigen. In the present study, using antibody-reactive peptide scanning of this repeat region, we demonstrated that the amino acids defining the epitopes for MAbs 3B1.5 5B1.1 and 10C6.6 are EQP, GK, and KEQPA, respectively. Peptide scanning analysis of an infected patient's serum antibody response showed that the dominant epitope was defined by the sequence PAGK. Mapping of these continuous epitopes revealed overlap between all MAb and patient polyclonal antibody binding sites, thus explaining the ability of a single MAb to apparently block all polyclonal antibody binding sites. We also show that a single amino acid difference in the sequence of the repeats of serovars 3 and 14 accounts for the lack of reactivity with serovar 14 of two of the serovar 3-specific MAbs. Finally, the data demonstrate the need to obtain the sequences of the mba genes of all serovars before an effective serovar-specific antibody detection method can be developed. PMID:8914774

Structural comparison of four different antibodies interacting with human papillomavirus 16 and mechanisms of neutralization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guan, Jian; Bywaters, Stephanie M.; Brendle, Sarah A.

2015-09-15

Cryo-electron microscopy (cryo-EM) was used to solve the structures of human papillomavirus type 16 (HPV16) complexed with fragments of antibody (Fab) from three different neutralizing monoclonals (mAbs): H16.1A, H16.14J, and H263.A2. The structure-function analysis revealed predominantly monovalent binding of each Fab with capsid interactions that involved multiple loops from symmetry related copies of the major capsid protein. The residues identified in each Fab-virus interface map to a conformational groove on the surface of the capsomer. In addition to the known involvement of the FG and HI loops, the DE loop was also found to constitute the core of each epitope.more » Surprisingly, the epitope mapping also identified minor contributions by EF and BC loops. Complementary immunological assays included mAb and Fab neutralization. The specific binding characteristics of mAbs correlated with different neutralizing behaviors in pre- and post-attachment neutralization assays. - Highlights: • We present HPV16-Fab complexes from neutralizing mAbs: H16.1A, H16.14J, and H263.A2. • The structure-function analysis revealed predominantly monovalent binding of each mAb. • Capsid–Fab interactions involved multiple loops from symmetry related L1 proteins. • Besides the known FG and HI loops, epitope mapping also identified DE, EF, and BC loops. • Neutralizing assays complement the structures to show multiple neutralization mechanisms.« less

Serum proteomic analysis of extracorporeal shock wave therapy-enhanced diabetic wound healing in a streptozotocin-induced diabetes model.

PubMed

Yang, Ming-Yu; Chiang, Yuan-Cheng; Huang, Yu-Ting; Chen, Chien-Chang; Wang, Feng-Sheng; Wang, Ching-Jen; Kuo, Yur-Ren

2014-01-01

Previous studies have demonstrated that extracorporeal shock wave therapy has a significant positive effect on accelerating diabetic wound healing. However, the systemic effect after therapy is still unclear. This study investigated the plasma protein expression in the extracorporeal shock wave therapy group and diabetic controls using proteomic study. A dorsal skin defect (6 × 5 cm) in a streptozotocin-induced diabetic Wistar rat model was used. Diabetic rats receiving either no therapy or extracorporeal shock wave therapy after wounding were analyzed. The spots of interest were subjected to in-gel trypsin digestion and matrix-assisted laser desorption ionization time-of-flight mass spectrometry to elucidate the peptide mass fingerprints. The mass spectrometric characteristics of the identified proteins, including their theoretical isoelectric points, molecular weights, sequence coverage, and Mascot score, were analyzed. Protein expression was validated using immunohistochemical analysis of topical periwounding tissues. The proteomic study revealed that at days 3 and 10 after therapy rats had significantly higher abundance of haptoglobin and significantly lower levels of the vitamin D-binding protein precursor as compared with the diabetic controls. Immunohistochemical staining of topical periwounding tissue also revealed significant upregulation of haptoglobin and downregulation of vitamin D-binding protein expression in the extracorporeal shock wave therapy group, which was consistent with the systemic proteome study. Proteome analyses demonstrated an upregulation of haptoglobin and a downregulation of vitamin D-binding protein in extracorporeal shock wave therapy-enhanced diabetic wound healing.

Thermodynamic stability of carbonic anhydrase: measurements of binding affinity and stoichiometry using ThermoFluor.

PubMed

Matulis, Daumantas; Kranz, James K; Salemme, F Raymond; Todd, Matthew J

2005-04-05

ThermoFluor (a miniaturized high-throughput protein stability assay) was used to analyze the linkage between protein thermal stability and ligand binding. Equilibrium binding ligands increase protein thermal stability by an amount proportional to the concentration and affinity of the ligand. Binding constants (K(b)) were measured by examining the systematic effect of ligand concentration on protein stability. The precise ligand effects depend on the thermodynamics of protein stability: in particular, the unfolding enthalpy. An extension of current theoretical treatments was developed for tight binding inhibitors, where ligand effect on T(m) can also reveal binding stoichiometry. A thermodynamic analysis of carbonic anhydrase by differential scanning calorimetry (DSC) enabled a dissection of the Gibbs free energy of stability into enthalpic and entropic components. Under certain conditions, thermal stability increased by over 30 degrees C; the heat capacity of protein unfolding was estimated from the dependence of calorimetric enthalpy on T(m). The binding affinity of six sulfonamide inhibitors to two isozymes (human type 1 and bovine type 2) was analyzed by both ThermoFluor and isothermal titration calorimetry (ITC), resulting in a good correlation in the rank ordering of ligand affinity. This combined investigation by ThermoFluor, ITC, and DSC provides a detailed picture of the linkage between ligand binding and protein stability. The systematic effect of ligands on stability is shown to be a general tool to measure affinity.

Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

PubMed

Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

2017-03-17

Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

StWRKY8 transcription factor regulates benzylisoquinoline alkaloid pathway in potato conferring resistance to late blight.

PubMed

Yogendra, Kalenahalli N; Dhokane, Dhananjay; Kushalappa, Ajjamada C; Sarmiento, Felipe; Rodriguez, Ernesto; Mosquera, Teresa

2017-03-01

The resistance to late blight is either qualitative or quantitative in nature. Quantitative resistance is durable, but challenging due to polygenic inheritance. In the present study, the diploid potato genotypes resistant and susceptible to late blight, were profiled for metabolites. Tissue specific metabolite analysis of benzylisoquinoline alkaloids (BIAs) in response to pathogen infection revealed increased accumulation of morphinone, codeine-6-glucuronide and morphine-3-glucuronides. These BIAs are antimicrobial compounds and possibly involved in cell wall reinforcement, especially through cross-linking cell wall pectins. Quantitative reverse transcription-PCR studies revealed higher expressions of TyDC, NCS, COR-2 and StWRKY8 transcription factor genes, in resistant genotypes than in susceptible genotype, following pathogen inoculation. A luciferase transient expression assay confirmed the binding of the StWRKY8 TF to promoters of downstream genes, elucidating a direct regulatory role on BIAs biosynthetic genes. Sequence analysis of StWRKY8 in potato genotypes revealed polymorphism in the WRKY DNA binding domain in the susceptible genotype, which is important for the regulatory function of this gene. A complementation assay of StWRKY8 in Arabidopsis wrky33 mutant background was associated with decreased fungal biomass. In conclusion, StWRKY8 regulates the biosynthesis of BIAs that are both antimicrobial and reinforce cell walls to contain the pathogen to initial infection. Copyright © 2017 Elsevier B.V. All rights reserved.

C/EBPα Expression is Partially Regulated by C/EBPβ in Response to DNA Damage and C/EBPα Deficient Fibroblasts Display an Impaired G1 Checkpoint

PubMed Central

Ranjan, Rakesh; Thompson, Elizabeth A.; Yoon, Kyungsil; Smart, Robert C.

2009-01-01

We observed that C/EBPα is highly inducible in primary fibroblasts by DNA damaging agents that induce strand breaks, alkylate and crosslink DNA as well as those that produce bulky DNA lesions. Fibroblasts deficient in C/EBPα (C/EBPα-/-) display an impaired G1 checkpoint as evidenced by inappropriate entry into S-phase in response to DNA damage and these cells also display an enhanced G1 to S transition in response to mitogens. The induction of C/EBPα by DNA damage in fibroblasts does not require p53. EMSA analysis of nuclear extracts prepared from UVB- and MNNG-treated fibroblasts revealed increased binding of C/EBPβ to a C/EBP consensus sequence and ChIP analysis revealed increased C/EBPβ binding to the C/EBPα promoter. To determine whether C/EBPβ has a role in the regulation of C/EBPα we treated C/EBPβ-/- fibroblasts with UVB or MNNG. We observed C/EBPα induction was impaired in both UVB- and MNNG- treated C/EBPβ-/- fibroblasts. Our study reveals a novel role for C/EBPβ in the regulation of C/EBPα in response to DNA damage and provides definitive genetic evidence that C/EBPα has a critical role in the DNA damage G1 checkpoint. PMID:19581927

Analysis of model replication origins in Drosophila reveals new aspects of the chromatin landscape and its relationship to origin activity and the prereplicative complex

PubMed Central

Liu, Jun; McConnell, Kristopher; Dixon, Michael; Calvi, Brian R.

2012-01-01

Epigenetic regulation exerts a major influence on origins of DNA replication during development. The mechanisms for this regulation, however, are poorly defined. We showed previously that acetylation of nucleosomes regulates the origins that mediate developmental gene amplification during Drosophila oogenesis. Here we show that developmental activation of these origins is associated with acetylation of multiple histone lysines. Although these modifications are not unique to origin loci, we find that the level of acetylation is higher at the active origins and quantitatively correlated with the number of times these origins initiate replication. All of these acetylation marks were developmentally dynamic, rapidly increasing with origin activation and rapidly declining when the origins shut off and neighboring promoters turn on. Fine-scale analysis of the origins revealed that both hyperacetylation of nucleosomes and binding of the origin recognition complex (ORC) occur in a broad domain and that acetylation is highest on nucleosomes adjacent to one side of the major site of replication initiation. It was surprising to find that acetylation of some lysines depends on binding of ORC to the origin, suggesting that multiple histone acetyltransferases may be recruited during origin licensing. Our results reveal new insights into the origin epigenetic landscape and lead us to propose a chromatin switch model to explain the coordination of origin and promoter activity during development. PMID:22049023

Identification, Expression Profiling and Fluorescence-Based Binding Assays of a Chemosensory Protein Gene from the Western Flower Thrips, Frankliniella occidentalis

PubMed Central

Zhang, Zhi-Ke; Lei, Zhong-Ren

2015-01-01

Using RT-PCR and RACE-PCR strategies, we cloned and identified a new chemosensory protein (FoccCSP) from the Western flower thrips, Frankliniella occidentalis, a species for which no chemosensory protein (CSP) has yet been identified. The FoccCSP gene contains a 387 bp open-reading frame encoding a putative protein of 128 amino acids with a molecular weight of 14.51 kDa and an isoelectric point of 5.41. The deduced amino acid sequence contains a putative signal peptide of 19 amino acid residues at the N-terminus, as well as the typical four—cysteine signature found in other insect CSPs. As FoccCSP is from a different order of insect than other known CSPs, the GenBank FoccCSP homolog showed only 31-50% sequence identity with them. A neighbor-joining tree was constructed and revealed that FoccCSP is in a group with CSPs from Homopteran insects (e.g., AgosCSP4, AgosCSP10, ApisCSP, and NlugCSP9), suggesting that these genes likely developed from a common ancestral gene. The FoccCSP gene expression profile of different tissues and development stages was measured by quantitative real-time PCR. The results of this analysis revealed this gene is predominantly expressed in the antennae and also highly expressed in the first instar nymph, suggesting a function for FoccCSP in olfactory reception and in particular life activities during the first instar nymph stage. We expressed recombinant FoccCSP protein in a prokaryotic expression system and purified FoccCSP protein by affinity chromatography using a Ni-NTA-Sepharose column. Using N-phenyl-1-naphthylamine (1-NPN) as a fluorescent probe in fluorescence-based competitive binding assay, we determined the binding affinities of 19 volatile substances for FoccCSP protein. This analysis revealed that anisic aldehyde, geraniol and methyl salicylate have high binding affinities for FoccCSP, with KD values of 10.50, 15.35 and 35.24 μM, respectively. Thus, our study indicates that FoccCSP may play an important role in regulating the development of the first instar nymph and mediate F. occidentalis host recognition. PMID:25635391

Identification, expression profiling and fluorescence-based binding assays of a chemosensory protein gene from the Western flower thrips, Frankliniella occidentalis.

PubMed

Zhang, Zhi-Ke; Lei, Zhong-Ren

2015-01-01

Using RT-PCR and RACE-PCR strategies, we cloned and identified a new chemosensory protein (FoccCSP) from the Western flower thrips, Frankliniella occidentalis, a species for which no chemosensory protein (CSP) has yet been identified. The FoccCSP gene contains a 387 bp open-reading frame encoding a putative protein of 128 amino acids with a molecular weight of 14.51 kDa and an isoelectric point of 5.41. The deduced amino acid sequence contains a putative signal peptide of 19 amino acid residues at the N-terminus, as well as the typical four-cysteine signature found in other insect CSPs. As FoccCSP is from a different order of insect than other known CSPs, the GenBank FoccCSP homolog showed only 31-50% sequence identity with them. A neighbor-joining tree was constructed and revealed that FoccCSP is in a group with CSPs from Homopteran insects (e.g., AgosCSP4, AgosCSP10, ApisCSP, and NlugCSP9), suggesting that these genes likely developed from a common ancestral gene. The FoccCSP gene expression profile of different tissues and development stages was measured by quantitative real-time PCR. The results of this analysis revealed this gene is predominantly expressed in the antennae and also highly expressed in the first instar nymph, suggesting a function for FoccCSP in olfactory reception and in particular life activities during the first instar nymph stage. We expressed recombinant FoccCSP protein in a prokaryotic expression system and purified FoccCSP protein by affinity chromatography using a Ni-NTA-Sepharose column. Using N-phenyl-1-naphthylamine (1-NPN) as a fluorescent probe in fluorescence-based competitive binding assay, we determined the binding affinities of 19 volatile substances for FoccCSP protein. This analysis revealed that anisic aldehyde, geraniol and methyl salicylate have high binding affinities for FoccCSP, with KD values of 10.50, 15.35 and 35.24 μM, respectively. Thus, our study indicates that FoccCSP may play an important role in regulating the development of the first instar nymph and mediate F. occidentalis host recognition.

Platelets Contain Tissue Factor Pathway Inhibitor-2 Derived from Megakaryocytes and Inhibits Fibrinolysis*

PubMed Central

Vadivel, Kanagasabai; Ponnuraj, Sathya-Moorthy; Kumar, Yogesh; Zaiss, Anne K.; Bunce, Matthew W.; Camire, Rodney M.; Wu, Ling; Evseenko, Denis; Herschman, Harvey R.; Bajaj, Madhu S.; Bajaj, S. Paul

2014-01-01

Tissue factor pathway inhibitor-2 (TFPI-2) is a homologue of TFPI-1 and contains three Kunitz-type domains and a basic C terminus region. The N-terminal domain of TFPI-2 is the only inhibitory domain, and it inhibits plasma kallikrein, factor XIa, and plasmin. However, plasma TFPI-2 levels are negligible (≤20 pm) in the context of influencing clotting or fibrinolysis. Here, we report that platelets contain significant amounts of TFPI-2 derived from megakaryocytes. We employed RT-PCR, Western blotting, immunohistochemistry, and confocal microscopy to determine that platelets, MEG-01 megakaryoblastic cells, and bone marrow megakaryocytes contain TFPI-2. ELISA data reveal that TFPI-2 binds factor V (FV) and partially B-domain-deleted FV (FV-1033) with Kd ∼9 nm and binds FVa with Kd ∼100 nm. Steady state analysis of surface plasmon resonance data reveal that TFPI-2 and TFPI-1 bind FV-1033 with Kd ∼36–48 nm and bind FVa with Kd ∼252–456 nm. Further, TFPI-1 (but not TFPI-1161) competes with TFPI-2 in binding to FV. These data indicate that the C-terminal basic region of TFPI-2 is similar to that of TFPI-1 and plays a role in binding to the FV B-domain acidic region. Using pull-down assays and Western blots, we show that TFPI-2 is associated with platelet FV/FVa. TFPI-2 (∼7 nm) in plasma of women at the onset of labor is also, in part, associated with FV. Importantly, TFPI-2 in platelets and in plasma of pregnant women inhibits FXIa and tissue-type plasminogen activator-induced clot fibrinolysis. In conclusion, TFPI-2 in platelets from normal or pregnant subjects and in plasma from pregnant women binds FV/Va and regulates intrinsic coagulation and fibrinolysis. PMID:25262870

A serum response factor-dependent transcriptional regulatory program identifies distinct smooth muscle cell sublineages.

PubMed Central

Kim, S; Ip, H S; Lu, M M; Clendenin, C; Parmacek, M S

1997-01-01

The SM22alpha promoter has been used as a model system to define the molecular mechanisms that regulate smooth muscle cell (SMC) specific gene expression during mammalian development. The SM22alpha gene is expressed exclusively in vascular and visceral SMCs during postnatal development and is transiently expressed in the heart and somites during embryogenesis. Analysis of the SM22alpha promoter in transgenic mice revealed that 280 bp of 5' flanking sequence is sufficient to restrict expression of the lacZ reporter gene to arterial SMCs and the myotomal component of the somites. DNase I footprint and electrophoretic mobility shift analyses revealed that the SM22alpha promoter contains six nuclear protein binding sites (designated smooth muscle elements [SMEs] -1 to -6, respectively), two of which bind serum response factor (SRF) (SME-1 and SME-4). Mutational analyses demonstrated that a two-nucleotide substitution that selectively eliminates SRF binding to SME-4 decreases SM22alpha promoter activity in arterial SMCs by approximately 90%. Moreover, mutations that abolish binding of SRF to SME-1 and SME-4 or mutations that eliminate each SME-3 binding activity totally abolished SM22alpha promoter activity in the arterial SMCs and somites of transgenic mice. Finally, we have shown that a multimerized copy of SME-4 (bp -190 to -110) when linked to the minimal SM22alpha promoter (bp -90 to +41) is necessary and sufficient to direct high-level transcription in an SMC lineage-restricted fashion. Taken together, these data demonstrate that distinct transcriptional regulatory programs control SM22alpha gene expression in arterial versus visceral SMCs. Moreover, these data are consistent with a model in which combinatorial interactions between SRF and other transcription factors that bind to SME-4 (and that bind directly to SRF) activate transcription of the SM22alpha gene in arterial SMCs. PMID:9121477

Crystallographic Analysis Reveals a Novel Second Binding Site for Trimethoprim in Active Site Double Mutants of Human Dihydrofolate Reductase†,‡

PubMed Central

Cody, Vivian; Pace, Jim; Piraino, Jennifer; Queener, Sherry F.

2011-01-01

In order to produce a more potent replacement for trimethoprim (TMP) used as a therapy for Pneumocystis pneumonia and targets dihydrofolate reductase from Pneumocystis jirovecii (pjDHFR), it is necessary to understand the determinants of potency and selectivity against DHFR from the mammalian host and fungal pathogen cells. To this end, active site residues in human (h)DHFR were replaced with those from pjDHFR. Structural data are reported for two complexes of TMP with the double mutants Gln35Ser/Asn64Phe (Q35S/N64F) and Gln35Lys/Asn64Phe (Q35K/N64F) of hDHFR that unexpectedly show evidence for the binding of two molecules of TMP: one molecule that binds in the normal folate binding site and the second molecule that binds in a novel subpocket site such that the mutated residue Phe64 is involved in van der Waals contacts to the trimethoxyphenyl ring of the second TMP molecule. Kinetic data for the binding of TMP to hDHFR and pjDHFR reveal an 84-fold selectivity of TMP against pjDHFR (Ki 49 nM) compared to hDHFR (Ki 4093 nM). Two mutants that contain one substitution from pj- and one from the closely related Pneumocystis carinii DHFR (pcDHFR) (Q35K/N64F and Q35S/N64F) show Ki values of 593 and 617 nM, respectively; these Ki values are well above both the Ki for pjDHFR and are similar to pcDHFR (Q35K/N64F) and Q35S/N64F) (305 nM). These results suggest that active site residues 35 and 64 play key roles in determining selectivity for pneumocystis DHFR, but that other residues contribute to the unique binding of inhibitors to these enzymes. PMID:21684339

Inhibition of acetylcholinesterase by two genistein derivatives: kinetic analysis, molecular docking and molecular dynamics simulation.

PubMed

Fang, Jiansong; Wu, Ping; Yang, Ranyao; Gao, Li; Li, Chao; Wang, Dongmei; Wu, Song; Liu, Ai-Lin; Du, Guan-Hua

2014-12-01

In this study two genistein derivatives (G1 and G2) are reported as inhibitors of acetylcholinesterase (AChE) and butyrylcholinesterase (BuChE), and differences in the inhibition of AChE are described. Although they differ in structure by a single methyl group, the inhibitory effect of G1 (IC50=264 nmol/L) on AChE was 80 times stronger than that of G2 (IC50=21,210 nmol/L). Enzyme-kinetic analysis, molecular docking and molecular dynamics (MD) simulations were conducted to better understand the molecular basis for this difference. The results obtained by kinetic analysis demonstrated that G1 can interact with both the catalytic active site and peripheral anionic site of AChE. The predicted binding free energies of two complexes calculated by the molecular mechanics/generalized born surface area (MM/GBSA) method were consistent with the experimental data. The analysis of the individual energy terms suggested that a difference between the net electrostatic contributions (ΔE ele+ΔG GB) was responsible for the binding affinities of these two inhibitors. Additionally, analysis of the molecular mechanics and MM/GBSA free energy decomposition revealed that the difference between G1 and G2 originated from interactions with Tyr124, Glu292, Val294 and Phe338 of AChE. In conclusion, the results reveal significant differences at the molecular level in the mechanism of inhibition of AChE by these structurally related compounds.

Integrative Analysis Reveals Regulatory Programs in Endometriosis

PubMed Central

Yang, Huan; Kang, Kai; Cheng, Chao; Mamillapalli, Ramanaiah; Taylor, Hugh S.

2015-01-01

Endometriosis is a common gynecological disease found in approximately 10% of reproductive-age women. Gene expression analysis has been performed to explore alterations in gene expression associated with endometriosis; however, the underlying transcription factors (TFs) governing such expression changes have not been investigated in a systematic way. In this study, we propose a method to integrate gene expression with TF binding data and protein–protein interactions to construct an integrated regulatory network (IRN) for endometriosis. The IRN has shown that the most regulated gene in endometriosis is RUNX1, which is targeted by 14 of 26 TFs also involved in endometriosis. Using 2 published cohorts, GSE7305 (Hover, n = 20) and GSE7307 (Roth, n = 36) from the Gene Expression Omnibus database, we identified a network of TFs, which bind to target genes that are differentially expressed in endometriosis. Enrichment analysis based on the hypergeometric distribution allowed us to predict the TFs involved in endometriosis (n = 40). This included known TFs such as androgen receptor (AR) and critical factors in the pathology of endometriosis, estrogen receptor α, and estrogen receptor β. We also identified several new ones from which we selected FOXA2 and TFAP2C, and their regulation was confirmed by quantitative real-time polymerase chain reaction and immunohistochemistry (IHC). Further, our analysis revealed that the function of AR and p53 in endometriosis is regulated by posttranscriptional changes and not by differential gene expression. Our integrative analysis provides new insights into the regulatory programs involved in endometriosis. PMID:26134036

Contrasting effects of photochemical and microbial degradation on Cu(II) binding with fluorescent DOM from different origins.

PubMed

Xu, Huacheng; Guan, Dong-Xing; Zou, Li; Lin, Hui; Guo, Laodong

2018-08-01

Effects of photochemical and microbial degradation on variations in composition and molecular-size of dissolved organic matter (DOM) from different sources (algal and soil) and the subsequent influence on Cu(II) binding were investigated using UV-Vis, fluorescence excitation-emission matrices coupled with parallel factor analysis, flow field-flow fractionation (FlFFF), and metal titration. The degradation processes resulted in an initial rapid decline in the bulk dissolved organic carbon and chromophoric and fluorescent DOM components, followed by a small or little decrease. Specifically, photochemical reaction decreased the aromaticity, humification and apparent molecular weights of all DOM samples, whereas a reverse trend was observed during microbial degradation. The FlFFF fractograms revealed that coagulation of both protein- and humic-like DOM induced an increase in molecular weights for algal-DOM, while the molecular weight enhancement for allochthonous soil samples was mainly attributed to the self-assembly of humic-like components. The Cu(II) binding capacity of algal-derived humic-like and fulvic-like DOM consistently increased during photo- and bio-degradation, while the soil-derived DOM exhibited a slight decline in Cu(II) binding capacity during photo-degradation but a substantial increase during microbial degradation, indicating source- and degradation-dependent metal binding heterogeneities. Pearson correlation analysis demonstrated that the Cu(II) binding potential was mostly related with aromaticity and molecular size for allochthonous soil-derived DOM, but was regulated by both DOM properties and specific degradation processes for autochthonous algal-derived DOM. This study highlighted the coupling role of inherent DOM properties and external environmental processes in regulating metal binding, and provided new insights into metal-DOM interactions and the behavior and fate of DOM-bound metals in aquatic environments. Copyright © 2018 Elsevier Ltd. All rights reserved.