Identification of RNAIII-binding proteins in Staphylococcus aureus using tethered RNAs and streptavidin aptamers based pull-down assay.

PubMed

Zhang, Xu; Zhu, Qing; Tian, Tian; Zhao, Changlong; Zang, Jianye; Xue, Ting; Sun, Baolin

2015-05-15

It has been widely recognized that small RNAs (sRNAs) play important roles in physiology and virulence control in bacteria. In Staphylococcus aureus, many sRNAs have been identified and some of them have been functionally studied. Since it is difficult to identify RNA-binding proteins (RBPs), very little has been known about the RBPs in S. aureus, especially those associated with sRNAs. Here we adopted a tRNA scaffold streptavidin aptamer based pull-down assay to identify RBPs in S. aureus. The tethered RNA was successfully captured by the streptavidin magnetic beads, and proteins binding to RNAIII were isolated and analyzed by mass spectrometry. We have identified 81 proteins, and expressed heterologously 9 of them in Escherichia coli. The binding ability of the recombinant proteins with RNAIII was further analyzed by electrophoresis mobility shift assay, and the result indicates that proteins CshA, RNase J2, Era, Hu, WalR, Pyk, and FtsZ can bind to RNAIII. This study suggests that some proteins can bind to RNA III in S. aureus, and may be involved in RNA III function. And tRSA based pull-down assay is an effective method to search for RBPs in bacteria, which should facilitate the identification and functional study of RBPs in diverse bacterial species.

A magnetic bead-based ligand binding assay to facilitate human kynurenine 3-monooxygenase drug discovery.

PubMed

Wilson, Kris; Mole, Damian J; Homer, Natalie Z M; Iredale, John P; Auer, Manfred; Webster, Scott P

2015-02-01

Human kynurenine 3-monooxygenase (KMO) is emerging as an important drug target enzyme in a number of inflammatory and neurodegenerative disease states. Recombinant protein production of KMO, and therefore discovery of KMO ligands, is challenging due to a large membrane targeting domain at the C-terminus of the enzyme that causes stability, solubility, and purification difficulties. The purpose of our investigation was to develop a suitable screening method for targeting human KMO and other similarly challenging drug targets. Here, we report the development of a magnetic bead-based binding assay using mass spectrometry detection for human KMO protein. The assay incorporates isolation of FLAG-tagged KMO enzyme on protein A magnetic beads. The protein-bound beads are incubated with potential binding compounds before specific cleavage of the protein-compound complexes from the beads. Mass spectrometry analysis is used to identify the compounds that demonstrate specific binding affinity for the target protein. The technique was validated using known inhibitors of KMO. This assay is a robust alternative to traditional ligand-binding assays for challenging protein targets, and it overcomes specific difficulties associated with isolating human KMO. © 2014 Society for Laboratory Automation and Screening.

Development and validation of an LC-ESI-MS/MS method for the quantification of D-84, reboxetine and citalopram for their use in MS Binding Assays addressing the monoamine transporters hDAT, hSERT and hNET.

PubMed

Neiens, Patrick; De Simone, Angela; Ramershoven, Anna; Höfner, Georg; Allmendinger, Lars; Wanner, Klaus T

2018-03-03

MS Binding Assays represent a label-free alternative to radioligand binding assays. In this study, we present an LC-ESI-MS/MS method for the quantification of (R,R)-4-(2-benzhydryloxyethyl)-1-(4-fluorobenzyl)piperidin-3-ol [(R,R)-D-84, (R,R)-1], (S,S)-reboxetine [(S,S)-2], and (S)-citalopram [(S)-3] employed as highly selective nonlabeled reporter ligands in MS Binding Assays addressing the dopamine [DAT, (R,R)-D-84], norepinephrine [NET, (S,S)-reboxetine] and serotonin transporter [SERT, (S)-citalopram], respectively. The developed LC-ESI-MS/MS method uses a pentafluorphenyl stationary phase in combination with a mobile phase composed of acetonitrile and ammonium formate buffer for chromatography and a triple quadrupole mass spectrometer in the multiple reaction monitoring mode for mass spectrometric detection. Quantification is based on deuterated derivatives of all three analytes serving as internal standards. The established LC-ESI-MS/MS method enables fast, robust, selective and highly sensitive quantification of all three reporter ligands in a single chromatographic run. The method was validated according to the Center for Drug Evaluation and Research (CDER) guideline for bioanalytical method validation regarding selectivity, accuracy, precision, calibration curve and sensitivity. Finally, filtration-based MS Binding Assays were performed for all three monoamine transporters based on this LC-ESI-MS/MS quantification method as read out. The affinities determined in saturation experiments for (R,R)-D-84 toward hDAT, for (S,S)-reboxetine toward hNET, and for (S)-citalopram toward hSERT, respectively, were in good accordance with results from literature, clearly demonstrating that the established MS Binding Assays have the potential to be an efficient alternative to radioligand binding assays widely used for this purpose so far. Copyright © 2018 John Wiley & Sons, Ltd.

Lectin binding assays for in-process monitoring of sialylation in protein production.

PubMed

Xu, Weiduan; Chen, Jianmin; Yamasaki, Glenn; Murphy, John E; Mei, Baisong

2010-07-01

Many therapeutic proteins require appropriate glycosylation for their biological activities and plasma half life. Coagulation factor VIII (FVIII) is a glycoprotein which has extensive post-translational modification by N-linked glycosylation. The terminal sialic acid in the N-linked glycans of FVIII is required for maximal circulatory half life. The extent of FVIII sialylation can be determined by high pH anion-exchange chromatography coupled with a pulse electrochemical detector (HPAEC-PED), but this requires a large amount of purified protein. Using FVIII as a model, the objective of the present study was to develop assays that enable detection and prediction of sialylation deficiency at an early stage in the process and thus prevent downstream product quality excursions. Lectin ECA (Erythrina Cristagalli) binds to unsialylated Galbeta1-4 GlcNAc and the ECA-binding level (i.e., terminal Gal(beta1-4) exposure) is inversely proportional to the level of sialylation. By using ECA, a cell-based assay was developed to measure the global sialylation profile in FVIII producing cells. To examine the Galbeta1-4 exposure on the FVIII molecule in bioreactor tissue culture fluid (TCF), an ELISA-based ECA-FVIII binding assay was developed. The ECA-binding specificity in both assays was assessed by ECA-specific sugar inhibitors and neuraminidase digestion. The ECA-binding specificity was also independently confirmed by a ST3GAL4 siRNA knockdown experiment. To establish the correlation between Galbeta1-4 exposure and the HPAEC-PED determined FVIII sialylation value, the FVIII containing bioreactor TCF and the purified FVIII samples were tested with ECA ELISA binding assay. The results indicated an inverse correlation between ECA binding and the corresponding HPAEC-PED sialylation value. The ECA-binding assays are cost effective and can be rapidly performed, thereby making them effective for in-process monitoring of protein sialylation.

Development of rapid and sensitive high throughput pharmacologic assays for marine phycotoxins.

PubMed

Van Dolah, F M; Finley, E L; Haynes, B L; Doucette, G J; Moeller, P D; Ramsdell, J S

1994-01-01

The lack of rapid, high throughput assays is a major obstacle to many aspects of research on marine phycotoxins. Here we describe the application of microplate scintillation technology to develop high throughput assays for several classes of marine phycotoxin based on their differential pharmacologic actions. High throughput "drug discovery" format microplate receptor binding assays developed for brevetoxins/ciguatoxins and for domoic acid are described. Analysis for brevetoxins/ciguatoxins is carried out by binding competition with [3H] PbTx-3 for site 5 on the voltage dependent sodium channel in rat brain synaptosomes. Analysis of domoic acid is based on binding competition with [3H] kainic acid for the kainate/quisqualate glutamate receptor using frog brain synaptosomes. In addition, a high throughput microplate 45Ca flux assay for determination of maitotoxins is described. These microplate assays can be completed within 3 hours, have sensitivities of less than 1 ng, and can analyze dozens of samples simultaneously. The assays have been demonstrated to be useful for assessing algal toxicity and for assay-guided purification of toxins, and are applicable to the detection of biotoxins in seafood.

Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

PubMed Central

2015-01-01

The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

Tissue Specific and Hormonal Regulation of Gene Expression

DTIC Science & Technology

1997-08-01

interference assays were performed. These assays identify DNA bases that, when modified, interfere with the binding of the nuclear factor to the hCRH promoter...thymidine residues. The DNA bases that when modified affected the binding of the protein are noted with arrows, and their location in the hCRH...indicated. B. Methylation interference. The fragments were partially methylated using dimethyl sulfate. The DNA bases that when modified affected the

Development of an enzyme-linked immunosorbent assay and a beta-1 adrenergic receptor-based assay for monitoring the drug atenolol.

PubMed

Sapir, A; Shalev, A Hariton; Skalka, N; Bronshtein, A; Altstein, M

2013-03-01

Two approaches for monitoring atenolol (ATL) were applied: an immunochemical assay and a competitive-binding assay, based on the interaction between ATL and its target receptor, β1 adrenergic receptor (β1AR). Polyclonal antibodies (Abs) for ATL were generated, and a highly specific microplate immunochemical assay, that is, an enzyme-linked immunosorbent assay (ELISA), for its detection was developed. The ATL ELISA exhibited I50 and limit of detection (I20) values of 0.15 ± 0.048 and 0.032 ± 0.016 ng/ml, respectively, and the Abs did not cross-react with any of the tested beta-blocker drugs. Furthermore, a human β1AR (h-β1AR) was stably expressed in Spodoptera frugiperda cells (Sf9). The receptor was employed to develop a competitive-binding assay that monitored binding of ATL in the presence of isoproteranol by quantification of secondary messenger, cyclic adenosine monophosphate (cAMP), levels in the transfected cells. The assay showed that the recombinant h-β1AR was functional, could bind the agonistic ligand isoproterenol as well as the antagonist ATL, as indicated by a dose-dependent elevation of cAMP in the presence of isoproteranol, and decrease after ATL addition. The highly efficient and sensitive ELISA and the receptor assay represent two methods suitable for efficient and cost-effective large-scale, high-throughput monitoring of ATL in environmental, agricultural, and biological samples. Copyright © 2012 SETAC.

A new assay format for NF-kappaB based on a DNA triple helix and a fluorescence resonance energy transfer.

PubMed

Altevogt, Dominik; Hrenn, Andrea; Kern, Claudia; Clima, Lilia; Bannwarth, Willi; Merfort, Irmgard

2009-10-07

Herein we report a feasibility study for a new concept to detect DNA binding protein NF-kappaB based on a DNA triple helix formation in combination with a fluorescence resonance energy transfer (FRET). The new principle avoids expensive antibodies and radioactivity and might have implications for assays of other DNA binding proteins.

Automated data processing and radioassays.

PubMed

Samols, E; Barrows, G H

1978-04-01

Radioassays include (1) radioimmunoassays, (2) competitive protein-binding assays based on competition for limited antibody or specific binding protein, (3) immunoradiometric assay, based on competition for excess labeled antibody, and (4) radioreceptor assays. Most mathematical models describing the relationship between labeled ligand binding and unlabeled ligand concentration have been based on the law of mass action or the isotope dilution principle. These models provide useful data reduction programs, but are theoretically unfactory because competitive radioassay usually is not based on classical dilution principles, labeled and unlabeled ligand do not have to be identical, antibodies (or receptors) are frequently heterogenous, equilibrium usually is not reached, and there is probably steric and cooperative influence on binding. An alternative, more flexible mathematical model based on the probability or binding collisions being restricted by the surface area of reactive divalent sites on antibody and on univalent antigen has been derived. Application of these models to automated data reduction allows standard curves to be fitted by a mathematical expression, and unknown values are calculated from binding data. The vitrues and pitfalls are presented of point-to-point data reduction, linear transformations, and curvilinear fitting approaches. A third-order polynomial using the square root of concentration closely approximates the mathematical model based on probability, and in our experience this method provides the most acceptable results with all varieties of radioassays. With this curvilinear system, linear point connection should be used between the zero standard and the beginning of significant dose response, and also towards saturation. The importance is stressed of limiting the range of reported automated assay results to that portion of the standard curve that delivers optimal sensitivity. Published methods for automated data reduction of Scatchard plots for radioreceptor assay are limited by calculation of a single mean K value. The quality of the input data is generally the limiting factor in achieving good precision with automated as it is with manual data reduction. The major advantages of computerized curve fitting include: (1) handling large amounts of data rapidly and without computational error; (2) providing useful quality-control data; (3) indicating within-batch variance of the test results; (4) providing ongoing quality-control charts and between assay variance.

Advantages and application of label-free detection assays in drug screening.

PubMed

Cunningham, Brian T; Laing, Lance G

2008-08-01

Adoption is accelerating for a new family of label-free optical biosensors incorporated into standard format microplates owing to their ability to enable highly sensitive detection of small molecules, proteins and cells for high-throughput drug discovery applications. Label-free approaches are displacing other detection technologies owing to their ability to provide simple assay procedures for hit finding/validation, accessing difficult target classes, screening the interaction of cells with drugs and analyzing the affinity of small molecule inhibitors to target proteins. This review describes several new drug discovery applications that are under development for microplate-based photonic crystal optical biosensors and the key issues that will drive adoption of the technology. Microplate-based optical biosensors are enabling a variety of cell-based assays, inhibition assays, protein-protein binding assays and protein-small molecule binding assays to be performed with high-throughput and high sensitivity.

Development of a Surface Plasmon Resonance Assay for the Characterization of Small-Molecule Binding Kinetics and Mechanism of Binding to Kynurenine 3-Monooxygenase.

PubMed

Poda, Suresh B; Kobayashi, Masakazu; Nachane, Ruta; Menon, Veena; Gandhi, Adarsh S; Budac, David P; Li, Guiying; Campbell, Brian M; Tagmose, Lena

2015-10-01

Kynurenine 3-monooxygenase (KMO), a pivotal enzyme in the kynurenine pathway, was identified as a potential therapeutic target for treating neurodegenerative and psychiatric disorders. In this article, we describe a surface plasmon resonance (SPR) assay that delivers both kinetics and the mechanism of binding (MoB) data, enabling a detailed characterization of KMO inhibitors for the enzyme in real time. SPR assay development included optimization of the protein construct and the buffer conditions. The stability and inhibitor binding activity of the immobilized KMO were significantly improved when the experiments were performed at 10°C using a buffer containing 0.05% n-dodecyl-β-d-maltoside (DDM) as the detergent. The KD values of the known KMO inhibitors (UPF648 and RO61-8048) from the SPR assay were in good accordance with the biochemical LC/MS/MS assay. Also, the SPR assay was able to differentiate the binding kinetics (k(a) and k(d)) of the selected unknown KMO inhibitors. For example, the inhibitors that showed comparable IC50 values in the LC/MS/MS assay displayed differences in their residence time (τ = 1/k(d)) in the SPR assay. To better define the MoB of the inhibitors to KMO, an SPR-based competition assay was developed, which demonstrated that both UPF648 and RO61-8048 bound to the substrate-binding site. These results demonstrate the potential of the SPR assay for characterizing the affinity, the kinetics, and the MoB profiles of the KMO inhibitors.

ApoHRP-based assay to measure intracellular regulatory heme.

PubMed

Atamna, Hani; Brahmbhatt, Marmik; Atamna, Wafa; Shanower, Gregory A; Dhahbi, Joseph M

2015-02-01

The majority of the heme-binding proteins possess a "heme-pocket" that stably binds to heme. Usually known as housekeeping heme-proteins, they participate in a variety of metabolic reactions (e.g., catalase). Heme also binds with lower affinity to the "Heme-Regulatory Motifs" (HRM) in specific regulatory proteins. This type of heme binding is known as exchangeable or regulatory heme (RH). Heme binding to HRM proteins regulates their function (e.g., Bach1). Although there are well-established methods for assaying total cellular heme (e.g., heme-proteins plus RH), currently there is no method available for measuring RH independent of the total heme (TH). The current study describes and validates a new method to measure intracellular RH. This method is based on the reconstitution of apo-horseradish peroxidase (apoHRP) with heme to form holoHRP. The resulting holoHRP activity is then measured with a colorimetric substrate. The results show that apoHRP specifically binds RH but not with heme from housekeeping heme-proteins. The RH assay detects intracellular RH. Furthermore, using conditions that create positive (hemin) or negative (N-methyl protoporphyrin IX) controls for heme in normal human fibroblasts (IMR90), the RH assay shows that RH is dynamic and independent of TH. We also demonstrated that short-term exposure to subcytotoxic concentrations of lead (Pb), mercury (Hg), or amyloid-β (Aβ) significantly alters intracellular RH with little effect on TH. In conclusion the RH assay is an effective assay to investigate intracellular RH concentration and demonstrates that RH represents ∼6% of total heme in IMR90 cells.

Image-based ELISA on an activated polypropylene microtest plate--a spectrophotometer-free low cost assay technique.

PubMed

Parween, Shahila; Nahar, Pradip

2013-10-15

In this communication, we report ELISA technique on an activated polypropylene microtest plate (APPµTP) as an illustrative example of a low cost diagnostic assay. Activated test zone in APPµTP binds a capture biomolecule through covalent linkage thereby, eliminating non-specific binding often prevalent in absorption based techniques. Efficacy of APPµTP is demonstrated by detecting human immunoglobulin G (IgG), human immunoglobulin E (IgE) and Aspergillus fumigatus antibody in patient's sera. Detection is done by taking the image of the assay solution by a desktop scanner and analyzing the color of the image. Human IgE quantification by color saturation in the image-based assay shows excellent correlation with absorbance-based assay (Pearson correlation coefficient, r=0.992). Significance of the relationship is seen from its p value which is 4.087e-11. Performance of APPµTP is also checked with respect to microtiter plate and paper-based ELISA. APPµTP can quantify an analyte as precisely as in microtiter plate with insignificant non-specific binding, a necessary prerequisite for ELISA assay. In contrast, paper-ELISA shows high non-specific binding in control sera (false positive). Finally, we have carried out ELISA steps on APPµTP by ultrasound waves on a sonicator bath and the results show that even in 8 min, it can convincingly differentiate a test sample from a control sample. In short, spectrophotometer-free image-based miniaturized ELISA on APPµTP is precise, reliable, rapid, and sensitive and could be a good substitute for conventional immunoassay procedures widely used in clinical and research laboratories. Copyright © 2013 Elsevier B.V. All rights reserved.

Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.

PubMed

Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S

2014-11-01

A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer.

Concentration Gradient Immunoassay I. A Rapid Immunoassay Based on Interdiffusion and Surface Binding in a Microchannel

PubMed Central

Nelson, Kjell E.; Foley, Jennifer O.; Yager, Paul

2008-01-01

We describe a novel microfluidic immunoassay method based on the diffusion of a small molecule analyte into a parallel-flowing stream containing cognate antibody. This interdiffusion results in a steady-state gradient of antibody binding site occupancy transverse to convective flow. In contrast to the diffusion immunoassay (Hatch et al. Nature Biotechnology,19:461−465 (2001)), this antibody occupancy gradient is interrogated by a sensor surface coated with a functional analog of the analyte. Antibodies with at least one unoccupied binding site may specifically bind to this functionalized surface, leading to a quantifiable change in surface coverage by the antibody. SPR imaging is used to probe the spatial distribution of antibody binding to the surface and, therefore, the outcome of the assay. We show that the pattern of antibody binding to the SPR sensing surface correlates with the concentration of a model analyte (phenytoin) in the sample stream. Using an inexpensive disposable microfluidic device, we demonstrate assays for phenytoin ranging in concentration from 75 to 1000 nM in phosphate buffer. At a total volumetric flow rate of 90 nL/sec, the assays are complete within 10 minutes. Inclusion of an additional flow stream on the side of the antibody stream opposite to that of the sample enables simultaneous calibration of the assay. This assay method is suitable for rapid quantitative detection of low-molecular weight analytes for point-of-care diagnostic instrumentation. PMID:17437332

Homogeneous bioluminescence competitive binding assay for folate based on a coupled glucose-6-phosphate dehydrogenase--bacterial luciferase enzyme system.

PubMed

Huang, W; Feltus, A; Witkowski, A; Daunert, S

1996-05-01

A homogeneous bioluminescence competitive binding assay for folate was developed by using a coupled enzyme system of glucose-6-phosphate dehydrogenase (G6PDH) and bacterial luciferase. A highly substituted G6PDH-folate conjugate was prepared by employing an N-hydroxysuccinimide/carbodiimide method. Folate binding protein inhibits the activity of the conjugate. In the presence of folate, there is a competition between folate and the G6PDH-folate conjugate for the binding site of the folate binding protein, and the activity of the conjugate is recovered. Thus, the concentration of folate can be related to the activity of the G6PDH-folate conjugate, which is directly related to the bioluminescence produced by the coupled enzyme reaction. Using this assay, dose-response curves with a detection limit of 2.5 x 10(-8) M folate were obtained, which is an improvement of an order of magnitude with respect to an assay that monitors G6PDH activity spectrophotometrically. The assay was validated using vitamin tablets and a cell culture medium.

New Horizons on Molecular Pharmacology Applied to Drug Discovery: When Resonance Overcomes Radioligand Binding.

PubMed

Pernomian, Larissa; Gomes, Mayara Santos; Moreira, Josimar Dornelas; da Silva, Carlos Henrique Tomich de Paula; Rosa, Joaquin Maria Campos; Cardoso, Cristina Ribeiro de Barros

2017-01-01

One of the cornerstones of rational drug development is the measurement of molecular parameters derived from ligand-receptor interaction, which guides therapeutic windows definition. Over the last decades, radioligand binding has provided valuable contributions in this field as key method for such purposes. However, its limitations spurred the development of more exquisite techniques for determining such parameters. For instance, safety risks related to radioactivity waste, expensive and controlled disposal of radioisotopes, radiotracer separation-dependence for affinity analysis, and one-site mathematical models-based fitting of data make radioligand binding a suboptimal approach in providing measures of actual affinity conformations from ligands and G proteincoupled receptors (GPCR). Current advances on high-throughput screening (HTS) assays have markedly extended the options of sparing sensitive ways for monitoring ligand affinity. The advent of the novel bioluminescent donor NanoLuc luciferase (Nluc), engineered from Oplophorus gracilirostris luciferase, allowed fitting bioluminescence resonance energy transfer (BRET) for monitoring ligand binding. Such novel approach named Nluc-based BRET (NanoBRET) binding assay consists of a real-time homogeneous proximity assay that overcomes radioligand binding limitations but ensures the quality in affinity measurements. Here, we cover the main advantages of NanoBRET protocol and the undesirable drawbacks of radioligand binding as molecular methods that span pharmacological toolbox applied to Drug Discovery. Also, we provide a novel perspective for the application of NanoBRET technology in affinity assays for multiple-state binding mechanisms involving oligomerization and/or functional biased selectivity. This new angle was proposed based on specific biophysical criteria required for the real-time homogeneity assigned to the proximity NanoBRET protocol. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Colorimetric detection with aptamer-gold nanoparticle conjugates coupled to an android-based color analysis application for use in the field.

PubMed

Smith, Joshua E; Griffin, Daniel K; Leny, Juliann K; Hagen, Joshua A; Chávez, Jorge L; Kelley-Loughnane, Nancy

2014-04-01

The feasibility of using aptamer-gold nanoparticle conjugates (Apt-AuNPs) to design colorimetric assays for in the field detection of small molecules was investigated. An assay to detect cocaine was designed using two clones of a known cocaine-binding aptamer. The assay was based on the AuNPs difference in affinity for single-stranded DNA (non-binding) and double stranded DNA (target bound). In the first assay, a commonly used design was followed, in which the aptamer and target were incubated to allow binding followed by exposure to the AuNPs. Interactions between the non-bound analytes and the AuNPs surface resulted in a number of false positives. The assay was redesigned by incubating the AuNPs and the aptamer prior to target addition to passivate the AuNPs surface. The adsorbed aptamer was able to bind the target while preventing non-specific interactions. The assay was validated with a number of masking and cutting agents and other controlled substances showing minimal false positives. Studies to improve the assay performance in the field were performed, showing that assay activity could be preserved for up to 2 months. To facilitate the assay analysis, an android application for automatic colorimetric characterization was developed. The application was validated by challenging the assay with cocaine standards of different concentrations, and comparing the results to a conventional plate reader, showing outstanding agreement. Finally, the rapid identification of cocaine in mixtures mimicking street samples was demonstrated. This work established that Apt-AuNPs can be used to design robust assays to be used in the field. Copyright © 2013 Elsevier B.V. All rights reserved.

Determination of DNA Binding Behavior of FoxA1 Constructs Using a Gold Nanoparticle-Based High Throughput Assay

NASA Astrophysics Data System (ADS)

Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi

Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.

FRET-based binding assay between a fluorescent cAMP analogue and a cyclic nucleotide-binding domain tagged with a CFP.

PubMed

Romero, Francisco; Santana-Calvo, Carmen; Sánchez-Guevara, Yoloxochitl; Nishigaki, Takuya

2017-09-01

The cyclic nucleotide-binding domain (CNBD) functions as a regulatory domain of many proteins involved in cyclic nucleotide signalling. We developed a straightforward and reliable binding assay based on intermolecular fluorescence resonance energy transfer (FRET) between an adenosine-3', 5'-cyclic monophosphate analogue labelled with fluorescein and a recombinant CNBD of human EPAC1 tagged with a cyan fluorescence protein (CFP). The high FRET efficiency of this method (~ 80%) allowed us to perform several types of binding experiments with nanomolar range of sample using conventional equipment. In addition, the CFP tag on the CNBD enabled us to perform a specific binding experiment using an unpurified protein. Considering these advantages, this technique is useful to study poorly characterized CNBDs. © 2017 Federation of European Biochemical Societies.

Evaluation of OASIS QSAR Models Using ToxCast™ in Vitro Estrogen and Androgen Receptor Binding Data and Application in an Integrated Endocrine Screening Approach

PubMed Central

Bhhatarai, Barun; Wilson, Daniel M.; Price, Paul S.; Marty, Sue; Parks, Amanda K.; Carney, Edward

2016-01-01

Background: Integrative testing strategies (ITSs) for potential endocrine activity can use tiered in silico and in vitro models. Each component of an ITS should be thoroughly assessed. Objectives: We used the data from three in vitro ToxCast™ binding assays to assess OASIS, a quantitative structure-activity relationship (QSAR) platform covering both estrogen receptor (ER) and androgen receptor (AR) binding. For stronger binders (described here as AC50 < 1 μM), we also examined the relationship of QSAR predictions of ER or AR binding to the results from 18 ER and 10 AR transactivation assays, 72 ER-binding reference compounds, and the in vivo uterotrophic assay. Methods: NovaScreen binding assay data for ER (human, bovine, and mouse) and AR (human, chimpanzee, and rat) were used to assess the sensitivity, specificity, concordance, and applicability domain of two OASIS QSAR models. The binding strength relative to the QSAR-predicted binding strength was examined for the ER data. The relationship of QSAR predictions of binding to transactivation- and pathway-based assays, as well as to in vivo uterotrophic responses, was examined. Results: The QSAR models had both high sensitivity (> 75%) and specificity (> 86%) for ER as well as both high sensitivity (92–100%) and specificity (70–81%) for AR. For compounds within the domains of the ER and AR QSAR models that bound with AC50 < 1 μM, the QSAR models accurately predicted the binding for the parent compounds. The parent compounds were active in all transactivation assays where metabolism was incorporated and, except for those compounds known to require metabolism to manifest activity, all assay platforms where metabolism was not incorporated. Compounds in-domain and predicted to bind by the ER QSAR model that were positive in ToxCast™ ER binding at AC50 < 1 μM were active in the uterotrophic assay. Conclusions: We used the extensive ToxCast™ HTS binding data set to show that OASIS ER and AR QSAR models had high sensitivity and specificity when compounds were in-domain of the models. Based on this research, we recommend a tiered screening approach wherein a) QSAR is used to identify compounds in-domain of the ER or AR binding models and predicted to bind; b) those compounds are screened in vitro to assess binding potency; and c) the stronger binders (AC50 < 1 μM) are screened in vivo. This scheme prioritizes compounds for integrative testing and risk assessment. Importantly, compounds that are not in-domain, that are predicted either not to bind or to bind weakly, that are not active in in vitro, that require metabolism to manifest activity, or for which in vivo AR testing is in order, need to be assessed differently. Citation: Bhhatarai B, Wilson DM, Price PS, Marty S, Parks AK, Carney E. 2016. Evaluation of OASIS QSAR models using ToxCast™ in vitro estrogen and androgen receptor binding data and application in an integrated endocrine screening approach. Environ Health Perspect 124:1453–1461; http://dx.doi.org/10.1289/EHP184 PMID:27152837

Comparison of Relative Binding Affinities for Trout and Human Estrogen Receptor Based upon Different Competitive Binding Assays

EPA Science Inventory

The development of a predictive model based upon a single aquatic species inevitably raises the question of whether this information is valid for other species. To partially address this question, relative binding affinities (RBA) for six alkylphenols (para-substituted, n- and b...

Laboratory Testing for von Willebrand Disease: The Past, Present, and Future State of Play for von Willebrand Factor Assays that Measure Platelet Binding Activity, with or without Ristocetin.

PubMed

Just, Sarah

2017-02-01

von Willebrand disease (VWD) was first described nearly a century ago in 1924 by Erik Adolf von Willebrand. Diagnostic testing at the time was very limited and it was not until the mid to late 1900s that more tests became available to assist with the diagnosis and classification of VWD. Two of these tests are based on ristocetin, one being ristocetin-induced platelet aggregation (RIPA) and the other the von Willebrand factor (VWF) ristocetin cofactor assay (VWF:RCo). The VWF:RCo assay provides functional assessment of in vitro VWF binding to the platelet glycoprotein (Gp) complex, GPIb-IX-V. Despite some advancements and newer technologies utilizing the principles of the original VWF:RCo assay, the original assay is still referred to as the gold standard for measurement of VWF activity. This article will review the history of VWD diagnostic assays, including RIPA and VWF:RCo over the past 40 years, as well as the newer assays that measure platelet binding with or without ristocetin, and which have been developed with the aim to potentially replace platelet-based ristocetin-dependent assays. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

Determining ERβ Binding Affinity to Singly Mutant ERE Using Dual Polarization Interferometry

NASA Astrophysics Data System (ADS)

Song, Hong Yan; Su, Xiaodi

In a classic mode of estrogen action, estrogen receptors (ERs) bind to estrogen responsive element (ERE) to activate gene transcription. A perfect ERE contains a 13-base pair sequence of a palindromic repeat separated by a three-base spacer, 5‧-GGTCAnnnTGACC-3‧. In addition to the consensus or wild-type ERE (wtERE), naturally occurring EREs often have one or two base pairs’ alternation. Based on the newly constructed Thermodynamic Modeling of ChIP-seq (TherMos) model, binding energy between ERβ and a series of 34-bp mutant EREs (mutERE) was simulated to predict the binding affinity between ERs and EREs with single base pair deviation at different sites of the 13-bp inverted sequence. Experimentally, dual polarization interferometry (DPI) method was developed to measure ERβ-mutEREs binding affinity. On a biotin-NeutrAvidin (NA)-biotin treated DPI chip, wtERE is immobilized. In a direct binding assay, ERβ-wtERE binding affinity is determined. In a competition assay, ERβ was preincubated with mutant EREs before being added for competitive binding to the immobilized wtERE. This competition strategy provided a successful platform to evaluate the binding affinity variation among large number of ERE with different base mutations. The experimental result correlates well with the mathematically predicted binding energy with a Spearman correlation coefficient of 0.97.

A CE-FL based method for real-time detection of in-capillary self-assembly of the nanoconjugates of polycysteine ligand and quantum dots.

PubMed

Wang, Jianhao; Zhu, Zhilan; Qiu, Lin; Wang, Jianpeng; Wang, Xiang; Xiao, Qicai; Xia, Jiang; Liu, Li; Liu, Xiaoqian; Feng, Wei; Wang, Jinmei; Miao, Peng; Gao, Liqian

2018-07-06

Small molecules with free thiol groups always show high binding affinity to quantum dots (QDs). However, it is still highly challenging to detect the binding capacity between thiol-containing molecules and QDs inside a capillary. To conquer this limitation, a capillary electrophoresis with fluorescence detection (CE-FL) based assay was proposed and established to investigate the binding capacity between QDs and a poly-thiolated peptide (ATTO 590-DDSSGGCCPGCC, ATTO-C4). Interestingly, the results showed that interval time had a great influence on QDs and ATTO-C4 self-assembly, which can be attributed to longer interval time benefitting the binding of QDs to ATTO-C4. The stability assays on ATTO-C4-QD assembly indicated that high concentration of imidazole or GSH had a high capability of competing with the bound ATTO-C4, evidenced by dramatically dropping of S 625 /S 565 ratio from 0.78 to 0.30 or 0.29. Therefore, all these results above suggested that this novel CE-FL based detection assay could be successfully applied to the binding studies between QDs and thiol-containing biomolecules.

A CE-FL based method for real-time detection of in-capillary self-assembly of the nanoconjugates of polycysteine ligand and quantum dots

NASA Astrophysics Data System (ADS)

Wang, Jianhao; Zhu, Zhilan; Qiu, Lin; Wang, Jianpeng; Wang, Xiang; Xiao, Qicai; Xia, Jiang; Liu, Li; Liu, Xiaoqian; Feng, Wei; Wang, Jinmei; Miao, Peng; Gao, Liqian

2018-07-01

Small molecules with free thiol groups always show high binding affinity to quantum dots (QDs). However, it is still highly challenging to detect the binding capacity between thiol-containing molecules and QDs inside a capillary. To conquer this limitation, a capillary electrophoresis with fluorescence detection (CE-FL) based assay was proposed and established to investigate the binding capacity between QDs and a poly-thiolated peptide (ATTO 590-DDSSGGCCPGCC, ATTO-C4). Interestingly, the results showed that interval time had a great influence on QDs and ATTO-C4 self-assembly, which can be attributed to longer interval time benefitting the binding of QDs to ATTO-C4. The stability assays on ATTO-C4-QD assembly indicated that high concentration of imidazole or GSH had a high capability of competing with the bound ATTO-C4, evidenced by dramatically dropping of S 625/S 565 ratio from 0.78 to 0.30 or 0.29. Therefore, all these results above suggested that this novel CE-FL based detection assay could be successfully applied to the binding studies between QDs and thiol-containing biomolecules.

An exonuclease I-based label-free fluorometric aptasensor for adenosine triphosphate (ATP) detection with a wide concentration range.

PubMed

Wei, Yanli; Chen, Yanxia; Li, Huanhuan; Shuang, Shaomin; Dong, Chuan; Wang, Gufeng

2015-01-15

A novel aptamer-based label-free assay for sensitive and selective detection of ATP was developed. This assay employs a new aptamer/fluorescent probe system that shows resistance to exonuclease I (Exo I) digestion upon binding to ATP molecules. In the absence of ATP, the complex between the ATP-binding aptamer (ATP-aptamer) and a DNA binding dye, berberine, is digested upon the addition of exonuclease I, leading to the release of berberine into solution and consequently, quenched berberine fluorescence. In the presence of ATP, the ATP-binding aptamer folds into a G-quadruplex structure that is resistant to Exo I digestion. Accordingly, berberine is protected in the G-quadruplex structure and high fluorescence intensity is observed. As such, based on the fluorescence signal change, a label-free fluorescence assay for ATP was developed. Factors affecting the analysis of ATP including the concentration of ATP-binding aptamer, reaction time, temperature and the concentration of Exo I were comprehensively investigated. Under optimal conditions, the fluorescence intensity of the sensing system displayed a response for ATP in a wide range up to 17.5 mM with a detection limit of 140 nM.

Mathematical simulations for bioanalytical assay development: the (un-)necessity and (im-)possibility of free drug quantification.

PubMed

Staack, Roland F; Jordan, Gregor; Heinrich, Julia

2012-02-01

For every drug development program it needs to be discussed whether discrimination between free and total drug concentrations is required to accurately describe its pharmacokinetic behavior. This perspective describes the application of mathematical simulation approaches to guide this initial decision based on available knowledge about target biology, binding kinetics and expected drug concentrations. We provide generic calculations that can be used to estimate the necessity of free drug quantification for different drug molecules. In addition, mathematical approaches are used to simulate various assay conditions in bioanalytical ligand-binding assays: it is demonstrated that due to the noncovalent interaction between the binding partners and typical assay-related interferences in the equilibrium, a correct quantification of the free drug concentration is highly challenging and requires careful design of different assay procedure steps.

Quantitation of proteins using a dye-metal-based colorimetric protein assay.

PubMed

Antharavally, Babu S; Mallia, Krishna A; Rangaraj, Priya; Haney, Paul; Bell, Peter A

2009-02-15

We describe a dye-metal (polyhydroxybenzenesulfonephthalein-type dye and a transition metal) complex-based total protein determination method. The binding of the complex to protein causes a shift in the absorption maximum of the dye-metal complex from 450 to 660 nm. The dye-metal complex has a reddish brown color that changes to green on binding to protein. The color produced from this reaction is stable and increases in a proportional manner over a broad range of protein concentrations. The new Pierce 660 nm Protein Assay is very reproducible, rapid, and more linear compared with the Coomassie dye-based Bradford assay. The assay reagent is room temperature stable, and the assay is a simple and convenient mix-and-read format. The assay has a moderate protein-to-protein variation and is compatible with most detergents, reducing agents, and other commonly used reagents. This is an added advantage for researchers needing to determine protein concentrations in samples containing both detergents and reducing agents.

In-Solution SH2 Domain Binding Assay Based on Proximity Ligation.

PubMed

Machida, Kazuya

2017-01-01

Protein-protein interactions mediated by SH2 domains confer specificity in tyrosine kinase pathways. Traditional assays for assessing interactions between an SH2 domain and its interacting protein such as far-Western and pull-down are inherently low throughput. We developed SH2-PLA, an in-solution SH2 domain binding assay, that takes advantage of the speed and sensitivity of proximity ligation and real-time PCR. SH2-PLA allows for rapid assessment of SH2 domain binding to a target protein using only a few microliters of cell lysate, thereby making it an attractive new tool to study tyrosine kinase signaling.

Identification of Tight-Binding Plasmepsin II and Falcipain 2 Inhibitors in Aqueous Extracts of Marine Invertebrates by the Combination of Enzymatic and Interaction-Based Assays

PubMed Central

Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.

2017-01-01

Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158

A Colorimetric Microplate Assay for DNA-Binding Activity of His-Tagged MutS Protein.

PubMed

Banasik, Michał; Sachadyn, Paweł

2016-09-01

A simple microplate method was designed for rapid testing DNA-binding activity of proteins. The principle of the assay involves binding of tested DNA by his-tagged protein immobilized on a nickel-coated ELISA plate, following colorimetric detection of biotinylated DNA with avidin conjugated to horseradish peroxidase. The method was used to compare DNA mismatch binding activities of MutS proteins from three bacterial species. The assay required relatively low amounts of tested protein (approximately 0.5-10 pmol) and DNA (0.1-10 pmol) and a relatively short time of analysis (up to 60 min). The method is very simple to apply and convenient to test different buffer conditions of DNA-protein binding. Sensitive colorimetric detection enables naked eye observations and quantitation with an ELISA reader. The performance of the assay, which we believe is a distinguishing trait of the method, is based on two strong and specific molecular interactions: binding of a his-tagged protein to a nickel-coated microplate and binding of biotinylated DNA to avidin. In the reported experiments, the solution was used to optimize the conditions for DNA mismatch binding by MutS protein; however, the approach could be implemented to test nucleic acids interactions with any protein of interest.

A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties

PubMed Central

Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.

2017-01-01

Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kovtun, Oleg; Ross, Emily J.; Tomlinson, Ian D.

Here we present the development and validation of a flow cytometry-based dopamine transporter (DAT) binding assay that uses antagonist-conjugated quantum dots (QDs). Our anticipation is that our QD-based assay is of immediate value to the high throughput screening of novel DAT modulators.

Data quality in drug discovery: the role of analytical performance in ligand binding assays

NASA Astrophysics Data System (ADS)

Wätzig, Hermann; Oltmann-Norden, Imke; Steinicke, Franziska; Alhazmi, Hassan A.; Nachbar, Markus; El-Hady, Deia Abd; Albishri, Hassan M.; Baumann, Knut; Exner, Thomas; Böckler, Frank M.; El Deeb, Sami

2015-09-01

Despite its importance and all the considerable efforts made, the progress in drug discovery is limited. One main reason for this is the partly questionable data quality. Models relating biological activity and structures and in silico predictions rely on precisely and accurately measured binding data. However, these data vary so strongly, such that only variations by orders of magnitude are considered as unreliable. This can certainly be improved considering the high analytical performance in pharmaceutical quality control. Thus the principles, properties and performances of biochemical and cell-based assays are revisited and evaluated. In the part of biochemical assays immunoassays, fluorescence assays, surface plasmon resonance, isothermal calorimetry, nuclear magnetic resonance and affinity capillary electrophoresis are discussed in details, in addition radiation-based ligand binding assays, mass spectrometry, atomic force microscopy and microscale thermophoresis are briefly evaluated. In addition, general sources of error, such as solvent, dilution, sample pretreatment and the quality of reagents and reference materials are discussed. Biochemical assays can be optimized to provide good accuracy and precision (e.g. percental relative standard deviation <10 %). Cell-based assays are often considered superior related to the biological significance, however, typically they cannot still be considered as really quantitative, in particular when results are compared over longer periods of time or between laboratories. A very careful choice of assays is therefore recommended. Strategies to further optimize assays are outlined, considering the evaluation and the decrease of the relevant error sources. Analytical performance and data quality are still advancing and will further advance the progress in drug development.

A Comparison of Protein Kinases Inhibitor Screening Methods Using Both Enzymatic Activity and Binding Affinity Determination

PubMed Central

Rudolf, Amalie Frederikke; Skovgaard, Tine; Knapp, Stefan; Jensen, Lars Juhl; Berthelsen, Jens

2014-01-01

Binding assays are increasingly used as a screening method for protein kinase inhibitors; however, as yet only a weak correlation with enzymatic activity-based assays has been demonstrated. We show that the correlation between the two types of assays can be improved using more precise screening conditions. Furthermore a marked improvement in the correlation was found by using kinase constructs containing the catalytic domain in presence of additional domains or subunits. PMID:24915177

Periplasmic binding protein-based detection of maltose using liposomes: a new class of biorecognition elements in competitive assays.

PubMed

Edwards, Katie A; Baeumner, Antje J

2013-03-05

A periplasmic binding protein (PBP) was investigated as a novel binding species in a similar manner to an antibody in a competitive enzyme linked immunosorbent assay (ELISA), resulting in a highly sensitive and specific assay utilizing liposome-based signal amplification. PBPs are located at high concentrations (10(-4) M) between the inner and outer membranes of gram negative bacteria and are involved in the uptake of solutes and chemotaxis of bacteria toward nutrient sources. Previous sensors relying on PBPs took advantage of the change in local environment or proximity of site-specific fluorophore labels resulting from the significant conformational shift of these proteins' two globular domains upon target binding. Here, rather than monitoring conformational shifts, we have instead utilized the maltose binding protein (MBP) in lieu of an antibody in an ELISA. To our knowledge, this is the first PBP-based sensor without the requirement for engineering site-specific modifications within the protein. MBP conjugated fluorescent dye-encapsulating liposomes served to provide recognition and signal amplification in a competitive assay for maltose using amylose magnetic beads in a microtiter plate-based format. The development of appropriate binding buffers and competitive surfaces are described, with general observations expected to extend to PBPs for other analytes. The resulting assay was specific for d-(+)-maltose versus other sugar analogs including d-(+)-raffinose, sucrose, d-trehalose, d-(+)-xylose, d-fructose, 1-thio-β-d-glucose sodium salt, d-(+)-galactose, sorbitol, glycerol, and dextrose. Cross-reactivity with d-lactose and d-(+)-glucose occurred only at concentrations >10(4)-fold greater than d-(+)-maltose. The limit of detection was 78 nM with a dynamic range covering over 3 orders of magnitude. Accurate detection of maltose as an active ingredient in a pharmaceutical preparation was demonstrated. This method offers a significant improvement over existing enzymatic detection approaches that cannot discriminate between maltose and glucose and over existing fluorescence resonance energy transfer (FRET)-based detection methods that are sensitivity limited. In addition, it opens up a new strategy for the development of biosensors to difficult analytes refractory to immunological detection.

Small molecule antagonists of the urokinase (uPA): urokinase receptor (uPAR) interaction with high reported potencies show only weak effects in cell-based competition assays employing the native uPAR ligand.

PubMed

De Souza, Melissa; Matthews, Hayden; Lee, Jodi A; Ranson, Marie; Kelso, Michael J

2011-04-15

Binding of the urokinase-type plasminogen activator (uPA) to its cell-surface-bound receptor uPAR and upregulation of the plasminogen activation system (PAS) correlates with increased metastasis and poor prognosis in several tumour types. Disruptors of the uPA:uPAR interaction represent promising anti-tumour/metastasis agents and several approaches have been explored for this purpose, including the use of small molecule antagonists. Two highly potent non-peptidic antagonists 1 and 2 (IC(50)1=0.8 nM, IC(50)2=33 nM) from the patent literature were reportedly identified using competition assays employing radiolabelled uPAR-binding uPA fragments and appeared as useful pharmacological tools for studying the PAS. Before proceeding to such studies, confirmation was sought that 1 and 2 retained their potencies in physiologically relevant cell-based competition assays employing uPAR's native binding partner high molecular weight uPA (HMW-uPA). This study describes a new solution phase synthesis of 1, a mixed solid/solution phase synthesis of 2 and reports the activities of 1 and 2 in semi-quantitative competition flow cytometry assays and quantitative cell-based uPA activity assays that employed HMW-uPA as the competing ligand. The flow cytometry experiments revealed that high concentrations of 2 (10-100 μM) are required to compete with HMW-uPA for uPAR binding and that 1 shows no antagonist effects at 100 μM. The cell-based enzyme activity assays similarly revealed that 1 and 2 are poor inhibitors of cell surface-bound HMW-uPA activity (IC(50) >100 μM for 1 and 2). The report highlights the dangers of identifying false-positive lead uPAR antagonists from competition assays employing labelled competing ligands other than the native HMW-uPA. Copyright © 2011 Elsevier Ltd. All rights reserved.

A novel and sensitive radioreceptor assay for serum melatonin levels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tenn, C.; Niles, L.

A simple and sensitive radioreceptor assay (RRA) has been developed to measure melatonin levels in serum. The assay is based on competition between 2-({sup 125}I)iodomelatonin (({sup 125}I)MEL) and melatonin for binding to high-affinity binding sites in chick forebrain. To measure the amount of melatonin present in a serum sample, it was extracted with dichloromethane and added to the assay medium. The percentage inhibition of radioligand binding in the presence of the extracted serum was determined and compared to the percent displacement by known amounts of melatonin in a standard curve. There was little or no cross-reactivity with other structurally relatedmore » compounds. The sensitivity of the assay is {approximately}1.5pg/0.15 mL and the intra- and inter-assay variations are approximately 8%. Since the RRA results are comparable to that of an established radioimmunoassay (RIA), it provides a sensitive and rapid alternative to the more time consuming RIA.« less

Microbubble Enzyme-Linked Immunosorbent Assay for the Detection of Targeted Microbubbles in in Vitro Static Binding Assays.

PubMed

Wischhusen, Jennifer; Padilla, Frederic

2017-07-01

Targeted microbubbles (MBs) are ultrasound contrast agents that are functionalized with a ligand for ultrasound molecular imaging of endothelial markers. Novel targeted MBs are characterized in vitro by incubation in protein-coated wells, followed by binding quantification by microscopy or ultrasound imaging. Both methods provide operator-dependent results: Between 3 and 20 fields of view from a heterogeneous sample are typically selected for analysis by microscopy, and in ultrasound imaging, different acoustic settings affect signal intensities. This study proposes a new method to reproducibly quantify MB binding based on enzyme-linked immunosorbent assay (ELISA), in which bound MBs are revealed with an enzyme-linked antibody. MB-ELISA was adapted to in vitro static binding assays, incubating the MBs in inverted position or by agitation, and compared with microscopy. The specificity and sensitivity of MB-ELISA enable the reliable quantification of MB binding in a rapid, high-throughput and whole-well analysis, facilitating the characterization of new targeted contrast agents. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

Two novel assays for the detection of haemin-binding properties of antimalarials evaluated with compounds isolated from medicinal plants.

PubMed

Steele, J C P; Phelps, R J; Simmonds, M S J; Warhurst, D C; Meyer, D J

2002-07-01

Forty-two compounds isolated from nine plants used within South America for the treatment of malaria were tested for haemin binding using two novel, rapid screening methods. The data obtained were analysed with respect to IC(50) values for in vitro toxicity to Plasmodium falciparum trophozoites. One method, a multiwell assay based on the inhibition of the interaction of haemin with glutathione (GSH), is sensitive in the 10 microM range, takes c. 1 h and is suitable for either a high throughput screen or rapid assay during natural product isolation. Of 19 compounds showing antiplasmodial activity (IC(50) < 40 microM), 16 (84%) showed >40% inhibition of GSH-haemin reaction. The sensitivity and specificity of the assay were 0.85 and 0.82, respectively. The positive predictive value was 0.81 and the negative predictive value 0.86. A more sensitive assay (0.1 microM range) is based on the reversal by haemin-binding compounds of the haemin inhibition of the L-dopachrome-methyl ester tautomerase activity of human macrophage migration inhibitory factor. This assay gives a better idea of the affinity of interaction and uses very small amounts of test compound. The log[RI(50)] of eight of the compounds that tested positive in the above assays together with those of quinine and chloroquine showed a positive correlation with log[antiplasmodial IC(50)] for strain T9-96 (r = 0.824) and strain K1 (r = 0.904). Several of the antimalarial compounds that bind haemin are isoquinolines, a class not shown previously to interact with haemin.

Time-Resolved Fluorescence Resonance Energy Transfer Assay for Discovery of Small-Molecule Inhibitors of Methyl-CpG Binding Domain Protein 2.

PubMed

Wyhs, Nicolas; Walker, David; Giovinazzo, Hugh; Yegnasubramanian, Srinivasan; Nelson, William G

2014-08-01

Methylated DNA binding proteins such as Methyl-CpG Binding Domain Protein 2 (MBD2) can transduce DNA methylation alterations into a repressive signal by recruiting transcriptional co-repressor complexes. Interfering with MBD2 could lead to reactivation of tumor suppressor genes and therefore represents an attractive strategy for epigenetic therapy. We developed and compared fluorescence polarization (FP) and time-resolved fluorescence resonance energy transfer (TR-FRET)-based high-throughput screening (HTS) assays to identify small-molecule inhibitors of the interaction between the methyl binding domain of MBD2 (MBD2-MBD) and methylated DNA. Although both assays performed well in 96-well format, the TR-FRET assay (Z' factor = 0.58) emerged as a superior screening strategy compared with FP (Z' factor = 0.08) when evaluated in an HTS 384-well plate format. Using TR-FRET, we screened the Sigma LOPAC library for MBD2-MBD inhibitors and identified four compounds that also validated in a dose-response series. This included two known DNA intercalators (mitoxantrone and idarubicin) among two other inhibitory compounds (NF449 and aurintricarboxylic acid). All four compounds also inhibited the binding of SP-1, a transcription factor with a GC-rich binding sequence, to a methylated oligonucleotide, demonstrating that the activity was nonspecific. Our results provide proof of principle for using TR-FRET-based HTS to identify small-molecule inhibitors of MBD2 and other DNA-protein interactions. © 2014 Society for Laboratory Automation and Screening.

Performance evaluation and multicentre study of a von Willebrand factor activity assay based on GPIb binding in the absence of ristocetin.

PubMed

Patzke, Juergen; Budde, Ulrich; Huber, Andreas; Méndez, Adriana; Muth, Heidrun; Obser, Tobias; Peerschke, Ellinor; Wilkens, Matthias; Schneppenheim, Reinhard

2014-12-01

The functional activity of von Willebrand factor (VWF) is most frequently measured by using the ristocetin cofactor assay (VWF:RCo). However, the method's drawbacks include unsatisfactory precision, sensitivity and availability of automated system applications. We have developed an alternative assay (INNOVANCE VWF Ac) that is based on the binding of VWF to recombinant glycoprotein Ib (GPIb). Two gain-of-function mutations were introduced into a GPIb fragment, allowing an assay format without ristocetin. Fully automated assay applications are available for the BCS/BCS XP systems and the Sysmex CS-2000i, Sysmex CA-7000, Sysmex CA-1500 and Sysmex CA-560 systems.The INNOVANCE VWF Ac assay measuring range extends from 4 to 600% VWF for all systems except the Sysmex CA-560 system. Within-device precision values were found to be between 2 and 7%. The limit of detection was below 2.2% VWF. In a study on the BCS XP system, a total number of 580 sample results yielded a correlation to the VWF:RCo assay of r equal to 0.99 (slope = 0.96). Very similar results were observed when von Willebrand disease samples type 1, 2A, 2B, 2M, 2N and 3 were investigated with the new assay and the VWF:RCo assay. The excellent performance data and comparability to VWF:RCo, together with the ease of use, led us to the conclusion that the ristocetin cofactor assay can be replaced by the new GPIb-binding assay to reliably diagnosing patients with von Willebrand disease.

Expression of human peroxisome proliferator-activated receptors ligand binding domain-maltose binding protein fusion protein in Escherichia coli: a convenient and reliable method for preparing receptor for screening ligands.

PubMed

Li, Changqing; Tian, Mi; Yuan, Ye; Zhou, Qinxin

2008-12-01

Human peroxisome proliferator-activated receptors (hPPARs) are ligand-activated transcription factors and are the target for the treatment of many diseases. Screening of their ligands is mainly based on assays of ligand binding to the ligand binding domain (LBD) of hPPARs.However, such assays are difficult because of the preparation of hPPARs LBD. In order to yield functional hPPARs LBD for screening ligands, hPPARs LBD was fused with maltose-binding protein(MBP) using the pMAL-p2x expression system through the gene engineering technique. The radioligand binding assay showed that MBP did not affect ligand binding with hPPARs LBD in the fusion proteins, which means that MBP-hPPARs LBD can be used instead of hPPARs LBD in ligand screening work. The results show that the new strategy using MBP as a fusion tag for preparing hPPARs LBD for screening ligands is a convenient and reliable method. It may be used to easily obtain the other nuclear receptors.

Paraffin section immunocytochemistry and cytosol-based ligand-binding assays for ER and PR detection in breast cancer: the time has come for more objectivity.

PubMed

Goussard, J

1998-10-23

The importance of the receptor level in breast cancer as an indicator of hormone response has been extensively studied for more than 20 years. Besides cytosol-based ligand-binding assays (dextran-coated charcoal assay, DCC), new methods using monoclonal antibodies raised against estrogen and progesterone receptors allow for the detection of receptors both in cytosol extracts (enzyme immunoassay, EIA) and in tissue sections (immunocytochemical assay, ICA). The biochemical assays (DCC and EIA) as well as the immunochemical detection (ICA) have specific qualities and produce original information which is useful for the therapeutic decision. While DCC gives a measure of the receptor level, whatever the real source of synthesis (normal and/or neoplastic tissue), ICA locates the positive cells and their relative proportion in the tumor. Both methods present their own advantages and disadvantages which are summarized in this study.

Novel Multiplexed Assay for Identifying SH2 Domain Antagonists of STAT Family Proteins

PubMed Central

Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

2013-01-01

Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z’ values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors. PMID:23977103

Novel multiplexed assay for identifying SH2 domain antagonists of STAT family proteins.

PubMed

Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

2013-01-01

Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z' values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors.

Assessment of a recombinant androgen receptor binding assay: initial steps towards validation.

PubMed

Freyberger, Alexius; Weimer, Marc; Tran, Hoai-Son; Ahr, Hans-Jürgen

2010-08-01

Despite more than a decade of research in the field of endocrine active compounds with affinity for the androgen receptor (AR), still no validated recombinant AR binding assay is available, although recombinant AR can be obtained from several sources. With funding from the European Union (EU)-sponsored 6th framework project, ReProTect, we developed a model protocol for such an assay based on a simple AR binding assay recently developed at our institution. Important features of the protocol were the use of a rat recombinant fusion protein to thioredoxin containing both the hinge region and ligand binding domain (LBD) of the rat AR (which is identical to the human AR-LBD) and performance in a 96-well plate format. Besides two reference compounds [dihydrotestosterone (DHT), androstenedione] ten test compounds with different affinities for the AR [levonorgestrel, progesterone, prochloraz, 17alpha-methyltestosterone, flutamide, norethynodrel, o,p'-DDT, dibutylphthalate, vinclozolin, linuron] were used to explore the performance of the assay. At least three independent experiments per compound were performed. The AR binding properties of reference and test compounds were well detected, in terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using recombinant AR preparations. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.6. Our data demonstrate that the assay reliably ranked compounds with strong, weak, and no/marginal affinity for the AR with high accuracy. It avoids the manipulation and use of animals, as a recombinant protein is used and thus contributes to the 3R concept. On the whole, this assay is a promising candidate for further validation. Copyright 2009 Elsevier Inc. All rights reserved.

Critical ligand binding reagent preparation/selection: when specificity depends on reagents.

PubMed

Rup, Bonita; O'Hara, Denise

2007-05-11

Throughout the life cycle of biopharmaceutical products, bioanalytical support is provided using ligand binding assays to measure the drug product for pharmacokinetic, pharmacodynamic, and immunogenicity studies. The specificity and selectivity of these ligand binding assays are highly dependent on the ligand binding reagents. Thus the selection, characterization, and management processes for ligand binding reagents are crucial to successful assay development and application. This report describes process considerations for selection and characterization of ligand binding reagents that are integral parts of the different phases of assay development. Changes in expression, purification, modification, and storage of the ligand binding reagents may have a profound effect on the ligand binding assay performance. Thus long-term management of the critical ligand binding assay reagents is addressed including suggested characterization criteria that allow ligand binding reagents to be used in as consistent a manner as possible. Examples of challenges related to the selection, modification, and characterization of ligand binding reagents are included.

Analysis of Ethylene Receptors: Ethylene-Binding Assays.

PubMed

Binder, Brad M; Schaller, G Eric

2017-01-01

Plant ethylene receptors bind ethylene with high affinity. Most of the characterization of ethylene binding to the receptors has been carried out using a radioligand-binding assay on functional receptors expressed in yeast. In this chapter, we describe methods for expressing ethylene receptors in yeast and conducting ethylene-binding assays on intact yeast and yeast membranes. The ethylene-binding assays can be modified to analyze ethylene binding to intact plants and other organisms as well as membranes isolated from any biological source.

Monoclonal antibodies to human vitamin D-binding protein.

PubMed Central

Pierce, E A; Dame, M C; Bouillon, R; Van Baelen, H; DeLuca, H F

1985-01-01

Monoclonal antibodies to vitamin D-binding protein isolated from human serum have been produced. The antibodies obtained have been shown to be specific for human vitamin D-binding protein by three independent assays. The antibodies recognize human vitamin D-binding protein specifically in an enzyme-linked immunosorbent assay. Human vitamin D-binding protein is detected specifically in both pure and crude samples by a radiometric immunosorbent assay (RISA) and by an immunoprecipitation assay. The anti-human vitamin D-binding protein antibodies cross-react with monkey and pig vitamin D-binding protein, but not with vitamin D-binding protein from rat, mouse, or chicken, as determined by the RISA and immunoprecipitation assays. Images PMID:3936035

Evaluation of Impermeant, DNA-Binding Dye Fluorescence as a Real-Time Readout of Eukaryotic Cell Toxicity in a High Throughput Screening Format

PubMed Central

Chiaraviglio, Lucius

2014-01-01

Abstract Interpretation of high throughput screening (HTS) data in cell-based assays may be confounded by cytotoxic properties of screening compounds. Therefore, assessing cell toxicity in real time during the HTS process itself would be highly advantageous. Here, we investigate the potential of putatively impermeant, fluorescent, DNA-binding dyes to give cell toxicity readout during HTS. Amongst 19 DNA-binding dyes examined, three classes were identified that were (1) permeant, (2) cytotoxic, or (3) neither permeant nor cytotoxic during 3-day incubation with a macrophage cell line. In the last class, four dyes (SYTOX Green, CellTox Green, GelGreen, and EvaGreen) gave highly robust cytotoxicity data in 384-well screening plates. As proof of principle, successful combination with a luminescence-based assay in HTS format was demonstrated. Here, both intracellular growth of Legionella pneumophila (luminescence) and host cell viability (SYTOX Green exclusion) were assayed in the same screening well. Incorporation of membrane-impermeant, DNA-binding, fluorescent dyes in HTS assays should prove useful by allowing evaluation of cytotoxicity in real time, eliminating reagent addition steps and effort associated with endpoint cell viability analysis, and reducing the need for follow-up cytotoxicity screening. PMID:24831788

A solid-phase assay for studying direct binding of progranulin to TNFR and progranulin antagonism of TNF/TNFR interactions.

PubMed

Tian, Qingyun; Zhao, Shuai; Liu, Chuanju

2014-01-01

The discovery that TNF receptors (TNFR) serve as the binding receptors for progranulin (PGRN) reveals the significant role of PGRN in inflammatory and autoimmune diseases, including inflammatory arthritis. Herein we describe a simple, antibody-free analytical assay, i.e., a biotin-based solid-phase binding assay, to examine the direct interaction of PGRN/TNFR and the PGRN inhibition of TNF/TNFR interactions. Briefly, a 96-well high-binding microplate is first coated with the first protein (protein A), and after blocking, the coated microplate is incubated with the biotin-labeled second protein (protein B) in the absence or presence of the third protein (protein C). Finally the streptavidin conjugated with a detecting enzyme is added, followed by a signal measurement. Also discussed in this chapter are the advantages of the strategy, key elements to obtain reliable results, and discrepancies among various PGRN proteins in view of the binding activity with TNFR.

A force-based protein biochip

NASA Astrophysics Data System (ADS)

Blank, K.; Mai, T.; Gilbert, I.; Schiffmann, S.; Rankl, J.; Zivin, R.; Tackney, C.; Nicolaus, T.; Spinnler, K.; Oesterhelt, F.; Benoit, M.; Clausen-Schaumann, H.; Gaub, H. E.

2003-09-01

A parallel assay for the quantification of single-molecule binding forces was developed based on differential unbinding force measurements where ligand-receptor interactions are compared with the unzipping forces of DNA hybrids. Using the DNA zippers as molecular force sensors, the efficient discrimination between specific and nonspecific interactions was demonstrated for small molecules binding to specific receptors, as well as for protein-protein interactions on protein arrays. Finally, an antibody sandwich assay with different capture antibodies on one chip surface and with the detection antibodies linked to a congruent surface via the DNA zippers was used to capture and quantify a recombinant hepatitis C antigen from solution. In this case, the DNA zippers enable not only discrimination between specific and nonspecific binding, but also allow for the local application of detection antibodies, thereby eliminating false-positive results caused by cross-reactive antibodies and nonspecific binding.

Development of binding assays for the SH2 domain of Grb7 and Grb2 using fluorescence polarization.

PubMed

Luzy, Jean-Philippe; Chen, Huixiong; Gril, Brunilde; Liu, Wang-Qing; Vidal, Michel; Perdereau, Dominique; Burnol, Anne-Françoise; Garbay, Christiane

2008-02-01

Adaptor proteins Grb7 and Grb2 have been implicated as being 2 potential therapeutic targets in several human cancers, especially those that overexpress ErbB2. These 2 proteins contain both a SH2 domain (Src homology 2) that binds to phosphorylated tyrosine residues contained within ErbB2 and other specific protein targets. Two assays based on enzyme-linked immunosorbent assay and fluorescence polarization methods have been developed and validated to find and rank inhibitors for both proteins binding to the pY(1139). Fluorescence polarization assays allowed the authors to determine quickly and reproducibly affinities of peptides from low nanomolar to high micromolar range and to compare them directly for Grb7 and Grb2. As a result, the assays have identified a known peptidomimetic Grb2 SH2 inhibitor (mAZ-pTyr-(alphaMe)pTyr-Asn-NH(2)) that exhibits the most potent affinity for the Grb7 SH2 domain described to date.

Assays for the determination of the activity of DNA nucleases based on the fluorometric properties of the YOYO dye.

PubMed

Fernández-Sierra, Mónica; Quiñones, Edwin

2015-03-15

Here we characterize the fluorescence of the YOYO dye as a tool for studying DNA-protein interactions in real time and present two continuous YOYO-based assays for sensitively monitoring the kinetics of DNA digestion by λ-exonuclease and the endonuclease EcoRV. The described assays rely on the different fluorescence intensities between single- and double-stranded DNA-YOYO complexes, allowing straightforward determination of nuclease activity and quantitative determination of reaction products. The assays were also employed to assess the effect of single-stranded DNA-binding proteins on the λ-exonuclease reaction kinetics, showing that the extreme thermostable single-stranded DNA-binding protein (ET-SSB) significantly reduced the reaction rate, while the recombination protein A (RecA) displayed no effect. Copyright © 2015 Elsevier Inc. All rights reserved.

D2 dopaminergic and 5-HT1A serotonergic activity of 2-(1-naphthyl)ethyl- and 2-(2-naphthyl)ethyl amines.

PubMed

Šukalović, V; Roglić, G; Husinec, S; Kostić-Rajaćić, S; Andrić, D; Šoškić, Vukić

2003-11-01

Several tertiary 2-phenylethyl, 2-(1-naphthyl)ethyl and 2-(2-naphthyl)ethyl amines were synthesized and their binding affinities for dopamine D(1), D(2) and serotonin 5-HT(1A) receptors evaluated in radioligand binding assays. All compounds were inactive in D(1) dopamine radioligand binding assay. The 2-(1-naphthyl)ethyl analogues expressed a low but significant binding affinity for the D(2) and moderate one for the 5-HT(1A) receptor subtypes. Most of the remaining compounds expressed binding affinity at the 5-HT(1A) receptor subtype but were inactive in D(2) receptor binding assay. Based on these results and considering the chemical characteristics of the compounds synthesized and evaluated for dopaminergic and serotonergic activity throughout the present study it can be concluded that hydrophobic type of interaction (stacking or edge-to-face) plays a significant role in the formation of receptor-ligand complexes of 2-(1-naphthyl)ethyl amines. This structural motive can be applied to design and synthesize new, more potent dopaminergic/serotonergic ligands by slight chemical modifications.

Two-colored fluorescence correlation spectroscopy screening for LC3-P62 interaction inhibitors.

PubMed

Tsuganezawa, Keiko; Shinohara, Yoshiyasu; Ogawa, Naoko; Tsuboi, Shun; Okada, Norihisa; Mori, Masumi; Yokoyama, Shigeyuki; Noda, Nobuo N; Inagaki, Fuyuhiko; Ohsumi, Yoshinori; Tanaka, Akiko

2013-10-01

The fluorescence correlation spectroscopy (FCS)-based competitive binding assay to screen for protein-protein interaction inhibitors is a highly sensitive method as compared with the fluorescent polarization assay used conventionally. However, the FCS assay identifies many false-positive compounds, which requires specifically designed orthogonal screenings. A two-colored application of the FCS-based screening was newly developed, and inhibitors of a protein-protein interaction, involving selective autophagy, were selected. We focused on the interaction of LC3 with the adaptor protein p62, because the interaction is crucial to degrade the specific target proteins recruited by p62. First, about 10,000 compounds were subjected to the FCS-based competitive assay using a TAMRA-labeled p62-derived probe, and 29 hit compounds were selected. Next, the obtained hits were evaluated by the second FCS assay, using an Alexa647-labeled p62-derived probe to remove the false-positive compounds, and six hit compounds inhibited the interaction. Finally, we tested all 29 compounds by surface plasmon resonance-based competitive binding assay to evaluate their inhibition of the LC3-p62 interaction and selected two inhibitors with IC50 values less than 2 µM. The two-colored FCS-based screening was shown to be effective to screen for protein-protein interaction inhibitors.

Rapid Diagnostic Assay for Intact Influenza Virus Using a High Affinity Hemagglutinin Binding Protein.

PubMed

Anderson, Caitlin E; Holstein, Carly A; Strauch, Eva-Maria; Bennett, Steven; Chevalier, Aaron; Nelson, Jorgen; Fu, Elain; Baker, David; Yager, Paul

2017-06-20

Influenza is a ubiquitous and recurring infection that results in approximately 500 000 deaths globally each year. Commercially available rapid diagnostic tests are based upon detection of the influenza nucleoprotein, which are limited in that they are unable to differentiate by species and require an additional viral lysis step. Sample preprocessing can be minimized or eliminated by targeting the intact influenza virus, thereby reducing assay complexity and leveraging the large number of hemagglutinin proteins on the surface of each virus. Here, we report the development of a paper-based influenza assay that targets the hemagglutinin protein; the assay employs a combination of antibodies and novel computationally designed, recombinant affinity proteins as the capture and detection agents. This system leverages the customizability of recombinant protein design to target the conserved receptor-binding pocket of the hemagglutinin protein and to match the trimeric nature of hemagglutinin for improved avidity. Using this assay, we demonstrate the first instance of intact influenza virus detection using a combination of antibody and affinity proteins within a porous network. The recombinant head region binder based assays yield superior analytical sensitivity as compared to the antibody based assay, with lower limits of detection of 3.54 × 10 7 and 1.34 × 10 7 CEID 50 /mL for the mixed and all binder stacks, respectively. Not only does this work describe the development of a novel influenza assay, it also demonstrates the power of recombinant affinity proteins for use in rapid diagnostic assays.

Nanoprobe-Enhanced, Split Aptamer-Based Electrochemical Sandwich Assay for Ultrasensitive Detection of Small Molecules.

PubMed

Zhao, Tao; Liu, Ran; Ding, Xiaofan; Zhao, Juncai; Yu, Haixiang; Wang, Lei; Xu, Qing; Wang, Xuan; Lou, Xinhui; He, Miao; Xiao, Yi

2015-08-04

It is quite challenging to improve the binding affinity of antismall molecule aptamers. We report that the binding affinity of anticocaine split aptamer pairs improved by up to 66-fold by gold nanoparticles (AuNP)-attached aptamers due to the substantially increased local concentration of aptamers and multiple and simultaneous ligand interactions. The significantly improved binding affinity enables the detection of small molecule targets with unprecedented sensitivity, as demonstrated in nanoprobe-enhanced split aptamer-based electrochemical sandwich assays (NE-SAESA). NE-SAESA replaces the traditional molecular reporter probe with AuNPs conjugated to multiple reporter probes. The increased binding affinity allowed us to use 1,000-fold lower reporter probe concentrations relative to those employed in SAESA. We show that the near-elimination of background in NE-SAESA effectively improves assay sensitivity by ∼1,000-100,000-fold for ATP and cocaine detection, relative to equivalent SAESA. With the ongoing development of new strategies for the selection of aptamers, we anticipate that our sensor platform should offer a generalizable approach for the high-sensitivity detection of diverse targets. More importantly, we believe that NE-SAESA represents a novel strategy to improve the binding affinity between a small molecule and its aptamer and potentially can be extended to other detection platforms.

High-throughput screening and mechanism-based evaluation of estrogenic botanical extracts

PubMed Central

Overk, Cassia R.; Yao, Ping; Chen, Shaonong; Deng, Shixing; Imai, Ayano; Main, Matthew; Schinkovitz, Andreas; Farnsworth, Norman R.; Pauli, Guido F.; Bolton, Judy L.

2009-01-01

Symptoms associated with menopause can greatly affect the quality of life for women. Botanical dietary supplements have been viewed by the public as safe and effective despite a lack of evidence indicating a urgent necessity to standardize these supplements chemically and biologically. Seventeen plants were evaluated for estrogenic biological activity using standard assays: competitive estrogen receptor (ER) binding assay for both alpha and beta subtypes, transient transfection of the estrogen response element luciferase plasmid into MCF-7 cells expressing either ER alpha or ER beta, and the Ishikawa alkaline phosphatase induction assay for both estrogenic and antiestrogenic activities. Based on the combination of data pooled from these assays, the following was determined: a) a high rate of false positive activity for the competitive binding assays, b) some extracts had estrogenic activity despite a lack of ability to bind the ER, c) one extract exhibited selective estrogen receptor modulator (SERM) activity, and d) several extracts show additive/synergistic activity. Taken together, these data indicate a need to reprioritize the order in which the bioassays are performed for maximal efficiency of programs involving bioassay-guided fractionation. In addition, possible explanations for the conflicts in the literature over the estrogenicity of Cimicifuga racemosa (black cohosh) are suggested. PMID:18473738

Assay for Arf GTP-binding Proteins | NCI Technology Transfer Center | TTC

Cancer.gov

The National Cancer Institute's Laboratory of Cellular and Molecular Biology is seeking statements of capability or interest from parties interested in collaborative research to further develop, evaluate, or commercialize an antibody-based proteomics assay.

Pyridoxylamine reactivity kinetics as an amine based nucleophile for screening electrophilic dermal sensitizers

PubMed Central

Chipinda, Itai; Mbiya, Wilbes; Adigun, Risikat Ajibola; Morakinyo, Moshood K.; Law, Brandon F.; Simoyi, Reuben H.; Siegel, Paul D.

2015-01-01

Chemical allergens bind directly, or after metabolic or abiotic activation, to endogenous proteins to become allergenic. Assessment of this initial binding has been suggested as a target for development of assays to screen chemicals for their allergenic potential. Recently we reported a nitrobenzenethiol (NBT) based method for screening thiol reactive skin sensitizers, however, amine selective sensitizers are not detected by this assay. In the present study we describe an amine (pyridoxylamine (PDA)) based kinetic assay to complement the NBT assay for identification of amine-selective and non-selective skin sensitizers. UV-Vis spectrophotometry and fluorescence were used to measure PDA reactivity for 57 chemicals including anhydrides, aldehydes, and quinones where reaction rates ranged from 116 to 6.2 × 10−6 M−1 s−1 for extreme to weak sensitizers, respectively. No reactivity towards PDA was observed with the thiol-selective sensitizers, non-sensitizers and prohaptens. The PDA rate constants correlated significantly with their respective murine local lymph node assay (LLNA) threshold EC3 values (R2 = 0.76). The use of PDA serves as a simple, inexpensive amine based method that shows promise as a preliminary screening tool for electrophilic, amine-selective skin sensitizers. PMID:24333919

The minor house dust mite allergen Der p 13 is a fatty acid-binding protein and an activator of a TLR2-mediated innate immune response.

PubMed

Satitsuksanoa, P; Kennedy, M; Gilis, D; Le Mignon, M; Suratannon, N; Soh, W T; Wongpiyabovorn, J; Chatchatee, P; Vangveravong, M; Rerkpattanapipat, T; Sangasapaviliya, A; Piboonpocanun, S; Nony, E; Ruxrungtham, K; Jacquet, A

2016-10-01

The house dust mite (HDM) allergen Der p 13 could be a lipid-binding protein able to activate key innate signaling pathways in the initiation of the allergic response. We investigated the IgE reactivity of recombinant Der p 13 (rDer p 13), its lipid-binding activities, and its capacity to stimulate airway epithelium cells. Purified rDer p 13 was characterized by mass spectrometry, circular dichroism, fluorescence-based lipid-binding assays, and in silico structural prediction. IgE-binding activity and allergenic potential of Der p 13 were examined by ELISA, basophil degranulation assays, and in vitro airway epithelial cell activation assays. Protein modeling and biophysical analysis indicated that Der p 13 adopts a β-barrel structure with a predominately apolar pocket representing a potential binding site for hydrophobic ligands. Fluorescent lipid-binding assays confirmed that the protein is highly selective for ligands and that it binds a fatty acid with a dissociation constant typical of lipid transporter proteins. The low IgE-binding frequency (7%, n = 224) in Thai HDM-allergic patients as well as the limited propensity to activate basophil degranulation classifies Der p 13 as a minor HDM allergen. Nevertheless, the protein with its presumptively associated lipid(s) triggered the production of IL-8 and GM-CSF in respiratory epithelial cells through a TLR2-, MyD88-, NF-kB-, and MAPK-dependent signaling pathway. Although a minor allergen, Der p 13 may, through its lipid-binding capacity, play a role in the initiation of the HDM-allergic response through TLR2 activation. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Acetylcholinesterase affinity-based screening assay on Lippia gracilis Schauer extracts.

PubMed

Vanzolini, K L; da F Sprenger, R; Leme, G M; de S Moraes, V R; Vilela, A F L; Cardoso, C L; Cass, Q B

2018-05-10

The use of affinity-based protein assay produced by covalently linking acetylcholinesterase to magnetic beads, followed by chemical characterization of the selective binders using Liquid Chromatography with tandem High-Resolution Mass Spectrometry (LC-HRMS) is herein described for profiling crude aqueous natural product extracts. The fishing assay was first modulated using galanthamine as a reference ligand and then, the assay condition was adjusted for the aqueous leaves extracts obtained from Lippia gracilis Schauer (genotype 201) that was used as the natural combinatory library. From the experiments, a selective binder has been undisclosed with an accurate mass of 449.1131 m/z and identified as eriodictyol 2'-O-glucoside or eriodictyol 3'-O-glucoside. The selectivity of the binding assay was demonstrated, as much as, that erydictiol 7-O-glucoside was not fished, although it was present in the crude aqueous extract. The binding assay platform exhibited high specificity and did not require any sample pretreatment, making it appropriate for profiling binders at natural libraries. Copyright © 2018 Elsevier B.V. All rights reserved.

Detection of potential (anti)progestagenic endocrine disruptors using a recombinant human progesterone receptor binding and transactivation assay.

PubMed

Viswanath, Gunda; Halder, Sujata; Divya, Gunda; Majumder, Chandrajeet B; Roy, Partha

2008-11-25

The present work describes the identification of (anti)progestin endocrine disrupting chemicals (EDC) using a two step screening system. In the first step a competitive binding assay was developed using recombinant human progesterone receptor (hPR). The tested chemicals were of various classes like insecticides, their metabolites, industrial chemicals and waste water treatment plant (WWTP) effluents. All the tested chemicals demonstrated a high affinity binding for hPR. The average IC50 values of the test chemicals were within the range of 1-25microM. In the second step of screening, a mammalian cell-based hPR transactivation assay was developed where HEK 293 cells were co-transfected with hPR and luciferase reporter gene under the control of progesterone-response element. Stimulation of the cells with progesterone resulted in about 25-fold up regulation of luciferase activity, with EC50 value of 4nM. Potent anti-progesterone, RU486, significantly inhibited progesterone-induced transactivation and non-progestagenic steroids failed to transactivate hPR till 1microM concentrations. The chemicals showing high binding affinities in competitive binding assays were then tested in transactivation assay and all of them were found to be anti-progestative except WWTP effluents. Transactivation assays using extracted water samples from five different WWTP effluents showed that it was rich in progestative compounds. The levels of induction caused by these effluents were in the range of 15-25% of induction by progesterone and they represented about 6ng/l equivalent progesterone activities. In conclusion, we demonstrated that this two step assay provides an efficient screening tool for the detection of (anti)progestative EDC in various samples.

A High Content Drug Screen Identifies Ursolic Acid as an Inhibitor of Amyloid β Protein Interactions with Its Receptor CD36*

PubMed Central

Wilkinson, Kim; Boyd, Justin D.; Glicksman, Marcie; Moore, Kathryn J.; El Khoury, Joseph

2011-01-01

A pathological hallmark of Alzheimer disease (AD) is deposition of amyloid β (Aβ) in the brain. Aβ binds to microglia via a receptor complex that includes CD36 leading to production of proinflammatory cytokines and neurotoxic reactive oxygen species and subsequent neurodegeneration. Interruption of Aβ binding to CD36 is a potential therapeutic strategy for AD. To identify pharmacologic inhibitors of Aβ binding to CD36, we developed a 384-well plate assay for binding of fluorescently labeled Aβ to Chinese hamster ovary cells stably expressing human CD36 (CHO-CD36) and screened an Food and Drug Administration-approved compound library. The assay was optimized based on the cells' tolerance to dimethyl sulfoxide, Aβ concentration, time required for Aβ binding, reproducibility, and signal-to-background ratio. Using this assay, we identified four compounds as potential inhibitors of Aβ binding to CD36. These compounds were ursolic acid, ellipticine, zoxazolamine, and homomoschatoline. Of these compounds, only ursolic acid, a naturally occurring pentacyclic triterpenoid, successfully inhibited binding of Aβ to CHO-CD36 cells in a dose-dependent manner. The ursolic acid effect reached a plateau at ∼20 μm, with a maximal inhibition of 64%. Ursolic acid also blocked binding of Aβ to microglial cells and subsequent ROS production. Our data indicate that cell-based high-content screening of small molecule libraries for their ability to block binding of Aβ to its receptors is a useful tool to identify novel inhibitors of receptors involved in AD pathogenesis. Our data also suggest that ursolic acid is a potential therapeutic agent for AD via its ability to block Aβ-CD36 interactions. PMID:21835916

In Situ Protein Binding Assay Using Fc-Fusion Proteins.

PubMed

Padmanabhan, Nirmala; Siddiqui, Tabrez J

2017-01-01

This protocol describes an in situ protein-protein interaction assay between tagged recombinant proteins and cell-surface expressed synaptic proteins. The assay is arguably more sensitive than other traditional protein binding assays such as co-immunoprecipitation and pull-downs and provides a visual readout for binding. This assay has been widely used to determine the dissociation constant of binding of trans-synaptic adhesion proteins. The step-wise description in the protocol should facilitate the adoption of this method in other laboratories.

Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

PubMed Central

Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

2011-01-01

The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

Formulation of vaccines containing CpG oligonucleotides and alum

PubMed Central

Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

2007-01-01

CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

GingisKHAN™ protease cleavage allows a high-throughput antibody to Fab conversion enabling direct functional assessment during lead identification of human monoclonal and bispecific IgG1 antibodies

PubMed Central

Moelleken, Jörg; Gassner, Christian; Lingke, Sabine; Tomaschek, Simone; Tyshchuk, Oksana; Lorenz, Stefan; Mølhøj, Michael

2017-01-01

ABSTRACT The determination of the binding strength of immunoglobulins (IgGs) to targets can be influenced by avidity when the targets are soluble di- or multimeric proteins, or associated to cell surfaces, including surfaces introduced from heterogeneous assays. However, for the understanding of the contribution of a second drug-to-target binding site in molecular design, or for ranking of monovalent binders during lead identification, affinity-based assessment of the binding strength is required. Typically, monovalent binders like antigen-binding fragments (Fabs) are generated by proteolytic cleavage with papain, which often results in a combination of under- and over-digestion, and requires specific optimization and chromatographic purification of the desired Fabs. Alternatively, the Fabs are produced by recombinant approaches. Here, we report a lean approach for the functional assessment of human IgG1s during lead identification based on an in-solution digestion with the GingisKHAN™ protease, generating a homogenous pool of intact Fabs and Fcs and enabling direct assaying of the Fab in the digestion mixture. The digest with GingisKHAN™ is highly specific and quantitative, does not require much optimization, and the protease does not interfere with methods typically applied for lead identification, such as surface plasmon resonance or cell-based assays. GingisKHAN™ is highly suited to differentiate between affinity and avidity driven binding of human IgG1 monoclonal and bispecific antibodies during lead identification. PMID:28805498

Ligation with Nucleic Acid Sequence–Based Amplification

PubMed Central

Ong, Carmichael; Tai, Warren; Sarma, Aartik; Opal, Steven M.; Artenstein, Andrew W.; Tripathi, Anubhav

2012-01-01

This work presents a novel method for detecting nucleic acid targets using a ligation step along with an isothermal, exponential amplification step. We use an engineered ssDNA with two variable regions on the ends, allowing us to design the probe for optimal reaction kinetics and primer binding. This two-part probe is ligated by T4 DNA Ligase only when both parts bind adjacently to the target. The assay demonstrates that the expected 72-nt RNA product appears only when the synthetic target, T4 ligase, and both probe fragments are present during the ligation step. An extraneous 38-nt RNA product also appears due to linear amplification of unligated probe (P3), but its presence does not cause a false-positive result. In addition, 40 mmol/L KCl in the final amplification mix was found to be optimal. It was also found that increasing P5 in excess of P3 helped with ligation and reduced the extraneous 38-nt RNA product. The assay was also tested with a single nucleotide polymorphism target, changing one base at the ligation site. The assay was able to yield a negative signal despite only a single-base change. Finally, using P3 and P5 with longer binding sites results in increased overall sensitivity of the reaction, showing that increasing ligation efficiency can improve the assay overall. We believe that this method can be used effectively for a number of diagnostic assays. PMID:22449695

Incorporating Aptamers in the Multiple Analyte Profiling Assays (xMAP): Detection of C-Reactive Protein.

PubMed

Bernard, Elyse D; Nguyen, Kathy C; DeRosa, Maria C; Tayabali, Azam F; Aranda-Rodriguez, Rocio

2017-01-01

Aptamers are short oligonucleotide sequences used in detection systems because of their high affinity binding to a variety of macromolecules. With the introduction of aptamers over 25 years ago came the exploration of their use in many different applications as a substitute for antibodies. Aptamers have several advantages; they are easy to synthesize, can bind to analytes for which it is difficult to obtain antibodies, and in some cases bind better than antibodies. As such, aptamer applications have significantly expanded as an adjunct to a variety of different immunoassay designs. The Multiple-Analyte Profiling (xMAP) technology developed by Luminex Corporation commonly uses antibodies for the detection of analytes in small sample volumes through the use of fluorescently coded microbeads. This technology permits the simultaneous detection of multiple analytes in each sample tested and hence could be applied in many research fields. Although little work has been performed adapting this technology for use with apatmers, optimizing aptamer-based xMAP assays would dramatically increase the versatility of analyte detection. We report herein on the development of an xMAP bead-based aptamer/antibody sandwich assay for a biomarker of inflammation (C-reactive protein or CRP). Protocols for the coupling of aptamers to xMAP beads, validation of coupling, and for an aptamer/antibody sandwich-type assay for CRP are detailed. The optimized conditions, protocols and findings described in this research could serve as a starting point for the development of new aptamer-based xMAP assays.

Small Molecule Regulation of Protein Conformation by Binding in the Flap of HIV Protease

PubMed Central

Tiefenbrunn, Theresa; Forli, Stefano; Baksh, Michael M.; Chang, Max W.; Happer, Meaghan; Lin, Ying-Chuan; Perryman, Alexander L.; Rhee, Jin-Kyu; Torbett, Bruce E.; Olson, Arthur J.; Elder, John H.; Finn, M. G.; Stout, C. David

2013-01-01

The fragment indole-6-carboxylic acid (1F1), previously identified as a flap site binder in a fragment-based screen against HIV protease (PR), has been co-crystallized with pepstatin-inhibited PR and with apo-PR. Another fragment, 3-indolepropionic acid (1F1-N), predicted by AutoDock calculations and confirmed in a novel ‘inhibition of nucleation’ crystallization assay, exploits the same interactions in the flap site in two crystal structures. Both 1F1 and 1F1-N bind to the closed form of apo-PR and to pepstatin:PR. In solution, 1F1 and 1F1-N raise the Tm of apo-PR by 3.5–5 °C as assayed by differential scanning fluorimetry (DSF), and show equivalent low-micromolar binding constants to both apo-PR and pepstatin:PR, assayed by backscattering interferometry (BSI). The observed signal intensities in BSI are greater for each fragment upon binding to apo-PR than to pepstatin-bound PR, consistent with greater conformational change in the former binding event. Together, these data indicate that fragment binding in the flap site favors a closed conformation of HIV PR. PMID:23540839

International Validation of Two Human Recombinant Estrogen ...

EPA Pesticide Factsheets

An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay using a ligand-binding domain of the human ER. Twenty three compounds were tested in 6 laboratories for the FW assay and 5 for the CERJ assay, which included three controls (used with every run), 9 uncoded, and 14 coded chemicals across 3 subtasks. The overall goal of this validation study was to demonstrate the ability of each of the two assays to reliably classify the test chemicals as binders or non-binders. Laboratories had little trouble with the ER binders that produced a full binding curve when using either the CERI or FW assays. As is typical with all ER competitive binding assays, the weak binders proved to be more challenging. However, overall results from both the FW and CERI assays were consistent and in agreement with expected classifications regardless of the form of the hrER (i.e., full length ER versus an ER ligand binding domain) or the subtle differences in the protocols for conducting each assay. The reproducibility and accuracy for classification of chemicals as potential ER binders and non- binders using the FW and CERI hrER binding assays were comparable to that of the U.S.EPA’s existing ER binding test guideline OPPTS 890.1250, while providing an improved, highe

Detection of HLA Antibodies in Organ Transplant Recipients – Triumphs and Challenges of the Solid Phase Bead Assay

PubMed Central

Tait, Brian D.

2016-01-01

This review outlines the development of human leukocyte antigen (HLA) antibody detection assays and their use in organ transplantation in both antibody screening and crossmatching. The development of sensitive solid phase assays such as the enzyme-linked immunosorbent assay technique, and in particular the bead-based technology has revolutionized this field over the last 10–15 years. This revolution however has created a new paradigm in clinical decision making with respect to the detection of low level pretransplant HLA sensitization and its clinical relevance. The relative sensitivities of the assays used are discussed and the relevance of conflicting inter-assay results. Each assay has its advantages and disadvantages and these are discussed. Over the last decade, the bead-based assay utilizing the Luminex® fluorocytometer instrument has become established as the “gold standard” for HLA antibody testing. However, there are still unresolved issues surrounding this technique, such as the presence of denatured HLA molecules on the beads which reveal cryptic epitopes and the issue of appropriate fluorescence cut off values for positivity. The assay has been modified to detect complement binding (CB) in addition to non-complement binding (NCB) HLA antibodies although the clinical relevance of the CB and NCB IgG isotypes is not fully resolved. The increase sensitivity of the Luminex® bead assay over the complement-dependent cytotoxicity crossmatch has permitted the concept of the “virtual crossmatch” whereby the crossmatch is predicted to a high degree of accuracy based on the HLA antibody specificities detected by the solid phase assay. Dialog between clinicians and laboratory staff on an individual patient basis is essential for correct clinical decision making based on HLA antibody results obtained by the various techniques. PMID:28018342

Synthesis and biological evaluation of guanylhydrazone coactivator binding inhibitors for the estrogen receptor.

PubMed

LaFrate, Andrew L; Gunther, Jillian R; Carlson, Kathryn E; Katzenellenbogen, John A

2008-12-01

Most patients with hormone-responsive breast cancer eventually develop resistance to traditional antiestrogens such as tamoxifen, and this has become a major obstacle in their treatment. We prepared and characterized the activity of a series of 16 guanylhydrazone small molecules that are designed to block estrogen receptor (ER) activity through a non-traditional mechanism, by directly interfering with coactivator binding to agonist-liganded ER. The inhibitory activity of these compounds was determined in cell-based transcription assays using ER-responsive reporter gene and mammalian two-hybrid assays. Several of the compounds gave IC(50) values in the low micromolar range. Two secondary assays were used to confirm that these compounds were acting through the proposed non-traditional mode of estrogen inhibitory action and not as conventional antagonists at the ligand binding site.

Antiviral and Anticancer Optimization Studies of the DNA-binding Marine Natural Product Aaptamine

PubMed Central

Bowling, John J.; Pennaka, Hari K.; Ivey, Kelly; Wahyuono, Subagus; Kelly, Michelle; Schinazi, Raymond F.; Valeriote, Frederick A.; Graves, David E.; Hamann, Mark T.

2016-01-01

Aaptamine has potent cytotoxicity that may be explained by its ability to intercalate DNA. Aaptamine was evaluated for its ability to bind to DNA to validate DNA binding as the primary mechanism of cytotoxicity. Based on UV–vis absorbance titration data, the Kobs for aaptamine was 4.0 (±0.2) × 103 which was essentially equivalent to the known DNA intercalator N-[2-(diethylamino)ethyl]-9-aminoacridine-4-carboxamide. Semi-synthetic core modifications were performed to improve the general structural diversity of known aaptamine analogs and vary its absorption characteristics. Overall, 26 aaptamine derivatives were synthesized which consisted of a simple homologous range of mono and di-N-alkylations as well as some 9-O-sulfonylation and bis-O-isoaaptamine dimer products. Each product was evaluated for activity in a variety of whole cell and viral assays including a unique solid tumor disk diffusion assay. Details of aaptamine's DNA-binding activity and its derivatives’ whole cell and viral assay results are discussed. PMID:18251774

Beyond radio-displacement techniques for Identification of CB1 Ligands: The First Application of a Fluorescence-quenching Assay

PubMed Central

Bruno, Agostino; Lembo, Francesca; Novellino, Ettore; Stornaiuolo, Mariano; Marinelli, Luciana

2014-01-01

Cannabinoid type 1 Receptor (CB1) belongs to the GPCR family and it has been targeted, so far, for the discovery of drugs aimed at the treatment of neuropathic pain, nausea, vomit, and food intake disorders. Here, we present the development of the first fluorescent assay enabling the measurement of kinetic binding constants for CB1orthosteric ligands. The assay is based on the use of T1117, a fluorescent analogue of AM251. We prove that T1117 binds endogenous and recombinant CB1 receptors with nanomolar affinity. Moreover, T1117 binding to CB1 is sensitive to the allosteric ligand ORG27569 and thus it is applicable to the discovery of new allosteric drugs. The herein presented assay constitutes a sustainable valid alternative to the expensive and environmental impacting radiodisplacement techniques and paves the way for an easy, fast and cheap high-throughput drug screening toward CB1 for identification of new orthosteric and allosteric modulators. PMID:24441508

What Do Chaotrope-Based Avidity Assays for Antibodies to HIV-1 Envelope Glycoproteins Measure?

PubMed Central

Alexander, Marina R.; Ringe, Rajesh; Sanders, Rogier W.; Voss, James E.; Moore, John P.

2015-01-01

ABSTRACT When HIV-1 vaccine candidates that include soluble envelope glycoproteins (Env) are tested in humans and other species, the resulting antibody responses to Env are sifted for correlates of protection or risk. One frequently used assay measures the reduction in antibody binding to Env antigens by an added chaotrope (such as thiocyanate). Based on that assay, an avidity index was devised for assessing the affinity maturation of antibodies of unknown concentration in polyclonal sera. Since a high avidity index was linked to protection in animal models of HIV-1 infection, it has become a criterion for evaluating antibody responses to vaccine candidates. But what does the assay measure and what does an avidity index mean? Here, we have used a panel of monoclonal antibodies to well-defined epitopes on Env (gp120, gp41, and SOSIP.664 trimers) to explore how the chaotrope acts. We conclude that the chaotrope sensitivity of antibody binding to Env depends on several properties of the epitopes (continuity versus tertiary- and quaternary-structural dependence) and that the avidity index has no simple relationship to antibody affinity for functional Env spikes on virions. We show that the binding of broadly neutralizing antibodies against quaternary-structural epitopes is particularly sensitive to chaotrope treatment, whereas antibody binding to epitopes in variable loops and to nonneutralization epitopes in gp41 is generally resistant. As a result of such biases, the avidity index may at best be a mere surrogate for undefined antibody or other immune responses that correlate weakly with protection. IMPORTANCE An effective HIV-1 vaccine is an important goal. Such a vaccine will probably need to induce antibodies that neutralize typically transmitted variants of HIV-1, preventing them from infecting target cells. Vaccine candidates have so far failed to induce such antibody responses, although some do protect weakly against infection in animals and, possibly, humans. In the search for responses associated with protection, an avidity assay based on chemical disruption is often used to measure the strength of antibody binding. We have analyzed this assay mechanistically and found that the epitope specificity of an antibody has a greater influence on the outcome than does its affinity. As a result, the avidity assay is biased toward the detection of some antibody specificities while disfavoring others. We conclude that the assay may yield merely indirect correlations with weak protection, specifically when Env vaccination has failed to induce broad neutralizing responses. PMID:25810537

Simple method provides resolution of albumin, lipoprotein, free fraction, and chylomicron to enhance the utility of protein binding assays.

PubMed

Brockman, Adam H; Oller, Haley R; Moreau, Benoît; Kriksciukaite, Kristina; Bilodeau, Mark T

2015-02-12

Medicinal chemists have been encouraged in recent years to embrace high speed protein binding assays. These methods employ dialysis membranes in 96-well format or spin filters. Membrane-based methods do not separate lipoprotein binding from albumin binding and introduce interference despite membrane binding controls. Ultracentrifugation methods, in contrast, do not introduce interference if density gradients can be avoided and they resolve lipoprotein from albumin. A new generation of compact, fast ultracentrifuges facilitates the rapid and fully informative separation of plasma into albumin, albumin/fatty acid complex, lipoprotein, protein-free, and chylomicron fractions with no need of salt or sugar density gradients. We present a simple and fast ultracentrifuge method here for two platinum compounds and a taxane that otherwise bound irreversibly to dialysis membranes and which exhibited distinctive lipoprotein binding behaviors. This new generation of ultracentrifugation methods underscores a need to further discuss protein binding assessments as they relate to medicinal chemistry efforts.

Estrogenicity of halogenated bisphenol A: in vitro and in silico investigations.

PubMed

Zhang, Jie; Li, Tiezhu; Wang, Tuoyi; Yuan, Cuiping; Zhong, Shuning; Guan, Tianzhu; Li, Zhuolin; Wang, Yongzhi; Yu, Hansong; Luo, Quan; Wang, Yongjun; Zhang, Tiehua

2018-03-01

The binding interactions of bisphenol A (BPA) and its halogenated derivatives (halogenated BPAs) to human estrogen receptor α ligand binding domain (hERα-LBD) was investigated using a combined in vitro and in silico approach. First, the recombinant hERα-LBD was prepared as a soluble protein in Escherichia coli BL21(DE3)pLysS. A native fluorescent phytoestrogen, coumestrol, was employed as tracer for the fluorescence polarization assay. The results of the in vitro binding assay showed that bisphenol compounds could bind to hERα-LBD as the affinity ligands. All the tested halogenated BPAs exhibited weaker receptor binding than BPA, which might be explained by the steric effect of substituents. Molecular docking studies elucidated that the halogenated BPAs adopted different conformations in the flexible hydrophobic ligand binding pocket (LBP), which is mainly dependent on their distinct halogenation patterns. The compounds with halogen substituents on the phenolic rings and on the bridging alkyl moiety acted as agonists and antagonists for hERα, respectively. Interestingly, all the compounds in the agonist conformation of hERα formed a hydrogen bond with His524, while the compounds in the antagonist conformation formed a hydrogen bond with Thr347. These docking results suggested a pivotal role of His524/Thr347 in maintaining the hERα structure in the biologically active agonist/antagonist conformation. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation, which might be applicable for the structure-based design of novel bisphenol compounds with reduced toxicities and for environmental risk assessment. In addition, based on hERα-LBD as a recognition element, the proposed fluorescence polarization assay may offer an alternative to chromatographic techniques for the multi-residue determination of bisphenol compounds.

Approaches for Investigating Translational Regulation Controlled by PARP1: Biotin-Based UV Cross-Linking and Luciferase Reporter Assay.

PubMed

Ji, Yingbiao

2017-01-01

The RNA-binding proteins (RBPs) play a pivotal role in controlling gene expression through posttranscriptional processes. As the trans-acting factors, RBPs interact with the cis-regulatory elements located within mRNAs to regulate mRNA translational efficiency. Adding a new-layer regulation, recent studies suggest that poly(ADP-ribosyl)ation of the RNA-binding proteins often inhibit the RNA-binding ability of RBPs, thus regulating RBP-dependent mRNA metabolism including translational control. Here, we describe a biotin-based UV cross-linking method to determine if excessive accumulation of pADPr in the cell disrupts the interaction between RBPs and their target mRNAs. In addition, we illustrate the protocol of using the luciferase reporter assay to determine the effect of poly(ADP-ribosyl)ation on mRNA translation.

Lipid Microarray Biosensor for Biotoxin Detection.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Anup K.; Throckmorton, Daniel J.; Moran-Mirabal, Jose C.

2006-05-01

We present the use of micron-sized lipid domains, patterned onto planar substrates and within microfluidic channels, to assay the binding of bacterial toxins via total internal reflection fluorescence microscopy (TIRFM). The lipid domains were patterned using a polymer lift-off technique and consisted of ganglioside-populated DSPC:cholesterol supported lipid bilayers (SLBs). Lipid patterns were formed on the substrates by vesicle fusion followed by polymer lift-off, which revealed micron-sized SLBs containing either ganglioside GT1b or GM1. The ganglioside-populated SLB arrays were then exposed to either Cholera toxin subunit B (CTB) or Tetanus toxin fragment C (TTC). Binding was assayed on planar substrates bymore » TIRFM down to 1 nM concentration for CTB and 100 nM for TTC. Apparent binding constants extracted from three different models applied to the binding curves suggest that binding of a protein to a lipid-based receptor is strongly affected by the lipid composition of the SLB and by the substrate on which the bilayer is formed. Patterning of SLBs inside microfluidic channels also allowed the preparation of lipid domains with different compositions on a single device. Arrays within microfluidic channels were used to achieve segregation and selective binding from a binary mixture of the toxin fragments in one device. The binding and segregation within the microfluidic channels was assayed with epifluorescence as proof of concept. We propose that the method used for patterning the lipid microarrays on planar substrates and within microfluidic channels can be easily adapted to proteins or nucleic acids and can be used for biosensor applications and cell stimulation assays under different flow conditions. KEYWORDS. Microarray, ganglioside, polymer lift-off, cholera toxin, tetanus toxin, TIRFM, binding constant.4« less

Circulating Immune Complexes in Lyme Arthritis

PubMed Central

Hardin, John A.; Walker, Lesley C.; Steere, Allen C.; Trumble, Thomas C.; Tung, Kenneth S. K.; Williams, Ralph C.; Ruddy, Shaun; Malawista, Stephen E.

1979-01-01

We have found immunoglobulin (Ig) G-containing material consistent with immune complexes in the sera of patients with Lyme arthritis. It was detected in 29 of 55 sera (55%) from 31 patients by at least one of three assays: 125I-C1q binding, C1q solid phase, or Raji cell. The presence of reactive material correlated with clinical aspects of disease activity; it was found early in the illness, was most prominent in sera from the sickest patients, was infrequent during remissions, and often fluctuated in parallel with changes in clinical status. The results in the two C1q assays showed a strong positive correlation (P<0.001). They were each elevated in 45% of the sera and were usually concordant (85%). In contrast, the Raji cell assay was less frequently positive and often discordant with the C1q assays. In sucrose density gradients, putative circulating immune complexes sedimented near 19S; they, too, were detected best by the two assays based on C1q binding. An additional 7S component was found in some sera by the 125I-C1q binding assay. Serum complement was often above the range of normal in patients with mild disease and normal in patients with severe disease but did not correlate significantly with levels of circulating immune complexes. IgM and IgG rheumatoid factors were not detectable. These findings support a role for immune complexes in the pathogenesis of Lyme arthritis. Their measurement, by either the 125I-C1q binding assay or by the C1q solid phase assay, often provides a sensitive index of disease activity. Moreover, the complexes are likely sources of disease-related antigens for further study of this new disorder. PMID:429566

Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

NASA Astrophysics Data System (ADS)

Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

2015-01-01

This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application.

PubMed

Dorraj, Ghamar Soltan; Rassaee, Mohammad Javad; Latifi, Ali Mohammad; Pishgoo, Bahram; Tavallaei, Mahmood

2015-08-20

Troponin T and I are ideal markers which are highly sensitive and specific for myocardial injury and have shown better efficacy than earlier markers. Since aptamers are ssDNA or RNA that bind to a wide variety of target molecules, the purpose of this research was to select an aptamer from a 79bp single-stranded DNA (ssDNA) random library that was used to bind the Human Cardiac Troponin I from a synthetic nucleic acids library by systematic evolution of ligands exponential enrichment (Selex) based on several selection and amplification steps. Human Cardiac Troponin I protein was coated onto the surface of streptavidin magnetic beads to extract specific aptamer from a large and diverse random ssDNA initial oligonucleotide library. As a result, several aptamers were selected and further examined for binding affinity and specificity. Finally TnIApt 23 showed beast affinity in nanomolar range (2.69nM) toward the target protein. A simple and rapid colorimetric detection assay for Human Cardiac Troponin I using the novel and specific aptamer-AuNPs conjugates based on dot blot assay was developed. The detection limit for this protein using aptamer-AuNPs-based assay was found to be 5ng/ml. Copyright © 2015 Elsevier B.V. All rights reserved.

Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction

PubMed Central

Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K.; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G.; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H.

2017-01-01

The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. PMID:27899623

Addressing matrix effects in ligand-binding assays through the use of new reagents and technology.

PubMed

Chilewski, Shannon D; Mora, Johanna R; Gleason, Carol; DeSilva, Binodh

2014-04-01

Ligand-binding assays (LBAs) used in the quantification of biotherapeutics for pharmacokinetic determinations rely on interactions between reagents (antibodies or target molecule) and the biotherapeutic. Most LBAs do not employ an analyte extraction procedure and are susceptible to matrix interference. Here, we present a case study on the development of a LBA for the quantification of a PEGylated domain antibody where matrix interference was observed. The assay used to support the single ascending dose study was a plate-based electrochemiluminescent assay with a lower limit of quantification of 80 ng/mL. To meet sensitivity requirements of future studies, new reagents and the Gyrolab™ Workstation were evaluated. Assay sensitivity improved nearly threefold in the final method utilizing new antibody reagents, a buffer containing blockers to human anti-animal antibodies, and the Gyrolab Workstation. Experimental data indicate that all factors changed played a role in overcoming matrix effects.

Multiplexed analysis of protein-ligand interactions by fluorescence anisotropy in a microfluidic platform.

PubMed

Cheow, Lih Feng; Viswanathan, Ramya; Chin, Chee-Sing; Jennifer, Nancy; Jones, Robert C; Guccione, Ernesto; Quake, Stephen R; Burkholder, William F

2014-10-07

Homogeneous assay platforms for measuring protein-ligand interactions are highly valued due to their potential for high-throughput screening. However, the implementation of these multiplexed assays in conventional microplate formats is considerably expensive due to the large amounts of reagents required and the need for automation. We implemented a homogeneous fluorescence anisotropy-based binding assay in an automated microfluidic chip to simultaneously interrogate >2300 pairwise interactions. We demonstrated the utility of this platform in determining the binding affinities between chromatin-regulatory proteins and different post-translationally modified histone peptides. The microfluidic chip assay produces comparable results to conventional microtiter plate assays, yet requires 2 orders of magnitude less sample and an order of magnitude fewer pipetting steps. This approach enables one to use small samples for medium-scale screening and could ease the bottleneck of large-scale protein purification.

Targeting Anti-Cancer Active Compounds: Affinity-Based Chromatographic Assays

PubMed Central

de Moraes, Marcela Cristina; Cardoso, Carmen Lucia; Seidl, Claudia; Moaddel, Ruin; Cass, Quezia Bezerra

2016-01-01

Affinity-based chromatography assays encompass the use of solid supports containing immobilized biological targets to monitor binding events in the isolation , identification and/or characterization of bioactive compounds. This powerful bioanalytical technique allows the screening of potential binders through fast analyses that can be directly performed using isolated substances or complex matrices. An overview of the recent researches in frontal and zonal affinity-based chromatography screening assays, which has been used as a tool in the identification and characterization of new anti-cancer agents, is discussed. In addition, a critical evaluation of the recently emerged ligands fishing assays in complex mixtures is also discussed. PMID:27306095

Coupling the Torpedo microplate-receptor binding assay with mass spectrometry to detect cyclic imine neurotoxins.

PubMed

Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M; Zakarian, Armen; Molgó, Jordi

2012-12-04

Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility.

Coupling the Torpedo Microplate-Receptor Binding Assay with Mass Spectrometry to Detect Cyclic Imine Neurotoxins

PubMed Central

Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M.; Zakarian, Armen; Molgó, Jordi

2014-01-01

Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility. PMID:23131021

Domain-based assays of individual antibody concentrations in an oligoclonal combination targeting a single protein.

PubMed

Meng, Q; Li, M; Silberg, M A; Conrad, F; Bettencourt, J; To, R; Huang, C; Ma, J; Meyer, K; Shimizu, R; Cao, L; Tomic, M T; Marks, J D

2012-02-15

Quantitation of individual monoclonal antibodies (mAbs) within a combined antibody drug product is required for preclinical and clinical drug development, including pharmacokinetic (PK), toxicology, stability, and biochemical characterization studies of such drugs. We have developed an antitoxin, XOMA 3AB, consisting of three recombinant mAbs that potently neutralize the known subtypes of type A botulinum neurotoxin (BoNT/A). The three mAbs bind nonoverlapping BoNT/A epitopes with high affinity. XOMA 3AB is being developed as a treatment for botulism resulting from BoNT/A. To develop antibody-specific assays, we cloned, expressed, and purified BoNT/A domains from Escherichia coli. Each mAb bound only to its specific domain with affinity comparable to the binding to holotoxin. mAb-specific domains were used to develop an enzyme-linked immunosorbent assay (ELISA) for characterization of the integrity and binding activity of the three mAbs in the drug product. An electrochemiluminescence bridging assay that is robust to interference from components in serum was also developed, and we demonstrate that it can be used for PK assays. This type of antigen engineering to generate mAb-specific domains is a general method allowing quantitation and characterization of individual mAbs in a mAb cocktail that binds the same protein and is superior to anti-idiotype approaches. Copyright © 2011 Elsevier Inc. All rights reserved.

Fluorescent Receptor Binding Assay for Detecting Ciguatoxins in Fish

PubMed Central

Hardison, D. Ransom; Holland, William C.; McCall, Jennifer R.; Bourdelais, Andrea J.; Baden, Daniel G.; Darius, H. Taiana; Chinain, Mireille; Tester, Patricia A.; Shea, Damian; Flores Quintana, Harold A.; Morris, James A.; Litaker, R. Wayne

2016-01-01

Ciguatera fish poisoning is an illness suffered by > 50,000 people yearly after consumption of fish containing ciguatoxins (CTXs). One of the current methodologies to detect ciguatoxins in fish is a radiolabeled receptor binding assay (RBA(R)). However, the license requirements and regulations pertaining to radioisotope utilization can limit the applicability of the RBA(R) in certain labs. A fluorescence based receptor binding assay (RBA(F)) was developed to provide an alternative method of screening fish samples for CTXs in facilities not certified to use radioisotopes. The new assay is based on competition binding between CTXs and fluorescently labeled brevetoxin-2 (BODIPY®- PbTx-2) for voltage-gated sodium channel receptors at site 5 instead of a radiolabeled brevetoxin. Responses were linear in fish tissues spiked from 0.1 to 1.0 ppb with Pacific ciguatoxin-3C (P-CTX-3C) with a detection limit of 0.075 ppb. Carribean ciguatoxins were confirmed in Caribbean fish by LC-MS/MS analysis of the regional biomarker (C-CTX-1). Fish (N = 61) of six different species were screened using the RBA(F). Results for corresponding samples analyzed using the neuroblastoma cell-based assay (CBA-N2a) correlated well (R2 = 0.71) with those of the RBA(F), given the low levels of CTX present in positive fish. Data analyses also showed the resulting toxicity levels of P-CTX-3C equivalents determined by CBA-N2a were consistently lower than the RBA(F) affinities expressed as % binding equivalents, indicating that a given amount of toxin bound to the site 5 receptors translates into corresponding lower cytotoxicity. Consequently, the RBA(F), which takes approximately two hours to perform, provides a generous estimate relative to the widely used CBA-N2a which requires 2.5 days to complete. Other RBA(F) advantages include the long-term (> 5 years) stability of the BODIPY®- PbTx-2 and having similar results as the commonly used RBA(R). The RBA(F) is cost-effective, allows high sample throughput, and is well-suited for routine CTX monitoring programs. PMID:27073998

Phytoestrogens and Mycoestrogens Induce Signature Structure Dynamics Changes on Estrogen Receptor α

PubMed Central

Chen, Xueyan; Uzuner, Ugur; Li, Man; Shi, Weibing; Yuan, Joshua S.; Dai, Susie Y.

2016-01-01

Endocrine disrupters include a broad spectrum of chemicals such as industrial chemicals, natural estrogens and androgens, synthetic estrogens and androgens. Phytoestrogens are widely present in diet and food supplements; mycoestrogens are frequently found in grains. As human beings and animals are commonly exposed to phytoestrogens and mycoestrogens in diet and environment, it is important to understand the potential beneficial or hazardous effects of estrogenic compounds. Many bioassays have been established to study the binding of estrogenic compounds with estrogen receptor (ER) and provided rich data in the literature. However, limited assays can offer structure information with regard to the ligand/ER complex. Our current study surveys the global structure dynamics changes for ERα ligand binding domain (LBD) when phytoestrogens and mycoestrogens bind. The assay is based on the structure dynamics information probed by hydrogen deuterium exchange mass spectrometry and offers a unique viewpoint to elucidate the mechanism how phytoestrogens and mycoestrogens interact with estrogen receptor. The cluster analysis based on the hydrogen deuterium exchange (HDX) assay data reveals a unique pattern when phytoestrogens and mycoestrogens bind with ERα LBD compared to that of estradiol and synthetic estrogen modulators. Our study highlights that structure dynamics could play an important role in the structure function relationship when endocrine disrupters interact with estrogen receptors. PMID:27589781

High throughput screening technologies for ion channels

PubMed Central

Yu, Hai-bo; Li, Min; Wang, Wei-ping; Wang, Xiao-liang

2016-01-01

Ion channels are involved in a variety of fundamental physiological processes, and their malfunction causes numerous human diseases. Therefore, ion channels represent a class of attractive drug targets and a class of important off-targets for in vitro pharmacological profiling. In the past decades, the rapid progress in developing functional assays and instrumentation has enabled high throughput screening (HTS) campaigns on an expanding list of channel types. Chronologically, HTS methods for ion channels include the ligand binding assay, flux-based assay, fluorescence-based assay, and automated electrophysiological assay. In this review we summarize the current HTS technologies for different ion channel classes and their applications. PMID:26657056

Novel multiple opioid ligands based on 4-aminobenzazepinone (Aba), azepinoindole (Aia) and tetrahydroisoquinoline (Tic) scaffolds

PubMed Central

Ballet, Steven; Marczak, Ewa D.; Feytens, Debby; Salvadori, Severo; Sasaki, Yusuke; Abell, Andrew D.; Lazarus, Lawrence H.; Balboni, Gianfranco; Tourwé, Dirk

2010-01-01

The dimerization and trimerization of the Dmt-Tic, Dmt-Aia and Dmt-Aba pharmacophores provided multiple ligands which were evaluated in vitro for opioid receptor binding and functional activity. Whereas the Tic- and Aba multimers proved to be dual and balanced δ/μ antagonists, as determined by the functional [S35]GTPγS binding assay, the dimerization of potent Aia-based ‘parent’ ligands unexpectedly resulted in substantial less efficient receptor binding and non-active dimeric compounds. PMID:20137938

Bicyclic tetrapeptide histone deacetylase inhibitors with methoxymethyl ketone and boronic acid zinc-binding groups.

PubMed

Islam, Md Nurul; Islam, Md Shahidul; Hoque, Md Ashraful; Kato, Tamaki; Nishino, Norikazu; Ito, Akihiro; Yoshida, Minoru

2014-12-01

Histone deacetylase (HDAC) inhibitors are a class of potential therapeutics for the treatment of cancer. Bicyclic tetrapeptides equipped with methoxymethyl ketone and boronic acid as zinc-binding group were designed and synthesized. The inhibitory activities of these compounds were evaluated against HDAC enzymes. The cell-free and cell-based assay data showed that both potency and selectivity changed with the change in zinc-binding group. Boronic acid-based compound showed poor activity whereas methoxymethyl ketone-based compound displayed impressive activity in both cell-free and cell-based conditions. Copyright © 2014 Elsevier Inc. All rights reserved.

International Validation of Two Human Recombinant Estrogen Receptor (ERa) Binding Assays

EPA Science Inventory

An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay...

An in vivo imaging-based assay for detecting protein interactions over a wide range of binding affinities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fowlkes, Jason Davidson; Owens, Elizabeth T; Standaert, Robert F

2009-01-01

Identifying and characterizing protein interactions are fundamental steps towards understanding and modeling biological networks. Methods that detect protein interactions in intact cells rather than buffered solutions are likely more relevant to natural systems since molecular crowding events in the cytosol can influence the diffusion and reactivity of individual proteins. One in vivo, imaging-based method relies on the co-localization of two proteins of interest fused to DivIVA, a cell division protein from Bacillus subtilis, and green fluorescent protein (GFP). We have modified this imaging-based assay to facilitate rapid cloning by constructing new vectors encoding N- and C-terminal DivIVA or GFP molecularmore » tag fusions based on site-specific recombination technology. The sensitivity of the assay was defined using a well-characterized protein interaction system involving the eukaryotic nuclear import receptor subunit, Importin (Imp ) and variant nuclear localization signals (NLS) representing a range of binding affinities. These data demonstrate that the modified co-localization assay is sensitive enough to detect protein interactions with Kd values that span over four orders of magnitude (1nM to 15 M). Lastly, this assay was used to confirm numerous protein interactions identified from mass spectrometry-based analyses of affinity isolates as part of an interactome mapping project in Rhodopseudomonas palustris« less

Hyperthermostable binding molecules on phage: Assay components for point-of-care diagnostics for active tuberculosis infection.

PubMed

Zhao, Ning; Spencer, John; Schmitt, Margaret A; Fisk, John D

2017-03-15

Tuberculosis is the leading cause of death from infectious disease worldwide. The low sensitivity, extended processing time, and high expense of current diagnostics are major challenges to the detection and treatment of tuberculosis. Mycobacterium tuberculosis ornithine transcarbamylase (Mtb OTC, Rv1656) has been identified in the urine of patients with active TB infection and is a promising target for point-of-care diagnostics. Specific binding proteins with low nanomolar affinities for Mtb OTC were selected from a phage display library built upon a hyperthermostable Sso7d scaffold. Phage particles displaying Sso7d variants were utilized to generate a sandwich ELISA-based assay for Mtb OTC. The assay response is linear between 2 ng/mL and 125 ng/mL recombinant Mtb OTC and has a limit of detection of 400 pg/mL recombinant Mtb OTC. The assay employing a phage-based detection reagent is comparable to commercially-available antibody-based biosensors. Importantly, the assay maintains functionality at both neutral and basic pH in presence of salt and urea over the range of concentrations typical for human urine. Phage-based diagnostic systems may feature improved physical stability and cost of production relative to traditional antibody-based reagents, without sacrificing specificity and sensitivity. Copyright © 2017 Elsevier Inc. All rights reserved.

SH2-PLA: a sensitive in-solution approach for quantification of modular domain binding by proximity ligation and real-time PCR.

PubMed

Thompson, Christopher M; Bloom, Lee R; Ogiue-Ikeda, Mari; Machida, Kazuya

2015-06-26

There is a great interest in studying phosphotyrosine dependent protein-protein interactions in tyrosine kinase pathways that play a critical role in many aspects of cellular function. We previously established SH2 profiling, a phosphoproteomic approach based on membrane binding assays that utilizes purified Src Homology 2 (SH2) domains as a molecular tool to profile the global tyrosine phosphorylation state of cells. However, in order to use this method to investigate SH2 binding sites on a specific target in cell lysate, additional procedures such as pull-down or immunoprecipitation which consume large amounts of sample are required. We have developed PLA-SH2, an alternative in-solution modular domain binding assay that takes advantage of Proximity Ligation Assay and real-time PCR. The SH2-PLA assay utilizes oligonucleotide-conjugated anti-GST and anti-EGFR antibodies recognizing a GST-SH2 probe and cellular EGFR, respectively. If the GST-SH2 and EGFR are in close proximity as a result of SH2-phosphotyrosine interactions, the two oligonucleotides are brought within a suitable distance for ligation to occur, allowing for efficient complex amplification via real-time PCR. The assay detected signal across at least 3 orders of magnitude of lysate input with a linear range spanning 1-2 orders and a low femtomole limit of detection for EGFR phosphotyrosine. SH2 binding kinetics determined by PLA-SH2 showed good agreement with established far-Western analyses for A431 and Cos1 cells stimulated with EGF at various times and doses. Further, we showed that PLA-SH2 can survey lung cancer tissues using 1 μl lysate without requiring phospho-enrichment. We showed for the first time that interactions between SH2 domain probes and EGFR in cell lysate can be determined in a microliter-scale assay using SH2-PLA. The obvious benefit of this method is that the low sample requirement allows detection of SH2 binding in samples which are difficult to analyze using traditional protein interaction assays. This feature along with short assay runtime makes this method a useful platform for the development of high throughput assays to determine modular domain-ligand interactions which could have wide-ranging applications in both basic and translational cancer research.

Adaptive Focused Acoustics (AFA) Improves the Performance of Microtiter Plate ELISAs.

PubMed

Green, David J; Rudd, Edwin A; Laugharn, James A

2014-08-01

We investigated the use of Adaptive Focused Acoustics (AFA) technology to improve the performance of microtiter plate enzyme-linked immunosorbent assays (ELISAs). Experiments were performed with commercially available AFA instrumentation and off-the-shelf 96-well microtiter plate sandwich ELISAs. AFA was applied over a range of acoustic energies, temperatures, and durations to the antigen/antibody binding step of an ELISA for measuring HIV-1 p24 in tissue culture samples. AFA-mediated antigen/antibody binding was enhanced up to 2-fold over passive binding at comparable temperatures and was superior or comparable at low temperature (8-10 °C) to passive binding at 37 °C. Lower nonspecific binding (NSB), lower inter- and intra-assay coefficients of variation (CVs), higher Z' factors, and lower limits of detection (LODs) were measured in AFA-mediated assays compared with conventional passive binding. In a more limited study, AFA enhancement of antigen/antibody binding and lower NSB was measured in an ELISA for measuring IGFBP-3 in human plasma. We conclude from this study that application of AFA to antigen/antibody binding steps in microtiter plate ELISAs can enhance key assay performance parameters, particularly Z' factors and LODs. These features render AFA-mediated binding assays potentially more useful in applications such as high-throughput screening and in vitro diagnostics than assays processed with conventional passive antigen/antibody binding steps. © 2014 Society for Laboratory Automation and Screening.

Integrated Summary Report: Validation of Two Binding Assays ...

EPA Pesticide Factsheets

This Integrated Summary Report (ISR) summarizes, in a single document, the results from an international multi-laboratory validation study conducted for two in vitro estrogen receptor (ER) binding assays. These assays both use human recombinant estrogen receptor, alpha subtype (hrERα), to identify chemicals that may impact estrogen signaling through binding to the ER. The purpose of the ISR is to support the peer review of the findings obtained during the validation process.The two assays evaluated during this validation process are: The Freyberger-Wilson Assay (FW) using a full length human ER, and The Chemical Evaluation and Research Institute (CERI) Assay using a ligand-binding domain of the human ER.The two assays are mechanistically and functionally similar in that each measures the ability of a test chemical to competitively inhibit binding of [3H]17β-estradiol to the human recombinant ER. The essential elements of the FW and the CERI assays were developed at the laboratories of Bayer Pharma AG, Wuppertal, Germany (Freyberger et al., 2010) and CERI, Tokyo, Japan (Akahori et al., 2008), respectively.The ER competitive binding assay has long been in use, and is a well characterized approach, but historically uses rodent or other animal tissues as a source of the ER. Validation of the FW and CERI assays using human recombinant estrogen receptors ( subtype) will provide an updated alternative for the Agency’s current test guideline (OPPTS 89

Characterization of Receptor Binding Profiles of Influenza A Viruses Using An Ellipsometry-Based Label-Free Glycan Microarray Assay Platform

PubMed Central

Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P.; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong

2015-01-01

A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10–100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven. PMID:26193329

Characterization of Receptor Binding Profiles of Influenza A Viruses Using An Ellipsometry-Based Label-Free Glycan Microarray Assay Platform.

PubMed

Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong

2015-07-16

A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10-100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven.

Stimulation of iodine organification in porcine thyroid cells by thyroid stimulators.

PubMed

Ginsberg, J; Shewring, G; Howells, R; Smith, B R; Hall, R

Several Graves' sera were simultaneously assessed in a bioassay based on the ability of porcine thyroid cells to organify 125I and in a radioreceptor assay for TSH receptor binding activity. Both assay systems were sensitive to 1 mcU/ml (final concentration) of unlabelled bovine TSH. Six Graves' sera were studied in detail over a wide (0-1.0 mcl sera) dose response range in repeat determinations. Two sera exhibited parallel binding and stimulating. However, two sera revealed significant inhibition of 125I-TSH binding prior to the demonstration of stimulation and the other two sera showed stimulatory capabilities before significant binding was evident. IgG was prepared from one serum by ammonium sulphate precipitation and chromatography on Sepharose 6B and then subjected to preparative isoelectric focusing. The isoelectric distribution of the two activities were found to be identical with major peaks of activity at pl=9.5 and pl=8.5. In summary: 1) each Graves' sera exhibits different dose-response curves with respect to binding and stimulation, 2) at certain concentrations of sera, only binding or stimulation were evident, 3) neither assay was consistently more sensitive for the presence of Graves' immunoglobulins, 4) for one Graves' sera, binding and stimulation could not be separated by isoelectric focusing. These studies would suggest each Graves' immunoglobulin has inherently different characteristics in its interaction with the TSH receptor.

A cooperative-binding split aptamer assay for rapid, specific and ultra-sensitive fluorescence detection of cocaine in saliva.

PubMed

Yu, Haixiang; Canoura, Juan; Guntupalli, Bhargav; Lou, Xinhui; Xiao, Yi

2017-01-01

Sensors employing split aptamers that reassemble in the presence of a target can achieve excellent specificity, but the accompanying reduction of target affinity mitigates any overall gains in sensitivity. We for the first time have developed a split aptamer that achieves enhanced target-binding affinity through cooperative binding. We have generated a split cocaine-binding aptamer that incorporates two binding domains, such that target binding at one domain greatly increases the affinity of the second domain. We experimentally demonstrate that the resulting cooperative-binding split aptamer (CBSA) exhibits higher target binding affinity and is far more responsive in terms of target-induced aptamer assembly compared to the single-domain parent split aptamer (PSA) from which it was derived. We further confirm that the target-binding affinity of our CBSA can be affected by the cooperativity of its binding domains and the intrinsic affinity of its PSA. To the best of our knowledge, CBSA-5335 has the highest cocaine affinity of any split aptamer described to date. The CBSA-based assay also demonstrates excellent performance in target detection in complex samples. Using this CBSA, we achieved specific, ultra-sensitive, one-step fluorescence detection of cocaine within fifteen minutes at concentrations as low as 50 nM in 10% saliva without signal amplification. This limit of detection meets the standards recommended by the European Union's Driving under the Influence of Drugs, Alcohol and Medicines program. Our assay also demonstrates excellent reproducibility of results, confirming that this CBSA-platform represents a robust and sensitive means for cocaine detection in actual clinical samples.

Detection of biotin in individual sea urchin oocytes using a bioluminescence binding assay.

PubMed

Feltus, A; Grosvenor, A L; Conover, R C; Anderson, K W; Daunert, S

2001-04-01

The ability to detect biomolecules in single cells is important in order to fully understand the processes by which many biochemical events occur. To that end, we have developed a bioluminescence binding assay capable of measuring the intracellular biotin content of individual cells. The assay depends on competition between an aequorin-biotin conjugate (AEQ-biotin) and free biotin within the oocytes for binding sites on the protein avidin. The assay is performed by microinjecting each component into the oocytes and following the resulting bioluminescence within the oocyte upon triggering of aequorin. Results obtained using sea urchin oocytes show that the assay performed within the cells behaves in a manner consistent with assay theory. Using the assay, the individual biotin content of the oocytes is an average of approximately 20 amol. To our knowledge, this is the first reported multicomponent binding assay to be performed inside an intact single cell.

High-throughput kinase assays with protein substrates using fluorescent polymer superquenching.

PubMed

Rininsland, Frauke; Stankewicz, Casey; Weatherford, Wendy; McBranch, Duncan

2005-05-31

High-throughput screening is used by the pharmaceutical industry for identifying lead compounds that interact with targets of pharmacological interest. Because of the key role that aberrant regulation of protein phosphorylation plays in diseases such as cancer, diabetes and hypertension, kinases have become one of the main drug targets. With the exception of antibody-based assays, methods to screen for specific kinase activity are generally restricted to the use of small synthetic peptides as substrates. However, the use of natural protein substrates has the advantage that potential inhibitors can be detected that affect enzyme activity by binding to a site other than the catalytic site. We have previously reported a non-radioactive and non-antibody-based fluorescence quench assay for detection of phosphorylation or dephosphorylation using synthetic peptide substrates. The aim of this work is to develop an assay for detection of phosphorylation of chemically unmodified proteins based on this polymer superquenching platform. Using a modified QTL Lightspeed assay, phosphorylation of native protein was quantified by the interaction of the phosphorylated proteins with metal-ion coordinating groups co-located with fluorescent polymer deposited onto microspheres. The binding of phospho-protein inhibits a dye-labeled "tracer" peptide from associating to the phosphate-binding sites present on the fluorescent microspheres. The resulting inhibition of quench generates a "turn on" assay, in which the signal correlates with the phosphorylation of the substrate. The assay was tested on three different proteins: Myelin Basic Protein (MBP), Histone H1 and Phosphorylated heat- and acid-stable protein (PHAS-1). Phosphorylation of the proteins was detected by Protein Kinase Calpha (PKCalpha) and by the Interleukin -1 Receptor-associated Kinase 4 (IRAK4). Enzyme inhibition yielded IC50 values that were comparable to those obtained using peptide substrates. Statistical parameters that are used in the high-throughput community to determine assay robustness (Z'-value) demonstrate the suitability of this format for high-throughput screening applications for detection of inhibitors of enzyme activity. The QTL Lightspeed protein detection system provides a simple mix and measure "turn on" assay for the detection of kinase activity using natural protein substrates. The platform is robust and allows for identification of inhibitors of kinase activity.

[Receptor elements for biosensors in two ways of methylotrophic yeast immobilization].

PubMed

Zaĭtsev, M G; Arliapov, V A; Alferov, V A; Reshetilov, A N

2012-01-01

Receptor elements for biosensors based on Hansenula polymorpha NCYC 495 In yeast cells for ethanol assay were developed using two ways of cell immobilization, i.e., physical adsorption on a glass fiber membrane and covalent binding on a modified nitrocellulose membrane. The linear diapason of ethanol assays for a biosensor based on yeast cells adsorbed on glass fiber was 0.05-1.18; for a biosensor based on yeasts immobilized on a nitrocellulose membrane, 0.2-1.53 mM. Receptor elements based on sorbed cells possessed 2.5 times higher long-term stability. The time response was 1.5 times less for cells immobilized using DEAE-dextran and benzochinone. The results of ethyl alcohol assays using biosensors based on cells immobilized via adsorption and covalent binding, as well as using the standard areometric method, had high correlation coefficients (0.998 and 0.997, respectively, for the two ways of immobilization). The results indicate the possibility to consider the described models of receptor elements for biosensors as prototypes for experimental samples for practical use.

A comparison of sperm agglutination and immobilization assays with a quantitative ELISA for anti-sperm antibody in serum.

PubMed

Lynch, D M; Leali, B A; Howe, S E

1986-08-01

An enzyme-linked immunosorbent assay (ELISA) that quantitates antisperm antibody in serum was compared with standard sperm agglutination and immobilization assays with the use of sera from 40 normal and 292 subfertile individuals. Quantitation of the assay was accomplished by standardizing assay parameters, including the incorporation of a standard reference curve, the number of whole target sperm, the optimal dilution of serum, the selection of microtiter plate, and the time and temperatures involved in the adsorption and incubation phases. With this method, the level of antisperm antibody binding to target sperm in 40 normal fertile individuals was found to be 2.3 (+/- 1.1 standard deviation [SD]) fg immunoglobulin (Ig)/sperm. An increased mean level of 7.4 +/- 3.7 fg Ig/sperm was determined in 84 infertile patients with positive agglutination and/or immobilization tests. In 208 individuals with negative agglutination and immobilization tests the mean concentration of antisperm antibody was 2.5 +/- 1.3 fg Ig/sperm. Postvasectomy patients assayed by this method had a mean Ig binding value of 7.1 +/- 2.4 fg Ig/sperm. The infertile group with positive agglutination and/or immobilization tests had a significantly higher mean antisperm antibody level than the normal fertile group, according to the Student's t-test for independent samples (P less than 0.001). This indirect serum-based assay reproducibly quantitates antisperm antibody binding to whole target sperm, suggests the normal and abnormal levels of antisperm antibody, and correlates with standard functional assays.

Synthesis of photothermal nanocomposites and their application to antibacterial assays

NASA Astrophysics Data System (ADS)

Yang, Ning; Wang, Chun; Wang, Xiaoyu; Li, Lidong

2018-04-01

In this work, we report a novel gold nanorod (AuNR)-based nanocomposite that shows strong binding to bacterium and high antibacterial efficiency. The AuNRs were used as a photothermal material to transform near-infrared radiation (NIR) into heat. We selected poly (acrylic acid) to modify the surface of the AuNRs based on a simple self-assembly method. After conjugation of the bacterium-binding molecule vancomycin, the nanocomposites were capable of efficiently gathering on the cell walls of bacteria. The nanocomposites exhibited a high bacterial inhibition capability owing to NIR-induced heat generation in situ. Therefore, the prepared photothermal nanocomposites show great potential for use in antibacterial assays.

Implantable fluorescence-based glucose sensor development

NASA Astrophysics Data System (ADS)

Ibey, Bennett L.; Yadavalli, Vamsi K.; Thomas, Hope R.; Rounds, Rebecca M.; Pishko, Michael V.; Cote, Gerard L.

2005-03-01

An implantable sensor is being created that allows measurement of blood glucose through fluorescent detection of an embedded chemical assay. The sensor is based on the competitive binding reaction between the protein Concanavalin A and various saccharide molecules, specifically a glycodendrimer and glucose. Previous studies have shown the ability of an embedded chemical assay using Con A and dextran with shorter wavelength dyes to both sense changes in glucose and generate sufficient fluorescent emission to pass through the dermal tissue. However, due to the chemical constituents of the assay, multivalent binding was evident resulting in poor spectral change due to glucose within the biological range. Use of a glycodendrimer and longer wavelength dyes has improved the sensor"s spectral change due to glucose and the overall signal to noise ratio of the sensor. In this work, a description of this sensor and the results obtained from it will be presented showing a large dynamic range of fluorescence with glucose.

Renilla luciferase-labeled Annexin V: a new probe for detection of apoptotic cells.

PubMed

Nazari, Mahboobeh; Emamzadeh, Rahman; Hosseinkhani, Saman; Cevenini, Luca; Michelini, Elisa; Roda, Aldo

2012-11-07

The Ca(2+)-dependent binding of Annexin V to phosphatidylserine on cell surfaces is a reliable marker for apoptosis that is widely used in flow cytometry based apoptosis assays. In this paper, we report a new class of Annexin V-based probes for apoptosis. Luciferase from Renilla reniformis (RLuc) was linked to Annexin V and expressed successfully in a soluble form in Escherichia coli BL21 (DE3). The new probe, Rluc/Annexin V, was purified and functionally assayed for detection of apoptosis in actinomycin D-induced apoptotic Jurkat cells. Moreover, the spontaneous apoptosis in neutrophils was shown using the new probe. The results indicate that Rluc/Annexin V can bind to the apoptotic cells, and the signal of Renilla luciferase can be detected by luminometric measurements. The availability of Rluc/Annexin V may be of potential commercial interest for improving current apoptosis assays.

A Fluorescence Polarization Biophysical Assay for the Naegleria DNA Hydroxylase Tet1.

PubMed

Marholz, Laura J; Wang, Wei; Zheng, Yu; Wang, Xiang

2016-02-11

The discovery of the 5-methylcytosine (5mC) oxidation by the ten-eleven translocation (Tet) protein family was an important advancement in our understanding of DNA-modified epigenetics. Potent inhibitors of these proteins are greatly desired for both the understanding of the functions of these enzymes and to serve as eventual therapeutic leads. So far, the discovery of such small molecules with high affinity has been quite limited. Original tools to screen for activity are greatly needed in order to accelerate this process. Here we present a novel fluorescent probe, and the results of a fluorescence polarization-based binding assay for Naegleria Tet1, a homologue to mammalian Tet. A fluorescence polarization-based competition assay was also established and applied to the rapid and quantitative measurement of the binding affinity of the cofactor αKG and several known Tet1 inhibitors.

Discovery of Novel Nonactive Site Inhibitors of the Prothrombinase Enzyme Complex.

PubMed

Kapoor, Karan; McGill, Nicole; Peterson, Cynthia B; Meyers, Harold V; Blackburn, Michael N; Baudry, Jerome

2016-03-28

The risk of serious bleeding is a major liability of anticoagulant drugs that are active-site competitive inhibitors targeting the Factor Xa (FXa) prothrombin (PT) binding site. The present work identifies several new classes of small molecule anticoagulants that can act as nonactive site inhibitors of the prothrombinase (PTase) complex composed of FXa and Factor Va (FVa). These new classes of anticoagulants were identified, using a novel agnostic computational approach to identify previously unrecognized binding pockets at the FXa-FVa interface. From about three million docking calculations of 281,128 compounds in a conformational ensemble of FXa heavy chains identified by molecular dynamics (MD) simulations, 97 compounds and their structural analogues were selected for experimental validation, through a series of inhibition assays. The compound selection was based on their predicted binding affinities to FXa and their ability to successfully bind to multiple protein conformations while showing selectivity for particular binding sites at the FXa/FVa interface. From these, thirty-one (31) compounds were experimentally identified as nonactive site inhibitors. Concentration-based assays further identified 10 compounds represented by four small-molecule families of inhibitors that achieve dose-independent partial inhibition of PTase activity in a nonactive site-dependent and self-limiting mechanism. Several compounds were identified for their ability to bind to protein conformations only seen during MD, highlighting the importance of accounting for protein flexibility in structure-based drug discovery approaches.

Molecular mechanisms of lymphocyte extravasation. II. Studies of in vitro lymphocyte adherence to high endothelial venules.

PubMed

Braaten, B A; Spangrude, G J; Daynes, R A

1984-07-01

Lymphocyte migration from the blood into the lymph nodes in most species occurs across post-capillary high endothelial venules (HEV). In a previous study, we proposed that lymphocyte extravasation involves receptor-mediated binding followed by adenylate cyclase-dependent activation of lymphocyte motility. This hypothesis was, in part, based on observations of in vitro lymphocyte adherence to HEV by employing pertussigen, which is a known inhibitor of lymphocyte recirculation. In vitro lymphocyte-HEV binding requires a cold (6 degrees C) incubation step and binding is poor to nil if the assay is attempted at room (23 degrees C) or physiologic temperature. We decided to investigate why this assay is temperature restricted, because of the possibility that pertussigen or fucoidin -treated lymphocytes might interact with HEV differently at higher temperatures. We now report that O.C.T. compound (OCT), the embedding matrix generally used to cut frozen lymph node sections, is toxic to lymphocytes at temperatures above 6 degrees C. Exclusion of OCT from the assay system will allow lymphocyte-HEV binding to occur at 23 degrees C and to a lesser extent at 37 degrees C. With this modified protocol, lymphocytes treated with either pertussigen, fucoidin , or neuraminidase were tested for adherence to HEV at 23 degrees C. No essential difference in binding properties was observed from what had been reported at 6 degrees C. In contrast, trypsin-treated lymphocytes that did not bind to HEV with the standard technique at 6 degrees C did adhere to a minimal extent to HEV at 23 degrees C using the modified procedure. We also report some preliminary work, using the modified assay, on in vitro lymphocyte-HEV binding of rat, rabbit, and guinea pig lymphocytes to sections of lymph nodes from the respective species.

Impact of SPR biosensor assay configuration on antibody: Neonatal Fc receptor binding data

PubMed Central

Wang, Xiangdan; McKay, Patrick; Dutina, George; Hass, Philip E.; Nijem, Ihsan; Allison, David; Cowan, Kyra J.; Lin, Kevin; Quarmby, Valerie; Yang, Jihong

2017-01-01

ABSTRACT Binding interactions with the neonatal Fc receptor (FcRn) are one determinant of pharmacokinetic properties of recombinant human monoclonal antibody (rhumAb) therapeutics, and a conserved binding motif in the crystallizable fragment (Fc) region of IgG molecules interacts with FcRn. Surface plasmon resonance (SPR) biosensor assays are often used to characterize interactions between FcRn and rhumAb therapeutics. In such assays, generally either the rhumAb (format 1) or the FcRn protein (format 2) is immobilized on a biosensor chip. However, because evidence suggests that, in some cases, the variable domains of a rhumAb may also affect FcRn binding, we evaluated the effect of SPR assay configuration on binding data. We sought to assess FcRn binding properties of 2 rhumAbs (rhumAb1 and rhumAb2) to FcRn proteins using these 2 biosensor assay formats. The two rhumAbs have greater than 99% sequence identity in the Fc domain but differ in their Fab regions. rhumAb2 contains a positively charged patch in the variable domain that is absent in rhumAb1. Our results showed that binding of rhumAb1 to FcRn was independent of biosensor assay configuration, while binding of rhumAb2 to FcRn was highly SPR assay configuration dependent. Further investigations revealed that the format dependency of rhumAb2-FcRn binding is linked to the basic residues that form a positively charged patch in the variable domain of rhumAb2. Our work highlights the importance of analyzing rhumAb-FcRn binding interactions using 2 alternate SPR biosensor assay configurations. This approach may also provide a simple way to identify the potential for non-Fc-driven FcRn binding interactions in otherwise typical IgGs. PMID:28001487

Label-Free Aptasensors for the Detection of Mycotoxins

PubMed Central

Rhouati, Amina; Catanante, Gaelle; Nunes, Gilvanda; Hayat, Akhtar; Marty, Jean-Louis

2016-01-01

Various methodologies have been reported in the literature for the qualitative and quantitative monitoring of mycotoxins in food and feed samples. Based on their enhanced specificity, selectivity and versatility, bio-affinity assays have inspired many researchers to develop sensors by exploring bio-recognition phenomena. However, a significant problem in the fabrication of these devices is that most of the biomolecules do not generate an easily measurable signal upon binding to the target analytes, and signal-generating labels are required to perform the measurements. In this context, aptamers have been emerged as a potential and attractive bio-recognition element to design label-free aptasensors for various target analytes. Contrary to other bioreceptor-based approaches, the aptamer-based assays rely on antigen binding-induced conformational changes or oligomerization states rather than binding-assisted changes in adsorbed mass or charge. This review will focus on current designs in label-free conformational switchable design strategies, with a particular focus on applications in the detection of mycotoxins. PMID:27999353

A homogeneous method to measure aminoacyl-tRNA synthetase aminoacylation activity using scintillation proximity assay technology.

PubMed

Macarrón, R; Mensah, L; Cid, C; Carranza, C; Benson, N; Pope, A J; Díez, E

2000-09-10

A new method to measure the aminoacylation of tRNA based upon the use of the scintillation proximity assay (SPA) technology has been developed. The assay detects incorporation of radiolabeled amino acids into cognate tRNA, catalyzed by a specific aminoacyl-tRNA synthetase (aaRS). Under acidic conditions, uncoated yttrium silicate SPA beads were found to bind tRNA aggregates, while the radiolabeled amino acid substrate remains in solution, resulting in good signal discrimination of these two species in the absence of any separation steps. The usefulness of this approach was demonstrated by measurement of steady-state kinetic constants and inhibitor binding constants for a range of aaRS enzymes in comparison with data from standard, trichloroacetic acid-precipitation-based assays. In all cases, the data were quantitatively comparable. Although the radioisotopic counting efficiency of the SPA method was less than that of standard liquid scintillation counting, the statistical performance (i.e., signal to background, variability, stability) of the SPA assays was at least equivalent to the separation-based methods. The assay was also shown to work well in miniaturized 384-well microtiter plate formats, resulting in considerable reagent savings. In summary, a new method to characterize aaRS activity is described that is faster and more amenable to high-throughput screening than traditional methods. Copyright 2000 Academic Press.

Evaluation of a newly developed quantitative heart-type fatty acid binding protein assay based on fluorescence immunochromatography using specific monoclonal antibodies.

PubMed

Kang, Keren; Wu, Peidian; Li, Wenmei; Tang, Shixing; Wang, Jihua; Luo, Xiaochun; Xie, Mingquan

2015-01-01

To develop a rapid, sensitive and specific assay for quantification of serum heart-type fatty acid binding protein (H-FABP) based on immunofluorescence of specific monoclonal antibodies. We generated novel H-FABP-directed monoclonal antibodies by cloning of spleen cells of mice immunized with H-FABP. Epitopes were mapped and antigen affinity was assessed by surface plasmon resonance (SPR). The H-FABP specific monoclonal antibodies were coupled to fluorescent beads and sprayed onto a nitrocellulose membrane facilitating quantification of H-FABP by immunofluorescence. Reagent cross-reactivity, interference resistance, accuracy and sensitivity were examined. A total of 103 clinical samples were used to compare the sensitivity and specificity of the new assay to a commercially available Randox kit. This new assay could be finished within 15 min, with sensitivity reaching 1 ng/ml. In a trial of 103 clinical serum samples, the new testing kit results were highly correlated with those from the Randox kit (R(2) = 0.9707). Using the Randox kit as the reference kit, the sensitivity of the new assay was 98.25%, and specificity was 100%. An immunofluorescence-based H-FABP assay employing novel monoclonal antibodies could rapidly, specifically and sensitively detect H-FABP in serum samples, providing an effective method for rapid clinical assessment of H-FABP index in the clinic.

A rapid, accurate and robust particle-based assay for the simultaneous screening of plasma samples for the presence of five different anti-cytokine autoantibodies.

PubMed

Guldager, Daniel Kring Rasmussen; von Stemann, Jakob Hjorth; Larsen, Rune; Bay, Jakob Thaning; Galle, Pia Søndergaard; Svenson, Morten; Ullum, Henrik; Hansen, Morten Bagge

2015-10-01

To establish and validate a rapid, cost-effective and accurate screening assay for the simultaneous testing of human naturally occurring anti-cytokine autoantibodies (c-aAb) targeting interleukin-1α (IL-1α), interleukin-6 (IL-6), interleukin-10 (IL-10), granulocyte-macrophage colony-stimulating factor (GM-CSF), and interferon α (IFNα). Because the c-aAbs can be transferred to patients through blood transfusion, the assay was used to assess c-aAb levels in a cohort of patients who were receiving blood transfusions and subsequently presented with or without febrile reactions. The microsphere-based Luminex platform was used. Recombinant forms of human IL-1α, IL-6, IL-10, GM-CSF, and IFNα were gently coupled to MAG-PLEX beads. Plasma IgG binding was measured with phycoerythrin (PE)-labeled secondary antibodies. Previously confirmed c-aAb positive and negative donor plasma samples and pooled normal immunoglobulin preparations were used to validate the assay. Plasma samples from 98 transfusion recipients, half of whom presented with febrile reactions, were tested by the assay. The assay detected specific and saturable immunoglobulin G (IgG) binding to each of the tested cytokines in previously confirmed c-aAb positive plasmas and in preparations of pooled normal immunoglobulin. Confirmed c-aAb negative plasmas gave no saturable binding. The detection limit of the cytokine autoantibodies was estimated to be between 1 pM and 10 pM. The recovery of confirmed cytokine autoantibodies quantities in the negative plasma samples ranged between 80% and 125%. The analytical intra- and inter-assay variations were 4% and 11%, respectively. Varying c-aAb levels were detectable in the transfusion recipients. There was no difference in c-aAb frequency between the patients with or without febrile transfusion reactions. The c-aAb level before and after the blood transfusions varied only slightly and in an irregular manner. This assay simultaneously detected up to five different c-aAbs in pooled human IgG and in plasma from individual blood donors, and it was deemed suitable for larger screenings. Based on confirmed antibody binding characteristics and the resultant reactivity in this multiplex assay, a classification of the c-aAb levels was suggested. The screening results of the recipients who received blood transfusions indicate that more studies are needed to clarify the role of antibodies, if any, in transfusion medicine and in high-dose immunoglobulin treatment. Copyright © 2015 Elsevier B.V. All rights reserved.

A novel assay reveals preferential binding between Rabs, kinesins, and specific endosomal subpopulations

PubMed Central

Bentley, Marvin; Decker, Helena; Luisi, Julie

2015-01-01

Identifying the proteins that regulate vesicle trafficking is a fundamental problem in cell biology. In this paper, we introduce a new assay that involves the expression of an FKBP12-rapamycin–binding domain–tagged candidate vesicle-binding protein, which can be inducibly linked to dynein or kinesin. Vesicles can be labeled by any convenient method. If the candidate protein binds the labeled vesicles, addition of the linker drug results in a predictable, highly distinctive change in vesicle localization. This assay generates robust and easily interpretable results that provide direct experimental evidence of binding between a candidate protein and the vesicle population of interest. We used this approach to compare the binding of Kinesin-3 family members with different endosomal populations. We found that KIF13A and KIF13B bind preferentially to early endosomes and that KIF1A and KIF1Bβ bind preferentially to late endosomes and lysosomes. This assay may have broad utility for identifying the trafficking proteins that bind to different vesicle populations. PMID:25624392

Validation of an enzyme-linked immunosorbent assay for the quantification of human IgG directed against the repeat region of the circumsporozoite protein of the parasite Plasmodium falciparum

PubMed Central

2012-01-01

Background Several pre-erythrocytic malaria vaccines based on the circumsporozoite protein (CSP) antigen of Plasmodium falciparum are in clinical development. Vaccine immunogenicity is commonly evaluated by the determination of anti-CSP antibody levels using IgG-based assays, but no standard assay is available to allow comparison of the different vaccines. Methods The validation of an anti-CSP repeat region enzyme-linked immunosorbent assay (ELISA) is described. This assay is based on the binding of serum antibodies to R32LR, a recombinant protein composed of the repeat region of P. falciparum CSP. In addition to the original recombinant R32LR, an easy to purify recombinant His-tagged R32LR protein has been constructed to be used as solid phase antigen in the assay. Also, hybridoma cell lines have been generated producing human anti-R32LR monoclonal antibodies to be used as a potential inexhaustible source of anti-CSP repeats standard, instead of a reference serum. Results The anti-CSP repeats ELISA was shown to be robust, specific and linear within the analytical range, and adequately fulfilled all validation criteria as defined in the ICH guidelines. Furthermore, the coefficient of variation for repeatability and intermediate precision did not exceed 23%. Non-interference was demonstrated for R32LR-binding sera, and the assay was shown to be stable over time. Conclusions This ELISA, specific for antibodies directed against the CSP repeat region, can be used as a standard assay for the determination of humoral immunogenicity in the development of any CSP-based P. falciparum malaria vaccine. PMID:23173602

Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction.

PubMed

Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H

2017-01-09

The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Predicting changes in cardiac myocyte contractility during early drug discovery with in vitro assays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morton, M.J., E-mail: michael.morton@astrazeneca.com; Armstrong, D.; Abi Gerges, N.

2014-09-01

Cardiovascular-related adverse drug effects are a major concern for the pharmaceutical industry. Activity of an investigational drug at the L-type calcium channel could manifest in a number of ways, including changes in cardiac contractility. The aim of this study was to define which of the two assay technologies – radioligand-binding or automated electrophysiology – was most predictive of contractility effects in an in vitro myocyte contractility assay. The activity of reference and proprietary compounds at the L-type calcium channel was measured by radioligand-binding assays, conventional patch-clamp, automated electrophysiology, and by measurement of contractility in canine isolated cardiac myocytes. Activity inmore » the radioligand-binding assay at the L-type Ca channel phenylalkylamine binding site was most predictive of an inotropic effect in the canine cardiac myocyte assay. The sensitivity was 73%, specificity 83% and predictivity 78%. The radioligand-binding assay may be run at a single test concentration and potency estimated. The least predictive assay was automated electrophysiology which showed a significant bias when compared with other assay formats. Given the importance of the L-type calcium channel, not just in cardiac function, but also in other organ systems, a screening strategy emerges whereby single concentration ligand-binding can be performed early in the discovery process with sufficient predictivity, throughput and turnaround time to influence chemical design and address a significant safety-related liability, at relatively low cost. - Highlights: • The L-type calcium channel is a significant safety liability during drug discovery. • Radioligand-binding to the L-type calcium channel can be measured in vitro. • The assay can be run at a single test concentration as part of a screening cascade. • This measurement is highly predictive of changes in cardiac myocyte contractility.« less

Protein-ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI).

PubMed

Grøftehauge, Morten K; Hajizadeh, Nelly R; Swann, Marcus J; Pohl, Ehmke

2015-01-01

Over the last decades, a wide range of biophysical techniques investigating protein-ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.

Protein–ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI)

PubMed Central

Grøftehauge, Morten K.; Hajizadeh, Nelly R.; Swann, Marcus J.; Pohl, Ehmke

2015-01-01

Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography. PMID:25615858

Cardio-vascular safety beyond hERG: in silico modelling of a guinea pig right atrium assay

NASA Astrophysics Data System (ADS)

Fenu, Luca A.; Teisman, Ard; De Buck, Stefan S.; Sinha, Vikash K.; Gilissen, Ron A. H. J.; Nijsen, Marjoleen J. M. A.; Mackie, Claire E.; Sanderson, Wendy E.

2009-12-01

As chemists can easily produce large numbers of new potential drug candidates, there is growing demand for high capacity models that can help in driving the chemistry towards efficacious and safe candidates before progressing towards more complex models. Traditionally, the cardiovascular (CV) safety domain plays an important role in this process, as many preclinical CV biomarkers seem to have high prognostic value for the clinical outcome. Throughout the industry, traditional ion channel binding data are generated to drive the early selection process. Although this assay can generate data at high capacity, it has the disadvantage of producing high numbers of false negatives. Therefore, our company applies the isolated guinea pig right atrium (GPRA) assay early-on in discovery. This functional multi-channel/multi-receptor model seems much more predictive in identifying potential CV liabilities. Unfortunately however, its capacity is limited, and there is no room for full automation. We assessed the correlation between ion channel binding and the GPRA's Rate of Contraction (RC), Contractile Force (CF), and effective refractory frequency (ERF) measures assay using over six thousand different data points. Furthermore, the existing experimental knowledge base was used to develop a set of in silico classification models attempting to mimic the GPRA inhibitory activity. The Naïve Bayesian classifier was used to built several models, using the ion channel binding data or in silico computed properties and structural fingerprints as descriptors. The models were validated on an independent and diverse test set of 200 reference compounds. Performances were assessed on the bases of their overall accuracy, sensitivity and specificity in detecting both active and inactive molecules. Our data show that all in silico models are highly predictive of actual GPRA data, at a level equivalent or superior to the ion channel binding assays. Furthermore, the models were interpreted in terms of the descriptors used to highlight the undesirable areas in the explored chemical space, specifically regions of low polarity, high lipophilicity and high molecular weight. In conclusion, we developed a predictive in silico model of a complex physiological assay based on a large and high quality set of experimental data. This model allows high throughput in silico safety screening based on chemical structure within a given chemical space.

Piezoelectric affinity sensors for cocaine and cholinesterase inhibitors.

PubMed

Halámek, Jan; Makower, Alexander; Knösche, Kristina; Skládal, Petr; Scheller, Frieder W

2005-01-30

We report here the development of piezoelectric affinity sensors for cocaine and cholinesterase inhibitors based on the formation of affinity complexes between an immobilized cocaine derivative and an anti-cocaine antibody or cholinesterase. For both binding reactions benzoylecgonine-1,8-diamino-3,4-dioxaoctane (BZE-DADOO) was immobilized on the surface of the sensor. For immobilization, pre-conjugated BZE-DADOO with 11-mercaptomonoundecanoic acid (MUA) via 2-(5-norbornen-2,3-dicarboximide)-1,1,3,3-tetramethyluronium-tetrafluoroborate (TNTU) allowed the formation of a chemisorbed monolayer on the piezosensor surface. The detection of cocaine was based on a competitive assay. The change of frequency measured after 300s of the binding reaction was used as the signal. The maximum binding of the antibody resulted in a frequency decrease of 35Hz (with an imprecision 3%, n = 3) while the presence of 100pmoll(-1) cocaine decreased the binding by 11%. The limit of detection was consequently below 100pmoll(-1) for cocaine. The total time of one analysis was 15min. This BZE-DADOO-modified sensor was adapted for the detection of organophosphates. BZE-DADOO - a competitive inhibitor - served as binding element for cholinesterase in a competitive assay.

Competitive Binding to Cuprous Ions of Protein and BCA in the Bicinchoninic Acid Protein Assay

PubMed Central

Huang, Tao; Long, Mian; Huo, Bo

2010-01-01

Although Bicinchoninic acid (BCA) has been widely used to determine protein concentration, the mechanism of interaction between protein, copper ion and BCA in this assay is still not well known. Using the Micro BCA protein assay kit (Pierce Company), we measured the absorbance at 562 nm of BSA solutions with different concentrations of protein, and also varied the BCA concentration. When the concentration of protein was increased, the absorbance exhibited the known linear and nonlinear increase, and then reached an unexpected plateau followed by a gradual decrease. We introduced a model in which peptide chains competed with BCA for binding to cuprous ions. Formation of the well-known chromogenic complex of BCA-Cu1+-BCA was competed with the binding of two peptide bonds (NTPB) to cuprous ion, and there is the possibility of the existence of two new complexes. A simple equilibrium equation was established to describe the correlations between the substances in solution at equilibrium, and an empirical exponential function was introduced to describe the reduction reaction. Theoretical predictions of absorbance from the model were in good agreement with the measurements, which not only validated the competitive binding model, but also predicted a new complex of BCA-Cu1+-NTPB that might exist in the final solution. This work provides a new insight into understanding the chemical bases of the BCA protein assay and might extend the assay to higher protein concentration. PMID:21625379

Rosette Assay: Highly Customizable Dot-Blot for SH2 Domain Screening.

PubMed

Ng, Khong Y; Machida, Kazuya

2017-01-01

With a growing number of high-throughput studies, structural analyses, and availability of protein-protein interaction databases, it is now possible to apply web-based prediction tools to SH2 domain-interactions. However, in silico prediction is not always reliable and requires experimental validation. Rosette assay is a dot blot-based reverse-phase assay developed for the assessment of binding between SH2 domains and their ligands. It is conveniently customizable, allowing for low- to high-throughput analysis of interactions between various numbers of SH2 domains and their ligands, e.g., short peptides, purified proteins, and cell lysates. The binding assay is performed in a 96-well plate (MBA or MWA apparatus) in which a sample spotted membrane is incubated with up to 96 labeled SH2 domains. Bound domains are detected and quantified using a chemiluminescence or near-infrared fluorescence (IR) imaging system. In this chapter, we describe a practical protocol for rosette assay to assess interactions between synthesized tyrosine phosphorylated peptides and a library of GST-tagged SH2 domains. Since the methodology is not confined to assessment of SH2-pTyr interactions, rosette assay can be broadly utilized for ligand and drug screening using different protein interaction domains or antibodies.

Quantitatively and Kinetically Identifying Binding Motifs of Amelogenin Proteins to Mineral Crystals Through Biochemical and Spectroscopic Assays

PubMed Central

Zhu, Li; Hwang, Peter; Witkowska, H. Ewa; Liu, Haichuan; Li, Wu

2014-01-01

Tooth enamel is the hardest tissue in vertebrate animals. Consisting of millions of carbonated hydroxyapatite crystals, this highly mineralized tissue develops from a protein matrix in which amelogenin is the predominant component. The enamel matrix proteins are eventually and completely degraded and removed by proteinases to form mineral-enriched tooth enamel. Identification of the apatite-binding motifs in amelogenin is critical for understanding the amelogenin–crystal interactions and amelogenin–proteinases interactions during tooth enamel biomineralization. A stepwise strategy is introduced to kinetically and quantitatively identify the crystal-binding motifs in amelogenin, including a peptide screening assay, a competitive adsorption assay, and a kinetic-binding assay using amelogenin and gene-engineered amelogenin mutants. A modified enzyme-linked immunosorbent assay on crystal surfaces is also applied to compare binding amounts of amelogenin and its mutants on different planes of apatite crystals. We describe the detailed protocols for these assays and provide the considerations for these experiments in this chapter. PMID:24188774

Characterization of the complex formed between a potent neutralizing ovine-derived polyclonal anti-TNFα Fab fragment and human TNFα

PubMed Central

Abbott, W. Mark; Snow, Melanie; Eckersley, Sonia; Renshaw, Jonathan; Davies, Gareth; Norman, Richard A.; Ceuppens, Peter; Slootstra, Jerry; Benschop, Joris J.; Hamuro, Yoshitomo; Lee, Jessica E.; Newham, Peter

2013-01-01

TNFα (tumour necrosis factor α) is an early mediator in the systemic inflammatory response to infection and is therefore a therapeutic target in sepsis. AZD9773 is an ovine-derived, polyclonal anti-TNFα Fab fragment derived from a pool of serum and currently being developed as a treatment for severe sepsis and septic shock. In the present study, we show that although AZD9773 has a modest affinity for TNFα in a binding assay, the Ki in a cell-based assay is approximately four orders of magnitude lower. We show using SEC (size exclusion chromatography) that the maximum size of the complex between AZD9773 and TNFα is consistent with approximately 12 Fabs binding to one TNFα trimer. A number of approaches were taken to map the epitopes recognized by AZD9773. These revealed that a number of different regions on TNFα are involved in binding to the polyclonal Fab. The data suggest that there are probably three epitopes per monomer that are responsible for most of the inhibition by AZD9773 and that all three can be occupied at the same time in the complex. We conclude that AZD9773 is clearly demonstrated to bind to multiple epitopes on TNFα and suggest that the polyclonal nature may account, at least in part, for the very high potency observed in cell-based assays. PMID:23863106

Comparison of Relative Binding Affinities for Trout and Human Estrogen Receptor Based upon Different Competitive Binding Assays, oral

EPA Science Inventory

The US EPA has been mandated to screen industrial chemicals and pesticides for potential endocrine activity. To evaluate the potential for chemicals to cause endocrine disruption in fish we have previously measured the affinity of a number of chemicals for the rainbow trout estr...

Assaying Auxin Receptor Activity Using SPR Assays with F-Box Proteins and Aux/IAA Degrons.

PubMed

Quareshy, Mussa; Uzunova, Veselina; Prusinska, Justyna M; Napier, Richard M

2017-01-01

The identification of TIR1 as an auxin receptor combined with advanced biophysical instrumentation has led to the development of real-time activity assays for auxins. Traditionally, molecules have been assessed for auxinic activity using bioassays, and agrochemical compound discovery continues to be based on "spray and pray" technologies. Here, we describe the methodology behind an SPR-based assay that uses TIR1 and related F-box proteins with surface plasmon resonance spectrometry for rapid compound screening. In addition, methods for collecting kinetic binding data and data processing are given so that they may support programs for rational design of novel auxin ligands.

An assay to image neuronal microtubule dynamics in mice.

PubMed

Kleele, Tatjana; Marinković, Petar; Williams, Philip R; Stern, Sina; Weigand, Emily E; Engerer, Peter; Naumann, Ronald; Hartmann, Jana; Karl, Rosa M; Bradke, Frank; Bishop, Derron; Herms, Jochen; Konnerth, Arthur; Kerschensteiner, Martin; Godinho, Leanne; Misgeld, Thomas

2014-09-12

Microtubule dynamics in neurons play critical roles in physiology, injury and disease and determine microtubule orientation, the cell biological correlate of neurite polarization. Several microtubule binding proteins, including end-binding protein 3 (EB3), specifically bind to the growing plus tip of microtubules. In the past, fluorescently tagged end-binding proteins have revealed microtubule dynamics in vitro and in non-mammalian model organisms. Here, we devise an imaging assay based on transgenic mice expressing yellow fluorescent protein-tagged EB3 to study microtubules in intact mammalian neurites. Our approach allows measurement of microtubule dynamics in vivo and ex vivo in peripheral nervous system and central nervous system neurites under physiological conditions and after exposure to microtubule-modifying drugs. We find an increase in dynamic microtubules after injury and in neurodegenerative disease states, before axons show morphological indications of degeneration or regrowth. Thus increased microtubule dynamics might serve as a general indicator of neurite remodelling in health and disease.

Galline Ex-FABP is an Antibacterial Siderocalin and a Lysophosphatidic Acid Sensor Functioning through Dual Ligand Specificities

PubMed Central

Correnti, Colin; Clifton, Matthew C.; Abergel, Rebecca J.; Allred, Ben; Hoette, Trisha M.; Ruiz, Mario; Cancedda, Ranieri; Raymond, Kenneth N.; Descalzi, Fiorella; Strong, Roland K.

2011-01-01

SUMMARY Galline Ex-FABP was identified as another candidate antibacterial, catecholate siderophore binding lipocalin (siderocalin) based on structural parallels with the family archetype, mammalian Siderocalin. Binding assays show that Ex-FABP retains iron in a siderophore-dependent manner in both hypertrophic and dedifferentiated chondrocytes, where Ex-FABP expression is induced after treatment with proinflammatory agents, and specifically binds ferric complexes of enterobactin, parabactin, bacillibactin and, unexpectedly, monoglucosylated enterobactin, which does not bind to Siderocalin. Growth arrest assays functionally confirm the bacteriostatic effect of Ex-FABP in vitro under iron-limiting conditions. The 1.8Å crystal structure of Ex-FABP explains the expanded specificity, but also surprisingly reveals an extended, multi-chambered cavity extending through the protein and encompassing two separate ligand specificities, one for bacterial siderophores (as in Siderocalin) at one end and one specifically binding co-purified lysophosphatidic acid, a potent cell signaling molecule, at the other end, suggesting Ex-FABP employs dual functionalities to explain its diverse endogenous activities. PMID:22153502

Avoiding false positives and optimizing identification of true ...

EPA Pesticide Factsheets

The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented from screening 94 chemicals from 54 chemical groups for estrogen receptor (ER) activation in a competitive rainbow trout ER (rtER) binding assay and a trout liver slice vitellogenin mRNA expression assay. Results from true competitive agonists and antagonists, and inactive chemicals with little or no indication of ER binding or gene activation were easily interpreted. However, results for numerous industrial chemicals were more challenging to interpret, including chemicals with: (1) apparent competitive binding curves but no gene activation, (2) apparent binding and gene inhibition with evidence of either cytotoxicity or changes in assay media pH, (3) apparent binding but non-competitive gene inhibition of unknown cause, or (4) no rtER binding and gene inhibition not due to competitive ER interaction but due to toxicity, pH change, or some unknown cause. The use of endpoints such as toxicity, pH, precipitate formation, and determination of inhibitor dissociation constants (Ki) for interpreting the results of antagonism and binding assays for diverse chemicals is presented. Of the 94 chemicals tested for antagonism only two, tamoxifen and ICI-182,780, were found to be true competitive

Spectroscopy on the wing: naturally inspired SERS substrates for biochemical analysis.

PubMed

Garrett, Natalie L; Vukusic, Peter; Ogrin, Feodor; Sirotkin, Evgeny; Winlove, C Peter; Moger, Julian

2009-03-01

We show that naturally occurring chitinous nanostructures found on the wings of the Graphium butterfly can be used as substrates for surface-enhanced Raman scattering when coated with a thin film of gold or silver. The substrates were found to exhibit excellent biocompatibility and sensitivity, making them ideal for protein assaying. An assay using avidin/biotin binding showed that the substrates could be used to quantify protein binding directly from changes in the surface-enhanced Raman scattering (SERS) spectra and were sensitive over a concentration range comparable with a typical enzyme-linked immunosorbent assays (ELISA) assay. A biomimetic version of the wing nanostructures produced using a highly reproducible, large-scale fabrication process, yielded comparable enhancement factors and biocompatibility. The excellent biocompatibility of the wings and biomimetic substrates is unparalleled by other lithographically produced substrates, and this could pave the way for widespread application of ultrasensitive SERS-based bioassays.

Protein–ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grøftehauge, Morten K., E-mail: m.k.groftehauge@durham.ac.uk; Hajizadeh, Nelly R.; Swann, Marcus J.

2015-01-01

The biophysical characterization of protein–ligand interactions in solution using techniques such as thermal shift assay, or on surfaces using, for example, dual polarization interferometry, plays an increasingly important role in complementing crystal structure determinations. Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmonmore » resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.« less

Functional assay for T4 lysozyme-engineered G protein-coupled receptors with an ion channel reporter.

PubMed

Niescierowicz, Katarzyna; Caro, Lydia; Cherezov, Vadim; Vivaudou, Michel; Moreau, Christophe J

2014-01-07

Structural studies of G protein-coupled receptors (GPCRs) extensively use the insertion of globular soluble protein domains to facilitate their crystallization. However, when inserted in the third intracellular loop (i3 loop), the soluble protein domain disrupts their coupling to G proteins and impedes the GPCRs functional characterization by standard G protein-based assays. Therefore, activity tests of crystallization-optimized GPCRs are essentially limited to their ligand binding properties using radioligand binding assays. Functional characterization of additional thermostabilizing mutations requires the insertion of similar mutations in the wild-type receptor to allow G protein-activation tests. We demonstrate that ion channel-coupled receptor technology is a complementary approach for a comprehensive functional characterization of crystallization-optimized GPCRs and potentially of any engineered GPCR. Ligand-induced conformational changes of the GPCRs are translated into electrical signal and detected by simple current recordings, even though binding of G proteins is sterically blocked by the added soluble protein domain. Copyright © 2014 Elsevier Ltd. All rights reserved.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

PatchSurfers: Two methods for local molecular property-based binding ligand prediction.

PubMed

Shin, Woong-Hee; Bures, Mark Gregory; Kihara, Daisuke

2016-01-15

Protein function prediction is an active area of research in computational biology. Function prediction can help biologists make hypotheses for characterization of genes and help interpret biological assays, and thus is a productive area for collaboration between experimental and computational biologists. Among various function prediction methods, predicting binding ligand molecules for a target protein is an important class because ligand binding events for a protein are usually closely intertwined with the proteins' biological function, and also because predicted binding ligands can often be directly tested by biochemical assays. Binding ligand prediction methods can be classified into two types: those which are based on protein-protein (or pocket-pocket) comparison, and those that compare a target pocket directly to ligands. Recently, our group proposed two computational binding ligand prediction methods, Patch-Surfer, which is a pocket-pocket comparison method, and PL-PatchSurfer, which compares a pocket to ligand molecules. The two programs apply surface patch-based descriptions to calculate similarity or complementarity between molecules. A surface patch is characterized by physicochemical properties such as shape, hydrophobicity, and electrostatic potentials. These properties on the surface are represented using three-dimensional Zernike descriptors (3DZD), which are based on a series expansion of a 3 dimensional function. Utilizing 3DZD for describing the physicochemical properties has two main advantages: (1) rotational invariance and (2) fast comparison. Here, we introduce Patch-Surfer and PL-PatchSurfer with an emphasis on PL-PatchSurfer, which is more recently developed. Illustrative examples of PL-PatchSurfer performance on binding ligand prediction as well as virtual drug screening are also provided. Copyright © 2015 Elsevier Inc. All rights reserved.

Quantitative pharmacological analysis of antagonist binding kinetics at CRF1 receptors in vitro and in vivo

PubMed Central

Ramsey, Simeon J; Attkins, Neil J; Fish, Rebecca; van der Graaf, Piet H

2011-01-01

BACKGROUND AND PURPOSE A series of novel non-peptide corticotropin releasing factor type-1 receptor (CRF1) antagonists were found to display varying degrees of insurmountable and non-competitive behaviour in functional in vitro assays. We describe how we attempted to relate this behaviour to ligand receptor-binding kinetics in a quantitative manner and how this resulted in the development and implementation of an efficient pharmacological screening method based on principles described by Motulsky and Mahan. EXPERIMENTAL APPROACH A non-equilibrium binding kinetic assay was developed to determine the receptor binding kinetics of non-peptide CRF1 antagonists. Nonlinear, mixed-effects modelling was used to obtain estimates of the compounds association and dissociation rates. We present an integrated pharmacokinetic–pharmacodynamic (PKPD) approach, whereby the time course of in vivo CRF1 receptor binding of novel compounds can be predicted on the basis of in vitro assays. KEY RESULTS The non-competitive antagonist behaviour appeared to be correlated to the CRF1 receptor off-rate kinetics. The integrated PKPD model suggested that, at least in a qualitative manner, the in vitro assay can be used to triage and select compounds for further in vivo investigations. CONCLUSIONS AND IMPLICATIONS This study provides evidence for a link between ligand offset kinetics and insurmountable/non-competitive antagonism at the CRF1 receptor. The exact molecular pharmacological nature of this association remains to be determined. In addition, we have developed a quantitative framework to study and integrate in vitro and in vivo receptor binding kinetic behaviour of CRF1 receptor antagonists in an efficient manner in a drug discovery setting. PMID:21449919

Domain based assays of individual antibody concentrations in an oligoclonal combination targeting a single protein

PubMed Central

Meng, Q.; Li, M.; Silberg, M.A.; Conrad, F.; Bettencourt, J.; To, R.; Huang, C.; Ma, J.; Meyer, K.; Shimizu, R.; Cao, L.; Tomic, M.T.; Marks, J.D.

2014-01-01

Quantitation of individual mAbs within a combined antibody drug product is required for preclinical and clinical drug development including pharmacokinetics (PK), toxicology, stability and biochemical characterization studies of such drugs. We have developed an antitoxin (XOMA 3AB) consisting of three recombinant monoclonal antibodies (mAbs) that potently neutralizes the known subtypes of type A botulinum neurotoxin (BoNT/A). The three mAbs bind non-overlapping BoNT/A epitopes with high affinity. XOMA3AB is being developed as a treatment for botulism resulting from BoNT/A. To develop antibody-specific assays, we cloned, expressed, and purified BoNT/A domains from E. coli. Each mAb bound only to its specific domain with affinity comparable to the binding to holotoxin. MAb specific domains were used to develop an ELISA for characterization of the integrity and binding activity of the three mAbs in the drug product. An electrochemiluminescence bridging assay was also developed that is robust to interference from components in serum and we demonstrate that it can be used for PK assays. This type of antigen engineering to generate mAb-specific domains is a general method allowing quantitation and characterization of individual mAbs in a mAb cocktail that bind the same protein and is superior to anti-idiotype approaches. PMID:22037290

Optimization of Time-Resolved Fluorescence Assay for Detection of Eu-DOTA-labeled Ligand-Receptor Interactions

PubMed Central

De Silva, Channa R.; Vagner, Josef; Lynch, Ronald; Gillies, Robert J.; Hruby, Victor J.

2010-01-01

Lanthanide-based luminescent ligand binding assays are superior to traditional radiolabel assays due to improved sensitivity and affordability in high throughput screening while eliminating the use of radioactivity. Despite significant progress using lanthanide(III)-coordinated chelators such as DTPA derivatives, dissociation-enhanced lanthanide fluoroimmunoassays (DELFIA) have not yet been successfully used with more stable chelators, e.g. DOTA derivatives, due to the incomplete release of lanthanide(III) ions from the complex. Here, a modified and an optimized DELFIA procedure incorporating an acid treatment protocol is introduced for use with Eu(III)-DOTA labeled peptides. Complete release of Eu(III) ions from DOTA labeled ligands was observed using hydrochloric acid (2.0 M) prior to the luminescent enhancement step. NDP-α-MSH labeled with Eu(III)-DOTA was synthesized and the binding affinity to cells overexpressing the human melanocortin-4 receptors (hMC4R) was evaluated using the modified protocol. Binding data indicate that the Eu(III)-DOTA linked peptide bound to these cells with an affinity similar to its DTPA analogue. The modified DELFIA procedure was further used to monitor the binding of an Eu(III)-DOTA labeled heterobivalent peptide to the cells expressing both hMC4R and CCK-2 (Cholecystokinin) receptors. The modified assay provides superior results and is appropriate for high-throughput screening of ligand libraries. PMID:19852924

Novel Yeast-based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR*

PubMed Central

Li, Hao; Redinbo, Matthew R.; Venkatesh, Madhukumar; Ekins, Sean; Chaudhry, Anik; Bloch, Nicolin; Negassa, Abdissa; Mukherjee, Paromita; Kalpana, Ganjam; Mani, Sridhar

2013-01-01

The pregnane X receptor (PXR) is a master regulator of xenobiotic metabolism, and its activity is critical toward understanding the pathophysiology of several diseases, including inflammation, cancer, and steatosis. Previous studies have demonstrated that ketoconazole binds to ligand-activated PXR and antagonizes receptor control of gene expression. Structure-function as well as computational docking analysis suggested a putative binding region containing critical charge clamp residues Gln-272, and Phe-264 on the AF-2 surface of PXR. To define the antagonist binding surface(s) of PXR, we developed a novel assay to identify key amino acid residues on PXR based on a yeast two-hybrid screen that examined mutant forms of PXR. This screen identified multiple “gain-of-function” mutants that were “resistant” to the PXR antagonist effects of ketoconazole. We then compared our screen results identifying key PXR residues to those predicted by computational methods. Of 15 potential or putative binding residues based on docking, we identified three residues in the yeast screen that were then systematically verified to functionally interact with ketoconazole using mammalian assays. Among the residues confirmed by our study was Ser-208, which is on the opposite side of the protein from the AF-2 region critical for receptor regulation. The identification of new locations for antagonist binding on the surface or buried in PXR indicates novel aspects to the mechanism of receptor antagonism. These results significantly expand our understanding of antagonist binding sites on the surface of PXR and suggest new avenues to regulate this receptor for clinical applications. PMID:23525103

A receptor binding assay for paralytic shellfish poisoning toxins: recent advances and applications.

PubMed

Powell, C L; Doucette, G J

1999-01-01

We recently described a high throughput receptor binding assay for paralytic shellfish poisoning (PSP) toxins, the use of the assay for detecting toxic activity in shellfish and algal extracts, and the validation of 11-[3H]-tetrodotoxin as an alternative radioligand to the [3H]-saxitoxin conventionally employed in the assay. Here, we report a dramatic increase in assay efficiency through application of microplate scintillation technology, resulting in an assay turn around time of 4 h. Efforts are now focused on demonstrating the range of applications for which this receptor assay can provide data comparable to the more time consuming, technically demanding HPLC analysis of PSP toxins, currently the method of choice for researchers. To date, we have compared the results of both methods for a variety of sample types, including different genera of PSP toxin producing dinoflagellates (e.g. Alexandrium lusitanicum, r2 = 0.9834, n = 12), size-fractioned field samples of Alexandrium spp. (20-64 microm; r2 = 0.9997, n = 10) as well as its associated zooplankton grazer community (200-500 microm: r2 = 0.6169, n = 10; >500 microm: r2 = 0.5063, n = 10), and contaminated human fluids (r2 = 0.9661, n = 7) from a PSP outbreak. Receptor-based STX equivalent values for all but the zooplankton samples were highly correlated and exhibited close quantitative agreement with those produced by HPLC. While the PSP receptor binding assay does not provide information on toxin composition obtainable by HPLC, it does represent a robust and reliable means of rapidly assessing PSP-like toxicity in laboratory and field samples. Moreover, this assay should be effective as a screening tool for use by public health officials in responding to suspected cases of PSP intoxication.

Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

PubMed Central

SivaRaman, L; Subramanian, S; Thimmappaya, B

1986-01-01

Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

Expression and purification of RHC-EGFP fusion protein and its application in hyaluronic acid assay.

PubMed

Duan, Ningjun; Lv, Wansheng; Zhu, Lingli; Zheng, Weijuan; Hua, Zichun

2017-03-16

Hyaluronan is a widely distributed glycosaminoglycan which has multiple functions. Hyaluronic acid (HA) accumulation has been reported in many human diseases. Understanding the role of hyaluronan and its binding proteins in the pathobiology of disease will facilitate the development of novel therapeutics for many critical diseases. Current techniques described for the analysis of HA are mainly for HA quantification in solutions, not for the direct detection of HA in tissues or on cell surfaces. In our study, a fusion protein, named C-terminal domain of RHAMM-enhanced green fluorescence protein (RHC-EGFP), combined the HA-binding domain, C-terminal of receptor for hyaluronan-mediated motility, with EGFP, a widely used enhanced green fluorescence protein, was expressed and purified from Escherichia coli with high purity. Based on the sensitivity and convenience of fluorescence detection, methods for direct assay of HA in solutions, on cell surface or in tissues were established using RHC-EGFP. The binding specificity was also confirmed by competitive binding experiment and hyaluronidase degradation experiment. Our results provide an alternative choice for the specific and convenient assay of HA in various samples, and maybe helpful for further understanding of the fundamental and comprehensive functions of HA.

A novel multiplex poliovirus binding inhibition assay applicable for large serosurveillance and vaccine studies, without the use of live poliovirus.

PubMed

Schepp, Rutger M; Berbers, Guy A M; Ferreira, José A; Reimerink, Johan H; van der Klis, Fiona R

2017-03-01

Large-scale serosurveillance or vaccine studies for poliovirus using the "gold standard" WHO neutralisation test (NT) are very laborious and time consuming. With the polio eradication at hand and with the removal of live attenuated Sabin strains from the oral poliovirus vaccine (OPV), starting with type 2 (as of April 2016), laboratories will need to conform to much more stringent laboratory biosafety regulations when handling live poliovirus strains. In this study, a poliovirus binding inhibition multiplex immunoassay (polio MIA) using inactivated poliovirus vaccine (IPV-Salk) was developed for simultaneous quantification of serum antibodies directed to all three poliovirus types. Our assay shows a good correlation with the NT and an excellent correlation with the ELISA-based binding inhibition assay (POBI). The assay is highly type-specific and reproducible. Additionally, serum sample throughput increases about fivefold relative to NT and POBI and the amount of serum needed is reduced by more than 90%. In conclusion, the polio MIA can be used as a safe and high throughput application, especially for large-scale surveillance and vaccine studies, reducing laboratory time and serum amounts needed. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Determination of nuvenzepine in human plasma by a sensitive sup 3 Hpirenzepine radioreceptor binding assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caselli, G.; Ferrari, M.P.; Tonon, G.

1991-02-01

A sensitive method for the quantitation of small amounts of nuvenzepine, a new M1-selective antimuscarinic drug, in plasma is described. The analytical method involves the use of a radioreceptor binding assay based on {sup 3}Hpirenzepine displacement in rat cerebral cortex homogenates; no previous extraction is required. The method is reliable, with an interassay CV ranging from 5 to 10%, and allows the analysis of greater than 100 samples/experiment. The limit of detection is {approximately} 0.1 ng/assay. Using this method we have determined the plasma levels of nuvenzepine in eight healthy volunteers treated PO with 15 or 25 mg of nuvenzepine.HCl.more » The pharmacokinetic parameters obtained were (for 15 and 25 mg): Cmax, 64 and 131 ng/mL; AUC0-infinity, 851 and 1379 ng.h/mL; t1/2, 8.6 and 7.2 h. These values are in good agreement with those obtained using an HPLC method. Therefore, this radioreceptor binding assay proved to be simple, rapid, and specific for the determination of low levels of nuvenzepine in human plasma.« less

Quantitative and discriminative analysis of nucleic acid samples using luminometric nonspecific nanoparticle methods

NASA Astrophysics Data System (ADS)

Pihlasalo, S.; Mariani, L.; Härmä, H.

2016-03-01

Homogeneous simple assays utilizing luminescence quenching and time-resolved luminescence resonance energy transfer (TR-LRET) were developed for the quantification of nucleic acids without sequence information. Nucleic acids prevent the adsorption of a protein to europium nanoparticles which is detected as a luminescence quenching of europium nanoparticles with a soluble quencher or as a decrease of TR-LRET from europium nanoparticles to the acceptor dye. Contrary to the existing methods based on fluorescent dye binding to nucleic acids, equal sensitivities for both single- (ssDNA) and double-stranded DNA (dsDNA) were measured and a detection limit of 60 pg was calculated for the quenching assay. The average coefficient of variation was 5% for the quenching assay and 8% for the TR-LRET assay. The TR-LRET assay was also combined with a nucleic acid dye selective to dsDNA in a single tube assay to measure the total concentration of DNA and the ratio of ssDNA and dsDNA in the mixture. To our knowledge, such a multiplexed assay is not accomplished with commercially available assays.Homogeneous simple assays utilizing luminescence quenching and time-resolved luminescence resonance energy transfer (TR-LRET) were developed for the quantification of nucleic acids without sequence information. Nucleic acids prevent the adsorption of a protein to europium nanoparticles which is detected as a luminescence quenching of europium nanoparticles with a soluble quencher or as a decrease of TR-LRET from europium nanoparticles to the acceptor dye. Contrary to the existing methods based on fluorescent dye binding to nucleic acids, equal sensitivities for both single- (ssDNA) and double-stranded DNA (dsDNA) were measured and a detection limit of 60 pg was calculated for the quenching assay. The average coefficient of variation was 5% for the quenching assay and 8% for the TR-LRET assay. The TR-LRET assay was also combined with a nucleic acid dye selective to dsDNA in a single tube assay to measure the total concentration of DNA and the ratio of ssDNA and dsDNA in the mixture. To our knowledge, such a multiplexed assay is not accomplished with commercially available assays. Electronic supplementary information (ESI) available: The labeling of amino modified polystyrene nanoparticles with Eu3+ chelate and the experimental details and results for the optimization of nucleic acid binding protein and for the ratiometric measurement of DNA and RNA with quenching assay. See DOI: 10.1039/c5nr09252c

Evaluation of potential endocrine activity of 2,4-dichlorophenoxyacetic acid using in vitro assays.

PubMed

Coady, Katherine K; Kan, H Lynn; Schisler, Melissa R; Gollapudi, B Bhaskar; Neal, Barbara; Williams, Amy; LeBaron, Matthew J

2014-08-01

The herbicide 2,4-dichlorophenoxyacetic acid (2,4-D) was evaluated in five in vitro screening assays to assess the potential for interaction with the androgen, estrogen and steroidogenesis pathways in the endocrine system. The assays were conducted to meet the requirements of the in vitro component of Tier 1 of the United States Environmental Protection Agency's Endocrine Disruptor Screening Program (EDSP), and included assays for estrogen receptor (ER) binding (rat uterine cytosol ER binding assay), ER-mediated transcriptional activation (HeLa-9903-ERα transactivation assay), androgen receptor (AR) binding (rat prostate cytosol AR binding assay), aromatase enzymatic activity inhibition (recombinant human CYP19 aromatase inhibition assay), and interference with steroidogenesis (H295R steroidogenesis assay). Results from these five assays demonstrated that 2,4-D does not have the potential to interact in vitro with the estrogen, androgen, or steroidogenesis pathways. These in vitro data are consistent with a corresponding lack of endocrine effects observed in apical in vivo animal studies, and thus provide important supporting data valuable in a comprehensive weight of evidence evaluation indicating a low potential of 2,4-D to interact with the endocrine system. Copyright © 2014 Elsevier Ltd. All rights reserved.

A simple and widely applicable hit validation strategy for protein-protein interaction inhibitors based on a quantitative ligand displacement assay.

PubMed

Sameshima, Tomoya; Miyahisa, Ikuo; Homma, Misaki; Aikawa, Katsuji; Hixon, Mark S; Matsui, Junji

2014-12-15

Identification of inhibitors for protein-protein interactions (PPIs) from high-throughput screening (HTS) is challenging due to the weak affinity of primary hits. We present a hit validation strategy of PPI inhibitors using quantitative ligand displacement assay. From an HTS for Bcl-xL/Mcl-1 inhibitors, we obtained a hit candidate, I1, which potentially forms a reactive Michael acceptor, I2, inhibiting Bcl-xL/Mcl-1 through covalent modification. We confirmed rapid reversible and competitive binding of I1 with a probe peptide, suggesting non-covalent binding. The advantages of our approach over biophysical assays include; simplicity, higher throughput, low protein consumption and universal application to PPIs including insoluble membrane proteins. Copyright © 2014 Elsevier Ltd. All rights reserved.

Protein-binding aptamer assisted signal amplification for the detection of influenza A (H1N1) DNA sequences based on quantum dot fluorescence polarization analysis.

PubMed

Zhang, Juanni; Tian, Jianniao; He, Yanlong; Chen, Sheng; Jiang, Yixuan; Zhao, Yanchun; Zhao, Shulin

2013-09-07

We report a fluorescence polarization platform for H1N1 detection based on the construction of a DNA functional QD fluorescence polarization probe and a bi-functional protein binding aptamer (Apt-DNA). The assay has a linear range from 10 nM to 100 nM with a detection limit of 3.45 nM and is selective over the mismatched bases.

Differential sensitivity of von Willebrand factor (VWF) 'activity' assays to large and small VWF molecular weight forms: a cross-laboratory study comparing ristocetin cofactor, collagen-binding and mAb-based assays.

PubMed

Favaloro, E J; Bonar, R; Chapman, K; Meiring, M; Funk Adcock, D

2012-06-01

von Willebrand disease (VWD), the most common inherited bleeding disorder, is caused by deficiencies and/or defects in von Willebrand factor (VWF). An effective diagnostic and VWD typing strategy requires plasma testing for factor VIII, and VWF antigen plus one or more VWF 'activity' assays. VWF activity is classically assessed by using VWF ristocetin cofactor activity (VWF:RCo), although VWF collagen-binding (VWF:CB) and VWF mAb-based (VWF activity [VWF:Act]) assays are used by some laboratories. To perform a cross-laboratory study to specifically evaluate these three VWF activity assays for comparative sensitivity to loss of high molecular weight (HMW) VWF, representing the form of VWF that is most functionally active and that is absent in some types of VWD, namely 2A and 2B. A set of eight samples, including six selectively representing stepwise reduction in HMW VWF, were tested by 51 different laboratories using a variety of assays. The combined data showed that the VWF:CB and VWF:RCo assays had higher sensitivity to the loss of HMW VWF than did the VWF:Act assay. Moreover, within-method analysis identified better HMW VWF sensitivity of some VWF:CB assays than of others, with all VWF:CB assays still showing better sensitivity than the VWF:Act assay. Differences were also identified between VWF:RCo methodologies on the basis of either platelet aggregometry or as performed on automated analyzers. We believe that these results have significant clinical implications for the diagnosis of VWD and monitoring of its therapy, as well as for the future diagnosis and therapy monitoring of thrombotic thrombocytopenic purpura. © 2012 International Society on Thrombosis and Haemostasis.

Flavonoid Regulation of HCN2 Channels*

PubMed Central

Carlson, Anne E.; Rosenbaum, Joel C.; Brelidze, Tinatin I.; Klevit, Rachel E.; Zagotta, William N.

2013-01-01

The hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels are pacemaker channels whose currents contribute to rhythmic activity in the heart and brain. HCN channels open in response to hyperpolarizing voltages, and the binding of cAMP to their cyclic nucleotide-binding domain (CNBD) facilitates channel opening. Here, we report that, like cAMP, the flavonoid fisetin potentiates HCN2 channel gating. Fisetin sped HCN2 activation and shifted the conductance-voltage relationship to more depolarizing potentials with a half-maximal effective concentration (EC50) of 1.8 μm. When applied together, fisetin and cAMP regulated HCN2 gating in a nonadditive fashion. Fisetin did not potentiate HCN2 channels lacking their CNBD, and two independent fluorescence-based binding assays reported that fisetin bound to the purified CNBD. These data suggest that the CNBD mediates the fisetin potentiation of HCN2 channels. Moreover, binding assays suggest that fisetin and cAMP partially compete for binding to the CNBD. NMR experiments demonstrated that fisetin binds within the cAMP-binding pocket, interacting with some of the same residues as cAMP. Together, these data indicate that fisetin is a partial agonist for HCN2 channels. PMID:24085296

Spectroscopic and molecular modeling approaches to investigate the interaction of bisphenol A, bisphenol F and their diglycidyl ethers with PPARα.

PubMed

Zhang, Jie; Zhang, Tiehua; Guan, Tianzhu; Ruan, Ping; Ren, Dayong; Dai, Weichang; Yu, Hansong; Li, Tiezhu

2017-08-01

A fluorescence polarization (FP) assay for the simultaneous determination of bisphenol A (BPA), bisphenol F (BPF), bisphenol A diglycidyl ether (BADGE) and bisphenol F diglycidyl ether (BFDGE) was developed. The method was based on the competition between bisphenols (BPs) and fluorescein-labeled dexamethasone derivative (Dex-fl) for mouse peroxisome proliferator-activated receptor α ligand binding domain (mPPARα-LBD). A recombinant soluble protein derivative mPPARα-LBD* was prepared, then in vitro binding of 4 BPs to mPPARα-LBD* was investigated. Fluorescence polarization assay showed that these compounds exhibited different binding potencies with mPPARα-LBD*. Additionally, molecular dynamics simulations were performed to further understand the mechanism of BPs binding affinity for mPPARα-LBD*. Docking results elucidated that the driving forces for the binding of BPs to mPPARα-LBD* were predominantly dependent on hydrophobic and hydrogen-bonding interactions. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation (R 2  = 0.7258). The proposed method has potential for multi-residue detection of BPA, BPF, BADGE, and BFDGE. Copyright © 2017 Elsevier Ltd. All rights reserved.

Characterization of the receptor-binding domain of Ebola glycoprotein in viral entry.

PubMed

Wang, Jizhen; Manicassamy, Balaji; Caffrey, Michael; Rong, Lijun

2011-06-01

Ebola virus infection causes severe hemorrhagic fever in human and non-human primates with high mortality. Viral entry/infection is initiated by binding of glycoprotein GP protein on Ebola virion to host cells, followed by fusion of virus-cell membrane also mediated by GP. Using an human immunodeficiency virus (HIV)-based pseudotyping system, the roles of 41 Ebola GP1 residues in the receptor-binding domain in viral entry were studied by alanine scanning substitutions. We identified that four residues appear to be involved in protein folding/structure and four residues are important for viral entry. An improved entry interference assay was developed and used to study the role of these residues that are important for viral entry. It was found that R64 and K95 are involved in receptor binding. In contrast, some residues such as I170 are important for viral entry, but do not play a major role in receptor binding as indicated by entry interference assay and/or protein binding data, suggesting that these residues are involved in post-binding steps of viral entry. Furthermore, our results also suggested that Ebola and Marburg viruses share a common cellular molecule for entry.

Application of the novel bioluminescent ligand-receptor binding assay to relaxin-RXFP1 system for interaction studies.

PubMed

Wu, Qing-Ping; Zhang, Lei; Shao, Xiao-Xia; Wang, Jia-Hui; Gao, Yu; Xu, Zeng-Guang; Liu, Ya-Li; Guo, Zhan-Yun

2016-04-01

Relaxin is a prototype of the relaxin family peptide hormones and plays important biological functions by binding and activating the G protein-coupled receptor RXFP1. To study their interactions, in the present work, we applied the newly developed bioluminescent ligand-receptor binding assay to the relaxin-RXFP1 system. First, a fully active easily labeled relaxin, in which three Lys residues of human relaxin-2 were replaced by Arg, was prepared through overexpression of a single-chain precursor in Pichia pastoris and in vitro enzymatic maturation. Thereafter, the B-chain N-terminus of the easily labeled relaxin was chemically cross-linked with a C-terminal cysteine residue of an engineered NanoLuc through a disulfide linkage. Receptor-binding assays demonstrated that the NanoLuc-conjugated relaxin retained high binding affinity with the receptor RXFP1 (K d = 1.11 ± 0.08 nM, n = 3) and was able to sensitively monitor binding of a variety of ligands with RXFP1. Using the novel bioluminescent binding assay, we demonstrated that three highly conserved B-chain Arg residues of relaxin-3 had distinct contributions to binding of the receptor RXFP1. In summary, our present work provides a novel bioluminescent ligand-receptor binding assay for the relaxin-RXFP1 system to facilitate their interaction studies, such as characterization of relaxin analogues or screening novel agonists or antagonists of RXFP1.

HPV binding assay to Laminin-332/integrin α6β4 on human keratinocytes.

PubMed

Brendle, Sarah A; Christensen, Neil D

2015-01-01

Human papillomaviruses (HPVs) have been shown to bind to Laminin-332 (Ln-332) on the extracellular matrix (ECM) secreted by human keratinocytes. The assay described here is an important tool to study HPV receptor binding to the ECM. The assay can also be modified to study the receptors required for HPV infection and for binding to tissues. We previously showed that Ln-332 is essential for the binding of HPV11 to human keratinocytes and that infectious entry of HPV11 requires α6β4 integrin for the transfer of HPV11 from ECM to host cells (Culp et al., J Virol 80:8940-8950, 2006). We also demonstrated that several of the high-risk HPV types (16, 18, 31 and 45) bind to Ln-332 and/or other components of the ECM in vitro (Broutian et al., J Gen Virol 91:531-540, 2010). The exact binding and internalization mechanism(s) for HPV are still under investigation. A better understanding of these mechanisms will aid in the design of therapeutics against HPVs and ultimately help prevent many cancers. In this chapter, we describe the HPV binding assay to Ln-332/integrin α6β4 on human keratinocytes (ECM). We also present data and suggestions for modifying the assay for testing the specificity of HPV for receptors (by blocking receptors) and binding to human tissues (basement membrane, BM) in order to study binding mechanisms.

Arabidopsis F-box protein containing a Nictaba-related lectin domain interacts with N-acetyllactosamine structures.

PubMed

Stefanowicz, Karolina; Lannoo, Nausicaä; Proost, Paul; Van Damme, Els J M

2012-01-01

The Arabidopsis thaliana genome contains a small group of bipartite F-box proteins, consisting of an N-terminal F-box domain and a C-terminal domain sharing sequence similarity with Nictaba, the jasmonate-induced glycan-binding protein (lectin) from tobacco. Based on the high sequence similarity between the C-terminal domain of these proteins and Nictaba, the hypothesis was put forward that the so-called F-box-Nictaba proteins possess carbohydrate-binding activity and accordingly can be considered functional homologs of the mammalian sugar-binding F-box or Fbs proteins which are involved in proteasomal degradation of glycoproteins. To obtain experimental evidence for the carbohydrate-binding activity and specificity of the A. thaliana F-box-Nictaba proteins, both the complete F-box-Nictaba sequence of one selected Arabidopsis F-box protein (in casu At2g02360) as well as the Nictaba-like domain only were expressed in Pichia pastoris and analyzed by affinity chromatography, agglutination assays and glycan micro-array binding assays. These results demonstrated that the C-terminal Nictaba-like domain provides the F-box-protein with a carbohydrate-binding activity that is specifically directed against N- and O-glycans containing N-acetyllactosamine (Galβ1-3GlcNAc and Galβ1-4GlcNAc) and poly-N-acetyllactosamine ([Galβ1-4GlcNAc]n) as well as Lewis A (Galβ1-3(Fucα1-4)GlcNAc), Lewis X (Galβ1-4(Fucα1-3)GlcNAc, Lewis Y (Fucα1-2Galβ1-4(Fucα1-3)GlcNAc) and blood type B (Galα1-3(Fucα1-2)Galβ1-3GlcNAc) motifs. Based on these findings one can reasonably conclude that at least the A. thaliana F-box-Nictaba protein encoded by At2g02360 can act as a carbohydrate-binding protein. The results from the glycan array assays revealed differences in sugar-binding specificity between the F-box protein and Nictaba, indicating that the same carbohydrate-binding motif can accommodate unrelated oligosaccharides.

Coordination of two sequential ester-transfer reactions: exogenous guanosine binding promotes the subsequent ωG binding to a group I intron

PubMed Central

Bao, Penghui; Wu, Qi-Jia; Yin, Ping; Jiang, Yanfei; Wang, Xu; Xie, Mao-Hua; Sun, Tao; Huang, Lin; Mo, Ding-Ding; Zhang, Yi

2008-01-01

Self-splicing of group I introns is accomplished by two sequential ester-transfer reactions mediated by sequential binding of two different guanosine ligands, but it is yet unclear how the binding is coordinated at a single G-binding site. Using a three-piece trans-splicing system derived from the Candida intron, we studied the effect of the prior GTP binding on the later ωG binding by assaying the ribozyme activity in the second reaction. We showed that adding GTP simultaneously with and prior to the esterified ωG in a substrate strongly accelerated the second reaction, suggesting that the early binding of GTP facilitates the subsequent binding of ωG. GTP-mediated facilitation requires C2 amino and C6 carbonyl groups on the Watson–Crick edge of the base but not the phosphate or sugar groups, suggesting that the base triple interactions between GTP and the binding site are important for the subsequent ωG binding. Strikingly, GTP binding loosens a few local structures of the ribozyme including that adjacent to the base triple, providing structural basis for a rapid exchange of ωG for bound GTP. PMID:18978026

A novel assay to identify the trafficking proteins that bind to specific vesicle populations

PubMed Central

Bentley, Marvin; Banker, Gary

2016-01-01

Here we describe a method capable of identifying interactions between candidate trafficking proteins and a defined vesicle population in intact cells. The assay involves the expression of an FKBP12-rapamycin–binding domain (FRB)–tagged candidate vesicle-binding protein that can be inducibly linked to an FKBP-tagged molecular motor. If the FRB-tagged candidate protein binds the labeled vesicles, then linking the FRB and FKBP domains recruits motors to the vesicles and causes a predictable, highly distinctive change in vesicle trafficking. We describe two versions of the assay: a general protocol for use in cells with a typical microtubule-organizing center and a specialized protocol designed to detect protein-vesicle interactions in cultured neurons. We have successfully used this assay to identify kinesins and Rabs that bind to a variety of different vesicle populations. In principle, this assay could be used to investigate interactions between any category of vesicle trafficking proteins and any vesicle population that can be specifically labeled. PMID:26621371

Bisphenol AF and Bisphenol B Exert Higher Estrogenic Effects than Bisphenol A via G Protein-Coupled Estrogen Receptor Pathway.

PubMed

Cao, Lin-Ying; Ren, Xiao-Min; Li, Chuan-Hai; Zhang, Jing; Qin, Wei-Ping; Yang, Yu; Wan, Bin; Guo, Liang-Hong

2017-10-03

Numerous studies have indicated estrogenic disruption effects of bisphenol A (BPA) analogues. Previous mechanistic studies were mainly focused on their genomic activities on nuclear estrogen receptor pathway. However, their nongenomic effects through G protein-coupled estrogen receptor (GPER) pathway remain poorly understood. Here, using a SKBR3 cell-based fluorescence competitive binding assay, we found six BPA analogues bound to GPER directly, with bisphenol AF (BPAF) and bisphenol B (BPB) displaying much higher (∼9-fold) binding affinity than BPA. Molecular docking also demonstrated the binding of these BPA analogues to GPER. By measuring calcium mobilization and cAMP production in SKBR3 cells, we found the binding of these BPA analogues to GPER lead to the activation of subsequent signaling pathways. Consistent with the binding results, BPAF and BPB presented higher agonistic activity than BPA with the lowest effective concentration (LOEC) of 10 nM. Moreover, based on the results of Boyden chamber and wound-healing assays, BPAF and BPB displayed higher activity in promoting GPER mediated SKBR3 cell migration than BPA with the LOEC of 100 nM. Overall, we found two BPA analogues BPAF and BPB could exert higher estrogenic effects than BPA via GPER pathway at nanomolar concentrations.

Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

PubMed Central

Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

2014-01-01

Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

Functional efficacy of adenosine A2A receptor agonists is positively correlated to their receptor residence time

PubMed Central

Guo, Dong; Mulder-Krieger, Thea; IJzerman, Adriaan P; Heitman, Laura H

2012-01-01

BACKGROUND AND PURPOSE The adenosine A2A receptor belongs to the superfamily of GPCRs and is a promising therapeutic target. Traditionally, the discovery of novel agents for the A2A receptor has been guided by their affinity for the receptor. This parameter is determined under equilibrium conditions, largely ignoring the kinetic aspects of the ligand-receptor interaction. The aim of this study was to assess the binding kinetics of A2A receptor agonists and explore a possible relationship with their functional efficacy. EXPERIMENTAL APPROACH We set up, validated and optimized a kinetic radioligand binding assay (a so-called competition association assay) at the A2A receptor from which the binding kinetics of unlabelled ligands were determined. Subsequently, functional efficacies of A2A receptor agonists were determined in two different assays: a novel label-free impedance-based assay and a more traditional cAMP determination. KEY RESULTS A simplified competition association assay yielded an accurate determination of the association and dissociation rates of unlabelled A2A receptor ligands at their receptor. A correlation was observed between the receptor residence time of A2A receptor agonists and their intrinsic efficacies in both functional assays. The affinity of A2A receptor agonists was not correlated to their functional efficacy. CONCLUSIONS AND IMPLICATIONS This study indicates that the molecular basis of different agonist efficacies at the A2A receptor lies within their different residence times at this receptor. PMID:22324512

Metal-amplified Density Assays, (MADAs), including a Density-Linked Immunosorbent Assay (DeLISA).

PubMed

Subramaniam, Anand Bala; Gonidec, Mathieu; Shapiro, Nathan D; Kresse, Kayleigh M; Whitesides, George M

2015-02-21

This paper reports the development of Metal-amplified Density Assays, or MADAs - a method of conducting quantitative or multiplexed assays, including immunoassays, by using Magnetic Levitation (MagLev) to measure metal-amplified changes in the density of beads labeled with biomolecules. The binding of target analytes (i.e. proteins, antibodies, antigens) to complementary ligands immobilized on the surface of the beads, followed by a chemical amplification of the binding in a form that results in a change in the density of the beads (achieved by using gold nanoparticle-labeled biomolecules, and electroless deposition of gold or silver), translates analyte binding events into changes in density measureable using MagLev. A minimal model based on diffusion-limited growth of hemispherical nuclei on a surface reproduces the dynamics of the assay. A MADA - when performed with antigens and antibodies - is called a Density-Linked Immunosorbent Assay, or DeLISA. Two immunoassays provided a proof of principle: a competitive quantification of the concentration of neomycin in whole milk, and a multiplexed detection of antibodies against Hepatitis C virus NS3 protein and syphilis T. pallidum p47 protein in serum. MADAs, including DeLISAs, require, besides the requisite biomolecules and amplification reagents, minimal specialized equipment (two permanent magnets, a ruler or a capillary with calibrated length markings) and no electrical power to obtain a quantitative readout of analyte concentration. With further development, the method may be useful in resource-limited or point-of-care settings.

A label-free aptamer-fluorophore assembly for rapid and specific detection of cocaine in biofluids.

PubMed

Roncancio, Daniel; Yu, Haixiang; Xu, Xiaowen; Wu, Shuo; Liu, Ran; Debord, Joshua; Lou, Xinhui; Xiao, Yi

2014-11-18

We report a rapid and specific aptamer-based method for one-step cocaine detection with minimal reagent requirements. The feasibility of aptamer-based detection has been demonstrated with sensors that operate via target-induced conformational change mechanisms, but these have generally exhibited limited target sensitivity. We have discovered that the cocaine-binding aptamer MNS-4.1 can also bind the fluorescent molecule 2-amino-5,6,7-trimethyl-1,8-naphthyridine (ATMND) and thereby quench its fluorescence. We subsequently introduced sequence changes into MNS-4.1 to engineer a new cocaine-binding aptamer (38-GC) that exhibits higher affinity to both ligands, with reduced background signal and increased signal gain. Using this aptamer, we have developed a new sensor platform that relies on the cocaine-mediated displacement of ATMND from 38-GC as a result of competitive binding. We demonstrate that our sensor can detect cocaine within seconds at concentrations as low as 200 nM, which is 50-fold lower than existing assays based on target-induced conformational change. More importantly, our assay achieves successful cocaine detection in body fluids, with a limit of detection of 10.4, 18.4, and 36 μM in undiluted saliva, urine, and serum samples, respectively.

Probing structurally altered and aggregated states of therapeutically relevant proteins using GroEL coupled to bio-layer interferometry.

PubMed

Naik, Subhashchandra; Kumru, Ozan S; Cullom, Melissa; Telikepalli, Srivalli N; Lindboe, Elizabeth; Roop, Taylor L; Joshi, Sangeeta B; Amin, Divya; Gao, Phillip; Middaugh, C Russell; Volkin, David B; Fisher, Mark T

2014-10-01

The ability of a GroEL-based bio-layer interferometry (BLI) assay to detect structurally altered and/or aggregated species of pharmaceutically relevant proteins is demonstrated. Assay development included optimizing biotinylated-GroEL immobilization to streptavidin biosensors, combined with biophysical and activity measurements showing native and biotinylated GroEL are both stable and active. First, acidic fibroblast growth factor (FGF-1) was incubated under conditions known to promote (40°C) and inhibit (heparin addition) molten globule formation. Heat exposed (40°C) FGF-1 exhibited binding to GroEL-biosensors, which was significantly diminished in the presence of heparin. Second, a polyclonal human IgG solution containing 6-8% non-native dimer showed an increase in higher molecular weight aggregates upon heating by size exclusion chromatography (SEC). The poly IgG solution displayed binding to GroEL-biosensors initially with progressively increased binding upon heating. Enriched preparations of the IgG dimers or monomers showed significant binding to GroEL-biosensors. Finally, a thermally treated IgG1 monoclonal antibody (mAb) solution also demonstrated increased GroEL-biosensor binding, but with different kinetics. The bound complexes could be partially to fully dissociated after ATP addition (i.e., specific GroEL binding) depending on the protein, environmental stress, and the assay's experimental conditions. Transmission electron microscopy (TEM) images of GroEL-mAb complexes, released from the biosensor, also confirmed interaction of bound complexes at the GroEL binding site with heat-stressed mAb. Results indicate that the GroEL-biosensor-BLI method can detect conformationally altered and/or early aggregation states of proteins, and may potentially be useful as a rapid, stability-indicating biosensor assay for monitoring the structural integrity and physical stability of therapeutic protein candidates. © 2014 The Protein Society.

Polymerase chain reaction-hybridization method using urease gene sequences for high-throughput Ureaplasma urealyticum and Ureaplasma parvum detection and differentiation.

PubMed

Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing

2016-04-15

In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.

A homogeneous, Anti-dsDNA antibody-based assay for multicolor detection of cancer stem cell transcription factors.

PubMed

Ma, Jiehua; Shi, Hai; Zhang, Meiling; Li, Chao; Xiang, Yang; Liu, Ping

2018-10-31

Cancer stem cells (CSCs) are responsible for maintaining tumor growth, metastasis and recurrence. The high expression of cancer stem cell transcription factors (Oct4, Sox2 and Nanog) is a valuable prognostic factor, suggesting a higher risk of tumor recurrence and metastasis. So, the development of a convenient and cost-effective method for multiplex assay of these transcription factors (TFs) is highly required. In this work, we have proposed a universal homogeneous assay for multicolor detection of these TFs based on anti-dsDNA antibody-decorated Fe 3 O 4 magnetite nanoparticles (aadMNPs). In the presence of analytes, the dye-labeled dsDNAs are bound by specific TFs, which will inhibit the interactions between the dsDNAs and aadMNPs, generating higher fluorescence that may provide signal readout for the immunosensing process. By using the proposed method, Oct4 can be determined in a linear range from 3 to 1200 ng/mL with a detection limit of 0.035 ng/mL. Furthermore, we have presented assays for the sensitive, selective and rapid detection of Oct4, Sox2 and Nanog in cell extract, as well as the analysis of binding affinity of the mutated binding sequences. This work may provide potential applications in clinical CSCs detections, and may open new opportunity for the study of nucleotide polymorphisms in TF binding sites. Copyright © 2018 Elsevier B.V. All rights reserved.

Reaction-based Indicator displacement Assay (RIA) for the selective colorimetric and fluorometric detection of peroxynitrite.

PubMed

Sun, Xiaolong; Lacina, Karel; Ramsamy, Elena C; Flower, Stephen E; Fossey, John S; Qian, Xuhong; Anslyn, Eric V; Bull, Steven D; James, Tony D

2015-05-01

Using the self-assembly of aromatic boronic acids with Alizarin Red S (ARS), we developed a new chemosensor for the selective detection of peroxynitrite. Phenylboronic acid (PBA), benzoboroxole (BBA) and 2-( N , N -dimethylaminomethyl)phenylboronic acid (NBA) were employed to bind with ARS to form the complex probes. In particular, the ARS-NBA system with a high binding affinity can preferably react with peroxynitrite over hydrogen peroxide and other ROS/RNS due to the protection of the boron via the solvent-insertion B-N interaction. Our simple system produces a visible colorimetric change and on-off fluorescence response towards peroxynitrite. By coupling a chemical reaction that leads to an indicator displacement, we have developed a new sensing strategy, referred to herein as RIA (Reaction-based Indicator displacement Assay).

Reductive methods for isotopic labeling of antibiotics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Champney, W.S.

1989-08-15

Methods for the reductive methylation of the amino groups of eight different antibiotics using {sup 3}HCOH or H{sup 14}COH are presented. The reductive labeling of an additional seven antibiotics by NaB{sub 3}H{sub 4} is also described. The specific activity of the methyl-labeled drugs was determined by a phosphocellulose paper binding assay. Two quantitative assays for these compounds based on the reactivity of the antibiotic amino groups with fluorescamine and of the aldehyde and ketone groups with 2,4-dinitrophenylhydrazine are also presented. Data on the cellular uptake and ribosome binding of these labeled compounds are also presented.

Solid-phase single molecule biosensing using dual-color colocalization of fluorescent quantum dot nanoprobes

NASA Astrophysics Data System (ADS)

Liu, Jianbo; Yang, Xiaohai; Wang, Kemin; Wang, Qing; Liu, Wei; Wang, Dong

2013-10-01

The development of solid-phase surface-based single molecule imaging technology has attracted significant interest during the past decades. Here we demonstrate a sandwich hybridization method for highly sensitive detection of a single thrombin protein at a solid-phase surface based on the use of dual-color colocalization of fluorescent quantum dot (QD) nanoprobes. Green QD560-modified thrombin binding aptamer I (QD560-TBA I) were deposited on a positive poly(l-lysine) assembled layer, followed by bovine serum albumin blocking. It allowed the thrombin protein to mediate the binding of the easily detectable red QD650-modified thrombin binding aptamer II (QD650-TBA II) to the QD560-TBA I substrate. Thus, the presence of the target thrombin can be determined based on fluorescent colocalization measurements of the nanoassemblies, without target amplification or probe separation. The detection limit of this assay reached 0.8 pM. This fluorescent colocalization assay has enabled single molecule recognition in a separation-free detection format, and can serve as a sensitive biosensing platform that greatly suppresses the nonspecific adsorption false-positive signal. This method can be extended to other areas such as multiplexed immunoassay, single cell analysis, and real time biomolecule interaction studies.The development of solid-phase surface-based single molecule imaging technology has attracted significant interest during the past decades. Here we demonstrate a sandwich hybridization method for highly sensitive detection of a single thrombin protein at a solid-phase surface based on the use of dual-color colocalization of fluorescent quantum dot (QD) nanoprobes. Green QD560-modified thrombin binding aptamer I (QD560-TBA I) were deposited on a positive poly(l-lysine) assembled layer, followed by bovine serum albumin blocking. It allowed the thrombin protein to mediate the binding of the easily detectable red QD650-modified thrombin binding aptamer II (QD650-TBA II) to the QD560-TBA I substrate. Thus, the presence of the target thrombin can be determined based on fluorescent colocalization measurements of the nanoassemblies, without target amplification or probe separation. The detection limit of this assay reached 0.8 pM. This fluorescent colocalization assay has enabled single molecule recognition in a separation-free detection format, and can serve as a sensitive biosensing platform that greatly suppresses the nonspecific adsorption false-positive signal. This method can be extended to other areas such as multiplexed immunoassay, single cell analysis, and real time biomolecule interaction studies. Electronic supplementary information (ESI) available: Absorbance and fluorescence spectra of quantum dot nanoprobes, electrophoresis analysis, and experimental setup for fluorescence imaging with dual channels. See DOI: 10.1039/c3nr03291d

A Novel Assay for Antibody-Dependent Cell-Mediated Cytotoxicity against HIV-1- or SIV-Infected Cells Reveals Incomplete Overlap with Antibodies Measured by Neutralization and Binding Assays

PubMed Central

Alpert, Michael D.; Heyer, Lisa N.; Williams, David E. J.; Harvey, Jackson D.; Greenough, Thomas; Allhorn, Maria

2012-01-01

The resistance of human immunodeficiency virus type 1 (HIV-1) to antibody-mediated immunity often prevents the detection of antibodies that neutralize primary isolates of HIV-1. However, conventional assays for antibody functions other than neutralization are suboptimal. Current methods for measuring the killing of virus-infected cells by antibody-dependent cell-mediated cytotoxicity (ADCC) are limited by the number of natural killer (NK) cells obtainable from individual donors, donor-to-donor variation, and the use of nonphysiological targets. We therefore developed an ADCC assay based on NK cell lines that express human or macaque CD16 and a CD4+ T-cell line that expresses luciferase from a Tat-inducible promoter upon HIV-1 or simian immunodeficiency virus (SIV) infection. NK cells and virus-infected targets are mixed in the presence of serial plasma dilutions, and ADCC is measured as the dose-dependent loss of luciferase activity. Using this approach, ADCC titers were measured in plasma samples from HIV-infected human donors and SIV-infected macaques. For the same plasma samples paired with the same test viruses, this assay was approximately 2 orders of magnitude more sensitive than optimized assays for neutralizing antibodies—frequently allowing the measurement of ADCC in the absence of detectable neutralization. Although ADCC correlated with other measures of Env-specific antibodies, neutralizing and gp120 binding titers did not consistently predict ADCC activity. Hence, this assay affords a sensitive method for measuring antibodies capable of directing ADCC against HIV- or SIV-infected cells expressing native conformations of the viral envelope glycoprotein and reveals incomplete overlap of the antibodies that direct ADCC and those measured in neutralization and binding assays. PMID:22933282

Microarray-based screening of heat shock protein inhibitors.

PubMed

Schax, Emilia; Walter, Johanna-Gabriela; Märzhäuser, Helene; Stahl, Frank; Scheper, Thomas; Agard, David A; Eichner, Simone; Kirschning, Andreas; Zeilinger, Carsten

2014-06-20

Based on the importance of heat shock proteins (HSPs) in diseases such as cancer, Alzheimer's disease or malaria, inhibitors of these chaperons are needed. Today's state-of-the-art techniques to identify HSP inhibitors are performed in microplate format, requiring large amounts of proteins and potential inhibitors. In contrast, we have developed a miniaturized protein microarray-based assay to identify novel inhibitors, allowing analysis with 300 pmol of protein. The assay is based on competitive binding of fluorescence-labeled ATP and potential inhibitors to the ATP-binding site of HSP. Therefore, the developed microarray enables the parallel analysis of different ATP-binding proteins on a single microarray. We have demonstrated the possibility of multiplexing by immobilizing full-length human HSP90α and HtpG of Helicobacter pylori on microarrays. Fluorescence-labeled ATP was competed by novel geldanamycin/reblastatin derivatives with IC50 values in the range of 0.5 nM to 4 μM and Z(*)-factors between 0.60 and 0.96. Our results demonstrate the potential of a target-oriented multiplexed protein microarray to identify novel inhibitors for different members of the HSP90 family. Copyright © 2014 Elsevier B.V. All rights reserved.

A rapid method for selecting suitable animal species for studying pathogen interactions with plasma protein ligands in vivo.

PubMed

Naudin, Clément; Schumski, Ariane; Salo-Ahen, Outi M H; Herwald, Heiko; Smeds, Emanuel

2017-05-01

Species tropism constitutes a serious problem for developing relevant animal models of infection. Human pathogens can express virulence factors that show specific selectivity to human proteins, while their affinity for orthologs from other species can vary significantly. Suitable animal species must be used to analyse whether virulence factors are potential targets for drug development. We developed an assay that rapidly predicts applicable animal species for studying virulence factors binding plasma proteins. We used two well-characterized Staphylococcus aureus proteins, SSL7 and Efb, to develop an ELISA-based inhibition assay using plasma from different animal species. The interaction between SSL7 and human C5 and the binding of Efb to human fibrinogen and human C3 was studied. Affinity experiments and Western blot analyses were used to validate the assay. Human, monkey and cat plasma interfered with binding of SSL7 to human C5. Binding of Efb to human fibrinogen was blocked in human, monkey, gerbil and pig plasma, while human, monkey, gerbil, rabbit, cat and guinea pig plasma inhibited the binding of Efb to human C3. These results emphasize the importance of choosing correct animal models, and thus, our approach is a rapid and cost-effective method that can be used to prevent unnecessary animal experiments. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

A simple method for determining polymeric IgA-containing immune complexes.

PubMed

Sancho, J; Egido, J; González, E

1983-06-10

A simplified assay to measure polymeric IgA-immune complexes in biological fluids is described. The assay is based upon the specific binding of a secretory component for polymeric IgA. In the first step, multimeric IgA (monomeric and polymeric) immune complexes are determined by the standard Raji cell assay. Secondly, labeled secretory component added to the assay is bound to polymeric IgA-immune complexes previously fixed to Raji cells, but not to monomeric IgA immune complexes. To avoid false positives due to possible complement-fixing IgM immune complexes, prior IgM immunoadsorption is performed. Using anti-IgM antiserum coupled to CNBr-activated Sepharose 4B this step is not time-consuming. Polymeric IgA has a low affinity constant and binds weakly to Raji cells, as Scatchard analysis of the data shows. Thus, polymeric IgA immune complexes do not bind to Raji cells directly through Fc receptors, but through complement breakdown products, as with IgG-immune complexes. Using this method, we have been successful in detecting specific polymeric-IgA immune complexes in patients with IgA nephropathy (Berger's disease) and alcoholic liver disease, as well as in normal subjects after meals of high protein content. This new, simple, rapid and reproducible assay might help to study the physiopathological role of polymeric IgA immune complexes in humans and animals.

Alternative Methods for the Detection of Emerging Marine Toxins: Biosensors, Biochemical Assays and Cell-Based Assays

PubMed Central

Reverté, Laia; Soliño, Lucía; Carnicer, Olga; Diogène, Jorge; Campàs, Mònica

2014-01-01

The emergence of marine toxins in water and seafood may have a considerable impact on public health. Although the tendency in Europe is to consolidate, when possible, official reference methods based on instrumental analysis, the development of alternative or complementary methods providing functional or toxicological information may provide advantages in terms of risk identification, but also low cost, simplicity, ease of use and high-throughput analysis. This article gives an overview of the immunoassays, cell-based assays, receptor-binding assays and biosensors that have been developed for the screening and quantification of emerging marine toxins: palytoxins, ciguatoxins, cyclic imines and tetrodotoxins. Their advantages and limitations are discussed, as well as their possible integration in research and monitoring programs. PMID:25431968

Toxin detection using a fiber-optic-based biosensor

NASA Astrophysics Data System (ADS)

Ogert, Robert A.; Shriver-Lake, Lisa C.; Ligler, Frances S.

1993-05-01

Using an evanescent wave fiber optic-based biosensor developed at Naval Research Laboratory, ricin toxin can be detected in the low ng/ml range. Sensitivity was established at 1 - 5 ng/ml using a two-step assay. The two-step assay showed enhanced signal levels in comparison to a one-step assay. A two-step assay utilizes a 10 minute incubation of an immobilized affinity purified anti-ricin antibody fiber optic probe in the ricin sample before placement in a solution of fluorophore-labeled goat anti-ricin antibodies. The specific fluorescent signal is obtained by the binding of the fluorophore-labeled antibodies to ricin which is bound by the immobilized antibodies on the fiber optic probe. The toxin can be detected directly from urine and river water using this fiber optic assay.

Phosphatidic acid binding proteins display differential binding as a function of membrane curvature stress and chemical properties.

PubMed

Putta, Priya; Rankenberg, Johanna; Korver, Ruud A; van Wijk, Ringo; Munnik, Teun; Testerink, Christa; Kooijman, Edgar E

2016-11-01

Phosphatidic acid (PA) is a crucial membrane phospholipid involved in de novo lipid synthesis and numerous intracellular signaling cascades. The signaling function of PA is mediated by peripheral membrane proteins that specifically recognize PA. While numerous PA-binding proteins are known, much less is known about what drives specificity of PA-protein binding. Previously, we have described the ionization properties of PA, summarized in the electrostatic-hydrogen bond switch, as one aspect that drives the specific binding of PA by PA-binding proteins. Here we focus on membrane curvature stress induced by phosphatidylethanolamine and show that many PA-binding proteins display enhanced binding as a function of negative curvature stress. This result is corroborated by the observation that positive curvature stress, induced by lyso phosphatidylcholine, abolishes PA binding of target proteins. We show, for the first time, that a novel plant PA-binding protein, Arabidopsis Epsin-like Clathrin Adaptor 1 (ECA1) displays curvature-dependence in its binding to PA. Other established PA targets examined in this study include, the plant proteins TGD2, and PDK1, the yeast proteins Opi1 and Spo20, and, the mammalian protein Raf-1 kinase and the C2 domain of the mammalian phosphatidylserine binding protein Lact as control. Based on our observations, we propose that liposome binding assays are the preferred method to investigate lipid binding compared to the popular lipid overlay assays where membrane environment is lost. The use of complex lipid mixtures is important to elucidate further aspects of PA binding proteins. Copyright © 2016. Published by Elsevier B.V.

Fragment screening using capillary electrophoresis (CEfrag) for hit identification of heat shock protein 90 ATPase inhibitors.

PubMed

Austin, Carol; Pettit, Simon N; Magnolo, Sharon K; Sanvoisin, Jonathan; Chen, Wenjie; Wood, Stephen P; Freeman, Lauren D; Pengelly, Reuben J; Hughes, Dallas E

2012-08-01

CEfrag is a new fragment screening technology based on affinity capillary electrophoresis (ACE). Here we report on the development of a mobility shift competition assay using full-length human heat shock protein 90α (Hsp90α), radicicol as the competitor probe ligand, and successful screening of the Selcia fragment library. The CEfrag assay was able to detect weaker affinity (IC(50) >500 µM) fragments than were detected by a fluorescence polarization competition assay using FITC-labeled geldanamycin. The binding site of selected fragments was determined by co-crystallization with recombinant Hsp90α N-terminal domain and X-ray analysis. The results of this study confirm that CEfrag is a sensitive microscale technique enabling detection of fragments binding to the biological target in near-physiological solution.

Tumor necrosis factor interaction with gold nanoparticles

NASA Astrophysics Data System (ADS)

Tsai, De-Hao; Elzey, Sherrie; Delrio, Frank W.; Keene, Athena M.; Tyner, Katherine M.; Clogston, Jeffrey D.; Maccuspie, Robert I.; Guha, Suvajyoti; Zachariah, Michael R.; Hackley, Vincent A.

2012-05-01

We report on a systematic investigation of molecular conjugation of tumor necrosis factor-α (TNF) protein onto gold nanoparticles (AuNPs) and the subsequent binding behavior to its antibody (anti-TNF). We employ a combination of physical and spectroscopic characterization methods, including electrospray-differential mobility analysis, dynamic light scattering, polyacrylamide gel electrophoresis, attenuated total reflectance-Fourier transform infrared spectroscopy, fluorescence assay, and enzyme-linked immunosorbent assay. The native TNF used in this study exists in the active homotrimer configuration prior to conjugation. After binding to AuNPs, the maximum surface density of TNF is (0.09 +/- 0.02) nm-2 with a binding constant of 3 × 106 (mol L-1)-1. Dodecyl sulfate ions induce desorption of monomeric TNF from the AuNP surface, indicating a relatively weak intermolecular binding within the AuNP-bound TNF trimers. Anti-TNF binds to both TNF-conjugated and citrate-stabilized AuNPs, showing that non-specific binding is significant. Based on the number of anti-TNF molecules adsorbed, a substantially higher binding affinity was observed for the TNF-conjugated surface. The inclusion of thiolated polyethylene glycol (SH-PEG) on the AuNPs inhibits the binding of anti-TNF, and the amount of inhibition is related to the number ratio of surface bound SH-PEG to TNF and the way in which the ligands are introduced. This study highlights the challenges in quantitatively characterizing complex hybrid nanoscale conjugates, and provides insight on TNF-AuNP formation and activity.We report on a systematic investigation of molecular conjugation of tumor necrosis factor-α (TNF) protein onto gold nanoparticles (AuNPs) and the subsequent binding behavior to its antibody (anti-TNF). We employ a combination of physical and spectroscopic characterization methods, including electrospray-differential mobility analysis, dynamic light scattering, polyacrylamide gel electrophoresis, attenuated total reflectance-Fourier transform infrared spectroscopy, fluorescence assay, and enzyme-linked immunosorbent assay. The native TNF used in this study exists in the active homotrimer configuration prior to conjugation. After binding to AuNPs, the maximum surface density of TNF is (0.09 +/- 0.02) nm-2 with a binding constant of 3 × 106 (mol L-1)-1. Dodecyl sulfate ions induce desorption of monomeric TNF from the AuNP surface, indicating a relatively weak intermolecular binding within the AuNP-bound TNF trimers. Anti-TNF binds to both TNF-conjugated and citrate-stabilized AuNPs, showing that non-specific binding is significant. Based on the number of anti-TNF molecules adsorbed, a substantially higher binding affinity was observed for the TNF-conjugated surface. The inclusion of thiolated polyethylene glycol (SH-PEG) on the AuNPs inhibits the binding of anti-TNF, and the amount of inhibition is related to the number ratio of surface bound SH-PEG to TNF and the way in which the ligands are introduced. This study highlights the challenges in quantitatively characterizing complex hybrid nanoscale conjugates, and provides insight on TNF-AuNP formation and activity. Electronic supplementary information (ESI) available: Experimental procedures, instrumentation, materials and calculations. See DOI: 10.1039/c2nr30415e

A new series of estrogen receptor modulators that display selectivity for estrogen receptor beta.

PubMed

Henke, Brad R; Consler, Thomas G; Go, Ning; Hale, Ron L; Hohman, Dana R; Jones, Stacey A; Lu, Amy T; Moore, Linda B; Moore, John T; Orband-Miller, Lisa A; Robinett, R Graham; Shearin, Jean; Spearing, Paul K; Stewart, Eugene L; Turnbull, Philip S; Weaver, Susan L; Williams, Shawn P; Wisely, G Bruce; Lambert, Millard H

2002-12-05

A series of 1,3,5-triazine-based estrogen receptor (ER) modulators that are modestly selective for the ERbeta subtype are reported. Compound 1, which displayed modest potency and selectivity for ERbeta vs ERalpha, was identified via high-throughput screening utilizing an ERbeta SPA-based binding assay. Subsequent analogue preparation resulted in the identification of compounds such as 21 and 43 that display 25- to 30-fold selectivity for ERbeta with potencies in the 10-30 nM range. These compounds profile as full antagonists at ERbeta and weak partial agonists at ERalpha in a cell-based reporter gene assay. In addition, the X-ray crystal structure of compound 15 complexed with the ligand binding domain of ERbeta has been solved and was utilized in the design of more conformationally restrained analogues such as 31 in an attempt to increase selectivity for the ERbeta subtype.

Dye-binding assays for evaluation of the effects of small molecule inhibitors on amyloid (aβ) self-assembly.

PubMed

Jameson, Laramie P; Smith, Nicholas W; Dzyuba, Sergei V

2012-11-21

Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors' potential toward Aβ peptides, species involved in Alzheimer's disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays.

Dye-Binding Assays for Evaluation of the Effects of Small Molecule Inhibitors on Amyloid (Aβ) Self-Assembly

PubMed Central

2012-01-01

Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors’ potential toward Aβ peptides, species involved in Alzheimer’s disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays. PMID:23173064

Flow cytometer measurement of binding assays

DOEpatents

Saunders, George C.

1987-01-01

A method of measuring the result of a binding assay that does not require separation of fluorescent smaller particles is disclosed. In a competitive binding assay the smaller fluorescent particles coated with antigen compete with antigen in the sample being analyzed for available binding sites on larger particles. In a sandwich assay, the smaller, fluorescent spheres coated with antibody attach themselves to molecules containing antigen that are attached to larger spheres coated with the same antibody. The separation of unattached, fluorescent smaller particles is made unnecessary by only counting the fluorescent events triggered by the laser of a flow cytometer when the event is caused by a particle with a light scatter measurement within a certain range corresponding to the presence of larger particles.

Synthesis, DNA binding, topoisomerase inhibition and cytotoxic properties of 2-chloroethylnitrosourea derivatives of hoechst 33258.

PubMed

Bielawski, Krzysztof; Bielawska, Anna; Anchim, Tomasz; Wołczyński, Sławomir

2005-06-01

A number of novel 2-chloroethylnitrosourea derivatives of Hoechst 33258 were synthesized and examined for cytotoxicity in breast cancer cell cultures and for inhibition of topoisomerases I and II. Evaluation of the cytotoxicity of these compounds employing a MTT assay and inhibition of [3H]thymidine incorporation into DNA in both MDA-MB-231 and MCF-7 breast cancer cells demonstrated that these compounds were more active than Hoechst 33258. The DNA-binding ability of these compounds was evaluated by an ultrafiltration method using calf thymus DNA, poly(dA-dT)2 and poly(dG-dC)2, indicated that these compounds as well as Hoechst 33258 well interact with AT base pair compared with GC pair. Binding studies indicate that these compounds bind more tightly to double-stranded DNA than the parent compound Hoechst 33258. The degree to which these compounds inhibited cell growth breast cancer cells was generally consistent with their relative DNA binding affinity. Mechanistic studies revealed that these compounds act as topoisomerase I (topo I) or topoisomerase II (topo II) inhibitors in plasmid relaxation assays.

Computational Identification of Diverse Mechanisms Underlying Transcription Factor-DNA Occupancy

PubMed Central

Cheng, Qiong; Kazemian, Majid; Pham, Hannah; Blatti, Charles; Celniker, Susan E.; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

2013-01-01

ChIP-based genome-wide assays of transcription factor (TF) occupancy have emerged as a powerful, high-throughput method to understand transcriptional regulation, especially on a global scale. This has led to great interest in the underlying biochemical mechanisms that direct TF-DNA binding, with the ultimate goal of computationally predicting a TF's occupancy profile in any cellular condition. In this study, we examined the influence of various potential determinants of TF-DNA binding on a much larger scale than previously undertaken. We used a thermodynamics-based model of TF-DNA binding, called “STAP,” to analyze 45 TF-ChIP data sets from Drosophila embryonic development. We built a cross-validation framework that compares a baseline model, based on the ChIP'ed (“primary”) TF's motif, to more complex models where binding by secondary TFs is hypothesized to influence the primary TF's occupancy. Candidates interacting TFs were chosen based on RNA-SEQ expression data from the time point of the ChIP experiment. We found widespread evidence of both cooperative and antagonistic effects by secondary TFs, and explicitly quantified these effects. We were able to identify multiple classes of interactions, including (1) long-range interactions between primary and secondary motifs (separated by ≤150 bp), suggestive of indirect effects such as chromatin remodeling, (2) short-range interactions with specific inter-site spacing biases, suggestive of direct physical interactions, and (3) overlapping binding sites suggesting competitive binding. Furthermore, by factoring out the previously reported strong correlation between TF occupancy and DNA accessibility, we were able to categorize the effects into those that are likely to be mediated by the secondary TF's effect on local accessibility and those that utilize accessibility-independent mechanisms. Finally, we conducted in vitro pull-down assays to test model-based predictions of short-range cooperative interactions, and found that seven of the eight TF pairs tested physically interact and that some of these interactions mediate cooperative binding to DNA. PMID:23935523

A portable measuring system for a competitive binding glucose biosensor

NASA Astrophysics Data System (ADS)

Colvin, Lydia E.; Means, A. Kristen; Grunlan, Melissa A.; Coté, Gerard L.

2018-02-01

Central to minimizing the long- and short-term complications associated with diabetes is careful monitoring and maintenance of blood glucose at normal levels. Towards replacing conventionally used finger-prick glucose testing, indwelling continuous glucose monitors (CGMs) based on amperometric electrodes have been introduced to the market. Envisioned to lead to a CGM with an increased lifetime, we report herein a fluorescently-labeled competitive binding assay contained within a hydrogel membrane whose glucose response is measured via a novel portable system. The optical system design included a laser source, bifurcated fiber, laser filter and simple fiber coupled spectrometer to obtain the change in FRET pair ratio of the assay. Glucose response of the assay in free solution was measured using this system across the physiologic range (0-200 mg/dL). The FRET pair ratio signal was seen to increase with glucose and the standard error of calibration was 22.42 mg/dL with a MARD value of 14.85%. When the assay was contained within the hydrogel membrane's central cavity and similarly analyzed, the standard error increased but the assay maintained its reversibility.

Biosensor discovery of thyroxine transport disrupting chemicals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marchesini, Gerardo R.; Meimaridou, Anastasia; Haasnoot, Willem

2008-10-01

Ubiquitous chemicals may interfere with the thyroid system that is essential in the development and physiology of vertebrates. We applied a surface plasmon resonance (SPR) biosensor-based screening method for the fast screening of chemicals with thyroxine (T4) transport disrupting activity. Two inhibition assays using the main thyroid hormone transport proteins, T4 binding globulin (TBG) and transthyretin (TTR), in combination with a T4-coated biosensor chip were optimized and automated for screening chemical libraries. The transport protein-based biosensor assays were rapid, high throughput and bioeffect-related. A library of 62 chemicals including the natural hormones, polychlorinated biphenyls (PCBs), polybrominated diphenylethers (PBDEs) and metabolites,more » halogenated bisphenol A (BPA), halogenated phenols, pharmaceuticals, pesticides and other potential environmentally relevant chemicals was tested with the two assays. We discovered ten new active compounds with moderate to high affinity for TBG with the TBG assay. Strikingly, the most potent binding was observed with hydroxylated metabolites of the brominated diphenyl ethers (BDEs) BDE 47, BDE 49 and BDE 99, that are commonly found in human plasma. The TTR assay confirmed the activity of previously identified hydroxylated metabolites of PCBs and PBDEs, halogenated BPA and genistein. These results show that the hydroxylated metabolites of the ubiquitous PBDEs not only target the T4 transport at the TTR level, but also, and to a great extent, at the TBG level where most of the T4 in humans is circulating. The optimized SPR biosensor-based transport protein assay is a suitable method for high throughput screening of large libraries for potential thyroid hormone disrupting compounds.« less

Stereoselective HDAC inhibition from cysteine-derived zinc-binding groups.

PubMed

Butler, Kyle V; He, Rong; McLaughlin, Kathryn; Vistoli, Giulio; Langley, Brett; Kozikowski, Alan P

2009-08-01

A series of small-molecule histone deacetylase (HDAC) inhibitors, which feature zinc binding groups derived from cysteine, were synthesized. These inhibitors were tested against multiple HDAC isoforms, and the most potent, compound 10, was determined to have IC(50) values below 1 microM. The compounds were also tested in a cellular assay of oxidative stress-induced neurodegeneration. Many of the inhibitors gave near-complete protection against cell death at 10 microM without the neurotoxicity seen with hydroxamic acid-based inhibitors, and were far more neuroprotective than HDAC inhibitors currently in clinical trials. Both enantiomers of cysteine were used in the synthesis of a variety of novel zinc-binding groups (ZBGs). Derivatives of L-cysteine were active in the HDAC inhibition assays, while the derivatives of D-cysteine were inactive. Notably, the finding that both the D- and L-cysteine derivatives were active in the neuroprotection assays suggests that multiple mechanisms are working to protect the neurons from cell death. Molecular modeling was employed to investigate the differences in inhibitory activity between the HDAC inhibitors generated from the two enantiomeric forms of cysteine.

A High-Throughput TNP-ATP Displacement Assay for Screening Inhibitors of ATP-Binding in Bacterial Histidine Kinases

PubMed Central

Guarnieri, Michael T.; Blagg, Brian S. J.

2011-01-01

Abstract Bacterial histidine kinases (HK) are members of the GHKL superfamily, which share a unique adenosine triphosphate (ATP)-binding Bergerat fold. Our previous studies have shown that Gyrase, Hsp90, MutL (GHL) inhibitors bind to the ATP-binding pocket of HK and may provide lead compounds for the design of novel antibiotics targeting these kinases. In this article, we developed a competition assay using the fluorescent ATP analog, 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate. The method can be used for high-throughput screening of compound libraries targeting HKs or other ATP-binding proteins. We utilized the assay to screen a library of GHL inhibitors targeting the bacterial HK PhoQ, and discuss the applications of the 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate competition assay beyond GHKL inhibitor screening. PMID:21050069

Concerted application of LC-MS and ligand binding assays to better understand exposure of a large molecule drug.

PubMed

Xu, Weifeng; Jiang, Hao; Titsch, Craig; Gadkari, Snaehal; Batog, Alicja; Wang, Bonnie; Hippeli, Lauren; Yamamoto, Brent; Chadwick, Kristina; Wheeler, Jennifer; Thompson, Chris; Stahl, James; Willett, Scott; DeSilva, Binodh S; Myler, Heather; Dodge, Robert W; Pillutla, Renuka C

2018-06-20

A ligand-binding assay (LBA) was used to measure exposure of PRM-151, the recombinant form of human pentraxin-2 (PTX-2), a complex pentamer with multiple binding partners. However, the assay showed a lack of dose-dependent exposure in select preclinical species and it could not differentiate the infused PRM-151 from the endogenous PTX-2 in nonhuman primates. Instead of assessing interference from its multiple binding partners, which could be time consuming and laborious, a LC-MS assay avoid of these interference was implemented to measure 'total' drug without the use of immunoaffinity capture reagents. The resultant LC-MS data confirmed the original data and the lack of dose-dependent exposure is now understood to be due to the multiple and diverse targets and functions and resultant complex biodistribution rather than an assay artifact.

A pollen-specific novel calmodulin-binding protein with tetratricopeptide repeats

NASA Technical Reports Server (NTRS)

Safadi, F.; Reddy, V. S.; Reddy, A. S.

2000-01-01

Calcium is essential for pollen germination and pollen tube growth. A large body of information has established a link between elevation of cytosolic Ca(2+) at the pollen tube tip and its growth. Since the action of Ca(2+) is primarily mediated by Ca(2+)-binding proteins such as calmodulin (CaM), identification of CaM-binding proteins in pollen should provide insights into the mechanisms by which Ca(2+) regulates pollen germination and tube growth. In this study, a CaM-binding protein from maize pollen (maize pollen calmodulin-binding protein, MPCBP) was isolated in a protein-protein interaction-based screening using (35)S-labeled CaM as a probe. MPCBP has a molecular mass of about 72 kDa and contains three tetratricopeptide repeats (TPR) suggesting that it is a member of the TPR family of proteins. MPCBP protein shares a high sequence identity with two hypothetical TPR-containing proteins from Arabidopsis. Using gel overlay assays and CaM-Sepharose binding, we show that the bacterially expressed MPCBP binds to bovine CaM and three CaM isoforms from Arabidopsis in a Ca(2+)-dependent manner. To map the CaM-binding domain several truncated versions of the MPCBP were expressed in bacteria and tested for their ability to bind CaM. Based on these studies, the CaM-binding domain was mapped to an 18-amino acid stretch between the first and second TPR regions. Gel and fluorescence shift assays performed with CaM and a CaM-binding synthetic peptide further confirmed MPCBP binding to CaM. Western, Northern, and reverse transcriptase-polymerase chain reaction analysis have shown that MPCBP expression is specific to pollen. MPCBP was detected in both soluble and microsomal proteins. Immunoblots showed the presence of MPCBP in mature and germinating pollen. Pollen-specific expression of MPCBP, its CaM-binding properties, and the presence of TPR motifs suggest a role for this protein in Ca(2+)-regulated events during pollen germination and growth.

Human Nup98 regulates the localization and activity of DExH/D-box helicase DHX9

PubMed Central

Capitanio, Juliana S; Montpetit, Ben; Wozniak, Richard W

2017-01-01

Beyond their role at nuclear pore complexes, some nucleoporins function in the nucleoplasm. One such nucleoporin, Nup98, binds chromatin and regulates gene expression. To gain insight into how Nup98 contributes to this process, we focused on identifying novel binding partners and understanding the significance of these interactions. Here we report on the identification of the DExH/D-box helicase DHX9 as an intranuclear Nup98 binding partner. Various results, including in vitro assays, show that the FG/GLFG region of Nup98 binds to N- and C-terminal regions of DHX9 in an RNA facilitated manner. Importantly, binding of Nup98 stimulates the ATPase activity of DHX9, and a transcriptional reporter assay suggests Nup98 supports DHX9-stimulated transcription. Consistent with these observations, our analysis revealed that Nup98 and DHX9 bind interdependently to similar gene loci and their transcripts. Based on our results, we propose that Nup98 functions as a co-factor that regulates DHX9 and, potentially, other RNA helicases. DOI: http://dx.doi.org/10.7554/eLife.18825.001 PMID:28221134

Characterization of 5-HT₁A receptors and their complexes with G-proteins in budded baculovirus particles using fluorescence anisotropy of Bodipy-FL-NAN-190.

PubMed

Tõntson, Lauri; Kopanchuk, Sergei; Rinken, Ago

2014-02-01

Bodipy-FL-NAN-190 was found to be well suited for characterization of ligand binding to 5-HT1A receptors expressed in budded baculovirus particles, as binding is accompanied by large increases in fluorescence intensity and anisotropy. This ligand appears to bind rapidly (t1/2,ass<1 min), reversibly (t1/2,diss∼6 min) and has high affinity (Kd=0.30 ± 0.13 nM). This fluorescence anisotropy assay based on Bodipy-FL-NAN-190 binding to baculovirus particles was also a suitable assay system for the pharmacological characterization of non-labelled serotonergic ligands, as well as being sensitive to the presence of G-proteins and guanine nucleotides. Coexpression of αi subunits of human G-proteins in baculovirus particles resulted in the appearance of significantly greater proportion of nucleotide sensitive high affinity agonist binding sites. There were no significant differences between αi1 and αi3 subtypes, while ligand binding in the presence of αi2 had higher sensitivity to GDP and Mn(2+). Copyright © 2014 Elsevier Ltd. All rights reserved.

A simple and rapid microplate assay for glycoprotein-processing glycosidases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kang, M.S.; Zwolshen, J.H.; Harry, B.S.

1989-08-15

A simple and convenient microplate assay for glycosidases involved in the glycoprotein-processing reactions is described. The assay is based on specific binding of high-mannose-type oligosaccharide substrates to concanavalin A-Sepharose, while monosaccharides liberated by enzymatic hydrolysis do not bind to concanavalin A-Sepharose. By the use of radiolabeled substrates (( 3H)glucose for glucosidases and (3H)mannose for mannosidases), the radioactivity in the liberated monosaccharides can be determined as a measure of the enzymatic activity. This principle was employed earlier for developing assays for glycosidases previously reported. These authors have reported the separation of substrate from the product by concanavalin A-Sepharose column chromatography. Thismore » procedure is handicapped by the fact that it cannot be used for a large number of samples and is time consuming. We have simplified this procedure and adapted it to the use of a microplate (96-well plate). This would help in processing a large number of samples in a short time. In this report we show that the assay is comparable to the column assay previously reported. It is linear with time and enzyme concentration and shows expected kinetics with castanospermine, a known inhibitor of alpha-glucosidase I.« less

Overcoming non-specific binding to measure the active concentration and kinetics of serum anti-HLA antibodies by surface plasmon resonance.

PubMed

Visentin, Jonathan; Couzi, Lionel; Dromer, Claire; Neau-Cransac, Martine; Guidicelli, Gwendaline; Veniard, Vincent; Coniat, Karine Nubret-le; Merville, Pierre; Di Primo, Carmelo; Taupin, Jean-Luc

2018-06-07

Human leukocyte antigen (HLA) donor-specific antibodies are key serum biomarkers for assessing the outcome of transplanted patients. Measuring their active concentration, i.e. the fraction that really interacts with donor HLA, and their affinity could help deciphering their pathogenicity. Surface plasmon resonance (SPR) is recognized as the gold-standard for measuring binding kinetics but also active concentrations, without calibration curves. SPR-based biosensors often suffer from non-specific binding (NSB) occurring with the sensor chip surface and the immobilized targets, especially for complex media such as human serum. In this work we show that several serum treatments such as dialysis or IgG purification reduce NSB but insufficiently for SPR applications. We then demonstrate that the NSB contribution to the SPR signal can be eliminated to determine precisely and reliably the active concentration and the affinity of anti-HLA antibodies from patients' sera. This was achieved even at concentrations close to the limit of quantification of the method, in the 0.5-1 nM range. The robustness of the assay was demonstrated by using a wide range of artificially generated NSB and by varying the density of the targets captured onto the surface. The assay is of general interest and can be used with molecules generating strong NSB, as far as a non-cognate target structurally close to the target can be captured on the same flow cell, in a different binding cycle. Compared with current fluorescence-based methods that are semi-quantitative, we expect this SPR-based assay to help better understanding anti-HLA antibodies pathogenicity and improving organ recipients' management. Copyright © 2018 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Wenfei; Wang, Ying; Wang, Nianshuang

Middle East respiratory syndrome coronavirus (MERS-CoV) infects host cells through binding the receptor binding domain (RBD) on its spike glycoprotein to human receptor dipeptidyl peptidase 4 (hDPP4). Here, we report identification of critical residues on hDPP4 for RBD binding and virus entry through analysis of a panel of hDPP4 mutants. Based on the RBD–hDPP4 crystal structure we reported, the mutated residues were located at the interface between RBD and hDPP4, which potentially changed the polarity, hydrophobic or hydrophilic properties of hDPP4, thereby interfering or disrupting their interaction with RBD. Using surface plasmon resonance (SPR) binding analysis and pseudovirus infection assay,more » we showed that several residues in hDPP4–RBD binding interface were important on hDPP4–RBD binding and viral entry. These results provide atomic insights into the features of interactions between hDPP4 and MERS-CoV RBD, and also provide potential explanation for cellular and species tropism of MERS-CoV infection. - Highlights: • It has been demonstrated that MERS-CoV infects host cells through binding its envelope spike (S) glycoprotein to the host cellular receptor dipeptidyl peptidase 4 (DPP4). • To identify the critical residues on hDPP4 for RBD binding and virus entry, we constructed a panel of hDPP4 mutants based on structure-guided mutagenesis. • Using surface plasmon resonance (SPR) binding analysis and pseudovirus infection assay, we showed that several residues on hDPP4 had significant impacts on virus/receptor interactions and viral entry. • Our study has provided new insights into the features of interactions between hDPP4 and MERS-CoV RBD, and provides potential explanation for cellular and species tropism of MERS-CoV infection.« less

ConA-based glucose sensing using the long-lifetime azadioxatriangulenium fluorophore

NASA Astrophysics Data System (ADS)

Cummins, Brian; Simpson, Jonathan; Gryczynski, Zygmunt; Sørensen, Thomas Just; Laursen, Bo W.; Graham, Duncan; Birch, David; Coté, Gerard

2014-02-01

Fluorescent glucose sensing technologies have been identified as possible alternatives to current continuous glucose monitoring approaches. We have recently introduced a new, smart fluorescent ligand to overcome the traditional problems of ConA-based glucose sensors. For this assay to be translated into a continuous glucose monitoring device where both components are free in solution, the molecular weight of the smart fluorescent ligand must be increased. We have identified ovalbumin as a naturally-occurring glycoprotein that could serve as the core-component of a 2nd generation smart fluorescent ligand. It has a single asparagine residue that is capable of displaying an N-linked glycan and a similar isoelectric point to ConA. Thus, binding between ConA and ovalbumin can potentially be monovalent and sugar specific. This work is the preliminary implementation of fluorescently-labeled ovalbumin in the ConA-based assay. We conjugate the red-emitting, long-lifetime azadioxatriangulenium (ADOTA+) dye to ovalbumin, as ADOTA have many advantageous properties to track the equilibrium binding of the assay. The ADOTA-labeled ovalbumin is paired with Alexa Fluor 647-labeled ConA to create a Förster Resonance Energy Transfer (FRET) assay that is glucose dependent. The assay responds across the physiologically relevant glucose range (0-500 mg/dL) with increasing intensity from the ADOTA-ovalbumin, showing that the strategy may allow for the translation of the smart fluorescent ligand concept into a continuous glucose monitoring device.

Functional diagnostics for thyrotropin hormone receptor autoantibodies: bioassays prevail over binding assays.

PubMed

Lytton, Simon David; Schluter, Anke; Banga, Paul J

2018-06-01

Autoantibodies to the thyrotropin hormone receptor (TSH-R) are directly responsible for the hyperthyroidism in Graves' disease and mediate orbital manifestations in Graves' orbitopathy (otherwise known as thyroid eye disease). These autoantibodies are heterogeneous in their function and collectively referred to as TRAbs. Measurement of TRAbs is clinically important for diagnosis of a variety of conditions and different commercial assays with high sensitivity and specificity are available for diagnostic purposes. This review provides overwhelming evidence that the TRAbs detected in binding assays by mainly the automated electrochemical luminescence immunoassays (ECLIA) do not distinguish TRAbs that stimulate the TSH-R (called TSIs or TSAbs) and TRAbs that just inhibit the binding of TSH without stimulating the TSH-R (called TBAbs). However, TSAbs and TBAbs have divergent pathogenic roles, and depending which fraction predominates cause different clinical symptoms and engender different therapeutic regimen. Therefore, diagnostic distinction of TSAbs and TBAbs is of paramount clinical importance. To date, only bioassays such as the Mc4 TSH-R bioassay (Thyretain TM , Quidel) and the Bridge assay (Immulite 2000, Siemens) can measure TSAbs, with only the former being able to distinguish between TSAbs and TBAbs. On this note, it is strongly recommended to only use the term TSI or TSAb when reporting the results of bioassays, whereas the results of automated TRAb binding assays should be reported as TRAbs (of undetermined functional significance). This review aims to present a technical and analytical account of leading commercial diagnostic methods of anti-TSH-R antibodies, a metaanalysis of their clinical performance and a perspective for the use of cell based TSH-R bioassays in the clinical diagnostics of Graves' disease.

Generation of cell lines for drug discovery through random activation of gene expression: application to the human histamine H3 receptor.

PubMed

Song, J; Doucette, C; Hanniford, D; Hunady, K; Wang, N; Sherf, B; Harrington, J J; Brunden, K R; Stricker-Krongrad, A

2005-06-01

Target-based high-throughput screening (HTS) plays an integral role in drug discovery. The implementation of HTS assays generally requires high expression levels of the target protein, and this is typically accomplished using recombinant cDNA methodologies. However, the isolated gene sequences to many drug targets have intellectual property claims that restrict the ability to implement drug discovery programs. The present study describes the pharmacological characterization of the human histamine H3 receptor that was expressed using random activation of gene expression (RAGE), a technology that over-expresses proteins by up-regulating endogenous genes rather than introducing cDNA expression vectors into the cell. Saturation binding analysis using [125I]iodoproxyfan and RAGE-H3 membranes revealed a single class of binding sites with a K(D) value of 0.77 nM and a B(max) equal to 756 fmol/mg of protein. Competition binding studies showed that the rank order of potency for H3 agonists was N(alpha)-methylhistamine approximately (R)-alpha- methylhistamine > histamine and that the rank order of potency for H3 antagonists was clobenpropit > iodophenpropit > thioperamide. The same rank order of potency for H3 agonists and antagonists was observed in the functional assays as in the binding assays. The Fluorometic Imaging Plate Reader assays in RAGE-H3 cells gave high Z' values for agonist and antagonist screening, respectively. These results reveal that the human H3 receptor expressed with the RAGE technology is pharmacologically comparable to that expressed through recombinant methods. Moreover, the level of expression of the H3 receptor in the RAGE-H3 cells is suitable for HTS and secondary assays.

Glucocorticoid receptor ligand binding in monocytic cells using a microplate assay.

PubMed

Jansen, J; Uitdehaag, B; Koper, J W; van Den Berg, T K

1999-01-01

Glucocorticoids have profound effects on macrophage function and are widely used as anti-inflammatory drugs. Glucocorticoids receptor (GR) ligand binding capacity is a major determinant of cellular glucocorticoid sensitivity. The number and affinity of GR can be measured in a whole cell binding assay using (3)H-dexamethasone. Here, we describe a rapid and simple microplate assay for GR measurement using the human promonocytic cell line THP-1. Copyright 2000 S. Karger AG, Basel.

miR-128 modulates chemosensitivity and invasion of prostate cancer cells through targeting ZEB1.

PubMed

Sun, Xianglun; Li, Youkong; Yu, Jie; Pei, Hong; Luo, Pengcheng; Zhang, Jie

2015-05-01

Recent reports strongly suggest the profound role of miRNAs in cancer therapeutic response and progression, including invasion and metastasis. The sensitivity to therapy and invasion is the major obstacle for successful treatment in prostate cancer. We aimed to investigate the regulative effect of miR-128/zinc-finger E-box-binding homeobox 1 axis on prostate cancer cell chemosensitivity and invasion. The miR-128 expression pattern of prostate cancer cell lines and tissues was detected by real-time reverse transcriptase-polymerase chain reaction, while the mRNA and protein expression levels of zinc-finger E-box-binding homeobox 1 were measured by real-time reverse transcriptase-polymerase chain reaction and western blot assay, respectively. Dual-luciferase reporter gene assay was used to find the direct target of miR-128. Furthermore, prostate cancer cells were treated with miR-128 mimic or zinc-finger E-box-binding homeobox 1-siRNA, and then the cells' chemosensitivity and invasion were detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and transwell assay, respectively. We found miR-128 expression obviously decreased in prostate cancer tissues compared with paired normal tissues. Restored miR-128 expression sensitized prostate cancer cells to cisplatin and inhibited the invasion. Furthermore, there was an inverse expression pattern between miR-128 and zinc-finger E-box-binding homeobox 1 in prostate cancer cells and tissues, and zinc-finger E-box-binding homeobox 1 was identified as a direct target of miR-128 in prostate cancer. Knockdown of zinc-finger E-box-binding homeobox 1 expression efficiently sensitized prostate cancer cells to cisplatin and inhibited the invasion. However, ectopic zinc-finger E-box-binding homeobox 1 expression impaired the effects of miR-128 on chemosensitivity and invasion in prostate cancer cells. miR-128 functions as a potential cancer suppressor in prostate cancer progression and rational therapeutic strategies for prostate cancer would be developed based on miR-128/zinc-finger E-box-binding homeobox 1 axis. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Thermometric enzyme linked immunosorbent assay: TELISA.

PubMed

Mattiasson, B; Borrebaeck, C; Sanfridson, B; Mosbach, K

1977-08-11

A new method, thermometric enzyme linked immunosorbent assay (TELISA), for the assay of endogenous and exogenous compounds in biological fluids is described. It is based on the previously described enzyme linked immunosorbent assay technique, ELISA, but utilizes enzymic heat formation which is measured in an enzyme thermistor unit. In the model system studied determination of human serum albumin down to a concentration of 10(-10) M (5 ng/ml) was achieved, with both normal and catalase labelled human serum albumin competing for the binding sites on the immunosorbent, which was rabbit antihuman serum albumin immobilized onto Sepharose CL-4B.

Avoiding false positives and optimizing identification of true negatives in estrogen receptor binding and agonist/antagonist assays

EPA Science Inventory

The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented fr...

Integrated Summary Report: Validation of Two Binding Assays Using Human Recombinant Estrogen Receptor Alpha (hrERa)

EPA Science Inventory

This Integrated Summary Report (ISR) summarizes, in a single document, the results from an international multi-laboratory validation study conducted for two in vitro estrogen receptor (ER) binding assays. These assays both use human recombinant estrogen receptor, alpha subtype (h...

Bead-based microfluidic immunoassay for diagnosis of Johne's disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wadhwa, Ashutosh; Foote, Robert; Shaw, Robert W

2012-01-01

Microfluidics technology offers a platform for development of point-of-care diagnostic devices for various infectious diseases. In this study, we examined whether serodiagnosis of Johne s disease (JD) can be conducted in a bead-based microfluidic assay system. Magnetic micro-beads were coated with antigens of the causative agent of JD, Mycobacterium avium subsp. paratuberculosis. The antigen-coated beads were incubated with serum samples of JD-positive or negative serum samples and then with a fluorescently-labeled secondary antibody (SAB). To confirm binding of serum antibodies to the antigen, the beads were subjected to flow cytometric analysis. Different conditions (dilutions of serum and SAB, types ofmore » SAB, and types of magnetic beads) were optimized for a great degree of differentiation between the JD-negative and JD-positive samples. Using the optimized conditions, we tested a well-classified set of 155 serum samples from JD negative and JD-positive cattle by using the bead-based flow cytometric assay. Of 105 JD-positive samples, 63 samples (60%) showed higher antibody binding levels than a cut-off value determined by using antibody binding levels of JD-negative samples. In contrast, only 43-49 JD-positive samples showed higher antibody binding levels than the cut-off value when the samples were tested by commercially-available immunoassays. Microfluidic assays were performed by magnetically immobilizing a number of beads within a microchannel of a glass microchip and detecting antibody on the collected beads by laser-induced fluorescence. Antigen-coated magnetic beads treated with bovine serum sample and fluorescently-labeled SAB were loaded into a microchannel to measure the fluorescence (reflecting level of antibody binding) on the beads in the microfluidic system. When the results of five bovine serum samples obtained with the system were compared to those obtained with the flow cytometer, a high level of correlation (linear regression, r2 = 0.994) was observed. In a further experiment, we magnetically immobilized antigen-coated beads in a microchannel, reacted the beads with serum and SAB in the channel, and detected antibody binding to the beads in the microfluidic system. A strong antibody binding in JD-positive serum was detected, whereas there was only negligible binding in negative control experiments. Our data suggest that the bead-based microfluidic system may form a basis for development of an on-site serodiagnosis of JD. Key Words: Mycobacterium avium ssp. paratuberculosis, Johne s disease, microfluidics, lab-on-a-chip.« less

Dopaminergic receptor-ligand binding assays based on molecularly imprinted polymers on quartz crystal microbalance sensors.

PubMed

Naklua, Wanpen; Suedee, Roongnapa; Lieberzeit, Peter A

2016-07-15

Molecularly imprinted polymers (MIPs) have been successfully applied as selective materials for assessing the binding activity of agonist and antagonist of dopamine D1 receptor (D1R) by using quartz crystal microbalance (QCM). In this study, D1R derived from rat hypothalamus was used as a template and thus self-organized on stamps. Those were pressed into an oligomer film consisting of acrylic acid: N-vinylpyrrolidone: N,N'-(1,2-dihydroxyethylene) bis-acrylamide in a ratio of 2:3:12 spin coated onto a dual electrode QCM. Such we obtained one D1R-MIP-QCM electrode, whereas the other electrode carried the non-imprinted control polymer (NIP) that had remained untreated. Successful imprinting of D1R was confirmed by AFM. The polymer can re-incorporate D1R leading to frequency responses of 100-1200Hz in a concentration range of 5.9-47.2µM. In a further step such frequency changes proved inherently useful for examining the binding properties of test ligands to D1R. The resulting mass-sensitive measurements revealed Kd of dopamine∙HCl, haloperidol, and (+)-SCH23390 at 0.874, 25.6, and 0.004nM, respectively. These results correlate well with the values determined in radio ligand binding assays. Our experiments revealed that D1R-MIP sensors are useful for estimating the strength of ligand binding to the active single site. Therefore, we have developed a biomimetic surface imprinting strategy for QCM studies of D1R-ligand binding and presented a new method to ligand binding assay for D1R. Copyright © 2016 Elsevier B.V. All rights reserved.

Fluorescence Polarization Screening Assays for Small Molecule Allosteric Modulators of ABL Kinase Function

PubMed Central

Grover, Prerna; Shi, Haibin; Baumgartner, Matthew; Camacho, Carlos J.; Smithgall, Thomas E.

2015-01-01

The ABL protein-tyrosine kinase regulates intracellular signaling pathways controlling diverse cellular processes and contributes to several forms of cancer. The kinase activity of ABL is repressed by intramolecular interactions involving its regulatory Ncap, SH3 and SH2 domains. Small molecules that allosterically regulate ABL kinase activity through its non-catalytic domains may represent selective probes of ABL function. Here we report a screening assay for chemical modulators of ABL kinase activity that target the regulatory interaction of the SH3 domain with the SH2-kinase linker. This fluorescence polarization (FP) assay is based on a purified recombinant ABL protein consisting of the N-cap, SH3 and SH2 domains plus the SH2-kinase linker (N32L protein) and a short fluorescein-labeled probe peptide that binds to the SH3 domain. In assay development experiments, we found that the probe peptide binds to the recombinant ABL N32L protein in vitro, producing a robust FP signal that can be competed with an excess of unlabeled peptide. The FP signal is not observed with control N32L proteins bearing either an inactivating mutation in the SH3 domain or enhanced SH3:linker interaction. A pilot screen of 1200 FDA-approved drugs identified four compounds that specifically reduced the FP signal by at least three standard deviations from the untreated controls. Secondary assays showed that one of these hit compounds, the antithrombotic drug dipyridamole, enhances ABL kinase activity in vitro to a greater extent than the previously described ABL agonist, DPH. Docking studies predicted that this compound binds to a pocket formed at the interface of the SH3 domain and the linker, suggesting that it activates ABL by disrupting this regulatory interaction. These results show that screening assays based on the non-catalytic domains of ABL can identify allosteric small molecule regulators of kinase function, providing a new approach to selective drug discovery for this important kinase system. PMID:26222440

Fluorescence Polarization Screening Assays for Small Molecule Allosteric Modulators of ABL Kinase Function.

PubMed

Grover, Prerna; Shi, Haibin; Baumgartner, Matthew; Camacho, Carlos J; Smithgall, Thomas E

2015-01-01

The ABL protein-tyrosine kinase regulates intracellular signaling pathways controlling diverse cellular processes and contributes to several forms of cancer. The kinase activity of ABL is repressed by intramolecular interactions involving its regulatory Ncap, SH3 and SH2 domains. Small molecules that allosterically regulate ABL kinase activity through its non-catalytic domains may represent selective probes of ABL function. Here we report a screening assay for chemical modulators of ABL kinase activity that target the regulatory interaction of the SH3 domain with the SH2-kinase linker. This fluorescence polarization (FP) assay is based on a purified recombinant ABL protein consisting of the N-cap, SH3 and SH2 domains plus the SH2-kinase linker (N32L protein) and a short fluorescein-labeled probe peptide that binds to the SH3 domain. In assay development experiments, we found that the probe peptide binds to the recombinant ABL N32L protein in vitro, producing a robust FP signal that can be competed with an excess of unlabeled peptide. The FP signal is not observed with control N32L proteins bearing either an inactivating mutation in the SH3 domain or enhanced SH3:linker interaction. A pilot screen of 1200 FDA-approved drugs identified four compounds that specifically reduced the FP signal by at least three standard deviations from the untreated controls. Secondary assays showed that one of these hit compounds, the antithrombotic drug dipyridamole, enhances ABL kinase activity in vitro to a greater extent than the previously described ABL agonist, DPH. Docking studies predicted that this compound binds to a pocket formed at the interface of the SH3 domain and the linker, suggesting that it activates ABL by disrupting this regulatory interaction. These results show that screening assays based on the non-catalytic domains of ABL can identify allosteric small molecule regulators of kinase function, providing a new approach to selective drug discovery for this important kinase system.

Development of an assay for a biomarker of pregnancy and early fetal loss

DOE Office of Scientific and Technical Information (OSTI.GOV)

Canfield, R.E.; O'Connor, J.F.; Birken, S.

1987-10-01

Human chorionic gonadotropin (hCG) is a glycoprotein hormone, secreted by the syncytiotrophoblast cells of the fertilized ovum, that enters the maternal circulation at the time of endometrial implantation. It is composed of two nonidentical subunits; ..cap alpha.. and ..beta.., with molecular weights of 14 kD and 23 kD, respectively. Human chorionic gonadotropin binds to the same receptor as hLH and displays the same biological response, namely, to stimulate the declining function of the corpus luteum to produce progestins and estrogen late in the menstrual cycle. The differences in the structures of hCG and hLH have been exploited to develop antibodiesmore » that can measure hCG specifically in the presence of hLH. Two-site antibody binding assays have been developed, based on a surface immunological concept of hCG epitopes, that involve four distinct regions to which antibodies against hCG can bind simultaneously. Antibody cooperative effects, in conjunction with kinetic advantages derived from the concentration factors by use of the sandwich assay technique (immunoradiometric assay, IRMA), have enabled development of extremely sensitive and specific measurement protocols for urinary hCG. The assay described herein permits the detection of pregnancy on an average 25.4 days after the first day of the preceding menses, as opposed to 29.5 days for conventional radioimmunoassay techniques. In addition, the greater sensitivity and specificity of this assay method has permitted the detection of episodes of fetal loss not detected by radioimmunoassay of urine specimens. A large scale epidemiological study is in progress using this assay technique as a way to identify pregnancies that are lost before becoming clinically apparent.« less

Automated On-tip Affinity Capture Coupled with Mass Spectrometry to Characterize Intact Antibody-Drug Conjugates from Blood

NASA Astrophysics Data System (ADS)

Li, Ke Sherry; Chu, Phillip Y.; Fourie-O'Donohue, Aimee; Srikumar, Neha; Kozak, Katherine R.; Liu, Yichin; Tran, John C.

2018-05-01

Antibody-drug conjugates (ADCs) present unique challenges for ligand-binding assays primarily due to the dynamic changes of the drug-to-antibody ratio (DAR) distribution in vivo and in vitro. Here, an automated on-tip affinity capture platform with subsequent mass spectrometry analysis was developed to accurately characterize the DAR distribution of ADCs from biological matrices. A variety of elution buffers were tested to offer optimal recovery, with trastuzumab serving as a surrogate to the ADCs. High assay repeatability (CV 3%) was achieved for trastuzumab antibody when captured below the maximal binding capacity of 7.5 μg. Efficient on-tip deglycosylation was also demonstrated in 1 h followed by affinity capture. Moreover, this tip-based platform affords higher throughput for DAR characterization when compared with a well-characterized bead-based method.

SDS-binding assay based on tyrosine fluorescence as a tool to determine binding properties of human serum albumin in blood plasma

NASA Astrophysics Data System (ADS)

Zhdanova, Nadezda; Shirshin, Evgeny; Fadeev, Victor; Priezzhev, Alexander

2016-04-01

Among all plasma proteins human serum albumin (HSA) is the most studied one as it is the main transport protein and can bind a wide variety of ligands especially fatty acids (FAs). The concentration of FAs bound to HSA in human blood plasma differs by three times under abnormal conditions (fasting, physical exercises or in case of social important diseases). In the present study a surfactant sodium dodecyl sulfate (SDS) was used to simulate FAs binding to HSA. It was shown that the increase of Tyr fluorescence of human blood plasma due to SDS addition can be completely explained by HSA-SDS complex formation. Binding parameters of SDS-HSA complex (average number of sites and apparent constant of complex formation) were determined from titration curves based on tyrosine (Tyr) fluorescence.

Evaluation of flow cytometric HIT assays in relation to an IgG-Specific immunoassay and clinical outcome.

PubMed

Kerényi, Adrienne; Beke Debreceni, Ildikó; Oláh, Zsolt; Ilonczai, Péter; Bereczky, Zsuzsanna; Nagy, Béla; Muszbek, László; Kappelmayer, János

2017-09-01

Heparin-induced thrombocytopenia (HIT) is a severe side effect of heparin treatment caused by platelet activating IgG antibodies generated against the platelet factor 4 (PF4)-heparin complex. Thrombocytopenia and thrombosis are the leading clinical symptoms of HIT. The clinical pretest probability of HIT was evaluated by the 4T score system. Laboratory testing of HIT was performed by immunological detection of antibodies against PF4-heparin complex (EIA) and two functional assays. Heparin-dependent activation of donor platelets by patient plasma was detected by flow cytometry. Increased binding of Annexin-V to platelets and elevated number of platelet-derived microparticles (PMP) were the indicators of platelet activation. EIA for IgG isotype HIT antibodies was performed in 405 suspected HIT patients. Based on negative EIA results, HIT was excluded in 365 (90%) of cases. In 40 patients with positive EIA test result functional tests were performed. Platelet activating antibodies were detected in 17 cases by Annexin V binding. PMP count analysis provided nearly identical results. The probability of a positive flow cytometric assay result was higher in patients with elevated antibody titer. 71% of patients with positive EIA and functional assay had thrombosis. EIA is an important first line laboratory test in the diagnosis of HIT; however, HIT must be confirmed by a functional test. Annexin V binding and PMP assays using flow cytometry are functional HIT tests convenient in a clinical diagnostic laboratory. The positive results of functional assays may predict the onset of thrombosis. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.

Two complementary fluorimetric assays for the determination of aminoquinoline binding and uptake by human erythrocytes in vitro.

PubMed

Basilico, Nicoletta; Cortelezzi, Lucia; Serpellini, Chiara; Taramelli, Donatella; Omodeo-Salè, Fausta; Salè, Fausta

2009-02-15

We provide two simple low-cost and low-tech procedures to measure with good precision and accuracy the binding and internalization into human erythrocytes of chloroquine and other aminoquinolines. The methods are based on the high fluorescence of the quinoline ring and are complementary. Method A evaluates residual drugs in the supernatants of treated erythrocytes, whereas method B quantifies the total uptake by whole cells and the fraction bound to the membranes. Drug uptake is dose dependent and related to the number of erythrocytes. These assays could be useful when studying the cell interaction of quinoline-type compounds not available in the radioactive form.

Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.

PubMed

Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T

2018-06-01

To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.

High affinity γPNA sandwich hybridization assay for rapid detection of short nucleic acid targets with single mismatch discrimination.

PubMed

Goldman, Johnathan M; Zhang, Li Ang; Manna, Arunava; Armitage, Bruce A; Ly, Danith H; Schneider, James W

2013-07-08

Hybridization analysis of short DNA and RNA targets presents many challenges for detection. The commonly employed sandwich hybridization approach cannot be implemented for these short targets due to insufficient probe-target binding strengths for unmodified DNA probes. Here, we present a method capable of rapid and stable sandwich hybridization detection for 22 nucleotide DNA and RNA targets. Stable hybridization is achieved using an n-alkylated, polyethylene glycol γ-carbon modified peptide nucleic acid (γPNA) amphiphile. The γPNA's exceptionally high affinity enables stable hybridization of a second DNA-based probe to the remaining bases of the short target. Upon hybridization of both probes, an electrophoretic mobility shift is measured via interaction of the n-alkane modification on the γPNA with capillary electrophoresis running buffer containing nonionic surfactant micelles. We find that sandwich hybridization of both probes is stable under multiple binding configurations and demonstrate single base mismatch discrimination. The binding strength of both probes is also stabilized via coaxial stacking on adjacent hybridization to targets. We conclude with a discussion on the implementation of the proposed sandwich hybridization assay as a high-throughput microRNA detection method.

Principles of quantitation of viral loads using nucleic acid sequence-based amplification in combination with homogeneous detection using molecular beacons.

PubMed

Weusten, Jos J A M; Carpay, Wim M; Oosterlaken, Tom A M; van Zuijlen, Martien C A; van de Wiel, Paul A

2002-03-15

For quantitative NASBA-based viral load assays using homogeneous detection with molecular beacons, such as the NucliSens EasyQ HIV-1 assay, a quantitation algorithm is required. During the amplification process there is a constant growth in the concentration of amplicons to which the beacon can bind while generating a fluorescence signal. The overall fluorescence curve contains kinetic information on both amplicon formation and beacon binding, but only the former is relevant for quantitation. In the current paper, mathematical modeling of the relevant processes is used to develop an equation describing the fluorescence curve as a function of the amplification time and the relevant kinetic parameters. This equation allows reconstruction of RNA formation, which is characterized by an exponential increase in concentrations as long as the primer concentrations are not rate limiting and by linear growth over time after the primer pool is depleted. During the linear growth phase, the actual quantitation is based on assessing the amplicon formation rate from the viral RNA relative to that from a fixed amount of calibrator RNA. The quantitation procedure has been successfully applied in the NucliSens EasyQ HIV-1 assay.

Combination of human acetylcholinesterase and serum albumin sensing surfaces as highly informative analytical tool for inhibitor screening.

PubMed

Fabini, Edoardo; Tramarin, Anna; Bartolini, Manuela

2018-06-05

In the continuous research for potential drug lead candidates, the availability of highly informative screening methodologies may constitute a decisive element in the selection of best-in-class compounds. In the present study, a surface plasmon resonance (SPR)-based assay was developed and employed to investigate interactions between human recombinant AChE (hAChE) and four known ligands: galantamine, tacrine, donepezil and edrophonium. To this aim, a sensor chip was functionalized with hAChE using mild immobilization conditions to best preserve enzyme integrity. Binding affinities and, for the first time, kinetic rate constants for all drug-hAChE complexes formation/disruption were determined. Inhibitors were classified in two groups: slow-reversible and fast-reversible binders according to respective target residence time. Combining data obtained on drug-target residence time with data obtained on serum albumin binding levels, a good correlation with potency, plasma protein binding in vivo, and administration regimen was found. The outcomes of this work demonstrated that the developed SPR-based assay is suitable for the screening, the binding affinity ranking and the kinetic evaluation of hAChE inhibitors. The method proposed ensures a simpler and cost-effective assay to quantify kinetic rate constants for inhibitor-hAChE interaction as compared with other proposed and published methods. Eventually, the determination of residence time in combination with preliminary ADME studies might constitute a better tool to predict in vivo behaviour, a key information for the research of new potential drug candidates. Copyright © 2018 Elsevier B.V. All rights reserved.

Identification of Litopenaeus vannamei BiP as a novel cellular attachment protein for white spot syndrome virus by using a biotinylation based affinity chromatography method.

PubMed

Yuan, Zengzhi; Chen, Meng; Wang, Jingting; Li, Zhuoyu; Geng, Xuyun; Sun, Jinsheng

2018-05-05

White spot syndrome virus (WSSV) is a dangerous threat to shrimp farming that also attacks a wide range of crustaceans. Knowledge of the surface protein-protein interactions between the pathogen and host is very crucial to unraveling the molecular pathogenesis mechanisms of WSSV. In this study, LvBiP (Litopenaeus vannamei immunoglobulin heavy-chain-binding protein) was identified as a novel WSSV binding protein of L. vannamei by a biotinylation based affinity chromatography method. By using pull-down and ELISA assays, the binding of recombinant LvBiP to WSSV was proved to be specific and ATP- dependent. The interaction was also confirmed by the result of co-immunoprecipitation assay. Immunofluorescence studies revealed the co-localization of LvBiP with WSSV on the cell surface of shrimp haemocytes. Additionally, LvBiP is likely to play an important role in WSSV infection. Treatment of gill cellular membrane proteins (CMPs) with purified rLvBiP and antibody that specifically recognizes LvBiP, led to a significant reduction in the binding of WSSV to gill CMPs. In the in vivo neutralization assay, rLvBiP and anti-LvBiP polyclonal antibody partially blocked the infection of WSSV. Taken together, the results indicate that LvBiP, a molecular chaperon of the HSP70 family, is a novel host factor involved at the step of attachment of the WSSV to the host cells and a potential candidate of therapeutic target. Copyright © 2018. Published by Elsevier Ltd.

Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

PubMed Central

Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

2008-01-01

We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

Simple and Sensitive Colorimetric Assay for Pb2+ Based on Glutathione Protected Ag Nanoparticles by Salt Amplification.

PubMed

Chen, Zhang; Li, Huidong; Chu, Lin; Liu, Chenbin; Luo, Shenglian

2015-02-01

A simple and sensitive colorimetric assay for Pb2+ detection has been reported using glutathione protected silver nanoparticles (AgNPs) by salt amplification. The naked AgNPs aggregate under the influence of salt. Glutathione (GSH) can bind to AgNPs via Ag-S bond, helping AgNPs to against salt-induced aggregation. However, GSH binding to AgNPs can be compromised by the interaction between Pb2+ and GSH. As a result, Pb2+-mediated aggregation of AgNPs under the influence of salt is reflected by the UV-Visible spectrum, and the qualitative and quantitative detection for Pb2+ is accomplished, with the detection range 0.5-4 µM and a detection limit of 0.5 µM. At the same time, Pb2+ in real water sample is detected. Furthermore, the high selectivity and low cost of the assay means it is promising for enviromental applications.

Glucose Sensors Based on Microcapsules Containing an Orange/Red Competitive Binding Resonance Energy Transfer Assay

PubMed Central

CHINNAYELKA, SWETHA; McSHANE, and MICHAEL J.

2015-01-01

Fluorescent sensing systems offer the potential for noninvasive monitoring with implantable devices, but they require carrier technologies that provide suitable immobilization, accessibility, and biocompatibility while maintaining adequate response characteristics. A recent development towards this goal is a highly specific and sensitive competitive binding assay for glucose using apo-glucose oxidase (apo-GOx) as the recognition element and dextran as the competing ligand; this has been demonstrated as a glucose sensor system by encapsulating the competitive binding assay in semipermeable microcapsule carriers. This paper describes the extension of this sensor design to longer wavelengths in an attempt to increase the applicability to in vivo monitoring. The glucose sensitivity of the tetramethylrhodamine isothiocyanate-dextran (TD) and cyanine Cy5-apo-GOx (CAG) complexes showed five to 10 times greater specificity for β-D-glucose over other sugars. Microcapsules loaded with TD/CAG complexes exhibited a linear, totally reversible response in the range of 0–720 mg/dL, with a sensitivity (percent change in intensity ratio) of 0.06%/(mg/dL). The decrease in sensitivity observed with the use of longer-wavelength dyes is most likely to be compensated with the deeper penetration of light and reduced tissue scattering. These findings imply that the encapsulation of sensing assay elements in microcapsules is a simple and translatable method for the fabrication of stable biosensors, and optimization of resonance energy transfer pairs and assay component preparation will further improve the response to approach clinically relevant performance. PMID:16800748

LC-MS/MS quantification of next-generation biotherapeutics: a case study for an IgE binding Nanobody in cynomolgus monkey plasma.

PubMed

Sandra, Koen; Mortier, Kjell; Jorge, Lucie; Perez, Luis C; Sandra, Pat; Priem, Sofie; Poelmans, Sofie; Bouche, Marie-Paule

2014-05-01

Nanobodies(®) are therapeutic proteins derived from the smallest functional fragments of heavy chain-only antibodies. The development and validation of an LC-MS/MS-based method for the quantification of an IgE binding Nanobody in cynomolgus monkey plasma is presented. Nanobody quantification was performed making use of a proteotypic tryptic peptide chromatographically enriched prior to LC-MS/MS analysis. The validated LLOQ at 36 ng/ml was measured with an intra- and inter-assay precision and accuracy <20%. The required sensitivity could be obtained based on the selectivity of 2D LC combined with MS/MS. No analyte specific tools for affinity purification were used. Plasma samples originating from a PK/PD study were analyzed and compared with the results obtained with a traditional ligand-binding assay. Excellent correlations between the two techniques were obtained, and similar PK parameters were estimated. A 2D LC-MS/MS method was successfully developed and validated for the quantification of a next generation biotherapeutic.

Linear scaffolds for multivalent targeting of melanocortin receptors.

PubMed

Dehigaspitiya, Dilani Chathurika; Anglin, Bobbi L; Smith, Kara R; Weber, Craig S; Lynch, Ronald M; Mash, Eugene A

2015-12-21

Molecules bearing one, two, three, or four copies of the tetrapeptide His-dPhe-Arg-Trp were attached to scaffolds based on ethylene glycol, glycerol, and d-mannitol by means of the copper-assisted azide-alkyne cyclization. The abilities of these compounds to block binding of a probe at the melanocortin 4 receptor were evaluated using a competitive binding assay. All of the multivalent molecules studied exhibited 30- to 40-fold higher apparent affinites when compared to a monovalent control. These results are consistent with divalent binding to receptor dimers. No evidence for tri- or tetravalent binding was obtained. Differences in the interligand spacing required for divalent binding, as opposed to tri- or tetravalent binding, may be responsible for these results.

Peptidic β-sheet binding with Congo Red allows both reduction of error variance and signal amplification for immunoassays.

PubMed

Wang, Yunyun; Liu, Ye; Deng, Xinli; Cong, Yulong; Jiang, Xingyu

2016-12-15

Although conventional enzyme-linked immunosorbent assays (ELISA) and related assays have been widely applied for the diagnosis of diseases, many of them suffer from large error variance for monitoring the concentration of targets over time, and insufficient limit of detection (LOD) for assaying dilute targets. We herein report a readout mode of ELISA based on the binding between peptidic β-sheet structure and Congo Red. The formation of peptidic β-sheet structure is triggered by alkaline phosphatase (ALP). For the detection of P-Selectin which is a crucial indicator for evaluating thrombus diseases in clinic, the 'β-sheet and Congo Red' mode significantly decreases both the error variance and the LOD (from 9.7ng/ml to 1.1 ng/ml) of detection, compared with commercial ELISA (an existing gold-standard method for detecting P-Selectin in clinic). Considering the wide range of ALP-based antibodies for immunoassays, such novel method could be applicable to the analysis of many types of targets. Copyright © 2016 Elsevier B.V. All rights reserved.

ELEGANT ENVIRONMENTAL IMMUNOASSAYS

EPA Science Inventory

Immunochemical methods are based on selective antibodies directed to a particular target analyte. The specific binding between antibody and analyte can be used for detection and quantitation. Methods such as the enzyme-linked immunosorbent assay (ELISA) can provide a sensitiv...

Highly variable sensitivity of five binding and two bio-assays for TSH-receptor antibodies.

PubMed

Diana, T; Wüster, C; Kanitz, M; Kahaly, G J

2016-10-01

TSH-receptor (TSHR) antibodies (Ab) can be measured with binding or bio-assays. Sensitivity and specificity of five binding and two bio-assays were compared. TSHR-blocking (TBAb) and TSHR-stimulating (TSAb) Ab were measured with reporter bio-assays. Blocking activity was defined as percent inhibition of luciferase expression relative to induction with bTSH alone. TSAb was reported as percentage of specimen-to-reference ratio (SRR%). TSHR-binding inhibitory immunoglobulins (TBII) were measured with Kronus, Dynex, Kryptor, Cobas, and Immulite. Sixty patients with Graves' disease (GD), 20 with Hashimoto's thyroiditis (HT), and 20 healthy controls (C) were included. C tested negative in all assays (specificity 100 %) while all 60 hyperthyroid GD patients tested positive in the TSAb bio-assay (sensitivity 100 %). Among these 60 GD patients, 20 had low TSAb positivity (SRR% 140-279), but were TBII positive in only 20 (100 %), 7 (35 %), 9 (45 %), 11 (55 %), and 18 (90 %) using the Kronus, Dynex, Kryptor, Cobas, and Immulite, respectively. In 20 moderate TSAb-positive (SRR% 280-420) patients, TBII tested positive in 20 (100 %), 14 (70 %), 13 (65 %), 16 (80 %), and 19 (95 %), respectively. The high (SRR% > 420) TSAb-positive patients were all TBII positive. All 20 hypothyroid HT patients tested TBAb positive (sensitivity 100 %) in the bio-assay while they tested TBII positive in 20 (100 %), 18 (90 %), 20, 20, and 18, respectively. Results obtained with two luminometers correlated for TSAb positive (r = 0.99, p < 0.001), TBAb positive (r = 0.88, p < 0.001), and C (r = 0.86, p < 0.001). None of the binding assays differentiated between TSAb and TBAb. Sensitivity is highly variable between binding and bio-assays for TSHR-Abs.

Riboswitch-based sensor in low optical background

NASA Astrophysics Data System (ADS)

Harbaugh, Svetlana V.; Davidson, Molly E.; Chushak, Yaroslav G.; Kelley-Loughnane, Nancy; Stone, Morley O.

2008-08-01

Riboswitches are a type of natural genetic control element that use untranslated sequence in the RNA to recognize and bind to small molecules that regulate expression of that gene. Creation of synthetic riboswitches to novel ligands depends on the ability to screen for analyte binding sensitivity and specificity. In our work, we have coupled a synthetic riboswitch to an optical reporter assay based on fluorescence resonance energy transfer (FRET) between two genetically-coded fluorescent proteins. Specifically, a theophylline-sensitive riboswitch was placed upstream of the Tobacco Etch Virus (TEV) protease coding sequence, and a FRET-based construct, BFP-eGFP or eGFP-REACh, was linked by a peptide encoding the recognition sequence for TEV protease. Cells expressing the riboswitch showed a marked optical difference in fluorescence emission in the presence of theophylline. However, the BFP-eGFP FRET pair posses significant optical background that reduces the sensitivity of a FRET-based assay. To improve the optical assay, we designed a nonfluorescent yellow fluorescent protein (YFP) mutant called REACh (for Resonance Energy-Accepting Chromoprotein) as the FRET acceptor for eGFP. The advantage of using an eGFP-REACh pair is the elimination of acceptor fluorescence which leads to an improved detection of FRET via better signal-to-noise ratio. The EGFP-REACh fusion protein was constructed with the TEV protease cleavage site; thus upon TEV translation, cleavage occurs diminishing REACh quenching and increasing eGFP emission resulting in a 4.5-fold improvement in assay sensitivity.

Noncompetitive blocking of human GLUT1 hexose transporter by methylxanthines reveals an exofacial regulatory binding site.

PubMed

Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M

2012-09-01

Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.

Identification of C3b-Binding Small-Molecule Complement Inhibitors Using Cheminformatics.

PubMed

Garcia, Brandon L; Skaff, D Andrew; Chatterjee, Arindam; Hanning, Anders; Walker, John K; Wyckoff, Gerald J; Geisbrecht, Brian V

2017-05-01

The complement system is an elegantly regulated biochemical cascade formed by the collective molecular recognition properties and proteolytic activities of more than two dozen membrane-bound or serum proteins. Complement plays diverse roles in human physiology, such as acting as a sentry against invading microorganisms, priming of the adaptive immune response, and removal of immune complexes. However, dysregulation of complement can serve as a trigger for a wide range of human diseases, which include autoimmune, inflammatory, and degenerative conditions. Despite several potential advantages of modulating complement with small-molecule inhibitors, small-molecule drugs are highly underrepresented in the current complement-directed therapeutics pipeline. In this study, we have employed a cheminformatics drug discovery approach based on the extensive structural and functional knowledge available for the central proteolytic fragment of the cascade, C3b. Using parallel in silico screening methodologies, we identified 45 small molecules that putatively bind C3b near ligand-guided functional hot spots. Surface plasmon resonance experiments resulted in the validation of seven dose-dependent C3b-binding compounds. Competition-based biochemical assays demonstrated the ability of several C3b-binding compounds to interfere with binding of the original C3b ligand that guided their discovery. In vitro assays of complement function identified a single complement inhibitory compound, termed cmp-5, and mechanistic studies of the cmp-5 inhibitory mode revealed it acts at the level of C5 activation. This study has led to the identification of a promising new class of C3b-binding small-molecule complement inhibitors and, to our knowledge, provides the first demonstration of cheminformatics-based, complement-directed drug discovery. Copyright © 2017 by The American Association of Immunologists, Inc.

Identification of C3b-binding Small Molecule Complement Inhibitors Using Cheminformatics

PubMed Central

Garcia, Brandon L.; Skaff, D. Andrew; Chatterjee, Arindam; Hanning, Anders; Walker, John K.; Wyckoff, Gerald J.; Geisbrecht, Brian V.

2017-01-01

The complement system is an elegantly regulated biochemical cascade formed by the collective molecular recognition properties and proteolytic activities of over two dozen membrane-bound or serum proteins. Complement plays diverse roles in human physiology which include acting as a sentry against invading microorganisms, priming of the adaptive immune response, and removal of immune complexes. However, dysregulation of complement can serve as a trigger for a wide range of human diseases which include autoimmune, inflammatory, and degenerative conditions. Despite several potential advantages of modulating complement with small molecule inhibitors, small molecule drugs are highly underrepresented in the current complement-directed therapeutics pipeline. In this study we have employed a cheminformatics drug discovery approach based on the extensive structural and functional knowledge available for the central proteolytic fragment of the cascade, C3b. Using parallel in silico screening methodologies we identified 45 small molecules which putatively bind C3b near ligand-guided functional hot-spots. Surface plasmon resonance experiments resulted in the validation of seven dose-dependent C3b-binding compounds. Competition-based biochemical assays demonstrated the ability of several C3b-binding compounds to interfere with binding of the original C3b ligand which guided their discovery. In vitro assays of complement function identified a single complement inhibitory compound, termed cmp-5, and mechanistic studies of the cmp-5 inhibitory mode revealed it acts at the level of C5 activation. This study has led to the identification of a promising new class of C3b-binding small molecule complement inhibitors, and to our knowledge, provides the first demonstration of cheminformatics-based complement-directed drug discovery. PMID:28298523

Miniaturization of a homogeneous fluorescence immunoassay based on energy transfer using nanotiter plates as high-density sample carriers.

PubMed

Schobel, U; Coille, I; Brecht, A; Steinwand, G M; Gauglitz, G

2001-11-01

The miniaturization of a homogeneous competitive immunoassay to a final assay volume of 70 nL is described. As the sample carrier, disposable plastic nanotiter plates (NTP) with dimensions of 2 x 2 cm2 containing 25 x 25 wells, corresponding to approximately 15,000 wells on a traditional 96-well microtiter plate footprint, were used. Sample handling was accomplished by a piezoelectrically actuated micropipet. To reduce evaporation while pipetting the assays, the NTP was handled in a closed humid chamber and cooled to the point of condensation. To avoid washing steps, a homogeneous assay was developed that was based on energy-transfer (ET). As a model system, an antibody-based assay for the detection of the environmentally relevant compound, simazine, in drinking water was chosen. Antibodies were labeled with the long-wavelength-excitable sulfoindocyanine dye Cy5 (donor), and a tracer was synthesized by labeling BSA with a triazine derivative and the acceptor dye Cy5.5. At low analyte concentrations, the tracer was preferably bound to the antibody binding sites. As a result of the close proximity of Cy5.5 and Cy5, an efficient quenching of the Cy5 fluorescence occurred. Higher analyte concentrations led to a progressive binding of the analyte to the antibody binding sites. The increased Cy5 fluorescence was determined by using a scanning laser-induced fluorescence detector. The limit of detection (LOD), using an antibody concentration of 20 nM, was 0.32 microg/L, or 1.11 x 10(-16) mol of simazine. In comparison, the LOD of the 96-well microtiter-plate-based ET immunoassay (micro-ETIA) was 0.15 microg/L, or 1.87 x 10(-13) mol. The LOD of the optimized micro-ETIA at 1 nM IgG, was 0.01 microg/L.

Specificity of the weak binding between the phage SPO1 transcription-inhibitory protein, TF1, and SPO1 DNA.

PubMed

Johnson, G G; Geiduschek, E P

1977-04-05

The interaction of the phage SPO1 protein transcription factor 1 (TF1), with DNA has been analyzed by membrane filter binding and by sedimentation methods. Substantially specific binding of TF1 to helical SPO1 DNA can be demonstrated by nitrocellulose filter-binding assays at relatively low ionic strength (0.08). However, TF1-DNA complexes dissociate and reequilibrate relatively rapidly and this makes filter-binding assays unsuitable for quantitative measurements of binding equilibra. Accordingly, the sedimentation properties of TF1-DNA complexes have been explored and a short-column centrifugation assay has been elaborated for quantitative measurements. Preferential binding of TF1 to the hydroxymethyluracil-containing SPO1 DNA has also been demonstrated by short-column centrifugation. TF1 binds relatively weakly and somewhat cooperatively to SPO1 DNA at many sites; TF1-DNA complexes dissociate and reequilibrate rapidly. At 20 degrees C in 0.01 M phosphate, pH 7.5, 0.15 KC1, one molecule of TF1 can bind to approximately every 60 nucleotide pairs of SPO1 DNA.

Development of a β-Lactoglobulin Sensor Based on SPR for Milk Allergens Detection.

PubMed

Ashley, Jon; D'Aurelio, Roberta; Piekarska, Monika; Temblay, Jeff; Pleasants, Mike; Trinh, Linda; Rodgers, Thomas L; Tothill, Ibtisam E

2018-03-27

A sensitive and label-free surface plasmon resonance (SPR) based sensor was developed in this work for the detection of milk allergens. β-lactoglobulin (BLG) protein was used as the biomarker for cow milk detection. This is to be used directly in final rinse samples of cleaning in-place (CIP) systems of food manufacturers. The affinity assay was optimised and characterised before a standard curve was performed in pure buffer conditions, giving a detection limit of 0.164 µg mL -1 as a direct binding assay. The detection limit can be further enhanced through the use of a sandwich assay and amplification with nanomaterials. However, this was not required here, as the detection limit achieved exceeded the required allergen detection levels of 2 µg mL -1 for β-lactoglobulin. The binding affinities of the polyclonal antibody for BLG, expressed by the dissociation constant (K D ), were equal to 2.59 × 10 -9 M. The developed SPR-based sensor offers several advantages in terms of label-free detection, real-time measurements, potential on-line system and superior sensitivity when compared to ELISA-based techniques. The method is novel for this application and could be applied to wider food allergen risk management decision(s) in food manufacturing.

Sensitive albuminuria analysis using dye-binding based test strips.

PubMed

Delanghe, Joris R; Himpe, Jonas; De Cock, Naomi; Delanghe, Sigurd; De Herde, Kevin; Stove, Veronique; Speeckaert, Marijn M

2017-08-01

Populations at increased risk for chronic kidney disease should be screened for albuminuria. Possibilities of advanced urine strip readers based on complementary metal oxide semiconductor (CMOS) sensor technology were investigated for obtaining quantitative albuminuria results. Reflectance data of test strips (Sysmex UFC 3500 reader+CMOS) were compared with albuminuria (BNII) and with proteinuria (Cobas 8000). Urinary creatinine was assayed using a Jaffe-based creatinine assay (Cobas 8000). Calibration curve was made between 11.5 and 121.5mg/L with detection limit of 5.5mg/L. Within-run CV values of reflectance data were 0.21% (UC-Control L; 10mg/L) and 0.37% (UC-Control H; >150mg/L) for albumin, and 0.71%/3.97% for creatinine. Between-run CV values were 0.24%/0.42% for albumin and 0.93%/5.13% for creatinine. A strong correlation (r=0.92) was obtained between albuminuria (BNII) and protein strip reflectance data. Creatinine reflectance data correlated well with Jaffe-based urinary creatinine data (r=0.90). Albumin:creatinine ratio obtained by test strip and by wet chemistry showed a good correlation (r=0.59). Carbamylated, glycated and partially hydrolyzed isoforms of albumin could be detected by test strip. Dye-binding based albumin test strip assay in combination with a CMOS based reader would potentially allow quantitative analysis of albuminuria and determination of albumin:creatinine ratio. Copyright © 2017 Elsevier B.V. All rights reserved.

A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Xun; Guanga, Gerald P; Wan, Cheng

2012-11-13

MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less

Rapid colorimetric detection of p53 protein function using DNA-gold nanoconjugates with applications for drug discovery and cancer diagnostics.

PubMed

Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee

2018-05-05

The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.

Thiabendazole inhibits ubiquinone reduction activity of mitochondrial respiratory complex II via a water molecule mediated binding feature.

PubMed

Zhou, Qiangjun; Zhai, Yujia; Lou, Jizhong; Liu, Man; Pang, Xiaoyun; Sun, Fei

2011-07-01

The mitochondrial respiratory complex II or succinate: ubiquinone oxidoreductase (SQR) is a key membrane complex in both the tricarboxylic acid cycle and aerobic respiration. Five disinfectant compounds were investigated with their potent inhibition effects on the ubiquinone reduction activity of the porcine mitochondrial SQR by enzymatic assay and crystallography. Crystal structure of the SQR bound with thiabendazole (TBZ) reveals a different inhibitor-binding feature at the ubiquinone binding site where a water molecule plays an important role. The obvious inhibitory effect of TBZ based on the biochemical data (IC(50) ~100 μmol/L) and the significant structure-based binding affinity calculation (~94 μmol/L) draw the suspicion of using TBZ as a good disinfectant compound for nematode infections treatment and fruit storage.

Persistent Graves' hyperthyroidism despite rapid negative conversion of thyroid-stimulating hormone-binding inhibitory immunoglobulin assay results: a case report.

PubMed

Ohara, Nobumasa; Kaneko, Masanori; Kitazawa, Masaru; Uemura, Yasuyuki; Minagawa, Shinichi; Miyakoshi, Masashi; Kaneko, Kenzo; Kamoi, Kyuzi

2017-02-06

Graves' disease is an autoimmune thyroid disorder characterized by hyperthyroidism, and patients exhibit thyroid-stimulating hormone receptor antibody. The major methods of measuring circulating thyroid-stimulating hormone receptor antibody include the thyroid-stimulating hormone-binding inhibitory immunoglobulin assays. Although the diagnostic accuracy of these assays has been improved, a minority of patients with Graves' disease test negative even on second-generation and third-generation thyroid-stimulating hormone-binding inhibitory immunoglobulins. We report a rare case of a thyroid-stimulating hormone-binding inhibitory immunoglobulin-positive patient with Graves' disease who showed rapid lowering of thyroid-stimulating hormone-binding inhibitory immunoglobulin levels following administration of the anti-thyroid drug thiamazole, but still experienced Graves' hyperthyroidism. A 45-year-old Japanese man presented with severe hyperthyroidism (serum free triiodothyronine >25.0 pg/mL; reference range 1.7 to 3.7 pg/mL) and tested weakly positive for thyroid-stimulating hormone-binding inhibitory immunoglobulins on second-generation tests (2.1 IU/L; reference range <1.0 IU/L). Within 9 months of treatment with oral thiamazole (30 mg/day), his thyroid-stimulating hormone-binding inhibitory immunoglobulin titers had normalized, but he experienced sustained hyperthyroidism for more than 8 years, requiring 15 mg/day of thiamazole to correct. During that period, he tested negative on all first-generation, second-generation, and third-generation thyroid-stimulating hormone-binding inhibitory immunoglobulin assays, but thyroid scintigraphy revealed diffuse and increased uptake, and thyroid ultrasound and color flow Doppler imaging showed typical findings of Graves' hyperthyroidism. The possible explanations for serial changes in the thyroid-stimulating hormone-binding inhibitory immunoglobulin results in our patient include the presence of thyroid-stimulating hormone receptor antibody, which is bioactive but less reactive on thyroid-stimulating hormone-binding inhibitory immunoglobulin assays, or the effect of reduced levels of circulating thyroid-stimulating hormone receptor antibody upon improvement of thyroid autoimmunity with thiamazole treatment. Physicians should keep in mind that patients with Graves' disease may show thyroid-stimulating hormone-binding inhibitory immunoglobulin assay results that do not reflect the severity of Graves' disease or indicate the outcome of the disease, and that active Graves' disease may persist even after negative results on thyroid-stimulating hormone-binding inhibitory immunoglobulin assays. Timely performance of thyroid function tests in combination with sensitive imaging tests, including thyroid ultrasound and scintigraphy, are necessary to evaluate the severity of Graves' disease and treatment efficacy.

Trimeric autotransporter DsrA is a major mediator of fibrinogen binding in Haemophilus ducreyi.

PubMed

Fusco, William G; Elkins, Christopher; Leduc, Isabelle

2013-12-01

Haemophilus ducreyi is the etiologic agent of the sexually transmitted genital ulcer disease chancroid. In both natural and experimental chancroid, H. ducreyi colocalizes with fibrin at the base of the ulcer. Fibrin is obtained by cleavage of the serum glycoprotein fibrinogen (Fg) by thrombin to initiate formation of the blood clot. Fg binding proteins are critical virulence factors in medically important Gram-positive bacteria. H. ducreyi has previously been shown to bind Fg in an agglutination assay, and the H. ducreyi Fg binding protein FgbA was identified in ligand blotting with denatured proteins. To better characterize the interaction of H. ducreyi with Fg, we examined Fg binding to intact, viable H. ducreyi bacteria and identified a novel Fg binding protein. H. ducreyi bound unlabeled Fg in a dose-dependent manner, as measured by two different methods. In ligand blotting with total denatured cellular proteins, digoxigenin (DIG)-Fg bound only two H. ducreyi proteins, the trimeric autotransporter DsrA and the lectin DltA; however, only the isogenic dsrA mutant had significantly less cell-associated Fg than parental strains in Fg binding assays with intact bacteria. Furthermore, expression of DsrA, but not DltA or an empty vector, rendered the non-Fg-binding H. influenzae strain Rd capable of binding Fg. A 13-amino-acid sequence in the C-terminal section of the passenger domain of DsrA appears to be involved in Fg binding by H. ducreyi. Taken together, these data suggest that the trimeric autotransporter DsrA is a major determinant of Fg binding at the surface of H. ducreyi.

Single-Molecule Counting of Point Mutations by Transient DNA Binding

NASA Astrophysics Data System (ADS)

Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

2017-03-01

High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

A glass fiber/diethylaminoethyl double filter binding assay that measures apoptotic internucleosomal DNA fragmentation.

PubMed

Erusalimsky, J D; John, J; Hong, Y; Moore, M

1996-11-15

A filter binding assay that measures internucleosomal DNA fragmentation associated with apoptosis is described. The assay is based on a novel principle that consists of using simultaneously two kinds of glass fiber filters to harvest [3H]thymidine-prelabeled cells following their incubation with inducers of apoptosis. One filter, which is neutral, traps intact chromatin and high-molecular-weight DNA. The other filter, which is positively charged with DEAE active groups, traps low-molecular-weight DNA fragments. DNA fragmentation is quantified by measuring the radioactivity retained by each of the filters. The assay was evaluated with the histiocytic lymphoma cell line U937 and the topoisomerase inhibitors camptothecin, etoposide, and doxorubicin. These agents caused a dose-dependent decrease of radioactivity in the neutral filter and a parallel increase of radioactivity in the DEAE filter. Irradiation-induced single strand breaks and topoisomerase-mediated primary DNA damage were not detected by this method. Consistent with the detection of internucleosomal DNA fragmentation, the effects measured by this assay were prevented by the endonuclease inhibitor zinc acetate and by the metabolic inhibitor sodium azide. Results obtained using this assay were validated by observation of DNA ladders on agarose gels and by morphologic examination of apoptotic features. Evaluation of the assay in a mock screen demonstrated that the introduction of the DEAE filter increases the assay sensitivity and eliminates false positives. Thus, this assay may be used in high-throughput screening approaches to discover novel modulators of apoptosis.

Methods and devices for protein assays

DOEpatents

Chhabra, Swapnil [San Jose, CA; Cintron, Jose M [Indianapolis, IN; Shediac, Renee [Oakland, CA

2009-11-03

Methods and devices for protein assays based on Edman degradation in microfluidic channels are disclosed herein. As disclosed, the cleaved amino acid residues may be immobilized in an array format and identified by detectable labels, such as antibodies, which specifically bind given amino acid residues. Alternatively, the antibodies are immobilized in an array format and the cleaved amino acids are labeled identified by being bound by the antibodies in the array.

Evaluation of the In Vivo and Ex Vivo Binding of Novel BC1 Cannabinoid Receptor Radiotracers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, A.; Gatley, J.; Gifford, A.

The primary active ingredient of marijuana, 9-tetrahydrocannabinol, exerts its psychoactive effects by binding to cannabinoid CB1 receptors. These receptors are found throughout the brain with high concentrations in the hippocampus and cerebellum. The current study was conducted to evaluate the binding of a newly developed putative cannabinoid antagonist, AM630, and a classical cannabinoid 8-tetrahydrocannabinol as potential PET and/or SPECT imaging agents for brain CB1 receptors. For both of these ligands in vivo and ex vivo studies in mice were conducted. AM630 showed good overall brain uptake (as measure by %IA/g) and a moderately rapid clearance from the brain with amore » half-clearance time of approximately 30 minutes. However, AM630 did not show selective binding to CB1 cannabinoid receptors. Ex vivo autoradiography supported the lack of selective binding seen in the in vivo study. Similar to AM630, 8-tetrahydrocanibol also failed to show selective binding to CB1 receptor rich brain areas. The 8-tetrahydrocanibol showed moderate overall brain uptake and relatively slow brain clearance as compared to AM630. Further studies were done with AM2233, a cannabinoid ligand with a similar structure as AM630. These studies were done to develop an ex vivo binding assay to quantify the displacement of [131I]AM2233 binding by other ligands in Swiss-Webster and CB1 receptor knockout mice. By developing this assay we hoped to determine the identity of an unknown binding site for AM2233 present in the hippocampus of CB1 knockout mice. Using an approach based on incubation of brain slices prepared from mice given intravenous [131I]AM2233 in either the presence or absence of AM2233 (unlabelled) it was possible to demonstrate a significant AM2233-displacable binding in the Swiss-Webster mice. Future studies will determine if this assay is appropriate for identifying the unknown binding site for AM2233 in the CB1 knockout mice.« less

Complementary Spectroscopic Assays for Investigating Protein-Ligand Binding Activity: A Project for the Advanced Chemistry Laboratory

ERIC Educational Resources Information Center

Mascotti, David P.; Waner, Mark J.

2010-01-01

A protein-ligand binding, guided-inquiry laboratory project with potential application across the advanced undergraduate curriculum is described. At the heart of the project are fluorescence and spectrophotometric assays utilizing biotin-4-fluorescein and streptavidin. The use of the same stock solutions for an assay that may be examined by two…

DEVELOPMENT AND CHARACTERIZATION OF A CELL LINE THAT STABLY EXPRESSES AN ESTROGEN-RESPONSIVE LUCIFERASE REPORTER FOR THE DETECTION OF ESTROGEN RECEPTOR AGONIST AND ANTAGONISTS

EPA Science Inventory

Screening for endocrine disrupting chemicals (EDCs) that act as estrogens or antiestrogens relies on the use of in vitro binding and gene expression assays coupled with short-term diagnostic in vivo assays. Although binding assays are useful to identify chemicals that are competi...

Human serum albumin binding assay based on displacement of a non selective fluorescent inhibitor.

PubMed

Thorarensen, Atli; Sarver, Ronald W; Tian, Fang; Ho, Andrea; Romero, Donna L; Marotti, Keith R

2007-08-15

In this paper, we describe a fluorescent antibacterial analog, 6, with utility as a competition probe to determine affinities of other antibacterial analogs for human serum albumin (HSA). Analog 6 bound to HSA with an affinity of 400+/-100 nM and the fluorescence was environmentally sensitive. With 370 nm excitation, environmental sensitivity was indicated by a quenching of the 530 nm emission when the probe bound to HSA. Displacement of dansylsarcosine from HSA by 6 indicated it competed with compounds that bound at site II (ibuprofen binding site) on HSA. Analog 6 also shifted the NMR peaks of an HSA bound oleic acid molecule that itself was affected by compounds that bound at site II. In addition to binding at site II, 6 interacted at site I (warfarin binding site) as indicated by displacement of dansylamide and the shifting of NMR peaks of an HSA bound oleic acid molecule affected by warfarin site binding. Additional evidence for multiple site interaction was discovered when a percentage of 6 could be displaced by either ibuprofen or phenylbutazone. A competition assay was established using 6 to determine relative affinities of other antibacterial inhibitors for HSA.

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

PubMed

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

2011-10-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein

PubMed Central

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S

2011-01-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373

Radioreceptor assay for analysis of fentanyl and its analogs in biological samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alburges, M.E.

The assay is based on the competition of these drugs with ({sup 3}H) fentanyl for opioid receptors in membrane preparations of rat forebrain in vitro. The binding in stereospecific, reversible and saturable. Scatchard plots of saturation suggest the presence of high and low affinity binding sites. Morphine and hydromorphone complete with ({sup 3}H)fentanyl for the opioid receptor, but other morphine-like compounds were relatively weak displacers of ({sup 3}H)fentanyl. Many other commonly abused drugs do not compete with ({sup 3}H)fentanyl for the opioid receptors. Urine samples from animals injected with fentanyl, ({plus minus})-cis-3-methylfentanyl, alpha-methylfentanyl, butyrylfentanyl and benzylfentanyl were analyzed by radioreceptormore » assay, radioimmunoassay, and gas chromatography/mass spectrometry. Urinary analysis of fentanyl showed a good correlation with these three methods; however, discrepancies were observed in the analysis of fentanyl analogs. This radioreceptor assay is well-suited as an initial assay for the detection of active analogs of fentanyl in urine with good correlation with other techniques in the analysis of fentanyl; however, there is substantial disagreement between techniques in the quantitation of fentanyl analogs. The implications of these discrepancies are discussed.« less

Lipid A binding sites in membranes of macrophage tumor cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hampton, R.Y.; Golenbock, D.T.; Raetz, C.R.

1988-10-15

Lipopolysaccharide affects a variety of eukaryotic cells and mammalian organisms. These actions are involved in the pathogenesis of Gram-negative septicemia. Many of the actions of lipopolysaccharide are believed to be caused by its active moiety, lipid A. Our laboratory has previously identified a bioactive lipid A precursor, termed lipid IVA, which can be labeled with 32P of high specific activity and purified. In this work we have used the labeled probe, 4'-32P-lipid IVA, to develop a novel assay for the specific binding of lipid IVA to whole cells. We have also demonstrated its use in a ligand blotting assay ofmore » immobilized cellular proteins. Using the whole cell assay, we show that 4'-32P-lipid IVA specifically binds to RAW 264.7 macrophage-like cultured cells. The binding is saturable, is inhibited with excess unlabeled lipid IVA, and is proteinase K-sensitive. It displays cellular and pharmacological specificity. Using the ligand blotting assay, we show that several RAW 264.7 cell proteins can bind 4'-32P-lipid IVA. The two principal binding proteins have Mr values of 31 and 95 kDa, as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Fractionation studies indicate that the 31-kDa protein is enriched in the nuclear fraction and may be a histone, whereas the 95-kDa protein is enriched in the membrane fraction. The binding assays that we have developed should lead to a clearer understanding of lipid A/animal cell interactions.« less

Role of receptor occupancy assays by flow cytometry in drug development.

PubMed

Stewart, Jennifer J; Green, Cherie L; Jones, Nicholas; Liang, Meina; Xu, Yuanxin; Wilkins, Danice E C; Moulard, Maxime; Czechowska, Kamila; Lanham, David; McCloskey, Thomas W; Ferbas, John; van der Strate, Barry W A; Högerkorp, Carl-Magnus; Wyant, Timothy; Lackey, Alan; Litwin, Virginia

2016-03-01

The measurement of the binding of a biotherapeutic to its cellular target, receptor occupancy (RO), is increasingly important in development of biologically-based therapeutic agents. Receptor occupancy (RO) assays by flow cytometry describe the qualitative and/or quantitative assessment of the binding of a therapeutic agent to its cell surface target. Such RO assays can be as simple as measuring the number of cell surface receptors bound by an antireceptor therapeutic agent or can be designed to address more complicated scenarios such as internalization or shedding events once a receptor engages the administered therapeutic agent. Data generated from RO assays can also be used to model whether given doses of an experimental therapeutic agent and their administration schedules lead to predicted levels of receptor occupancy and whether the receptor is modulated (up or down) on cells engaged by the therapeutic agent. There are a variety of approaches that can be used when undertaking RO assays and with the ability to measure distinct subsets in heterogeneous populations, flow cytometry is ideally suited to RO measurements. This article highlights the importance of RO assays on the flow cytometric platform in the development of biotherapeutic agents. © 2016 The Authors Cytometry Part B: Clinical Cytometry Published by Wiley Periodicals, Inc.

Further characterization and independent validation of a DNA aptamer-quantum dot-based magnetic sandwich assay for Campylobacter.

PubMed

Bruno, John G; Sivils, Jeffrey C

2017-11-01

Previously reported DNA aptamers developed against surface proteins extracted from Campylobacter jejuni were further characterized by aptamer-based Western blotting and shown to bind epitopes on proteins weighing ~16 and 60 kD from reduced C. jejuni and Campylobacter coli lysates. Proteins of these approximate weights have also been identified in traditional antibody-based Western blots of Campylobacter spp. Specificity of the capture and reporter aptamers from the previous report was further validated by aptamer-based ELISA-like (ELASA) colorimetric microplate assay. Finally, the limit of detection of the previously reported plastic-adherent aptamer-magnetic bead and aptamer-quantum dot sandwich assay (PASA) was validated by an independent food safety testing laboratory to lie between 5 and 10 C. jejuni cells per milliliter in phosphate buffered saline and repeatedly frozen and thawed chicken rinsate. Such ultrasensitive and rapid (30 min) aptamer-based assays could provide alternative or additional screening tools to enhance food safety testing for Campylobacter and other foodborne pathogens.

A novel carbohydrate derived compound FCP5 causes DNA strand breaks and oxidative modifications of DNA bases in cancer cells.

PubMed

Czubatka, Anna; Sarnik, Joanna; Lucent, Del; Blasiak, Janusz; Witczak, Zbigniew J; Poplawski, Tomasz

2015-02-05

1,5-Anhydro-6-deoxy-methane-sulfamido-D-glucitol (FCP5) is a functionalized carbohydrate containing functional groups that render it potentially therapeutically useful. According to our concept of 'functional carb-pharmacophores' (FCPs) incorporation of the methanesulfonamido pharmacophore to 1,5 glucitol could create a therapeutically useful compound. Our previous studies revealed that FCP5 was cytotoxic to cancer cells. Therefore, in this work we assessed the cytotoxic mechanisms of FCP5 in four cancer cell lines - HeLa, LoVo, A549 and MCF-7, with particular focus on DNA damage and repair. A broad spectrum of methods, including comet assay with modifications, DNA repair enzyme assay, plasmid relaxation assay, and DNA fragmentation assay, were used. We also checked the potential for FCP5 to induce apoptosis. The results show that FCP5 can induce DNA strand breaks as well as oxidative modifications of DNA bases. DNA lesions induced by FCP5 were not entirely repaired in HeLa cells and DNA repair kinetics differs from other cell lines. Results from molecular docking and plasmid relaxation assay suggest that FCP5 binds to the major groove of DNA with a preference for adenosine-thymine base pair sequences and directly induces DNA strand breaks. Thus, FCP5 may represent a novel lead for the design of new major groove-binding compounds. The results also confirmed the validity of functional carb-pharmacophores as a new source of innovative drugs. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Aptamers as the Agent in Decontamination Assays (Apta-Decontamination Assays): From the Environment to the Potential Application In Vivo

PubMed Central

Bilibana, Mawethu Pascoe; Yeoh, Tzi Shien; Tang, Thean-Hock

2017-01-01

The binding specificity and affinity of aptamers have long been harnessed as the key elements in the development of aptamer-based assays, particularly aptasensing application. One promising avenue that is currently explored based on the specificity and affinity of aptamers is the application of aptamers in the decontamination assays. Aptamers have been successfully harnessed as the decontamination agents to remove contaminants from the environment and to decontaminate infectious elements. The reversible denaturation property inherent in aptamers enables the repeated usage of aptamers, which can immensely save the cost of decontamination. Analogous to the point-of-care diagnostics, there is no doubt that aptamers can also be deployed in the point-of-care aptamer-based decontamination assay, whereby decontamination can be performed anywhere and anytime for instantaneous decision-making. It is also prophesied that aptamers can also serve more than as a decontaminant, probably as a tool to capture and kill hazardous elements, particularly pathogenic agents. PMID:29225967

Structure dependent selective efficacy of pyridine and pyrrole based Cu(II) Schiff base complexes towards in vitro cytotoxicity, apoptosis and DNA-bases binding in ground and excited state.

PubMed

Koley Seth, Banabithi; Saha, Arpita; Haldar, Srijan; Chakraborty, Partha Pratim; Saha, Partha; Basu, Samita

2016-09-01

This work highlights a systematic and comparative study of the structure-dependent influence of a series of biologically active Cu(II) Schiff base complexes (CSCs) on their in vitro cytotoxicity, apoptosis and binding with polymeric DNA-bases in ground and photo-excited states. The structure-activity relationship of the closely resembled CSCs towards in vitro cytotoxicity and apoptosis against cervical cancerous HeLa and normal human diploid WI-38 cell lines has been investigated by MTT assay and FACS techniques respectively. The steady-state and time-resolved spectroscopic studies have also been carried out to explore the selective binding affinities of the potential complexes towards different polymeric nucleic acid bases (poly d(A), poly d(T), poly d(G), poly d(C), Poly d(G)-Poly d(C)), which enlighten the knowledge regarding their ability in controlling the structure and medium dependent interactions in 'ground' and 'excited' states. The pyridine containing water soluble complexes (CuL(1) and CuL(3)) are much more cytotoxic than the corresponding pyrrole counterparts (CuL(2) and CuL(4)). Moreover the acidic hydrogens in CuL(1) increase its cytotoxicity much more than methyl substitution as in CuL(3). The results of MTT assay and double staining FACS experiments indicate selective inhibition of cell growth (cell viability 39% (HeLa) versus 85% (WI-38)) and occurrence of apoptosis rather than necrosis. The ground state binding of CuL(1) with polymeric DNA bases, especially with guanine rich DNA (Kb=6.41±0.122×10(5)), that enhances its cytotoxic activity, is further confirmed from its binding isotherms. On the other hand the pyrrole substituted CuL(4) complex exhibits the structure and medium dependent selective electron-transfer in triplet state as observed in laser flash photolysis studies followed by magnetic field (MF) effect. Copyright © 2016 Elsevier B.V. All rights reserved.

In vitro isolation of small-molecule-binding aptamers with intrinsic dye-displacement functionality

PubMed Central

Yu, Haixiang; Yang, Weijuan; Alkhamis, Obtin; Canoura, Juan; Yang, Kyung-Ae; Xiao, Yi

2018-01-01

Abstract Aptamer-based sensors offer a powerful tool for molecular detection, but the practical implementation of these biosensors is hindered by costly and laborious sequence engineering and chemical modification procedures. We report a simple strategy for directly isolating signal-reporting aptamers in vitro through systematic evolution of ligands by exponential enrichment (SELEX) that transduce binding events into a detectable change of absorbance via target-induced displacement of a small-molecule dye. We first demonstrate that diethylthiatricarbocyanine (Cy7) can stack into DNA three-way junctions (TWJs) in a sequence-independent fashion, greatly altering the dye's absorbance spectrum. We then design a TWJ-containing structured library and isolate an aptamer against 3,4-methylenedioxypyrovalerone (MDPV), a synthetic cathinone that is an emerging drug of abuse. This aptamer intrinsically binds Cy7 within its TWJ domain, but MDPV efficiently displaces the dye, resulting in a change in absorbance within seconds. This assay is label-free, and detects nanomolar concentrations of MDPV. It also recognizes other synthetic cathinones, offering the potential to detect newly-emerging designer drugs, but does not detect structurally-similar non-cathinone compounds or common cutting agents. Moreover, we demonstrate that the Cy7-displacement colorimetric assay is more sensitive than a conventional strand-displacement fluorescence assay. We believe our strategy offers an effective generalized approach for the development of sensitive dye-displacement colorimetric assays for other small-molecule targets. PMID:29361056

Interaction of immobilized avidin with an aequorin-biotin conjugate: an aequorin-linked assay for biotin.

PubMed

Feltus, A; Ramanathan, S; Daunert, S

1997-12-01

Biotinylated recombinant aequorin was used in the development of a heterogeneous bioluminescence binding assay for biotin. This assay is based on a competition between a biotinylated aequorin conjugate and biotin for the binding sites of avidin immobilized on solid particles. Dose-response curves were obtained that relate solid-phase aequorin activity to the concentration of biotin. Under certain experimental conditions these curves were biphasic; i.e., as the biotin concentration increased, the solid-phase aequorin activity first increased reaching a maximum and then decreased at higher biotin concentrations. This "hook" effect was observed with four different types of immobilization supports. The effect was more pronounced when low concentrations of aequorin-biotin conjugate were used, and diminished at a high conjugate concentration. This behavior indicates a possible positive cooperativity in the interaction between the immobilized avidin and biotin. Scatchard plot analysis was also consistent with a positive cooperativity mechanism. By using the ascending portion of the dose-response curve, the detection limit of the assay for biotin was 1 x 10(-15) M (100 zmol of biotin in the sample). Copyright 1997 Academic Press.

On optimizing the blocking step of indirect enzyme-linked immunosorbent assay for Epstein-Barr virus serology.

PubMed

Lim, Chun Shen; Krishnan, Gopala; Sam, Choon Kook; Ng, Ching Ching

2013-01-16

Because blocking agent occupies most binding surface of a solid phase, its ability to prevent nonspecific binding determines the signal-to-noise ratio (SNR) and reliability of an enzyme-linked immunosorbent assay (ELISA). We demonstrate a stepwise approach to seek a compatible blocking buffer for indirect ELISA, via a case-control study (n=176) of Epstein-Barr virus (EBV)-associated nasopharyngeal carcinoma (NPC). Regardless of case-control status, we found that synthetic polymer blocking agents, mainly Ficoll and poly(vinyl alcohol) (PVA) were able to provide homogeneous backgrounds among samples, as opposed to commonly used blocking agents, notably nonfat dry milk (NFDM). The SNRs for NPC samples that correspond to blocking using PVA were approximately 3-fold, on average, higher than those blocking using NFDM. Both intra- and inter-assay precisions of PVA-based assays were <14%. A blocking agent of choice should have tolerable sample backgrounds from both cases and controls to ensure the reliability of an immunoassay. Copyright © 2012 Elsevier B.V. All rights reserved.

[Effect of Acetonitrile and n-hexane on the Immunoassay of Environmental Representative Pollutants].

PubMed

Lou, Xue-ning; Zhou, Li-ping; Song, Dan; Yang, Rong; Long, Feng

2016-01-15

Based on indirect competitive immunoassay mechanism, bisphenol A (BPA) was detected by the evanescent wave all-fiber immunosensor previously developed with the detection limit of 0.2 microg x L(-1) and the linear detection range of 0.3-33.4 microg x L(-1). The effects of two commonly used organic solvents, including acetonitrile and n-hexane, on the immunosensing assay of BPA were investigated. The influence mechanism of organic solvents on immunosensing assay was discussed. The experimental results showed that the effect of n-hexane on immunosensing assay was negligible even at a high concentration of up to 10%, whereas the effect of acetonitrile on the immunosensing assay was relatively great. BPA could be detected in solutions containing a low concentration of acetonitrile. However, the specific binding reaction between antibody and antigen in homogeneous solution was completely inhibited by high concentrations of acetonitrile, and the quantitative analysis of BPA was not achieved. This might result from the changes of antibody conformation or binding capability between antibody and antigen because acetonitrile replaced a part of the water molecules on the antibody surface.

The transcription factor CCAAT-binding factor CBF/NF-Y regulates the proximal promoter activity in the human alpha 1(XI) collagen gene (COL11A1).

PubMed

Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu

2003-08-29

We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.

Development of an online p38α mitogen-activated protein kinase binding assay and integration of LC–HR-MS

PubMed Central

Falck, David; de Vlieger, Jon S. B.; Niessen, Wilfried M. A.; Kool, Jeroen; Honing, Maarten; Irth, Hubertus

2010-01-01

A high-resolution screening method was developed for the p38α mitogen-activated protein kinase to detect and identify small-molecule binders. Its central role in inflammatory diseases makes this enzyme a very important drug target. The setup integrates separation by high-performance liquid chromatography with two parallel detection techniques. High-resolution mass spectrometry gives structural information to identify small molecules while an online enzyme binding detection method provides data on p38α binding. The separation step allows the individual assessment of compounds in a mixture and links affinity and structure information via the retention time. Enzyme binding detection was achieved with a competitive binding assay based on fluorescence enhancement which has a simple principle, is inexpensive, and is easy to interpret. The concentrations of p38α and the fluorescence tracer SK&F86002 were optimized as well as incubation temperature, formic acid content of the LC eluents, and the material of the incubation tubing. The latter notably improved the screening of highly lipophilic compounds. For optimization and validation purposes, the known kinase inhibitors BIRB796, TAK715, and MAPKI1 were used among others. The result is a high-quality assay with Z′ factors around 0.8, which is suitable for semi-quantitative affinity measurements and applicable to various binding modes. Furthermore, the integrated approach gives affinity data on individual compounds instead of averaged ones for mixtures. Figure P38 α online screening platform Electronic supplementary material The online version of this article (doi:10.1007/s00216-010-4087-8) contains supplementary material, which is available to authorized users. PMID:20730527

Towards novel therapeutics for HIV through fragment-based screening and drug design.

PubMed

Tiefendbrunn, Theresa; Stout, C David

2014-01-01

Fragment-based drug discovery has been applied with varying levels of success to a number of proteins involved in the HIV (Human Immunodeficiency Virus) life cycle. Fragment-based approaches have led to the discovery of novel binding sites within protease, reverse transcriptase, integrase, and gp41. Novel compounds that bind to known pockets within CCR5 have also been identified via fragment screening, and a fragment-based approach to target the TAR-Tat interaction was explored. In the context of HIV-1 reverse transcriptase (RT), fragment-based approaches have yielded fragment hits with mid-μM activity in an in vitro activity assay, as well as fragment hits that are active against drug-resistant variants of RT. Fragment-based drug discovery is a powerful method to elucidate novel binding sites within proteins, and the method has had significant success in the context of HIV proteins.

A novel cell-based assay for measuring neutralizing autoantibodies against type I interferons in patients with autoimmune polyendocrine syndrome type 1.

PubMed

Breivik, Lars; Oftedal, Bergithe E V; Bøe Wolff, Anette S; Bratland, Eirik; Orlova, Elizaveta M; Husebye, Eystein S

2014-07-01

An important characteristic of autoimmune polyendocrine syndrome type 1 (APS 1) is the existence of neutralizing autoantibodies (nAbs) against the type I interferons (IFN) -α2 and -ω at frequencies close to 100%. Type 1 IFN autoantibodies are detected by antiviral neutralizing assays (AVA), binding assays with radiolabelled antigens (RLBA), enzyme-linked immunosorbent assay (ELISA), or by reporter-based cell assays. We here present a simple and reliable version of the latter utilizing a commercially available cell line (HEK-Blue IFN-α/β). All 67 APS 1 patients were positive for IFN-ω nAbs, while 90% were positive for IFN-α2 nAbs, a 100% and 96% correlation with RLBA, respectively. All blood donors and non-APS 1 patients were negative. The dilution titer required to reduce the effect of IFN-ω nAbs correlated with the RLBA index. This cell-based autoantibody assay (CBAA) is easy to perform, suitable for high throughput, while providing high specificity and sensitivity. Copyright © 2014 Elsevier Inc. All rights reserved.

pH and reduction dual-responsive dipeptide cationic lipids with α-tocopherol hydrophobic tail for efficient gene delivery.

PubMed

Liu, Qiang; Su, Rong-Chuan; Yi, Wen-Jing; Zheng, Li-Ting; Lu, Shan-Shan; Zhao, Zhi-Gang

2017-03-31

A series of tocopherol-based cationic lipid 3a-3f bearing a pH-sensitive imidazole moiety in the dipeptide headgroup and a reduction-responsive disulfide linkage were designed and synthesized. Acid-base titration of these lipids showed good buffering capacities. The liposomes formed from 3 and co-lipid 1, 2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) could efficiently bind and condense DNA into nanoparticles. Gel binding and HPLC assays confirmed the encapsulated DNA could release from lipoplexes 3 upon addition of 10 mM glutathione (GSH). MTT assays in HEK 293 cells demonstrated that lipoplexes 3 had low cytotoxicity. The in vitro gene transfection studies showed cationic dipeptide headgroups clearly affected the transfection efficiency (TE), and arginine-histidine based dipeptide lipid 3f give the best TE, which was 30.4 times higher than Lipofectamine 3000 in the presence of 10% serum. Cell-uptake assays indicated that basic amino acid containing dipeptide cationic lipids exhibited more efficient cell uptake than serine and aromatic amino acids based dipeptide lipids. Confocal laser scanning microscopy (CLSM) studies corroborated that 3 could efficiently deliver and release DNA into the nuclei of HeLa cells. These results suggest that tocopherol-based dipeptide cationic lipids with pH and reduction dual-sensitive characteristics might be promising non-viral gene delivery vectors. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Development of a Strategy Based on the Surface Plasmon Resonance Technology for Platelet Compatibility Testing.

PubMed

Wu, Chang-Lin; He, Jian-An; Gu, Da-Yong; Shao, Chao-Peng; Zhu, Yi; Dang, Xin-Tang

2018-01-01

This study was aimed to establish a novel strategy based on the surface plasmon resonance (SPR) technology for platelet compatibility testing. A novel surface matrix was prepared based on poly (OEGMA-co-HEMA) via surface-initiated polymerization as a biosensor surface platform. Type O universal platelets and donor platelets were immobilized on these novel matrices via amine-coupling reaction and worked as a capturing ligand for binding the platelet antibody. Antibodies binding to platelets were monitored in real time by injecting the samples into a microfluidic channel. Clinical serum samples (n = 186) with multiple platelet transfusions were assayed for platelet antibodies using the SPR technology and monoclonal antibody-immobilized platelet antigen (MAIPA) assay. The novel biosensor surface achieved nonfouling background and high immobilization capacity and showed good repeatability and stability after regeneration. The limit of detection of the SPR biosensor for platelet antibody was estimated to be 50 ng/mL. The sensitivity and specificity were 92% and 98.7%. It could detect the platelet antibody directly in serum samples, and the results were similar to MAIPA assay. A novel strategy to facilitate the sensitive and reliable detection of platelet compatibility for developing an SPR-based biosensor was established in this study. The SPR-based biosensor combined with novel surface chemistry is a promising method for platelet compatibility testing.

FcUni-RLuc: an engineered Renilla luciferase with Fc binding ability and light emission activity.

PubMed

Farzannia, A; Roghanian, R; Zarkesh-Esfahani, S H; Nazari, M; Emamzadeh, R

2015-03-07

A novel and advanced Fc-binding probe – FcUni-RLuc namely – has been produced and functionally assayed for labelling IgGs. The Fc antibody binding sequence – HWRGWV – was fused to Renilla luciferase, and the purified probe was employed for bioluminescence enzyme-linked immunoabsorbance assay of Her2 positive cells.

[Integration of pharmacokinetics and pharmacodynamics based on the in vivo analysis of drug-receptor binding].

PubMed

Yamada, Shizuo

2015-01-01

  As I was deeply interested in the effects of drugs on the human body, I chose pharmacology as the subject of special study when I became a 4th year student at Shizuoka College of Pharmacy. I studied abroad as a postdoctoral fellow for two years, from 1978, under the tutelage of Professor Henry I. Yamamura (pharmacology) in the College of Medicine at the University of Arizona, USA. He taught me a variety of valuable skills such as the radioreceptor binding assay, which represented the most advanced technology developed in the US at that time. After returning home, I engaged in clarifying receptor abnormalities in pathological conditions, as well as in drug action mechanisms, by making the best use of this radioreceptor binding assay. In 1989, following the founding of the University of Shizuoka, I was invited by Professor Ryohei Kimura to join the Department of Pharmacokinetics. This switch in discipline provided a good opportunity for me to broaden my perspectives in pharmaceutical sciences. I worked on evaluating drug-receptor binding in vivo as a combined index for pharmacokinetics and pharmacological effect manifestation, with the aim of bridging pharmacology and pharmacokinetics. In fact, by focusing on data from in vivo receptor binding, it became possible to clearly rationalize the important consideration of drug dose-concentration-action relationships, and to study quantitative and kinetic analyses of relationships among pharmacokinetics, receptor binding and pharmacological effects. Based on this concept, I was able to demonstrate the utility of dynamic analyses of drug-receptor binding in drug discovery, drug fostering, and the proper use of pharmacokinetics with regard to many drugs.

In vitro toxicity testing with microplate cell cultures: Impact of cell binding.

PubMed

Gülden, Michael; Schreiner, Jeannine; Seibert, Hasso

2015-06-05

In vitro generated data on toxic potencies are generally based on nominal concentrations. However, cellular and extracellular binding and elimination processes may reduce the available free fraction of a compound. Then, nominal effective concentrations do not represent appropriate measures of toxic exposure in vitro and underestimate toxic potencies. In this study it was investigated whether cell binding can affect the availability of chemicals in microplate based toxicity assays. To this end the cytotoxicity of compounds like mercury chloride, digitonin and alcohol ethoxylates, accumulated by cells via different modes, was investigated in 96-well microplate cultures with varying concentrations of Balb/c 3T3 cells. The median effective nominal concentrations of all but one of the tested compounds depended linearly from the cell concentration. Applying a previously developed equilibrium distribution model cell concentration-independent median effective extracellular concentrations and cell burdens, respectively, could be calculated. The compounds were accumulated by the cells with bioconcentration factors, BCF, between 480 and ≥ 25,000. Cell binding of the alcohol ethoxylates was correlated with their lipophilicity. The results show that significant cell binding can occur even at the small cell volume fractions (∼ 1 × 10(-5) to 3 × 10(-3) L/L) encountered in microplate assays. To what extent cell binding affects the bioavailability depends on the BCF and the cell volume fraction. EC50 measurements in the presence of at least two different cell concentrations allow for excluding or detecting significant cell binding and for determining more appropriate measures of toxic exposure in vitro like median effective extracellular (free) concentrations or cell burdens. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Studying the Salt Dependence of the Binding of σ70 and σ32 to Core RNA Polymerase Using Luminescence Resonance Energy Transfer

PubMed Central

Glaser, Bryan T.; Bergendahl, Veit; Anthony, Larry C.; Olson, Brian; Burgess, Richard R.

2009-01-01

The study of protein-protein interactions is becoming increasingly important for understanding the regulation of many cellular processes. The ability to quantify the strength with which two binding partners interact is desirable but the accurate determination of equilibrium binding constants is a difficult process. The use of Luminescence Resonance Energy Transfer (LRET) provides a homogeneous binding assay that can be used for the detection of protein-protein interactions. Previously, we developed an LRET assay to screen for small molecule inhibitors of the interaction of σ70 with theβ' coiled-coil fragment (amino acids 100–309). Here we describe an LRET binding assay used to monitor the interaction of E. coli σ70 and σ32 with core RNA polymerase along with the controls to verify the system. This approach generates fluorescently labeled proteins through the random labeling of lysine residues which enables the use of the LRET assay for proteins for which the creation of single cysteine mutants is not feasible. With the LRET binding assay, we are able to show that the interaction of σ70 with core RNAP is much more sensitive to NaCl than to potassium glutamate (KGlu), whereas the σ32 interaction with core RNAP is insensitive to both salts even at concentrations >500 mM. We also find that the interaction of σ32 with core RNAP is stronger than σ70 with core RNAP, under all conditions tested. This work establishes a consistent set of conditions for the comparison of the binding affinities of the E.coli sigma factors with core RNA polymerase. The examination of the importance of salt conditions in the binding of these proteins could have implications in both in vitro assay conditions and in vivo function. PMID:19649256

Discovery of a diaminoquinoxaline benzenesulfonamide antagonist of HIV-1 Nef function using a yeast-based phenotypic screen

PubMed Central

2013-01-01

Background HIV-1 Nef is a viral accessory protein critical for AIDS progression. Nef lacks intrinsic catalytic activity and binds multiple host cell signaling proteins, including Hck and other Src-family tyrosine kinases. Nef binding induces constitutive Hck activation that may contribute to HIV pathogenesis by promoting viral infectivity, replication and downregulation of cell-surface MHC-I molecules. In this study, we developed a yeast-based phenotypic screen to identify small molecules that inhibit the Nef-Hck complex. Results Nef-Hck interaction was faithfully reconstituted in yeast cells, resulting in kinase activation and growth arrest. Yeast cells expressing the Nef-Hck complex were used to screen a library of small heterocyclic compounds for their ability to rescue growth inhibition. The screen identified a dihydrobenzo-1,4-dioxin-substituted analog of 2-quinoxalinyl-3-aminobenzene-sulfonamide (DQBS) as a potent inhibitor of Nef-dependent HIV-1 replication and MHC-I downregulation in T-cells. Docking studies predicted direct binding of DQBS to Nef which was confirmed in differential scanning fluorimetry assays with recombinant purified Nef protein. DQBS also potently inhibited the replication of HIV-1 NL4-3 chimeras expressing Nef alleles representative of all M-group HIV-1 clades. Conclusions Our findings demonstrate the utility of a yeast-based growth reversion assay for the identification of small molecule Nef antagonists. Inhibitors of Nef function discovered with this assay, such as DQBS, may complement the activity of current antiretroviral therapies by enabling immune recognition of HIV-infected cells through the rescue of cell surface MHC-I. PMID:24229420

Tb3+-cleavage assays reveal specific Mg2+ binding sites necessary to pre-fold the btuB riboswitch for AdoCbl binding

NASA Astrophysics Data System (ADS)

Choudhary, Pallavi K.; Gallo, Sofia; Sigel, Roland K. O.

2017-03-01

Riboswitches are RNA elements that bind specific metabolites in order to regulate the gene expression involved in controlling the cellular concentration of the respective molecule or ion. Ligand recognition is mostly facilitated by Mg2+ mediated pre-organization of the riboswitch to an active tertiary fold. To predict these specific Mg2+ induced tertiary interactions of the btuB riboswitch from E. coli, we here report Mg2+ binding pockets in its aptameric part in both, the ligand-free and the ligand-bound form. An ensemble of weak and strong metal ion binding sites distributed over the entire aptamer was detected by terbium(III) cleavage assays, Tb3+ being an established Mg2+ mimic. Interestingly many of the Mn+ (n = 2 or 3) binding sites involve conserved bases within the class of coenzyme B12-binding riboswitches. Comparison with the published crystal structure of the coenzyme B12 riboswitch of S. thermophilum aided in identifying a common set of Mn+ binding sites that might be crucial for tertiary interactions involved in the organization of the aptamer. Our results suggest that Mn+ binding at strategic locations of the btuB riboswitch indeed facilitates the assembly of the binding pocket needed for ligand recognition. Binding of the specific ligand, coenzyme B12 (AdoCbl), to the btuB aptamer does however not lead to drastic alterations of these Mn+ binding cores, indicating the lack of a major rearrangement within the three-dimensional structure of the RNA. This finding is strengthened by Tb3+ mediated footprints of the riboswitch's structure in its ligand-free and ligand-bound state indicating that AdoCbl indeed induces local changes rather than a global structural rearrangement.

The role of dimension in multivalent binding events: structure-activity relationship of dendritic polyglycerol sulfate binding to L-selectin in correlation with size and surface charge density.

PubMed

Weinhart, Marie; Gröger, Dominic; Enders, Sven; Riese, Sebastian B; Dernedde, Jens; Kainthan, Rajesh K; Brooks, Donald E; Haag, Rainer

2011-08-11

L-, P-, and E-Selectin are cell adhesion molecules that play a crucial role in leukocyte recruitment from the blood stream to the afflicted tissue in an acute and chronic inflammatory setting. Since selectins mediate the initial contact of leukocytes to the vascular endothelium, they have evolved as a valuable therapeutic target in diseases related to inflammation by inhibition of the physiological selectin-ligand interactions. In a previous study, it was demonstrated that dPGS, a fully synthetic heparin analogue, works as an efficient inhibitor towards L- and P-selectin in vitro as well as in vivo. Herein, the focus is directed towards the effect of size and charge density of the polyanion. The efficiency of L-selectin inhibition via an SPR-based in vitro assay and a cell-based flow chamber assay is investigated with dPGS ranging from approximately 4 to 2000 kDa. SPR measurements show that the inhibitory potential of highly sulfated dPGS increases with size and charge density. Thereby, IC(50) values from the micromolar to the low picomolar range are determined. The same tendency could be observed in a cell-based flow chamber assay with three representative dPGS samples. This structure-affinity relationship of dPGS suggests that the strong inhibitory potential of dPGS is not only based on the strong electrostatic interaction with areas of cationic surface potential on L-selectin but is also due to a steric shielding of the carbohydrate binding site by large, flexible dPGS particles. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Detecting cooperative sequences in the binding of RNA Polymerase-II

NASA Astrophysics Data System (ADS)

Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

2008-03-01

Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

Test/QA Plan for Verification of Microcystin Test Kits

EPA Science Inventory

Microcystin test kits are used to quantitatively measure total microcystin in recreational waters. These test kits are based on enzyme-linked immunosorbent assays (ELISA) with antibodies that bind specifically to microcystins or phosphate activity inhibition where the phosphatas...

High-throughput screening in two dimensions: binding intensity and off-rate on a peptide microarray.

PubMed

Greving, Matthew P; Belcher, Paul E; Cox, Conor D; Daniel, Douglas; Diehnelt, Chris W; Woodbury, Neal W

2010-07-01

We report a high-throughput two-dimensional microarray-based screen, incorporating both target binding intensity and off-rate, which can be used to analyze thousands of compounds in a single binding assay. Relative binding intensities and time-resolved dissociation are measured for labeled tumor necrosis factor alpha (TNF-alpha) bound to a peptide microarray. The time-resolved dissociation is fitted to a one-component exponential decay model, from which relative dissociation rates are determined for all peptides with binding intensities above background. We show that most peptides with the slowest off-rates on the microarray also have the slowest off-rates when measured by surface plasmon resonance (SPR). 2010 Elsevier Inc. All rights reserved.

Heptameric Targeting Ligands against EGFR and HER2 with High Stability and Avidity

PubMed Central

Kim, Dongwook; Yan, Yitang; Valencia, C. Alexander; Liu, Rihe

2012-01-01

Multivalency of targeting ligands provides significantly increased binding strength towards their molecular targets. Here, we report the development of a novel heptameric targeting system, with general applications, constructed by fusing a target-binding domain with the heptamerization domain of the Archaeal RNA binding protein Sm1 through a flexible hinge peptide. The previously reported affibody molecules against EGFR and HER2, ZEGFR and ZHER2, were used as target binding moieties. The fusion molecules were highly expressed in E. coli as soluble proteins and efficiently self-assembled into multimeric targeting ligands with the heptamer as the predominant form. We demonstrated that the heptameric molecules were resistant to protease-mediated digestion or heat- and SDS-induced denaturation. Surface plasmon resonance (SPR) analysis showed that both heptameric ZEGFR and ZHER2 ligands have a significantly enhanced binding strength to their target receptors with a nearly 100 to 1000 fold increase relative to the monomeric ligands. Cellular binding assays showed that heptameric ligands maintained their target-binding specificities similar to the monomeric forms towards their respective receptor. The non-toxic property of each heptameric ligand was demonstrated by the cell proliferation assay. In general,, the heptamerization strategy we describe here could be applied to the facile and efficient engineering of other protein domain- or short peptide-based affinity molecules to acquire significantly improved target-binding strengths with potential applications in the targeted delivery of various imaging or therapeutic agents.. PMID:22912791

Calix[3]carbazole: A C3-symmetrical receptor for barium ion

NASA Astrophysics Data System (ADS)

Yang, Zhaozheng; Tian, Zhangmin; Yang, Peng; Deng, Tuo; Li, Gang; Zhou, Xue; Chen, Yan; Zhao, Liang; Shen, Hongyan

2017-03-01

The binding ability of calix[3]carbazole (1) to metal ions has been investigated. It is found that 1 could serve as a non crown ether based, C3-symmetrical receptor for Ba2 + via the marriage of cation-π and cation-dipole interactions. FID assay further illustrates that 1 could selectively interact with Ba2 + over Pd2 +. A possible binding mechanism for [1-Ba2 +] complex is proposed.

Fluorescent-responsive synthetic C1b domains of protein kinase Cδ as reporters of specific high-affinity ligand binding.

PubMed

Ohashi, Nami; Nomura, Wataru; Narumi, Tetsuo; Lewin, Nancy E; Itotani, Kyoko; Blumberg, Peter M; Tamamura, Hirokazu

2011-01-19

Protein kinase C (PKC) is a critical cell signaling pathway involved in many disorders such as cancer and Alzheimer-type dementia. To date, evaluation of PKC ligand binding affinity has been performed by competitive studies against radiolabeled probes that are problematic for high-throughput screening. In the present study, we have developed a fluorescent-based binding assay system for identifying ligands that target the PKC ligand binding domain (C1 domain). An environmentally sensitive fluorescent dye (solvatochromic fluorophore), which has been used in multiple applications to assess protein-binding interactions, was inserted in proximity to the binding pocket of a novel PKCδ C1b domain. These resultant fluorescent-labeled δC1b domain analogues underwent a significant change in fluorescent intensity upon ligand binding, and we further demonstrate that the fluorescent δC1b domain analogues can be used to evaluate ligand binding affinity.

Exploring DNA binding and nucleolytic activity of few 4-aminoantipyrine based amino acid Schiff base complexes: A comparative approach

NASA Astrophysics Data System (ADS)

Raman, N.; Sakthivel, A.; Pravin, N.

A series of novel Co(II), Cu(II), Ni(II) and Zn(II) complexes were synthesized from Schiff base(s), obtained by the condensation of 4-aminoantipyrine with furfural and amino acid (glycine(L1)/alanine(L2)/valine(L3)) and respective metal(II) chloride. Their structural features and other properties were explored from the analytical and spectral methods. The binding behaviors of the complexes to calf thymus DNA were investigated by absorption spectra, viscosity measurements and cyclic voltammetry. The intrinsic binding constants for the above synthesized complexes are found to be in the order of 102 to 105 indicating that most of the synthesized complexes are good intercalators. The binding constant values (Kb) clearly indicate that valine Schiff-base complexes have more intercalating ability than alanine and glycine Schiff-base complexes. The results indicate that the complexes bind to DNA through intercalation and act as efficient cleaving agents. The in vitro antibacterial and antifungal assay indicates that these complexes are good antimicrobial agents against various pathogens. The IC50 values of [Ni(L1)2] and [Zn(L1)2] complexes imply that these complexes have preferable ability to scavenge hydroxyl radical.

Discovery of non-peptidic small molecule inhibitors of cyclophilin D as neuroprotective agents in Aβ-induced mitochondrial dysfunction

NASA Astrophysics Data System (ADS)

Park, Insun; Londhe, Ashwini M.; Lim, Ji Woong; Park, Beoung-Geon; Jung, Seo Yun; Lee, Jae Yeol; Lim, Sang Min; No, Kyoung Tai; Lee, Jiyoun; Pae, Ae Nim

2017-10-01

Cyclophilin D (CypD) is a mitochondria-specific cyclophilin that is known to play a pivotal role in the formation of the mitochondrial permeability transition pore (mPTP).The formation and opening of the mPTP disrupt mitochondrial homeostasis, cause mitochondrial dysfunction and eventually lead to cell death. Several recent studies have found that CypD promotes the formation of the mPTP upon binding to β amyloid (Aβ) peptides inside brain mitochondria, suggesting that neuronal CypD has a potential to be a promising therapeutic target for Alzheimer's disease (AD). In this study, we generated an energy-based pharmacophore model by using the crystal structure of CypD—cyclosporine A (CsA) complex and performed virtual screening of ChemDiv database, which yielded forty-five potential hit compounds with novel scaffolds. We further tested those compounds using mitochondrial functional assays in neuronal cells and identified fifteen compounds with excellent protective effects against Aβ-induced mitochondrial dysfunction. To validate whether these effects derived from binding to CypD, we performed surface plasmon resonance (SPR)—based direct binding assays with selected compounds and discovered compound 29 was found to have the equilibrium dissociation constants (KD) value of 88.2 nM. This binding affinity value and biological activity correspond well with our predicted binding mode. We believe that this study offers new insights into the rational design of small molecule CypD inhibitors, and provides a promising lead for future therapeutic development.

An affinity improved single-chain antibody from phage display of a library derived from monoclonal antibodies detects fumonisins by immunoassay.

PubMed

Hu, Zu-Quan; Li, He-Ping; Wu, Ping; Li, Ya-Bo; Zhou, Zhu-Qing; Zhang, Jing-Bo; Liu, Jin-Long; Liao, Yu-Cai

2015-03-31

Fumonisin B analogs, particularly FB1, FB2, and FB3, are major mycotoxins found in cereals. Single-chain fragment variable (scFv) antibodies represent a promising alternative immunoassay system. A phage-displayed antibody library derived from four monoclonal antibodies (mAbs) generated against FB1 was used to screen high binding affinity scFv antibodies; the best candidate was designated H2. Surface plasmon resonance measurements confirmed that the H2 scFv displayed a 82-fold higher binding affinity than its parent mAb. Direct competitive enzyme-linked immunosorbent assay demonstrated that the H2 antibody could competitively bind to free FB1, FB2, and FB3, with an IC50 of 0.11, 0.04, and 0.10 μM, respectively; it had no cross-reactivity to deoxynivalenol, nivalenol and aflatoxin. Validation assays with naturally contaminated samples revealed a linear relationship between the H2 antibody-based assay results and chemical analysis results, that could be expressed as y=1.7072x+5.5606 (R(2)=0.8883). Homology modeling of H2 revealed a favorable binding structure highly complementary to the three fumonisins. Molecular docking analyses suggested that the preferential binding of the H2 scFv to FB2 was due to the presence of a hydrogen radical in its R1 position, leading to a proper electrostatic matching and hydrophobic interaction. The H2 scFv antibody can be used for the rapid, accurate, and specific detection of fumonisin contamination in agricultural samples. Copyright © 2015 Elsevier B.V. All rights reserved.

Discovery of a novel general anesthetic chemotype using high-throughput screening.

PubMed

McKinstry-Wu, Andrew R; Bu, Weiming; Rai, Ganesha; Lea, Wendy A; Weiser, Brian P; Liang, David F; Simeonov, Anton; Jadhav, Ajit; Maloney, David J; Eckenhoff, Roderic G

2015-02-01

The development of novel anesthetics has historically been a process of combined serendipity and empiricism, with most recent new anesthetics developed via modification of existing anesthetic structures. Using a novel high-throughput screen employing the fluorescent anesthetic 1-aminoanthracene and apoferritin as a surrogate for on-pathway anesthetic protein target(s), we screened a 350,000 compound library for competition with 1-aminoanthracene-apoferritin binding. Hit compounds meeting structural criteria had their binding affinities for apoferritin quantified with isothermal titration calorimetry and were tested for γ-aminobutyric acid type A receptor binding using a flunitrazepam binding assay. Chemotypes with a strong presence in the top 700 and exhibiting activity via isothermal titration calorimetry were selected for medicinal chemistry optimization including testing for anesthetic potency and toxicity in an in vivo Xenopus laevis tadpole assay. Compounds with low toxicity and high potency were tested for anesthetic potency in mice. From an initial chemical library of more than 350,000 compounds, we identified 2,600 compounds that potently inhibited 1-aminoanthracene binding to apoferritin. A subset of compounds chosen by structural criteria (700) was successfully reconfirmed using the initial assay. Based on a strong presence in both the initial and secondary screens the 6-phenylpyridazin-3(2H)-one chemotype was assessed for anesthetic activity in tadpoles. Medicinal chemistry efforts identified four compounds with high potency and low toxicity in tadpoles, two were found to be effective novel anesthetics in mice. The authors demonstrate the first use of a high-throughput screen to successfully identify a novel anesthetic chemotype and show mammalian anesthetic activity for members of that chemotype.

A Novel Antiviral Target Structure Involved in the RNA Binding, Dimerization, and Nuclear Export Functions of the Influenza A Virus Nucleoprotein

PubMed Central

Yamada, Kazunori; Kondoh, Yasumitsu; Hikono, Hirokazu; Osada, Hiroyuki; Tomii, Kentaro; Saito, Takehiko; Aida, Yoko

2015-01-01

Developing antiviral therapies for influenza A virus (IAV) infection is an ongoing process because of the rapid rate of antigenic mutation and the emergence of drug-resistant viruses. The ideal strategy is to develop drugs that target well-conserved, functionally restricted, and unique surface structures without affecting host cell function. We recently identified the antiviral compound, RK424, by screening a library of 50,000 compounds using cell-based infection assays. RK424 showed potent antiviral activity against many different subtypes of IAV in vitro and partially protected mice from a lethal dose of A/WSN/1933 (H1N1) virus in vivo. Here, we show that RK424 inhibits viral ribonucleoprotein complex (vRNP) activity, causing the viral nucleoprotein (NP) to accumulate in the cell nucleus. In silico docking analysis revealed that RK424 bound to a small pocket in the viral NP. This pocket was surrounded by three functionally important domains: the RNA binding groove, the NP dimer interface, and nuclear export signal (NES) 3, indicating that it may be involved in the RNA binding, oligomerization, and nuclear export functions of NP. The accuracy of this binding model was confirmed in a NP-RK424 binding assay incorporating photo-cross-linked RK424 affinity beads and in a plaque assay evaluating the structure-activity relationship of RK424. Surface plasmon resonance (SPR) and pull-down assays showed that RK424 inhibited both the NP-RNA and NP-NP interactions, whereas size exclusion chromatography showed that RK424 disrupted viral RNA-induced NP oligomerization. In addition, in vitro nuclear export assays confirmed that RK424 inhibited nuclear export of NP. The amino acid residues comprising the NP pocket play a crucial role in viral replication and are highly conserved in more than 7,000 NP sequences from avian, human, and swine influenza viruses. Furthermore, we found that the NP pocket has a surface structure different from that of the pocket in host molecules. Taken together, these results describe a promising new approach to developing influenza virus drugs that target a novel pocket structure within NP. PMID:26222066

Multi-Laboratory Study of Five Methods for the Determination of Brevetoxins in Shellfish Tissue Extracts.

PubMed

Dickey, Robert W; Plakas, Steven M; Jester, Edward L E; El Said, Kathleen R; Johannessen, Jan N; Flewelling, Leanne J; Scott, Paula; Hammond, Dan G; Van Dolah, Frances M; Leighfield, Tod A; Bottein Dachraoui, Marie-Yasmine; Ramsdell, John S; Pierce, Richard H; Henry, Mike S; Poli, Mark A; Walker, Calvin; Kurtz, Jan; Naar, Jerome; Baden, Daniel G; Musser, Steve M; White, Kevin D; Truman, Penelope; Miller, Aaron; Hawryluk, Timothy P; Wekell, Marleen M; Stirling, David; Quilliam, Michael A; Lee, Jung K

A thirteen-laboratory comparative study tested the performance of four methods as alternatives to mouse bioassay for the determination of brevetoxins in shellfish. The methods were N2a neuroblastoma cell assay, two variations of the sodium channel receptor binding assay, competitive ELISA, and LC/MS. Three to five laboratories independently performed each method using centrally prepared spiked and naturally incurred test samples. Competitive ELISA and receptor binding (96-well format) compared most favorably with mouse bioassay. Between-laboratory relative standard deviations (RSDR) ranged from 10 to 20% for ELISA and 14 to 31% for receptor binding. Within-laboratory (RSDr) ranged from 6 to 15% for ELISA, and 5 to 31% for receptor binding. Cell assay was extremely sensitive but data variation rendered it unsuitable for statistical treatment. LC/MS performed as well as ELISA on spiked test samples but was inordinately affected by lack of toxin-metabolite standards, uniform instrumental parameters, or both, on incurred test samples. The ELISA and receptor binding assay are good alternatives to mouse bioassay for the determination of brevetoxins in shellfish.

Assessment of a robust model protocol with accelerated throughput for a human recombinant full length estrogen receptor-alpha binding assay: protocol optimization and intralaboratory assay performance as initial steps towards validation.

PubMed

Freyberger, Alexius; Wilson, Vickie; Weimer, Marc; Tan, Shirlee; Tran, Hoai-Son; Ahr, Hans-Jürgen

2010-08-01

Despite about two decades of research in the field of endocrine active compounds, still no validated human recombinant (hr) estrogen receptor-alpha (ERalpha) binding assay is available, although hr-ERalpha is available from several sources. In a joint effort, US EPA and Bayer Schering Pharma with funding from the EU-sponsored 6th framework project, ReProTect, developed a model protocol for such a binding assay. Important features of this assay are the use of a full length hr-ERalpha and performance in a 96-well plate format. A full length hr-ERalpha was chosen, as it was considered to provide the most accurate and human-relevant results, whereas truncated receptors could perform differently. Besides three reference compounds [17beta-estradiol, norethynodrel, dibutylphthalate] nine test compounds with different affinities for the ERalpha [diethylstilbestrol (DES), ethynylestradiol, meso-hexestrol, equol, genistein, o,p'-DDT, nonylphenol, n-butylparaben, and corticosterone] were used to explore the performance of the assay. Three independent experiments per compound were performed on different days, and dilutions of test compounds from deep-frozen stocks, solutions of radiolabeled ligand and receptor preparation were freshly prepared for each experiment. The ERalpha binding properties of reference and test compounds were well detected. As expected dibutylphthalate and corticosterone were non-binders in this assay. In terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using a human recombinant ERalpha ligand binding domain. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.5. Our data demonstrate that the assay was robust and reliably ranked compounds with strong, weak, and no affinity for the ERalpha with high accuracy. It avoids the manipulation and use of animals, i.e., the preparation of uterine cytosol as receptor source from ovariectomized rats, as a recombinant protein is used and thus contributes to the 3R concept (reduce, replace, and refine). Furthermore, in contrast to other assays, this assay could be adjusted to an intermediate/high throughput format. On the whole, this assay is a promising candidate for further validation. Copyright 2010 Elsevier Inc. All rights reserved.

Assessing cellular efficacy of bromodomain inhibitors using fluorescence recovery after photobleaching

PubMed Central

2014-01-01

Background Acetylation of lysine residues in histone tails plays an important role in the regulation of gene transcription. Bromdomains are the readers of acetylated histone marks, and, consequently, bromodomain-containing proteins have a variety of chromatin-related functions. Moreover, they are increasingly being recognised as important mediators of a wide range of diseases. The first potent and selective bromodomain inhibitors are beginning to be described, but the diverse or unknown functions of bromodomain-containing proteins present challenges to systematically demonstrating cellular efficacy and selectivity for these inhibitors. Here we assess the viability of fluorescence recovery after photobleaching (FRAP) assays as a target agnostic method for the direct visualisation of an on-target effect of bromodomain inhibitors in living cells. Results Mutation of a conserved asparagine crucial for binding to acetylated lysines in the bromodomains of BRD3, BRD4 and TRIM24 all resulted in reduction of FRAP recovery times, indicating loss of or significantly reduced binding to acetylated chromatin, as did the addition of known inhibitors. Significant differences between wild type and bromodomain mutants for ATAD2, BAZ2A, BRD1, BRD7, GCN5L2, SMARCA2 and ZMYND11 required the addition of the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) to amplify the binding contribution of the bromodomain. Under these conditions, known inhibitors decreased FRAP recovery times back to mutant control levels. Mutation of the bromodomain did not alter FRAP recovery times for full-length CREBBP, even in the presence of SAHA, indicating that other domains are primarily responsible for anchoring CREBBP to chromatin. However, FRAP assays with multimerised CREBBP bromodomains resulted in a good assay to assess the efficacy of bromodomain inhibitors to this target. The bromodomain and extraterminal protein inhibitor PFI-1 was inactive against other bromodomain targets, demonstrating the specificity of the method. Conclusions Viable FRAP assays were established for 11 representative bromodomain-containing proteins that broadly cover the bromodomain phylogenetic tree. Addition of SAHA can overcome weak binding to chromatin, and the use of tandem bromodomain constructs can eliminate masking effects of other chromatin binding domains. Together, these results demonstrate that FRAP assays offer a potentially pan-bromodomain method for generating cell-based assays, allowing the testing of compounds with respect to cell permeability, on-target efficacy and selectivity. PMID:25097667

Evaluation of a new serological technique for detecting rabies virus antibodies following vaccination.

PubMed

Ma, Xiaoyue; Niezgoda, Michael; Blanton, Jesse D; Recuenco, Sergio; Rupprecht, Charles E

2012-08-03

Two major techniques are currently used to estimate rabies virus antibody values: neutralization assays, such as the rapid fluorescent focus inhibition test (RFFIT), and enzyme-linked immunosorbent assays (ELISAs). The RFFIT is considered the gold standard assay and has been used to assess the titer of rabies virus neutralizing antibodies for more than three decades. In the late 1970s, ELISA began to be used to estimate the level of rabies virus antibody and has recently been used by some laboratories as an alternate screening test for animal sera. Although the ELISA appears simpler, safer and more efficient, the assay is less sensitive in detecting low values of rabies virus neutralizing antibodies than neutralization tests. This study was designed to evaluate a new ELISA-based method for detecting rabies virus binding antibody. This new technique uses electro-chemi-luminescence labels and carbon electrode plates to detect binding events. In this comparative study, the RFFIT and the new ELISA-based technique were used to evaluate the level of rabies virus antibodies in human and animal serum samples. By using a conservative approximation of 0.15 IU/ml as a cutoff point, the new ELISA-based technique demonstrated a sensitivity of 100% and a specificity of 95% for human samples and for experimental animal samples. The sensitivity and specificity for field animal samples was 96% and 95%, respectively. The preliminary results from this study appear promising and demonstrate a higher sensitivity than traditional ELISA methods. Published by Elsevier Ltd.

Real-Time Tau Protein Detection by Sandwich-Based Piezoelectric Biosensing: Exploring Tubulin as a Mass Enhancer.

PubMed

Li, Dujuan; Scarano, Simona; Lisi, Samuele; Palladino, Pasquale; Minunni, Maria

2018-03-22

Human tau protein is one of the most advanced and accepted biomarkers for AD and tauopathies diagnosis in general. In this work, a quartz crystal balance (QCM) immunosensor was developed for the detection of human tau protein in buffer and artificial cerebrospinal fluid (aCSF), through both direct and sandwich assays. Starting from a conventional immuno-based sandwich strategy, two monoclonal antibodies recognizing different epitopes of tau protein were used, achieving a detection limit for the direct assay in nanomolar range both in HBES-EP and aCSF. Afterward, for exploring alternative specific receptors as secondary recognition elements for tau protein biosensing, we tested tubulin and compared its behavior to a conventional secondary antibody in the sandwich assay. Tau-tubulin binding has shown an extended working range coupled to a signal improvement in comparison with the conventional secondary antibody-based approach, showing a dose-response trend at lower tau concentration than is usually investigated and closer to the physiological levels in the reference matrix for protein tau biomarker. Our results open up new and encouraging perspectives for the use of tubulin as an alternative receptor for tau protein with interesting features due to the possibility of taking advantage of its polymerization and reversible binding to this key hallmark of Alzheimer's disease.

Gold nanoparticles-based electrochemical method for the detection of protein kinase with a peptide-like inhibitor as the bioreceptor

PubMed Central

Sun, Kai; Chang, Yong; Zhou, Binbin; Wang, Xiaojin; Liu, Lin

2017-01-01

This article presents a general method for the detection of protein kinase with a peptide-like kinase inhibitor as the bioreceptor, and it was done by converting gold nanoparticles (AuNPs)-based colorimetric assay into sensitive electrochemical analysis. In the colorimetric assay, the kinase-specific aptameric peptide triggered the aggregation of AuNPs in solution. However, the specific binding of peptide to the target protein (kinase) inhibited its ability to trigger the assembly of AuNPs. In the electrochemical analysis, peptides immobilized on a gold electrode and presented as solution triggered together the in situ formation of AuNPs-based network architecture on the electrode surface. Nevertheless, the formation of peptide–kinase complex on the electrode surface made the peptide-triggered AuNPs assembly difficult. Electrochemical impedance spectroscopy was used to measure the change in surface property in the binding events. When a ferrocene-labeled peptide (Fc-peptide) was used in this design, the network of AuNPs/Fc-peptide produced a good voltammetric signal. The competitive assay allowed for the detection of protein kinase A with a detection limit of 20 mU/mL. This work should be valuable for designing novel optical or electronic biosensors and likely lead to many detection applications. PMID:28331314

Trimeric Autotransporter DsrA Is a Major Mediator of Fibrinogen Binding in Haemophilus ducreyi

PubMed Central

Fusco, William G.; Elkins, Christopher

2013-01-01

Haemophilus ducreyi is the etiologic agent of the sexually transmitted genital ulcer disease chancroid. In both natural and experimental chancroid, H. ducreyi colocalizes with fibrin at the base of the ulcer. Fibrin is obtained by cleavage of the serum glycoprotein fibrinogen (Fg) by thrombin to initiate formation of the blood clot. Fg binding proteins are critical virulence factors in medically important Gram-positive bacteria. H. ducreyi has previously been shown to bind Fg in an agglutination assay, and the H. ducreyi Fg binding protein FgbA was identified in ligand blotting with denatured proteins. To better characterize the interaction of H. ducreyi with Fg, we examined Fg binding to intact, viable H. ducreyi bacteria and identified a novel Fg binding protein. H. ducreyi bound unlabeled Fg in a dose-dependent manner, as measured by two different methods. In ligand blotting with total denatured cellular proteins, digoxigenin (DIG)-Fg bound only two H. ducreyi proteins, the trimeric autotransporter DsrA and the lectin DltA; however, only the isogenic dsrA mutant had significantly less cell-associated Fg than parental strains in Fg binding assays with intact bacteria. Furthermore, expression of DsrA, but not DltA or an empty vector, rendered the non-Fg-binding H. influenzae strain Rd capable of binding Fg. A 13-amino-acid sequence in the C-terminal section of the passenger domain of DsrA appears to be involved in Fg binding by H. ducreyi. Taken together, these data suggest that the trimeric autotransporter DsrA is a major determinant of Fg binding at the surface of H. ducreyi. PMID:24042118

Characterization of the high affinity binding of epsilon toxin from Clostridium perfringens to the renal system.

PubMed

Dorca-Arévalo, Jonatan; Martín-Satué, Mireia; Blasi, Juan

2012-05-25

Epsilon toxin (ε-toxin), produced by Clostridium perfringens types B and D, causes fatal enterotoxaemia in livestock. In the renal system, the toxin binds to target cells before oligomerization, pore formation and cell death. Still, there is little information about the cellular and molecular mechanism involved in the initial steps of the cytotoxic action of ε-toxin, including the specific binding to the target sensitive cells. In the present report, the binding step of ε-toxin to the MDCK cell line is characterized by means of an ELISA-based binding assay with recombinant ε-toxin-green fluorescence protein (ε-toxin-GFP) and ε-prototoxin-GFP. In addition, different treatments with Pronase E, detergents, N-glycosidase F and beta-elimination on MDCK cells and renal cryosections have been performed to further characterize the ε-toxin binding. The ELISA assays revealed a single binding site with a similar dissociation constant (K(d)) for ε-toxin-GFP and ε-prototoxin-GFP, but a three-fold increase in B(max) levels in the case of ε-toxin-GFP. Double staining on kidney cryoslices with lectins and ε-prototoxin-GFP revealed specific binding to distal and collecting tubule cells. In addition, experiments on kidney and bladder cryoslices demonstrated the specific binding to distal tubule of a range of mammalian renal systems. Pronase E and beta-elimination treatments on kidney cryoslices and MDCK cells revealed that the binding of ε-toxin in renal system is mediated by a O-glycoprotein. Detergent treatments revealed that the integrity of the plasma membrane is required for the binding of ε-toxin to its receptor. Copyright © 2011 Elsevier B.V. All rights reserved.

Square-wave voltammetry assays for glycoproteins on nanoporous gold

PubMed Central

Pandey, Binod; Bhattarai, Jay K.; Pornsuriyasak, Papapida; Fujikawa, Kohki; Catania, Rosa; Demchenko, Alexei V.; Stine, Keith J.

2014-01-01

Electrochemical enzyme-linked lectinsorbent assays (ELLA) were developed using nanoporous gold (NPG) as a solid support for protein immobilization and as an electrode for the electrochemical determination of the product of the reaction between alkaline phosphatase (ALP) and p-aminophenyl phosphate (p-APP), which is p-aminophenol (p-AP). Glycoproteins or concanavalin A (Con A) and ALP conjugates were covalently immobilized onto lipoic acid self-assembled monolayers on NPG. The binding of Con A – ALP (or soybean agglutinin – ALP) conjugate to glycoproteins covalently immobilized on NPG and subsequent incubation with p-APP substrate was found to result in square-wave voltammograms whose peak difference current varied with the identity of the glycoprotein. NPG presenting covalently bound glycoproteins was used as the basis for a competitive electrochemical assay for glycoproteins in solution (transferrin and IgG). A kinetic ELLA based on steric hindrance of the enzyme-substrate reaction and hence reduced enzymatic reaction rate after glycoprotein binding is demonstrated using immobilized Con A–ALP conjugates. Using the immobilized Con A-ALP conjugate, the binding affinity of immunoglobulin G (IgG) was found to be 105 nM, and that for transferrin was found to be 650 nM. Minimal interference was observed in the presence of 5 mg mL−1 BSA as a model serum protein in both the kinetic and competitive ELLA. Inhibition studies were performed with methyl D-mannoside for the binding of TSF and IgG to Con A-ALP; IC50 values were found to be 90 μM and 286 μM, respectively. Surface coverages of proteins were estimated using solution depletion and the BCA protein concentration assay. PMID:24611035

Enhanced target-specific signal detection using an Escherichia coli lysate in multiplex microbead immunoassays with E. coli-derived recombinant antigens.

PubMed

Crestani, Sandra; Leitolis, Amanda; Lima, Lucianna Freitas Oliveira; Krieger, Marco A; Foti, Leonardo

2016-08-01

Diverse techniques have been developed to analyze antibody-mediated responses to infections. However, the most common tests, i.e., enzyme-linked immunosorbent assays, require separate reactions for each antigen and consequently necessitate large sample volumes. Luminex technology allows the detection of multiple antibodies in a single experiment, but nonspecific binding can impair the results. Therefore, we examined the use of Escherichia coli lysates to reduce nonspecific binding and improve the results of liquid microarrays based on Luminex technology. Anti-bacteria antibodies were detected in human serum samples, as evidenced by high median fluorescence intensity (MFI) in assays performed with paramagnetic microspheres coupled with E. coli lysates. Moreover, the addition of an E. coli lysate as a blocker reduced the nonspecific binding of antigens produced by E. coli in a concentration-dependent manner. Tris-HCl reduced MFI values in negative samples, but did not affect MFI for positive samples. For microspheres coupled with different antigens, an E. coli lysate blocker significantly improved the fluorescence signals from positive samples. The addition of Tris-HCl and the E. coli lysate induced antigen-specific differences in MFI. This combination of the E. coli lysate blocker and Tris-HCl yielded a statistically significant improvement in MFI in the assays for Chagas disease and hepatitis C virus samples. However, for the Treponema pallidum p47 antigen improvement in MFI was only observed for the preparation with the E. coli blocker at a concentration of 3%. In conclusion, the addition of an E. coli lysate and Tris-HCl to the microarray assay reduced the nonspecific binding of human anti-bacteria antibodies and, therefore, increased the specific MFI. Copyright © 2016 Elsevier B.V. All rights reserved.

Insight into the recognition, binding, and reactivity of catalytic metallodrugs targeting stem loop IIb of hepatitis C IRES RNA.

PubMed

Bradford, Seth S; Ross, Martin James; Fidai, Insiya; Cowan, James A

2014-06-01

The complex Cu-GGHYrFK-amide (1-Cu) was previously reported as a novel metallotherapeutic that catalytically inactivates stem loop IIb (SLIIb) of the hepatitis C virus (HCV) internal ribosomal entry site (IRES) RNA and demonstrates significant antiviral activity in a cellular HCV replicon assay. Herein we describe additional studies focused on understanding the cleavage mechanism as well as the relationship of catalyst configuration to structural recognition and site-selective cleavage of the structured RNA motif. These are advanced by use of a combination of MALDI-TOF mass spectrometry, melting temperature determinations, and computational analysis to develop a structural model for binding and reactivity toward SLIIb of the IRES RNA. In addition, the binding, reactivity, and structural chemistry of the all-D-amino acid form of this metallopeptide, complex 2-Cu, are reported and compared with those of complex 1-Cu. In vitro RNA binding and cleavage assays for complex 2-Cu show a KD value of 76 ± 3 nM, and Michaelis-Menten parameters of kcat =0.14 ± 0.01 min(-1) and KM =7.9 ± 1.2 μM, with a turnover number exceeding 40. In a luciferase-based cellular replicon assay Cu-GGhyrfk-amide shows activity similar to that of the 1-Cu parent peptide, with an IC50 value of 1.9 ± 0.4 μM and cytotoxicity exceeding 100 μM. RT-PCR experiments confirm a significant decrease in HCV RNA levels in replicon assays for up to nine days when treated with complex 1-Cu in three-day dosing increments. This study shows the influence that the α-carbon stereocenter has for this new class of compounds, while detailed mass spectrometry and computational analyses provide new insight into the mechanisms of recognition, binding, and reactivity. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

In vitro screening of major neurotransmitter systems possibly involved in the mechanism of action of antibodies to S100 protein in released-active form

PubMed Central

Gorbunov, Evgeniy A; Ertuzun, Irina A; Kachaeva, Evgeniya V; Tarasov, Sergey A; Epstein, Oleg I

2015-01-01

Experimentally and clinically, it was shown that released-active form of antibodies to S100 protein (RAF of Abs to S100) exerts a wide range of pharmacological activities: anxiolytic, antiasthenic, antiaggressive, stress-protective, antihypoxic, antiischemic, neuroprotective, and nootropic. The purpose of this study was to determine the influence of RAF of Abs to S100 on major neurotransmitter systems (serotoninergic, GABAergic, dopaminergic, and on sigma receptors as well) which are possibly involved in its mechanism of pharmacological activity. Radioligand binding assays were used for assessment of the drug influence on ligand–receptor interaction. [35S]GTPγS binding assay, cyclic adenosine monophosphate HTRF™, cellular dielectric spectroscopy assays, and assays based on measurement of intracellular concentration of Ca2+ ions were used for assessment of agonist or antagonist properties of the drug toward receptors. RAF of Abs to S100 increased radioligand binding to 5-HT1F, 5-HT2B, 5-HT2Cedited, 5-HT3, and to D3 receptors by 142.0%, 131.9%, 149.3%, 120.7%, and 126.3%, respectively. Also, the drug significantly inhibited specific binding of radioligands to GABAB1A/B2 receptors by 25.8%, and to both native and recombinant human sigma1 receptors by 75.3% and 40.32%, respectively. In the functional assays, it was shown that the drug exerted antagonism at 5-HT1B, D3, and GABAB1A/B2 receptors inhibiting agonist-induced responses by 23.24%, 32.76%, and 30.2%, respectively. On the contrary, the drug exerted an agonist effect at 5-HT1A receptors enhancing receptor functional activity by 28.0%. The pharmacological profiling of RAF of Abs to S100 among 27 receptor provides evidence for drug-related modification of major neurotransmitter systems. PMID:26604768

Lectins discriminate between pathogenic and nonpathogenic South American trypanosomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

de Miranda Santos, I.K.; Pereira, M.E.

1984-09-01

Cell surface carbohydrates of Trypanosoma cruzi, Trypanosoma rangeli, and Trypanosoma conorhini were analyzed by a micro-agglutination assay employing 27 highly purified lectins and by binding assays using various /sup 125/I-labeled lectins. The following seven lectins discriminated between the trypanosomes: 1) tomato lectin (an N-acetyl-D-glucosamine-binding protein), both in purified form and as crude tomato juice; 2) Bauhinea purpurea and Sophora japonica lectins (both N-acetyl-D-galactosamine-binding proteins), which selectively agglutinated T. cruzi; 3) Vicia villosa (an N-acetyl-D-galactosamine-binding protein) which was specific for T. rangeli; 4) peanut lectin (a D-galactose-binding protein) both in purified form and as crude saline extract; and 5) Ulex europaeusmore » and Lotus tetragonolobus (both L-fucose-binding proteins) lectins which reacted only with T. conorhini. Binding studies with 125I-labeled lectins were performed to find whether unagglutinated cells of the three different species of trypanosomes might have receptors for these lectins, in which case absence of agglutination could be due to a peculiar arrangement of the receptors. These assays essentially confirmed the agglutination experiments.« less

Novel Confocal Microscopic and Flow Cytometric Based Assays to Visualize and Detect the (Beta)2-Adrenergic Receptor in Human Lymphocyte and Mononuclear Cell Populations

NASA Technical Reports Server (NTRS)

Salicru, A. N.; Crucian, B. E.; Nelman, M. A.; Sams, C. F.; Actor, J. K.; Marshall, G. D.

2006-01-01

The data show that immunophenotyping of leukocyte populations with (beta)2AR is possible with the commercially available Ab, although the FC assay is limited to the IST as a result of the Ab binding site to the intracellular C-terminus of the 2AR. The FC assay has applications for measuring alterations in total (beta)2AR in human leukocyte populations as changes in fluorescence. In addition, CM confirms that both surface and intracellular compartments stain positively for the (beta)2AR and can be used for qualitative assays that screen for changes in receptor compartmentalization and localization.

A versatile assay for RNA-binding proteins in living cells

PubMed Central

Strein, Claudia; Alleaume, Anne-Marie; Rothbauer, Ulrich; Hentze, Matthias W.; Castello, Alfredo

2014-01-01

RNA-binding proteins (RBPs) control RNA fate from synthesis to decay. Since their cellular expression levels frequently do not reflect their in vivo activity, methods are needed to assess the steady state RNA-binding activity of RBPs as well as their responses to stimuli. While electrophoresis mobility shift assays (EMSA) have been used for such determinations, their results serve at best as proxies for the RBP activities in living cells. Here, we describe a quantitative dual fluorescence method to analyze protein–mRNA interactions in vivo. Known or candidate RBPs are fused to fluorescent proteins (eGFP, YFP), expressed in cells, cross-linked in vivo to RNA by ultraviolet light irradiation, and immunoprecipitated, after lysis, with a single chain antibody fragment directed against eGFP (GFP-binding protein, GBP). Polyadenylated RNA-binding activity of fusion proteins is assessed by hybridization with an oligo(DT) probe coupled with a red fluorophore. Since UV light is directly applied to living cells, the assay can be used to monitor dynamic changes in RNA-binding activities in response to biological or pharmacological stimuli. Notably, immunoprecipitation and hybridization can also be performed with commercially available GBP-coupled 96-well plates (GFP-multiTrap), allowing highly parallel RNA-binding measurements in a single experiment. Therefore, this method creates the possibility to conduct in vivo high-throughput RNA-binding assays. We believe that this fast and simple radioactivity-free method will find many useful applications in RNA biology. PMID:24664470

From Bits and Pieces to Whole Phage to Nanomachines: Pathogen Detection Using Bacteriophages.

PubMed

Anany, H; Chou, Y; Cucic, S; Derda, R; Evoy, S; Griffiths, M W

2017-02-28

The innate specificity of bacteriophages toward their hosts makes them excellent candidates for the development of detection assays. They can be used in many ways to detect pathogens, and each has its own advantages and disadvantages. Whole bacteriophages can carry reporter genes to alter the phenotype of the target. Bacteriophages can act as staining agents or the progeny of the infection process can be detected, which further increases the sensitivity of the detection assay. Compared with whole-phage particles, use of phage components as probes offers other advantages: for example, smaller probe size to enhance binding activity, phage structures that can be engineered for better affinity, as well as specificity, binding properties, and robustness. When no natural binding with the target exists, phages can be used as vehicles to identify new protein-ligand interactions necessary for diagnostics. This review comprehensively summarizes many uses of phages as detection tools and points the way toward how phage-based technologies may be improved.

Sequence, Structure, and Context Preferences of Human RNA Binding Proteins.

PubMed

Dominguez, Daniel; Freese, Peter; Alexis, Maria S; Su, Amanda; Hochman, Myles; Palden, Tsultrim; Bazile, Cassandra; Lambert, Nicole J; Van Nostrand, Eric L; Pratt, Gabriel A; Yeo, Gene W; Graveley, Brenton R; Burge, Christopher B

2018-06-07

RNA binding proteins (RBPs) orchestrate the production, processing, and function of mRNAs. Here, we present the affinity landscapes of 78 human RBPs using an unbiased assay that determines the sequence, structure, and context preferences of these proteins in vitro by deep sequencing of bound RNAs. These data enable construction of "RNA maps" of RBP activity without requiring crosslinking-based assays. We found an unexpectedly low diversity of RNA motifs, implying frequent convergence of binding specificity toward a relatively small set of RNA motifs, many with low compositional complexity. Offsetting this trend, however, we observed extensive preferences for contextual features distinct from short linear RNA motifs, including spaced "bipartite" motifs, biased flanking nucleotide composition, and bias away from or toward RNA structure. Our results emphasize the importance of contextual features in RNA recognition, which likely enable targeting of distinct subsets of transcripts by different RBPs that recognize the same linear motif. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Direct fluorescence anisotropy assay for cocaine using tetramethylrhodamine-labeled aptamer.

PubMed

Liu, Yingxiong; Zhao, Qiang

2017-06-01

Development of simple, sensitive, and rapid method for cocaine detection is important in medicine and drug abuse monitoring. Taking advantage of fluorescence anisotropy and aptamer, this study reports a direct fluorescence anisotropy (FA) assay for cocaine by employing an aptamer probe with tetramethylrhodamine (TMR) labeled on a specific position. The binding of cocaine and the aptamer causes a structure change of the TMR-labeled aptamer, leading to changes of the interaction between labeled TMR and adjacent G bases in aptamer sequence, so FA of TMR varies with increasing of cocaine. After screening different labeling positions of the aptamer, including thymine (T) bases and terminals of the aptamer, we obtained a favorable aptamer probe with TMR labeled on the 25th base T in the sequence, which exhibited sensitive and significant FA-decreasing responses upon cocaine. Under optimized assay conditions, this TMR-labeled aptamer allowed for direct FA detection of cocaine as low as 5 μM. The maximum FA change reached about 0.086. This FA method also enabled the detection of cocaine spiked in diluted serum and urine samples, showing potential for applications. Graphical Abstract The binding of cocaine to the TMR-labeled aptamer causes conformation change and alteration of the intramolecular interaction between TMR and bases of aptamer, leading to variance of fluorescence anisotropy (FA) of TMR, so direct FA analyis of cocaine is achieved.

Probing structurally altered and aggregated states of therapeutically relevant proteins using GroEL coupled to bio-layer interferometry

PubMed Central

Naik, Subhashchandra; Kumru, Ozan S; Cullom, Melissa; Telikepalli, Srivalli N; Lindboe, Elizabeth; Roop, Taylor L; Joshi, Sangeeta B; Amin, Divya; Gao, Phillip; Middaugh, C Russell; Volkin, David B; Fisher, Mark T

2014-01-01

The ability of a GroEL-based bio-layer interferometry (BLI) assay to detect structurally altered and/or aggregated species of pharmaceutically relevant proteins is demonstrated. Assay development included optimizing biotinylated-GroEL immobilization to streptavidin biosensors, combined with biophysical and activity measurements showing native and biotinylated GroEL are both stable and active. First, acidic fibroblast growth factor (FGF-1) was incubated under conditions known to promote (40°C) and inhibit (heparin addition) molten globule formation. Heat exposed (40°C) FGF-1 exhibited binding to GroEL-biosensors, which was significantly diminished in the presence of heparin. Second, a polyclonal human IgG solution containing 6–8% non-native dimer showed an increase in higher molecular weight aggregates upon heating by size exclusion chromatography (SEC). The poly IgG solution displayed binding to GroEL-biosensors initially with progressively increased binding upon heating. Enriched preparations of the IgG dimers or monomers showed significant binding to GroEL-biosensors. Finally, a thermally treated IgG1 monoclonal antibody (mAb) solution also demonstrated increased GroEL-biosensor binding, but with different kinetics. The bound complexes could be partially to fully dissociated after ATP addition (i.e., specific GroEL binding) depending on the protein, environmental stress, and the assay’s experimental conditions. Transmission electron microscopy (TEM) images of GroEL-mAb complexes, released from the biosensor, also confirmed interaction of bound complexes at the GroEL binding site with heat-stressed mAb. Results indicate that the GroEL-biosensor-BLI method can detect conformationally altered and/or early aggregation states of proteins, and may potentially be useful as a rapid, stability-indicating biosensor assay for monitoring the structural integrity and physical stability of therapeutic protein candidates. PMID:25043635

Integrated In Silico-In Vitro Identification and Characterization of the SH3-Mediated Interaction between Human PTTG and its Cognate Partners in Medulloblastoma.

PubMed

Liu, Jiangang; Wang, Dapeng; Li, Yanyan; Yao, Hui; Zhang, Nan; Zhang, Xuewen; Zhong, Fangping; Huang, Yulun

2018-06-01

The human pituitary tumor-transforming gene is an oncogenic protein which serves as a central hub in the cellular signaling network of medulloblastoma. The protein contains two vicinal PxxP motifs at its C terminus that are potential binding sites of peptide-recognition SH3 domains. Here, a synthetic protocol that integrated in silico analysis and in vitro assay was described to identify the SH3-binding partners of pituitary tumor-transforming gene in the gene expression profile of medulloblastoma. In the procedure, a variety of structurally diverse, non-redundant SH3 domains with high gene expression in medulloblastoma were compiled, and their three-dimensional structures were either manually retrieved from the protein data bank database or computationally modeled through bioinformatics technique. The binding capability of these domains towards the two PxxP-containing peptides m1p: 161 LGPPSPVK 168 and m2p: 168 KMPSPPWE 175 of pituitary tumor-transforming gene were ranked by structure-based scoring and fluorescence-based assay. Consequently, a number of SH3 domains, including MAP3K and PI3K, were found to have moderate or high affinity for m1p and/or m2p. Interestingly, the two overlapping peptides exhibits a distinct binding profile to these identified domain partners, suggesting that the binding selectivity of m1p and m2p is optimized across the medulloblastoma expression spectrum by competing for domain candidates. In addition, two redesigned versions of m1p peptide ware obtained via a structure-based rational mutation approach, which exhibited an increased affinity for the domain as compared to native peptide.

Nanobiophotonics for molecular imaging of cancer: Au- and Ag-based Epidermal Growth Factor receptor (EGFR) specific nanoprobes

NASA Astrophysics Data System (ADS)

Lucas, Leanne J.; Hewitt, Kevin C.

2012-03-01

Our aim is to create and validate a novel SERS-based nanoprobe for optical imaging of the epidermal growth factor receptor (EGFR). Gold and silver nanoparticles (Au/AgNPs) of various sizes were synthesized and coupled to epidermal growth factor (EGF) via a short ligand, α-lipoic acid (206 g/mol), which binds strongly to both Au and Ag nanoparticles via its disulfide end group. We used carbodiimide chemistry to couple EGF to α-lipoic acid. These nanoprobes were tested for binding affinity using Enzyme Linked ImmunoSorbent Assay (ELISA) and, in-vitro, using EGFRoverexpressing A431 cells. The nanoprobes show excellent EGFR-specific binding. Time of Flight Mass Spectrometry demonstrate the carbodiimide based linking of the carboxylic acid end-group of α-lipoic acid to one or more of the three (terminal, or 2 lysine) amine groups on EGF. ELISA confirms that the linked EGF is active by itself, and following conjugation with gold or silver nanoparticles. Compared with bare nanoparticles, UV-Vis spectroscopy of Ag-based nanoprobes exhibit significant plasmon red-shift, while there was no discernable shift for Au-based ones. Dark field microscopy shows abundant uptake by EGFR overexpressing A431 cells, and serves to further confirm the excellent binding affinity. Nanoprobe internalization and consequent aggregation is thought to be the basis of enhanced light scattering in the dark field images, supporting the notion that these nanoprobes should provide excellent SERS signals at all nanoprobe sizes. In summary, novel EGFR-specific nanoprobes have been synthesized and validated by standard assay and in cell culture for use as SERS optical imaging probes.

Improved flow cytometer measurement of binding assays

DOEpatents

Saunders, G.C.

1984-05-30

The invention relates to a method of measuring binding assays carried out with different size particles wherein the binding assay sample is run through a flow cytometer without separating the sample from the marking agent. The amount of a binding reactant present in a sample is determined by providing particles with a coating of binder and also a known quantity of smaller particles with a coating of binder reactant. The binding reactant is the same as the binding reactant present in the sample. The smaller particles also contain a fluorescent chemical. The particles are combined with the sample and the binding reaction is allowed to occur for a set length of time followed by combining the smaller particles with the mixture of the particles and the sample produced and allowing the binding reactions to proceed to equilibrium. The fluorescence and light scatter of the combined mixture is then measured as the combined mixture passes through a flow cytometer equipped with a laser to bring about fluorescence, and the number and strength of fluorescent events are compared. A similar method is also provided for determining the amount of antigen present in the sample by providing spheres with an antibody coating and some smaller spheres with an antigen coating. (LEW)

Screening a fragment cocktail library using ultrafiltration

PubMed Central

Shibata, Sayaka; Zhang, Zhongsheng; Korotkov, Konstantin V.; Delarosa, Jaclyn; Napuli, Alberto; Kelley, Angela M.; Mueller, Natasha; Ross, Jennifer; Zucker, Frank H.; Buckner, Frederick S.; Merritt, Ethan A.; Verlinde, Christophe L. M. J.; Van Voorhis, Wesley C.; Hol, Wim G. J.; Fan, Erkang

2011-01-01

Ultrafiltration provides a generic method to discover ligands for protein drug targets with millimolar to micromolar Kd, the typical range of fragment-based drug discovery. This method was tailored to a 96-well format, and cocktails of fragment-sized molecules, with molecular masses between 150 and 300 Da, were screened against medical structural genomics target proteins. The validity of the method was confirmed through competitive binding assays in the presence of ligands known to bind the target proteins. PMID:21750879

Discovery of Small-Molecule Nonfluorescent Inhibitors of Fluorogen-Fluorogen Activating Protein Binding Pair.

PubMed

Wu, Yang; Stauffer, Shaun R; Stanfield, Robyn L; Tapia, Phillip H; Ursu, Oleg; Fisher, Gregory W; Szent-Gyorgyi, Christopher; Evangelisti, Annette; Waller, Anna; Strouse, J Jacob; Carter, Mark B; Bologa, Cristian; Gouveia, Kristine; Poslusney, Mike; Waggoner, Alan S; Lindsley, Craig W; Jarvik, Jonathan W; Sklar, Larry A

2016-01-01

A new class of biosensors, fluorogen activating proteins (FAPs), has been successfully used to track receptor trafficking in live cells. Unlike the traditional fluorescent proteins (FPs), FAPs do not fluoresce unless bound to their specific small-molecule fluorogens, and thus FAP-based assays are highly sensitive. Application of the FAP-based assay for protein trafficking in high-throughput flow cytometry resulted in the discovery of a new class of compounds that interferes with the binding between fluorogens and FAP, thus blocking the fluorescence signal. These compounds are high-affinity, nonfluorescent analogs of fluorogens with little or no toxicity to the tested cells and no apparent interference with the normal function of FAP-tagged receptors. The most potent compound among these, N,4-dimethyl-N-(2-oxo-2-(4-(pyridin-2-yl)piperazin-1-yl)ethyl)benzenesulfonamide (ML342), has been investigated in detail. X-ray crystallographic analysis revealed that ML342 competes with the fluorogen, sulfonated thiazole orange coupled to diethylene glycol diamine (TO1-2p), for the same binding site on a FAP, AM2.2. Kinetic analysis shows that the FAP-fluorogen interaction is more complex than a homogeneous one-site binding process, with multiple conformational states of the fluorogen and/or the FAP, and possible dimerization of the FAP moiety involved in the process. © 2015 Society for Laboratory Automation and Screening.

Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

PubMed

Barnert, R H; Zeichhardt, H; Habermehl, K O

1992-02-01

Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

In vitro and in silico assessment of the structure-dependent binding of bisphenol analogues to glucocorticoid receptor.

PubMed

Zhang, Jie; Zhang, Tiehua; Guan, Tianzhu; Yu, Hansong; Li, Tiezhu

2017-03-01

Widespread use of bisphenol A (BPA) and other bisphenol analogues has attracted increasing attention for their potential adverse effects. As environmental endocrine-disrupting compounds (EDCs), bisphenols (BPs) may activate a variety of nuclear receptors, including glucocorticoid receptor (GR). In this work, the binding of 11 BPs to GR was investigated by fluorescence polarization (FP) assay in combination with molecular dynamics simulations. The human glucocorticoid receptor was prepared as a soluble recombinant protein. A fluorescein-labeled dexamethasone derivative (Dex-fl) was employed as tracer. Competitive displacement of Dex-fl from GR by BPs showed that the binding affinities of bisphenol analogues were largely dependent on their characteristic functional groups. In order to further understand the relationship between BPs structures and their GR-mediated activities, molecular docking was utilized to explore the binding modes at the atomic level. The results confirmed that structural variations of bisphenol analogues contributed to different interactions of BPs with GR, potentially causing distinct toxic effects. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation (R 2  = 0.8266), which might be helpful for the design of environmentally benign materials with reduced toxicities. In addition, the established FP assay based on GR exhibited the potential to offer an alternative to traditional methods for the detection of bisphenols.

Establishment of a robust dengue virus NS3-NS5 binding assay for identification of protein-protein interaction inhibitors.

PubMed

Takahashi, Hirotaka; Takahashi, Chikako; Moreland, Nicole J; Chang, Young-Tae; Sawasaki, Tatsuya; Ryo, Akihide; Vasudevan, Subhash G; Suzuki, Youichi; Yamamoto, Naoki

2012-12-01

Whereas the dengue virus (DENV) non-structural (NS) proteins NS3 and NS5 have been shown to interact in vitro and in vivo, the biological relevance of this interaction in viral replication has not been fully clarified. Here, we first applied a simple and robust in vitro assay based on AlphaScreen technology in combination with the wheat-germ cell-free protein production system to detect the DENV-2 NS3-NS5 interaction in a 384-well plate. The cell-free-synthesized NS3 and NS5 recombinant proteins were soluble and in possession of their respective enzymatic activities in vitro. In addition, AlphaScreen assays using the recombinant proteins detected a specific interaction between NS3 and NS5 with a robust Z' factor of 0.71. By employing the AlphaScreen assay, we found that both the N-terminal protease and C-terminal helicase domains of NS3 are required for its association with NS5. Furthermore, a competition assay revealed that the binding of full-length NS3 to NS5 was significantly inhibited by the addition of an excess of NS3 protease or helicase domains. Our results demonstrate that the AlphaScreen assay can be used to discover novel antiviral agents targeting the interactions between DENV NS proteins. Copyright © 2012 Elsevier B.V. All rights reserved.

Efavirenz directly modulates the oestrogen receptor and induces breast cancer cell growth.

PubMed

Sikora, M J; Rae, J M; Johnson, M D; Desta, Z

2010-10-01

Efavirenz-based HIV therapy is associated with breast hypertrophy and gynaecomastia. Here, we tested the hypothesis that efavirenz induces gynaecomastia through direct binding and modulation of the oestrogen receptor (ER). To determine the effect of efavirenz on growth, the oestrogen-dependent, ER-positive breast cancer cell lines MCF-7, T47D and ZR-75-1 were treated with efavirenz under oestrogen-free conditions in the presence or absence of the anti-oestrogen ICI 182,780. Cells treated with 17β-oestradiol in the absence or presence of ICI 182,780 served as positive and negative controls, respectively. Cellular growth was assayed using the crystal violet staining method and an in vitro receptor binding assay was used to measure the ER binding affinity of efavirenz. Efavirenz induced growth in MCF-7 cells with an estimated effective concentration for half-maximal growth (EC(50)) of 15.7 μM. This growth was reversed by ICI 182,780. Further, efavirenz binds directly to the ER [inhibitory concentration for half maximal binding (IC(50)) of ∼52 μM] at a roughly 1000-fold higher concentration than observed with 17β-oestradiol. Our data suggest that efavirenz-induced gynaecomastia may be caused, at least in part, by drug-induced ER activation in breast tissues.

Synthesis and characterization of a Eu-DTPA-PEGO-MSH(4) derivative for evaluation of binding of multivalent molecules to melanocortin receptors.

PubMed

Xu, Liping; Vagner, Josef; Alleti, Ramesh; Rao, Venkataramanarao; Jagadish, Bhumasamudram; Morse, David L; Hruby, Victor J; Gillies, Robert J; Mash, Eugene A

2010-04-15

A labeled variant of MSH(4), a tetrapeptide that binds to the human melanocortin 4 receptor (hMC4R) with low microM affinity, was prepared by solid-phase synthesis methods, purified, and characterized. The labeled ligand, Eu-DTPA-PEGO-His-dPhe-Arg-Trp-NH(2), exhibited a K(d) for hMC4R of 9.1+/-1.4 microM, approximately 10-fold lower affinity than the parental ligand. The labeled MSH(4) derivative was employed in a competitive binding assay to characterize the interactions of hMC4R with monovalent and divalent MSH(4) constructs derived from squalene. The results were compared with results from a similar assay that employed a more potent labeled ligand, Eu-DTPA-NDP-alpha-MSH. While results from the latter assay reflected only statistical effects, results from the former assay reflected a mixture of statistical, proximity, and/or cooperative binding effects. Copyright 2010 Elsevier Ltd. All rights reserved.

Screening Anti-Cancer Drugs against Tubulin using Catch-and-Release Electrospray Ionization Mass Spectrometry

NASA Astrophysics Data System (ADS)

Rezaei Darestani, Reza; Winter, Philip; Kitova, Elena N.; Tuszynski, Jack A.; Klassen, John S.

2016-05-01

Tubulin, which is the building block of microtubules, plays an important role in cell division. This critical role makes tubulin an attractive target for the development of chemotherapeutic drugs to treat cancer. Currently, there is no general binding assay for tubulin-drug interactions. The present work describes the application of the catch-and-release electrospray ionization mass spectrometry (CaR-ESI-MS) assay to investigate the binding of colchicinoid drugs to αβ-tubulin dimers extracted from porcine brain. Proof-of-concept experiments using positive (ligands with known affinities) and negative (non-binders) controls were performed to establish the reliability of the assay. The assay was then used to screen a library of seven colchicinoid analogues to test their binding to tubulin and to rank their affinities.

Competitive Enzyme-Linked Immunosorbent Assay Based on a Rhoptry-Associated Protein 1 Epitope Specifically Identifies Babesia bovis-Infected Cattle

PubMed Central

Goff, Will L.; McElwain, Terry F.; Suarez, Carlos E.; Johnson, Wendell C.; Brown, Wendy C.; Norimine, Junzo; Knowles, Donald P.

2003-01-01

The competitive enzyme-linked immunosorbent assay (cELISA) format has proven to be an accurate, reliable, easily standardized, and high-throughput method for detecting hemoparasite infections. In the present study, a species-specific, broadly conserved, and tandemly repeated B-cell epitope within the C terminus of the rhoptry-associated protein 1 of the hemoparasite Babesia bovis was cloned and expressed as a histidine-tagged thioredoxin fusion peptide and used as antigen in a cELISA. The assay was optimized with defined negative and positive bovine sera, where positive sera inhibited the binding of the epitope-specific monoclonal antibody BABB75A4. The cELISA accurately differentiated animals with B. bovis-specific antibodies from uninfected animals and from animals with antibodies against other tick-borne hemoparasites (98.7% specificity). In addition, B. bovis-specific sera from Australia, Argentina, Bolivia, Puerto Rico, and Morocco inhibited the binding of BABB75A4, confirming conservation of the epitope. The assay first detected experimentally infected animals between 13 and 17 days postinfection, and with sera from naturally infected carrier cattle, was comparable to indirect immunofluorescence (98.3% concordance). The assay appears to have the characteristics necessary for an epidemiologic and disease surveillance tool. PMID:12522037

Direct replacement of antibodies with molecularly imprinted polymer nanoparticles in ELISA--development of a novel assay for vancomycin.

PubMed

Chianella, Iva; Guerreiro, Antonio; Moczko, Ewa; Caygill, J Sarah; Piletska, Elena V; De Vargas Sansalvador, Isabel M Perez; Whitcombe, Michael J; Piletsky, Sergey A

2013-09-03

A simple and straightforward technique for coating microplate wells with molecularly imprinted polymer nanoparticles (nanoMIPs) to develop assays similar to the enzyme-linked immunosorbent assay (ELISA) is presented here for the first time. NanoMIPs were synthesized by a solid-phase approach with an immobilized vancomycin (template) and characterized using Biacore 3000, dynamic light scattering, and electron microscopy. Immobilization, blocking, and washing conditions were optimized in microplate format. The detection of vancomycin was achieved in competitive binding experiments with a horseradish peroxidase-vancomycin conjugate. The assay was capable of measuring vancomycin in buffer and in blood plasma within the range of 0.001-70 nM with a detection limit of 0.0025 nM (2.5 pM). The sensitivity of the assay was 3 orders of magnitude better than a previously described ELISA based on antibodies. In these experiments, nanoMIPs have shown high affinity and minimal interference from blood plasma components. Immobilized nanoMIPs were stored for 1 month at room temperature without any detrimental effects to their binding properties. The high affinity of nanoMIPs and the lack of a requirement for cold chain logistics make them an attractive alternative to traditional antibodies used in ELISA.

A dynamic sandwich assay on magnetic beads for selective detection of single-nucleotide mutations at room temperature.

PubMed

Wang, Junxiu; Xiong, Guoliang; Ma, Liang; Wang, Shihui; Zhou, Xu; Wang, Lei; Xiao, Lehui; Su, Xin; Yu, Changyuan

2017-08-15

Single-nucleotide mutation (SNM) has proven to be associated with a variety of human diseases. Development of reliable methods for the detection of SNM is crucial for molecular diagnosis and personalized medicine. The sandwich assays are widely used tools for detecting nucleic acid biomarkers due to their low cost and rapid signaling. However, the poor hybridization specificity of signal probe at room temperature hampers the discrimination of mutant and wild type. Here, we demonstrate a dynamic sandwich assay on magnetic beads for SNM detection based on the transient binding between signal probe and target. By taking the advantage of mismatch sensitive thermodynamics of transient DNA binding, the dynamic sandwich assay exhibits high discrimination factor for mutant with a broad range of salt concentration at room temperature. The beads used in this assay serve as a tool for separation, and might be helpful to enhance SNM selectivity. Flexible design of signal probe and facile magnetic separation allow multiple-mode downstream analysis including colorimetric detection and isothermal amplification. With this method, BRAF mutations in the genomic DNA extracted from cancer cell lines were tested, allowing sensitive detection of SNM at very low abundances (0.1-0.5% mutant/wild type). Copyright © 2017 Elsevier B.V. All rights reserved.

In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A

PubMed Central

Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

2015-01-01

A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5’-end including the 5’-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer. PMID:26221730

In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.

PubMed

Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

2015-01-01

A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.

Engineered domain-based assays to identify individual antibodies in oligoclonal combinations targeting the same protein.

PubMed

Meng, Q; Garcia-Rodriguez, C; Manzanarez, G; Silberg, M A; Conrad, F; Bettencourt, J; Pan, X; Breece, T; To, R; Li, M; Lee, D; Thorner, L; Tomic, M T; Marks, J D

2012-11-15

Quantitation of individual monoclonal antibodies (mAbs) within a combined antibody drug product is required for preclinical and clinical drug development. We have developed two antitoxins, XOMA 3B and XOMA 3E, each consisting of three mAbs that neutralize type B and type E botulinum neurotoxin (BoNT/B and BoNT/E) to treat serotype B and E botulism. To develop mAb-specific binding assays for each antitoxin, we mapped the epitopes of the six mAbs. Each mAb bound an epitope on either the BoNT light chain (LC) or translocation domain (H(N)). Epitope mapping data were used to design LC-H(N) domains with orthogonal mutations to make them specific for only one mAb in either XOMA 3B or XOMA 3E. Mutant LC-H(N) domains were cloned, expressed, and purified from Escherichia coli. Each mAb bound only to its specific domain with affinity comparable to the binding to holotoxin. Further engineering of domains allowed construction of enzyme-linked immunosorbent assays (ELISAs) that could characterize the integrity, binding affinity, and identity of each of the six mAbs in XOMA 3B and 3E without interference from the three BoNT/A mAbs in XOMA 3AB. Such antigen engineering is a general method allowing quantitation and characterization of individual mAbs in a mAb cocktail that bind the same protein. Copyright © 2012 Elsevier Inc. All rights reserved.

Synthesis and pharmacological evaluation of indole-based sigma receptor ligands

PubMed Central

Mésangeau, Christophe; Amata, Emanuele; Alsharif, Walid; Seminerio, Michael J.; Robson, Matthew J.; Matsumoto, Rae R.; Poupaert, Jacques H.; McCurdy, Christopher R.

2011-01-01

A series of novel indole-based analogues were prepared and their affinities for sigma receptors were determined using in vitro radioligand binding assays. The results of this study identified several compounds with nanomolar sigma-2 affinity and significant selectivity over sigma-1 receptors. In particular, 2-(4-(3-(4-fluorophenyl)indol-1-yl)butyl)-6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline (9f) was found to display high affinity at sigma-2 receptors with good selectivity (σ-1/σ-2 = 395). The pharmacological binding profile for this compound was established with other relevant nonsigma sites. PMID:21899931

Oleamide activates peroxisome proliferator-activated receptor gamma (PPARγ) in vitro.

PubMed

Dionisi, Mauro; Alexander, Stephen P H; Bennett, Andrew J

2012-05-14

Oleamide (ODA) is a fatty acid primary amide first identified in the cerebrospinal fluid of sleep-deprived cats, which exerts effects on vascular and neuronal tissues, with a variety of molecular targets including cannabinoid receptors and gap junctions. It has recently been reported to exert a hypolipidemic effect in hamsters. Here, we have investigated the nuclear receptor family of peroxisome proliferator-activated receptors (PPARs) as potential targets for ODA action. Activation of PPARα, PPARβ and PPARγ was assessed using recombinant expression in Chinese hamster ovary cells with a luciferase reporter gene assay. Direct binding of ODA to the ligand binding domain of each of the three PPARs was monitored in a cell-free fluorescent ligand competition assay. A well-established assay of PPARγ activity, the differentiation of 3T3-L1 murine fibroblasts into adipocytes, was assessed using an Oil Red O uptake-based assay. ODA, at 10 and 50 μM, was able to transactivate PPARα, PPARβ and PPARγ receptors. ODA bound to the ligand binding domain of all three PPARs, although complete displacement of fluorescent ligand was only evident for PPARγ, at which an IC50 value of 38 μM was estimated. In 3T3-L1 cells, ODA, at 10 and 20 μM, induced adipogenesis. We have, therefore, identified a novel site of action of ODA through PPAR nuclear receptors and shown how ODA should be considered as a weak PPARγ ligand in vitro.

Designed Ankyrin Repeat Proteins: A New Approach to Mimic Complex Antigens for Diagnostic Purposes?

PubMed Central

Hausammann, Stefanie; Vogel, Monique; Kremer Hovinga, Johanna A.; Lacroix-Desmazes, Sebastien; Stadler, Beda M.; Horn, Michael P.

2013-01-01

Inhibitory antibodies directed against coagulation factor VIII (FVIII) can be found in patients with acquired and congenital hemophilia A. Such FVIII-inhibiting antibodies are routinely detected by the functional Bethesda Assay. However, this assay has a low sensitivity and shows a high inter-laboratory variability. Another method to detect antibodies recognizing FVIII is ELISA, but this test does not allow the distinction between inhibitory and non-inhibitory antibodies. Therefore, we aimed at replacing the intricate antigen FVIII by Designed Ankyrin Repeat Proteins (DARPins) mimicking the epitopes of FVIII inhibitors. As a model we used the well-described inhibitory human monoclonal anti-FVIII antibody, Bo2C11, for the selection on DARPin libraries. Two DARPins were selected binding to the antigen-binding site of Bo2C11, which mimic thus a functional epitope on FVIII. These DARPins inhibited the binding of the antibody to its antigen and restored FVIII activity as determined in the Bethesda assay. Furthermore, the specific DARPins were able to recognize the target antibody in human plasma and could therefore be used to test for the presence of Bo2C11-like antibodies in a large set of hemophilia A patients. These data suggest, that our approach might be used to isolate epitopes from different sets of anti-FVIII antibodies in order to develop an ELISA-based screening assay allowing the distinction of inhibitory and non-inhibitory anti-FVIII antibodies according to their antibody signatures. PMID:23626669

Cry1Ac and Vip3Aa proteins from Bacillus thuringiensis targeting Cry toxin resistance in Diatraea flavipennella and Elasmopalpus lignosellus from sugarcane

PubMed Central

2017-01-01

The biological potential of Vip and Cry proteins from Bacillus is well known and widely established. Thus, it is important to look for new genes showing different modes of action, selecting those with differentiated entomotoxic activity against Diatraea flavipennella and Elasmopalpus lignosellus, which are secondary pests of sugarcane. Therefore, Cry1 and Vip3 proteins were expressed in Escherichia coli, and their toxicities were evaluated based on bioassays using neonate larvae. Of those, the most toxic were Cry1Ac and Vip3Aa considering the LC50 values. Toxins from E. coli were purified, solubilized, trypsinized, and biotinylated. Brush Border Membrane Vesicles (BBMVs) were prepared from intestines of the two species to perform homologous and heterologous competition assays. The binding assays demonstrated interactions between Cry1Aa, Cry1Ac, and Vip3Aa toxins and proteins from the BBMV of D. flavipennella and E. lignosellus. Homologous competition assays demonstrated that binding to one of the BBMV proteins was specific for each toxin. Heterologous competition assays indicated that Vip3Aa was unable to compete for Cry1Ac toxin binding. Our results suggest that Cry1Ac and Vip3Aa may have potential in future production of transgenic sugarcane for control of D. flavipennella and E. lignosellus, but more research is needed on the potential antagonism or synergism of the toxins in these pests. PMID:28123906

Odorant-binding protein-based identification of natural spatial repellents for the African malaria mosquito Anopheles gambiae.

PubMed

Kröber, Thomas; Koussis, Konstantinos; Bourquin, Martine; Tsitoura, Panagiota; Konstantopoulou, Maria; Awolola, Taiwo Sam; Dani, Francesca R; Qiao, Huili; Pelosi, Paolo; Iatrou, Kostas; Guerin, Patrick M

2018-05-01

There is increasing interest in the development of effective mosquito repellents of natural origin to reduce transmission of diseases such as malaria and yellow fever. To achieve this we have employed an in vitro competition assay involving odorant-binding proteins (OBPs) of the malaria mosquito, Anopheles gambiae, with a predominantly female expression bias to identify plant essential oils (EOs) containing bioactive compounds that target mosquito olfactory function. EOs and their fractions capable of binding to such OBPs displayed repellence against female mosquitoes in a laboratory repellent assay. Repellent EOs were subjected to gas chromatographic analysis linked to antennogram (EAG) recordings from female A. gambiae to identify the biologically active constituents. Among these compounds cumin alcohol, carvacrol, ethyl cinnamate and butyl cinnamate proved as effective as DEET at an equivalent dose in the repellent assay, and combinations of carvacrol with either butyl cinnamate or cumin alcohol proved to be significantly more effective than DEET in the assay. When tested as spatial repellents in experimental shelters housing sleeping humans in northern Nigeria a binary mixture of carvacrol plus cumin alcohol caused mosquitoes to leave shelters in significantly higher numbers to those induced by DEET in female Anopheles spp. and in numbers equivalent to that of DEET in Culex spp. mosquitoes. These findings indicate an approach for the identification of biologically active molecules of natural origin serving as repellents for mosquitoes. Copyright © 2018 Elsevier Ltd. All rights reserved.

DIRECT ELECTROCHEMICAL IMMUNOSENSOR FOR POLYCHLORINATED BIPHENYLS. (R825323)

EPA Science Inventory

A direct electrochemical immunosensor has been developed for the determination of polychlorinated biphenyls (PCBs) in water. The assay is based on the measurement of the current due to the specific binding between PCB and anti-PCB antibody-immobilized conducting polymer matrix. T...

In silico studies and fluorescence binding assays of potential anti-prion compounds reveal an important binding site for prion inhibition from PrP(C) to PrP(Sc).

PubMed

Pagadala, Nataraj S; Perez-Pineiro, Rolando; Wishart, David S; Tuszynski, Jack A

2015-02-16

To understand the pharmacophore properties of 2-aminothiazoles and design novel inhibitors against the prion protein, a highly predictive 3D quantitative structure-activity relationship (QSAR) has been developed by performing comparative molecular field analysis (CoMFA) and comparative similarity analysis (CoMSIA). Both CoMFA and CoMSIA maps reveal the presence of the oxymethyl groups in meta and para positions on the phenyl ring of compound 17 (N-[4-(3,4-dimethoxyphenyl)-1,3-thiazol-2-yl]quinolin-2-amine), is necessary for activity while electro-negative nitrogen of quinoline is highly favorable to enhance activity. The blind docking results for these compounds show that the compound with quinoline binds with higher affinity than isoquinoline and naphthalene groups. Out of 150 novel compounds retrieved using finger print analysis by pharmacophoric model predicted based on five test sets of compounds, five compounds with diverse scaffolds were selected for biological evaluation as possible PrP inhibitors. Molecular docking combined with fluorescence quenching studies show that these compounds bind to pocket-D of SHaPrP near Trp145. The new antiprion compounds 3 and 6, which bind with the interaction energies of -12.1 and -13.2 kcal/mol, respectively, show fluorescence quenching with binding constant (Kd) values of 15.5 and 44.14 μM, respectively. Further fluorescence binding assays with compound 5, which is similar to 2-aminothiazole as a positive control, also show that the molecule binds to the pocket-D with the binding constant (Kd) value of 84.7 μM. Finally, both molecular docking and a fluorescence binding assay of noscapine as a negative control reveals the same binding site on the surface of pocket-A near a rigid loop between β2 and α2 interacting with Arg164. This high level of correlation between molecular docking and fluorescence quenching studies confirm that these five compounds are likely to act as inhibitors for prion propagation while noscapine might act as a prion accelerator from PrP(C) to PrP(Sc). Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Capillary electrophoresis-based immunoassays: principles and quantitative applications.

PubMed

Moser, Annette C; Hage, David S

2008-08-01

The use of CE as a tool to conduct immunoassays has been an area of increasing interest over the last decade. This approach combines the efficiency, small sample requirements, and relatively high speed of CE with the selectivity of antibodies as binding agents. This review examines the various assay formats and detection modes that have been reported for these assays, along with some representative applications. Most CE immunoassays in the past have employed homogeneous methods in which the sample and reagents are allowed to react in solution. These homogeneous methods have been conducted as both competitive binding immunoassays and as noncompetitive binding immunoassays. Fluorescent labels are most commonly used for detection in these assays, but enzyme labels have also been utilized for such work. Some additional work has been performed in CE immunoassays with heterogeneous methods in which either antibodies or an analog of the analyte is immobilized to a solid support. These heterogeneous methods can be used for the selective isolation of analytes prior to their separation by CE or to remove a given species from a sample/reagent mixture prior to analysis by CE. These CE immunoassays can be used with a variety of detection modes, such as fluorescence, UV/Vis absorbance, chemiluminescence, electrochemical measurements, MS, and surface plasmon resonance.

In vitro studies on the relationship between the antioxidant activities of some berry extracts and their binding properties to serum albumin.

PubMed

Namiesnik, Jacek; Vearasilp, Kann; Nemirovski, Alina; Leontowicz, Hanna; Leontowicz, Maria; Pasko, Pawel; Martinez-Ayala, Alma Leticia; González-Aguilar, Gustavo A; Suhaj, Milan; Gorinstein, Shela

2014-03-01

The aim of this study was to investigate the possibility to use the bioactive components from cape gooseberry (Physalis peruviana), blueberry (Vaccinium corymbosum), and cranberry (Vaccinium macrocarpon) extracts as a novel source against oxidation in food supplementation. The quantitative analysis of bioactive compounds (polyphenols, flavonoids, flavanols, carotenoids, and chlorophyll) was based on radical scavenging spectrophometric assays and mass spectrometry. The total phenolic content was the highest (P < 0.05) in water extract of blueberries (46.6 ± 4.2 mg GAE/g DW). The highest antioxidant activities by 2,2-diphenyl-1-picrylhydrazyl radical scavenging assay and Cupric reducing antioxidant capacity were in water extracts of blueberries, showing 108.1 ± 7.2 and 131.1 ± 9.6 μMTE/g DW with correlation coefficients of 0.9918 and 0.9925, and by β-carotene linoleate assay at 80.1 ± 6.6 % with correlation coefficient of 0.9909, respectively. The water extracts of berries exhibited high binding properties with human serum albumin in comparison with quercetin. In conclusion, the bioactive compounds from a relatively new source of gooseberries in comparison with blueberries and cranberries have the potential as food supplementation for human health. The antioxidant and binding activities of berries depend on their bioactive compounds.

Quantitative Assessment of the Interplay Between DNA Elasticity and Cooperative Binding of Ligands

NASA Astrophysics Data System (ADS)

Siman, L.; Carrasco, I. S. S.; da Silva, J. K. L.; de Oliveira, M. C.; Rocha, M. S.; Mesquita, O. N.

2012-12-01

Binding of ligands to DNA can be studied by measuring the change of the persistence length of the complex formed, in single-molecule assays. We propose a methodology for persistence length data analysis based on a quenched disorder statistical model and describing the binding isotherm by a Hill-type equation. We obtain an expression for the effective persistence length as a function of the total ligand concentration, which we apply to our data of the DNA-cationic β-cyclodextrin and to the DNA-HU protein data available in the literature, determining the values of the local persistence lengths, the dissociation constant, and the degree of cooperativity for each set of data. In both cases the persistence length behaves nonmonotonically as a function of ligand concentration and based on the results obtained we discuss some physical aspects of the interplay between DNA elasticity and cooperative binding of ligands.

Biotin IgM Antibodies in Human Blood: A Previously Unknown Factor Eliciting False Results in Biotinylation-Based Immunoassays

PubMed Central

Chen, Tingting; Hedman, Lea; Mattila, Petri S.; Jartti, Laura; Jartti, Tuomas; Ruuskanen, Olli; Söderlund-Venermo, Maria; Hedman, Klaus

2012-01-01

Biotin is an essential vitamin that binds streptavidin or avidin with high affinity and specificity. As biotin is a small molecule that can be linked to proteins without affecting their biological activity, biotinylation is applied widely in biochemical assays. In our laboratory, IgM enzyme immuno assays (EIAs) of µ-capture format have been set up against many viruses, using as antigen biotinylated virus like particles (VLPs) detected by horseradish peroxidase-conjugated streptavidin. We recently encountered one serum sample reacting with the biotinylated VLP but not with the unbiotinylated one, suggesting in human sera the occurrence of biotin-reactive antibodies. In the present study, we search the general population (612 serum samples from adults and 678 from children) for IgM antibodies reactive with biotin and develop an indirect EIA for quantification of their levels and assessment of their seroprevalence. These IgM antibodies were present in 3% adults regardless of age, but were rarely found in children. The adverse effects of the biotin IgM on biotinylation-based immunoassays were assessed, including four inhouse and one commercial virus IgM EIAs, showing that biotin IgM do cause false positivities. The biotin can not bind IgM and streptavidin or avidin simultaneously, suggesting that these biotin-interactive compounds compete for the common binding site. In competitive inhibition assays, the affinities of biotin IgM antibodies ranged from 2.1×10−3 to 1.7×10−4 mol/L. This is the first report on biotin antibodies found in humans, providing new information on biotinylation-based immunoassays as well as new insights into the biomedical effects of vitamins. PMID:22879954

Recognition of the pro-mutagenic base uracil by family B DNA polymerases from archaea.

PubMed

Shuttleworth, Gillian; Fogg, Mark J; Kurpiewski, Michael R; Jen-Jacobson, Linda; Connolly, Bernard A

2004-03-26

Archaeal family B DNA polymerases contain a specialised pocket that binds tightly to template-strand uracil, causing the stalling of DNA replication. The mechanism of this unique "template-strand proof-reading" has been studied using equilibrium binding measurements, DNA footprinting, van't Hoff analysis and calorimetry. Binding assays have shown that the polymerase preferentially binds to uracil in single as opposed to double-stranded DNA. Tightest binding is observed using primer-templates that contain uracil four bases in front of the primer-template junction, corresponding to the observed stalling position. Ethylation interference analysis of primer-templates shows that the two phosphates, immediately flanking the uracil (NpUpN), are important for binding; contacts are also made to phosphates in the primer-strand. Microcalorimetry and van't Hoff analysis have given a fuller understanding of the thermodynamic parameters involved in uracil recognition. All the results are consistent with a "read-ahead" mechanism, in which the replicating polymerase scans the template, ahead of the replication fork, for the presence of uracil and halts polymerisation on detecting this base. Post-stalling events, serving to eliminate uracil, await full elucidation.

Quantitative Detection of Small Molecule/DNA Complexes Employing a Force-Based and Label-Free DNA-Microarray

PubMed Central

Ho, Dominik; Dose, Christian; Albrecht, Christian H.; Severin, Philip; Falter, Katja; Dervan, Peter B.; Gaub, Hermann E.

2009-01-01

Force-based ligand detection is a promising method to characterize molecular complexes label-free at physiological conditions. Because conventional implementations of this technique, e.g., based on atomic force microscopy or optical traps, are low-throughput and require extremely sensitive and sophisticated equipment, this approach has to date found only limited application. We present a low-cost, chip-based assay, which combines high-throughput force-based detection of dsDNA·ligand interactions with the ease of fluorescence detection. Within the comparative unbinding force assay, many duplicates of a target DNA duplex are probed against a defined reference DNA duplex each. The fractions of broken target and reference DNA duplexes are determined via fluorescence. With this assay, we investigated the DNA binding behavior of artificial pyrrole-imidazole polyamides. These small compounds can be programmed to target specific dsDNA sequences and distinguish between D- and L-DNA. We found that titration with polyamides specific for a binding motif, which is present in the target DNA duplex and not in the reference DNA duplex, reliably resulted in a shift toward larger fractions of broken reference bonds. From the concentration dependence nanomolar to picomolar dissociation constants of dsDNA·ligand complexes were determined, agreeing well with prior quantitative DNAase footprinting experiments. This finding corroborates that the forced unbinding of dsDNA in presence of a ligand is a nonequilibrium process that produces a snapshot of the equilibrium distribution between dsDNA and dsDNA·ligand complexes. PMID:19486688

Efavirenz directly modulates estrogen receptor and induces breast cancer cell growth

PubMed Central

Sikora, Matthew J.; Rae, James M.; Johnson, Michael D.; Desta, Zeruesenay

2010-01-01

Objectives Efavirenz-based HIV therapy is associated with breast hypertrophy and gynecomastia. Here, we tested the hypothesis that efavirenz induces gynecomastia through direct binding and modulation of estrogen receptor (ER). Methods To determine the effect of efavirenz on growth, the estrogen-dependent, ER-positive breast cancer cell lines MCF-7, T47D and ZR-75-1 were treated with efavirenz under estrogen-free conditions in the presence or absence of the anti-estrogen ICI 182,780. Cells treated with 17β-estradiol in the absence or presence of ICI 182,780 served as positive and negative controls, respectively. Cellular growth was assayed using the crystal violet staining method and an in vitro receptor binding assay was used to measure efavirenz’s ER binding affinity. Results Efavirenz induced growth in MCF-7 cells with an estimated EC50 of 15.7µM. This growth was reversed by ICI 182,780. Further, efavirenz binds directly to ER (IC50 of ~52µM) at roughly 1000-fold higher concentration than observed with E2. Conclusions Our data suggest that efavirenz-induced gynecomastia may be due, at least in part, to drug-induced ER activation in breast tissues. PMID:20408889

Dual inhibition of HY023016 based on binding properties of platelet membrane receptor subunit glycoprotein Ibα and thrombin exosites.

PubMed

Chen, Qiu-Fang; Cui, Shuang; Shen, Hui-Liang; Chen, Xiang; Li, Yun-Zhan; Wu, Qian; Xu, Yun-Gen; Gong, Guo-Qing

2018-03-05

Thrombin has long been suggested as a desirable antithrombotic target, but anti-thrombin therapy without anti-platelet thereby has never achieved the ideal effect. HY023016 is a novel compound, in our previous study, it exerted better anti-thrombotic than dabigatran etexilate. The present study aims to illustrate the excess anti-thrombotic molecular mechanisms of HY023016 through thrombin anion exosites and the platelet membrane receptor subunit glycoprotein Ibα (GPIbα). HY023016 strongly inhibited the conversion of fibrinogen to fibrous may via blocking thrombin exosite I. We also discovered that HY023016 remarkably inhibited exosite II by a loss of affinity for the γ'-peptide of fibrinogen and for heparin. Furthermore, a solid phase binding assay revealed that HY023016 inhibited ristocetin-induced washed platelets bind to von Willebrand factor (vWF). In GST pull-down assay, HY023016 decreased the binding of recombinant vWF-A1 to GPIbα N-terminal. Thus, HY023016 provides an innovative idea for designing multi-targeted anti-thrombotic drugs and laying a scientific foundation for reducing "total thrombosis risk" in a clinical drug treatment. Copyright © 2018 Elsevier B.V. All rights reserved.

Planar optical waveguide based sandwich assay sensors and processes for the detection of biological targets including protein markers, pathogens and cellular debris

DOEpatents

Martinez, Jennifer S [Santa Fe, NM; Swanson, Basil I [Los Alamos, NM; Grace, Karen M [Los Alamos, NM; Grace, Wynne K [Los Alamos, NM; Shreve, Andrew P [Santa Fe, NM

2009-06-02

An assay element is described including recognition ligands bound to a film on a single mode planar optical waveguide, the film from the group of a membrane, a polymerized bilayer membrane, and a self-assembled monolayer containing polyethylene glycol or polypropylene glycol groups therein and an assay process for detecting the presence of a biological target is described including injecting a biological target-containing sample into a sensor cell including the assay element, with the recognition ligands adapted for binding to selected biological targets, maintaining the sample within the sensor cell for time sufficient for binding to occur between selected biological targets within the sample and the recognition ligands, injecting a solution including a reporter ligand into the sensor cell; and, interrogating the sample within the sensor cell with excitation light from the waveguide, the excitation light provided by an evanescent field of the single mode penetrating into the biological target-containing sample to a distance of less than about 200 nanometers from the waveguide thereby exciting the fluorescent-label in any bound reporter ligand within a distance of less than about 200 nanometers from the waveguide and resulting in a detectable signal.

Planar optical waveguide based sandwich assay sensors and processes for the detection of biological targets including early detection of cancers

DOEpatents

Martinez, Jennifer S [Santa Fe, NM; Swanson, Basil I [Los Alamos, NM; Shively, John E [Arcadia, CA; Li, Lin [Monrovia, CA

2009-06-02

An assay element is described including recognition ligands adapted for binding to carcinoembryonic antigen (CEA) bound to a film on a single mode planar optical waveguide, the film from the group of a membrane, a polymerized bilayer membrane, and a self-assembled monolayer containing polyethylene glycol or polypropylene glycol groups therein and an assay process for detecting the presence of CEA is described including injecting a possible CEA-containing sample into a sensor cell including the assay element, maintaining the sample within the sensor cell for time sufficient for binding to occur between CEA present within the sample and the recognition ligands, injecting a solution including a reporter ligand into the sensor cell; and, interrogating the sample within the sensor cell with excitation light from the waveguide, the excitation light provided by an evanescent field of the single mode penetrating into the biological target-containing sample to a distance of less than about 200 nanometers from the waveguide thereby exciting any bound reporter ligand within a distance of less than about 200 nanometers from the waveguide and resulting in a detectable signal.

Analysis of surface properties of fixed and live cells using derivatized agarose beads.

PubMed

Navarro, Vanessa M; Walker, Sherri L; Badali, Oliver; Abundis, Maria I; Ngo, Lylla L; Weerasinghe, Gayani; Barajas, Marcela; Zem, Gregory; Oppenheimer, Steven B

2002-01-01

A novel assay has been developed for the histochemical characterization of surface properties of cells based on their adhesion to agarose beads derivatized with more than 100 types of molecules, including sugars, lectins and other proteins, and amino acids. The assay simply involves mixing small quantities of washed cells and beads in droplets on glass microscope slides and determining to which beads various cell types adhere. Distilled water was found to be the best medium for this assay because added ions or molecules in other media inhibit adhesion in some cases. Many cells, however, cannot tolerate distilled water. Here we show that cells fixed with either of two fixatives (1% formaldehyde or Prefer fixative) displayed similar bead-binding properties as did live cells. Specificity of cell-bead binding was tested by including specific free molecules in the test suspensions in hapten-type inhibition experiments. If a hapten compound inhibited live-cell adhesion to a specific bead, it also inhibited fixed-cell adhesion to a specific bead. The results of these experiments suggest that fixed cells display authentic surface properties, opening the door for the use of this assay with many cell types that cannot tolerate distilled water.

Direct replacement of antibodies with molecularly imprinted polymer (MIP) nanoparticles in ELISA – development of a novel assay for vancomycin

PubMed Central

Chianella, Iva; Guerreiro, Antonio; Moczko, Ewa; Caygill, J. Sarah; Piletska, Elena V.; Perez De Vargas Sansalvador, Isabel M.; Whitcombe, Michael J.; Piletsky, Sergey A.

2016-01-01

A simple and straightforward technique for coating microplate wells with molecularly imprinted polymer nanoparticles (nanoMIPs) to develop ELISA type assays is presented here for the first time. NanoMIPs were synthesized by a solid phase approach with immobilized vancomycin (template) and characterized using Biacore 3000, dynamic light scattering and electron microscopy. Immobilization, blocking and washing conditions were optimized in microplate format. The detection of vancomycin was achieved in competitive binding experiments with a HRP-vancomycin conjugate. The assay was capable of measuring vancomycin in buffer and in blood plasma within the range 0.001-70 nM with a detection limit of 0.0025 nM (2.5 pM). The sensitivity of the assay was three orders of magnitude better than a previously described ELISA based on antibodies. In these experiments nanoMIPs have shown high affinity and minimal interference from blood plasma components. Immobilized nanoMIPs were stored for 1 month at room temperature without any detrimental effects to their binding properties. The high affinity of nanoMIPs and the lack of a requirement for cold chain logistics make them an attractive alternative to traditional antibodies used in ELISA. PMID:23947402

Discovery of a Novel General Anesthetic Chemotype Using High-throughput Screening

PubMed Central

McKinstry-Wu, Andrew R.; Bu, Weiming; Rai, Ganesha; Lea, Wendy A.; Weiser, Brian P.; Liang, David F.; Simeonov, Anton; Jadhav, Ajit; Maloney, David J.; Eckenhoff, Roderic G.

2014-01-01

Background The development of novel anesthetics has historically been a process of combined serendipity and empiricism, with most recent new anesthetics developed via modification of existing anesthetic structures. Methods Using a novel high-throughput screen employing the fluorescent anesthetic 1-aminoanthracene (1-AMA) and apoferritin as a surrogate for on-pathway anesthetic protein target(s), we screened a 350,000 compound library for competition with 1-AMA-apoferritin binding. Hit compounds meeting structural criteria had their binding affinities for apoferritin quantified with isothermal titration calorimetry and were tested for γ-aminobutyric acid type A-receptor binding using a flunitrazepam binding assay. Chemotypes with a strong presence in the top 700 and exhibiting activity via isothermal titration calorimetry were selected for medicinal chemistry optimization including testing for anesthetic potency and toxicity in an in vivo Xenopus laevis tadpole assay. Compounds with low toxicity and high potency were tested for anesthetic potency in mice. Results From an initial chemical library of over 350,000 compounds, we identified 2,600 compounds that potently inhibited 1-AMA binding to apoferritin. A subset of compounds chosen by structural criteria (700) was successfully reconfirmed using the initial assay. Based upon a strong presence in both the initial and secondary screens the 6-phenylpyridazin-3(2H)-one chemotype was assessed for anesthetic activity in tadpoles. Medicinal chemistry efforts identified four compounds with high potency and low toxicity in tadpoles, two were found to be effective novel anesthetics in mice. Conclusions We demonstrate the first use of a high-throughput screen to successfully identify a novel anesthetic chemotype and show mammalian anesthetic activity for members of that chemotype. PMID:25603205

A Ligand-observed Mass Spectrometry Approach Integrated into the Fragment Based Lead Discovery Pipeline

PubMed Central

Chen, Xin; Qin, Shanshan; Chen, Shuai; Li, Jinlong; Li, Lixin; Wang, Zhongling; Wang, Quan; Lin, Jianping; Yang, Cheng; Shui, Wenqing

2015-01-01

In fragment-based lead discovery (FBLD), a cascade combining multiple orthogonal technologies is required for reliable detection and characterization of fragment binding to the target. Given the limitations of the mainstream screening techniques, we presented a ligand-observed mass spectrometry approach to expand the toolkits and increase the flexibility of building a FBLD pipeline especially for tough targets. In this study, this approach was integrated into a FBLD program targeting the HCV RNA polymerase NS5B. Our ligand-observed mass spectrometry analysis resulted in the discovery of 10 hits from a 384-member fragment library through two independent screens of complex cocktails and a follow-up validation assay. Moreover, this MS-based approach enabled quantitative measurement of weak binding affinities of fragments which was in general consistent with SPR analysis. Five out of the ten hits were then successfully translated to X-ray structures of fragment-bound complexes to lay a foundation for structure-based inhibitor design. With distinctive strengths in terms of high capacity and speed, minimal method development, easy sample preparation, low material consumption and quantitative capability, this MS-based assay is anticipated to be a valuable addition to the repertoire of current fragment screening techniques. PMID:25666181

Immobilizing affinity proteins to nitrocellulose: a toolbox for paper-based assay developers.

PubMed

Holstein, Carly A; Chevalier, Aaron; Bennett, Steven; Anderson, Caitlin E; Keniston, Karen; Olsen, Cathryn; Li, Bing; Bales, Brian; Moore, David R; Fu, Elain; Baker, David; Yager, Paul

2016-02-01

To enable enhanced paper-based diagnostics with improved detection capabilities, new methods are needed to immobilize affinity reagents to porous substrates, especially for capture molecules other than IgG. To this end, we have developed and characterized three novel methods for immobilizing protein-based affinity reagents to nitrocellulose membranes. We have demonstrated these methods using recombinant affinity proteins for the influenza surface protein hemagglutinin, leveraging the customizability of these recombinant "flu binders" for the design of features for immobilization. The three approaches shown are: (1) covalent attachment of thiolated affinity protein to an epoxide-functionalized nitrocellulose membrane, (2) attachment of biotinylated affinity protein through a nitrocellulose-binding streptavidin anchor protein, and (3) fusion of affinity protein to a novel nitrocellulose-binding anchor protein for direct coupling and immobilization. We also characterized the use of direct adsorption for the flu binders, as a point of comparison and motivation for these novel methods. Finally, we demonstrated that these novel methods can provide improved performance to an influenza hemagglutinin assay, compared to a traditional antibody-based capture system. Taken together, this work advances the toolkit available for the development of next-generation paper-based diagnostics.

Toward low-cost affinity reagents: lyophilized yeast-scFv probes specific for pathogen antigens.

PubMed

Gray, Sean A; Weigel, Kris M; Ali, Ibne K M; Lakey, Annie A; Capalungan, Jeremy; Domingo, Gonzalo J; Cangelosi, Gerard A

2012-01-01

The generation of affinity reagents, usually monoclonal antibodies, remains a critical bottleneck in biomedical research and diagnostic test development. Recombinant antibody-like proteins such as scFv have yet to replace traditional monoclonal antibodies in antigen detection applications, in large part because of poor performance of scFv in solution. To address this limitation, we have developed assays that use whole yeast cells expressing scFv on their surfaces (yeast-scFv) in place of soluble purified scFv or traditional monoclonal antibodies. In this study, a nonimmune library of human scFv displayed on the surfaces of yeast cells was screened for clones that bind to recombinant cyst proteins of Entamoeba histolytica, an enteric pathogen of humans. Selected yeast-scFv clones were stabilized by lyophilization and used in detection assay formats in which the yeast-scFv served as solid support-bound monoclonal antibodies. Specific binding of antigen to the yeast-scFv was detected by staining with rabbit polyclonal antibodies. In flow cytometry-based assays, lyophilized yeast-scFv reagents retained full binding activity and specificity for their cognate antigens after 4 weeks of storage at room temperature in the absence of desiccants or stabilizers. Because flow cytometry is not available to all potential assay users, an immunofluorescence assay was also developed that detects antigen with similar sensitivity and specificity. Antigen-specific whole-cell yeast-scFv reagents can be selected from nonimmune libraries in 2-3 weeks, produced in vast quantities, and packaged in lyophilized form for extended shelf life. Lyophilized yeast-scFv show promise as low cost, renewable alternatives to monoclonal antibodies for diagnosis and research.

Surface plasmon resonance-based competition assay to assess the sera reactivity of variants of humanized antibodies.

PubMed

Gonzales, Noreen R; Schuck, Peter; Schlom, Jeffrey; Kashmiri, Syed V S

2002-10-15

While clinical trials are the only way to evaluate the immunogenicity, in patients, of murine or genetically engineered humanized variants of a potentially therapeutic or diagnostic monoclonal antibody (MAb), ethical and logistical considerations of clinical trials do not permit the evaluation of variants of a given MAb that are generated to minimize its immunogenicity. The most promising variant could be identified by comparing the reactivities of the parental antibody (Ab) and its variants to the sera of patients containing anti-variable region (anti-VR) Abs to the administered parental Ab. We have developed a surface plasmon resonance (SPR) biosensor-based assay to monitor the binding of the sera anti-VR Abs to the parental Ab and the inhibition of this binding by the variants. SPR biosensors allow the real-time detection and monitoring of the binding between an immobilized protein and its soluble ligand without the need for prior purification and labeling of the mobile analyte. This new assay requires no radiolabeling, is relatively less time-consuming, and uses only small amounts of serum (5-20 microl of diluted serum) through a new microfluidic sample handling technique. To validate the assay, we have tested the relative reactivities of the CDR-grafted anti-carcinoma Ab, HuCC49, and its two variants, designated V5 and V10, to the sera of patients who were earlier administered radiolabeled murine CC49 in a clinical trial. A comparison of IC(50)s (the concentrations of the competitor Abs required for 50% inhibition of the binding of sera to immobilized HuCC49) showed that V5 and V10 were less reactive than HuCC49 to the three patients' sera tested. We have also demonstrated, for the first time, the specific detection and comparison of relative amounts of anti-VR Abs present in the sera of different patients without prior removal of anti-murine Fc Abs and/or circulating antigen. This may facilitate the rapid screening, for the presence of anti-VR Abs, of the sera of patients undergoing clinical trials.

Integrated Model of Chemical Perturbations of a Biological PathwayUsing 18 In Vitro High Throughput Screening Assays for the Estrogen Receptor

EPA Science Inventory

We demonstrate a computational network model that integrates 18 in vitro, high-throughput screening assays measuring estrogen receptor (ER) binding, dimerization, chromatin binding, transcriptional activation and ER-dependent cell proliferation. The network model uses activity pa...

Electromobility Shift Assay Reveals Evidence in Favor of Allele-Specific Binding of RUNX1 to the 5' Hypersensitive Site 4-Locus Control Region.

PubMed

Dehghani, Hossein; Ghobakhloo, Sepideh; Neishabury, Maryam

2016-08-01

In our previous studies on the Iranian β-thalassemia (β-thal) patients, we identified an association between the severity of the β-thal phenotype and the polymorphic palindromic site at the 5' hypersensitive site 4-locus control region (5'HS4-LCR) of the β-globin gene cluster. Furthermore, a linkage disequilibrium was observed between this region and XmnI-HBG2 in the patient population. Based on this data, it was suggested that the well-recognized phenotype-ameliorating role assigned to positive XmnI could be associated with its linked elements in the LCR. To investigate the functional significance of polymorphisms at the 5'HS4-LCR, we studied its influence on binding of transcription factors. Web-based predictions of transcription factor binding revealed a binding site for runt-related transcription factor 1 (RUNX1), when the allele at the center of the palindrome (TGGGG(A/G)CCCCA) was A but not when it was G. Furthermore, electromobility shift assay (EMSA) presented evidence in support of allele-specific binding of RUNX1 to 5'HS4. Considering that RUNX1 is a well-known regulator of hematopoiesis, these preliminary data suggest the importance of further studies to confirm this interaction and consequently investigate its functional and phenotypical relevance. These studies could help us to understand the molecular mechanism behind the phenotype modifying role of the 5'HS4-LCR polymorphic palindromic region (rs16912979), which has been observed in previous studies.

Ligand and membrane-binding behavior of the phosphatidylinositol transfer proteins PITPα and PITPβ.

PubMed

Baptist, Matilda; Panagabko, Candace; Cockcroft, Shamshad; Atkinson, Jeffrey

2016-12-01

Phosphatidylinositol transfer proteins (PITPs) are believed to be lipid transfer proteins because of their ability to transfer either phosphatidylinositol (PI) or phosphatidylcholine (PC) between membrane compartments, in vitro. However, the detailed mechanism of this transfer process is not fully established. To further understand the transfer mechanism of PITPs we examined the interaction of PITPs with membranes using dual polarization interferometry (DPI), which measures protein binding affinity on a flat immobilized lipid surface. In addition, a fluorescence resonance energy transfer (FRET)-based assay was also employed to monitor how quickly PITPs transfer their ligands to lipid vesicles. DPI analysis revealed that PITPβ had a higher affinity to membranes compared with PITPα. Furthermore, the FRET-based transfer assay revealed that PITPβ has a higher ligand transfer rate compared with PITPα. However, both PITPα and PITPβ demonstrated a preference for highly curved membrane surfaces during ligand transfer. In other words, ligand transfer rate was higher when the accepting vesicles were highly curved.

An ultrasensitive universal detector based on neutralizer displacement

NASA Astrophysics Data System (ADS)

Das, Jagotamoy; Cederquist, Kristin B.; Zaragoza, Alexandre A.; Lee, Paul E.; Sargent, Edward H.; Kelley, Shana O.

2012-08-01

Diagnostic technologies that can provide the simultaneous detection of nucleic acids for gene expression, proteins for host response and small molecules for profiling the human metabolome will have a significant advantage in providing comprehensive patient monitoring. Molecular sensors that report changes in the electrostatics of a sensor's surface on analyte binding have shown unprecedented sensitivity in the detection of charged biomolecules, but do not lend themselves to the detection of small molecules, which do not carry significant charge. Here, we introduce the neutralizer displacement assay that allows charge-based sensing to be applied to any class of molecule irrespective of the analyte charge. The neutralizer displacement assay starts with an aptamer probe bound to a neutralizer. When analyte binding occurs the neutralizer is displaced, which results in a dramatic change in the surface charge for all types of analytes. We have tested the sensitivity, speed and specificity of this system in the detection of a panel of molecules: (deoxy)ribonucleic acid, ribonucleic acid, cocaine, adenosine triphosphate and thrombin.

Detection of Myoglobin with an Open-Cavity-Based Label-Free Photonic Crystal Biosensor.

PubMed

Zhang, Bailin; Tamez-Vela, Juan Manuel; Solis, Steven; Bustamante, Gilbert; Peterson, Ralph; Rahman, Shafiqur; Morales, Andres; Tang, Liang; Ye, Jing Yong

2013-01-01

The label-free detection of one of the cardiac biomarkers, myoglobin, using a photonic-crystal-based biosensor in a total-internal-reflection configuration (PC-TIR) is presented in this paper. The PC-TIR sensor possesses a unique open optical microcavity that allows for several key advantages in biomolecular assays. In contrast to a conventional closed microcavity, the open configuration allows easy functionalization of the sensing surface for rapid biomolecular binding assays. Moreover, the properties of PC structures make it easy to be designed and engineered for operating at any optical wavelength. Through fine design of the photonic crystal structure, biochemical modification of the sensor surface, and integration with a microfluidic system, we have demonstrated that the detection sensitivity of the sensor for myoglobin has reached the clinically significant concentration range, enabling potential usage of this biosensor for diagnosis of acute myocardial infarction. The real-time response of the sensor to the myoglobin binding may potentially provide point-of-care monitoring of patients and treatment effects.

Aptamer-based detection of plasma proteins by an electrochemical assay coupled to magnetic beads.

PubMed

Centi, Sonia; Tombelli, Sara; Minunni, Maria; Mascini, Marco

2007-02-15

The DNA thrombin aptamer has been extensively investigated, and the coupling of this aptamer to different transduction principles has demonstrated the wide applicability of aptamers as bioreceptors in bioanalytical assays. The goal of this work was to design an aptamer-based sandwich assay with electrochemical detection for thrombin analysis in complex matrixes, using a simple target capturing step by aptamer-functionalized magnetic beads. The conditions for the aptamer immobilization and for the protein binding have been first optimized by surface plasmon resonance, and then transferred to the electrochemical-based assay performed onto screen-printed electrodes. The assay was then applied to the analysis of thrombin in buffer, spiked serum, and plasma and high sensitivity and specificity were found. Moreover, thrombin was generated in situ in plasma by the conversion of its precursor prothrombin, and the formation of thrombin was followed at different times. The concentrations detected by the electrochemical assay were in agreement with a simulation software that mimics the formation of thrombin over time (thrombogram). The proposed work demonstrates that the high specificity of aptamers together with the use of magnetic beads are the key features for aptamer-based analysis in complex matrixes, opening the possibility of a real application to diagnostics or medical investigation.

A multiprotein binding interface in an intrinsically disordered region of the tumor suppressor protein interferon regulatory factor-1.

PubMed

Narayan, Vikram; Halada, Petr; Hernychová, Lenka; Chong, Yuh Ping; Žáková, Jitka; Hupp, Ted R; Vojtesek, Borivoj; Ball, Kathryn L

2011-04-22

The interferon-regulated transcription factor and tumor suppressor protein IRF-1 is predicted to be largely disordered outside of the DNA-binding domain. One of the advantages of intrinsically disordered protein domains is thought to be their ability to take part in multiple, specific but low affinity protein interactions; however, relatively few IRF-1-interacting proteins have been described. The recent identification of a functional binding interface for the E3-ubiquitin ligase CHIP within the major disordered domain of IRF-1 led us to ask whether this region might be employed more widely by regulators of IRF-1 function. Here we describe the use of peptide aptamer-based affinity chromatography coupled with mass spectrometry to define a multiprotein binding interface on IRF-1 (Mf2 domain; amino acids 106-140) and to identify Mf2-binding proteins from A375 cells. Based on their function as known transcriptional regulators, a selection of the Mf2 domain-binding proteins (NPM1, TRIM28, and YB-1) have been validated using in vitro and cell-based assays. Interestingly, although NPM1, TRIM28, and YB-1 all bind to the Mf2 domain, they have differing amino acid specificities, demonstrating the degree of combinatorial diversity and specificity available through linear interaction motifs.

A practical approach to automate randomized design of experiments for ligand-binding assays.

PubMed

Tsoi, Jennifer; Patel, Vimal; Shih, Judy

2014-03-01

Design of experiments (DOE) is utilized in optimizing ligand-binding assay by modeling factor effects. To reduce the analyst's workload and error inherent with DOE, we propose the integration of automated liquid handlers to perform the randomized designs. A randomized design created from statistical software was imported into custom macro converting the design into a liquid-handler worklist to automate reagent delivery. An optimized assay was transferred to a contract research organization resulting in a successful validation. We developed a practical solution for assay optimization by integrating DOE and automation to increase assay robustness and enable successful method transfer. The flexibility of this process allows it to be applied to a variety of assay designs.

Binding-Site Compatible Fragment Growing Applied to the Design of β2-Adrenergic Receptor Ligands.

PubMed

Chevillard, Florent; Rimmer, Helena; Betti, Cecilia; Pardon, Els; Ballet, Steven; van Hilten, Niek; Steyaert, Jan; Diederich, Wibke E; Kolb, Peter

2018-02-08

Fragment-based drug discovery is intimately linked to fragment extension approaches that can be accelerated using software for de novo design. Although computers allow for the facile generation of millions of suggestions, synthetic feasibility is however often neglected. In this study we computationally extended, chemically synthesized, and experimentally assayed new ligands for the β 2 -adrenergic receptor (β 2 AR) by growing fragment-sized ligands. In order to address the synthetic tractability issue, our in silico workflow aims at derivatized products based on robust organic reactions. The study started from the predicted binding modes of five fragments. We suggested a total of eight diverse extensions that were easily synthesized, and further assays showed that four products had an improved affinity (up to 40-fold) compared to their respective initial fragment. The described workflow, which we call "growing via merging" and for which the key tools are available online, can improve early fragment-based drug discovery projects, making it a useful creative tool for medicinal chemists during structure-activity relationship (SAR) studies.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu Wei; Leal, Walter S.

Pheromone-binding proteins (PBPs) are involved in the uptake of pheromones from pores on the antennae, transport through an aqueous environment surrounding the olfactory receptor neurons, and fast delivery to pheromone receptors. We tested the hypothesis that a C-terminal segment and a flexible loop are involved in the release of pheromones to membrane-bound receptors. We expressed in Escherichia coli 11 mutants of the PBP from the silkworm moth, BmorPBP, taking into consideration structural differences between the forms with high and low binding affinity. The N-terminus was truncated and His-69, His-70 and His-95 at the base of a flexible loop, and amore » cluster of acidic residues at the C-terminus were mutated. Binding assays and circular dichroism analyses support a mechanism involving protonation of acidic residues Asp-132 and Glu-141 at the C-terminus and histidines, His-70 and His-95, in the base of a loop covering the binding pocket. The former leads to the formation of a new {alpha}-helix, which competes with pheromone for the binding pocket, whereas positive charge repulsion of the histidines opens the opposite side of the binding pocket.« less

Improved flow cytometer measurement of binding assays

NASA Astrophysics Data System (ADS)

Saunders, G. C.

1984-05-01

A method of measuring binding assays is carried out with different size particles wherein the binding assay sample is run through a flow cytometer without separating the sample from the marking agent. The amount of a binding reactant present in a sample is determined by providing particles with a coating of binder and also known quantity of smaller particles with a coating of binder reactant. The smaller particles also contain a fluorescent chemical. The particles are combined with the sample and the binding reaction is allowed to occur for a set length of time followed by combining the smaller particles with the mixture of the particles and the sample produced and allowing the binding reactions to proceed to equilibrium. The fluorescence and light scatter of the combined mixture is then measured as the combined mixture passes through a flow cytometer equipped with a laser to bring about fluorescence, and the number of fluorescent events are compared. A similar method is also provided for determining the amount of antigen present in the sample by providing spheres with an antibody coating and some smaller spheres with an antigen coating.

Detection of Z DNA binding proteins in tissue culture cells.

PubMed Central

Leith, I R; Hay, R T; Russell, W C

1988-01-01

A gel electrophoresis DNA binding assay to detect Z DNA binding proteins has been developed utilising [32P] labelled poly [d(G-C)] which was converted to the Z form by incubation in 100 microM Co(NH3)6Cl3. The parameters of the assay were established using a Z DNA antibody as a model system and then applied to extracts of Hela and BHK21 cells. Using an anti-Z DNA antibody conditions were established which allowed resolution of antibody-DNA complexes and free DNA in the presence of 100 microM Co(NH3)6Cl3. The inclusion of unlabelled complementary homopolymers eliminated non-specific binding to the labelled Z-DNA probe. Competition experiments demonstrated that the assay was highly specific for double stranded non-B DNA. Application of the technique to extracts of mammalian cells demonstrated that human and hamster cells contain Z-DNA binding proteins; further characterisation by a blotting technique indicated that a 56,000 molecular weight cell protein preferentially binds Z-DNA. Images PMID:3419919

Binding of environmental carcinogens to asbestos and mineral fibres.

PubMed Central

Harvey, G; Pagé, M; Dumas, L

1984-01-01

A rapid method has been developed for measuring the binding capacity of asbestos and other mineral fibres for environmental carcinogens. Benzo(alpha)pyrene (B(alpha)P), nitrosonornicotine (NNN), and N-acetyl-2-aminofluorene (NAAF) were assayed in the presence of Canadian grade 4T30 chrysotile, chrysotile A, amosite, crocidolite, glass microfibres, glasswool, attapulgite, and titanium dioxide. Chrysotile binds significantly more carcinogens than the other mineral fibres. This binding assay is reproducible with coefficients of variation of less than 8% and 6% respectively for inter and intra assay. The influence of pH was also studied, and there is good correlation between the carcinogen binding and the charge of the tested mineral fibres. The in vitro cytotoxicity on macrophage like cell line P388D1 and the haemolytic activity of various mineral fibres were also measured; a good correlation was found between the binding capacity and the cytotoxicity of tested mineral fibres on P388D1 cells. These results give some explanations for the reported synergism between exposure to asbestos and the smoking habits of workers. PMID:6331497

Volatile anesthetics, not intravenous anesthetic propofol bind to and attenuate the activation of platelet receptor integrin αIIbβ3.

PubMed

Yuki, Koichi; Bu, Weiming; Shimaoka, Motomu; Eckenhoff, Roderic

2013-01-01

In clinical reports, the usage of isoflurane and sevoflurane was associated with more surgical field bleeding in endoscopic sinus surgeries as compared to propofol. The activation of platelet receptor αIIbβ3 is a crucial event for platelet aggregation and clot stability. Here we studied the effect of isoflurane, sevoflurane, and propofol on the activation of αIIbβ3. The effect of anesthetics on the activation of αIIbβ3 was probed using the activation sensitive antibody PAC-1 in both cell-based (platelets and αIIbβ3 transfectants) and cell-free assays. The binding sites of isoflurane on αIIbβ3 were explored using photoactivatable isoflurane (azi-isoflurane). The functional implication of revealed isoflurane binding sites were studied using alanine-scanning mutagenesis. Isoflurane and sevoflurane diminished the binding of PAC-1 to wild-type αIIbβ3 transfectants, but not to the high-affinity mutant, β3-N305T. Both anesthetics also impaired PAC-1 binding in a cell-free assay. In contrast, propofol did not affect the activation of αIIbβ3. Residues adducted by azi-isoflurane were near the calcium binding site (an important regulatory site termed SyMBS) just outside of the ligand binding site. The mutagenesis experiments demonstrated that these adducted residues were important in regulating integrin activation. Isoflurane and sevoflurane, but not propofol, impaired the activation of αIIbβ3. Azi-isoflurane binds to the regulatory site of integrin αIIbβ3, thereby suggesting that isoflurane blocks ligand binding of αIIbβ3 in not a competitive, but an allosteric manner.

DNA-aptamers binding aminoglycoside antibiotics.

PubMed

Nikolaus, Nadia; Strehlitz, Beate

2014-02-21

Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.

Development of a nanoparticle-based surface-modified fluorescence assay for the detection of prion proteins.

PubMed

Henry, James; Anand, Ashish; Chowdhury, Mustafa; Coté, Gerard; Moreira, Rosana; Good, Theresa

2004-11-01

A nanoparticle-based immunoassay for the detection of recombinant bovine prion protein (PrP) was developed as a step in the development of screening tools for the prevention of the spread of transmissible spongiform encephalopathies. The assay is based on the competitive binding between PrP and a peptide-fluorophore to a nanoparticle-labeled antibody which is specific for a conserved prion sequence. The fluorophore, when bound to the antibody, is subject to surfaced-modified fluorescence, enabling detection of changes in the concentration of bound fluorophore in the presence of prion protein. Important factors considered during the development of the assay were ease of use, robustness, and detection level. The effects of pH and nanoparticle conjugation chemistry on surface-modified fluorescence observed in the assay were explored. Effects of concentrations of antibody and fluorophore on reproducibility and detection limits were examined. At present, the detection limits of the system are approximately equal to the antibody-peptide fluorophore equilibrium dissociation constant, which is near one nanomolar concentration. Improved assay performance could be obtained by optimization of the nanoparticle surface resonance effects. The simplicity of the assay and ease of use may make the type of assay described in this report attractive for screening purposes in the food industry.

Discovery of potent DOT1L inhibitors by AlphaLISA based High Throughput Screening assay.

PubMed

Song, Yakai; Li, Linjuan; Chen, Yantao; Liu, Jingqiu; Xiao, Senhao; Lian, Fulin; Zhang, Naixia; Ding, Hong; Zhang, Yuanyuan; Chen, Kaixian; Jiang, Hualiang; Zhang, Chenhua; Liu, Yu-Chih; Chen, Shijie; Luo, Cheng

2018-05-01

DOT1L (the disruptor of telomeric silencing 1-like), through its methyltransferase activity of H3K79, plays essential roles in transcriptional regulation, cell cycle regulation, and DNA damage response. In addition, DOT1L is believed to be involved in the development of MLL-rearranged leukemia driven by the MLL (mixed-lineage leukemia) fusion proteins, which thus to be a crucial target for leukemia therapy. Hence, discovering of novel DOT1L inhibitors has been in a great demand. In this study, we initiated the discovering process from setting up the AlphaLISA based High Throughput Screening (HTS) assay of DOT1L. Combining with radioactive inhibition assay and Surface Plasmon Resonance (SPR) binding assay, we identified compound 3 and its active analogues as novel DOT1L inhibitors with IC 50 values range from 7 μM to 20 μM in vitro. Together with the analysis of structure activity relationships (SAR) and binding modes of these compounds, we provided clues to assist in the future development of more potent DOT1L inhibitors. Moreover, compounds 3 and 9 effectively inhibited the proliferation of MLL-rearranged leukemia cells MV4-11, which could induce cell cycle arrest and apoptosis. In conclusion, we developed a HTS platform based on AlphaLISA method for screening and discovery of DOT1L novel inhibitor, through which we discovered compound 3 and its analogues as potent DOT1L inhibitors with promising MLL-rearranged leukemia therapeutic application. Copyright © 2018 Elsevier Ltd. All rights reserved.

Performance and Specificity of the Covalently Linked Immunomagnetic Separation-ATP Method for Rapid Detection and Enumeration of Enterococci in Coastal Environments

PubMed Central

Zimmer-Faust, Amity G.; Thulsiraj, Vanessa; Ferguson, Donna

2014-01-01

The performance and specificity of the covalently linked immunomagnetic separation-ATP (Cov-IMS/ATP) method for the detection and enumeration of enterococci was evaluated in recreational waters. Cov-IMS/ATP performance was compared with standard methods: defined substrate technology (Enterolert; IDEXX Laboratories), membrane filtration (EPA Method 1600), and an Enterococcus-specific quantitative PCR (qPCR) assay (EPA Method A). We extend previous studies by (i) analyzing the stability of the relationship between the Cov-IMS/ATP method and culture-based methods at different field sites, (ii) evaluating specificity of the assay for seven ATCC Enterococcus species, (iii) identifying cross-reacting organisms binding the antibody-bead complexes with 16S rRNA gene sequencing and evaluating specificity of the assay to five nonenterococcus species, and (iv) conducting preliminary tests of preabsorption as a means of improving the assay. Cov-IMS/ATP was found to perform consistently and with strong agreement rates (based on exceedance/compliance with regulatory limits) of between 83% and 100% compared to the culture-based Enterolert method at a variety of sites with complex inputs. The Cov-IMS/ATP method is specific to five of seven different Enterococcus spp. tested. However, there is potential for nontarget bacteria to bind the antibody, which may be reduced by purification of the IgG serum with preabsorption at problematic sites. The findings of this study help to validate the Cov-IMS/ATP method, suggesting a predictable relationship between the Cov-IMS/ATP method and traditional culture-based methods, which will allow for more widespread application of this rapid and field-portable method for coastal water quality assessment. PMID:24561583

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus.

PubMed

Duan, Nuo; Wu, Shijia; Chen, Xiujuan; Huang, Yukun; Wang, Zhouping

2012-04-25

A whole-bacterium systemic evolution of ligands by exponential enrichment (SELEX) method was applied to a combinatorial library of FAM-labeled single-stranded DNA molecules to identify DNA aptamers demonstrating specific binding to Vibrio parahemolyticus . FAM-labeled aptamer sequences with high binding affinity to V. parahemolyticus were identified by flow cytometric analysis. Aptamer A3P, which showed a particularly high binding affinity in preliminary studies, was chosen for further characterization. This aptamer displayed a dissociation constant (K(d)) of 16.88 ± 1.92 nM. Binding assays to assess the specificity of aptamer A3P showed a high binding affinity (76%) for V. parahemolyticus and a low apparent binding affinity (4%) for other bacteria. Whole-bacterium SELEX is a promising technique for the design of aptamer-based molecular probes for microbial pathogens that does not require the labor-intensive steps of isolating and purifying complex markers or targets.

Application of mass spectrometry technologies for the discovery of low-molecular weight modulators of enzymes and protein-protein interactions.

PubMed

Zehender, Hartmut; Mayr, Lorenz M

2007-10-01

In recent years, mass spectrometry has gained widespread use as an assay and screening technology in drug discovery because it enables sensitive, label-free detection of low-molecular weight modulators of biomolecules as well as sensitive and accurate detection of high-molecular weight modifications of biomolecules. Electrospray and matrix-assisted laser desorption ionization are the most widely used ionization techniques to identify chemical compounds interfering with enzymatic function, receptor-ligand binding or molecules modulating a protein-protein interaction of interest. Mass spectrometry based techniques are no longer restricted to screening in biochemical assay systems but have now become also applicable to imaging of biomolecules and chemical compounds in cell-based assay systems and even in highly complex tissue sections.

Demonstration of four immunoassay formats using the array biosensor

NASA Technical Reports Server (NTRS)

Sapsford, Kim E.; Charles, Paul T.; Patterson, Charles H Jr; Ligler, Frances S.

2002-01-01

The ability of a fluorescence-based array biosensor to measure and quantify the binding of an antigen to an immobilized antibody has been demonstrated using the four different immunoassay formats: direct, competitive, displacement, and sandwich. A patterned array of antibodies specific for 2,4,6-trinitrotoluene (TNT) immobilized onto the surface of a planar waveguide and used to measure signals from different antigen concentrations simultaneously. For direct, competitive, and displacement assays, which are one-step assays, measurements were obtained in real time. Dose-response curves were calculated for all four assay formats, demonstrating the array biosensor's ability to quantify the amount of antigen present in solution.

Octahydropyrrolo[3,4-c]pyrrole negative allosteric modulators of mGlu1.

PubMed

Manka, Jason T; Rodriguez, Alice L; Morrison, Ryan D; Venable, Daryl F; Cho, Hyekyung P; Blobaum, Anna L; Daniels, J Scott; Niswender, Colleen M; Conn, P Jeffrey; Lindsley, Craig W; Emmitte, Kyle A

2013-09-15

Development of SAR in an octahydropyrrolo[3,4-c]pyrrole series of negative allosteric modulators of mGlu1 using a functional cell-based assay is described in this Letter. The octahydropyrrolo[3,4-c]pyrrole scaffold was chosen as an isosteric replacement for the piperazine ring found in the initial hit compound. Characterization of selected compounds in protein binding assays was used to identify the most promising analogs, which were then profiled in P450 inhibition assays in order to further assess the potential for drug-likeness within this series of compounds. Copyright © 2013 Elsevier Ltd. All rights reserved.

Comprehensive analysis of T cell epitope discovery strategies using 17DD yellow fever virus structural proteins and BALB/c (H2d) mice model.

PubMed

Maciel, Milton; Kellathur, Srinivasan N; Chikhlikar, Pryia; Dhalia, Rafael; Sidney, John; Sette, Alessandro; August, Thomas J; Marques, Ernesto T A

2008-08-15

Immunomics research uses in silico epitope prediction, as well as in vivo and in vitro approaches. We inoculated BALB/c (H2d) mice with 17DD yellow fever vaccine to investigate the correlations between approaches used for epitope discovery: ELISPOT assays, binding assays, and prediction software. Our results showed a good agreement between ELISPOT and binding assays, which seemed to correlate with the protein immunogenicity. PREDBALB/c prediction software partially agreed with the ELISPOT and binding assay results, but presented low specificity. The use of prediction software to exclude peptides containing no epitopes, followed by high throughput screening of the remaining peptides by ELISPOT, and the use of MHC-biding assays to characterize the MHC restrictions demonstrated to be an efficient strategy. The results allowed the characterization of 2 MHC class I and 17 class II epitopes in the envelope protein of the YF virus in BALB/c (H2d) mice.

High-throughput receptor-based assay for the detection of spirolides by chemiluminescence.

PubMed

Rodríguez, Laura P; Vilariño, Natalia; Molgó, Jordi; Aráoz, Rómulo; Botana, Luis M

2013-12-01

The spirolides are marine toxins that belong to a new class of macrocyclic imines produced by dinoflagellates. In this study a previously described solid-phase receptor-based assay for the detection of spirolides was optimized for high-throughput screening and prevalidated. This method is based on the competition between 13-desmethyl spirolide C and biotin-α-bungarotoxin immobilized on a streptavidin-coated surface, for binding to nicotinic acetylcholine receptors. In this inhibition assay the amount of nAChR bound to the well surface is quantified using a specific antibody, followed by a second anti-mouse IgG antibody labeled with horseradish peroxidase (HRP). The assay protocol was optimized for 384-well microplates, which allowed a reduction of the amount of reagents per sample and an increase of the number of samples per plate versus previously published receptor-based assays. The sensitivity of the assay for 13-desmethyl spirolide C ranged from 5 to 150 ng mL(-1). The performance of the assay in scallop extracts was adequate, with an estimated detection limit for 13-desmethyl spirolide C of 50 μg kg(-1) of shellfish meat. The recovery rate of 13-desmethyl spirolide C for spiked samples with this assay was 80% and the inter-assay coefficient of variation was 8%. This 384-well microplate, chemiluminescence method can be used as a high-throughput screening assay to detect 13-desmethyl spirolide C in shellfish meat in order to reduce the number of samples to be processed through bioassays or analytical methods. Copyright © 2013 Elsevier Ltd. All rights reserved.

Structural Transformation Detection Contributes to Screening of Behaviorally Active Compounds: Dynamic Binding Process Analysis of DhelOBP21 from Dastarcus helophoroides.

PubMed

Yang, Rui-Nan; Li, Dong-Zhen; Yu, Guangqiang; Yi, Shan-Cheng; Zhang, Yinan; Kong, De-Xin; Wang, Man-Qun

2017-12-01

In light of reverse chemical ecology, the fluorescence competitive binding assays of functional odorant binding proteins (OBPs) is a recent advanced approach for screening behaviorally active compounds of insects. Previous research on Dastareus helophoroides identified a minus-C OBP, DhelOBP21, which preferably binds to several ligands. In this study, only (+)-β-pinene proved attractive to unmated adult beetles. To obtain a more in-depth explanation of the lack of behavioral activity of other ligands we selected compounds with high (camphor) and low (β-caryophyllene) binding affinities. The structural transformation of OBPs was investigated using well-established approaches for studying binding processes, such as fluorescent quenching assays, circular dichroism, and molecular dynamics. The dynamic binding process revealed that the flexibility of DhelOBP21 seems conducive to binding specific ligands, as opposed to broad substrate binding. The compound (+)-β-pinene and DhelOBP21 formed a stable complex through a secondary structural transformation of DhelOBP21, in which its amino-terminus transformed from random coil to an α-helix to cover the binding pocket. On the other hand, camphor could not efficiently induce a stable structural transformation, and its high binding affinities were due to strong hydrogen-bonding, compromising the structure of the protein. The other compound, β-caryophyllene, only collided with DhelOBP21 and could not be positioned in the binding pocket. Studying structural transformation of these proteins through examining the dynamic binding process rather than using approaches that just measure binding affinities such as fluorescence competitive binding assays can provide a more efficient and reliable approach for screening behaviorally active compounds.

Design, discovery, modelling, synthesis, and biological evaluation of novel and small, low toxicity s-triazine derivatives as HIV-1 non-nucleoside reverse transcriptase inhibitors.

PubMed

Viira, Birgit; Selyutina, Anastasia; García-Sosa, Alfonso T; Karonen, Maarit; Sinkkonen, Jari; Merits, Andres; Maran, Uko

2016-06-01

A set of top-ranked compounds from a multi-objective in silico screen was experimentally tested for toxicity and the ability to inhibit the activity of HIV-1 reverse transcriptase (RT) in cell-free assay and in cell-based assay using HIV-1 based virus-like particles. Detailed analysis of a commercial sample that indicated specific inhibition of HIV-1 reverse transcription revealed that a minor component that was structurally similar to that of the main compound was responsible for the strongest inhibition. As a result, novel s-triazine derivatives were proposed, modelled, discovered, and synthesised, and their antiviral activity and cellular toxicity were tested. Compounds 18a and 18b were found to be efficient HIV-1 RT inhibitors, with an IC50 of 5.6±1.1μM and 0.16±0.05μM in a cell-based assay using infectious HIV-1, respectively. Compound 18b also had no detectable toxicity for different human cell lines. Their binding mode and interactions with the RT suggest that there was strong and adaptable binding in a tight (NNRTI) hydrophobic pocket. In summary, this iterative study produced structural clues and led to a group of non-toxic, novel compounds to inhibit HIV-RT with up to nanomolar potency. Copyright © 2016 Elsevier Ltd. All rights reserved.

Discovery of a Series of Acridinones as Mechanism-Based Tubulin Assembly Inhibitors with Anticancer Activity

PubMed Central

Magalhaes, Luma G.; Marques, Fernando B.; da Fonseca, Marina B.; Rogério, Kamilla R.; Graebin, Cedric S.; Andricopulo, Adriano D.

2016-01-01

Microtubules play critical roles in vital cell processes, including cell growth, division, and migration. Microtubule-targeting small molecules are chemotherapeutic agents that are widely used in the treatment of cancer. Many of these compounds are structurally complex natural products (e.g., paclitaxel, vinblastine, and vincristine) with multiple stereogenic centers. Because of the scarcity of their natural sources and the difficulty of their partial or total synthesis, as well as problems related to their bioavailability, toxicity, and resistance, there is an urgent need for novel microtubule binding agents that are effective for treating cancer but do not have these disadvantages. In the present work, our lead discovery effort toward less structurally complex synthetic compounds led to the discovery of a series of acridinones inspired by the structure of podophyllotoxin, a natural product with important microtubule assembly inhibitory activity, as novel mechanism-based tubulin assembly inhibitors with potent anticancer properties and low toxicity. The compounds were evaluated in vitro by wound healing assays employing the metastatic and triple negative breast cancer cell line MDA-MB-231. Four compounds with IC50 values between 0.294 and 1.7 μM were identified. These compounds showed selective cytotoxicity against MDA-MB-231 and DU-145 cancer cell lines and promoted cell cycle arrest in G2/M phase and apoptosis. Consistent with molecular modeling results, the acridinones inhibited tubulin assembly in in vitro polymerization assays with IC50 values between 0.9 and 13 μM. Their binding to the colchicine-binding site of tubulin was confirmed through competitive assays. PMID:27508497

2-Styrylindolium based fluorescent probes visualize neurofibrillary tangles in Alzheimer's disease.

PubMed

Gu, Jiamin; Anumala, Upendra Rao; Lo Monte, Fabio; Kramer, Thomas; Heyny von Haußen, Roland; Hölzer, Jana; Goetschy-Meyer, Valérie; Mall, Gerhard; Hilger, Ingrid; Czech, Christian; Schmidt, Boris

2012-12-15

We evaluated 2-styrylindolium derivatives (6-11) as novel and selective probes for neurofibrillary tangles (NFTs) on brain sections of AD patients. The staining experiments indicated that these compounds may bind selectively to NFTs in the presence of ß-amyloid (Aß) plaques. Cell free binding assays confirmed that 2-[2-[4-(1-pyrrolidinyl)phenyl]ethenyl]-1,3,3-trimethyl-3H-indolium iodide (9) and 2-[2-[4-(diethylamino)phenyl]ethenyl]-1-butyl-3,3-dimethyl-3H-indolium iodide (11) display excellent affinities to Tau-aggregates (IC(50) values of 5.1 and 1.4 nM, respectively) in the displacement of Thiazin Red R. These probes have good solubility in distilled water and low or no cytotoxicity in zebrafish embryo and liver hepatocellular carcinoma cell assays. Copyright © 2012 Elsevier Ltd. All rights reserved.

Dual-Color Luciferase Complementation for Chemokine Receptor Signaling.

PubMed

Luker, Kathryn E; Luker, Gary D

2016-01-01

Chemokine receptors may share common ligands, setting up potential competition for ligand binding, and association of activated receptors with downstream signaling molecules such as β-arrestin. Determining the "winner" of competition for shared effector molecules is essential for understanding integrated functions of chemokine receptor signaling in normal physiology, disease, and response to therapy. We describe a dual-color click beetle luciferase complementation assay for cell-based analysis of interactions of two different chemokine receptors, CXCR4 and ACKR3, with the intracellular scaffolding protein β-arrestin 2. This assay provides real-time quantification of receptor activation and signaling in response to chemokine CXCL12. More broadly, this general imaging strategy can be applied to quantify interactions of any set of two proteins that interact with a common binding partner. © 2016 Elsevier Inc. All rights reserved.

A REACTIVITY PATTERN OF DISCRIMINATION OF ER AGONISM AND ANTAGONISM BASED ON 3-D MOLECULAR ATTRIBUTES

EPA Science Inventory

Various models have been developed to predict the relative binding affinity (RBA) of chemicals to estrogen receptors (ER). These models are important for prioritizing chemicals for screening in biological assays assessing the potential for endocrine disruption. One shortcoming of...

Binding determinants in the interplay between porcine aminopeptidase N and enterotoxigenic Escherichia coli F4 fimbriae.

PubMed

Xia, Pengpeng; Quan, Guomei; Yang, Yi; Zhao, Jing; Wang, Yiting; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Jianzhong; Liu, Siguo; Zhu, Guoqiang

2018-02-26

The binding of F4 + enterotoxigenic Escherichia coli (ETEC) and the specific receptor on porcine intestinal epithelial cells is the initial step in F4 + ETEC infection. Porcine aminopeptidase N (APN) is a newly discovered receptor for F4 fimbriae that binds directly to FaeG adhesin, which is the major subunit of the F4 fimbriae variants F4ab, F4ac, and F4ad. We used overlapping peptide assays to map the APN-FaeG binding sites, which has facilitated in the identifying the APN-binding amino acids that are located in the same region of FaeG variants, thereby limiting the major binding regions of APN to 13 peptides. To determine the core sequence motif, a panel of FaeG peptides with point mutations and FaeG mutants were constructed. Pull-down and binding reactivity assays using piglet intestines determined that the amino acids G159 of F4ab, N209 and L212 of F4ac, and A200 of F4ad were the critical residues for APN binding of FaeG. We further show using ELISA and confocal microscopy assay that amino acids 553-568, and 652-670 of the APN comprise the linear epitope for FaeG binding in all three F4 fimbriae variants.

Identification of DNA primase inhibitors via a combined fragment-based and virtual screening

NASA Astrophysics Data System (ADS)

Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak

2016-11-01

The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets.

Substitution of synthetic chimpanzee androgen receptor for human androgen receptor in competitive binding and transcriptional activation assays for EDC screening

EPA Science Inventory

The potential effect of receptor-mediated endocrine modulators across species is of increasing concern. In attempts to address these concerns we are developing androgen and estrogen receptor binding assays using recombinant hormone receptors from a number of species across differ...

RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND THE HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY

EPA Science Inventory

Rainbow Trout Androgen Receptor Alpha And Human Androgen Receptor: Comparisons in the COS Whole Cell Binding Assay
Mary C. Cardon, L. Earl Gray, Jr. and Vickie S. Wilson
U.S. Environmental Protection Agency, ORD, NHEERL, Reproductive Toxicology Division, Research Triangle...

Preclinical Evaluation of [(18)F]THK-5105 Enantiomers: Effects of Chirality on Its Effectiveness as a Tau Imaging Radiotracer.

PubMed

Tago, Tetsuro; Furumoto, Shozo; Okamura, Nobuyuki; Harada, Ryuichi; Adachi, Hajime; Ishikawa, Yoichi; Yanai, Kazuhiko; Iwata, Ren; Kudo, Yukitsuka

2016-04-01

Noninvasive imaging of tau and amyloid-β pathologies would facilitate diagnosis of Alzheimer's disease (AD). Recently, we have developed [(18)F]THK-5105 for selective detection of tau pathology by positron emission tomography (PET). The purpose of this study was to clarify biological properties of optically pure [(18)F]THK-5105 enantiomers. Binding for tau aggregates in AD brain section was evaluated by autoradiography (ARG). In vitro binding assays were performed to evaluate the binding properties of enantiomers for AD brain homogenates. The pharmacokinetics in the normal mouse brains was assessed by ex vivo biodistribution assay The ARG of enantiomers showed the high accumulation of radioactivity corresponding to the distribution of tau deposits. In vitro binding assays revealed that (S)-[(18)F]THK-5105 has slower dissociation from tau than (R)-[(18)F]THK-5105. Biodistribution assays indicated that (S)-[(18)F]THK-5105 eliminated faster from the mouse brains and blood compared with (R)-[(18)F]THK-5105. (S)-[(18)F]THK-5105 could be more suitable than (R)-enantiomer for a tau imaging agent.

Fluorescence polarization-based assay using N-glycan-conjugated quantum dots for screening in hemagglutinin blockers for influenza A viruses.

PubMed

Okamatsu, Masatoshi; Feng, Fei; Ohyanagi, Tatsuya; Nagahori, Noriko; Someya, Kazuhiko; Sakoda, Yoshihiro; Miura, Nobuaki; Nishimura, Shin-Ichiro; Kida, Hiroshi

2013-02-01

Attachment of influenza virus to susceptible cells is mediated by viral protein hemagglutinin (HA), which recognizes cell surface glycoconjugates that terminate in α-sialosides. To develop anti-influenza drugs based on inhibition of HA-mediated infection, novel fluorescent nanoparticles displaying multiple biantennary N-glycan chains with α-sialosides (A2-PC-QDs) that have high affinity for the HA were designed and constructed. The A2-PC-QDs enabled an easy and efficient fluorescence polarization (FP) assay for detection of interaction with the HA and competitive inhibition even by small molecule compounds against A2-PC-QDs-HA binding. The quantum dot (QD)-based FP assay established in the present study is a useful tool for high-throughput screening and to accelerate the development of novel and more effective blockers of the viral attachment of influenza virus. Copyright © 2012 Elsevier B.V. All rights reserved.

In search of novel ligands using a structure-based approach: a case study on the adenosine A2A receptor.

PubMed

Lenselink, Eelke B; Beuming, Thijs; van Veen, Corine; Massink, Arnault; Sherman, Woody; van Vlijmen, Herman W T; IJzerman, Adriaan P

2016-10-01

In this work, we present a case study to explore the challenges associated with finding novel molecules for a receptor that has been studied in depth and has a wealth of chemical information available. Specifically, we apply a previously described protocol that incorporates explicit water molecules in the ligand binding site to prospectively screen over 2.5 million drug-like and lead-like compounds from the commercially available eMolecules database in search of novel binders to the adenosine A 2A receptor (A 2A AR). A total of seventy-one compounds were selected for purchase and biochemical assaying based on high ligand efficiency and high novelty (Tanimoto coefficient ≤0.25 to any A 2A AR tested compound). These molecules were then tested for their affinity to the adenosine A 2A receptor in a radioligand binding assay. We identified two hits that fulfilled the criterion of ~50 % radioligand displacement at a concentration of 10 μM. Next we selected an additional eight novel molecules that were predicted to make a bidentate interaction with Asn253 6.55 , a key interacting residue in the binding pocket of the A 2A AR. None of these eight molecules were found to be active. Based on these results we discuss the advantages of structure-based methods and the challenges associated with finding chemically novel molecules for well-explored targets.

Nerve cell-mimicking liposomes as biosensor for botulinum neurotoxin complete physiological activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weingart, Oliver G., E-mail: Oliver.Weingart@hest.

Botulinum neurotoxins (BoNT) are the most toxic substances known, and their neurotoxic properties and paralysing effects are exploited for medical treatment of a wide spectrum of disorders. To accurately quantify the potency of a pharmaceutical BoNT preparation, its physiological key activities (binding to membrane receptor, translocation, and proteolytic degradation of SNARE proteins) need to be determined. To date, this was only possible using animal models, or, to a limited extent, cell-based assays. We here report a novel in vitro system for BoNT/B analysis, based on nerve-cell mimicking liposomes presenting motoneuronal membrane receptors required for BoNT binding. Following triggered membrane translocationmore » of the toxin's Light Chain, the endopeptidase activity can be quantitatively monitored employing a FRET-based reporter assay within the functionalized liposomes. We were able to detect BoNT/B physiological activity at picomolar concentrations in short time, opening the possibility for future replacement of animal experimentation in pharmaceutical BoNT testing. - Highlights: • A cell-free in vitro system was used to measure BoNT/B physiological function. • The system relies on nerve-cell mimicking liposomes as a novel detection system. • A FRET-based reporter assay is used as final readout of the test system. • BoNT/B physiological activity was detected at picogram quantities in short time. • The method opens the possibility to replace animal experimentation in BoNT testing.« less

Identification and Characterization of a Broadly Cross-Reactive HIV-1 Human Monoclonal Antibody That Binds to Both gp120 and gp41

PubMed Central

Zhang, Mei-Yun; Yuan, Tingting; Li, Jingjing; Rosa Borges, Andrew; Watkins, Jennifer D.; Guenaga, Javier; Yang, Zheng; Wang, Yanping; Wilson, Richard; Li, Yuxing; Polonis, Victoria R.; Pincus, Seth H.; Ruprecht, Ruth M.; Dimitrov, Dimiter S.

2012-01-01

Identification of broadly cross-reactive HIV-1-neutralizing antibodies (bnAbs) may assist vaccine immunogen design. Here we report a novel human monoclonal antibody (mAb), designated m43, which co-targets the gp120 and gp41 subunits of the HIV-1 envelope glycoprotein (Env). M43 bound to recombinant gp140 s from various primary isolates, to membrane-associated Envs on transfected cells and HIV-1 infected cells, as well as to recombinant gp120 s and gp41 fusion intermediate structures containing N-trimer structure, but did not bind to denatured recombinant gp140 s and the CD4 binding site (CD4bs) mutant, gp120 D368R, suggesting that the m43 epitope is conformational and overlaps the CD4bs on gp120 and the N-trimer structure on gp41. M43 neutralized 34% of the HIV-1 primary isolates from different clades and all the SHIVs tested in assays based on infection of peripheral blood mononuclear cells (PBMCs) by replication-competent virus, but was less potent in cell line-based pseudovirus assays. In contrast to CD4, m43 did not induce Env conformational changes upon binding leading to exposure of the coreceptor binding site, enhanced binding of mAbs 2F5 and 4E10 specific for the membrane proximal external region (MPER) of gp41 Envs, or increased gp120 shedding. The overall modest neutralization activity of m43 is likely due to the limited binding of m43 to functional Envs which could be increased by antibody engineering if needed. M43 may represent a new class of bnAbs targeting conformational epitopes overlapping structures on both gp120 and gp41. Its novel epitope and possibly new mechanism(s) of neutralization could helpdesign improved vaccine immunogens and candidate therapeutics. PMID:22970187

Detection of glycosylation abnormality in rheumatoid IgG using N-acetylglucosamine-specific Psathyrella velutina lectin.

PubMed

Tsuchiya, N; Endo, T; Matsuta, K; Yoshinoya, S; Takeuchi, F; Nagano, Y; Shiota, M; Furukawa, K; Kochibe, N; Ito, K

1993-07-15

Although the galactose deficiency in the Asn297-linked sugar chains of serum IgG from patients with rheumatoid arthritis (RA) has been established, structural analysis of sugar chains has not been readily available. Psathyrella velutina lectin (PVL) preferentially interacts with the N-acetylglucosamine beta 1-->2Man group, exposed at the termini of sugar chains in agalacto IgG. Biotinylated PVL reacted strongly in Western blotting with H chains of IgG derived from patients with RA. An ELISA-based assay for the detection of agalacto IgG was developed using recombinant protein G and biotinylated PVL in combination, and the screening of patients' sera was performed. PVL binding of serum IgG significantly correlated with percentage of galactose-deficient IgG determined by the structural analysis. Age-related slight increase in PVL binding was observed among normal controls. Patients with RA showed significantly higher PVL binding (37.90 +/- 42.25 U/ml, n = 93) as compared with normal controls (5.75 +/- 2.92 U/ml, n = 112) (p = 0.0001). Patients with SLE showed lower but still significant PVL binding (17.86 +/- 5.18 U/ml, n = 10, p = 0.0001). PVL binding correlated with C-reactive protein level in serial analysis of individual RA patients, and was significantly higher in the synovial fluid compared with paired serum samples. PVL binding assay may provide an ideal tool for the simple and sensitive detection of agalacto IgG.

Bio-nanocapsule-based scaffold improves the sensitivity and ligand-binding capacity of mammalian receptors on the sensor chip.

PubMed

Iijima, Masumi; Yoshimoto, Nobuo; Niimi, Tomoaki; Maturana, Andrés D; Kuroda, Shun'ichi

2016-06-01

Mammalian receptors are recognized as target molecules for drug discovery, and chemical libraries have been screened for both potential antagonists and agonists mainly by ligand-binding assays using immobilized receptors. A bio-nanocapsule (BNC) of approximately 30 nm that displays a tandem form of the protein A-derived immunoglobulin G (IgG) Fc-binding Z domains (denoted as ZZ-BNC) has been developed for both clustering and oriented immobilization of IgGs on the solid phase of immunosensors. In this study, human IgG1 Fc-fused vascular endothelial growth factor (VEGF) receptor was immobilized through ZZ-BNC on the sensor chip of quartz crystal microbalance (ZZ-BNC-coating). When compared with direct adsorption and protein A-coating, the sensor chip showed higher sensitivity (∽46- and ∽165-fold, respectively) and larger ligand-binding capacity (∽4- and ∽18-fold, respectively). Furthermore, the number of VEGF molecules bound to its receptor increased from 0.20 (direct adsorption) to 2.06 by ZZ-BNC-coating, strongly suggesting that ZZ-BNC reduced the steric hindrance near ligand recognition sites through oriented immobilization. Similarly, the sensitivity and ligand-binding capacity of leptin and prolactin receptors were both enhanced at a level comparable to that observed for the VEGF receptor. Thus, the combination of ZZ-BNC and Fc-fused receptors could significantly improve the function of ligand-binding assays. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Functional coupling between adenosine A1 receptors and G-proteins in rat and postmortem human brain membranes determined with conventional guanosine-5'-O-(3-[35S]thio)triphosphate ([35S]GTPγS) binding or [35S]GTPγS/immunoprecipitation assay.

PubMed

Odagaki, Yuji; Kinoshita, Masakazu; Ota, Toshio; Meana, J Javier; Callado, Luis F; Matsuoka, Isao; García-Sevilla, Jesús A

2018-06-01

Adenosine signaling plays a complex role in multiple physiological processes in the brain, and its dysfunction has been implicated in pathophysiology of neuropsychiatric diseases such as schizophrenia and affective disorders. In the present study, the coupling between adenosine A 1 receptor and G-protein was assessed by means of two [ 35 S]GTPγS binding assays, i.e., conventional filtration method and [ 35 S]GTPγS binding/immunoprecipitation in rat and human brain membranes. The latter method provides information about adenosine A 1 receptor-mediated Gα i-3 activation in rat as well as human brain membranes. On the other hand, adenosine-stimulated [ 35 S]GTPγS binding determined with conventional assay derives from functional activation of Gα i/o proteins (not restricted only to Gα i-3 ) coupled to adenosine A 1 receptors. The determination of adenosine concentrations in the samples used in the present study indicates the possibility that the assay mixture under our experimental conditions contains residual endogenous adenosine at nanomolar concentrations, which was also suggested by the results on the effects of adenosine receptor antagonists on basal [ 35 S]GTPγS binding level. The effects of adenosine deaminase (ADA) on basal binding also support the presence of adenosine. Nevertheless, the varied patterns of ADA discouraged us from adding ADA into assay medium routinely. The concentration-dependent increases elicited by adenosine were determined in 40 subjects without any neuropsychiatric disorders. The increases in %E max values determined by conventional assay according to aging and postmortem delay should be taken into account in future studies focusing on the effects of psychiatric disorders on adenosine A 1 receptor/G-protein interaction in postmortem human brain tissue.

Geraniin extracted from the rind of Nephelium lappaceum binds to dengue virus type-2 envelope protein and inhibits early stage of virus replication.

PubMed

Abdul Ahmad, Siti Aisyah; Palanisamy, Uma D; Tejo, Bimo A; Chew, Miaw Fang; Tham, Hong Wai; Syed Hassan, Sharifah

2017-11-21

The rapid rise and spread in dengue cases, together with the unavailability of safe vaccines and effective antiviral drugs, warrant the need to discover and develop novel anti-dengue treatments. In this study the antiviral activity of geraniin, extracted from the rind of Nephelium lappaceum, against dengue virus type-2 (DENV-2) was investigated. Geraniin was prepared from Nephelium lappaceum rind by reverse phase C-18 column chromatography. Cytotoxicity of geraniin towards Vero cells was evaluated using MTT assay while IC 50 value was determined by plaque reduction assay. The mode-of-action of geraniin was characterized using the virucidal, attachment, penetration and the time-of-addition assays'. Docking experiments with geraniin molecule and the DENV envelope (E) protein was also performed. Finally, recombinant E Domain III (rE-DIII) protein was produced to physiologically test the binding of geraniin to DENV-2 E-DIII protein, through ELISA competitive binding assay. Cytotoxicity assay confirmed that geraniin was not toxic to Vero cells, even at the highest concentration tested. The compound exhibited DENV-2 plaque formation inhibition, with an IC 50 of 1.75 μM. We further revealed that geraniin reduced viral infectivity and inhibited DENV-2 from attaching to the cells but had little effect on its penetration. Geraniin was observed to be most effective when added at the early stage of DENV-2 infection. Docking experiments showed that geraniin binds to DENV E protein, specifically at the DIII region, while the ELISA competitive binding assay confirmed geraniin's interaction with rE-DIII with high affinity. Geraniin from the rind of Nephelium lappaceum has antiviral activity against DENV-2. It is postulated that the compound inhibits viral attachment by binding to the E-DIII protein and interferes with the initial cell-virus interaction. Our results demonstrate that geraniin has the potential to be developed into an effective antiviral treatment, particularly for early phase dengue viral infection.

Method for screening inhibitors of the toxicity of Bacillus anthracis

DOEpatents

Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.

2001-01-01

The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.

In vivo biotinylation and incorporation of a photo-inducible unnatural amino acid to an antibody-binding domain improve site-specific labeling of antibodies.

PubMed

Kanje, Sara; Hober, Sophia

2015-04-01

Antibodies are important molecules in many research fields, where they play a key role in various assays. Antibody labeling is therefore of great importance. Currently, most labeling techniques take advantage of certain amino acid side chains that commonly appear throughout proteins. This makes it hard to control the position and exact degree of labeling of each antibody. Hence, labeling of the antibody may affect the antibody-binding site. This paper presents a novel protein domain based on the IgG-binding domain C2 of streptococcal protein G, containing the unnatural amino acid BPA, that can cross-link other molecules. This novel domain can, with improved efficiency compared to previously reported similar domains, site-specifically cross-link to IgG at the Fc region. An efficient method for simultaneous in vivo incorporation of BPA and specific biotinylation in a flask cultivation of Escherichia coli is described. In comparison to a traditionally labeled antibody sample, the C2-labeled counterpart proved to have a higher proportion of functional antibodies when immobilized on a solid surface and the same limit of detection in an ELISA. This method of labeling is, due to its efficiency and simplicity, of high interest for all antibody-based assays where it is important that labeling does not interfere with the antibody-binding site. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Surface plasmon resonance as a tool for ligand-binding assay reagent characterization in bioanalysis of biotherapeutics.

PubMed

Duo, Jia; Bruno, JoAnne; Kozhich, Alexander; David-Brown, Donata; Luo, Linlin; Kwok, Suk; Santockyte, Rasa; Haulenbeek, Jonathan; Liu, Rong; Hamuro, Lora; Peterson, Jon E; Piccoli, Steven; DeSilva, Binodh; Pillutla, Renuka; Zhang, Yan J

2018-04-01

Ligand-binding assay (LBA) performance depends on quality reagents. Strategic reagent screening and characterization is critical to LBA development, optimization and validation. Application of advanced technologies expedites the reagent screening and assay development process. By evaluating surface plasmon resonance technology that offers high-throughput kinetic information, this article aims to provide perspectives on applying the surface plasmon resonance technology to strategic LBA critical reagent screening and characterization supported by a number of case studies from multiple biotherapeutic programs.

Binding Assays Using Recombinant SH2 Domains: Far-Western, Pull-Down, and Fluorescence Polarization.

PubMed

Machida, Kazuya; Liu, Bernard

2017-01-01

Recognition of phosphotyrosine-containing sequences by SH2 domains confers specificity in tyrosine kinase pathways. By assessing interactions between isolated SH2 domains and their binding proteins, it is possible to gain insight into otherwise inaccessible complex cellular systems. Far-Western, pull-down, and fluorescence polarization (FP) have been frequently used for characterization of phosphotyrosine signaling. Here, we outline standard protocols for these established assays using recombinant SH2 domain, emphasizing the importance of appropriate sample preparation and assay controls.

Piezoelectrically driven vertical cavity acoustic transducers for the convective transport and rapid detection of DNA and protein binding to DNA microarrays with SPR imaging--a parametric study.

PubMed

Okabe, Yuka; Chen, Yulin; Purohit, Rishi; Corn, Robert M; Lee, Abraham P

2012-05-15

Mixing within the microdomain is limited because convective mixing cannot be achieved since diffusion dominates as the main form of transport. Hence microassays can take on the order of 1 to 72 h, without the aid of a passive or active mixer to shorten the time of transport of a target molecule to a probe (Lai et al., 2004). Liu et al. (2002, 2003) developed a low cost cavitation microstreaming based mixer which is easy to implement and use, but no comprehensive study has been done to optimize such a mixer for various applications. We present a study of the effects of various frequencies and cavity parameters on mixing using dye and surface based assays with protein, DNA, and nanoparticles to obtain an optimum mixing frequency and configuration for a wide range of assay applications. We present a novel method to monitor real time binding using surface plasmon resonance imaging (SPRI) coupled with a vertical cavity acoustic transducer (VCAT) micromixer for various biomolecule surface assays. The combination of VCAT and SPRI allows assay signal saturation within one minute while conserving reagent volume. The kinetic rate constant for adsorption (k(a)) and desorption (k(d)) as well as the limit of detection (LOD) of 5 nM for the DNA duplex formation are reported using this VCAT micromixer. Copyright © 2012 Elsevier B.V. All rights reserved.

Identification of second arginine-glycine-aspartic acid motif of ovine vitronectin as the complement C9 binding site and its implication in bacterial infection.

PubMed

Prasada, Rao T; Lakshmi, Prasanth T; Parvathy, R; Murugavel, S; Karuna, Devi; Paritosh, Joshi

2017-02-01

Vitronectin (Vn), a multifunctional protein of blood and extracellular matrix, interacts with complement C9. This interaction may modulate innate immunity. Details of Vn-C9 interactions are limited. Vn-C9 interactions were assessed by employing a goat homologous system and observing Vn binding to C9 in three different assays. Using recombinant fragments, C9 binding was mapped to the N-terminus of Vn. Site directed mutagenesis was performed to alter the second arginine glycine aspartic acid (RGD) sequence (RGD-2) of Vn. Changing R to G or D to A in RGD-2 caused significant decrease in Vn binding to C9 whereas changing of R to G in the first RGD motif (RGD-1) had no effect on Vn binding to C9. These results imply that the RGD-2 of goat Vn is involved in C9 binding. In a competitive binding assay, the presence of soluble RGD peptide inhibited Vn binding to C9 whereas heparin had no effect. Vn binding to C9 was also evaluated in terms of bacterial pathogenesis. Serum dependent inhibition of Escherichia coli growth was significantly reverted when Vn or its N-fragment were included in the assay. The C-fragment, which did not support C9 binding, also partly nullified serum-dependent inhibition of bacterial growth, probably through other serum component(s). © 2017 The Societies and John Wiley & Sons Australia, Ltd.

SKLB060 Reversibly Binds to Colchicine Site of Tubulin and Possesses Efficacy in Multidrug-Resistant Cell Lines.

PubMed

Yan, Wei; Yang, Tao; Yang, Jianhong; Wang, Taijin; Yu, Yamei; Wang, Yuxi; Chen, Qiang; Bai, Peng; Li, Dan; Ye, Haoyu; Qiu, Qiang; Zhou, Yongzhao; Hu, Yiguo; Yang, Shengyong; Wei, Yuquan; Li, Weimin; Chen, Lijuan

2018-05-22

Many tubulin inhibitors are in clinical use as anti-cancer drugs. In our previous study, a novel series of 4-substituted coumarins derivatives were identified as novel tubulin inhibitors. Here, we report the anti-cancer activity and underlying mechanism of one of the 4-substituted coumarins derivatives (SKLB060). The anti-cancer activity of SKLB060 was tested on 13 different cancer cell lines and four xenograft cancer models. Immunofluorescence staining, cell cycle analysis, and tubulin polymerization assay were employed to study the inhibition of tubulin. N, N '-Ethylenebis(iodoacetamide) assay was used to measure binding to the colchicine site. Wound-healing migration and tube formation assays were performed on human umbilical vascular endothelial cells to study anti-vascular activity (the ability to inhibit blood vessel growth). Mitotic block reversibility and structural biology assays were used to investigate the SKLB060-tubulin bound model. SKLB060 inhibited tubulin polymerization and subsequently induced G2/M cell cycle arrest and apoptosis in cancer cells. SKLB060 bound to the colchicine site of β-tubulin and showed antivascular activity in vitro. Moreover, SKLB060 induced reversible cell cycle arrest and reversible inhibition of tubulin polymerization. A mitotic block reversibility assay showed that the effects of SKLB060 have greater reversibility than those of colcemid (a reversible tubulin inhibitor), indicating that SKLB060 binds to tubulin in a totally reversible manner. The crystal structures of SKLB060-tubulin complexes confirmed that SKLB060 binds to the colchicine site, and the natural coumarin ring in SKLB060 enables reversible binding. These results reveal that SKLB060 is a powerful and reversible microtubule inhibitor that binds to the colchicine site and is effective in multidrug-resistant cell lines. © 2018 The Author(s). Published by S. Karger AG, Basel.

Efficient Identification of Novel Hla-A*0201–Presented Cytotoxic T Lymphocyte Epitopes in the Widely Expressed Tumor Antigen Prame by Proteasome-Mediated Digestion Analysis

PubMed Central

Kessler, Jan H.; Beekman, Nico J.; Bres-Vloemans, Sandra A.; Verdijk, Pauline; van Veelen, Peter A.; Kloosterman-Joosten, Antoinette M.; Vissers, Debby C.J.; ten Bosch, George J.A.; Kester, Michel G.D.; Sijts, Alice; Drijfhout, Jan Wouter; Ossendorp, Ferry; Offringa, Rienk; Melief, Cornelis J.M.

2001-01-01

We report the efficient identification of four human histocompatibility leukocyte antigen (HLA)-A*0201–presented cytotoxic T lymphocyte (CTL) epitopes in the tumor-associated antigen PRAME using an improved “reverse immunology” strategy. Next to motif-based HLA-A*0201 binding prediction and actual binding and stability assays, analysis of in vitro proteasome-mediated digestions of polypeptides encompassing candidate epitopes was incorporated in the epitope prediction procedure. Proteasome cleavage pattern analysis, in particular determination of correct COOH-terminal cleavage of the putative epitope, allows a far more accurate and selective prediction of CTL epitopes. Only 4 of 19 high affinity HLA-A*0201 binding peptides (21%) were found to be efficiently generated by the proteasome in vitro. This approach avoids laborious CTL response inductions against high affinity binding peptides that are not processed and limits the number of peptides to be assayed for binding. CTL clones induced against the four identified epitopes (VLDGLDVLL, PRA100–108; SLYSFPEPEA, PRA142–151; ALYVDSLFFL, PRA300–309; and SLLQHLIGL, PRA425–433) lysed melanoma, renal cell carcinoma, lung carcinoma, and mammary carcinoma cell lines expressing PRAME and HLA-A*0201. This indicates that these epitopes are expressed on cancer cells of diverse histologic origin, making them attractive targets for immunotherapy of cancer. PMID:11136822

Thermodynamics of ligand binding to histone deacetylase like amidohydrolase from Bordetella/Alcaligenes.

PubMed

Meyners, Christian; Baud, Matthias G J; Fuchter, Matthew J; Meyer-Almes, Franz-Josef

2014-03-01

Thermodynamic studies on ligand-protein binding have become increasingly important in the process of drug design. In combination with structural data and molecular dynamics simulations, thermodynamic studies provide relevant information about the mode of interaction between compounds and their target proteins and therefore build a sound basis for further drug optimization. Using the example of histone deacetylases (HDACs), particularly the histone deacetylase like amidohydrolase (HDAH) from Bordetella/Alcaligenes, a novel sensitive competitive fluorescence resonance energy transfer-based binding assay was developed and the thermodynamics of interaction of both fluorescent ligands and inhibitors to histone deacetylase like amidohydrolase were investigated. The assay consumes only small amounts of valuable target proteins and is suitable for fast kinetic and mechanistic studies as well as high throughput screening applications. Binding affinity increased with increasing length of aliphatic spacers (n = 4-7) between the hydroxamate moiety and the dansyl head group of ligand probes. Van't Hoff plots revealed an optimum in enthalpy contribution to the free energy of binding for the dansyl-ligand with hexyl spacer. The selectivity in the series of dansyl-ligands against human class I HDAC1 but not class II HDACs 4 and 6 increased with the ratio of ΔH(0)/ΔG(0). The data clearly emphasize the importance of thermodynamic signatures as useful general guidance for the optimization of ligands or rational drug design. Copyright © 2014 John Wiley & Sons, Ltd.

Discovery and Optimization of Novel 5-Indolyl-7-arylimidazo[1,2-a]pyridine-8-carbonitrile Derivatives as Potent Antitubulin Agents Targeting Colchicine-binding Site

NASA Astrophysics Data System (ADS)

Zhai, Xin; Wang, Xiaoqiang; Wang, Jiao; Liu, Jin; Zuo, Daiying; Jiang, Nan; Zeng, Tianfang; Yang, Xiuxiu; Jing, Tongfei; Gong, Ping

2017-02-01

Aiming at development of potent antitubulin agents targeting colchicine-binding site, a series of novel 5-indolyl-7-arylimidazo[1,2-a]pyridine-8-carbonitrilederivatives (5a-5v and 7a-7h) were designed based on bioisosterism and hybridization strategies. All these compounds were concisely synthesized via a three-step process and examined against five human cancer cell lines (HT-29, A549, MKN-45, MDA-MB-231 and SMMC-7721) along with a normal human cell (L02) in vitro. A structure-activity relationships (SARs) study was carried out and optimization towards this series of compounds in cellular assay resulted in the discovery of 5k, which displayed similar or better antitumor potency against the tested cancer cells with IC50 value ranging from 0.02 to 1.22 μM superior to CA-4 and Crolibulin. Significantly, a cell cycle study disclosed the ability of 5k to arrest cell cycle at the G2/M phase, and immunofluorescence assay as well as a colchicine competition assay revealed that tubulin polymerization was disturbed by 5k by binding to the colchicine site. Moreover, the molecular modeling mode showed the posture of 5k and Crolibulin was similar in the colchcine-binding pocket of tubulin as identified with the SARs and pharmacological results. Together, all these results rationalized 5k might serve as a promising lead for a novel class of antitubulin agents for cancer treatments.

Microfluidic Devices for Automation of Assays on Drosophila Melanogaster for Applications in Drug Discovery and Biological Studies.

PubMed

Ghaemi, Reza; Selvaganapathy, Ponnambalam R

Drug discovery is a long and expensive process, which usually takes 12-15 years and could cost up to ~$1 billion. Conventional drug discovery process starts with high throughput screening and selection of drug candidates that bind to specific target associated with a disease condition. However, this process does not consider whether the chosen candidate is optimal not only for binding but also for ease of administration, distribution in the body, effect of metabolism and associated toxicity if any. A holistic approach, using model organisms early in the drug discovery process to select drug candidates that are optimal not only in binding but also suitable for administration, distribution and are not toxic is now considered as a viable way for lowering the cost and time associated with the drug discovery process. However, the conventional drug discovery assays using Drosophila are manual and required skill operator, which makes them expensive and not suitable for high-throughput screening. Recently, microfluidics has been used to automate many of the operations (e.g. sorting, positioning, drug delivery) associated with the Drosophila drug discovery assays and thereby increase their throughput. This review highlights recent microfluidic devices that have been developed for Drosophila assays with primary application towards drug discovery for human diseases. The microfluidic devices that have been reviewed in this paper are categorized based on the stage of the Drosophila that have been used. In each category, the microfluidic technologies behind each device are described and their potential biological applications are discussed.

Selection of fluorophore and quencher pairs for fluorescent nucleic acid hybridization probes.

PubMed

Marras, Salvatore A E

2006-01-01

With the introduction of simple and relatively inexpensive methods for labeling nucleic acids with nonradioactive labels, doors have been opened that enable nucleic acid hybridization probes to be used for research and development, as well as for clinical diagnostic applications. The use of fluorescent hybridization probes that generate a fluorescence signal only when they bind to their target enables real-time monitoring of nucleic acid amplification assays. The use of hybridization probes that bind to the amplification products in real-time markedly improves the ability to obtain quantitative results. Furthermore, real-time nucleic acid amplification assays can be carried out in sealed tubes, eliminating carryover contamination. Because fluorescent hybridization probes are available in a wide range of colors, multiple hybridization probes, each designed for the detection of a different nucleic acid sequence and each labeled with a differently colored fluorophore, can be added to the same nucleic acid amplification reaction, enabling the development of high-throughput multiplex assays. It is therefore important to carefully select the labels of hybridization probes, based on the type of hybridization probe used in the assay, the number of targets to be detected, and the type of apparatus available to perform the assay. This chapter outlines different aspects of choosing appropriate labels for the different types of fluorescent hybridization probes used with different types of spectrofluorometric thermal cyclers.

Enhanced Sensitive Immunoassay: Noncompetitive Phage Anti-Immune Complex Assay for the Determination of Malachite Green and Leucomalachite Green

PubMed Central

2015-01-01

To develop a more sensitive immunoassay for malachite green (MG) and leucomalachite green (LMG), we identified the immunocomplex binding phage-borne peptides for use in the noncompetitive phage anti-immunocomplex assay (PHAIA). An anti-LMG monoclonal antibody (mAb) was used to select immunocomplex binding peptides from a circular random eight-amino-acid phage-displayed library. After three rounds of panning-elution, five peptides that bound the LMG–mAb immunocomplex were obtained. One of the phage-borne peptide clones that resulted in an assay with the highest sensitivity was chosen for further research. The concentration of LMG producing 50% of the saturated signal and the limit of detection of the assay were 7.02 and 0.55 ng/mL, respectively, with a linear range of 1.35 to 21.56 ng/mL. The PHAIA based on the same antibody was 16 times more sensitive compared to the competitive immunoassay. PHAIA was used to analyze LMG, MG, and two mixtures of spiked fish samples, with validation by high-performance liquid chromatography (HPLC) with fluorescence detector. Results showed a good correlation (R2LMG = 0.9841; R2MG = 0.993; R2Mixture = 0.9903) between the data of PHAIA and HPLC, thus the assay was an efficient method for monitoring food safety. PMID:25077381

Sol-Gel-Based Titania-Silica Thin Film Overlay for Long Period Fiber Grating-Based Biosensors.

PubMed

Chiavaioli, Francesco; Biswas, Palas; Trono, Cosimo; Jana, Sunirmal; Bandyopadhyay, Somnath; Basumallick, Nandini; Giannetti, Ambra; Tombelli, Sara; Bera, Susanta; Mallick, Aparajita; Baldini, Francesco

2015-12-15

An evanescent wave optical fiber biosensor based on titania-silica-coated long period grating (LPG) is presented. The chemical overlay, which increases the refractive index (RI) sensitivity of the sensor, consists of a sol-gel-based titania-silica thin film, deposited along the sensing portion of the fiber by means of the dip-coating technique. Changing both the sol viscosity and the withdrawal speed during the dip-coating made it possible to adjust the thickness of the film overlay, which is a crucial parameter for the sensor performance. After the functionalization of the fiber surface using a methacrylic acid/methacrylate copolymer, an antibody/antigen (IgG/anti-IgG) assay was carried out to assess the performance of sol-gel based titania-silica-coated LPGs as biosensors. The analyte concentration was determined from the wavelength shift at the end of the binding process and from the initial binding rate. This is the first time that a sol-gel based titania-silica-coated LPG is proposed as an effective and feasible label-free biosensor. The specificity of the sensor was validated by performing the same model assay after spiking anti-IgG into human serum. With this structured LPG, detection limits of the order of tens of micrograms per liter (10(-11) M) are attained.

The binding sites for benztropines and dopamine in the dopamine transporter overlap

PubMed Central

Bisgaard, Heidi; Larsen, M. Andreas B.; Mazier, Sonia; Beuming, Thijs; Newman, Amy Hauck; Weinstein, Harel; Shi, Lei; Loland, Claus J.; Gether, Ulrik

2013-01-01

Analogues of benztropines (BZTs) are potent inhibitors of the dopamine transporter (DAT) but are less effective than cocaine as behavioral stimulants. As a result, there have been efforts to evaluate these compounds as leads for potential medication for cocaine addiction. Here we use computational modeling together with site-directed mutagenesis to characterize the binding site for BZTs in DAT. Docking into molecular models based on the structure of the bacterial homologue LeuT supported a BZT binding site that overlaps with the substrate binding pocket. In agreement, mutations of residues within the pocket, including Val1523.46* to Ala or Ile, Ser4228.60 to Ala and Asn1573.51 to Cys or Ala, resulted in decreased affinity for BZT and the analog JHW007, as assessed in [3H]dopamine uptake inhibition assays and/or [3H]CFT competition binding assay. A putative polar interaction of one of the phenyl ring fluorine substituents in JHW007 with Asn1573.51 was used as a criterion for determining likely binding poses and establish a structural context for the mutagenesis findings. The analysis positioned the other fluorine substituted phenyl ring of JHW007 in close proximity to Ala47910.51/Ala48010.52 in transmembrane segment (TM) 10. The lack of such an interaction for BZT led to a more tilted orientation, as compared to JHW007, bringing one of the phenyl rings even closer to Ala47910.51/Ala48010.52. Mutation of Ala47910.51 and Ala48010.52 to valines supported these predictions with a larger decrease in the affinity for BZT than for JHW007. Summarized, our data suggest that BZTs display a classical competitive binding mode with binding sites overlapping those of cocaine and dopamine. PMID:20816875

Technological advances in diagnostic testing for von Willebrand disease: new approaches and challenges.

PubMed

Hayward, C P M; Moffat, K A; Graf, L

2014-06-01

Diagnostic tests for von Willebrand disease (VWD) are important for the assessment of VWD, which is a commonly encountered bleeding disorder worldwide. Technical innovations have been applied to improve the precision and lower limit of detection of von Willebrand factor (VWF) assays, including the ristocetin cofactor activity assay (VWF:RCo) that uses the antibiotic ristocetin to induce plasma VWF binding to glycoprotein (GP) IbIXV on target platelets. VWF-collagen-binding assays, depending on the type of collagen used, can improve the detection of forms of VWD with high molecular weight VWF multimer loss, although the best method is debatable. A number of innovations have been applied to VWF:RCo (which is commonly performed on an aggregometer), including replacing the target platelets with immobilized GPIbα, and quantification by an enzyme-linked immunosorbent assay (ELISA), immunoturbidimetric, or chemiluminescent end-point. Some common polymorphisms in the VWF gene that do not cause bleeding are associated with falsely low VWF activity by ristocetin-dependent methods. To overcome the need for ristocetin, some new VWF activity assays use gain-of-function GPIbα mutants that bind VWF without the need for ristocetin, with an improved precision and lower limit of detection than measuring VWF:RCo by aggregometry. ELISA of VWF binding to mutated GPIbα shows promise as a method to identify gain-of-function defects from type 2B VWD. The performance characteristics of many new VWF activity assays suggest that the detection of VWD, and monitoring of VWD therapy, by clinical laboratories could be improved through adopting newer generation VWF assays. © 2014 John Wiley & Sons Ltd.

Preparation of milk samples for immunoassay and liquid chromatographic screening using matrix solid-phase dispersion.

PubMed

Barker, S A; Long, A R

1994-01-01

The use of drugs to maintain the health and maximize the output of dairy cattle has made the monitoring of milk for such agents essential. Screening tests based on immunological, microbial inhibition, and bacterial receptor assays have been developed for the detection of violative levels of therapeutic substances. However, such assays are not infallible, and false positive or negative results can occur when contaminants bind receptors or compete for the binding of the target residues. Such effects may arise from dietary sources, diseases, or other variables. Thus, a violation by such a test is not definitive until further confirmation is obtained. Our laboratory has developed extraction procedures for several drugs used in dairy production. Our method uses matrix solid-phase dispersion (MSPD) to isolate drugs away from contaminants and to eliminate many possible interferences. MSPD can also be used to enhance the specificity of such assays by fractionating various classes of drugs that may cross-react. Similarly, such methods may be used for liquid chromatographic screening and confirmation of a suspect sample.

Online assay of bone specific alkaline phosphatase with a flow injection-bead injection system.

PubMed

Hartwell, Supaporn Kradtap; Somprayoon, Duangporn; Kongtawelert, Prachya; Ongchai, Siriwan; Arppornchayanon, Olarn; Ganranoo, Lucksagoon; Lapanantnoppakhun, Somchai; Grudpan, Kate

2007-09-26

Alkaline phosphatase (ALP) has been used as one of the biomarkers for bone resorption and liver diseases. Normally, total alkaline phosphatase is quantified along with other symptoms to determine the releasing source of the alkaline phosphatase. A semi-automated flow injection-bead injection system was proposed to conveniently and selectively assay bone alkaline phosphatase (BALP) based on its specific binding to wheat germ coated beads. Amount of BALP in serum was determined from the intensity of the yellow product produced from bound BALP on the retained beads and its substrate pNPP. The used beads were discarded and the fresh ones were introduced for the next analysis. The reaction cell was designed to be opened and closed using a computer controlled solenoid valve for a precise incubation time. The performance of the proposed system was evaluated by using it to assay BALP in human serum. The results were compared to those obtained by using a commercial ELISA kit. The system is proposed to be an easy and cost effective system for quantification of BALP as an alternative to batch wise wheat germ specific binding technique.

Functionalization of DNA Nanostructures for Cell Signaling Applications

NASA Astrophysics Data System (ADS)

Pedersen, Ronnie O.

Transforming growth factor beta (TGF-beta) is an important cytokine responsible for a wide range of different cellular functions including extracellular matrix formation, angiogenesis and epithelial-mesenchymal transition. We have sought to use self-assembling DNA nanostructures to influence TGF-beta signaling. The predictable Watson Crick base pairing allows for designing self-assembling nanoscale structures using oligonucleotides. We have used the method of DNA origami to assemble structures functionalized with multiple peptides that bind TGF-beta receptors outside the ligand binding domain. This allows the nanostructures to cluster TGF-beta receptors and lower the energy barrier of ligand binding thus sensitizing the cells to TGF-beta stimulation. To prove efficacy of our nanostructures we have utilized immunofluorescent staining of Smad2/4 in order to monitor TGF-beta mediated translocation of Smad2/4 to the cell nucleus. We have also utilized Smad2/4 responsive luminescence constructs that allows us to quantify TGF-beta stimulation with and without nanostructures. To functionalize our nanostructures we relied on biotin-streptavidin linkages. This introduces a multivalency that is not necessarily desirable in all designs. Therefore we have investigated alternative means of functionalization. The first approach is based on targeting DNA nanostructure by using zinc finger binding proteins. Efficacy of zinc finger binding proteins was assayed by the use of enzyme-linked immunosorbent (ELISA) assay and atomic force microscopy (AFM). While ELISA indicated a relative specificity of zinc finger proteins for target DNA sequences AFM showed a high degree of non-specific binding and insufficient affinity. The second approach is based on using peptide nucleic acid (PNA) incorporated in the nanostructure through base pairing. PNA is a synthetic DNA analog consisting of a backbone of repeating N-(2-aminoethyl)-glycine units to which purine and pyrimidine bases are linked by amide bonds. The solid phase synthesis of PNA allows for convenient extension of the backbone into a peptide segment enabling peptide functionalization of DNA nanostructures. We have investigated how the neutral character of PNA alters the incorporation in DNA based nanostructures compared to a DNA control using biotinylation and AFM. Results indicate that PNA can successfully be used as a way of functionalizing DNA nanostructures. Additionally we have shown that functionalized nanostructures are capable of sensitizing cells to TGF-beta stimulation.

Analysis of molecular determinants of affinity and relative efficacy of a series of R- and S-2-(dipropylamino)tetralins at the 5-HT1A serotonin receptor

PubMed Central

Alder, J Tracy; Hacksell, Uli; Strange, Philip G

2003-01-01

Factors influencing agonist affinity and relative efficacy have been studied for the 5-HT1A serotonin receptor using membranes of CHO cells expressing the human form of the receptor and a series of R-and S-2-(dipropylamino)tetralins (nonhydroxylated and monohydroxylated (5-OH, 6-OH, 7-OH, 8-OH) species). Ligand binding studies were used to determine dissociation constants for agonist binding to the 5-HT1A receptor: Ki values for agonists were determined in competition versus the binding of the agonist [3H]-8-OH DPAT. Competition data were all fitted best by a one-binding site model.Ki values for agonists were also determined in competition versus the binding of the antagonist [3H]-NAD-199. Competition data were all fitted best by a two-binding site model, and agonist affinities for the higher (Kh) and lower affinity (Kl) sites were determined. The ability of the agonists to activate the 5-HT1A receptor was determined using stimulation of [35S]-GTPγS binding. Maximal effects of agonists (Emax) and their potencies (EC50) were determined from concentration/response curves for stimulation of [35S]-GTPγS binding. Kl/Kh determined from ligand binding assays correlated with the relative efficacy (relative Emax) of agonists determined in [35S]-GTPγS binding assays. There was also a correlation between Kl/Kh and Kl/EC50 for agonists determined from ligand binding and [35S]-GTPγS binding assays. Simulations of agonist binding and effect data were performed using the Ternary Complex Model in order to assess the use of Kl/Kh for predicting the relative efficacy of agonists. PMID:12684269

HLA Class I Binding 9mer Peptides from Influenza A Virus Induce CD4+ T Cell Responses

PubMed Central

Wang, Mingjun; Larsen, Mette V.; Nielsen, Morten; Harndahl, Mikkel; Justesen, Sune; Dziegiel, Morten H.; Buus, Søren; Tang, Sheila T.; Lund, Ole; Claesson, Mogens H.

2010-01-01

Background Identification of human leukocyte antigen class I (HLA-I) restricted cytotoxic T cell (CTL) epitopes from influenza virus is of importance for the development of new effective peptide-based vaccines. Methodology/Principal Findings In the present work, bioinformatics was used to predict 9mer peptides derived from available influenza A viral proteins with binding affinity for at least one of the 12 HLA-I supertypes. The predicted peptides were then selected in a way that ensured maximal coverage of the available influenza A strains. One hundred and thirty one peptides were synthesized and their binding affinities for the HLA-I supertypes were measured in a biochemical assay. Influenza-specific T cell responses towards the peptides were quantified using IFNγ ELISPOT assays with peripheral blood mononuclear cells (PBMC) from adult healthy HLA-I typed donors as responder cells. Of the 131 peptides, 21 were found to induce T cell responses in 19 donors. In the ELISPOT assay, five peptides induced responses that could be totally blocked by the pan-specific anti-HLA-I antibody W6/32, whereas 15 peptides induced responses that could be completely blocked in the presence of the pan-specific anti-HLA class II (HLA-II) antibody IVA12. Blocking of HLA-II subtype reactivity revealed that 8 and 6 peptide responses were blocked by anti-HLA-DR and -DP antibodies, respectively. Peptide reactivity of PBMC depleted of CD4+ or CD8+ T cells prior to the ELISPOT culture revealed that effectors are either CD4+ (the majority of reactivities) or CD8+ T cells, never a mixture of these subsets. Three of the peptides, recognized by CD4+ T cells showed binding to recombinant DRA1*0101/DRB1*0401 or DRA1*0101/DRB5*0101 molecules in a recently developed biochemical assay. Conclusions/Significance HLA-I binding 9mer influenza virus-derived peptides induce in many cases CD4+ T cell responses restricted by HLA-II molecules. PMID:20479886

First 25-hydroxyvitamin D assay for general chemistry analyzers.

PubMed

Saida, Fakhri B; Chen, Xiaoru; Tran, Kiet; Dou, Chao; Yuan, Chong

2015-03-01

25-Hydroxyvitamin D [25(OH)D], the predominant circulating form of vitamin D, is an accurate indicator of the general vitamin D status of an individual. Because vitamin D deficiencies have been linked to several pathologies (including osteoporosis and rickets), accurate monitoring of 25(OH)D levels is becoming increasingly important in clinical settings. Current 25(OH)D assays are either chromatographic or immunoassay-based assays. These assays include HPLC, liquid chromatography-tandem mass spectrometry (LC-MS/MS), enzyme-immunosorbent, immunochemiluminescence, immunofluorescence and radioimmunoassay. All these assays use heterogeneous formats that require phase separation and special instrumentations. In this article, we present an overview of these assays and introduce the first homogeneous assay of 25(OH)D for use on general chemistry analyzers. A special emphasis is put on the unique challenges posed by the 25(OH)D analyte. These challenges include a low detection limit, the dissociation of the analyte from its serum transporter and the inactivation of various binding proteins without phase separation steps.

Comparison of Chemical Binding to Recombinant Fathead minnow and Human Estrogen Receptor alpha (ERα) in Whole Cell and Cell-Free Assay Systems.

EPA Science Inventory

Our objectives were to assess whether binding of chemicals differs significantly between recombinant estrogen receptors from fathead minnow (fhERα) and human (hERα) and to evaluate the performance of these receptors using two different in vitro assay systems: a COS whole cell bin...

RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND THE HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY

EPA Science Inventory

RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY.
MC Cardon, PC Hartig,LE Gray, Jr. and VS Wilson.
U.S. EPA, ORD, NHEERL, RTD, Research Triangle Park, NC, USA.
Typically, in vitro hazard assessments for ...

Measurement of Bluetongue Virus Binding to a Mammalian Cell Surface Receptor by an In Situ Immune Fluorescent Staining Technique

USDA-ARS?s Scientific Manuscript database

A quantifiable in situ immune fluorescent assay (IFA) was developed to measure bluetongue virus (BTV) binding to mammalian cells. The utility of the assay was demonstrated with both Chinese hamster ovary (CHO) and bovine pulmonary artery endothelial (CPAE) cells. Since heparin sulfate (HS) has been ...

Characterization of the swine adipocyte A1 adenosine receptor using an optimized assay system.

PubMed

Dong, Q; Schuchman, J; Carey, G B

1994-07-01

The radioligand binding assay of A1 adenosine receptors in adipocyte crude plasma membrane from Yucatan miniature swine was optimized by evaluating 17 factors involved in the assay. Significant effects of CHAPS, adenosine deaminase, EDTA, pre-rinsing glass fiber filters and pH were found for the binding measurements. Using the optimized procedure, [3H]8-cyclopentyl-1,3-dipropylxanthine, ([3H]-DPCPX) binding to A1 adenosine receptors in swine subcutaneous adipocyte crude plasma membrane was measured; Bmax and Kd values were 479 +/- 77 fmol/mg protein and 0.87 +/- 0.10 nM, respectively. Values for mesenteric adipose tissue from sedentary swine and subcutaneous adipose tissue from exercise-trained swine were also measured.

An innovative and highly drug-tolerant approach for detecting neutralizing antibodies directed to therapeutic antibodies.

PubMed

Sloan, John H; Conway, Richard G; Pottanat, Thomas G; Troutt, Jason S; Higgs, Richard E; Konrad, Robert J; Qian, Yue-Wei

2016-10-01

Immunogenicity testing of biotherapeutic drugs is a regulatory requirement. Herein, we describe a drug-tolerant assay for detecting neutralizing antibodies against a therapeutic antibody. Excess target of the therapeutic antibody was incorporated into the detection step of an affinity capture elution assay. Signal generated from binding of antidrug antibody (ADA) to the therapeutic antibody was compared with signal from binding of ADA to the therapeutic antibody preincubated with its target. The results demonstrated that the target blocked binding of the therapeutic antibody to neutralizing monkey ADA and to two anti-idiotypic antibodies. This highly drug-tolerant novel approach enables the detection of neutralizing antibodies and allows for one basic assay format to achieve complete characterization of ADA responses.

Two antibacterial C-type lectins from crustacean, Eriocheir sinensis, stimulated cellular encapsulation in vitro.

PubMed

Jin, Xing-Kun; Li, Shuang; Guo, Xiao-Nv; Cheng, Lin; Wu, Min-Hao; Tan, Shang-Jian; Zhu, You-Ting; Yu, Ai-Qing; Li, Wei-Wei; Wang, Qun

2013-12-01

The first step of host fighting against pathogens is that pattern recognition receptors recognized pathogen-associated molecular patterns. However, the specificity of recognition within the innate immune molecular of invertebrates remains largely unknown. In the present study, we investigated how invertebrate pattern recognition receptor (PRR) C-type lectins might be involved in the antimicrobial response in crustacean. Based on our previously obtained completed coding regions of EsLecA and EsLecG in Eriocheir sinensis, the recombinant EsLectin proteins were produced via prokaryotic expression system and affinity chromatography. Subsequently, both rEsLecA and rEsLecG were discovered to have wide spectrum binding activities towards microorganisms, and their microbial-binding was calcium-independent. Moreover, the binding activities of both rEsLecA and rEsLecG induced the aggregation against microbial pathogens. Both microorganism growth inhibitory activities assays and antibacterial activities assays revealed their capabilities of suppressing microorganisms growth and directly killing microorganisms respectively. Furthermore, the encapsulation assays signified that both rEsLecA and rEsLecG could stimulate the cellular encapsulation in vitro. Collectively, data presented here demonstrated the successful expression and purification of two C-type lectins proteins in the Chinese mitten crab, and their critical role in the innate immune system of an invertebrate. Copyright © 2013 Elsevier Ltd. All rights reserved.

Screening for lead compounds and herbal extracts with potential anti-influenza viral activity.

PubMed

Klaywong, Konrapob; Khutrakul, Gachagorn; Choowongkomon, Kiattawee; Lekcharoensuk, Chalermpol; Petcharat, Nantawan; Leckcharoensuk, Porntippa; Ramasoota, Pongrama

2014-01-01

Nonstructural protein 1 (NS1) of the highly pathogenic avian influenza virus (H5N1) contains a conserved RNA binding domain (RBD) that inhibits antiviral functions of host-innate immune response. Dimerization of NS1 forms a central groove and binds to double stranded (ds) RNA. This region might serve as a potential drug target. In this study, three dimensional structure model of NS1 RBD protein was constructed and virtual screening was performed to identify lead compounds that bound within and around the central groove. The virtual screening showed that 5 compounds bound within the central groove with binding energy ranging between -16.05 and -17.36 Kcal/mol. Two commercially available compounds, estradiol and veratridine, were selected for using in an in vitro screening assay. The results showed that neither of the compounds could inhibit the association between dsRNA and NS1 RBD protein. In addition, 34 herbal extracts were examined for their inhibitory effects. Five of them were able to inhibit association between NS1 RBD and dsRNA in electrophoresis mobility shift assay. Four herbs, Terminalia belirica, Salacia chinensis, Zingiber montanum and Peltophorum pterocarpum, could reduce > 50% of infectivity of H5N1 in a cell-based assay, and it is worth further studying their potential use as source of antiviral drugs.

A cell-based MHC stabilization assay for the detection of peptide binding to the canine classical class I molecule, DLA-88.

PubMed

Ross, Peter; Holmes, Jennifer C; Gojanovich, Gregory S; Hess, Paul R

2012-12-15

Identifying immunodominant CTL epitopes is essential for studying CD8+ T-cell responses in populations, but remains difficult, as peptides within antigens typically are too numerous for all to be synthesized and screened. Instead, to facilitate discovery, in silico scanning of proteins for sequences that match the motif, or binding preferences, of the restricting MHC class I allele - the largest determinant of immunodominance - can be used to predict likely candidates. The high false positive rate with this analysis ideally requires binding confirmation, which is obtained routinely by an assay using cell lines such as RMA-S that have defective transporter associated with antigen processing (TAP) machinery, and consequently, few surface class I molecules. The stabilization and resultant increased life-span of peptide-MHC complexes on the cell surface by the addition of true binders validates their identity. To determine whether a similar assay could be developed for dogs, we transfected a prevalent class I allele, DLA-88*50801, into RMA-S. In the BARC3 clone, the recombinant heavy chain was associated with murine β2-microglobulin, and importantly, could differentiate motif-matched and -mismatched peptides by surface MHC stabilization. This work demonstrates the potential to use RMA-S cells transfected with canine alleles as a tool for CTL epitope discovery in this species. Copyright © 2012 Elsevier B.V. All rights reserved.

Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

NASA Astrophysics Data System (ADS)

Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

2009-08-01

For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

Contacts between the factor TUF and RPG sequences.

PubMed

Vignais, M L; Huet, J; Buhler, J M; Sentenac, A

1990-08-25

The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.

Expanding RNA binding specificity and affinity of engineered PUF domains.

PubMed

Zhao, Yang-Yang; Mao, Miao-Wei; Zhang, Wen-Jing; Wang, Jue; Li, Hai-Tao; Yang, Yi; Wang, Zefeng; Wu, Jia-Wei

2018-05-18

Specific manipulation of RNA is necessary for the research in biotechnology and medicine. The RNA-binding domains of Pumilio/fem-3 mRNA binding factors (PUF domains) are programmable RNA binding scaffolds used to engineer artificial proteins that specifically modulate RNAs. However, the native PUF domains generally recognize 8-nt RNAs, limiting their applications. Here, we modify the PUF domain of human Pumilio1 to engineer PUFs that recognize RNA targets of different length. The engineered PUFs bind to their RNA targets specifically and PUFs with more repeats have higher binding affinity than the canonical eight-repeat domains; however, the binding affinity reaches the peak at those with 9 and 10 repeats. Structural analysis on PUF with nine repeats reveals a higher degree of curvature, and the RNA binding unexpectedly and dramatically opens the curved structure. Investigation of the residues positioned in between two RNA bases demonstrates that tyrosine and arginine have favored stacking interactions. Further tests on the availability of the engineered PUFs in vitro and in splicing function assays indicate that our engineered PUFs bind RNA targets with high affinity in a programmable way.

Expanding RNA binding specificity and affinity of engineered PUF domains

PubMed Central

Zhao, Yang-Yang; Zhang, Wen-Jing; Wang, Jue; Li, Hai-Tao; Yang, Yi; Wang, Zefeng; Wu, Jia-Wei

2018-01-01

Abstract Specific manipulation of RNA is necessary for the research in biotechnology and medicine. The RNA-binding domains of Pumilio/fem-3 mRNA binding factors (PUF domains) are programmable RNA binding scaffolds used to engineer artificial proteins that specifically modulate RNAs. However, the native PUF domains generally recognize 8-nt RNAs, limiting their applications. Here, we modify the PUF domain of human Pumilio1 to engineer PUFs that recognize RNA targets of different length. The engineered PUFs bind to their RNA targets specifically and PUFs with more repeats have higher binding affinity than the canonical eight-repeat domains; however, the binding affinity reaches the peak at those with 9 and 10 repeats. Structural analysis on PUF with nine repeats reveals a higher degree of curvature, and the RNA binding unexpectedly and dramatically opens the curved structure. Investigation of the residues positioned in between two RNA bases demonstrates that tyrosine and arginine have favored stacking interactions. Further tests on the availability of the engineered PUFs in vitro and in splicing function assays indicate that our engineered PUFs bind RNA targets with high affinity in a programmable way. PMID:29490074

Development and evaluation of probe based real time loop mediated isothermal amplification for Salmonella: A new tool for DNA quantification.

PubMed

Mashooq, Mohmad; Kumar, Deepak; Niranjan, Ankush Kiran; Agarwal, Rajesh Kumar; Rathore, Rajesh

2016-07-01

A one step, single tube, accelerated probe based real time loop mediated isothermal amplification (RT LAMP) assay was developed for detecting the invasion gene (InvA) of Salmonella. The probe based RT LAMP is a novel method of gene amplification that amplifies nucleic acid with high specificity and rapidity under isothermal conditions with a set of six primers. The whole procedure is very simple and rapid, and amplification can be obtained in 20min. Detection of gene amplification was accomplished by amplification curve, turbidity and addition of DNA binding dye at the end of the reaction results in colour difference and can be visualized under normal day light and in UV. The sensitivity of developed assay was found 10 fold higher than taqman based qPCR. The specificity of the RT LAMP assay was validated by the absence of any cross reaction with other members of enterobacteriaceae family and other gram negative bacteria. These results indicate that the probe based RT LAMP assay is extremely rapid, cost effective, highly specific and sensitivity and has potential usefulness for rapid Salmonella surveillance. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

Molecular docking guided structure based design of symmetrical N,N'-disubstituted urea/thiourea as HIV-1 gp120-CD4 binding inhibitors.

PubMed

Sivan, Sree Kanth; Vangala, Radhika; Manga, Vijjulatha

2013-08-01

Induced fit molecular docking studies were performed on BMS-806 derivatives reported as small molecule inhibitors of HIV-1 gp120-CD4 binding. Comprehensive study of protein-ligand interactions guided in identification and design of novel symmetrical N,N'-disubstituted urea and thiourea as HIV-1 gp120-CD4 binding inhibitors. These molecules were synthesized in aqueous medium using microwave irradiation. Synthesized molecules were screened for their inhibitory ability by HIV-1 gp120-CD4 capture enzyme-linked immunosorbent assay (ELISA). Designed compounds were found to inhibit HIV-1 gp120-CD4 binding in micromolar (0.013-0.247 μM) concentrations. Copyright © 2013 Elsevier Ltd. All rights reserved.

Antibody binding in altered gravity: implications for immunosorbent assay during space flight

NASA Technical Reports Server (NTRS)

Maule, Jake; Fogel, Marilyn; Steele, Andrew; Wainwright, Norman; Pierson, Duane L.; McKay, David S.

2003-01-01

A single antibody-incubation step of an indirect, enzyme-linked immunosorbent assay (ELISA) was performed during microgravity, Martian gravity (0.38 G) and hypergravity (1.8 G) phases of parabolic flight, onboard the NASA KC-135 aircraft. Antibody-antigen binding occurred within 15 seconds; the level of binding did not differ between microgravity, Martian gravity and 1 G (Earth's gravity) conditions. During hypergravity and 1 G, antibody binding was directly proportional to the fluid volume (per microtiter well) used for incubation; this pattern was not observed during microgravity. These effects in microgravity may be due to "fluid spread" within the chamber (observed during microgravity with digital photography), leading to greater fluid-surface contact and subsequently antibody-antigen contact. In summary, these results demonstrate that: i) ELISA antibody-incubation and washing steps can be successfully performed by human operators during microgravity, Martian gravity and hypergravity; ii) there is no significant difference in antibody binding between microgravity, Martian gravity and 1 G conditions; and iii) a smaller fluid volume/well (and therefore less antibody) was required for a given level of binding during microgravity. These conclusions indicate that reduced gravity would not present a barrier to successful operation of immunosorbent assays during spaceflight.

Holotrichia oblita Midgut Proteins That Bind to Bacillus thuringiensis Cry8-Like Toxin and Assembly of the H. oblita Midgut Tissue Transcriptome

PubMed Central

Jiang, Jian; Huang, Ying; Shu, Changlong; Soberón, Mario; Bravo, Alejandra; Liu, Chunqing; Song, Fuping; Lai, Jinsheng

2017-01-01

ABSTRACT The Bacillus thuringiensis strain HBF-18 (CGMCC 2070), containing two cry genes (cry8-like and cry8Ga), is toxic to Holotrichia oblita larvae. Both Cry8-like and Cry8Ga proteins are active against this insect pest, and Cry8-like is more toxic. To analyze the characteristics of the binding of Cry8-like and Cry8Ga proteins to brush border membrane vesicles (BBMVs) in H. oblita larvae, binding assays were conducted with a fluorescent DyLight488-labeled Cry8-like toxin. The results of saturation binding assays demonstrated that Cry8-like bound specifically to binding sites on BBMVs from H. oblita, and heterologous competition assays revealed that Cry8Ga shared binding sites with Cry8-like. Furthermore, Cry8-like-binding proteins in the midgut from H. oblita larvae were identified by pulldown assays and liquid chromatography-tandem mass spectrometry (LC-MS/MS). In addition, the H. oblita midgut transcriptome was assembled by high-throughput RNA sequencing and used for identification of Cry8-like-binding proteins. Eight Cry8-like-binding proteins were obtained from pulldown assays conducted with BBMVs. The LC-MS/MS data for these proteins were successfully matched with the H. oblita transcriptome, and BLASTX results identified five proteins as serine protease, transferrin-like, uncharacterized protein LOC658236 of Tribolium castaneum, ATPase catalytic subunit, and actin. These identified Cry8-like-binding proteins were different from those confirmed previously as receptors for Cry1A proteins in lepidopteran insect species, such as aminopeptidase, alkaline phosphatase, and cadherin. IMPORTANCE Holotrichia oblita is one of the main soil-dwelling pests in China. The larvae damage the roots of crops, resulting in significant yield reductions and economic losses. H. oblita is difficult to control, principally due to its soil-dwelling habits. In recent years, some Cry8 toxins from Bacillus thuringiensis were shown to be active against this pest. Study of the mechanism of action of these Cry8 toxins is needed for their effective use in the control of H. oblita and for their future utilization in transgenic plants. Our work provides important basic data and promotes understanding of the insecticidal mechanism of Cry8 proteins against H. oblita larvae. PMID:28389549

A high-throughput fluorescence polarization assay for inhibitors of gyrase B.

PubMed

Glaser, Bryan T; Malerich, Jeremiah P; Duellman, Sarah J; Fong, Julie; Hutson, Christopher; Fine, Richard M; Keblansky, Boris; Tang, Mary J; Madrid, Peter B

2011-02-01

DNA gyrase, a type II topoisomerase that introduces negative supercoils into DNA, is a validated antibacterial drug target. The holoenzyme is composed of 2 subunits, gyrase A (GyrA) and gyrase B (GyrB), which form a functional A(2)B(2) heterotetramer required for bacterial viability. A novel fluorescence polarization (FP) assay has been developed and optimized to detect inhibitors that bind to the adenosine triphosphate (ATP) binding domain of GyrB. Guided by the crystal structure of the natural product novobiocin bound to GyrB, a novel novobiocin-Texas Red probe (Novo-TRX) was designed and synthesized for use in a high-throughput FP assay. The binding kinetics of the interaction of Novo-TRX with GyrB from Francisella tularensis has been characterized, as well as the effect of common buffer additives on the interaction. The assay was developed into a 21-µL, 384-well assay format and has been validated for use in high-throughput screening against a collection of Food and Drug Administration-approved compounds. The assay performed with an average Z' factor of 0.80 and was able to identify GyrB inhibitors from a screening library.

Chemically functionalized gold nanoparticles: Synthesis, characterization, and applications

NASA Astrophysics Data System (ADS)

Daniel, Weston Lewis

This thesis focuses on the development and application of gold nanoparticle based detection systems and biomimetic structures. Each class of modified nanoparticle has properties that are defined by its chemical moieties that interface with solution and the gold nanoparticle core. In Chapter 2, a comparison of the biomolecular composition and binding properties of various preparations of antibody oligonucleotide gold nanoparticle conjugates is presented. These constructs differed significantly in terms of their structure and binding properties. Chapter 3 reports the use of electroless gold deposition as a light scattering signal enhancer in a multiplexed, microarray-based scanometric immunoassay using the gold nanoparticle probes evaluated in Chapter 2. The use of gold development results in greater signal enhancement than the typical silver development, and multiple rounds of metal development were found to increase the resulting signal compared to one development. Chapter 4 describes an amplified scanometric detection method for human telomerase activity. Gold nanoparticles functionalized with specific oligonucleotide sequences can efficiently capture telomerase enzymes and subsequently be elongated. Both the elongated and unmodified oligonucleotide sequences are simultaneously measured. At low telomerase concentrations, elongated strands cannot be detected, but the unmodified sequences, which come from the same probe particles, can be detected because their concentration is higher, providing a novel form of amplification. Chapter 5 reports the development of a novel colorimetric nitrite and nitrate ion assay based upon gold nanoparticle probes functionalized with Griess reaction reagents. This assay takes advantage of the distance-dependent plasmonic properties of the gold nanoparticles and the ability of nitrite ion to facilitate the cross coupling of novel nanoparticle probes. The assay works on the concept of a kinetic end point and can be triggered at the EPA limit for this ion in drinking water. Finally, Chapter 6 describes the synthesis of high density lipoprotein biomimetic nanoparticles capable of binding cholesterol. These structures use a gold nanoparticle core to template the assembly of a mixed phospholipid layer and the adsorption of apolipoprotein A-I. These synthesized structures have the general size and surface composition of natural HDL and bind free cholesterol with a Kd of 4 nM.

Calcyclin Binding Protein/Siah-1 Interacting Protein Is a Hsp90 Binding Chaperone

PubMed Central

Góral, Agnieszka; Bieganowski, Paweł; Prus, Wiktor; Krzemień-Ojak, Łucja; Kądziołka, Beata; Fabczak, Hanna; Filipek, Anna

2016-01-01

The Hsp90 chaperone activity is tightly regulated by interaction with many co-chaperones. Since CacyBP/SIP shares some sequence homology with a known Hsp90 co-chaperone, Sgt1, in this work we performed a set of experiments in order to verify whether CacyBP/SIP can interact with Hsp90. By applying the immunoprecipitation assay we have found that CacyBP/SIP binds to Hsp90 and that the middle (M) domain of Hsp90 is responsible for this binding. Furthermore, the proximity ligation assay (PLA) performed on HEp-2 cells has shown that the CacyBP/SIP-Hsp90 complexes are mainly localized in the cytoplasm of these cells. Using purified proteins and applying an ELISA we have shown that Hsp90 interacts directly with CacyBP/SIP and that the latter protein does not compete with Sgt1 for the binding to Hsp90. Moreover, inhibitors of Hsp90 do not perturb CacyBP/SIP-Hsp90 binding. Luciferase renaturation assay and citrate synthase aggregation assay with the use of recombinant proteins have revealed that CacyBP/SIP exhibits chaperone properties. Also, CacyBP/SIP-3xFLAG expression in HEp-2 cells results in the appearance of more basic Hsp90 forms in 2D electrophoresis, which may indicate that CacyBP/SIP dephosphorylates Hsp90. Altogether, the obtained results suggest that CacyBP/SIP is involved in regulation of the Hsp90 chaperone machinery. PMID:27249023

Assessment of the nickel-albumin binding assay for diagnosis of acute coronary syndrome.

PubMed

da Silva, Sandra Huber; Pereira, Renata da Silva; Hausen, Bruna dos Santos; Signor, Cristiane; Gomes, Patrícia; de Campos, Marli Matiko Anraku; Moresco, Rafael Noal

2011-03-01

Myocardial ischemia may alter the metal binding capacity of circulating serum albumin. Thus, the aim of this study was to describe an automated method to measure ischemia-induced alterations in the binding capacity of serum albumin for exogenous nickel, and to evaluate the diagnostic characteristics of this assay for the assessment of acute coronary syndrome (ACS) in patients presenting to the emergency room (ER) with acute chest pain. We assessed the concentrations of cardiac troponin I (cTnI), serum albumin, ischemia-modified albumin (IMA) measured by the cobalt-albumin binding assay (CABA), and by an automated nickel-albumin binding assay (NABA) in the following groups: ACS (n=63) and non-ischemic chest pain (NICP, n=26). Biochemical markers were determined in blood samples obtained from patients within 3 h of ER admission. cTnI, CABA and NABA concentrations were higher in ACS group in comparison to the NICP group. A significant correlation between NABA and CABA was observed (r=0.5387, p<0.001). Areas under the curve for CABA and NABA were 0.7289 and 0.7582, respectively. Both CABA and NABA have the ability to discriminate patients with ACS. However, NABA has a slightly higher ability to discriminate ACS compared with CABA. Patients with ACS have reduced nickel binding to human serum albumin, and NABA may have an important role as an early marker of myocardial ischemia, particularly in patients presenting to the ER with acute chest pain.

Real-time PCR based on SYBR-Green I fluorescence: an alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions.

PubMed

Ponchel, Frederique; Toomes, Carmel; Bransfield, Kieran; Leong, Fong T; Douglas, Susan H; Field, Sarah L; Bell, Sandra M; Combaret, Valerie; Puisieux, Alain; Mighell, Alan J; Robinson, Philip A; Inglehearn, Chris F; Isaacs, John D; Markham, Alex F

2003-10-13

Real-time PCR is increasingly being adopted for RNA quantification and genetic analysis. At present the most popular real-time PCR assay is based on the hybridisation of a dual-labelled probe to the PCR product, and the development of a signal by loss of fluorescence quenching as PCR degrades the probe. Though this so-called 'TaqMan' approach has proved easy to optimise in practice, the dual-labelled probes are relatively expensive. We have designed a new assay based on SYBR-Green I binding that is quick, reliable, easily optimised and compares well with the published assay. Here we demonstrate its general applicability by measuring copy number in three different genetic contexts; the quantification of a gene rearrangement (T-cell receptor excision circles (TREC) in peripheral blood mononuclear cells); the detection and quantification of GLI, MYC-C and MYC-N gene amplification in cell lines and cancer biopsies; and detection of deletions in the OPA1 gene in dominant optic atrophy. Our assay has important clinical applications, providing accurate diagnostic results in less time, from less biopsy material and at less cost than assays currently employed such as FISH or Southern blotting.

Ligand induced stabilization of the melting temperature of the HSV-1 single-strand DNA binding protein using the thermal shift assay.

PubMed

Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E

2014-11-28

We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.

On the possibility of using polycrystalline material in the development of structure-based generic assays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allaire, Marc, E-mail: allaire@bnl.gov; Moiseeva, Natalia; Botez, Cristian E.

The correlation coefficients calculated between raw powder diffraction profiles can be used to identify ligand-bound/unbound states of lysozyme. The discovery of ligands that bind specifically to a targeted protein benefits from the development of generic assays for high-throughput screening of a library of chemicals. Protein powder diffraction (PPD) has been proposed as a potential method for use as a structure-based assay for high-throughput screening applications. Building on this effort, powder samples of bound/unbound states of soluble hen-egg white lysozyme precipitated with sodium chloride were compared. The correlation coefficients calculated between the raw diffraction profiles were consistent with the known bindingmore » properties of the ligands and suggested that the PPD approach can be used even prior to a full description using stereochemically restrained Rietveld refinement.« less

G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

PubMed

Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

2016-09-21

Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA

PubMed Central

Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

2016-01-01

Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5′-end also contributes essentially to the aptameric function. PMID:27650576

A Multiprotein Binding Interface in an Intrinsically Disordered Region of the Tumor Suppressor Protein Interferon Regulatory Factor-1*

PubMed Central

Narayan, Vikram; Halada, Petr; Hernychová, Lenka; Chong, Yuh Ping; Žáková, Jitka; Hupp, Ted R.; Vojtesek, Borivoj; Ball, Kathryn L.

2011-01-01

The interferon-regulated transcription factor and tumor suppressor protein IRF-1 is predicted to be largely disordered outside of the DNA-binding domain. One of the advantages of intrinsically disordered protein domains is thought to be their ability to take part in multiple, specific but low affinity protein interactions; however, relatively few IRF-1-interacting proteins have been described. The recent identification of a functional binding interface for the E3-ubiquitin ligase CHIP within the major disordered domain of IRF-1 led us to ask whether this region might be employed more widely by regulators of IRF-1 function. Here we describe the use of peptide aptamer-based affinity chromatography coupled with mass spectrometry to define a multiprotein binding interface on IRF-1 (Mf2 domain; amino acids 106–140) and to identify Mf2-binding proteins from A375 cells. Based on their function as known transcriptional regulators, a selection of the Mf2 domain-binding proteins (NPM1, TRIM28, and YB-1) have been validated using in vitro and cell-based assays. Interestingly, although NPM1, TRIM28, and YB-1 all bind to the Mf2 domain, they have differing amino acid specificities, demonstrating the degree of combinatorial diversity and specificity available through linear interaction motifs. PMID:21245151

High Throughput Determination of Critical Human Dosing ...

EPA Pesticide Factsheets

High throughput toxicokinetics (HTTK) is a rapid approach that uses in vitro data to estimate TK for hundreds of environmental chemicals. Reverse dosimetry (i.e., reverse toxicokinetics or RTK) based on HTTK data converts high throughput in vitro toxicity screening (HTS) data into predicted human equivalent doses that can be linked with biologically relevant exposure scenarios. Thus, HTTK provides essential data for risk prioritization for thousands of chemicals that lack TK data. One critical HTTK parameter that can be measured in vitro is the unbound fraction of a chemical in plasma (Fub). However, for chemicals that bind strongly to plasma, Fub is below the limits of detection (LOD) for high throughput analytical chemistry, and therefore cannot be quantified. A novel method for quantifying Fub was implemented for 85 strategically selected chemicals: measurement of Fub was attempted at 10%, 30%, and 100% of physiological plasma concentrations using rapid equilibrium dialysis assays. Varying plasma concentrations instead of chemical concentrations makes high throughput analytical methodology more likely to be successful. Assays at 100% plasma concentration were unsuccessful for 34 chemicals. For 12 of these 34 chemicals, Fub could be quantified at 10% and/or 30% plasma concentrations; these results imply that the assay failure at 100% plasma concentration was caused by plasma protein binding for these chemicals. Assay failure for the remaining 22 chemicals may

Simple Methods and Rational Design for Enhancing Aptamer Sensitivity and Specificity

PubMed Central

Kalra, Priya; Dhiman, Abhijeet; Cho, William C.; Bruno, John G.; Sharma, Tarun K.

2018-01-01

Aptamers are structured nucleic acid molecules that can bind to their targets with high affinity and specificity. However, conventional SELEX (Systematic Evolution of Ligands by EXponential enrichment) methods may not necessarily produce aptamers of desired affinity and specificity. Thus, to address these questions, this perspective is intended to suggest some approaches and tips along with novel selection methods to enhance evolution of aptamers. This perspective covers latest novel innovations as well as a broad range of well-established approaches to improve the individual binding parameters (aptamer affinity, avidity, specificity and/or selectivity) of aptamers during and/or post-SELEX. The advantages and limitations of individual aptamer selection methods and post-SELEX optimizations, along with rational approaches to overcome these limitations are elucidated in each case. Further the impact of chosen selection milieus, linker-systems, aptamer cocktails and detection modules utilized in conjunction with target-specific aptamers, on the overall assay performance are discussed in detail, each with its own advantages and limitations. The simple variations suggested are easily available for facile implementation during and/or post-SELEX to develop ultrasensitive and specific assays. Finally, success studies of established aptamer-based assays are discussed, highlighting how they utilized some of the suggested methodologies to develop commercially successful point-of-care diagnostic assays. PMID:29868605

Discovery of potent and selective cytotoxic activity of new quinazoline-ureas against TMZ-resistant glioblastoma multiforme (GBM).

PubMed

Elkamhawy, Ahmed; Viswanath, Ambily Nath Indu; Pae, Ae Nim; Kim, Hyeon Young; Heo, Jin-Chul; Park, Woo-Kyu; Lee, Chong-Ock; Yang, Heekyoung; Kim, Kang Ho; Nam, Do-Hyun; Seol, Ho Jun; Cho, Heeyeong; Roh, Eun Joo

2015-10-20

Herein, we report new quinazoline-urea based compounds with potent cytotoxic activities against TMZ-resistant glioblastoma multiforme (GBM) cells. Low micromolar IC₅₀ values were exhibited over a panel of three primary GBM patient-derived cell cultures belonging to proneural (GBM-1), mesenchymal (GBM-2), and classical (GBM-3) subtypes. Eight compounds showed excellent selectivity indices for GBM cells comparing to a normal astrocyte cell line. In JC-1 assay, analogues 11, 12, 20, 22, and 24 exerted promising rates of mPTP opening induction towards proneural GBM subtype. Compounds 11, 20, and 24 bound to the translocator protein 18 kDa (TSPO) in submicromolar range using [(3)H] PK-11195 binding affinity assay. A homology model was built and docked models of 11, 12, 20, 22 and 24 were generated for describing their plausible binding modes in TSPO. In 3D clonogenic assay, compound 20 manifested potent tumoricidal effects on TMZ-resistant GBM cells even at submicromolar concentrations. In addition, CYP450 and hERG assays presented a safe toxicity profile of 20. Taken as a whole, this report presents compound 20 as a potent, selective and safe GBM cytotoxic agent which constitutes a promising direction against TMZ-resistant GBM. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Simple Methods and Rational Design for Enhancing Aptamer Sensitivity and Specificity.

PubMed

Kalra, Priya; Dhiman, Abhijeet; Cho, William C; Bruno, John G; Sharma, Tarun K

2018-01-01

Aptamers are structured nucleic acid molecules that can bind to their targets with high affinity and specificity. However, conventional SELEX (Systematic Evolution of Ligands by EXponential enrichment) methods may not necessarily produce aptamers of desired affinity and specificity. Thus, to address these questions, this perspective is intended to suggest some approaches and tips along with novel selection methods to enhance evolution of aptamers. This perspective covers latest novel innovations as well as a broad range of well-established approaches to improve the individual binding parameters (aptamer affinity, avidity, specificity and/or selectivity) of aptamers during and/or post-SELEX. The advantages and limitations of individual aptamer selection methods and post-SELEX optimizations, along with rational approaches to overcome these limitations are elucidated in each case. Further the impact of chosen selection milieus, linker-systems, aptamer cocktails and detection modules utilized in conjunction with target-specific aptamers, on the overall assay performance are discussed in detail, each with its own advantages and limitations. The simple variations suggested are easily available for facile implementation during and/or post-SELEX to develop ultrasensitive and specific assays. Finally, success studies of established aptamer-based assays are discussed, highlighting how they utilized some of the suggested methodologies to develop commercially successful point-of-care diagnostic assays.

Competitive Binding Assay for the G-Protein-Coupled Receptor 30 (GPR30) or G-Protein-Coupled Estrogen Receptor (GPER).

PubMed

Thekkumkara, Thomas; Snyder, Russell; Karamyan, Vardan T

2016-01-01

The role of 2-methoxyestradiol is becoming a major area of investigation because of its therapeutic utility, though its mechanism is not fully explored. Recent studies have identified the G-protein-coupled receptor 30 (GPR30, GPER) as a high-affinity membrane receptor for 2-methoxyestradiol. However, studies aimed at establishing the binding affinities of steroid compounds for specific targets are difficult, as the tracers are highly lipophilic and often result in nonspecific binding in lipid-rich membrane preparations with low-level target receptor expression. 2-Methoxyestradiol binding studies are essential to elucidate the underlying effects of this novel estrogen metabolite and to validate its targets; therefore, this competitive receptor-binding assay protocol was developed in order to assess the membrane receptor binding and affinity of 2-methyoxyestradiol.

Synthesis, biological evaluation and molecular modeling of GW 501516 analogues.

PubMed

Ciocoiu, Calin C; Ravna, Aina W; Sylte, Ingebrigt; Hansen, Trond Vidar

2010-11-01

Eleven analogues of GW 501516 (1) were prepared and subjected to biological testing in a semi-high throughput human skeletal muscle cell assay. The assay testing indicated that all analogues elicited oxidation of oleic acid. Among the most potent agonists, 2e (2-{2-ethyl-4-[(4-methyl-2-(4-trifluoromethylphenyl)thiazol-5-yl)methylthio]phenoxy}-2-methylpropanoic acid), was also subjected to a luciferase-based transfection assay, which showed that this compound is a potent agonist against PPARδ and a moderate agonist against PPARα. Docking of compound 2e into PPARδ revealed that it occupied the agonist binding site and exhibited key hydrogen bonding interactions with His323, His449, and Tyr473.

Fluorescent cellular assay for screening agents inhibiting Pseudomonas aeruginosa adherence.

PubMed

Nosková, Libuše; Kubíčková, Božena; Vašková, Lucie; Bláhová, Barbora; Wimmerová, Michaela; Stiborová, Marie; Hodek, Petr

2015-01-16

Antibodies against Pseudomonas aeruginosa (PA) lectin, PAIIL, which is a virulence factor mediating the bacteria binding to epithelium cells, were prepared in chickens and purified from egg yolks. To examine these antibodies as a prophylactic agent preventing the adhesion of PA we developed a well plate assay based on fluorescently labeled bacteria and immortalized epithelium cell lines derived from normal and cystic fibrosis (CF) human lungs. The antibodies significantly inhibited bacteria adhesion (up to 50%) in both cell lines. In agreement with in vivo data, our plate assay showed higher susceptibility of CF cells towards the PA adhesion as compared to normal epithelium. This finding proved the reliability of the developed experimental system.

Thyroid receptor ligands. Part 8: Thyromimetics derived from N-acylated-alpha-amino acid derivatives displaying modulated pharmacological selectivity compared with KB-141.

PubMed

Garg, Neeraj; Li, Yi-Lin; Garcia Collazo, Ana Maria; Litten, Chris; Ryono, Denis E; Zhang, Minsheng; Caringal, Yolanda; Brigance, Robert P; Meng, Wei; Washburn, William N; Agback, Peter; Mellström, Karin; Rehnmark, Stefan; Rahimi-Ghadim, Mahmoud; Norin, Thomas; Grynfarb, Marlena; Sandberg, Johnny; Grover, Gary; Malm, Johan

2007-08-01

Based on the scaffold of the pharmacologically selective thyromimetic 2b, structurally a close analog to KB-141 (2a), a number of novel N-acylated-alpha-amino acid derivatives were synthesized and tested in a TR radioligand binding assay as well as in a reporter cell assay. On the basis of TRbeta(1)-isoform selectivity and affinity, as well as affinity to the reporter cell assay, 3d was selected for further studies in the cholesterol-fed rat model. In this model 3d revealed an improved therapeutic window between cholesterol and TSH lowering but decreased margins versus tachycardia compared with 2a.

Validation of APF as a Urinary Biomarker for Interstitial Cystitis

DTIC Science & Technology

2016-12-01

using a CKAP4127-360 biosensor with sufficient binding efficiency to detect as-APF in urine with detection limits in the high nM to uM range. Urine...specimens from 14 (47%) of 30 women diagnosed with IC/PBS demonstrated as-APF binding activity to the CKAP4127-360 biosensor compared with 22 (73%) of 30...CKAP4 immobilized biosensor to detect APF (1-24 months) 2) Determine the ability of the SPR-based assay to detect APF in urine from patients with IC (1

Development of a lectin binding assay to differentiate between recombinant and endogenous proteins in pharmacokinetic studies of protein-biopharmaceuticals.

PubMed

Weber, Alfred; Minibeck, Eva; Scheiflinger, Friedrich; Turecek, Peter L

2015-04-10

Human glycoproteins, expressed in hamster cell lines, show similar glycosylation patterns to naturally occurring human molecules except for a minute difference in the linkage of terminal sialic acid: both cell types lack α2,6-galactosyl-sialyltransferase, abundantly expressed in human hepatocytes and responsible for the α2,6-sialylation of circulating glycoproteins. This minute difference, which is currently not known to have any physiological relevance, was the basis for the selective measurement of recombinant glycoproteins in the presence of their endogenous counterparts. The assay is based on using the lectin Sambucus nigra agglutinin (SNA), selectively binding to α2,6-sialylated N-glycans. Using von Willebrand factor (VWF), factor IX (FIX), and factor VIIa (FVIIa), it was demonstrated that (i) the plasma-derived proteins, but not the corresponding recombinant proteins, specifically bind to SNA and (ii) this binding can be used to deplete the plasma-derived proteins. The feasibility of this approach was confirmed in spike-recovery studies for all three recombinant coagulation proteins in human plasma and for recombinant VWF (rVWF) in macaque plasma. Analysis of plasma samples from macaques after administration of recombinant and a plasma-derived VWF demonstrated the suitability and robustness of this approach. Data showed that rVWF could be selectively measured without changing the ELISAs and furthermore revealed the limitations of baseline adjustment using a single measurement of the predose concentration only. The SNA gel-based depletion procedure can easily be integrated in existing procedures as a specific sample pre-treatment step. While ELISA-based methods were used to measure the recombinant coagulation proteins in the supernatants obtained by depletion, this procedure is applicable for all biochemical analyses. Copyright © 2015 Elsevier B.V. All rights reserved.

Immunoliposome-based immunomagnetic concentration and separation assay for rapid detection of Cronobacter sakazakii.

PubMed

Shukla, Shruti; Lee, Gibaek; Song, Xinjie; Park, Sunhyun; Kim, Myunghee

2016-03-15

This study aimed to develop an immunoliposome-based immunomagnetic concentration and separation assay for the rapid detection of Cronobacter sakazakii (C. sakazakii), an acute opportunistic foodborne pathogenic bacterium, in both pure culture and infant formula. To develop the assay, magnetic nanoparticles (diameter 30 nm) were coated with immunoglobulin G (IgG), specifically anti-C. sakazakii IgG, and applied for the sensitive and efficient detection of C. sakazakii using immunoliposomes. The binding efficiency of anti-C. sakazakii IgG to the magnetic nanoparticles was 86.23 ± 0.59%. The assay developed in this study detected as few as 3.3 × 10(3) CFUmL(-1) of C. sakazakii in pure culture within 2h 30 min; in comparison, an indirect non-competitive enzyme-linked immunosorbent assay was able to detect 6.2 × 10(5) CFUmL(-1) of C. sakazakii in pure culture after 17 h. The developed assay did not show any cross-reactivity with other Cronobacter spp. or pathogens belonging to other genera. In addition, the method was able to detect 10(3) CFUmL(-1) of C. sakazakii in infant formula without any pre-incubation. These results confirm that the immunoliposome-based immunomagnetic concentration and separation assay may facilitate highly sensitive, efficient, and rapid detection of C. sakazakii. Copyright © 2015 Elsevier B.V. All rights reserved.

A highly sensitive and selective diagnostic assay based on virus nanoparticles

NASA Astrophysics Data System (ADS)

Park, Jin-Seung; Cho, Moon Kyu; Lee, Eun Jung; Ahn, Keum-Young; Lee, Kyung Eun; Jung, Jae Hun; Cho, Yunjung; Han, Sung-Sik; Kim, Young Keun; Lee, Jeewon

2009-04-01

Early detection of the protein marker troponin I in patients with a higher risk of acute myocardial infarction can reduce the risk of death from heart attacks. Most troponin assays are currently based on the conventional enzyme linked immunosorbent assay and have detection limits in the nano- and picomolar range. Here, we show that by combining viral nanoparticles, which are engineered to have dual affinity for troponin antibodies and nickel, with three-dimensional nanostructures including nickel nanohairs, we can detect troponin levels in human serum samples that are six to seven orders of magnitude lower than those detectable using conventional enzyme linked immunosorbent assays. The viral nanoparticle helps to orient the antibodies for maximum capture of the troponin markers. High densities of antibodies on the surfaces of the nanoparticles and nanohairs lead to greater binding of the troponin markers, which significantly enhances detection sensitivities. The nickel nanohairs are re-useable and can reproducibly differentiate healthy serum from unhealthy ones. We expect other viral nanoparticles to form similar highly sensitive diagnostic assays for a variety of other protein markers.

Cationic polymers for DNA origami coating - examining their binding efficiency and tuning the enzymatic reaction rates

NASA Astrophysics Data System (ADS)

Kiviaho, Jenny K.; Linko, Veikko; Ora, Ari; Tiainen, Tony; Järvihaavisto, Erika; Mikkilä, Joona; Tenhu, Heikki; Nonappa, Affc; Kostiainen, Mauri A.

2016-06-01

DNA origamis are fully tailored, programmable, biocompatible and readily functionalizable nanostructures that provide an excellent foundation for the development of sophisticated drug-delivery systems. However, the DNA origami objects suffer from certain drawbacks such as low cell-transfection rates and low stability. A great deal of studies on polymer-based transfection agents, mainly focusing on polyplex formation and toxicity, exists. In this study, the electrostatic binding between a brick-like DNA origami and cationic block-copolymers was explored. The effect of the polymer structure on the binding was investigated and the toxicity of the polymer-origami complexes evaluated. The study shows that all of the analyzed polymers had a suitable binding efficiency irrespective of the block structure. It was also observed that the toxicity of polymer-origami complexes was insignificant at the biologically relevant concentration levels. Besides brick-like DNA origamis, tubular origami carriers equipped with enzymes were also coated with the polymers. By adjusting the amount of cationic polymers that cover the DNA structures, we showed that it is possible to control the enzyme kinetics of the complexes. This work gives a starting point for further development of biocompatible and effective polycation-based block copolymers that can be used in coating different DNA origami nanostructures for various bioapplications.DNA origamis are fully tailored, programmable, biocompatible and readily functionalizable nanostructures that provide an excellent foundation for the development of sophisticated drug-delivery systems. However, the DNA origami objects suffer from certain drawbacks such as low cell-transfection rates and low stability. A great deal of studies on polymer-based transfection agents, mainly focusing on polyplex formation and toxicity, exists. In this study, the electrostatic binding between a brick-like DNA origami and cationic block-copolymers was explored. The effect of the polymer structure on the binding was investigated and the toxicity of the polymer-origami complexes evaluated. The study shows that all of the analyzed polymers had a suitable binding efficiency irrespective of the block structure. It was also observed that the toxicity of polymer-origami complexes was insignificant at the biologically relevant concentration levels. Besides brick-like DNA origamis, tubular origami carriers equipped with enzymes were also coated with the polymers. By adjusting the amount of cationic polymers that cover the DNA structures, we showed that it is possible to control the enzyme kinetics of the complexes. This work gives a starting point for further development of biocompatible and effective polycation-based block copolymers that can be used in coating different DNA origami nanostructures for various bioapplications. Electronic supplementary information (ESI) available: Details of materials, syntheses of the polymers, fabrication and purification of DNA origamis, luminescence decay assays, agarose gel electrophoresis, ethidium bromide displacement assay, MTT assay and TEM characterization. See DOI: 10.1039/c5nr08355a

ω-Conotoxin GVIA Mimetics that Bind and Inhibit Neuronal Cav2.2 Ion Channels

PubMed Central

Tranberg, Charlotte Elisabet; Yang, Aijun; Vette, Irina; McArthur, Jeffrey R.; Baell, Jonathan B.; Lewis, Richard J.; Tuck, Kellie L.; Duggan, Peter J.

2012-01-01

The neuronal voltage-gated N-type calcium channel (Cav2.2) is a validated target for the treatment of neuropathic pain. A small library of anthranilamide-derived ω-Conotoxin GVIA mimetics bearing the diphenylmethylpiperazine moiety were prepared and tested using three experimental measures of calcium channel blockade. These consisted of a 125I-ω-conotoxin GVIA displacement assay, a fluorescence-based calcium response assay with SH-SY5Y neuroblastoma cells, and a whole-cell patch clamp electrophysiology assay with HEK293 cells stably expressing human Cav2.2 channels. A subset of compounds were active in all three assays. This is the first time that compounds designed to be mimics of ω-conotoxin GVIA and found to be active in the 125I-ω-conotoxin GVIA displacement assay have also been shown to block functional ion channels in a dose-dependent manner. PMID:23170089

Long term storage of virus templated fluorescent materials for sensing applications

NASA Astrophysics Data System (ADS)

Seetharam, Raviraja N.; Szuchmacher Blum, Amy; Soto, Carissa M.; Whitley, Jessica L.; Sapsford, Kim E.; Chatterji, Anju; Lin, Tianwei; Johnson, John E.; Guerra, Charles; Satir, Peter; Ratna, Banahalli R.

2008-03-01

Wild type, mutant, and chemically modified Cowpea mosaic viruses (CPMV) were studied for long term preservation in the presence and absence of cryoprotectants. Viral complexes were reconstituted and tested via fluorescence spectroscopy and a UV/vis-based RNase assay for structural integrity. When viruses lyophilized in the absence of cryoprotectant were rehydrated and RNase treated, UV absorption increased, indicating that the capsids were damaged. The addition of trehalose during lyophilization protected capsid integrity for at least 7 weeks. Measurements of the fluorescence peak maximum of CPMV lyophilized with trehalose and reconstituted also indicate that the virus remained intact. Microarray binding assays indicated that CPMV particles chemically modified for use as a fluorescent tracer were intact and retained binding specificity after lyophilization in the presence of trehalose. Thus, we demonstrate that functionalized CPMV nanostructures can be stored for the long term, enabling their use in practical sensing applications.

Coupled diffusion processes and 2D affinities of adhesion molecules at synthetic membrane junctions

NASA Astrophysics Data System (ADS)

Peel, Christopher; Choudhuri, Kaushik; Schmid, Eva M.; Bakalar, Matthew H.; Ann, Hyoung Sook; Fletcher, Daniel A.; Journot, Celine; Turberfield, Andrew; Wallace, Mark; Dustin, Michael

A more complete understanding of the physically intrinsic mechanisms underlying protein mobility at cellular interfaces will provide additional insights into processes driving adhesion and organization in signalling junctions such as the immunological synapse. We observed diffusional slowing of structurally diverse binding proteins at synthetic interfaces formed by giant unilamellar vesicles (GUVs) on supported lipid bilayers (SLBs) that shows size dependence not accounted for by existing models. To model the effects of size and intermembrane spacing on interfacial reaction-diffusion processes, we describe a multistate diffusion model incorporating entropic effects of constrained binding. This can be merged with hydrodynamic theories of receptor-ligand diffusion and coupling to thermal membrane roughness. A novel synthetic membrane adhesion assay based on reversible and irreversible DNA-mediated interactions between GUVs and SLBs is used to precisely vary length, affinity, and flexibility, and also provides a platform to examine these effects on the dynamics of processes such as size-based segregation of binding and non-binding species.

Droplet microfluidics with magnetic beads: a new tool to investigate drug-protein interactions.

PubMed

Lombardi, Dario; Dittrich, Petra S

2011-01-01

In this study, we give the proof of concept for a method to determine binding constants of compounds in solution. By implementing a technique based on magnetic beads with a microfluidic device for segmented flow generation, we demonstrate, for individual droplets, fast, robust and complete separation of the magnetic beads. The beads are used as a carrier for one binding partner and hence, any bound molecule is separated likewise, while the segmentation into small microdroplets ensures fast mixing, and opens future prospects for droplet-wise analysis of drug candidate libraries. We employ the method for characterization of drug-protein binding, here warfarin to human serum albumin. The approach lays the basis for a microfluidic droplet-based screening device aimed at investigating the interactions of drugs with specific targets including enzymes and cells. Furthermore, the continuous method could be employed for various applications, such as binding assays, kinetic studies, and single cell analysis, in which rapid removal of a reactive component is required.

Cucurbiturils: molecular nanocapsules for time-resolved fluorescence-based assays.

PubMed

Marquez, Cesar; Huang, Fang; Nau, Werner M

2004-03-01

A new fluorescent host-guest system based on the inclusion of the fluorophore 2,3-diazabicyclo[2.2.2]oct-2-ene (DBO) into the cavity of the molecular container compound cucurbit[7]uril (CB7) has been designed which possesses an exceedingly long-lived emission (690 ns in aerated water). The large binding constant of (4 +/- 1) x 10(5) M(-1) along with the resistance of the CB7.DBO complex toward external fluorescence quenchers allow the use of CB7 as an enhancer in time-resolved fluorescence-based assays, e.g., to screen enzyme activity or inhibition by using DBO-labeled peptides as substrates. The response of CB7.DBO to different environmental conditions and possible quenchers are described.

Multiple and cooperative binding of fluorescence light-up probe thioflavin T with human telomere DNA G-quadruplex.

PubMed

Gabelica, Valérie; Maeda, Ryuichi; Fujimoto, Takeshi; Yaku, Hidenobu; Murashima, Takashi; Sugimoto, Naoki; Miyoshi, Daisuke

2013-08-20

Thioflavin T (ThT), a typical probe for protein fibrils, also binds human telomeric G-quadruplexes with a fluorescent light-up signal change and high specificity against DNA duplexes. Cell penetration and low cytotoxicity of fibril probes having been widely established, modifying ThT and other fibril probes is an attractive means of generating new G-quadruplex ligands. Thus, elucidating the binding mechanism is important for the design of new drugs and fluorescent probes based on ThT. Here, we investigated the binding mechanism of ThT with several variants of the human telomeric sequence in the presence of monovalent cations. Fluorescence titrations and electrospray ionization mass spectrometry (ESI-MS) analyses demonstrated that each G-quadruplex unit cooperatively binds to several ThT molecules. ThT brightly fluoresces when a single ligand is bound to the G-quadruplex and is quenched as ligand binding stoichiometry increases. Both the light-up signal and the dissociation constants are exquisitely sensitive to the base sequence and to the G-quadruplex structure. These results are crucial for the sensible design and interpretation of G-quadruplex detection assays using fluorescent ligands in general and ThT in particular.

Site Identification by Ligand Competitive Saturation (SILCS) simulations for fragment-based drug design.

PubMed

Faller, Christina E; Raman, E Prabhu; MacKerell, Alexander D; Guvench, Olgun

2015-01-01

Fragment-based drug design (FBDD) involves screening low molecular weight molecules ("fragments") that correspond to functional groups found in larger drug-like molecules to determine their binding to target proteins or nucleic acids. Based on the principle of thermodynamic additivity, two fragments that bind nonoverlapping nearby sites on the target can be combined to yield a new molecule whose binding free energy is the sum of those of the fragments. Experimental FBDD approaches, like NMR and X-ray crystallography, have proven very useful but can be expensive in terms of time, materials, and labor. Accordingly, a variety of computational FBDD approaches have been developed that provide different levels of detail and accuracy.The Site Identification by Ligand Competitive Saturation (SILCS) method of computational FBDD uses all-atom explicit-solvent molecular dynamics (MD) simulations to identify fragment binding. The target is "soaked" in an aqueous solution with multiple fragments having different identities. The resulting computational competition assay reveals what small molecule types are most likely to bind which regions of the target. From SILCS simulations, 3D probability maps of fragment binding called "FragMaps" can be produced. Based on the probabilities relative to bulk, SILCS FragMaps can be used to determine "Grid Free Energies (GFEs)," which provide per-atom contributions to fragment binding affinities. For essentially no additional computational overhead relative to the production of the FragMaps, GFEs can be used to compute Ligand Grid Free Energies (LGFEs) for arbitrarily complex molecules, and these LGFEs can be used to rank-order the molecules in accordance with binding affinities.

An Undergraduate Laboratory Experiment that Utilizes a Glass Fiber Filter Assay to Determine the Steroid Specificity and Equilibrium Binding Properties of Glucocorticoid Receptors.

ERIC Educational Resources Information Center

John, Nancy J.; Firestone, Gary L.

1987-01-01

Describes two complementary laboratory exercises that use the glass fiber assay to assess receptor specificity and hormone binding affinity in rat liver cytoplasmic extracts. Details the methods, materials and protocol of the experiments. Discusses the basic concepts illustrated and the feasibility of using the experiments at the undergraduate…

Monoclonal Antibody Binding to a Surface-Exposed Epitope on Cowdria ruminantium That Is Conserved among Eight Strains

PubMed Central

Shompole, Sankale; Rurangirwa, Fred R.; Wambugu, Anderson; Sitienei, John; Mwangi, Duncan M.; Musoke, Anthony J.; Mahan, Suman; Wells, Clive W.; McGuire, Travis C.

2000-01-01

Monoclonal antibodies (MAb) binding to Cowdria ruminantium elementary bodies (EB) were identified by enzyme-linked immunosorbent assay, and surface binding of one MAb (446.15) to intact EB was determined by immunofluorescence, immunogold labeling, and transmission electron microscopy. MAb 446.15 bound an antigen of approximately 43 kDa in immunoblots of eight geographically distinct strains. The MAb did not react with Ehrlichia canis antigens or uninfected bovine endothelial cell lysate and may be useful in diagnostic assays and vaccine development. PMID:11063511

JAK2 JH2 Fluorescence Polarization Assay and Crystal Structures for Complexes with Three Small Molecules.

PubMed

Newton, Ana S; Deiana, Luca; Puleo, David E; Cisneros, José A; Cutrona, Kara J; Schlessinger, Joseph; Jorgensen, William L

2017-06-08

A competitive fluorescence polarization (FP) assay is reported for determining binding affinities of probe molecules with the pseudokinase JAK2 JH2 allosteric site. The syntheses of the fluorescent 5 and 6 used in the assay are reported as well as K d results for 10 compounds, including JNJ7706621, NVP-BSK805, and filgotinib (GLPG0634). X-ray crystal structures of JAK2 JH2 in complex with NVP-BSK805, filgotinib, and diaminopyrimidine 8 elucidate the binding poses.

JAK2 JH2 Fluorescence Polarization Assay and Crystal Structures for Complexes with Three Small Molecules

PubMed Central

2017-01-01

A competitive fluorescence polarization (FP) assay is reported for determining binding affinities of probe molecules with the pseudokinase JAK2 JH2 allosteric site. The syntheses of the fluorescent 5 and 6 used in the assay are reported as well as Kd results for 10 compounds, including JNJ7706621, NVP-BSK805, and filgotinib (GLPG0634). X-ray crystal structures of JAK2 JH2 in complex with NVP-BSK805, filgotinib, and diaminopyrimidine 8 elucidate the binding poses. PMID:28626520

Lipid-Coated Gold Nanoparticles and FRET Allow Sensitive Monitoring of Liposome Clustering Mediated by the Synaptotagmin-7 C2A Domain.

PubMed

Hamilton, Desmond J; Coffman, Matthew D; Knight, Jefferson D; Reed, Scott M

2017-09-12

Synaptotagmin (Syt) family proteins contain tandem C2 domains, C2A and C2B, which insert into anionic membranes in response to increased cytosolic Ca 2+ concentration and facilitate exocytosis in neuronal and endocrine cells. The C2A domain from Syt7 binds lipid membranes much more tightly than the corresponding domain from Syt1, but the implications of this difference for protein function are not yet clear. In particular, the ability of the isolated Syt7 C2A domain to initiate membrane apposition and/or aggregation has been previously unexplored. Here, we demonstrate that Syt7 C2A induces apposition and aggregation of liposomes using Förster resonance energy transfer (FRET) assays, dynamic light scattering, and spectroscopic techniques involving lipid-coated gold nanoparticles (LCAuNPs). Protein-membrane binding, membrane apposition, and macroscopic aggregation are three separate phenomena with distinct Ca 2+ requirements: the threshold Ca 2+ concentration for membrane binding is lowest, followed by apposition and aggregation. However, aggregation is highly sensitive to protein concentration and can occur even at submicromolar Syt7 C2A; thus, highly sensitive assays are needed for measuring apposition without complications arising from aggregation. Notably, the localized surface plasmon resonance of the LCAuNP is sensitive to ≤10 nM Syt7 C2A concentrations. Furthermore, when the LCAuNPs were added into a FRET-based liposome apposition assay, the resultant energy transfer increased; possible explanations are discussed. Overall, LCAuNP-based methods allow for highly sensitive detection of protein-induced membrane apposition under conditions that miminize large-scale aggregation.

Development, characterization, and in vitro evaluation of phosphatidylcholine-sodium cholate-based nanoparticles for siRNA delivery to MCF-7 human breast cancer cells

NASA Astrophysics Data System (ADS)

Pérez, Sebastián Ezequiel; Gándola, Yamila; Carlucci, Adriana Mónica; González, Lorena

2015-03-01

Phosphatidylcholine-sodium cholate (SC)-based nanoparticles were designed, characterized, and evaluated as plausible oligonucleotides delivery systems. For this purpose, formulation of the systems was optimized to obtain low cytotoxic vehicles with high siRNA-loading capacity and acceptable transfection ability. Mixtures of soybean phosphatidylcholine (SPC) and SC were prepared at different molar ratios with 2 % w/v total concentration; distilled water and two different buffers were used as dispersion medium. Nanoparticles below 150 nm were observed showing spherical shape which turned smaller in diameter as the SC molar proportion increased, accounting for small unilamellar vesicles when low proportions of SC were present in the formulation, but clear mixed micellar solutions at higher SC percentages. Macroscopic characteristics along with physico-chemical parameters values supported the presence of these types of structures. SYBR green displacement assays demonstrated an important oligonucleotide binding that increased as bile salt relative content got higher. Within the same molar ratio, nanoparticles showed the following binding efficiency order: pH 7.4 > pH 5.0 > distilled water. siRNA-loading capacity assays confirmed the higher siRNA binding by the mixed micelles containing higher SC proportion; moreover, the complexes formed were smaller as the SC:SPC ratio increased. Considering cytotoxicity and siRNA-loading capacity, 1:2 and 1:4 SPC:SC formulations were selected for further biological assays. Nanoparticles prepared in any of the three media were able to induce dsRNA uptake and efficiently transfect RNA for gene silencing, for the compositions prepared in buffer pH 5.0 being the most versatile.

The Biology of IgG Subclasses and Their Clinical Relevance to Transplantation.

PubMed

Valenzuela, Nicole M; Schaub, Stefan

2018-01-01

Immunoglobulin G (IgG) is the dominant immunoglobulin and can be divided into 4 distinct subclasses. The evolution of IgG subclass switches is regulated by interaction with T cells and follows a 1-way direction (IgG3 → IgG1 → IgG2 → IgG4). Based on their structure, the 4 IgG subclasses can initiate different effector function such as complement activation, recruitment of various cells by Fc receptors, and agonistic signaling. Using current assays for HLA antibody detection as a template and replacing the generic reporter antibody with IgG subclass-specific reporter antibodies, it is possible to investigate the IgG subclasses of HLA antibodies. There are 15 different IgG subclass compositions possible. Based on the capability to activate the complement system and the class switch direction, 3 arbitrary patterns can be defined (ie, only complement-binding subclasses [IgG3 and/or IgG1], expansion to noncomplement-binding subclasses [IgG3 and/or IgG1 plus IgG2 and/or IgG4], and switch to noncomplement-binding subclasses [IgG2 and/or IgG4]). The latter group accounts for less than 5%, whereas the former 2 groups have a similar prevalence close to 50%. In the past 5 years, several studies correlated the IgG subclass pattern with occurrence of antibody-mediated rejection and allograft outcomes. Because of differences of the used IgG subclass assay, the time point of analyses, and the definition of outcomes, a clear picture has not emerged yet. Future needs are standardization of the assay, a more detailed knowledge of the initiated effector functions, and more well-designed clinical studies also looking at changes of the IgG subclass pattern over time.

Quantitative Analysis of NF-κB Transactivation Specificity Using a Yeast-Based Functional Assay

PubMed Central

Sharma, Vasundhara; Jordan, Jennifer J.; Ciribilli, Yari; Resnick, Michael A.; Bisio, Alessandra; Inga, Alberto

2015-01-01

The NF-κB transcription factor family plays a central role in innate immunity and inflammation processes and is frequently dysregulated in cancer. We developed an NF-κB functional assay in yeast to investigate the following issues: transactivation specificity of NF-κB proteins acting as homodimers or heterodimers; correlation between transactivation capacity and in vitro DNA binding measurements; impact of co-expressed interacting proteins or of small molecule inhibitors on NF-κB-dependent transactivation. Full-length p65 and p50 cDNAs were cloned into centromeric expression vectors under inducible GAL1 promoter in order to vary their expression levels. Since p50 lacks a transactivation domain (TAD), a chimeric construct containing the TAD derived from p65 was also generated (p50TAD) to address its binding and transactivation potential. The p50TAD and p65 had distinct transactivation specificities towards seventeen different κB response elements (κB-REs) where single nucleotide changes could greatly impact transactivation. For four κB-REs, results in yeast were predictive of transactivation potential measured in the human MCF7 cell lines treated with the NF-κB activator TNFα. Transactivation results in yeast correlated only partially with in vitro measured DNA binding affinities, suggesting that features other than strength of interaction with naked DNA affect transactivation, although factors such as chromatin context are kept constant in our isogenic yeast assay. The small molecules BAY11-7082 and ethyl-pyruvate as well as expressed IkBα protein acted as NF-κB inhibitors in yeast, more strongly towards p65. Thus, the yeast-based system can recapitulate NF-κB features found in human cells, thereby providing opportunities to address various NF-κB functions, interactions and chemical modulators. PMID:26147604

Targets Fishing and Identification of Calenduloside E as Hsp90AB1: Design, Synthesis, and Evaluation of Clickable Activity-Based Probe

PubMed Central

Wang, Shan; Tian, Yu; Zhang, Jing-Yi; Xu, Hui-Bo; Zhou, Ping; Wang, Min; Lu, Sen-Bao; Luo, Yun; Wang, Min; Sun, Gui-Bo; Xu, Xu-Dong; Sun, Xiao-Bo

2018-01-01

Calenduloside E (CE), a natural triterpenoid compound isolated from Aralia elata, can protect against ox-LDL-induced human umbilical vein endothelial cell (HUVEC) injury in our previous reports. However, the exact targets and mechanisms of CE remain elusive. For the sake of resolving this question, we designed and synthesized a clickable activity-based probe (CE-P), which could be utilized to fish the functional targets in HUVECs using a gel-based strategy. Based on the previous studies of the structure-activity relationship (SAR), we introduced an alkyne moiety at the C-28 carboxylic group of CE, which kept the protective and anti-apoptosis activity. Via proteomic approach, one of the potential proteins bound to CE-P was identified as Hsp90AB1, and further verification was performed by pure recombinant Hsp90AB1 and competitive assay. These results demonstrated that CE could bind to Hsp90AB1. We also found that CE could reverse the Hsp90AB1 decrease after ox-LDL treatment. To make our results more convincing, we performed SPR analysis and the affinity kinetic assay showed that CE/CE-P could bind to Hsp90AB1 in a dose-dependent manner. Taken together, our research showed CE could probably bind to Hsp90AB1 to protect the cell injury, which might provide the basis for the further exploration of its cardiovascular protective mechanisms. For the sake of resolving this question, we designed and synthesized a clickable activity-based probe (CE-P), which could be utilized to fish the functional targets in HUVECs using a gel-based strategy. PMID:29875664

Characterization of Lactic Acid Bacteria as Poultry Probiotic Candidates with Aflatoxin B1 Binding Activities

NASA Astrophysics Data System (ADS)

Damayanti, E.; Istiqomah, L.; Saragih, J. E.; Purwoko, T.; Sardjono

2017-12-01

Our previous studies have selected lactic acid bacteria (LAB) with antifungal activities from traditional fermented foods made from cassava (G7) and silage feed palm leaf (PDS5 and PDS3). In this study we evaluated their ability to bind aflatoxin B1 (AFB1) and probiotic characteristic. The probiotic characteristic assays of LAB consisted of resistance to acidic conditions (pH 3), gastric juice and bile salts 0.3%. We also carried out an in vitro evaluation of LAB aflatoxin binding ability in viable and non-viable cell for 24 and 48 hours of incubation. The measurement of aflatoxin content was performed by ELISA method using AgraQuant Total Aflatoxin Assay kit. The results showed that all isolates were potential as probiotics and the G7 isolate had the highest viability among other isolates in pH 3 (92.61 %) and the bile salts assay (97.71 %). The percentage of aflatoxin reduction between viable and non-viable cell from each LAB isolate were different. The highest aflatoxin reduction in viable cell assay was performed by G7 isolate (69.11 %) whereas in non-viable cell assay was performed by PDS3 isolate (73.75 %) during incubation time 48 hours. In this study, G7 isolate performed the best probiotic characteristics with the highest viability in acid pH assay, bile salt 0.3% assay and percentage of aflatoxin B1 reduction in viable cell condition. Molecular identification using 16S rRNA sequence analysis showed that G7 isolate had homology with Lactobacillus plantarum (99.9%). It was concluded that Lactobacillus plantarum G7 was potential as probiotic with aflatoxin binding activities.

Flexible Label-Free Quantitative Assay for Antibodies to Influenza Virus Hemagglutinins ▿

PubMed Central

Carney, Paul J.; Lipatov, Aleksandr S.; Monto, Arnold S.; Donis, Ruben O.; Stevens, James

2010-01-01

During the initial pandemic influenza H1N1 virus outbreak, assays such as hemagglutination inhibition and microneutralization provided important information on the relative protection afforded by the population's cross-reactivity from prior infections and immunizations with seasonal vaccines. However, these assays continue to be limited in that they are difficult to automate for high throughput, such as in pandemic situations, as well as to standardize between labs. Thus, new technologies are being sought to improve standardization, reliability, and throughput by using chemically defined reagents rather than whole cells and virions. We now report the use of a cell-free and label-free flu antibody biosensor assay (f-AbBA) for influenza research and diagnostics that utilizes recombinant hemagglutinin (HA) in conjunction with label-free biolayer interferometry technology to measure biomolecular interactions between the HA and specific anti-HA antibodies or sialylated ligands. We evaluated f-AbBA to determine anti-HA antibody binding activity in serum or plasma to assess vaccine-induced humoral responses. This assay can reveal the impact of antigenic difference on antibody binding to HA and also measure binding to different subtypes of HA. We also show that the biosensor assay can measure the ability of HA to bind a model sialylated receptor-like ligand. f-AbBA could be used in global surveillance laboratories since preliminary tests on desiccated HA probes showed no loss of activity after >2 months in storage at room temperature, indicating that the same reagent lots could be used in different laboratories to minimize interlaboratory assay fluctuation. Future development of such reagents and similar technologies may offer a robust platform for future influenza surveillance activities. PMID:20660137

Transcriptional regulation of human MUC4 gene: identification of a novel inhibitory element and its nuclear binding protein.

PubMed

Zhang, Jing-Jing; Zhu, Yi; Zhang, Xiong-Fei; Liang, Wen-Biao; Xie, Kun-Ling; Tao, Jin-Qiu; Peng, Yun-Peng; Xu, Ze-Kuan; Miao, Yi

2013-08-01

The human mucin 4 (MUC4) is aberrantly expressed in pancreatic adenocarcinoma and tumor cell lines, while remaining undetectable in normal pancreas, indicating its important role in pancreatic cancer development. Although its transcriptional regulation has been investigated in considerable detail, some important elements remain unknown. The aim of the present study was to demonstrate the existence of a novel inhibitory element in the MUC4 promoter and characterize some of its binding proteins. By luciferase reporter assay, we located the inhibitory element between nucleotides -2530 and -2521 in the MUC4 promoter using a series of deletion and mutant reporter constructs. Electrophoretic mobility shift assay (EMSA) with Bxpc-3 cell nuclear extracts revealed that one protein or protein complex bind to this element. The proteins binding to this element were purified and identified as Yin Yang 1 (YY1) by mass spectrometry. Supershift assay and chromatin immunoprecipitation (ChIP) assay confirmed that YY1 binds to this element in vitro and in vivo. Moreover, transient YY1 overexpression significantly inhibited MUC4 promoter activity and endogenous MUC4 protein expression. In conclusion, we reported here a novel inhibitory element in the human MUC4 promoter. This provides additional data on MUC4 gene regulation and indicates that YY1 may be a potential target for abnormal MUC4 expression.

Site-directed mutagenesis study on DNA binding regions of the mouse homologue of Suppressor of Hairless, RBP-J kappa.

PubMed Central

Chung, C N; Hamaguchi, Y; Honjo, T; Kawaichi, M

1994-01-01

To map regions important for DNA binding of the mouse homologue of Suppressor of Hairless or RBP-J kappa protein, mutated mouse RBP-J kappa cDNAs were made by insertion of oligonucleotide linkers or base replacement. DNA binding assays using the mutated proteins expressed in COS cells showed that various mutations between 218 Arg and 227 Arg decreased the DNA binding activity drastically. The DNA binding activity was not affected by amino acid replacements within the integrase motif of the RBP-J kappa protein (230His-269His). Replacements between 291Arg and 323Tyr affected the DNA binding activity slightly but reproducibly. These results indicate that the region encompassing 218Arg-227Arg is critical for the DNA binding activity of RBP-J kappa. This region did not show any significant homology to motifs or domains of the previously described DNA binding proteins. Using a truncation mutant protein RBP-J kappa was shown to associate with DNA as a monomer. Images PMID:8065905

In Silico Analysis of Epitope-Based Vaccine Candidates against Hepatitis B Virus Polymerase Protein

PubMed Central

Zheng, Juzeng; Lin, Xianfan; Wang, Xiuyan; Zheng, Liyu; Lan, Songsong; Jin, Sisi; Ou, Zhanfan; Wu, Jinming

2017-01-01

Hepatitis B virus (HBV) infection has persisted as a major public health problem due to the lack of an effective treatment for those chronically infected. Therapeutic vaccination holds promise, and targeting HBV polymerase is pivotal for viral eradication. In this research, a computational approach was employed to predict suitable HBV polymerase targeting multi-peptides for vaccine candidate selection. We then performed in-depth computational analysis to evaluate the predicted epitopes’ immunogenicity, conservation, population coverage, and toxicity. Lastly, molecular docking and MHC-peptide complex stabilization assay were utilized to determine the binding energy and affinity of epitopes to the HLA-A0201 molecule. Criteria-based analysis provided four predicted epitopes, RVTGGVFLV, VSIPWTHKV, YMDDVVLGA and HLYSHPIIL. Assay results indicated the lowest binding energy and high affinity to the HLA-A0201 molecule for epitopes VSIPWTHKV and YMDDVVLGA and epitopes RVTGGVFLV and VSIPWTHKV, respectively. Regions 307 to 320 and 377 to 387 were considered to have the highest probability to be involved in B cell epitopes. The T cell and B cell epitopes identified in this study are promising targets for an epitope-focused, peptide-based HBV vaccine, and provide insight into HBV-induced immune response. PMID:28509875

Strip biosensor for amplified detection of nerve growth factor-beta based on a molecular translator and catalytic DNA circuit.

PubMed

Liu, Jun; Lai, Ting; Mu, Kejie; Zhou, Zheng

2014-10-07

We have demonstrated a new visual detection approach based on a molecular translator and a catalytic DNA circuit for the detection of nerve growth factor-beta (NGF-β). In this assay, a molecular translator based on the binding-induced DNA strand-displacement reaction was employed to convert the input protein to an output DNA signal. The molecular translator is composed of a target recognition element and a signal output element. Target recognition is achieved by the binding of the anti-NGF-β antibody to the target protein. Polyclonal anti-NGF-β antibody is conjugated to DNA1 and DNA2. The antibody conjugated DNA1 is initially hybridized to DNA3 to form a stable DNA1/DNA3 duplex. In the presence of NGF-β, the binding of the same target protein brings DNA1 and DNA2 into close proximity, resulting in an increase in their local effective concentration. This process triggers the strand-displacement reaction between DNA2 and DNA3 and releases the output DNA3. The released DNA3 is further amplified by a catalytic DNA circuit. The product of the catalytic DNA circuit is detected by a strip biosensor. This proposed assay has high sensitivity and selectivity with a dynamic response ranging from 10 fM to 10 pM, and its detection limit is 10 fM of NGF-β. This work provides a sensitive, enzyme-free, and universal strategy for the detection of other proteins.